Datasets:
File size: 7,575 Bytes
5aa41a1 33e1f31 397e4cb 0a06a37 397e4cb 0a06a37 33e1f31 0a06a37 6f1ad2d 5aa41a1 46a3a9a 0a06a37 46a3a9a 12da334 46a3a9a 76607d0 46a3a9a 0cedd4c 46a3a9a 023cdae 46a3a9a 023cdae 46a3a9a da687e3 46a3a9a da687e3 46a3a9a da687e3 46a3a9a 023cdae eb8fde9 bcd339a eb8fde9 46a3a9a 11063d6 46a3a9a 0cedd4c 46a3a9a 76607d0 46a3a9a 0cedd4c 46a3a9a 76607d0 46a3a9a 0cedd4c 76607d0 46a3a9a 76607d0 46a3a9a 0cedd4c 46a3a9a a576568 46a3a9a 9edf3eb 46a3a9a 1535ca4 46a3a9a 9edf3eb 46a3a9a 1535ca4 46a3a9a 9edf3eb 46a3a9a 1535ca4 46a3a9a 9edf3eb 46a3a9a 1535ca4 46a3a9a 76607d0 46a3a9a 76607d0 397e4cb |
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 |
---
license: cc-by-3.0
license_name: cc-by-3.0
license_link: https://creativecommons.org/licenses/by/3.0/
language:
- en
tags:
- ViT
- ResNet
- Transfer_learning
- Fine_tuning
- Classification
- Vision
- Taxonomy
- Biodiversity
- DNA_barcodes
- Insects
- Species
- BigData
pretty_name: BIOSCAN-1M
size_categories:
- 1M<n<10M
maintainers:
- https://huggingface.co/Gharaee
author:
name: Zahra Gharaee
github: https://github.com/zahrag
hf: https://huggingface.co/Gharaee
---
[](https://huggingface.co/Gharaee)
# BIOSCAN-1M
<div align="center">
<img src="images/Fig1.png" alt="Alt Text" width="1000" style="display: block; margin: 0 auto;">
</div>
### Overview
The BIOSCAN-1M dataset offers researchers detailed information about insects, with each record containing four primary attributes:
- DNA Barcode Sequence
- Barcode Index Number (BIN)
- Biological Taxonomy Classification
- RGB image
### Citation
If you make use of the BIOSCAN-1M dataset and/or its code repository, please cite the following paper:
```
cite as:
@inproceedings{gharaee2023step,
title={A Step Towards Worldwide Biodiversity Assessment: The {BIOSCAN-1M} Insect Dataset},
booktitle={Advances in Neural Information Processing Systems},
author={Gharaee, Z. and Gong, Z. and Pellegrino, N. and Zarubiieva, I. and Haurum, J. B. and Lowe, S. C. and McKeown, J. T. A. and Ho, C. Y. and McLeod, J. and Wei, Y. C. and Agda, J. and Ratnasingham, S. and Steinke, D. and Chang, A. X. and Taylor, G. W. and Fieguth, P.},
editor={A. Oh and T. Neumann and A. Globerson and K. Saenko and M. Hardt and S. Levine},
pages={43593--43619},
publisher={Curran Associates, Inc.},
year={2023},
volume={36},
url={https://proceedings.neurips.cc/paper_files/paper/2023/file/87dbbdc3a685a97ad28489a1d57c45c1-Paper-Datasets_and_Benchmarks.pdf},
}
```
## Dataset Access
To clone this dataset repository, use the following command:
```bash
GIT_LFS_SKIP_SMUDGE=1 git clone https://huggingface.co/datasets/bioscan-ml/BIOSCAN-1M
```
### 📦 Resources and Access
- **📄 Paper**: [arXiv](https://arxiv.org/abs/2307.10455)
- **🌐 Website**: [BIOSCAN-1M Project Page](https://biodiversitygenomics.net/1M_insects/)
- **💻 GitHub**: [bioscan-ml/BIOSCAN-1M](https://github.com/bioscan-ml/BIOSCAN-1M)
- **📁 Downloads**:
- [Google Drive](https://drive.google.com/drive/u/1/folders/1kD9cXuQ1FdL30etp7sjy_Gs_NAAJ3EXI)
- [Zenodo](https://zenodo.org/records/8030065)
- [Kaggle](https://www.kaggle.com/datasets/zahragharaee/bioscan-1m-insect-dataset)
## BIOSCAN-1M Dataset Record
### I. DNA barcode sequence
The provided DNA barcode sequence showcases the arrangement of nucleotides:
* Adenine (A): Red
* Thymine (T): Blue
* Cytosine (C): Green
* Guanine (G): Yellow
```
TTTATATTTTATTTTTGGAGCATGATCAGGAATAGTTGGAACTTCAATAAGTTTATTAATTCGAACAGAATTAAGCCAACCAGGAATTTTTA ...
```
<div align="center">
<img src="images/DNA_sequence.png" alt="Alt Text" width="1000" style="display: block; margin: 0 auto;">
</div>
### II. Barcode Index Number (BIN)
BINs, acting as an alternative to Linnean names, provide a genetic-centric classification for organisms,
emphasizing the significance of genetic code in taxonomy.
```
BOLD:AER5166
```
<div align="center">
<img src="images/BIN.png" alt="Alt Text" width="1000" style="display: block; margin: 0 auto;">
</div>
### III. Biological taxonomy ranking annotations
Taxonomic group ranking annotations categorize organisms hierarchically based on evolutionary relationships.
It organizes species into groups based on shared characteristics and genetic relatedness.
<div align="center">
<img src="images/Taxonomy_horiz_upd1.png" alt="Alt Text" width="1000" style="display: block; margin: 0 auto;">
</div>
### IV. RGB image
Original insect images from 16 most densly populated orders of the BIOSCAN-1M Insect dataset.
The numbers below each image identify the number of images in each class, and clearly illustrate the degree of class imbalance in the BIOSCAN-1M Insect dataset.
<div align="center">
<table>
<!-- First Row -->
<tr>
<td align="center" ><img src="images/Diptera.jpg" width="400px" height="400px" class="image"></td>
<td align="center" ><img src="images/Hymenoptera.jpg" width="400px" height="400px" class="image"></td>
<td align="center" ><img src="images/Coleoptera.jpg" width="400px" height="400px" class="image"></td>
<td align="center" ><img src="images/Hemiptera.jpg" width="400px" height="400px" class="image"></td>
</tr>
<tr>
<td align="center"><strong>Diptera: 896,234</strong></td>
<td align="center"><strong>Hymenoptera: 89,311</strong></td>
<td align="center"><strong>Coleoptera: 47,328</strong></td>
<td align="center"><strong>Hemiptera: 46,970</strong></td>
</tr>
<!-- Second Row -->
<tr>
<td align="center" ><img src="images/Lepidoptera.jpg" width="400px" height="400px" class="image"></td>
<td align="center" ><img src="images/Psocodea.jpg" width="400px" height="400px" class="image"></td>
<td align="center" ><img src="images/Thysanoptera.jpg" width="400px" height="400px" class="image"></td>
<td align="center" ><img src="images/Trichoptera.jpg" width="400px" height="400px" class="image"></td>
</tr>
<tr>
<td align="center"><strong>Lepidoptera: 32,538</strong></td>
<td align="center"><strong>Psocodea: 9,635</strong></td>
<td align="center"><strong>Thysanoptera: 2,088</strong></td>
<td align="center"><strong>Trichoptera: 1,296</strong></td>
</tr>
<!-- Third Row -->
<tr>
<td align="center" ><img src="images/Orthoptera.jpg" width="400px" height="400px" class="image"></td>
<td align="center" ><img src="images/Blattodea.jpg" width="400px" height="400px" class="image"></td>
<td align="center" ><img src="images/Neuroptera.jpg" width="400px" height="400px" class="image"></td>
<td align="center" ><img src="images/Ephemeroptera.jpg" width="400px" height="400px" class="image"></td>
</tr>
<tr>
<td align="center"><strong>Orthoptera: 1,057</strong></td>
<td align="center"><strong>Blattodea: 824</strong></td>
<td align="center"><strong>Neuroptera: 676</strong></td>
<td align="center"><strong>Ephemeroptera: 96</strong></td>
</tr>
<!-- Fourth Row -->
<tr>
<td align="center" ><img src="images/Dermaptera.jpg" width="400px" height="400px" class="image"></td>
<td align="center" ><img src="images/Archaeognatha.jpg" width="400px" height="400px" class="image"></td>
<td align="center" ><img src="images/Plecoptera.jpg" width="400px" height="400px" class="image"></td>
<td align="center" ><img src="images/Embioptera.jpg" width="400px" height="400px" class="image"></td>
</tr>
<tr>
<td align="center"><strong>Dermaptera: 66</strong></td>
<td align="center"><strong>Archaeognatha: 63</strong></td>
<td align="center"><strong>Plecoptera: 30</strong></td>
<td align="center"><strong>Embioptera: 6</strong></td>
</tr>
</table>
</div>
## Class Distribution
Class distribution and class imbalance in the BIOSCAN-1M Insect dataset. Orders (top) and diptera families (bottom).
The image demonstrates that class imbalance is an inherent characteristic within the insect community.
<div align="center">
<img src="images/BIOSCAN_Fig2_upd3.png" alt="Alt Text" width="1000" style="display: block; margin: 0 auto;">
</div> |