identifier
stringlengths 1
43
| dataset
stringclasses 3
values | question
stringclasses 4
values | rank
int64 0
99
| url
stringlengths 14
1.88k
| read_more_link
stringclasses 1
value | language
stringclasses 1
value | title
stringlengths 0
200
| top_image
stringlengths 0
125k
| meta_img
stringlengths 0
125k
| images
listlengths 0
18.2k
| movies
listlengths 0
484
| keywords
listlengths 0
0
| meta_keywords
listlengths 1
48.5k
| tags
null | authors
listlengths 0
10
| publish_date
stringlengths 19
32
⌀ | summary
stringclasses 1
value | meta_description
stringlengths 0
258k
| meta_lang
stringclasses 68
values | meta_favicon
stringlengths 0
20.2k
| meta_site_name
stringlengths 0
641
| canonical_link
stringlengths 9
1.88k
⌀ | text
stringlengths 0
100k
|
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
1850
|
dbpedia
|
0
| 30 |
https://www.slideshare.net/slideshow/hereditary-diffuse-leukoencephalopathy-with-axonal-spheroids/170300841
|
en
|
Hereditary Diffuse Leukoencephalopathy with Axonal Spheroids
|
[
"https://public.slidesharecdn.com/images/next/svg/logo/slideshare-scribd-company.svg?w=128&q=75 1x, https://public.slidesharecdn.com/images/next/svg/logo/slideshare-scribd-company.svg?w=256&q=75 2x",
"https://image.slidesharecdn.com/hereditarydiffuseleukoencephalopathywithaxonalspheroids0919-190909155330/85/Hereditary-Diffuse-Leukoencephalopathy-with-Axonal-Spheroids-1-320.jpg 320w, https://image.slidesharecdn.com/hereditarydiffuseleukoencephalopathywithaxonalspheroids0919-190909155330/85/Hereditary-Diffuse-Leukoencephalopathy-with-Axonal-Spheroids-1-638.jpg 638w, https://image.slidesharecdn.com/hereditarydiffuseleukoencephalopathywithaxonalspheroids0919-190909155330/75/Hereditary-Diffuse-Leukoencephalopathy-with-Axonal-Spheroids-1-2048.jpg 2048w",
"https://image.slidesharecdn.com/hereditarydiffuseleukoencephalopathywithaxonalspheroids0919-190909155330/85/Hereditary-Diffuse-Leukoencephalopathy-with-Axonal-Spheroids-2-320.jpg 320w, https://image.slidesharecdn.com/hereditarydiffuseleukoencephalopathywithaxonalspheroids0919-190909155330/85/Hereditary-Diffuse-Leukoencephalopathy-with-Axonal-Spheroids-2-638.jpg 638w, https://image.slidesharecdn.com/hereditarydiffuseleukoencephalopathywithaxonalspheroids0919-190909155330/75/Hereditary-Diffuse-Leukoencephalopathy-with-Axonal-Spheroids-2-2048.jpg 2048w",
"https://image.slidesharecdn.com/hereditarydiffuseleukoencephalopathywithaxonalspheroids0919-190909155330/85/Hereditary-Diffuse-Leukoencephalopathy-with-Axonal-Spheroids-3-320.jpg 320w, https://image.slidesharecdn.com/hereditarydiffuseleukoencephalopathywithaxonalspheroids0919-190909155330/85/Hereditary-Diffuse-Leukoencephalopathy-with-Axonal-Spheroids-3-638.jpg 638w, https://image.slidesharecdn.com/hereditarydiffuseleukoencephalopathywithaxonalspheroids0919-190909155330/75/Hereditary-Diffuse-Leukoencephalopathy-with-Axonal-Spheroids-3-2048.jpg 2048w",
"https://image.slidesharecdn.com/hereditarydiffuseleukoencephalopathywithaxonalspheroids0919-190909155330/85/Hereditary-Diffuse-Leukoencephalopathy-with-Axonal-Spheroids-4-320.jpg 320w, https://image.slidesharecdn.com/hereditarydiffuseleukoencephalopathywithaxonalspheroids0919-190909155330/85/Hereditary-Diffuse-Leukoencephalopathy-with-Axonal-Spheroids-4-638.jpg 638w, https://image.slidesharecdn.com/hereditarydiffuseleukoencephalopathywithaxonalspheroids0919-190909155330/75/Hereditary-Diffuse-Leukoencephalopathy-with-Axonal-Spheroids-4-2048.jpg 2048w",
"https://image.slidesharecdn.com/hereditarydiffuseleukoencephalopathywithaxonalspheroids0919-190909155330/85/Hereditary-Diffuse-Leukoencephalopathy-with-Axonal-Spheroids-5-320.jpg 320w, https://image.slidesharecdn.com/hereditarydiffuseleukoencephalopathywithaxonalspheroids0919-190909155330/85/Hereditary-Diffuse-Leukoencephalopathy-with-Axonal-Spheroids-5-638.jpg 638w, https://image.slidesharecdn.com/hereditarydiffuseleukoencephalopathywithaxonalspheroids0919-190909155330/75/Hereditary-Diffuse-Leukoencephalopathy-with-Axonal-Spheroids-5-2048.jpg 2048w",
"https://image.slidesharecdn.com/hereditarydiffuseleukoencephalopathywithaxonalspheroids0919-190909155330/85/Hereditary-Diffuse-Leukoencephalopathy-with-Axonal-Spheroids-6-320.jpg 320w, https://image.slidesharecdn.com/hereditarydiffuseleukoencephalopathywithaxonalspheroids0919-190909155330/85/Hereditary-Diffuse-Leukoencephalopathy-with-Axonal-Spheroids-6-638.jpg 638w, https://image.slidesharecdn.com/hereditarydiffuseleukoencephalopathywithaxonalspheroids0919-190909155330/75/Hereditary-Diffuse-Leukoencephalopathy-with-Axonal-Spheroids-6-2048.jpg 2048w",
"https://image.slidesharecdn.com/hereditarydiffuseleukoencephalopathywithaxonalspheroids0919-190909155330/85/Hereditary-Diffuse-Leukoencephalopathy-with-Axonal-Spheroids-7-320.jpg 320w, https://image.slidesharecdn.com/hereditarydiffuseleukoencephalopathywithaxonalspheroids0919-190909155330/85/Hereditary-Diffuse-Leukoencephalopathy-with-Axonal-Spheroids-7-638.jpg 638w, https://image.slidesharecdn.com/hereditarydiffuseleukoencephalopathywithaxonalspheroids0919-190909155330/75/Hereditary-Diffuse-Leukoencephalopathy-with-Axonal-Spheroids-7-2048.jpg 2048w",
"https://image.slidesharecdn.com/hereditarydiffuseleukoencephalopathywithaxonalspheroids0919-190909155330/85/Hereditary-Diffuse-Leukoencephalopathy-with-Axonal-Spheroids-8-320.jpg 320w, https://image.slidesharecdn.com/hereditarydiffuseleukoencephalopathywithaxonalspheroids0919-190909155330/85/Hereditary-Diffuse-Leukoencephalopathy-with-Axonal-Spheroids-8-638.jpg 638w, https://image.slidesharecdn.com/hereditarydiffuseleukoencephalopathywithaxonalspheroids0919-190909155330/75/Hereditary-Diffuse-Leukoencephalopathy-with-Axonal-Spheroids-8-2048.jpg 2048w",
"https://image.slidesharecdn.com/hereditarydiffuseleukoencephalopathywithaxonalspheroids0919-190909155330/85/Hereditary-Diffuse-Leukoencephalopathy-with-Axonal-Spheroids-9-320.jpg 320w, https://image.slidesharecdn.com/hereditarydiffuseleukoencephalopathywithaxonalspheroids0919-190909155330/85/Hereditary-Diffuse-Leukoencephalopathy-with-Axonal-Spheroids-9-638.jpg 638w, https://image.slidesharecdn.com/hereditarydiffuseleukoencephalopathywithaxonalspheroids0919-190909155330/75/Hereditary-Diffuse-Leukoencephalopathy-with-Axonal-Spheroids-9-2048.jpg 2048w",
"https://image.slidesharecdn.com/hereditarydiffuseleukoencephalopathywithaxonalspheroids0919-190909155330/85/Hereditary-Diffuse-Leukoencephalopathy-with-Axonal-Spheroids-10-320.jpg 320w, https://image.slidesharecdn.com/hereditarydiffuseleukoencephalopathywithaxonalspheroids0919-190909155330/85/Hereditary-Diffuse-Leukoencephalopathy-with-Axonal-Spheroids-10-638.jpg 638w, https://image.slidesharecdn.com/hereditarydiffuseleukoencephalopathywithaxonalspheroids0919-190909155330/75/Hereditary-Diffuse-Leukoencephalopathy-with-Axonal-Spheroids-10-2048.jpg 2048w"
] |
[] |
[] |
[
""
] | null |
[] |
2019-09-09T15:53:30+00:00
|
Hereditary Diffuse Leukoencephalopathy with Axonal Spheroids - Download as a PDF or view online for free
|
en
|
https://public.slidesharecdn.com/_next/static/media/favicon.7bc3d920.ico
|
SlideShare
|
https://www.slideshare.net/slideshow/hereditary-diffuse-leukoencephalopathy-with-axonal-spheroids/170300841
|
1. Hereditary Diffuse Leukoencephalopathy with Axonal Spheroids (HDLS) ADE WIJAYA, MD – SEPTEMBER 2019
2. Outline: Introduction Pathogenesis Clinical presentation Neuroimaging Differential diagnosis The natural course and prognosis Summary
3. Introduction • First identified in a Western Swedish family reported in 1984 • Closely related to familial pigmentary orthochromatic leukodystrophy (POLD) • The pathological hallmark of this disease is the presence of brain white matter changes with neuroaxonal spheroids present • Autosomal dominant with variable penetrance • A devastating neurodegenerative disease with adult onset Sundal C, Lash J, Aasly J, Øygarden S, Roeber S, Kretzschman H, Garbern JY, Tselis A, Rademakers R, Dickson DW, Broderick D. Hereditary diffuse leukoencephalopathy with axonal spheroids (HDLS): a misdiagnosed disease entity. Journal of the neurological sciences. 2012 Mar 15;314(1-2):130-7.
4. Pathogenesis Primary disruption of the axon integrity Neuroaxonal damage Focal axonal swelling (axonal spheroids) leading to secondary demyelination However, demyelination may precede the axonal damage, triggering an autonomous neurodegenerative process. Baba Y, Ghetti B, Baker MC, Uitti RJ, Hutton ML, Yamaguchi K. Hereditary diffuse leukoencephalopathy with spheroids: clinical, pathologic and genetic studies of a new kindred. Acta Neuropathol (Berl) 2006;111:300–11. Lin WL, Wszolek ZK, Dickson DW. Hereditary diffuse leukoencephalopathy with spheroids: ultrastructural and immunoelectron microscopic studies. Int J Clin Exp Pathol. 2010;3:665–74. Trapp BD, Bo L, Mork S, Chang A. Pathogenesis of tissue injury in MS lesions. J Neuroimmunol.1999;98:49–56.
5. Clinical Presentation • Personality changes • Cognitive dysfunction • Motor impairments such as gait dysfunction, tremor, bradykinesia and rigidity. Van Gerpen JA, Wider C, Broderick DF, Dickson DW, Brown LA, Wszolek ZK. Insights into the dynamics of hereditary diffuse leukoencephalopathy with axonal spheroids. Neurology. 2008;71:925–9.
6. Neuroimaging Brain MRI shows: White matter lesions in a frontal predominant distribution, spreading out from the periventricular and deep white matter into the subcortical areas with enlarged ventricles and often signal changes in corpus callosum Van Gerpen JA, Wider C, Broderick DF, Dickson DW, Brown LA, Wszolek ZK. Insights into the dynamics of hereditary diffuse leukoencephalopathy with axonal spheroids. Neurology. 2008;71:925–9.
7. Differential Diagnosis • Dementia (e.g., FTD and AD) • Atypical Parkinsonism (e.g., corticobasal degeneration, multisystem atrophy or PSP) • Progressive MS • Leukodystrophies Seelaar H, Rohrer JD, Pijnenburg YA, Fox NC, van Swieten JC. Clinical, genetic and pathological heterogeneity of frontotemporal dementia: a review. J Neurol Neurosurg Psychiatry. 2011;82:476–86 Ballard C, Gauthier S, Corbett A, Brayne C, Aarsland D, Jones E. Alzheimer's disease. Lancet.2011;377:1019–31. Seppi K. MRI for the differential diagnosis of neurodegenerative parkinsonism in clinical practice.Parkinsonism Relat Disord. 2007;13(Suppl 3):S400–5. Stadelmann C. Multiple sclerosis as a neurodegenerative disease: pathology, mechanisms and therapeutic implications. Curr Opin Neurol. 2011;24:224–9. Kohlschutter A, Bley A, Brockmann K, Gartner J, Krageloh-Mann I, Rolfs A, et al. Leukodystrophies and other genetic metabolic leukoencephalopathies in children and adults. Brain Dev. 2010;32:82–9.
8. The Natural Course and Prognosis • The mean age of onset in our patients was 44 years (range, 36–52 years), • Disease duration was six years (range, 3–11 years) • The mean age of death was 48 years (range, 40–63 years).
9. Summary • HDLS imitates many neurodegenerative diseases • An accurate diagnosis of HDLS currently depends on a histopathologic evaluation, because the gene(s) causing HDLS remain unknown • Frequently unrecognized and misdiagnosed
|
||||
1850
|
dbpedia
|
3
| 6 |
https://www.heartuk.org.uk/genetic-conditions/high-hdl-cholesterol
|
en
|
High HDL Cholesterol
|
[
"https://www.heartuk.org.uk/genetic-conditions/templates/default/images/heart-uk-logo-white.svg",
"https://www.heartuk.org.uk/genetic-conditions/templates/default/images/heart-uk-logo-colour.svg",
"https://www.heartuk.org.uk/genetic-conditions/images/cholesterol/heart-stethoscope.jpg",
"https://www.heartuk.org.uk/genetic-conditions/templates/default/images/fundraising-regulator-white.png, templates/default/images/fundraising-regulator-white-2x.png 2x"
] |
[] |
[] |
[
"High HDL",
"optimum HDL",
"HDL recent research",
"causes of high HDL",
"treatment for high HDL cholesterol",
"menopause and HDL"
] | null |
[] | null |
High Density Lipoprotein (HDL) is commonly referred to as good cholesterol, but it is possible for it to become too high and lose its protective effects.
|
en
|
https://www.heartuk.org.uk/favicon.ico
|
https://www.heartuk.org.uk/genetic-conditions/high-hdl-cholesterol
|
HDL cholesterol is a type of cholesterol which is essential for good health. It removes fat from the artery walls, lowering the risk of heart disease, but it is possible for it to become too high and lose its protective effects.
Why is HDL cholesterol important?
How high is too high?
Most health professionals are taught that the higher the HDL cholesterol, the more protective it is for your heart health. However, some specialist doctors are beginning to question this.
Very high levels of HDL have been reported to speed up the process of atherosclerosis, where the arteries become clogged up with fat, suggesting that at very high levels HDL doesn’t do its normal job of clearing fat from the arteries.
Current recommendations for healthy levels of HDL cholesterol
1.2mmol/L or above in women
1.1mmol/L or above in men
Our HEART UK experts say the protective effect of HDL cholesterol appears to reach its maximum at roughly 1.4mmol/L, and higher levels may not provide extra protection.
At very high levels HDL may behave more like LDL cholesterol (or ‘bad cholesterol’) and raise the risk of disease, according to current research. This is especially important for women leading up to after the menopause.
What causes high HDL cholesterol?
There are a number of possible causes for high HDL cholesterol, and some of these can be reversed. If you have high HDL cholesterol, your doctor should consider what’s causing it to decide on a course of action.
What you eat and drink
Eating a diet high in saturated fats and drinking too much alcohol can contribute to a higher level of HDL. If you and your doctor discuss making lifestyle changes, you will need to keep these going for an agreed time period, such as three months, before checking your HDL cholesterol levels again to see if the changes are working.
Medication
Some medicines could raise your HDL levels, including:
the oral contraceptive pill (the pill)
oestrogen replacement therapy
anti convulsants.
Your genes
Your doctor should ask you questions about your family to understand if your high HDL could be inherited.
If members of your family, including your parents, grandparents and siblings, have lived for a long time, this is reassuring. If you have a family history of heart disease or strokes, your doctor may want to refer you to a lipid specialist.
Japanese ancestry
Some people with Japanese ancestry have high HDL levels due to a lack of a protein called CETP. This is inherited in the genes.
Menopause
Research has suggested that the changes in hormones that happen during the menopause can affect the way HDL works in the body, and HDL loses some of its protective effects in some women.
Hypothyroidism
People who have an underactive thyroid may have high levels of HDL cholesterol.
Infections and inflammation
Recent research has suggested that HDL cholesterol changes in some situations, such as acute infection (infection which starts suddenly) and chronic (long term) conditions linked to inflammation, such as rheumatoid arthritis. More research is needed to fully understand why.
Other research suggests that high HDL cholesterol may be harmful if you are having dialysis for kidney disease, as it may make inflammation and tissue damage worse.
HEART UK recommendations for people with high levels of HDL
If you have a family history of early heart disease
Ideally your doctor should contact a lipid specialist for advice if:
your HDL cholesterol level is higher than average with no obvious cause
and other people in your family, such as a parent or sibling, have heart disease and were diagnosed below the age of 60.
Your doctor can send a referral or an advice and guidance request to a specialist at a lipid clinic for further support:
Lipid clinic information
If your total cholesterol and HDL cholesterol are high
If your total cholesterol is over 7.5mmol, with HDL over 2.5mmol, then your doctor should base their treatment decision mainly on your LDL cholesterol (and other non HDL-cholesterol).
Raised LDL cholesterol puts your heart health at risk so it needs to be brought under control.
Note that the TC/HDL ratio (which would otherwise be used) may be misleading if your HDL is high.
Find out what the numbers mean
Look after your overall health
If you have high cholesterol, it’s important to lower your risk of heart disease overall. Try to adopt a healthy diet and lifestyle and manage any other health problems you have that can lead to heart disease. For example:
get high blood pressure under control
bring high blood sugar under control
lose weight if you are overweight.
This is especially important for women leading up to, during and after the menopause.
Can medication help?
There are no medications that specifically target high HDL cholesterol, so the main thing is to lower your risk of heart disease overall.
We need more research to fully understand how HDL cholesterol works to develop ways to prevent and treat heart disease. This means studying how HDL lipoproteins work, and how this can be improved on, as simply raising the amount of HDL in the blood does not prevent disease.
If you have high HDL, this is not a reason to avoid lowering LDL cholesterol. Even though HDL is protective and LDL is harmful, high HDL cannot counteract high LDL.
Page updated May 2024
|
|||||
1850
|
dbpedia
|
3
| 73 |
https://www.eatright.org/health/essential-nutrients/fats/what-is-cholesterol
|
en
|
What is Cholesterol?
|
[
"https://www.eatright.org/-/media/images/navigation/site-selector/eatright-org-horizontal.png?h=86&w=312&rev=a8da4e9a760e4316b33446255ac6f5fa&hash=8C5F7E8CA46155120DEC4BA866549962",
"https://www.eatright.org/-/media/images/navigation/site-selector/eatright-pro-horizontal.png?h=84&w=442&rev=88e59438236343b5b9ed63f793d218e9&hash=0756401AD3362C27F0A5503622548594",
"https://www.eatright.org/-/media/images/navigation/site-selector/eatright-store-horizontal.png?h=82&w=504&rev=75ad1d2fc3d04cbab310527cd78ea839&hash=F18F3F1420FF9F59778664906FF68392",
"https://www.eatright.org/-/media/images/navigation/site-selector/eatright-cpe-horizontal.png?h=92&w=482&rev=97dc7f80248546d295981ef333448eae&hash=A06FF3C0A9A75CFD9B6AE203569D12A8",
"https://www.eatright.org/-/media/images/navigation/header/eatrightorgrwebrev2020svg.svg?h=75&iar=0&w=310&rev=b790ca5056964efeb01cb1fd265c3160&hash=C88D6548A60F244276C70BCA2E0A1A1E",
"https://www.eatright.org/-/media/images/eatright-articles/eatright-article-thumbnails/whatischolesterol_600x450.jpg?as=0&w=967&rev=7a51f95dd8ba47de9f3b27595f34f755&hash=7AA1FF862349FC66F6E6C5AA50BA0E50",
"https://www.eatright.org/-/media/images/navigation/footer/logo-eatright-footer.png?h=120&iar=0&w=204&rev=765adf9ae59d40fcae14c9c281891adf&hash=43D39579048CE518718B4912F5CE509E"
] |
[] |
[] |
[
"cholesterol",
"heart health",
"LDL",
"HDL",
"heart disease",
"plaque"
] | null |
[] | null |
Cholesterol is a waxy substance found in animal-based foods that we eat and also is in our body’s cells. People with high cholesterol can benefit from a heart-healthy lifestyle.
|
en
|
/Areas/Shared/favicons/apple-touch-icon.png
|
https://www.eatright.org/health/essential-nutrients/fats/what-is-cholesterol
|
Is your head spinning over the conflicting messages you hear about fat and cholesterol? That’s not surprising. Researchers continue to learn more about cholesterol and saturated fat, too. And, as they learn more, nutrition advice may change.
What is Cholesterol?
Cholesterol is a waxy substance found in animal-based foods that we eat and in our body’s cells. Our bodies need some cholesterol to function normally, however, we can make all the cholesterol our system needs. Cholesterol in the body is used to make hormones and vitamin D. It also plays a role in digestion.
There are three main types of cholesterol in the body:
High-density lipoprotein, or HDL. Often called “good” cholesterol, HDL helps to remove excess cholesterol from your body.
Low-density lipoprotein, or LDL. LDL is the bad cholesterol. It can lead to a buildup of plaque in the arteries.
Very low-density lipoprotein, or VLDL. VLDL also tends to promote plaque buildup.
Another substance included in lipid lab tests is triglyceride levels. Triglycerides are a specific type of fat in the blood. Certain risk factors may increase your risk of elevated triglycerides, such as excess body fat or uncontrolled Type 2 diabetes. Excess calories, especially from refined carbohydrates like added sugars, smoking and drinking alcohol also may increase triglycerides.
If there is too much cholesterol in the body, it builds up. The waxy buildup, called plaque, sticks to the insides of the arteries. As the arteries narrow and clog, it is difficult for the blood to flow through them. The blockage can lead to a blood clot, stroke or heart disease.
Am I at Risk?
Many things may increase your risk for high cholesterol, including:
Genetics: High cholesterol runs in some families.
Age: As we age, our cholesterol levels rise.
Medicines: Certain drugs can elevate cholesterol levels.
Obesity: Individuals with an elevated body mass index are at greater risk for high cholesterol.
Diet: Consuming high quantities of saturated and trans fats can raise LDL cholesterol levels.
Inactivity: Activity helps to elevate HDL cholesterol.
Smoking: Tobacco products decrease HDL and increase LDL. The link between smoking and high cholesterol is greater for women.
I Have High Cholesterol. Now What?
Everyone with high cholesterol can benefit from a heart-healthy lifestyle. However, your doctor might also recommend additional support to manage your cholesterol levels, like a cholesterol-lowering drug, if your cholesterol is high because of genetics. And, if you are at risk of developing high cholesterol, simple lifestyle changes can help reduce that risk. These include eating a heart-healthy diet, being physically active and achieving or maintaining a healthy body weight.
When it comes to a healthy eating plan, four dietary changes may help keep your cholesterol in check:
Enjoy Foods with Plant Sterols and Stanols
Some foods — fruits, vegetables, vegetable oils, nuts, seeds and whole grains — contain substances called plant sterols and stanols. Eating foods rich in these substances may help reduce total and LDL cholesterol levels. To increase your daily intake, also look for foods fortified with plant sterols and stanols. For example, some orange juice, cereals and breakfast bars may be fortified.
Limit Your Intake of Saturated Fat
Saturated fats are predominantly found in animal-based foods such as meats and whole-fat dairy products, as well as some tropical fats like coconut oil. Higher intakes of saturated fat have been found to elevate LDL cholesterol. Studies have also shown that replacing sources of saturated fat with unsaturated fats can help decrease your total and LDL cholesterol levels. To help reduce your intake of saturated fat:
Cook with vegetable oils, such as olive, canola, sunflower and safflower.
Eat foods rich in omega-3 fatty acids such as salmon, walnuts and ground flaxseed.
Choose low-fat or fat-free dairy products, such as 1% or skim milk and non-fat yogurt or low-fat cheeses, such as reduced-fat feta and part-skim mozzarella.
Swap out butter and lard for vegetable oil options, which offer unsaturated fats.
Select Lean Protein Foods
Lean protein foods provide less calories from fat. To choose lean cuts:
Check the package for the words loin or round.
Remove the skin from chicken and turkey to reduce the saturated fat.
Limit fatty, marbled meats, fried or deep-fried foods and other foods that are high in saturated fat, such as organ meats
Choose healthier options when eating out by selecting foods that are baked, broiled or grilled.
Look for Soluble Fiber
Dietary fiber is found in fruits, vegetables, beans, lentils and whole grains. These nutrient-dense foods provide two types of dietary fiber, soluble and insoluble. Both types are important for good health. Getting adequate amounts of dietary fiber from a variety of foods is important for everyone.
Research has shown that soluble fiber, specifically, from fruits, vegetables, beans, lentils and whole grains, may help to lower LDL cholesterol. In the stomach, soluble fiber forms a thick, jelly-like substance, which helps bind dietary cholesterol from foods you’re eating. So, load up on vegetables and fruits:
Eat a variety of different colored fruits and veggies.
Select fruits and vegetables that also provide soluble fiber. For example, figs, Brussels sprouts, peaches, carrots, apricots, mangoes and oranges.
Shift to more plant-based or vegetarian meals by including protein sources like beans, lentils and soy foods.
Focus on whole forms of produce, which includes fresh, frozen, canned and dried varieties.
Look for canned fruits packed in water or their own juice.
Choose low-sodium canned veggies or varieties with no added salt.
Whole grains also are a great way to get the benefits of dietary fiber:
Eat barley (not pearled) and oats — both of these provide soluble fiber.
Make sure the food label on your bread says 100% whole-grain or lists a whole grain as one of the first ingredients.
Limit refined carbohydrates, especially sources of added sugars, such as sweets and sugar-sweetened beverages.
One note of caution: as you increase your fiber intake, also increase your intake of water. This will help to reduce your risk of becoming constipated. If you find it difficult to get enough dietary fiber daily through your foods, ask your health care provider before considering a fiber supplement.
|
|||||
1850
|
dbpedia
|
0
| 26 |
https://storymd.com/journal/nwlknbxcej-adult-onset-leukoencephalopathy-with-axonal-spheroids-and-pigmented-glia/page/a38ovir924-what-are-the-signs-and-symptoms-of-hereditary-diffuse-leukoencephalopathy-with-spheroids
|
en
|
What Are the Signs and Symptoms of Hereditary Diffuse Leukoencephalopathy with Spheroids?
|
[
"https://storymd.com/images/Safari.jpg",
"https://storymd.com/images/Chrome.jpg",
"https://storymd.com/images/Mozilla.jpg",
"https://storymd.com/images/Edge.jpg"
] |
[] |
[] |
[
""
] | null |
[] | null |
HDLS is characterized by leukoencephalopathy, which is damage to a type of brain tissue called white matter (made up of nerve fibers (axons) covered by myelin). Also common in HDLS are swellings...
|
en
|
/favicon.ico
|
StoryMD.com
|
https://storymd.com/journal/nwlknbxcej-adult-onset-leukoencephalopathy-with-axonal-spheroids-and-pigmented-glia/page/a38ovir924-what-are-the-signs-and-symptoms-of-hereditary-diffuse-leukoencephalopathy-with-spheroids
|
Sorry, this browser or its version
is not supported.
StoryMD requires the latest versions of Safari, Chrome, Firefox or Edge.
|
||||
1850
|
dbpedia
|
1
| 50 |
https://storymd.com/journal/nwlknbxcej-adult-onset-leukoencephalopathy-with-axonal-spheroids-and-pigmented-glia/page/a38ovir924-what-are-the-signs-and-symptoms-of-hereditary-diffuse-leukoencephalopathy-with-spheroids
|
en
|
What Are the Signs and Symptoms of Hereditary Diffuse Leukoencephalopathy with Spheroids?
|
[
"https://storymd.com/images/Safari.jpg",
"https://storymd.com/images/Chrome.jpg",
"https://storymd.com/images/Mozilla.jpg",
"https://storymd.com/images/Edge.jpg"
] |
[] |
[] |
[
""
] | null |
[] | null |
HDLS is characterized by leukoencephalopathy, which is damage to a type of brain tissue called white matter (made up of nerve fibers (axons) covered by myelin). Also common in HDLS are swellings...
|
en
|
/favicon.ico
|
StoryMD.com
|
https://storymd.com/journal/nwlknbxcej-adult-onset-leukoencephalopathy-with-axonal-spheroids-and-pigmented-glia/page/a38ovir924-what-are-the-signs-and-symptoms-of-hereditary-diffuse-leukoencephalopathy-with-spheroids
|
Sorry, this browser or its version
is not supported.
StoryMD requires the latest versions of Safari, Chrome, Firefox or Edge.
|
||||
1850
|
dbpedia
|
1
| 70 |
https://www.mayoclinic.org/diseases-conditions/prediabetes/symptoms-causes/syc-20355278
|
en
|
Prediabetes - Symptoms and causes
|
[
"https://assets.mayoclinic.org/content/dam/mayoclinic/logos/mayo-clinic-logo.svg",
"https://assets.mayoclinic.org/content/dam/media/global/images/2023/06/26/pt-visitor-Getty-1419492732-415x275.jpg",
"https://assets.mayoclinic.org/content/dam/media/global/images/2023/06/26/disease-conditions-Getty-1334250777-415x275.jpg",
"https://assets.mayoclinic.org/content/dam/media/global/images/2023/06/26/cont-ed-1676659-3734290-0048-C-415x275.jpg",
"https://assets.mayoclinic.org/content/dam/media/global/images/2023/06/26/mccms-Getty-1082003662-415x275.jpg",
"https://assets.mayoclinic.org/content/dam/media/global/images/2023/10/23/giving-to-mayo-em100063715-p-195580295-415x275.png",
"https://assets.mayoclinic.org/content/dam/mayoclinic/logos/mayo-clinic-logo.svg",
"https://assets.mayoclinic.org/content/dam/media/global/images/2023/06/26/pt-visitor-Getty-1419492732-415x275.jpg",
"https://assets.mayoclinic.org/content/dam/media/global/images/2023/06/26/disease-conditions-Getty-1334250777-415x275.jpg",
"https://assets.mayoclinic.org/content/dam/media/global/images/2023/06/26/cont-ed-1676659-3734290-0048-C-415x275.jpg",
"https://assets.mayoclinic.org/content/dam/media/global/images/2023/06/26/mccms-Getty-1082003662-415x275.jpg",
"https://assets.mayoclinic.org/content/dam/media/global/images/2023/10/23/giving-to-mayo-em100063715-p-195580295-415x275.png",
"https://assets.mayoclinic.org/content/dam/media/global/images/2023/11/14/giving-charity.svg",
"https://assets.mayoclinic.org/content/dam/mayoclinic/badges/Google_Play_Store_badge_EN.svg",
"https://assets.mayoclinic.org/content/dam/mayoclinic/badges/App_Store_Badge_EN.svg"
] |
[] |
[] |
[
""
] | null |
[] |
2023-11-11T00:00:00
|
en
|
/-/media/web/gbs/shared/images/apple-touch-icon-152x152.svg
|
Mayo Clinic
|
https://www.mayoclinic.org/diseases-conditions/prediabetes/symptoms-causes/syc-20355278
|
Hello. I'm Dr. Eleanna De Filippis, an endocrinologist at Mayo Clinic. In this video, we'll cover the basics of insulin resistance. What is it? Who gets it? The symptoms, diagnosis and treatment. Whether you're looking for answers for yourself or someone you love, we're here to give you the best information available. To understand insulin resistance, often referred to as prediabetes, let's first talk about what insulin does. When you eat food, your body converts that food into dietary sugars. Insulin is a hormone released by the pancreas that tells your cells to open up to that sugar and convert it into energy. With insulin resistance, the cells don't react, and don't open up, resulting in excessive sugar in the blood. Over time, the pancreas keeps trying to regulate the blood sugar, producing more and more insulin until it wears out and can't produce large amounts of insulin anymore. As a result, blood sugar levels increase to the point of being in the diabetic range.
Who gets it?
Anyone can become insulin-resistant. In particular, people with excess weight are at a higher risk, compared to the general population. Risk is further increased with a family history of type two diabetes, age over 45, African, Latino or Native American ancestry, smoking, and certain medications, including steroids, anti-psychotics, and HIV medication. There are other medical conditions associated with insulin resistance, like obstructive sleep apnea, fatty liver disease, polycystic ovarian syndrome, also known as PCOS, Cushing's syndrome, and lipodystrophy syndromes. Lipodystrophy syndromes are conditions that cause abnormal fat loss. So carrying either too much or not enough fat tissue in your body can be associated with insulin resistance.
What are the symptoms?
Very often people with insulin resistance don't have any symptoms at all. It is usually picked up by their doctor during an annual health exam or routine blood work. There are some signs of insulin resistance that your doctor may look for. These includes a waistline over 40 inches in men, and a waistline over 35 inches in women. Skin tags or patches of dark velvety skin called acanthosis nigricans. A blood pressure reading of 130 over 80 or higher. A fasting glucose level equal or above 100 milligrams per deciliter. Or a blood sugar level equal or above 140 milligrams per deciliter two hours after a glucose load test. An A1C between 5.7% and 6.3%. A fasting triglycerides level over 150 milligram per deciliter. And an HDL cholesterol level under 40 milligrams per deciliter in men, and an HDL cholesterol level under 50 milligrams per deciliter in women.
How is it diagnosed?
If your doctor spots these symptoms, they may follow up with a physical exam and a variety of blood tests that measure the levels of glucose, or sugar, in your blood and/or your tolerance to that glucose. Or more recently, a blood test called hemoglobin glycosylated A1C, often simply referred to as A1C.
How is it treated?
Reversing insulin resistance and preventing type two diabetes is possible through lifestyle changes, medication, or sometimes both. Healthy bodies come in different shapes and sizes. Losing weight through drastic means can be dangerous and counterproductive. Instead, get ideas from a doctor or a nutritionist about ways to incorporate healthy foods like fruits, vegetables, nuts, beans, and lean proteins into your meals. Also, consider incorporating exercise and movement into your day-to-day life in ways that make you feel good.
What now?
Even though permanently defeating insulin resistance isn't always possible, you can help your body to be more receptive to insulin. Listen to your body, reduce stress, give it the nutrition and activity it desires. If you'd like to learn even more about insulin resistance, watch our other related videos or visit mayoclinic.org. We wish you well.
|
|||||
1850
|
dbpedia
|
0
| 1 |
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2933386/
|
en
|
Hereditary diffuse leukoencephalopathy with spheroids: ultrastructural and immunoelectron microscopic studies
|
[
"https://www.ncbi.nlm.nih.gov/coreutils/uswds/img/favicons/favicon-57.png",
"https://www.ncbi.nlm.nih.gov/coreutils/uswds/img/icon-dot-gov.svg",
"https://www.ncbi.nlm.nih.gov/coreutils/uswds/img/icon-https.svg",
"https://www.ncbi.nlm.nih.gov/coreutils/nwds/img/logos/AgencyLogo.svg",
"https://www.ncbi.nlm.nih.gov/corehtml/pmc/pmcgifs/logo-ijcep.gif",
"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2933386/bin/ijcep0003-0665-f1-4.jpg",
"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2933386/bin/ijcep0003-0665-f5-8.jpg",
"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2933386/bin/ijcep0003-0665-f9-12.jpg",
"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2933386/bin/ijcep0003-0665-f13.jpg",
"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2933386/bin/ijcep0003-0665-f14-15.jpg",
"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2933386/bin/ijcep0003-0665-f16-17.jpg"
] |
[] |
[] |
[
""
] | null |
[
"Wen-Lang Lin",
"Zbigniew K Wszolek",
"Dennis W Dickson"
] |
2010-08-19T00:00:00
|
Hereditary diffuse leukoencephalopathy with spheroids (HDLS) is a rare autosomal dominant disorder characterized by cerebral white matter degeneration with myelin loss and axonal swellings (spheroids) leading to progressive cognitive and motor dysfunction. ...
|
en
|
https://www.ncbi.nlm.nih.gov/coreutils/nwds/img/favicons/favicon.ico
|
PubMed Central (PMC)
|
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2933386/
|
Discussion
Here we describe two major ultrastructural features of the white matter in HDLS: (1) axonal spheroids and (2) the changes in capillary basal lamina. The pathology was further characterized by IEM.
Spheroids contained various combinations of cytoplasmic components. Thus, some spheroids were filled with packed neurofilaments and a few trapped cellular organelles, such as mitochondria, ribosomes and vesicles, while others were packed with membrane-bound dense bodies and a few filaments scattered among them. Aggregation of filaments either pushed organelles peripherally or confined them centrally. Whether the various types of spheroids represent different stages of axonal degeneration remains unknown. It is also not clear whether the accumulation of neurofilaments is the cause or result of axonal swelling.
Our early study of HDLS showed immunohistochemical staining of abundant spheroids with pNF [11]. In this study, a subset of spheroids was immunoreactive to antibodies against nonpNF and αB-crystallin. Immunostaining of nonpNF to demyelinating axons and axon-terminal spheroids is thought to be indicative of axonal transaction in multiple sclerosis [16]. αB-crystallin is a member of heat shock proteins with diverse functions in the nervous system [17]. Its roles, if any, in HDLS remains to be determined.
Myelin sheaths of spheroids also showed various thicknesses. The larger (more swollen) spheroids appear to have thinner sheaths. This correlation could be confirmed by quantitative studies. Loss/thinning of myelin sheaths would result in decompaction of the sheath and subsequent swelling of axons and accumulation of axonal contents. EM also revealed vacuoles between axoplasm and myelin sheath, giving the appearance of peripheral vacuolations of spheroids by light microscopy. Since myelin sheaths are produced by oligodendrocytes, myelin pathology could be caused by oligodendrocyte degeneration. Transgenic mice overexpressing tumor necrosis factor (TNF)-α by astrocytes selectively induced oligodendrocyte apoptosis and myelin vacuolation in the absence of immune cell infiltration. The primary demyelination then evolves to have many phagocytic macrophages, axonal damage and markedly oligodendrocyte loss [18]. In vanishing white matter disease (VWM), a disorder clinically and pathologically similar to HDLS, white matter pathology has been shown to be due, at least in part, to oligodendrocyte dysfunction and loss [19, 20]. VWM has been linked to mutations in genes encoding the subunits of eukaryotic initiation factor 2B [21, 22], which were shown to be unaffected in HDLS in our previous study [11]. Additional quantitative and qualitative studies of oligodendrocytes are needed in HDLS.
It has been postulated that in Binswanger disease hypoperfusion of the deep white matter due to stenosis of the long penetrating arterioles causes demyelination, axonal loss and gliosis of the subcortical white matter or leukoencephalopathy [23]. In the first report of HDLS, Axelsson et al. [1] noted white matter capillary pathology in the form of duplicated basal lamina (BL). Their low magnification micrograph looked similar to ours. Here, we provide higher resolution images of common findings in capillary BL of HDLS. Normally, the vascular BL is a thin, amorphous structure that is formed by fusion of two basal laminae, each from the vascular endothelial cell/pericyte and the perivascular astrocyte [24]. In HDLS many capillaries in affected white matter showed the two basal laminae were widely separated and the widened space was deposited with large amounts of banded collagen and other material. Similar capillary ultrastructure has been reported in white matter of biopsy tissues from human leukodystrophies, including adrenoleukodystrophy, Canavan's disease and Alexander's diseases [25]. Therefore, these changes cannot be due to post mortem changes in autopsy tissues. Similar collagenosis in the human cerebral periventricular white mater (WM) has been shown to increase with age, notably after 70 years of age [26]. The ages of our cases were mostly younger than that (i.e. 46, 49, 51, 55, 62 and 71 years). Further, these changes were observed in white matter beyond the periventricular area in our cases, and in spinal cords of amyotrophic lateral sclerosis (ALS) cases with a mean age of 60.7 ± 7.8 years [27 and references therein], as well as a 15-year-old ALS patient [our unpublished data], suggesting that factor(s) other than old age may be involved. It is noteworthy that Kondo and Suzuki [25] also reported increased pinocytotic vesicles in the capillary endothelial cells and postulated that this and the widened capillary wall may be closely related to the disruption of blood-brain barrier in leukodystrophies. The banded collagen in HDLS has normal diameter (20 to 100 nm) and periodicity (65 nm). Occasionally, some fibers had diameters over 100 nm; others aggregated and showed ragged, moth-eaten appearance. Such appearance is thought to be due to dissociated or poorly packed collagen fibrils [28].
Previous studies did not identify the basal lamina components. Our IEM finding is the first to identify capillary banded collagen as being derived from type I and III collagen, which also had association with fibronectin, but not collagen type IV. A recent review lists collagen IV, laminin, nidogen and perlecan as four major components of basal lamina in general [29]. Fibronectin is not considered a component per se, due to its variable detection [29]. During cerebral angiogenesis in the rat, fibronectin was down-regulated in capillaries [30]. It was strongly increased in adult mice subjected to hypobaric hypoxia [31], indicating angiogenic role for fibronectin. In Binswanger's disease, there is a marked deposition of several collagen types, including type I, in intracerebral arterioles and capillaries [32]. Accumulation of collagen could be due to increase synthesis or decreased degradation. Metalloproteinases (MMP) are enzymes involved in degradation of extracellular matrix, and MMP-2 and -9 degrade collagen types I and III [33]. Interestingly, MMP-2 activity was decreased, while MMP-9 activity was significantly increased in spinal cord of ALS patients [34], where we and others have seen deposits of collagen in capillary basal lamina. The significance of our findings with respect to cerebral capillary function in HDLS, and perhaps other neurodegenerative disorders, remains to be investigated.
On a technical note, there are some reports that immunolabeling of fibrillar collagen requires collagenase digestion to loosen up the interactions between collagens and other extracellular components. We were able to detect capillary associated collagen in paraffin embedded sections simply by heating in pH 7 citrate buffer (data not shown), while no pretreatments were needed for IEM, indicating that these collagens are probably not tightly bound with basal lamina components. This notion agrees with the loose and random distribution of the collagens fibrils in the widened basal lamina.
Ultrastructure of lipid-laden macrophages has not been reported in previous cases of HDLS. The ceroid-like ultrastructural appearance, with lamellated or fingerprint-like bodies, was similar to that reported in neuronal ceroidlipofuscinoses [35] and orthochromatic leukodystrophy [36, 37] and may be nonspecific [38]. On the other hand, they appear to be a consistent finding in HDLS.
In summary, we describe ultrastructural pathology in white matter of HDLS. Spheroids of myelinated or demyelinated swollen axons contained packed pNF and variable non-pNF, mitochondria and cellular debris. Capillaries have split basal laminae with considerable deposits of banded collagen type I and III that were associated with fibronectin, but not type IV collagen. It remains to be determined if these changes are a primary cause or a reactive response of white matter degeneration in HDLS.
|
||||
1850
|
dbpedia
|
2
| 64 |
https://bora.uib.no/bora-xmlui/handle/1956/8449
|
en
|
Bergen Open Research Archive: Colorectal cancer derived organotypic spheroids maintain essential tissue characteristics but adapt their metabolism in culture
|
[
"https://bora.uib.no/bora-xmlui/bitstream/handle/1956/8449/1477-5956-12-39.pdf.jpg?sequence=13&isAllowed=y",
"https://bora.uib.no/bora-xmlui/themes/Mirage2//images/creativecommons/cc-by.png",
"https://bora.uib.no/bora-xmlui/themes/Mirage2/images/unit_product.png",
"https://bora.uib.no/bora-xmlui/themes/Mirage2/images/unit_product.png"
] |
[] |
[] |
[
""
] | null |
[
"Thang V",
"Simone P",
"Connie R",
"Jaco C"
] | null |
en
|
/bora-xmlui/themes/Mirage2/images/favicon.ico
| null |
Sammendrag
Background: Organotypic tumor spheroids, a 3D in vitro model derived from patient tumor material, preserve tissue heterogeneity and retain structural tissue elements, thus replicating the in vivo tumor more closely than commonly used 2D and 3D cell line models. Such structures harbour tumorigenic cells, as revealed by xenograft implantation studies in animal models and maintain the genetic makeup of the original tumor material. The aim of our work was a morphological and proteomic characterization of organotypic spheroids derived from colorectal cancer tissue in order to get insight into their composition and associated biology. Results: Morphological analysis showed that spheroids were of about 250 μm in size and varied in structure, while the spheroid cells differed in shape and size and were tightly packed together by desmosomes and tight junctions. Our proteomic data revealed significant alterations in protein expression in organotypic tumor spheroids cultured as primary explants compared to primary colorectal cancer tissue. Components underlying cellular and tissue architecture were changed; nuclear DNA/ chromatin maintenance systems were up-regulated, whereas various mitochondrial components were down-regulated in spheroids. Most interestingly, the mesenchymal cells appear to be substantial component in such cellular assemblies. Thus the observed changes may partly occur in this cellular compartment. Finally, in the proteomics analysis stem cell-like characteristics were observed within the spheroid cellular assembly, reflected by accumulation of Alcam, Ctnnb1, Aldh1, Gpx2, and CD166. These findings were underlined by IHC analysis of Ctnnb1, CD24 and CD44, therefore warranting closer investigation of the tumorigenic compartment in this 3D culture model for tumor tissue. Conclusions: Our analysis of organotypic CRC tumor spheroids has identified biological processes associated with a mixture of cell types and states, including protein markers for mesenchymal and stem-like cells. This 3D tumor model in which tumor heterogeneity is preserved may represent an advantageous model system to investigate novel therapeutic approaches.
|
||||||
1850
|
dbpedia
|
1
| 8 |
https://www.betterhealth.vic.gov.au/health/conditionsandtreatments/genetic-factors-and-cholesterol
|
en
|
Genetic factors and cholesterol
|
[
"https://content.dhhs.vic.gov.au/sites/default/files/site_logo/logo.png",
"https://content.dhhs.vic.gov.au/sites/default/files/site_logo/dhlogo.png",
"https://content.dhhs.vic.gov.au/sites/default/files/site_logo/logo.png",
"https://content.dhhs.vic.gov.au/sites/default/files/site_logo/dhlogo.png",
"https://www.betterhealth.vic.gov.au/_nuxt/img/logo-DH.1e3c39d.png",
"https://content.dhhs.vic.gov.au/sites/default/files/logo-VCGS.jpg",
"https://www.betterhealth.vic.gov.au/_nuxt/img/logo-DH.1e3c39d.png",
"https://content.dhhs.vic.gov.au/sites/default/files/logo-VCGS.jpg",
"https://www.betterhealth.vic.gov.au/_nuxt/img/logo-DH.1e3c39d.png",
"https://content.dhhs.vic.gov.au/sites/default/files/logo-VCGS.jpg",
"https://www.betterhealth.vic.gov.au/_nuxt/img/flag-torres-strait.8fc9c3c.png",
"https://www.betterhealth.vic.gov.au/_nuxt/img/pride-progress-flag.c1c6916.png",
"https://www.betterhealth.vic.gov.au/_nuxt/img/logo-DHHS.8d8f412.jpg",
"https://www.betterhealth.vic.gov.au/_nuxt/img/footer-logo.c95ca18.png"
] |
[] |
[] |
[
"angina",
"chest pain",
"cholesterol",
"cholesterol-lowering drugs",
"genetic condition",
"genetic counselling",
"heart attacks young",
"high blood cholesterol",
"high LDL",
"inherited conditions",
"plant sterols",
"plant stanols"
] | null |
[] |
2003-01-28T00:00:00
|
Familial hypercholesterolaemia is an inherited condition characterised by higher than normal levels of blood cholesterol.
|
en
|
/favicon.ico
|
http://www.betterhealth.vic.gov.au/health/conditionsandtreatments/genetic-factors-and-cholesterol
|
Cholesterol is an essential component of cell membranes and is needed for many bodily functions, such as the production of hormones. It is produced when foods containing oil and fat are digested. It is also produced in the liver.
Cholesterol in the blood is found in two types of particles. The cholesterol in low density lipoproteins (LDL) is known as the ‘bad’ cholesterol because it contributes to heart disease by ‘sticking’ to and narrowing the arteries supplying the heart. High density lipoprotein (HDL) cholesterol is known as the ‘good’ cholesterol because it keeps LDL levels in check.
Familial hypercholesterolaemia is an inherited condition characterised by higher than normal levels of LDL blood cholesterol. Familial hypercholesterolaemia causes up to 10 per cent of early onset coronary artery disease – heart disease that occurs before the age of 55 years.
The cause is a mutation in a gene. About one in every 300 Australians is thought to be affected. Other names for familial hypercholesterolaemia include familial hyperlipidaemia, hypercholesterolaemic xanthomatosis and low density lipoprotein receptor mutation.
Symptoms of familial hypercholesterolaemia
High blood cholesterol can be asymptomatic, which means the person may not even realise they have it. Some of the signs and symptoms of familial hypercholesterolaemia can include:
family history of the disorder
family history of heart attacks at an early age
high LDL cholesterol levels that resist treatment in one or both parents
cholesterol deposits on the knees, elbows and buttocks (xanthomas)
high blood cholesterol levels
chest pain caused by narrowed coronary arteries (angina)
heart attack early in life.
Genetics of familial hypercholesterolaemia
Cholesterol is delivered to cells via the bloodstream. Normally, the tiny particles of LDL cholesterol attach to ‘receptor’ sites on the targeted cells and are then absorbed. A gene on chromosome 19, called the LDLR gene, controls the production of these receptors. Most familial hypercholesterolaemia is due to a mutation of the LDLR gene that changes the way the receptors develop, either in number or structure. This means that LDL cholesterol is not well absorbed into cells, and remains circulating in the blood.
High blood cholesterol is a risk factor in coronary artery disease, because it sticks to the artery walls, produces fatty plaques and narrows the diameter of the arteries (atherosclerosis). Less commonly, familial hypercholesterolemia is caused by a mutation on other genes, such as APOB or PCSK9.
Pattern of inheritance for familial hypercholesterolaemia
Familial hypercholesterolaemia is an autosomal dominant disorder. In the great majority of cases, the gene is inherited from just one parent. Very rarely, it is inherited from both.
One parent
If one parent has one mutated gene and one normal gene in the pair, each child of this parent has a 50 per cent chance of inheriting the mutated gene. The risk of developing early coronary artery disease depends on the gender of the child and includes:
Around 50 per cent of males who inherit the genetic mutation from this parent will develop coronary artery disease before the age of 50 years.
All of the affected male children of this parent will develop heart disease by the age of 70 years.
About 85 per cent of affected male children of this parent will have a heart attack before the age of 60 years.
Around 12 per cent of females who inherit the genetic mutation from this parent will develop coronary artery disease before the age of 50 years, and 74 per cent by the age of 70 years.
Two parents
If both parents carry the mutated gene, each child has a 25 per cent chance of inheriting both the genes containing mutations. In this case, the child will develop a severe form of coronary artery disease very early in life, perhaps while still in childhood. This form of familial hypercholesterolaemia is resistant to treatment.
Despite medical intervention, the risk of heart attack remains high. Symptoms can include patches of excess cholesterol collecting in the skin, particularly at the elbows, knees and buttocks.
Diagnosis of familial hypercholesterolaemia
Familial hypercholesterolaemia is diagnosed using a number of tests including:
physical examination
blood tests
heart tests, such as the stress test
genetic tests.
Treatment for familial hypercholesterolaemia
There is no cure for familial hypercholesterolaemia. Treatment aims to reduce the person’s risk of coronary artery disease and heart attack, and may include:
Dietary changes – recommended dietary changes include reduced intake of saturated fats and cholesterol-rich foods, and increased intake of fibre. Modifying the diet is usually the first line of treatment. After three months, test results will show whether more aggressive treatment is needed.
Plant sterols and stanols – these substances are structurally similar to cholesterol, but aren’t absorbed by the cells. Studies show that increasing the intake of plant sterols and stanols can substantially reduce blood cholesterol. Sources include corn, rice, vegetable oils and nuts.
Exercise – regular exercise has been shown to reduce blood cholesterol levels. Any exercise program should be supervised by your doctor.
Weight loss – obesity is a risk factor. Maintaining a healthy weight for your height can reduce your risk of coronary artery disease and heart attack.
Avoid smoking – cigarette smoke encourages cholesterol to ‘stick’ to artery walls. Quitting can significantly reduce your risk of heart attack.
Medication – very few people with familial hypercholesterolaemia will be able to reduce their cholesterol levels by diet and lifestyle changes alone. Most will need special cholesterol-lowering drugs.
Where to get help
|
|||||
1850
|
dbpedia
|
0
| 47 |
https://karger.com/dem/article/32/2/150/99137/Adult-Onset-Leukoencephalopathy-with-Axonal
|
en
|
Adult-Onset Leukoencephalopathy with Axonal Spheroids and Pigmented Glia Can Present as Frontotemporal Dementia Syndrome
|
[
"https://karger.silverchair-cdn.com/data/SiteBuilderAssetsOriginals/Live/Images/umbrella/Karger_RGB_neg.svg",
"https://karger.silverchair-cdn.com/data/SiteBuilderAssetsOriginals/Live/Images/umbrella/Karger_RGB.svg",
"https://karger.silverchair-cdn.com/data/SiteBuilderAssets/Live/Images/dem/DEM_logo864402569.png",
"https://karger.silverchair-cdn.com/data/SiteBuilderAssets/Live/Images/umbrella/karger_default_cover387652959.png",
"https://karger.silverchair-cdn.com/karger/content_public/journal/dem/32/2/10.1159_000331422/2/m_000331422_f01.gif?Expires=1726994151&Signature=P4iiBRZ6QMos2SD4R6tJvqWc64zkp~7JW4bJsRRv33uX6zjNya1M8-~IMAMUFTk-4z0kfSxUOv1C4S0Wh5TI4B8IGkuRL5pYOeig4pfMGpiD9nKCPE7JlwWK96SMP9Bacq6eoqc83~3UpvVUPS7sg628pBowq1nJ0RXkXTa~t1PkHc1cppezmELffDRpPUJppoJFro5N0VihgC-MGcCSFABL7Cmr4nUcine5fP4~HAb7Gy8NQuTawCdvzDWAAl8ulBy1hsps1venQS980eODW9kaIg21cJkhTn5JNzo2IhvWgJSkHVPxhJ0Fsq-7GgPrQd~Ium72U31cxGu~QblSgQ__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA",
"https://karger.silverchair-cdn.com/karger/content_public/journal/dem/32/2/10.1159_000331422/2/m_000331422_f01.gif?Expires=1726994151&Signature=P4iiBRZ6QMos2SD4R6tJvqWc64zkp~7JW4bJsRRv33uX6zjNya1M8-~IMAMUFTk-4z0kfSxUOv1C4S0Wh5TI4B8IGkuRL5pYOeig4pfMGpiD9nKCPE7JlwWK96SMP9Bacq6eoqc83~3UpvVUPS7sg628pBowq1nJ0RXkXTa~t1PkHc1cppezmELffDRpPUJppoJFro5N0VihgC-MGcCSFABL7Cmr4nUcine5fP4~HAb7Gy8NQuTawCdvzDWAAl8ulBy1hsps1venQS980eODW9kaIg21cJkhTn5JNzo2IhvWgJSkHVPxhJ0Fsq-7GgPrQd~Ium72U31cxGu~QblSgQ__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA",
"https://karger.silverchair-cdn.com/karger/content_public/journal/dem/32/2/10.1159_000331422/2/m_000331422_t01.gif?Expires=1726994151&Signature=pfkf~dVTrXPOPjgKBjG68ozxDdAj6bNPibQCKVbdIZNGuXZ8TbGALWxQDs~AFnpytureVXyAyHHOAF9KSqjxj0nQLhzk2455UjgbIkMk4jrI5dlAWlfGuQESVh3WaKPsHdcu0AtVOh2F6C0nd6MnoFMSqOyzgXNKy~RZxOu-DdYLAdK9E71smNPa4YDs1Zzba66wsD9qXWJdy-bq7c9zdUs3YRwi8oj0HD2oB1Blmfnov-UV1PvG3t45sGZ5Ddd371hSJNcHmJ-gwf0Y9XXbHDFlNUQ-N5zdxOzHm6XPMOOmQKlIw9O7AijFKS8kcadlB7mTeJCI1z4yCGa8qIFY9A__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA",
"https://karger.silverchair-cdn.com/karger/content_public/journal/dem/32/2/10.1159_000331422/2/m_000331422_t01.gif?Expires=1726994151&Signature=pfkf~dVTrXPOPjgKBjG68ozxDdAj6bNPibQCKVbdIZNGuXZ8TbGALWxQDs~AFnpytureVXyAyHHOAF9KSqjxj0nQLhzk2455UjgbIkMk4jrI5dlAWlfGuQESVh3WaKPsHdcu0AtVOh2F6C0nd6MnoFMSqOyzgXNKy~RZxOu-DdYLAdK9E71smNPa4YDs1Zzba66wsD9qXWJdy-bq7c9zdUs3YRwi8oj0HD2oB1Blmfnov-UV1PvG3t45sGZ5Ddd371hSJNcHmJ-gwf0Y9XXbHDFlNUQ-N5zdxOzHm6XPMOOmQKlIw9O7AijFKS8kcadlB7mTeJCI1z4yCGa8qIFY9A__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA",
"https://karger.silverchair-cdn.com/karger/content_public/journal/dem/32/2/10.1159_000331422/2/m_000331422_t02.gif?Expires=1726994151&Signature=a75XlEk~qfsYRYvw08PMd68yddvNoTU~BiIJ1hJTU7~8tUNwmUiOoAN6GGk6pRYFyjA7DGsG~PtHQ8XnuukaT0HGKPhVnJ1b4ZudzfxyTWTpL7X1GQguIBkXq8lHSU9zPyaUbkVvMqoULJGDaLNzBbk-s7XJP8rN4XLkIJxfmlF7ory7XKI-wyiAEkjfHn5iw25ug~WBm9pbkiCPK8pXHLpOnClIEvqKBh2379I8rSCI2fARZWzEs4r5gXBpjVwHQXnwXfN7YYzoV5oAHcyp4OWVyiOHcKfcWXse8wYYaPkDBY6Ll6F4EmNZ0ZXOYYRyTNP8~7TBqWMJ0~LzOvrZAA__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA",
"https://karger.silverchair-cdn.com/karger/content_public/journal/dem/32/2/10.1159_000331422/2/m_000331422_t02.gif?Expires=1726994151&Signature=a75XlEk~qfsYRYvw08PMd68yddvNoTU~BiIJ1hJTU7~8tUNwmUiOoAN6GGk6pRYFyjA7DGsG~PtHQ8XnuukaT0HGKPhVnJ1b4ZudzfxyTWTpL7X1GQguIBkXq8lHSU9zPyaUbkVvMqoULJGDaLNzBbk-s7XJP8rN4XLkIJxfmlF7ory7XKI-wyiAEkjfHn5iw25ug~WBm9pbkiCPK8pXHLpOnClIEvqKBh2379I8rSCI2fARZWzEs4r5gXBpjVwHQXnwXfN7YYzoV5oAHcyp4OWVyiOHcKfcWXse8wYYaPkDBY6Ll6F4EmNZ0ZXOYYRyTNP8~7TBqWMJ0~LzOvrZAA__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA",
"https://karger.silverchair-cdn.com/karger/content_public/journal/dem/32/2/10.1159_000331422/2/m_000331422_t03.gif?Expires=1726994151&Signature=jmwbALbcvS4NrSrfSSbDer6k2wunTxEoUcwtt9auP4acsGmNqF0UPj8bNbuHehuXRh4wNHMSubyrPrfiqN9PMMOSP-N2xJ3Tamdbz3JVUAmFt~AycgJBz8K2UUFRWchaCZMQ44SzEW1de19UpK31rWg1uqQyoTn~JVRzOCacPrBaGOrt6rmkAvEKwWGZzLIUAGBXpyeUdD9ER5e5bfsXajGqoTWPE2BUERLy4c~ye3Mv5uA0x1dX-2zgJmQWENi2X274NI9MBDHZxu3~edcWujOLrXRl6Mu3LdCU2xWUQO5Ze-3~S-SuL27mDtjOW9iOnXXXeM~8IxKlZYZPRiumzg__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA",
"https://karger.silverchair-cdn.com/karger/content_public/journal/dem/32/2/10.1159_000331422/2/m_000331422_t03.gif?Expires=1726994151&Signature=jmwbALbcvS4NrSrfSSbDer6k2wunTxEoUcwtt9auP4acsGmNqF0UPj8bNbuHehuXRh4wNHMSubyrPrfiqN9PMMOSP-N2xJ3Tamdbz3JVUAmFt~AycgJBz8K2UUFRWchaCZMQ44SzEW1de19UpK31rWg1uqQyoTn~JVRzOCacPrBaGOrt6rmkAvEKwWGZzLIUAGBXpyeUdD9ER5e5bfsXajGqoTWPE2BUERLy4c~ye3Mv5uA0x1dX-2zgJmQWENi2X274NI9MBDHZxu3~edcWujOLrXRl6Mu3LdCU2xWUQO5Ze-3~S-SuL27mDtjOW9iOnXXXeM~8IxKlZYZPRiumzg__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA",
"https://karger.silverchair-cdn.com/karger/content_public/journal/dem/32/2/10.1159_000331422/2/m_000331422_t04.gif?Expires=1726994151&Signature=g~es9K96LsSYa5kWg7wmzT4JbtHsYatbgkIblC9Da1Q-4gdtCMfZyjSfyIp9~vLOqMWWigqWjT3MBJVAJJb6uZq99x2y8l0AmVWk8iF~LEvm0KLQ8iDzWgCx-xJCjBg0NYAD8udNWD4uKvLTrh6IOEGctJMn7F1M4lF0jmesYINcWC4CYZLGSJ7C2FKJZUyx-LT91h-WHuwZPApCreHF0tnwWJs676~x8vbsXo3vNtEhivXUi2xpxnYiu7ptmA7i-Yx4PXZ-MyQqDQ7XFqC7VdpQGJxivzSe5z6nNuD0~-xDuRI8NYTgkfu-4beuUuGsl-XwJxviBB1qmPizbHDpkg__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA",
"https://karger.silverchair-cdn.com/karger/content_public/journal/dem/32/2/10.1159_000331422/2/m_000331422_t04.gif?Expires=1726994151&Signature=g~es9K96LsSYa5kWg7wmzT4JbtHsYatbgkIblC9Da1Q-4gdtCMfZyjSfyIp9~vLOqMWWigqWjT3MBJVAJJb6uZq99x2y8l0AmVWk8iF~LEvm0KLQ8iDzWgCx-xJCjBg0NYAD8udNWD4uKvLTrh6IOEGctJMn7F1M4lF0jmesYINcWC4CYZLGSJ7C2FKJZUyx-LT91h-WHuwZPApCreHF0tnwWJs676~x8vbsXo3vNtEhivXUi2xpxnYiu7ptmA7i-Yx4PXZ-MyQqDQ7XFqC7VdpQGJxivzSe5z6nNuD0~-xDuRI8NYTgkfu-4beuUuGsl-XwJxviBB1qmPizbHDpkg__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA",
"https://karger.silverchair-cdn.com/karger/content_public/journal/dem/32/2/10.1159_000331422/2/m_000331422_f02.jpeg?Expires=1726994151&Signature=f~3MFmiCAJmze7f2N2V8zifWpuB5BAyUMztTgQYuF7aAr0flvUduVNY0itL8CHUr4qA~Ut5PRbg8O0LxNaz3sZcfBQdJ0G7WDF5JAkbKH2YxaUWlJVSFMiRTzXA85802lzEIB9Z2ILUIAqjz8fIUbf2TNSjSjH7alm5tj4fuii1ReyyIUsw~PCndIDV20tC6ikSsPN4ZX~mi-zepoQ3QIAQZA7Zv7OotKvHKfEP0g-8mysaxMxo4kT9hhC-FiUavMgT5m2ocIrkVkbUD0UwJEwAa2U4yfGGSIapVWVRjtubX5yvhsE-7EBFLb2IPKOjoRKIqBaxG6N4HcrfK24CcOg__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA",
"https://karger.silverchair-cdn.com/karger/content_public/journal/dem/32/2/10.1159_000331422/2/m_000331422_f02.jpeg?Expires=1726994151&Signature=f~3MFmiCAJmze7f2N2V8zifWpuB5BAyUMztTgQYuF7aAr0flvUduVNY0itL8CHUr4qA~Ut5PRbg8O0LxNaz3sZcfBQdJ0G7WDF5JAkbKH2YxaUWlJVSFMiRTzXA85802lzEIB9Z2ILUIAqjz8fIUbf2TNSjSjH7alm5tj4fuii1ReyyIUsw~PCndIDV20tC6ikSsPN4ZX~mi-zepoQ3QIAQZA7Zv7OotKvHKfEP0g-8mysaxMxo4kT9hhC-FiUavMgT5m2ocIrkVkbUD0UwJEwAa2U4yfGGSIapVWVRjtubX5yvhsE-7EBFLb2IPKOjoRKIqBaxG6N4HcrfK24CcOg__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA",
"https://karger.silverchair-cdn.com/ImageLibrary/umbrella/Karger_RGB_neg.svg?versionId=23030"
] |
[] |
[] |
[
""
] | null |
[
"Wong, Janice C",
"Chow, Tiffany W",
"Hazrati, Lili-Naz",
"Lili-Naz",
"Janice C",
"Tiffany W"
] |
2011-10-05T00:00:00
|
Abstract. Background/Aims: We review the characteristics of adult-onset leukoencephalopathy with axonal spheroids and pigmented glia(ALSP) and determine
|
en
|
//karger.silverchair-cdn.com/Themes/Client/app/img/favicons/v-638576255786243535/apple-touch-icon.png
|
Karger Publishers
|
https://karger.com/dem/article/32/2/150/99137/Adult-Onset-Leukoencephalopathy-with-Axonal
|
Results of the systematic literature search are summarized in figure 1. The literature search identified 51 individual cases that fulfilled the inclusion criteria, with absence of exclusion criteria, from 31 publications [2,3,4,6,7,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36]. Including the new case described in this study, a total of 52 individual ALSP cases were subsequently analyzed. Widening the range of keywords for the search made us aware that although ALSP is rare, there was a substantial number of ALSP cases already published.
Online supplementary Appendix A (see online at www.karger.com?doi=10.1159/000331422) lists specific information extracted from 31 publications and 1 case of ALSP. Overall, there were 30 women and 21 men (1 unrecorded). Pathological diagnoses were recorded as ALSP in 8 patients, HDLS in 12 patients, POLD in 17 patients, and adult-onset leukoencephalopathy with neuroaxonal spheroids in 15 patients. Eight diagnoses were confirmed by biopsy antemortem, while the rest were confirmed at autopsy. Mean age of onset was 42.2 ± 12.1 years, ranging from 15 to 78 years (n = 52). Initial symptoms of disease were highly varied and are listed in detail in online supplementary Appendix A. Patients could present with more than one initial symptom, which included personality or behavioral changes (n = 15), motor abnormalities (n = 15), depression or anxiety (n = 9), memory impairment (n = 9), speech abnormalities (n = 9) and seizure (n = 3).
Mean duration of progression was 6.2 ± 6.0 years, ranging from 2 months to 34 years (n = 45). Excluding the two extreme cases of 2 months and 34 years of progression, which were both reported by Axelsson et al. [6], mean duration was 5.7 ± 4.2 years (n = 43). Of the 45 patients who were followed until death, 24 had a disease duration of 4 years or less. Mean age of death was 48.6 ± 14.3 years, ranging from 17 to 89 years (n = 45). Of the 44 cases that did not have brain biopsies performed, 14 listed antemortem diagnoses, none of which accurately diagnosed ALSP: Pick’s disease, bvFTD or FTD (n = 4), Alzheimer’s disease (n = 2), corticobasal degeneration (n = 2), presenile dementia (n = 2), psychiatric disorder (n = 2), microvascular leukoencephalopathy (n = 1) and Binswanger leukoencephalopathy (n = 1).
Twenty-five patients had at least one family member with histopathologically confirmed ALSP, belonging to 10 unique kindreds; 24 had family histories of neurodegenerative diseases, which are listed in online supplementary Appendix A.
Analysis of clinical features from 52 histopathologically confirmed cases of ALSP revealed a high frequency of clinical bvFTD features. Four patients were diagnosed antemortem with a FTD syndrome. Using 2011 bvFTD criteria, 26.9% of ALSP cases could have been diagnosed with possible bvFTD and 11.5% could have been diagnosed with probable bvFTD [10]. Furthermore, undocumented bvFTD features may have existed in some cases included in our review. For example, psychiatric symptoms of emotional lability, depression, irritability or aggression could have contributed to features typical of bvFTD – such as decline in interpersonal or personal conduct and loss of sympathy or empathy – that were not explicitly documented.
There were key distinguishing features of ALSP that are not commonly seen in bvFTD. First, the prominent white matter hyperintensities on T2-weighted MRI of ALSP cases were not consistent with ‘routine’ bvFTD imaging findings. In bvFTD, distinct atrophy is expected in frontal and temporal lobes with limited white matter damage [3,37]. Secondly, many ALSP patients had seizures. Interestingly, despite the prevalence of seizures, no patients showed epileptiform activity on EEG investigations. Abnormal EEG results are also unsupportive of bvFTD, and most ALSP patients who underwent EEG investigations had abnormal slow wave activity. Thirdly, the mean age of onset in ALSP patients (42.2 years, ranging from 15 to 78 years) was younger than that in FTD patients (60.4 years, ranging from 30 to 82 years) [38]. Finally, ALSP progressed more rapidly (mean 74.4 months) than FTD (mean 89.1 months) [38]. Common pathologies underlying rapidly progressive dementia include Creutzfeldt-Jakob disease, frontotemporal lobar degeneration, tauopathies, diffuse Lewy body disease and Alzheimer’s disease [39]. While ALSP is a comparably rare pathology, it nevertheless should be considered in the differential diagnosis of rapidly progressive dementia.
ALSP is pathologically distinguished by myelin loss, gliosis, neuroaxonal spheroids, macrophages with pigmented granules, sparing of subcortical U-fibers and varied but frontal-predominant white matter damage. Some cases had macrophages with intracytoplasmic ‘fingerprint’ patterns. These patterns have been observed in previous case reports and are suggestive of ceroid [12,15,18]. Since oxidative stress or decreased lysosomal proteolytic activity can lead to ceroid or lipofuscin accumulation in human glial cells [40], these patterns raise the possibility that oxidative damage plays a role in the pathogenesis of ALSP. Macrophages with granular inclusions may also be associated with solvent inhalation, but none of the ALSP cases had a recorded history of solvent exposure [41].
The past decade featured an increasing number of ALSP cases diagnosed antemortem by brain biopsy, whereas previous diagnoses had largely relied on autopsies. Historically, other diagnostic techniques in ALSP also evolved. Since the 1970s, CT imaging has revealed regional or generalized atrophy in brains of ALSP patients. EEG tests have also been used for investigations, but have not been definitively diagnostic. MRI became commonplace since the late 1990s; T2-weighted MRI has been especially important in revealing white matter changes. Functional imaging such as SPECT or PET may provide more opportunities for antemortem diagnosis of ALSP in the future.
|
||||
1850
|
dbpedia
|
3
| 12 |
https://www.merckmanuals.com/home/hormonal-and-metabolic-disorders/cholesterol-disorders/elevated-hdl-cholesterol
|
en
|
Elevated HDL Cholesterol
|
[
"https://www.merckmanuals.com/home/_next/static/media/icon_search_black.3a2bfc46.png 1x, /home/_next/static/media/icon_search_black.3a2bfc46.png 2x",
"https://www.merckmanuals.com/home/_next/static/media/settings-icon.948bffc5.svg 1x, /home/_next/static/media/settings-icon.948bffc5.svg 2x",
"https://www.merckmanuals.com/_next/image?url=&w=16&q=75 1x",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/facebook.svg?h=40&iar=0&w=40",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/social_round_instagram.svg?h=40&iar=0&w=40",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/social_round_youtube.svg?h=40&iar=0&w=40",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/social_round_twitter.svg?iar=0",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/brand-logos/mm_logo.svg?h=52&iar=0&w=52&mw=64 1x, https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/brand-logos/mm_logo.svg?h=52&iar=0&w=52&mw=128 2x",
"https://www.merckmanuals.com/home/_next/static/media/home-icon.2ae865eb.svg 1x, /home/_next/static/media/home-icon.2ae865eb.svg 2x",
"https://www.merckmanuals.com/home/_next/static/media/icon_search_white.ab0fbaf1.svg 1x, /home/_next/static/media/icon_search_white.ab0fbaf1.svg 2x",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/marketing/quizzes_lightbulb_red.png?h=52&iar=0&w=64&mw=64 1x, https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/marketing/quizzes_lightbulb_red.png?h=52&iar=0&w=64&mw=128 2x",
"https://www.merckmanuals.com/_next/image?url=https%3A%2F%2Fedge.sitecorecloud.io%2Fmmanual-ssq1ci05%2Fmedia%2Fmanual%2Fmarketing%2Fmobileqr%2Fen_mer_mobile_con_326.gif&w=384&q=75 1x, /_next/image?url=https%3A%2F%2Fedge.sitecorecloud.io%2Fmmanual-ssq1ci05%2Fmedia%2Fmanual%2Fmarketing%2Fmobileqr%2Fen_mer_mobile_con_326.gif&w=750&q=75 2x",
"https://www.merckmanuals.com/_next/image?url=https%3A%2F%2Fedge.sitecorecloud.io%2Fmmanual-ssq1ci05%2Fmedia%2Fmanual%2Fmarketing%2Fmobileqr%2Fen_mer_mobile_con_326.gif&w=384&q=75 1x, /_next/image?url=https%3A%2F%2Fedge.sitecorecloud.io%2Fmmanual-ssq1ci05%2Fmedia%2Fmanual%2Fmarketing%2Fmobileqr%2Fen_mer_mobile_con_326.gif&w=750&q=75 2x",
"https://www.merckmanuals.com/_next/image?url=https%3A%2F%2Fedge.sitecorecloud.io%2Fmmanual-ssq1ci05%2Fmedia%2Fmanual%2Fmarketing%2Fmobileqr%2Fen_mer_mobile_qr_con_326.gif&w=384&q=75 1x, /_next/image?url=https%3A%2F%2Fedge.sitecorecloud.io%2Fmmanual-ssq1ci05%2Fmedia%2Fmanual%2Fmarketing%2Fmobileqr%2Fen_mer_mobile_qr_con_326.gif&w=750&q=75 2x",
"https://www.merckmanuals.com/home/_next/static/media/mmanual_logo_transparent.587a6151.png 1x, /home/_next/static/media/mmanual_logo_transparent.587a6151.png 2x",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/facebook.svg?h=40&iar=0&w=40",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/social_round_youtube.svg?h=40&iar=0&w=40",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/social_round_twitter.svg?iar=0",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/social_round_instagram.svg?h=40&iar=0&w=40",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/footer/accessibility.png?h=28&iar=0&w=75&mw=96 1x, https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/footer/accessibility.png?h=28&iar=0&w=75&mw=256 2x",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/footer/accessibility.png?h=28&iar=0&w=75&mw=96 1x, https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/footer/accessibility.png?h=28&iar=0&w=75&mw=256 2x",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/facebook.svg?h=40&iar=0&w=40",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/social_round_youtube.svg?h=40&iar=0&w=40",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/social_round_twitter.svg?iar=0",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/social_round_instagram.svg?h=40&iar=0&w=40",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/brand-logos/mmanual_foot_logo.png?h=70&iar=0&w=240&mw=256 1x, https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/brand-logos/mmanual_foot_logo.png?h=70&iar=0&w=240&mw=480 2x",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/facebook.svg?h=40&iar=0&w=40",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/social_round_youtube.svg?h=40&iar=0&w=40",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/social_round_twitter.svg?iar=0",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/social_round_instagram.svg?h=40&iar=0&w=40",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/footer/accessibility.png?h=28&iar=0&w=75&mw=96 1x, https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/footer/accessibility.png?h=28&iar=0&w=75&mw=256 2x",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/facebook.svg?h=40&iar=0&w=40",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/social_round_youtube.svg?h=40&iar=0&w=40",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/social_round_twitter.svg?iar=0",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/social_round_instagram.svg?h=40&iar=0&w=40",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/footer/accessibility.png?h=28&iar=0&w=75&mw=96 1x, https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/footer/accessibility.png?h=28&iar=0&w=75&mw=256 2x",
"https://www.merckmanuals.com/_next/image?url=https%3A%2F%2Fedge.sitecorecloud.io%2Fmmanual-ssq1ci05%2Fmedia%2Fmanual%2Fbrand-logos%2Fmmanual_foot_logo.png%3Fh%3D70%26iar%3D0%26w%3D240&w=96&q=75 1x, /_next/image?url=https%3A%2F%2Fedge.sitecorecloud.io%2Fmmanual-ssq1ci05%2Fmedia%2Fmanual%2Fbrand-logos%2Fmmanual_foot_logo.png%3Fh%3D70%26iar%3D0%26w%3D240&w=256&q=75 2x",
"https://www.merckmanuals.com/home/_next/static/media/more_options.17949f37.png 1x, /home/_next/static/media/more_options.17949f37.png 2x",
"https://www.merckmanuals.com/home/_next/static/media/icon_close_gray.add02139.png 1x, /home/_next/static/media/icon_close_gray.add02139.png 2x",
"https://www.merckmanuals.com/home/_next/static/media/search-uparrow-black.29e4f8db.png 1x",
"https://www.merckmanuals.com/home/_next/static/media/search-downarrow-black.b622a9d6.png 1x"
] |
[] |
[] |
[
"fat",
"lipid"
] | null |
[
"Michael H. Davidson",
"Pallavi Pradeep"
] |
2023-07-03T00:00:00
|
Elevated HDL Cholesterol - Learn about the causes, symptoms, diagnosis & treatment from the Merck Manuals - Medical Consumer Version.
|
en
|
/home/_next/static/media/favicon.f7343459.ico
|
Merck Manual Consumer Version
|
https://www.merckmanuals.com/home/hormonal-and-metabolic-disorders/cholesterol-disorders/elevated-hdl-cholesterol
|
Elevated high-density lipoprotein (HDL) level is abnormally high levels of HDL cholesterol in the blood.
(See also Overview of Cholesterol and Lipid Disorders.)
A high level of HDL cholesterol (the "good" cholesterol) may decrease the risk of heart attacks and strokes. However, HDL cholesterol levels may be increased in some genetic disorders. In these disorders, the high HDL level may not protect against heart attacks or strokes, probably because the disease also causes other changes in lipid levels and other abnormalities in the way the body breaks down food.
Elevated HDL levels may be
Primary: Caused by a genetic mutation
Secondary: Caused by another disorder
Primary causes of elevated HDL levels are
Genetic mutations that result in overproduction or decreased removal of HDL
Secondary causes of high HDL cholesterol include all of the following:
Alcohol use disorder without cirrhosis
An overactive thyroid gland (hyperthyroidism)
Primary biliary cirrhosis
High HDL cholesterol levels are diagnosed with blood tests that measure lipid levels in the blood. If a high HDL level is found in a person who is not taking lipid-lowering drugs, doctors look for the cause of the elevation.
A disorder that is causing very high HDL levels is treated.
Cholesteryl ester transfer protein (CETP) deficiency
Cholesteryl ester transfer protein (CETP) deficiency is a rare autosomal recessive disorder caused by a mutation of the CETP gene. Because CETP helps in the transfer of cholesterol from HDL to other lipoproteins, CETP deficiency affects low-density lipoprotein (LDL) cholesterol levels and slows removal of HDL cholesterol from the blood. Affected people have no symptoms but have high HDL cholesterol in their blood. No treatment is necessary.
|
||||
1850
|
dbpedia
|
0
| 10 |
https://rarediseases.org/rare-diseases/adult-onset-leukoencephalopathy-with-axonal-spheroids-and-pigmented-glia/
|
en
|
Adult-Onset Leukoencephalopathy with Axonal Spheroids and Pigmented Glia - Symptoms, Causes, Treatment
|
[
"https://rarediseases.org/wp-content/uploads/2024/05/NORD_Logo-with-tag_Wide_Print_RGB-01.png",
"https://rarediseases.org/wp-content/uploads/2022/06/Post-DBS-op-Me-eating-McDonalds-and-Loving-it-e1652280852247.jpg",
"https://rarediseases.org/wp-content/uploads/2024/05/NRD-2326-State-Resource-Center_Thumbnail-01-1.png",
"https://rarediseases.org/wp-content/uploads/2022/09/NORD_CommunitySupport_320x320.jpg",
"https://rarediseases.org/wp-content/uploads/2023/04/nord-nav-policy-alert.jpg",
"https://rarediseases.org/wp-content/uploads/2024/06/NRD-2331-Summit-Sidebar-Ad-01-1.png",
"https://rarediseases.org/wp-content/uploads/2024/05/NRD-2326-State-Resource-Center_Sidebar-01.png",
"https://rarediseases.org/wp-content/uploads/2024/05/NORD_Logo_Stacked_Print_RGB-with-tag-WHITE-ORANGE-01-860x1024.png",
"https://rarediseases.org/wp-content/uploads/2023/10/2023TRbadge-lg.png",
"https://widgets.guidestar.org/gximage2?o=6915935&l=v4",
"https://rarediseases.org/wp-content/uploads/2019/11/4Star-125x125-2-web.jpg",
"https://rarediseases.org/wp-content/uploads/2024/07/NRD-2331-Summit_Pop-Up-Ad_Who-Should-Attend-1024x678.jpg"
] |
[] |
[] |
[
""
] | null |
[] |
2024-01-22T07:34:53-05:00
|
Learn about Adult-Onset Leukoencephalopathy with Axonal Spheroids and Pigmented Glia, including symptoms, causes, and treatments. If you or a loved one is
|
en
|
National Organization for Rare Disorders
|
https://rarediseases.org/rare-diseases/adult-onset-leukoencephalopathy-with-axonal-spheroids-and-pigmented-glia/
|
Disease Overview
Summary
Adult-onset leukoencephalopathy with axonal spheroids and pigmented glia (ALSP) is a rare, progressive neurological disease that causes brain tissue known as white matter to waste away (leukodystrophy), forming lesions in certain brain areas due to disease-causing variants in the CSF1R (colony-stimulating factor-1 receptor) gene. ALSP is one type of leukodystrophy disorder, estimated by some studies to account for 10 to 25% of adult-onset leukodystrophies. Lesions of this white matter lead to major changes in personality, thinking (cognition), and muscle function, eventually causing people with this disorder to develop dementia and later decline into a vegetative state. Aside from the presence of a specific gene variant, the brains of people with ALSP show characteristic microscopic changes and patterns of atrophy on brain imaging that distinguish ALSP patients from those with other neurological conditions. Symptoms of ALSP overlap with frontotemporal dementia and other disorders associated with dementia such as Alzheimer disease as well as other neurological disorders such as Parkinson’s disease, multiple sclerosis, schizophrenia and several others, making diagnosis difficult unless genetic testing is done. Symptoms can vary considerably from one person with ALSP to the next (even in the same family). Currently, brain biopsy is not necessary for diagnosis because genetic testing is available.
Introduction
ALSP was previously known as two separate disorders: hereditary diffuse leukoencephalopathy with spheroids (HDLS) and pigmentary orthochromatic leukodystrophy (POLD). Once both disorders were linked to CSF1R gene variants, they became known as ALSP.
View Full Report Show Less
Print / Download as PDF
Next section >
< Previous section
Next section >
Synonyms
hereditary diffuse leukoencephalopathy with spheroids (HDLS)
leukoencephalopathy, diffuse hereditary, with spheroids
adult-onset leukodystrophy with neuroaxonal spheroids
autosomal dominant leukoencephalopathy with neuroaxonal spheroids
neuroaxonal leukodystrophy
pigmentary orthochromatic leukodystrophy (POLD)
CSF1R-related leukoencephalopathy
ALSP
CSF1R-related adult-onset leukoencephalopathy with axonal spheroids and pigmented glia
CSF1R-related ALSP
< Previous section
Next section >
< Previous section
Next section >
Signs & Symptoms
Early symptoms of ALSP often include mild psychological or cognitive changes, but, while rare, can present as disturbances in motor function, such as difficulty walking, falling, and slowness of movements. Eventually, as damage in the brain becomes more extensive, psychological, cognitive and motor symptoms exist together. Initial symptoms and rate of disease progression vary quite a bit from one individual to the next, including those within the same family when the condition is inherited.
Psychiatric features of ALSP include changes in personality and the development of anxiety, depression, lack of interest in things (apathy), irritability, distractibility, socially inappropriate behaviors (disinhibition) and cravings for certain types of food (for example eating only ice cream). Cognitive features include the development of dementia, with a general decline in mental functioning, including memory loss, word-finding and language difficulties (aphasia), difficulty planning voluntary muscle movements (apraxia), poor attention, poor judgment and problem solving and reduced impulse control.
Brain degeneration in ALSP also affects what is known as the pyramidal system in the brain. These are nerve tracts that travel from the cerebral cortex (responsible for control of voluntary movements) to the brainstem or the spinal cord. Damage to these tracts in ALSP causes overactive reflexes (hyperreflexia); increased muscle tone, meaning muscles stay stiff and contracted at rest (hypertonicity); muscle spasms with increased movement (spasticity); weakness of one side of the body (hemiparesis) or in all four limbs (quadriparesis); reduced coordination; changes in vision; difficulty walking; difficulty swallowing; slurred speech; and heightened emotional responses, meaning patients may cry or laugh at inappropriate times (pseudobulbar palsy).
Symptoms similar to Parkinson’s disease, such as increased muscle stiffness (rigidity), tremors, a slowing of movement (bradykinesia), a shuffling gait and a reduction or loss of facial expression (hypomimic face or masked facies) can occur in ALSP as well. In ALSP, these symptoms are referred to as Parkinsonism and are not helped by increasing dopamine levels with medications like levodopa, which would ordinarily improve symptoms in Parkinson’s disease.
Changes to sensory nerves can also occur, making it more difficult for patients to sense pain, touch, vibration and changes in body position. Frequently, the patients cannot recognize the right or left side of the body.
Less commonly, seizures can accompany ALSP, occurring in approximately 30% of patients with the diagnosis. The seizures usually occur at the onset of the illness.
As the disease worsens, patients enter a state where they can no longer walk or speak and need total care with all daily living functions. They also lose control of bladder and bowel sphincter functions (double incontinent). Most patients with ALSP die from pneumonia.
< Previous section
Next section >
< Previous section
Next section >
Causes
ALSP is caused by an abnormal CSF1R gene variant that codes for the protein colony-stimulating factor-1 receptor found on many cell membranes, including those in the central nervous system, or CNS (consisting of the brain and spinal cord). This receptor plays a role in cell growth and cell specialization where cells take on specific functions in the body. Without a normally-functioning CSF-1 receptor, structural changes to the nerve cell, or neuron, eventually occur. Axons, the portions of neurons that transmit signals to the next neuron, are covered in a myelin sheath, or the white matter that is destroyed in ALSP and other leukodystrophies. In ALSP, the formation of swellings known as spheroids within axons causes immune cells known as macrophages to destroy myelin sheathing, further damaging nerve cell function. Microglia, another type of macrophage immune cell of the CNS that’s responsible for maintaining brain tissue, are highly dependent on the CSF-1 receptor. When the receptor is inhibited, microglia become underactive and are destroyed. Macrophages and microglia take on a pigmented appearance in brain biopsies of ALSP patients.
ALSP is an autosomal dominant genetic condition, meaning only a single copy of the disease-causing CSF1R gene variant is necessary to cause ALSP. The altered gene can be inherited from either parent or can be the result of a new mutation in the affected individual, known as a de novo mutation where the mutation has never before been present in the family. The latter case is referred to as a sporadic, rather than an inherited, case of ALSP. In autosomal dominant conditions, there’s a 50% chance the affected individual will pass the altered gene to their child, with the risk of inheritance being the same for males and females.
< Previous section
Next section >
< Previous section
Next section >
Affected populations
The estimated number of people thought to have ALSP in the United States is 10,000 with similar estimates in Europe and Japan. Average age of diagnosis is 43 years old, but symptoms have been reported to occur in patients as young as 18, and 95% of ALSP patients start having symptoms before age 60. Both men and women are equally affected but symptoms usually appear earlier in women, at age 40 versus 47 for men. Life expectancy ranges from 2 to over 30 years, with an average life expectancy of 8 years after symptom onset.
< Previous section
Next section >
< Previous section
Next section >
Disorders with Similar Symptoms
Many symptoms of ALSP overlap with other neurological disorders, including other types of leukodystrophies. Genetic testing is required for accurate diagnosis. Based on symptoms, ALSP is most similar to the following disorders:
Frontotemporal dementias (FTDs) are a group of neurodegenerative disorders associated with shrinking of the frontal and temporal anterior lobes of the brain. Symptoms include marked changes in social behavior and personality, and/or problems with language. People with behavior changes may have disinhibition (with socially inappropriate behavior), apathy and loss of empathy, hyperorality (eating excessive amounts of food or attempting to consume inedible things), agitation, compulsive behavior and various other changes. Examples of problems with language include difficulty speaking or understanding speech. Some people with FTD also develop a motor syndrome such as Parkinsonism or motor neuron disease (which may be associated with various additional symptoms). (For more information on this condition search for “frontotemporal degeneration” in the Rare Disease Database.)
Multiple sclerosis (MS) is a chronic neuroimmunologic (both the nervous system and the immunological system are involved) disorder of the central nervous system involving the brain, spinal cord and optic nerves. By means of a mechanism not clearly understood, the protective fatty, insulating substance called myelin sheath that covers the nerve is destroyed. The inflammatory attacks that produce the characteristic scarring (plaques or patches) of the myelin sheath occurs unpredictability, vary in intensity, and at many sites thus the name, multiple sclerosis. During the course of the disease, patients may have attacks (relapses or exacerbations), gradually worsen (progression), or stabilize. The randomness of the location of damage can result in a wide range of neurological symptoms, which may vary from person to person. (For more information on this condition search for “multiple sclerosis” in the Rare Disease Database.)
Parkinson’s disease is a slowly progressive neurologic condition characterized by involuntary trembling (resting tremor), muscular stiffness or inflexibility (rigidity), slowness of movement (bradykinesia) and difficulty carrying out voluntary movements (akinesia). Degenerative changes occur in areas deep within the brain (substantia nigra and other pigmented regions of the brain), causing a decrease in dopamine levels in the brain. Dopamine is a neurotransmitter, which is a chemical that sends a signal from one nerve cell to another in the brain.
< Previous section
Next section >
< Previous section
Next section >
Diagnosis
Diagnosis of ALSP is made by a neurologist. ALSP is diagnosed through genetic testing that identifies a CSF1R gene variant associated with the disease. However, family history, clinical signs and brain imaging results are integral in raising suspicions enough to order genetic testing. When symptoms affecting cognition and movements or when seizures combined with either cognitive or motor symptoms are present before or by age 60, suspicion for ALSP should be raised. Cognitive testing by psychiatrists, neurologists or psychologists can identify behaviors that confirm frontal lobe dysfunction (e.g., reduced inhibition), especially when subtle, that is associated with ALSP.
Specific patterns of brain deterioration on MRI and CT scans can further raise suspicion. These include the existence of lesions of white matter on both sides of the cerebrum (the largest, most exterior part of the brain that controls more complex functions) that in earlier stages of ALSP are less symmetric but become more symmetric and extensive as the disease progresses. White matter lesions in ALSP are most common in the frontal and parietal brain lobes of the cerebrum and the white matter around the lateral ventricles (periventricular deep white matter), making the ventricles appear enlarged in imaging. Also apparent in brain scans is thinning of the corpus callosum (a bundle of white matter, or myelinated, nerve fibers that connect the right and left halves of the brain so that they can communicate with one another) and small calcifications (from calcium deposits) in the white matter around the frontal and parietal brain lobes.
Detection of high levels of neurofilament light chain, a protein that serves as an indicator of axonal damage, has been found in the blood and cerebrospinal fluid of ALSP patients and may aid clinicians in formulating their diagnosis.
< Previous section
Next section >
< Previous section
Next section >
Standard Therapies
There are currently no FDA-approved treatments for ALSP. Researchers are further investigating underlying disease mechanisms and symptom progression to develop more effective treatment options. Current treatment options do not reverse brain damage but instead are meant to manage symptoms. For patients with ALSP who have seizures, anti-epileptic medications are useful for controlling seizures. Antibiotics may be prescribed to help control infections, such as pneumonia or urinary tract infections that may arise as patients grow progressively weaker. Muscle relaxers may be recommended to target spasticity. Anti-depressants are often prescribed to treat psychological symptoms of ALSP but are not especially effective. Anti-psychotic medications may be used to control aggression in ALSP but side effects are generally not well-tolerated. Nutritional supplements and physical therapy are often recommended to slow overall decline and maintain the most optimal overall health possible.
Genetic counseling is recommended to help patients and families understand the genetics and progression of ALSP and to provide psychosocial support.
< Previous section
Next section >
< Previous section
Next section >
Clinical Trials and Studies
Bone marrow transplantation is the most promising and first potential treatment to modify the ALSP disease course. Results vary between each patient, but in some cases, bone marrow transplants have slowed the progression of motor and cognitive symptoms of the disease. Bone marrow transplants are thought to be beneficial for some individuals with ALSP by providing new immune cells from donors with normal CSF-1 receptors to develop into and increase levels of microglia in the brain.
Information on current clinical trials is posted on the Internet at www.clinicaltrials.gov. All studies receiving U.S. government funding, and some supported by private industry, are posted on this government web site.
For information about clinical trials being conducted at the NIH Clinical Center in Bethesda, MD, contact the NIH Patient Recruitment Office:
Toll-free: (800) 411-1222
TTY: (866) 411-1010
Email: [email protected]
Some current clinical trials also are posted on the following page on the NORD website:
https://rarediseases.org/living-with-a-rare-disease/find-clinical-trials/
For information about clinical trials sponsored by private sources, in the main, contact:
www.centerwatch.com
For more information about clinical trials conducted in Europe, contact: https://www.clinicaltrialsregister.eu/
< Previous section
Next section >
< Previous section
Next section >
References
JOURNAL ARTICLES
Tipton PW, Kenney-Jung D, Rush BK, et al. Treatment of CSF1R-Related Leukoencephalopathy: Breaking New Ground. Mov Disord. 2021 Jul 30. https://pubmed.ncbi.nlm.nih.gov/34329526/
Gefkand J, Greenfield A, Barkovich M, et al. Allogeneic HSCT for adult-onset leukoencephalopathy with spheroids and pigmented glia, Brain. 2020 Feb; 143(2): 503-511 https://academic.oup.com/brain/article/143/2/503/5678694?login=true
Han, J., Sarlus, H., Wszolek, Z. K., Karrenbauer, V. D., & Harris, R. A. Microglial replacement therapy: a potential therapeutic strategy for incurable CSF1R-related leukoencephalopathy. Acta neuropathologica communications. 2020; 8(1), 217. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7720517/
Konno T, Yoshida K, Mizuta I, et al. Diagnostic criteria for adult-onset leukoencephalopathy with axonal spheroids and pigmented glia due to CSF1R mutation. Eur J Neurol. 2018 Jan; 25(1): 142–147. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5741468/
Konno, T., Kasanuki, K., Ikeuchi, T., Dickson, D. W., & Wszolek, Z.K. CSF1R-related leukoencephalopathy: A major player in primary microgliopathies. Neurology. 2018; 91(24), 1092–1104. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6329328/
Lynch D, Jaunmuktane Z, Sheerin U, et al. Hereditary leukoencephalopathy with axonal spheroids: a spectrum of phenotypes from CNS vasculitis to parkinsonism in an adult onset leukodystrophy series. Journal of Neurology, Neurosurgery & Psychiatry. 2016; 87:512-519. https://jnnp.bmj.com/content/87/5/512.info
INTERNET
Sundal C, Wszolek ZK. CSF1R-Related Adult-Onset Leukoencephalopathy with Axonal Spheroids and Pigmented Glia. 2012 Aug 30 [Updated 2017 Oct 5]. In: Adam MP, Ardinger HH, Pagon RA, et al., editors. GeneReviews® [Internet]. Seattle (WA): University of Washington, Seattle; 1993-2021. Available from: https://www.ncbi.nlm.nih.gov/books/NBK100239/ Accessed November 1, 2021.
Genetic and Rare Diseases Information Center. Hereditary diffuse leukoencephalopathy with spheroids. Last updated: 3/27/2013. Available at: https://rarediseases.info.nih.gov/diseases/10981/adult-onset-leukoencephalopathy-with-axonal-spheroids-and-pigmented-glia. Accessed November 1, 2021.
Sisters’ Hope Foundation. What is ALSP? Available at: https://sistershopefoundation.com/what-is-alsp/. Accessed November 1, 2021.
< Previous section
Next section >
< Previous section
Programs & Resources
Assistance Programs
Patient Organizations
More Information
RareCare® Assistance Programs
NORD strives to open new assistance programs as funding allows. If we don’t have a program for you now, please continue to check back with us.
Additional Assistance Programs
MedicAlert Assistance Program
NORD and MedicAlert Foundation have teamed up on a new program to provide protection to rare disease patients in emergency situations.
Learn more https://rarediseases.org/patient-assistance-programs/medicalert-assistance-program/
Rare Disease Educational Support Program
Ensuring that patients and caregivers are armed with the tools they need to live their best lives while managing their rare condition is a vital part of NORD’s mission.
Learn more https://rarediseases.org/patient-assistance-programs/rare-disease-educational-support/
Rare Caregiver Respite Program
This first-of-its-kind assistance program is designed for caregivers of a child or adult diagnosed with a rare disorder.
Learn more https://rarediseases.org/patient-assistance-programs/caregiver-respite/
Patient Organizations
More Information
The information provided on this page is for informational purposes only. The National Organization for Rare Disorders (NORD) does not endorse the information presented. The content has been gathered in partnership with the MONDO Disease Ontology. Please consult with a healthcare professional for medical advice and treatment.
GARD Disease Summary
The Genetic and Rare Diseases Information Center (GARD) has information and resources for patients, caregivers, and families that may be helpful before and after diagnosis of this condition. GARD is a program of the National Center for Advancing Translational Sciences (NCATS), part of the National Institutes of Health (NIH).
View report
Orphanet
Orphanet has a summary about this condition that may include information on the diagnosis, care, and treatment as well as other resources. Some of the information and resources are available in languages other than English. The summary may include medical terms, so we encourage you to share and discuss this information with your doctor. Orphanet is the French National Institute for Health and Medical Research and the Health Programme of the European Union.
View report
OMIM
Online Mendelian Inheritance In Man (OMIM) has a summary of published research about this condition and includes references from the medical literature. The summary contains medical and scientific terms, so we encourage you to share and discuss this information with your doctor. OMIM is authored and edited at the McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins University School of Medicine.
View report
GeneReviews
GeneReviews has an article on this condition covering diagnosis, management, and inheritance. Each article is written by one or more experts on the specific disease and is reviewed by other specialists. The article contains medical and scientific terms, so we encourage you to share and discuss this information with your doctor. The GeneReviews database is managed by the University of Washington.
View report
MedlinePlus
MedlinePlus has information about this condition that may include a description, frequency, causes, inheritance, and links to more information. The information is written for the public, including patients, caregivers and families. MedlinePlus is a service of the National Library of Medicine (NLM), which is part of the National Institutes of Health (NIH).
View report
< Previous section
|
|||||
1850
|
dbpedia
|
3
| 45 |
https://www.uptodate.com/contents/high-cholesterol-and-lipid-treatment-options-beyond-the-basics/print
|
en
|
UpToDate
|
[] |
[] |
[] |
[
""
] | null |
[] | null |
en
|
/app/utd-menu/utd-icon.png
| null | |||||||
1850
|
dbpedia
|
2
| 3 |
https://www.ncbi.nlm.nih.gov/medgen/1794139
|
en
|
Leukoencephalopathy, diffuse hereditary, with spheroids 1 (Concept Id: C5561929)
|
[
"https://www.ncbi.nlm.nih.gov/coreutils/uswds/img/favicons/favicon-57.png",
"https://www.ncbi.nlm.nih.gov/coreutils/uswds/img/icon-dot-gov.svg",
"https://www.ncbi.nlm.nih.gov/coreutils/uswds/img/icon-https.svg",
"https://www.ncbi.nlm.nih.gov/coreutils/nwds/img/logos/AgencyLogo.svg",
"https://static.pubmed.gov/portal/portal3rc.fcgi/4215050/img/4204968",
"https://static.pubmed.gov/portal/portal3rc.fcgi/4215050/img/4204968",
"https://www.ncbi.nlm.nih.gov/stat?jsdisabled=true&ncbi_app=entrez&ncbi_db=medgen&ncbi_pdid=FullReport&ncbi_phid=CE8C239B6C3789410000000002950255"
] |
[] |
[] |
[
"C5561929",
"adult-onset leukodystrophy with neuroaxonal spheroids",
"adult-onset leukoencephalopathy with axonal spheroids and pigmented glia",
"alsp",
"autosomal dominant leukoencephalopathy with neuroaxonal spheroids",
"csf1r",
"csf1r-related adult-onset leukoencephalopathy with axonal spheroids and pigmented glia",
"csf1r-related alsp",
"csf1r-related hereditary diffuse leukoencephalopathy with spheroids",
"dementia",
"familial",
"neumann type",
"disease or syndrome",
"familial dementia",
"neumann type",
"familial progressive subcortical gliosis",
"fpsg",
"gliosis",
"familial progressive subcortical",
"gpsc",
"hdls",
"hdls1",
"hereditary diffuse leukoencephalopathy with axonal spheroids",
"hereditary diffuse leukoencephalopathy with axonal spheroids and pigmented glia",
"hereditary diffuse leukoencephalopathy with spheroids",
"leukoencephalopathy with neuroaxonal spheroids",
"autosomal dominant",
"leukoencephalopathy",
"adult-onset",
"with axonal spheroids and pigmented glia",
"leukoencephalopathy",
"diffuse hereditary",
"with spheroids 1",
"leukoencephalopathy",
"hereditary diffuse",
"with spheroids 1",
"neuroaxonal leukodystrophy",
"pigmentary orthochromatic leukodystrophy",
"pold",
"subcortical gliosis of neumann",
"autosomal dominant",
"autosomal recessive",
"birth defects",
"chromosomal disease",
"chromosome",
"clinical features",
"clinical findings",
"clinical genetics",
"clinical recommendations",
"clinvar",
"congenital chromosomal disease",
"consumer genetic resources",
"cytogenetic location",
"disease characteristics",
"disease definitions",
"disease descriptions",
"disease ontology",
"disease synonyms",
"disease vocabulary",
"dysmorphology",
"entrez",
"familial disease",
"gene",
"gene-disease relationship",
"genereviews",
"genetic disease",
"genetic disorder",
"genetic terminology",
"genetic testing registry",
"genetics home reference",
"genomic disease",
"gtr",
"hereditary disease",
"heritable disease",
"hpo",
"human phenotype ontology",
"inherited disease",
"management guidelines",
"maternal inheritance",
"medgen",
"medical genetics",
"medical subject headings",
"mesh",
"mitochondrial inheritance",
"mode of inheritance",
"national center for biotechnology information",
"national institutes of health",
"national library of medicine",
"ncbi",
"nih",
"nlm",
"omim",
"ordo",
"orphanet",
"paternal inheritance",
"phenome",
"position statements",
"professional practice guidelines",
"rare disease",
"reference sequence",
"refseq",
"snomed ct",
"syndrome",
"undiagnosed diseases",
"x-linked recessive"
] | null |
[] | null |
CSF1R-related adult-onset leukoencephalopathy with axonal spheroids and pigmented glia (ALSP) is characterized by executive dysfunction, memory decline, personality changes, motor impairments, and seizures. A frontal lobe syndrome (e.g., loss of judgment, lack of social inhibitors, lack of insight, and motor persistence) usually appears early in the disease course. The mean age of onset is usually in the fourth decade. Affected individuals eventually become bedridden with spasticity and rigidity. The disease course ranges from two to 30 or more years (mean: 8 years).
|
en
|
//www.ncbi.nlm.nih.gov/favicon.ico
| null |
Modes of inheritance:
Autosomal dominant inheritance
MedGen UID:
141047
•Concept ID:
C0443147
•
Intellectual Product
Source: Orphanet
A mode of inheritance that is observed for traits related to a gene encoded on one of the autosomes (i.e., the human chromosomes 1-22) in which a trait manifests in heterozygotes. In the context of medical genetics, an autosomal dominant disorder is caused when a single copy of the mutant allele is present. Males and females are affected equally, and can both transmit the disorder with a risk of 50% for each child of inheriting the mutant allele.
|
|||||
1850
|
dbpedia
|
2
| 2 |
https://ulf.org/leukodystrophies/hereditary-diffuse-leukoencephalopathy-with-spheroids-hdls/
|
en
|
Hereditary Diffuse Leukoencephalopathy with Spheroids (HDLS)
|
[
"https://0zv8e8.a2cdn1.secureserver.net/wp-content/uploads/2020/05/cropped-ULF_FullColor_horizontal-01-1-204x68.jpg 204w, https://0zv8e8.a2cdn1.secureserver.net/wp-content/uploads/2020/05/cropped-ULF_FullColor_horizontal-01-1-300x100.jpg 300w, https://0zv8e8.a2cdn1.secureserver.net/wp-content/uploads/2020/05/cropped-ULF_FullColor_horizontal-01-1-1024x341.jpg 1024w, https://0zv8e8.a2cdn1.secureserver.net/wp-content/uploads/2020/05/cropped-ULF_FullColor_horizontal-01-1-768x256.jpg 768w, https://0zv8e8.a2cdn1.secureserver.net/wp-content/uploads/2020/05/cropped-ULF_FullColor_horizontal-01-1.jpg 1250w",
"https://0zv8e8.a2cdn1.secureserver.net/wp-content/uploads/2020/05/cropped-ULF_FullColor_horizontal-01-1-204x68.jpg",
"https://widgets.guidestar.org/TransparencySeal/7431867",
"https://0zv8e8.a2cdn1.secureserver.net/wp-content/uploads/2024/03/NORD_MembershipLogo_PLAT_2024_RGB-01-150x150.webp",
"https://0zv8e8.a2cdn1.secureserver.net/wp-content/uploads/2024/03/NORD_MembershipLogo_PLAT_2024_RGB-01-150x150.webp"
] |
[] |
[] |
[
""
] | null |
[] |
2020-04-10T20:16:09+00:00
|
Hereditary diffuse leukoencephalopathy with spheroids (HDLS) is an autosomal dominant progressive disease.
|
en
|
https://0zv8e8.a2cdn1.secureserver.net/wp-content/uploads/2019/12/favicon.ico?time=1723756663
|
United Leukodystrophy Foundation
|
https://ulf.org/leukodystrophies/hereditary-diffuse-leukoencephalopathy-with-spheroids-hdls/
|
causes of Neuroaxonal leukoencephalopathy with axonal spheriods
Hereditary diffuse leukoencephalopathy with spheroids (HDLS) is an autosomal dominant progressive disease. The disease was described for the first time in multiple members of a large Swedish pedigree in 1984 (Axelsson et al, 1984). In this family, 17 of 71 subjects from 4 generations were affected. The age at onset varied from 8 to 60 years with a mean of 36 years. The age at death was 39 to 89 years with a mean of 57 years. The time between onset and death varied from 3 months to over 30 years. Some patients rapidly developed severe dementia and died a few months after the onset of symptoms, whereas in others the course was prolonged with dementia developing over decades. Sporadic patients have also been reported.
The predominant clinical manifestations are psychiatric and include depression, anxiety, alcohol abuse, irritability, and aggressiveness. Psychotic symptoms may occur with confusion, delusions, and hallucinations. The most frequent neurologic symptoms are dementia, seizures, impaired balance, retropulsion, gait apraxia, spasticity, ataxia, and urinary incontinence. Extrapyramidal symptoms may occur with hyperkinesia, chorea, tremor and oral dyskinesia.
EEG usually shows nonspecific abnormalities with slowing of the background pattern and sometimes paroxysmal changes. The abnormalities often have a frontotemporal predominance. They may be asymmetrical. Routine and metabolic laboratory investigations reveal no abnormalities. The diagnosis is at present based on histopathologic findings.
Pathology
External examination of the brain shows mild atrophy of the frontoparietal regions. The thalamus and the rostral part of the caudate nucleus may be mildly reduced in size. The lateral ventricles are moderately enlarged. The corticospinal tracts and the basis of the pons are atrophic. On microscopy, a widespread leukoencephalopathy is found, characterized by a commensurate loss of myelin sheaths and axons and the presence of numerous neuroaxonal spheroids in the affected white matter. Neuroaxonal spheroids are round to sausage-shaped axonal swellings, which are easily identified with Bielschowsky, Bodian, and anti-neurofilament immunostains. The leukoencephalopathy is most severe in the frontal, frontoparietal and temporal areas and may be mildly asymmetrical. The U-fibers are relatively spared. The abnormalities tend to be most pronounced in the white matter below the pre- and postcentral gyri and extend through the posterior limb of the internal capsule into the pyramidal tracts of the brain stem. The corpus callosum is variably affected. The abnormal white matter may show vacuolization. Reactive astrocytes and macrophages are present, but no inflammatory cells. The cerebral cortex and basal ganglia are normal and contain no or only few spheroids. Within the cerebellum, a marked loss of Purkinje cells is seen, but the cerebellar white matter is normal. Electron microscopy of the spheroids reveals neurofilaments scattered among electron-dense material and mitochondria.
Pathogenetic Considerations
The homogeneity of the clinical picture and histopathologic findings strongly suggests that HDLS is a distinct disease entity. The disease has an autosomal dominant mode of inheritance. Isolated cases are probably the result of new mutations. The genetic defect and the pathophysiology of HDSL are as yet unresolved. Considering the more or less commensurate loss of axons and myelin sheaths, the preferential involvement of long tracts and the presence of axonal swellings, it is likely that axons are the primary target of the disease.
Axonal spheroids are pathologic findings characteristic of the neuroaxonal dystrophies. They occur most often in the context of neuronal degenerative disorders, such as infantile neuroaxonal dystrophy (Seitelberger disease) and Hallervorden-Spatz disease. The combination of a leukoencephalopathy and neuroaxonal spheroids in the abnormal white matter is rare. Apart form HDSL, this combination is observed in dermatoleukodystrophy with neuroaxonal spheroids (Matsuyama et al, 1978) and polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy (Nasu-Hakola disease). Both disorders are clinically different form HDLS.
How is Neuroaxonal Leukoencephalopathy with axonal spheriods treated?
Supportive care is the only therapeutic option.
Magnetic Resonance Imaging
MR images demonstrate signal abnormalities bilaterally within the cerebral white matter, either most pronounced within the white matter under the pre- and postcentral gyri, or within the frontal white matter. The signal abnormalities may be patchy or more confluent, and may be symmetrical or asymmetrical. They are ill-defined. The corpus callosum is thin and may contain areas of abnormal signal. The signal abnormalities extend downwards through the posterior limb of the internal capsule into the pyramidal tracts of the brain stem. The affected cerebral white matter is atrophic with widening of the lateral ventricles and subarachnoid spaces. The head of the caudate nucleus may be flattened. There may be cerebellar atrophy.
The above MRI findings may confirm the diagnosis within a pedigree with known HDLS. However, the MRI findings in itself are not specific and do not allow definite diagnosis. The diagnosis needs to be confirmed by histopathology.
The differential diagnosis of HDLS includes disorders with frontal cortical degeneration, such as frontotemporal dementia and Pick disease. In these disorders MRI shows atrophy of mainly the frontotemporal areas. Sometimes there are additional white matter changes, which are ill-defined and usually mild. If present, they make differentiation from HDLS difficult.
The differential diagnosis also includes disorders with frontal lobe dysfunction caused by white matter degeneration, such as metachromatic leukodystrophy, X-linked adrenoleukodystrophy with frontal predominance, Nasu-Hakola disease (PLOSL), Binswanger disease, CADASIL, orthochromatic pigmentary leukodystrophy, and adult-oset autosomal dominant leukodystrophies. Most disorders can be ruled out by typical clinical, physical and laboratory findings and neuroimaging differences. Some disorders require histopathologic confirmation.
Courtesy of Van der Knaap et al, Neurology 2000; 54: 463-468, with permission
|
||||
1850
|
dbpedia
|
1
| 9 |
https://www.pennmedicine.org/news/news-releases/2016/march/penn-study-shows-a-form-of-gen
|
en
|
[] |
[] |
[] |
[
""
] | null |
[] | null | null | ||||||||||
1850
|
dbpedia
|
0
| 46 |
https://gupea.ub.gu.se/handle/2077/31995%3Fshow%3Dfull
|
en
|
Hereditary diffuse leukoencephalopathy with spheroids: Insights into an adult onset neurodegenerative disease
|
[
"https://gupea.ub.gu.se/themes/Mirage2/images/DSpace-logo-line.svg",
"https://gupea.ub.gu.se/handle/2077/holder.js/100%x80/text:No Thumbnail",
"https://gupea.ub.gu.se/handle/2077/holder.js/100%x80/text:No Thumbnail",
"https://gupea.ub.gu.se/themes/Mirage2/images/atmire-logo-small.svg",
"https://gupea.ub.gu.se/themes/Mirage2/images/atmire-logo-small.svg"
] |
[] |
[] |
[
""
] | null |
[] | null |
en
|
/themes/Mirage2/images/favicon.ico
| null |
dc.description.abstractDuring the last three decades, the areas of inherited white matter (WM) disorders have expanded. Advances in magnetic resonance imaging (MRI) and genetics have led to increased detection of adult-onset WM disorders. Hereditary diffuse leukoencephalopathy with spheroids (HDLS) is an adult-onset, invariably lethal, brain WM disorder with an autosomal dominant inheritance pattern. The clinical symptoms are characterized by a constellation of features that progress to a devastating disease with multiple neurological impairments. The neuropathological hallmarks of HDLS are demyelination and the presence of axonal spheroids. The overall aim of this study was to gather enough clinical cases, radiological images, cerebrospinal fluid (CSF) biomarkers and molecular genetic data to place HDLS in a nosographic context and define its relationship with other neurodegenerative disorders. We updated the original Swedish HDLS family and created a pedigree consisting of 166 individuals. Fifteen of those cases were affected with HDLS, including two new cases. The clinical course was different in the two recent cases, with a sub-acute and a more chronic variant, respectively. Familial clustering of HDLS is not always obvious and in the Mayo Clinic HDLS collection we found that all of our cases had been misdiagnosed with other more common neurological disorders. Using exome sequencing, we identified the colony stimulating factor 1 receptor (CSF1R) mutation in 14 Mayo Clinic HDLS families. MRIs of 15 of these CSF1R mutation carriers demonstrated asymmetric WM lesions (WML) with frontoparietal predominance. With diffusion weighted-, and diffusion tensor imaging (DTI/DWI) we defined three different stages of HDLS pathology, and detected a peripheral rim of restricted diffusion that had a centrifugal migration from the anterior ventricular horns. This might be pathognomonic for the original Swedish type of HDLS. In conclusion, HDLS is a distinct disease entity and the combination of clinical features such as frontal lobe syndromes, pyramidal-, extrapyramidal-, parietal- and visual signs, as well as WML in a characteristic frontoparietal distribution gives diagnostic clues. To clarify the distinction between the unknown genetics of the original Swedish family and the CSF1R mutation carriers, we propose to use molecular classification of HDLS type 1 and type 2, respectively. Results from our studies indicate that HDLS is probably primarily a neuroaxonal degeneration. Thus, elucidating the molecular mechanism of HDLS may provide novel insights into neurodegeneration.sv
|
||||||
1850
|
dbpedia
|
1
| 30 |
https://academic.oup.com/eurheartj/article/39/23/2179/5037141
|
en
|
HDL-cholesterol, genetics, and coronary artery disease: the myth of the ‘good cholesterol’?
|
[
"https://oup.silverchair-cdn.com/UI/app/svg/umbrella/oxford-academic-logo.svg",
"https://oup.silverchair-cdn.com/UI/app/svg/i.svg",
"https://oup.silverchair-cdn.com/UI/app/svg/account.svg",
"https://oup.silverchair-cdn.com/UI/app/svg/i.svg",
"https://oup.silverchair-cdn.com/UI/app/svg/account.svg",
"https://oup.silverchair-cdn.com/data/SiteBuilderAssets/Live/Images/eurheartj/eurheartj_title-1067741957.svg",
"https://oup.silverchair-cdn.com/data/SiteBuilderAssets/Live/Images/eurheartj/eurheartj_h1-607441458.svg",
"https://oup.silverchair-cdn.com/oup/backfile/Content_public/Journal/eurheartj/Issue/39/23/1/m_ehj_39_23cover.jpeg?Expires=1727114209&Signature=S4VmYaXTKyAkSUqeEcxSKxuPjeNK36F9qn1x55f3LkDDh5FQl3lSjMhGc7U3aKMlTA1VmsN9RK97UA-8U6BaSMAKC0VXXoAqetTs4dvUI-EkA00JsjO5Wh9OIm-UHsX18XmzOBHpVYtxhcWjKe2fNQsA5NwofeSnnBfz1Khps36VyRSmooq0MrVv~enBAxFV8DBFevbnqhCc1aPZL4es~RYrGcOHMS~QT8va0mFdAtNLBwSqwHtosTZXL9Awz~thoq-wKkBvW5sxUiaWBpr3OJVNDX8gqIqG9S4lqwPnMhCHIOKUcYsa2MsKMvA02kBWYozWHXJCJ6a9t9dD6heCWA__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA",
"https://oup.silverchair-cdn.com/UI/app/svg/pdf.svg",
"https://oup.silverchair-cdn.com/oup/backfile/Content_public/Journal/eurheartj/39/23/10.1093_eurheartj_ehy299/2/m_eurheartj_39_23_2179_f1.jpeg?Expires=1726830014&Signature=rmyoyNIP6Iaclbp6iFsMEsI1gHRYfIqU244dpP~r4jBd1JGhvCOlns-pv3weKSxcpDAJRU1hElUDtC0W7QRIFcI2QX-McbBJC56th9gp~YxYDVRemufIozh3F2PBN3KwI74BlsaKnez5R28~fadYGf3DB6VcQvsMA3Qgh8efQEeNm5zc3I5kE3cp2m6HtRbrma9KJEij2yj~9QYOM5JRY2AmXMct5Y-nUMmmda96nD0rD4SuXY-wTh9bp4lUtC5gOjD6xcN1Y5ioFkW9a2kzeizv6xjTAPHH07sW-rrtjiSSkSQ14FH-fS-ggg1qvOY3zYYsakhY~MLGls86NMngGQ__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA",
"https://oup.silverchair-cdn.com/UI/app/svg/i.svg",
"https://oup.silverchair-cdn.com/data/Multimedia/oup-logo.svg",
"https://oup.silverchair-cdn.com/data/Multimedia/journals-careers-network.svg",
"https://oup.silverchair-cdn.com/data/SiteBuilderAssets/Live/Images/eurheartj/eurheartj_f11699044851.svg",
"https://oup.silverchair-cdn.com/UI/app/svg/umbrella/oup-logo.svg",
"https://ouptag.scholarlyiq.com/ntpagetag.gif?js=0"
] |
[] |
[] |
[
""
] | null |
[
"Landmesser, Ulf",
"Hazen, Stan"
] |
2018-06-14T00:00:00
|
This editorial refers to ‘Rare SCARB1 mutations associate with high-density lipoprotein cholesterol but not with coronary artery disease’†, by A. Helgadott
|
en
|
//oup.silverchair-cdn.com/UI/app/img/v-638576256025047103/apple-touch-icon.png
|
OUP Academic
|
https://academic.oup.com/eurheartj/article/39/23/2179/5037141
|
This editorial refers to ‘Rare SCARB1 mutations associate with high-density lipoprotein cholesterol but not with coronary artery disease’†, by A. Helgadottir et al., on page .
Coronary disease remains a leading cause of death and disability in developed countries, and development of more effective prevention and treatment strategies is of paramount importance.1 , 2
Lowering LDL-cholesterol by targeting HMG-CoA reductase (using statins), Niemann–Pick C1-Like 1 (NPC1L1) protein (by ezetimibe), or proprotein convertase subtilisin/kexin type 9 (PCSK9; by human monoclonal antibodies) has become a safe and effective approach to reduce risk of coronary disease as observed in large-scale clinical outcome studies.3–5 Of note, these therapeutic approaches reduce the plasma concentrations of LDL. Moreover, genetic studies have suggested that lifelong reduction of LDL-cholesterol is associated with a more profound, almost three-fold stronger reduction in risk of coronary disease as compared with effects observed in clincial outcome studies,6 strongly supporting the concept of ‘LDL burden’, i.e. cumulative exposure of the vasculature to increased LDL, rather than simply a one time LDL-cholesterol level, as a determinant and causal risk factor for the pathophysiology and progression of coronary disease.7
HDL-cholesterol has been considered as the so-called ‘good cholesterol’, largely based on epidemiological studies demonstrating an inverse relationship between reduced HDL-cholesterol levels and an increased risk of coronary disease and myocardial infarction.8 , 9 Several recent large-scale clinical studies testing HDL-cholesterol-raising treatments have, however, failed to demonstrate a preventive effect on coronary disease.10 , 11 Notably, translational studies have suggested that potential vasoprotective effects of HDL from healthy subjects were markedly altered in HDL obtained from patients with coronary disease, that has been termed ‘HDL dysfunction’.12 , 13 Of note, Mendelian randomization genetic studies, including those using loss-of-function mutations of ABCA1 or a single nucleotide polymorphism (SNP) in the endothelial lipase gene (LIPG Asn396Ser), have shown that genetically higher HDL-cholesterol levels were not associated with a reduced risk of myocardial infarction, in contrast to genetic scores associated with reduced LDL-cholesterol levels.14 , 15 These observations have further challenged the concept that there is a causal relationship between increased HDL-cholesterol levels and a reduced cardiovascular risk. In a recent publication by Zanoni et al. in 2016, the opposite has been suggested by a genetic study, i.e. that heterozygous carriers of the very rare P376L variant of SCARB1, the gene encoding scavenger receptor class B type 1 (SR-BI), had markedly increased levels of plasma HDL-cholesterol, but also an increased risk of coronary disease.16 The P376L variant impairs post-translational processing of SR-BI and abrogates selective cholesterol uptake from HDL that was elegantly shown in hepatocyte-like cells derived from induced pluripotent stem cells from a homozygous subject.16 The association between P376L carrier status and coronary disease was tested in the CARDIoGRAM Exome Consortium and the CHD Exome+ Consortium in 137 995 individuals [across 49 846 coronary heart disease (CHD) cases and 88 149 CHD controls], and this analysis suggested an increased risk of coronary disease in P376L carriers.16 However, the P376L variant of SCARB1 is very rare and only 86 carriers could be identified, e.g. ∼1 in 1600 individuals.16
In the present issue of the European Heart Journal, Helgadottir et al. present a study from the large cohort of Icelanders who have whole genomes sequenced, and study the hypothesis that alleles in or close to SCARB1 that associate with elevated levels of HDL-cholesterol also associate with increased risk of coronary disease (n = 36 886 cases, 306 268 controls). Thirteen SCARB1 mutations were identified and examined for association with HDL-cholesterol. Three different rare SCARB1 mutations, encoding PG319V, PV111M, and PV32M, were shown to be associated with increased HDL-cholesterol levels. However, in the present study, none of the SCARB1 variants was associated with an increased risk of coronary disease.17 In this large Icelandic cohort, 147 carriers of the above SCARB1 mutations were identified, with a combined allelic frequency of 0.2%.17 In further analyses, three additional HDL-cholesterol-raising common SCARB1 non-coding variants were examined and similarly were found not to be associated with increased risk for coronary disease.
Taken together, the study by Helgadottir et al. did not observe a relationship between genetic variants of SR-B1 leading to elevated HDL-cholesterol levels and risk of coronary disease. It is possible that the SR-B1 variant studied by Zanoni et al. has different functional consequences as compared with the variants studied by Helgadottir et al., and the relationship of the different SR-B1 variants and its functional implications needs to be further studied. However, consistently, the novel data further add to the notion that raising HDL-cholesterol levels (at least via SR-B1 inhibition) is unlikely to protect from coronary disease.
The studies discussed invite the question of which therapeutic targets in lipoprotein metabolism might be approached next to reduce cardiovascular risk efficiently and safely beyond the proven LDL-cholesterol-lowering strategies. Genetic studies over the past years have suggested novel potential causal relationships between genes that are also regulating lipoprotein lipase (LPL) activity and the triglyceride-rich lipoprotein (TLR) clearance pathway, such as apoCIII, and coronary disease. Several studies have reported that rare apoCIII loss-of-function mutations were associated with a reduced risk of coronary disease (Figure 1),18 , 19 and translational studies have provided plausible underlying mechanisms,20 although apoCIII did not appear in genome-wide association studies (GWAS) of coronary disease. Another potential target is lipoprotein a [Lp(a)], for which genetic evidence from Mendelian randomization studies suggests that high Lp(a) is causally associated with cardiovascular disease.21–23 In patients with prevalent coronary disease, however, some recent studies did not observe a relationship between Lp(a) levels and subsequent cardiovascular events.24
Notably, molecular strategies to target lipid metabolism in humans are currently in rapid development towards large-scale clinical outcome programmes,25 and first molecular approaches to regulate gene expression of the above novel potential targets have already been developed.23 , 26 , 27 Therefore, genetic studies can certainly be highly valuable in providing information on which new developments may have to be prioritized for a more effective and safe prevention of coronary disease (Figure 1).
Conflict of interest: U.L. has received lecture and advisory board honoraria from Amgen; lecture or advisory board honoraria from Sanofi; and lecture or advisory board honoraria from the Medicines Company outside the submitted work. S.H. reports grants and personal fees from Procter & Gamble, grants from Pfizer, Inc., grants from Roche Diagnostics, grants from Takeda, other from Cleveland Heart Lab, other from Frantz Biomarkers, LLC, and grants from Astra Zeneca, outside the submitted work. In addition, he has a patent Pending & Issued Patents held by CCF issued to P & G; Cleveland Heart Lab.
References
Author notes
Published on behalf of the European Society of Cardiology. All rights reserved. © The Author(s) 2018. For permissions, please email: journals.permissions@oup.com.
|
||||
1850
|
dbpedia
|
0
| 0 |
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3275663/
|
en
|
Hereditary diffuse leukoencephalopathy with axonal spheroids (HDLS): a misdiagnosed disease entity
|
[
"https://www.ncbi.nlm.nih.gov/coreutils/uswds/img/favicons/favicon-57.png",
"https://www.ncbi.nlm.nih.gov/coreutils/uswds/img/icon-dot-gov.svg",
"https://www.ncbi.nlm.nih.gov/coreutils/uswds/img/icon-https.svg",
"https://www.ncbi.nlm.nih.gov/coreutils/nwds/img/logos/AgencyLogo.svg",
"https://www.ncbi.nlm.nih.gov/corehtml/pmc/pmcgifs/logo-nihpa.png",
"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3275663/bin/nihms-331541-f0001.jpg",
"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3275663/bin/nihms-331541-f0002.jpg",
"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3275663/bin/nihms-331541-f0003.jpg"
] |
[] |
[] |
[
""
] | null |
[
"Christina Sundal",
"Jennifer Lash",
"Jan Aasly",
"Sarka Ø ygarden",
"Sigrun Roeber",
"Hans Kretzschman",
"James Y. Garbern",
"Alex Tselis",
"Rosa Rademakers",
"Dennis W. Dickson"
] |
2012-03-15T00:00:00
|
Hereditary diffuse leukoencephalopathy with spheroids (HDLS) was originally described in a large Swedish pedigree. Since then, 22 reports describing a total of 13 kindred's and 11 sporadic cases have been published. Inheritance is autosomal dominant, ...
|
en
|
https://www.ncbi.nlm.nih.gov/coreutils/nwds/img/favicons/favicon.ico
|
PubMed Central (PMC)
|
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3275663/
|
Introduction
Hereditary diffuse leukoencephalopathy with axonal spheroids (HDLS) was first identified in a Western Swedish family reported in 1984 [1]. There have been 13 kindreds [2–5] and 11 sporadic cases [2, 6–9] since that first report. HDLS is probably closely related to familial pigmentary orthochromatic leukodystrophy (POLD) or is within the same disease spectrum [2]. The pathological hallmark of this disease is the presence of brain white matter changes with neuroaxonal spheroids present [1]. Inheritance is autosomal dominant with variable penetrance, but the causative genes are unknown. HDLS is characterized by a constellation of symptoms including personality changes, cognitive dysfunction and motor impairments such as gait dysfunction, tremor, bradykinesia and rigidity. Brain MRI shows white matter lesions in a frontal predominant distribution, spreading out from the periventricular and deep white matter into the subcortical areas with enlarged ventricles and often signal changes in corpus callosum. Van Gerpen et al. reported a HDLS case with serial MRI's. In the presymptomatic stage, MRI demonstrated subtle patchy abnormalities in the periventricular white matter, which later on subsequent MRI, performed when patient was in advance stage of disease, became widespread and confluent [3]. This important observation suggests that the disease process in the brain starts locally and then becomes more widespread with disease progression.
An international consortium on HDLS was established in 2005 by one of the authors (ZKW) after the first Mayo Clinic kindred with HDLS was reported [10]. Since then, 14 additional families have been collected at the Mayo Clinic and 4 have been reported [2, 3]. In our research study brains and brain biopsy specimens have been collected both retrospectively and prospectively. All have been examined by DWD, and only those demonstrating pathological features of HDLS were included in our study. Based on our collection we found that all of the 20 cases were misdiagnosed (unpublished data). Therefore, we describe here the HDLS cases from the smallest families as the evidence of familial clustering indicating a genetic disorder is not always obvious. Phenotypic variability may occur in the affected members of a given kindred, and can misleadingly be interpreted as two unrelated sporadic disorders. Diagnoses of HDLS in small families can therefore be challenging and particularly difficult since there is often not a convincing family history.
However, there is strong evidence that HDLS is a genetic disorder due to the larger families, both reported and unpublished, who show an autosomal dominant heredity [1, 3, 10]. Based on our Mayo Clinic HDLS collection and published reports, HDLS patients may be misdiagnosed with Alzheimer's disease (AD), frontotemporal dementia (FTD), atypical parkinsonism (AP), multiple sclerosis (MS) and/or small vessel diseases. Herein we report three new HDLS families to increase the awareness of this disorder and discuss the differential diagnoses from the clinical, imaging, and pathological perspective.
Results
Short case reports are provided below. Summary of the clinical characteristics and laboratory investigations of our probands are provided in . Pedigrees are presented in
Table 1
Case #SexOnset Age (yrs)Age at Death (yrs)Years with HDLSInitial SymptomsLater SymptomsAdditional FeaturesLaboratory investigationsDifferential Diagnosis1F38413-Depression
-Personality changes
-Cognitive problems-Apraxia
-Bradykinesia,
-Shuffling gait
-Homonymous hemianopsia
-Spasticity
-Tetraparesis
-Mutism
-Dysphagia-Seizure
-Alien limb sign-Routine blood and urine tests
-Amino acids, VDRL, HIV serologies ArylsutfataseA, galactocerebrosidase, glucosidase, galactosidase, mannosidase, fucosidase, very long chain fatty acids
-Anti-nuclear, anti-neutrophil cytoplasmic-/ anti-neuronal nuclear antibodies
-Cerebrospinal fluid examination
-CADASIL skin biopsy test and NOTCH 3 gene test
-Mitochondrial muscle biopsies
-All test were normal-Atypical MS2F36404-Dizziness
-Executive dysfunction
-Depression
-Personality changes
-Cognitive problems-Apraxia
-Bradykinesia
-Spastic broad-based gait
-Homonymous quadrantanopsia
-Spasticity
-Tetraparesis
-Dysphasia
-Dysphagia-Seizure
-Dystonia-Routine blood and urine tests
-Amino acids, VDRL, HIV serologies
-ArylsulfataseA, galactocerebrosidase, glucosidase, galactosidase, mannosidase, fucosidase, very long chain fatty acids
-Anti-nuclear, anti-neutrophil cytoplasmic-/ anti-neuronal nuclear antibodies
-Cerebrospinal fluid examination
-CADASIL skin biopsy test and NOTCH3 gene test
-Mitochondrial muscle biopsies
-All tests were normal-Atypical MS3M526311-Personality changes
-Cognitive problems
-Memory problems-Reduced proprioceptions
-Paresis in arm
-Vertical gaze palsy
-Ataxic and shuffling gait
-Bradykinesia
-Tetraparesis-Myoclouus finger movements
-Palatal and arms tremor-Routine blood and unine tests
-Amino acids, VDRL, HIV, syphilis serologies
-Antinuclear-, antineutrophil cytoplasmic-/ antineuronal nuclear antibodies
-Lead and copper
-Cortisol
-Unine organic acids and lactate
-CSF
-Nerve conduction study
-CADASIL skin biopsy test
-All tests were normal (except a slight protein elevation in CSF)-No specific final clinical diagnosis was made but:
AD.
Atypical CADASIL
Atypical MS were considered
4M48Patient still livingPatient still living-Parkinsonism
-Personality changes-Slow saccadic eye movements
-Shuffling gait
-Bradykinesia
-Kinetic tremor
-Rigidity
-Dysarthria
-Dysphagia-Occulomotor appraxia
-Hypophonic speech-Routine blood and urine tests
-Ceruloplasmin and lactate
-Pyruvate
-Aminoacids, VDRL, TPHA, Lyme,Brucella screens, HIV and NMO antigene
-Antinuclear-, antineutrophil cytoplasmic-/ autineuronal nuclear antibodies
-Urinary organic acids
-ACE (serum and CSF)
Arylsulfatase A, galactocerebrosidase, beta-galactosidase, hexosaminidase, sphingomyelinase, and very long chain fatty acids
-CSF examination
-CADASIL skin biopsy test and NOTCH3 gene test
-Paraneoplastic panel
-Malignancy screening with PET
-Genetic analyses for Parkin, PINKI, LRRK2
-Nerve conduction study
-EMG
-All test were normal-No specific final clinical diagnosis was made but:
NMO
Atypical PD
MS
PSP(PSP superimposed on MS) were considered
Case 1. (Norwegian family)
A 38-year-old female developed depression, difficulties with following directions and performing calculations, slowness of thoughts and fatigue. Due to progressive cognitive dysfunction, she had difficulties continuing her work as a mail carrier. During the first evaluation, approximately six months after symptom onset, she had slight bradykinesia in all extremities, which was more evident on her right side. She also had exaggerated deep tendon reflexes, but no extensor plantar responses. An axial T2-weighted brain MRI was performed 1.2 years after the onset of her symptoms and showed localized white matter T2 hyperintense foci in the bifrontal and biparietal white matter (more on the left) and corpus callosum, with associated atrophy ( ). Clinical examination, at the time of the MRI, demonstrated increased bradykinesia in all extremities, slight apraxia, unsteady broad based gait and extensor plantar response on the right side. Over the next nine months, there was rapid deterioration of cognitive and motor functions with spasticity and multiple falls. She developed primitive reflexes, homonymous hemianopsia to the right side, alien limb sign in her right arm, mutism, somnolence and generalized tonic- clonic seizures. She became bedridden about six months before passing away at the age of 41, after a 3 year disease course. She was treated with intermittent regimes with intravenous (IV) methylprednisolone sodium succinate 1000 mg given in three consecutive days followed by oral prednisolone 60 mg daily with downward titration over 3 weeks. This therapy was repeated every two months three times over the course of her illness. No benefit was seen. Her clinical diagnosis was atypical MS.
Case 2. (Norwegian family)
The identical twin sister of Case 1 had similar symptoms and disease course. Her symptoms started insidiously with attacks of dizziness at age 36 and lasting intermittently for the following year. Subsequently, at the age of 37 year old, she developed executive dysfunction, depression, memory problems, reduced fine skill movements, clumsiness and stiffness in her left arm. Two years after the onset of her symptoms she was found to have left sided arm dystonia, left sided dysmetria, generalized bradykinesia, slight apraxia, exaggerated tendon reflexes and a positive bilateral extensor plantar responses. Her gait was spastic and she had left inferior homonymous quadrantanopsia. Over the next few months she developed generalized seizures, spasticity in all four extremities, tetraparesis, contractures of the large joints in both upper and lower extremities, dysphasia, dysphagia, and became totally bedridden. A brain MRI, axial T2-weighted, performed 1.9 years after the onset of symptoms demonstrated confluent bifrontal and biparietal white matter (more marked on the right) T2 hyperintensities with corresponding atrophy ( ). She was treated with steroids followed the same protocol as for her sister. However, after completion of steroid therapy without any benefit, she was placed on subcutaneous interferon beta-1a (IFN-1a), 44 μg, three times weekly for six months. These provided no benefit. She died at 40 years of age. Her final clinical diagnosis was atypical MS.
Both sisters had negative routine blood and urine tests. Amino acids, VDRL and HIV serologies, arylsulfatase A, galactocerebrosidase, glucosidase, galactosidase, mannosidase, fucosidase, very long chain fatty acids, anti-nuclear, anti-neutrophil cytoplasmic, and anti-neuronal nuclear antibodies were all negative. Cerebrospinal fluid examination, CADASIL skin biopsy and NOTCH3 blood test and mitochondrial muscle biopsies were also normal.
Autopsies demonstrated brain white matter abnormalities with axonal spheroids that were immunohistochemistry-positive for neurofilament and amyloid precursor protein, similarly to other reported cases of HDLS [10] ( ). Both patients also had corticospinal tract degeneration. Contrarily, their parents are alive and healthy and there are no other affected family members.
Case 3. (German family)
A 52-year-old male developed personality and memory problems over a period of three months. He lost interest in daily activities, became withdrawn and aggressive. At neurological examination, three months after symptom start, no focal abnormalities were detected, with the exception of mini-mental state examination (MMSE) score of 24/30 points. Over the next 10 years, he developed insidious increase of symptoms with reduced vibration sensation in all extremities, finger myoclonus, vertical gaze palsy, brisk reflexes and upper motor neuron weakness in the right arm. Tremor was present in both arms and palate. The gait became ataxic with small steps; he also became doubly incontinent and became totally ADL dependent. In the last year of the disease he had reached a vegetative state; was totally bedridden and mute. He died 11 years after the onset of the first symptom.
Laboratory investigations including serum electrolytes; complete blood counts; liver and thyroid function tests; vitamin B12 and folate levels; vitamin E; cholesterol and triglycerides; amino acids (serum and urine); syphilis and HIV serologies; antinuclear, antineutrophil cytoplasmic, and antineuronal nuclear antibodies; erythrocyte sedimentation rate; lead and copper; and cortisol, as well as urine organic acids and lactate (blood and CSF), which did not revealed any abnormalities. CSF showed no abnormalities, except a slight protein elevation. Skin biopsy for granular osmiophilic material (GOM) pathology was absent in regard to Cerebral Autosomal Dominant Arteriopathy with Subcortical Infarcts and Leukoencephalopathy (CADASIL). MRI, axial T2-weighted, performed 3.5 years after symptom onset demonstrated localized bilateral frontoparietal periventricular white matter T2 hyperintensities with corresponding atrophy ( ).
No final diagnosis was established, but the differential diagnoses included AD, MS and atypical CADASIL, even though skin biopsy was negative for GOM. Autopsy of Case 3 demonstrated white matter pathology; cortical atrophy and axonal spheroids consistent with HDLS ( ).
His brother had developed personality, memory and gait problems at age 58 and received the diagnosis of atypical CADASIL, even though he also had a negative skin biopsy test for GOM pathology. His sister developed neurological symptoms at age 18, and became wheelchair bound and bedridden. She died at age 49, diagnosed with MS. Their mother had developed dementia at age 54 and died 7 years after the onset of her symptoms ( ). None of these family members had brain biopsy or autopsy.
Case 4. (US family)
A 48-year-old male of Polish and German descent experienced gradual progressive gait difficulty affecting the left leg, which gradually affected the right leg. Upon neurological examination six months after onset of symptoms, he was found to be oriented to date, time and place; his MMSE score was 27 of 30 points and he was reported to have a slight personality change, becoming withdrawn and having periods of sadness. He had mild apraxia, masked facies and slow saccadic eye movements (horizontal and vertical) with ocular motor apraxia. There was rigidity and dysdiadochokinesia in all extremities, more on the left side, dysarthria and dysphagia. Over the next six months, his gait became slow and shuffling and he developed neurogenic bladder. Investigational work up was extensive and included; routine complete blood count and chemistry, thyroid function, serum creatine phosphate, ceruloplasmin, lactate, pyruvate, amino acids, cerebrospinal fluid analysis with oligoclonal bands and IgG index, urinary organic acids, angiotensin conversion enzyme, arylsulfatase A, galactocerebrosidase, beta-galactosidase, hexosaminidase, sphingomyelinase, and very long chain fatty acids and all test results were normal. Skin biopsy and NOTCH3 blood test in regard to CADASIL were normal. VDRL, TPHA, Lyme and Brucella screens, HIV and NMO antigene were negative. Paraneoplastic panel, malignancy screening with PET and genetic analyses for Parkin, PINK1, LRRK2; all came out with negative results. EMG, nerve conduction studies and angiogram were both negative.
A brain MRI, axial T2-weighted, performed 2.5 years after disease onset showed patchy bilateral frontoparietal white matter T2 hyperintensities extending into the corpus callosum with correspondent atrophy ( ). He received treatment with IV methylprednisolone sodium succinate (1000 mg for three consecutive days every other month for six months), IV plasmapheresis (every 3rd month for 9 months), subcutaneous interferon, 44 μg IFN-1a, (three times weekly for approximately a year) and L-dopa (up to 1000 mg/day over 5 months). These provided no benefit. Over the next three years, his symptoms progressed with increased tone in all extremities, could not ambulate secondary to bradykinesia, prominent bulbar signs with dysarthria and dysphagia and became total care dependent. He is today bedridden and almost mute. Prior to brain biopsy at the age of 50, he received multiple diagnoses including neuromyelitis optica (NMO), AP, atypical MS and progressive supranuclear palsy (PSP) superimposed on MS. His brain biopsy showed white matter abnormalities with axonal spheroids present consistent with HDLS ( ).
His half-sister was diagnosed with MS and died, bedridden at age 46. His mother died at the age of 52 in a nursing home after a three-year course of an AP illness1 ( ). Neither individual had a brain biopsy or autopsy.
Discussion
HDLS is a devastating neurodegenerative disease with adult onset. The disease is inherited in an autosomal dominant fashion, but the genetic defect has not yet been identified. It is thought that HDLS is caused by primary disruption of the axon integrity, neuroaxonal damage, and focal axonal swelling (axonal spheroids) leading to secondary demyelination [10, 11]. However, demyelination may precede the axonal damage [12], triggering an autonomous neurodegenerative process.
Neuropathology of our 4 cases demonstrated white matter abnormalities confined to the cerebrum, sparing the optic nerve, and major fiber tracts in the diencephalon, and cerebellum. However, the corticospinal tract, posterior limb of the internal capsule and less affected anterior limb were involved in all cases. Most of the white matter tracts in the brainstem were unaffected, including the medial and lateral lemnisci, medial longitudinal fasciculus and the cerebellar peduncle. The exception was the involvement of the cerebral peduncle and frontopontine fibers in the pontine base. The white matter vacuolation and demyelination with axonal spheroids that are immunoreactive for neurofilament, APP and ubiquitin, the histopathologic hallmark in HDLS, was found in all our cases. Bizarre astrocytes and lipid-and myelin-laden macrophages are also found. There are no pathognomonic lesions that absolutely confirm the diagnosis, but the presence of white matter changes with neuroaxonal spheroids present, confirmed the diagnosis of HDLS in our cases. These findings are similar to those previously reported [1, 3, 10] ( ). In HDLS the basal ganglia, thalamus, hypothalamus, hippocampus, substantia nigra, raphe nucleus, reticular formation and cerebellar grey matter are unaffected. There is no significant evidence of amyloid angiopathy in parenchymal or leptomeningeal vessels.
In order to exclude common adult onset leukodystrophies, the Cases 1, 2 and 4 were tested for Arylsulfatase A, galactocerebrosidase, glucosidase, galactosidase, mannosidase, fucosidase and very long chain fatty acids. Metachromatic leukodystrophy (MLD), Krabbe disease and X-linked adrenoleukodystrophy (X-ADL) may start in adult age but the neuropathological findings in our cases are incompatible with these diagnoses. In MLD there is accumulation of metachromatic material in the white matter [13]. Krabbe disease is characterized by the presence of globoid cells derived from microglia which have multiple nuclei [14]. X-ALD has often significant inflammatory features in the white matter and lamellar cytoplasmic inclusions in the brain and other organs [15]. These histological features were clearly lacking in the brain in all of our patients, ruling out these diseases on pathologic grounds. Furthermore MLD often has a tigroid pattern of white matter lesion [16] and X-ALD has a predominant parieto-occipital white matter abnormality [17], neither of our cases had a tigroid pattern and all demonstrated frontal predominant white matter lesions. Vanishing white matter (VMW) disease can also present in adult age but it is neuropathologically characterized by increased white matter rarefaction and cystic degeneration, sparse dysmorphic astrocytes, scanty astrogliosis and the distinguishing increased macroglia around cavitated regions and in lesser affected areas. It has characteristic foamy oligodendrocytosis and apoptotic loss of oligodendrocytes [18]. These features were not present in our cases.
The rarer adult onset lysosomal storage diseases such as adult (Type 3) GM1 Gangliosidosis [19], Niemann –Pick (GM2 and GM 3 gangliosides) [20]; Fabrys disease [21] and the even more rare hexosaminidase A deficiency [22, 23] differ from HDLS both in clinical- and MRI presentations and neuropathologically.
White matter lesion with axonal spheroids can also be due to Nasu-Hakula disease or traumatic closed head injury [24, 25]. Naso-Hakula disease can present with a clinical syndrome similar to HDLS, but contrarily, affected patients complain of pain and tenderness of ankles/feet/wrist, and there are characteristic cystic bone lesions seen on plain radiological films [26]. There was no history of head trauma in any of our cases.
Adult onset autosomal dominant leukodystrophy (ADLD) often initially presents with autonomic symptoms followed by cerebellar and pyramidal signs. It has a characteristic MRI pattern and neuropathology with loss of myelin and rarefaction with vacuolated myelin in both the white matter of cerebrum and cerebellum; atrophy and signal changes in medulla oblongata and spinal cord; and normally usually no axonal spheroids, differentiating it from HDLS [27, 28]. All of our cases were post-mortem and were tested genetically for Naso-Hakula and ADLD with negative results.
Skin biopsies were obtained and the skin vessels were tested for accumulation of GOM by electron microscopy in all of our cases, but the NOTCH3 gene mutations were not performed in Case 3. GOM has been considered specifically diagnostic for CADASIL, but the reports on the sensitivity of detecting GOM in patients' skin biopsy have been contradictory. However, there was no characteristic white matter lesions in the temporal poles on MRI [24] and the neuropathology was incompatible with CADASIL; having no evidence for infarct or arteriolar pathology to support a vascular etiology [29].
The clinical characteristics of Case 1–4 are summarized in . The three unrelated families illustrate the clinical and neuroimaging similarities of HDLS. In these Cases, the disease commenced with changes in personality, memory and executive functions, depression and/or parkinsonism, and later progressed to devastation across multiple domains of neurological impairments.
There are several novel factors in relation to our cases. The first matter is that all cases we have identified so far are Caucasians. This may represent a possible risk allele in Caucasians. However, an ascertainment bias can not be excluded and more research is needed to confirm this observation. Secondly, we report the families from Norway and Germany. To our knowledge this is the first report of a Norwegian family with HDLS and first report of a familiar case with HDLS from Germany. However, Mayer et al. [8] have reported two German independent cases with sporadic leukoencephalopathy with axonal spheroids. Thirdly, our Case 3 had also a palatal tremor. Palatal tremor has not been reported in HDLS cases. Therefore, this observation expands the phenotypic presentation of HDLS. Finally, all of our cases have been neuropathological evaluated by the same pathologist confirming the diagnoses of HDLS. This is an important factor in studying rare neurodegenerative disorders.
The mean age of onset in our patients was 44 years (range, 36–52 years), disease duration was six years (range, 3–11 years) and the mean age of death was 48 years (range, 40–63 years). All patients had bilateral frontal and parietal white matter T2 hyperintense foci with frontal prominence; the foci often extended from the periventricular and deep regions to the subcortical tissues. Atrophy was associated with the regions of signal abnormality. All the cases demonstrated abnormal T2 signal in the corpus callosum with or without atrophy (Case 2 not shown). Cases 3 and 4 demonstrated a convincing family history, whereas it remains unclear whether the Norwegian family reflects reduced penetrance or a de novo mutation.
Leukoencephalopathies with adult onset are serious disorders and the combination of extensive white matter lesions in cases with progressive neuropsychiatric symptoms constitutes a common diagnostic dilemma. Many of these disorders, even a few hereditary disorders, are treatable, so it is of utmost importance to clarify the diagnostic spectrum.
Better understanding of leukoencephalopathies in neurological practice is crucial to differentiating among metabolic, toxic, inflammatory, vascular white matter diseases or heritable illness. Clinical differential diagnoses include dementia (e.g., FTD and AD) [30, 31]; atypical Parkinsonism (e.g., corticobasal degeneration, multisystem atrophy or PSP) [32]; progressive MS [33]; and leukodystrophies [34].
On MRI, HDLS could be mistaken for other leukoencephalopathies, usually early in the disease stage, like Nasu-Hakola disease, VWM, X-ALD, MLD, Krabbe disease and even a Susac's syndrome [34, 35]. In addition, a family history consistent with a dominant autosomal disease could suggest adult onset Alexander disease, ADLD and CADASIL [24, 28]. However, diagnostic MRI criteria may predict these latter diseases with high probability and most of the ones listed also have a known gene mutation [34, 36].
We conclude that HDLS imitates many neurodegenerative diseases. An accurate diagnosis of HDLS currently depends on a histopathologic evaluation, because the gene(s) causing HDLS remain unknown. Finding the gene for this condition is of paramount importance in understanding the neurodegeneration associated with white matter abnormalities. The identification of three new families with pathologically-confirmed HDLS in this study further suggest that HDLS may be frequently unrecognized and misdiagnosed. Alerting the clinicians to this disorder will feasibly increase identification of HDLS cases. Being familiar with the clinical presentation and neuroimaging will aid in the diagnostic evaluation.
|
||||
1850
|
dbpedia
|
2
| 65 |
https://repositorio.tec.mx/handle/11285/650350%3Fshow%3Dfull%26locale-attribute%3Des
|
en
|
3D printed tumor on chips for the culture and maturation of heterotypic cancer spheroids as a platform for drug testing
|
[
"https://repositorio.tec.mx/bitstream/handle/11285/650350/GallegosMartinez_TesisDoctoradopdfa.pdf.jpg?sequence=9&isAllowed=y",
"https://repositorio.tec.mx/bitstream/handle/11285/650350/GallegosMart%c3%adnez_ActadeGradoyDeclaracionAutoriapdfa.pdf.jpg?sequence=11&isAllowed=n",
"https://repositorio.tec.mx/bitstream/handle/11285/650350/CartaAutorizacionTesis-CON%20%281%29.pdf.jpg?sequence=13&isAllowed=n",
"https://repositorio.tec.mx/themes/Mirage2//images/creativecommons/cc-by.png"
] |
[] |
[] |
[
""
] | null |
[
"Gallegos Martínez"
] | null |
en
|
/themes/Mirage2/images/favicon.ico
| null |
dc.description.abstractThe recapitulation of cancer environment in tumor-on-chip systems will greatly contribute to accelerate cancer studies in the fronts on fundamental research, pharmacological testing of new therapeutic compounds, and personalized medicine. Here we describe the development of two microfluidic platforms aimed to contribute to the advance of tumor-on-chip research. First, we describe a simple and robust method for the fabrication, maturation, and extended culture of large heterotypic cancer (MCF7 and MCF7/fibroblasts) spheroids (~900 µm in diameter) in a 3D-printed mini continuous stirred tank reactor (mini-CSTR). In brief, MCF7 and MCF7/BJ cell suspensions (5×104 cells) were incubated in batch culture to form discoid cell aggregates (600 µm in diameter). These microtissues were then transferred into the mini-CSTR and continuously fed with culture media for an extended time (~30 days). The spheroids progressively increased in size during the first 20 days of perfusion culture to reach a steady diameter. We characterized the spheroid morphology, architecture and the evolution of expression of relevant tumor-related genes (i.e., ER, VEGF, Ki67, Bcl2, LDHA, and HIF-1α) in spheroids cultured for 30 days. This mini-CSTR culture strategy enables the simple and reproducible fabrication of relatively large spheroids and offers great potential for studying the effects of diverse effectors on tumor progression. In addition, we introduce a 3D-printed microfluidic system that can be generically used to culture tumor-tissues under well-controlled environments. The system is composed by three compartments. The left and right compartments have two inlets and two outlets which provide means to continuously feed liquid streams to the system. The central compartment is designed to host a hydrogel where a microtissue can be confined and cultured. A transparent lid can be adapted to enable visual inspection under a microscope. We conducted fluorescent and FITC dextran tracer experiments to characterize the hydraulic performance of the system. In addition, we cultured MCF7 and MCF7/BJ spheroids embedded in a GelMA hydrogel constructs (placed in the central chamber), to illustrate the use of this system to sustain long term micro-tissue culture experiments. We also present experimental results that illustrate the flexibility and robustness of this 3D-printed device for tumor-on-chip experiments including pharmacological testing of anticancer compounds. These “open-source” organ-on-chip systems are intended to be a general-purpose resource to facilitate and democratize the development of tumor-on-chip applications. We also explored the use of these cell aggregates and some of the characterization techniques to develop educational activities in the context of tissue engineering. Students fabricated a DIY (do it yourself) incubator and cultured spheroids for 7 days on average. They evaluated glucose consumption, size progression and change in color of the culture media. In this proposed activity students were exposed to concepts and basic experimental duties commonly use in a tissue engineering lab.es_MX
|
||||||
1850
|
dbpedia
|
1
| 88 |
https://www.nhsinform.scot/illnesses-and-conditions/cardiovascular-disease/risk-factors-for-cardiovascular-disease/high-cholesterol/
|
en
|
High cholesterol
|
[
"https://appnhs24wp41a8c38064.blob.core.windows.net/blobappnhs24wp41a8c38064/wp-content/uploads/2023/03/logo.svg",
"https://appnhs24wp41a8c38064.blob.core.windows.net/blobappnhs24wp41a8c38064/wp-content/uploads/2023/06/home-nhs.png",
"https://www.nhsinform.scot/wp-content/themes/nhsinform/assets/images/launchpad-icon.svg",
"https://appnhs24wp41a8c38064.blob.core.windows.net/blobappnhs24wp41a8c38064/wp-content/uploads/2023/10/scotgov-logo-small-transparent-final.png",
"https://appnhs24wp41a8c38064.blob.core.windows.net/blobappnhs24wp41a8c38064/wp-content/uploads/2023/03/nhs-24-white.svg",
"https://appnhs24wp41a8c38064.blob.core.windows.net/blobappnhs24wp41a8c38064/wp-content/uploads/2023/03/bsl-logo.svg"
] |
[
"https://www.youtube.com/embed/_qzT246x8DE?feature=oembed"
] |
[] |
[
""
] | null |
[] |
2024-07-01T15:31:35+00:00
|
Cholesterol is a fatty substance known as a lipid and is carried in your blood. Learn more about high cholesterol and how it's managed.
|
en
|
NHS inform
|
https://www.nhsinform.scot/illnesses-and-conditions/cardiovascular-disease/risk-factors-for-cardiovascular-disease/high-cholesterol/
|
Cholesterol is a fatty substance that’s produced in the liver. It’s also in some foods that we eat. The body needs a certain amount of cholesterol to function normally.
Cholesterol combines with proteins to be carried around the blood. This combination is known as lipoproteins.
There are 2 main types of lipoprotein.
High-density lipoprotein (HDL) carries cholesterol away from the cells and back to the liver to be removed. For this reason, HDL is referred to as ‘good cholesterol’ and higher levels of this type are better.
Non-HDL lipoproteins are known as ‘bad cholesterol’. This is because it can build up in blood vessel walls if there’s too much. This is known as atherosclerosis. This can lead to heart disease, strokes and peripheral arterial disease (PAD).
What are healthy cholesterol levels?
This information is just a guide to healthy cholesterol levels. What matters is your overall risk of cardiovascular disease. This is assessed by considering your cholesterol levels alongside other things like your age, whether you smoke and if you have a family history of cardiovascular disease.
Blood cholesterol is measured in units called millimoles per litre of blood. This is often shortened to mmol/L.
A healthy level of:
total cholesterol – is below 5mmol/L
HDL (good cholesterol) – is above 1.0mmol/L for men or above 1.2mmol/L for women
non-HDL (bad cholesterol) – is below 4mmol/L
You should speak to your healthcare professional if you’re worried about your cholesterol level.
Causes of high cholesterol
There are many things that can influence your chance of developing high cholesterol. Some of these you have control over and some of these you don’t.
For example, the chance of developing high cholesterol is increased by certain lifestyle factors. These are sometimes called controllable risk factors. This includes your diet, level of physical activity and smoking habits.
Things that influence high cholesterol that you can’t change include:
age
being male
ethnicity
There’s also an inherited condition called familial hypercholesterolaemia (FH). An inherited condition means that it can be passed through families by faulty genes. This can cause high cholesterol even in people who follow a healthy lifestyle.
Diagnosing high cholesterol
High cholesterol doesn’t usually cause any symptoms on it’s own. You can have your cholesterol levels checked.
Your healthcare professional may recommend that you get your cholesterol levels tested if they think you’re at risk of cardiovascular disease.
If you have high cholesterol, your healthcare professional will talk to you about how you can lower it. This might include things like changing your diet or taking medicine.
Managing your high cholesterol
Lifestyle changes can help to lower your cholesterol level, including:
eating a healthy, balanced diet
exercising regularly
stopping smoking
drinking less alcohol
The most common medications for high cholesterol are statins. But, there are some other types of medications available. Your healthcare professional will advise if you need these.
|
|||||
1850
|
dbpedia
|
1
| 71 |
https://www.uptodate.com/contents/hdl-cholesterol-clinical-aspects-of-abnormal-values
|
en
|
UpToDate
|
[] |
[] |
[] |
[
""
] | null |
[] | null |
en
|
/app/utd-menu/utd-icon.png
| null | |||||||
1850
|
dbpedia
|
3
| 68 |
https://www.nhs.uk/conditions/high-cholesterol/cholesterol-levels/
|
en
|
High cholesterol - Cholesterol levels
|
[] |
[] |
[] |
[
""
] | null |
[
"NHS website",
"www.facebook.com"
] |
2019-05-28T08:09:00
|
Find out what cholesterol tests measure and what a healthy cholesterol level should be.
|
en
|
/static/nhsuk/img/favicons/favicon.68c7f017cfba.ico
|
nhs.uk
|
https://www.nhs.uk/conditions/high-cholesterol/cholesterol-levels/
|
About your cholesterol result
A cholesterol test can measure:
total cholesterol – the overall amount of cholesterol in your blood
good cholesterol (called HDL) – this may make you less likely to have heart problems or a stroke
non-HDL cholesterol – the difference between total cholesterol and HDL
When you get your result, you may just be told your total cholesterol.
You might be able to get separate results for your HDL and non-HDL cholesterol too. Ask your doctor or nurse.
How your GP uses your results
Your GP will use your cholesterol levels along with other factors, such as your age, blood pressure and health conditions, to estimate your risk of cardiovascular disease.
They may give you a score (called a QRISK score) which estimates how likely you are to have a heart or circulation problem over the next 10 years.
What your cholesterol levels should be
What is a good target level for you depends on things like your age, whether you have any health conditions and your risk of cardiovascular disease.
These levels are a guide for healthy adults. If you have been ill, are taking some medicines, or have recently had a baby, your levels may be lower or higher. It does not make much difference to these levels whether you have eaten before your test or not.
|
||||
1850
|
dbpedia
|
2
| 73 |
https://ri.conicet.gov.ar/handle/11336/175014
|
en
|
IRGD-guided tamoxifen polymersomes inhibit estrogen receptor transcriptional activity and decrease the number of breast cancer cells with self-renewing capacity
|
[
"https://ri.conicet.gov.ar/static/images/logo.png",
"https://ri.conicet.gov.ar/themes/CONICETDigital/images/conicet.png",
"https://ri.conicet.gov.ar/themes/CONICETDigital/images/conicet.png",
"https://ri.conicet.gov.ar/themes/CONICETDigital/images/conicet.png",
"https://ri.conicet.gov.ar/themes/CONICETDigital/images/conicet.png",
"https://ri.conicet.gov.ar/themes/CONICETDigital/images/conicet.png",
"https://ri.conicet.gov.ar/bitstream/handle/11336/175014/CONICET_Digital_Nro.96c5417a-1a2f-491f-a4c5-d2fc008eaf18_D.pdf.jpg?sequence=-1&isAllowed=y",
"https://ri.conicet.gov.ar/static/images/openAcc.png",
"https://ri.conicet.gov.ar/themes/CONICETDigital/images/creativecommons/cc-by.png",
"https://ri.conicet.gov.ar/static/images/google-scholar.png",
"https://ri.conicet.gov.ar/static/images/mendeley-ico.png",
"https://ri.conicet.gov.ar/themes/CONICETDigital/images/logo.png"
] |
[] |
[] |
[
""
] | null |
[
"Lago Huvelle",
"María Amparo",
"Soler Illia",
"Díaz Bessone",
"María Inés",
"Simón Gracia",
"Maria de Los Angeles"
] | null |
/themes/CONICETDigital/images/favicon.ico
| null |
Resumen
Background: Tamoxifen (Tam) is the most frequent treatment for estrogen receptor (ER) positive breast cancer. We recently showed that fibronectin (FN) leads to Tam resistance and selection of breast cancer stem cells. With the aim of developing a nanoformulation that would simultaneously tackle ER and FN/β1 integrin interactions, we designed polyethylene glycol-polycaprolactone polymersomes polymersomes (PS) that carry Tam and are functionalized with the tumor-penetrating iRGD peptide (iRGD-PS-Tam). Results: Polyethylene glycol-polycaprolactone PS were assembled and loaded with Tam using the hydration film method. The loading of encapsulated Tam, measured by UPLC, was 2.4 ± 0.5 mol Tam/mol polymer. Physicochemical characterization of the PS demonstrated that iRGD functionalization had no effect on morphology, and a minimal effect on the PS size and polydispersity (176 nm and Pdi 0.37 for iRGD-TAM-PS and 171 nm and Pdi 0.36 for TAM-PS). iRGD-PS-Tam were taken up by ER+ breast carcinoma cells in 2D-culture and exhibited increased penetration of 3D-spheroids. Treatment with iRGD-PS-Tam inhibited proliferation and sensitized cells cultured on FN to Tam. Mechanistically, treatment with iRGD-PS-Tam resulted in inhibition ER transcriptional activity as evaluated by a luciferase reporter assay. iRGD-PS-Tam reduced the number of cells with self-renewing capacity, a characteristic of breast cancer stem cells. In vivo, systemic iRGD-PS-Tam showed selective accumulation at the tumor site. Conclusions: Our study suggests iRGD-guided delivery of PS-Tam as a potential novel therapeutic strategy for the management of breast tumors that express high levels of FN. Future studies in pre-clinical in vivo models are warranted.
|
|||||||
1850
|
dbpedia
|
1
| 5 |
https://www.healthline.com/health/high-cholesterol/is-high-cholesterol-hereditary
|
en
|
High Cholesterol: Is It Hereditary?
|
[
"https://i0.wp.com/post.healthline.com/wp-content/uploads/2022/01/Megan-Soliman-500x500-Bio.png?w=105&h=105",
"https://i0.wp.com/post.healthline.com/wp-content/uploads/2022/01/Megan-Soliman-500x500-Bio.png?w=105&h=105",
"http://b.scorecardresearch.com/p?c1=2&c2=38584006&cv=3.9&cj=1&"
] |
[] |
[] |
[
"is high cholesterol hereditary"
] | null |
[
"Neel Duggal"
] |
2017-02-22T08:00:00+00:00
|
High cholesterol can be hereditary, but it can also be caused by other factors. Learn more about what causes high cholesterol.
|
en
|
Healthline
|
https://www.healthline.com/health/high-cholesterol/is-high-cholesterol-hereditary
|
Being diagnosed with high cholesterol usually means you have either high LDL (low-density lipoprotein) cholesterol, or a high level of total cholesterol. Total cholesterol is also sometimes called serum cholesterol. It’s the sum of LDL and HDL cholesterol and 20% of your triglycerides, a type of fat.
LDL cholesterol and total cholesterol can be used as indicators of your risk of developing cardiovascular disease and other complications.
Learn more: What is serum cholesterol, and why is it important? »
A variety of risk factors contribute to unhealthy levels of cholesterol, including genetics, lifestyle choices, or a combination of the two.
Familial hypercholesterolemia
Having a close relative, such as a parent, sibling, or grandparent, who has high levels of cholesterol is called familial hypercholesterolemia, and it means you may be at a higher risk of having it too, because you may have inherited genes that contribute to high cholesterol levels. People with familial hypercholesterolemia can’t control their cholesterol through diet and exercise alone and may also need to take medication.
Obesity or large waist circumference
Obesity is defined as a body mass index (BMI) of 30 or higher. A large waist circumference is 40 or more inches for men and 35 or more inches for women. Fat that accumulates in your waist increases your risk of elevated cholesterol and other cardiovascular complications.
Elevated blood sugar
High levels of glucose can increase LDL cholesterol and decrease HDL cholesterol. High levels of glucose in your blood can also damage the lining of arteries which can increase your risk of fatty deposits building up in your arteries.
Lifestyle factors
Some risk factors for high cholesterol may be completely controlled by lifestyle choices. These include diet, exercise, and smoking.
Diet
Eating a diet high in saturated and trans fats can increase your cholesterol levels. Foods high in these types of fats include:
red meat
full-fat milk and yogurt
fried foods
highly processed sweets
Exercise
Exercise can increase your HDL cholesterol and decrease your LDL cholesterol. That means that adding exercise to your routine can help promote healthy levels of cholesterol in your body.
Aim for 150 minutes of moderate to high intensity aerobic exercise each week. If you’re new to exercise, work your way up to that goal. Be sure to talk with your healthcare professional before starting any new exercise routines. Adding resistance exercises, such as weightlifting or yoga, into your exercise plan may help too.
Quitting smoking
Smoking can have a negative impact on your heart health. That’s because tobacco damages the walls of your blood vessels. This makes it more likely for fat deposits to build up.
Talk with your doctor or healthcare professional about smoking cessation programs that may work for your lifestyle. Sometimes you may need to try more than one method to stop smoking. Having a support group can help.
Learn more: 14 tips for quitting smoking »
High levels of cholesterol are usually asymptomatic. To determine your cholesterol levels, you’ll need a blood test. Your primary care physician will draw your blood to check lipid levels. This is called a lipid panel, and it’s a standard procedure for most primary care physicians. Your results will typically include:
total cholesterol
HDL cholesterol
LDL cholesterol, sometimes including particle count in addition to the total amount
triglycerides
There are two additional cholesterol tests you may have, Lipoprotein-a (Lp(a)) and Apolipoprotein B (ApoB). These tests measure proteins related to LDL and can help your doctor assess your cardiovascular health and risks.
Generally, doctors use the following guidelines when interpreting the results of total cholesterol:
Cholesterol levels and what they mean
healthy total cholesterolbelow 200 mg/dLat-risk total cholesterol200 to 239 mg/dLhigh total cholesterolabove 240 mg/dLlipoprotein a – Lp (a)at or above 50 mg/dL apolipoprotein B (ApoB)at or above 130 mg/dL
Your doctor will also interpret the other numbers to get a more complete picture of your health.
When you should get tested
If you’re at low risk for high levels of cholesterol, you should start getting lipid panel screenings starting at age 40 for women and 35 for men. You should have your levels tested about every five years.
If you have more risk factors for cardiovascular disease and high cholesterol, you should start getting lipid panel screenings in your 20s and at more frequent intervals. If the results show you have unhealthy levels of cholesterol or other lipids, your doctor will work with you to create a treatment and monitoring plan.
Genetic testing
If you think you may be at risk for familial hypercholesterolemia, your doctor may recommend genetic testing. Genetic testing can identify faulty genes and determine if you have familial hypercholesterolemia.
If you do test positive for familial hypercholesterolemia, you may need more frequent lipid panels.
Other cholesterol testing
Apolipoprotein (b) (ApoB) and lipoprotein (a) (Lp(a))
Newer cholesterol testing includes ApoB and Lp(a) testing. Both ApoB and Lp(a) are proteins associated with LDL. High levels of these substances may indicate you are at a higher risk for cardiovascular disease.
|
|||||
1850
|
dbpedia
|
2
| 69 |
https://www.a-z.lu/discovery/fulldisplay%3Fdocid%3Dalma9923257533307251%26context%3DL%26vid%3D352LUX_BIBNET_NETWORK:BIBNET_UNION%26lang%3Dfr%26search_scope%3DDN_and_CI%26adaptor%3DLocal%2520Search%2520Engine%26tab%3DDiscoveryNetwork%26query%3Dsub%252Cexact%252C%2520Equipment%2520Design%2520%252CAND%26mode%3Dadvanced%26offset%3D40
|
en
|
[] |
[] |
[] |
[
""
] | null |
[] | null |
en
| null | |||||||||
1850
|
dbpedia
|
0
| 27 |
https://www.ajnr.org/ajnr-case-collections-diagnosis/hereditary-diffuse-leukoencephalopathy-spheroids-hdls
|
en
|
Hereditary Diffuse Leukoencephalopathy with Spheroids (HDLS)
|
[
"https://www.ajnr.org/sites/default/files/ajnr-logo.png",
"https://www.ajnr.org/sites/default/files/ajnr-web-logo_0.png",
"https://www.ajnr.org/sites/default/files/styles/medium/public/additional_assets/case_collections/com/2020feb_homeprev.jpg?itok=qcUz-_5C",
"https://www.ajnr.org/misc/feed.png",
"https://www.ajnr.org/sites/default/files/ajnr-logo.png",
"https://www.ajnr.org/sites/all/modules/highwire/highwire/plugins/content_types/images/logo_small_hw_white.png"
] |
[] |
[] |
[
""
] | null |
[] | null |
en
|
https://www.ajnr.org/sites/default/files/images/favicon.ico
| null |
Background:
Autosomal dominant
Mutations in the colony stimulating factor 1 receptor (CSF1R) gene
Also known as adult-onset leukoencephalopathy with axonal spheroids and pigmented glia (ALSP)
Most common cause of adult-onset leukodystrophy (approximately 10%)
Clinical Presentation:
Dementia, neuropsychiatric changes, motor decline
Manifests exclusively in adults, typically fourth to fifth decade
Prominent symptoms include parkinsonism (not levodopa-responsive) and upper motor neuron signs.
Mean disease duration is approximately 6.8 years.
Key Diagnostic Features:
CT: Small, symmetric calcifications, mainly located adjacent to the anterior horns of the lateral ventricle and in the parietal subcortical white matter
MRI: Symmetric, T2-hyperintense/T1-hypointense signal abnormality in the frontoparietal and periventricular white matter, spares the U-fibers; often associated with restricted diffusion in the early phases of the disease (termed "deep white dots"); small cysts; involvement of the corpus callosum with T2 hyperintensity and thinning
Differential Diagnosis:
Neuroinflammatory diseases in the early stages
Alexander disease
Frontal variant of X-linked adrenoleukodystrophy
Metachromatic leukodystrophy
Treatment:
Incurable disease with no available treatment other than supportive care available
|
||||||
1850
|
dbpedia
|
3
| 72 |
https://www.mountsinai.org/health-library/tests/hdl-test
|
en
|
Mount Sinai - New York
|
[
"https://www.mountsinai.org/mshealth/themes/default/media/images/logo-color.png",
"https://www.mountsinai.org/mshealth/themes/default/media/images/adamsquarequart.gif",
"https://www.mountsinai.org/files/MSHealth/Assets/Health Library/MSHS-HealthLibrary-MyMountSinai-Spotlight-740x540-v5.jpg"
] |
[] |
[] |
[
""
] | null |
[] | null |
Learn about HDL test, find a doctor, complications, outcomes, recovery and follow-up care for HDL test.
|
en
|
Mount Sinai Health System
|
https://www.mountsinai.org/health-library/tests/hdl-test
|
A blood sample is needed. Most of the time, blood is drawn from a vein located on the inside of the elbow or the back of the hand.
You should not eat for 9 to 12 hours before the test.
Alcohol and some medicines can interfere with blood test results.
Make sure your health care provider knows what medicines you take, including over-the-counter medicines and supplements.
Your provider will tell you if you need to stop taking any medicines before you have this test.
Do not stop or change your medicines without talking to your provider first.
You may feel slight pain or a sting when the needle is inserted. You may also feel some throbbing at the site after the blood is drawn.
You want your HDL cholesterol to be high (unless it is due to a condition described below). Optimal values are 60 mg/dL or 1.55 millimoles per liter (mmol/L) or above.
At risk:
Men - Less than 40 mg/dL (1.04 mmol/L)
Women - Less than 50 mg/dL (1.29 mmol/L)
Normal value ranges may vary slightly among different laboratories. Talk to your provider about the meaning of your specific test results.
Low HDL cholesterol levels may be due to:
Eating a diet high in saturated fats or a diet high in carbohydrates and low in fat
Lack of physical activity
Being overweight or having obesity
Metabolic syndrome
Diabetes
A disorder passed down through families in which there are high amounts of cholesterol and triglycerides in the blood (familial combined hyperlipidemia)
Side effect of certain medicines
Overall, the treatment of low HDL focuses on increased exercise and changes in the diet.
An elevated HDL is anything over 80 mg/dL (2.0 mmol/L). This can be a result of:
A genetic variation that causes the body to produce too much HDL
Overactive thyroid (hyperthyroidism)
Drinking too much alcohol
There is little risk involved with having your blood taken. Veins and arteries vary in size from one person to another and from one side of the body to the other. Taking blood from some people may be more difficult than from others.
Other risks associated with having blood drawn are slight, but may include:
Fainting or feeling lightheaded
Multiple punctures to locate veins
Hematoma (blood buildup under the skin)
Excessive bleeding
Infection (a slight risk any time the skin is broken)
Bredefeld CL, Lau R, Hussain MM. Lipids and dyslipoproteinemia. In: McPherson RA, Pincus MR, eds. Henry's Clinical Diagnosis and Management by Laboratory Methods. 24th ed. Philadelphia, PA: Elsevier; 2022:chap 18.
Genest J, Mora S, Libby P. Lipoprotein disorders and cardiovascular disease. In: Libby P, Bonow RO, Mann DL, Tomaselli, GF, Bhatt DL, Solomon SD, eds. Braunwald's Heart Disease: A Textbook of Cardiovascular Medicine. 12th ed. Philadelphia, PA: Elsevier; 2022:chap 27.
Grundy SM, Stone NJ, Bailey AL, et al. 2018 AHA/ACC/AACVPR/AAPA/ABC/ACPM/ADA/AGS/APhA/ASPC/NLA/PCNA Guideline on the management of blood cholesterol: executive summary: a report of the American College of Cardiology/American Heart Association Task Force on Clinical Practice Guidelines. Circulation. 2019;139(25):e1046-e1081. PMID: 30565953 pubmed.ncbi.nlm.nih.gov/30565953/.
Mora S, Libby P, Ridker PM. Primary prevention of cardiovascular disease. In: Libby P, Bonow RO, Mann DL, Tomaselli, GF, Bhatt DL, Solomon SD, eds. Braunwald's Heart Disease: A Textbook of Cardiovascular Medicine. 12th ed. Philadelphia, PA: Elsevier; 2022:chap 25.
Robinson JG. Disorders of lipid metabolism. In: Goldman L, Cooney KA, eds. Goldman-Cecil Medicine. 27th ed. Philadelphia, PA: Elsevier; 2024:chap 190.
|
|||||
1850
|
dbpedia
|
3
| 7 |
https://www.lipid.org/lipid-spin/potpourri-2015/disorders-high-density-lipoprotein-hdl
|
en
|
Disorders of High-Density Lipoprotein (HDL)
|
[
"https://www.lipid.org/sites/default/files/images/NLA%20Horizontal.jpg",
"https://www.lipid.org/sites/default/files/NLAStore.png",
"https://www.lipid.org/sites/default/files/MemorialWall.png",
"https://www.lipid.org/sites/default/files/fall_clu_landing_page_logo.png",
"https://www.lipid.org/sites/default/files/images/NLA_SS25_Home%20Page_493x342.png",
"https://www.lipid.org/sites/default/files/images/NLA_SS_VEGAS_2024_design-01(1).jpg",
"https://www.lipid.org/sites/default/files/images/2024%20Masters_Web%20Thumbnail_375x296.jpg",
"https://www.lipid.org/sites/default/files/images/2024%20Foundations_Web%20Thumbnail_375x296(1).jpg",
"https://www.lipid.org/sites/default/files/images/NLA%20Mastering%20Triglycerides-493x342_website_no%20date%20(1).png",
"https://www.lipid.org/sites/default/files/images/Lipid%20Panel%20Logo.png",
"https://www.lipid.org/sites/default/files/images/A1138%20NLA%20600x200.jpg",
"https://www.lipid.org/sites/default/files/FindMember.png",
"https://www.lipid.org/sites/default/files/Dues.png",
"https://www.lipid.org/sites/default/files/images/JCL-400x167.jpg",
"https://www.lipid.org/sites/default/files/2017_sela_lipid_spin_online_cropped.jpg",
"https://www.lipid.org/sites/default/files/images/Drop_down_button-400x167-02.jpg",
"https://www.lipid.org/sites/default/files/nla_logo_-_use_1.png",
"https://www.lipid.org/sites/default/files/raj_pai.jpg",
"https://www.lipid.org/sites/all/themes/bootstrap-7.x-3.16/nla_bootstrap/nla_white_logo.png"
] |
[] |
[] |
[
"Lipid",
"Lipids",
"Cholesterol",
"LDL",
"HDL",
"Lp(a)",
"Triglycerides",
"Familial Hypercholesterolemia",
"PCSK9",
"Statin",
"Statins",
"Fibrates",
"Diabetes",
"Metabolic Syndrome",
"Obesity"
] | null |
[
"National Lipid Association"
] | null |
National Lipid Association
|
en
|
https://www.lipid.org/sites/default/files/favicon_dqr_icon.ico
|
https://www.lipid.org/lipid-spin/potpourri-2015/disorders-high-density-lipoprotein-hdl
|
A 35-year-old healthy woman is seen at the endocrine clinic for above-normal high-density lipoprotein (HDL). Her triglyceride level is 200mg/dl, and low- density lipoprotein (LDL) is 90mg/dl, with HDL of 129mg/dl. She has no risk factors for coronary artery disease (CAD), except that her father died of premature coronary artery disease at the age of 42.
How does one approach a patient with abnormal HDL? When is HDL protective and when is it not? How do we treat low HDL? This editorial discusses those questions as well as when to consider genetic testing in patients with HDL disorders.
HDL mobilizes cellular cholesterol and transport of cholesterol for hepatic uptake.1 Cholesterol carried by HDL is sometimes referred to as “atheroprotective cholesterol,” because it transports cholesterol away from lipid-laden cells (macrophages) known as foam cells in arteries and tissues to the liver for excretion and reutilization.1 Therefore, HDL may help prevent atherosclerosis and reduce macrophage accumulation.
HDL-cholesterol (HDL-C) refers to free cholesterol and cholesterol ester carried by HDL in the circulation. In practice, the terms HDL and HDL-C often are used interchangeably. Lipoproteins Apo A-I and Apo A-II are the major structural components of HDL.2 In healthy individuals, around 30 percent of cholesterol is carried by HDL.1 HDL-C has an inherited basis in 40 to 80 percent of cases.3 Extreme levels of HDL-C can have a polygenic origin.3
U.S. National Cholesterol Education Program Adult Treatment Panel III (ATP III) guidelines define an HDL-C of 60 mg/dL or greater as a negative risk factor.4 Low HDL-C level is below 40 mg/dL in men and less than 50mg/dL in women.4
Factors that increase HDL-C include female gender5 and moderate alcohol intake.6 Age is positively correlated with HDL-C.7 Elevated HDL-C usually correlates with decreased cardiovascular risk in observational analyses.1 However, high HDL-C levels caused by genetic disorders such as cholesteryl ester transfer protein (CETP) deficiency, primary familial hyperalphalipoproteinemia and endothelial lipase deficiency may not protect against cardiovascular disease.8,9,10 Patients with promoter variants of hepatic lipase(LIPC) have elevated HDL-C and, paradoxically, increased cardiovascular risk.11
Secondary causes of high HDL-C include primary biliary cirrhosis and thyroid disorders, possibly because of increased phospholipid to protein ratio and effect on hepatic lipase, respectively.12,13 High HDL-C in patients not taking lipid-lowering drugs should prompt a diagnostic evaluation, including hepatic function and thyroid-stimulating hormone levels.
Primary causes of high HDL-C are genetic mutations causing overproduction or decreased HDL clearance. CETP deficiency is an autosomal recessive disorder caused by CETP gene mutation.14 CETP facilitates transfer of cholesterol esters from HDL to other lipoproteins. Affected patients have asymptomatic elevation of HDL cholesterol above 150 mg/dL.14
Primary familial hyperalphalipoproteinemia is an autosomal-dominant condition caused by genetic mutations of Apo protein A-I overproduction or Apo protein C-III variants. It is diagnosed incidentally with plasma HDL-C levels above 80 mg/dL9.
Even though high HDL does not need to be treated, per se, the patient needs counseling to avoid risk factors such as smoking in light of her family’s CAD history. It has to be considered that the high HDL, in her case, is not likely to protect against CAD.
Low HDL, in general, is associated with increased CAD risk.15 Obesity, a high- fat diet, a lack of physical activity, and smoking are among the modifiable risk factors low HDL-C levels.16,17 Type 2 diabetes mellitus is also associated with reduced HDL-C levels.16
Multiple epidemiological studies and the landmark Framingham Heart Study have shown that low HDL-C represents a significant and independent predictor of cardiovascular disease (CVD).15,18,19,20
Genetic disorders causing low HDL are Apo lipoprotein A-1 (Apo A-I) deficiency, lecithin: cholesterol acyltransferase (LCAT) deficiency, and ATP-Binding Cassette Transporter A1 (ABCA1) deficiency, all of which are rare and autosomal-recessive.21 Apo A-I mutations cause the most elevation in cardiovascular risk compared with other gene mutations in HDL metabolism. Not all genetic forms of very low HDL-C are associated with increased risk of CVD.22
Apo A-I deficiency is characterized by the absence of apoA-I, whereas LDL-C and triglyceride levels are not affected.23 Symptoms include xanthomas and corneal opacities. Heterozygotes of the Apo A-I Milano variant exhibit low HDL-C levels but reduced CAD,22 whereas carriers of the Apo A-I Paris variant are protected against CAD.22 LCAT converts free cholesterol into cholesteryl ester.
LCAT deficiency causes accelerated catabolism of Apo A-I and ApoA-II and low HDL. Heterozygotes have 40 percent reductions in HDL- C. Symptoms include corneal opacity in partial LCAT deficiency (fish eye), proteinuria, and anemia. Both partial LCAT deficiency and familial LCAT deficiency increase the risk of premature CAD.23,24
Patients with ABCA1 gene mutations (Tangier disease), are not at increased cardiovascular risk as these patients can have cholesterol delivered onto more mature HDL via the ABCG1 (ATP- Binding Cassette G1) Transporter.25,26 In Tangier disease, ABCA1 function is impaired. Apo A-I cannot be lipidated, leading to rapid clearance that results in significantly reduced levels of Apo A-I and the presence of small pre–β-HDL particles. Symptoms include peripheral neuropathy, hepatosplenomegaly, corneal opacities, and thrombocytopenia and intracellular accumulation of cholesterol ester deposition in lymphoid organs.25,26 Plasma levels of Apo A-I are reduced to about 3 percent of normal, and triglyceride levels are increased along with reduced LDL-C (50 percent of normal).26
Treatments for LDL cholesterol and triglycerides often increase HDL cholesterol, and the three objectives can sometimes be achieved simultaneously. The Heart Protection Study 2-Treatment of HDL to Reduce the Incidence of Vascular Events (HPS2-THRIVE) study27 and the Atherothrombosis Intervention in Metabolic Syndrome with Low HDL/ High Triglycerides: Impact on Global Health Outcomes (AIM-HIGH)28 trial failed to demonstrate that an increase in HDL-C with niacin in statin-treated patients resulted in a reduced CAD risk. Fibrates and CETP inhibitors (dalcetrapib) have failed to demonstrate cardiovascular outcome benefits, in spite of increasing HDL-C levels.14,29
Recombinant HDL (Apo protein A-1 Milano) is a possible future treatment option for atherosclerosis.
A patient with high or low HDL and a family history of cardiovascular disorders makes a case for genetic testing. A family history of longevity is reassuring in a patient with extremes of HDL levels with no other risk factors.
Disclosure statement: Dr. Ramachandra Pai has no disclosures to report.
References are listed on page 36 of the PDF.
|
|||||
1850
|
dbpedia
|
3
| 64 |
https://www.rupahealth.com/biomarkers/hdl
|
en
|
High-Density Lipoprotein Cholesterol
|
[
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/63fe3da1b25f2fa5b77ddda0_hamb.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/63d896b4741f1b0a2e5d632a_Rupa%20Logo%20half.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/65dbc7ccd813bc701c8d5fb9_Rupa%20Logo%20SVG.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/620b21fa19a3bb99b34b940e_%F4%80%8F%A4.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/620b18a8f2c76178566b39b5_%F4%80%8D%B0.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/620b0b2e5e71149fad4a953d_%F4%80%89%9F.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/620b0b2df41e1f266289c81c_%F4%80%8F%A4.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/620b0b2e6b6e24f896fd82dd_%F4%80%AC%93.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/620b0b2df41e1f6bb789c81d_%F4%80%8F%BC.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/620b0b2d26aa0f6946e48f99_%F4%80%BE%AD-1.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/620b0b2cc292cf7d539cf871_%F4%80%98%B2.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/620b10aa7371a86a1f850eed_%F4%80%91%8A.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/5f63cdce157f951cc5032898_arrow%20right%20text.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/5f63cdce157f951cc5032898_arrow%20right%20text.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/5f63cdce157f951cc5032898_arrow%20right%20text.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/620b15767371a83cc3852ad2_%F4%80%9F%B1.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/620b157672a99164ff0545e1_%F4%80%95%BB.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/620b1576b7ce37530715ab74_%F4%80%8D%96.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/620b1576862a2b7637fd8a82_%F4%80%89%9F.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/65cc09a4875a0a131e32abea_%F4%80%89%9B.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/620b17d3370a5076f49a8cf4_%F4%80%BE%AD.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/6222ae90c1b8af6d9137fd74_%F4%80%AB%94.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/65cc09a44d188206f2a01051_%F4%81%92%84.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/65cc09a4cbf1b55505f7276f_%F4%80%B7%BE.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/65cc09a4ebe8a1edf7e28d66_%F4%80%93%A6.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/6222ae90c020d9301173b172_%F4%81%82%BF.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/65cc0a6351b74018f4966ab6_%F4%80%B7%89.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/62d46c52af5e2e6729b70abb_rrguide-books.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/620b21fa19a3bb99b34b940e_%F4%80%8F%A4.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/620b18a8f2c76178566b39b5_%F4%80%8D%B0.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/620b0b2e5e71149fad4a953d_%F4%80%89%9F.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/620b0b2df41e1f266289c81c_%F4%80%8F%A4.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/620b0b2e6b6e24f896fd82dd_%F4%80%AC%93.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/620b0b2df41e1f6bb789c81d_%F4%80%8F%BC.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/620b0b2d26aa0f6946e48f99_%F4%80%BE%AD-1.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/620b0b2cc292cf7d539cf871_%F4%80%98%B2.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/620b10aa7371a86a1f850eed_%F4%80%91%8A.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/5f63cdce157f951cc5032898_arrow%20right%20text.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/5f63cdce157f951cc5032898_arrow%20right%20text.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/5f63cdce157f951cc5032898_arrow%20right%20text.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/620b15767371a83cc3852ad2_%F4%80%9F%B1.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/620b157672a99164ff0545e1_%F4%80%95%BB.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/620b1576b7ce37530715ab74_%F4%80%8D%96.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/620b1576862a2b7637fd8a82_%F4%80%89%9F.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/65cc09a4875a0a131e32abea_%F4%80%89%9B.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/620b17d3370a5076f49a8cf4_%F4%80%BE%AD.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/6222ae90c1b8af6d9137fd74_%F4%80%AB%94.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/65cc09a44d188206f2a01051_%F4%81%92%84.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/65cc09a4cbf1b55505f7276f_%F4%80%B7%BE.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/65cc09a4ebe8a1edf7e28d66_%F4%80%93%A6.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/6222ae90c020d9301173b172_%F4%81%82%BF.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/65cc0a6351b74018f4966ab6_%F4%80%B7%89.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/62d46c52af5e2e6729b70abb_rrguide-books.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/63fe3c6bd6a1d2b6ac0e75ca_sidebarr.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/63d896b4741f1b0a2e5d632a_Rupa%20Logo%20half.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/63fd2321ff64eea166d83516_dashboard.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/657a64d5f01b25ae03a0c1bc_catalog-light-blue.c7be399e%201.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/63fd5a8c039baa4e3b929fc5_rupa%20u.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/657aa1cc853502406cf39b21_search.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/63fe6d8b31ade6da4e1a6001_white%20chev.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/63fe6d8b31ade6da4e1a6001_white%20chev.svg",
"https://cdn.prod.website-files.com/5e066fbd0d37a10ebf1f4139/62ce007681d79fd965fa173d_hormones.svg",
"https://cdn.prod.website-files.com/5e066fbd0d37a10ebf1f4139/62ce00891f00453080f1aa96_trees.svg",
"https://cdn.prod.website-files.com/5e066fbd0d37a10ebf1f4139/62ce009ab745d00efba830b4_diet.svg",
"https://cdn.prod.website-files.com/5e066fbd0d37a10ebf1f4139/62ce00d69a7a21b45b27067f_autoimmune-disease.svg",
"https://cdn.prod.website-files.com/5e066fbd0d37a10ebf1f4139/62ce00e788e7e1939c23164a_red-blood-cells.svg",
"https://cdn.prod.website-files.com/5e066fbd0d37a10ebf1f4139/62ce00fcf9a0536e582660e7_virus.svg",
"https://cdn.prod.website-files.com/5e066fbd0d37a10ebf1f4139/62ce010d07de4edfeadf2f4a_heart-2.svg",
"https://cdn.prod.website-files.com/5e066fbd0d37a10ebf1f4139/62ce01ed3f0aa108595eb07a_toxic.svg",
"https://cdn.prod.website-files.com/5e066fbd0d37a10ebf1f4139/62ce012feb73d184eab75220_female.svg",
"https://cdn.prod.website-files.com/5e066fbd0d37a10ebf1f4139/62ce015c71d2536eee7b30a7_bowels.svg",
"https://cdn.prod.website-files.com/5e066fbd0d37a10ebf1f4139/62ce016e56b85d08972c002b_dna-2.svg",
"https://cdn.prod.website-files.com/5e066fbd0d37a10ebf1f4139/62ce017cac923d05ba44661e_liver.svg",
"https://cdn.prod.website-files.com/5e066fbd0d37a10ebf1f4139/62ce018aa6b4320e660deb7d_bacteria.svg",
"https://cdn.prod.website-files.com/5e066fbd0d37a10ebf1f4139/62ce0198cf93ed4fac2a4f5d_virus-2.svg",
"https://cdn.prod.website-files.com/5e066fbd0d37a10ebf1f4139/62ce01a56e3bd9cf3005d100_lyme-disease.svg",
"https://cdn.prod.website-files.com/5e066fbd0d37a10ebf1f4139/62ce01ba71d25340887b32c6_male.svg",
"https://cdn.prod.website-files.com/5e066fbd0d37a10ebf1f4139/62ce01c83f0aa1dac95eaec1_pills.svg",
"https://cdn.prod.website-files.com/5e066fbd0d37a10ebf1f4139/62ce01d6f9a0538da326692c_metabolism.svg",
"https://cdn.prod.website-files.com/5e066fbd0d37a10ebf1f4139/64765264bdb520e88f1f6e85_metal.svg",
"https://cdn.prod.website-files.com/5e066fbd0d37a10ebf1f4139/6671dfc8ffdc7f4a6c9edfbb_Mould%20(1).svg",
"https://cdn.prod.website-files.com/5e066fbd0d37a10ebf1f4139/62ce4a406da82db2ef1859ba_brain.svg",
"https://cdn.prod.website-files.com/5e066fbd0d37a10ebf1f4139/62ce4a51ced2c32b468b58c6_healthy-food.svg",
"https://cdn.prod.website-files.com/5e066fbd0d37a10ebf1f4139/62ce4a663ae3bc4f183fb184_o2.svg",
"https://cdn.prod.website-files.com/5e066fbd0d37a10ebf1f4139/62ce4a752ab9f2e394399395_pancreas.svg",
"https://cdn.prod.website-files.com/5e066fbd0d37a10ebf1f4139/62ce4a827ec6b0d26adf7164_woman.svg",
"https://cdn.prod.website-files.com/5e066fbd0d37a10ebf1f4139/62ce4aa8b0d1e354507b249e_kidney.svg",
"https://cdn.prod.website-files.com/5e066fbd0d37a10ebf1f4139/62ce4a992ab9f28ed3399695_sleeping.svg",
"https://cdn.prod.website-files.com/5e066fbd0d37a10ebf1f4139/62ce4a0d7ec6b0666ddf6f04_thyroid-gland.svg",
"https://cdn.prod.website-files.com/5e066fbd0d37a10ebf1f4139/62ce4abcced2c34cb88b5f2b_cancer.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/62dae6345e312c329564270a_Group%202141.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/62d45f4ecc6dd87465bd4af4_rrguide.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/62d1cf3f663cd183ee459102_Rupa%20Logo%20white.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/65d690a6d8d9b7bc8254966f_up.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/65d6903fdc5a52be356f1aee_%F4%80%BC%90.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/65d6903fa03b69ab2d7cd28f_%E2%96%BC.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/65d6903fdc5a52be356f1aee_%F4%80%BC%90.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/60303b525ee8ea64ec1683cc_plus.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/60c26bdf30b1ec02c254b03d_arrow%20right.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/60c26bdf30b1ec02c254b03d_arrow%20right.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/60c26bdf30b1ec02c254b03d_arrow%20right.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/60c26bdf30b1ec02c254b03d_arrow%20right.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/60c26bdf30b1ec02c254b03d_arrow%20right.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/5dd334b91282e145493639ed_chev.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/62d1d2013d6b10f13a244d3e_Frame%202336.png",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/664d8a7cb85948d2835a9aed_icons8-instagram.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/664d8a7c3ab0f39f1e1b735e_icons8-facebook-circled.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/664d8a7c6f5b89909a89ed56_icons8-youtube.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/664d8a7cd5b1657237f5e5a0_icons8-linkedin.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/664d8a7c6966c946e75eb039_icons8-twitterx.svg",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/667eee6369ab6734fcd0ebb9_%F0%9F%8D%AA.png",
"https://cdn.prod.website-files.com/5dd07f6bc5a7ed039456e602/62dae6345e312c329564270a_Group%202141.svg"
] |
[] |
[] |
[
""
] | null |
[] | null |
High-Density Lipoprotein Cholesterol (HDL) is the "good" cholesterol that collects excess cholesterol from your blood and delivers it to your liver for removal, helping keep arteries clean.
|
Rupa Health
| null |
High-density lipoprotein (HDL) is often hailed as the "good" cholesterol, playing a crucial role in maintaining heart health and reducing the risk of cardiovascular diseases.Â
HDL, or high-density lipoprotein, is a type of cholesterol-containing lipoprotein particle that helps remove cholesterol from your bloodstream.
HDL is known for its protective role in the cardiovascular system, as it transports cholesterol from the arteries to the liver for excretion, thereby reducing the risk of plaque buildup and heart disease.
This article delves into the definition and function of HDL. It also provides guidance on preparing for and interpreting HDL lab tests, understanding related biomarkers, and exploring natural ways to optimize HDL levels through diet, lifestyle, and supplementation.
Definition and Function of High Density Lipoprotein
Definition: What is High Density Lipoprotein, HDL?
HDL is a type of lipoprotein particle, which is responsible for shuttling cholesterol through the body. Â
A lipoprotein particle is a biochemical assembly that contains both proteins and lipids, which are bound to the proteins. These particles are responsible for transporting lipids, such as cholesterol and triglycerides, throughout the bloodstream.Â
The protein component, known as apolipoproteins, helps to stabilize the lipid molecules and also serves as a recognition signal for cellular receptors, facilitating the uptake and metabolism of the lipids carried by the lipoprotein particles.Â
The different types of lipoprotein particles, such as high-density lipoprotein (HDL), low-density lipoprotein (LDL), and very-low-density lipoprotein (VLDL), have distinct roles and compositions, contributing to their specific functions in lipid transport and metabolism.
To understand the significance of HDL in health and disease, it is important to understand the different fractions of cholesterol present in the bloodstream. Â
Overview of Cholesterol Lipoprotein Particle Types in the Bloodstream
Cholesterol is shuttled through the body in lipoprotein particles, and some types confer a higher risk of cardiovascular disease than others. Â
There are five main types of lipoprotein particles: their individual cardiac risk, or atherogenicity, depends on their size, the direction in which theyâre traveling (to or away from the liver), and the lipoproteins attached to them. [11.]
Chylomicrons: chylomicrons contain lipids absorbed from the digestive system and are too large to have a direct effect on cardiovascular health
High-density lipoprotein (HDL): HDL particles contain the ApoA1 lipoprotein, among others, and tends to carry cholesterol back to the liver; therefore, HDL is considered âgoodâ cholesterol. [19.]
Non-HDL particles: these include very low-density lipoproteins [VLDL], intermediate-density lipoprotein [IDL], low-density lipoprotein [LDL], and lipoprotein(a), or Lp(a). These particles all contain Apo-B lipoproteins, are traveling from the liver to peripheral tissues, and are small enough to cause atherosclerosis; for all of these reasons, they are considered to increase cardiovascular risk. [3.]
In the basic lipid panel, the Total Cholesterol biomarker is used to describe the sum of HDL + Non-HDL particles. Often, this is similar to HDL + LDL particles (the markers typically present on a standard lipid panel), but not always. [11.]
Overview of HDL Structure, Production and Apolipoproteins [2.]
High-density lipoprotein (HDL) particles are complex structures primarily involved in reverse cholesterol transport. They are composed of a core of cholesterol esters and triglycerides surrounded by a surface monolayer of phospholipids, free cholesterol, and various apolipoproteins.Â
The main apolipoproteins present in HDL are:Â [2.]
Apo-AI: the primary structural protein of HDL, activates LecithinâCholesterol AcylTransferase (LCAT).
Apo-AII: a structural protein in HDL, acts as an activator of hepatic lipase.
Apo-AIV: its function is not fully understood.
Apo-AV: activates lipoprotein lipase (LPL), responsible for triglyceride lipolysis.
Apo-CI: activates LCAT.
Apo-CII: activates LPL.
Apo-CIII: inhibits LPL.
Apo-E: serves as a ligand for the LDL receptor.
HDL particles are synthesized in the liver and intestines, starting with the production of Apo-AI.Â
As HDL circulates, it acquires free cholesterol and phospholipids from peripheral tissues, chylomicrons, and very-low-density lipoprotein (VLDL). LCAT, activated by Apo-AI, converts free cholesterol on HDL's surface to cholesterol esters, which are then incorporated into HDL's core.Â
HDL facilitates the return of cholesterol to the liver via several pathways, including direct uptake through receptors like SR-B1 and indirect transfer to other lipoproteins via the cholesterol ester transfer protein (CETP) pathway.
Function of HDL: What Does HDL Do in the Body? [2., 4., 18.]
The primary function of high-density lipoprotein (HDL) is to transport cholesterol from peripheral tissues to the liver, a process known as reverse cholesterol transport (RCT). This role is crucial in maintaining lipid homeostasis and preventing the accumulation of cholesterol in blood vessels, which can lead to atherosclerosis.Â
HDL particles are composed of various apolipoproteins, including Apo-AI, Apo-AII, Apo-AIV, Apo-AV, Apo-CI, Apo-CII, Apo-CIII, and Apo-E, each playing a distinct role in HDL function and metabolism.
Apo-AI, the main structural protein of HDL, is synthesized in the liver and intestines and is critical for the formation of nascent HDL particles. It activates the enzyme LecithinâCholesterol AcylTransferase (LCAT), which converts free cholesterol on the surface of HDL to cholesterol esters, allowing for its incorporation into the core of the HDL particle.Â
Apo-AII acts as a structural component and activator of hepatic lipase, while Apo-AV stimulates lipoprotein lipase, crucial for triglyceride metabolism.Â
Apo-CI, Apo-CII, and Apo-CIII are involved in the regulation of lipid metabolism, with Apo-CII activating lipoprotein lipase and Apo-CIII inhibiting it.Â
Apo-E serves as a ligand for the LDL receptor, facilitating the uptake of HDL cholesterol by the liver.
In the liver, HDL cholesterol can be taken up via several pathways, including the scavenger receptor class B type 1 (SR-B1) pathway, which allows for the selective uptake of cholesterol without internalizing the entire HDL particle.Â
The cholesterol ester transfer protein (CETP) pathway involves the exchange of cholesterol esters from HDL to apolipoprotein B-containing particles, such as very-low-density lipoprotein (VLDL) and low-density lipoprotein (LDL), in exchange for triglycerides.Â
This process enriches HDL in triglycerides and depletes its cholesterol ester core, leading to the formation of smaller HDL particles that can be metabolized by hepatic lipases or taken up by the liver through LDL receptors.
Overall, HDL plays a crucial role in lipid metabolism and cardiovascular health by facilitating the removal of excess cholesterol from peripheral tissues and its transport to the liver for excretion. Its anti-atherogenic and anti-inflammatory properties are attributed to its ability to reduce the size of atherosclerotic plaques and decrease inflammation associated with lipid accumulation.
Lab Testing for HDL Cholesterol Levels
General Testing Information and Sample Type
Typically, cholesterol assessment starts with a lipid panel, which includes the following biomarkers: total cholesterol, LDL and HDL cholesterols, and triglycerides, as well as the TC/HDL ratio.
People are increasingly aware of the benefits of advanced testing for cholesterol levels in order to support wellness, reduce their risk of cardiovascular disease, and inform personalized medical decisions. To address the desire for more information about cholesterol health, lab companies are increasingly offering more comprehensive assessments. Â
A few examples include:
The Cardiometabolic Profile by Doctorâs Data
The CadioPro Advanced Profile by Access Medical Labs
The Cardiometabolic Comprehensive Profile by BostonHeart Diagnostics
The LPP Plus by Spectracell Laboratories
These tests, including the standard lipid profile, are all blood tests that require a venipuncture. Fasting is typically recommended for these tests. In some cases, a mobile phlebotomist can come to you to have the blood draw performed from the home or office, and the sample can then be taken to the lab by the phlebotomist.Â
Interpreting Test Results
Reference Range for HDL Cholesterol
Reference ranges may vary among labs, so it is important to interpret test results according to the individual lab company used.
Generally, the reference ranges for HDL-C are as follows:Â [26.]Â
Male: >45 mg/dL or >0.75 mmol/L (SI units)
Female: >55 mg/dL or >0.91 mmol/L (SI units)
Clinical Significance of High Levels of HDL Cholesterol [6.]Â
Elevated HDL cholesterol levels are considered > 80 mg/dL (>2.1 mmol/L).
High levels of high-density lipoprotein (HDL) cholesterol are generally considered beneficial for cardiovascular health due to HDL's role in reverse cholesterol transport and its anti-inflammatory and anti-oxidative properties.Â
However, recent studies suggest that extremely high HDL cholesterol levels may not always be protective and could, in some cases, increase the risk of cardiovascular disease (CVD). [6., 23., 33.]Â
This has led to a shift in focus from merely the quantity of HDL to the quality and functionality of HDL particles. [1.]
The size and composition of HDL particles, including the presence of specific proteins and lipids, are now recognized as crucial factors influencing their protective effects. Smaller, denser HDL particles, for example, are believed to be more effective in cholesterol efflux and exhibit greater anti-inflammatory capacity than larger, less dense particles.
While elevated HDL cholesterol levels typically indicate a reduced risk of CVD, certain genetic disorders associated with high HDL cholesterol may not offer the same protective benefits due to accompanying lipid and metabolic abnormalities. [34.]
Primary causes of elevated HDL cholesterol include genetic mutations that lead to overproduction or decreased clearance of HDL cholesterol. Secondary causes can include conditions such as alcohol use disorder without cirrhosis, hyperthyroidism, primary biliary cirrhosis, and the use of certain medications like corticosteroids, insulin, phenytoin, and estrogen.
Cholesteryl ester transfer protein (CETP) deficiency, a rare autosomal recessive disorder caused by mutations in the CETP gene, is characterized by extremely high HDL cholesterol levels (> 150 mg/dL or > 3.9 mmol/L) but without proven protection from cardiovascular disorders.Â
Familial hyperalphalipoproteinemia, an autosomal dominant condition resulting from various genetic mutations, is usually diagnosed incidentally with plasma HDL cholesterol levels exceeding 80 mg/dL (> 2.1 mmol/L). Patients with these conditions typically do not exhibit symptoms or signs related to their elevated HDL cholesterol levels, and no specific treatment is necessary.
Possible causes of elevated HDL cholesterol levels include:Â
Genetic Factors: as noted above, certain genetic mutations can lead to elevated HDL levels.
Physical Activity: regular exercise, especially aerobic activities, can increase HDL cholesterol. [13.]
Diet: a diet rich in healthy fats, such as those found in olive oil, nuts, and fatty fish, can raise HDL levels. [7.]Â
âAlcohol Consumption: moderate alcohol intake, particularly red wine, is associated with higher HDL levels. [5.]
âMedications: some medications including certain fibrates and niacin, can increase HDL cholesterol. [20.]Â
Weight Loss: losing excess weight, particularly in individuals with obesity, can lead to an increase in HDL levels. [28.]
Hormonal Factors: changes in hormone levels, such as during menopause or with hormone replacement therapy, can affect HDL cholesterol. [9., 21.]
Smoking Cessation: quitting smoking can result in an increase in HDL cholesterol levels. [14.]
Liver Disease: certain liver conditions, such as primary biliary cirrhosis, can lead to elevated HDL levels. [32.]
Clinical Significance of Low Levels of HDL CholesterolÂ
A low HDL cholesterol level is typically considered to be below 40 mg/dL. [22.]
Traditionally, low levels of high-density lipoprotein (HDL) cholesterol are associated with an increased risk of cardiovascular disease (CVD). While new research uncovers the nuances of the relationship between optimal levels of HDL cholesterol and cardiovascular health, it is still accepted that low levels of HDL cholesterol may confer increased risk of cardiovascular disease. [15.]
Low HDL cholesterol levels can lead to the accumulation of cholesterol in the arteries, forming plaques that narrow and harden the arteries, a condition known as atherosclerosis. This can increase the risk of heart attacks, strokes, and peripheral artery disease.
Several factors can contribute to low HDL cholesterol levels. Genetic factors play a significant role, with some individuals inheriting conditions that result in low HDL cholesterol. Lifestyle factors are also crucial, with poor diet, physical inactivity, obesity, and smoking being major contributors to low HDL levels. A diet high in saturated and trans fats can lower HDL cholesterol, while regular physical activity and maintaining a healthy weight can help increase HDL levels.
Medical conditions and certain medications can also lead to low HDL cholesterol levels. For example, type 2 diabetes, metabolic syndrome, chronic kidney disease, and inflammatory conditions such as rheumatoid arthritis and lupus can all result in lower HDL cholesterol. Additionally, medications such as beta-blockers, anabolic steroids, and progestins can also decrease HDL cholesterol levels.
What is an Optimal HDL Cholesterol Level?
Research continues to shed light on optimal levels of cholesterol markers and overall human health. A range of HDL cholesterol between 40-60 mg/dL is given as an optimal level. [22.]Â
Research increasingly shows increased risk of cardiovascular disease and events with HDL levels above 80 mg/dL, indicating that this may be the upper threshold of optimal HDL levels. [6., 23., 33.]Â
Related Biomarkers: What Should Be Tested Besides Total Cholesterol?
The standard lipid panel is a good place to begin to evaluate an individualâs risk of developing heart disease. There are a variety of other biomarkers available that can provide increased information above and beyond a standard lipid panel. Some of these include:Â
VLDL Particles: very-low-density lipoprotein (VLDL) particles are a precursor to LDL particles and play a crucial role in lipid metabolism. Elevated VLDL levels are associated with increased risk of atherosclerosis and cardiovascular disease. [8.]
Total LDL Particles (LDL-P): measuring the number of LDL particles gives different information than LDL-C, which is the amount of cholesterol thatâs carried by LDL particles. Â
Knowing the number of LDL particles present in the bloodstream provides a more comprehensive assessment of cardiovascular risk than LDL-C alone because the size of LDL particles also confers cardiovascular risk, with smaller LDL particles being more atherogenic. Â
Therefore, in two people with the same LDL-C number, the person with a higher LDL-P (and therefore more small LDL particles present in his or her bloodstream) has a higher risk for a cardiovascular event than the person with the lower LDL-P. [24.]
Remnant Lipoprotein: remnant lipoproteins, remnants of VLDL and chylomicrons after triglyceride hydrolysis, are atherogenic particles associated with increased risk of cardiovascular events, even in individuals with normal LDL cholesterol levels. [25., 35.]
Dense LDL III and Dense LDL IV: small dense LDL (sdLDL) subfractions, particularly LDL III and LDL IV, are more atherogenic than larger, buoyant LDL particles. Measuring these subfractions provides additional information for assessing cardiovascular risk beyond traditional lipid panels. [27.]
Buoyant HDL 2b: buoyant HDL 2b particles are considered particularly cardioprotective due to their role in reverse cholesterol transport. Higher levels of buoyant HDL 2b are associated with reduced risk of cardiovascular events. [17.]
Lipoprotein(a): Elevated lipoprotein(a) levels are an independent risk factor for cardiovascular disease, particularly in individuals with a family history of premature heart disease. It is important to note that Lp(a) levels are genetically determined and change little, if at all, in response to diet and lifestyle. [30.]
Apolipoprotein B (ApoB): Apolipoprotein B is a structural component of atherogenic cholesterol particles including VLDL, IDL, LDL and Lp(a) particles and is considered a more accurate predictor of cardiovascular risk compared to LDL cholesterol levels alone, particularly in the setting of insulin resistance and diabetes. [3.]
âApolipoprotein A1 (apoA1): apoA1 is attached to the surface of HDL particles, and is associated with a cardioprotective effect. Elevated apoA1 levels are associated with improved HDL functionality and reduced cardiovascular risk, while low levels are independently linked to increased risk of cardiovascular events.Â
Monitoring apoA1 levels allows for better risk prediction and assessment of therapeutic efficacy in managing cardiovascular disease risk. [19.]
hs-CRP (High-Sensitivity C-Reactive Protein): elevated hs-CRP levels are indicative of systemic inflammation and are associated with increased risk of cardiovascular events, including myocardial infarction and stroke. [12.]
Homocysteine: elevated homocysteine levels are associated with increased risk of cardiovascular disease, including atherosclerosis, stroke, and venous thromboembolism. [29.]
How to Support Healthy Cholesterol Levels
Lifestyle Modifications
Maintain a healthy weight through regular physical activity and a balanced diet. [28.]
Reduce sedentary behavior and incorporate more movement throughout the day to support a healthy metabolism.
Manage stress levels through relaxation techniques such as meditation or yoga. High stress has been correlated with metabolic dysfunction. [36.]
Ensure adequate sleep duration and quality to support metabolic health. [31.]
Dietary Changes [7.]
Consume a diet rich in whole foods, including fruits, vegetables, whole grains, lean proteins, and healthy fats. Â
Limit intake of highly processed foods, sugary beverages, and foods high in saturated and trans fats.
Increase fiber intake from sources like legumes, nuts, seeds, and whole grains to promote satiety and regulate blood sugar levels.
Monitor portion sizes and practice mindful eating to prevent overeating and promote weight management.
Follow a plant-based diet, and reduce intake of high-fat animal products.Â
Exercise Recommendations [13.]
Engage in a combination of aerobic exercise, strength training, and flexibility exercises to improve metabolic function.
Aim for regular physical activity throughout the week, incorporating both cardiovascular exercise and resistance training sessions.
Gradually increase exercise intensity and duration over time to challenge the body and promote fitness gains.
Incorporate activities you enjoy to increase adherence to exercise routines and maintain long-term consistency.
Consult with a healthcare provider or fitness professional to develop a personalized exercise plan based on individual fitness levels and health goals.
Order HDL Cholesterol Testing
|
||||||
1850
|
dbpedia
|
1
| 92 |
https://memory.ucsf.edu/publications/parkinsonian-features-hereditary-diffuse-leukoencephalopathy-spheroids-hdls-and-csf1r
|
en
|
Parkinsonian features in hereditary diffuse leukoencephalopathy with spheroids (HDLS) and CSF1R mutations.
|
[
"https://memory.ucsf.edu/sites/memory.ucsf.edu/files/Weill_WebLogo_Lockup_MemoryandAgingCenter_Web_0.png"
] |
[] |
[] |
[
""
] | null |
[] | null |
en
|
https://memory.ucsf.edu/profiles/ucsf_b1gfoot/themes/ucsf_b1gfoot_theme/favicon.ico
|
Memory and Aging Center
|
https://memory.ucsf.edu/publications/parkinsonian-features-hereditary-diffuse-leukoencephalopathy-spheroids-hdls-and-csf1r
|
UCSF’s innovative, collaborative approach to patient care, research and education spans disciplines across the life sciences, making it a world leader in scientific discovery and its translation to improving health.
|
|||||
1850
|
dbpedia
|
2
| 90 |
https://air.unimi.it/handle/2434/1042099
|
en
|
Multicellular spheroids: a new model to screen novel drugs for incurable forms of thyroid cancer
|
[
"https://air.unimi.it/sr/logo_iris.png",
"https://air.unimi.it/sr/logo_customer.png",
"https://air.unimi.it/sr/cineca/images/flag/flag_it.png",
"https://air.unimi.it/sr/cineca/images/flag/flag_en.png",
"https://collezioni.unimi.it/sbafiles/resolver.gif",
"https://air.unimi.it/sr/cineca/images/thirdparty/pmc_small.png",
"https://air.unimi.it/sr/cineca/images/thirdparty/scopus_small.png",
"https://air.unimi.it/sr/cineca/images/thirdparty/isi_small.png",
"https://air.unimi.it/sr/cineca/images/interface/logo-cineca-small-white.png"
] |
[] |
[] |
[
""
] | null |
[
"E.S"
] | null |
it
|
/sr/favicon.ico
| null |
Thyroid cancer (TC) is the most common endocrine malignancy and its incidence is increasing worldwide even if the mortality rate remains low. There is accumulating evidence that solid tumors contain a distinct subpopulation of Cancer Stem-like Cells (CSCs), or tumor-initiating cells (TICs), that play important roles in cancer initiation, progression, recurrence and metastasis. Whether thyroid cancer cells are derived from mutated adult stem cells or whether they display a newly acquired stem-like phenotype due to cancer mutations remains controversial, but they are believed to be one main actor in therapy resistance and disease progression. The aim of the project is to understand the biology of thyroid TICs, by in vitro characterization of thyrosphere-forming cells, and use this 3D model to investigate thyroid TICs sensibility to different anticancer treatments. To overcome the intrinsic limitations of primary cultures and fresh sample availability, we are currently developing a standardized thyrosphere model based on immortalized cell lines with different genetic background. Hanging drop cell cultures and coating with poly(2-hydroxyethyl methacrylate) non-adhesive substrate are the main methods to obtain thyrosphere-forming cells. In appropriate growth condition, all the cell lines tested are able to generate thyrospheres when seeded at clonal density, with an efficiency significantly higher that what has been previously reported. In particular, we’ve obtained a sphere-forming efficiency of 61.22% for B-CPAP, 52.22% for HTC/C3, 61.20% for SW579, 70.24% for FRO, 51.09% for SW1736 and 50.09% for HTH-74. Furthermore, we selected different anticancer drugs and analysed their effects on both 3D and 2D cultures. In this regard, we’ve tested two inhibitors so far: PLX-4720, a potent and selective inhibitor of ERK phosphorylation in BRAFV600E cells, and Cariporide, a selective inhibitor of NHE-1, a Na+/H+ exchanger. We evaluated the effects of these compounds by MTT colorimetric assay and observed that cell lines with different genetic background respond differently when seeded as adherent cells or as 3D thyrospheres. In conclusion, this 3D model can partially mimic the tumor complexity in vitro, and the most promising results shall be validated on patients-derived samples.
Multicellular spheroids: a new model to screen novel drugs for incurable forms of thyroid cancer / V. Ghiandai, E.S. Grassi, L. Persani, L. Fugazzola. ((Intervento presentato al 43. convegno Annual Meeting of the European Thyroid Association : 4-7 September tenutosi a (Online) nel 2021.
|
||||||
1850
|
dbpedia
|
2
| 74 |
https://hub.hku.hk/handle/10722/236242
|
en
|
free Prevascularized Microtissue Spheroids Containing Human Dental Pulp Cells and Endothelial Cells
|
[
"https://hub.hku.hk/image/hku-logo.jpg",
"https://hub.hku.hk/image/hku.jpg",
"https://hub.hku.hk/image/find_at_hkul.jpg"
] |
[] |
[] |
[
""
] | null |
[
"Kenneth M",
"Waruna Lakmal"
] | null |
/favicon.ico
| null |
Abstract© 2015 American Association of Endodontists.Introduction: Scaffolds often fail to mimic essential functions of the physiologic extracellular matrix (ECM) that regulates cell-cell communication in tissue microenvironments. The development of scaffold-free microtissues containing stem cell-derived ECM may serve as a successful alternative to the use of artificial scaffolds. The current study aimed to fabricate 3-dimensional microtissue spheroids of dental pulp cells (DPCs) prevascularized by human umbilical vein endothelial cells (HUVECs) and to characterize these scaffold-free spheroids for the in vitro formation of pulplike tissue constructs. Methods: Three-dimensional microtissue spheroids of DPC alone and DPC-HUVEC co-cultures were fabricated using agarose micro-molds. Cellular organization within the spheroids and cell viability (live/dead assay) were assessed at days 1, 7, and 14. Microtissue spheroids were allowed to self-assemble into macrotissues, induced for odontogenic differentiation (21 days), and examined for expression levels of osteo/odontogenic markers: alkaline phosphatase, bone sialoprotein and RUNX2 (Real-time PCR), mineralization (von-Kossa), and prevascularisation (immunohistochemistry for CD31). Results: The DPC microtissue microenvironment supported HUVEC survival and capillary network formation in the absence of a scaffolding material and external angiogenic stimulation. Immunohistochemical staining for CD31 showed the capillary network formed by HUVECs did sustain - for a prolonged period - even after the microtissues transformed into a macrotissue. Induced, prevascularized macrotissues showed enhanced differentiation capacity compared with DPC alone macrotissues, as shown by higher osteo/odontogenic gene expression levels and mineralization. Conclusions: These findings provide insight into the complex intercellular cross talk occurring between DPCs and HUVECs in the context of angiogenesis and pulp regeneration and highlight the significance of developing a favorable 3-dimensional microenvironment that can, in turn, contribute toward successful pulp regeneration strategies.
dc.description.abstract© 2015 American Association of Endodontists.Introduction: Scaffolds often fail to mimic essential functions of the physiologic extracellular matrix (ECM) that regulates cell-cell communication in tissue microenvironments. The development of scaffold-free microtissues containing stem cell-derived ECM may serve as a successful alternative to the use of artificial scaffolds. The current study aimed to fabricate 3-dimensional microtissue spheroids of dental pulp cells (DPCs) prevascularized by human umbilical vein endothelial cells (HUVECs) and to characterize these scaffold-free spheroids for the in vitro formation of pulplike tissue constructs. Methods: Three-dimensional microtissue spheroids of DPC alone and DPC-HUVEC co-cultures were fabricated using agarose micro-molds. Cellular organization within the spheroids and cell viability (live/dead assay) were assessed at days 1, 7, and 14. Microtissue spheroids were allowed to self-assemble into macrotissues, induced for odontogenic differentiation (21 days), and examined for expression levels of osteo/odontogenic markers: alkaline phosphatase, bone sialoprotein and RUNX2 (Real-time PCR), mineralization (von-Kossa), and prevascularisation (immunohistochemistry for CD31). Results: The DPC microtissue microenvironment supported HUVEC survival and capillary network formation in the absence of a scaffolding material and external angiogenic stimulation. Immunohistochemical staining for CD31 showed the capillary network formed by HUVECs did sustain - for a prolonged period - even after the microtissues transformed into a macrotissue. Induced, prevascularized macrotissues showed enhanced differentiation capacity compared with DPC alone macrotissues, as shown by higher osteo/odontogenic gene expression levels and mineralization. Conclusions: These findings provide insight into the complex intercellular cross talk occurring between DPCs and HUVECs in the context of angiogenesis and pulp regeneration and highlight the significance of developing a favorable 3-dimensional microenvironment that can, in turn, contribute toward successful pulp regeneration strategies.-
|
|||||||
1850
|
dbpedia
|
1
| 76 |
https://www.yalemedicine.org/news/should-you-take-a-statin-for-high-cholesterol
|
en
|
Should You Take a Statin for Your High Cholesterol? > News > Yale Medicine
|
https://ysm-res.cloudinary.com/image/upload/c_limit,f_auto,h_810,q_auto,w_1440/v1/yms/prod/61a323e2-f642-4caf-9f13-ae5056a46dbc
|
https://ysm-res.cloudinary.com/image/upload/c_limit,f_auto,h_810,q_auto,w_1440/v1/yms/prod/61a323e2-f642-4caf-9f13-ae5056a46dbc
|
[
"https://ysm-res.cloudinary.com/image/upload/ar_16:9,c_fill,dpr_auto,f_auto,g_faces:auto,q_auto:eco,w_0.5/v1/yms/prod/61a323e2-f642-4caf-9f13-ae5056a46dbc",
"https://ysm-res.cloudinary.com/image/upload/ar_1:1,c_fill,dpr_auto,f_auto,g_faces:auto,q_auto:eco,w_0.5/v1/yms/prod/3ad26cd3-b018-40de-a4ad-a47ada54ec66",
"https://ysm-res.cloudinary.com/image/upload/ar_1:1,c_fill,dpr_auto,f_auto,g_faces:auto,q_auto:eco,w_0.5/v1/yms/prod/e49ead12-26b0-4ebd-a64f-f064c4465a47",
"https://ysm-res.cloudinary.com/image/upload/ar_1:1,c_fill,dpr_auto,f_auto,g_faces:auto,q_auto:eco,w_0.5/v1/yms/prod/00620f50-1208-4c23-8d72-01a5b7dc4b0d",
"https://ysm-res.cloudinary.com/image/upload/c_crop,x_0,y_152,w_3000,h_1688/ar_16:9,c_fill,dpr_auto,f_auto,g_faces:auto,q_auto:eco,w_0.5/v1/yms/prod/ff3aed88-d389-45e7-86f9-3a1c8c48aa8b",
"https://ysm-res.cloudinary.com/image/upload/c_crop,x_0,y_156,w_3000,h_1687/ar_16:9,c_fill,dpr_auto,f_auto,g_faces:auto,q_auto:eco,w_0.5/v1/yms/prod/b3930e01-9561-43a0-8ba1-ca98309d8a3e",
"https://ysm-res.cloudinary.com/image/upload/c_crop,x_0,y_156,w_3000,h_1687/ar_16:9,c_fill,dpr_auto,f_auto,g_faces:auto,q_auto:eco,w_0.5/v1/yms/prod/e31df19c-dc9e-4a3e-be2e-ce95351745ae"
] |
[] |
[] |
[
""
] | null |
[
"Kathy Katella"
] |
2024-01-22T00:00:00
|
A statin is a pill that can reduce cholesterol—and prevent and treat heart disease. But it’s important to talk to your doctor to make sure a statin is right for you.
|
en
|
Yale Medicine
|
https://www.yalemedicine.org/news/should-you-take-a-statin-for-high-cholesterol
|
Each day, 47 million Americans take cholesterol medication—and usually it’s a statin, a pill that has a powerful impact on keeping the heart healthy. When there is too much of a waxy substance (called cholesterol) in the blood, a statin can help to clear it away and reduce the amount the liver can make. This keeps the cholesterol from leaving fatty deposits (called plaque) in the arteries, greatly reducing the risk of heart attack or stroke.
However, taking a statin can be a complicated choice. Many people find the potential side effects concerning or think they’ll have to take the statin for the rest of their lives. Others prefer to try to fix the problem with diet and exercise.
“We know that if you have heart disease, specifically atherosclerosis, statins, if tolerated, are an absolute must,” says Brian Cambi, MD, a Yale Medicine cardiologist. “As far as who should take statins for prevention, that continues to get refined.” Many studies have shown statins are safe, effective, and beneficial for multiple segments of the population, he adds.
“If your doctor does recommend a statin, it’s important to understand why,” says Yale Medicine cardiologist Erica Spatz, MD, MHS. “We want to identify people who will benefit most from a statin and bring them into the decision-making process. Many people never fill the prescription or abandon the therapy because the doctor may not have had those discussions with them.”
Patients often don’t know why they are taking a statin and end up discontinuing what is supposed to be a lifelong therapy, she adds.
If you have high cholesterol, making an informed choice also may require assessments and medical tests beyond a lipid profile (or “lipid panel”)—the blood test that measures cholesterol levels—often, the first clue that your levels are on the rise.
Below, Drs. Cambi and Spatz answered common questions about statins.
Cholesterol is the offending agent in atherosclerosis, a condition that develops when cholesterol, fat, blood cells, and other substances in the blood create plaque in the arteries. The waxy, fat-like substance can accumulate in the middle layer of the vessel wall, inciting an inflammatory reaction. “Over time, inflammatory debris can grow and ultimately encroach on the part of the vessel where blood is flowing, obstructing that blood flow,” Dr. Cambi says. That can cause chest pain and lead to heart attacks and strokes.
There are two kinds of cholesterol: blood cholesterol, which is made by the liver and necessary for performing such tasks as digesting fatty foods and making hormones, and dietary cholesterol, which is found in animal foods, including dairy products, eggs, meat, poultry, and some types of seafood.
Reducing dietary cholesterol can sometimes bring it down to normal levels, but diet alone isn’t effective for everyone. “Genetically speaking, some of us make more cholesterol than others, and some of us have blood vessels that absorb more cholesterol than others,” Dr. Cambi says. So, it can be a surprise for some to learn that they have high cholesterol even though they exercise regularly and eat a healthy diet.
Statins (medically known as HMG CoA reductase inhibitors) work in the liver, inhibiting an enzyme (a substance that acts as a catalyst in organs) important in cholesterol synthesis. As a result, the liver makes less cholesterol and pulls in the cholesterol found in the bloodstream, Dr. Cambi explains.
Looking at it another way, “statins do three things,” Dr. Cambi says. “One, they lower the amount of bad cholesterol in the bloodstream that can be deposited in the arteries. Two, almost all of us have some amount of plaques, and statins stabilize the covering [what’s called the fibrous cap] over these plaques, rendering them less likely to rupture, thereby decreasing the chance of an unstable plaque or a heart attack. Three, statins put up theoretical ‘roadblocks’ in the vessel wall, helping to prevent cholesterol from being deposited in its lining.”
Statins also reduce heart attack and stroke through other non-cholesterol effects, Dr. Spatz says. “They have anti-inflammatory and antioxidant effects.”
Statins can lower cholesterol by as much as 30% to 50%, according to some sources. This is a better result than any other drug that has been used for reducing cholesterol. “Researchers worked for years to develop medicines to lower cholesterol in the body before the first statin was introduced in the 1980s,” Dr. Cambi says, adding that they were the first drugs to show an ability to reduce “a hard endpoint,” such as a reduction in death or heart attack or stroke.
Since then, an abundance of research has shown that statins are effective. In fact, “statins are among the most studied cardiovascular medications,” says Dr. Cambi. “There have been studies looking at people who just have high cholesterol, those with multiple risk factors for heart disease, and those who have already had a heart attack or stroke. All of this work has shown the benefits from statins to be durable and reproducible.”
One concern is statin side effects. Some people report muscle pain and weakness, which has been shown to affect about 10% to 15% of people who take statins. But Dr. Spatz believes the figure is closer to 5%, especially if you consider the “nocebo” effect—a negative reaction in a patient who had negative expectations for a treatment, she explains. “People hear reports about muscle aches and become hypervigilant about that kind of symptom,” she says.
Some research has shown that statins increase blood sugar. “Statins can increase blood sugar by a small amount,” says Dr. Spatz. “For some people who are just on the margin of being diagnosed with diabetes, that can make the difference. However, it’s also true that if they already had elevated blood sugars and are now classified as having diabetes, there's more benefit to be derived from the statin medicines because having diabetes puts them at higher risk for cardiovascular diseases.”
Yet another concern is that once you take a statin, you must remain on it, which Dr. Cambi says is not the case. “If you have heart disease, it would be my recommendation to be on a statin lifelong,” he says. “But it’s not dangerous to stop. There are medicines where you may have withdrawal or a rebound if you stop them suddenly. That's not the case with statins.” But if, say, a person’s high-fat diet contributed to high cholesterol, and they don’t change their diet, their levels are likely to go back up if they stop the statin, he adds.
Dr. Spatz says that women historically have been considered at low risk for heart disease and, as a result, are under-prescribed preventive medications. For that reason, it may be especially important for women to talk to their doctors about statins, especially if they have heart disease risk factors, she says. If they are of childbearing age, Dr. Spatz also recommends patients bring up any history of preeclampsia (a condition in pregnancy characterized by high blood pressure and other symptoms), early menopause, and any other heart disease risk factors that could change the value equation for taking a statin.
Women may find it’s more important to monitor their cholesterol levels during and after menopause, when the risk of plaque narrowing coronary arteries increases, Dr. Cambi adds. “Women's endogenous estrogen is often cardioprotective in their younger years,” he says. “But after menopause, a woman's risk for heart disease quickly escalates to that of a man of the same age.”
When a person’s cholesterol numbers are out of the recommended ranges, but their 10-year risk is moderate, a doctor may suggest making lifestyle changes and repeating the lipid profile in a few months to see if there is a change. A lifestyle overhaul should include switching to a heart-healthy diet focused on fruits, vegetables, whole grains, legumes, nuts, fish, and poultry. Many refer to this as a Mediterranean-style or (for vegetarians) a whole-food, plant-based diet.
Patients also can increase physical activity, eliminate tobacco, and limit alcohol, as well as manage their weight and conditions like diabetes. Such lifestyle changes are important even if you take a statin, Dr. Cambi says.
If these changes don’t eliminate the need for a statin, it may suggest the appropriateness of a lower dose. “Success may depend on the patient’s starting point,” Dr. Cambi says, explaining that those who make major life changes tend to have the most dramatic results.
“You should ask the doctor to help you understand the rationale behind putting you on the medicine,” Dr. Cambi says. “Medicine is becoming a more personalized service and that can help with statins. We have tools that allow us to learn about a patient’s unique characteristics to the point where we can tailor a medical regimen that's specific to them.”
Dr. Spatz says patients should talk to their doctor about anything on their mind regarding a statin. The more they understand about the medication and their own health, family history, and risks for heart disease, the more likely they will be to make the right choice—and the chances are better they will keep taking the medicine if that’s what they choose.
“A statin medication is always a shared decision, even in people who have established disease,” she says. “If people understand the evidence and some of the trade-offs, they can make their own decisions. Often, people choose well for themselves.”
|
|||
1850
|
dbpedia
|
2
| 62 |
https://karger.com/dem/article/32/2/150/99137/Adult-Onset-Leukoencephalopathy-with-Axonal
|
en
|
Adult-Onset Leukoencephalopathy with Axonal Spheroids and Pigmented Glia Can Present as Frontotemporal Dementia Syndrome
|
[
"https://karger.silverchair-cdn.com/data/SiteBuilderAssetsOriginals/Live/Images/umbrella/Karger_RGB_neg.svg",
"https://karger.silverchair-cdn.com/data/SiteBuilderAssetsOriginals/Live/Images/umbrella/Karger_RGB.svg",
"https://karger.silverchair-cdn.com/data/SiteBuilderAssets/Live/Images/dem/DEM_logo864402569.png",
"https://karger.silverchair-cdn.com/data/SiteBuilderAssets/Live/Images/umbrella/karger_default_cover387652959.png",
"https://karger.silverchair-cdn.com/karger/content_public/journal/dem/32/2/10.1159_000331422/2/m_000331422_f01.gif?Expires=1726994151&Signature=P4iiBRZ6QMos2SD4R6tJvqWc64zkp~7JW4bJsRRv33uX6zjNya1M8-~IMAMUFTk-4z0kfSxUOv1C4S0Wh5TI4B8IGkuRL5pYOeig4pfMGpiD9nKCPE7JlwWK96SMP9Bacq6eoqc83~3UpvVUPS7sg628pBowq1nJ0RXkXTa~t1PkHc1cppezmELffDRpPUJppoJFro5N0VihgC-MGcCSFABL7Cmr4nUcine5fP4~HAb7Gy8NQuTawCdvzDWAAl8ulBy1hsps1venQS980eODW9kaIg21cJkhTn5JNzo2IhvWgJSkHVPxhJ0Fsq-7GgPrQd~Ium72U31cxGu~QblSgQ__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA",
"https://karger.silverchair-cdn.com/karger/content_public/journal/dem/32/2/10.1159_000331422/2/m_000331422_f01.gif?Expires=1726994151&Signature=P4iiBRZ6QMos2SD4R6tJvqWc64zkp~7JW4bJsRRv33uX6zjNya1M8-~IMAMUFTk-4z0kfSxUOv1C4S0Wh5TI4B8IGkuRL5pYOeig4pfMGpiD9nKCPE7JlwWK96SMP9Bacq6eoqc83~3UpvVUPS7sg628pBowq1nJ0RXkXTa~t1PkHc1cppezmELffDRpPUJppoJFro5N0VihgC-MGcCSFABL7Cmr4nUcine5fP4~HAb7Gy8NQuTawCdvzDWAAl8ulBy1hsps1venQS980eODW9kaIg21cJkhTn5JNzo2IhvWgJSkHVPxhJ0Fsq-7GgPrQd~Ium72U31cxGu~QblSgQ__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA",
"https://karger.silverchair-cdn.com/karger/content_public/journal/dem/32/2/10.1159_000331422/2/m_000331422_t01.gif?Expires=1726994151&Signature=pfkf~dVTrXPOPjgKBjG68ozxDdAj6bNPibQCKVbdIZNGuXZ8TbGALWxQDs~AFnpytureVXyAyHHOAF9KSqjxj0nQLhzk2455UjgbIkMk4jrI5dlAWlfGuQESVh3WaKPsHdcu0AtVOh2F6C0nd6MnoFMSqOyzgXNKy~RZxOu-DdYLAdK9E71smNPa4YDs1Zzba66wsD9qXWJdy-bq7c9zdUs3YRwi8oj0HD2oB1Blmfnov-UV1PvG3t45sGZ5Ddd371hSJNcHmJ-gwf0Y9XXbHDFlNUQ-N5zdxOzHm6XPMOOmQKlIw9O7AijFKS8kcadlB7mTeJCI1z4yCGa8qIFY9A__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA",
"https://karger.silverchair-cdn.com/karger/content_public/journal/dem/32/2/10.1159_000331422/2/m_000331422_t01.gif?Expires=1726994151&Signature=pfkf~dVTrXPOPjgKBjG68ozxDdAj6bNPibQCKVbdIZNGuXZ8TbGALWxQDs~AFnpytureVXyAyHHOAF9KSqjxj0nQLhzk2455UjgbIkMk4jrI5dlAWlfGuQESVh3WaKPsHdcu0AtVOh2F6C0nd6MnoFMSqOyzgXNKy~RZxOu-DdYLAdK9E71smNPa4YDs1Zzba66wsD9qXWJdy-bq7c9zdUs3YRwi8oj0HD2oB1Blmfnov-UV1PvG3t45sGZ5Ddd371hSJNcHmJ-gwf0Y9XXbHDFlNUQ-N5zdxOzHm6XPMOOmQKlIw9O7AijFKS8kcadlB7mTeJCI1z4yCGa8qIFY9A__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA",
"https://karger.silverchair-cdn.com/karger/content_public/journal/dem/32/2/10.1159_000331422/2/m_000331422_t02.gif?Expires=1726994151&Signature=a75XlEk~qfsYRYvw08PMd68yddvNoTU~BiIJ1hJTU7~8tUNwmUiOoAN6GGk6pRYFyjA7DGsG~PtHQ8XnuukaT0HGKPhVnJ1b4ZudzfxyTWTpL7X1GQguIBkXq8lHSU9zPyaUbkVvMqoULJGDaLNzBbk-s7XJP8rN4XLkIJxfmlF7ory7XKI-wyiAEkjfHn5iw25ug~WBm9pbkiCPK8pXHLpOnClIEvqKBh2379I8rSCI2fARZWzEs4r5gXBpjVwHQXnwXfN7YYzoV5oAHcyp4OWVyiOHcKfcWXse8wYYaPkDBY6Ll6F4EmNZ0ZXOYYRyTNP8~7TBqWMJ0~LzOvrZAA__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA",
"https://karger.silverchair-cdn.com/karger/content_public/journal/dem/32/2/10.1159_000331422/2/m_000331422_t02.gif?Expires=1726994151&Signature=a75XlEk~qfsYRYvw08PMd68yddvNoTU~BiIJ1hJTU7~8tUNwmUiOoAN6GGk6pRYFyjA7DGsG~PtHQ8XnuukaT0HGKPhVnJ1b4ZudzfxyTWTpL7X1GQguIBkXq8lHSU9zPyaUbkVvMqoULJGDaLNzBbk-s7XJP8rN4XLkIJxfmlF7ory7XKI-wyiAEkjfHn5iw25ug~WBm9pbkiCPK8pXHLpOnClIEvqKBh2379I8rSCI2fARZWzEs4r5gXBpjVwHQXnwXfN7YYzoV5oAHcyp4OWVyiOHcKfcWXse8wYYaPkDBY6Ll6F4EmNZ0ZXOYYRyTNP8~7TBqWMJ0~LzOvrZAA__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA",
"https://karger.silverchair-cdn.com/karger/content_public/journal/dem/32/2/10.1159_000331422/2/m_000331422_t03.gif?Expires=1726994151&Signature=jmwbALbcvS4NrSrfSSbDer6k2wunTxEoUcwtt9auP4acsGmNqF0UPj8bNbuHehuXRh4wNHMSubyrPrfiqN9PMMOSP-N2xJ3Tamdbz3JVUAmFt~AycgJBz8K2UUFRWchaCZMQ44SzEW1de19UpK31rWg1uqQyoTn~JVRzOCacPrBaGOrt6rmkAvEKwWGZzLIUAGBXpyeUdD9ER5e5bfsXajGqoTWPE2BUERLy4c~ye3Mv5uA0x1dX-2zgJmQWENi2X274NI9MBDHZxu3~edcWujOLrXRl6Mu3LdCU2xWUQO5Ze-3~S-SuL27mDtjOW9iOnXXXeM~8IxKlZYZPRiumzg__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA",
"https://karger.silverchair-cdn.com/karger/content_public/journal/dem/32/2/10.1159_000331422/2/m_000331422_t03.gif?Expires=1726994151&Signature=jmwbALbcvS4NrSrfSSbDer6k2wunTxEoUcwtt9auP4acsGmNqF0UPj8bNbuHehuXRh4wNHMSubyrPrfiqN9PMMOSP-N2xJ3Tamdbz3JVUAmFt~AycgJBz8K2UUFRWchaCZMQ44SzEW1de19UpK31rWg1uqQyoTn~JVRzOCacPrBaGOrt6rmkAvEKwWGZzLIUAGBXpyeUdD9ER5e5bfsXajGqoTWPE2BUERLy4c~ye3Mv5uA0x1dX-2zgJmQWENi2X274NI9MBDHZxu3~edcWujOLrXRl6Mu3LdCU2xWUQO5Ze-3~S-SuL27mDtjOW9iOnXXXeM~8IxKlZYZPRiumzg__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA",
"https://karger.silverchair-cdn.com/karger/content_public/journal/dem/32/2/10.1159_000331422/2/m_000331422_t04.gif?Expires=1726994151&Signature=g~es9K96LsSYa5kWg7wmzT4JbtHsYatbgkIblC9Da1Q-4gdtCMfZyjSfyIp9~vLOqMWWigqWjT3MBJVAJJb6uZq99x2y8l0AmVWk8iF~LEvm0KLQ8iDzWgCx-xJCjBg0NYAD8udNWD4uKvLTrh6IOEGctJMn7F1M4lF0jmesYINcWC4CYZLGSJ7C2FKJZUyx-LT91h-WHuwZPApCreHF0tnwWJs676~x8vbsXo3vNtEhivXUi2xpxnYiu7ptmA7i-Yx4PXZ-MyQqDQ7XFqC7VdpQGJxivzSe5z6nNuD0~-xDuRI8NYTgkfu-4beuUuGsl-XwJxviBB1qmPizbHDpkg__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA",
"https://karger.silverchair-cdn.com/karger/content_public/journal/dem/32/2/10.1159_000331422/2/m_000331422_t04.gif?Expires=1726994151&Signature=g~es9K96LsSYa5kWg7wmzT4JbtHsYatbgkIblC9Da1Q-4gdtCMfZyjSfyIp9~vLOqMWWigqWjT3MBJVAJJb6uZq99x2y8l0AmVWk8iF~LEvm0KLQ8iDzWgCx-xJCjBg0NYAD8udNWD4uKvLTrh6IOEGctJMn7F1M4lF0jmesYINcWC4CYZLGSJ7C2FKJZUyx-LT91h-WHuwZPApCreHF0tnwWJs676~x8vbsXo3vNtEhivXUi2xpxnYiu7ptmA7i-Yx4PXZ-MyQqDQ7XFqC7VdpQGJxivzSe5z6nNuD0~-xDuRI8NYTgkfu-4beuUuGsl-XwJxviBB1qmPizbHDpkg__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA",
"https://karger.silverchair-cdn.com/karger/content_public/journal/dem/32/2/10.1159_000331422/2/m_000331422_f02.jpeg?Expires=1726994151&Signature=f~3MFmiCAJmze7f2N2V8zifWpuB5BAyUMztTgQYuF7aAr0flvUduVNY0itL8CHUr4qA~Ut5PRbg8O0LxNaz3sZcfBQdJ0G7WDF5JAkbKH2YxaUWlJVSFMiRTzXA85802lzEIB9Z2ILUIAqjz8fIUbf2TNSjSjH7alm5tj4fuii1ReyyIUsw~PCndIDV20tC6ikSsPN4ZX~mi-zepoQ3QIAQZA7Zv7OotKvHKfEP0g-8mysaxMxo4kT9hhC-FiUavMgT5m2ocIrkVkbUD0UwJEwAa2U4yfGGSIapVWVRjtubX5yvhsE-7EBFLb2IPKOjoRKIqBaxG6N4HcrfK24CcOg__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA",
"https://karger.silverchair-cdn.com/karger/content_public/journal/dem/32/2/10.1159_000331422/2/m_000331422_f02.jpeg?Expires=1726994151&Signature=f~3MFmiCAJmze7f2N2V8zifWpuB5BAyUMztTgQYuF7aAr0flvUduVNY0itL8CHUr4qA~Ut5PRbg8O0LxNaz3sZcfBQdJ0G7WDF5JAkbKH2YxaUWlJVSFMiRTzXA85802lzEIB9Z2ILUIAqjz8fIUbf2TNSjSjH7alm5tj4fuii1ReyyIUsw~PCndIDV20tC6ikSsPN4ZX~mi-zepoQ3QIAQZA7Zv7OotKvHKfEP0g-8mysaxMxo4kT9hhC-FiUavMgT5m2ocIrkVkbUD0UwJEwAa2U4yfGGSIapVWVRjtubX5yvhsE-7EBFLb2IPKOjoRKIqBaxG6N4HcrfK24CcOg__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA",
"https://karger.silverchair-cdn.com/ImageLibrary/umbrella/Karger_RGB_neg.svg?versionId=23030"
] |
[] |
[] |
[
""
] | null |
[
"Wong, Janice C",
"Chow, Tiffany W",
"Hazrati, Lili-Naz",
"Lili-Naz",
"Janice C",
"Tiffany W"
] |
2011-10-05T00:00:00
|
Abstract. Background/Aims: We review the characteristics of adult-onset leukoencephalopathy with axonal spheroids and pigmented glia(ALSP) and determine
|
en
|
//karger.silverchair-cdn.com/Themes/Client/app/img/favicons/v-638576255786243535/apple-touch-icon.png
|
Karger Publishers
|
https://karger.com/dem/article/32/2/150/99137/Adult-Onset-Leukoencephalopathy-with-Axonal
|
Adult-onset leukoencephalopathy with axonal spheroids and pigmented glia (ALSP) is a rare inherited or sporadic dementia affecting the white matter of the central nervous system, although it may be less rare than previously expected. ALSP is now thought to encompass previously distinct entities of hereditary diffuse leukoencephalopathy with axonal spheroids (HDLS) and familial pigmentary orthochromatic leukodystrophy (POLD) [1,2]. ‘Adult-onset leukoencephalopathy with neuroaxonal spheroids’ and minor variations of this name have also been used interchangeably with ALSP or HDLS. A diagnosis that requires histopathological confirmation, ALSP has distinctive pathological features of both HDLS and POLD [1]. Accordingly, we refer to ALSP as the disease entity encompassing HDLS, POLD and adult-onset leukoencephalopathy with neuroaxonal spheroids. ALSP can be distinguished from other adult-onset leukodystrophies and leukoencephalopathies, which have been discussed elsewhere [3,4].
An early case report of POLD was published in 1936 [5], and a HDLS familial kindred was described in 1984 [6]. Since then, several authors have qualitatively reviewed pathological and clinical characteristics of ALSP [1], HDLS [2] and POLD [7]. We encountered a case of rapidly progressive frontotemporal dementia (FTD) that had ALSP at autopsy, raising the question of how often the neuropsychiatric manifestation of ALSP meets criteria for behavioral variant of FTD (bvFTD). FTD is the third most common cause of cortical dementia after Alzheimer’s disease and dementia with Lewy bodies. FTD most commonly presents with progressive behavioral changes, which is known as bvFTD; the other variant presents with progressive language dysfunction with preservation of other cognitive domains [8]. Diagnosis of bvFTD has been based on the consensus report by Neary et al. [9] in 1998, but recently in 2011, newer bvFTD criteria were developed with improved diagnostic sensitivity [10]. We thus performed a systematic literature search for all histopathologically confirmed cases of ALSP from 1970 to 2011 to characterize clinical and pathological features of ALSP and determine the prevalence of bvFTD features in ALSP based on 1998 and 2011 criteria. We also describe our new illustrative case study of a patient with underlying ALSP which presented as bvFTD.
Results of the systematic literature search are summarized in figure 1. The literature search identified 51 individual cases that fulfilled the inclusion criteria, with absence of exclusion criteria, from 31 publications [2,3,4,6,7,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36]. Including the new case described in this study, a total of 52 individual ALSP cases were subsequently analyzed. Widening the range of keywords for the search made us aware that although ALSP is rare, there was a substantial number of ALSP cases already published.
Online supplementary Appendix A (see online at www.karger.com?doi=10.1159/000331422) lists specific information extracted from 31 publications and 1 case of ALSP. Overall, there were 30 women and 21 men (1 unrecorded). Pathological diagnoses were recorded as ALSP in 8 patients, HDLS in 12 patients, POLD in 17 patients, and adult-onset leukoencephalopathy with neuroaxonal spheroids in 15 patients. Eight diagnoses were confirmed by biopsy antemortem, while the rest were confirmed at autopsy. Mean age of onset was 42.2 ± 12.1 years, ranging from 15 to 78 years (n = 52). Initial symptoms of disease were highly varied and are listed in detail in online supplementary Appendix A. Patients could present with more than one initial symptom, which included personality or behavioral changes (n = 15), motor abnormalities (n = 15), depression or anxiety (n = 9), memory impairment (n = 9), speech abnormalities (n = 9) and seizure (n = 3).
Mean duration of progression was 6.2 ± 6.0 years, ranging from 2 months to 34 years (n = 45). Excluding the two extreme cases of 2 months and 34 years of progression, which were both reported by Axelsson et al. [6], mean duration was 5.7 ± 4.2 years (n = 43). Of the 45 patients who were followed until death, 24 had a disease duration of 4 years or less. Mean age of death was 48.6 ± 14.3 years, ranging from 17 to 89 years (n = 45). Of the 44 cases that did not have brain biopsies performed, 14 listed antemortem diagnoses, none of which accurately diagnosed ALSP: Pick’s disease, bvFTD or FTD (n = 4), Alzheimer’s disease (n = 2), corticobasal degeneration (n = 2), presenile dementia (n = 2), psychiatric disorder (n = 2), microvascular leukoencephalopathy (n = 1) and Binswanger leukoencephalopathy (n = 1).
Twenty-five patients had at least one family member with histopathologically confirmed ALSP, belonging to 10 unique kindreds; 24 had family histories of neurodegenerative diseases, which are listed in online supplementary Appendix A.
Table 1 shows the prevalence of bvFTD features in ALSP patients according to the 2011 and 1998 criteria [9,10]. All cases had progressive deterioration, fulfilling the first criteria for bvFTD according to 2011 criteria [10]; 14 cases had 3 or more of 6 clinically discriminating features, fulfilling the criteria for possible bvFTD [3,6,7,10,11,12,18,20,23,27,28,33,36]; 9 cases had 3 features [6,7,18,20,23,27,33,36], 4 cases had 4 features [3,11,12,28] and our case had 5 features. Of these 14 cases, 6 went on to fulfill criteria for probable bvFTD with imaging consistent with bvFTD (frontal and/or temporal atrophy on CT or MRI, or frontal hypoperfusion or hypometabolism on SPECT or PET) and significant functional decline [7,10,12,23,28,33]. These cases also fulfilled the requirement for possible or probable bvFTD diagnoses that other non-degenerative nervous system, medical or psychiatric disorders could not better account for the disease, and the requirement for probable bvFTD diagnosis that biomarkers indicative of another neurodegenerative process were absent [10]. None of the ALSP cases had frontotemporal lobar degeneration pathology or a known pathogenic mutation, thus none had a diagnosis of definite bvFTD [10].
From a total of five 1998 core features [9], the mean number of core features exhibited was 2.0 ± 1.6 (n = 52); 3 cases had all 5 core features [11,12,23] and 10 cases had 4 core features [3,4,6,7,27,30,33,36]. The most common core feature was insidious onset and gradual progression. Mean number of supportive features exhibited was 3.7 ± 2.5, ranging from 0 to 11 out of a total of 18 supportive features (n = 52) [9]. Common supportive diagnostic features included altered speech output, primitive reflexes, incontinence, frontal or anterior temporal abnormality on imaging, and mutism. Notably, 50 patients had onset of disease before age 65 years.
A 60-year-old right-handed Caucasian man with 17 years of formal education presented to a specialty memory clinic after 2 years of cognitive decline that had accelerated in the past year. The history of emotional blunting, poor interpersonal conduct, amotivational syndrome, new preference for sweets, and distractibili- ty – against relative preservation of spatial orientation and short-term memory – raised the highest suspicion of bvFTD. At presentation, he required prompting for activities of daily living, yet maintained fluent speech. His family denied dysarthria, dysphagia, new weakness or falls. He had no stroke risk factors, no significant neurological or psychiatric past medical history, and no relevant family history. Mental status testing showed abnormal executive functions of sustained attention, set-shifting and self-monitoring. Elemental neurological examination was normal.
Brain MRI on previous work-up for presumed depression showed symmetrical cerebral atrophy with frontal predominance (fig. 2a). There were hyperintensities in deep white matter of bilateral frontal lobes, left temporal lobe, subcortical regions and splenium of the corpus callosum. On a SPECT scan the same year, perfusion in the right anterior frontal lobe was decreased. Brain MRI repeated 6 months later showed increased volume of the previously identified hyperintensities (fig. 2b). Frontal cerebral atrophy had also worsened and progressed dorsally. Hippocampal atrophy was not apparent.
Two and a half years into the illness, he lost spontaneous speech. There was no parkinsonism, loss of vertical saccades or gait abnormality. Brain MRI at that time showed further progression of all white matter changes, including involvement of the entire inferior corpus callosum. The patient developed incontinence and falls, then dysphagia in the third year of illness.
Within the next year, he manifested a generalized tonic-clonic seizure. Cerebrospinal fluid analysis did not support viral encephalitis, multiple sclerosis, Lyme’s disease or active inflammatory processes. This seizure heralded a rapid decline into nursing home admission for palliative care. Motor weakness rapidly worsened to the point of immobility and full dependence for nutrition. The patient died before completing a fourth year of illness. The family deferred an electromyogram study, but requested an autopsy.
The postmortem brain weighed 1,600 g. Cortical atrophy was pronounced at bilateral frontal tips, but not in other regions. Frontal coronal sections revealed bilateral atrophy of deep white matter, corpus callosum and internal capsule (fig. 2c–d). Subcortical U-fibers were intact. White matter atrophy was observed in temporal and subcortical regions and cerebellar peduncles. Occipital white matter was relatively spared. Ventricles appeared enlarged with a preserved but flattened head of the caudate nucleus.
Microscopic examination confirmed myelinated white matter loss with sparing of subcortical U-fibers. There were gliosis and reactive astrocytosis (fig. 2e), axonal spheroids (fig. 2f) and macrophages with pigmentation (fig. 2g) in white matter regions. Microcalcifications and vacuolations were observed in some sections. Electron microscopy revealed intracytoplasmic ‘fingerprint’ patterns in white matter regions (fig. 2h).
|
||||
1850
|
dbpedia
|
1
| 37 |
https://www.verywellhealth.com/is-high-cholesterol-hereditary-5202344
|
en
|
Is High Cholesterol Hereditary?
|
[
"https://privacy-policy.truste.com/privacy-seal/seal?rid=33c36249-6102-4b62-8673-787e6e3429a0",
"https://www.verywellhealth.com/thmb/6RuW6QRikeK75CXcbaK4wLPsBM0=/1500x0/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-1254899249-db1182b09f1949118a1326d11b20d382.jpg",
"https://www.verywellhealth.com/thmb/6RuW6QRikeK75CXcbaK4wLPsBM0=/1500x0/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-1254899249-db1182b09f1949118a1326d11b20d382.jpg",
"https://www.verywellhealth.com/thmb/9_k9bVFy3vMlyVzl3bN-HeFf6SE=/144x144/filters:no_upscale():max_bytes(150000):strip_icc()/Rachael-Zimlich-1000-db09b152f8424b29a2ffa3d0123e917d.jpg",
"https://www.verywellhealth.com/thmb/9_k9bVFy3vMlyVzl3bN-HeFf6SE=/144x144/filters:no_upscale():max_bytes(150000):strip_icc()/Rachael-Zimlich-1000-db09b152f8424b29a2ffa3d0123e917d.jpg",
"https://www.verywellhealth.com/thmb/2rY8X5omQG5_Izt4LZQJ-u8N4bE=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-84120557-592262a83df78cf5fa2b1564.jpg",
"https://www.verywellhealth.com/thmb/2rY8X5omQG5_Izt4LZQJ-u8N4bE=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-84120557-592262a83df78cf5fa2b1564.jpg",
"https://www.verywellhealth.com/thmb/HMdMU-Q-4fHBq_sSCUYtAtzNZEM=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-1296507353-122fc15649ca40eea4758916a2fc4e6f.jpg",
"https://www.verywellhealth.com/thmb/HMdMU-Q-4fHBq_sSCUYtAtzNZEM=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-1296507353-122fc15649ca40eea4758916a2fc4e6f.jpg",
"https://www.verywellhealth.com/thmb/xghSWsO_vH4vHqGke8JIbP3PgwE=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/200464129-001-56a144863df78cf7726901cc.jpg",
"https://www.verywellhealth.com/thmb/xghSWsO_vH4vHqGke8JIbP3PgwE=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/200464129-001-56a144863df78cf7726901cc.jpg",
"https://www.verywellhealth.com/thmb/USPE4BwI-pzGBZvliwG7-6dU6mY=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-1225223624-d2cb329a547e49c285119a87d0b45c30.jpg",
"https://www.verywellhealth.com/thmb/USPE4BwI-pzGBZvliwG7-6dU6mY=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-1225223624-d2cb329a547e49c285119a87d0b45c30.jpg",
"https://www.verywellhealth.com/thmb/lgcPB7-oCflU_JWs25wqg8hleOE=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/Stocksy_burger-and-fries_11104-57e2fb945f9b586c355e6a14.jpg",
"https://www.verywellhealth.com/thmb/lgcPB7-oCflU_JWs25wqg8hleOE=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/Stocksy_burger-and-fries_11104-57e2fb945f9b586c355e6a14.jpg",
"https://www.verywellhealth.com/thmb/HdQklLsQypxGR6GDWm1YMijgQgQ=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-476804053-5a68c8476edd650037e382ab.jpg",
"https://www.verywellhealth.com/thmb/HdQklLsQypxGR6GDWm1YMijgQgQ=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-476804053-5a68c8476edd650037e382ab.jpg",
"https://www.verywellhealth.com/thmb/yrSjuVJ961DtBjEX8L72zsHihW8=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-1173046608-2c9146bf435245cd8d2d762947cfede7.jpg",
"https://www.verywellhealth.com/thmb/yrSjuVJ961DtBjEX8L72zsHihW8=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-1173046608-2c9146bf435245cd8d2d762947cfede7.jpg",
"https://www.verywellhealth.com/thmb/f-zoCRV1VSTpC2kge0lDUdTPztY=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-1188431836-5d73aa6cb46e47af93651dedb6cbb80e.jpg",
"https://www.verywellhealth.com/thmb/f-zoCRV1VSTpC2kge0lDUdTPztY=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-1188431836-5d73aa6cb46e47af93651dedb6cbb80e.jpg",
"https://www.verywellhealth.com/thmb/UN1vPMahx4fDRa3XjpX78zTJpF4=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-10556620421-dd4e05f7647644d892b672f445745700.jpg",
"https://www.verywellhealth.com/thmb/UN1vPMahx4fDRa3XjpX78zTJpF4=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-10556620421-dd4e05f7647644d892b672f445745700.jpg",
"https://www.verywellhealth.com/thmb/4RDsXwWomIl1Mq6s5iUY4MXl-CE=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-505323661-5686b6163df78ccc15fd8489.jpg",
"https://www.verywellhealth.com/thmb/4RDsXwWomIl1Mq6s5iUY4MXl-CE=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-505323661-5686b6163df78ccc15fd8489.jpg",
"https://www.verywellhealth.com/thmb/yAEat-UM0hrPN29VBdNnK5OJWAY=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/lots-of-pints-of-beers---man--in-background--566272557-59ca6126054ad90011051c7e.jpg",
"https://www.verywellhealth.com/thmb/yAEat-UM0hrPN29VBdNnK5OJWAY=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/lots-of-pints-of-beers---man--in-background--566272557-59ca6126054ad90011051c7e.jpg",
"https://www.verywellhealth.com/thmb/3ev56N0yMx7nSKGXMSinKII_jSk=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-1316198689-ed313732a8e74929ac61cce32c53a0ec.jpg",
"https://www.verywellhealth.com/thmb/3ev56N0yMx7nSKGXMSinKII_jSk=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-1316198689-ed313732a8e74929ac61cce32c53a0ec.jpg",
"https://www.verywellhealth.com/thmb/LJLfyAKt5lS5BRpYaB8zKgb_DNE=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-907329974-faecb50958c1490db53a035b18a45d8a.jpg",
"https://www.verywellhealth.com/thmb/LJLfyAKt5lS5BRpYaB8zKgb_DNE=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-907329974-faecb50958c1490db53a035b18a45d8a.jpg",
"https://www.verywellhealth.com/thmb/67Assd1DSFDI9WQpYD1Le8PONTU=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/walking-GettyImages-1411303413-54f7dd7d555944cb99f7cd41ba747d12.jpg",
"https://www.verywellhealth.com/thmb/67Assd1DSFDI9WQpYD1Le8PONTU=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/walking-GettyImages-1411303413-54f7dd7d555944cb99f7cd41ba747d12.jpg",
"https://www.verywellhealth.com/thmb/0LhGFFe7-eEjQtLwcFgdZkmmQq8=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-1276388018-ec83c456411c472980b9e765fd397aae.jpg",
"https://www.verywellhealth.com/thmb/0LhGFFe7-eEjQtLwcFgdZkmmQq8=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-1276388018-ec83c456411c472980b9e765fd397aae.jpg",
"https://www.verywellhealth.com/thmb/meD87nXGKaQI6ZpcqIHEIDyO8Zs=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/134556105-56a144885f9b58b7d0bda47a.jpg",
"https://www.verywellhealth.com/thmb/meD87nXGKaQI6ZpcqIHEIDyO8Zs=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/134556105-56a144885f9b58b7d0bda47a.jpg",
"https://privacy-policy.truste.com/privacy-seal/seal?rid=33c36249-6102-4b62-8673-787e6e3429a0"
] |
[] |
[] |
[
""
] | null |
[
"Rachael Zimlich, BSN, RN",
"www.facebook.com",
"Rachael Zimlich"
] |
2021-10-09T05:22:16.229000-04:00
|
If someone in your immediate family has been diagnosed with high cholesterol, you may be wondering if you, too, are at risk.
|
en
|
/favicon.ico
|
Verywell Health
|
https://www.verywellhealth.com/is-high-cholesterol-hereditary-5202344
|
If someone in your immediate family has been diagnosed with high cholesterol, you may be wondering if you, too, are at risk.
This article will discuss how high cholesterol can be hereditary, as well as how healthcare professionals diagnose and treat the condition.
What Is High Cholesterol?
Cholesterol is a fatty molecule that your cells need to function. These molecules are made in your liver, but they also come from your diet and other sources. While you need cholesterol to survive, having too much of it in your blood can cause health problems.
To understand when cholesterol is bad and when it’s good, you need to understand the different types of cholesterol and their normal ranges:
Low-density lipoprotein (LDL) cholesterol moves fat cells around the body. When LDL cholesterol is too high—above 130 mg/dL—it can build up in the walls of your blood vessels and cause blockages. This is why LDL cholesterol is known as the “bad” cholesterol.
High-density lipoprotein (HDL) cholesterol removes cholesterol from your blood and can help clear buildups in blood vessels. HDL cholesterol takes fatty molecules back to the liver, where they are removed from the body. This is why HDL is called the “good” cholesterol and levels should be above 45 to 55 mg/dL.
While elevated LDL cholesterol is bad, high HDL cholesterol is good. Things like stress, high blood sugar, diabetes, and even genetics can cause these numbers to reach unhealthy levels.
High Cholesterol: Signs and Symptoms
If you see your doctor for regular preventive or wellness visits, they may perform a lipid panel to check the cholesterol levels in your blood. This is the best way to tell if your cholesterol levels are unhealthy.
Cholesterol levels can creep up to unhealthy levels with no symptoms at all. Over time, however, cholesterol buildup in your blood, vessels, and tissue will start to be more noticeable and cause the following:
Fatty deposits: As the cholesterol level in your body rises, bits of fat and cholesterol can collect under your skin and become visible on the surface. These fatty deposits are called xanthomas. They can be found on your hands, elbows, ankles, and around the eyes. Cholesterol deposits around your eyes can also be called xanthelasmas.
Chest pain: High cholesterol increases your risks of atherosclerosis and coronary artery disease, reducing blood flow to the heart muscle. An oxygen-starved heart muscle can produce chest pain, also called angina.
Cramping and pain: As your blood vessels narrow as a result of cholesterol buildup, you can develop issues in your circulation, like peripheral artery disease. This can cause problems like pain or cramping, especially in either or both calves when you are walking.
Slow healing: When your blood isn’t flowing as well as it should be, blood and nutrients that help keep tissues vibrant and healthy don’t get to where they need to go. This can cause sores, especially on the toes or feet, and prevent even small injuries from healing well.
Stroke and heart attack: High cholesterol is a leading risk factor for sudden stroke and heart attack. This occurs when your blood supply is suddenly cut off from your heart or brain.
Is High Cholesterol Hereditary?
While lifestyle choices like your activity level, diet, and whether you smoke affect your cholesterol levels, some people may have elevated cholesterol regardless of their lifestyle choices.
Familial hypercholesterolemia is a hereditary form of high cholesterol. Your doctor may check your cholesterol and monitor you for this condition if you have a family history of high cholesterol or sudden heart attacks. Fatty deposits under the skin, especially around the eyes, are a common symptom of this kind of high cholesterol.
Genetic Risk: Familial Hypercholesterolemia
You can have familial hypercholesterolemia if one or both of your parents carry a genetic mutation that helps control the level of LDL cholesterol in your blood. In many cases, the mutation occurs in one of the following genes:
LDLR
APOB
PCSK9
You have a 50% chance of inheriting the gene mutation that causes hereditary high cholesterol from each parent who carries it. This means that if one parent carries an affected gene, you have a 50% chance of developing familial hypercholesterolemia.
If both parents carry the gene—or have more than one gene mutation that could lead to the condition—your chances of developing the condition are even higher. People who have genes from both parents need appropriate diagnosis and treatment to live a healthy life.
How to Diagnose and Treat High Cholesterol
Cholesterol screenings are part of wellness visits every few years, but if high cholesterol runs in your family, you may need more frequent testing and treatment to avoid complications.
Diagnosing High Cholesterol
The first step to diagnosing high cholesterol is to share a detailed personal and family health history with your doctor. If your parents or other close relatives have high cholesterol and heart disease, your doctor may check your health with lab tests.
Most doctors will complete a routine cholesterol screening during a wellness exam starting at age 20, repeating the test every four to six years. Lipid panels measure your cholesterol levels, but if your doctor thinks you have a genetic risk for high cholesterol, they may perform more frequent tests.
If a child has a known history of familial hypercholesterolemia, their doctor will start checking their cholesterol levels with blood tests around age 2.
Treating High Cholesterol
When your cholesterol is high because of your diet, a lack of exercise, or smoking, lifestyle changes can help lower your bad cholesterol and increase your good cholesterol. If your high cholesterol is caused by a genetic mutation, these changes can help, but will not cure the condition.
If you have familial hypercholesterolemia, you will have to take medications to keep your cholesterol levels in check. Several types of medications might be used to lower your cholesterol, including:
Statins reduce how much cholesterol your liver makes. Examples include medications like Lipitor (atorvastatin) and Mevacor (lovastatin).
Bile acid sequestrants help reduce cholesterol by affecting liver function. Examples include Questran (cholestyramine) and Colestid (colestipol).
Fibrates lower triglyceride levels, a type of fat in your blood, and increase HDL levels. An example is Triglide (fenofibrate).
PCSK9 inhibitors and ACL inhibitors are a newer class of medications that can change how your body responds to cholesterol. Examples include Praluent (alirocumab), Repatha (evolocumab), Leqvio (inclisiran), and Nexletol (bempedoic acid). These medications are often taken by people who can’t take statins or who are already taking high doses of statins and need to reduce their LDL cholesterol even more.
Ways to Prevent High Cholesterol
Making healthy lifestyle choices can help you keep your cholesterol under control. These include:
Exercising regularly
Avoiding high-fat foods
Eating plenty of fiber
Maintaining a healthy body weight
Not smoking
If you know you have a family history of high cholesterol or have been diagnosed with familial hypercholesterolemia, you cannot prevent the condition from developing. However, you can work closely with your doctor to manage your condition well and prevent complications. This includes checking your cholesterol levels regularly and taking medications that can lower your cholesterol.
Summary
High cholesterol can cause a lot of serious health problems, including high blood pressure, heart attack, and stroke. While some people can manage high cholesterol with lifestyle changes, this usually isn’t enough for people who inherited familial hypercholesterolemia. These people will need to manage their condition with medications and lifestyle changes to prevent complications.
A Word from Verywell
A lot of serious health problems can develop because of high cholesterol, and some people might not even know how at risk they are. Familial hypercholesterolemia can go undetected and put you at risk of conditions like heart attack or stroke.
Be sure to review your family medical history with your doctor so that this condition can be caught and treated early. Early detection and proper management can help you keep your cholesterol under control and prevent serious complications.
|
||||
1850
|
dbpedia
|
0
| 41 |
https://en.wikipedia.org/wiki/Leukoencephalopathy_with_neuroaxonal_spheroids
|
en
|
Leukoencephalopathy with neuroaxonal spheroids
|
https://en.wikipedia.org/static/favicon/wikipedia.ico
|
https://en.wikipedia.org/static/favicon/wikipedia.ico
|
[
"https://en.wikipedia.org/static/images/icons/wikipedia.png",
"https://en.wikipedia.org/static/images/mobile/copyright/wikipedia-wordmark-en.svg",
"https://en.wikipedia.org/static/images/mobile/copyright/wikipedia-tagline-en.svg",
"https://upload.wikimedia.org/wikipedia/commons/thumb/0/0c/Neuron_with_oligodendrocyte_and_myelin_sheath-2.svg/207px-Neuron_with_oligodendrocyte_and_myelin_sheath-2.svg.png",
"https://upload.wikimedia.org/wikipedia/commons/thumb/6/64/Missense_Mutation_Example.jpg/258px-Missense_Mutation_Example.jpg",
"https://upload.wikimedia.org/wikipedia/commons/thumb/4/4e/Autosomal_dominant_-_en.svg/140px-Autosomal_dominant_-_en.svg.png",
"https://upload.wikimedia.org/wikipedia/commons/thumb/8/83/Lobes_of_the_brain.jpg/460px-Lobes_of_the_brain.jpg",
"https://upload.wikimedia.org/wikipedia/commons/thumb/7/7a/1511_The_Limbic_Lobe.jpg/472px-1511_The_Limbic_Lobe.jpg",
"https://upload.wikimedia.org/wikipedia/commons/thumb/8/82/White_Matter_Lesions_%2848601156232%29.jpg/234px-White_Matter_Lesions_%2848601156232%29.jpg",
"https://upload.wikimedia.org/wikipedia/commons/thumb/d/da/Blausen_0617_LumbarPuncture.png/354px-Blausen_0617_LumbarPuncture.png",
"https://upload.wikimedia.org/wikipedia/commons/thumb/e/e5/Stem_cell_differentiation.svg/286px-Stem_cell_differentiation.svg.png",
"https://login.wikimedia.org/wiki/Special:CentralAutoLogin/start?type=1x1",
"https://en.wikipedia.org/static/images/footer/wikimedia-button.svg",
"https://en.wikipedia.org/static/images/footer/poweredby_mediawiki.svg"
] |
[] |
[] |
[
""
] | null |
[
"Contributors to Wikimedia projects"
] |
2008-04-30T13:16:55+00:00
|
en
|
/static/apple-touch/wikipedia.png
|
https://en.wikipedia.org/wiki/Leukoencephalopathy_with_neuroaxonal_spheroids
|
Medical condition
Leukoencephalopathy with neuroaxonal spheroidsSpecialtyNeurology
Leukoencephalopathy with neuroaxonal spheroids (LENAS), also known as adult-onset leukoencephalopathy with axonal spheroids and pigmented glia (ALSP), hereditary diffuse leukoencephalopathy with spheroids (HDLS) and pigmentary orthochromatic leukodystrophy (POLD)[1] is an extremely rare kind of leukoencephalopathy and is classified as a neurodegenerative disease. LENAS is a cause of severe and subacute dementia that results from damage to certain areas of the brain. This damage is to a type of brain tissue called white matter and axon damage due to swellings which are termed spheroids.[2]
The rarity and unknown prevalence of this disease may be due to most symptoms being similar to other common disorders, leading to misdiagnosis.[3] LENAS normally has an adult onset (but also can be present in childhood), which can present on MRIs that mimics progressive multiple sclerosis and is thus misdiagnosed for this instead.[4]
The genetic etiology of LENAS is known to follow an autosomal dominant pattern through a mutation in the CSF1R gene.
Signs and Symptoms
[edit]
The signs and symptoms that are present vary with each individual as some may have all symptoms while some may only have some listed below. However, the progression of this disease is different with each individual which reflects how the symptoms change over time. Further, the damage that we see to the myelin and axons is thought to contribute to many of the neurological signs and symptoms that are shown in this condition.[2] The most frequent symptoms are categorized into psychiatric, psychotic and neurologic.[5]
Predominant Symptoms Based on Category[5] Category Symptoms Psychiatric Depression, Anxiety, Alcohol use disorder, Irritability, and Aggressiveness Psychotic Confusion, Delusions, and Hallucinations Neurologic Dementia, Seizures, Impaired Balance, Retropulsion, Gait Apraxia, Spasticity, Ataxia, and Urinary Incontinence
General Symptoms
[edit]
Personality Changes[2]
Loss of social inhibitions[2]
Depression[2]
Memory Loss[2]
Loss of Executive Function[2]
The ability to plan and use problem-solving skills inhibits normal life skills such as impulse control and appropriately paying attention in general[2]
Seizures[2]
Severe decline in thinking and reasoning abilities (dementia ).[2]
Motor Skills become affected, many may have difficulty walking[2]
Patterns of movement abnormalities can occur as well such as:[2]
Parkinsonism :[2]
Generally will see bradykinesia , tremors, and muscle rigidity.[2]
While these vary among individuals as mentioned, over time, almost all patients with this condition will be unable to walk, speak and care for themselves.[2]
Causes
[edit]
Leukoencephalopathy with neuroaxonal spheroids (LENAS) is believed to occur when presence of white matter degeneration and axonal spheroids are seen with a brain biopsy or an MRI.[6][3]
White matter consists of nerve fibers (axons) covered by a substance called myelin that insulates and protects them.[3] The axons extend from nerve cells (neurons) and transmit nerve impulses throughout the body.[3]
The result of spheroids in the brain leads to this significant decline of functioning that progressively worsens the brain function and leads to varied symptoms. However, why this occurs is still not entirely understood, thus more research is continuously being done to this day.
There have been identifiable genetic differences that are better understood. This disease is inherited while following an autosomal dominant pattern.
Genetic Etiology
[edit]
There are identifiable genetic causes that are better understood with this disease. LENAS is caused by a mutation in a gene, specifically the CSF1R gene. This mutation changes protein receptors on the gene which normally plays a role in important cell signaling pathways; however, this altercation inhibits the regular function.[2]
Normal Function of CSF1R Gene
The colony stimulating factor 1 receptor (CSFR1) gene regularly functions by giving instructions for making a protein termed the colony stimulating factor 1 receptor (CSF-1 receptor).[7] Proteins in general attach (bind) to their specific receptor which "turns on" (activates) to stimulate a cascade of cellular signaling pathways crucial for cell function to occur. These events occur with the specific CSF-1 protein. As it binds and is activated, it allows for important cellular processes to occur which include cell growth, division, and maturation of cells to in turn take on specific functions.[7]
Glial cells, located in the brain, are responsible for protection and maintenance of neurons. In a healthy brain, the membrane of glial cells are abundant with the CSF-1 receptor gene and is also thought to be an important player in the proliferation and differentiation of these cells.[7]
Medical condition
Leukoencephalopathy with neuroaxonal spheroidsThis condition is inherited in an autosomal dominant mannerSpecialtyNeurology
Mutated CSF1R Gene
[edit]
There are several types of mutations that occur in genes. The majority of CSF1R genetic mutations in LENAS occur due to a type of mutation which is called a missense mutation.[3] Missense mutations occur when there is a change in a single amino acid of a protein. This single change can result in problems with functions of the protein, like the CSF-1 receptor. The kinase domain, which is the region of CSF-1 receptor where the mutation occurs, is altered and thus the normal function that activates other proteins is compromised and cannot stimulate cell signaling pathways properly.[3]
Although this is the primary type of mutation in LENAS, other types may occur as well but it is not as well understood for this disease.[3]
This genetic mutation is related to LENAS and said to be the main cause but how these lead to damage in the white matter and associated symptoms (cognitive and movement impairment symptoms) is still not fully clear.[3][7]
Inheritance
[edit]
LENAS is inherited in an autosomal dominant pattern. This means that one copy of the mutated gene in each cell is sufficient to cause the disorder.[2]
If one parent who is unaffected and one parent who is affected with LENAS give birth to four children, at least two of the four will become affected and have the disorder because the affected parent would pass on the one copy of the gene. In most cases, an affected person does inherit the mutation from one affected parent but not all cases.
There have been very few reports of cases that result from new mutations have been seen as well as cases in which there has been no history of LENAS.[2] These few reports are not as concrete or well understood yet and further studies should be conducted.
Pathophysiology
[edit]
Neuropathology
[edit]
LENAS is seen with damage to the white matter and axons within the brain. The external human LENAS brain shows findings in several major structures. There is mild atrophy of the frontoparietal regions of the brain and a mild reduction of the thalamus and rostral (front) part of the caudate nucleus (which is located in an area of the brain called the basal ganglia).[5] Abnormalities in the frontal, frontoparietal, and temporal lobes are most severe and predominant with LENAS and asymmetry of the cerebral hemispheres has sometimes been found.[5] LENAS also may show moderately enlarged lateral ventricles and atrophy in corticospinal tracts as well as in the pons.[5]
The area where it is seen to be the most pronounced abnormalities appear in the white matter below the pre- and postcentral gyri that extend through the posterior limb of the internal capsule into pyramidal tracts of the brain stem.[5]
The corpus callosum is variably affected.
Reactive astrocytes and macrophages are present, but no inflammation appears.
The cerebral cortex and basal ganglia are normal and contain no or only few spheroids.
Within the cerebellum, there is a marked loss of Purkinje cells seen but cerebral white matter is normal.
Specific Immunostains are used as the easiest identification of neuroaxonal spheroids in LENAS which appear as round to oval shaped swellings and are seen in affected white matter.[5] If there appears to be a large amount of loss in myelin sheaths on axons and these spheroids, LENAS progressed to become widespread.[5]
Electron Microscopy has also been used to identify spheroids. In LENAS, evidence of the spheroids may show neurofilaments that are scattered amount electron-dense material and mitochondria.[5]
Subcortical U-fibers in the brain appear to be relatively spared, meaning they seem to not be involved in most cases but this does not mean they are not always/eventually involved.[5][8] U-fibers represent connections which are between adjacent areas of the brain located within the cortex or deep in the white matter that are one of the last parts of the brain to be myelinated.[8] In LENAS, it has been found that because these U-fibers are last to myelinate normally, they are also last to be affected as the disease progresses.
Biochemistry
[edit]
The primary biochemical defect in LENAS disrupts normal states and may involve oxidative stress. Ceroids, which are essentially products of unsaturated fatty acids that build up, are found in macrophages and other glia is thought to be an end-product of oxidative damage, indicative of membrane damage from abnormal accumulation.[9]
The high levels of Iron is also present in LENAS which can be associated to cause an increased level of toxic free radicals and causing oxidative damage to the body, causing failure in our cellular energy systems.[10]
Disease Mechanism
[edit]
The mechanism of LENAS still seems to remain unclear and it varies as more research on this is being done. Some mechanisms that can be of clinical importance of why individuals show certain symptoms and which area of the brain has been shown to be consistent.[10]
Normally, the frontal lobe in our brain are important for our higher level executive functions. Predominance of white matter damage in this lobe has been found to be consistent with both the psychiatric and behavioral signs and symptoms pertaining to LENAS.[10] The underlying symptoms seen of frontotemporal dementia seen commonly in LENAS is associated with the temporal lobe damage.[10] There is a large disconnect in the brain between the lobes that reflect the neuropsychiatric symptoms that are common with the disease.[10]
Ataxia, which is related to our daily voluntary movements of muscles, are often present even in patients without cerebellar involvement which could reflect either minimal damage to the cerebellum or diffuse cerebral white matter lesions.[10]
Diagnosis
[edit]
The diagnosis of LENAS is usually based on medical and family history, genetic testing, extensive imaging and other supplemental testing. As this disease is extremely rare, diagnosis is still very complex as many of these diagnostic criteria for LENAS can be mistaken for similar neurodegenerative disorders. The differential diagnosis of leukoencephalopathy in general is very extensive and specialized investigations are required to make an accurate diagnosis.[11]
Diagnostic Criteria
[edit]
Note: These criteria were established by a group consisting of board-certified neurologists from the Mayo Clinic, Niigata University, Shinshu University School of Medicine, Kyoto Prefectural University of Medicine, and Tokushima University Graduate School.
Core Features
[edit]
Age at onset ≤ 60 years old[11]
More than 2 findings of the following clinical signs and symptoms:[11]
Cognitive Impairment or Psychiatric Symptoms[11]
Pyramidal Signs[11]
Parkinsonism[11]
Epilepsy[11]
Autosomal Dominant inheritance or sporadic occurrence[11]
Brain CT/MRI findings:
Bilateral Cerebral white matter lesions[11]
Thinning of the Corpus Callosum[11]
Other causes of Leukoencephalopathy including vascular dementia, multiple sclerosis, or leukodystrophy can be excluded.[11]
Exclusionary Findings
[edit]
Age at onset ≤ 10 years[11]
Stroke-like episodes more than twice except for epilepsy[11]
Prominent peripheral neuropathy[11]
Supportive Findings
[edit]
Frontal lobe dysfunction shown by clinical features or cognitive battery test[11]
Rapidly progressive course. Become bedridden within 5 years after onset[11]
Spotty small calcifications in the white matter shown by brain CT[11]
Neuropathologic findings compatible to LENAS[11]
Diagnosis By Criteria Definite Probable Possible Fulfills core features 2,3 and 4A and confirmation of CSF1R mutation[11] Fulfills core features 1-5, but genetic testing has not been performed[11] Fulfills core features 2a, 3, and 4a, but genetic testing has not been performed[11]
Genetic Testing
[edit]
Single-Gene testing is first performed for sequence analysis of the CSF1R gene.[12]
A multi-gene panel that includes CSF1R gene and other genes of interest may be considered for differential diagnoses.[12]
If necessary, more comprehensive genomic testing (not always available though) can be performed.[12]
Testing Resources
ALSP Aware is a testing opportunity provided at no-cost for individuals with a family history of Adult-Onset Leukoencephalopathy with Axonal Spheroids and Pigmented Glia (ALSP). It is also available to physicians to test individuals that they suspect may have ALSP.
Eligibility Requirements
Adults 18 years or older, AND
Living in the United States, AND
Have a family history of ALSP, OR
Are referred by an ALSPAware participating physician
Further Evaluations
[edit]
Complete neurologic assessment[12]
Psychological and psychiatric assessments[12]
Assessment of feeding/eating, digestive problems, and nutrition based on clinical history[12]
EEG if seizure disorder suspected[12]
Assessment of family and social structure to determine the availability of adequate support systems[12]
Consultation with a clinical geneticist and/or genetic counselor[12]
Prevention
[edit]
There currently is not any suggestive findings of preventative measures that should be taken for LENAS before diagnosis. However, prevention of secondary complications can be taken once diagnosis is confirmed.
Prevention of Secondary Complications
[edit]
Social problems such as unemployment, divorce, financial troubles, and alcoholism as well as suicidal tendencies are often associated as this disease worsens over time. Some of these social consequences may be avoided if family members are informed early about the nature of this disorder as well as if it is diagnosed early enough.[12]
As depression is a major symptom associated, suicidal tendencies may occur. Antidepressant medications can be prescribed for this depression for the attempt to help with depression but they have not shown long-term benefit to date.[12]
Agents and Circumstances to Avoid
[edit]
The following should be avoided not to prevent the disease, but rather to prevent this disease from progressing faster and causing symptoms to worsen:
Use of first-generation neuroleptics: these increase seizure risk and risk of additional parkinsonian signs.[12]
Treatment agents for multiple sclerosis: these have no benefit and have major side effects.[12]
Treatment
[edit]
No specific therapy for LENAS is currently known or proven to cure this disease, but management of it should be immediately initiated following diagnosis. While more research should be taken, some suggest that hematopoietic stem cell transplantation may show a therapeutic role for this disease.[12]
Management
[edit]
Management is important in support of this disease and includes attention to general care and nutrition requirements and other possible drug therapies that may help or slow the progression of the disease.[12]
L-dopa or other dopaminergic therapies have not yet been beneficial in individuals with this disease but was noted that it may be worth trying as it does not show negative effects.[12]
Antipsychotics are in general not recommended due to extrapyramidal side effects. However, they may be used in aggressive individuals.[12]
Anti-seizure medications should be initiated in individuals who are having seizure activity along with having this disease as it is reported to be beneficial.[12]
Surveillance
[edit]
Periodic clinical evaluation and surveillance to monitor the progression of the disease is appropriate to determine if changes need to be made:
Changes in mobility, communication, and behavior, which could indicate the need to alter care and support systems (for example, moving to a nursing facility or getting personal care, access to wheelchair or walker, etc).[12]
Onset of seizure activity may cue in the need for anti-seizure therapy[12]
Contractures, which could indicate the need to change medical management and physical therapy[12]
More severe behavioral changes that appeared to have worsened. This could include inappropriate emotions and actions, problems following directions, memory loss, and incontinence all which indicate curtailing of independence[12]
Difficulties in swallowing or weight loss, which trigger physicians consideration for gastrostomy[12]
Need for physical therapy to minimize contractures and maintain locomotion[12]
Prognosis
[edit]
Because of how rare this genetic condition is an exact prognosis is still not known and varies. Some data has suggested that the median age of onset is 45 years old, but patients with onset as young as 18 years old has also been described.[6] Further, it is believed that the median life expectancy is 6 years but is also extremely variable as it has also been reported that some patients survived up to 29 years after the onset of symptoms.[6]
While gaining a definitive prognosis for this disease studies suggest a few different techniques that may or may not benefit in getting a better prognosis for the individual patient:
Lumbar puncture to measure neurofilament light protein (NFL) in the cerebrospinal fluid (CSF) to follow the progression of the disease[12]. An increase NFL level on CSF examinations may suggest faster disease course as well as a worse prognosis.[12]
Longitudinal MRI studies annually can potentially also help with prognosis. This was found from another study which found that, as throughout the disease course, the more rapid the confluence of patchy or focal T2-weighted hyperintensities and the progression of cortical atrophy suggests the poorer the prognosis appears to be.[13][14][12]
Epidemiology
[edit]
Epidemiological studies for rare diseases are difficult to have exact and known values that are still difficult to find. However, most studies show the mean age of onset was 43 years old (range 18–78 years old), with a mean death at 53 years (range 23–84 years) and the mean disease duration was found to be 6.8 years (range 1–29 years).[15]
History
[edit]
LENAS was first reported in multiple members of a large Swedish pedigree in 1984. In this family, 17 out of 71 subjects from 4 generations were affected with this disease.[5] It was found that the age onset of this family varied from 8 to 60 years of age.[5] The age of death in this family was 39 to 89 years with a time between onset and death varied from 3 months to over 30 years.[5] Some patients in this family rapidly developed severe dementia and died a few months after this onset whereas others had a more prolonged progression of the disease.[5] This family was also to have reported sporadic patients as well.[5]
Prevalence
[edit]
To date, the prevalence of this disease is unclear. Literature has few publications to date of this due to the rarity of the disease. However, a study done in 2011 found information dating back to 1970 that identified 51 individual cases fulfilling criteria to be identified.[16] Today, there could be more confirmed cases but these data have not increased significantly.
Research
[edit]
The need for future research in this disease is necessary for varied reasons. First, this disease is still so rare and it is to this date very difficult to diagnose. Further, the signs and symptoms of this disease are often confused with other diseases that are more well known and misdiagnosis often occurs. This disease can commonly be mistaken for Multiple Sclerosis (MS) or another form of a more common leukoencephalopathy or neurodegenerative diseases as well. However, some current research has been done primarily on case studies in which scientists are attempting to find new mutations or new ways to diagnose. There are a few studies however that pose to lean in the direction of therapeutical's using hematopoietic stem cell transplantation therapy.
Hematopoietic Stem Cell Therapy
[edit]
Bone marrow is the soft spongy area in some larger bones of the body that produces many cells which make up red blood cells, white blood cells and platelets.[17] These cells are developed from a type of cell found in bone marrow, termed hematopoietic stem cells.[17] The body is able to direct these stem cells to develop in the blood at any given moment and this is a rapid process.[17] Most of the stem cells remain in the marrow until they are mature which then they are released for specific functions in the body such as carrying oxygen, providing infection protection, and helping blood clotting.[17] Stem cells found in circulating blood are able to be extracted for stem cell therapy use and research.[17]
A study done using hematopoietic stem cell therapy (HSCT) showed clinical benefit but suggested further exploration must be done.[18] Findings using HSCT was beneficial in recessive disorders and saw that it may similarly enhance CSF1R signaling after partial loss seen in LENAS.[18] In the subjects who had LENAS were introduced to HSCT and the finding of further progressed cells was minimal 15 years after the therapy was finished.[18] The most important finding in the subject was that they retained a high level of communication and survived beyond 15 years after onset of symptoms.[18] This is very rare for LENAS as it has been reported to be averaged at 6.8 years for surviving after the onset. This finding provides hope for future research direction and suggests that there may be great benefit to slow the progression of LENAS using HSCT.
See also
[edit]
Leukoencephalopathy
|
||||
1850
|
dbpedia
|
0
| 16 |
https://www.biorxiv.org/content/10.1101/2024.02.12.579869v1
|
en
|
Modeling Hereditary Diffuse Leukoencephalopathy with Axonal Spheroids using microglia-sufficient brain organoids
|
[
"https://www.biorxiv.org/sites/default/files/biorxiv_article.jpg",
"https://www.biorxiv.org/sites/all/modules/contrib/panels_ajax_tab/images/loading.gif",
"https://www.biorxiv.org/sites/all/modules/highwire/highwire/images/twitter.png",
"https://www.biorxiv.org/sites/all/modules/highwire/highwire/images/fb-blue.png",
"https://www.biorxiv.org/sites/all/modules/highwire/highwire/images/linkedin-32px.png",
"https://www.biorxiv.org/sites/all/modules/highwire/highwire/images/mendeley.png"
] |
[] |
[] |
[
""
] | null |
[
"Wei Jie Wong",
"Yi Wen Zhu",
"Hai Ting Wang",
"Jia Wen Qian",
"Ziyi Li",
"Li Song",
"Zhao Yuan Liu",
"Wei Guo",
"Shuang Yan Zhang",
"Bing Su"
] |
2024-02-12T00:00:00
|
bioRxiv - the preprint server for biology, operated by Cold Spring Harbor Laboratory, a research and educational institution
|
en
|
https://www.biorxiv.org/sites/default/files/images/favicon.ico
|
bioRxiv
|
https://www.biorxiv.org/content/10.1101/2024.02.12.579869v1
|
Abstract
Hereditary diffuse leukoencephalopathy with axonal spheroids (HDLS) is a rare, fatal, adult-onset neurodegenerative disease that is most often caused by mutations affecting the Colony Stimulating factor-1 Receptor (CSF-1R). To understand how CSF-1R-mutation affects human microglia – the specialized brain-resident macrophages of the central nervous system – and the downstream consequences for neuronal cells, we used a macrophage and forebrain organoid co-culture system based on induced pluripotent stem cells generated from two patients with HDLS, with CSF-1R gene-corrected isogenic organoids as controls. Macrophages derived from iPSC (iMacs) of patients exhibited a metabolic shift towards the glycolytic pathway and reduced CSF-1 sensitivity, which was associated with higher levels of IL-1β production and an activated inflammatory phenotype. Single-cell RNA sequencing revealed that iMacs adopt a reactive state that leads to impaired regulation of neuronal cell populations in organoid cultures, thereby identifying microglial dysregulation and specifically IL-1β production as key contributors to the degenerative neuro-environment in HDLS.
|
||||
1850
|
dbpedia
|
3
| 43 |
https://medlineplus.gov/medlineplus-videos/cholesterol-good-and-bad/
|
en
|
MedlinePlus: Cholesterol Good and Bad
|
[
"https://medlineplus.gov/uswds/img/us_flag_small.png",
"https://medlineplus.gov/uswds/img/icon-dot-gov.svg",
"https://medlineplus.gov/uswds/img/icon-https.svg",
"https://medlineplus.gov/images/nihlogo.png",
"https://medlineplus.gov/images/m_logo_25.png",
"https://medlineplus.gov/images/feed.png",
"https://medlineplus.gov/images/i_share_twitter.png",
"https://medlineplus.gov/images/i_share_fb.png",
"https://medlineplus.gov/images/Instagram_Glyph_Gradient_RGB.png",
"https://medlineplus.gov/images/i_social_media_toolkit.png",
"https://medlineplus.gov/images/return-top.png"
] |
[
"https://medlineplus.gov/videofiles/en/cholesterol-good-and-bad.mp4"
] |
[] |
[
""
] | null |
[] | null |
Did you know that cholesterol can be âgoodâ and âbadâ? What does cholesterol do and how can it affect your health?
|
en
|
https://medlineplus.gov/images/favicon.ico
|
https://medlineplus.gov/medlineplus-videos/cholesterol-good-and-bad/
|
Transcript
Good cholesterol, Bad cholesterol
Cholesterol: It can be good. It can be bad.Â
Hereâs how cholesterol can be good.
Cholesterol is found in all of our cells. Cells need it to keep their membranes just the right consistency.
Our body also makes things with cholesterol, like steroid hormones, vitamin D, and bile.
Hereâs how cholesterol can be bad.
Cholesterol in the blood can stick to artery walls, forming plaque. This can block blood flow. Atherosclerosis is the condition where plaque narrows the space inside the artery.
Multiple factors can cause plaques to rupture, like inflammation. The bodyâs natural healing response to damaged tissue can cause clots. If the clots plug up arteries, blood cannot deliver vital oxygen.
If the coronary arteries that feed the heart are blocked, this could lead to a heart attack.
If the blood vessels of the brain or the carotid arteries of the neck are blocked, this could lead to a stroke.Â
If the arteries of the leg are blocked, this could lead to peripheral artery disease. This causes painful leg cramps when walking, numbness and weakness, or foot sores that do not heal.
So cholesterol can be good and bad. There are also different types of cholesterol sometimes  called âgood cholesterolâ and âbad cholesterolâ.
LDL, or low-density lipoprotein, is sometimes called âbad cholesterolâ. It carries cholesterol that can stick to arteries, collect in the vessel lining forming plaque, and sometimes block blood flow.
HDL, or high-density lipoprotein, is sometimes called âgood cholesterolâ. It takes cholesterol away from the blood and returns it to the liver.Â
When checked, you want your LDL to be low. L for low.
You want your HDL to be high. H for High.
A blood test can measure the LDL, HDL, and total cholesterol. Usually, there are no visible symptoms of high cholesterol, so it is important to be periodically checked.
Ways to decrease your LDL and increase your HDL include:
Eating a heart-healthy diet low in saturated and trans fats.Â
Regular exercise and being more physically active.
Maintaining healthy weight.Â
Quitting smoking.
Medications. Medications might be recommended depending on known risk factors for cardiovascular disease (such as age and family history among others).
You may already be familiar with these guidelines for heart-healthy living. They are based on research supported by the National Heart, Lung, and Blood Institute (NHLBI) at the National Institutes of Health, or NIH.Â
This video was produced by MedlinePlus, a trusted source of health information from the US National Library of Medicine.Â
|
|||||
1850
|
dbpedia
|
2
| 5 |
https://www.frontiersin.org/journals/neurology/articles/10.3389/fneur.2021.788168/full
|
en
|
Adult-Onset Leukoencephalopathy With Axonal Spheroids and Pigmented Glia: Review of Clinical Manifestations as Foundations for Therapeutic Development
|
[
"https://loop.frontiersin.org/images/profile/402750/32",
"https://loop.frontiersin.org/images/profile/1536519/32",
"https://loop.frontiersin.org/images/profile/1544087/32",
"https://www.frontiersin.org/article-pages/_nuxt/img/crossmark.5c8ec60.svg",
"https://loop.frontiersin.org/images/profile/194567/74",
"https://loop.frontiersin.org/images/profile/1501809/74",
"https://loop.frontiersin.org/cdn/images/profile/default_32.jpg",
"https://loop.frontiersin.org/cdn/images/profile/default_32.jpg",
"https://loop.frontiersin.org/cdn/images/profile/default_32.jpg",
"https://loop.frontiersin.org/images/profile/1513774/74",
"https://loop.frontiersin.org/cdn/images/profile/default_32.jpg",
"https://loop.frontiersin.org/images/profile/196022/74",
"https://loop.frontiersin.org/images/profile/19210/74",
"https://loop.frontiersin.org/cdn/images/profile/default_32.jpg",
"https://loop.frontiersin.org/images/profile/499925/74",
"https://loop.frontiersin.org/images/profile/311789/74",
"https://loop.frontiersin.org/images/profile/786144/74",
"https://loop.frontiersin.org/images/profile/865344/74",
"https://loop.frontiersin.org/cdn/images/profile/default_32.jpg",
"https://loop.frontiersin.org/images/profile/1060358/74",
"https://www.frontiersin.org/files/Articles/788168/fneur-12-788168-HTML/image_m/fneur-12-788168-g001.jpg",
"https://www.frontiersin.org/files/Articles/788168/fneur-12-788168-HTML/image_m/fneur-12-788168-g002.jpg",
"https://www.frontiersin.org/files/Articles/788168/fneur-12-788168-HTML/image_m/fneur-12-788168-g003.jpg",
"https://www.frontiersin.org/files/Articles/788168/fneur-12-788168-HTML/image_m/fneur-12-788168-g004.jpg",
"https://www.frontiersin.org/files/Articles/788168/fneur-12-788168-HTML/image_m/fneur-12-788168-t001.jpg"
] |
[] |
[] |
[
"Adult-onset",
"leukoencephalopathy",
"Leukodystrophy",
"axonal spheroids",
"Pigmented glia",
"HDLS",
"ALSP",
"Csf1r"
] | null |
[
"David S",
"Stefanie N",
"Orthmann-Murphy",
"Zbigniew K"
] | null |
A comprehensive review of published literature was conducted to elucidate the genetics, neuropathology, imaging findings, prevalence, clinical course, diagno...
|
en
|
Frontiers
|
https://www.frontiersin.org/journals/neurology/articles/10.3389/fneur.2021.788168/full
|
Introduction
Adult-onset leukoencephalopathy with axonal spheroids and pigmented glia (ALSP) is a rare neurologic disorder that is characterized by demyelination of white matter of the brain, swollen axons and pigmented glial cells. The term ALSP encompasses two clinicopathologically similar entities that were previously known as hereditary diffuse leukoencephalopathy with spheroids (HDLS) and pigmentary orthochromatic leukodystrophy (POLD) (1). POLD was first described in 1936 in a family with adult-onset leukodystrophy (2). The term HDLS was first coined in 1984 to describe a Swedish family with adult-onset leukoencephalopathy in which axonal dilatations (spheroids) were a prominent feature (3). However, the original Swedish family (HDLS-S) was recently found to carry a different genetic makeup with the affected family members displaying the alanyl-transfer (t) RNA synthetase (AARS) gene mutation as the likely cause of Swedish type HDLS with spheroids (4). Thus, this family belongs to yet another class of genetic disorders identified as AARS-related leukoencephalopathy (5–7).
Several cases of POLD that fulfill all criteria for HDLS prior to the discovery of the AARS gene mutation causing HDLS in the Swedish family, except heritability, have been described in the literature. These cases are likely sporadic due to de novo mutations or issues of reduced disease penetrance (8, 9). Identification of common mutations in the kinase domain of CSF1R, a gene that regulates mononuclear cell lineages, including microglia in both HDLS and POLD (1), has provided additional evidence that HDLS and POLD should be regarded as a single disease entity (10, 11). In line with this, the diseases are now summarized as CSF1R-related leukoencephalopathy and for the purposes of this review are collectively referred to as ALSP.
The genetic, structural and neuropathophysiologic abnormalities of ALSP result in multiple neurologic symptoms, such as cognitive dysfunction, movement disorders, motor impairment, familial dementia and subcortical gliosis of the Neumann type and neuropsychiatric complications, that result in diminishing quality of life and eventual premature death (12–17). At present, some symptoms of ALSP are treated off-label with existing US Food and Drug Administration (FDA)-approved drugs that elicit variable levels of short-term efficacy. However, these symptomatic therapies have limited efficacy and do not target the etiology or the most debilitating symptoms, such as rapidly progressive cognitive impairment of ALSP (14). Future novel therapies that focus on the neuropathophysiologic features that underlie ALSP are essential to adequately reverse, delay or stop progression and improve quality of life in patients who are afflicted with this incapacitating disorder.
This review of the published literature was conducted to critically evaluate the clinical characteristics of ALSP as a foundation for rigorous strategy to develop therapeutic agents targeting ALSP. The review highlights key considerations for design of human clinical trials for ALSP including clinically meaningful and convergent endpoints that will lead to the development of safe and effective therapies for this orphan neurologic disorder.
Literature Search Strategy
Published data for the clinical characterization of ALSP were limited by the small number of patients who are afflicted with this adult-onset leukoencephalopathy. Observational case studies comprised the majority of publications for ALSP. The primary literature search for published and in-press clinical studies of ALSP were obtained from a MEDLINE search in the timeframe of January 1, 1980 through October 31, 2020. ALSP literature subsequent to October 31, 2020 was also monitored through MEDLINE. Literature relevant to proposed efficacy endpoints, future interventional clinical trials of ALSP and burden of care due to unmet medical needs was derived from MEDLINE and PUBMED during the above time periods. Review of all publications was restricted to articles in English or translated into English. The following primary search terms were utilized to identify ALSP-related publications:
• Adult-onset leukodystrophy with neuroaxonal spheroids and pigmented glia
• Adult-onset leukoencephalopathy with axonal spheroids and pigmented glia
• ALSP
• CSF1R-related leukoencephalopathy
• Hereditary diffuse leukoencephalopathy with spheroids
• HDLS
• Pigmentary type of orthochromatic leukodystrophy
• POLD.
Genetics
ALSP is primarily inherited as an autosomal dominant disorder with CSF1R gene mutations as the most common mutation to date (14, 18, 19). At least 106 different CSF1R mutations have been identified in approximately 300 cases published in the peer-reviewed literature worldwide (6, 17–32). There is no major correlation of genotype and phenotypes. Family members with identical CSF1R gene mutations do not share the same clinical phenotype (6, 14). However, patients harboring truncating mutations of CSF1R as well as those that lead to nonsense-mediated decay have been shown to have an earlier age of onset than ALSP patients with substitution mutations (32). Although de novo mutations of CSF1R have been reported, they are less common (9, 20). Penetrance of ALSP associated with CSF1R mutations is high, but incomplete, due to de novo mutations and genetic mosaicism (6, 9, 13, 33).
The non-mutated CSF1R gene consists of 22 exons. Its normal gene product is the CSF1R protein, a cell-surface transmembrane tyrosine kinase receptor with two known ligands for cytokine colony-stimulating factor 1 (CSF1) and IL-34. Most mutations of CSF1R that are associated with ALSP are located in the tyrosine kinase domain (TKD), most frequently in exons 18 and 19 (6). However, novel CSF1R variants in regions such as the signal peptide, immunoglobulin (Ig) domain, transmembrane domain, other exons of the TKD, and at the C-terminus, have been reported (6, 18, 21, 23, 31). Additionally, unique splice site variants, deletion/insertion mutations and frameshift mutations have been reported in introns and exons that span nearly all of CSF1R (6, 17, 19, 21, 23, 24, 26, 31). Figure 1 illustrates the location of CSF1R mutations in patients with CSF1R-related leukoencephalopathy. A more detailed presentation of genetic mutations in CSF1R-related leukoencephalopathy is provided in Supplementary Table 1.
FIGURE 1
Survival, development, proliferation, and activation of mononuclear phagocytic cells and central nervous system (CNS) microglia are regulated by CSF1R. CSF1R gene mutations are considered an underlying cause of primary brain microgliopathies and are linked to CNS damage of ALSP (20, 34–36).
Biallelic mutations in the AARS gene have been detected in approximately 20 patients with late-onset leukoencephalopathy who did not have a CSF1R mutation (37). The AARS2 gene encodes a mitochondrial enzyme that is essential for loading alanine onto tRNA during mitochondrial translation (37). Most of these patients displayed an autosomal recessive inheritance of AARS2-related leukoencephalopathy with symptoms and brain neuropathology similar to ALSP (37–40).
Both CSF1R- and AARS2-related leukoencephalopathy share several neurological symptoms and can present with similar white matter involvement, predominantly in the frontoparietal and periventricular regions. However, differences in radiologic images between patients with CSF1R and AARS2 gene encoding mutations have been reported in the corpus callosum, in regions with severe brain atrophy and in patients with AARS2 gene mutations lacking the unique ALSP-associated calcifications that are seen on computed tomography (CT) (13, 37, 41). Unlike CSF1R, the AARS2-related phenotype has not been restricted to adults, with some cases reported during adolescence (42). The changes in nomenclature for leukoencephalopathies are a result of additional understanding of pathology and genetics. The five main classifications of leukoencephalopathies are CSF1R-related leukoencephalopathy, AARS2-related leukoencephalopathy, AARS1-related leukoencephalopathy, HDLS-S-related leukoencephalopathy and CSF1R/AARS1/AARS2-negative ALSP. The last classification represents cases with a neuropathological diagnosis of ALSP without mutations in the CSF1R and AARS2 genes.
Further analyses of brain images and modern neuropathology are necessary to definitively characterize AARS2-related leukoencephalopathy. However, due to limited and conflicting data associated with AARS2, as well as no known molecular signaling convergence between CSF1R and AARS2, this clinical review has focused on the term ALSP, a CSF1R-related leukoencephalopathy.
Neuropathology
Histopathologic evaluation (light and electron microscopy) of brain tissue from biopsies and autopsies of patients with ALSP shows multiple morphologic alterations (6, 14, 17, 29, 43–46). One of the principal neuropathologies consists of vacuolated and demyelinated white matter that is found primarily within the corpus callosum, pyramidal tracts and periventricular region of the frontal and parietal lobes. The degenerate white matter is often associated with deteriorating neurons and axonal spheroids that contain neurofilaments, amyloid and ubiquitin. The axonal pathology is accompanied by macrophages that are engorged with lipid and myelin. Other characteristic neuropathological findings of ALSP include deformed astrocytes and pigmented (iron or lipofuscin) microglia cells that decrease in function and number with progression of the disorder. Representative lesions from cases of ALSP are shown in Figure 2.
FIGURE 2
ALSP is associated with leaky blood brain barrier (BBB) and cerebrovascular abnormalities similar to cerebral amyloid angiopathy (CAA) (47). Post-mortem brain sections from ALSP patients were stained for Claudin-5, a key mediator of tight junction function at the BBB in areas of dense amyloid-beta integrity and demonstrated a non-linear distribution of Celaudin-5 in tandem with extravasation of IgG and fibrinogen. These findings implicate BBB disruption. Perivascular localization of CD68- and CD163-positive cells in the brain of ALSP patients suggest that peripheral macrophages are recruited to the vasculature (47). Identification of donor chimerism in the CSF (cerebrospinal fluid) obtained from patients who underwent hematopoietic stem cell transplantation (HSCT) further supports this observation (48).
Additionally, the proinflammatory cytokine, granulocyte macrophage colony stimulating factor (GM-CSF), was shown to be significantly upregulated in the gray matter on post-mortem analysis of brain tissue from patients with ALSP and migration and adhesion-related molecules derived peripheral blood monocytes were also significantly upregulated, suggesting widespread immune dysfunction (28, 32). More robust characterization of the innate and adaptive immune system throughout the course of disease progression is warranted to understand its potential role in ALSP pathobiology.
Imaging
Magnetic resonance imaging (MRI) of patients with ALSP typically demonstrates abnormal white matter signal with hyperintense (T2) and fluid-attenuated inversion recovery (FLAIR) lesions and diffusion tensor imaging (DTI) identifies diffusion restriction lesions (6, 13, 49–52). Figure 3 presents the typical abnormal brain MRI findings in patients with ALSP.
FIGURE 3
White matter lesions are some of the most common neuroradiological findings on MRI in ALSP. They can be symmetric or asymmetric, patchy or confluent and tend to involve different lobes of the brain during the evolution of the disease. A study of 122 patients with ALSP and CSF1R mutations reported the presence of bilateral white matter lesions in 96% of the patients (13). Similarly, a subsequent MRI study found bilateral, predominantly frontal and parietal, T2/FLAIR white matter hyperintensities associated with T1 hypointensities in 16 patients with ALSP (22). This study also reported progression of white matter lesions on imaging in a subset of 13 patients with follow-up MRIs. White matter lesions were identified with either a patchy or confluent appearance and the occipital and temporal lobes showed white matter lesion involvement in later stages of the disease (51). A summary review of white matter lesions confirmed that they are often asymmetric, patchy, and focal especially in the early stages of the disease, but with time they become confluent (50). Lesions are found predominantly in frontoparietal and periventricular areas. Overall, previously published MRI data identify some distinctive features of white matter lesions in patients with ALSP. These data are included in the diagnostic criteria (53) that may prove useful in assessing disease progression.
Focal and global brain atrophy as well as thinning of cortex and corpus callosum are other hallmarks found in ALSP. Brain atrophy was shown in 94% of cases (15/16), predominant in the frontal (40%, 6/15) or frontoparietal (53%, 8/15) areas, and progressed in association with larger white matter lesions over time (22). Dilation of the lateral ventricles was identified in a population of 122 subjects (13). Thinning of the corpus callosum was evident in 88% (23/26) and cortical atrophy in 92% (24/26) of patients (13). Similarly, a case study revealed corpus callosum abnormalities were present in 81% (13/16) and atrophy in 88% (14/16) (22). A striking finding in ALSP in some patients is areas of diffusion restriction that can be confused with stroke (often leading to misdiagnosis), but do not occur in vascular distributions. In summary, MRI data across several studies consistently demonstrates brain volumetric changes including cortical and corpus callosum thinning in ALSP patients highlighting the importance of utilizing advanced analysis techniques for systematic investigation of regional brain volume and cortical thinning as imaging markers for progression of ALSP.
Overall, MRI, as a non-invasive approach, has consistently shown a variety of features of ALSP that demonstrate a strong radiological, pathological and clinical correlation. Four stages of ALSP have been described on the basis of degree of axon loss (54). Stage I is depicted as patchy axon decline in cerebral white matter without atrophy. Stage II reveals large patchy axon loss with slight atrophy of cerebral white matter and slight dilation of the lateral ventricles. Stage III presents wide-spread axon loss in cerebral white matter and dilation of the lateral and third ventricles without prominent axon loss in the brainstem and cerebellum. Stage IV is characterized by extensive damage of cerebral white matter with pronounced dilation of the ventricles and loss of axons in the brainstem and/or cerebellum. With MRI, patients with ALSP have been shown to exhibit bilateral asymmetric white matter lesions that were patchy (as described in histopathology of Stage I), particularly within frontal and parietal lobes in early stages of the disorder. These lesions become confluent and expand into temporal and occipital lobes in later stages of the disease (6, 13, 22, 50, 51), as shown in histopathology of ALSP during Stages III, IV. Based on clinical manifestations of the disease, a frontal lobe syndrome is typical in the early course of the disease and aligns with the histopathology and imaging findings. The thinning of corpus callosum is evident from histopathology of ALSP Stage I and is also evident in the early phases of the disease with MRI. Similarly, both histopathology and MRI indicate that ventricular dilation begins in relatively earlier stages of the disease with consistent progression. Consistent with histopathology, brain atrophy starts in the cerebrum and can affect other brain regions over time (22). Other common findings of histopathology and MRI includes thinning of cerebral cortex or cortical atrophy as well as degeneration of projection fibers (e.g., corticospinal tracts, internal capsule, pyramidal tracts). Notably, some features such as involvement of deep gray matter are rarely seen on MRI and are only present in histopathology of Stage IV. Contrast-enhanced MRI studies in genetically diagnosed ALSP have also revealed a breakdown of the BBB integrity as indicated by the perilesional accumulation of the contrast agent gadobenate-disodium (Gd-BOPTA) (47).
CT images have identified characteristic stepping-stone calcification of periventricular white matter near the frontal horns in up to 50% of patients with ALSP (6, 13) (Figure 4). Brain calcifications have been detected in patients with asymptomatic ALSP and the CSF1R mutation (13, 55). The relationship between formation of calcifications and the underlying disease mechanisms are unclear.
FIGURE 4
To date, alternate and advanced imaging techniques have been tested or proposed for use in ALSP and other leukodystrophies. For example, DTI, which quantifies the white matter integrity through analysis of water diffusivity, is a unique analysis technique applied to Diffusion Weighted Imaging (DWI) scans to characterize global diffusivity but also along specific directionality. A DTI study (56) was conducted in patients with leukodystrophy across different age groups and showed that DTI could be used to quantitatively capture changes in the white matter integrity in terms of magnitude and directionality and correlate the diffusivity abnormalities with ALSP progression, both spatially and temporally.
Magnetic resonance spectroscopy reveals markedly increased levels of cholin, myo-inositol and lactate and a decreased N-acetylaspartate peak in ALSP. These findings are clearly different from cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) (51).
Single photon emission computed tomography (SPECT) in combination with DaTscanTM I-123 ioflupane injection and positron emission computed tomography (PET) have been used for brain imaging of neurodegenerative disorders such as ALSP, Alzheimer's Disease (AD) and Parkinson's Disease (PD). These imaging techniques provide valuable information on clinical diagnosis, pathology, disease progression and patient care (57). For example, SPECT with DaTscanTM reveals loss of presynaptic dopamine transporter function in the striatum and 18F-[fluorodeoxyglucose] PET illustrates diffuse cortical hypometabolism primarily in fronto-parietal areas of patients with ALSP (1, 6, 58). Finally, optical coherence tomographic imaging has also shown atrophy of the retinal nerve consistent with optic tract degeneration in a single case of ALSP (59).
Prevalence
Mendelian adult-onset leukodystrophies are a spectrum of rare, chronic, complex and progressive neurologic disorders that affect the white matter of the CNS, with a total estimated global prevalence of 300 cases per million (60). However, dedicated epidemiological studies are missing to support the available prevalence data. The worldwide incidence of these disorders has more recently been reported to be 5 per 100,000 (61). Future studies are critical to fully evaluate the epidemiology of adult-onset leukodystrophies.
Historically, the diagnosis of ALSP was previously dependent on histopathologic findings from brain biopsies or autopsies. The number of patients who were definitively diagnosed with ALSP was extremely limited until the discovery of CSF1R-related gene mutations. Although still rare, genetically diagnosed CSF1R-related ALSP has been increasingly recognized around the world (identified in Canada, China, Croatia, Germany, Italy, Japan, Netherlands, Norway, Poland, Saudi Arabia, Sweden, South Korea, Taiwan, United Kingdom, and United States) since 2012. Therefore, this disease obviously has global distribution and many patients may still be underdiagnosed (6).
In a series of leukodystrophy cases, 12 probands or cases with mutations in the CSF1R gene were identified (58). These mutations were responsible for 11% (12 of 114) of the overall series, including 7% (6 of 88) of the clinical series of patients with leukodystrophy on brain MRI and 20% (5 of 25) of the patients with a histopathological diagnosis of HDLS. In a smaller series in which 25 patients with adult-onset leukoencephalopathy of unknown cause were screened for mutations in the CSF1R gene, six patients (24%) showed a CSF1R mutation (9).
One study estimated the frequency of CSF1R-related leukoencephalopathy at 10% (5 of 48) of adult-onset leukoencephalopathies and suggested that it could be the most common type (5). Approximately one-third of patients with genetically proven CSF1R-related ALSP have been reported in the adult-onset leukoencephalopathy population in Japan (13). Based on an increasing number of such case report studies, patients with CSF1R-related ALSP constitute an overall global incidence range of 10-25% of the adult-onset leukodystrophy population (14).
As of 20 May 2021, based upon the available peer-reviewed literature, the total estimated global prevalence of mendelian adult-onset leukodystrophies is 300 cases/million and 10-25% of those cases are projected to be CSF1R-related ALSP patients. In the United States population, the estimated prevalence of CSF1R-related ALSP patients is 9,970-24,926 (60). Additional epidemiological studies are warranted to fully characterize the prevalence of ALSP.
Clinical Course
The mean age for onset of symptoms of ALSP is primarily in the 4th decade but can span from early adulthood to the 8th decade (14). The cumulative incidence of CSF1R-associated ALSP increases from 10% at 27 years of age, to 50% at 43 years of age and to 95% at 60 years of age, for a median age of 43 years (13). One of the few large case studies and literature reviews (122 patients) reported that the onset of ALSP symptoms occurs on average earlier in women (40 years) than in men (47 years) (13). Progression of the disorder from onset of symptoms to death varies from 2 to >30 years (mean, 6-8 years) (13, 62).
ALSP is clinically delineated by cognitive dysfunction with neuropsychiatric and motor symptoms. Signs and symptoms tend to be non-specific in the early stages of the disorder and may be difficult to distinguish from other neurological disorders in the absence of genetic confirmation of CSF1R gene mutations. The presenting cognitive, neuropsychiatric and motor symptoms and the rate of progression of symptoms varies among patients and within family members who carry the same CSF1R mutation (14). A frontal lobe syndrome, which is characterized by cognitive impairment, neuropsychiatric changes (depression, minimal social inhibition and poor insight) and limited motor dysfunction, is usually detected during the early stages of ALSP, and some patients may exhibit mild seizures (14, 53, 63).
The type and incidence of initial core clinical symptoms of ALSP were rigorously evaluated in a case series and literature review of 106 out of 122 male and female patients diagnosed with ALSP (13). Cognitive impairment (59%), neuropsychiatric symptoms (44%) including anxiety, depression, apathy, indifference, abulia, irritability, disinhibition and distraction, motor dysfunction (38%) involving parkinsonian symptoms, gait disturbances and spasticity, speech difficulty (19%) and other symptoms (8%) including stroke-like episodes, sensory dysfunction, dizziness, fatigue and epilepsy, were reported in the early stages of ALSP. Approximately half of the 106 cases presented with 2 or more symptoms during early onset of ALSP. The rate of motor dysfunction was higher than the rate of cognitive impairment in women aged 20-29 years.
Progression of the neuropsychiatric aspects of ALSP can lead to further cognitive decline, severe depression, apathy, anxiety, irritability and familial dementia and subcortical gliosis of the Neumann type. Progressive motor symptoms are numerous and often include parkinsonian signs, such as tremor, rigidity, bradykinesia and postural instability. Additional progressive symptoms involve higher cortical functions (aphasia, agraphia, acalculia and very frequently apraxia), pyramidal detriments (hyperreflexia, hypertonia, spasticity and bilateral Babinski signs), bulbar signs (dysarthria, dysphagia and slurred speech), cerebellar abnormalities (ataxia, dysmetria, intention tremor and gait disturbances), and seizures. Development of sensory symptoms involve a diminished sense of vibration, position, touch and pain perception (6, 13, 14).
Rare progressive events of ALSP may include stroke-like episodes, bone cysts and optic and peripheral nerve dysfunction (6, 13, 14). Progression of the cognitive and motor deficits elicits a significant diminution in quality of life and disruption of employment. In the final stages of the disorder, loss of speech and voluntary movements, confinement to bed and a vegetative state are evident. Infections such as pneumonia often result in death (14).
Diagnosis and Clinical Evaluation
The diagnosis of ALSP requires exclusion of autosomal dominant disorders with symptoms that overlap with ALSP, including Alexander disease (bulbar/pseudo bulbar signs, ataxia and spasticity), adult-onset autosomal dominant leukodystrophy (ADLD) (impaired cognition, pyramidal and cerebellar signs), cerebral autosomal dominant arteriopathy (subcortical infarcts and leukoencephalopathy, frontal lobe syndrome and white matter lesions), frontotemporal dementia (FTD) (frontal lobe pathology and pyramidal/extrapyramidal signs) and early-onset AD (executive dysfunction, personality derangement and similar onset of age) (14). Several other disorders such as autosomal recessive or X-linked leukodystrophies (vanishing white matter disease, metachromatic leukodystrophy, Krabbe's disease or X-linked adrenoleukodystrophy) as well as mitochondrial diseases (e.g., Leigh syndrome) have overlapping clinical symptoms with ALSP (14) and further complicate the differential diagnosis of ALSP, confirming the need for genetic testing, such as a leukodystrophy panel or whole exome testing (no family history) or gene testing (known family history).
Diagnosis of suspected ALSP is a multistep process (14, 30, 53, 64) that is typically initiated in patients, with a positive family history, who exhibit one or more of a variety of characteristic symptoms, such as personality changes, impaired cognition, memory derangement, bouts of depression or motor dysfunction, such as muscle weakness, impaired gait, slow movement, rigidity and tremor. MRI scans show distinctive radiological signs that are used to identify white matter lesions in the frontal region, corpus callosum and corticospinal tracts of the brain, as well as recognize enlarged ventricles due to cerebral atrophy.
A three-step MRI differential diagnostic approach has been proposed for several adult leukodystrophies, including ALSP. The first step involves identification of symmetric white matter. The second step consists of classification of the white matter into one or more of six patterns (parietal-occipital, frontal, periventricular, subcortical, brainstem involvement, and cerebellar involvement). The third step entails evaluation of five distinct characteristics (enhancement, lesions with signal intensity similar to CSF, susceptibility-weighted MRI signal intensity abnormalities, atypical peaks of MRI spectroscopy and spinal cord involvement) (65).
Medical history of family members can inform if ALSP is present in the lineage. The diagnosis of ALSP is verified through genetic testing and identification of a mutated CSF1R gene in most patients who are afflicted with ALSP (13, 14, 22, 30, 31, 53, 66).
Diagnostic criteria for CSFIR-related ALSP without a genetic test diagnosis have been developed and validated through a retrospective case study (Supplementary Table 2) (53), although a genetic test is recommended and finding of a known pathogenic CSF1R mutation supercedes these criteria. “Probable” and “possible” diagnostic designations were the outcomes based upon retrospectively specified clinical characteristics of ALSP, including age at onset ≤ 60 years, >2 impairments (e.g., cognitive, pyramidal, Parkinsonism or epilepsy), autosomal dominant inheritance and brain MRI/CT findings, such as bilateral cerebral white matter lesions and thinning of corpus callosum. Among the 83 patients that were positive for a CSF1R mutation, 50 (60%) had a “probable” diagnosis and 32 (39%) had a “possible” diagnosis of ALSP, resulting in a high level of sensitivity.
The specificity of an MRI diagnosis for CSF1R-related leukoencephalopathy was determined by retrospective evaluation of 53 cases of CSF1R-mutation-negative leukoencephalopathy and 32 cases of CADASIL. The MRI diagnostic algorithm excluded 22 cases (42%) that were negative for a CSF1R mutation and 28 cases (88%) that had a diagnosis of CADASIL. Moderate specificity for accurate diagnosis of CSF1R-related leukoencephalopathy relative to mutation-negative cases and the high specificity of CSF1R-related leukoencephalopathy relative to CADASIL cases were confirmed by this MRI diagnostic platform (53).
A more recent case study of 135 patients who were suspected of having adult-onset leukoencephalopathy due to CSF1R mutation was conducted to further evaluate the sensitivity and selectivity of diagnostic factors (30). As a result of genetic testing, 28 cases were positive for a CSF1R mutation and 107 cases were negative for a CSF1R mutation. Younger age at onset, Parkinsonian symptoms, reduction in the corpus callosum volume and presence of diffusion- restricted lesions were important predictors of CSF1R-positive cases whereas involuntary movements and brain stem or cerebellar atrophy were poor predictors of CSF1R-positive cases. The model confirmed high sensitivity for probable or possible CSF1R-related leukoencephalopathy at 81%, but like many models, suffered from lack of specificity at 14%.
Due to the above studies, the diagnostic accuracy for CSF1R-related leukoencephalopathy has significantly improved in recent years. After diagnosis of ALSP, clinical evaluations by a neurologist, psychiatrist, orthopedist, physical therapist and occupational therapist are periodically conducted for surveillance and for the treatment of symptoms with progression of the disorder. These assessments involve neurologic examination with cognitive and psychiatric evaluations, MRI of the brain for white matter lesions, brain atrophy and thinned corpus callosum and electroencephalograms (EEGs) for suspected seizures. Lumbar punctures have been proposed for the assessment of protein and cellular content. While not yet measured routinely for clinical management, serum NfL is an easily accessible, putative biomarker for following native disease course in ALSP (67) and potential treatment response.
Current Treatment For Management of Symptoms
Currently, there are no regulatory-approved, disease modifying therapies for ALSP. Symptomatic treatments target the temporary relief of motor, mood and behavior symptoms and provide supportive care with the goal of maintaining quality of life as the disorder progresses (6). Although several regulatory-approved pharmacotherapies are prescribed off-label to treat the symptoms of ALSP, such as spasticity or seizures, that are comparable to those of other neurologic disorders (14), none of these pharmacotherapies target the cause or slow the progression of ALSP.
Dopaminergic drugs are used off-label to treat Parkinsonian symptoms with limited effectiveness because dopaminergic neurons are usually unaffected in the substantia nigra of patients with ALSP (68). As some symptoms of ALSP are similar to those of patients with AD, cholinesterase inhibitors have been prescribed but elicit minimal stabilization of symptoms of cognitive deficiency in patients with ALSP (69).
Antidepressants offer modest short-term efficacy for depression (14) and antipsychotic drugs are occasionally prescribed with caution for patients with ALSP because of the side effects including extrapyramidal symptoms and safety issues. There is risk of suicidal ideation associated with these agents but they may be useful in highly aggressive patients (14). Muscle relaxants for spasticity, anti-epileptic medications (e.g., benzodiazepines, gabapentin, valproic acid) generalized epileptic seizures and antibiotics for pneumonia and urinary tract infections have shown some benefit in patients with ALSP (6). Patients with ALSP generally fail to respond to immunomodulators, such as steroids, interferon and cyclophosphamide (6). The efficacy of other approaches, such as allogeneic HSCT (27, 48, 70, 71) and pre-symptomatic immunosuppression (72) have shown potential effectiveness in small retrospective case reports but have not yet been tested in controlled clinical trials.
Food consumption patterns and nutrition should be monitored throughout the disease course, as symptoms of ALSP can include dysphagia and gastrointestinal dysfunction, such as constipation and fecal incontinence. Urinary or urge incontinence may be alleviated by medication, scheduled toileting and intermittent or permanent catheterization of the urinary bladder. Physical, occupational and speech therapy are essential to maintain patient mobility, self-dependence and execution of daily living for as long as possible. Professional counseling is important to educate the patient and relatives on the symptoms and progression of ALSP and ensure a supportive family structure. However, due to the rareness of the disease, only a small number of experts in ALSP are available. Genetic counseling of the patient and relatives is necessary to explain the probability of inheritance and assist in the decision making of genetic testing of relatives (6, 14, 44). Referral to leukodystrophy communities/relevant foundations (e.g., Sisters' Hope Foundation) is essential for ongoing patient, family and caregiver support.
Potential Neuropathophysiologic Biomarkers
A limited number of clinical case studies have been performed to evaluate the neuropathophysiologic biomarkers of ALSP. Abnormal levels of cytoskeletal proteins, such as NfL protein, tau protein, and glial fibrillary acid, were originally identified as potential biomarkers in 4 cases of ALSP (33, 62). In a more recent small study of 4 patients with CSF1R-mutation-positive ALSP, profiling of peripheral blood mononuclear cells (PBMCs) showed a basal proinflammatory phenotype (28).
NfL proteins support the cytoskeleton of neurons and myelinated axons, and elevated levels of NfL in CSF and blood are believed to be indicative of neuron death and axonal deterioration in a growing number of neurodegenerative disorders, including AD, PD, FTD, Lewy body dementia (LBD), progressive supranuclear palsy (PSP), Down syndrome, multiple sclerosis (MS), amyotrophic lateral sclerosis (ALS), Huntington's disease, X-linked adrenoleukodystrophy, spinocerebellar ataxia and Charcot-Marie-Tooth disease (73–85). A recent case control study demonstrated that serum and CSF levels of NfL protein were markedly higher in patients with symptomatic or presymptomatic (i.e., carriers) CSF1R-mutation-positive ALSP vs. that in healthy control subjects or in patients with MS (67). NfL protein levels in CSF were over 30-fold higher in patients with CSF1R-mutation-positive ALSP than in age-matched control subjects and serum NfL protein levels were significantly higher in symptomatic patients compared to presymptomatic CSF1R mutation carriers. Comparatively, patients with AD, ALS, FTD, LBD, and PSP have been shown to have CSF NfL levels approximately 2.3-fold, 7.2-fold, 3-fold, 2.8-fold, and 3.5-fold higher than healthy controls, respectively (82). Based on compelling evidence from case studies of ALSP and other neurodegenerative disorders, levels of NfL protein in serum and CSF may be predictive of clinical efficacy and should be rigorously tested as a potential biomarker and surrogate clinical endpoint for future clinical trials of therapeutic agents for ALSP.
Tau proteins regulate stability of microtubules in axons and neurons of the CNS. Abnormal levels of total tau protein concentrations (tauopathies) in CSF have been identified as a potential therapeutic biomarker in several neurodegenerative disorders, including AD, PD, progressive supranuclear palsy and ALSP (14, 86–88). Glial fibrillary acidic protein reinforces the cytoskeleton of astrocytes and increased expression often correlates with various types of neurodegenerative pathology. Increased concentrations of this protein have been observed in patients with ALSP and in patients with brain injuries (14, 89). Tau and glial fibrillary acidic proteins should also undergo further evaluation as potential biomarkers and surrogate endpoints for clinical trials of therapeutic agents for ALSP.
Current and Proposed Interventional Clinical Studies of Therapeutics
Information on the use of HSCT for the treatment of ALSP is derived from four case studies with a limited number of patients (n=11) and inadequate controls. In the earliest case study, 1 of 4 siblings with ALSP underwent an allogeneic HSCT and experienced stabilization of ALSP symptoms and personality within 6 months, together with no progression in motor symptoms over the next 15 years (70). However, as the authors point out, the stabilization of symptoms in this transplanted patient may have developed spontaneously and therefore was potentially unrelated to HSCT. In a second case study of a single ALSP patient (71), the patient displayed deterioration with pyramidal symptoms and was confined to a wheelchair after 3 months of HSCT. Complications during HSCT involved hemorrhagic cystitis and pyelonephritis but both resolved after 6 months. Some stabilization of neurologic symptoms began at 6 months after allogeneic HSCT. Modest improvement in symptoms of ALSP occurred during the 30-month post-transplant period, including minimal limb mobility and stabilized cognition and mood on the Expanded Disability Status Scale (EDSS), concomitant with a decrease in lesions in the white matter through diffusion weighted imaging and reduced FLAIR hyperintensities on MRI. In a third case study of 2 patients with ALSP (27), some stabilization of cognitive deficits, functional status and gait impairment occurred over 2 years after transplant despite some continued neurological deterioration. There was no evidence of graft vs. host disease (GVHD), but a major infection developed in one patient and seizures were evident in the other patient. MRI scans of the brain demonstrated stabilization of FLAIR-related lesions in the white matter at 1 year, with continued stabilization over 2 years post-transplant. In a fourth case study, seven ALSP patients received HSCT at different stages of the disease (48) to determine the effect on progression. Six of the seven patients had several clinical evaluations at various time points post-transplant (one patient died post-transplant) and trended toward stabilization on motor examinations, cognitive scores and/or MIR abnormalities. Other minor clinical improvements tended to be empirical and subject to investigator bias because a negative control group was not included. Three patients developed GVHD. Overall, the four published case studies of HSCT with limited numbers of patients (n = 11) showed minimal to modest stabilization or improvement of ALSP symptoms with significant safety concerns including death of one patient.
Although the data on HSCT in ALSP are limited, given the challenges and risks of HSCT for the treatment of leukodystrophies and associated complications, clinical guidelines have been developed for pediatric patients with leukodystrophies and are likely applicable to adult patients as well (90). These guidelines focus on the assessment depending on the type of HSCT, patient eligibility, donor selection, conditioning regimen, pre-transplantation, supportive care and posttransplant follow-up. Early detection and therapy of leukodystrophies are highly recommended along with a close working relationship between families of patients and healthcare providers.
Microglial replacement, which represents a potential therapy for CSF1R-related leukoencephalopathy, has been the focal point of intense non-clinical research and may enter into clinical studies in the near future (91). Microglia are resident, innate immunity cells of CNS that monitor and maintain the robust physiology of the CNS. Microglia respond to various types of cellular and metabolic distress signals in the CNS and regulate responses for repair and remyelination of nerve fibers, phagocytosis of dead cells, maintenance of synapses and blood vessels and control of neuroinflammation associated with infection and carcinoma. The CSF1R cell-surface receptor is expressed predominantly on microglia in the brain (92) and in the spleen, placenta and appendix according to the Human Protein Atlas. Mutations of the CSF1R gene codes are transcribed to mutant CSF1R protein with suboptimal receptor function that leads to dysfunctional monocytic lineage cells with reduced survival and abnormal distribution (93). Thus, impaired microglia are recognized as a primary causative factor underlying CSF1R-related leukoencephalopathy.
The strong link between CSF1R mutations and pathologic microglia has resulted in further classification of CSF1R-related leukoencephalopathy as a CNS primary microgliopathy (91). Replacement of microglia by proliferation of resident microglia, infiltration of microglia-like cells and HSCT (described above) have been evaluated as therapeutic approaches for CSF1R-related leukoencephalopathy in mouse models and shown preliminary evidence of efficacy (91). Future human case studies and clinical trials of these microglial replacement therapies will assess the efficacy and safety in patients with ALSP.
The response of microglial cells to changes in the environment of the CNS is activated through a triggering receptor on myeloid cells 2 (TREM2) and its associated protein kinase complex, kDa transmembrane protein (DAP12) (94). The TREM2/DAP12 complex initiates a signaling cascade, including phosphorylation of the spleen tyrosine kinase (SYK). This phosphorylation subsequently activates multiple intracellular pathways of microglia controlled by TREM2 signaling cascades, including phosphatidylinositol 3-kinase, protein kinase C, extracellular regulated kinase, Akt serine/threonine kinase and the elevation of intracellular calcium (95, 96). TREM2-mediated activation pathways include phagocytosis, cell survival and proliferation, modulation of inflammation and regulation of lipid metabolism (97, 98) potentially enabling neuroprotection and nerve tissue regeneration. Mutations in TREM2/DAP12 are associated with the autosomal recessive disorder Nasu-Hakola disease, which is characterized by bone cysts, muscle wasting, and demyelination phenotypes (58). Animal and human genetic studies have demonstrated that microglia without TREM2 or with mutated TREM2 do not convert to an activated stage and subsequently lead to development and/or progression of neurologic disorders. Furthermore, animal models of PD, AD, ALS and demyelinating disease display dysregulation of TREM2/DAP12 signals that promotes pathogenesis of neurodegeneration (94). Based on extensive biochemical research, CSF1R and TREM2 share significant portions of their signaling function that converge via DAP12 and SYK phosphorylation. ALSP is presumably caused by haploinsufficiency of CSF1R due to inactivating mutations, usually in the kinase domain, which results in dysfunctional microglia leading to neurodegenerative pathology, such as neuroinflammation, dementia, and white matter loss (29). Therefore, the signaling pathway convergence between TREM2 and CSF1R, shown in Figure 4, provides the possibility for TREM2 activation to rescue or compensate for CSF1R loss of function (94).
It is apparent that there is dearth of therapies that directly target the etiology of ALSP. Clinical studies should be conducted to develop safe and effective therapies that address the etiology of ALSP, a rare, debilitating and life-threatening neurologic disorder.
Potential Efficacy Endpoints For Future Interventional Trials
Due to the relatively recent identification of the CSF1R gene mutations, specific clinical trial methodologies for ALSP are still evolving. Meaningful biomarkers and efficacy endpoints that capture disease progression will be essential for interventional clinical trials of ALSP. Based upon case studies of ALSP, neuroimaging markers (MRI and CT) and clinician- and patient-rated scales for cognitive, psychiatric and motor dysfunction, coupled with global impression of change assessments, quality of life and disability evaluations, will likely yield convergent endpoints to evaluate efficacy and justify clinical meaningfulness of novel therapeutic agents. Given the similarity of some signs and symptoms of ALSP with FTD, PD and MS, some of the clinical trial methodologies for efficacy endpoints of the related neurologic disorders may be applicable to clinical trials of ALSP.
Cognitive Decline
Cognitive decline is a clinically significant symptom of ALSP that presents early in the disorder and progresses rapidly (6, 14). In view of this finding, identification of cognitive assessments that capture deficits and decline is an important predictive clinical endpoint for interventional clinical trials of ALSP. Effective scales for measurement of cognitive decline should be fully validated, have inter-relater reliability, show sensitivity to early cognitive changes as well capture decline during progression of the disease and be acceptable to both the patient and assessor (99). Reports of the performance of patients with ALSP on specific cognitive tests have been limited to case reports (63). Given these limitations and the known localization of pathology in patients with ALSP, cognitive tests probing frontal lobe functions, both cortical and subcortical, including attention, processing speed, working memory and cognitive flexibility, are of particular interest.
The Montreal Cognitive Assessment (MoCA) is a validated tool for rapid screening of mild cognitive impairment (100, 101). The MoCA is extensively used as a clinical trial endpoint and for clinical screening in practices to measure cognitive dysfunction in patients with PD or dementia because of its high sensitivity (100%) and specificity (87%) (102, 103).
Other commonly used assessment scales for cognitive decline are the Mini-Mental State Examination (MMSE) (104) and Mini-Cog Test (105). The MMSE has acceptable test-retest and inter-relater reliability, with a sensitivity of 69-91% and a specificity of 87-99% (103). The MMSE has advantages over other scales because of its ability to quantitate cognitive dysfunction over time and to definitively assess treatment effects in clinical trials. A disadvantage of MMSE is its lack of sensibility to mild cognitive disruptions, particularly those related to frontal lobe dysfunction (106).
Several other cognitive tests may be appropriate for ALSP clinical trials. The Trail Making Test (TMT) measures cognition related to processing speed, sequencing, mental flexibility and visual/motor skills (107). The Wisconsin Card Sorting Test (WCST) is aimed at higher level cognitive processes, such as attention, perseverance, abstract thinking and adaption to change (108). The WCST employs two card packs with four stimulus cards and 64 response cards in each pack. The Symbol Digit Modalities Test (SDMT) examines divided attention, visual scanning, tracking, processing speed and motor speed (109). A smartphone-based symbol-digit SDMT has recently been developed to reduce the time of the test (110). The Verbal Fluency Test is primarily designed to measure executive dysfunction (111). The Stroop Color and Word Test (SCWT) assesses the ability to inhibit cognitive interference that takes place when the processing of an initial stimulus affects the simultaneous processing of a second stimulus (112). Due to the reduced capacity of ALSP patients to focus on tasks for a prolonged period of time along with loss of speech and dysfunctional arms and hands, it will be critical to select a battery of cognitive tests that have the flexibility to conduct simple and time expedient verbal or written versions.
Additional clinical scales of cognitive dysfunction that have the potential to yield endpoints for clinical trials of ALSP are the well-known CERAD test battery for AD, Saint Louis University Mental Status (SLUMS) (113), the Memory Impairment Screen (MIS) (114, 115), Clock Drawing Test (CDT) (116), Clinical Dementia Rating (CDR) scale (117), CDR plus National Alzheimer's Coordinating Center Frontotemporal Lobar Degeneration (FTLD) rating (118) and Neuropsychiatry Unit Cognitive Assessment Tool (NUCOG) (119). These scales (described in Supplementary Table 3) are semi-quantitative and have acceptable levels of sensitivity and specificity. Further evaluation of these scales will determine their degree of applicability as endpoints for therapeutic clinical trials of ALSP.
Motor and Sensory Dysfunctions
Scales that are specifically designed to score motor and sensory dysfunctions of ALSP are not currently available. As the early and progressive stages of ALSP display some motor and non-motor symptoms that are comparable to PD (14), scales used in PD clinical trials may serve as predictive clinical endpoints for interventional clinical trials of ALSP.
Based upon the four components of the Movement Disorder Society (MDS)-sponsored revision (120) of the Unified Parkinson's Disease Rating Scale (MDS-UPDRS), this validated scoring system may be applicable to ALSP. The MDS-UPDRS items are rated by clinicians, patients or both. There are four main components each of which includes several questions related to sensory and motor disabilities. With the exclusion of part 4 which quantifies complications of dopamine replacement therapies, the MDS-UPDRS is a comprehensive scoring tool for motor and sensory complications and quality of life and, therefore, may serve as a clinically meaningful and predictive endpoint to assess therapies in interventional clinical trials of ALSP. However, the overlapping pyramidal and extrapyramidal symptoms in ALSP may introduce scoring limitations and should be considered during the endpoint selection process.
The EDSS is a frequently used disability scale for clinical trials in MS with high relevance to symptoms and functions of patients with ALSP (121). Due to some similarity in the symptoms of ALSP and MS, the EDSS may be another tool to quantify disability endpoints over time in clinical trials of ALSP. The following functional systems are rated: pyramidal (muscle weakness), cerebellar (ataxia, loss of balance, tremor), brainstem (speech problems, swallowing, nystagmus), sensory (numbness, loss of sensation), bowel and bladder (incontinence), visual and cerebral (thinking, memory, fatigue), walking distance and usage of walking aid and/or extension wheelchair.
Several tools that directly measure how a patient functions (gait, strength, spasticity) or feels may provide clinically meaningful endpoints for clinical trials in ALSP. Measurement of the distance walked within a specific time period is evaluated by the 2- or 6-min walk test (122). The Timed Up and Go (TUG) test identifies mobility and balance abnormalities. (123). The Spastic Paraplegia Rating Scale (SPRS) is a reliable and validated measurement of the severity and progression of spasticity (124). Limb and muscle spasticity can also be scored by the Modified Ashworth Scale (MAS), a scale that is widely used in clinical practice for rating the spasticity of extremities and in clinical trials for an assessment of the therapeutic efficacy of spasticity (125).
Impaired Activities of Daily Living and Physical and Behavioral Dysfunction
Several scales rate the patient's feelings about how daily activities of life are affected by their health disorder. These additional scales may serve as congruent, clinically predictive endpoints of efficacy in clinical trials of therapeutic agents for ALSP. The Goal Attainment Scale (GAS) is a clinician- and patient-scored tool that rates three health goals that are developed by the patient. The patient's progress toward goal achievement is evaluated on a five-point scale from −2 (unfavorable) to +2 (best anticipated outcome) (126). The visual analog scale (VAS) (127), Clinical Global Impressions of Severity (CGI-S) and Improvement (CGI-I) (128), 36-item Short Form Health Survey (SF-36) (129) and Schwab and England Activities of Daily Living (ADL) for PD (130) (described in Supplementary Table 4) are widely accepted global scoring systems for MS and PD and, therefore, may be beneficial for patient and clinician assessment of the dysfunctional effects of ALSP on activities of daily life. Disability and functional scales (described in Supplementary Table 4), such as the Total Functional Capacity (TFC) for Huntington's Disease (131), the Karnofsky Performance Status (KPS) (132) and the Cortical Basal ganglia Functional Scale (CBFS) (133) may also prove to yield clinically meaningful endpoints for ALSP clinical trials. The EuroQOL 5 dimensions questionnaire (EQ-SD) scale is used for MS patients and may be applicable to ALSP (134).
Scales that measure behavioral impairment of patients are likely to generate clinically meaningful data in clinical trials of ALSP (Supplementary Table 5). These widely used neuropsychiatric tools evaluate depression with the Hamilton Rating Scale for Depression (HAM-D) (135, 136) and the Beck Depression Inventory (BDI) (137, 138) and psychosis using the Neuropsychiatric Interview (NPI) (139). Hospital, anxiety, depression scale (HADS) is a useful self-assessment scale for anxiety and depression and a screening tool for mood disorders (140).
Given the severity and devastating progression of ALSP, it will be meaningful to evaluate the behavioral burden that affects the daily lives of caregivers. The Zarit Burden Interview (ZBI) is a commonly used measure of caregiver burden (141). This scoring system covers a wide range of dimensions that include consequences of caregiving, patient dependence, exhaustion and uncertainty, guilt or self-criticism, embarrassment, anger or frustration, psychological burden, emotional reactions and personal/role strain. ZBI has shown acceptable internal consistency and excellent reliability and validity in patients with dementia (142).
Finally, given the heterogeneity of potential symptom presentations and combinations in ALSP, particularly in the early symptomatic stages, patient-specific and patient-centered outcome measures may also be valuable approaches (143).
Magnetic Resonance Imaging and Other Biomarker Surrogates
Analysis of MRI scans has demonstrated that white matter damage is a congruous finding in most patients with ALSP. White matter abnormalities occur early and are progressive. Given the rapid confluence of patchy or focal T2-weighted hyperintensities and progression of cortical atrophy during the course of ALSP, longitudinal MRI scans on a yearly follow-up basis after diagnosis of ALSP have been recommended to generate a more accurate prognosis of the disorder (14) and may serve as reliable surrogate endpoints for clinical trials.
The MRI severity scoring system, which was developed based on MRI scans of 15 patients with ALSP, may serve as an endpoint for interventional trials of ALSP. The semi-quantitative severity scoring of white matter lesions and brain atrophy is based on a range of 0 (minimal severity) to 57 (maximum severity). Analysis of MRI scans from these 15 patients showed that 14 of the patients (93%) had white matter lesions and the mean total severity score was 16.6 points (range, 10-33.5 points). Although this MRI scoring system shows promise, it requires further validation by prospective longitudinal studies of additional patients and a standard imaging protocol (50, 53).
A widely used scoring method for MRIs of leukodystrophies, the Loes severity score, may also serve as a surrogate clinical endpoint for ALSP clinical trials. This scoring method employs a severity score of 0-34 points for white matter lesions and, with minor modifications, has the capability to detect progression, stabilization and improvement of multiple leukodystrophies (144). Definitive longitudinal MRI studies of progression of white matter abnormalities have not been conducted in patients with ALSP. In one case study of a family in which seven members were diagnosed with HDLS, sequential images in the proband (one MRI at the onset of the disorder and two MRIs during the follow-up period) displayed a progressive, confluent frontal predominant HDLS with symmetrical cortical atrophy (49).
Longitudinal MRI alterations were also detected in seven patients with HDLS through the MRI rating scale. Total MRI scores varied from 12 to 44, white matter lesion scores ranged from 11 to 32 and atrophy scores ranged from 1 to 12. The severity of MRI scores increased significantly with the duration of HDLS (total score, p < 0.01, white matter lesion score, p < 0.01 and atrophy score, p < 0.01). The mean changes in scores on a year basis were 3.7 ± 1.5 for the total score, 2.5 ± 1.1 for white matter lesion score and 1.3 ± 0.5 for the atrophy score (52).
Rapid Estimation of Myelin for Diagnostic Imaging provides a validated and robust myelin quantification that detects diffuse demyelination in normal-appearing tissue in MS (145). This demyelination is associated with both cognitive and clinical disability. Because the technique is rapid with automatic postprocessing and U.S. FDA approval, it may be a clinically feasible biomarker suitable for monitoring myelin dynamics and evaluation of treatments aimed at remyelination of ALSP.
Biochemical assays of levels of various soluble biomarkers in CSF (tau proteins, NfL proteins and glial fibrillary acidic protein) and in plasma (NfL) of ALSP patients may serve as meaningful surrogate endpoints for clinical trials (14, 20, 24, 40, 67, 86). These biomarkers are etiologic factors that underlie neural, axonal and glial cell damage, and may be considered as trial endpoints in conjunction with MRI analysis. Further development and validation of such assays are important for early translational trials in ALSP.
Digital Biomarkers
Traditional methods of assessing neuromotor disorders, such as clinical rating scales, are subjective and prone to human bias. During the last decade, a multitude of technology-based objective measures of human behavior and function have been developed, bringing with them the promise of substantial change to the diagnostic, monitoring and therapeutic landscape in neurodegenerative diseases (146, 147). Sensors, mobile communications, cloud computing, advanced analytics and the Internet of Things (wireless connectivity of all electronic devices) are among the innovations that have the potential to transform healthcare and the approach to patients with chronic, complex and fluctuating disorders (148). These devices offer potential novel approaches to more accurately assess motor dysfunction in interventional clinical trials of ALSP.
Wearable activity trackers are electronic monitoring devices that enable users to track and monitor their health-related physical fitness metrics, including the number of steps taken, level of activity, walking distance, heart rate and sleep patterns. Despite the proliferation of these devices in various contexts of use and rising research interest, there is limited understanding of the broad research landscape (149).
Although commercial grade activity monitors like Fitbits and the Apple Watch provide objective data, the results are limited to activity tracking only. Medical-grade wearable precision motion sensor solutions overcome these limitations. Such platforms can deliver objective, high-frequency data combined with scientifically validated endpoints that are specific to a patient population (148).
The use of consumer wearable technologies in medicine is becoming increasingly more common. For instance, in the field of sleep medicine, the use of actigraphy for sleep monitoring may be used to supplant more traditional methods like polysomnography due to its validity, lower cost and ability to evaluate individuals in their homes over a longer period of time (150). Advanced wearable technologies can also precisely monitor skin conductance, respiratory rate, blood pressure and oximetry and provide surface electromyography (EMG), electrocardiography (ECG) and electroencephalograpy (EEG) tracings. Furthermore, the ability to collect multiple aspects of human function with smart devices (mobile phones, tablets and smart watches) provides additional opportunities to collect and analyze numerous clinically relevant parameters (e.g., posture, balance, gait, dexterity, voice and speech patterns, facial expression, eye tracking, medication).
Development of precision medicine subtypes for common diseases, such as PD and AD, and deep phenotype maps based on digital sensing technologies of rare disease populations, such as ALSP, could capture therapeutic responsiveness to experimental treatment paradigms (151–156).
Patient and Caregiver Perspective of Burden Due to Unmet Medical Need
Progressive neurologic disorders invoke a heavy burden on afflicted patients, caregivers and society (157). Although data on the patient and caregiver burden of ALSP are unavailable, data from other progressive neurological disorders provide insight into the potential burden of ALSP on patients and caregivers.
Research questionnaires have been used to understand the unmet medical needs of progressive neurologic disorders by directly seeking input from the afflicted patients. A cross-sectional study of 1,205 patients with MS was conducted using a questionnaire to collect information on demographics (sex, age, education, employment), clinical status (form, disease duration, disability level) and unmet healthcare and social needs (12 items scored as yes/no) (158). Psychological support (27.5%) was the greatest unmet healthcare need, followed by temporary admission to rehabilitation (9.8%), access to technical aid (6.7%), access to drugs (5.4%) and lack of nursing home admission (3.2%). Social care needs included assistance with transportation (41%), financial support, architectural barriers, personal assistance (>30%), career guidance and adaptation to workplace (>10%). Unmet healthcare needs were linked to clinical factors, such as disease progression and level of disability.
Because there is a paucity of data underlying the major burden of the physical, psychological, emotional and financial impositions of ALSP on patients, families and caregivers, it is appropriate to examine the burden of closely related neurologic disorders, such as ALS and FTD. ALS and FTD are both characterized as rare diseases by Genetic and Rare Diseases (GARD), National Organization for Rare Disease (NORD) and Orphanet. These are meaningful comparative disorders for ALSP because both are rare diseases that affect motor function, cognition and mental health and have unmet medical needs.
The burden of devastating symptoms of ALS disrupts quality of life and shortens the lifespan of patients. The financial burden to patients, families and payers is substantial. A case study of the costs of care for individual patients was conducted in the United States over a 10-year period (2001-2010) (159). Total costs for the duration of ALS were $1,433,992 (85% paid by insurance, 9% paid by patient and family and 6% paid by charity). The greatest costs involved in-home caregivers ($669,150), ventilation ($212,430) and hospital care ($114,558). These cost factors are particularly burdensome for patients because they markedly influence treatment decisions. It is important to note that this case study did not address the indirect financial detriments to patients, such as lost wages, productivity and terminated employment.
The burden of the progressive symptoms of FTD and the economic burden are staggering for patients, families and caregivers. A robust 250-item survey was administered to primary caregivers of patients with FTD to estimate the cost burden of the disorder (160). The survey was completed by 674 of the 956 caregivers. Direct and indirect annual costs of FTD were $47,916 and $71,737, respectively, and resulted in an annual per-patient charge of $119,653. Elderly patients with later stages of behavioral-variant FTD had higher direct costs whereas male patients aged <65 years had higher indirect costs. The impact of FTD on the patient and family resulted in a mean reduction in household income ranging from $75,000 to $99,000 (12 months before diagnosis) to $50,000 to $59,000 (12 months after diagnosis). This dramatic loss of household income was related to lost days of employment and to early departure from employment. The profound economic burden of FTD may be reduced in the future through accurate and early diagnosis, effective treatments to target cause of the disorder and improved professional services.
The financial burden of MS has been explored in cohort studies conducted with patient data extracted from the Swedish Multiple Sclerosis Register (SMSreg). These MS studies have shown that the level of cognitive function correlates directly with the amount of work disability (161) and quantity of income independent of physical disability (162). Patients with relapsing, remitting MS also earned twice the income of patients with progressive MS (163).
ALSP is a rare, progressive, debilitating disorder and its treatment is an unmet medical need. The signs and symptoms of ALSP present a major burden for daily living, cost of care and life expectancy of afflicted patients. The treatment of ALSP will require a patient-focused, precision medicine therapeutic approach by the multidisciplinary caregiver team and foundation and support groups to address the cause of the disorder, management of motor and sensory symptoms and careful attention to quality of life issues.
Gap Analysis of Clinical Manifestations
There is a paucity of published clinical research literature for ALSP, a rare neurodegenerative disorder. The limited number of published clinical research studies is comprised primarily of case reports with small numbers of patients and absence of controls. Therefore, formal gap analysis of ALSP clinical manifestations was not conducted for this comprehensive review. In an effort to gain some understanding of the gaps in clinical manifestations of ALSP, a count of ALSP-specific publications was conducted. Table 1 lists the references and total number of references for publications that are ALSP-specific for each of the clinical manifestations. The most conspicuous gaps in the literature were identified as the potential efficacy endpoints for future clinical trials. Endpoints such as cognitive decline, motor and sensory dysfunction, impaired activities of daily living with physical and behavioral dysfunction, digital biomarkers and patient and caregiver perspective of burden due to unmet medical need had the fewest (0-3) ALSP-specific literature references. These gaps are likely related to the low global incidence of ALSP patients which have restricted the number of adequate and controlled clinical trials. Future clinical studies of ALSP should target the development of clinically meaningful, congruent, specific and validated efficacy endpoints that will accelerate the discovery of safe and effective therapies for this rare disorder.
TABLE 1
Limitations
There were limitations to this comprehensive review of the clinical manifestations of ALSP. Most of the clinical data were derived from limited numbers of patients in published case studies. Due to the paucity of ALSP-specific clinical literature, some gaps were evident in the clinical manifestations of the disorder, particularly efficacy endpoints. Lack of patient medical records associated with the case studies may have resulted in inaccurate, incomplete or missing assessments of symptoms and disease progression. Quality control of case studies was restricted to inclusion and exclusion criteria with no additional quality parameters. There was considerable variation in geographic location of the clinics involved in the case studies and this may have created inconsistent interpretation of the clinical manifestations.
Conclusions
This comprehensive clinical review of the literature focused on the genetics, neuropathology, imaging findings, prevalence, clinical course, diagnosis and clinical evaluation of ALSP, as well as on prospective biomarkers, current and proposed treatment, promising clinical scales and efficacy endpoints for future therapeutic trials and the burden of ALSP on patients and caregivers. The description of the clinical manifestations of ALSP was derived primarily from clinical case studies with small numbers of patients. Due to the paucity of non-interventional and interventional clinical studies of ALSP, the information gained from this review can serve as a foundation for the strategy and design of future clinical trials, with clinically meaningful and congruent efficacy endpoints for patients with ALSP. These clinical trials will be designed to elicit determinative assessments for the development of therapeutics for ALSP, an orphan neurodegenerative disease with an unmet medical need, target with precision the etiology and alleviate symptoms in an effort to reverse, halt or slow progression of ALSP.
Author Contributions
SP, AP, MB, and SZ were involved in the strategy, conception of work, literature search, and writing and revision of manuscript. EF, VK, DL, WK, LS, SH, TK, TI, TL, JO-M, FE, and ZKW read and critically revised the manuscript. All authors approved the final manuscript for submission.
Conflict of Interest
Unrelated to this study, EF received personal compensation for serving on a PSP Scientific Advisory or Data Safety Monitoring board for Biogen, Vigil Neuroscience, Inc., and Denali Therapeutics, as a section editor for NeuroImage Clinical and as a course director for the AAN Annual Meeting. EF has received research support paid to her institution (UWO) from CIHR and the Weston Foundation to conduct an ongoing study of oxytocin in FTD, from Alzheimer Society of Canada and the Physicians and Services Incorporated Foundation, the Ministry of Research and Innovation of Ontario for research and for site participation in clinical trials sponsored by Alector, Biogen, and TauRx. VK was funded by the Stockholm County Council. WK received consulting honoraria from Vigil Neuroscience. LS was funded by the German Research council (DFG grant SCHO754/6-2), German Ministryof Health (BMG grant ZMVI1-2520DAT94E to LeukoExpert), German Ministry of Education and Research (BMBF grant 01GM1905A to Treat HSP and grant 01GM1907A to Treat ION), European Commission (EU grant 947588 to the ERNRND registry and JPND grant 01ED16028 to ESMI). LS was a member of the European Reference Network for Rare Neurological Diseases (Project No 739510). SH was funded by the Hertie Network of Excellence in Clinical Neuroscience (GHST grant P1200021). TK and TI are funded by AMED JP21dk0207045, a public grant from the Japanese government to support research on ALSP. JO-M was funded by the Conrad N. Hilton Foundation, the Institute for Translational Medicine and Therapeutics Transdisciplinary (ITMAT) and serves as a principal investigator on Vigil Neuroscience, Inc. sponsored clinical studies (VGL101-01.001; VGL101-01.002). FE is the principal investigator of Bluebird Bio and Minoryx Therapeutics clinical trials; consultant to Ionis, Alnylam, Sanofi Genzyme, Minoryx, and SwanBio Therapeutics; director of the Third Rock MGH Neuroscience Fellowship; and founder of SwanBio Therapeutics. ZW was partially supported by the NIH/NIA and NIH/NINDS (1U19AG063911, FAIN: U19AG063911), Mayo Clinic Center for Regenerative Medicine, Mayo Clinic in Florida Focused Research Team Program, gifts from the Sol Goldman Charitable Trust and Donald G. and Jodi P. Heeringa Family, the Haworth Family Professorship in Neurodegenerative Diseases fund, and the Albertson Parkinson's Research Foundation. He serves as PI or Co-PI on Biohaven Pharmaceuticals, Inc. (BHV4157-206 and BHV3241-301), Neuraly, Inc. (NLY01-PD-1), and Vigil Neuroscience, Inc. (VGL101-01.001) clinical studies. He serves as an external advisory board member for Vigil Neuroscience, Inc.
SP, AP, MB, and SZ are employed by Vigil Neuroscience, Inc.
The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Publisher's Note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Acknowledgments
The authors wish to thank Lillian Neff and Serena Hung for content suggestions and edits for this manuscript.
Supplementary Material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fneur.2021.788168/full#supplementary-material
References
|
|||||
1850
|
dbpedia
|
2
| 97 |
https://bora.uib.no/bora-xmlui/handle/11250/2999588
|
en
|
Bergen Open Research Archive: Metabolic flux analysis of 3D spheroids reveals significant differences in glucose metabolism from matched 2D cultures of colorectal cancer and pancreatic ductal adenocar
|
[
"https://bora.uib.no/bora-xmlui/bitstream/handle/11250/2999588/s40170-022-00285-w.pdf.jpg?sequence=6&isAllowed=y",
"https://bora.uib.no/bora-xmlui/themes/Mirage2//images/creativecommons/cc-by.png",
"https://bora.uib.no/bora-xmlui/themes/Mirage2/images/unit_product.png",
"https://bora.uib.no/bora-xmlui/themes/Mirage2/images/unit_product.png"
] |
[] |
[] |
[
""
] | null |
[
"Hanne Røland",
"Tia R",
"Gro Vatne",
"Karl Johan"
] | null |
en
|
/bora-xmlui/themes/Mirage2/images/favicon.ico
| null | |||||||
1850
|
dbpedia
|
3
| 0 |
https://my.clevelandclinic.org/health/articles/24395-hdl-cholesterol
|
en
|
What To Know About HDL Cholesterol: The "Good" Cholesterol
|
https://my.clevelandclinic.org/-/scassets/images/org/health/articles/24395-hdl-illustration
|
https://my.clevelandclinic.org/-/scassets/images/org/health/articles/24395-hdl-illustration
|
[
"https://my.clevelandclinic.org/health/_next/static/media/gray-gradient-left-16.59910877.svg?w=16&q=75 1x, /health/_next/static/media/gray-gradient-left-16.59910877.svg?w=32&q=75 2x",
"https://my.clevelandclinic.org/health/_next/static/media/gray-gradient-right-32.dd7ce4e5.svg?w=32&q=75 1x, /health/_next/static/media/gray-gradient-right-32.dd7ce4e5.svg?w=64&q=75 2x",
"https://my.clevelandclinic.org/health/_next/static/media/search--blue.a23a2bb9.svg?w=16&q=75 1x, /health/_next/static/media/search--blue.a23a2bb9.svg?w=32&q=75 2x",
"https://my.clevelandclinic.org/health/_next/static/media/logo-ccf.a7ea0118.svg?w=16&q=75 16w, /health/_next/static/media/logo-ccf.a7ea0118.svg?w=32&q=75 32w, /health/_next/static/media/logo-ccf.a7ea0118.svg?w=48&q=75 48w, /health/_next/static/media/logo-ccf.a7ea0118.svg?w=64&q=75 64w, /health/_next/static/media/logo-ccf.a7ea0118.svg?w=96&q=75 96w, /health/_next/static/media/logo-ccf.a7ea0118.svg?w=128&q=75 128w, /health/_next/static/media/logo-ccf.a7ea0118.svg?w=256&q=75 256w, /health/_next/static/media/logo-ccf.a7ea0118.svg?w=384&q=75 384w, /health/_next/static/media/logo-ccf.a7ea0118.svg?w=640&q=75 640w, /health/_next/static/media/logo-ccf.a7ea0118.svg?w=750&q=75 750w, /health/_next/static/media/logo-ccf.a7ea0118.svg?w=828&q=75 828w, /health/_next/static/media/logo-ccf.a7ea0118.svg?w=1080&q=75 1080w, /health/_next/static/media/logo-ccf.a7ea0118.svg?w=1200&q=75 1200w, /health/_next/static/media/logo-ccf.a7ea0118.svg?w=1920&q=75 1920w, /health/_next/static/media/logo-ccf.a7ea0118.svg?w=2048&q=75 2048w, /health/_next/static/media/logo-ccf.a7ea0118.svg?w=3840&q=75 3840w",
"https://my.clevelandclinic.org/health/_next/static/media/search--gray.86f52a63.svg?w=32&q=75 1x, /health/_next/static/media/search--gray.86f52a63.svg?w=48&q=75 2x",
"https://zdbb.net/l/Dnl1wmWs8xCCpvWNCt9Egf/?w=16&q=75 1x",
"https://my.clevelandclinic.org/-/scassets/images/org/health/articles/24395-hdl-illustration"
] |
[] |
[] |
[
""
] | null |
[
"Cleveland Clinic medical professional"
] |
2022-11-01T17:11:35+00:00
|
HDL (high-density lipoprotein) cholesterol earned the title of “good cholesterol” because it helps you get rid of extra cholesterol.
|
en
|
https://my.clevelandclinic.org/assets/imgs/favicon.ico
|
Cleveland Clinic
|
https://my.clevelandclinic.org/health/articles/24395-hdl-cholesterol
|
What is HDL?
HDL stands for high-density lipoprotein. It’s a type of lipoprotein that circulates in your blood.
Lipoproteins are particles made of lipids (fats) and proteins. Their main job is to transport fats, like cholesterol, throughout your body to the cells that need them. Fats need a ride because their chemical structure keeps them from traveling solo through your blood. They need help from lipoproteins to get where they need to be.
What is HDL cholesterol?
HDL and HDL cholesterol are the same thing. Most people use both terms to talk about these particles and the role they play in your heart health.
People know HDL particles by the type of fat they carry (cholesterol), even though they contain fats and proteins.
Why is HDL called “good cholesterol?”
HDL is the “good cholesterol” because it helps your body get rid of extra cholesterol. This process can lower your risk of cardiovascular disease.
Cholesterol normally travels from your liver to your bloodstream. From there, lipoproteins carry the cholesterol to different cells in your body to support important functions (like helping your body form cell membranes and produce hormones).
But sometimes, there’s too much cholesterol in your blood. It’s more than your body needs. That’s when reverse cholesterol transport helps.
Reverse cholesterol transport is a complex body process, and researchers continue to explore how and when HDL plays a role. What we know is that HDL particles can transport excess cholesterol from your bloodstream back to your liver. Your liver then breaks down this cholesterol and gets it out of your body through your poop.
This is a good thing because too much cholesterol in your blood raises your risk of plaque buildup in your artery walls (atherosclerosis).
Getting rid of extra cholesterol makes HDL the helpful cholesterol. But that’s not all it does. HDL cholesterol also works against inflammation and oxidants to keep your cells strong. And it plays a role in preventing blood clots.
How can I find out my HDL cholesterol level?
Your healthcare provider can order a lipid panel blood test for you. You’ll get numbers for different kinds of cholesterol, including your HDL.
What is a good level of HDL?
Ideally, your HDL should be 60 milligrams per deciliter (mg/dL) or higher. Research shows this can lower your risk of cardiovascular (heart and blood vessel) diseases like heart disease and stroke.
What is an unhealthy level of HDL?
An unhealthy level of HDL cholesterol doesn’t fall within the normal range. People who have low HDL have an unhealthy level. But a level that’s too high also isn’t good because it can allow atherosclerosis to progress faster. HDL levels that are too high or low can happen because of other medical issues going on.
What is the HDL cholesterol normal range?
Normal HDL cholesterol ranges for adults vary depending on whether you’re assigned male at birth (AMAB) or assigned female at birth (AFAB).
It’s important to talk to your healthcare provider about your lipid panel results so you understand what they mean for you.
What does low HDL cholesterol mean?
There are many reasons why your HDL cholesterol may be low, including:
Tangier disease. This genetic condition causes your HDL cholesterol to be too low.
Familial combined hyperlipidemia. This genetic condition causes your HDL cholesterol to be too low and your LDL cholesterol to be too high.
ApoA1 deficiency. People with this genetic condition don’t have enough Apolipoprotein A1. This is a key component of HDL.
Metabolic syndrome. This is a combination of cardiovascular disease risk factors including lower-than-normal HDL levels.
A body mass index (BMI) greater than 25 (overweight/obesity). Having extra weight can lower your HDL level.
Smoking or tobacco use. Tobacco contains nicotine, which lowers your HDL level. All tobacco products, including e-cigarettes, have this harmful effect.
Insulin resistance. Excess fat can make it difficult for insulin in your body to manage your blood sugar well. This can cause a low level of HDL.
Medicines you take. Some drugs, like beta-blockers, certain hormones or some diuretics, can lower your HDL cholesterol level.
What does it mean if I have high HDL?
An elevated, or abnormally high, HDL level is anything above 80 mg/dL.
One thing that can make your HDL cholesterol high is a genetic mutation. Some mutations to your genes can cause your body to produce too much HDL cholesterol or have trouble getting rid of it. For example, a mutation to the CETP gene can cause your HDL to be higher than 150 mg/dL.
Other causes of abnormally high HDL can include:
Hyperthyroidism.
Primary biliary cholangitis.
Alcohol use disorder.
Certain medications.
Your healthcare provider will investigate the cause of your elevated HDL and tell you if you need treatment.
How do I raise my HDL?
It’s best to talk to your healthcare provider for advice tailored to your specific needs and any medical conditions you might have. In general, certain lifestyle changes can help improve your HDL level. These include:
Eating heart-healthy foods. Research supports the Mediterranean Diet as a way to improve your overall heart health, including your cholesterol numbers. This plan includes lots of fruits and veggies, legumes (beans and lentils) and whole grains. Foods rich in omega-3 fatty acids can raise your HDL cholesterol, too.
Avoiding or limiting unhealthy foods. Skip fried doughnuts or baked goods that contain trans fats (partially hydrogenated oils). Limit how much saturated fat you eat, like sausage, cheese, bacon and butter.
Exercising. Aerobic exercise can help raise your HDL cholesterol. Aim for at least 30 minutes of exercise five or more days per week. If you haven’t exercised much in the past, it’s OK. Start with just five or 10 minutes per day and gradually build up. But be sure to talk to your provider before starting any new exercise plan.
Staying at a weight that’s healthy for you. Losing body weight, especially around your midsection, helps improve HDL levels.
Avoiding all tobacco use. Smoking, vaping and using other tobacco products lowers your HDL. So, if you don’t currently use tobacco, don’t start. And if you do, it’s important to work on stopping. Talk to your provider about strategies to help you quit. Secondhand smoke is also harmful. If you live with someone who smokes, offer your support to help them quit — for their benefit and yours.
Taking medicines. Your provider may prescribe medication like PCSK9 inhibitors or ezetimibe to help increase your HDL.
A note from Cleveland Clinic
Making sense of your cholesterol test results can be confusing. There are many terms to learn, and it can be hard to remember which cholesterol is “good” or “bad.” When it comes to HDL, remember “h” for “helpful.” HDL cholesterol is good because it helps move extra cholesterol out of your blood. This is why healthy levels of HDL can help lower your risk for heart disease. If your HDL level isn’t where it should be, talk with your provider about ways to improve it.
|
||
1850
|
dbpedia
|
3
| 75 |
https://www.aafp.org/pubs/afp/issues/2001/0115/p323.html
|
en
|
Goals for Lowering Your Cholesterol
|
[
"https://www.aafp.org/content/dam/AAFP/images/logos_internal/afp-masthead-2024.jpg"
] |
[] |
[] |
[
""
] | null |
[] |
2001-01-15T00:00:00
|
A high cholesterol level can increase your risk of having a heart attack or stroke. You have an even higher risk if you also have other risk factors, such as:
|
en
|
https://ui.aafp.net/aafp-brand-components/2/assets/icons/favicon.ico
|
https://www.aafp.org/pubs/afp/issues/2001/0115/p323.html
|
A high cholesterol level can increase your risk of having a heart attack or stroke. You have an even higher risk if you also have other risk factors, such as:
The term “total cholesterol” refers to the total amount of the different kinds of cholesterol in your blood. One kind of cholesterol is the LDL cholesterol. Another kind is the HDL cholesterol. “LDL” stands for low-density lipoprotein. LDL is the “bad” cholesterol. “HDL” stands for high-density lipoprotein. HDL is the “good” cholesterol.
LDL is called the “bad” cholesterol because it can cause a buildup of fat and cholesterol in the walls of your blood vessels. If your LDL has been high for many years, this buildup can clog the arteries to your heart or brain. The arteries may be partly or totally blocked. The medical word for this blockage is “atherosclerosis.” Clogged arteries to the heart can cause a heart attack. Clogged arteries to the brain can cause a stroke.
A high HDL level is better. An HDL level higher than 60 is the best. HDL is called the “good” cholesterol because it helps remove cholesterol from your body. In this way, HDL helps prevent heart disease and stroke. Regular exercise is a good way to increase your HDL level.
If your total cholesterol level is 200 to 239, you have a borderline level. The word “borderline” is used because levels of 200 to 239 are close to being high. A total cholesterol of 240 or above is a high level.
If your LDL level is 130 to 159, you have a borderline level. If your LDL level is 160 or higher, you have a high level.
It depends. If you don't have heart disease, your goal would be to lower your LDL level to less than 130. If you do have heart disease, your goal would be to reduce your LDL level to less than 100. But even if you don't have heart disease, it's better to get your LDL level as low as you can.
Eating a low-fat, heart-healthy diet is a good start. Try not to eat fatty cuts of beef and pork. Eat more chicken, turkey and fish. Drink fatfree milk instead of whole milk. Avoid other high-fat dairy foods like cheese, butter and ice cream. Avoid fried foods. Eat lots of fresh fruits and vegetables.
If you stay on a low-fat diet for three to six months but still have not reached your goal, talk to your doctor about taking a medicine to reduce your cholesterol level.
When you take a cholesterol-lowering medicine, try to take it every day at about the same time. The drop in your cholesterol level caused by the drug lasts only one or two days after you stop taking the medicine.
Be sure to tell your doctor about any changes in your body that might be a side effect from the medicine. Also, talk to your doctor if you are worried about taking the medicine.
If the cholesterol medicine does not help reduce your LDL level enough after several months of treatment, your doctor may increase the dose. Changing to a different cholesterol medicine can also help.
Another way to make the cholesterol medicine work would be to add a second medicine to your treatment. Your doctor can try different treatments to find which one works for you. Even if you are taking a medicine to lower your cholesterol, it's still important to follow a heart-healthy diet.
Ask your doctor where you can find information on cholesterol. Your library may have books on high cholesterol and heart disease. The Web sites of the National Heart, Lung, and Blood Institute and the American Heart Association have good information. Their addresses are http://www.nhlbi.nih.gov and http://www.americanheart.org.
|
|||||
1850
|
dbpedia
|
1
| 83 |
https://www.ingentaconnect.com/contentone/ben/cpd/2014/00000020/00000040/art00003%3Fcrawler%3Dtrue
|
en
|
HDL Genetic Defects: Ingenta Connect
|
[
"https://www.ingentaconnect.com/images/ingenta-connect_182x60.png",
"https://www.ingentaconnect.com/images/journal-logos/ben/cpd.png",
"https://www.ingentaconnect.com/images/icon_m_p_square.gif",
"https://www.ingentaconnect.com/images/ic_ingenta_logo_200x64.png",
"https://assets.crossref.org/logo/crossref-logo-landscape-200.svg",
"https://www.ingentaconnect.com/images/ic_counter_logo_200x84.png"
] |
[] |
[] |
[
""
] | null |
[
"R Nair"
] | null |
en
|
/images/ic.ico
| null |
Home / Current Pharmaceutical Design, Volume 20, Number 40
Share Content
Access Key
Free content
Partial Free content
New content
Open access content
Partial Open access content
Subscribed content
Partial Subscribed content
Free trial content
|
||||||
1850
|
dbpedia
|
0
| 20 |
https://www.frontiersin.org/journals/neurology/articles/10.3389/fneur.2021.788168/full
|
en
|
Adult-Onset Leukoencephalopathy With Axonal Spheroids and Pigmented Glia: Review of Clinical Manifestations as Foundations for Therapeutic Development
|
[
"https://loop.frontiersin.org/images/profile/402750/32",
"https://loop.frontiersin.org/images/profile/1536519/32",
"https://loop.frontiersin.org/images/profile/1544087/32",
"https://www.frontiersin.org/article-pages/_nuxt/img/crossmark.5c8ec60.svg",
"https://loop.frontiersin.org/images/profile/194567/74",
"https://loop.frontiersin.org/images/profile/1501809/74",
"https://loop.frontiersin.org/cdn/images/profile/default_32.jpg",
"https://loop.frontiersin.org/cdn/images/profile/default_32.jpg",
"https://loop.frontiersin.org/cdn/images/profile/default_32.jpg",
"https://loop.frontiersin.org/images/profile/1513774/74",
"https://loop.frontiersin.org/cdn/images/profile/default_32.jpg",
"https://loop.frontiersin.org/images/profile/196022/74",
"https://loop.frontiersin.org/images/profile/19210/74",
"https://loop.frontiersin.org/cdn/images/profile/default_32.jpg",
"https://loop.frontiersin.org/images/profile/499925/74",
"https://loop.frontiersin.org/images/profile/311789/74",
"https://loop.frontiersin.org/images/profile/786144/74",
"https://loop.frontiersin.org/images/profile/865344/74",
"https://loop.frontiersin.org/cdn/images/profile/default_32.jpg",
"https://loop.frontiersin.org/images/profile/1060358/74",
"https://www.frontiersin.org/files/Articles/788168/fneur-12-788168-HTML/image_m/fneur-12-788168-g001.jpg",
"https://www.frontiersin.org/files/Articles/788168/fneur-12-788168-HTML/image_m/fneur-12-788168-g002.jpg",
"https://www.frontiersin.org/files/Articles/788168/fneur-12-788168-HTML/image_m/fneur-12-788168-g003.jpg",
"https://www.frontiersin.org/files/Articles/788168/fneur-12-788168-HTML/image_m/fneur-12-788168-g004.jpg",
"https://www.frontiersin.org/files/Articles/788168/fneur-12-788168-HTML/image_m/fneur-12-788168-t001.jpg"
] |
[] |
[] |
[
"Adult-onset",
"leukoencephalopathy",
"Leukodystrophy",
"axonal spheroids",
"Pigmented glia",
"HDLS",
"ALSP",
"Csf1r"
] | null |
[
"David S",
"Stefanie N",
"Orthmann-Murphy",
"Zbigniew K"
] | null |
A comprehensive review of published literature was conducted to elucidate the genetics, neuropathology, imaging findings, prevalence, clinical course, diagno...
|
en
|
Frontiers
|
https://www.frontiersin.org/journals/neurology/articles/10.3389/fneur.2021.788168/full
|
Introduction
Adult-onset leukoencephalopathy with axonal spheroids and pigmented glia (ALSP) is a rare neurologic disorder that is characterized by demyelination of white matter of the brain, swollen axons and pigmented glial cells. The term ALSP encompasses two clinicopathologically similar entities that were previously known as hereditary diffuse leukoencephalopathy with spheroids (HDLS) and pigmentary orthochromatic leukodystrophy (POLD) (1). POLD was first described in 1936 in a family with adult-onset leukodystrophy (2). The term HDLS was first coined in 1984 to describe a Swedish family with adult-onset leukoencephalopathy in which axonal dilatations (spheroids) were a prominent feature (3). However, the original Swedish family (HDLS-S) was recently found to carry a different genetic makeup with the affected family members displaying the alanyl-transfer (t) RNA synthetase (AARS) gene mutation as the likely cause of Swedish type HDLS with spheroids (4). Thus, this family belongs to yet another class of genetic disorders identified as AARS-related leukoencephalopathy (5–7).
Several cases of POLD that fulfill all criteria for HDLS prior to the discovery of the AARS gene mutation causing HDLS in the Swedish family, except heritability, have been described in the literature. These cases are likely sporadic due to de novo mutations or issues of reduced disease penetrance (8, 9). Identification of common mutations in the kinase domain of CSF1R, a gene that regulates mononuclear cell lineages, including microglia in both HDLS and POLD (1), has provided additional evidence that HDLS and POLD should be regarded as a single disease entity (10, 11). In line with this, the diseases are now summarized as CSF1R-related leukoencephalopathy and for the purposes of this review are collectively referred to as ALSP.
The genetic, structural and neuropathophysiologic abnormalities of ALSP result in multiple neurologic symptoms, such as cognitive dysfunction, movement disorders, motor impairment, familial dementia and subcortical gliosis of the Neumann type and neuropsychiatric complications, that result in diminishing quality of life and eventual premature death (12–17). At present, some symptoms of ALSP are treated off-label with existing US Food and Drug Administration (FDA)-approved drugs that elicit variable levels of short-term efficacy. However, these symptomatic therapies have limited efficacy and do not target the etiology or the most debilitating symptoms, such as rapidly progressive cognitive impairment of ALSP (14). Future novel therapies that focus on the neuropathophysiologic features that underlie ALSP are essential to adequately reverse, delay or stop progression and improve quality of life in patients who are afflicted with this incapacitating disorder.
This review of the published literature was conducted to critically evaluate the clinical characteristics of ALSP as a foundation for rigorous strategy to develop therapeutic agents targeting ALSP. The review highlights key considerations for design of human clinical trials for ALSP including clinically meaningful and convergent endpoints that will lead to the development of safe and effective therapies for this orphan neurologic disorder.
Literature Search Strategy
Published data for the clinical characterization of ALSP were limited by the small number of patients who are afflicted with this adult-onset leukoencephalopathy. Observational case studies comprised the majority of publications for ALSP. The primary literature search for published and in-press clinical studies of ALSP were obtained from a MEDLINE search in the timeframe of January 1, 1980 through October 31, 2020. ALSP literature subsequent to October 31, 2020 was also monitored through MEDLINE. Literature relevant to proposed efficacy endpoints, future interventional clinical trials of ALSP and burden of care due to unmet medical needs was derived from MEDLINE and PUBMED during the above time periods. Review of all publications was restricted to articles in English or translated into English. The following primary search terms were utilized to identify ALSP-related publications:
• Adult-onset leukodystrophy with neuroaxonal spheroids and pigmented glia
• Adult-onset leukoencephalopathy with axonal spheroids and pigmented glia
• ALSP
• CSF1R-related leukoencephalopathy
• Hereditary diffuse leukoencephalopathy with spheroids
• HDLS
• Pigmentary type of orthochromatic leukodystrophy
• POLD.
Genetics
ALSP is primarily inherited as an autosomal dominant disorder with CSF1R gene mutations as the most common mutation to date (14, 18, 19). At least 106 different CSF1R mutations have been identified in approximately 300 cases published in the peer-reviewed literature worldwide (6, 17–32). There is no major correlation of genotype and phenotypes. Family members with identical CSF1R gene mutations do not share the same clinical phenotype (6, 14). However, patients harboring truncating mutations of CSF1R as well as those that lead to nonsense-mediated decay have been shown to have an earlier age of onset than ALSP patients with substitution mutations (32). Although de novo mutations of CSF1R have been reported, they are less common (9, 20). Penetrance of ALSP associated with CSF1R mutations is high, but incomplete, due to de novo mutations and genetic mosaicism (6, 9, 13, 33).
The non-mutated CSF1R gene consists of 22 exons. Its normal gene product is the CSF1R protein, a cell-surface transmembrane tyrosine kinase receptor with two known ligands for cytokine colony-stimulating factor 1 (CSF1) and IL-34. Most mutations of CSF1R that are associated with ALSP are located in the tyrosine kinase domain (TKD), most frequently in exons 18 and 19 (6). However, novel CSF1R variants in regions such as the signal peptide, immunoglobulin (Ig) domain, transmembrane domain, other exons of the TKD, and at the C-terminus, have been reported (6, 18, 21, 23, 31). Additionally, unique splice site variants, deletion/insertion mutations and frameshift mutations have been reported in introns and exons that span nearly all of CSF1R (6, 17, 19, 21, 23, 24, 26, 31). Figure 1 illustrates the location of CSF1R mutations in patients with CSF1R-related leukoencephalopathy. A more detailed presentation of genetic mutations in CSF1R-related leukoencephalopathy is provided in Supplementary Table 1.
FIGURE 1
Survival, development, proliferation, and activation of mononuclear phagocytic cells and central nervous system (CNS) microglia are regulated by CSF1R. CSF1R gene mutations are considered an underlying cause of primary brain microgliopathies and are linked to CNS damage of ALSP (20, 34–36).
Biallelic mutations in the AARS gene have been detected in approximately 20 patients with late-onset leukoencephalopathy who did not have a CSF1R mutation (37). The AARS2 gene encodes a mitochondrial enzyme that is essential for loading alanine onto tRNA during mitochondrial translation (37). Most of these patients displayed an autosomal recessive inheritance of AARS2-related leukoencephalopathy with symptoms and brain neuropathology similar to ALSP (37–40).
Both CSF1R- and AARS2-related leukoencephalopathy share several neurological symptoms and can present with similar white matter involvement, predominantly in the frontoparietal and periventricular regions. However, differences in radiologic images between patients with CSF1R and AARS2 gene encoding mutations have been reported in the corpus callosum, in regions with severe brain atrophy and in patients with AARS2 gene mutations lacking the unique ALSP-associated calcifications that are seen on computed tomography (CT) (13, 37, 41). Unlike CSF1R, the AARS2-related phenotype has not been restricted to adults, with some cases reported during adolescence (42). The changes in nomenclature for leukoencephalopathies are a result of additional understanding of pathology and genetics. The five main classifications of leukoencephalopathies are CSF1R-related leukoencephalopathy, AARS2-related leukoencephalopathy, AARS1-related leukoencephalopathy, HDLS-S-related leukoencephalopathy and CSF1R/AARS1/AARS2-negative ALSP. The last classification represents cases with a neuropathological diagnosis of ALSP without mutations in the CSF1R and AARS2 genes.
Further analyses of brain images and modern neuropathology are necessary to definitively characterize AARS2-related leukoencephalopathy. However, due to limited and conflicting data associated with AARS2, as well as no known molecular signaling convergence between CSF1R and AARS2, this clinical review has focused on the term ALSP, a CSF1R-related leukoencephalopathy.
Neuropathology
Histopathologic evaluation (light and electron microscopy) of brain tissue from biopsies and autopsies of patients with ALSP shows multiple morphologic alterations (6, 14, 17, 29, 43–46). One of the principal neuropathologies consists of vacuolated and demyelinated white matter that is found primarily within the corpus callosum, pyramidal tracts and periventricular region of the frontal and parietal lobes. The degenerate white matter is often associated with deteriorating neurons and axonal spheroids that contain neurofilaments, amyloid and ubiquitin. The axonal pathology is accompanied by macrophages that are engorged with lipid and myelin. Other characteristic neuropathological findings of ALSP include deformed astrocytes and pigmented (iron or lipofuscin) microglia cells that decrease in function and number with progression of the disorder. Representative lesions from cases of ALSP are shown in Figure 2.
FIGURE 2
ALSP is associated with leaky blood brain barrier (BBB) and cerebrovascular abnormalities similar to cerebral amyloid angiopathy (CAA) (47). Post-mortem brain sections from ALSP patients were stained for Claudin-5, a key mediator of tight junction function at the BBB in areas of dense amyloid-beta integrity and demonstrated a non-linear distribution of Celaudin-5 in tandem with extravasation of IgG and fibrinogen. These findings implicate BBB disruption. Perivascular localization of CD68- and CD163-positive cells in the brain of ALSP patients suggest that peripheral macrophages are recruited to the vasculature (47). Identification of donor chimerism in the CSF (cerebrospinal fluid) obtained from patients who underwent hematopoietic stem cell transplantation (HSCT) further supports this observation (48).
Additionally, the proinflammatory cytokine, granulocyte macrophage colony stimulating factor (GM-CSF), was shown to be significantly upregulated in the gray matter on post-mortem analysis of brain tissue from patients with ALSP and migration and adhesion-related molecules derived peripheral blood monocytes were also significantly upregulated, suggesting widespread immune dysfunction (28, 32). More robust characterization of the innate and adaptive immune system throughout the course of disease progression is warranted to understand its potential role in ALSP pathobiology.
Imaging
Magnetic resonance imaging (MRI) of patients with ALSP typically demonstrates abnormal white matter signal with hyperintense (T2) and fluid-attenuated inversion recovery (FLAIR) lesions and diffusion tensor imaging (DTI) identifies diffusion restriction lesions (6, 13, 49–52). Figure 3 presents the typical abnormal brain MRI findings in patients with ALSP.
FIGURE 3
White matter lesions are some of the most common neuroradiological findings on MRI in ALSP. They can be symmetric or asymmetric, patchy or confluent and tend to involve different lobes of the brain during the evolution of the disease. A study of 122 patients with ALSP and CSF1R mutations reported the presence of bilateral white matter lesions in 96% of the patients (13). Similarly, a subsequent MRI study found bilateral, predominantly frontal and parietal, T2/FLAIR white matter hyperintensities associated with T1 hypointensities in 16 patients with ALSP (22). This study also reported progression of white matter lesions on imaging in a subset of 13 patients with follow-up MRIs. White matter lesions were identified with either a patchy or confluent appearance and the occipital and temporal lobes showed white matter lesion involvement in later stages of the disease (51). A summary review of white matter lesions confirmed that they are often asymmetric, patchy, and focal especially in the early stages of the disease, but with time they become confluent (50). Lesions are found predominantly in frontoparietal and periventricular areas. Overall, previously published MRI data identify some distinctive features of white matter lesions in patients with ALSP. These data are included in the diagnostic criteria (53) that may prove useful in assessing disease progression.
Focal and global brain atrophy as well as thinning of cortex and corpus callosum are other hallmarks found in ALSP. Brain atrophy was shown in 94% of cases (15/16), predominant in the frontal (40%, 6/15) or frontoparietal (53%, 8/15) areas, and progressed in association with larger white matter lesions over time (22). Dilation of the lateral ventricles was identified in a population of 122 subjects (13). Thinning of the corpus callosum was evident in 88% (23/26) and cortical atrophy in 92% (24/26) of patients (13). Similarly, a case study revealed corpus callosum abnormalities were present in 81% (13/16) and atrophy in 88% (14/16) (22). A striking finding in ALSP in some patients is areas of diffusion restriction that can be confused with stroke (often leading to misdiagnosis), but do not occur in vascular distributions. In summary, MRI data across several studies consistently demonstrates brain volumetric changes including cortical and corpus callosum thinning in ALSP patients highlighting the importance of utilizing advanced analysis techniques for systematic investigation of regional brain volume and cortical thinning as imaging markers for progression of ALSP.
Overall, MRI, as a non-invasive approach, has consistently shown a variety of features of ALSP that demonstrate a strong radiological, pathological and clinical correlation. Four stages of ALSP have been described on the basis of degree of axon loss (54). Stage I is depicted as patchy axon decline in cerebral white matter without atrophy. Stage II reveals large patchy axon loss with slight atrophy of cerebral white matter and slight dilation of the lateral ventricles. Stage III presents wide-spread axon loss in cerebral white matter and dilation of the lateral and third ventricles without prominent axon loss in the brainstem and cerebellum. Stage IV is characterized by extensive damage of cerebral white matter with pronounced dilation of the ventricles and loss of axons in the brainstem and/or cerebellum. With MRI, patients with ALSP have been shown to exhibit bilateral asymmetric white matter lesions that were patchy (as described in histopathology of Stage I), particularly within frontal and parietal lobes in early stages of the disorder. These lesions become confluent and expand into temporal and occipital lobes in later stages of the disease (6, 13, 22, 50, 51), as shown in histopathology of ALSP during Stages III, IV. Based on clinical manifestations of the disease, a frontal lobe syndrome is typical in the early course of the disease and aligns with the histopathology and imaging findings. The thinning of corpus callosum is evident from histopathology of ALSP Stage I and is also evident in the early phases of the disease with MRI. Similarly, both histopathology and MRI indicate that ventricular dilation begins in relatively earlier stages of the disease with consistent progression. Consistent with histopathology, brain atrophy starts in the cerebrum and can affect other brain regions over time (22). Other common findings of histopathology and MRI includes thinning of cerebral cortex or cortical atrophy as well as degeneration of projection fibers (e.g., corticospinal tracts, internal capsule, pyramidal tracts). Notably, some features such as involvement of deep gray matter are rarely seen on MRI and are only present in histopathology of Stage IV. Contrast-enhanced MRI studies in genetically diagnosed ALSP have also revealed a breakdown of the BBB integrity as indicated by the perilesional accumulation of the contrast agent gadobenate-disodium (Gd-BOPTA) (47).
CT images have identified characteristic stepping-stone calcification of periventricular white matter near the frontal horns in up to 50% of patients with ALSP (6, 13) (Figure 4). Brain calcifications have been detected in patients with asymptomatic ALSP and the CSF1R mutation (13, 55). The relationship between formation of calcifications and the underlying disease mechanisms are unclear.
FIGURE 4
To date, alternate and advanced imaging techniques have been tested or proposed for use in ALSP and other leukodystrophies. For example, DTI, which quantifies the white matter integrity through analysis of water diffusivity, is a unique analysis technique applied to Diffusion Weighted Imaging (DWI) scans to characterize global diffusivity but also along specific directionality. A DTI study (56) was conducted in patients with leukodystrophy across different age groups and showed that DTI could be used to quantitatively capture changes in the white matter integrity in terms of magnitude and directionality and correlate the diffusivity abnormalities with ALSP progression, both spatially and temporally.
Magnetic resonance spectroscopy reveals markedly increased levels of cholin, myo-inositol and lactate and a decreased N-acetylaspartate peak in ALSP. These findings are clearly different from cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) (51).
Single photon emission computed tomography (SPECT) in combination with DaTscanTM I-123 ioflupane injection and positron emission computed tomography (PET) have been used for brain imaging of neurodegenerative disorders such as ALSP, Alzheimer's Disease (AD) and Parkinson's Disease (PD). These imaging techniques provide valuable information on clinical diagnosis, pathology, disease progression and patient care (57). For example, SPECT with DaTscanTM reveals loss of presynaptic dopamine transporter function in the striatum and 18F-[fluorodeoxyglucose] PET illustrates diffuse cortical hypometabolism primarily in fronto-parietal areas of patients with ALSP (1, 6, 58). Finally, optical coherence tomographic imaging has also shown atrophy of the retinal nerve consistent with optic tract degeneration in a single case of ALSP (59).
Prevalence
Mendelian adult-onset leukodystrophies are a spectrum of rare, chronic, complex and progressive neurologic disorders that affect the white matter of the CNS, with a total estimated global prevalence of 300 cases per million (60). However, dedicated epidemiological studies are missing to support the available prevalence data. The worldwide incidence of these disorders has more recently been reported to be 5 per 100,000 (61). Future studies are critical to fully evaluate the epidemiology of adult-onset leukodystrophies.
Historically, the diagnosis of ALSP was previously dependent on histopathologic findings from brain biopsies or autopsies. The number of patients who were definitively diagnosed with ALSP was extremely limited until the discovery of CSF1R-related gene mutations. Although still rare, genetically diagnosed CSF1R-related ALSP has been increasingly recognized around the world (identified in Canada, China, Croatia, Germany, Italy, Japan, Netherlands, Norway, Poland, Saudi Arabia, Sweden, South Korea, Taiwan, United Kingdom, and United States) since 2012. Therefore, this disease obviously has global distribution and many patients may still be underdiagnosed (6).
In a series of leukodystrophy cases, 12 probands or cases with mutations in the CSF1R gene were identified (58). These mutations were responsible for 11% (12 of 114) of the overall series, including 7% (6 of 88) of the clinical series of patients with leukodystrophy on brain MRI and 20% (5 of 25) of the patients with a histopathological diagnosis of HDLS. In a smaller series in which 25 patients with adult-onset leukoencephalopathy of unknown cause were screened for mutations in the CSF1R gene, six patients (24%) showed a CSF1R mutation (9).
One study estimated the frequency of CSF1R-related leukoencephalopathy at 10% (5 of 48) of adult-onset leukoencephalopathies and suggested that it could be the most common type (5). Approximately one-third of patients with genetically proven CSF1R-related ALSP have been reported in the adult-onset leukoencephalopathy population in Japan (13). Based on an increasing number of such case report studies, patients with CSF1R-related ALSP constitute an overall global incidence range of 10-25% of the adult-onset leukodystrophy population (14).
As of 20 May 2021, based upon the available peer-reviewed literature, the total estimated global prevalence of mendelian adult-onset leukodystrophies is 300 cases/million and 10-25% of those cases are projected to be CSF1R-related ALSP patients. In the United States population, the estimated prevalence of CSF1R-related ALSP patients is 9,970-24,926 (60). Additional epidemiological studies are warranted to fully characterize the prevalence of ALSP.
Clinical Course
The mean age for onset of symptoms of ALSP is primarily in the 4th decade but can span from early adulthood to the 8th decade (14). The cumulative incidence of CSF1R-associated ALSP increases from 10% at 27 years of age, to 50% at 43 years of age and to 95% at 60 years of age, for a median age of 43 years (13). One of the few large case studies and literature reviews (122 patients) reported that the onset of ALSP symptoms occurs on average earlier in women (40 years) than in men (47 years) (13). Progression of the disorder from onset of symptoms to death varies from 2 to >30 years (mean, 6-8 years) (13, 62).
ALSP is clinically delineated by cognitive dysfunction with neuropsychiatric and motor symptoms. Signs and symptoms tend to be non-specific in the early stages of the disorder and may be difficult to distinguish from other neurological disorders in the absence of genetic confirmation of CSF1R gene mutations. The presenting cognitive, neuropsychiatric and motor symptoms and the rate of progression of symptoms varies among patients and within family members who carry the same CSF1R mutation (14). A frontal lobe syndrome, which is characterized by cognitive impairment, neuropsychiatric changes (depression, minimal social inhibition and poor insight) and limited motor dysfunction, is usually detected during the early stages of ALSP, and some patients may exhibit mild seizures (14, 53, 63).
The type and incidence of initial core clinical symptoms of ALSP were rigorously evaluated in a case series and literature review of 106 out of 122 male and female patients diagnosed with ALSP (13). Cognitive impairment (59%), neuropsychiatric symptoms (44%) including anxiety, depression, apathy, indifference, abulia, irritability, disinhibition and distraction, motor dysfunction (38%) involving parkinsonian symptoms, gait disturbances and spasticity, speech difficulty (19%) and other symptoms (8%) including stroke-like episodes, sensory dysfunction, dizziness, fatigue and epilepsy, were reported in the early stages of ALSP. Approximately half of the 106 cases presented with 2 or more symptoms during early onset of ALSP. The rate of motor dysfunction was higher than the rate of cognitive impairment in women aged 20-29 years.
Progression of the neuropsychiatric aspects of ALSP can lead to further cognitive decline, severe depression, apathy, anxiety, irritability and familial dementia and subcortical gliosis of the Neumann type. Progressive motor symptoms are numerous and often include parkinsonian signs, such as tremor, rigidity, bradykinesia and postural instability. Additional progressive symptoms involve higher cortical functions (aphasia, agraphia, acalculia and very frequently apraxia), pyramidal detriments (hyperreflexia, hypertonia, spasticity and bilateral Babinski signs), bulbar signs (dysarthria, dysphagia and slurred speech), cerebellar abnormalities (ataxia, dysmetria, intention tremor and gait disturbances), and seizures. Development of sensory symptoms involve a diminished sense of vibration, position, touch and pain perception (6, 13, 14).
Rare progressive events of ALSP may include stroke-like episodes, bone cysts and optic and peripheral nerve dysfunction (6, 13, 14). Progression of the cognitive and motor deficits elicits a significant diminution in quality of life and disruption of employment. In the final stages of the disorder, loss of speech and voluntary movements, confinement to bed and a vegetative state are evident. Infections such as pneumonia often result in death (14).
Diagnosis and Clinical Evaluation
The diagnosis of ALSP requires exclusion of autosomal dominant disorders with symptoms that overlap with ALSP, including Alexander disease (bulbar/pseudo bulbar signs, ataxia and spasticity), adult-onset autosomal dominant leukodystrophy (ADLD) (impaired cognition, pyramidal and cerebellar signs), cerebral autosomal dominant arteriopathy (subcortical infarcts and leukoencephalopathy, frontal lobe syndrome and white matter lesions), frontotemporal dementia (FTD) (frontal lobe pathology and pyramidal/extrapyramidal signs) and early-onset AD (executive dysfunction, personality derangement and similar onset of age) (14). Several other disorders such as autosomal recessive or X-linked leukodystrophies (vanishing white matter disease, metachromatic leukodystrophy, Krabbe's disease or X-linked adrenoleukodystrophy) as well as mitochondrial diseases (e.g., Leigh syndrome) have overlapping clinical symptoms with ALSP (14) and further complicate the differential diagnosis of ALSP, confirming the need for genetic testing, such as a leukodystrophy panel or whole exome testing (no family history) or gene testing (known family history).
Diagnosis of suspected ALSP is a multistep process (14, 30, 53, 64) that is typically initiated in patients, with a positive family history, who exhibit one or more of a variety of characteristic symptoms, such as personality changes, impaired cognition, memory derangement, bouts of depression or motor dysfunction, such as muscle weakness, impaired gait, slow movement, rigidity and tremor. MRI scans show distinctive radiological signs that are used to identify white matter lesions in the frontal region, corpus callosum and corticospinal tracts of the brain, as well as recognize enlarged ventricles due to cerebral atrophy.
A three-step MRI differential diagnostic approach has been proposed for several adult leukodystrophies, including ALSP. The first step involves identification of symmetric white matter. The second step consists of classification of the white matter into one or more of six patterns (parietal-occipital, frontal, periventricular, subcortical, brainstem involvement, and cerebellar involvement). The third step entails evaluation of five distinct characteristics (enhancement, lesions with signal intensity similar to CSF, susceptibility-weighted MRI signal intensity abnormalities, atypical peaks of MRI spectroscopy and spinal cord involvement) (65).
Medical history of family members can inform if ALSP is present in the lineage. The diagnosis of ALSP is verified through genetic testing and identification of a mutated CSF1R gene in most patients who are afflicted with ALSP (13, 14, 22, 30, 31, 53, 66).
Diagnostic criteria for CSFIR-related ALSP without a genetic test diagnosis have been developed and validated through a retrospective case study (Supplementary Table 2) (53), although a genetic test is recommended and finding of a known pathogenic CSF1R mutation supercedes these criteria. “Probable” and “possible” diagnostic designations were the outcomes based upon retrospectively specified clinical characteristics of ALSP, including age at onset ≤ 60 years, >2 impairments (e.g., cognitive, pyramidal, Parkinsonism or epilepsy), autosomal dominant inheritance and brain MRI/CT findings, such as bilateral cerebral white matter lesions and thinning of corpus callosum. Among the 83 patients that were positive for a CSF1R mutation, 50 (60%) had a “probable” diagnosis and 32 (39%) had a “possible” diagnosis of ALSP, resulting in a high level of sensitivity.
The specificity of an MRI diagnosis for CSF1R-related leukoencephalopathy was determined by retrospective evaluation of 53 cases of CSF1R-mutation-negative leukoencephalopathy and 32 cases of CADASIL. The MRI diagnostic algorithm excluded 22 cases (42%) that were negative for a CSF1R mutation and 28 cases (88%) that had a diagnosis of CADASIL. Moderate specificity for accurate diagnosis of CSF1R-related leukoencephalopathy relative to mutation-negative cases and the high specificity of CSF1R-related leukoencephalopathy relative to CADASIL cases were confirmed by this MRI diagnostic platform (53).
A more recent case study of 135 patients who were suspected of having adult-onset leukoencephalopathy due to CSF1R mutation was conducted to further evaluate the sensitivity and selectivity of diagnostic factors (30). As a result of genetic testing, 28 cases were positive for a CSF1R mutation and 107 cases were negative for a CSF1R mutation. Younger age at onset, Parkinsonian symptoms, reduction in the corpus callosum volume and presence of diffusion- restricted lesions were important predictors of CSF1R-positive cases whereas involuntary movements and brain stem or cerebellar atrophy were poor predictors of CSF1R-positive cases. The model confirmed high sensitivity for probable or possible CSF1R-related leukoencephalopathy at 81%, but like many models, suffered from lack of specificity at 14%.
Due to the above studies, the diagnostic accuracy for CSF1R-related leukoencephalopathy has significantly improved in recent years. After diagnosis of ALSP, clinical evaluations by a neurologist, psychiatrist, orthopedist, physical therapist and occupational therapist are periodically conducted for surveillance and for the treatment of symptoms with progression of the disorder. These assessments involve neurologic examination with cognitive and psychiatric evaluations, MRI of the brain for white matter lesions, brain atrophy and thinned corpus callosum and electroencephalograms (EEGs) for suspected seizures. Lumbar punctures have been proposed for the assessment of protein and cellular content. While not yet measured routinely for clinical management, serum NfL is an easily accessible, putative biomarker for following native disease course in ALSP (67) and potential treatment response.
Current Treatment For Management of Symptoms
Currently, there are no regulatory-approved, disease modifying therapies for ALSP. Symptomatic treatments target the temporary relief of motor, mood and behavior symptoms and provide supportive care with the goal of maintaining quality of life as the disorder progresses (6). Although several regulatory-approved pharmacotherapies are prescribed off-label to treat the symptoms of ALSP, such as spasticity or seizures, that are comparable to those of other neurologic disorders (14), none of these pharmacotherapies target the cause or slow the progression of ALSP.
Dopaminergic drugs are used off-label to treat Parkinsonian symptoms with limited effectiveness because dopaminergic neurons are usually unaffected in the substantia nigra of patients with ALSP (68). As some symptoms of ALSP are similar to those of patients with AD, cholinesterase inhibitors have been prescribed but elicit minimal stabilization of symptoms of cognitive deficiency in patients with ALSP (69).
Antidepressants offer modest short-term efficacy for depression (14) and antipsychotic drugs are occasionally prescribed with caution for patients with ALSP because of the side effects including extrapyramidal symptoms and safety issues. There is risk of suicidal ideation associated with these agents but they may be useful in highly aggressive patients (14). Muscle relaxants for spasticity, anti-epileptic medications (e.g., benzodiazepines, gabapentin, valproic acid) generalized epileptic seizures and antibiotics for pneumonia and urinary tract infections have shown some benefit in patients with ALSP (6). Patients with ALSP generally fail to respond to immunomodulators, such as steroids, interferon and cyclophosphamide (6). The efficacy of other approaches, such as allogeneic HSCT (27, 48, 70, 71) and pre-symptomatic immunosuppression (72) have shown potential effectiveness in small retrospective case reports but have not yet been tested in controlled clinical trials.
Food consumption patterns and nutrition should be monitored throughout the disease course, as symptoms of ALSP can include dysphagia and gastrointestinal dysfunction, such as constipation and fecal incontinence. Urinary or urge incontinence may be alleviated by medication, scheduled toileting and intermittent or permanent catheterization of the urinary bladder. Physical, occupational and speech therapy are essential to maintain patient mobility, self-dependence and execution of daily living for as long as possible. Professional counseling is important to educate the patient and relatives on the symptoms and progression of ALSP and ensure a supportive family structure. However, due to the rareness of the disease, only a small number of experts in ALSP are available. Genetic counseling of the patient and relatives is necessary to explain the probability of inheritance and assist in the decision making of genetic testing of relatives (6, 14, 44). Referral to leukodystrophy communities/relevant foundations (e.g., Sisters' Hope Foundation) is essential for ongoing patient, family and caregiver support.
Potential Neuropathophysiologic Biomarkers
A limited number of clinical case studies have been performed to evaluate the neuropathophysiologic biomarkers of ALSP. Abnormal levels of cytoskeletal proteins, such as NfL protein, tau protein, and glial fibrillary acid, were originally identified as potential biomarkers in 4 cases of ALSP (33, 62). In a more recent small study of 4 patients with CSF1R-mutation-positive ALSP, profiling of peripheral blood mononuclear cells (PBMCs) showed a basal proinflammatory phenotype (28).
NfL proteins support the cytoskeleton of neurons and myelinated axons, and elevated levels of NfL in CSF and blood are believed to be indicative of neuron death and axonal deterioration in a growing number of neurodegenerative disorders, including AD, PD, FTD, Lewy body dementia (LBD), progressive supranuclear palsy (PSP), Down syndrome, multiple sclerosis (MS), amyotrophic lateral sclerosis (ALS), Huntington's disease, X-linked adrenoleukodystrophy, spinocerebellar ataxia and Charcot-Marie-Tooth disease (73–85). A recent case control study demonstrated that serum and CSF levels of NfL protein were markedly higher in patients with symptomatic or presymptomatic (i.e., carriers) CSF1R-mutation-positive ALSP vs. that in healthy control subjects or in patients with MS (67). NfL protein levels in CSF were over 30-fold higher in patients with CSF1R-mutation-positive ALSP than in age-matched control subjects and serum NfL protein levels were significantly higher in symptomatic patients compared to presymptomatic CSF1R mutation carriers. Comparatively, patients with AD, ALS, FTD, LBD, and PSP have been shown to have CSF NfL levels approximately 2.3-fold, 7.2-fold, 3-fold, 2.8-fold, and 3.5-fold higher than healthy controls, respectively (82). Based on compelling evidence from case studies of ALSP and other neurodegenerative disorders, levels of NfL protein in serum and CSF may be predictive of clinical efficacy and should be rigorously tested as a potential biomarker and surrogate clinical endpoint for future clinical trials of therapeutic agents for ALSP.
Tau proteins regulate stability of microtubules in axons and neurons of the CNS. Abnormal levels of total tau protein concentrations (tauopathies) in CSF have been identified as a potential therapeutic biomarker in several neurodegenerative disorders, including AD, PD, progressive supranuclear palsy and ALSP (14, 86–88). Glial fibrillary acidic protein reinforces the cytoskeleton of astrocytes and increased expression often correlates with various types of neurodegenerative pathology. Increased concentrations of this protein have been observed in patients with ALSP and in patients with brain injuries (14, 89). Tau and glial fibrillary acidic proteins should also undergo further evaluation as potential biomarkers and surrogate endpoints for clinical trials of therapeutic agents for ALSP.
Current and Proposed Interventional Clinical Studies of Therapeutics
Information on the use of HSCT for the treatment of ALSP is derived from four case studies with a limited number of patients (n=11) and inadequate controls. In the earliest case study, 1 of 4 siblings with ALSP underwent an allogeneic HSCT and experienced stabilization of ALSP symptoms and personality within 6 months, together with no progression in motor symptoms over the next 15 years (70). However, as the authors point out, the stabilization of symptoms in this transplanted patient may have developed spontaneously and therefore was potentially unrelated to HSCT. In a second case study of a single ALSP patient (71), the patient displayed deterioration with pyramidal symptoms and was confined to a wheelchair after 3 months of HSCT. Complications during HSCT involved hemorrhagic cystitis and pyelonephritis but both resolved after 6 months. Some stabilization of neurologic symptoms began at 6 months after allogeneic HSCT. Modest improvement in symptoms of ALSP occurred during the 30-month post-transplant period, including minimal limb mobility and stabilized cognition and mood on the Expanded Disability Status Scale (EDSS), concomitant with a decrease in lesions in the white matter through diffusion weighted imaging and reduced FLAIR hyperintensities on MRI. In a third case study of 2 patients with ALSP (27), some stabilization of cognitive deficits, functional status and gait impairment occurred over 2 years after transplant despite some continued neurological deterioration. There was no evidence of graft vs. host disease (GVHD), but a major infection developed in one patient and seizures were evident in the other patient. MRI scans of the brain demonstrated stabilization of FLAIR-related lesions in the white matter at 1 year, with continued stabilization over 2 years post-transplant. In a fourth case study, seven ALSP patients received HSCT at different stages of the disease (48) to determine the effect on progression. Six of the seven patients had several clinical evaluations at various time points post-transplant (one patient died post-transplant) and trended toward stabilization on motor examinations, cognitive scores and/or MIR abnormalities. Other minor clinical improvements tended to be empirical and subject to investigator bias because a negative control group was not included. Three patients developed GVHD. Overall, the four published case studies of HSCT with limited numbers of patients (n = 11) showed minimal to modest stabilization or improvement of ALSP symptoms with significant safety concerns including death of one patient.
Although the data on HSCT in ALSP are limited, given the challenges and risks of HSCT for the treatment of leukodystrophies and associated complications, clinical guidelines have been developed for pediatric patients with leukodystrophies and are likely applicable to adult patients as well (90). These guidelines focus on the assessment depending on the type of HSCT, patient eligibility, donor selection, conditioning regimen, pre-transplantation, supportive care and posttransplant follow-up. Early detection and therapy of leukodystrophies are highly recommended along with a close working relationship between families of patients and healthcare providers.
Microglial replacement, which represents a potential therapy for CSF1R-related leukoencephalopathy, has been the focal point of intense non-clinical research and may enter into clinical studies in the near future (91). Microglia are resident, innate immunity cells of CNS that monitor and maintain the robust physiology of the CNS. Microglia respond to various types of cellular and metabolic distress signals in the CNS and regulate responses for repair and remyelination of nerve fibers, phagocytosis of dead cells, maintenance of synapses and blood vessels and control of neuroinflammation associated with infection and carcinoma. The CSF1R cell-surface receptor is expressed predominantly on microglia in the brain (92) and in the spleen, placenta and appendix according to the Human Protein Atlas. Mutations of the CSF1R gene codes are transcribed to mutant CSF1R protein with suboptimal receptor function that leads to dysfunctional monocytic lineage cells with reduced survival and abnormal distribution (93). Thus, impaired microglia are recognized as a primary causative factor underlying CSF1R-related leukoencephalopathy.
The strong link between CSF1R mutations and pathologic microglia has resulted in further classification of CSF1R-related leukoencephalopathy as a CNS primary microgliopathy (91). Replacement of microglia by proliferation of resident microglia, infiltration of microglia-like cells and HSCT (described above) have been evaluated as therapeutic approaches for CSF1R-related leukoencephalopathy in mouse models and shown preliminary evidence of efficacy (91). Future human case studies and clinical trials of these microglial replacement therapies will assess the efficacy and safety in patients with ALSP.
The response of microglial cells to changes in the environment of the CNS is activated through a triggering receptor on myeloid cells 2 (TREM2) and its associated protein kinase complex, kDa transmembrane protein (DAP12) (94). The TREM2/DAP12 complex initiates a signaling cascade, including phosphorylation of the spleen tyrosine kinase (SYK). This phosphorylation subsequently activates multiple intracellular pathways of microglia controlled by TREM2 signaling cascades, including phosphatidylinositol 3-kinase, protein kinase C, extracellular regulated kinase, Akt serine/threonine kinase and the elevation of intracellular calcium (95, 96). TREM2-mediated activation pathways include phagocytosis, cell survival and proliferation, modulation of inflammation and regulation of lipid metabolism (97, 98) potentially enabling neuroprotection and nerve tissue regeneration. Mutations in TREM2/DAP12 are associated with the autosomal recessive disorder Nasu-Hakola disease, which is characterized by bone cysts, muscle wasting, and demyelination phenotypes (58). Animal and human genetic studies have demonstrated that microglia without TREM2 or with mutated TREM2 do not convert to an activated stage and subsequently lead to development and/or progression of neurologic disorders. Furthermore, animal models of PD, AD, ALS and demyelinating disease display dysregulation of TREM2/DAP12 signals that promotes pathogenesis of neurodegeneration (94). Based on extensive biochemical research, CSF1R and TREM2 share significant portions of their signaling function that converge via DAP12 and SYK phosphorylation. ALSP is presumably caused by haploinsufficiency of CSF1R due to inactivating mutations, usually in the kinase domain, which results in dysfunctional microglia leading to neurodegenerative pathology, such as neuroinflammation, dementia, and white matter loss (29). Therefore, the signaling pathway convergence between TREM2 and CSF1R, shown in Figure 4, provides the possibility for TREM2 activation to rescue or compensate for CSF1R loss of function (94).
It is apparent that there is dearth of therapies that directly target the etiology of ALSP. Clinical studies should be conducted to develop safe and effective therapies that address the etiology of ALSP, a rare, debilitating and life-threatening neurologic disorder.
Potential Efficacy Endpoints For Future Interventional Trials
Due to the relatively recent identification of the CSF1R gene mutations, specific clinical trial methodologies for ALSP are still evolving. Meaningful biomarkers and efficacy endpoints that capture disease progression will be essential for interventional clinical trials of ALSP. Based upon case studies of ALSP, neuroimaging markers (MRI and CT) and clinician- and patient-rated scales for cognitive, psychiatric and motor dysfunction, coupled with global impression of change assessments, quality of life and disability evaluations, will likely yield convergent endpoints to evaluate efficacy and justify clinical meaningfulness of novel therapeutic agents. Given the similarity of some signs and symptoms of ALSP with FTD, PD and MS, some of the clinical trial methodologies for efficacy endpoints of the related neurologic disorders may be applicable to clinical trials of ALSP.
Cognitive Decline
Cognitive decline is a clinically significant symptom of ALSP that presents early in the disorder and progresses rapidly (6, 14). In view of this finding, identification of cognitive assessments that capture deficits and decline is an important predictive clinical endpoint for interventional clinical trials of ALSP. Effective scales for measurement of cognitive decline should be fully validated, have inter-relater reliability, show sensitivity to early cognitive changes as well capture decline during progression of the disease and be acceptable to both the patient and assessor (99). Reports of the performance of patients with ALSP on specific cognitive tests have been limited to case reports (63). Given these limitations and the known localization of pathology in patients with ALSP, cognitive tests probing frontal lobe functions, both cortical and subcortical, including attention, processing speed, working memory and cognitive flexibility, are of particular interest.
The Montreal Cognitive Assessment (MoCA) is a validated tool for rapid screening of mild cognitive impairment (100, 101). The MoCA is extensively used as a clinical trial endpoint and for clinical screening in practices to measure cognitive dysfunction in patients with PD or dementia because of its high sensitivity (100%) and specificity (87%) (102, 103).
Other commonly used assessment scales for cognitive decline are the Mini-Mental State Examination (MMSE) (104) and Mini-Cog Test (105). The MMSE has acceptable test-retest and inter-relater reliability, with a sensitivity of 69-91% and a specificity of 87-99% (103). The MMSE has advantages over other scales because of its ability to quantitate cognitive dysfunction over time and to definitively assess treatment effects in clinical trials. A disadvantage of MMSE is its lack of sensibility to mild cognitive disruptions, particularly those related to frontal lobe dysfunction (106).
Several other cognitive tests may be appropriate for ALSP clinical trials. The Trail Making Test (TMT) measures cognition related to processing speed, sequencing, mental flexibility and visual/motor skills (107). The Wisconsin Card Sorting Test (WCST) is aimed at higher level cognitive processes, such as attention, perseverance, abstract thinking and adaption to change (108). The WCST employs two card packs with four stimulus cards and 64 response cards in each pack. The Symbol Digit Modalities Test (SDMT) examines divided attention, visual scanning, tracking, processing speed and motor speed (109). A smartphone-based symbol-digit SDMT has recently been developed to reduce the time of the test (110). The Verbal Fluency Test is primarily designed to measure executive dysfunction (111). The Stroop Color and Word Test (SCWT) assesses the ability to inhibit cognitive interference that takes place when the processing of an initial stimulus affects the simultaneous processing of a second stimulus (112). Due to the reduced capacity of ALSP patients to focus on tasks for a prolonged period of time along with loss of speech and dysfunctional arms and hands, it will be critical to select a battery of cognitive tests that have the flexibility to conduct simple and time expedient verbal or written versions.
Additional clinical scales of cognitive dysfunction that have the potential to yield endpoints for clinical trials of ALSP are the well-known CERAD test battery for AD, Saint Louis University Mental Status (SLUMS) (113), the Memory Impairment Screen (MIS) (114, 115), Clock Drawing Test (CDT) (116), Clinical Dementia Rating (CDR) scale (117), CDR plus National Alzheimer's Coordinating Center Frontotemporal Lobar Degeneration (FTLD) rating (118) and Neuropsychiatry Unit Cognitive Assessment Tool (NUCOG) (119). These scales (described in Supplementary Table 3) are semi-quantitative and have acceptable levels of sensitivity and specificity. Further evaluation of these scales will determine their degree of applicability as endpoints for therapeutic clinical trials of ALSP.
Motor and Sensory Dysfunctions
Scales that are specifically designed to score motor and sensory dysfunctions of ALSP are not currently available. As the early and progressive stages of ALSP display some motor and non-motor symptoms that are comparable to PD (14), scales used in PD clinical trials may serve as predictive clinical endpoints for interventional clinical trials of ALSP.
Based upon the four components of the Movement Disorder Society (MDS)-sponsored revision (120) of the Unified Parkinson's Disease Rating Scale (MDS-UPDRS), this validated scoring system may be applicable to ALSP. The MDS-UPDRS items are rated by clinicians, patients or both. There are four main components each of which includes several questions related to sensory and motor disabilities. With the exclusion of part 4 which quantifies complications of dopamine replacement therapies, the MDS-UPDRS is a comprehensive scoring tool for motor and sensory complications and quality of life and, therefore, may serve as a clinically meaningful and predictive endpoint to assess therapies in interventional clinical trials of ALSP. However, the overlapping pyramidal and extrapyramidal symptoms in ALSP may introduce scoring limitations and should be considered during the endpoint selection process.
The EDSS is a frequently used disability scale for clinical trials in MS with high relevance to symptoms and functions of patients with ALSP (121). Due to some similarity in the symptoms of ALSP and MS, the EDSS may be another tool to quantify disability endpoints over time in clinical trials of ALSP. The following functional systems are rated: pyramidal (muscle weakness), cerebellar (ataxia, loss of balance, tremor), brainstem (speech problems, swallowing, nystagmus), sensory (numbness, loss of sensation), bowel and bladder (incontinence), visual and cerebral (thinking, memory, fatigue), walking distance and usage of walking aid and/or extension wheelchair.
Several tools that directly measure how a patient functions (gait, strength, spasticity) or feels may provide clinically meaningful endpoints for clinical trials in ALSP. Measurement of the distance walked within a specific time period is evaluated by the 2- or 6-min walk test (122). The Timed Up and Go (TUG) test identifies mobility and balance abnormalities. (123). The Spastic Paraplegia Rating Scale (SPRS) is a reliable and validated measurement of the severity and progression of spasticity (124). Limb and muscle spasticity can also be scored by the Modified Ashworth Scale (MAS), a scale that is widely used in clinical practice for rating the spasticity of extremities and in clinical trials for an assessment of the therapeutic efficacy of spasticity (125).
Impaired Activities of Daily Living and Physical and Behavioral Dysfunction
Several scales rate the patient's feelings about how daily activities of life are affected by their health disorder. These additional scales may serve as congruent, clinically predictive endpoints of efficacy in clinical trials of therapeutic agents for ALSP. The Goal Attainment Scale (GAS) is a clinician- and patient-scored tool that rates three health goals that are developed by the patient. The patient's progress toward goal achievement is evaluated on a five-point scale from −2 (unfavorable) to +2 (best anticipated outcome) (126). The visual analog scale (VAS) (127), Clinical Global Impressions of Severity (CGI-S) and Improvement (CGI-I) (128), 36-item Short Form Health Survey (SF-36) (129) and Schwab and England Activities of Daily Living (ADL) for PD (130) (described in Supplementary Table 4) are widely accepted global scoring systems for MS and PD and, therefore, may be beneficial for patient and clinician assessment of the dysfunctional effects of ALSP on activities of daily life. Disability and functional scales (described in Supplementary Table 4), such as the Total Functional Capacity (TFC) for Huntington's Disease (131), the Karnofsky Performance Status (KPS) (132) and the Cortical Basal ganglia Functional Scale (CBFS) (133) may also prove to yield clinically meaningful endpoints for ALSP clinical trials. The EuroQOL 5 dimensions questionnaire (EQ-SD) scale is used for MS patients and may be applicable to ALSP (134).
Scales that measure behavioral impairment of patients are likely to generate clinically meaningful data in clinical trials of ALSP (Supplementary Table 5). These widely used neuropsychiatric tools evaluate depression with the Hamilton Rating Scale for Depression (HAM-D) (135, 136) and the Beck Depression Inventory (BDI) (137, 138) and psychosis using the Neuropsychiatric Interview (NPI) (139). Hospital, anxiety, depression scale (HADS) is a useful self-assessment scale for anxiety and depression and a screening tool for mood disorders (140).
Given the severity and devastating progression of ALSP, it will be meaningful to evaluate the behavioral burden that affects the daily lives of caregivers. The Zarit Burden Interview (ZBI) is a commonly used measure of caregiver burden (141). This scoring system covers a wide range of dimensions that include consequences of caregiving, patient dependence, exhaustion and uncertainty, guilt or self-criticism, embarrassment, anger or frustration, psychological burden, emotional reactions and personal/role strain. ZBI has shown acceptable internal consistency and excellent reliability and validity in patients with dementia (142).
Finally, given the heterogeneity of potential symptom presentations and combinations in ALSP, particularly in the early symptomatic stages, patient-specific and patient-centered outcome measures may also be valuable approaches (143).
Magnetic Resonance Imaging and Other Biomarker Surrogates
Analysis of MRI scans has demonstrated that white matter damage is a congruous finding in most patients with ALSP. White matter abnormalities occur early and are progressive. Given the rapid confluence of patchy or focal T2-weighted hyperintensities and progression of cortical atrophy during the course of ALSP, longitudinal MRI scans on a yearly follow-up basis after diagnosis of ALSP have been recommended to generate a more accurate prognosis of the disorder (14) and may serve as reliable surrogate endpoints for clinical trials.
The MRI severity scoring system, which was developed based on MRI scans of 15 patients with ALSP, may serve as an endpoint for interventional trials of ALSP. The semi-quantitative severity scoring of white matter lesions and brain atrophy is based on a range of 0 (minimal severity) to 57 (maximum severity). Analysis of MRI scans from these 15 patients showed that 14 of the patients (93%) had white matter lesions and the mean total severity score was 16.6 points (range, 10-33.5 points). Although this MRI scoring system shows promise, it requires further validation by prospective longitudinal studies of additional patients and a standard imaging protocol (50, 53).
A widely used scoring method for MRIs of leukodystrophies, the Loes severity score, may also serve as a surrogate clinical endpoint for ALSP clinical trials. This scoring method employs a severity score of 0-34 points for white matter lesions and, with minor modifications, has the capability to detect progression, stabilization and improvement of multiple leukodystrophies (144). Definitive longitudinal MRI studies of progression of white matter abnormalities have not been conducted in patients with ALSP. In one case study of a family in which seven members were diagnosed with HDLS, sequential images in the proband (one MRI at the onset of the disorder and two MRIs during the follow-up period) displayed a progressive, confluent frontal predominant HDLS with symmetrical cortical atrophy (49).
Longitudinal MRI alterations were also detected in seven patients with HDLS through the MRI rating scale. Total MRI scores varied from 12 to 44, white matter lesion scores ranged from 11 to 32 and atrophy scores ranged from 1 to 12. The severity of MRI scores increased significantly with the duration of HDLS (total score, p < 0.01, white matter lesion score, p < 0.01 and atrophy score, p < 0.01). The mean changes in scores on a year basis were 3.7 ± 1.5 for the total score, 2.5 ± 1.1 for white matter lesion score and 1.3 ± 0.5 for the atrophy score (52).
Rapid Estimation of Myelin for Diagnostic Imaging provides a validated and robust myelin quantification that detects diffuse demyelination in normal-appearing tissue in MS (145). This demyelination is associated with both cognitive and clinical disability. Because the technique is rapid with automatic postprocessing and U.S. FDA approval, it may be a clinically feasible biomarker suitable for monitoring myelin dynamics and evaluation of treatments aimed at remyelination of ALSP.
Biochemical assays of levels of various soluble biomarkers in CSF (tau proteins, NfL proteins and glial fibrillary acidic protein) and in plasma (NfL) of ALSP patients may serve as meaningful surrogate endpoints for clinical trials (14, 20, 24, 40, 67, 86). These biomarkers are etiologic factors that underlie neural, axonal and glial cell damage, and may be considered as trial endpoints in conjunction with MRI analysis. Further development and validation of such assays are important for early translational trials in ALSP.
Digital Biomarkers
Traditional methods of assessing neuromotor disorders, such as clinical rating scales, are subjective and prone to human bias. During the last decade, a multitude of technology-based objective measures of human behavior and function have been developed, bringing with them the promise of substantial change to the diagnostic, monitoring and therapeutic landscape in neurodegenerative diseases (146, 147). Sensors, mobile communications, cloud computing, advanced analytics and the Internet of Things (wireless connectivity of all electronic devices) are among the innovations that have the potential to transform healthcare and the approach to patients with chronic, complex and fluctuating disorders (148). These devices offer potential novel approaches to more accurately assess motor dysfunction in interventional clinical trials of ALSP.
Wearable activity trackers are electronic monitoring devices that enable users to track and monitor their health-related physical fitness metrics, including the number of steps taken, level of activity, walking distance, heart rate and sleep patterns. Despite the proliferation of these devices in various contexts of use and rising research interest, there is limited understanding of the broad research landscape (149).
Although commercial grade activity monitors like Fitbits and the Apple Watch provide objective data, the results are limited to activity tracking only. Medical-grade wearable precision motion sensor solutions overcome these limitations. Such platforms can deliver objective, high-frequency data combined with scientifically validated endpoints that are specific to a patient population (148).
The use of consumer wearable technologies in medicine is becoming increasingly more common. For instance, in the field of sleep medicine, the use of actigraphy for sleep monitoring may be used to supplant more traditional methods like polysomnography due to its validity, lower cost and ability to evaluate individuals in their homes over a longer period of time (150). Advanced wearable technologies can also precisely monitor skin conductance, respiratory rate, blood pressure and oximetry and provide surface electromyography (EMG), electrocardiography (ECG) and electroencephalograpy (EEG) tracings. Furthermore, the ability to collect multiple aspects of human function with smart devices (mobile phones, tablets and smart watches) provides additional opportunities to collect and analyze numerous clinically relevant parameters (e.g., posture, balance, gait, dexterity, voice and speech patterns, facial expression, eye tracking, medication).
Development of precision medicine subtypes for common diseases, such as PD and AD, and deep phenotype maps based on digital sensing technologies of rare disease populations, such as ALSP, could capture therapeutic responsiveness to experimental treatment paradigms (151–156).
Patient and Caregiver Perspective of Burden Due to Unmet Medical Need
Progressive neurologic disorders invoke a heavy burden on afflicted patients, caregivers and society (157). Although data on the patient and caregiver burden of ALSP are unavailable, data from other progressive neurological disorders provide insight into the potential burden of ALSP on patients and caregivers.
Research questionnaires have been used to understand the unmet medical needs of progressive neurologic disorders by directly seeking input from the afflicted patients. A cross-sectional study of 1,205 patients with MS was conducted using a questionnaire to collect information on demographics (sex, age, education, employment), clinical status (form, disease duration, disability level) and unmet healthcare and social needs (12 items scored as yes/no) (158). Psychological support (27.5%) was the greatest unmet healthcare need, followed by temporary admission to rehabilitation (9.8%), access to technical aid (6.7%), access to drugs (5.4%) and lack of nursing home admission (3.2%). Social care needs included assistance with transportation (41%), financial support, architectural barriers, personal assistance (>30%), career guidance and adaptation to workplace (>10%). Unmet healthcare needs were linked to clinical factors, such as disease progression and level of disability.
Because there is a paucity of data underlying the major burden of the physical, psychological, emotional and financial impositions of ALSP on patients, families and caregivers, it is appropriate to examine the burden of closely related neurologic disorders, such as ALS and FTD. ALS and FTD are both characterized as rare diseases by Genetic and Rare Diseases (GARD), National Organization for Rare Disease (NORD) and Orphanet. These are meaningful comparative disorders for ALSP because both are rare diseases that affect motor function, cognition and mental health and have unmet medical needs.
The burden of devastating symptoms of ALS disrupts quality of life and shortens the lifespan of patients. The financial burden to patients, families and payers is substantial. A case study of the costs of care for individual patients was conducted in the United States over a 10-year period (2001-2010) (159). Total costs for the duration of ALS were $1,433,992 (85% paid by insurance, 9% paid by patient and family and 6% paid by charity). The greatest costs involved in-home caregivers ($669,150), ventilation ($212,430) and hospital care ($114,558). These cost factors are particularly burdensome for patients because they markedly influence treatment decisions. It is important to note that this case study did not address the indirect financial detriments to patients, such as lost wages, productivity and terminated employment.
The burden of the progressive symptoms of FTD and the economic burden are staggering for patients, families and caregivers. A robust 250-item survey was administered to primary caregivers of patients with FTD to estimate the cost burden of the disorder (160). The survey was completed by 674 of the 956 caregivers. Direct and indirect annual costs of FTD were $47,916 and $71,737, respectively, and resulted in an annual per-patient charge of $119,653. Elderly patients with later stages of behavioral-variant FTD had higher direct costs whereas male patients aged <65 years had higher indirect costs. The impact of FTD on the patient and family resulted in a mean reduction in household income ranging from $75,000 to $99,000 (12 months before diagnosis) to $50,000 to $59,000 (12 months after diagnosis). This dramatic loss of household income was related to lost days of employment and to early departure from employment. The profound economic burden of FTD may be reduced in the future through accurate and early diagnosis, effective treatments to target cause of the disorder and improved professional services.
The financial burden of MS has been explored in cohort studies conducted with patient data extracted from the Swedish Multiple Sclerosis Register (SMSreg). These MS studies have shown that the level of cognitive function correlates directly with the amount of work disability (161) and quantity of income independent of physical disability (162). Patients with relapsing, remitting MS also earned twice the income of patients with progressive MS (163).
ALSP is a rare, progressive, debilitating disorder and its treatment is an unmet medical need. The signs and symptoms of ALSP present a major burden for daily living, cost of care and life expectancy of afflicted patients. The treatment of ALSP will require a patient-focused, precision medicine therapeutic approach by the multidisciplinary caregiver team and foundation and support groups to address the cause of the disorder, management of motor and sensory symptoms and careful attention to quality of life issues.
Gap Analysis of Clinical Manifestations
There is a paucity of published clinical research literature for ALSP, a rare neurodegenerative disorder. The limited number of published clinical research studies is comprised primarily of case reports with small numbers of patients and absence of controls. Therefore, formal gap analysis of ALSP clinical manifestations was not conducted for this comprehensive review. In an effort to gain some understanding of the gaps in clinical manifestations of ALSP, a count of ALSP-specific publications was conducted. Table 1 lists the references and total number of references for publications that are ALSP-specific for each of the clinical manifestations. The most conspicuous gaps in the literature were identified as the potential efficacy endpoints for future clinical trials. Endpoints such as cognitive decline, motor and sensory dysfunction, impaired activities of daily living with physical and behavioral dysfunction, digital biomarkers and patient and caregiver perspective of burden due to unmet medical need had the fewest (0-3) ALSP-specific literature references. These gaps are likely related to the low global incidence of ALSP patients which have restricted the number of adequate and controlled clinical trials. Future clinical studies of ALSP should target the development of clinically meaningful, congruent, specific and validated efficacy endpoints that will accelerate the discovery of safe and effective therapies for this rare disorder.
TABLE 1
Limitations
There were limitations to this comprehensive review of the clinical manifestations of ALSP. Most of the clinical data were derived from limited numbers of patients in published case studies. Due to the paucity of ALSP-specific clinical literature, some gaps were evident in the clinical manifestations of the disorder, particularly efficacy endpoints. Lack of patient medical records associated with the case studies may have resulted in inaccurate, incomplete or missing assessments of symptoms and disease progression. Quality control of case studies was restricted to inclusion and exclusion criteria with no additional quality parameters. There was considerable variation in geographic location of the clinics involved in the case studies and this may have created inconsistent interpretation of the clinical manifestations.
Conclusions
This comprehensive clinical review of the literature focused on the genetics, neuropathology, imaging findings, prevalence, clinical course, diagnosis and clinical evaluation of ALSP, as well as on prospective biomarkers, current and proposed treatment, promising clinical scales and efficacy endpoints for future therapeutic trials and the burden of ALSP on patients and caregivers. The description of the clinical manifestations of ALSP was derived primarily from clinical case studies with small numbers of patients. Due to the paucity of non-interventional and interventional clinical studies of ALSP, the information gained from this review can serve as a foundation for the strategy and design of future clinical trials, with clinically meaningful and congruent efficacy endpoints for patients with ALSP. These clinical trials will be designed to elicit determinative assessments for the development of therapeutics for ALSP, an orphan neurodegenerative disease with an unmet medical need, target with precision the etiology and alleviate symptoms in an effort to reverse, halt or slow progression of ALSP.
Author Contributions
SP, AP, MB, and SZ were involved in the strategy, conception of work, literature search, and writing and revision of manuscript. EF, VK, DL, WK, LS, SH, TK, TI, TL, JO-M, FE, and ZKW read and critically revised the manuscript. All authors approved the final manuscript for submission.
Conflict of Interest
Unrelated to this study, EF received personal compensation for serving on a PSP Scientific Advisory or Data Safety Monitoring board for Biogen, Vigil Neuroscience, Inc., and Denali Therapeutics, as a section editor for NeuroImage Clinical and as a course director for the AAN Annual Meeting. EF has received research support paid to her institution (UWO) from CIHR and the Weston Foundation to conduct an ongoing study of oxytocin in FTD, from Alzheimer Society of Canada and the Physicians and Services Incorporated Foundation, the Ministry of Research and Innovation of Ontario for research and for site participation in clinical trials sponsored by Alector, Biogen, and TauRx. VK was funded by the Stockholm County Council. WK received consulting honoraria from Vigil Neuroscience. LS was funded by the German Research council (DFG grant SCHO754/6-2), German Ministryof Health (BMG grant ZMVI1-2520DAT94E to LeukoExpert), German Ministry of Education and Research (BMBF grant 01GM1905A to Treat HSP and grant 01GM1907A to Treat ION), European Commission (EU grant 947588 to the ERNRND registry and JPND grant 01ED16028 to ESMI). LS was a member of the European Reference Network for Rare Neurological Diseases (Project No 739510). SH was funded by the Hertie Network of Excellence in Clinical Neuroscience (GHST grant P1200021). TK and TI are funded by AMED JP21dk0207045, a public grant from the Japanese government to support research on ALSP. JO-M was funded by the Conrad N. Hilton Foundation, the Institute for Translational Medicine and Therapeutics Transdisciplinary (ITMAT) and serves as a principal investigator on Vigil Neuroscience, Inc. sponsored clinical studies (VGL101-01.001; VGL101-01.002). FE is the principal investigator of Bluebird Bio and Minoryx Therapeutics clinical trials; consultant to Ionis, Alnylam, Sanofi Genzyme, Minoryx, and SwanBio Therapeutics; director of the Third Rock MGH Neuroscience Fellowship; and founder of SwanBio Therapeutics. ZW was partially supported by the NIH/NIA and NIH/NINDS (1U19AG063911, FAIN: U19AG063911), Mayo Clinic Center for Regenerative Medicine, Mayo Clinic in Florida Focused Research Team Program, gifts from the Sol Goldman Charitable Trust and Donald G. and Jodi P. Heeringa Family, the Haworth Family Professorship in Neurodegenerative Diseases fund, and the Albertson Parkinson's Research Foundation. He serves as PI or Co-PI on Biohaven Pharmaceuticals, Inc. (BHV4157-206 and BHV3241-301), Neuraly, Inc. (NLY01-PD-1), and Vigil Neuroscience, Inc. (VGL101-01.001) clinical studies. He serves as an external advisory board member for Vigil Neuroscience, Inc.
SP, AP, MB, and SZ are employed by Vigil Neuroscience, Inc.
The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Publisher's Note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Acknowledgments
The authors wish to thank Lillian Neff and Serena Hung for content suggestions and edits for this manuscript.
Supplementary Material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fneur.2021.788168/full#supplementary-material
References
|
|||||
1850
|
dbpedia
|
1
| 17 |
https://www.medschool.umaryland.edu/news/2018/novel-gene-mutations-linked-to-high-hdl-cholesterol-and-apparent-protection-from-heart-disease.html
|
en
|
2018 Archive - Novel Gene Mutations Linked to High HDL Cholesterol and Apparent Protection from Heart Disease
|
[
"https://www.medschool.umaryland.edu/media/som/assets/images/umsom-logo.png",
"https://www.medschool.umaryland.edu/media/som/news/2018/images/Miller_Michael.jpg",
"https://www.medschool.umaryland.edu/media/som/faculty/faculty-portraits/Adebamowo_Sally.jpg",
"https://www.medschool.umaryland.edu/media/som/news/2020/images/Harris_Anthony.jpg",
"https://www.medschool.umaryland.edu/media/som/news/2022/images/Goodman_Katherine.jpg",
"https://www.medschool.umaryland.edu/media/som/news/2022/images/Baghdadi_Jonathan.jpg",
"https://www.medschool.umaryland.edu/media/som/news/2017/images/3679-Schriml_Lynn.jpg",
"https://www.medschool.umaryland.edu/media/som/news/2020/images/Harris_Anthony.jpg",
"https://www.medschool.umaryland.edu/media/som/news/2019/images/Tracy-featured.jpg",
"https://www.medschool.umaryland.edu/media/som/news/2019/images/genome-featured.jpg",
"https://www.medschool.umaryland.edu/media/som/news/2016/images/3355-Muffins.jpg"
] |
[] |
[] |
[
""
] | null |
[] | null |
en
| null | ||||||||
1850
|
dbpedia
|
1
| 2 |
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6995741/
|
en
|
Clinical features and genetic characteristics of hereditary diffuse leukoencephalopathy with spheroids due to CSF1R mutation: a case report and literature review
|
[
"https://www.ncbi.nlm.nih.gov/coreutils/uswds/img/favicons/favicon-57.png",
"https://www.ncbi.nlm.nih.gov/coreutils/uswds/img/icon-dot-gov.svg",
"https://www.ncbi.nlm.nih.gov/coreutils/uswds/img/icon-https.svg",
"https://www.ncbi.nlm.nih.gov/coreutils/nwds/img/logos/AgencyLogo.svg",
"https://www.ncbi.nlm.nih.gov/corehtml/pmc/pmcgifs/logo-anntransmed.png",
"https://www.ncbi.nlm.nih.gov/corehtml/pmc/pmcgifs/corrauth.gif",
"https://www.ncbi.nlm.nih.gov/corehtml/pmc/pmcgifs/corrauth.gif",
"https://www.ncbi.nlm.nih.gov/corehtml/pmc/pmcgifs/corrauth.gif",
"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6995741/bin/atm-08-01-11-f1.jpg",
"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6995741/bin/atm-08-01-11-f2.jpg"
] |
[] |
[] |
[
""
] | null |
[
"Lv-Ping Zhuang",
"Chang-Yun Liu",
"Yuan-Xiao Li",
"Hua-Ping Huang",
"Zhang-Yu Zou"
] |
2020-01-19T00:00:00
|
Hereditary diffuse leukoencephalopathy with spheroid (HDLS) is an autosomal dominant white matter disease characterized by adult-onset cognitive impairment, behavioral or emotional changes, paresis, Parkinsonism, and seizures. Mutations in the gene encoding ...
|
en
|
https://www.ncbi.nlm.nih.gov/coreutils/nwds/img/favicons/favicon.ico
|
PubMed Central (PMC)
|
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6995741/
|
Discussion
In this study, we identified a novel missense mutation p.G651E in the CSF1R gene in a patient presenting with adult-onset leukoencephalopathy, cognitive impairment and motor dysfunction. G651 is highly conserved across species ( ) and lies in the TKD domain, the critical domain of CSF1R (PM1). The p.G651H variant was absent from the control databases (gnomAD, 1000 Genomes Project, ClinVar) (PM2). In silico tools indicated the variant was deleterious (PP3), and the patient’s phenotype and family history are highly specific for a disease with a single genetic etiology (PP4). Therefore, according to the guidelines of the American College of Medical Genetics and Genomics for sequence variant interpretation, the p.G651E variant was interpreted as likely pathogenic (6). The patient had the core features of HDLS: age at onset ≤60 years, cognitive impairment and pyramidal signs, autosomal dominant inheritance, bilateral cerebral white matter lesions and thinning of the corpus callosum in brain MRI images. He also carried a CSF1R gene mutation. Therefore, a diagnosis of definite HDLS can be made according to the diagnostic criteria (7).
Our review showed that average age of onset of patients with HDLS is 43 years; however, the onset age can vary from 10 to 71 years. This disease is clinically characterized by two groups of symptoms: neuropsychiatric and motor symptoms (8). The neuropsychiatric symptoms include memory impairment, progressive cognitive decline, depression, apathy, anxiety, and other behavioral or personality changes. Motor symptoms include Parkinsonism, pyramidal signs, dysarthria, dysphagia, and ataxia (8). The most common clinical characteristic of patients with HDLS is cognitive impairment (84%), followed by psychiatric symptoms, Parkinsonism, gait disorders, and dysphagia.
The neuroradiographic characteristics of patients with HDLS are bilateral but asymmetric T2-weighted and FLAIR hyperintensities in the deep and subcortical white matter, predominantly in the frontal, frontoparietal, and periventricular areas ( ) (5,8). Early lesions are patchy and focal, but with time spread around and become confluent. The preferential involvement of the frontal white matter may account for the predominant cognitive impairment and psychiatric symptoms in patients with HDLS. Diffusion-restricted lesions with reduced ADC can be observed in the white matter and can be persistent for several months or more, which can be differentiated from stroke. There was no enhancement and microbleeding. Thinning of the corpus callosum, cerebral atrophy and dilation of the lateral ventricles is typical, even in the early phases of the disease. Calcifications in the white matter on CT scan are characteristic imaging features of HDLS and demonstrate a “stepping stone appearance” in the frontal pericallosal area and punctate appearance in the frontal white matter adjacent to the anterior horns of the lateral ventricles (8). It should be noted that neuroradiographical abnormalities could precede the presence of clinical symptoms. At least three asymptomatic CSF1R mutation carriers with subtle T2 hyperintensities or bilateral white matter lesion, abnormal signals in lateral ventricle and frontal lobe have been reported (9,10).
So far, there have been no obvious genotype-phenotype correlations regarding HDLS, with some family members showing significant differences in disease presentation and course within the same family. Therefore, the clinical symptoms of patients with HDLS are variable and easily misdiagnosed with other diseases. Patients with HDLS presented with cognitive decline and personality changes in midlife with a progressive course, and evident white matter lesions on MRI should be differentiated with other leukoencephalopathy, such as adult-onset autosomal dominant leukodystrophy, Alexander disease, or cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy. Patients with predominant motor symptoms are easily misdiagnosed as multiple sclerosis, especially during the earliest phases of the disease (1). Recently, Konno et al proposed a diagnostic criterion for CSF1R-related leukoencephalopathy. The criteria yield high sensitivity (96%) and can successfully exclude other leukoencephalopathy. If a patient fulfills the probable criteria, genetic testing for CSF1R should be performed (7).
The mean disease duration for patients with HDLS was 6.2 years ( ). However, the rate of progression varies among individuals and patients may develop a rapid progression or a very slow progression (http://cdn.amegroups.cn/static/application/81246daeff6dfc2975d183fab093c632/10.21037atm.2019.12.17-1.pdf). Indicators of rapid disease progression of patients with HDLS were symptomatic disease onset before 45 years, female, white matter lesions extending beyond the frontal regions, an MRI severity score based on a point system [0–57] greater than 15 points, and mutation type of deletion (11).
Although HDLS is usually inherited in an autosomal dominant pattern, 36% of HDLS cases were apparent sporadic cases (http://cdn.amegroups.cn/static/application/81246daeff6dfc2975d183fab093c632/10.21037atm.2019.12.17-1.pdf). However, whether these sporadic cases reflect incomplete or non-penetrance or were caused by de novo mutations in the CSF1R gene remains unknown. The HDLS pedigrees reported so far showed that mutations in CSF1R have a high penetrance, but in one family carrying the CSF1R p.Q877X mutation and another p.V784M mutated pedigree, the index patient was severely affected since the age of 28 years whereas their parents who carried the same CSF1R mutation still had no neurological symptoms at 69 years and 79 years, suggesting incomplete penetrance in HDLS (9,12). In addition, three confirmed de novo CSF1R mutations (3,9) and two apparent (without paternity confirmation) de novo CSF1R mutations (13,14) have been reported in patients with HDLS, suggesting at least some patients with HDLS are true sporadic and caused by de novo mutations in the CSF1R gene.
CSF1R is an essential factor for development and maintenance of microglia. Approximately 95% of CSF1R mutations in HDLS are located within the TKD ( ), suggesting that loss of tyrosine kinase activity may be necessary for the development of HDLS. Reduced expression of CSF1R was also observed in brains of patients with missense and splice-site mutations, indicating that any type of CSF1R mutation may cause HDLS by haploinsufficiency (4,15) ( ). A mutant CSF1R mouse strain with a haploinsufficient allele developed HDLS-like symptoms, including cognitive decline, behavioral changes, and motor symptoms. White matter abnormalities, enlargement of the lateral ventricles, and thinning of the corpus callosum were also evident on MRI. The mouse model provides strong evidence that CSF1R haploinsufficiency is enough to cause white matter degeneration (16). However, marginally elevated cell surface CSF1 receptor levels with increased Tyr723 autophosphorylation was observed in a HDLS patient with CSF1R p.I843_L844delinsGI mutation, suggesting a mutation-related CSF1R gain-of-function (17). Notably, mutations tend to occur more frequently in the distal part of the TKD than the proximal part (5), and exons 18–20 of CSF1R gene are mutation hotspots where 63% of CSF1R mutations exist ( ). Further functional experiments are needed to elucidate the pathogenesis of CSF1R mutations.
In conclusion, HDLS typically presents with broad phenotypic variability, and although it demonstrates an autosomal dominant pattern, sporadic cases are not uncommon. Early recognition of clinical and neuroradiographical characteristics of HDLS is key for the correct diagnosis of the disease, given the poor prognosis, rapid course, and genetic testing implications for family members.
|
||||
1850
|
dbpedia
|
2
| 9 |
https://actaneurocomms.biomedcentral.com/articles/10.1186/s40478-015-0219-x
|
en
|
Common neuropathological features underlie distinct clinical presentations in three siblings with hereditary diffuse leukoencephalopathy with spheroids caused by CSF1R p.Arg782His
|
[
"https://pubads.g.doubleclick.net/gampad/ad?iu=/270604982/bmc/actaneurocomms/articles&sz=728x90,970x90&pos=LB1&doi=10.1186/s40478-015-0219-x&type=article&kwrd=Leukoencephalopathy,Microglia,HDLS,CSF1R,Frontotemporal degeneration,Corticobasal syndrome,Dementia with Lewy bodies&pmc=B18006,H4800X,H36001&",
"https://actaneurocomms.biomedcentral.com/static/images/bmc/logos/logo-bmc-white-aj-be532aa3f0.svg",
"https://actaneurocomms.biomedcentral.com/static/images/bmc/logos/logo-bmc-white-strapline-sn-f224388d67.svg",
"https://media.springernature.com/lw685/springer-static/image/art%3A10.1186%2Fs40478-015-0219-x/MediaObjects/40478_2015_219_Fig1_HTML.gif",
"https://media.springernature.com/lw685/springer-static/image/art%3A10.1186%2Fs40478-015-0219-x/MediaObjects/40478_2015_219_Fig2_HTML.gif",
"https://media.springernature.com/lw685/springer-static/image/art%3A10.1186%2Fs40478-015-0219-x/MediaObjects/40478_2015_219_Fig3_HTML.gif",
"https://media.springernature.com/lw685/springer-static/image/art%3A10.1186%2Fs40478-015-0219-x/MediaObjects/40478_2015_219_Fig4_HTML.gif",
"https://pubads.g.doubleclick.net/gampad/ad?iu=/270604982/bmc/actaneurocomms/articles&sz=300x250&pos=MPU1&doi=10.1186/s40478-015-0219-x&type=article&kwrd=Leukoencephalopathy,Microglia,HDLS,CSF1R,Frontotemporal degeneration,Corticobasal syndrome,Dementia with Lewy bodies&pmc=B18006,H4800X,H36001&",
"https://actaneurocomms.biomedcentral.com/track/article/10.1186/s40478-015-0219-x",
"https://actaneurocomms.biomedcentral.com/static/images/logo-springernature-acb40b85fb.svg"
] |
[] |
[] |
[
""
] | null |
[
"John L",
"Elisabeth M",
"Edward B",
"H. Branch",
"Virginia M.-Y",
"John Q",
"Van Deerlin",
"Vivianna M"
] |
2015-07-04T00:00:00
|
Hereditary diffuse leukoencephalopathy with spheroids (HDLS) presents with a variety of clinical phenotypes including motor impairments such as gait dysfunction, rigidity, tremor and bradykinesia as well as cognitive deficits including personality changes and dementia. In recent years, colony stimulating factor 1 receptor gene (CSF1R) has been identified as the primary genetic cause of HDLS. We describe the clinical and neuropathological features in three siblings with HDLS and the CSF1R p.Arg782His (c.2345G > A) pathogenic mutation. Each case had varied motor symptoms and clinical features, but all included slowed movements, poor balance, memory impairment and frontal deficits. Neuroimaging with magnetic resonance imaging revealed atrophy and increased signal in the deep white matter. Abundant white matter spheroids and CD68-positive macrophages were the predominant pathologies in these cases. Similar to other cases reported in the literature, the three cases described here had varied clinical phenotypes with a pronounced, but heterogeneous distribution of axonal spheroids and distinct microglia morphology. Our findings underscore the critical importance of genetic testing for establishing a clinical and pathological diagnosis of HDLS.
|
en
|
/static/img/favicons/bmc/apple-touch-icon-582ef1d0f5.png
|
BioMed Central
|
https://actaneurocomms.biomedcentral.com/articles/10.1186/s40478-015-0219-x
|
Hereditary diffuse leukoencephalopathy with spheroids (HDLS) is a rare, autosomal-dominant neurodegenerative disease that presents with diverse phenotypes including motor impairments such as gait dysfunction, rigidity, tremor and bradykinesia along with cognitive impairments like personality changes and dementia [1]. The onset of symptoms is usually in the fourth or fifth decade, progressing to dementia and death within 5–10 years. Magnetic resonance imaging (MRI) typically shows patchy cerebral white matter abnormalities [2]. A definite diagnosis of HDLS requires pathology demonstrating widespread myelin loss and abundant axonal spheroids. Since the discovery of mutations in the colony stimulating factor 1 receptor gene (CSF1R) that are pathogenic for HDLS [3], genetic screening of CSF1R has increased the number of individuals diagnosed with HDLS [4–9]. Here we describe the clinical and neuropathological features of three siblings with a previously published pathogenic CSF1R mutation, p.Arg782His [1].
Genetics
Targeted next-generation sequencing was performed alongside histology, immunohistochemistry and microscopic analyses of the brain tissue [10]. A heterozygous missense mutation c.2345G > A (p.Arg782His, rs282860281) was identified in exon 18 of CSF1R (Fig. 1) in all three symptomatic siblings (Fig. 2). Other neurodegenerative disease-associated gene mutations were excluded and the mutation was confirmed by genotyping using a custom TaqMan allelic discrimination assay (Life Technologies). The family history is notable for late-onset dementia in the mother at the age of 89 (Fig. 2) and a father who died at age 62 of unrelated causes. Of note, a paternal first cousin once removed may have had symptoms similar to Case #1 (not shown in pedigree). The genetic status of four additional living siblings shown in the pedigree is not provided for privacy reasons. Because of the father’s relatively early death and the fact that neither parent’s DNA was available to test, the penetrance of the mutation cannot be fully assessed.
All three cases presented with slowed movement, poor balance and cognitive deficits (Table 1). Gait disturbances included retropulsion and postural instability, without tremor, rigidity or cog-wheeling. Early behavioral changes included impulsiveness and disinhibition. MRIs from the three patients were reviewed by several neurologists with expertise in neurodegenerative diseases as well as neuroradiologists. The most consistent finding was increased signal on FLAIR and T2-weighted images in the periventricular and deep white matter; volumetric measurements were not available. Ultimately, the MRI findings were supportive of, but not distinctive for, HDLS, although the MRI pulse sequences were not optimized for the detection of calcifications and other distinctive markers. Case #1, a female in her late 40s, developed depression and difficulty with cognition in addition to motor impairments, and was unable to work after approximately one year. She was noted to be increasingly emotionally labile. Examination at age 52 demonstrated a pseudobulbar affect. Her short-term memory was only mildly impaired, but she exhibited poor emotional regulation, perseveration and a deficit in set-shifting. For example, she was unable to perform the oral version of the Trail Making Test on which she was required to produce an ascending sequence of alternating letters and numbers (e.g., A-1-B-2…). Clinically, she was thought to have frontotemporal degeneration (FTD). Case #2 was a woman in excellent health until age 55. When first evaluated neurologically both mild memory problems and limited use of her left hand were noted. Her personality and behavior were mildly altered in that she was slightly labile emotionally. Examination demonstrated normal cognition except for a moderate impairment in short-term word memory. She had clear but subtle parietal deficits including left visual extinction and a mild left motor neglect manifested as failure to use her left arm unless instructed to do so. There was a mild decrease in left hand dexterity. Her clinical diagnosis was corticobasal syndrome (CBS). Case #3 was a man who presented with symptoms that began in his early 50s. He was found to have poor judgment at work and trouble balancing his checkbook. He became disabled after two years. On examination he exhibited prominent frontal deficits including distractibility, perseveration and mild emotional lability. Memory and visuo-spatial function were poor, with left visual extinction. By MRI, there was thinning of the corpus callosum which was not clearly evident in the other subjects. Clinically, his diagnosis was dementia with Lewy bodies (DLB) and parkinsonism. In all three instances, cognitive/behavioral and motor deficits worsened slowly and relentlessly over several years; subjects were not examined by the authors in their terminal states.
Neuropathology
Each case showed abundant white matter Aβ precursor protein (APP) positive spheroids that were heterogeneously distributed in subcortical regions (Figs. 3 and 4a-c). These spheroids were also observed by neurofilament (Fig. 4i), tau and ubiquitin antibodies and H&E (not shown). The spheroids were more numerous in deep white matter with the U-fibers relatively spared (Fig. 4a). Phagocytic cells (macrophages and microglia) were also heterogeneously distributed in the subcortical white matter and these cells showed highly varied and distinctly unusual morphologies. The most distinctive morphology was characteristic of activated phagocytic macrophages (Fig. 4d-e) that were strongly positive for CD68, but not Iba1 positive. Other, Iba1 positive microglia had a more classic microglia shape (Fig. 4f). Prominent spongiosis in neocortical regions was another common feature. Neither TDP-43 nor α-synuclein inclusions were observed.
Case #1’s gross examination revealed severe frontal and temporal atrophy with severe ventricular enlargement and a 1092 g brain weight. Microscopically, besides the numerous spheroids (Fig. 3a), additional pathology included obvious neuronal loss and degeneration of long axonal projections, extensive cell loss and gliosis with relative sparing of the granule cells in the hippocampus, rare Aβ plaques and focal cortical amyloid angiopathy (CAA), but no neurofibrillary tangles (NFTs). Case #2 had moderate frontal atrophy with mild ventricular enlargement and weighed 1338 g. There were focal areas of dystrophic calcification and mild demyelination in the corpus callosum (Fig. 4g) and entorhinal cortex that were not apparent in the MRI. Rare ballooned neurons were noted in the cingulate, along with tau-positive grains and neurites in limbic areas, occasional tau-positive coiled bodies, mild CAA without Aβ plaques and NFTs in the medial temporal lobe. Case #3 had mild, diffuse atrophy with mild ventricular enlargement and weighed 1278 g. The limbic regions and brainstem were relatively spared, although spheroids were observed in the medulla. Similar to Case #2, irregular, tau-positive ballooned neurons were also noted in the cingulate (Fig. 4h) while no Aβ plaques were seen but some NFTs were present only in the entorhinal cortex.
Abundant white matter spheroids and CD68-positive macrophages were the predominant pathologies in these cases. Cases #2 and #3 had rare ballooned neurons, coiled bodies and tau-positive grains and neurites, which are found in other tauopathies such as corticobasal degeneration, progressive supranuclear palsy, Pick’s disease and argyrophilic grain disease [11]. What role pathological tau plays in HDLS has yet to be determined.
The p.Arg782His mutation has been previously reported in three families from Japan (Case #4) [12], USA (Case #5) [13] and Korea (Case #6) [14]. The clinical similarities and differences of our three cases and the additional published cases with the same mutation are highlighted in Table 1. Cognitive difficulties were noted for all cases. Our three patients all presented with slowed movements, as did Case #6 in the Table, but Cases #4 and #5 did not. Postural instability was also common, although this was a late symptom for Case #5. The motor deficits in Cases #4 and #6 were eventually severe, while the others had relatively mild impairments.
CSF1R is a key regulator of myeloid lineage cells and microglia in the adult brain [15] and HDLS-associated CSF1R mutations are all located in the protein’s tyrosine kinase domain. Experimental evidence indicates that these mutations cause loss of function [16, 17]. CSF1R mutations may also result in haploinsufficiency [18] which, in mice, causes a HDLS-like phenotype [19]. CSF1R’s role as a microglial regulator and the functional deficits associated with CSF1R mutations supports the hypothesis that microglia dysfunction may precede the accumulation of axonal spheroids in HDLS. Here we present three familial cases with full neuropathological characterization that demonstrate the range of pathology and clinical phenotypes that can be seen in individuals with the same CSF1R mutation. Since the three siblings studied here were diagnosed clinically with FTD, CBS, and DLB, our findings underscore the critical importance of genetic testing for establishing a clinical and pathological diagnosis of HDLS.
|
||||
1850
|
dbpedia
|
1
| 3 |
https://ulf.org/leukodystrophies/hereditary-diffuse-leukoencephalopathy-with-spheroids-hdls/
|
en
|
Hereditary Diffuse Leukoencephalopathy with Spheroids (HDLS)
|
[
"https://0zv8e8.a2cdn1.secureserver.net/wp-content/uploads/2020/05/cropped-ULF_FullColor_horizontal-01-1-204x68.jpg 204w, https://0zv8e8.a2cdn1.secureserver.net/wp-content/uploads/2020/05/cropped-ULF_FullColor_horizontal-01-1-300x100.jpg 300w, https://0zv8e8.a2cdn1.secureserver.net/wp-content/uploads/2020/05/cropped-ULF_FullColor_horizontal-01-1-1024x341.jpg 1024w, https://0zv8e8.a2cdn1.secureserver.net/wp-content/uploads/2020/05/cropped-ULF_FullColor_horizontal-01-1-768x256.jpg 768w, https://0zv8e8.a2cdn1.secureserver.net/wp-content/uploads/2020/05/cropped-ULF_FullColor_horizontal-01-1.jpg 1250w",
"https://0zv8e8.a2cdn1.secureserver.net/wp-content/uploads/2020/05/cropped-ULF_FullColor_horizontal-01-1-204x68.jpg",
"https://widgets.guidestar.org/TransparencySeal/7431867",
"https://0zv8e8.a2cdn1.secureserver.net/wp-content/uploads/2024/03/NORD_MembershipLogo_PLAT_2024_RGB-01-150x150.webp",
"https://0zv8e8.a2cdn1.secureserver.net/wp-content/uploads/2024/03/NORD_MembershipLogo_PLAT_2024_RGB-01-150x150.webp"
] |
[] |
[] |
[
""
] | null |
[] |
2020-04-10T20:16:09+00:00
|
Hereditary diffuse leukoencephalopathy with spheroids (HDLS) is an autosomal dominant progressive disease.
|
en
|
https://0zv8e8.a2cdn1.secureserver.net/wp-content/uploads/2019/12/favicon.ico?time=1723756663
|
United Leukodystrophy Foundation
|
https://ulf.org/leukodystrophies/hereditary-diffuse-leukoencephalopathy-with-spheroids-hdls/
|
causes of Neuroaxonal leukoencephalopathy with axonal spheriods
Hereditary diffuse leukoencephalopathy with spheroids (HDLS) is an autosomal dominant progressive disease. The disease was described for the first time in multiple members of a large Swedish pedigree in 1984 (Axelsson et al, 1984). In this family, 17 of 71 subjects from 4 generations were affected. The age at onset varied from 8 to 60 years with a mean of 36 years. The age at death was 39 to 89 years with a mean of 57 years. The time between onset and death varied from 3 months to over 30 years. Some patients rapidly developed severe dementia and died a few months after the onset of symptoms, whereas in others the course was prolonged with dementia developing over decades. Sporadic patients have also been reported.
The predominant clinical manifestations are psychiatric and include depression, anxiety, alcohol abuse, irritability, and aggressiveness. Psychotic symptoms may occur with confusion, delusions, and hallucinations. The most frequent neurologic symptoms are dementia, seizures, impaired balance, retropulsion, gait apraxia, spasticity, ataxia, and urinary incontinence. Extrapyramidal symptoms may occur with hyperkinesia, chorea, tremor and oral dyskinesia.
EEG usually shows nonspecific abnormalities with slowing of the background pattern and sometimes paroxysmal changes. The abnormalities often have a frontotemporal predominance. They may be asymmetrical. Routine and metabolic laboratory investigations reveal no abnormalities. The diagnosis is at present based on histopathologic findings.
Pathology
External examination of the brain shows mild atrophy of the frontoparietal regions. The thalamus and the rostral part of the caudate nucleus may be mildly reduced in size. The lateral ventricles are moderately enlarged. The corticospinal tracts and the basis of the pons are atrophic. On microscopy, a widespread leukoencephalopathy is found, characterized by a commensurate loss of myelin sheaths and axons and the presence of numerous neuroaxonal spheroids in the affected white matter. Neuroaxonal spheroids are round to sausage-shaped axonal swellings, which are easily identified with Bielschowsky, Bodian, and anti-neurofilament immunostains. The leukoencephalopathy is most severe in the frontal, frontoparietal and temporal areas and may be mildly asymmetrical. The U-fibers are relatively spared. The abnormalities tend to be most pronounced in the white matter below the pre- and postcentral gyri and extend through the posterior limb of the internal capsule into the pyramidal tracts of the brain stem. The corpus callosum is variably affected. The abnormal white matter may show vacuolization. Reactive astrocytes and macrophages are present, but no inflammatory cells. The cerebral cortex and basal ganglia are normal and contain no or only few spheroids. Within the cerebellum, a marked loss of Purkinje cells is seen, but the cerebellar white matter is normal. Electron microscopy of the spheroids reveals neurofilaments scattered among electron-dense material and mitochondria.
Pathogenetic Considerations
The homogeneity of the clinical picture and histopathologic findings strongly suggests that HDLS is a distinct disease entity. The disease has an autosomal dominant mode of inheritance. Isolated cases are probably the result of new mutations. The genetic defect and the pathophysiology of HDSL are as yet unresolved. Considering the more or less commensurate loss of axons and myelin sheaths, the preferential involvement of long tracts and the presence of axonal swellings, it is likely that axons are the primary target of the disease.
Axonal spheroids are pathologic findings characteristic of the neuroaxonal dystrophies. They occur most often in the context of neuronal degenerative disorders, such as infantile neuroaxonal dystrophy (Seitelberger disease) and Hallervorden-Spatz disease. The combination of a leukoencephalopathy and neuroaxonal spheroids in the abnormal white matter is rare. Apart form HDSL, this combination is observed in dermatoleukodystrophy with neuroaxonal spheroids (Matsuyama et al, 1978) and polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy (Nasu-Hakola disease). Both disorders are clinically different form HDLS.
How is Neuroaxonal Leukoencephalopathy with axonal spheriods treated?
Supportive care is the only therapeutic option.
Magnetic Resonance Imaging
MR images demonstrate signal abnormalities bilaterally within the cerebral white matter, either most pronounced within the white matter under the pre- and postcentral gyri, or within the frontal white matter. The signal abnormalities may be patchy or more confluent, and may be symmetrical or asymmetrical. They are ill-defined. The corpus callosum is thin and may contain areas of abnormal signal. The signal abnormalities extend downwards through the posterior limb of the internal capsule into the pyramidal tracts of the brain stem. The affected cerebral white matter is atrophic with widening of the lateral ventricles and subarachnoid spaces. The head of the caudate nucleus may be flattened. There may be cerebellar atrophy.
The above MRI findings may confirm the diagnosis within a pedigree with known HDLS. However, the MRI findings in itself are not specific and do not allow definite diagnosis. The diagnosis needs to be confirmed by histopathology.
The differential diagnosis of HDLS includes disorders with frontal cortical degeneration, such as frontotemporal dementia and Pick disease. In these disorders MRI shows atrophy of mainly the frontotemporal areas. Sometimes there are additional white matter changes, which are ill-defined and usually mild. If present, they make differentiation from HDLS difficult.
The differential diagnosis also includes disorders with frontal lobe dysfunction caused by white matter degeneration, such as metachromatic leukodystrophy, X-linked adrenoleukodystrophy with frontal predominance, Nasu-Hakola disease (PLOSL), Binswanger disease, CADASIL, orthochromatic pigmentary leukodystrophy, and adult-oset autosomal dominant leukodystrophies. Most disorders can be ruled out by typical clinical, physical and laboratory findings and neuroimaging differences. Some disorders require histopathologic confirmation.
Courtesy of Van der Knaap et al, Neurology 2000; 54: 463-468, with permission
|
||||
1850
|
dbpedia
|
2
| 55 |
https://uwspace.uwaterloo.ca/handle/10012/20461
|
en
|
A Droplet Microfluidic Platform Used to Encapsulate Single Pre-formed Cancer Spheroids in Hydrogel Microenvironments
|
https://uwspace.uwaterloo.ca/handle/10012/assets/dspace_7_uwspace_theme/images/favicons/favicon.ico
|
https://uwspace.uwaterloo.ca/handle/10012/assets/dspace_7_uwspace_theme/images/favicons/favicon.ico
|
[
"https://uwspace.uwaterloo.ca/handle/10012/assets/dspace_7_uwspace_theme/images/logo.svg",
"https://uwspace.uwaterloo.ca/handle/10012/assets/dspace_7_uwspace_theme/images/logo.svg",
"https://dspacemainprd01.lib.uwaterloo.ca/server/api/core/bitstreams/86f93df0-bbb3-497e-b203-e2010d344912/content"
] |
[] |
[] |
[
""
] | null |
[] | null |
Cancer has been a leading cause of death around the world for many years. Even with the emerging technologies seen in these times, there is still a lack of truly personalized treatments since cancer tumors are not fully understood, especially between different cancer patients. 3D models known as patient derived tumor organoids (PDTOs) have been gaining traction as in vitro models to mimic a patient’s tumor outside of their body. Grown from the patients' cells into cell clusters (spheroids) or organoids (mini parts of the tumor tissue), these models can serve as precise avenues for personalized drug discovery or studying tumor complexity. However, there are still limitations to these 3D models due to conventional fabrication methods. In order to achieve personalized care, the models being tested on should be consistent through each batch, reliable, and affordable. Traditionally, organoid development from cells aggregating in hanging droplets or rotating in flasks for maintained cell-aggregate suspension, can cause batch-to-batch inconsistencies (lack of uniformity between samples), low throughput, and often require high volume of reagents.
To recreate a 3D suspension for cells in a more native environment, hydrogels have become popular biocompatible scaffolds capable of sustaining cell growth. Hydrogels themselves have been widely studied for ideal cell environments, yet common methods of cell encapsulation into these hydrogels (e.g. manually pipetting) do not address the mentioned limitations, but rather introduce inconsistencies.
Droplet microfluidics (DM), with the inclusion of hydrogels, has become a technology that has assisted in organoid fabrication, addressing conventional limitations. DM can create uniform aqueous droplets at high frequencies through controlled emulsion, using microchannels. These uniform droplets allow for controlled cell encapsulation with minimal reagent usage, thus addressing the drawbacks of traditional organoid formation and cell encapsulation techniques. Yet, the downside to using DM for cell encapsulation (whether it is multi- or single- cell encapsulation) is the high initial concentration of cells used at the inlet reservoir (millions), compared to the typical sample size obtained from patient biopsies (thousands).
To still leverage the advantages of DM, thoughts of encapsulating pre-formed cell clusters or spheroids (instead of forming them with the DM devices) can aim to lower the number of initial cells used, and aid in growing spheroids into organoids. Thus, the proposal of this thesis was to employ DM and defined hydrogels to encapsulate pre-formed spheroids into their own microenvironment, for the goal of supporting the growth of primary cancer patient cells into PDTOs in a robust and uniform iv manner. This thesis intends to give a better understanding of the need of using DM for pre-formed spheroid encapsulation, and the ways to achieve a robust system for this purpose.
The first chapter of this thesis provides a deeper background of the motivation to the overarching goal and a further breakdown of the project tasks. Specifically, projects were designed around two aims: (1) optimizing portions of the system and (2) validating the system. In addition to this background information, more context is given through a literature review found in Chapter 2. This literature review further justifies the rationale of the work by providing more insight into each component.
After outlining protocols used in each project (Chapter 3), the optimization work began, starting with finding the best way to form spheroids that would enter the DM device (Chapter 4). It was important that the mechanism of forming these spheroids was also robust and uniform to maintain the advantage over conventional spheroid fabrication techniques. A well-established micropattern technology known as the AggreWellTM was implemented due to its capabilities of forming uniform spheroids in a high throughput manner with a low quantity of cells. Using PDMS replicas of the AggreWellTM (referred to as PDMS AWs) caused for adjustments to typical protocols followed when using the original AggrewellTM. Parameters such as surface treatment, cell culture conditions, and collection methods, were studied to find the most appropriate outcome of spheroids for the intended application.
Continuing in the avenue of optimization, the other portion of Chapter 4 focused on exploring DM devices and fabrication techniques. After comparing parameters such as mold fabrication through 3D printing and soft lithography, chip design and geometry (T-junction versus double flow focusing (DFF)), and system tubing size, the selected chip design was a DFF junction, similar to one used in previous work of single cell encapsulation. The other factors ensured that uniform droplet formation and single pre-formed spheroid encapsulation could be achieved, in part of making the system robust.
Using the decisions made in the optimization work, validation of hydrogel selection, encapsulation efficiency, and spheroid viability were assessed in the main chapter (Chapter 5). This thesis work aimed to demonstrate the capabilities of the DFF DM device with the use of stratified flow. A hydrodynamic focusing stream of either Gelatin Methacrylate (GelMA) or sodium alginate hydrogel precursors helped to gather spheroids into their own droplets. Depending on the flow conditions, the width of the flow focusing stream varied, affecting the encapsulation efficiency. Along with focusing width, the concentration of spheroids at the inlet reservoir also affected the encapsulation efficiency. This study was able to show spheroid encapsulation with a range of spheroid quantities; from 1000 to 7000 total spheroids in 500 μL of hydrogel precursor.
Lastly, the spheroid laden hydrogel droplets were crosslinked and assessed for stability in cell culture conditions over time. With this, the spheroid viability was also tested to ensure the overall system was not too harsh on them. As most spheroids showed a high viability, this was enough to satisfy the proposed objective and conclude that this system has potential to be further explored.
In conclusion, the overall system showed success in robustly encapsulating pre-formed spheroids, in hopes of being applied to patient derived samples for uniform growth into relevant 3D models. As this work is preliminary, Chapter 6 outlines recommendations and suggestions to future work, to guide this project towards the overarching goal.
|
en
|
assets/dspace_7_uwspace_theme/images/favicons/favicon.ico
| null |
Abstract
Cancer has been a leading cause of death around the world for many years. Even with the emerging technologies seen in these times, there is still a lack of truly personalized treatments since cancer tumors are not fully understood, especially between different cancer patients. 3D models known as patient derived tumor organoids (PDTOs) have been gaining traction as in vitro models to mimic a patient’s tumor outside of their body. Grown from the patients' cells into cell clusters (spheroids) or organoids (mini parts of the tumor tissue), these models can serve as precise avenues for personalized drug discovery or studying tumor complexity. However, there are still limitations to these 3D models due to conventional fabrication methods. In order to achieve personalized care, the models being tested on should be consistent through each batch, reliable, and affordable. Traditionally, organoid development from cells aggregating in hanging droplets or rotating in flasks for maintained cell-aggregate suspension, can cause batch-to-batch inconsistencies (lack of uniformity between samples), low throughput, and often require high volume of reagents. To recreate a 3D suspension for cells in a more native environment, hydrogels have become popular biocompatible scaffolds capable of sustaining cell growth. Hydrogels themselves have been widely studied for ideal cell environments, yet common methods of cell encapsulation into these hydrogels (e.g. manually pipetting) do not address the mentioned limitations, but rather introduce inconsistencies. Droplet microfluidics (DM), with the inclusion of hydrogels, has become a technology that has assisted in organoid fabrication, addressing conventional limitations. DM can create uniform aqueous droplets at high frequencies through controlled emulsion, using microchannels. These uniform droplets allow for controlled cell encapsulation with minimal reagent usage, thus addressing the drawbacks of traditional organoid formation and cell encapsulation techniques. Yet, the downside to using DM for cell encapsulation (whether it is multi- or single- cell encapsulation) is the high initial concentration of cells used at the inlet reservoir (millions), compared to the typical sample size obtained from patient biopsies (thousands). To still leverage the advantages of DM, thoughts of encapsulating pre-formed cell clusters or spheroids (instead of forming them with the DM devices) can aim to lower the number of initial cells used, and aid in growing spheroids into organoids. Thus, the proposal of this thesis was to employ DM and defined hydrogels to encapsulate pre-formed spheroids into their own microenvironment, for the goal of supporting the growth of primary cancer patient cells into PDTOs in a robust and uniform iv manner. This thesis intends to give a better understanding of the need of using DM for pre-formed spheroid encapsulation, and the ways to achieve a robust system for this purpose. The first chapter of this thesis provides a deeper background of the motivation to the overarching goal and a further breakdown of the project tasks. Specifically, projects were designed around two aims: (1) optimizing portions of the system and (2) validating the system. In addition to this background information, more context is given through a literature review found in Chapter 2. This literature review further justifies the rationale of the work by providing more insight into each component. After outlining protocols used in each project (Chapter 3), the optimization work began, starting with finding the best way to form spheroids that would enter the DM device (Chapter 4). It was important that the mechanism of forming these spheroids was also robust and uniform to maintain the advantage over conventional spheroid fabrication techniques. A well-established micropattern technology known as the AggreWellTM was implemented due to its capabilities of forming uniform spheroids in a high throughput manner with a low quantity of cells. Using PDMS replicas of the AggreWellTM (referred to as PDMS AWs) caused for adjustments to typical protocols followed when using the original AggrewellTM. Parameters such as surface treatment, cell culture conditions, and collection methods, were studied to find the most appropriate outcome of spheroids for the intended application. Continuing in the avenue of optimization, the other portion of Chapter 4 focused on exploring DM devices and fabrication techniques. After comparing parameters such as mold fabrication through 3D printing and soft lithography, chip design and geometry (T-junction versus double flow focusing (DFF)), and system tubing size, the selected chip design was a DFF junction, similar to one used in previous work of single cell encapsulation. The other factors ensured that uniform droplet formation and single pre-formed spheroid encapsulation could be achieved, in part of making the system robust. Using the decisions made in the optimization work, validation of hydrogel selection, encapsulation efficiency, and spheroid viability were assessed in the main chapter (Chapter 5). This thesis work aimed to demonstrate the capabilities of the DFF DM device with the use of stratified flow. A hydrodynamic focusing stream of either Gelatin Methacrylate (GelMA) or sodium alginate hydrogel precursors helped to gather spheroids into their own droplets. Depending on the flow conditions, the width of the flow focusing stream varied, affecting the encapsulation efficiency. Along with focusing width, the concentration of spheroids at the inlet reservoir also affected the encapsulation efficiency. This study was able to show spheroid encapsulation with a range of spheroid quantities; from 1000 to 7000 total spheroids in 500 μL of hydrogel precursor. Lastly, the spheroid laden hydrogel droplets were crosslinked and assessed for stability in cell culture conditions over time. With this, the spheroid viability was also tested to ensure the overall system was not too harsh on them. As most spheroids showed a high viability, this was enough to satisfy the proposed objective and conclude that this system has potential to be further explored. In conclusion, the overall system showed success in robustly encapsulating pre-formed spheroids, in hopes of being applied to patient derived samples for uniform growth into relevant 3D models. As this work is preliminary, Chapter 6 outlines recommendations and suggestions to future work, to guide this project towards the overarching goal.
|
|||
1850
|
dbpedia
|
3
| 74 |
https://www.merckmanuals.com/professional/endocrine-and-metabolic-disorders/lipid-disorders/elevated-high-density-lipoprotein-cholesterol-hdl-c-levels
|
en
|
Density Lipoprotein Cholesterol (HDL
|
[
"https://www.merckmanuals.com/professional/_next/static/media/icon_search_black.3a2bfc46.png 1x, /professional/_next/static/media/icon_search_black.3a2bfc46.png 2x",
"https://www.merckmanuals.com/professional/_next/static/media/settings-icon.948bffc5.svg 1x, /professional/_next/static/media/settings-icon.948bffc5.svg 2x",
"https://www.merckmanuals.com/_next/image?url=&w=16&q=75 1x",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/facebook.svg?h=40&iar=0&w=40",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/social_round_instagram.svg?h=40&iar=0&w=40",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/social_round_youtube.svg?h=40&iar=0&w=40",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/social_round_twitter.svg?iar=0",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/brand-logos/mm_logo.svg?h=52&iar=0&w=52&mw=64 1x, https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/brand-logos/mm_logo.svg?h=52&iar=0&w=52&mw=128 2x",
"https://www.merckmanuals.com/professional/_next/static/media/home-icon.2ae865eb.svg 1x, /professional/_next/static/media/home-icon.2ae865eb.svg 2x",
"https://www.merckmanuals.com/professional/_next/static/media/icon_search_white.ab0fbaf1.svg 1x, /professional/_next/static/media/icon_search_white.ab0fbaf1.svg 2x",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/marketing/quizzes_lightbulb_red.png?h=52&iar=0&w=64&mw=64 1x, https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/marketing/quizzes_lightbulb_red.png?h=52&iar=0&w=64&mw=128 2x",
"https://www.merckmanuals.com/_next/image?url=https%3A%2F%2Fedge.sitecorecloud.io%2Fmmanual-ssq1ci05%2Fmedia%2Fmanual%2Fmarketing%2Fmobileqr%2Fen_mer_mobile_pro_326.gif&w=384&q=75 1x, /_next/image?url=https%3A%2F%2Fedge.sitecorecloud.io%2Fmmanual-ssq1ci05%2Fmedia%2Fmanual%2Fmarketing%2Fmobileqr%2Fen_mer_mobile_pro_326.gif&w=750&q=75 2x",
"https://www.merckmanuals.com/_next/image?url=https%3A%2F%2Fedge.sitecorecloud.io%2Fmmanual-ssq1ci05%2Fmedia%2Fmanual%2Fmarketing%2Fmobileqr%2Fen_mer_mobile_pro_326.gif&w=384&q=75 1x, /_next/image?url=https%3A%2F%2Fedge.sitecorecloud.io%2Fmmanual-ssq1ci05%2Fmedia%2Fmanual%2Fmarketing%2Fmobileqr%2Fen_mer_mobile_pro_326.gif&w=750&q=75 2x",
"https://www.merckmanuals.com/_next/image?url=https%3A%2F%2Fedge.sitecorecloud.io%2Fmmanual-ssq1ci05%2Fmedia%2Fmanual%2Fmarketing%2Fmobileqr%2Fen_mer_mobile_qr_pro_326.gif&w=384&q=75 1x, /_next/image?url=https%3A%2F%2Fedge.sitecorecloud.io%2Fmmanual-ssq1ci05%2Fmedia%2Fmanual%2Fmarketing%2Fmobileqr%2Fen_mer_mobile_qr_pro_326.gif&w=750&q=75 2x",
"https://www.merckmanuals.com/professional/_next/static/media/mmanual_logo_transparent.587a6151.png 1x, /professional/_next/static/media/mmanual_logo_transparent.587a6151.png 2x",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/facebook.svg?h=40&iar=0&w=40",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/social_round_youtube.svg?h=40&iar=0&w=40",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/social_round_twitter.svg?iar=0",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/social_round_instagram.svg?h=40&iar=0&w=40",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/footer/accessibility.png?h=28&iar=0&w=75&mw=96 1x, https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/footer/accessibility.png?h=28&iar=0&w=75&mw=256 2x",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/footer/accessibility.png?h=28&iar=0&w=75&mw=96 1x, https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/footer/accessibility.png?h=28&iar=0&w=75&mw=256 2x",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/facebook.svg?h=40&iar=0&w=40",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/social_round_youtube.svg?h=40&iar=0&w=40",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/social_round_twitter.svg?iar=0",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/social_round_instagram.svg?h=40&iar=0&w=40",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/brand-logos/mmanual_foot_logo.png?h=70&iar=0&w=240&mw=256 1x, https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/brand-logos/mmanual_foot_logo.png?h=70&iar=0&w=240&mw=480 2x",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/facebook.svg?h=40&iar=0&w=40",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/social_round_youtube.svg?h=40&iar=0&w=40",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/social_round_twitter.svg?iar=0",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/social_round_instagram.svg?h=40&iar=0&w=40",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/footer/accessibility.png?h=28&iar=0&w=75&mw=96 1x, https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/footer/accessibility.png?h=28&iar=0&w=75&mw=256 2x",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/facebook.svg?h=40&iar=0&w=40",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/social_round_youtube.svg?h=40&iar=0&w=40",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/social_round_twitter.svg?iar=0",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/icons/social-share/social_round_instagram.svg?h=40&iar=0&w=40",
"https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/footer/accessibility.png?h=28&iar=0&w=75&mw=96 1x, https://edge.sitecorecloud.io/mmanual-ssq1ci05/media/manual/footer/accessibility.png?h=28&iar=0&w=75&mw=256 2x",
"https://www.merckmanuals.com/_next/image?url=https%3A%2F%2Fedge.sitecorecloud.io%2Fmmanual-ssq1ci05%2Fmedia%2Fmanual%2Fbrand-logos%2Fmmanual_foot_logo.png%3Fh%3D70%26iar%3D0%26w%3D240&w=96&q=75 1x, /_next/image?url=https%3A%2F%2Fedge.sitecorecloud.io%2Fmmanual-ssq1ci05%2Fmedia%2Fmanual%2Fbrand-logos%2Fmmanual_foot_logo.png%3Fh%3D70%26iar%3D0%26w%3D240&w=256&q=75 2x",
"https://www.merckmanuals.com/professional/_next/static/media/more_options.17949f37.png 1x, /professional/_next/static/media/more_options.17949f37.png 2x",
"https://www.merckmanuals.com/professional/_next/static/media/icon_close_gray.add02139.png 1x, /professional/_next/static/media/icon_close_gray.add02139.png 2x",
"https://www.merckmanuals.com/professional/_next/static/media/search-uparrow-black.29e4f8db.png 1x",
"https://www.merckmanuals.com/professional/_next/static/media/search-downarrow-black.b622a9d6.png 1x"
] |
[] |
[] |
[
"CETP",
"LDL",
"cholesterol",
"lipid",
"fat",
"fatty",
"HDL C",
"HDL"
] | null |
[
"Michael H. Davidson",
"Pallavi Pradeep"
] |
2023-05-09T00:00:00
|
Elevated High-Density Lipoprotein Cholesterol (HDL-C) Levels - Etiology, pathophysiology, symptoms, signs, diagnosis & prognosis from the Merck Manuals - Medical Professional Version.
|
en
|
/professional/_next/static/media/favicon.f7343459.ico
|
Merck Manual Professional Edition
|
https://www.merckmanuals.com/professional/endocrine-and-metabolic-disorders/lipid-disorders/elevated-high-density-lipoprotein-cholesterol-hdl-c-levels
|
Elevated high-density lipoprotein (HDL) level is HDL cholesterol > 80 mg/dL (>2.1 mmol/L).
(See also Overview of Lipid Metabolism.)
Elevated HDL-C levels usually correlate with decreased cardiovascular risk; however, high HDL-C levels caused by some genetic disorders may not protect against cardiovascular disease, probably because of accompanying lipid and metabolic abnormalities.
Primary causes of elevated HDL-C levels are
Single or multiple genetic mutations that result in overproduction or decreased clearance of HDL-C.
Secondary causes of high HDL-C include all of the following:
Alcohol use disorder without cirrhosis
Hyperthyroidism
Primary biliary cirrhosis
estrogen)
The unexpected finding of high HDL-C in patients not taking lipid-lowering drugs should prompt a diagnostic evaluation for a secondary cause with measurements of AST (aspartate aminotransferase), ALT (alanine aminotransferase), and thyroid-stimulating hormone; a negative evaluation suggests a possible primary cause.
Cholesteryl ester transfer protein (CETP) deficiency is a rare autosomal recessive disorder caused by a CETP gene mutation. CETP facilitates transfer of cholesterol esters from HDL to other lipoproteins, and CETP deficiency affects low-density lipoprotein cholesterol (LDL-C) and slows HDL-C clearance. Affected patients display no symptoms or signs but have HDL-C > 150 mg/dL (> 3.9 mmol/L). Protection from cardiovascular disorders has not been proved. No treatment is necessary.
|
||||
1850
|
dbpedia
|
3
| 1 |
https://medlineplus.gov/hdlthegoodcholesterol.html
|
en
|
HDL: The "Good" Cholesterol: MedlinePlus
|
[
"https://medlineplus.gov/uswds/img/us_flag_small.png",
"https://medlineplus.gov/uswds/img/icon-dot-gov.svg",
"https://medlineplus.gov/uswds/img/icon-https.svg",
"https://medlineplus.gov/images/nihlogo.png",
"https://medlineplus.gov/images/m_logo_25.png",
"https://medlineplus.gov/images/nih.png",
"https://medlineplus.gov/images/videocamera.gif",
"https://medlineplus.gov/images/nih.png",
"https://medlineplus.gov/images/DietaryFats.jpg",
"https://medlineplus.gov/images/feed.png",
"https://medlineplus.gov/images/i_share_twitter.png",
"https://medlineplus.gov/images/i_share_fb.png",
"https://medlineplus.gov/images/Instagram_Glyph_Gradient_RGB.png",
"https://medlineplus.gov/images/i_social_media_toolkit.png",
"https://medlineplus.gov/images/return-top.png"
] |
[] |
[] |
[
""
] | null |
[] | null |
HDL, or high-density lipoprotein, is the "good" cholesterol. It helps to remove bad cholesterol from your arteries, so a higher HDL level is better.
|
en
|
https://medlineplus.gov/images/favicon.ico
|
https://medlineplus.gov/hdlthegoodcholesterol.html
|
HDL: The "Good" Cholesterol
Also called: High-density lipoprotein
Summary
What is cholesterol?
Cholesterol is a waxy, fat-like substance that's found in all the cells in your body. Your liver makes cholesterol, and it is also in some foods, such as meat and dairy products. Your body needs some cholesterol to work properly. But having too much cholesterol in your blood raises your risk of coronary artery disease.
What are HDL and LDL?
HDL and LDL are two types of lipoproteins.They are a combination of fat (lipid) and protein. The lipids need to be attached to the proteins so they can move through the blood. HDL and LDL have different purposes:
HDL stands for high-density lipoproteins. It is sometimes called the "good" cholesterol because it carries cholesterol from other parts of your body back to your liver. Your liver then removes the cholesterol from your body.
LDL stands for low-density lipoproteins. It is sometimes called the "bad" cholesterol because a high LDL level leads to a buildup of cholesterol in your arteries.
How do I know what my HDL level is?
A blood test can measure your cholesterol levels, including HDL. When and how often you should get this test depends on your age, risk factors, and family history. The general recommendations are:
For people who are age 19 or younger::
The first test should be between ages 9 to 11
Children should have the test again every 5 years
Some children may have this test starting at age 2 if there is a family history of high blood cholesterol, heart attack, or stroke
For people who are age 20 or older::
Younger adults should have the test every 5 years
Men ages 45 to 65 and women ages 55 to 65 should have it every 1 to 2 years
What should my HDL level be?
With HDL cholesterol, higher numbers are better, because a high HDL level can lower your risk for coronary artery disease and stroke. How high your HDL should be depends on your age and sex:
Group Healthy HDL Level Age 19 or younger More than 45mg/dl Men age 20 or older More than 40mg/dl Women age 20 or older More than 50mg/dl
How can I raise my HDL level?
If your HDL level is too low, lifestyle changes may help. These changes may also help prevent other diseases, and make you feel better overall:
Eat a healthy diet. To raise your HDL level, you need to eat good fats instead of bad fats. This means limiting saturated fats, which include full-fat milk and cheese, high-fat meats like sausage and bacon, and foods made with butter, lard, and shortening. You should also avoid trans fats, which may be in some margarines, fried foods, and processed foods like baked goods. Instead, eat unsaturated fats, which are found in avocado, vegetable oils like olive oil, and nuts. Limit carbohydrates, especially sugar. Also try to eat more foods naturally high in fiber, such as oatmeal and beans.
Stay at a healthy weight. You can boost your HDL level by losing weight, especially if you have lots of fat around your waist.
Exercise. Getting regular exercise can raise your HDL level, as well as lower your LDL. You should try to do 30 minutes of moderate to vigorous aerobic exercise on most, if not all, days.
Avoid cigarettes. Smoking and exposure to secondhand smoke can lower your HDL level. If you are a smoker, ask your health care provider for help in finding the best way for you to quit. You should also try to avoid secondhand smoke.
Limit alcohol. Moderate alcohol may lower your HDL level, although more studies are needed to confirm that. What we do know is that too much alcohol can make you gain weight, and that lowers your HDL level.
Some cholesterol medicines, including certain statins, can raise your HDL level, in addition to lowering your LDL level. Health care providers don't usually prescribe medicines only to raise HDL. But if you have a low HDL and high LDL level, you might need medicine.
What else can affect my HDL level?
Taking certain medicines can lower HDL levels in some people. They include:
Beta blockers, a type of blood pressure medicine
Anabolic steroids, including testosterone, a male hormone
Progestins, which are female hormones that are in some birth control pills and hormone replacement therapy
Benzodiazepines, sedatives that are often used for anxiety and insomnia
If you are taking one of these and you have a very low HDL level, ask your provider if you should continue to take them.
Diabetes can also lower your HDL level, so that gives you another reason to manage your diabetes.
Learn More
Cholesterol - what to ask your doctor (Medical Encyclopedia) Also in Spanish
Cholesterol Good and Bad (National Library of Medicine) Also in Spanish
Cholesterol Levels (National Library of Medicine) Also in Spanish
Elevated HDL Cholesterol (Merck & Co., Inc.) Also in Spanish
HDL Cholesterol: How to Boost Your 'Good' Cholesterol (Mayo Foundation for Medical Education and Research) Also in Spanish
Niacin for cholesterol (Medical Encyclopedia) Also in Spanish
Niacin to Improve Cholesterol Numbers (Mayo Foundation for Medical Education and Research) Also in Spanish
|
|||||
1850
|
dbpedia
|
1
| 94 |
https://www.webmd.com/cholesterol-management/heterozygous-familial-hypercholesterolemia
|
en
|
Heterozygous Familial Hypercholesterolemia (HeFH)
|
[
"https://img.wbmdstatic.com/vim/live/webmd/consumer_assets/site_images/logos/webmd/web/webmd_logo_white.svg",
"https://img.lb.wbmdstatic.com/webmd_static_vue/091e9c5e81e52376/client/img/arrow-right.cddcbeb3.svg",
"https://img.lb.wbmdstatic.com/webmd_static_vue/091e9c5e81e52376/client/img/arrow-right.cddcbeb3.svg",
"https://img.lb.wbmdstatic.com/webmd_static_vue/091e9c5e81e52376/client/img/library_books.2bf509db.svg",
"https://img.lb.wbmdstatic.com/vim/live/webmd/consumer_assets/site_images/articles/biographies/ambardekar_nayana_382x382.jpg?resize=51px:51px&output-quality=75",
"https://img.lb.wbmdstatic.com/vim/live/webmd/consumer_assets/site_images/article_thumbnails/hpt_toc_redesign/more_on/MoreOn_AdultADHD.jpg?resize=300px:*&output-quality=75",
"https://img.lb.wbmdstatic.com/vim/live/webmd/consumer_assets/site_images/article_thumbnails/hpt_toc_redesign/cholesterol_hpt_toc_redesign/cholesterol_guide_chapter_3_11823622013_alt.jpg?resize=500px:*&output-quality=75",
"https://privacy-policy.truste.com/privacy-seal/seal?rid=07326333-3522-463d-81bf-f00fd7171fff",
"https://img.webmd.com/dtmcms/live/webmd/consumer_assets/site_images/layout/shared/tag-registered.png?resize=*:60px",
"https://img.webmd.com/dtmcms/live/webmd/consumer_assets/site_images/oncology/1/footer-images/ad-choice.png",
"https://img.wbmdstatic.com/vim/live/webmd/consumer_assets/site_images/oncology/1/images/webmd-logo-white.svg",
"https://sb/p?c1=2&c2=6035829&cv=3.9.1&cj=1"
] |
[] |
[] |
[
""
] | null |
[
"WebMD Editorial Contributors",
"www.facebook.com"
] |
2016-08-09T20:00:00
|
Learn about the causes, symptoms, and treatment of heterozygous familial hypercholesterolemia, a disease that causes you to have very high cholesterol levels.
|
en
|
WebMD
|
https://www.webmd.com/cholesterol-management/heterozygous-familial-hypercholesterolemia
|
What Is Heterozygous Familial Hypercholesterolemia?
You've probably heard that you need to watch your cholesterol to keep heart disease away. That's also true of heterozygous familial hypercholesterolemia. The disease can cause your cholesterol numbers to go way up. If your doctor tells you that you have it, it's important to get treatment to cut your chances of a heart attack or stroke.
You don't catch HeFH the way you might pick up a cold. It's a condition you're born with that was passed down to you from genes you got from your parents. Over time, your high cholesterol levels can damage your arteries, which carry blood and oxygen from your heart to the rest of your body. That raises your chances of a heart attack at a young age.
Diet, exercise, and, most important, medicine can bring down your levels of cholesterol. Learn your risk for HeFH and get treated early to cut your chances of heart disease.
Causes
HeFH is caused by a change in a gene that makes it harder for your body to remove LDL cholesterol from your bloodstream.
Cholesterol is a fatty, waxy substance in your blood and cells. It travels through your body in two forms: HDL and LDL.
HDL helps carry cholesterol to your liver to be removed from your body. It's called "good" cholesterol. LDL is known as "bad" cholesterol because it damages arteries and can lead to heart disease.
If you have HeFH, you inherit a faulty gene from one of your parents. If you're a parent and you have the gene, you've got a 50-50 chance of passing it to each of your children.
HeFH affects about 1 out of every 500 people. In white people whose families came from Europe, the rate may be as high as 1 in every 200 people.
You may hear about a disease with a similar name called homozygous familial hypercholesterolemia (HoFH). It differs from HeFH in the way it's passed down from your parents. Instead of getting a faulty gene from just one of your parents, you get HoFH when you inherit one faulty gene from each parent.
HoFH is more severe than HeFH, but it's rare. Only about 1 out of every 1 million people have it.
Symptoms
Without treatment, HeFH will cause your LDL and total cholesterol levels to go extremely high.
Extra LDL cholesterol can form clumps called plaque in the walls of your arteries. The plaque narrows the arteries so less blood can flow through them. This is called hardening of the arteries.
When this happens, your heart has to work harder to push blood through your body. Over time, your heart can get damaged, and you can get heart disease. If that happens, one of the main symptoms is chest pain called angina. Without any treatment, it can lead to a heart attack or stroke.
Narrowed blood vessels can prevent enough blood from reaching your heart. Or a piece of plaque can break off and get stuck in a blood vessel that supplies blood to your heart or your brain.
If blood flow to your heart gets blocked, you'll have a heart attack and parts of your heart muscle can die. If you're a man and you don't get treatment, you can have a heart attack as early as your 40s or 50s. If you're a woman, you're also at a higher risk for a heart attack, but it can often happen later in your life, possibly in your 60s.
Get medical help right away if you have symptoms of a heart attack:
Pressure, squeezing, or pain in your chest
Pain in your upper back or neck
Pain that radiates down the arms
Nausea or vomiting
Shortness of breath
Fatigue
Get emergency medical help right away if you have warning signs of a stroke, including:
Trouble speaking
Weakness in your arm or leg
Drooping of your face on one side
Loss of balance
High cholesterol in your blood can also cause other symptoms.
Xanthomas
These are bumps under your skin that form when extra cholesterol in your blood clumps together. They're usually yellow or orange.
You're most likely to see them in your tendons, especially in the Achilles tendon in the back of your heel and in the joints of your hands.
Sometimes, these growths can also form on your:
Hands
Elbows
Knees
Feet
Buttocks
Some xanthomas may be very small. Others may grow as large as 3 inches. Smaller bumps can join together to form larger growths. They don't necessarily cause pain, but it depends on their location.
Xanthelasmas
These are xanthomas that grow on your eyelids. They're yellow and form near the inner corner of your eye, often on the upper lid. You'll usually see the same-shaped growth on both the left and right eyelids. They can get larger over time and may be permanent.
Achilles tendinitis
When xanthomas form in your Achilles tendon, they can cause Achilles tendinitis: pain, stiffness, and swelling in the back of the heel.
Corneal arcus
It's a condition you get when cholesterol forms deposits around the outside of your cornea, the clear cover over the front of your eye.
It looks like a white or gray ring around the iris, the colored part of your eye. It won't affect your vision.
Getting a Diagnosis
Some simple exams can help your doctor figure out if you or your child has HeFH. It's important to get the right diagnosis, as early as you can, to start treatment to bring your cholesterol levels down.
Although kids may not be at risk for a heart attack, their high cholesterol levels put them at risk for heart disease later on. Early treatment or lifestyle changes can help your child lower their cholesterol and stay healthy.
If you or your child has any of these signs, talk to your doctor to see if you need to get checked for HeFH:
High LDL cholesterol on a blood test that won't go down with changes in diet. High means above 190 milligrams per deciliter (mg/dL) in adults and 160 mg/dL in kids under 16.
Family history of high cholesterol
Male relatives who had a heart attack or heart disease before 60, or female relatives who had either before 70
Xanthomas
Swollen Achilles tendons
Sore, swollen feet
Yellow or white patches on your eyes
Chest pain
Your doctor or your child's pediatrician will also do a physical exam to look for signs of the disease.
Tests
Your doctor will also do one or more tests to check you or your child for HeFH.
Blood tests. If your doctor thinks you have HeFH, theyâll do a blood test to check your cholesterol level. With HeFH, your:
Total cholesterol level will be over 300 mg/dL
LDL cholesterol level will be over 200 mg/dL
Heart tests. An abnormal stress test may be a clue that you have heart disease. This exam shows how well your ticker works when you rev it up. You'll walk on a treadmill while your doctor tracks your heartbeat.
Genetic test. The most common genetic sign of HeFH is a mutation, or change, in your LDLR gene. That's the gene that affects your cholesterol levels.
Changes in these other genes could also suggest you have HeFH:
Apolipoprotein B-100
PCSK9
LDLRAP1
You'll need to give a small sample of tissue for this test. You can swab the inside of your cheek to scrape off a few cells, which get sent to a lab to see what gene changes you may have. Babies can get a small skin prick on the heel to collect a little blood instead of a cheek swab.
If high cholesterol or heart attacks run in your family, everyone can be tested for these gene problems.
Questions for Your Doctor
Â
Which medicines are best for me?
Do the medications have side effects?
What new symptoms should I watch for?
How often should I see you?
Do I need to see any other specialists? Which ones?
Do I need to lose weight?
Which foods should I avoid?
How much exercise should I do, and what types are best?
Â
Treatment
If you've been diagnosed with heterozygous familial hypercholesterolemia (HeFH), your doctor will work with you to figure out the best way to treat the disease. Whatever you decide, the goal is to lower your levels of LDL "bad" cholesterol and cut your risk for heart disease. Often, it can take a combo of drugs -- along with diet and exercise -- to get your cholesterol numbers down.
Lifestyle changes
Studies with people who have HeFH show that the healthier your lifestyle, the less likely you are to get heart disease in the future.
Try to maintain a healthy weight, keep your blood pressure under control, and stay away from tobacco. Talk to your doctor about how to make these changes in the safest way for you. Here are some more tips for healthier habits:
Eat a low-fat diet. Avoid foods high in saturated and trans fats, like beef, pork, coconut oil, egg yolks, and whole milk. Instead, eat more veggies, fruits, whole grains, nuts, seafood, lean poultry, and low-fat dairy.
You can track what you eat by keeping a journal or working with a nutritionist. Once you learn some easy tips on what foods to avoid or substitute, the diet will become second nature. Some ways to get started:
Stay away from prepackaged, highly processed, and deep-fried foods.
Avoid butter, margarine, salad dressing, and mayonnaise. Try vegetable oil instead.
Choose lean meat like chicken, fish, and turkey, and avoid red or fatty meat like beef and bacon.
Limit drinks with alcohol or a lot of sugar.
Eat a wide variety of fruits, veggies, and whole grains.
Exercise. Walk, swim, dance, bike, climb stairs, and do other activities that make your heart pump harder. Even if you eat an ideal diet and are at a healthy weight, it's important to stay active. Do some aerobic exercise -- activity that gets your heart pumping -- for at least 30 minutes, four or more times a week, to help lower the levels of fats and cholesterol in your blood.
Set a goal for how much you want to exercise, and start slowly. Then slowly increase the number of times per week you work out and the length of time you do it.
Lose extra weight. If you're overweight, drop some pounds with diet and exercise.
If you smoke, stop. Ask your doctor for ways to quit. Cigarettes raise your risk for heart disease.
Medical treatment
Lifestyle changes are usually not enough to treat HeFH. You'll take medicine, too, to lower your cholesterol levels.
Statins. The first type of drug that your doctor may prescribe is called a statin. It blocks one of the compounds your body needs to make cholesterol and helps it absorb cholesterol that's in your blood. Because HeFH can send your cholesterol levels way up, your doctor may suggest high doses of statins.
Studies show that taking the maximum amounts of rosuvastatin or atorvastatin -- the strongest statin drugs -- can lower your LDL levels by more than 50%. Other statins include:
Lovastatin (Mevacor)
Pravastatin (Pravachol)
Simvastatin (Zocor)
PCSK9 inhibitors. Alirocumab (Praluent) and evolocumab (Repatha) are drugs in this group. They make it easier for your liver to remove LDL cholesterol from your blood. Your doctor may recommend these medications if you take the maximum dose of statins but still have high LDL levels. Evolocumab has been approved for treatment in preventing heart attacks or strokes in people with cardiovascular disease.
Ezetimibe (Zetia). This is a drug that stops your body from absorbing all the cholesterol you eat. It often works well when combined with statins. Your doctor may suggest Liptruzet, which contains atorvastatin and ezetimibe, or Vytorin, a medication that's a combo of ezetimibe and a statin called simvastatin.
Other drugs. It's not uncommon for people with HeFH to take two, three, or even four drugs to lower cholesterol. Your doctor may also prescribe bile acid sequestrants (colesevelam, WelChol), fibrates (fenofibrate, gemfibrozil), and nicotinic acid (Niaspan, Slo-Niacin).
Procedures
If medication and lifestyle changes aren't enough to lower your LDL levels, your doctor may suggest other methods to help prevent heart disease.
LDL apheresis. This is a safe and effective way to remove all the LDL from your blood by filtering it. You'll relax in a hospital bed while your blood is slowly drawn through a machine and sent back into your body. Some people feel light-headed, flushed, or nauseated while it's going on. To have the most benefit, you'll probably have to repeat the procedure every few weeks to continue removing LDL from your blood.
Liver transplant. You may hear people talk about liver transplants as a possible treatment, but they're rarely used for HeFH. They're more commonly used to treat homozygous familial hypercholesterolemia (HoFH).
|
|||||
1850
|
dbpedia
|
3
| 62 |
https://www.keckmedicine.org/blog/what-is-the-difference-between-good-and-bad-cholesterol/
|
en
|
What Is the Difference Between Good and Bad Cholesterol?
|
[
"https://www.keckmedicine.org/wp-content/plugins/keck-alert-bar/images/fff5ea.svg",
"https://www.keckmedicine.org/wp-content/uploads/2022/02/keck-medicine-usc-logo.jpg",
"https://www.keckmedicine.org/wp-content/uploads/2022/02/keck-medicine-usc-logo.jpg",
"https://www.keckmedicine.org/wp-content/uploads/2022/02/2line-km-logo.jpg",
"https://www.keckmedicine.org/wp-content/uploads/2023/07/2698.jpg",
"https://www.keckmedicine.org/wp-content/uploads/2023/07/2696.jpg",
"https://www.keckmedicine.org/wp-content/uploads/2023/07/2706.jpg",
"https://www.keckmedicine.org/wp-content/uploads/2023/07/104084.jpg",
"https://content.presspage.com/uploads/2478/cdc93196-420d-42fb-ae42-90c5f51f75c7/500_adobestock-250143346.jpeg?10000",
"https://www.keckmedicine.org/wp-content/uploads/2024/08/speech_therapy.jpg",
"https://www.keckmedicine.org/wp-content/uploads/2021/11/Cholesterol-img.png",
"https://live-keck-medicine.pantheonsite.io/wp-content/uploads/2021/11/cholesterol-sm-img.png",
"https://www.keckmedicine.org/wp-content/themes/understrap-child/images/logos/KMOfUSC_Limitless_LogoLockup_1line_cardblk.png"
] |
[] |
[] |
[
""
] | null |
[
"admin"
] |
2017-07-11T13:24:45+00:00
|
Cholesterol — a waxy substance that builds in the arteries — is not completely harmful, despite its reputation. Here's what you should know.
|
en
|
Keck Medicine of USC
|
https://www.keckmedicine.org/blog/what-is-the-difference-between-good-and-bad-cholesterol/
|
Cholesterol — a waxy substance that builds in the arteries — is not completely harmful, despite its reputation for being bad for you. In fact, some of it can even improve your health when consumed in the right amounts.
The physicians at the USC Cardiac and Vascular Institute at Keck Medicine of USC can measure your good cholesterol and bad cholesterol levels, and help you adopt healthier eating and living habits so you can achieve the best balance of both.
What are the different types of cholesterol?
There are two types: high-density lipoprotein (HDL) and low-density lipoprotein (LDL). As a general rule, HDL is considered “good” cholesterol, while LDL is considered “bad.” This is because HDL carries cholesterol to your liver, where it can be removed from your bloodstream before it builds up in your arteries. LDL, on the other hand, takes cholesterol directly to your arteries. This can result in atherosclerosis, a plaque buildup that can even cause heart attack and stroke.
Triglycerides make up the third component of cholesterol and act as unused calories that are stored as fat in the blood. Eating more calories than you burn can cause triglycerides to build up in the bloodstream, increasing your risk for heart attacks.
Understanding your numbers
More than one-third of Americans suffer from high LDL cholesterol, so it’s important to see your physician to learn your cholesterol counts — or the amount of cholesterol in your blood — and closely monitor them. Your physician will perform a simple blood test and check your other risk factors to find your counts.
An LDL count of 100 or less is considered healthy. Your HDL count should be at least 40 (or 50 if you’re female) or greater. Healthy triglyceride counts are 150 or less. Your “numbers,” or total HDL and LDL cholesterol plus triglycerides, should add up to no more than 200. If your numbers are higher than 200, check with your physician — you may have a higher HDL count, which is not unhealthy.
Keep your cholesterol counts under control
Maintaining healthy levels of cholesterol is manageable. Medication is key, along with eating a healthy diet with lots of vegetables and getting regular exercise.
Topics
|
|||||
1850
|
dbpedia
|
2
| 79 |
https://repositorio.udd.cl/entities/publication/a5d978eb-dae6-4a8e-b7c2-d0cd075f8329
|
en
|
Spheroids derived from the stromal vascular fraction of adipose tissue self
|
https://repositorio.udd.cl/entities/publication/assets/dspace/images/favicons/favicon.ico
|
https://repositorio.udd.cl/entities/publication/assets/dspace/images/favicons/favicon.ico
|
[
"https://repositorio.udd.cl/entities/publication/assets/images/logo-udd-biblioteca.png",
"https://biblioteca.udd.cl/wp-content/themes/biblioteca-2020/assets/img/logo-udd-blanco.svg"
] |
[] |
[] |
[
""
] | null |
[] | null |
Background: Adipose tissue-derived stromal vascular fraction (SVF) harbors multipotent cells with potential therapeutic relevance. We developed a method to form adipose spheroids (AS) from the SVF with complex organoid structure and enhanced leptin secretion upon insulin stimulation.
Methods: SVF was generated from the interscapular brown adipose tissue of newborn mice. Immunophenotype and stemness of cultured SVF were determined by flow cytometry and in vitro differentiation, respectively. Spheroids were generated in hanging drops and non-adherent plates and compared by morphometric methods. The adipogenic potential was compared between preadipocyte monolayers and spheroids. Extracellular leptin was quantified by immunoassay. Lipolysis was stimulated with isoprenaline and quantified by colorimetric methods. AS viability and ultrastructure were determined by confocal and transmission electron microscopy analyses.
Results: Cultured SVF contained Sca1 + CD29 + CD44 + CD11b- CD45- CD90- cells with adipogenic and chondrogenic but no osteogenic potential. Culture on non-adherent plates yielded the highest quantity and biggest size of spheroids. Differentiation of AS for 15 days in a culture medium supplemented with insulin and rosiglitazone resulted in greater Pparg, Plin1, and Lep expression compared to differentiated adipocytes monolayers. AS were viable and maintained leptin secretion even in the absence of adipogenic stimulation. Glycerol release after isoprenaline stimulation was higher in AS compared to adipocytes in monolayers. AS were composed of outer layers of unilocular mature adipocytes and an inner structure composed of preadipocytes, immature adipocytes and an abundant loose extracellular matrix.
Conclusion: Newborn mice adipose SVF can be efficiently differentiated into leptin-secreting AS. Prolonged stimulation with insulin and rosiglitazone allows the formation of structurally complex adipose organoids able to respond to adrenergic lipolytic stimulation.
|
en
|
assets/dspace/images/favicons/favicon.ico
| null |
Background: Adipose tissue-derived stromal vascular fraction (SVF) harbors multipotent cells with potential therapeutic relevance. We developed a method to form adipose spheroids (AS) from the SVF with complex organoid structure and enhanced leptin secretion upon insulin stimulation. Methods: SVF was generated from the interscapular brown adipose tissue of newborn mice. Immunophenotype and stemness of cultured SVF were determined by flow cytometry and in vitro differentiation, respectively. Spheroids were generated in hanging drops and non-adherent plates and compared by morphometric methods. The adipogenic potential was compared between preadipocyte monolayers and spheroids. Extracellular leptin was quantified by immunoassay. Lipolysis was stimulated with isoprenaline and quantified by colorimetric methods. AS viability and ultrastructure were determined by confocal and transmission electron microscopy analyses. Results: Cultured SVF contained Sca1 + CD29 + CD44 + CD11b- CD45- CD90- cells with adipogenic and chondrogenic but no osteogenic potential. Culture on non-adherent plates yielded the highest quantity and biggest size of spheroids. Differentiation of AS for 15 days in a culture medium supplemented with insulin and rosiglitazone resulted in greater Pparg, Plin1, and Lep expression compared to differentiated adipocytes monolayers. AS were viable and maintained leptin secretion even in the absence of adipogenic stimulation. Glycerol release after isoprenaline stimulation was higher in AS compared to adipocytes in monolayers. AS were composed of outer layers of unilocular mature adipocytes and an inner structure composed of preadipocytes, immature adipocytes and an abundant loose extracellular matrix. Conclusion: Newborn mice adipose SVF can be efficiently differentiated into leptin-secreting AS. Prolonged stimulation with insulin and rosiglitazone allows the formation of structurally complex adipose organoids able to respond to adrenergic lipolytic stimulation.
|
|||
1850
|
dbpedia
|
3
| 42 |
https://www.verywellhealth.com/what-causes-low-hdl-cholesterol-levels-698078
|
en
|
Low HDL Cholesterol: 7 Key Causes and What You Can Do
|
[
"https://privacy-policy.truste.com/privacy-seal/seal?rid=33c36249-6102-4b62-8673-787e6e3429a0",
"https://www.verywellhealth.com/thmb/1YmfRrqszeQHoju6EbvyOD7Fdxs=/1500x0/filters:no_upscale():max_bytes(150000):strip_icc()/what-causes-low-hdl-cholesterol-levels-698078_redraw_color1-5c454ef6c9e77c0001b2ffa9.png",
"https://www.verywellhealth.com/thmb/1YmfRrqszeQHoju6EbvyOD7Fdxs=/1500x0/filters:no_upscale():max_bytes(150000):strip_icc()/what-causes-low-hdl-cholesterol-levels-698078_redraw_color1-5c454ef6c9e77c0001b2ffa9.png",
"https://www.verywellhealth.com/thmb/1_sA8EvxU0ax2Hnt6kkGhZqRUis=/270x180/filters:no_upscale():max_bytes(150000):strip_icc()/DoctorDiscussionGuideOldMan-5c3e5dd446e0fb00017d6d47.png",
"https://www.verywellhealth.com/thmb/1_sA8EvxU0ax2Hnt6kkGhZqRUis=/270x180/filters:no_upscale():max_bytes(150000):strip_icc()/DoctorDiscussionGuideOldMan-5c3e5dd446e0fb00017d6d47.png",
"https://www.verywellhealth.com/thmb/HMdMU-Q-4fHBq_sSCUYtAtzNZEM=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-1296507353-122fc15649ca40eea4758916a2fc4e6f.jpg",
"https://www.verywellhealth.com/thmb/HMdMU-Q-4fHBq_sSCUYtAtzNZEM=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-1296507353-122fc15649ca40eea4758916a2fc4e6f.jpg",
"https://www.verywellhealth.com/thmb/xghSWsO_vH4vHqGke8JIbP3PgwE=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/200464129-001-56a144863df78cf7726901cc.jpg",
"https://www.verywellhealth.com/thmb/xghSWsO_vH4vHqGke8JIbP3PgwE=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/200464129-001-56a144863df78cf7726901cc.jpg",
"https://www.verywellhealth.com/thmb/USPE4BwI-pzGBZvliwG7-6dU6mY=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-1225223624-d2cb329a547e49c285119a87d0b45c30.jpg",
"https://www.verywellhealth.com/thmb/USPE4BwI-pzGBZvliwG7-6dU6mY=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-1225223624-d2cb329a547e49c285119a87d0b45c30.jpg",
"https://www.verywellhealth.com/thmb/lgcPB7-oCflU_JWs25wqg8hleOE=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/Stocksy_burger-and-fries_11104-57e2fb945f9b586c355e6a14.jpg",
"https://www.verywellhealth.com/thmb/lgcPB7-oCflU_JWs25wqg8hleOE=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/Stocksy_burger-and-fries_11104-57e2fb945f9b586c355e6a14.jpg",
"https://www.verywellhealth.com/thmb/yrSjuVJ961DtBjEX8L72zsHihW8=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-1173046608-2c9146bf435245cd8d2d762947cfede7.jpg",
"https://www.verywellhealth.com/thmb/yrSjuVJ961DtBjEX8L72zsHihW8=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-1173046608-2c9146bf435245cd8d2d762947cfede7.jpg",
"https://www.verywellhealth.com/thmb/HdQklLsQypxGR6GDWm1YMijgQgQ=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-476804053-5a68c8476edd650037e382ab.jpg",
"https://www.verywellhealth.com/thmb/HdQklLsQypxGR6GDWm1YMijgQgQ=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-476804053-5a68c8476edd650037e382ab.jpg",
"https://www.verywellhealth.com/thmb/yAEat-UM0hrPN29VBdNnK5OJWAY=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/lots-of-pints-of-beers---man--in-background--566272557-59ca6126054ad90011051c7e.jpg",
"https://www.verywellhealth.com/thmb/yAEat-UM0hrPN29VBdNnK5OJWAY=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/lots-of-pints-of-beers---man--in-background--566272557-59ca6126054ad90011051c7e.jpg",
"https://www.verywellhealth.com/thmb/f-zoCRV1VSTpC2kge0lDUdTPztY=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-1188431836-5d73aa6cb46e47af93651dedb6cbb80e.jpg",
"https://www.verywellhealth.com/thmb/f-zoCRV1VSTpC2kge0lDUdTPztY=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-1188431836-5d73aa6cb46e47af93651dedb6cbb80e.jpg",
"https://www.verywellhealth.com/thmb/4RDsXwWomIl1Mq6s5iUY4MXl-CE=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-505323661-5686b6163df78ccc15fd8489.jpg",
"https://www.verywellhealth.com/thmb/4RDsXwWomIl1Mq6s5iUY4MXl-CE=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-505323661-5686b6163df78ccc15fd8489.jpg",
"https://www.verywellhealth.com/thmb/UN1vPMahx4fDRa3XjpX78zTJpF4=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-10556620421-dd4e05f7647644d892b672f445745700.jpg",
"https://www.verywellhealth.com/thmb/UN1vPMahx4fDRa3XjpX78zTJpF4=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-10556620421-dd4e05f7647644d892b672f445745700.jpg",
"https://www.verywellhealth.com/thmb/67Assd1DSFDI9WQpYD1Le8PONTU=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/walking-GettyImages-1411303413-54f7dd7d555944cb99f7cd41ba747d12.jpg",
"https://www.verywellhealth.com/thmb/67Assd1DSFDI9WQpYD1Le8PONTU=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/walking-GettyImages-1411303413-54f7dd7d555944cb99f7cd41ba747d12.jpg",
"https://www.verywellhealth.com/thmb/LJLfyAKt5lS5BRpYaB8zKgb_DNE=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-907329974-faecb50958c1490db53a035b18a45d8a.jpg",
"https://www.verywellhealth.com/thmb/LJLfyAKt5lS5BRpYaB8zKgb_DNE=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-907329974-faecb50958c1490db53a035b18a45d8a.jpg",
"https://www.verywellhealth.com/thmb/meD87nXGKaQI6ZpcqIHEIDyO8Zs=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/134556105-56a144885f9b58b7d0bda47a.jpg",
"https://www.verywellhealth.com/thmb/meD87nXGKaQI6ZpcqIHEIDyO8Zs=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/134556105-56a144885f9b58b7d0bda47a.jpg",
"https://www.verywellhealth.com/thmb/OyO9Gd0WPb7tQ7DYC1_8vqMCTFQ=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/saladprep_GettyImages-836430946-6a124e5e2b6f412393c5a4a967c2f7cb.jpeg",
"https://www.verywellhealth.com/thmb/OyO9Gd0WPb7tQ7DYC1_8vqMCTFQ=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/saladprep_GettyImages-836430946-6a124e5e2b6f412393c5a4a967c2f7cb.jpeg",
"https://www.verywellhealth.com/thmb/PLr3oJAJEQcj2n7myGPlAGLA4yM=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-1985097904-2cce859e78a549aa995c9f27e9f2f4bb.jpg",
"https://www.verywellhealth.com/thmb/PLr3oJAJEQcj2n7myGPlAGLA4yM=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-1985097904-2cce859e78a549aa995c9f27e9f2f4bb.jpg",
"https://www.verywellhealth.com/thmb/3ev56N0yMx7nSKGXMSinKII_jSk=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-1316198689-ed313732a8e74929ac61cce32c53a0ec.jpg",
"https://www.verywellhealth.com/thmb/3ev56N0yMx7nSKGXMSinKII_jSk=/400x250/filters:no_upscale():max_bytes(150000):strip_icc()/GettyImages-1316198689-ed313732a8e74929ac61cce32c53a0ec.jpg",
"https://privacy-policy.truste.com/privacy-seal/seal?rid=33c36249-6102-4b62-8673-787e6e3429a0"
] |
[] |
[] |
[
""
] | null |
[
"Jennifer Moll, PharmD",
"www.facebook.com",
"Jennifer Moll"
] |
2009-01-25T23:58:44-05:00
|
Smoking, poor diet, and lack of exercise can cause an HDL ("good") cholesterol count that's too low. Learn more about how to boost your HDL levels.
|
en
|
/favicon.ico
|
Verywell Health
|
https://www.verywellhealth.com/what-causes-low-hdl-cholesterol-levels-698078
|
High-density lipoprotein (HDL) cholesterol that is too low can increase your risk of heart disease and stroke, especially when your low-density lipoprotein (LDL) cholesterol is too high. That's because HDL protects the arteries by removing cholesterol and taking it to the liver for processing and elimination.
Some people have a genetic risk for cholesterol problems, but you can limit some of the risk factors when your "good" HDL is too low. Lifestyle changes including diet, exercise, and not smoking can help to improve your levels. Medication can help to control your LDL lipoproteins, too.
There are seven key factors linked specifically to HDL deficiency.
Genetic Mutations
Sometimes, a very low HDL count is caused by genes that run in families. These include conditions like Tangier’s disease, caused by mutations in the ABCA1 gene, and another called familial hypoalphalipoproteinemia, caused by mutations of the APOA1, ABCA1, or LCAT genes.
Excess Weight
If you are overweight or diagnosed with obesity, a type of blood fat called triglycerides will increase. HDL is composed of triglycerides and, when triglyceride levels are high, HDL will undergo changes that cause it to break down faster, leading to a lower count.
Losing 5% of your body weight is a reasonable short-term goal to address overweight and obesity. Over the longer term, losing 15% of your body weight and remaining at this weight is considered a good result. Some studies note that these goals vary with the individual.
Working with a healthcare provider, personal trainer, and/or nutritionist can ensure that the weight-loss plan is safe and effective.
Poor Diet
A diet high in refined carbohydrates (such as white bread and sugar) causes the liver to produce more triglycerides, resulting in a drop in HDL. Some foods you eat are also rich in triglycerides, including fried foods, processed foods, red meat, high-fat dairy, and margarine.
To counter this, limit your intake of refined carbs and saturated fats found in animal-derived foods. Instead, substitute with whole grains and healthier monounsaturated and polyunsaturated fats. These are found in plant-based foods.
Inactivity
A lack of exercise is associated with the buildup of fatty deposits in arteries called atherosclerosis. Exercise improves HDL's ability to scoop up these fatty deposits and move them to the liver for disposal (a process known as cholesterol efflux).
Aerobic exercise is known to increase HDL levels. Studies have shown that the duration of aerobic exercise, as opposed to intensity, is the main factor associated with benefits but more study is needed to understand why.
To counter this, try to get 150 minutes of moderate intensity exercise or 75 minutes of aerobic exercise each week. A combination of the two can include moderate dancing or brisk walking, along with the more intense running, faster bicycling, or swimming laps.
Smoking
The chemicals in tobacco smoke can lower HDL levels in different ways, and research studies confirm the effects of smoking on HDL. However, the precise reasons are not fully understood.
Some studies point to interaction with proteins called cholesterol ester transfer protein (CETP) and fats called lecithin, both of which are needed to build HDL, but the results are mixed. Smoking also appears to affect liver function that's important to cholesterol and triglyceride levels.
Quitting cigarettes can be hard, but you can succeed. Speak with your healthcare provider about smoking cession aids, many of which are fully covered by health insurance under the Affordable Care Act.
Uncontrolled Diabetes
Low levels of HDL and the risk of type 2 diabetes are closely linked, although more study is needed to fully understand why. Insulin resistance, for example, is associated with both low HDL levels and the development of type 2 diabetes.
Some studies point to the role of apolipoprotein A1 (ApoA1), which is needed to produce HDL, because it appears to influence the development of diabetes and other metabolic diseases. The low HDL levels seen in people with chronic kidney disease also may be related to ApoA1.
Researchers are even looking at ways that treatments based on ApoA1 levels can be used to manage blood sugar in type 2 diabetes. It's essential to avoid poorly controlled diabetes, so speak with your healthcare provider about any needed changes to your diet, exercise, or diabetes medication.
Medicines
Certain medications are known to lower HDL levels. Some of these are used to treat heart disease, while others affect hormones that can indirectly affect the production of lipoproteins.
These include:
Beta-blockers: Most often used to treat irregular heartbeats and angina
Thiazide diuretics: A type of "water pill" used to treat high blood pressure
Androgens: Male hormones, most specifically testosterone
Progesterone: Commonly used in hormonal birth control
Anabolic steroids: Used for rapid muscle growth and bodybuilding
Do not stop any prescribed drug or alter the dose without first speaking with your healthcare provider.
Optimal HDL Levels
Cholesterol levels are checked with a simple blood test called a lipid panel. HDL counts are described in milligrams per deciliter of blood (mg/dL).
Optimal HDL levels can vary by a person's age and/or assigned sex at birth, as follows:
People 19 and under: Greater than 45 mg/dL
Males over 20: Greater than 40 mg/dL
Females over 20: Greater than 50 mg/dL
Anything below these values is considered HDL deficiency. While an HDL count is just one factor in overall health, it can direct actions to reduce risk, including smoking cessation, changes in diet, and medications called statins used to reduce "bad" cholesterol.
Summary
HDL is the "good" cholesterol that helps remove cholesterol from your arteries. Higher levels are considered better for heart health. Normal levels are at least 40 mg/dL for adult males and 50 mg/dL for adult females.
Your HDL level is important, but your healthcare provider will likely focus less on the number and more on what it means for your overall health. That may mean lifestyle changes, which can put you in control of your weight, diet, smoking habits, and other contributing factors.
Talk with your healthcare provider about how often you should have your cholesterol checked (it's a common test with your annual physical) and what your results mean in terms of any treatment.
|
||||
1850
|
dbpedia
|
2
| 4 |
https://elifesciences.org/reviewed-preprints/96693
|
en
|
Modeling Hereditary Diffuse Leukoencephalopathy with Axonal Spheroids using microglia-sufficient brain organoids
|
[
"https://elifesciences.org/reviewed-preprints/_next/static/media/elife-logo.2ab2ee88.svg",
"https://prod--epp.elifesciences.org/iiif/2/96693%2Fv2%2Fcontent%2F579869v2_fig1.tif/full/max/0/default.jpg",
"https://prod--epp.elifesciences.org/iiif/2/96693%2Fv2%2Fcontent%2F579869v2_fig2.tif/full/max/0/default.jpg",
"https://prod--epp.elifesciences.org/iiif/2/96693%2Fv2%2Fcontent%2F579869v2_fig3.tif/full/max/0/default.jpg",
"https://prod--epp.elifesciences.org/iiif/2/96693%2Fv2%2Fcontent%2F579869v2_fig4.tif/full/max/0/default.jpg",
"https://prod--epp.elifesciences.org/iiif/2/96693%2Fv2%2Fcontent%2F579869v2_fig5.tif/full/max/0/default.jpg",
"https://prod--epp.elifesciences.org/iiif/2/96693%2Fv2%2Fcontent%2F579869v2_fig6.tif/full/max/0/default.jpg",
"https://prod--epp.elifesciences.org/iiif/2/96693%2Fv2%2Fcontent%2F579869v2_utbl1.tif/full/max/0/default.jpg",
"https://prod--epp.elifesciences.org/iiif/2/96693%2Fv2%2Fcontent%2F579869v2_utbl2.tif/full/max/0/default.jpg",
"https://prod--epp.elifesciences.org/iiif/2/96693%2Fv2%2Fcontent%2F579869v2_figs1.tif/full/max/0/default.jpg",
"https://prod--epp.elifesciences.org/iiif/2/96693%2Fv2%2Fcontent%2F579869v2_figs2.tif/full/max/0/default.jpg",
"https://prod--epp.elifesciences.org/iiif/2/96693%2Fv2%2Fcontent%2F579869v2_figs3.tif/full/max/0/default.jpg",
"https://prod--epp.elifesciences.org/iiif/2/96693%2Fv2%2Fcontent%2F579869v2_tbls1.tif/full/max/0/default.jpg",
"https://prod--epp.elifesciences.org/iiif/2/96693%2Fv2%2Fcontent%2F579869v2_tbls2.tif/full/max/0/default.jpg",
"https://prod--epp.elifesciences.org/iiif/2/96693%2Fv2%2Fcontent%2F579869v2_tbls3.tif/full/max/0/default.jpg",
"https://prod--epp.elifesciences.org/iiif/2/96693%2Fv2%2Fcontent%2F579869v2_tbls3a.tif/full/max/0/default.jpg",
"https://prod--epp.elifesciences.org/iiif/2/96693%2Fv2%2Fcontent%2F579869v2_tbls3b.tif/full/max/0/default.jpg",
"https://prod--epp.elifesciences.org/iiif/2/96693%2Fv2%2Fcontent%2F579869v2_tbls4.tif/full/max/0/default.jpg",
"https://prod--epp.elifesciences.org/iiif/2/96693%2Fv2%2Fcontent%2F579869v2_tbls5.tif/full/max/0/default.jpg",
"https://elifesciences.org/reviewed-preprints/_next/static/media/hhmi.9d544219.svg",
"https://elifesciences.org/reviewed-preprints/_next/static/media/wellcome.6030b788.svg",
"https://elifesciences.org/reviewed-preprints/_next/static/media/max.7d8ce9e5.svg",
"https://elifesciences.org/reviewed-preprints/_next/static/media/kaw.ee7653b1.svg",
"https://elifesciences.org/reviewed-preprints/_next/static/media/carbon-neutral.1d34f2f1.svg"
] |
[] |
[] |
[
""
] | null |
[
"Wei Jie Wong",
"Yi Wen Zhu",
"Hai Ting Wang",
"Jia Wen Qian",
"Ziyi Li",
"Song Li",
"Zhao Yuan Liu",
"Wei Guo",
"Shuang Yan Zhang",
"Bing Su"
] |
2024-06-13T00:00:00+00:00
|
en
| null |
Introduction
Hereditary diffused leukoencephalopathy with axonal spheroids (HDLS) – also known as adult-onset leukodystrophy with axonal spheroids and pigmented glia (ALSP), is a rare, inherited, autosomal dominant, neurodegenerative disease that is characterized by patchy axonal swellings (spheroids) and demyelination that result in the alteration of the white matter of the brain (1). Although detailed epidemiological data are lacking, in 2021, it was estimated that approximately a quarter of a million people globally are affected by the condition (2); yet our understanding of the pathogenesis of the disease is limited, and there is no cure or even effective treatment.
For more than a decade, we have known that HDLS is caused by mutations affecting the colony-stimulating factor-1 receptor (CSF-1R) (3) which most often occur in the tyrosine kinase domain (TKD) (4), and lead to reduced auto-phosphorylation in response to CSF-1, which results in impaired downstream signaling (4, 5). These mutations most profoundly affect microglia (6), the specialized brain-resident macrophages that play critical roles in brain development and homeostasis (7, 8) as well as in a wide range of neuroinflammatory and neurodegenerative diseases (9). Patients with HDLS have few, small, microglia that are distributed abnormally within the neocortex and that express low levels of the homeostatic marker P2RY12 and high levels of the inflammatory marker CD68, compared to healthy controls (10–12).
Studies aiming to understand the pathophysiology of HDLS have used various approaches. Rodent models have been generated, but do not faithfully recapitulate the disease phenotype in humans: the earliest haplo-insufficient Csf-1r+/- mice model exhibited microgliosis within brain regions (13), but this was not recapitulated in a later Csf-1r knockout rat model (14); while a subsequent orthologous mouse model has phenocopied the reduced microglia density seen in patients with HDLS but does not exhibit brain pathology (15). A zebrafish model of HDLS similarly saw reduced microglia during brain development (16), but does not offer the opportunity to study pathology associated with adult-onset neurodegenerative diseases (17). To overcome these species-specific limitations, in this study we generated human induced pluripotent stem cell (iPSC) - derived macrophages from patients with HDLS and used them to create microglia-sufficient autologous brain organoids (18) in which we characterized the effects of naturally occurring CSF-1R mutation on microglial function. By comparing iPSC-derived macrophages to genetically corrected macrophages from the same patients, we uncovered evidence of significant transcriptional and metabolic reprogramming that was associated with profound changes to neuronal regulation by these cells, indicative of the likely mechanistic links between microglial dysfunction and HDLS.
Results
Generation and characterization of iPSC lines from patients with HDLS
We first isolated dermal fibroblasts from skin biopsies taken from two patients with HDLS and confirmed mutations in the TDK region of the CSF-1R gene (HD1, HD2; clinical characteristics shown in Supplemental Table 1) then cultured them for approximately four weeks before reprogramming into induced pluripotent stem cells (iPSCs) (Fig 1A). Four to five weeks post-transfection, we observed iPSC-like colonies emerging (Supp Fig 1B), and 7-10 days later, we selected those clones that were proliferating and displayed typical iPSC morphology (Fig 1C). We confirmed successful reprogramming by visualization of pluripotency markers including SOX2 and OCT4 (nuclear markers), and TRA-1-60 and SSEA-4 (intracellular marker), by immunofluorescence (Fig 1D). We also confirmed that these clones had normal karyotype (Fig 1E) and termed them Mut HD1 and Mut HD2. One clone per cell line was used for further analysis. We then generated isogenic from Mut HD1 and Mut HD2 iPSC cell lines which we termed IsoHD1 and IsoHD2 respectively, as controls (see Methods). Clones that were karyotypically normal were used for downstream experiments alongside their mutant counterparts (Fig 1B), with no off-target events identified (Supp Fig 1C). Collectively, HDLS iPSC and their corresponding isogenic iPSC controls were successfully generated from two patients with HDLS (HD1 and HD2).
Generation and characterization of patient iPSC-derived macrophages
We next sought to differentiate primitive microglia-like macrophages from patient-derived iPSC cell lines (iMacs) using our serum-free protocol that faithfully recapitulates the generation of in vivo microglial progenitor cells (19). Briefly, iPSCs were initially inducted towards the mesodermal lineage before being differentiated into hemangioblast-like cells with the potential to differentiate into both endothelial and hematopoietic progenitors - the latter emerging as free-floating cells as early as day six after seeding - which we collected and then terminally differentiated into iMacs by the addition of CSF-1 (Fig 2A). Although HDLS mutation downregulates the sensitivity of CSF-1R to its ligand (5), we were able to successfully generate iMacs using this protocol: the yield of iMacs from iPSC varied between cultures (Fig 2B), but flow cytometry confirmed their consistent macrophage-like phenotype, with abundant expression of CD45 and CD14 (Fig 2C), and Giemsa staining showed that iMacs exhibited comparable morphology between donors (Fig 2D). Functionally, all iMac cultures were equally able to take up PE-labelled beads that were detectable within their cell bodies (Fig 2D); flow cytometry confirmed that the level of actin-dependent phagocytosis of pHrodo beads was comparable among CD45-expressing cells from all cultures (Fig 2E). Collectively, these data show that iMacs generated from HDLS donor-derived iPSC adopted the typical morphology, phenotype and functions associated with macrophages.
The mutations associated with HDLS downregulate the sensitivity of CSF-1R to its ligand CSF-1, but to different extents depending on the mutation site (5). We therefore compared the survival of our mutant and isogenic cells lines from both patients during culture with CSF-1. As expected, even with high concentrations of CSF-1, relatively few mutant cells survived across seven days of culture; by contrast, even low CSF-1 levels allowed significantly more isogenic cells to survive (Fig 2F).
In summary, we generated iMacs from iPSC of patients with HDLS and their respective isogenic controls that exhibit typical macrophage morphology, phenotype, and phagocytic capabilities.
Mutant and isogenic control iMacs have distinct gene expression profiles
Although iMacs derived from patients with HDLS exhibited core macrophage features, we wanted to more fully understand the impact of CSF-1R mutation on these cells. We first characterized their gene expression profile using bulk RNA-seq and compared it to that of their respective CSF-1R-restored isogenic iMac cultures.
Principal component analysis (PCA) showed that patterns of gene expression differed markedly between mutant and isogenic iMacs. Among cell cultures from HD1, mutant iMacs exhibited patterns of gene expression consistent with a more reactive state compared to isogenic CSF-1R-restored HD1: HD1 Mut had higher expression of genes involved in pathways related to proliferation (IGF2, MYBL2, STAT1, INCEP, TGFA) and the defense response to virus (IFI27, IFI44L, STAT1, MX1, IFIT3); while Iso HD1 iMacs expressed high levels of genes involved in chemokine-related responses and signaling pathways (CXCL2, ADAM8, CCL31L, CCL5,), as well as leukocyte migration and chemotaxis (CXCL3, CCL13, CCL2, E5AR1, C3AR1) (Fig 3A-C). We observed a similar transcriptomic profile in HD2-derived iMacs: HD2 Mut showed up-regulated gene expression for the defensive response to virus, while isogenic HD2 iMacs exhibited high expression levels of genes involved in leukocyte migration and chemotaxis (Fig 3D-F). These data are in line with previous reports suggesting that macrophages from patients with HDLS adopt an inflammatory phenotype with increased expression of the immunoreactive markers CD68 and CD163 (10, 12). Additionally, an upregulation of the immature myeloid cell marker MPO (20), and a reduced expression of mature macrophage marker MARCO (21) was observed within mutant iMac of both cell lines. Taken together, iMac cultures derived from patients with HDLS exhibited transcriptomic profiles consistent with upregulated inflammatory gene expression as a result of impeded CSF-1R function.
Mutant and isogenic control iMacs have distinct metabolic profiles
Studies have shown that activated macrophages often undergo metabolic reprogramming to fulfil the energetic needs of demanding biochemical processes (22, 23); alongside, we know that energy metabolism, as well as metabolic cell features, plays an important role in mediating macrophage function and plasticity (24). Therefore, we next compared the cellular metabolic profiles of patient-derived CSF-1R mutant and isogenic CSF-1R-restored iMacs.
We first assessed glycolysis by measuring the extracellular acidification rate (ECAR) in the presence of specific modulators (glucose, oligomycin, 2-deoxy-glucose) that were added sequentially to the cell cultures to reveal various aspects of the metabolic pathway (see Methods): this showed that CSF-1R-mutant iMacs from both HD1 and HD2 had a significant overall increase in glycolytic function (Fig 3G and 3O). Although the magnitude of the difference between iMac HD1 and HD2 and their respective CSF-1R-restored counterparts varied, in both cases, CSF-1R mutation was associated with significantly increased glycolytic capacity and glycolytic reserve.
Next, we determined the functional metabolic profile of mitochondrial respiration by measuring real-time changes in the extracellular oxygen consumption rate (OCR) during sequential treatment of cells with oligomycin, carbonyl cynide p-trifluoromethoxyphenylhydrazone (FCCP) and a combination of rotenone and antimycin A. As before, although the magnitude of effect was less for cells from HD1, both sets of iMacs showed a similar trend towards higher OCR values, and greater capacity for basal respiration, ATP production, and maximal respiratory capacity in the presence of mutated CSF-1R in the case of HD2 Mut cells, these differences achieved statistical significance across all three bioenergetic parameters.
Taken together, these results indicate that the absence of fully functional CSF-1R in cells from HD1 and HD2 is associated with an upregulated glycolytic metabolic profile, which is cells from HD2 is clearly accompanied by a higher mitochondrial oxidative phosphorylation rate. This suggests that macrophages from patients with HDLS have an altered metabolic profile that correlates with their higher activation status and could contribute to disease pathology.
HDLS iMacs upregulate IL-1β when exposed to apoptotic neuronal cells
Our data suggest that mutant iMacs have dysregulated transcriptomic and metabolic profiles, suggestive of an active inflammatory state. To better understand how this would be expressed in the context of their functions in the brain, we mimicked a need for apoptotic cell clearance by incubating iMacs from patients with HDLS with UV-irradiated neuronal SH-SY5Y cells (Supp Fig 2A). Both iMac lines (CSF-1R mutant and isogenic) from both patients effectively phagocytosed apoptotic but not control, non-UV-irradiated, SH-SY5Y cells, in an actin-dependent manner (Supp Fig 2B).
We then measured the expression of genes encoding pro-(IFN-g, TNF-α, IL-1β, IL-6, IL-18) and anti-(IL-10, IL-12, TGF-β) inflammatory cytokines following incubation of iMacs with UV-irradiated or non-irradiated SH-SY5Y cells, or without any SH-SY5Y cells, for eight hours. We observed a significant and specific increase in IL-1β transcription in CSF-1R mutated iMacs from both HD1 and HD2 when exposed to apoptotic cells, compared with their isogenic counterparts. Among the anti-inflammatory cytokines, Mut HD2 cells exhibited significantly increased transcription of the gene encoding TGF-β when cocultured with UV-treated cells, alongside high baseline levels of IL-12 and TGF-β in control cultures compared to isogenic HD2 iMacs. Interestingly, all CSF-1R mutant iMac groups had higher levels of transcription of most pro-inflammatory cytokines at baseline, consistent with their activated/reactive transcriptional profile, than did their CSF-1R-restored counterparts (Fig 4A-B).
Collectively, all iMacs exhibited the ability to specifically phagocytose apoptotic cells, but in the absence of a fully functional CSF-1R, this led to high levels of IL-1β transcription, which reflected a general propensity towards the transcription of pro-inflammatory cytokine genes, even in the absence of overt stimulation. Importantly, restoration of CSF-1R via gene editing was sufficient to reverse this inflammatory phenotype.
iMacs differentiate into microglia-like cells (iMicro) in a coculture with forebrain organoid
During HDLS, patients typically exhibit degeneration of the frontal lobes of the brain, which contributes to the deficit and decline in cognitive ability, changes to personality and behavior, and dysfunctional motor, social, and language skills (25, 26). Therefore, we next generated iPSC-derived forebrain organoids including autologous iMacs from patients with HDLS to better understand their potential role in the brain.
To better understand how diseased or non-diseased macrophages affect the developing brain, we first generated forebrain organoids from the isogenic cell line variant of the respective donor’s iPSC (see Methods). After 31 days, organoids were harvested (Supp Fig 3A) and co-cultured for seven days with isogenic or mutant iMacs that had been generated in parallel (Fig 5A). At this point, each organoid was removed from its coculture and cultured individually for 16 more days (Fig 5B).
We then applied 3D imaging of forebrain organoids to assess their morphology and the distribution/differentiation of the iMacs. This showed that iMacs expressing the microglial marker IBA-1, were mostly located on the surface of the organoids (Fig 5C). We also labelled organoids for NESTIN (a neuronal cell marker) and SOX2 (expressed by neuronal progenitor cells (NPCs). In all of the organoids, neural epithelial rosettes were present, consisting mostly of SOX2+ NPCs (Supp Fig 3B); these structures indicate favorable organoid growth as they demonstrate proper lineage progression leading to forebrain region identity (27) Importantly, organoids to which we did not add iMacs did not contain any IBA-1+ cells (Supp Fig 3C); this was as expected from our previous work (18), but was in contrast to previous studies that reported innately-derived microglia in mesodermal-lineage-containing cerebral organoids (27, 28).
Next, we characterized the different cell populations within organoids after 23 days of coculture and compared iMacs before and after co-culture. After organoid dissociation, cells were labelled with antibodies to differentiate neurons (CD45-/CD184-/CD44-/CD15lo/CD24+), NPCs (CD45-/CD184+/CD271-/CD44-/CD24+) and iMacs (CD45+) before undergoing sorting (Fig 5D) followed by bulk-RNA sequencing. During the course of the work, sufficient iMicro numbers for downstream analysis were only generated from coculture with mutant iMacs for HD1 and isogenic iMacs for HD2 respectively. Compared to Day 31 non-co-cultured iMacs, HD1 iMacs after co-culture had profoundly altered their gene expression (Fig 5E), with the upregulated DEGs showing an increase in various pathways that are characteristic of microglial functions in the brain such as central nervous system and brain development (CNTN1, ZIC2, EFNA2, GLI3), synapse organization, synapse and neuron organization and development (SLC1A1, DGKB, TRIM67), as well as neurogenesis (CHD11, ADCYAP1) (Fig 5F-G).
Likewise, for HD2 iMacs, PCA also suggested that their patterns of gene expression were markedly different between cocultured and non-cocultured populations (Fig 5H), while GO analysis of the upregulated DEGs revealed an increase in various pathways linked with typical microglial functions in the brain such as glial cell differentiation and gliogenesis (CLU, MDK, CXCR4, RELN, TMEM98, TUBA1A), axonal development (UCHL1, MAP1B, CRABP2, TUBB2B, LGI1) as well as forebrain development (TUBB2B, MDK, CXCR4, RELN, LHX2) (Fig 5I-J). This shows that iMacs undergoing coculture with forebrain organoids have differentiated to a certain extent, into microglia-like cells.
Co-culture results in impaired regulation of neurons within organoids
Microglia not only act as sentinel cells, but are also important contributors to neuroplasticity and neurogenesis in the developing brain that ultimately help shape the brain circuitry (29). Part of this role requires microglia to regulate the population of NPCs and neurons during the unrestrained, highly proliferative phase of early brain development (30, 31); therefore, we next asked whether the microglia-like cells from our iMac-forebrain organoids were also capable of regulating neurogenesis in vitro.
As such, we sought to compare the size of the organoids, as well as the individual major cell population in each organoid, for both variants between isogenic organoids that did not undergo co-culture, and those that underwent 23 days of co-culture by comparing their area before and after co-culture. Co-culture of HD1 saw a slight reduction in the organoid size among both co-culture parameters before and after co-culture. However, comparison of the organoid size on coculture Day 23 only, saw the isogenic control parameter as the only group that had a reduction in organoid size when compared to the organoid-only control (Fig 6A). On the contrary, HD2 displayed no significance in organoid size reduction even after co-culture (Fig 6B).
Subsequently, these co-cultured organoids were dissociated, stained, sorted and quantified for the respective cell populations. Co-culture of IsoHD1 organoid with IsoHD1 iMac saw a significant reduction in the neuronal population when compared to control organoids that did not underwent co-culture. Conversely, coculture with mutant HD1 iMac saw a smaller degree of neurons reduction but was not significant (Fig 6C). Next, co-culture of IsoHD2 organoid with IsoHD2 iMac saw a slight reduction in neuronal population that was not statistically significant, while the co-culture with mutant HD2 iMac saw no difference when compared with control organoids (Fig 6D). Interestingly, we did not detect any change in the NPC population for either HD1 or HD2 after co-culture, likely because their numbers were relatively low to begin with due to the cellular composition of the forebrain organoid. Similarly, the iMac population was also small in all co-cultures. Transcriptomic analysis of the neurons of HD2 co-culture saw the mutant iMac co-culture having upregulated expression of genes associated with mitochondrial respiration (BCS1L, MRPL18, TSFM, MRPL11, MRPS30) but this phenomenon was not present in the isogenic iMac co-culture (Fig 6E). Conversely, transcriptomic analysis of the NPCs of HD2 co-culture saw the isogenic iMac co-culture having upregulated expression of genes associated with mitochondrial respiration (Fig 6F). Taken together, our model suggests that HDLS mutation affects neuronal population in a microglia-dependent manner and that this phenomenon is variable and mutation-dependent.
Discussion
HDLS is an incurable neurodegenerative disease that begins in adulthood, progresses rapidly and has a grim prognosis. Efforts to elucidate the functional or dysfunctional aspects of the causative mutations in the CSF-1R gene have been hampered by the lack of an accurate disease model that recapitulates the human pathology: although rodent and zebrafish models have been generated and imparted valuable insights towards HDLS (13–16), discrepancies and limitations in each case have led to incomplete recapitulation of the disease’s pathology, specifically in microglia numbers within brain regions and the effects on respective cognitive and sensorimotor tests. Additionally, a model looking into immune-neuronal crosstalk to better understand a neurodegenerative disorder that is primarily associated with microgliopathy, is important to advance the field. Here, we first generated iPSC lines from two patients with HDLS and then used CRISPR/Cas9 technology to reinstate a fully functional CSF-1R gene into some of the lines. While the generation of an HDLS donor-derived iPSC cell line has been reported (32), no other in vitro studies have yet reverted the causative mutation to wild type; a necessary step to understanding the direct impacts of diminished/absent CSF-1R signaling.
We then generated and characterized iMacs - precursors of microglia - from these lines, which exhibited typical morphology, phenotype and phagocytic capacity that were not obviously affected by CSF-1R mutation. Although we were able to generate phenotypically and functionally similar iMac across these lines for example for phagocytic capability, iMac yield varied greatly between the cell lines with a 50% lower yield for Mut HD1 compared to IsoHD1 and, conversely, a higher yield for Mut HD2 200% compared to IsoHD2. This fundamental difference could be attributed to their respective mutations: the nonsense mutation identified in HD2 could not only more profoundly affect receptor signaling, but might also be a major factor during the course of gene editing leading to incomplete reversion to wild type at the epigenetic level, which we speculate was not the case for IsoHD1. Additionally, this observation could also be attributable to a reduced CSF-1 sensitivity in HD2 Mut iMacs as compared to HD1 Mut iMacs and we speculate that this would potentially give rise to the generation and subsequent maintenance of immature iMacs that lacks maturation even after terminally differentiated into tissue-resident macrophages.
Functionally, while phagocytosis of E.Coli beads was similar across lines, the baseline cytokine production as well as after phagocytosis of apoptotic neuronal cell line was different with an increase of IL-1β secretion in both mutant HD1 and HD2, compared to isogenic HD1 and HD2 iMacs. In the case of phagocytosis of apoptotic cells, this was not due to a difference in phagocytic activity as all cells were able to phagocytose apoptotic cells at a similar level. Importantly, higher levels of baseline pro-and anti-inflammatory cytokine production in the control group without apoptotic cells were observed within HD1 mutant, and both HD1 and HD2 mutant iMacs respectively. This suggest that mutant iMacs are innately in a more reactive or activated state when compared to isogenic iMacs and could reflect the reactive phenotype of HDLS-associated microglia and macrophage identified in vivo (10, 12). Conversely, isogenic iMacs seems to adopt less of the reactive phenotype with the reverted mutation as identified with an overall lesser cytokine production level. Importantly, such reactive phenotype was also highlighted by our transcriptomic and metabolic profiling with upregulated pathways involving pro-inflammatory cytokines and preferential utilization of the glycolytic pathways in the mutant groups, a feature of macrophage activation (33, 34), respectively.
We subsequently incorporated donor-specific and their isogenic controls into a co-culture system using 3D forebrain organoids and iPSC-derived macrophages to better study HDLS. Isogenic and mutant iMacs co-cultured separately with their respective isogenic forebrain organoid differentiate into microglia-like cells with 23 days of coculture as shown by the expression of the microglial marker IBA-1, their ramified morphology as well as their transcriptomic profiles with up-regulation of genes associated with biological pathways that are typical of microglia functions such as neurodevelopment, neurodifferentiation, neurogenesis and brain development.
Subsequently, we analyzed the size of the organoids before and after co-culture as we recently showed that addition of iMac modulated NPC differentiation, limiting their proliferation and promoting axonogenesis, resulting in a reduction of co-culture organoid size (18). Here, while we noticed a significant decreased in the size of isogenic HD1 forebrains co-cultured with isogenic HD1 iMac compared to isogenic HD1 organoids, we did not measure any significant change in organoid size in the isogenic HD1 organoids co-cultured with mutant HD1 iMacs. This suggested that the crosstalk between iMicro and NPC is dysregulated in the context of the HD1 mutation. Since we showed that such size reduction is mediated by cholesterol transfer from iMicro to NPC, further work will be required to characterize cholesterol metabolism of HD iMac.
While we did not observe major changes in cell type composition in these cocultures, transcriptomic analysis of neuronal and NPC population after co-culture showed an increase in mitochondrial respiratory pathways associated genes in the mutant HD2 iMac co-culture neuron and isogenic HD2 iMac co-culture NPCs population respectively. This suggests increased metabolic rates in these respective populations that are contributed to by the different variants of iMac during co-culture, and show that mutated iMicro can change the states of non-mutated isogenic organoid cells. A parallel process in vivo would likely have profound long-term consequences for brain development and homeostasis.
Altogether, we propose that CSF-1R mutation in HDLS may cause subtle yet impactful disruptions to microglia homeostasis due to abnormal metabolic functions in the developing fetal brain, that subsequently compound and result in aberrant microglia functions during adulthood. This could also be mediated by upregulated pro-inflammatory cytokine production such as IL-1β at a basal level or upon clearing of cellular debris during development and adulthood homeostasis. IL-1β is of particular interest as numerous studies reported the role of IL-1β in neuroinflammation and neurodegeneration especially within the field of Alzheimer’s disease: for example, postmortem brain sample analysis revealed elevated levels of Il-1β production, including around amyloid beta plaques; all suggestive of pathology-associated inflammation (35–37). Hence, we speculate that in CSF-1R+/- mutant microglia, which already have a predisposition towards increased secretion of IL-1β, are constantly being activated by IL-1β, either autocrine or paracrine, creating a dysfunctional neuro-environment that contributes to HDLS pathology. As such, experimental models looking to block or reduce IL-1β levels in the brain using the human mAb, canakinumab, targeting the proinflammatory cytokine IL-1β (38, 39), during both health and disease could be a potential target for therapy and may help to ameliorate HDLS pathology.
While no model perfectly recapitulates the full complexity of a disease, the application of iPSC-derived organoid co-culture approaches to primary patient-derived cells offers a valuable way to study the disease mechanisms of this rare pathology using human cells. Future studies employing microglia-sufficient patient-derived brain organoids have the potential to shed much-needed light into the pathogenesis of HDLS and other neurodegenerative diseases.
Materials and methods
Preparation of human dermal fibroblasts from donor biopsies
Samples from patients with HDLS were collected via skin punch and placed in biopsy medium [Gibco DMEM Glutamax supplemented with 1% 100x Antibiotics/Antimycotics (Gibco AB/AM) and 10% Fetal Bovine Serum (Gibco, FBS)] for transport to the laboratory. Immediately on arrival, biopsies were placed in 75% ethanol for 30 sec then washed three times with DMEM Glutamax supplemented with 1% AB/AM; attached adipose tissue was removed using sterile scissors before biopsies were cut into small 1mm2 cubes and placed dermis-side down onto a 6-well plate then left to dry slightly for 20 min to facilitate adhesion. Biopsy culture medium was then added and plates incubated overnight at 37°C, 5% carbon dioxide in air; 48 hrs later, the medium was changed then biopsies cultured for a further 10-14 days during which fibroblast outgrowth was observed. At around 90% confluency, fibroblasts were detached from the plates using 0.05% Trypsin/EDTA and passaged. Biopsies were re-plated up to three times for further fibroblast propagation.
Reprogramming of human dermal fibroblasts into induced pluripotent stem cells
Individual donor’s fibroblasts were reprogrammed into induced pluripotent stem cells (iPSC) using the Epi5 Episomal reprogramming kit (Invitrogen), and the Human dermal fibroblast nucleofector kit (Lonza) on a Lonza Nucleofector 2B device. Briefly, fibroblast cultures at approximately 90% confluency were detached from their plates using 0.025% Trypsin/EDTA then collected by centrifugation at 350 g for 5 min at room temperature. Cell pellets were resuspended in 100 µl of nucleofector solution at room temperature then counted: 200,000 cells were used per transfection with 1 µl of each of the episomal vectors, using program U-023. Transfected cells were subsequently plated onto Matrigel-coated (Stemcell) 6-well plates with 2 ml of pre-warmed fibroblast medium (DMEM supplemented with 10% FBS & 1% AB/AM) and incubated for two days. The medium was then replaced with 2 ml of TeSR-E7 medium, which was changed every two days for 25-35 days until early iPSC clones emerged.
Isolating iPSC colonies
Between days 25 and 35, colonies resembling human embryonic stem cell colonies emerged, were collected using a sterile needle under a stereomicroscope, mechanically fragmented, and added to 24-well plates pre-coated with Matrigel and containing 500 µl of mTeSR-1. The colonies were cultured for 24 hr then underwent medium change with fresh mTeSR-1 for 7-10 days until 80% confluent.
Culture and maintenance of iPSC cell lines
To passage, 500 ul of ReleSR were added into each well and incubated in 37°C for 3 min before tapping the plate firmly on all sides to dislodge the iPSC colonies. Subsequently, the iPSC fragments were transferred into 12-well plates and again cultured until approximately 80% confluent, before passaging into 6-well plates, all while maintaining in mTeSR-1 with daily medium change. Mature iPSC colonies were identified by their characteristic phenotype: clear distinct borders, high nuclei-to-cytoplasm ratio, and raised, refractive, three-dimensional-like colonies.
Characterization of induced pluripotent stem cell colonies
Characterization of iPSC colonies was achieved using the PSC 4-Marker Immunocytochemistry Kit (Gibco). Briefly, spent mTeSR-1 medium was aspirated from the cells before adding 200 µl of fixative solution per well and incubating for 15 min at room temperature, which was then replaced by 200 µl of permeabilization solution for 15 min, then by 200 µl of blocking solution for 30 min. Subsequently, 2 µl of antibodies recognizing SSEA4 and OCT4 were added directly to the blocking solution and incubated for three hrs before washing three times with wash buffer (1x DPBS). Secondary antibodies were added at 0.8 µl per well and incubated for one hr at room temperature before washing three more times. During the last wash, one drop of NucBlue Fixed Cell Stain (DAPI) was added into the wash buffer and incubated for 5 min. Cells were either imaged immediately or stored at 4°C in the dark, for up to one month before analysis.
Karyotyping iPSC colonies
Mature iPSC colonies were pre-treated with 0.1 µg/ml of colcemid for 3 hr in the incubator before dissociation into single cells for imaging. Subsequently, cells were fixed with 4% PFA and sent for karyotype analysis at Zhen He Biotech, Shanghai.
Microscopy
Cell morphology observations were regularly performed using an Olympus CKX41 inverted microscope. Bright field and phase contrast images were taken using a Nikon Eclipse TS2 inverted microscope equipped with a Digital Sight camera. Images were processed using the proprietary software ImageView.
Differentiation of iPSC into primitive-like macrophages (iMacs)
Patient-derived iMacs were generated as previously described (1). Briefly, iPSCs were cultured in Stempro34 medium, supplemented with L-glutamine (100x) , ascorbic acid (5mg/ml), 1-Thioglycerol (26ul/2ml), Transferrin (200x) and Pen/Strep (1%), with the addition of CHIR99021 (2 µM), VEGF (50 ng/mL) and BMP4 (5 ng/mL) from days 0-2 to induce mesodermal lineage commitment; hemangioblast-like cell formation was then induced by culture in the presence of BMP4 (5 ng/mL), VEGF (50 ng/mL) and bFGF (20 ng/mL) on day 2 and only VEGF (15 ng/mL) and bFGF (5 ng/mL) on day four. From day 6-10, hemangioblasts were further committed to the generation of hematopoietic cells by the addition of DKK-1 (30 ng/mL), VEGF (10 ng/mL), bFGF (10 ng/mL), IL-6 (10 ng/mL), IL-3 (20 ng/mL) and SCF (50 ng/mL). To further promote the maturation of hematopoietic cells and CSF-1R expression, on days 12 and 14, medium was supplemented with SCF (50 ng/ml), bFGF (10 ng/ml), IL-6 (10 ng/ml) and IL-3 (20 ng/ml). From day 16 to day 31, the medium was switched to SF-Diff consisting of IMDM (75%) and F12 (25%) with the addition of N2 (100x), B27 (50x), 0.05% BSA, 1% Pen/Strep, supplemented with 50 ng/ml of CSF-1 to terminally differentiate the primitive cells to iMacs. Full medium changes were carried out every two days from days 0-14 and every three days from days 16-31. Free-floating cells were observed from as early as day six of culture and were collected and re-seeded back into individual wells during medium changes. Additionally, iMacs were initially cultured in a hypoxia incubator (5% O2, 5% CO2) from day 0–8 before moving into a normoxic incubator until day 31, when the cells were used for experiments. iMac identity was confirmed by flow cytometry with labeling for the macrophage markers CD45 and CD14.
Generation of forebrain organoids
Forebrain organoid generation was adapted from Qian et al., (2), which described a guided differentiation method that requires various cytokines and growth factors to be added at different differentiation stages, as follows.
Stage 1 (days 0-4: embryoid body formation)
iPSC on 6-well plate at approximately 80% confluency were dissociated into single cells using Accutase (Stemcell) before counting and seeding at 50,000 cells per well into an ultra-low attachment (ULA) 96-well plate with 150 µl of forebrain first medium (F1M: DMEM/F12, 20% KOSR, 1x GlutaMax, 1x MEM-NEAA, 1x 2-Mercaptoethanol, Pen/strep, Dorsomorphine 2 µM, A-83 2 µM) and 20 µM of ROCK Inhibitor (Stemcell). Plates were incubated at 37°C and 5% CO2 for 24 hrs (day -1). On day zero, medium was refreshed with the addition of 2 uM Dorsomorphin (Sigma) and 2 uM A83-01 (Sigma). Half medium changes were then performed on days two and four with the exclusion of ROCK inhibitor: small embryoid bodies (EB) were observed at this point.
Stage 2 (days 5–13: neuro-ectodermal induction)
On day five, one EB was transferred into each well of a ULA 24-well plate with 500 µl of Forebrain second medium (F2M: DMEM/F12, 1x N2 supplement, 1x GlutaMax, 1x MEM-NEAA, Pen/Strep, CHIR-99021 1 µM, SB-431542 1 µM). On day seven, healthy EB displaying a smooth and round surface were embedded individually into 20 µl of Matrigel, according to the method of Lancaster et al., (3). Once the Matrigel had fully polymerized, eight embedded EBs were transferred into a 10 cm petri dish with 10 ml of F2M before incubating at 37°C with half medium changes every two days until day 13. At this point, cluster(s) of neuroepithelium buds were present in individual organoids, evident as neural tube-like structure without extending cell processes.
Stage 3 (days 14–31: maturation)
On day 14, Matrigel-embedded organoids were collected and replated, with the attached Matrigel removed by repeated pipetting, before being transferred into a clean 10 cm petri dish with eight ml of Forebrain third medium (F3M: DMEM/F12, 1x N2 supplement, 1x B27 supplement, 1x GlutaMax, 1x MEM-NEAA, 1x 2-Mercaptoethanol, Pen/Strep, Insulin 2.5 ug/ml). Dishes were incubated at 37°C on an orbital shaker at 80 rpm, with half F3M changes every three days until organoids were used for analysis/experiments.
Generation of isogenic clones using CRISPR/CAS9
sgRNAs were designed using the CRISPR design tool www.crispor.tefor.net and selected based on highest efficiencies as well as off-target scores and synthesized by GENESCRIPT with scaffold. ssDNA template was designed with 40bp of homologous nucleotides flanking both arms of the point of mutation, inclusive of silent mutations on, and adjacent to, the PAM region, and synthesized by Sangor Shanghai. Genome editing via homology-directed repair from the CRISPR/Cas9 system in combination with a ssDNA was used to guide the single nucleotide correction of the HDLS point mutation, according to donor’s Sanger sequencing reports on Exon 15 (Donor #2) and 18 (Donor #1) of CSF-1R by homologous recombination.
The ribonucleoprotein (RNP) complex consisting of Cas9 protein and sgRNA was assembled using the Trucut V2 (Invitrogen) and Amaxa Human Stell Cell Nucleofector Starter Kit (VPH-5002). The RNP complex was subsequently transfected into dissociated iPSCs by electroporation with Lonza Nucleofector 2B using the Amaxa Human Stem Cell Nucleofector Starter Kit (Lonza) according to manufacturer’s manual. After electroporation, the cells were immediately plated onto Matrigel-coated 6-well plates containing mTeSR1 medium supplemented with 10 µM ROCK inhibitor (Stemcell) and CloneR (Stemcell) at various seeding densities to facilitate the harvesting of clones. After 48 hrs, medium was refreshed with the removal of ROCK inhibitor; subsequently, medium was refreshed daily with the removal of both ROCK inhibitor and CloneR until clones were mature enough for manual picking. Individual clones were manually harvested and plated onto Matrigel-coated 24-well plates with mTesr-1 medium and 10 µM of ROCK inhibitor.
GuideRNA and ssDNA template used for targeting HDLS#1
gRNA = TGGTCATGTGGCCAAGACTG
ssDNA= GCGCGTAACGTGCTGTTGACCAATGGTCATGTAGCTAAAATCGGGGACT TCGGGCTGGCTAGGGACATCATGAATGACTC
(Green nucleotide denotes a silent mutation)
GuideRNA and ssDNA template used for targeting HDLS#2
gRNA = GCTCAACTTTCTGTGAAGGA
ssDNA= CACGGAGTACTGTTGCTATGGCGACCTGCTCAATTTCCTTCGAAGAAAA GCTGAAGCCATGCTGGGACCCAGCCTGAGCC (Green nucleotide denotes a silent mutation)
Clones were screened for SNP editing using the ICE SYNTHEGO tool (https://ice.synthego.com) and off-target events (OTE) screened for using CRISP-ID software (http://crispid.gbiomed.kuleuven.be).
Co-culture of forebrain organoids and iMacs to generate iMicroglia
Co-culturing iMacs (primitive macrophages) with organoids enables the iMacs to be in a neurogenic niche environment where they would subsequently differentiate into iPSC-derived microglia (iMicro). Thirty thousand day 31 iMacs (mutant or Isogenic controls) were resuspended in F3M before adding onto their isogenic organoid in each well of an ULA 96-well plate. Cocultures were incubated for seven days with daily half F3M change supplemented with CSF-1 (100 ng/ml). On day eight, each organoid was transferred to an individual well of a ULA 24-well plate and supplemented with 1 ml of F3M and CSF-1 (100 ng/ml); half F3M change was performed every three days until analysis.
Clearing of forebrain organoids for 3D-imaging
Organoids were first fixed in 4% paraformaldehyde for 30 min at room temperature followed by washing twice in PBS then incubating in PBS overnight at 4°C. The next day, PBS was replaced with a permeabilization buffer (2% Triton X-100 in PBS solution) and organoids were incubated on an orbital shaker at room temperature for 72 hrs. At the end of permeabilization, organoids were incubated in blocking buffer (5% normal donkey serum, 5% normal goat serum, 1% Fetal Bovine Serum, 1% Triton X-100 in PBS solution) at 4°C overnight. Organoids were then incubated with primary antibodies at 1:200 in antibody dilution buffer (1% bovine serum albumin, 0.2% Triton X-100 in PBS solution) at 4°C for 72 hrs. Primary antibodies specific for the following markers were used: NESTIN (MERCK ), SOX2 (Abcam), and IBA-1 (Abcam). Organoids were washed in washing buffer (1x PBS solution) on an orbital shaker at room temperature for one hr before being kept in 1x PBS solution at 4°C overnight. The organoids were subsequently incubated with the following secondary antibodies at 1:200 in antibody dilution buffer, at 4°C for 48 hrs: goat anti-mouse Alexa Fluor 488 (Biolegend), goat anti-rabbit Alexa Fluor 594 (Abcam), and donkey anti-goat Alexa Fluor 647 (Abcam). The organoids were then washed with wash buffer for one hr on an orbital shaker at room temperature then kept in PBS at 4°C overnight before counterstaining with the nuclear marker DAPI on an orbital shaker at room temperature for two hrs. Organoids were then washed twice in washing buffer on an orbital shaker at room temperature for one hr, then again kept overnight at 4°C in 1x PBS. The following day, organoids were transferred individually to confocal-imaging-compatible glass-bottomed containers and 20 µl of RapiClear (SUNJin Lab) solution was added onto each organoid and left until they were cleared (usually 24 hrs depending on the size of the organoid). Whole organoids were imaged using a FV3000 confocal microscope with 20× objective lens (Olympus, Japan) and analyzed using iMaris software (BITPLANE).
Measurement of area of organoid
Area of organoids were measured using ImageJ software. Briefly, the “freehand selection” tool was used to trace the circumference of each individual organoid. The average of three measurements was used as the final readout.
Dissociation of forebrain organoids
Organoids were collected individually using 200 µl pipette with a cut pipette tip and incubated in 500 µl of Accutase at 37°C with gentle pipetting after 10 min, then allowed to fully dissociate for another 5-15 min at 37°C as needed. After again pipetting, cells were suspended in 1 ml of MACS buffer and collected by centrifugation at 350 g at RT for 5 min. Cells were then used in experiments.
Flow cytometry
Cells were prepared for labeling by first washing in FACS buffer, then resuspending cells in 70 µl of Fc-block (1:200) and incubating for 20 min at 4°C. Subsequently, the primary antibody cocktails were added into the cells at a 1:200 dilution before being vortexed and incubated for 30 min at 4°C. For samples that required secondary antibody labeling, after incubation with primary antibodies the cells were washed with FACS buffer before secondary antibodies (1:500) were added and incubated for 25 min at 4°C. After a further wash in FACS buffer, DAPI was added then cells were analysed using the BD Symphony X-50.
Cell sorting of cocultured organoids
Cells were isolated into sorting solution (SMART-Seq HT kit. 10X lysis buffer, RNase inhibitor, 3’ SMART-Seq CDS Primer II A, nuclease-free water) using the BD Aria III cell sorter. After sorting, cell-containing tubes were briefly spun down and immediately placed in liquid nitrogen for snap freezing. Lysates were stored at -80°C.
RNA extraction of samples
RNA extraction was performed using Trizol according to the manufacturer’s instructions. Briefly, 500 µl of Trizol was added to each sample before the addition of 100 µl of chlorofoam to each sample and mixed thrice (15 sec per succession) before incubating at room temperature for 5 min. Samples were then centrifuged at 20,000g, 20 min, 4°C before the organic solvent was transferred into new eppendorf tubes. One µl of GlycoBlue co-precipitate (Invitrogen) was added to each sample and mixed well before the addition of 250 µl of isoproponol. Samples were mixed well before incubating at -80°C for at least one hr. Thawed samples were subsequently centrifuged at 12,000g, 4°C for 15 min before decanting supernatant, washing again with ice-cold 75% ethanol and centrifuging at 7500g, 4°C for 5 min. Samples were left to air dry for approximately 5 min after decanting of supernatant, before the RNA pellet was resuspended in 10 µl of DPEC water and stored at -80°C.
cDNA library construction for RNA-sequencing
RNA samples from the previous step were first converted to complementary DNA (cDNA) using the Takara HT kit according to the manufacturer’s instruction. Briefly, 5 µl of purified total RNA was added to 1 µl of 10X reaction buffer consisting of 10X lysis buffer and RNase inhibitor; 1 µl of 3’ SMART-seq primer II A was added and mixed well by vortexing before incubating the samples at 72°C for 3 min. Samples were then immediately placed on ice for 2 min. A one-step master mix consisting of 0.7 µl of nuclease-free water, 8 µl of one-step buffer, 1 µl of SMART-Seq HT oligonucletide, 0.5 µl RNase inhibitor, 0.3 µl SeqAmp DNA polymerase, and 2 µl of SMARTscribe reverse transcriptase was subsequently added to each sample and mixed well. The following program was used to run the PCR protocol:
The resulting cDNA product was purified using the Vazyme VAHTS DNA Clean beads. Briefly, 20 µl of beads were added to each cDNA product, mixed well and incubated for 5 min at RT before placing samples on a magnectic stand for 2 min. The supernatant was discarded and cDNA was washed twice with cold 80% ethanol before being air-dried for 3 min. Purified cDNA was subsequently eluted from the magnetic beads with 15 µl of DPEC water. The concentration of cDNA was measured with the Qubit dsDNA HS Assay Kit (Invitrogen) using the Qubit 4 fluorometer.
cDNA library construction was performed using the Vazyme TruePrep DNA library prep kit V2 for illumina according to the manufacturer’s instructions. Briefly, the purified cDNA obtained from the previous step was diluted to a final concentration of 1ng/µl with sterile water. Next, 7.5 µl of Mix A ( 2 µl 5x TTBL, 2.5 µl TTE Mix V5, 3 µl DPEC water) was added to 2.5 µl of diluted cDNA and run using the Nextera-1 program at 55°C for 10 min.
TSS was immediately added to each sample and left to incubate at RT for 5 min before 7.5 µl of Mix B (2 ul DPEC water, 5 µl 5x TAB, 0.5 µl TAE) was added to each sample. 2.5 µl of N5 and N7 primer was added and mixed well before running on the Nextera-2 program:
Subsequently, samples were purified using the vazyme beads and cDNA was eluted with 20 µl of DPEC water before measuring the concentration.
For pooling of cDNA libraries, 40 ng of each sample was added to a final volume of 40 µl, adjusted with DPEC water, and incubated with 22.6 µl of Vazyme clean beads at RT for 5 min before magnectic separation. The entire volumn of supernatant was transferred to a fresh PCR tube to which was added 6.4 µl of Vazyme clean beads. The contents were mixed well and incubated at RT for 5 min before separation: subsequently, the supernatant was discarded and bead-bound-cDNA was washed twice with 80% ethanol before being air dried for 3 min. Purified pooled cDNA samples were eluted with 20 µl of DPEC water and tested for concentration.
Bulk RNA Analysis
The clean paired-ends reads were aligned to the GRCh38.96 human genome reference using kallisto (version 0.46.1) with parameters “–bootstrap-samples=100”. The transcript-level estimated counts belonging to the same gene were then aggregated into the matrix of gene-level counts (TPM) implemented in the R package tximport (version 1.14.2).
Pairwise comparison across RNA-seq data was performed to get differentially expressed genes between each two types of cells, using the linear model and the empirical Bayes method implemented in R limma package (version 3.42.2), with significance thresholds for p-value<0.05 and log2(fold change)≥0.5 (Figure 3) or 1.5 (Figure 5). The differentially expressed genes identified with top log2(fold change) were selected to perform the PCA analysis in R using prcomp function. Additionally, the clusterProfiler package (version 4.10.0) was employed for pathway enrichment analysis via the compareCluster function and “enrichGO” method, targeting “ALL” GO ontologies.
Metabolic function using Seahorse analysis
The bioenergetic profile of iMacs was assessed by determining the oxygen consumption rate (OCR) and the extracellular acidification rate (ECAR) using an XF-96 Flux Analyzer (Seahorse Bioscience). Sensor cartridges (Agilent Technologies) were hydrated in XF Calibrant (Agilent Technologies) at 37°C overnight, devoid of carbon dioxide, following the manufacturer’s instructions. Cells were resuspended in either OCR XF base medium supplemented with 10 mM glucose, 2 mM L-glutamine and 1mM sodium pyruvate, or ECR XF base medium supplemented with 2 mM L-glutamine, before being seeded at 40,000 cells/50 µl/well into XF96 culture plates. Cells were pelleted by centrifugation at 200g for 1 min then resuspended in either 125 µl of OCR or ECR medium per well and incubated at 37°C in a CO2-free incubator for 45 min before loading into the Seahorse analyzer. Cells were sequentially treated with 25 µl injections of specific bioenergtic modulators that were added to the wells prior to loading, to test for different paramters of mitochondrial and glycolytic functions. ECR analysis was probed with 10 mM glucose to stimulate glycolysis, followed by the addition of 2μM oligomycin to block ATP synthase and 50 mM 2-deoxy-glucose (2DG) to shut down the function of glycolysis. Conversely, OCR analysis was probed with 2 μM oligomycin, 1 μM FCCP (carbonyl cyanide-4-(trifluoromethoxy) phenylhydrazone) to stimulate maximal mitochondrial oxygen consumption and 0.5 μM rotenone plus antimycin A to asses OXPHOX parameters from the OCR levels. Mitochondrial and glycolytic parameters were calculated as recommended by the instrument manufacturer (Agilent Technologies).
MTT Test
On the day before testing, 25,000 iMacs were seeded into each well of a 96-well flat-bottom plate. The next morning, 20 µl of MTT solvent (10% of total volume) was added to each well and incubated at 37°C for 3.5 hrs before being decanted. Next, 200 µl of MTT formazan solvent was added to each well before being placed onto a shaker for 15min in the dark, then incubated RT for an additional 30 min in the dark. Measurements were read by a spectrophotometer at OD570 and OD690.
Cytospin assay
iMacs were first trypsinzed using TryPLE express before being counted using the Countess II. Approximately 50,000 cells were resuspended in 150 µl of PBS before being transferred to a cytocentrifuge cytofunnel paired with a glass slide, and centrifuged for 5 min at 800rpm 200 g, air dried for 30 min before sealing with mounting medium. Images were acquired with an Olympus BX53 light microscope equipped with a 100x oil immersion objective lens.
Giemsa staining
Adequately air-dried slides were placed in a staining tray and flooded with 1ml per slide of Solution A of the Wright-Giemsa staining kit (BASO) for 1 min. Subsequently, 500 µl of Solution B was added to each slide and agitated for 5 min. Slides were then rinsed in distilled water for 5 min before being air-dried for 30 min then sealed in synthesis resin. Images were acquired with the Olympus BX53 light microscope paired with a 100X oil immersion objective lens.
Neuronal cell line SH-5YSY apoptosis induction
SH-5YSY cells were kindly provided by the lab of Xu Tien le from the Shanghai Institute of Immunology. SH-SY5Y cell monolayers in sterile PBS were exposed to UV-radiation for 30 min before collection of cells into serum-free medium (DMEM + 1% P/S) and incubation at 37°C overnight to induce apoptosis. The following day, cells were centrifuged at 350 g, RT for 3 min before staining with Annexin V (BD Pharmingen PE Annexin V apoptosis detection kit) for 20 min at RT in the dark, before being analyzed by flow cytometry.
Phagocytic assay with conjugated E. coli beads
First, pHrodo Red E. coli-conjugated bioparticles (Invitrogen) were reconstituted to a working concentration of 1 mg/ml with sterile water before adding to iMacs in complete medium at 1:10 final concentration. After incubation at 37°C for 45 min, cells were washed twice with PBS before collection for flow cytometry analysis.
RNA extraction and real-time quantitative PCR (qPCR)
Total RNA was extracted from each group with TRIzol Reagent (Invitrogen). The cDNA was obtained by using the PrimeScript RT Reagent Perfect Real Time kit (Takara, Japan). Briefly, 500 ng of RNA for each sample was amplified as a template, in 10 µl of reaction mixture (2 µl 5X PrimeScript buffer, 0.5 µl PrimeScript RT Enzyme Mix I, 0.5 µl Oligo dT Primer, 0.5 µl random 6-mers, RNA product, RNase-free water). This mixture was then incubated at 37°C for 15 min and subsequently at 85°C for 5 sec to obtain cDNA. qPCR was performed in a ViiA 7 Real-time PCR system (Applied Biosystems) with ChamQ SYBR® Color qPCR Master Mix Low ROX Premixed (Vazyme).
Statistical anslysis
Statistical tests were performed using GraphPad Prism 8.0.1 (GraphPad Software, La Jolla, CA, USA; www.graphpad.com). All experiments were performed in triplicate and data analysis was performed using unpaired Student’s t-tests. All data represent the mean ± standard error of mean (SEM). Statistical significance was assigned as: p < 0.05 was considered significant: *p < 0.05; **p < 0.01; ***p < 0.001. p > 0.05 was considered nonsignificant (n.s.).
|
|||||||
1850
|
dbpedia
|
3
| 15 |
https://www.medicalnewstoday.com/articles/319275
|
en
|
High HDL levels: Recommendations, balance, and tips
|
[
"https://i0.wp.com/post.medicalnewstoday.com/wp-content/uploads/sites/3/2019/12/StacySampson.png?w=105&h=105",
"https://i0.wp.com/post.medicalnewstoday.com/wp-content/uploads/sites/3/2017/09/GettyImages-200428479-001_header-1024x575.jpg?w=1155&h=1528",
"https://i0.wp.com/post.medicalnewstoday.com/wp-content/uploads/sites/3/2019/12/StacySampson.png?w=105&h=105",
"http://b.scorecardresearch.com/p?c1=2&c2=38584006&cv=3.9&cj=1&"
] |
[] |
[] |
[
""
] | null |
[
"Jennifer Berry"
] |
2017-09-06T13:00:00+00:00
|
Doctors advise people to limit their overall cholesterol but maximize levels of high-density lipoprotein (HDL) cholesterol. Why is this, and it is always the best way?
|
en
|
https://www.medicalnewstoday.com/articles/319275
|
Doctors recommend aiming for high levels of high-density lipoprotein (HDL), or “good” cholesterol. However, in some cases, a person may develop very high HDL cholestero levels that are not beneficial to their health.
The Centers for Disease Control and Prevention (CDC) notes that that high cholesterol increases a person’s risk of heart disease and stroke, adding that around 38% of Americans have high total cholesterol, with levels of 200 mg/dL or over.
However, cholesterol levels are more complicated than that, as different types have different impacts. High-density lipoprotein (HDL) cholesterol, often known as “good” cholesterol, helps remove “bad” low-density lipoprotein (LDL) cholesterol from the body. For this reason, doctors consider it beneficial. However, there is still more to discover, and researchers are still learning how HDL and other types of cholesterol work.
In this article, we look at whether or not HDL cholesterol can be too high. We also look at what healthy levels are, and what can happen to people if HDL falls out of this range.
There are two main types of cholesterol in the body, and only one is usually considered a risk to heart health.
LDL cholesterol contributes to the fatty buildup that can clog a person’s arteries. When this buildup clogs or narrows the arteries, a heart attack or stroke is more likely to occur. With LDL cholesterol, lower is better.
HDL cholesterol helps remove LDL cholesterol from the blood and transports it to the liver for processing and elimination. A higher HDL number is desirable because it usually signals a lower risk of heart disease.
Some experts also believe HDL may have anti-inflammatory, anticoagulant, antioxidant, and other properties that may offer additional protection from cardiovascular disease.
Lifestyle recommendations for managing cholesterol focus on balancing the types of cholesterol by increasing HDL levels and lowering LDL.
The CDC recommends aiming for HDL levels of 60 mg/dL or above. It is the only measure in the cholesterol test that has a lower rather than an upper limit. Total cholesterol should be below 200 mg/dL, and LDL levels should be less than 100 mg/dL.
Previous research suggests the higher the HDL levels, the more protection a person has from heart disease. However, new evidence is appearing that may challenge this. Some experts are now talking about a U-shaped relationship, in which both very low and very high HDL levels may be harmful.
Some scientists now believe that genetic, lifestyle, and environmental factors may affect the way HDL accumulates in the body and how it behaves, and that some of these effects could be harmful to some people. However, it is still unclear whether this happens and, if so, who it affects and why.
In 2010, some researchers found that people who had recently had a heart attack with high levels of both HDL and a substance called C-reactive protein were at higher risk of having another cardiac event. The liver produces C-reactive protein when inflammation occurs in the body.
Some experts believe that, in certain conditions, HDL particles may take on inflammatory properties rather than protecting a person from inflammation. The authors of a 2019 review note that the protective features of HDL depend not only on how much HDL is present but also on the way it behaves in the body.
A 2018 study with the same lead author suggested that functionality — how HDL works — could be even more significant than circulating HDL levels.
A 2016 research article discusses a rare genetic change that may cause exceptionally high HDL levels. It occurs in a molecule known as SR-BI. The change affects the way HDL works in the body, and it can lead to high levels of HDL and an increased risk of heart disease. The authors note that, in one study, some participants had levels of HDL greater than 95 mg/dL, which is unusual. Some participants with these high levels had this rare genetic feature.
Meanwhile, a 2017 review suggests that the balance of HDL and LDL may play a role. In one of two large studies reviewed, people with “extreme” high or low HDL levels had a higher risk of death than those who had more moderate levels. The authors proposed that optimal levels could be 73 mg/dL in males and 93 mg/dL in females.
While researchers continue to investigate this field, experts still recommend focusing on managing the known risks for cardiovascular disease, including reducing LDL levels.
The first step to healthy cholesterol levels is for people to take a test and discuss the results with a doctor, who will also consider their individual risk factors.
The CDC advises most adults to have a cholesterol test every 4–6 years but more often if they have diabetes, heart disease, or a family history of high cholesterol. The CDC also recommends testing for children at some time between the ages of 9 and 11 years and again at 17–21 years.
Cholesterol tests measure the amount of different cholesterols in mg/dL. Most tests show HDL, LDL, and total (serum) cholesterol. To find a total cholesterol score, a doctor will add together a person’s HDL and LDL cholesterol levels and 20% of their triglyceride level.
The CDC lists desirable levels as follows:
Total cholesterolBelow 200 mg/dLHDL “good” cholesterol60 mg/dL or aboveLDL “bad” cholesterol Below 100 mg/dLTriglyceridesBelow 150 mg/dL
However, various factors will affect what is healthy for each person. A doctor will work with the individual to make a plan for maintaining or establishing suitable levels.
Learn more here about cholesterol testing.
|
||||||
1850
|
dbpedia
|
2
| 59 |
https://uis.brage.unit.no/uis-xmlui/handle/11250/2999548
|
en
|
UiS Brage: Metabolic flux analysis of 3D spheroids reveals significant differences in glucose metabolism from matched 2D cultures of colorectal cancer and pancreatic ductal adenocarcinoma cell lines
|
[
"https://uis.brage.unit.no/uis-xmlui/bitstream/handle/11250/2999548/s40170-022-00285-w.pdf.jpg?sequence=6&isAllowed=y",
"https://uis.brage.unit.no/uis-xmlui/themes/Mirage2//images/creativecommons/cc-by.png",
"https://uis.brage.unit.no/uis-xmlui/themes/Mirage2/images/unit_product.png",
"https://uis.brage.unit.no/uis-xmlui/themes/Mirage2/images/unit_product.png"
] |
[] |
[] |
[
""
] | null |
[
"Hanne Røland",
"Tia R",
"Gro Vatne",
"Karl Johan"
] | null |
en
|
/uis-xmlui/themes/Mirage2/images/favicon.ico
| null | |||||||
1850
|
dbpedia
|
2
| 18 |
https://search.proquest.com/openview/234bfffae3168adf85b062b16b2f2d3c/1%3Fpq-origsite%3Dgscholar%26cbl%3D27321
|
en
|
Hereditary diffuse leukoencephalopathy with spheroids mimicking primary progressive aphasia: report of a Greek case
|
[
"https://search.proquest.com/assets/ctx/51be0a5b/images/icons/blank.gif",
"https://search.proquest.com/assets/ctx/51be0a5b/images/icons/blank.gif",
"https://search.proquest.com/assets/ctx/51be0a5b/images/icons/blank.gif",
"https://search.proquest.com/assets/ctx/51be0a5b/images/icons/blank.gif",
"https://search.proquest.com/assets/ctx/51be0a5b/images/icons/blank.gif",
"https://search.proquest.com/assets/ctx/51be0a5b/images/icons/blank.gif",
"https://search.proquest.com/assets/ctx/51be0a5b/images/icons/blank.gif",
"https://search.proquest.com/assets/ctx/51be0a5b/images/icons/blank.gif",
"https://search.proquest.com/assets/ctx/51be0a5b/images/icons/blank.gif",
"https://search.proquest.com/assets/ctx/51be0a5b/images/icons/blank.gif",
"https://search.proquest.com/assets/ctx/51be0a5b/images/icons/blank.gif",
"https://search.proquest.com/assets/ctx/51be0a5b/images/icons/blank.gif",
"https://search.proquest.com/assets/ctx/51be0a5b/images/icons/blank.gif",
"https://search.proquest.com/assets/ctx/51be0a5b/images/icons/blank.gif"
] |
[] |
[] |
[
""
] | null |
[] | null |
Explore millions of resources from scholarly journals, books, newspapers, videos and more, on the ProQuest Platform.
|
en
|
/apple-icon-57x57.png
| null |
This is a short preview of the document. Your library or institution may give you access to the complete full text for this document in ProQuest.
|
|||||
1850
|
dbpedia
|
0
| 6 |
https://rarediseases.org/gard-rare-disease/hereditary-diffuse-leukoencephalopathy-with-spheroids/
|
en
|
List of Rare Diseases
|
[
"https://cdn-ilacfll.nitrocdn.com/xKGwaXziVOzqqgOYUYgBBekRvlVxIOUi/assets/images/optimized/rev-310d706/rarediseases.org/wp-content/uploads/2024/05/NORD_Logo-with-tag_Wide_Print_RGB-01.png",
"https://cdn-ilacfll.nitrocdn.com/xKGwaXziVOzqqgOYUYgBBekRvlVxIOUi/assets/images/optimized/rev-310d706/rarediseases.org/wp-content/uploads/2022/06/Post-DBS-op-Me-eating-McDonalds-and-Loving-it-e1652280852247.jpg 554w, https://cdn-ilacfll.nitrocdn.com/xKGwaXziVOzqqgOYUYgBBekRvlVxIOUi/assets/images/optimized/rev-310d706/rarediseases.org/wp-content/uploads/2022/06/Post-DBS-op-Me-eating-McDonalds-and-Loving-it-e1652280852247-300x281.jpg 300w",
"https://cdn-ilacfll.nitrocdn.com/xKGwaXziVOzqqgOYUYgBBekRvlVxIOUi/assets/images/optimized/rev-310d706/rarediseases.org/wp-content/uploads/2024/05/NRD-2326-State-Resource-Center_Thumbnail-01-1.png",
"https://cdn-ilacfll.nitrocdn.com/xKGwaXziVOzqqgOYUYgBBekRvlVxIOUi/assets/images/optimized/rev-310d706/rarediseases.org/wp-content/uploads/2022/09/NORD_CommunitySupport_320x320.jpg 320w, https://cdn-ilacfll.nitrocdn.com/xKGwaXziVOzqqgOYUYgBBekRvlVxIOUi/assets/images/optimized/rev-310d706/rarediseases.org/wp-content/uploads/2022/09/NORD_CommunitySupport_320x320-300x300.jpg 300w, https://cdn-ilacfll.nitrocdn.com/xKGwaXziVOzqqgOYUYgBBekRvlVxIOUi/assets/images/optimized/rev-310d706/rarediseases.org/wp-content/uploads/2022/09/NORD_CommunitySupport_320x320-150x150.jpg 150w",
"https://cdn-ilacfll.nitrocdn.com/xKGwaXziVOzqqgOYUYgBBekRvlVxIOUi/assets/images/optimized/rev-310d706/rarediseases.org/wp-content/uploads/2023/04/nord-nav-policy-alert.jpg 2083w, https://cdn-ilacfll.nitrocdn.com/xKGwaXziVOzqqgOYUYgBBekRvlVxIOUi/assets/images/optimized/rev-310d706/rarediseases.org/wp-content/uploads/2023/04/nord-nav-policy-alert-300x300.jpg 300w, https://cdn-ilacfll.nitrocdn.com/xKGwaXziVOzqqgOYUYgBBekRvlVxIOUi/assets/images/optimized/rev-310d706/rarediseases.org/wp-content/uploads/2023/04/nord-nav-policy-alert-1024x1024.jpg 1024w, https://cdn-ilacfll.nitrocdn.com/xKGwaXziVOzqqgOYUYgBBekRvlVxIOUi/assets/images/optimized/rev-310d706/rarediseases.org/wp-content/uploads/2023/04/nord-nav-policy-alert-150x150.jpg 150w, https://cdn-ilacfll.nitrocdn.com/xKGwaXziVOzqqgOYUYgBBekRvlVxIOUi/assets/images/optimized/rev-310d706/rarediseases.org/wp-content/uploads/2023/04/nord-nav-policy-alert-768x768.jpg 768w, https://cdn-ilacfll.nitrocdn.com/xKGwaXziVOzqqgOYUYgBBekRvlVxIOUi/assets/images/optimized/rev-310d706/rarediseases.org/wp-content/uploads/2023/04/nord-nav-policy-alert-1536x1536.jpg 1536w, https://cdn-ilacfll.nitrocdn.com/xKGwaXziVOzqqgOYUYgBBekRvlVxIOUi/assets/images/optimized/rev-310d706/rarediseases.org/wp-content/uploads/2023/04/nord-nav-policy-alert-2048x2048.jpg 2048w",
"https://cdn-ilacfll.nitrocdn.com/xKGwaXziVOzqqgOYUYgBBekRvlVxIOUi/assets/images/optimized/rev-310d706/rarediseases.org/wp-content/uploads/2024/06/NRD-2331-Summit-Sidebar-Ad-01-1.png",
"https://cdn-ilacfll.nitrocdn.com/xKGwaXziVOzqqgOYUYgBBekRvlVxIOUi/assets/images/optimized/rev-310d706/rarediseases.org/wp-content/uploads/2024/05/NRD-2326-State-Resource-Center_Sidebar-01.png",
"https://cdn-ilacfll.nitrocdn.com/xKGwaXziVOzqqgOYUYgBBekRvlVxIOUi/assets/images/optimized/rev-310d706/rarediseases.org/wp-content/uploads/2022/08/NORD_RL_Caregiver2_1024x384.jpg 1024w, https://cdn-ilacfll.nitrocdn.com/xKGwaXziVOzqqgOYUYgBBekRvlVxIOUi/assets/images/optimized/rev-310d706/rarediseases.org/wp-content/uploads/2022/08/NORD_RL_Caregiver2_1024x384-300x113.jpg 300w, https://cdn-ilacfll.nitrocdn.com/xKGwaXziVOzqqgOYUYgBBekRvlVxIOUi/assets/images/optimized/rev-310d706/rarediseases.org/wp-content/uploads/2022/08/NORD_RL_Caregiver2_1024x384-768x288.jpg 768w",
"https://cdn-ilacfll.nitrocdn.com/xKGwaXziVOzqqgOYUYgBBekRvlVxIOUi/assets/images/optimized/rev-310d706/rarediseases.org/wp-content/uploads/2024/05/NORD_Logo_Stacked_Print_RGB-with-tag-WHITE-ORANGE-01-860x1024.png",
"https://cdn-ilacfll.nitrocdn.com/xKGwaXziVOzqqgOYUYgBBekRvlVxIOUi/assets/images/optimized/rev-310d706/rarediseases.org/wp-content/uploads/2023/10/2023TRbadge-lg.png",
"https://cdn-ilacfll.nitrocdn.com/xKGwaXziVOzqqgOYUYgBBekRvlVxIOUi/assets/desktop/source/rev-310d706/widgets.guidestar.org/7ccc8f5c78e5bbd70335ee87e210a2c6.gximage2",
"https://cdn-ilacfll.nitrocdn.com/xKGwaXziVOzqqgOYUYgBBekRvlVxIOUi/assets/images/optimized/rev-310d706/rarediseases.org/wp-content/uploads/2019/11/4Star-125x125-2-web.jpg",
"https://cdn-ilacfll.nitrocdn.com/xKGwaXziVOzqqgOYUYgBBekRvlVxIOUi/assets/images/optimized/rev-310d706/rarediseases.org/wp-content/uploads/2024/07/NRD-2331-Summit_Pop-Up-Ad_Who-Should-Attend-1024x678.jpg 1024w, https://cdn-ilacfll.nitrocdn.com/xKGwaXziVOzqqgOYUYgBBekRvlVxIOUi/assets/images/optimized/rev-310d706/rarediseases.org/wp-content/uploads/2024/07/NRD-2331-Summit_Pop-Up-Ad_Who-Should-Attend-300x199.jpg 300w, https://cdn-ilacfll.nitrocdn.com/xKGwaXziVOzqqgOYUYgBBekRvlVxIOUi/assets/images/optimized/rev-310d706/rarediseases.org/wp-content/uploads/2024/07/NRD-2331-Summit_Pop-Up-Ad_Who-Should-Attend-768x508.jpg 768w, https://cdn-ilacfll.nitrocdn.com/xKGwaXziVOzqqgOYUYgBBekRvlVxIOUi/assets/images/optimized/rev-310d706/rarediseases.org/wp-content/uploads/2024/07/NRD-2331-Summit_Pop-Up-Ad_Who-Should-Attend.jpg 1458w"
] |
[] |
[] |
[
""
] | null |
[] | null |
Rare Diseases Archive - National Organization for Rare Disorders
|
en
|
National Organization for Rare Disorders
|
https://rarediseases.org/rare-diseases/
|
What Is the NORD Rare Disease Database?
The NORD Rare Disease Database has over 1,300 reports on rare disorders. These reports provide detailed information about symptoms, causes, diagnosis, treatments, clinical trials, and support resources, including patient advocacy organizations. Each report includes references from textbooks, articles, websites, and government agencies.
NORD also provides many reports in Spanish, and additional translations can be requested by contacting us at [email protected].
WHAT IS A RARE DISEASE?
A rare disorder is a condition that affects fewer than 200,000 Americans. There are over 10,000 rare diseases that together affect more than 30 million Americans. NORD is dedicated to the identification, treatment, and cure of these diseases through comprehensive education, advocacy, research, and service programs.
ADDITIONAL RESOURCES AND SUPPORT
While many rare conditions in our database have detailed reports, some do not have much detail yet. You can click on the disease name to find information about that condition from well-respected sources. Some of the information from these additional resources has technical language, so you may want to talk to your healthcare provider about it.
NEED MORE HELP?
|
|||||
1850
|
dbpedia
|
2
| 63 |
https://gup.ub.gu.se/publication/178804
|
en
|
[] |
[] |
[] |
[
""
] | null |
[] | null |
/img/favicon.ico
| null | |||||||||
1850
|
dbpedia
|
3
| 97 |
https://www.stanfordchildrens.org/en/topic/default%3Fid%3Dcholesterol-ldl-hdl-and-triglycerides-in-children-and-adolescents-90-P01593
|
en
|
Cholesterol, LDL, HDL, and Triglycerides in Children and Adolescents
|
[
"https://www.stanfordchildrens.org/content/dam/sch/site-assets/smch-logo-header.svg",
"https://www.stanfordchildrens.org/etc.clientlibs/sch/clientlibs/clientlib-site/resources/images/mychart-profile-icon.svg",
"https://images.stanfordchildrens.org/is/image/stanfordchildrens/16_Monterey_Brand_Images_003-(1)?qlt=85&ts=1706811121350&$TopTeaser_Desktop$&dpr=off",
"https://images.stanfordchildrens.org/is/image/stanfordchildrens/telomeres-1116x628-stanford-childrens?qlt=85&ts=1714062573820&$TopTeaser_Desktop$&dpr=off",
"https://images.stanfordchildrens.org/is/image/stanfordchildrens/welcome-guide-family-resources?qlt=85&ts=1706811224806&$TopTeaser_Desktop$&dpr=off",
"https://images.stanfordchildrens.org/is/image/stanfordchildrens/cpei-home-page1116x628?qlt=85&ts=1722275521240&$TopTeaser_Desktop$&dpr=off",
"https://images.stanfordchildrens.org/is/image/stanfordchildrens/App-Store-Badge?fmt=png-alpha",
"https://images.stanfordchildrens.org/is/image/stanfordchildrens/Google-Play-Badge?fmt=png-alpha",
"https://www.stanfordchildrens.org/content/experience-fragments/sch/us/en/site/footer/master/_jcr_content/root/footer/container1/image.coreimg.png/1712274234885/magnet-recognition-logo-stanford-childrens.png",
"https://images.stanfordchildrens.org/is/image/stanfordchildrens/us-news-1?qlt=85&ts=1712274266966&$Transparent_Image_Footer$&dpr=off"
] |
[] |
[] |
[
"cholesterol;low cholesterol diet;high cholesterol;lipoprotein;lower cholesterol;hdl cholesterol;ldl cholesterol;cholesterol medication;diet to lower cholesterol;cholesterol ratio;cholesterol and heart disease;cholesterol control;P01593"
] | null |
[] | null |
The cholesterol in blood comes from 2 sources: the foods your teen eats and their liver. The liver, however, makes all of the cholesterol your teen's body needs.
|
en
|
/etc.clientlibs/sch/clientlibs/clientlib-site/resources/images/favicon.ico
| null |
Cholesterol, LDL, HDL, and Triglycerides in Children and Teens
What is cholesterol?
Cholesterol is a fat-like, waxy substance. It can be found in all parts of your child's body. It helps make cell membranes, some hormones, and vitamin D. The cholesterol in blood comes from 2 sources. The first source is from the foods your child eats. The second source is from their liver. Your child's liver can make all of the cholesterol they need.
Cholesterol and other fats are carried through the blood. They are in the form of round blobs called lipoproteins. There are 2 main types of lipoproteins. One type is low-density lipoproteins (LDL). The other type is high-density lipoproteins (HDL).
What is LDL cholesterol?
What is HDL cholesterol?
What are triglycerides?
Triglycerides are another type of fat found in the blood. Most of your teen's body fat is in the form of triglycerides.
High levels of triglycerides are linked with a higher risk of heart disease.
High triglyceride levels may be caused by any of these:
Diabetes
Hypothyroidism
Kidney disease
Liver disease
Gene that causes high triglyceride levels in families (familial hypertriglyceridemia)
Obesity
Some medicines
Eating a lot of high-fat or sugary foods
Drinking a lot of alcohol
Should my child have a blood lipid test?
A lipid screening is a test to look at the levels of the fats in the blood. In the past, healthcare providers felt that children and teens were not at risk for high cholesterol levels. But we now know that children and teens are at risk. This is due to things such as:
Being inactive from too much screen time and not enough exercise
High-fat or high-sugar diets
Obesity
Family history of high cholesterol levels
Children and teens with high cholesterol are at higher risk for heart disease when they become adults. Keeping blood cholesterol levels in the normal range reduces this risk.
Lipid testing by age
Your child may need to fast before the blood test. This depends on the type of lipid test done. Fasting means your child should not eat food or drink anything but water before the test.
Under age 2. Lipid testing is not advised.
Ages 2 to 8. Testing is advised if your child has other risk factors for heart disease. These include diabetes, high blood pressure, obesity, exposure to cigarette smoke, or a family history of these. Other risk factors include family history of early coronary artery disease or lipid disorder, kidney disease, or other chronic inflammatory diseases.
Ages 9 to 11. Testing is advised. This can be done with either a fasting or non-fasting lipid profile.
Ages 12 to 16. Testing is not advised. This is because of changing lipid levels during puberty. But testing is advised if your child has risk factors as noted above.
Ages 17 to 21. Testing is advised. This is because lipid levels are more stable after puberty.
Understanding the test results
A full lipid profile can be an important part of your child’s health information. It shows the levels of each type of fat in the blood. These include LDL, HDL, triglycerides, and total cholesterol. Your child's healthcare provider can tell you what the results should be for your child. In general, healthy levels are:
LDL of less than 130 mg/dL
HDL of greater than 60 mg/dL (less than 35 mg/dL puts your teen at higher risk for heart disease)
Some children and teens (ages 2 to 19) have families with high cholesterol or early heart disease. In these cases, the National Heart Lung and Blood Institute advises these levels for cholesterol:
Total Cholesterol
LDL-Cholesterol
Acceptable
Less than 170 mg/dL
Less than 110 mg/dL
Borderline High
170 to 199 mg/dL
110 to 129 mg/dL
High
200 mg/dL or greater
130 mg/dL or greater
Treating high cholesterol in your child or teen
If the results of your child's lipid tests are abnormal, your child's healthcare provider will work with you to create a treatment plan. Most children and teens will not need medicine. A healthy diet, weight loss, and more physical activity may bring your child's blood lipid levels to normal. The provider will track lipid levels and help your child make lifestyle changes. Your child's provider will talk with you about medicine if needed.
|
|||||
1850
|
dbpedia
|
3
| 78 |
https://www.escardio.org/Journals/E-Journal-of-Cardiology-Practice/Volume-6/HDL-Cholesterol-in-the-Atherosclerotic-disease-Title-HDL-Cholesterol-in-the-A
|
en
|
HDL cholesterol in the atherosclerotic disease
|
https://www.escardio.org/static-resources/escardio3-5/favicons/favicon.ico?v=2
|
https://www.escardio.org/static-resources/escardio3-5/favicons/favicon.ico?v=2
|
[
"https://www.escardio.org/static-file/Escardio/Templates/logo.png?mts=1709631638000.png",
"https://www.escardio.org/static-file/Escardio/Templates/logo.png?mts=1709631638000.png",
"https://www.escardio.org/static-file/Escardio/Medias/common-library/faces/bohm12_escardio-peoplePhoto.jpg?mts=1654279933000.jpg",
"https://www.escardio.org/static-resources/escardio/images/placeholder-default/placeholder-faces.png",
"https://www.escardio.org/static-file/Escardio/Medias/councils/council-for-cardiology-practice/e-journal/ej-vol6n18-fig1.jpg?mts=1654279933000.jpg",
"https://www.escardio.org/static-file/IS/Templates/logo-esc-50.png?mts=1709631638000.png"
] |
[] |
[] |
[
""
] | null |
[
"['Michael Bohm'",
"'Nicolas Werner']"
] | null |
Your access to the latest cardiovascular news, science, tools and resources.
|
/static-resources/escardio3-5/favicons/favicon.ico?v=2
|
https://www.escardio.org/Journals/E-Journal-of-Cardiology-Practice/Volume-6/HDL-Cholesterol-in-the-Atherosclerotic-disease-Title-HDL-Cholesterol-in-the-A
|
Introduction
Recent studies have underlined the importance of high density lipoprotein cholesterol (HDL) levels as a strong inverse predictor of cardiovascular morbidity and mortality (1;2). However, therapeutic attempts to pharmacologically increase HDL plasma concentrations were disappointing (3-5). Here we describe the importance of HDL as an independent predictor for cardiovascular events and novel therapeutic strategies to increase HDL for the prevention of atherosclerotic disease.
Endothelial dysfunction and atherosclerosis
Cardiovascular diseases account for the majority of deaths in the industrialised world and are associated with abundant morbidity rates leading to frequent hospitalisation, disability, and profound health costs. Although multiple treatment strategies have been developed, therapeutic options are still limited. Onset and progression of atherosclerosis is driven by a poorly understood genetic predisposition and prolonged exposure to multiple cardiovascular risk factors (6).
Upon risk factor exposition, the endothelial monolayer becomes dysfunctional and is accompanied by the loss of genuine physiological properties. These early stages of atherosclerosis are characterised by an impaired endothelium-dependent vasorelaxation due to increased oxidative stress and reduced nitric oxide bioavailability. This condition is referred to as endothelial dysfunction.
Besides the compromised vasomotion, attraction and adhesion of monocytes and T-lymphocytes are important events characterising endothelial dysfunction (7). Ultimately, these inflammatory cells invade the vessel wall and form, along with enhanced lipid deposition as well as migration and proliferation of vascular smooth muscle cells, the atherosclerotic lesion. Continuous inflammation and lipid accumulation renders the plaque unstable which in turn leads to lesion rupture and occlusion of the diseased vessel.
Of note, endothelial dysfunction is not only present in early forms of vascular disease, but is active in virtually all stages of atherosclerosis and is of fundamental importance for the magnitude of cardiovascular complications. Thus, endothelial dysfunction resembles an important pathophysiological condition of the vessel wall, but, beyond that, strongly predicts the outcome of the patient (8).
Endothelial dysfunction and atherosclerosis – the role of HDL
High density lipoprotein (HDL) plasma concentrations negatively correlate with cardiovascular event rates. Individuals with elevated HDL plasma levels are less susceptible to the development of atherosclerosis and endothelial dysfunction. In contrast, low HDL levels predict an increased incidence of myocardial infarction. Experimental data revealed that HDL is potentially anti-atherogenic via the following actions (2):
HDL facilitates reverse cholesterol transport and delivers cholesterol from the vasculature to the liver for excretion from the body for example. In so doing, it counteracts the harmful pro-atherogenic lipid particles such as LDL9.
HDL works as an antioxidant. Reduction of vascular oxidative stress could contribute to the atheroprotective effects of HDL9.
HDL carries anti-inflammatory properties which probably decrease inflammatory processes in the vessel wall occurring during atherogenesis9.
HDL enhances the proliferation and migration of endothelial cells and endothelial progenitor cells and thereby promotes the restoration of the endothelium’s integrity10;11.
HDL has anti-apoptotic effects on endothelial cells and endothelial progenitors9;12.
The accumulation of these cellular and molecular effects leads to endothelial protection and prevention of atherosclerotic disease (figure 1).
High HDL levels are vasculoprotective
In a recently published study in the New England Journal of Medicine, the importance of HDL cholesterol levels as an LDL cholesterol independent predictor has been demonstrated (1).
In a post-hoc analysis of the Treating to New Targets (TNT) study the predictive value of HDL for cardiovascular events was assessed. LDL cholesterol was lowered to levels <130mg during a run-in phase. Patients were then randomised to receive either 10mg or 80mg atorvastatin and the occurrence of the first major cardiovascular events was determined. The post-hoc analysis was performed in 9770 patients. HDL levels were predictive of major cardiovascular events. Interestingly, when stratified to LDL levels, HDL cholesterol remained a significant predictor for cardiovascular events. Even in subjects with LDL levels <70mg/dl, high HDL levels were associated with a lower risk for cardiovascular events. These results clearly demonstrate the importance of HDL levels beyond LDL cholesterol.
Treatment strategies to increase HDL levels
The current therapeutic strategies to increase HDL levels are limited (9). According to the guidelines, treatment of patients with low HDL (<40mg/dl) should first include LDL lowering to goal, followed by intensive weight management, increased physical activity, and potentially the use of nicotinic acid or fibrates.
The importance of HDL as an inverse risk predictor has triggered various attempts to further influence HDL levels in patients at risk. Infusion of reconstituted HDL (rHDL, CSL-111) was associated with improvements in endothelial function in hypercholesterolemic men (13) or in patients with low HDL levels14. In a randomized placebo-controlled trial, 183 patients were treated with reconstituted HDL or placebo and the atherosclerotic plaque burden was assessed using intravascular ultrasound (IVUS). 4 weekly infusions of rHDL did not result in a reduction of atheroma volume but was able to positively influence plaque characteristics (5).
Further attempts to increase HDL levels were based on small-molecule inhibitors of cholesteryl ester transfer protein (CETP) (9). Blocking of CETP leads to inhibition of the transfer of cholesteryl ester from HDL to apolipoprotein-B-containing lipoproteins and the simultaneous transfer of triglycerides in the opposite direction, resulting in increased HDL levels. However, despite promising experimental data (10;15), clinical trials with the CETP inhibitor torcetrapib were disappointing. In patients with familial hypercholesterolemia (3) and in patients with coronary artery disease4, the use of CETP inhibition in combination with statin treatment did not result in a reduction of atherosclerotic lesion progression (carotid artery intima/media thickness and coronary atherosclerosis, IVUS) despite a large increase in HDL cholesterol.
Finally, the recently published ILLUMINATE study in 15,067 patients at high cardiovascular risk demonstrated an increase of 72.1% in HDL cholesterol and a decrease of 24.9% in LDL cholesterol (16). However, these effects were associated with an increase of 5.4 mm Hg in systolic blood pressure, a decrease in serum potassium, and increases in serum sodium, bicarbonate, and aldosterone. The study was prematurely terminated due to an increased risk of cardiovascular events (hazard ratio, 1.25; 95% confidence interval, 1.09 to 1.44; P=0.001) and death from any cause (hazard ratio, 1.58; 95% CI, 1.14 to 2.19; P=0.006) in the torcetrapib arm leading finally to the withdrawal of the compound. Post hoc analyses showed an increased risk of death in patients treated with torcetrapib whose reduction in potassium or increase in bicarbonate was greater than the median change.
A recently published study in The Lancet shades new light on CETP inhibition (17). In two double-blind placebo controlled trials with a small patient number (50 patients and 22 healthy participants, respectively), anacetrapib was not associated with an increase in blood pressure17. However, the studies were too small for outcome analysis and the paper was published and written by the pharmaceutical company investigating anacetrapib. Interestingly, blood pressure increase was not associated with increased mortality in the post-hoc analysis of the ILLUMINATE study indicating that other factors may have influenced the outcome (16). Further experimental research is urgently needed to dissect the multiple mechanisms by which CETP inhibition itself or the increased HDL particles may affect cardiovascular outcome.
Conclusions
HDL cholesterol levels are an important target in patients with atherosclerotic disease. Recently published data underline the importance of HDL as an inverse risk predictor independent of LDL cholesterol levels. Currently, HDL levels >60mg/dl are regarded as an “inverse risk factor”. The health care provider should aim to increase HDL levels in patients <40mg/dl as stated in the guidelines using lifestyle modifications (weight loss, regular exercise, quit cigarette smoking, and reduction of excess carbohydrate calories) and pharmacological concepts such as nicotinic acid or fibrates. However, in these patients, the primary goal remains to lower LDL cholesterol and non-HDL to target levels.
Figure 1. Effects of high density lipoproteins (HDL) on the endothelium
HDL influences the function and survival of endothelial cells and regenerating endothelial progenitor cells. Effective repair of the endothelium results in the prevention of endothelial dysfunction, atherosclerotic lesion progression, plaque rupture, and restenosis.
The content of this article reflects the personal opinion of the author/s and is not necessarily the official position of the European Society of Cardiology.
|
||||
1850
|
dbpedia
|
1
| 77 |
https://www.bhf.org.uk/informationsupport/conditions/familial-hypercholesterolaemia
|
en
|
Familial hypercholesterolaemia
|
[
"https://www.bhf.org.uk/assets/img/BHF-logo.svg",
"https://www.bhf.org.uk/assets/img/BHF-logo-desktop.svg",
"https://www.bhf.org.uk/-/media/images/nav-promo-panels/london-to-brighton-bike-ride-400x225px.jpg?rev=08a07c10aa5b41fc9cd7a9e45e70b75d",
"https://www.bhf.org.uk/-/media/images/nav-promo-panels/volunteer-in-our-shops_group-of-volunteers-400x225px.jpg?rev=a737b12ce7f6436b8272217f09a73730",
"https://www.bhf.org.uk/-/media/images/nav-promo-panels/retail-store-fascia-400x225px.jpg?rev=84f9aeb5d5a845709db7019c5e2e6e3b",
"https://www.bhf.org.uk/-/media/images/nav-promo-panels/heartstatistics-400x225.jpg?rev=0198052ab398483f855242de633fd425",
"https://www.bhf.org.uk/-/media/images/shop/book-a-furniture-collection/furniture-collection-570x380.png?rev=724588574288467eae9071652dfbbdcc",
"https://www.bhf.org.uk/-/media/images/donate/category-page/lottery-raffle-faqsv2-600x450.jpg?rev=cc9816149d704163bfa9a3cc24e3a16f",
"https://www.bhf.org.uk/-/media/images/nav-promo-panels/london-to-brighton-bike-ride-400x225px.jpg?rev=08a07c10aa5b41fc9cd7a9e45e70b75d",
"https://www.bhf.org.uk/-/media/images/nav-promo-panels/volunteer-in-our-shops_group-of-volunteers-400x225px.jpg?rev=a737b12ce7f6436b8272217f09a73730",
"https://www.bhf.org.uk/-/media/images/nav-promo-panels/retail-store-fascia-400x225px.jpg?rev=84f9aeb5d5a845709db7019c5e2e6e3b",
"https://www.bhf.org.uk/-/media/images/nav-promo-panels/heartstatistics-400x225.jpg?rev=0198052ab398483f855242de633fd425",
"https://www.bhf.org.uk/-/media/images/shop/book-a-furniture-collection/furniture-collection-570x380.png?rev=724588574288467eae9071652dfbbdcc",
"https://www.bhf.org.uk/-/media/images/donate/category-page/lottery-raffle-faqsv2-600x450.jpg?rev=cc9816149d704163bfa9a3cc24e3a16f",
"https://www.bhf.org.uk/assets/img/mvc/scp-hero-curve.svg?v=DQiDqsMAhx0Qo4tI1y6Gkn681ETM1YA7gecLL1qbRaE=",
"https://www.bhf.org.uk/-/media/images/information-support/conditions/tendon-xanthormata3.jpg?h=143&w=150&rev=ed8fb534fd3d48bab3d233c815e72748&hash=DE4322425F836BB2CFEF1E49DC4A7C64",
"https://www.bhf.org.uk/-/media/images/information-support/conditions/xanthelasmas1.jpg?h=143&w=150&rev=db4c689c663a42469dc564afd9f41062&hash=E25F2884AC4053313B075B90B41C4C23",
"https://www.bhf.org.uk/-/media/images/information-support/conditions/corneal-arcus2.jpg?h=143&w=150&rev=b838df9e3d3f48a186aac29dc8a3f5a0&hash=B77FE582B8E3898E4C42AC413C9503BA",
"https://www.bhf.org.uk/-/media/images/donation-widget/payment-methods-cross-sell.png?rev=6ac9726b887d4b368472d03aceeb5512",
"https://www.bhf.org.uk/-/media/images/information-support/publications/heart-conditions/fh-sitecore-thumb.jpg?rev=be71203d67084c27b72ca80029b2802c&h=280&w=210&la=en&hash=1B08F5687974E2153B7EA94C3040C76A",
"https://www.bhf.org.uk/-/media/images/information-support/blood-test-640.jpg?mh=380&mw=570&rev=f63cd3df84ab4f63be1c3477dc8fd991&hash=E0CF5C610F03708C5CB8C3A980F9AD4E",
"https://www.bhf.org.uk/-/media/images/for-professionals/healthcare-professionals/updates-and-insights/updates/six-challenges-in-heart-disease-that-artificial-intelligence-is-helping-to-solve/medication-770x510.png?mh=380&mw=570&rev=5f7059383f8b47f8bc6d1c9321079c17&hash=AFCE794F96C8F004975816B9B422E1F0",
"https://www.bhf.org.uk/-/media/images/information-support/august-2023-updated-image-folder/info-support-support-landing-page-woman-hand-on-shoulder-250-170px.jpg?mh=380&mw=570&rev=92c3ce24798b4760a28777203cdc970a&hash=8182C76FE3F44357CF0084A7DE96E621",
"https://www.bhf.org.uk/-/media/system/logo-white.svg?rev=f07c00ef8c1c41bcb2458bc592052b43&la=en&hash=BBA651047E4F09B23E0E4345D6031A2D",
"https://www.bhf.org.uk/-/media/system/logo-fundraising.svg?rev=d83487c493644472a2621ca1ef0d1028&la=en&hash=7658364AC83AF9B0E20FBFC3924F869E"
] |
[] |
[] |
[
""
] | null |
[] | null |
Some people are born with familial hypercholesterolaemia (FH), a genetic condition where your liver can’t process cholesterol properly.
|
en
|
/favicon.ico?v=HXts/Y6GCWPMlO5PawfVqFmDXE/78my1zkPdRXlQZJU=
|
British Heart Foundation
|
https://www.bhf.org.uk/informationsupport/conditions/familial-hypercholesterolaemia
|
What is familial hypercholesterolaemia (FH)?
FH is an inherited condition that is passed down through families and is caused by one or more faulty genes.
It's caused by a genetic mutation (a change in one or more genes) making your liver less able to remove excess ‘bad’ cholesterol, known as LDL. This means the LDL level in your blood can get too high. Having FH means you’re at risk of getting heart and circulatory disease at an early age if it’s not treated.
FH is one of the most common inherited conditions that affects about 1 in every 250. It’s estimated that around 270,000 people in the UK have it, but many don’t know they do.
If one of your parents has the condition, there’s a 50 per cent (1 in 2) chance that you could have it. If you have FH, there’s a 1 in 2 chance that you could pass it on to any of your children.
Why is having high cholesterol bad for you?
Having high cholesterol causes a gradual build-up of fatty material in your coronary arteries (known as atheroma). Other risk factors – like high blood pressure or smoking – can also cause atheroma build-up.
A build-up of atheroma means your arteries gradually become narrower, making it harder for blood to flow to your vital organs. This puts you at higher risk of having a heart attack or stroke.
What are the signs and symptoms of familial hypercholesterolaemia (FH)?
FH is not easy to diagnose. Your doctor may suspect FH if:
a routine blood test shows you have a high cholesterol level
you have a heart attack or stroke, especially if it happens at a young age
other members of your family have a history of premature heart disease or stroke
other members of your family have been diagnosed with FH.
You may also notice physical changes to your body that suggest you have FH. Your doctor will perform a simple physical exam to check for these symptoms. These can include:
Genetic testing for familial hypercholesterolaemia (FH)
The first step to finding out whether you have FH is to visit your GP to have your cholesterol checked. Your doctor will also ask whether you have a history of high cholesterol or heart conditions in your family.
If your results come back high, or if your doctor notices some of the physical signs of FH listed above, they will refer you to a specialist for an assessment, which is likely to include genetic testing. The specialist will explain which of your relatives should be checked out, too.
Genetic testing is a DNA test that’s done to see if you have a faulty gene which can cause an inherited condition. This test may be:
a blood sample
a mouth swab, from the inside of your cheek.
If you’re diagnosed with FH, your first-degree relatives (parents, siblings, children) should also be tested as soon as possible. FH is an inherited condition which means that if a parent has FH, their child has a 50% chance of inheriting it.
If one of your family members has FH, you should get tested as well. Early diagnosis of FH means you can get treatment and improve your lifestyle to lower your cholesterol and avoid risk to your health.
How is familial hypercholesterolaemia (FH) treated?
There isn’t a cure for FH but it can be well managed. Treatment can greatly reduce your risk of getting coronary heart disease, having a heart attack or stroke, or needing other treatments. If you or your child is diagnosed with FH, your doctor will discuss and agree a treatment plan with you.
FH is usually treated using medicines called statins, which help to lower your cholesterol levels.
There are other types of medicines which can be used to lower blood cholesterol levels either instead of or as well as statins. These are:
ezetimibe
PCSK9 inhibitors such as alirocumab and evolocumab
bempedoic acid
inclisiran
fibrates such as bezafibrate and fenofibrate.
As well as taking medications, you'll need to make changes to your diet and lifestyle which also help to improve your cholesterol level.
People with high cholesterol often find they can bring their levels of cholesterol down just by changing their diet. Unfortunately, FH can’t be treated through diet alone, but you should still make sure you:
maintain a healthy weight
do plenty of exercise
don’t smoke
drink less alcohol.
Pregnancy and familial hypercholesterolaemia (FH)
FH shouldn’t affect your chances of getting pregnant. However, you should talk to your doctor about your plans before you try to get pregnant. This means that they can advise you on your medication and talk to you about risks during pregnancy.
They may also want to discuss the risk of your child inheriting FH and when they can test for it.
Eating a healthy balanced diet and keeping active will help you to stay as healthy as possible during your pregnancy.
For more information on FH, you can:
|
||||
692
|
dbpedia
|
2
| 7 |
https://50playwrights.org/tag/nuyorican/
|
en
|
Nuyorican
|
https://secure.gravatar.com/blavatar/98096074cec68f805e3620217e89460b6196f9597f4c4f403557bd535e04224d?s=200&ts=1723285734
|
https://secure.gravatar.com/blavatar/98096074cec68f805e3620217e89460b6196f9597f4c4f403557bd535e04224d?s=200&ts=1723285734
|
[
"https://50playwrights.org/wp-content/uploads/2017/04/cropped-50pp-pp-smaller4.jpg",
"https://secure.gravatar.com/blavatar/98096074cec68f805e3620217e89460b6196f9597f4c4f403557bd535e04224d?s=50&d=https%3A%2F%2Fs2.wp.com%2Fi%2Flogo%2Fwpcom-gray-white.png",
"https://secure.gravatar.com/blavatar/98096074cec68f805e3620217e89460b6196f9597f4c4f403557bd535e04224d?s=50&d=https%3A%2F%2Fs2.wp.com%2Fi%2Flogo%2Fwpcom-gray-white.png",
"https://pixel.wp.com/b.gif?v=noscript"
] |
[] |
[] |
[
""
] | null |
[] | null |
Posts about Nuyorican written by trevorboffone
|
en
|
https://secure.gravatar.com/blavatar/98096074cec68f805e3620217e89460b6196f9597f4c4f403557bd535e04224d?s=32
|
https://50playwrights.org/tag/nuyorican/
|
© 50 Playwrights Project, 2016-2018. All Rights Reserved.
Unauthorized use and/or duplication of any original material on this website belonging to 50 Playwrights Project without express and written permission from Trevor Boffone is strictly prohibited. Excerpts and links may, of course, be used, provided that full and clear credit is given to 50 Playwrights Project and Trevor Boffone with appropriate and specific direction to the original content.
Thank you for reading. Please comment, share, and return regularly.
|
|||
692
|
dbpedia
|
3
| 41 |
https://miamivice.fandom.com/wiki/Julia_Cameron
|
en
|
Julia Cameron
|
https://static.wikia.nocookie.net/ucp-internal-test-starter-commons/images/a/aa/FandomFireLogo.png/revision/latest?cb=20210713142711
|
https://static.wikia.nocookie.net/ucp-internal-test-starter-commons/images/a/aa/FandomFireLogo.png/revision/latest?cb=20210713142711
|
[
"https://static.wikia.nocookie.net/6a181c72-e8bf-419b-b4db-18fd56a0eb60",
"https://static.wikia.nocookie.net/6c42ce6a-b205-41f5-82c6-5011721932e7",
"https://static.wikia.nocookie.net/464fc70a-5090-490b-b47e-0759e89c263f",
"https://static.wikia.nocookie.net/f7bb9d33-4f9a-4faa-88fe-2a0bd8138668"
] |
[] |
[] |
[
""
] | null |
[
"Contributors to Miami Vice Wiki"
] |
2024-07-29T22:27:06+00:00
|
Julia Cameron (born March 4, 1948) is an American author, journalist, and screenwriter who wrote the Miami Vice episode "Junk Love". Cameron was born in Libertyville, Illinois, a suburb of Chicago. She got into journalism after college, working for The Washington Post before moving to Rolling...
|
en
|
/skins-ucp/mw139/common/favicon.ico
|
Miami Vice Wiki
|
https://miamivice.fandom.com/wiki/Julia_Cameron
|
Miami Vice Writer
Born
March 4, 1948, Libertyville, Illinois
Active
1978-present
Spouse(s)/Children
Martin Scorsese (1975-77), one daughter
Julia Cameron (born March 4, 1948) is an American author, journalist, and screenwriter who wrote the Miami Vice episode "Junk Love".
Career[]
|
||
692
|
dbpedia
|
3
| 16 |
https://www.nytimes.com/2019/02/02/style/julia-cameron-the-artists-way.html
|
en
|
Julia Cameron Wants You to Do Your Morning Pages
|
[
"https://static01.nyt.com/images/2019/02/03/fashion/03JULIACAMERON/merlin_149295975_44170fa1-6d57-454f-a8b4-112222add07b-articleLarge.jpg?quality=75&auto=webp&disable=upscale",
"https://static01.nyt.com/images/2018/07/18/multimedia/author-penelope-green/author-penelope-green-thumbLarge-v3.png"
] |
[] |
[] |
[
""
] | null |
[
"Penelope Green"
] |
2019-02-02T00:00:00
|
With “The Artist’s Way,” Julia Cameron invented the way people renovate the creative soul.
|
en
|
/vi-assets/static-assets/favicon-d2483f10ef688e6f89e23806b9700298.ico
|
https://www.nytimes.com/2019/02/02/style/julia-cameron-the-artists-way.html
|
SANTA FE, N.M. — On any given day, someone somewhere is likely leading an Artist’s Way group, gamely knocking back the exercises of “The Artist’s Way” book, the quasi-spiritual manual for “creative recovery,” as its author Julia Cameron puts it, that has been a lodestar to blocked writers and other artistic hopefuls for more than a quarter of a century. There have been Artist’s Way clusters in the Australian outback and the Panamanian jungle; in Brazil, Russia, the United Kingdom and Japan; and also, as a cursory scan of Artist’s Way Meetups reveals, in Des Moines and Toronto. It has been taught in prisons and sober communities, at spiritual retreats and New Age centers, from Esalen to Sedona, from the Omega Institute to the Open Center, where Ms. Cameron will appear in late March, as she does most years. Adherents of “The Artist’s Way” include the authors Patricia Cornwell and Sarah Ban Breathnach. Pete Townshend, Alicia Keys and Helmut Newton have all noted its influence on their work.
So has Tim Ferriss, the hyperactive productivity guru behind “The Four Hour Workweek,” though to save time he didn’t actually read the book, “which was recommended to me by many megaselling authors,” he writes. He just did the “Morning Pages,” one of the book’s central exercises. It requires you write three pages, by hand, first thing in the morning, about whatever comes to mind. (Fortunes would seem to have been made on the journals printed to support this effort.) The book’s other main dictum is the “Artist’s Date” — two hours of alone time each week to be spent at a gallery, say, or any place where a new experience might be possible.
Elizabeth Gilbert, who has “done” the book three times, said there would be no “Eat, Pray, Love,” without “The Artist’s Way.” Without it, there might be no adult coloring books, no journaling fever. “Creativity” would not have its own publishing niche or have become a ubiquitous buzzword — the “fat-free” of the self-help world — and business pundits would not deploy it as a specious organizing principle.
The book’s enduring success — over 4 million copies have been sold since its publication in 1992 — have made its author, a shy Midwesterner who had a bit of early fame in the 1970s for practicing lively New Journalism at the Washington Post and Rolling Stone, among other publications, and for being married, briefly, to Martin Scorsese, with whom she has a daughter, Domenica — an unlikely celebrity. With its gentle affirmations, inspirational quotes, fill-in-the-blank lists and tasks — write yourself a thank-you letter, describe yourself at 80, for example — “The Artist’s Way” proposes an egalitarian view of creativity: Everyone’s got it.
|
|||||
692
|
dbpedia
|
1
| 62 |
https://www.amazon.com/Women-Susan-Sontag/dp/0375500200
|
en
|
Amazon.com
|
[
"https://images-na.ssl-images-amazon.com/captcha/docvmtpr/Captcha_bkccfbpodw.jpg",
"https://fls-na.amazon.com/1/oc-csi/1/OP/requestId=31HDPB9F66C01VB7S57G&js=0"
] |
[] |
[] |
[
""
] | null |
[] | null |
en
| null |
Enter the characters you see below
Sorry, we just need to make sure you're not a robot. For best results, please make sure your browser is accepting cookies.
|
|||||||
692
|
dbpedia
|
3
| 94 |
https://boo.world/database/profile/313229/julia-cameron-personality-type
|
en
|
Julia Cameron's Personality Unveiled: MBTI, Enneagram and More
|
[
"https://boo.world/boo_logo.png",
"https://boo.world/boo_logo.png",
"https://boo.world/boo_logo.png",
"https://boo.world/boo_logo.png",
"https://boo.world/boo_logo.png",
"https://boo.world/boo_logo.png",
"https://boo.world/boo_logo.png",
"https://boo.world/boo_logo.png",
"https://boo.world/boo_logo.png",
"https://boo.world/boo_logo.png",
"https://boo.world/boo_logo.png",
"https://boo.world/boo_logo.png",
"https://boo.world/boo_logo.png",
"https://boo.world/boo_logo.png",
"https://boo.world/boo_logo.png",
"https://boo.world/boo_logo.png",
"https://boo.world/boo_logo.png",
"https://boo.world/boo_logo.png",
"https://boo.world/boo_logo.png"
] |
[] |
[] |
[
""
] | null |
[] | null |
What 16 personality type is Julia Cameron from Screenwriters? Find out Julia Cameron's 16 type, Enneagram, and Zodiac sign in the Soulverse, the comprehensive personality database.
|
en
|
/icon.png
|
Boo
|
https://boo.world/database/profile/313229/julia-cameron-personality-type
|
Julia Cameron Personality Type
Julia Cameron is an INFP and Enneagram Type 4w5.
What is Julia Cameron's personality type?
|
||||
692
|
dbpedia
|
2
| 21 |
https://www.cambridge.org/core/books/cambridge-companion-to-american-theatre-since-1945/commercial-and-mainstream-theatre/D081A79C36C64A8687DB0F42BAD296D6
|
en
|
The Cambridge Companion to American Theatre since 1945
|
[
"https://www.cambridge.org/core/cambridge-core/public/images/icn_circle__btn_close_white.svg",
"https://www.cambridge.org/core/cambridge-core/public/images/logo_core.png",
"https://www.cambridge.org/core/cambridge-core/public/images/logo_core.svg",
"https://www.cambridge.org/core/cambridge-core/public/images/logo_core.svg",
"https://www.cambridge.org/core/cambridge-core/public/images/logo_core.svg",
"https://assets.cambridge.org/97811087/27211/cover/9781108727211.jpg",
"https://www.cambridge.org/core/page-component/img/share-icon.cbcfad8.svg",
"https://www.cambridge.org/core/page-component/img/close-icon.194b28a.svg",
"https://www.cambridge.org/core/page-component/img/cite-icon.44eaaa4.svg",
"https://static.cambridge.org/content/id/urn%3Acambridge.org%3Aid%3Abook%3A9781108648134/resource/name/firstPage-9781108480260ptl1_17-18.jpg",
"https://www.cambridge.org/core/cambridge-core/public/images/cambridge_logo.png"
] |
[] |
[] |
[
""
] | null |
[
"Julia Listengarten",
"University of Central Florida",
"Stephen Di Benedetto",
"Michigan State University"
] | null |
The Cambridge Companion to American Theatre since 1945 - September 2021
|
en
|
/core/cambridge-core/public/images/favicon.ico
|
Cambridge Core
|
https://www.cambridge.org/core/books/cambridge-companion-to-american-theatre-since-1945/commercial-and-mainstream-theatre/D081A79C36C64A8687DB0F42BAD296D6
|
To save this book to your Kindle, first ensure coreplatform@cambridge.org is added to your Approved Personal Document E-mail List under your Personal Document Settings on the Manage Your Content and Devices page of your Amazon account. Then enter the ‘name’ part of your Kindle email address below. Find out more about saving to your Kindle.
Note you can select to save to either the @free.kindle.com or @kindle.com variations. ‘@free.kindle.com’ emails are free but can only be saved to your device when it is connected to wi-fi. ‘@kindle.com’ emails can be delivered even when you are not connected to wi-fi, but note that service fees apply.
|
||||
692
|
dbpedia
|
1
| 23 |
https://howlround.com/series/theatre-age-climate-change
|
en
|
Theatre in the Age of Climate Change
|
[
"https://www.facebook.com/tr?id=687348145509629&ev=PageView&noscript=1",
"https://howlround.com/themes/custom/howlround/logo.svg",
"https://howlround.com/modules/custom/howlround_blocks/images/logo.svg",
"https://howlround.com/sites/default/files/styles/profile_tint_large_square/public/pictures/2023-06/_C8A3916-Edit-web-1600.jpg?itok=bwVWBX0V 1x, /sites/default/files/styles/profile_tint_large_square/public/pictures/2023-06/_C8A3916-Edit-web-1600.jpg?itok=bwVWBX0V 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/2024-04/a_jordan_1.jpg?itok=8xtfuq9z 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2024-04/Screenshot%202024-04-25%20at%209.48.35%20AM.png?itok=6HcZh539 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2024-04/Screenshot%202024-04-25%20at%209.48.35%20AM.png?itok=cJk-dEA5 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/2024-04/d_weaver_1.jpg?itok=vuVLPywE 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2024-04/DekeWeaver.gif?itok=NjtatnLe 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2024-04/DekeWeaver.gif?itok=K1eX3vmO 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/2024-04/c_bilodeau_3.jpg?itok=qAhTBTtU 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2023-06/_C8A3916-Edit-web-1600.jpg?itok=1ZwBL66O 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2023-06/_C8A3916-Edit-web-1600.jpg?itok=LYCdTCZm 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/2024-04/606533786-t-kowalchuk_2.jpg?itok=2HnP2SGN 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2024-04/Zinnia%20Tannis.JPG?itok=lSdwe2Cl 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2024-04/Zinnia%20Tannis.JPG?itok=M4XV9cgo 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/2023-06/r_garza_1.jpeg?itok=GaCScCEB 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2023-06/Raul%20Garza.png?itok=yggf6dyV 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2023-06/Raul%20Garza.png?itok=ilEab-tx 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/2023-06/k_gwynn_1.png?itok=EXRVWGAn 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2023-06/headshot.jpg?itok=Q0G-SVnY 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2023-06/headshot.jpg?itok=csft77a3 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/2023-06/221026_emory_arts_033.jpg?itok=IwADxHbv 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2019-07/portrait%20of%20TM.jpg?itok=9nxNL7Ce 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2019-07/portrait%20of%20TM.jpg?itok=P3ivGK6k 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/2023-06/c_bilodeau_3.jpeg?itok=POEmxW7l 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2023-06/_C8A3916-Edit-web-1600.jpg?itok=1ZwBL66O 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2023-06/_C8A3916-Edit-web-1600.jpg?itok=LYCdTCZm 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/2023-06/g_simon_2.jpg?itok=uuB_XW8s 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2023-06/Genevieve%20Simon_cropped.jpg?itok=tbx5x7yT 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2023-06/Genevieve%20Simon_cropped.jpg?itok=qfHR8emn 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/2020-04/b_osnes_climate5.png?itok=UwjOGpR3 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2020-03/IMG_5274%202_0.jpg?itok=WUsSZpho 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2020-03/IMG_5274%202_0.jpg?itok=aJt5h4pL 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/2020-04/d_geary_climate4.png?itok=iGKU4RT6 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2020-04/DG%20smiley%20pic.jpg?itok=_ll6oc2n 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2020-04/DG%20smiley%20pic.jpg?itok=cBB2oXFw 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/2020-04/h_cormick_climate1.png?itok=Tg5XntjE 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2020-03/ABX_2221-a.jpg?itok=VPALq03q 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2020-03/ABX_2221-a.jpg?itok=vz9UmamR 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/2020-04/t_peterson_climate4.png?itok=2zvs3i-K 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2020-04/IMG_2631%20copy_0.jpg?itok=SmhF3sYE 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2020-04/IMG_2631%20copy_0.jpg?itok=5OirzGG2 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/2019-09/creck2.png?itok=Hx9w36nt 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2019-10/Caroline%20Reck-55905bwWEB.jpg?itok=HBTB2lWP 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2019-10/Caroline%20Reck-55905bwWEB.jpg?itok=C6klWMNA 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/2019-09/may5.png?itok=Kvn9Vtp- 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2019-07/portrait%20of%20TM.jpg?itok=9nxNL7Ce 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2019-07/portrait%20of%20TM.jpg?itok=P3ivGK6k 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/2019-09/evalyn_parry_photo_1.png?itok=iHtxHuPu 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2019-09/EP.jpg?itok=lMAYA1c3 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2019-09/EP.jpg?itok=A6QMiIio 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/2019-09/zoe1.png?itok=ueZliY6f 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2019-08/Screen%20Shot%202019-03-30%20at%2016.39.42.jpg?itok=aSfDXOIt 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2019-08/Screen%20Shot%202019-03-30%20at%2016.39.42.jpg?itok=0Z4oh-kk 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/2019-09/reisman1.png?itok=sEL24b82 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2019-08/NpX%20headshot.jpg?itok=Am8R2_pk 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2019-08/NpX%20headshot.jpg?itok=rL3rkezj 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/2019-03/photo_1.jpg?itok=ozlu1Dnx 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2019-03/DSC_0368%202.jpg?itok=lmkLU8Bl 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2019-03/DSC_0368%202.jpg?itok=q0R35C6r 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/2019-03/reeves_photo_5.jpg?itok=yp1-W3QP 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2019-03/CReevesHeadshot%202018-min.JPG?itok=X-GwoXDM 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2019-03/CReevesHeadshot%202018-min.JPG?itok=IgCEZ3Zn 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/2019-04/AMC%20Kutiyattam%2012.png?itok=zOCAGP5Z 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2019-04/Headshot.jpg?itok=R_VU-ZsY 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2019-04/Headshot.jpg?itok=-eQDCzyE 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/2020-11/College%20Ambassador%20Program_0.jpg?itok=k_S3XBvb 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2019-03/Lucycropped.jpg?itok=2claAiny 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2019-03/Lucycropped.jpg?itok=jh_dhhIB 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/2019-03/e_c_bilodeau_photo_1.jpg?itok=8Vq_M7rl 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2023-06/_C8A3916-Edit-web-1600.jpg?itok=1ZwBL66O 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2023-06/_C8A3916-Edit-web-1600.jpg?itok=LYCdTCZm 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/IMG_3761%20copy.jpg?itok=v5HZue8B 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/AnnalisaDIAS.jpg?itok=_WmxMqiV 1x, /sites/default/files/styles/profile_tint_small_2/public/user/AnnalisaDIAS.jpg?itok=b3Q7s0sS 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/B_A_Teague_photo%201%20copy.png?itok=7H1yED8O 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2020-07/ashley_0457.jpg?itok=FutXnGDL 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2020-07/ashley_0457.jpg?itok=d9c5N4b_ 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/DSC_0205%20copy.jpg?itok=z-erTHb5 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/L_Fu.png?itok=5PJ9flX6 1x, /sites/default/files/styles/profile_tint_small_2/public/user/L_Fu.png?itok=gD7ujeyY 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/Edwardine%20van%20Wyk%20and%20the%20Seal%20in%20SLIME%2C%20set%20and%20puppet%20design%20by%20Shizuka%20Kai%2C%20photo%20by%20Donald%20Lee%20copy.jpg?itok=iERytytg 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/Photo%20on%202015-07-14%20at%2010.31.jpg?itok=_IWlGn_r 1x, /sites/default/files/styles/profile_tint_small_2/public/user/Photo%20on%202015-07-14%20at%2010.31.jpg?itok=bMCZSNmD 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/DSC_0186_0.JPG?itok=ZB6Ybkgl 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/Screen%20Shot%202018-09-14%20at%202.44.18%20PM.png?itok=xJxNSdPv 1x, /sites/default/files/styles/profile_tint_small_2/public/user/Screen%20Shot%202018-09-14%20at%202.44.18%20PM.png?itok=CzfHe8Cm 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/B_A_Weller_photo%202_0.jpg?itok=j2vqqmZC 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/AW%20shot%20no%20name%20HIres.jpg?itok=CTHXhVb0 1x, /sites/default/files/styles/profile_tint_small_2/public/user/AW%20shot%20no%20name%20HIres.jpg?itok=0kSTQNic 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/E_N_Balestrini_photo%201_0.jpg?itok=qZobvc_j 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/Balestrini.jpg?itok=dqge-v0J 1x, /sites/default/files/styles/profile_tint_small_2/public/user/Balestrini.jpg?itok=X53iWZWj 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/everything%20is%20connected%20poster%20copy.jpg?itok=54nQSVfL 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2018-10/18%20Peterson%20T%20040retouch%20copy.jpg?itok=1_gMJqJg 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2018-10/18%20Peterson%20T%20040retouch%20copy.jpg?itok=6FJgxv9X 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/NYUAD%20Students%252C%20Staff%20and%20Faculty%20read%20_Oh%20How%20We%20Loved%20Our%20Tuna%2521_%20by%20Amahl%20Khouri_0.jpeg?itok=Ain37U8f 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/Screen%20Shot%202018-03-01%20at%201.58.44%20PM.png?itok=KJjgyC5W 1x, /sites/default/files/styles/profile_tint_small_2/public/user/Screen%20Shot%202018-03-01%20at%201.58.44%20PM.png?itok=olM6KD6- 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/E_C_Bilodeau_photo%201%20copy.jpg?itok=i7kK4ic7 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2023-06/_C8A3916-Edit-web-1600.jpg?itok=1ZwBL66O 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2023-06/_C8A3916-Edit-web-1600.jpg?itok=LYCdTCZm 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/IMG_5443_0.jpg?itok=j_xBxcwR 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/C.%20Murphy%20Headshot.png?itok=K_kuOJhN 1x, /sites/default/files/styles/profile_tint_small_2/public/user/C.%20Murphy%20Headshot.png?itok=zRQP2wkC 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/E_E_Schorr_Photo%203.jpg?itok=74SC6LJn 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/E.%20Schorr%20Headshot.jpg?itok=MGSvXviL 1x, /sites/default/files/styles/profile_tint_small_2/public/user/E.%20Schorr%20Headshot.jpg?itok=jzeQXHr5 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/D_Finnigan_Photo%201%20copy.jpg?itok=YT9Pgd-A 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/D.%20Finnigan%20Headshot.png?itok=J6ZRcDEu 1x, /sites/default/files/styles/profile_tint_small_2/public/user/D.%20Finnigan%20Headshot.png?itok=hdHxn7aL 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/J_Hahn_Photo1_0.jpg?itok=ceRyXhvX 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/Hahn_Headshot.jpg?itok=rq-MGb-h 1x, /sites/default/files/styles/profile_tint_small_2/public/user/Hahn_Headshot.jpg?itok=p2EvtrhO 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/L_Fu_Photo%203_0.jpg?itok=NQe1TKHR 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/L_Fu.png?itok=5PJ9flX6 1x, /sites/default/files/styles/profile_tint_small_2/public/user/L_Fu.png?itok=gD7ujeyY 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/f-ck_the_system.png?itok=mG7WrJeJ 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2023-06/_C8A3916-Edit-web-1600.jpg?itok=1ZwBL66O 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2023-06/_C8A3916-Edit-web-1600.jpg?itok=LYCdTCZm 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/B_T_Palmquist_H_Helinsky_photo%201_1.jpg?itok=-NkKUZhb 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/Tira%20Palmquist.png?itok=fi0o8rC_ 1x, /sites/default/files/styles/profile_tint_small_2/public/user/Tira%20Palmquist.png?itok=0w3g2ojG 2x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2020-12/H%20Helinsky_40.jpg?itok=zTkBrX_A 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2020-12/H%20Helinsky_40.jpg?itok=eb4ZE8VE 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/B_U_Chaudhuri_photo%201_0.jpg?itok=kKZyl3DJ 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/Una%20Chaudhuri.png?itok=9I5VqLMo 1x, /sites/default/files/styles/profile_tint_small_2/public/user/Una%20Chaudhuri.png?itok=jsScGysl 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/E_K_Watt_Photo1_0.jpeg?itok=YjR9LIA3 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/KennWatt.png?itok=qgZ9xXeu 1x, /sites/default/files/styles/profile_tint_small_2/public/user/KennWatt.png?itok=snwCa9kR 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/B_C_Bilodeau_photo%201_0.jpg?itok=7nHPRjqD 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2023-06/_C8A3916-Edit-web-1600.jpg?itok=1ZwBL66O 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2023-06/_C8A3916-Edit-web-1600.jpg?itok=LYCdTCZm 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/B_W_Bilderback_photo%201_0.jpg?itok=zpwPIJsY 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/10255491_754803765607_1207190030316707920_n%20%281%29.jpg?itok=5Tbpzo2Y 1x, /sites/default/files/styles/profile_tint_small_2/public/user/10255491_754803765607_1207190030316707920_n%20%281%29.jpg?itok=euYQSxM3 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/B_M_LAKERVELD_PHOTO2.png?itok=YG36mZcP 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/Miranda%20Lakerveld.jpeg?itok=m1NEMHZ_ 1x, /sites/default/files/styles/profile_tint_small_2/public/user/Miranda%20Lakerveld.jpeg?itok=BxLrVH59 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/Screen%20Shot%202017-04-16%20at%206.13.45%20PM.png?itok=sINJcJcG 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2020-04/katie%20in%20scarf.png?itok=UFds0916 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2020-04/katie%20in%20scarf.png?itok=U-1td5tl 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/B_S_Kerley%20Schwartz_Photo2.png?itok=p9YcfTHW 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/skschwartz.png?itok=V23scozp 1x, /sites/default/files/styles/profile_tint_small_2/public/user/skschwartz.png?itok=MvBNdoCf 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/B_J_Levine_Photo2.png?itok=luUvM9jg 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/Julia%20Levine.png?itok=VExXWm3Y 1x, /sites/default/files/styles/profile_tint_small_2/public/user/Julia%20Levine.png?itok=iudpiHPj 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/E_E_Tilley_photo%201.jpg?itok=wVnTafAB 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/Elspeth%20Tilley.png?itok=UDxzXwnY 1x, /sites/default/files/styles/profile_tint_small_2/public/user/Elspeth%20Tilley.png?itok=w2hhW8si 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/B_S_Oliver_photo%202_0.jpg?itok=GxYodd_2 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/Sterling%20Oliver%20Headshot.jpg?itok=e-rshbc0 1x, /sites/default/files/styles/profile_tint_small_2/public/user/Sterling%20Oliver%20Headshot.jpg?itok=o7JJ1QoO 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/B_E_Mendelsohn_Photo2.jpg?itok=xW4uqJI9 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/Emily%20Mendelsohn.png?itok=PVaUWaq7 1x, /sites/default/files/styles/profile_tint_small_2/public/user/Emily%20Mendelsohn.png?itok=sNkaq-w0 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/B_J_Bates_photo%204.jpg?itok=9Y0kRnJd 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/jaisey%202.jpg?itok=Z0eupb2x 1x, /sites/default/files/styles/profile_tint_small_2/public/user/jaisey%202.jpg?itok=9gSQw9fI 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/E_P_Cizmar_photo%201.jpg?itok=3dMwP-Zh 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2023-10/Screen%20Shot%202023-10-26%20at%203.33.13%20PM_0.png?itok=aYZtGHvy 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2023-10/Screen%20Shot%202023-10-26%20at%203.33.13%20PM_0.png?itok=FFw8h1S6 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/B_S_Katzoff_photo%201_0.JPG?itok=32D-L3h4 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/Headshot_SaraKatzoff.jpg?itok=SM3WrNfk 1x, /sites/default/files/styles/profile_tint_small_2/public/user/Headshot_SaraKatzoff.jpg?itok=LAx-V_Vb 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/freytags_pyramid_1.png?itok=zqJrZm1M 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2023-06/_C8A3916-Edit-web-1600.jpg?itok=1ZwBL66O 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2023-06/_C8A3916-Edit-web-1600.jpg?itok=LYCdTCZm 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/B_E_Avila_Kitimat%20Photo1_0.jpg?itok=raS0fRqB 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/user-403.jpg?itok=vCNs9Fpb 1x, /sites/default/files/styles/profile_tint_small_2/public/user/user-403.jpg?itok=BOtnezbp 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/B_T_May_Photo-1.png?itok=6uFkyFwQ 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2019-07/portrait%20of%20TM.jpg?itok=9nxNL7Ce 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2019-07/portrait%20of%20TM.jpg?itok=P3ivGK6k 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/B_A_Majumbar_PHOTO%201_0.jpg?itok=LVLz2ylj 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/AbhishekMajumdarPic1_0.jpg?itok=CswiDd0s 1x, /sites/default/files/styles/profile_tint_small_2/public/user/AbhishekMajumdarPic1_0.jpg?itok=U4_yW9Ji 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/B_N_Gray_Photo3.jpg?itok=tyxTGB_U 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/Nelson%20Gray.png?itok=_BrbGHpX 1x, /sites/default/files/styles/profile_tint_small_2/public/user/Nelson%20Gray.png?itok=UdOVm53P 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/E_U_Chaudhurit_photo3.jpg?itok=gb8L_8h_ 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/Una%20Chaudhuri.png?itok=9I5VqLMo 1x, /sites/default/files/styles/profile_tint_small_2/public/user/Una%20Chaudhuri.png?itok=jsScGysl 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/E_K%20Fanconi_Photo2_0.jpeg?itok=Q1odpIlW 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/Photo%20on%202015-07-14%20at%2010.31.jpg?itok=_IWlGn_r 1x, /sites/default/files/styles/profile_tint_small_2/public/user/Photo%20on%202015-07-14%20at%2010.31.jpg?itok=bMCZSNmD 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/B_A_Carey_Photo%201.jpg?itok=n7MN3Ktq 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2021-12/alison-carey.jpeg?itok=nt7x1zLh 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2021-12/alison-carey.jpeg?itok=22dWAoV9 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/B_I_Burton_Photo2.jpg?itok=0GXlJM4h 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/Ian%20Burton.png?itok=MXRsvW67 1x, /sites/default/files/styles/profile_tint_small_2/public/user/Ian%20Burton.png?itok=Jye79ybD 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/E_I%20Garrett_Photo1.jpeg?itok=ou0YWBn3 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/Ian%20Garrett%20Headshot-4-2014.jpg?itok=Q2fRngDR 1x, /sites/default/files/styles/profile_tint_small_2/public/user/Ian%20Garrett%20Headshot-4-2014.jpg?itok=DBDSa7a8 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/E_C%20Svich_Photo2.jpg?itok=RhKLN4dI 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/Caridad%20Svich%20photo%20by%20Jody%20Christopherson-5_edited.jpg?itok=0mbGnP2h 1x, /sites/default/files/styles/profile_tint_small_2/public/user/Caridad%20Svich%20photo%20by%20Jody%20Christopherson-5_edited.jpg?itok=T4wjpqyd 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/B_S_Hilfinger_Photo%201.jpg?itok=7uuiScq7 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/Sharmon%20Hilfinger.png?itok=UfXbudLo 1x, /sites/default/files/styles/profile_tint_small_2/public/user/Sharmon%20Hilfinger.png?itok=_qcrR8wz 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/B_N_Slie_Photo%202.jpeg?itok=JVDp7KaZ 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2024-02/Slie-Nick-500x750.jpg?itok=x0FQXh0y 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2024-02/Slie-Nick-500x750.jpg?itok=zLzlMyca 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/B_C_Bilodeau_Photo-1.png?itok=gqpB9-Ij 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2023-06/_C8A3916-Edit-web-1600.jpg?itok=1ZwBL66O 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2023-06/_C8A3916-Edit-web-1600.jpg?itok=LYCdTCZm 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/B_J_Sokolove_Photo%201_0.jpeg?itok=Fv2D-DjM 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/Jennifer%20Sokolove.jpeg?itok=LCFsGbuf 1x, /sites/default/files/styles/profile_tint_small_2/public/user/Jennifer%20Sokolove.jpeg?itok=oK0AzHkU 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/B_M_Royeng_Photo%203.jpeg?itok=WyVXSzRG 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/Marte%20R%C3%B8yeng.jpeg?itok=5iOa06BK 1x, /sites/default/files/styles/profile_tint_small_2/public/user/Marte%20R%C3%B8yeng.jpeg?itok=ETvAbkRa 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/E_E-Doud_We-are-Doing-It-2015-Photo-3-by-Giovanni-Luquini_43.png?itok=ZLrMltG- 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/Elizabeth%20Doud.JPG?itok=kZYfhRvi 1x, /sites/default/files/styles/profile_tint_small_2/public/user/Elizabeth%20Doud.JPG?itok=7rmHbyYz 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/B_J_Pickard_Photo-2_1000px_4_3.png?itok=IcbkQ27h 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/Jeremy%20Pickard.jpg?itok=tnfKlCZl 1x, /sites/default/files/styles/profile_tint_small_2/public/user/Jeremy%20Pickard.jpg?itok=1mC3At84 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/B_T_Beer_Photo-2_43_Featured.png?itok=zE6TqaN0 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/Tanja%20Beer.jpg?itok=GQ91yr_J 1x, /sites/default/files/styles/profile_tint_small_2/public/user/Tanja%20Beer.jpg?itok=_IFwqNmx 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/B_S_Sunde_Photo-3_43.png?itok=0Hx6Z73x 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2023-11/20171010_Sarah_Cameron_Sunde_Geoff-Green_0115.jpg?itok=qCAtzuhU 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2023-11/20171010_Sarah_Cameron_Sunde_Geoff-Green_0115.jpg?itok=1KLvzEhw 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/B_A_Mitchell_Photo%201_0.jpg?itok=khg0ucUT 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/user/Alanna%20Mitchell.jpg?itok=jMVj41To 1x, /sites/default/files/styles/profile_tint_small_2/public/user/Alanna%20Mitchell.jpg?itok=8nazYs-H 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/earth_nasa_43.png?itok=XLFhgK37 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2018-11/HowlRound-graphic-inverted%20%281%29.jpg?itok=ya1dFG45 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2018-11/HowlRound-graphic-inverted%20%281%29.jpg?itok=5A77FRMf 2x",
"https://howlround.com/sites/default/files/styles/650w_x_366h/public/J_C_Bilodeau_Photo-4_.png?itok=8KPzDQdD 1x",
"https://howlround.com/sites/default/files/styles/profile_tint_small/public/pictures/2023-06/_C8A3916-Edit-web-1600.jpg?itok=1ZwBL66O 1x, /sites/default/files/styles/profile_tint_small_2/public/pictures/2023-06/_C8A3916-Edit-web-1600.jpg?itok=LYCdTCZm 2x",
"https://howlround.com/themes/custom/howlround/logo.svg"
] |
[] |
[] |
[
""
] | null |
[] | null |
|The climate crisis has been called a “crisis of imagination.” The phrase refers to our inability to grasp the magnitude and violence of the changes we are facing, our reluctance to let the reality of it permeate our collective consciousness, and our resistance to envision positive futures. But imagination is the currency of artists. In this ongoing series, Chantal Bilodeau, playwright and artistic director of the Arts & Climate Initiative, invites theatre artists, practitioners, and scholars to reflect on the ways in which they use their imagination to create the stories that will support us through, and lift us out of, this transformative moment.
|
en
|
/themes/custom/howlround/favicon.ico
|
HowlRound Theatre Commons
|
https://howlround.com/series/theatre-age-climate-change
|
The climate crisis has been called a “crisis of imagination.” The phrase refers to our inability to grasp the magnitude and violence of the changes we are facing, our reluctance to let the reality of it permeate our collective consciousness, and our resistance to envision positive futures. But imagination is the currency of artists. In this ongoing series, Chantal Bilodeau, playwright and artistic director of the Arts & Climate Initiative, invites theatre artists, practitioners, and scholars to reflect on the ways in which they use their imagination to create the stories that will support us through, and lift us out of, this transformative moment.
|
||||
692
|
dbpedia
|
1
| 0 |
https://en.wikisource.org/wiki/The_Part_Taken_by_Women_in_American_History/Playwrights_and_Authors
|
en
|
The Part Taken by Women in American History/Playwrights and Authors
|
https://en.wikisource.org/static/favicon/wikisource.ico
|
https://en.wikisource.org/static/favicon/wikisource.ico
|
[
"https://upload.wikimedia.org/wikipedia/commons/thumb/e/e0/The_part_taken_by_women_in_American_history_-_p842.png/400px-The_part_taken_by_women_in_American_history_-_p842.png",
"https://login.wikimedia.org/wiki/Special:CentralAutoLogin/start?type=1x1",
"https://en.wikisource.org/static/images/footer/wikimedia-button.svg",
"https://en.wikisource.org/static/images/footer/poweredby_mediawiki.svg"
] |
[] |
[] |
[
""
] | null |
[] | null |
en
|
/static/favicon/wikisource.ico
|
https://en.wikisource.org/wiki/The_Part_Taken_by_Women_in_American_History/Playwrights_and_Authors
|
Playwrights.
At the organization of the Women's Playwright Club, of New York City, there were forty women eligible for admission. This vocation for women is especially an American institution. In no other country are there so many who have obtained recognition in a field where the compensation is the same for women as for men. The New Theatre when opened made its bow to the public with a play from the pen of an American woman.
Mary Hunter Austin, the newest woman dramatist, has spent the greater part of her life in the West, and many of her plays deal with the border life.
Margaret Mayo is another successful playwright, who was the author of "Baby Mine" and "Polly of the Circus," two of the biggest New York successes. In private life Miss Mayo is the wife of Edgar Selwyn, a successful writer and playwright of distinction. He is the author of "The Country Boy."
Kate Douglas Wiggin, whose writings we are all familiar with, dramatized her "Rebecca of Sunnybrook Farm."
Charlotte Thompson made a most successful dramatization of "The Awakening of Helena Richie," in which Margaret Anglin starred.
Another successful playwright is the author of "The Nest Egg"—Anne Caldwell, who has been an actress, opera singer, musician, composer, magazine and newspaper writer.
The music of "The Top of the World" is her composition, position.
Another talented writer of plays is Rida Johnson Young, who in five years has successfully produced "Brown of Harvard," 'The Boys of Company B," "Glorious Betsey," "The Lottery Man," as well as two plays for Chauncey Olcott. One of the New York successes, "Naughty Marietta," was written by her, Victor Herbert writing the music. Mrs. Young is the wife of Mr. James Young, leading man, who has appeared with E. H. Sothern. He was formerly a newspaper man on the staff of a daily newspaper of Baltimore, Md. Mrs. Young before her marriage was Rida Johnson.
Lottie Blair Parker is another successful professional woman, whose husband, Harry Doel Parker, attends entirely to the production and the leasing of her plays. "Way Down East," written in 1897, is still being played throughout the country. "Under Southern Skies" is another one from her pen. Among others by this same author are "A War Correspondent," "The Lights of Home," a dramatization of "The Redemption of David Corson," a number of one-act plays, and a novel entitled "Homespun."
Miss Alice Ives, the author of "The Village Postmaster," has done every phase of literary work, art criticisms, music notes, deep articles for the Forum and similar magazines, as well as some light verse. She has written ten plays. "The Village Postmaster" was on the road for ten successive seasons. Miss Ives wrote a clever one-act play, a satire on women's clubs, introducing all the famous women characters of popular plays. She is the first vice-president of the Society of Women Dramatists, to which all these playwrights belong.
The pioneer playwright of her sex is Miss Martha Morton. Some dozen years ago, the New York World offered prizes for the cleverest scenarios to be submitted under assumed names. It was a general surprise when a woman secured one of the prizes. This successful person was Miss Morton. Some of the most distinguished American actors have appeared in her plays, the best known of which are, "Brother John," "His Wife's Father," and "A Bachelor's Romance." Miss Morton was the first vice-president of the Society of Dramatic Authors. Off the stage she is Mrs. Herman Conheim, and is one of the most popular dramatists in New York City.
Another successful prize winner, who ultimately made this her profession, was Mrs. Martha Fletcher Bellinger, a graduate of Mount Holyoke. The title of her scenario was "A Woman's Sphere."
Mrs. Mary Rider Mechtold, also a college woman and successful winner of newspaper prizes, wrote her first plays when she was still a student at the Chicago University. She is the author of a clever play, "The Little Lady."
The thousand-dollar prize offered by the Shakespeare Memorial Theatre in England a year or two ago was won by an American woman, Josephine Preston Peabody. The contest for the best play in English verse dealing with a romantic subject was won by a graduate of Radcliffe. It is said that this college has long been famous for its unusually clever plays, in which its students take part.
Beulah Dix is also a graduate of Radcliffe. She was author of "Hugh Gwyeth." She collaborated with Evelyn Greenleaf in a number of successful plays, "The Rose o' Plymouth Town," and "The Road to Yesterday."
Another Radcliffe graduate, who has become a successful playwright, is Agnes Morgan, who wrote "When Two Write History."
Another is Rebecca Lane Hooper. Miss Hooper not only stages these performances herself, but has often played comedy roles.
The exception to the rule of directors for theatrical performances, which are usually men, is Miss Edith Ellis, author of "Mary Jane's Pa," one of the most successful plays produced. She began her career as a child actress. She is one of the few successful stage managers, and has frequently strengthened lines in places and made a possible success from what seemed an inevitable failure.
Rachel Crothers is another who supervises much of the rehearsing of her own plays. She began her authorship of plays while a teacher in the Wheatcroft School of Acting. Among her plays are "The Coming of Mrs. Patrick," "Myself Bettina," and "The Inferior Sex," which were written for Maxine Elliott. "The Man on the Box" was dramatized by Grace Livingston Furniss, who with the late Abby Sage Richardson dramatized "The Pride of Jennico." Since then she has written a number of other plays, including, "Mrs. Jack," "The Colonial Girl," and "Gretna Green."
Frances Hodgson Burnett writes her books and then dramatizes them. This she has done most successfully in the case of "Little Lord Fauntleroy," "The Little Princess," "A Lady of Quality," "That Lass o' Lowries," "The Pretty Sister of Jose," and "The Dawn of a To-morrow."
Harriet Ford has successfully dramatized many books, among them: "The Gentleman of France," "Audrey," and with Mr. Joseph Medill Patterson, she wrote the most successful play of last season (1910-1911), "The Fourth Estate." This play brought forth more favorable comment and discussion from the press than any other produced.
Miss Mary Roberts Rinehart has written three plays, two of which were in co-authorship, "Double Life," "The Avenger," and "Seven Days." Her husband, Dr. Stanley Rinehart, contributed to "The Avenger," and Avery Hapgood to "Seven Days." This was one of the season's successes.
Two successful playwrights, Pauline Phelps and Marion Short, have formed a partnership and turned out a number of most successful plays. Miss Phelps, a country girl, deals with life in the country, and Miss Short, with city life and its problems. Their greatest success is "The Grand Army Man," in which David Warfield starred last season. They are also the authors of "The Girl from Out Yonder," "At Cozy Corners," "Sweet Clover," the latter used largely for stock companies.
Anne Warner's "Rejuvenation of Aunt Mary" is familiar to everyone.
Frances Aymar Matthews, as well as being a successful dramatist, is a writer of poetry and books. One of her plays, "Julie Bon Bon," was starred by Clara Lipman.
Among others that may be mentioned are : Cora Maynard, Kate Jordan, and Mrs. Doremus.
MARY W. CALKINS.
Miss Calkins is head of the Department of Philosophy and Psychology at Wellesley College. She was born in Hartford, Connecticut, in 1863, and is the daughter of Wolcott and Charlotte Grosvenor Whiton Calkins. Miss Calkins is a graduate of Smith College of the Class of 1885, where she received the degrees of A.B. and A.M. She has written several books on psychology and numerous monographs and papers on psychological and philosophical questions.
VIDA D. SCUDDER.
Miss Scudder is to-day professor of English at Wellesley College and a well-known writer on literary and social topics. She was born in Southern India, December 15, 1861, and is the daughter of David Coit and Harriet L. Dutton Scudder. She received the degree of A.B. at Smith College in 1884 and that of A.M. in 1889, graduated at Oxford and Paris, and was the originator of the College Settlement in New York City. She is the author of "The Life of the Spirit in Modern English Poets," "Social Ideals in English Letters," "Introduction to the Study of English Literature" and "Selected Letters of Saint Catherine," and was the editor of Macaulay's "Lord Give," and also of the introduction to the writings of John Ruskin, Shelly's "Prometheus Unbound," works of John Woolman and Everybody's Library.
HANNAH ADAMS.
Miss Adams is believed to be the first woman in the United States to make literature a profession. She was born in Medfield, Massachusetts, in 1755, and died in Brookline, Mass., November 15, 1832. She was the daughter of a well-to do farmer, of good education and culture. In her childhood she was very fond of writing and a close student, memorizing the works of Milton, Pope, Thomson, Young and others. She was a good Latin and Greek scholar and instructed divinity students who made their home in her family. In 1772, her father losing his property, the children were forced to provide for themselves. During the Revolutionary War, Miss Adams had taught school and after the close of the war she opened a school to prepare young men for college, which was very successful. She wrote quite extensively. One of her books, "A View of Religious Opinions" appeared in 1784, and passed through several editions in the United States and was also published in England and became a standard work. In 1799 she published her second work, "A History of England," and in 1801 "Evidences of Christianity." In 1812, her "History of the Jews" appeared, being followed by "A Controversy with Dr. Morse," and in 1826 "Letters on the Gospels." She spent a quiet, secluded life, and it is said her only journeys were trips from Boston to Nahant and from Boston to Chelmsford. Notwithstanding the many books which she published, her business abilities seemed to have been very limited and in the last years of her life she was supported by an annuity settled upon her by three wealthy residents of Boston. She was buried at Mount Auburn, being the first person buried in that beautiful cemetery.
LYDIA MARIA CHILD.
Lydia Maria Francis was born in Medford, Massachusetts, February II, 1802. Her ancestor, Richard Francis, came from England in 1636 and settled in Cambridge, where his tombstone may be still seen in the burial ground. Her paternal grandfather, a weaver by trade, was in the Concord fight. Her father, Convers Francis, was a baker, first in West Cambridge, then in Medford, where he first introduced the article of food still known as "Medford crackers." He was a man of strong character and great industry. Though without much cultivation he had an uncommon love of reading and his anti-slavery convictions were deeply rooted and must have influenced his child's later career. He married Susanah Rand, of whom it is only recorded that "She had a simple, loving heart and a spirit busy in doing good." They had six children of whom Lydia Maria was the youngest. While her brother Convers was fitting for college she was his faithful companion, though more than six years younger. They read together and she was constantly bringing him Milton and Shakespeare to explain so that it may well be granted that the foundation of Miss Lydia's intellectual attainments was laid in this companionship. Apart from her brother's help the young girl had, as was then usual, a very subordinate share of educational opportunities, attending only the public schools with one year at the private seminary of Miss Swan, in Medford. In 1819 Convers Francis was ordained for the first parish, in Watertcwn, and there occurred in his city, in 1824, an incident which was to determine the whole life of his sister. Doctor G. G. Palfrey had written in the North American Review, for April, 1821, a "Review" of the now forgotten poem of "Yamoyden," in which he ably pointed out the use that might be made of early American History for the purpose of fictitious writing. Miss Francis read this article at her brother's house one summer Sunday morning. Before attending afternoon service she wrote the first chapter of a novel. It was soon finished and was published that year, then came "Hobomak," a tale of early times.
In juding of this little book it is to be remembered that it marked the very dawn of American imaginative literature. Irving had printed only his "Sketchbook"; Cooper only "Precaution." This new production was the hurried work of a young woman of nineteen, an Indian tale by one who had scarcely even seen an Indian. Accordingly "Hobomak" now seems very crude in execution, very improbable in plot and is redeemed only by a sincere attempt at local coloring.
The success of this first effort was, however, such as to encourage the publication of a second tale in the following year. This was "The Rebels; The Boston before the Revolution, by the Author of Hobomak." It was a great advance on its predecessor, and can even be compared, favorably, with Cooper's Revolutionary novels.
In October, 1828, Miss Francis married David Lee Child, a lawyer of Boston. In that day it seemed to be held necessary for American women to work their passage into literature by first completing some kind of cookery book, so Mrs. Child published in 1829 her "Frugal Housewife," a book which proved so popular that in 1855 it had reached its thirty-third edition.
The "Biographies of Good Wives" reached a fifth edition in the course of time as did her "History of Woman," and in 1833 Mrs. Child was brought to one of those bold steps which made successive eras of her literary life—the publication of her "Appeal for that Class of Americans called Africans." It was just at the most dangerous moment of the rising storm of the slavery question that Mrs. Child wrote this and it brought down upon her unending censure. It is evident that this result was not unexpected for the preface to the book explicitly recognizes the probable dissatisfaction of the public. She says, "I am fully aware of the unpopularity of the task I have undertaken; but though I expect ridicule and censure, I cannot fear them. Should it be the means of advancing, even one single hour, the inevitable progress of truth and justice, I would not exchange the consciousness for all Rothschild's wealth or Sir Walter's fame." These words have in them a genuine ring; and the book is really worthy of them. The tone is calm and strong, the treatment systematic, the points well put, the statements well guarded.
It was the first anti-slavery work ever printed in America and it appears to be the ablest, covering the whole ground better than any other. During the next year she published the "Oasis," also about this time appeared from her hand the "Anti-slavery Catechism" and a small book called "Authentic Anecdotes of American Slavery."
While seemingly absorbed in reformatory work she still kept an outlook in the direction of pure literature and was employed for several years on "Philothea," which appeared in 1836. The scene of this novel was laid in Greece, and in spite of the unpopularity that Mrs. Child's slavery appeal had created it went through three editions.
In 1841 Mr. and Mrs. Child were engaged by the American Anti-Slavery Standard, a weekly newspaper published in New York. Mr. Child's health being impaired his wife undertook the task alone and conducted the newspaper in that manner for two years, after which she aided her husband in the work, remaining there for eight years. She was a very successful editor. Her management proved efficient while her cultivated taste made the Standard pleasing to many who were not attracted by the plainer fare of the Liberator. During all this period she was a member of the family of the well-known Quaker philanthropist, Isaac T. Hopper, whose biographer she afterwards became. This must have been the most important and satisfactory time in Mrs. Child's whole life. She was placed where her sympathetic nature found abundant outlet and earnest co-operation. Here she also found an opportunity for her best eloquence in writing letters to the Distant Courier. This was the source of "Letters from New York," that afterwards became famous. They were the precursors of that modern school of newspaper correspondence in which women now have so large a share, and which has something of the charm of women's private letters.
Her last publication, and perhaps her favorite among the whole series, appeared in 1867—"A Romance of the Republic." It was received with great cordiality and is in some respects her best fictitious work. In later life Mrs. Child left New York and took up her abode in Wayland, Massachusetts. She outlived her husband six years and died October 20, 1880.
ALMIRA LINCOLN PHELPS.
There were but two among all the early distinguished literary women of America who had the honor of being members of the American Association for the advancement of science, and these two women were Maria Mitchell and Almira Lincoln Phelps,—one from the North and one from the South. Mrs. Phelp's father, Samuel Harte, was a descendant of Thomas Hooker, the first minister of Hartford and founder of Connecticut. She was the youngest child and was born in Berlin, Connecticut, in 1793, educated at Pittsfield, Massachusetts, and later married to Simeon Lincoln, editor of the Connecticut Mirror, in Hartford. She was early left a widow with two children. Finding the estates of both her husband and father insolvent, she took up the study of Latin and Greek, the natural sciences, art of drawing and painting, in order to perfect herself for the work which she had in comtemplation, namely, the education of the young. She was a student under Miss Willard for seven years. In 1831, she married Honorable John Phelps, a distinguished lawyer and statesman of Vermont. In 1839 she accepted a position at the head of the female seminary at West Chester, Pennsylvania. In 1841 she and her husband established the Patapsco Female Institute of Maryland. Pupils came to them from all parts of the West and South. In 1849 she was again left a widow. In 1855 her daughter's death so saddened her that she resigned her position and removed to the city of Baltimore. Her best known works are: "Lectures on Botany," "Botany for Beginners," "Lectures on Chemistry." "Chemistry for Beginners," "Lectures on Natural Philosophy," "Philosophy for Beginners," "Female Students," "A Fireside Friend," "A Juvenile Story," "Geology for Beginners," "Translation of the Works of Benedicte de Saussure," "Progressive Education," with a mothers' journal by Mrs. Willard and Mrs. Phelps, "Ada Norman, or Trials and Their Uses," "Hours with My Pupils," and "Christian Households." She probably had as much to do with the education of the young of this country as any woman, her works having been largely used in the schools.
SARAH BUELL (MRS. DAVID HALE).
Author and magazine editor, was born in Newport, New Hampshire. When a young girl, the first regular novel she read was "Mysteries of Udolpho," which, noting it was written by a woman, awakened in her an ardent desire to become an author herself. Her first work, however, was a small volume of fugitive poetry ; then "Northward," in two volumes. Her first novel was issued in 1827. Afterwards she was given charge of the editorial department of the Lady's Magazine, then published in Boston. In 1837 the Lady's Magazine united with the Lady's Book, published by Godey, in Philadelphia, and in 1841 Mrs. Hill removed to that city editing the double magazine. She has written a large number of books. The most notable of these are "Sketches of American Character," "Traits of American Life," "Flora's Interpreter," "The Lady's Wreath," a selection from the familiar poets of England and America; "The Way to Live Well and be Well While You Live," "Grosvenor," "Alice Ray," a romance in rhyme; "Harry Guy," "The Widow's Son," a story of the sea; "Three Hours or Vigils of Love," and other poems, and, finally, "Woman's Regret."
LYDIA HUNTLY SIGOURNEY.
Born in Norwich, Connecticut, September 1, 1791, and died in Hartford, Connecticut, June 10, 1865; was the daughter of Ezekiel Huntly, a soldier of the Revolution. It is said that she wrote verses at the age of seven. She taught a private girls' school in Hartford for five years, and in 1815 published her first volume "Moral Pieces in Prose and Verse." In 1819 she became the wife of Charles Sigourney, a gentleman of literary and artistic tastes, a resident of Hartford. After her marriage she devoted herself to literature. She wrote forty-six separate works, besides two thousand articles, which she contributed to about three hundred periodicals. She was a favorite poetess in England and France, as well as in her own country. Mrs. Sigourney was always an active worker in charity and philanthropy. Her best known works are "Letters to Young Ladies," "Pocahontas, and Other Poems," and "Pleasant Memories of Pleasant Lands."
LUCRETIA MARIA DAVIDSON.
Lucretia Maria Davidson was born in Plattsburg, New York, September 27, 1808, and was the daughter of Dr. Oliver Davidson, a lover of science. Her mother, Margaret Davidson, whose maiden name was Miller, came of a good family and had received the best education that times afforded at the school of the celebrated Scotch lady, Isabella Graham, in New York City. The family of Miss Davidson lived in seclusion. Their pleasures were intellectual. Her mother suffered for years from ill health. Miss Davidson was delicate from infancy. When eighteen months old, she suffered from typhus fever which threatened her life. Her first literary acquisition indicated her after course. Her application to her studies at school was intense. Her early poems were of great merit. While devoting her time and attention to her invalid mother, she wrote many beautiful poems, the best known of which is her "Amir Khan" and a tale of some length called "The Recluse of Saranac." "Amir Khan" has long been before the public. Its versification is graceful and the story of orientalism beautifully developed and well sustained; as a production of a girl of fifteen it is considered prodigious. Many of her poems are addressed to her mother. "The Fear of Madness" was written by her while confined to her bed and was the last piece she ever wrote. The records of the last scenes of Lucretia Davidson's life are scanty. Her poetical writings which have been collected amount in all to 278 pieces of various length. The following tribute paid her by Mr. Southey is from the London Quarterly Review, whose scant praise of American productions is well known. "In these poems ("Amir Khan," etc.) there is enough of originality, enough of aspiration, enough of conscientious energy, enough of growing power to warrant any expectations, however sanguine, which the patron and the friends and parents of the deceased could have formed." Her death occurred August 27, 1825, in Plattsburg, New York.
JULIA WARD HOWE.
Few women of America enjoy greater fame than Julia Ward Howe, the author of the "Battle Hymn of the Republic." She can be classed as an essayist, poetess, philanthropist, and public speaker. She was born in New York City, May 27, 1819. Her parents were Samuel and Julia Cuttler Ward. She included among her ancestors some of the descendants of the Huguenots, the Marions of South Carolina, Governor Sam Ward of Rhode Island, and Roger Williams, the apostle of religious tolerance. Her father being a banker and a man of means gave her every advantage of education and accomplishment. In 1843 she married Dr. Samuel Gridley Howe, and they spent some time abroad. In 1852 she published her first volume of poems; in 1853 a drama in blank verse, and during the war other works and patriotic songs. In 1867 while she and her husband were visitors in Greece they won the affection and gratitude of the people by aiding them in their struggle for national independence. In 1868 she took an active part in the suffrage movement. She preached, wrote and lectured for many years. She died in the summer of 1910, but her fame will ever be linked with the "Battle Hymn of the Republic."
LOUISA M. ALCOTT.
No name is more beloved among the girls of America of former days and present times than that of Louisa May Alcott, the author of "Little Women," a book dear to the heart of every American girl. Miss Alcott was born in Germantown, Pennsylvania, November 29, 1832. Her parents were charming, cultivated people. Her father, Amos Bronson Alcott, became a teacher. He taught in Boston for eleven years, Margaret Fuller being one of his assistants. The atmosphere of the Alcott home was always one of culture and refinement, though their life was one of extreme simplicity. Whittier, Phillips, Garrison, Mrs. Hawthorne, Emerson, Thoreau and Oliver Wendell Holmes were frequent guests. Louisa was the eldest child, full of activity and enthusiasm, constantly in trouble from her frankness and lack of policy, but enjoying many friends from her generous heart, and it has not been difficult to recognize the picture of herself in the character of Joe in "Little Women." In this little home in Concord were enacted many of the scenes, sports and amusements pictured in Miss Alcott's stories. At sixteen she began to teach school, having but twenty pupils, and to these she told many of the stories which were later woven into her books. Her restless disposition gave her many occupations; sometimes she acted as a governess, sometimes she did sewing, and again writing. At nineteen she published one of her early stories in Gleason's Pictorial. For this she received five dollars. Later appeared "The Rival Prima Donna," and though she received but ten dollars for this, the request from the editor for another story was more to her than a larger check would have been. Another story appeared in the Saturday Evening Gazette. This was announced in the most sensational way by means of large yellow posters which spread terror to Miss Alcott's heart. Finding, however, that sensational stories paid, she turned them out at the rate of ten or twelve a month. But she soon tired of this unstable kind of fame, and she began work upon a novel which appeared under the name of "Moods" but was not a success. At this time the Civil War broke out. She offered herself as a nurse in the hospitals and was accepted, just after the defeat at Fredericksburg. After a time she became ill from overwork and was obliged to return home, and in 1865 published her hospital sketches, which made it possible for her to take a rest by a trip to Europe. Here she met many of the distinguished writers of her day. In 1868 her father submitted a collection of her stories to her publishers who declined them, and asked for a single story for girls, which was the occasion for the writing of "Little Women." It was simply the story of herself and her three sisters and she became at once famous. Girls from all over the country wrote her. When "Little Men" was announced, fifty thousand copies were ordered in advance of its publication. Among her other stories are those entitled, "Shawl Straps," "Under the Lilacs," "Aunt Jo's Scrap-Bag," "Jack and Jill," and the greatest after "Little Women," "An Old-Fashioned Girl." Most of her stories were written in Boston and depict her life in Concord. Miss Alcott's devotion to her sex made her a strong supporter of the women's suffrage movement, no one has done more for the women of her own generation than she. The pleasure which her books have given, and will ever continue to give, make her one of the most beloved of our American literary women. Miss Alcott died in Boston, March 6, 1888.
MARY VIRGINIA TERHUNE.
Mrs. Terhune is more familiar to the public under the pen name of "Marion Harland." She was born December 21, 1831, in Amelia County, Vir ginia, her father Samuel P. Hawes, having removed there from Massachusetts. In 1856 she was married to Rev. E. P. Terhune, and since 1859 has lived in the North, but her stories have dealt largely with Southern life. She wrote her book "The Story of Mary Washington" to get funds to aid in the effort to erect a monument to the mother of Washington, which was unveiled on May 10, 1894. She has been a most industrious writer. Among her works are "Alone," "Nemesis," "The Hidden Path," "Miriam," "Husks," "Husbands and Home," "Sunnybank," "Helen Gardner's Wedding Day," "At Last," "The Empty Heart," "Common Sense in the Household." Her novel "Sunnybank" was very severely criticised by Southern editors, when it appeared soon after the Civil War. Mrs. Terhune's younger brothers were in the Confederate Army.
Mrs. Terhune has three children, with all of whom she has collaborated in literary work.
ELIZABETH STUART PHELPS WARD.
Mrs. Ward was born in Andover, Massachusetts, August 31, 1844, and inherited literary talent from both of her parents. Her mother was the writer of a number of stories for children, and her father, Rev. Austin Phelps, a professor of sacred rhetoric in the Theological Seminary of Andover, was the writer of many lectures which in book form have become classics and to-day are accepted text-books. At the age of thirteen Mrs. Ward made her first literary venture in a story which was accepted by the Youths' Companion. Her first novel, "Gates Ajar," 1869, met with unprecedented success. In 1888, she married Rev. Herbert D. Ward, and with him has written several novels, the most important of which are, "The Last of the Magicans," "Come Forth," "A Singular Life," and what she regards as her most important work, "The Story of Jesus Christ," which appeared in 1897. Some of Mrs. Ward's books are, "Ellen's Idol," "Up Hill," "A Singular Life," "The Gipsy Series," "Mercy Glidden's Works," "I Don't Know How," "Men, Women and Ghosts," "The Silent Partner," "Walled In," "The Story of Avis," "My Cousin and I," "The Madonna of the Tubs," "Sealed Waters," "Jack, the Fisherman," "The Master of Magicians," and many sketches, stories and poems for magazines.
FRANCES HODGSON BURNETT.
Was born in Manchester, England, November 24, 1849. Her father was a well-to-do merchant. He died when she was but ten years old. Soon after his death the family removed to Tennessee to reside with an uncle. They settled in Knoxville, but her uncle having lost everything by the war, they made their home in the country and experienced the greatest poverty. Her mother's health failed under these trying conditions, and she died about two years after. Frances Hodgson obtained a position as school teacher, receiving her pay in flour, bacon, eggs and potatoes. She had early shown much talent in story writing, and at thirteen she wrote quite a creditable story, which her sister insisted on sending to a publisher. The only difficulty in the way of accomplishing this was how to procure the necessary postage, and a basket of wild grapes was sold by these
DISTINGUISHED WOMEN POETS.
two girls to pay for the mailing of the manuscript to Ballon's Magazine. As the publisher did not wish to pay for the printing of the story, which he had complimented in his letter to Frances, it was returned and sent to Godey's Ladies' Book, and from this source she received her first remuneration. Later she became a regular contributor to Peterson's Magazine and the publication of "Mrs. Carruther's Engagement" and another story entitled "Hearts and Diamonds" fixed the author's vocation. In 1873, she married Swan Moses Burnett. They had two children, the heroes of "Little Lord Fauntleroy," Mrs. Burnett's most famous story. The one named Lionel died in Paris, Vivian was the little Lord Fauntleroy of her story. "That Lass o' Lowrie's," "Pretty Polly Pemberton," "The Fair at Grantley Mills," "A Fair Barbarian" and "A Lady of Quality," are some of Mrs. Burnett's novels. Among her plays are : "Little Lord Fauntleroy," "The First Gentleman of Europe" and "A Lady of Quality." Her work has brought to Mrs. Burnett quite a handsome fortune. She now makes her home in England.
SARAH ORNE JEWETT.
Was born in South Berwick, Maine, on September 3, 1849. Her father was Dr. Theodore Herman Jewett, a physician, and her mother was the daughter of Dr. Perry of Exeter, also a prominent physician of that section of New England. Most of the characters and life of the people in her story have been taken from the simple New England life about the little village of Berwick. She frequently went about with her father on his errands of mercy and through these was enabled to gain much data for her stories. Her father was the hero of "A Country Doctor" from her pen. She first wrote short stories for the Atlantic Monthly, and it is said was but fourteen years of age when she wrote "Lucy Garron's Lovers." Her first great success was "Deephaven" which appeared in 1877. Lowell and Whittier were among her friends and admirers as a writer. Whittier attended the Friends' meeting in Berwick, and it was here Miss Jewett met him. The old sea-faring life of these New England towns has been preserved to us by Miss Jewett. Her grandfather was a sea captain, and in his home she met and enjoyed the companionship and heard the tales of this old sea captain's friends. Miss Jewett died in 1909.
MRS. BURTON HARRISON.
Was before her marriage Constance Cary, of Virginia, and on her father's side she is descended from Colonel Miles Carey of Devonshire, England, who emigrated to America and settled in Virginia about the middle of the seventeenth century, and during the rule of Sir William Berkeley was one of the king's council. Her father, Archibald Cary, of Cary's Brook, Virginia, was the son of Virginia Randolph, who was the ward and pupil of Thomas Jefferson and sister of his son-in-law, Thomas Mann Randolph. Her mother was the youngest daughter of Thomas Fairfax, Baron of Cameron, who resided upon a large plantation in Fairfax, Virginia. It is said Mrs. Harrison inherits her literary taste from her grandmother on her father's side, Mrs. Wilson Jefferson Cary, who was herself a writer, and whose father's writings exerted quite an influence over Thomas Jefferson. Mrs. Harrison's first story was written when she was but seventeen years of age. The Civil War brought an end to her literary aspirations and the loss of her home necessitated her mother and herself living abroad for some years. After her return to this country she married Burton Harrison, a prominent member of the New York Bar. Charles A. Dana was a great friend of Mrs. Harrison and gave her the agreeable task of editing "Monticello Letters," and from this she gleaned the matter which was the basis of her story, "The Old Dominion." Some of the stories that she has written are : "Helen of Troy," "The Old-Fashioned Fairy Book," "Short Comedies for American Players," a translation; "The Anglomaniacs," "Flower-de-Hundred," "Sweet Bells Out of Tune," "A Bachelor Maid," "An Errant Wooing," "A Princess of the Hills," "A Daughter of the South." Mrs. Harrison resides in New York, and is still busy with her pen.
MARY N. MURFREE.
"Charles Egbert Craddock."
For several years of her early literary life both publishers and public were in ignorance of the fact that she was a woman. She was born at Grantsland, near Murfreesborough, Tennessee, in 1850, at the family home, which had been inherited from her great-grandfather, Colonel Hardy Murfree, a soldier of the Revolution, who, in 1807, had moved from his native state of North Carolina to the new state of Tennessee. Miss Murfree's father, William Law Murfree, was a lawyer, and her mother, Priscilla Murfree, was the daughter of Judge Dickinson. The family suffered greatly from the effects of the war. Mary Murfree had poor health but began to write of the people she found about her in the Tennessee mountains, and her novel, "In the Tennessee Mountains" appeared in the Atlantic Monthly and was supposed to have been written by a man. When Mr. Howells assumed the editorial chair in the Atlantic Monthly office he requested further contributions from Charles Egbert Craddock, and a series of excellent stories from her pen were published: "Where the Battle was Fought," "The Prophet of the Great Stony Mountain," "The Star in the Valley," "The Romance of Sunrise Rock," "Over on Tother Mounting," "Electioneering on Big Injun Mounting," "A-Playing of Old Sledge at Settlement," "Adnfting down Lost Creek,"vhich ran through three numbers of the Atlantic, "Down the Ravine," a story for young people. It was possible for Miss Murfree to cover her identity in her nom de plume, for her style of writing and even her penmanship were masculine and she appreciated the fact that, at that time, men in the literary world had a great advantage over women writers. No one was more surprised than her own publishers at the discovery that Charles Egbert Craddock was a woman. Her great skill lies in vitalizing the picturesque characters who are the subjects of her stories.
ANNA KATHARINE GREEN ROHLFS.
Was born in Brooklyn, New York, on November II, 1846, and was thirty-two years of age when her famous story, "The Leavenworth Case" was published. Her father was a famous lawyer, and from him she is supposed to have gained the knowledge which she had in handling the details of this story. It was questioned for some time, although her maiden name, Anna Katharine Green, was signed to the story, whether it was possible that this story could have been written by a woman. She was a graduate of the Ripley Female College in Poultney, Vermont, and received the degree of B.A. In her early days she wrote poems, but her fame has come from her detective stories. "The Affair Next Door," "The Filigree Ball," and other stories from her pen are well known. In November, 1884, she became Mrs. Charles Rohlfs.
MOLLY ELLIOT SEAWELL.
Miss Seawell's uncle was an officer in the United States navy before the Civil War, and served in the Confederate Army with distinction during the entire war. From him she heard the tales of our early navy which gave her inspiration to write her nautical sketches. Some of these are "Decatur and Somers," "Paul Jones," "Midshipman Paulding," "Quarter-deck," "Fo'c'sle," and "Little Jarvis," the latter winning the prize of five hundred dollars for the best story for boys offered by the Youths' Companion, in 1890. She was a constant reader of Shakespeare, Rousseau and other writers. Byron, Shelley, Thackeray, Macaulay, Jane Austen, Boswell's "Johnson" all formed a part of her home education. In 1895, she received a prize of $3,000 from the New York Herald for the best novelette, "The Sprightly Romance of Marsac." Her "Maid Marian" is a well-known and an amusing story of the Knickerbocker element of New York.
AMELIA E. BARR.
Among the foremost of American writers is Amelia Barr. She was born in Ulverston, Lancashire, England, in 183 1. Her maiden name was Amelia Edith Huddleston. Her father was the Reverend Doctor William Henry Huddleston, and her first introduction into the literary field was when she served as a reader to her father. She was educated in Glasgow and in 1850 married Robert Barr, a Scotchman, and four years later they came to this country. They made their residence in several states, in New York, the South and West, finally settling in Austin, Texas. In 1867, the yellow fever was epidemic in Austin. Mr. Barr became famous through his work among the Indians and white settlers of this city. Doctors and nurses dying on all sides, he gave up his life in his unselfish devotion to poor suffering humanity. Mrs. Barr lost not only her husband but three sons in this terrible epidemic, and after it was over she returned to New York City. Her first literary venture was brought out through the kind personal interest of the editor of the New York Ledger, Mr. Robert Bonner, and was a story published in the Christian Union. She did all kinds of literary work, wrote advertisements, circulars, paragraphs and verses. Her first great success came in 1885 in the publication of "Jan Vedder's Wife." Three other books followed: "Scottish Sketches," "Cluny MacPherson," and "Pawl and Christina," but none equalled "Jan Vedder's Wife." "The Bow of Orange Ribbon" is a delightful picture of New York in provincial days, as is "The Maid of Maiden Lane." One of her later books, "The Lion's Whelp," a story of Cromwell's time, is considered one of her strongest books.
MARY E. WILKINS FREEMAN.
Was born in Randolph, Massachusetts, in 1862. Her father was a native of Salem, and was a descendant of Bray Wilkins of good old Puritan stock. Her mother was a Holbrook, one of the old families of Massachusetts. The family early removed to Brattleboro, Vermont, and with Mr. J. E. Chamberland she wrote "The Long Arm" for which they received a two thousand dollar prize offered by a newspaper. Like many other writers she was largely influenced by the people about her and associated with her early life and that of her family. Barnabas, one of the characters in her story, "Pembroke," was drawn from Randolph. Losing her father and mother and sister, she returned to Randolph and took up her residence. Her story "A Humble Romance" was considered by Phillips Brooks the best short story ever written. In 1893, she wrote a play, "Giles Corey, Yeoman" a drama of the early Puritan days. "The Heart's Highway" is another of her stories of Colonial times, and "The Portion of Labor." In 1902 she married Dr. Charles Manning Freeman, of Metuchen, New Jersey, where she now resides.
ALICE FRENCH.
"Octave Thanet."
Miss French took a nom de plume to hide her identity, there being an unmistakably masculine tinge in many of her writings. Her real name is Alice French, she was born in Andover, Massachusetts, March 19, 1850. Her father was George Henry French, a man of important business connections and comfortable means. The family were descended from Sir William French who settled in Massachusetts in the seventeenth century, and one of his descendants took part in the Revolutionary War, receiving the name of the "Fighting Parson of Andover." Miss French's grandfather on her mother's side was Governor Marcus Morton, and some of her ancestors were numbered among those who came to this country in the Mayflower. Miss French is a graduate of Vassar College. Her first story was printed in Godey's Magazine. Her story entitled "The Bishop's Vagabond," published in the Atlantic Monthly, in 1884, was the beginning of her substantial literary fame. Her story "Expiation" is considered very strong, as is "Knitters in the Sun "
KATE DOUGLASS WIGGIN (MRS. RIGGS.)
Her family were people of prominence in church and politics and at the New England Bar. She was born in Philadelphia and educated in New England, transplanted to California, and returned again to the Atlantic coast. Her first article appeared in St. Nicholas and was written at the age of eighteen. This she wrote while studying kindergarten work under the celebrated Marshall in California. After the death of her stepfather, she taught in the Santa Barbara College and organized the first free kindergarten west of the Rocky Mountains. Soon after the successful establishment of this work, she was married to Mr. Samuel Bradley Wiggin, a talented young lawyer. She gave up her work in the kindergarten but continued to give lectures. One of the stories written at this time was the story of "Patsy," which she wrote to obtain money for the work in which was so much interested, to be followed by "The Birds' Christmas Carol," written for the same purpose. After removing to New York, in 1888, she was urged to offer these two books to an eastern publisher, and Houghton, Mifflin and Company reprinted them in book form, and they met with remarkable success. "The Birds' Christmas Carol" has been translated into Japanese, French, German and Swedish, even being put into raised type for the blind. Her story "Timothy's Quest" met with great success as also "Polly Oliver's Problem." Mr. Wiggin's death soon after they left San Francisco necessitated her taking up the kindergarten work in the East with great energy. She does much of her work at her old home in Maine, and many of the scenes and descriptions in the "Village Watch Tower" were taken from this neighborhood. In 1895 she married Mr. George Christopher Riggs, and has spent much of her time since then in England. "Penelope's English Experience" is a story of her own experiences among her English friends, as were those of "Penelope's Irish Experiences," "Penelope's Progress in Scotland" which followed a period of her life in these countries.
GERTRUDE ATHERTON.
Was born in Rincon Hill, a part of San Francisco, in 1857. Her mother was the daughter of Stephen Franklin, a descendant of one of the brothers of Benjamin Franklin. His daughter was quite famous in California as a beauty. She married Thomas L. Horn, a prominent citizen of San Francisco from Stonington, Connecticut, and a member of the famous Vigilant Committee. The daughter Gertrude was educated in California and married George Henry Bowen Atherton of Menlo Park, California, a Chilian by birth. Her first story, "The Randolphs of Redwoods," was published in the San Francisco Argonaut, but among her many stories perhaps the best known is "Senator North." Her story of the life of Alexander Hamilton under the title "The Conqueror" is considered her best work.
JOHN OLIVER HOBBES (MRS. CRAIGIE.)
Mrs. Pearl Mary Theresa Craigie was born in Boston, Massachusetts, November 3, 1867. Her mother's maiden name was Laura Hortense Arnold. Her father was John Morgan Richards, the son of Reverend Doctor James Richards, the founder of Auburn Theological Seminary, of New York. She received her early education from tutors, later studying in Paris, and then in London. She was an enthusiastic student of classical literature, and through the advice of Professor Goodwin, she took up literature as a profession. In 1887, she was married to Mr. Reginald Walpole Craigie of a well-to-do English family. "Rohert of Orange" was one of her early and most notable books. Mrs. Craigie did some writing for the stage and one of her plays, "The Ambassador," was considered very good. Her story "Love and Soul Hunters," has not been excelled by any of her contemporaries.
LILIAN BELL.
Was born in Chicago in 1867, but spent her early years in Atlanta. Daughter of Major William Bell, an officer of the Civil War. Her grandfather, General Joseph Warren Bell, was a Southerner, but sold and freed his slaves before the war, brought his family North to Illinois. He organized the Thirteenth Illinois Cavalry. Her first literary work was "The Expatriates." Probably her best known book is "The Love Affairs of an Old Maid." In 1893 she married Arthur Hoyt Bogue of Chicago. They now make their home in New York City, where Mrs. Bogue is still engaged in literary work under her maiden name.
RUTH McENERY STUART.
Mrs. Stuart was born at Avoyelles Parish, Louisiana, the daughter of a wealthy planter. Her family had always been slave holders and her life was spent on a plantation where she gained her familiarity and knowledge of the negro character. She was educated at a school in New Orleans where she remained after her marriage in 1879 to Alfred O. Stuart, a cotton planter, and her early life was spent near their plantation in a small Arkansas town. Her first story was sent by Charles Dudley Warner to the Princeton Review in which it appeared, and the second was published in Harper's Magazine. Her stories are of the la-ry life of the Creoles and the plantation negroes. They give a true picture of a peculiar race of people fast disappearing in the South. They are largely dialect stories. Since her husband's death Mrs. Stuart has resided in New York City and here most of her literary work has been done. "Moriah's Mourning," "In Simpkinsville," "A Golden Wedding." "Charlotta's Intended," "Solomon Crow's Christmas Box," "The Story of Babette," "Sonny," "Uncle Eph's Advice to Brer Rabbit," "Holly and Pizen," are some of her well-known stories. Charles Dudley Warner says, "her pictures of Louisiana life both white and colored are indeed the best we have."
ANNA FARQUHAR BERGENGREN.
Mrs. Bergengren was of Scotch-English ancestry, her people coming to America in Lord Baltimore's time and settling in Maryland, near Baltimore. She was born December 23, 1865, near Brookville, Indiana, her father being a lawyer, a member of Congress, and during her life in Washington, she obtained the material for her book called "Her Washington Experiences." Her father's death made her determine upon a career for herself and she chose a musical education, but her health failed while studying in Boston, and she was ultimately obliged to give up singing, in which she had already attained fair success. Her story "The Singer's Heart" expressed her professional ambitions. "The Professor's Daughter" was published in The Saturday Evening Post and was very popular. "Her Boston Experiences" appeared in a magazine and ultimately in book form. Her book, "The Devil's Plough," is a story of the early French missionaries of North America. In January, 1900, she was married to Ralph Bergengren, a Boston Journalist, and has continued her literary labors.
PAULINE BRADFORD MACKIE HOPKINS.
Mrs. Hopkins is a writer of historical fiction. For two years after her graduation from the Toledo High School she was engaged as a writer on the Toledo Blade. She soon abandoned this for a literary career, and most of her stories have appeared in magazines and newspapers. "Mademoiselle de Berny" and "Ye Lyttle Salem Maide" were, after most trying experiences with publishers, printed in book form. "A Georgian Actress" was written in Berkeley, California, where Mrs. Hopkins had gone with her husband, Dr. Herbert Müller Hopkins, now occupying the chair of Latin in Trinity College, Hartford, Connecticut. Here she also wrote two novels of Washington life during the Civil War. Mrs. Hopkins was born in Connecticut in 1873. Her father, Rev. Andrew Mackie, was an Episcopal clergyman and a very scholarly man, from whom she inherited her literary talent.
MARY JOHNSTON.
The publication of "Prisoners of Hope" brought, in 1898, a new star into the literary firmament, and instantly made Mary Johnston's name famous. At the time of the publication of her first novel Miss Johnston was but twenty-eight years of age. She was born in Buchanan, Virginia, November 21, 1870. Her great-great-great-grandfather, Peter Johnston, came to Virginia early in the Eighteenth Century and was a man of wealth and influence. He donated the land on which the Hampden Sidney College now stands, and Peter, his eldest son, rode in "light-horse," Harry Lee's legion and was the father of General Joseph E. Johnston. Her family numbered among its members some of the most distinguished men of the early Virginia history. "Prisoners of Hope" was hardly more famous than her second book, "To Have and To Hold." The latter established a record of sales among books unprecedented for any work by an American woman. Her latest novel is "The Long Roll," a story of the Confederacy during the war.
ELLEN ANDERSON G. GLASGOW.
Miss Glasgow is a Virginia writer who has become a member of the literary life of the New South. "The Descendant," "The Phases of an Inferior Planet" and "The Voice of the People" are among her best works. She was born in Richmond, Virginia, April 22, 1874, and lived the greater part of her life at the family home. Her father was a lawyer, and the majority of her male ancestors were either lawyers, judges or men of literary tastes and talents.
BERTHA RUNKLE.
One of the most famous novels of the past few years was "The Helmet of Navarre," and was written, when its author, Bertha Runkle, was a little over twenty years of age. One of the most remarkable facts in this connection is that the authoress had never seen the shores of France, in fact had seldom been beyond the boundaries of New York State. Miss Runkle was born in New Jersey, but in 1888 she and her mother moved to New York City. Her father, Cornelius A. Runkle, a well-known New York lawyer, was for many years counsel for the New York Tribune, and her mother, Lucia Isabella Runkle, had been, previous to her marriage, an editorial writer on the same paper, in fact she was the first American woman to be placed on the staff of a great Metropolitan daily. In 1904 Miss Runkle married Captain Louis H. Bash, United States Army. She is very fond of outdoor life and spends much of her time in such sports as golf, riding, driving and tennis.
HARRIET BEECHER STOWE.
In the little town of Litchfield, Connecticut, on June 14, 1811, one of the most famous literary women, Harriet Beecher Stowe, was born. She was the seventh child of her parents Rev. Lyman Beecher and Roxanna Beecher. Her father was an eminent divine, but her early childhood days were filled with the privations of great poverty. When Harriet Stowe was but five years of age, her mother died and she went to live for a short time with her aunt and grandmother, until Mr. Beecher's second marriage. At twelve years of age she was sent to the school of Mr. John P. Brace, a well-known teacher, where she soon began to show a great love for composition, and one of her essays, "Can the Immortality of the Soul be Proved by the Light of Nature," was considered quite a literary triumph, and won great admiration from her father who was ignorant of its authorship. Her sister Catherine went to Hartford, Connecticut, where her brother was teaching, and decided she would build a female seminary that women might have equal opportunities with men. She raised the money and built the Hartford Female Seminary, and Harriet Beecher at the age of twelve attended her sister Catherine's school. She soon became one of the pupil teachers. Mr. Beecher's fame as a revivalist and brilliant preacher took him to Boston, but his heart was in the temperance work and he longed to go West. When called to Ohio to become president of Lane Theological Seminary at Cincinnati he accepted, and perhaps we owe to this circumstance Harriet Beecher Stowe's famous book "Uncle Tom's Cabin." In 1836, Harriet married the Professor of Biblical Criticism and Oriental Literature in that seminary, Calvin E. Stowe. At this time the question of slavery was uppermost in the minds of Christian people. In 1850 the Beecher family and the Stowes moved to Brunswick, Maine, where Mr. Stowe had accepted a professorship at Bowdoin College. The fugitive slave law was in operation and the people of the North seemed lacking in effort. Mrs. Stowe felt she must do something to arouse the people on this question, and we are told that one Sunday while sitting in church the picture of Uncle Tom came to her mind. When she went home she wrote the chapter on his death and read it to her two sons, ten and twelve years of age. This so affected them that they burst into tears. After two or three more chapters were ready she wrote to Dr. Bailey, her old friend of Cincinnati days, who had removed his press to Washington and was editing the National Era in that city. He accepted her manuscript and it was published as a serial. Mr. Jewett of Boston feared to undertake the work in book form, thinking it too long to be popular, but Uncle Tom's Cabin was published March 20, 1852, as a book. In less than a year over three hundred thousand copies had been sold. Congratulations came from crown heads and the literary world. In 1853, when Professor Stowe and his wife visited England no crowned head was shown greater honor. Other books followed from her pen on her return to America, her husband having taken a position as Professor of Sacred Literature in the Theological Seminary at Andover, Massachusetts. Her other works are: "Sunny Memories of Foreign Lands," "Dread," an anti-slavery story; "The Minister's Wooing," "Agnes of Sorrento," an Italian story; "Pearl of Orr's Island," a New England coast tale; "Old Town Folks," "House and Home Papers," "My Wife and I," "Pink and White Tyranny," but none has added to the fame of her great work, "Uncle Tom's Cabin." This book has been translated into almost all the languages. The latter years of Mrs. Stowe's life was spent between her home among the orange groves of Florida, and her summer residence in Hartford, Connecticut. On her seventy-first birthday her publishers, Houghton Mifflin & Company, gave her a monster garden party in Newton, Massachusetts, at the home of Governor Claflin. Poets, artists, statesmen, and our country's greatest men and women came to do her honor, and when her life went out at Hartford, Connecticut, July 1, 1896, we lost one of the famous women of America.
HELEN HUNT JACKSON.
She was born in Amherst, Massachusetts, October 18, 1831. Her father, Nathan W. Fiske, was a professor of languages and philosophy in the college of that town. When twelve years of age both her father and mother died, leaving her to the care of her grandfather. She entered the school of Rev. J. S. C. Abbott of New York. At twenty-one she married a young army officer, Captain, afterward Major, Edward B. Hunt. They lived much of their time at West Point and Newport. Major Hunt was killed in Brooklyn, October 2, 1863, while experimenting with a submarine gun of his own invention. After a year abroad and a long illness in Rome, she returned to this country in 1870. In her first small book of verses she was obliged to pay for the plates when they appeared, and it was only after years of hard work that she succeeded in her literary career. Her health becoming somewhat impaired, she moved to Colorado, and here in 1876 she married Mr. William Sharpless Jackson, a banker and cultured gentleman. They made their home at Colorado Springs, and it became one of the attractions of the place, her great love for flowers beautifying her surroundings. Here she wrote her first novels, "Mercy Philbrick's Choice" and "Hetty's Strange History," also, later "Ramona," but her strongest work was brought about through her intense interest and indignation over the wrongs of the Indians inflicted upon them by the white race. She advocated education and christianization of the race rather than their extermination. Leaving home, she spent three months in New York in the Astor Library gathering facts and material for her "Century of Dishonor." When published she sent a copy to each member of Congress at her own expense to awaken interest in her favorite theme, and this resulted in her being appointed special commissioner with Abbott Kinney, her friend, to examine and report on the condition of the Indians in California. She went into the work with enthusiasm and energy and the report was most exhaustive and convincing. In the winter of 1883, she began to write her famous novel, "Ramona," and we quote her own language when she says of it "I put my heart and soul into it." The book enjoyed wonderful popularity not only in this country but in England. In June, 1884, a fall caused a long, severe and painful illness. She was taken to Los Angeles, for the winter, but a slow malarial fever followed and she was removed to San Francisco and on the evening of August 12, 1885, she died. Her two works "Ramona," and "The Century of Dishonor" will ever preserve her name among the famous literary women of America. "The Century of Dishonor," has placed her name among the up-builders of our nation. She was buried near the summit of Cheyenne Mountain, four miles from Colorado Springs, a spot of her own choosing, and which is to-day one of the shrines of America.
THE CARY SISTERS.
The Cary sisters stand out as the most prominent poetical writers of the state of Ohio. Alice Cary was born April 26, 1820, on the farm of her father, situated within the present limits of Mount Healthy, Ohio. In 1832, the family moved to a larger residence near their former home, and it was christened "Clover Nook." Alice Cary had only the advantages of ordinary school education, but began early in life to contribute literary compositions, and at the age of eighteen, her first poetical adventure, "The Child of Sorrow," to the Sentinel and Star, a universalist paper of Cincinnati. Gradually her reputation spread and she contributed to many papers, among them, the National Mirror of Washington, D. C, the editor of which, Dr. Bailey, was the first to consider her writings worthy of pecuniary reward. In 1848, her name appeared first among the female poets of America, and in 1850, a small collection of poems by Alice and Phoebe Cary made their first appearance. Horace Greeley and John G. Whittier were among the warm friends and literary admirers of the Cary sisters. In 1860, Alice moved to New York City, and on February 12, 1870, she died.
PHOEBE CARY.
Was born September 4, 1824, in the old homestead at Clover Nook, Hamilton County, Ohio. Her writings were noted for their sincerity and sweetness. Her gifts were hardly inferior to those of her sister, Alice, whom she outlived but one year and a half, dying July 31, 1871.
ALICE WILLIAMS BROTHERTON.
Daughter of Alfred Baldwin Williams and Ruth Hoge Johnson Williams, was born at Cambridge, Indiana, her parents removing to Cincinnati, Ohio, when she was quite young. Her education was received mainly from the grammar and high schools of Cincinnati. She was married October 18, 1876, to Mr. William Ernest Brotherton of that city. She has been a constant contributor to newspapers and magazines, a prominent college woman, and has devoted much time to essays and writings on Shakespeare, delivering lectures before women's colleges and dramatic schools.
EDITH MATILDA THOMAS.
Was born in Chatham, Ohio, August 12, 1854. Daughter of Frederick J. Thomas and Jane Louisa Sturges Thomas, both natives of New England, her great-grandfather being a soldier in the Revolutionary War. The family lived for a short time at Kenton, Ohio, and also at Bowling Green, where her father died in 1861. Soon after this, her mother and sisters moved to Geneva, Ohio, where Edith received her education at the Normal Institute. She taught for a short time in Geneva, but soon decided to make literature her profession. She had, while a student, contributed to the newspapers, and her first admirer was Helen Hunt Jackson, who brought her to the attention of the editors of the Atlantic Monthly and Century. In 1888, Miss Thomas moved to New York City, making her home on Staten Island, and has devoted her entire time to literature, being a frequent contributor to the prominent magazines of the day.
ALICE ARCHER SEWALL JAMES.
Daughter of Frank Sewall, an eminent Swedenborgian divine, and Thedia Redelia Gilchrist Sewall, and was born at Glendale, Ohio, in 1870, where her father was in charge of a church. The family removed to Urbana, Ohio, that year, and Doctor Sewall became president of Urbana University. Here Alice received her early education. At sixteen, she studied in the art schools of Glasgow, Scotland, traveling later on the Continent. In 1899, her home was in Washington, D. C, and here she met Mr. John H. James, a prominent attorney of Urbana, Ohio, whom she married. As an artist, Mrs. James' work has received much favorable comment and honors from the New York Architectural League, the Philadelphia Academy of Art, the Chicago World's Fair, the Expositions of Atlanta and Nashville, and at the Salon, Paris. Her illustrative work is of a high order, and she has contributed designs to the Century Magazine, Harper's Monthly, and the Cosmopolitan. She is hardly less noted as a poet than as a painter, and has published several volumes of verses. She was the authoress of the "Centennial Ode" of Champagne County, Ohio.
MARGARET JUNKIN PRESTON.
Daughter of Rev. Dr. Junkin, the founder of Lafayette College in Pennsylvania, was born in Philadelphia in 1820. Her father moved to Virginia in 1848, and became the president of Washington College in Lexington, now known as the Washington and Lee University. He was succeeded in this position by Robert E. Lee. In 1857, Miss Junkin married Professor J. T. L. Preston, one of the professors of the Virginia Military Institute. Mrs. Preston belonged to a very noted family of the South, her brother being General Stonewall Jackson, who was also one of the professors of this famous college of the South. A few years prior to her death, she removed to Baltimore, her son being a prominent physician and surgeon of that city, and here she died March 28, 1897. She was a great admirer of the Scotch writers and produced some valuable literary work in verse and prose, which appeared in the magazines and journals of the day. she also published five volumes of poems. "Her Centennial Ode" for the Washington and Lee University was considered a very notable production. Much of her writings were of a religious character, and all breathed a very pure, simple and sweet nature.
MARGARET FULLER. (MARCHIONESS D'OSSOLI.)
Margaret Fuller was a woman of most eccentric genius and great mental powers. She was born May 23, 1810, the daughter of Timothy Fuller, Esq., of Cambridge, Mass. In very early life Miss Fuller was put to the study of classical languages and showed wonderful power of acquisition. She then turned to living tongues and before she reached a mature age she was accounted a giant of philological accomplishments. Indeed she poured over the German philosophers until her very being became imbued with their transcendental doctrines. She was the best educated woman in the country and devoted her life to raising the standard of woman's intellectual training. To this effect she opened classes for women's instruction in several of the larger towns of New England. Her first publication was a translation of Goethe's "Conversation," which appeared in 1839. In the following year she was employed by the publisher of the "Dial," at whose head was Ralph Waldo Emerson, and she aided in the editorship of that journal for several years. In 1843 Miss Fuller moved to New York and entered into arrangement with the publishers of the Tribune, to aid in its literary department. This same year she made public her best literary effort, her "Summer on the Lakes," a journal of a journey to the West.
MARTHA JOANNA LAMB.
Mrs. Martha Joanna Lamb was born on August 18, 1829, at Plainfield, Massachusetts. She was at one time considered the leading woman historian of the nineteenth century. She is a life member of the American Historical Association and a Fellow of the Clarendon Association of Edinburgh, Scotland. Was editor of the Magazine of American History for eleven years. Her father was Arvin Nash and her mother was Lucinda Vinton. Her grandfather, Jacob Nash, was a Revolutionary soldier. The family is an old English one and to it belong the Rev. Treadway Nash D.D., the historian, and his wife, Joanna Reade, and to her family belongs Charles Reade, the well-known novelist. The ancestors of the Reade family came to America in the "Mayflower." Mrs. Lamb made her home at different times at Goshen, Massachusetts, Northampton and Easthampton. In 1882 she became the wife of Charles A. Lamb, and became conspicuous in charitable work in the city of Chicago, in which they resided from 1857 to 1866. She was an active worker after the great fire of 1863. In 1866 the Lambs made their home in New York City. Mrs. Lamb had always been a woman of remarkable mathematical talent and training. In 1879 she prepared for Harper's Magazine a notable paper translating to unlearned readers the mysteries and work of the Coast Survey. She has written a remarkable history of the city of New York, in two volumes, which was pronounced by competent authorities to be the best history ever written on any great city in the world. The preparation of this work required fifteen years of study and research. The list of Mrs. Lamb's works is long and distinguished, among them many historical sketches. Some titles are: "Lyme, a Chapter of American Genealogy"; "Chimes of Old Trinity," "State and Society in Washington," "The Coast Survey," "The Homes of America," "Memorial to Dr. Rust" and the "Philanthropist;" several sketches for magazines, "Unsuccessful candidates for the Presidential Nomination," sketch of Major-General John A. Dix, "Historical Homes in Lafayette Place," "The Historical Homes of Our Presidents." It is said that Mrs. Lamb wrote upwards of two hundred articles, essays and short stories, for weekly and monthly periodicals, but her greatest work was her "History of the City of New York," which is a standard authority and will be throughout all time. Mrs. Lamb died in 1893.
EMMA D. E. N. SOUTHWORTH.
Emma D. E. Nevitt was the eldest daughter of Captain Charles Nevitt, of Alexandria, Virginia. Was born in Washington, D. C, December 26, 1819. The family was descended from those of high rank in England and France. Her people had emigrated to this country in 1632, and were conspicuous in the American Revolution. Her father served at the head of a company in the War of 1812, receiving a wound from which he never recovered. At the age of forty-five, Captain Nevitt married his second wife, a young girl of but fifteen years and removed to Washington, where they leased a large house said to have been occupied at one time by General Washington. Mrs. Nevitt, after Captain Nevitt's death, married the second time, her husband being Joshua L. Henshaw of Boston, and to him Mrs. Southworth says she is indebted almost entirely for her education. Among her early writings is "The Irish Refugee," which was accepted by the editor of the Baltimore Saturday Visitor, who so encouraged the young writer that she wrote "The Wife's Victory." A few of her early stories were printed in the National Era of Washington City, its editor engaging her as a regular writer for that paper. She then commenced her third novel "Sibyl's Brother, or The Temptation," and in 1849 "Retribution" was published by Harper Brothers, and in five years after its appearance she had written "The Deserted Wife," "Shannondale," "The Mother-in-Law," "Children of the Isle," "The Foster Sisters," "The Courts of Clifton," "Old Neighbors in New Settlements," "The Lost Heiress" and "Hickory Hall." Her prolific pen was latterly engaged exclu sively for the New York Ledger. In 1853 Mrs. Southworth moved to a beautiful old home on the heights above the Potomac in Georgetown, and this became the rendezvous of distinguished people from all parts of the country. Here, in what was known as Prospect Cottage, Mrs. Southworth spent the last years of her life, dying there June 30, 1899.
MADELEINE VINTON DAHLGREN.
The wife of the distinguished Admiral Dahlgren was born in Gallipolis, Ohio, about 1835. She was the only daughter of Samuel F. Vinton, who served with distinction as a member of Congress for some years. At an early age she became the wife of Daniel Convers Goddard, who left her a widow with two children. On the 2nd of August, 1865, she became the wife of Admiral Dahlgren, and three children were born of this marriage. Admiral Dahlgren died in 1870. Her first contributions to the press were written in 1859 under the signature "Corinne." She also used the pen-name "Cornelia." Her first book was a little book entitled "Idealities." She made several translations from the French, Spanish and Italian languages, among them, "Montalembert's Brochure," "Pius IX," and the philosophical works of Donoso Cortes from the Spanish. These translations brought her many complimentary notices and an autographed letter from Pope Pius IX, and the thanks of the Queen of Spain. She was also the author of a voluminous biograph of Admiral Dahlgren and a number of novels including, "The South-Mountain Magic," "A Washington Winter," "The Lost Name," "Lights and Shadows of a Life," "Divorced," "South Sea Sketches," and a volume on "Etiquette of Social Life in Washington," and quite a number of essays, reviews, and short stories for the leading papers and periodicals of the day. She was a woman of fine talent and a thorough scholar, and in the social circles of Washington of which she was a conspicuous figure, she was considered a literary authority, and the Literary Society of Washington, of which she was one of the founders, had about the only "Salon" ever in existence in Washington. Her house was the center of a brilliant circle of official and literary life of the Capital city. In 1870-1873 she actively opposed the movement for female suffrage, presenting a petition to Congress which had been extensively signed asking that the right to vote should not be extended to women. Mrs. Dahlgren was a devout Catholic, and was for some time president of the Ladies' Catholic Missionary Society of Washington, and built a chapel at her summer home on South Mountain, Maryland, near the battlefield, known as St. Joseph's of the Sacred Heart of Jesus.
EMILY LEE SHERWOOD.
Mrs. Sherwood was born in 1843, in Madison, Indiana, where she spent her childhood. Her father, Monroe Wells Lee, was a native of Ohio; her mother, of the state of Massachusetts. At the age of sixteen she entered the office of her brother, who published the Herald and Era, a religious weekly paper in Indianapolis. Here she did most creditably whatever work she was asked to do in the various departments of this paper. At the age of twenty she became the wife of Henry Lee Sherwood, a young attorney of Indianapolis, and later they made their home in Washington, D. C. Mrs. Sherwood became one of the most prominent newspaper correspondents of the Capital city. She sent letters to the various papers over the country and was a contributor of stories and miscellaneous articles to the general press. In 1889 she became a member of the staff of the Sunday Herald, of Washington, D. C, and contributed articles also to the New York Sun and World. She is an all-round author, writing in connection with her newspaper work, books, reviews, stories, character sketches, society notes and reports. She published a novel entitled "Willis Peyton's Inheritance"; is an active member of the Daughters of the American Revolution, National Press League and the Triennial Council of Women.
JULIA HOLMES SMITH.
Born in Savannah, Georgia, December 23, 1839. On her mother's side, her grandfather was Captain George Raynall Turner, United States Navy. She was educated in the famous seminary of Gorman D. Abbott, and after graduating, married Waldo Abbott, eldest son of the historian, John S. C. Abbott. Mrs. Abbott was the organizer and first president of the Woman's Medical Association, the only society of its kind in America. In 1889 she contributed to the New York Ledger a series of articles on "Common Sense in the Nursery." She was at one time the only woman who contributed to the Arndts System of Medicine.
MARY STUART SMITH.
Mrs. Mary Stuart Smith was born at the University of Virginia, February 10, 1834. Was the second daughter of Professor Gessner Harrison and his wife, Eliza Lewis Carter Tucker. In 1853 she became the wife of Professor Francis H. Smith, of the University of Virginia. Besides original articles, her translations from the German for leading periodicals form a long list. She is a most pleasing writer for children.
MARY ELIZABETH SHERWOOD.
Mrs. Mary Elizabeth Sherwood was born in Keene, New Hampshire, in 1830. Her father, General James Wilson, served as a member of Congress from New Hampshire. Her mother, Mary Richardson, was well known for her great beauty and fine intellect. Mrs. Sherwood was a woman of strong personality and distinguished appearance. While living in Washington she became the wife of John Sherwood and soon obtained a prominent place among literary people. She was a contributor to all the leading magazines of the day, a writer of several well-known novels, among them, "A Transplanted Rose," "Sweet Briar," and "Royal Girls and Royal Courts," but is best known for her books on etiquette, being considered an authority on that subject. During Mrs. Sherwood's residence abroad she was prominent in the literary circles of Europe. In 1885 she gave readings in her New York home for the benefit of the Mt. Vernon Fund. Mrs. Sherwood was active in many of the charities of New York City, and through her pen raised sums of money for many in which she was interested. Mrs. Sherwood died in 1903.
KATE BROWNLEE SHERWOOD.
Mrs. Kate B. Sherwood was born in Mahoning County, Ohio, September 24, 1841. Of Scotch descent, her maiden name was Brownlee. Before graduating from the Poland Union Seminary, she became the wife of Isaac R. Sherwood, afterward General Secretary of the State, and at present Congressman from Ohio. Her husband was the owner and editor of the Canton Daily News Democrat.
She has always taken an active interest in all public and philanthropic questions for the soldiers and her state. While her husband served his first term in Congress, she was correspondent for the Ohio papers, and at one time contributed to the columns of the National 'tribune, Washington, D. C, published for the benefit of the Grand Army of the Republic and the soldiers of the country.
Mrs. Sherwood has done valiant work for her state and the Woman's Relief Corps, being one of the founders of the latter organization. She was at one time its national president; organized the Department of Relief and instituted the National Home for Army Nurses in Geneva, Ohio.
In her earlier years she was well known by her very melodious voice and frequently sang at meetings of military organizations. There is no woman better known or whose ability is more universally conceded or who wields a wider influence in the organizations of women for the advancement of her sex and the progress of our country.
EVA MUNSON SMITH.
Mrs. Eva Munson Smith was born July 12, 1843. She was the daughter of William Chandler Munson and Hannah Bailey Munson. Her mother was a direct descendant of Hannah Bailey of Revolutionary fame, who tore up her flannel petticoat to make wadding for the guns in battle. Mrs. Smith has made a collection of sacred compositions of women under the title "Women in Sacred Song." She has written quite a number of musical selections.
AMELIE RIVES. (PRINCESS TROUBETZKOY).
Princess Troubetzkoy was born in Richmond, Virginia, August 23, 1863, but her early life was passed at the family home, Castle Hill, Albermarle County. She is a granddaughter of William Cabell Rives, once minister to France and who wrote the "Life of Madison." Her grandmother, Mrs. Judith Walker Rives, left some writings entitled "Home and the World" and "Residence in Europe." Amelie Rives was married in 1899 to John Armstrong Chanler, of New York. Her most conspicuous story was "The Quick and the Dead." She wrote "A Brother to Dragons," "Virginia of Virginia," "According to St. John," "Barbara Dering," "Tanis" and several other well known stories. Her first marriage proved unhappy and she was divorced, and has since married Prince Pierre Troubetzkoy, a Russian artist, and continues her literary work.
GRACE ELIZABETH KING.
Miss King was born in New Orleans, in 1852, and is the daughter of William W. and Sarah Ann King. She has attained a distinguished reputation as the writer of short stories of Creole life. Among them are: "Monsieur Mottee," "Tales of Time and Place," "New Orleans, the Place and the People," "Jean Baptiste Lemoine, Founder of New Orleans," "Balcony Stories," "De Soto and His Men in the Land of Florida," "Stories from the History of Louisiana."
ELIZABETH WORMELEY LATIMER.
Mrs. Elizabeth Wormeley Latimer was born in London, England, in July, 1822. Her father was Rear Admiral Ralph Randolph Wormeley of the English navy, and her mother was Caroline Preble, of Boston, Massachusetts. In 1842 she was a member of the family of George Ticknor, of Boston, and her first literary work was the appendix to Prescott's Conquest, of Mexico. Her father's death occurred at Niagara Falls, in 1852. In 1856 Miss Wormeley married Randolph Brandt Latimer and they later made their home in Howard County, Maryland. Mrs. Latimer's works have been quite numerous. Among them are "Cousin Veronica," "Amabel," "My Wife and My Wife's Sister," "A Chain of Errors," and "France in the Nineteenth Century." Mrs. Latimer died in 1904.
MARY A. RIPLEY.
Was born January n, 1831, and was the daughter of John Huntington Ripley and Eliza L. Spalding Ripley. The Huntington family was very prominent in New England, one of its members, Samuel Huntington, signed the Declaration of Independence and Articles of Federation. On her mother's side Miss Ripley is descended from a distinguished French Huguenot family. She taught school in Buffalo for many years and contributed letters, articles on questions of the day and short poems. Her poems are characterized by sweetness and vigor. Her articles attracted much attention and exerted a wide influence. In 1867 she published a small book entitled "Parsing Lessons for School Room Use," which was followed by "Household Service," published under the auspices of the Woman's Educational and Industrial Union, of Buffalo. Her health failing, she resigned her position and removed to Carney, Nebraska, where she took an active part in every good work of that state, and was later made state superintendent of Scientific Temperance Instruction in the public schools and colleges of Nebraska.
EMMA WINNER ROGERS.
Was a native of Plainfield, New Jersey. She is the daughter of Reverend John Ogden Winner and granddaughter of Reverend Isaac Winner, D.D., both clergymen of the Methodist Episcopal Church. For six years she was the corresponding secretary of the Woman's Home Missionary Society of the Detroit Conference and later honorary president of the Rock River Conference, Woman's Home Missionary Society. She is specially interested in literary work on the lines of social science and political economy and has been a contributor on these subjects to various papers and periodicals. She has written a monograph entitled "Deaconesses in the Early and Modern Church." Mrs. Rogers is a woman of marked ability and specially endowed with strong logical faculties and the power of dispassionate judgment. She is of the type of American College women who, with the advantage of higher training and higher education, bring their disciplined faculties to bear with equally good effect upon the amenities of social life and the philanthropic and economic questions of the day. She is the wife of Henry Wade Rogers, of Buffalo, New York, dean of the Law School of the University of Michigan, and later president of the Northwestern University of Evanston, Illinois. As the wife of the president of a great University her influence upon the young men and women connected with it was marked and advantageous. Mrs. Rogers has left an impress upon the life of her times that is both salutary and permanent.
ELLEN SARGENT RUDE.
Born March 17, 1838, in Sodus, New York. Her mother died when she was an infant. Educated in the public schools of Sodus and Lima, New York. She became the wife of Benton C. Rude, in 1859. She won a prize for a temperance story from the Temperance Patriot. Some of the choicest poems of the "Arbor Day Manual" are from her pen.
GRACE ATKINSON OLIVER.
Born in Boston, September 24, 1844. In 1869 she became the wife of John Harvard Ellis, the son of Reverend John E. Ellis, of Boston, who died a year after they were married. She was for some years a regular contributor to the Boston Transcript. In 1874 Mrs. Ellis spent a season in London and while there met some of the members of the family of Maria Edgeworth, who suggested her writing the life of Miss Edgeworth. This she did, and the book was published in the famous old corner book store in Boston, in 1882. In 1879 she became the wife of Doctor Joseph P. Oliver, of Boston. Subsequently she wrote a memoir of the Reverend Dean Stanley, which was brought out both in Boston and London. Mrs. Oliver is a member of the New England Woman's Press Association and the New England Woman's Club; vice-president of the Thought and Work Clnb, in Salem, and a member of the Essex Institute, in Salem. Mrs. Oliver died in 1899.
ELIZABETH MARTHA OLMSTED.
Born December 31, 1825, in Caledonia, New York. Her father, Oliver Allen, belonged to the family of Ethan Allen. In 1853 she became the wife of John R. Olmsted, of LeRoy, New York. The Olmsteds were descended from the first settlers of Hartford, Connecticut, and pioneers of the Genesee Valley, New York. Her poems were well known during the war, and appeared in the newspapers and magazines of that period.
MARY FROST ORMSBY.
Was born in 1852 in Albany, New York. Her family connections included many distinguished persons. She opened a school known as the Seabury Institute, in New York City, a private school for young women. She has been active in reforms and movements on social and philanthropic lines. Mrs. Ormsby is a member of the Sorosis Club also of the American Society of Authors, Woman's National Press Association, an officer and member of the Pan Republican Congress and Human Freedom League, a member of the executive committee of the Universal Peace Union and in 1891 was a delegate from the United States to the Universal Peace Congress, in Rome, Italy. Writer of short stories and a contributor of articles to various publications.
REGINA ARMSTRONG NIEHAUS.
Was born in Virginia, March 4, 1869. Daughter of Thomas J. and Jane Ann Welch. Married Charles Henry Niehaus, in 1900. Has contributed poems, stories and critiques to leading New York magazine since 1896, also to The Studio, London.
MARIA I. JOHNSTON.
Mrs. Maria I. Johnston was born in Fredericksburg, Virginia, May, 1835. Her father was Judge Richard Barnett, of Fredericksburg, who later removed to Vicksburg, Mississippi, and here Mrs. Johnston was a resident during the terrible forty days' siege of that city during the Civil War. That experience was made the subject of her first novel, "The Siege of Vicksburg." She was a contributor to the New Orleans Picayune, The Times Democrat and to the Boston Women's Journal. Since the death of her husband, Doctor W. R. Johnston, Mrs. Johnston has supported herself by her pen. She has educated her children, one son, a graduate of Yale, becoming a Judge of the Circuit Court of Montana. She was editor at one time of St. Louis Spectator, a weekly family paper. She has made her home in St. Louis, Missouri, for some time.
CORNELIA JANE MATTHEWS JORDAN.
Mrs. Cornelia Jane Matthews Jordan was born at Lynchburg, Virginia, in 1830. Her father was Edwin Matthews and her mother, Emily Goggin Matthews. Her parents dying when she was young, she was brought up by her grandmother. In 1851 she married F. H. Jordan, a lawyer of Luray, Virginia. She is the author of many poems and some quite stirring lyrics of the Civil War. Her book of poems entitled "Corinth, and other Poems," published after the surrender was seized by the military commander of Richmond and suppressed. She has published a volume entitled "Richmond, Her Glory and Her Graves." Has also contributed many articles to magazines and newspapers, the best of which are "The Battle of Manassas," "The Death of Jackson and Appeal for Jefferson Davis." She is a member of the Alumni of the Convent of the Visitation, Georgetown, District of Columbia, her Alma Mater.
RUTH WARD KAHN.
Mrs. Ruth Ward Kahn was born in August, 1870, in Jackson, Michigan. She is a contributor to magazines and local newspapers. She is one of the youngest members of the Incorporated Society of Authors, of London, England. She is a member of the Authors' and Artists' Club, of Kansas City, and the Women's National Press Association.
MAREA WOOD JEFFERIS.
Mrs. Marea Wood Jefferis was born at Providence, Rhode Island, and is a descendant of William Brewster, of Mayflower fame. Her father is Doctor J. F. B. Flagg, a distinguished physician, who is well known through his work on anesthetics, and to whom is justly due the credit of making them practicable in the United States.
Her grandfather, Doctor Josiah Foster Flagg, was one of the early pioneers in dental surgery in the United States. Mrs. Jefferis' first husband was Thomas Wood; her second husband, Professor William Walter Jefferis, distinguished scientist and mineralogist. Mrs. Jefferis has published a volume of verses in memory of her daughter, the proceeds of which she has devoted to charity. She is a prominent resident of Philadelphia and is actively interested in all charitable work.
LUCY LARCOM.
Miss Lucy Larcom was born in Beverley, Massachusetts, in 1826. Her father died when she was but a child. In her early life Miss Larcom worked in the factories in Lowell, Massachusetts, and in her books "Idyls of Work" and a "New England Girlhood" she describes the life in these places. During her work she had constantly before her textbooks to further her education, and in 1842 the operatives in the Lowell mills published a paper known as the Offering. Miss Larcom became one of the corps of writers for this paper and in it appeared many of her first poems; also verses and essays which were afterwards collected and published in book form. Miss Larcom holds an honored place among the women poets of America. Among her earliest contributions to the Atlantic Monthly was the "Rose Enthroned" which was attributed to Emerson, as it was published anonymously. "A Loyal Woman's Party" attracted considerable attention during the Civil War; also her poems entitled "Childhood's Songs." She was at one time a teacher in one of the young women's seminaries of Massachusetts. She was also a contributor to Our Young Folks, and at one time was the associate editor and later the editor of this periodical. She also collected and published in two volumes a compilation from the world's greatest religious thinkers, under the title of "Breathings of the Better Life." She was the author of a number of religious works. Her death occurred in Boston, April 17, 1893.
JOSEPHINE B. THOMAS PORTUONDO.
Was born in Belleville, Illinois, November 23, 1867. Her grandfather was William H. Bissell, the first Republican Governor of Illinois. Writer of short stories and contributor to Benziger's Magazine and the Catholic Standard and Times.
MARY F. NIXON ROULET.
Author, journalist, musician, art critic, and noted linguist. On her father's side she is descended from a distinguished English family who were prominent in the Revolution of 1812. On her mother's side, the family were prominent in Connecticut, and fought in the Revolutionary War. She was born in Indianapolis, Indiana, and educated in Philadelphia. She married Alfred de Roulet, B.S. and M.D. She is the author of several books, "The Harp of Many Chords," "Lasca and Other Stories," "The Blue Lady's Knight," "St. Anthony in Art," books on Spain, Alaska, Brazil, Greece, and Australia, also Japanese Folk and Fairy Tales, Indian Folk and Fairy Tales, and a contributor to the Ladies' Home Journal, The Messenger, The Catholic World, The Rosary, New York Sun, New York World, Boston Transcript and Ave Maria. Secretary of the Illinois Women's Press Association.
MARGARET ELLEN HENRY RUFFIN.
Was born in Alabama and is the daughter of Thomas Henry, of Kilglas, Ireland, who was a prominent merchant and banker of Mobile, Alabama. Her mother was a cousin of Archbishop Corrigan, of New York. One of her ancestors was the last Spanish Governor of Mobile. In 1887 she married Francis Gildart Ruffin, Jr., of Richmond, Virginia, who was the son of Francis G. Ruffin auditor of the state of Virginia for many years, and a great-great-grandson of Thomas Jefferson, and related to almost all the prominent families in Virginia, the Randolphs, Harrisons, Carys, Fairfaxes, and others. Mrs. Ruffin has written several books, one of which, "The North Star," a Norwegian historical work, was translated into the Norwegian language for the schools of that country, and she had the honor of receiving the congratulations of the King and Queen of Norway for this work; also having her name mentioned among the writers of consequence by the Society of Gens de Lettres, of Paris, in the Bibliotheque Nationale and given acclaim by the department of Belles Lettres of the Sorbonne, University of Paris, after receiving the degree of Doctor of Literature. Is the author of a small volume of poems entitled, "Drifting Leaves," and a story in verse, "John Gildart." Is a contributor to the magazines and papers of both the secular and religious press.
MARGARET LYNCH SENN.
Was born in 1882 in Chicago. Was the wife of a distinguished surgeon of that city, the late Doctor William Nicholas Senn. Mrs. Senn after her husband's death presented to the Newberry Library, of Chicago, the cygne noir edition number one of H. H. Bancroft's "Book of Health" in ten massive volumes. She is a contributor to the Rosary Magazine and Times.
HELEN GRACE SMITH.
Daughter of General Thomas Kilby Smith and was born in December, 1865, at Torresdale, Pennsylvania. Contributor of poems to various magazines, The Atlantic Monthly, Lippincott's, The Rosary, Catholic World and other religious papers.
MARY AGNES EASBY SMITH.
Was born in Washington, District of Columbia, February, 1855, when her father, Honorable William Russell Smith, was serving as a member of Congress from Alabama. Writes under the pen-name of Agnes Hampton. Has written sketches for several newspapers. In 1887 she married Milton E. Smith, editor of the Church News. Is the author of romances, poems, sketches, which have appeared in her husband's paper, and also Donahoe's Magazine, The Messenger uf the Sacred Heart, and other church publications. Wrote some of the sketches which appeared in the "National Cyclopedia of Biography." Is at present one of the expert indexers of the Agricultural Department.
ALICE J. STEVENS.
Editor of The Tidings, Los Angeles, California. She was born March 10, i860. Was at one time notary public for Los Angeles County. Was also engaged in the real estate business prior to becoming editor of The Tidings. Is a contributor to Harper's, Sunset, Overland, and Los Angeles Times Magazine, also edited the Children's Department, of the Tidings for a number of years. Is conspicuous in patriotic and philanthropic work.
MARY FLORENCE TANEY.
Was born at Newport, Kentucky, May 15, 1861. Her father, Peter Taney, was a grand-nephew of Roger B. Taney, chief justice of the United States. Her mother, Catherine Alphonse Taney, was descended from a distinguished Maryland family which came to this country with Lord Baltimore, in 1632. Miss Taney has been a teacher, president of a commercial college, newspaper correspondent, private secretary, and assistant editor of the Woman's Club Magazine. Has written an' operetta, the state song of Kentucky, and has contributed to the well-known Catholic magazines.
CAROLINE WADSWORTH THOMPSON
Was born in 1856 in New York City. Married Charles Otis Thompson, whose mother was a great-granddaughter of General Israel Putnam and daughter of Lemuel Grosvenor, of Boston. Her grandfather on her father's side was John Wadsworth, of New York. The wife of her maternal grandfather, Howard Henderson, was of French descent and her great-grandfather was one of the original signers of the Louisiana Purchase. Mrs. Thompson is a contributor to the Ave Maria, Benziger's, and Sacred Heart Review, and is a prominent woman socially and in the charitable works of the Catholic Church.
FRANCIS FISHER TIERNAN.
Is the daughter of Colonel Charles F. Fisher, of Salisbury, North Carolina. Married James M. Tiernan, of Maryland. Mrs. Tiernan is a writer of note and some of her novels, under the pen-name of "Christian Reid," are "A Daughter of Bohemia," "Valerie Aylmer," "Morton House," "The Lady of Las Cruces," and a "Little Maid of Arcady," and many others.
ELEANOR ELIZABETH TONG.
Daughter of Lucius G. Tong, at one time professor in the Notre Dame University. She is a descendant of William Tong, one of the Revolutionary heroes, and related also to Archbishop Punket. She is the author of the new manual of Catholic devotions under the title, "The Catholics' Manual, a New Manual of Prayer."
HONOR WALSH.
Associate editor of the Catholic Standard and Times. Is related to Daniel O'Connell and is the wife of Charles Thomas Walsh, of Philadelphia. She has charge of the home and school page of the Young Crusader. Is the author of "The Story Book House," and contributor to the New York Sun, Youth's Companion, Benziger's, Donahoe's, The Rosary, Irish Monthly and other publications of the Roman Catholic Church.
PAULINE WILLIS.
Was born in 1870, in Boston, Massachusetts. Daughter of Hamilton and Helen Phillips. Was a direct descendant on her mother's side, of Reverend George Phillips, of Watertown, Massachusetts, who came to this country in 1630 in Governor Winthrop's Massachusetts Colony from Norfolk, England. The descendants of this Doctor Phillips were the founders of the Phillips' Academy, at Andover, Massachusetts. Miss Willis is the author of "The Willis' Records, or Records of the Willis Family of Haverhill, Portland, and Boston"; also a memoir of her late brother, Hamilton Willis, and is a contributor to the Catholic and secular press, and active worker in the charitable works and the foreign missions of the Roman Catholic Church.
CELIA LOGAN.
Was born in 1840, in Philadelphia, Pennsylvania. When quite young she filled a highly responsible position as critical reader of manuscripts in a large publishing house of London. While here she was a regular correspondent of the Boston Saturday Evening Gazette and the Golden Era of San Francisco, and was well-known as a writer of short stories for magazines in the United States and England. After the war, on her return to America, she became associate editor of the Capital, Don Piatt's paper published in Washington, District of Columbia. She did a great deal of translating from French and Italian. She was a writer of plays, the first of which was entitled "Rose," followed by "An American Marriage." In one of her plays Fay Templeton made her appearance and won success as a child actress. She wrote several stories and arranged and adapted from the French several plays. Her first husband was Minor K. Kellogg, an artist. After his death she married James H. Connelly, an author. She died in 1904.
HARRIET M. LOTHROP.
Was born June 22, 1844, in New Haven, Connecticut. She is best known under her pen-name "Margaret Sidney." Daughter of Sidney Mason Stone and Harriet Mulford Stone, and is connected with some of the most distinguished of the Puritan families. Her genius for writing began to develop early and the products of her pen have had wide circulation and enjoyed an enviable reputation. She is the author of the well-known "Five Little Pepper Stories," stories for children and young people. Mrs. Lothrop has written many books. Her story, "A New Departure for Girls" was written for those who are left without the means of support with the object of having them see their opportunities. In October 1881, she married Daniel Lothrop, the publisher and founder of the D. Lothrop Company. Their home at Wayside, in Concord, New Hampshire, is well-known, having been the home of Nathaniel Hawthorne. Mr. Lothrop's death occurred March 18, 1892, and since that time Mrs. Lothrop has devoted herself entirely to literary work, the education of her daughter, and to the patriotic societies of which she is a member. She i
|
||||
692
|
dbpedia
|
0
| 59 |
https://www.mcclernan.com/2014/05/
|
en
|
Heavens to Mergatroyd
|
https://www.mcclernan.com/favicon.ico
|
https://www.mcclernan.com/favicon.ico
|
[
"https://2.bp.blogspot.com/_8_NIJDa2ANE/TJqic4-S4LI/AAAAAAAAABY/_X5Loh8dW6w/S1600-R/heavens.jpg",
"https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj86oIJJQbBSVNyaE7cJl5FMiwdRk7vY7vqWl9NsrJsNmIX7WsDe4cFPusVKeMKGwwFGH6zfhIrjsbfuacZCpBRTXafsPu1j64QaJtIiUsG87dBWZ9w3ERI0Ew2c4wjiGx8rfM/s1600/index.png",
"https://lh3.googleusercontent.com/blogger_img_proxy/AEn0k_tz9Jvs8r906lFR9CeUwiGYvCOxdF-4UxS419vdaNyKRPHdSVRtQ-9M96wVct9J9LkvtpyEFcGZ3qW4k1qfLkfte18I11RsA2v_jFGfc6Jht7dPAm-iV7v2=s0-d",
"https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi0jYz0ri6RKuYVQpSnd5ZsKWDEiAw21YZ1lzLMgOKkXJ_titwRYaKiQ1L6Zwybs_-PKt2msgEGX9jxcWQy7it_HTBt5PA9odQC22aOCaqnCBEHdMijP7UjYqbdhc7pw66TbRc/s1600/buddha.jpg",
"https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiXShFPNnRU0iOQciZfDApKqWuQMuRFPFRt5-jDlAop05q7-IGbezSzV6n4UlanVq8GDx5L6iWZJ3iDOwGTcfGTOljSYIXYfsYnTtIIe-UQ7dlOubfpE9A9LleF00ghXXkYTnY/s1600/yoga.jpg",
"https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhOppGr01-we_UwPXMNCTlaHpZyV-utoWIZHfEXz5COIQAuKm9kue-6dlAjjZM0fKe8pNLiXhzmCCn-aORmoe-bACPv73cCXV91TS8Uo5CmcR05MizUvGXEzMP2TL8aN2jZaf8/s1600/characters.jpg",
"https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhB-q5R32Vv_Ntkcs5fWyKFHDQ4Q6NU8vu2qv8cfAQ6vgJr-p86jxQzwrOXNuFRzS-WmBCZmgFYedxEeYRgfUiTjzzfSp7aFTgXb0fS_tT-nrMsHb5sDWGXkoIV9Vj_8JgDlOs/s1600/pooh.jpg",
"https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgmcieRDDv3b697svKuzbis5nf9DUcllKDSIpnKrvzhd8ee0RVZe-B-oFaGotFYT4J4tx_EiOspz8hrNYW4AJc6gHw05FuwZKQUGrYbJl1tU74iT6OsFT3tZQISVGK0qZf6EBU/s1600/50floor.jpg",
"https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj2AoXCnvdLBF9AG1aCWKPi2rs3mYa4jGxjNs9Y8nNZZmjNQLgdiniGYsfMVFMgmK4KJ7f9VF6PcVay1D0YisuxP-giSoMOl7ma93r3My-e8Y1gqX5xwOZ_VfhuIjeOumE89xw/s1600/skylight.jpg",
"https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjiWEMEKD-yZlC0WIKQ6RXcc4-KGVy7P4vsDbNO6h1hZ5w1HGl3vMNt8vtrD5hHhPoeJKbhWIc4xLnoQ0eQdWt6vtCQLI0uwLlqmyUnuGil0bdUgUxdxDr70LvNhpgpkZkA_yI/s1600/jekyl.jpg",
"https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj4HC97mFUMqDmZm5nmG0NHJaTZ3sx3S7myX7_3Wi7-cfGV3T0iUH6dBlJ-i_gvaGMEb98VY1A9aPmDONIIk7vbDjoY3I7p511OSkrffiPzIn1rQWKREVvllDuCJ7NhZWx9rqs/s1600/workselfie.jpg",
"https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj0KvcL_RCHLCYe-gz7Q6IY4qUB9Y1Cd8L0u7eNa91yR_AOvvc6yT2B6ciWW9EYIWswCyneJW4V7rBx6cSaxzYXwETbESvsh6UlDrKmX29FjgTBj80Im6-J2xF1zdjWC-R5Ef0/s1600/brooklyn-botanical.jpg",
"https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhl8uTAGYeL9ccdzhUHR1pcmmfCx4FvIkyYeu11bW7iT_-Wm0b7KtjapRpu1GL1ozhua0lc-0KfuHxa9lhaKLHwCvDceQ0Kffdk3RskJKFXqyIXr9Gyf4r-MX_PYGKfmV4DnP0/s1600/10363701_10203828166925821_8117661441381929978_n.jpg",
"https://lh3.googleusercontent.com/blogger_img_proxy/AEn0k_teuVchak0UWKTKDK6tqAJKWqr5PZNjgifPqkC7fPYVSvM9yZN2f7QhcA4FR_Sp8qc0SFFJDQIZGgCfZtBSbjn73P39GX70ja4gRNKst5qdX64704OPCax0jw=s0-d",
"https://lh3.googleusercontent.com/blogger_img_proxy/AEn0k_vyKlKpe2zBLB5mDo01AgcLDExfeOT-lHKrPB8i1bgnivsYVLGprFv-ToypdVGBYwBCGxCnABgVZfiQE2e5I_QgmgdxyQOoBAW3ZBky7oKja50GlZmtZtcB3g3JU2utd5L9fTSA2Yo1-mBWAAVEIOrESqvYuYdUw81uBb0Yr2R2hbVpETVSOrWqMJtefW-pv7mi9jmK4tq9BhqCpTwTpixMXRLDviL31s_ZodkTQoiKRA=s0-d",
"https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhJ-WLrtperhBpcY1XfxO2FBPH5YiZTxSCDi0t5rxFyNTnuLMZroxVpmhYP6QLfvQb7x2_JUo4fuPFpXDREJ9uW2snk3iE6uPI5AGYcT7900qpvIykFjJX2vy6o39oo6C5K5Ro/s1600/harriselfie.png",
"https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjvzRY2F13JRcutqPsJPlP70dmssJjWya0iddZqv6bVdyrv4CGwdtD2NYAY_IMQUC1tIiniOyycP0-wg7ZvA9yVKJbdvteRCCG89pWM-egS6KHWPDVvLLbqB2DEmr-twddqcaU/s1600/arsenal.jpg",
"https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh_vsW2saMv-J4rjHwauFsZIPSSzcjqE9IBequchGbbzS6QDkKdIGlTefQW6rOzkTrlenwgPKBaZsg0n71GQYMds02HpAv9g684o6j_ze11kfr9rcxzRy6KKcERCNy1G6gVXqU/s1600/10255787_232680176928651_4599891069008561056_n.jpg",
"https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEilauvnzrv7OE2WXdpnrrBHAth01ltloD7kxKgZb1Z8a6yinMuaF12gsUzcr3BLHktOIxx2wrKuO0ctA5jMCd7S6x_jYEIEt2oYcZgnqdp7GEPcOUdzFwCx_P4B7S374cIQd5k/s1600/unisphere.jpg",
"https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj9Qc1W-61v3EtiIUjjYNadmUsSdu5Kwnsj8id12ikeZTNU3zg49qA68tlycbOTi5Oke-zNutse9cZD-ZDbh-ugPk4tJgNEiYgOdDnCmba06UDbdL3t0NZXCiW78Da5_NYvrYE/s1600/robin.jpg",
"https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiV-thBfYO5KbsCNwt_fnJLwk4-AwZi7lwvKV9Q4z8hzZPhvDF8Fkpxppkf2xMis0Ya1AiMFCqx8640irmH014brbT8rx9MgPUpnGf6eeZhPsv2H-OLOOWlJmLYPGW1caFsPr8/s1600/bridge.jpg",
"https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhapU4fqh9Q4Xq6K0J6EFCScJGXpcu0KH4BIoS_pZu9tIox6Y2LCYQJHiAY8SxjLc_3dbk_nRBv0Zk9GgurKHoN9PChb2zB8oH3fQUpyW3ODjqV7bkl1jrYxp_yv188i5Kt0aM/s1600/Ndtcotwbbkcvr.jpg",
"https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgyJMxvL0vtyFCBjyB4HIgUWRL4F7M03IwGt072hO3kVPzAYjs8-PcbFDriBgUEQP7A2zFqQNX1wJceLJMvA-IIeShaBH7m6XbW0qmbRc2uoebVgPSeiS-igEkMJw_Jkq_kBEQ/s1600/2013-06-12-22-16-41-4959.jpg",
"https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgh2ZoiJWZbYgTXevzThw6T_XYKKDQumjZesdZ0L-s6P1f2rUmRXQMJYvcKj1qdRp5Y_86eSykGDYuzrQ6W7imZKSDrf2ZcxPYEwStGcksZ1dmk8S4EDMlRHl-xcdX4yrtQOYo/s1600/side_banner.jpg",
"https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgmO5l9HkuaNQl15NXo3ARknmPESzypcnRgjUQDJaSe9JGOUZLPA_EzduaIrvBawLT8QiymrauHKS4GxXpv9OkPTus8adJd1O4LZd1iy2WgIvkVJPQyEx9ShNc44WkOp54rzLI/s1600/mkpart2.png",
"https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg_2l1wXaoRFy-zM-SguqHUc1Y7cEIQSK1D_BnvGmlD1DOofhWNGIqtDlCfKB6fD0dafXgphr3qqtMyTbZIxgm-HtuXfsFtiHAOcaC9OawV8RdZ8qk7_YU11hsX-ckh_uCdBtk/s1600/mkpart1.png",
"https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiv6zTgwuf98yEgTyoo18kkQlAp0OpZIdfvKn3jGRoJ1WtETphX2NyGt78Y_NblnCi6s781XuyUmZmvDkHoHDq-Ddo41uz5-P-NEHdHaHC1OXZNT8XfVP5HzmhiZoT8laAT5ps/s1600/building.jpg",
"https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhyMenypYpcOfAcsysdbRSkjgKxj-IvzxhsJJRcjjSsks6jHtoAj9SF4QxcHjwtWIwyjN72cezm4cklVZopYWl1o1wndnmEzuSuLTIjivMg_bnXhTXJ-rbPpScUH0sSn-XEFIM/s1600/rainbow.jpg",
"https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgGKclqYA_nBtr0ukUJ4ga64jTN594rfwzL60HiMQRk6UW7_mcsMA1QFq74J-GyAbKIjrAFBSNG7cD8DKsS8hJgqhq50B39Y75Q-HIWIaFDHyGU61g7lcUbEstDRwbKadCUvaM/s1600/clowns.jpg",
"https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg1bI3WQ5kbJELxIhT4Zyqvx8obaTdRp32N0xINhNzmzJ8Q1_aHZLMDYW10n3FUraQ5TqeOPhCmz2XX-Iz7HMPQ0U6UyFEsV0u1SlioIsjKtPZSxYgrVUqSnD_Lf2LDQd-eYF8/s1600/elevator.jpg",
"https://www.mergatroyd.org/SPLC.png",
"https://blogger.googleusercontent.com/img/a/AVvXsEiJI_wGfbC56ru_YAM3EJ6aRP8Ve6-0NCkKFepmmsD4TLBrMFbnAYSu5aPmGq5lyOfGZhLrHfnwpYhp2II_g3V5MWN6idGVyZ8e3OO1NjLoLUHGhT-D9eW7E67vVpU7ZQ5Mg_2MNwvU40IZ5j3TBhhPZ6V5vhjYvCO_6sK5cQrjeVQ5mJki3A=s341"
] |
[] |
[] |
[
""
] | null |
[] | null |
Heavens to Mergatroyd, the website and blog of Nancy McClernan, playwright, egalitarian, and advocate for civil and human rights.
|
en
|
https://www.mcclernan.com/favicon.ico
|
https://www.mcclernan.com/2014/05/
|
Bruce Barton, Winnie the Pooh,
Nick Fondulis in POOH STORY The view from the penthouse
Seen down the street Lear
Cordelia
King of France
Kent
Edgar
Albany
Gloucester
The servant who stabs Cornwall Goneril
Regan
Edmund
Cornwall
Oswald
Duke of Burgundy
Edmund's henchman Waiting to start the race - the start line was next to the Queensborough Bridge. Feelin' groovy! Hey, who says only Brooklyn has nice things? Somebody's clown doll collection in the window -
OK, that's disturbing...
|
|||
692
|
dbpedia
|
2
| 40 |
https://www.studiotheatre.org/plays/play-detail/2016-2017-the-hard-problem
|
en
|
The Hard Problem
|
[
"https://studio-theatre.s3.amazonaws.com/u/logo.png",
"https://studio-theatre.s3.amazonaws.com/u/logo-small.png",
"https://studio-theatre.s3.amazonaws.com/u/500x320_Play_Image.wOSa.jpg",
"https://studio-theatre.s3.amazonaws.com/u/375x375_Headshots_001.K7Zl.cv360x360.jpg",
"https://studio-theatre.s3.amazonaws.com/u/375x375_Headshots_002.mAPd.cv360x360.jpg",
"https://studio-theatre.s3.amazonaws.com/u/265x265_Headshots_001.0SGQ.jpg",
"https://studio-theatre.s3.amazonaws.com/u/265x265_Headshots_002.gEdV.jpg",
"https://studio-theatre.s3.amazonaws.com/u/265x265_Headshots_003.GrKG.jpg",
"https://studio-theatre.s3.amazonaws.com/u/265x265_Headshots_004.ZTC9.jpg",
"https://studio-theatre.s3.amazonaws.com/u/265x265_Headshots_005.gSNi.jpg",
"https://studio-theatre.s3.amazonaws.com/u/265x265_Headshots_006.3vwQ.jpg",
"https://studio-theatre.s3.amazonaws.com/u/265x265_Headshots_007.HP4O.jpg",
"https://studio-theatre.s3.amazonaws.com/u/265x265_Headshots_006.dht4.jpg",
"https://studio-theatre.s3.amazonaws.com/u/265x265_Headshots_008.bZuZ.jpg",
"https://studio-theatre.s3.amazonaws.com/u/265x265-17.18-Translations-headshot-Martin-Giles.jpg",
"https://studio-theatre.s3.amazonaws.com/u/265x265_Headshots_010.png",
"https://studio-theatre.s3.amazonaws.com/u/350x260_Featured_Writing_004.ugKl.cv300x225.jpg",
"https://studio-theatre.s3.amazonaws.com/u/350x260_Featured_Writing_005.kq8I.cv300x225.jpg",
"https://studio-theatre.s3.amazonaws.com/u/350x260_Featured_Writing_003_2.cv300x225.jpg",
"https://studio-theatre.s3.amazonaws.com/u/350x260_Featured_Writing_001.wBgS.cv300x225.jpg",
"https://studio-theatre.s3.amazonaws.com/u/350x260_Featured_Writing_006.gVop.cv300x225.jpg",
"https://studio-theatre.s3.amazonaws.com/u/350x260_Featured_Writing_002.NtnT.cv300x225.jpg",
"https://studio-theatre.s3.amazonaws.com/u/studio-black.png",
"https://studio-theatre.s3.amazonaws.com/u/f_logo_RGB-Black_144.png",
"https://studio-theatre.s3.amazonaws.com/u/Twitter_Social_Icon_Square_black.rImJ.png",
"https://studio-theatre.s3.amazonaws.com/u/glyph-logo_May2016.png",
"https://studio-theatre.s3.amazonaws.com/u/youtube_social_icon_dark.png"
] |
[] |
[] |
[
""
] | null |
[] | null |
en
|
/favicon.ico
| null |
Born Tomáš Straüssler in 1937 in what would soon be Nazi-occupied Czechoslovakia, Tom Stoppard and his family lived in Singapore and India before settling in England in 1946. Although he would go on to write thrillingly (and notoriously) intellectual plays, the young Stoppard was bored by school and left at 17 to work as a journalist. When he was 21, Stoppard saw Peter O’Toole play Hamlet, and decided that he was interested in writing for the stage.
Over the next eight years, Stoppard completed several radio plays and even a novel (Lord Malquist and Mr. Moon) before his first success on stage: the dazzling 1966 comedy Rosencrantz and Guildenstern Are Dead, in which two minor characters from Shakespeare’s Hamlet take center stage. The play debuted at the Royal National Theatre in 1968, transferred to the West End and then to Broadway, where it won Tony and New York Drama Critics awards for Best Play. Stoppard has continued to write award-winning plays over the course of his career, plays that vary in tone from highly literary and comic (Rosencrantz and Guildenstern Are Dead; The Coast of Utopia), to experimental and musical (Every Good Boy Deserves Favour), to scientific (Hapgood; Arcadia), or more overtly political (Indian Ink; Rock ‘n’ Roll). Stoppard is also a successful screenwriter whose work includes Anna Karenina, the BBC mini-series Parade’s End, co-writing Terry Gilliam’s Brazil and sharing writing credit on 1998’s Academy Award-winning Shakespeare in Love.
Stoppard has received an impressive array of accolades over his career, including five Tony Awards, a Drama Desk Award, and a Laurence Olivier Award in addition to his Oscar for Shakespeare in Love. In 1997, Queen Elizabeth II knighted Stoppard. Receiving the high honor at Buckingham Palace was a touching experience for Stoppard, who fondly speaks of the event: “I have felt English almost from the day I arrived, but the knighthood puts some kind of seal on that emotion.”
(As of May 2013)
Matt Torney is entering his fifth season as Associate Artistic Director at Studio, where he has previously directed If I Forget, Translations, The Hard Problem, MotherStruck!, Hedda Gabler, Jumpers for Goalposts, The New Electric Ballroom, and The Walworth Farce. Prior to his work at Studio, Matt served as the Director of Programming for Origin Theatre in New York, an Off Broadway company that specializes in European new writing. His New York credits include Stop the Tempo and Tiny Dynamite at Origin Theatre (Drama Desk Award nominee), The Twelfth Labor at Loading Dock, The Dudleys at Theatre for the New City, The Angel of History at HERE Arts, and Three Sisters and A Bright Room Called Day at the Atlantic Theatre School. Regional credits include Brighton Beach Memoirs at Theatre J (nominated for two Helen Hayes Awards), Sherlock Holmes and the Crucifer of Blood and Observe the Sons of Ulster Marching Towards the Somme at Pittsburgh Irish and Classical Theatre, and Improbable Frequency at Solas Nua (Helen Hayes Award nominee for Best Choreography). International credits include Digging for Fire and Plaza Suite with Rough Magic (National Tour), Angola workshop at the Abbey Theatre, Paisley and Me at the Grand Opera House Belfast, The Last Days of Judas Iscariot at Making Strange (Irish Theatre Award nominee for Best Director), and Woyzeck at Rough Magic (Best Production nominee at the Dublin Fringe Festival). Originally from Belfast, Matt holds an MFA from Columbia University.
(As of August 2019)
David Andrew Macdonald has appeared on Broadway in Skylight, Rocky, Mamma Mia!, Coram Boy, Two Shakespearean Actors, and the National Tour of Stephen Daldry's An Inspector Calls (Jeff Award nomination). His Off Broadway credits include A Night and her Stars and The Green Heart at Manhattan Theatre Club. He has appeared in world and American premieres by Lucinda Coxon, Theresa Rebeck, and Emily Mann at Yale Rep, The Alley Theatre, and McCarter Theatre Center. Across the U.S. and Canada, Mr. MacDonald has worked at The Old Globe, Hartford Stage, Wilma Theatre, Cleveland Playhouse, Shakespeare Theatre of New Jersey, The Cape Playhouse, Manitoba Theatre Centre, and many others. His television credits include Elementary, Person of Interest, The Blacklist, The Big C, Michael J. Fox Show, Law and Order, Law and Order: SVU, Sex and the City, Another World, and ten years as Edmund Winslow on Guiding Light. Mr Macdonald is a graduate of The Juilliard School.
(As of January 2017)
Nancy Robinette has been affiliated with Studio since the late 1970s, first as a student and then performing in The Woolgatherer, Camino Real, Tribes, The Beauty Queen of Leenane, The Play About the Baby, Three Sisters (1995-96), Ivanov, The Seagull, Afterplay, Frozen, Souvenir, Slavs!, The New Electric Ballroom, and Laughing Wild. Her recent work at Studio includes Three Sisters (2016-17) and The Hard Problem. Ms. Robinette most recently performed on Broadway in The Curious Incident of the Dog in the Night-Time. She has also performed on most of the DC stages, and at the McCarter Theatre, Paper Mill Playhouse, Williamstown Theatre Festival, Roundabout Theatre, New York Theatre Workshop, The Globe Theatre, as well as in Key West and the former Yugoslavia. Film and television credits include Louie, Serial Mom, Soldier Jack, and the upcoming Three Christs. Ms. Robinette is a Woolly Mammoth Theatre Alumna and an Associated Artist with Shakespeare Theatre Company.
(As of March 2017)
Michael Russotto returns to Studio Theatre for The Hard Problem, having last appeared in Love! Valour! Compassion! Mr. Russotto is a member of Woolly Mammoth Theatre Company, where he has performed in productions such as The Elaborate Entrance of Chad Deity, A Bright New Boise, and She Stoops to Comedy. Other regional credits include Guess Who’s Coming to Dinner and Legacy of Light at Arena Stage as well as Copenhagen and The Christians, at Theater J. His work in Washington has earned him several Helen Hayes Award nominations in the Outstanding Lead Actor and Outstanding Ensemble categories. Film and television work includes Playing Through and The Battle of Bloody Lane. Mr. Russotto can be heard on the LA Theatre Works recording of Seven Days in May with Ed Asner. He has also narrated hundreds of recorded books. In March he will make his Cleveland Play House debut in Between Riverside and Crazy.
(As of February 2017)
Debra Booth is Director of Design at Studio Theatre, where she has designed If I Forget, Translations, The Wolves, The Father, The Hard Problem, Moment, Constellations, The Apple Family Cycle, Jumpers for Goalposts, Belleville, Cock, Edgar & Annabel, Bachelorette, Moonlight, Blackbird, My Children! My Africa!, The Pillowman, and many others. Her international work includes premiere opera Marco Polo (Tan Dun/Martha Clarke) in Munich, Hong Kong, and New York. Regionally, Debra’s credits include Small Mouth Sounds at Round House Theatre; Richard III, The Collection, and The Lover at the Shakespeare Theatre Company; Marisol at Hartford Stage and The Public Theatre; Trying, The Illusion, and Happy Days at Portland Stage Company; the New York premiere of Angels in America at The Juilliard School; Broken Glass at Philadelphia Theatre Company (Barrymore Award nomination); and Moon for the Misbegotten at Yale Repertory Theatre. Debra is the recipient of the DC Commission on the Arts and Humanities Artist Fellowship, National Endowment for the Arts Design Grant, and a graduate of the Yale School of Drama.
(As of October 2019)
Michael Giannitti was Resident Lighting Designer at Studio Theatre from 2006-2010; since 1991 he has designed 45 productions at Studio, including The Hard Problem, Jumpers For Goalposts, Water by the Spoonful, The New Electric Ballroom, American Buffalo, Reasons to Be Pretty, Rock ‘n’ Roll, The Pillowman, and Seven Guitars (Helen Hayes Award nomination). He designed lighting for the Broadway premiere of August Wilson’s Joe Turner’s Come and Gone. His Off Broadway credits include Cross That River and Sounding Beckett. He has designed extensively for Shakespeare Theatre of New Jersey, Dorset Theatre Festival, Capital Rep, Trinity Rep, Shakespeare & Company, and the Weston Playhouse. Giannitti has also designed for Arkansas Rep, Barrington Stage, Chautauqua Theatre Company, Virginia Stage, Indiana Rep, Portland Stage, George Street, Yale Repertory Theatre, Olney Theatre Center, and the Spoleto Festival. He has been on the faculty at Bennington College in Vermont since 1992. As a Fulbright Specialist, he taught in Romania and New Zealand, and has been a guest lecturer at the Guangxi Arts Institute in China.
(As of August 2018)
Elizabeth Forte Alman returns to Studio Theatre after coaching Cloud 9 earlier this season. Residing in the DC area for over 15 years, she has coached productions at the Kennedy Center, Shakespeare Theatre Company, Round House Theatre, Rep Stage, and Everyman Theatre. Maintaining a private practice of voice, speech, and performance coaching, she engages clients from the Congressional, Department of State, and Department of Defense community; members of multi-national organizations and corporations; and practitioners in the fields of health care, law, science, journalism, education, investment banking, public relations, and acting. Currently a member of the Performance Faculty at George Mason University, Dr. Alman has taught Acting and Voice classes at the University of Maryland, Catholic University of America, the Academy of Classical Acting at George Washington University, and the University of Maryland- Baltimore County. She is a Shakespeare's Globe Fellow, a Cosmos Club Scholar, and an Associate Teacher of Fitzmaurice Voicework®. Dr. Alman received her PhD in Theatre and Performance Studies from the University of Maryland, an MFA from the Alabama Shakespeare Festival/University of Alabama Professional Actor Training Program, and a BA from Illinois State University.
(As of December 2016)
|
||||||
692
|
dbpedia
|
1
| 15 |
https://www.howtowriteplays.com/the-playwriting-podcast
|
en
|
The Playwriting Podcast — How to Write Plays.com
|
https://images.squarespace-cdn.com/content/v1/5f4e8a891c8347308465e548/1599477233185-81IOOXE4BH2RQMY8RVTA/favicon.ico
|
https://images.squarespace-cdn.com/content/v1/5f4e8a891c8347308465e548/1599477233185-81IOOXE4BH2RQMY8RVTA/favicon.ico
|
[
"https://images.squarespace-cdn.com/content/v1/5f4e8a891c8347308465e548/2aebfff1-6ef4-4740-8c7e-dc2812adb84d/Fantastic+Play+Series+titles+4+LINKED.jpg",
"https://images.squarespace-cdn.com/content/v1/5f4e8a891c8347308465e548/21489b07-b661-4c2a-b777-63167e9100e5/ATHE%2BPLAYWRITING%2BPODCAST%2BSMALL%2BFinal%2Bcopy.jpeg",
"https://images.squarespace-cdn.com/content/v1/5f4e8a891c8347308465e548/8537a121-9e77-4278-b051-33ec770ba982/KEN+2+copy.jpg",
"https://images.squarespace-cdn.com/content/v1/5f4e8a891c8347308465e548/9b142913-898b-4823-8015-b3d8bf6158cc/Professor%2BAl%2Band%2BMonster.jpeg",
"https://images.squarespace-cdn.com/content/v1/5f4e8a891c8347308465e548/1609434983442-47XQ4EXQKWBKT8NCEYIW/PROF%2BAL%2Bcopy.png",
"https://images.squarespace-cdn.com/content/v1/5f4e8a891c8347308465e548/1600105166671-WG5XJYGW7GKGH7G80Q4S/PROF+AL+copy.png"
] |
[] |
[] |
[
""
] | null |
[] | null |
en
|
https://images.squarespace-cdn.com/content/v1/5f4e8a891c8347308465e548/1599477233185-81IOOXE4BH2RQMY8RVTA/favicon.ico
|
How to Write Plays.com
|
https://www.howtowriteplays.com/the-playwriting-podcast
|
In this episode, I share some very cool techniques for you to Get into that Elusive Creativity Zone consistently, and if you are in the Creativity Zone consistently, your creative output is going to soar! Check this out and change your life!
Bio:
Playwright/ Screenwriter, Director and Producer Sarah T. Schwab
Initially developed for the stage, the film Sarah wrote and produced “A Stage of Twilight” stars Karen Allen and William Sadler. This film is a love story set in the final chapter of Cora and Barry's lives. The film premiered in a limited theater run this March and is now available to stream on demand on Amazon, Vudu, Vubiquity/Verizon Fios, Hoopla, Charter/Spectrum, Comcast/Xfinity, and Cox.
Sarah is an active member of the Playwright/Directors unit at the Actors Studio in New York City and has previously won Best Director in an English Language Feature Film at the Madrid International Film Festival in 2020 for her first feature film, “Life After You.” Sarah was also honored in 2022 with the Best Emerging Director award at the Woods Hole Film Festival for "A Stage of Twilight.” In 2023, “A Stage of Twilight” won the Filmmaker Award at the Sonoma International Film Festival.
In this awesome episode, I interview Playwright, Director and Producer, Freedom Farlow Cooke! She talks about her writing workflow, her new play which is being produced in Philadelphia in June, and both Freedom and I, invite you to direct some of your own work for it will change your life. Check out this episode. Freedom is a fantastic creator and she has a lot of wonderful insights to share!
More about Freedom:
Bio
Playwright - Freedom Farlow Cooke
I have written several plays (a number of which have been produced) that relate to social issues within the African American community. I have also received a grant for my short film entitled “AMELIKA.”
I write because it allows me to tell stories that are not only relatable, but encourage others to explore their own perspectives of thought.
Playwriting is a gift that allows the audience to view stories through the lens and imagination of others, a wonderful journey into unique life experiences told through beautiful and compelling stories. While some stories have been told, many have yet to be explored - so anytime I can be a conduit to bridge the gap, I am willing to write!
In this very cool episode of The Playwriting Podcast, I talk about how to make BIG and congruent choices in your work, so that you are not a mediocre playwright! Wow! Tough love! But heck, wimpy choices create wimpy plays, and yes, you have to risk being over the top, in order to land on the precipice called BIG and PERFECT. Do you have the Beach Balls to make some big choices and take a risk? You only live once, so what are you waiting for?
And in this process of talking BIG Choices…
I talk about WITCHLAND which Manhattan Rep is producing and bringing to stunning life.
What better than a play about and EVIL WITCH in a town maybe poisioned by Nuclear waste?
Sound like the perfect play to make some big choices!
Check this out!
Listen online at the button below.
And get your tickets to Witchland at the link below opening April 5th in NYC!
https://witchlandplay.com/get-tickets/
In this exciting episode, I talk about editing, and I offer my 10 Editing Questions again as a means of editing your work as you write and editing your first draft, second draft and more. Editing is often tedious but it is one of the most important things you can do to refine your play. And with my 10 Editing Questions (Below) - Wow! Editing your play will be more effective and faster than you have ever experienced before!
My 10 Editing Questions:
These questions are like filters to refine your play and make it more concise.
And concise is good.
1. Is there a clear problem & action related to the problem that needs to be solved in each scene? If not, fix it.
2. Does this scene top the scene before? If not, fix it.
3. Are your characters saying too many words? Do they need to say three sentences when they could say the same thing in one sentence?
4. Do your characters speak in clear and distinctly different ways? If not, how can you make them consistently different?
5. Are your characters telling stories that don’t have a dramatic event attached to the telling of the story? If not, cut them or make them two sentences tops. I’m serious. (A story with a dramatic event attached could be a Coming Out story, or a Break Up story.)
6. Are the characters saying too little? Is it clear what is happening in each EVENT?
7. Are you telling BACK STORY to the audience that is not intrinsically told during a dramatic action moment in the scene? If not, fix it!
8. Is the scene too long? Could it be a page or two shorter and still convey all the important information and ACTION that will propel this play to its dramatic conclusion?
9. Is the scene too short? Are the actions and events in this scene big enough?
10. Do you need this scene? Does this scene top the scene before, and propel the dramatic action of the play? If you answer yes to this - keep the scene. If no, cut it!
In this episode, I talk about how you can take IDEAS from plays, film and TV and make those ideas your own and put them into your plays. This is not plagiarism, for you are not taking lines, just concepts and adapting them for your own amazing uses. I talk about FROM SCRATCH on Netflix that steals from Chekhov in an incredible and amazing way, but if you don’t know The Three Sisters as well as I know it, you would never see it. (BTW, FROM SCRATCH is one of the best TV series I have ever seen. It is brilliant and so beautifully constructed, and acted. Bravo!). And then I talk about all the ways you can take these concepts and ideas to improve your playwriting. This one is fun!
In this episode, I talk about the opportunities for playwrights in this very Brave New Normal. The Theatre world has been disrupted by the pandemic, making now the perfect time to connect with theatres and producers and Theatre ANGELS, to get your play produced.
I talk about Powerhouse by David Harms which we are producing OFF-BROADWAY in October and I talk about the wild process of reaching out to Agents to find Name Talent for the lead, and how that process too has changed because of this pandemic. Then I tell a quick Zen story, and invite you to use this time to get your plays produced! This nutty new time is filled with opportunity if you look at this world as it is and not as you think it was. Don’t miss this one. Super Fun!
My old pal, Professor Albert is back and he has hijacked the podcast again to talk to playwrights all over the world about creating specific characters, and to demonstrate his intense acting abilities in the process.
Aren’t you tired of Ken Wolf on this podcast telling you that you need to do this and you need to do that to propel your playwriting career to the next level? Now you can listen to Motivational Music Superstar Professor Albert as he tells you that you need to do this, and you need to do that to propel your playwriting career to the next level. And then for the first time on this podcast, Professor Albert shares a hypnosis meditation so that you can write better characters and also, become one with the universe! Don’t miss this exciting episode!
In this episode, I rail about how often writers will play with new ways to TELL a story at the expense of creating a clear context, so that the people watching will actually UNDERSTAND what is going on! I see it in movies, TV and alas, in plays.
Then I talk about the importance of creating a clear context and how it will ultimately be the foundation on which to build your play. And as usual, I tell a cool story to illustrate all.
Then, I talk about Powerhouse by David Harms, the Off-Broadway show we are producing opening next October in Midtown Manhattan. I talk about working on the script and how my intention is to create a perfect rehearsal draft for this play.
And lastly, I offer up really good reasons why you need to take one of my Master Academy Zoom Courses: The Playwright’s Reading, or Rewriting Your Play, and I share the wonders of a great playwright website and how we will build it for you.
All this in under 18 minutes. What fun!
In this episode, I talk about FEAR, our old Pal who often comes a callin’ when we are moving forward in our lives and doing new things.
I take you through a process to challenge your FEAR and find a better emotional answer, so you can move forward in your playwriting career with new clarity and passion, and BE MORE.
Becoming a working playwright is not just about writing a great play. You need to become FEARLESS and relentless and connect to theatres, producers, agents and more.
And to do that, often, you have to change how you think.
Wow, a podcast about playwriting that is not about playwriting…
…and it is.
Check this out. Do the work. Change your thinking and get your work out into the world!
In this episode, I talk about Amsterdam’s Orange Theatre Company’s Short Zoom Theatre Film - FEVER DREAMS, which was one of the most exciting and creative Zoom presentations that I have ever seen! (It is a part of Manhattan Rep’s Stories Film Festival in May. Don’t miss it!)
In this amazing Zoom Film there was a Big Problem, Big Events happening in the story (AND ON THE COMPUTER!) It was so well rehearsed and filled with INSANE PASSION!!
I outline these FOUR STEPS to take your PLAY to the next level. How can you go further with your work? And get your work out into the world as we move into this NEW RENAISSANCE OF THEATRE! Don’t miss this!
In the episode, I ask the BIG QUESTION: Do you want to join the REVOLUTION?
Do you want to be part of tomorrow’s theatre, a vibrant and passionate community of artists writing plays that make a difference? Do you want to be a part of this NEW AGE of live storytelling? Are you willing to do the work to write like you have never written before to help transform this BRAVE NEW WORLD?
As storytellers, we have more power to create a shift in consciousness than all the politicians in the world. Playwrights are magicians and miracle makers. (Yes, you are!) So are you ready to create some miracles with your work? Are you willing to be bigger, bolder, more passionate and work harder than ever before to create some transformational plays for this New Age? How can you with your storytelling skills be a part of the solution as we return to live theatre?
Ah yes, that is the question!
In this episode, I interview Broadway Producer, Ken Davenport, about the road back for Broadway and for theatre opening around the world. This interview is inspiring and sheds some glorious light at the end of a very long and dark tunnel. Ken talks about what is happening now, and what the process moving forward might look like as theatre reopens! Don’t miss this episode!
Ken Davenport’s Bio:
Ken Davenport is a Tony Award-winning Broadway producer whose credits include Once On This Island (Tony Award), Gettin’ the Band Back Together, The Play that Goes Wrong, Groundhog Day (Tony nomination), Deaf West Theatre’s Spring Awakening (Tony nomination), It’s Only a Play, Macbeth starring Alan Cumming, Godspell, Kinky Boots (Broadway - Tony Award, National Tour, Toronto, Australia, and West End), The Visit (Tony nomination), Mothers and Sons (Tony nomination), The Bridges of Madison County (National Tour), Allegiance, Chinglish, Oleanna starring Bill Pullman and Julia Stiles, Speed-the-Plow, Will Ferrell's You're Welcome America (Tony nomination), Blithe Spirit starring Angela Lansbury (Broadway, West End and National Tour), and 13.
Off-Broadway, Ken has produced Daddy Long Legs, Altar Boyz (Co-Conceiver), My First Time (Author), The Awesome 80’s Prom (Creator), That Bachelorette Show! (Creator), and Miss Abigail’s Guide to Dating, Mating, & Marriage (Author). Ken's productions have been produced internationally in over 25 countries around the world.
In 2019, Inc. 5000 named Ken’s production company, Davenport Theatrical Enterprises, one of America’s fastest-growing private companies.
He is the founder of TheaterMakersStudio.com, a one-of-a-kind "masterclass" community that provides training and inspiration from Broadway's best to writers, directors, producers and more.
Ken also serves as the Executive Producer for North America for Andrew Lloyd Webber’s Really Useful Group.
Outside of theatre, he has produced the award-winning These Magnificent Miles: On the Long Road with Red Wanting Blue, a documentary on one of the top unsigned rock bands in the country, and an award-winning TV pilot entitled The Bunny Hole which has appeared in the LA Indie Film Festival, the Orlando Film Festival, the LA Comedy Festival and more. Ken was featured on a national commercial for Apple’s iPhone, named one of Crain’s “Forty Under 40” and is one of the co-founders of TEDxBroadway. He created the best-selling Broadway board game Be A Broadway Star. His blog, TheProducersPerspective.com, has been featured in Vanity Fair, New York Magazine, The Gothamist and more. He has written articles for Forbes, Mashable, and many others. Ken’s unique production and marketing style has garnered him international attention, including two front page articles in the NY Times and features on MSNBC, Rock Center, Fox News, BBC, and his favorite, a mention in Jay Leno’s monologue on “The Tonight Show.”
Upcoming projects include Broadway Vacation, Joy the Musical, My Life In Pink, a revival of The Great White Hope, Harmony: A New Musical written by Barry Manilow and Bruce Sussman, a musical based on the life and songs of Neil Diamond, and a musical based on the life of Harry Belafonte.
Prior to his career as a Producer, Ken was a Company Manager and General Manager for Broadway shows and National Tours including Show Boat, Ragtime, Jekyll & Hyde, Chicago, Candide, Thoroughly Modern Millie, Gypsy and others.
Get ready for a really wild ride as I talk to actors Dave Silberger & Florence Pape about Play Development, specifically on their work on Mike Zielinski’s awesome comedy entitled “HE’S YOUR DADDY” which Manhattan Rep produced in March 2019, directed by yours truly. Florence and Dave have worked with me on a myriad of productions over the past 3 years, and they are fantastic actors and awesome human beings. This episode is great fun, and an inside look at what happens in rehearsal.
My intention with this episode is for playwrights to get a real sense of what play development is, as we talk about the process of bringing this comedy to life.
Florence’s Bio
Florence Pape Theatre: Marti, Mints by George Cameron Grant (Best Actress-Think Fast Festival, Secret Theatre, Best Play-Manhattan Rep., United Solo Festival, Theatre Row), Wendy, Grant’s Lovers Kiss (Manhattan Rep. & Think Fast Festival - Best Actress nom.), Mae West, Laugh Supper, Connie Conrad, He’s Your Daddy (Manhattan Rep); Doris, Can You Hear Me Now?, Dottie,It Gets Better, Lucy, Criminally Insane, Mrs. Mendelson,Sorry For Your Loss, Grandma,Family Secrets, God,Strong Meds and Jewish Guilt (Alternative Theater), Helene Berman, Significant Other (nom. best actress BroadwayWorld.com Regional Awards, NJ Theater), Lavinia Penniman,The Heiress and Marietta Claypoole, Regrets Only, Nutley Little Theatre, Motherhood Out Loud and Virginia,Three Viewings, Hackensack Performing Arts/Hoboken Library. Favorite roles Hudson Theatre Ensemble: Joanne, Company, Martha,Who’s Afraid of Virginia Woolf, Reba, The Last Night of Ballyhoo, Ouisier, Steel Magnolias. Commercials/TV/Film: Major Pharmaceutical Commercial (also print/ internet), Immersive Installation Facebook Portal, Twin Chef Infomercial, Comedy Central Mini-Mocks, Comcast Spotlight. Film: Wendy, Lovers Kiss (filmed/directed Michael Stever) florence@fpls.com
Dave’s Bio
Dave Silberger has been entertaining audiences at Renaissance Festivals for eons as Half Wit Henry in The Sturdy Beggars Mud Show. He has also performed with Theater Companies in Chicago, New Jersey and New York, as well as indie films and the occasional commercial. There is nothing he likes better then collaborating on exciting projects with generous and talented people.
In this episode, I have a wonderful conversation with Playwright Coni Koepfinger, who is one of our Resident Playwrights at Manhattan Rep. We talk about her plays, how she writes and what she often writes about, and the future of theatre as we move into this Brave New World.
Coni Koepfinger (Playwright in residence at Manhattan Rep and Cosmic Orchid)
A recent finalist in Playbill’s inaugural Virtual Theatre Festival, 2020,
Coni Koepfinger is the host of AIRPLAY, a weekly theatre program now in its 12th season that gives voice to artists worldwide and DETERMINED WOMEN, a monthly feature that interviews women who share stories to encourage and inspire. In addition to teaching theatre and composition at prominent universities, Koepfinger is an internationally published and produced playwright, theatre theorist, and librettist. Coni is a Media Advisor for the Lifeboat Foundation who recently published her play, Get the Message in their Visions of the Future anthology; a contributing writer for the Center of Conscious Creativity in LA; a Member of The Dramatists Guild, and an instrumental member of the International Center for Women Playwrights and the League of Professional Theatre Women. Recent work includes three new powerful pieces with her writing partner Joe Izen: including Eve of Beltane -a fresh look at political corruption in the face of ancient Celtic mythology that was given a 29 hr AEA staged reading at Broadway Bound Festival (2019),; Schoolhouse - an ultramodern musical that takes the young victim of a school shooting through a magical journey into an imaginary schoolhouse to find compassion and joy; and the new age musical, Kingdom Come, where technology meets its match in matchmaking with TED, the world's first transhuman who falls in love with boss only to reveal a bigger, brighter picture for all humanity. She has written well over 40 plays, short stories , books and commissions such as Takin’ It Back, a ten-minute play for THE ME TOO PROJECT in Harlem, and Playing House a commissioned one-act about Bella Abzug for the UNTOLD STORIES OF JEWISH WOMEN and Playing Fate which was accepted for New Blood Series at Theatre for the New City. In 2020 Koepfinger is virtually all over, with Caging the Spirit, a short James Scheider at Walls & Bridges at California State University's \\ and her new full-length, My Dinner with Mary, which was read online for The Producer’s Circle in March, and will be produced in the Dream Up Festival in 2021 at Theatre for the New City. Simonyt, New Blood Series at TNC; Caging the Spirit at California State University and My Dinner with Mary, read for cutworms The Producer’s Circle and was chosen for the Dream Up Festival 2021 at Theatre for the New City and The Simon Says in the Playbill VTF.
On this Episode, I talk about how to refine your play and make it absolutely perfect! I offer these 10 Editing questions below, along with the process of editing and I talk about the importance of having a reading of your play after you finish your first draft, that is a reading for you, not for feedback. And I talk about this website How To Write Plays.com.
Here are the 10 Editing Questions to refine your first draft:
1. Is there a clear problem & action related to the problem that needs to be solved in each scene? If not, fix it.
2. Does this scene top the scene before? If not, fix it.
3. Are your characters saying too many words? Do they need to say three sentences when they could say the same thing in one sentence?
4. Do your characters speak in clear and distinctly different ways? If not, how can you make them consistently different?
5. Are your characters telling stories that don’t have a dramatic event attached to the telling of the story? If not, cut them or make them two sentences tops. I’m serious. (A story with a dramatic event attached could be a Coming Out story, or a Break Up story.)
6. Are the characters saying too little? Is it clear what is happening in each EVENT?
7. Are you telling BACK STORY to the audience that is not intrinsically told during a dramatic action moment in the scene? If not, fix it!
8. Is the scene too long? Could it be a page or two shorter and still convey all the important information and ACTION that will propel this play to its dramatic conclusion?
9. Is the scene too short? Are the actions and events in this scene big enough?
10. Do you need this scene? Does this scene top the scene before, and propel the dramatic action of the play? If you answer yes to this - keep the scene. If no, cut it!
|
|||
692
|
dbpedia
|
0
| 9 |
https://www.playpenn.org/tag/summer-classes/
|
en
|
Summer Classes – Play Penn
|
[
"https://www.playpenn.org/wp-content/uploads/2017/05/logo-sticky.png",
"https://www.playpenn.org/wp-content/uploads/2017/05/logo-sticky.png",
"https://www.playpenn.org/wp-content/uploads/2017/05/logo-main.png",
"https://www.playpenn.org/wp-content/themes/pp/images/logos/logo-sticky.png",
"https://www.playpenn.org/wp-content/uploads/2022/05/Lisa-Berger-Website-Headshot.jpg",
"https://www.playpenn.org/wp-content/uploads/2022/05/Lisa-Berger-Website-Headshot.jpg",
"https://www.playpenn.org/wp-content/uploads/2021/05/Yearly-Cammarato-Class-Headshot.jpg",
"https://www.playpenn.org/wp-content/uploads/2021/05/Yearly-Cammarato-Class-Headshot.jpg",
"https://www.playpenn.org/wp-content/uploads/2021/05/R-Eric-Thomas-Class-Headshot.jpg",
"https://www.playpenn.org/wp-content/uploads/2021/05/R-Eric-Thomas-Class-Headshot.jpg",
"https://www.playpenn.org/wp-content/uploads/2021/05/L-Feldman-Class-Headshot.jpg",
"https://www.playpenn.org/wp-content/uploads/2021/05/L-Feldman-Class-Headshot.jpg",
"https://www.playpenn.org/wp-content/uploads/2019/12/Quinn-D.-Eli-Classes-Photo-1.jpg",
"https://www.playpenn.org/wp-content/uploads/2017/08/Lauren-Feldman-scaled.jpg",
"https://www.playpenn.org/wp-content/uploads/2019/12/Quinn-D.-Eli-Classes-Photo-1.jpg",
"https://www.playpenn.org/wp-content/uploads/2019/12/Quinn-D.-Eli-Classes-Photo-1.jpg",
"https://www.playpenn.org/wp-content/uploads/2020/05/Yearley-Headshot-Classes-2020.jpg",
"https://www.playpenn.org/wp-content/uploads/2020/05/Yearley-Headshot-Classes-2020.jpg",
"https://www.playpenn.org/wp-content/uploads/2020/05/J.-Julian-Christopher-Featured-Class-Photo.jpg",
"https://www.playpenn.org/wp-content/uploads/2020/05/J.-Julian-Christopher-Featured-Class-Photo.jpg",
"https://www.playpenn.org/wp-content/uploads/2020/05/Charly_Robert-Dual-Headshot-Classes.jpg",
"https://www.playpenn.org/wp-content/uploads/2019/12/Charly-Evon-Simpson-Classes-Headshot.jpg",
"https://www.playpenn.org/wp-content/uploads/2020/05/Robert-Munoz-Classes-Headshot.jpg",
"https://www.playpenn.org/wp-content/uploads/2020/05/Cat-Miller-Zoe-Hurwitz-Classes-Dual-Headshot.jpg",
"https://www.playpenn.org/wp-content/uploads/2020/05/Cat-Miller-Headshot.jpg",
"https://www.playpenn.org/wp-content/uploads/2020/05/Zoe-Hurwitz-Headshot.jpg",
"https://www.playpenn.org/wp-content/uploads/2017/05/logo-footer.png"
] |
[] |
[] |
[
""
] | null |
[
"Play Penn"
] |
2022-05-25T13:58:45+00:00
|
en
|
//www.playpenn.org/wp-content/uploads/2017/08/favicon.png
| null |
The Artist’s Way, with Lisa Berger
https://www.playpenn.org/wp-content/uploads/2022/05/Lisa-Berger-Website-Headshot.jpg 640 433 Play Penn Play Penn https://www.playpenn.org/wp-content/uploads/2022/05/Lisa-Berger-Website-Headshot.jpg May 25, 2022 June 2, 2022
A 12-week creative recovery. This program offers exercises in gaining self-confidence and harnessing your creative talents and skills.
The Artist’s Way written by Julia Cameron supports people in their creative recovery. It teaches techniques and exercises to assist people in gaining self-confidence in harnessing their creative talents and skills. Participants will read one chapter a week, prior to convening as a group. As a group, you will then come together to discuss the chapter and activities of the week. Lisa Berger will facilitate the group. This is meant to be a safe and brave space. Each participant will make their own goals and have their own journey in reclaiming ownership of their artist practice.
Online (via Zoom)
A PDF of The Artist’s Way by Julia Cameron will be distributed before the class, but feel free to purchase a copy of The Artist’s Way as well. Please read the first chapter before class.
Lisa Berger is a director, Meisner teacher and professor of Theatre. Her San Diego directing credits include How High the Moon and The Car Plays: Incident Row (Wow Festival); The Car Plays: We Wait (LaJolla Playhouse, Moving Arts) , Red Truck, Blue Truck, When It Comes and Skelton Crew (readings;The Old Globe), Parlour Song (Backyard Renaissance) A Behanding in Spokane (Cygnet Theatre) Looking for Normal, The Long Christmas Ride Home and The Moors, (Diversionary Theatre) She received her MFA from the University of Montana and is also a graduate of The William Esper Studio in New York City. She currently teaches at Mira Costa College and the University of San Diego. She is co-artistic director of Meisner/Chekhov Integrated Training Studio.
$480
Tuition
Register Here
Click the link below to visit our Reservation Page, where you can view all classes and register for this course. For questions or to inquire about payment plans, please email classes@playpenn.org.
“Writing can be a lonely road. I’m thankful that Philadelphia offers the supportive, talented PlayPenn community.”
-Joe G., 2020 Participant
“I walked away with an arsenal of guidelines for what makes a high-concept play, but also with half a notebook full of fantastic off-the-cuff breakthroughs and exercises.”
-Danielle B., 2019 Participant
Finding Your True Subject: How to Write the Plays That Only You Can Write, with Anne Marie Cammarato and John Yearley
https://www.playpenn.org/wp-content/uploads/2021/05/Yearly-Cammarato-Class-Headshot.jpg 640 433 Play Penn Play Penn https://www.playpenn.org/wp-content/uploads/2021/05/Yearly-Cammarato-Class-Headshot.jpg May 5, 2021 May 5, 2021
This class will assist students in identifying their true subjects and celebrating what they can uniquely bring to a play.
As audiences, we have all sat though plays wondering why the playwright has chosen this particular subject to write about. As playwrights, we have all struggled to approach a subject that we want to write about but can’t find our way into. Finding Your True Subject provides the tools to unlock these subjects, striving to help each writer discover what you (and only you) can bring to a subject, whether that subject is autobiographical or not.
Online (via Zoom)
None
Anne Marie Cammarato is a playwright and director, whose plays include Hazel, Bobby James, Milk Pie, A Scar, 10 Months, and The Big Room. Her work has been developed at PlayPenn, Theatre Exile, Temple University, University of the Arts and the Resident Ensemble Players. She has worked throughout the country at theatres including Cincinnati Playhouse in the Park, Madison Repertory Theater, Theatre X, Milwaukee Repertory Theatre, Renaissance Theatreworks, and Delaware Theatre Company, where she served as Artistic Director for six seasons. She was a finalist for the Leah Ryan Fund prize (2015) and in 2012, she was the Established Literary Fellow in Playwriting for the State of Delaware. She is a proud member of the Dramatists Guild and the Stage Directors and Choreographers Society. She has taught at the University of Delaware and Temple University, and is currently Playwright in Residence at the University of Mississippi.
John Yearley is the author of The Unrepeatable Moment (“Thought provoking…exhilarating…painfully hilarious” – New York Times, “Yearley is a master” – Huffington Post), Leap (Mickey Kaplan New American Play Prize, Cincinnati Playhouse in the Park), Ephemera (John Gassner Award), Another Girl (PlayPenn), and Bruno Hauptmann Kissed My Forehead (Abingdon Theatre). His latest play, 8 Minutes, 20 Seconds, was workshopped by LABryinth Theatre Company and performed at Temple University. Work for young audiences include The Last Wish (Macy’s New Play Prize for Young Audiences) and an adaptation of Sophocles’ Antigone. Short plays All in Little Pieces and A Low-Lying Fog are available through Samuel French. He currently writes for the children’s TV program Treasure Trekkers and has worked previously on PBS Kids’ Arthur and as a “script doctor” for New Line Cinema. Teaches playwriting, TV Writing, and screenwriting at Temple University, Drexel University, and the Barrow Group in New York City, as well as previously being a lead artist of the Foundry, a playwriting group in Philadelphia. Member of the Dramatists Guild, Writers Guild, and twice a MacDowell Fellow.
$225
Tuition
Register Here
Click the link below to visit our Reservation Page, where you can view all classes and register for this course. For questions or to inquire about payment plans, please email classes@playpenn.org.
“Writing can be a lonely road. I’m thankful that Philadelphia offers the supportive, talented PlayPenn community.”
-Joe G., 2020 Participant
“I walked away with an arsenal of guidelines for what makes a high-concept play, but also with half a notebook full of fantastic off-the-cuff breakthroughs and exercises.”
-Danielle B., 2019 Participant
Creative Ways into Building a Character, with R. Eric Thomas
https://www.playpenn.org/wp-content/uploads/2021/05/R-Eric-Thomas-Class-Headshot.jpg 640 433 Play Penn Play Penn https://www.playpenn.org/wp-content/uploads/2021/05/R-Eric-Thomas-Class-Headshot.jpg May 5, 2021 May 5, 2021
What makes a character memorable? How do we mold a three-dimensional person out of our ideas?
Join playwright, screenwriter, and PlayPenn Alum R. Eric Thomas on an exploration of masterfully created, specific characters, using examples from great works for stage, Eric’s own experience, in-class exercises, and more. Students will come away with more tools for fleshing out their ideas into fully realized people and activating their plays with dynamic personalities. Perfect for new or experienced playwrights!
Online (via Zoom)
None
R. Eric Thomas, a national bestselling author and playwright, won the 2016 Barrymore Award for Best New Play and the 2018 Dramatist Guild Lanford Wilson Award, was a finalist for the 2017 Steinberg/ATCA New Play Award and is a finalist for two 2021 Lambda Literary Awards. He was a staff writer for the Peabody Award-winning series Dickinson (AppleTV+) and Better Things (FX) and has been commissioned or produced on stage by Arden Theatre Company, Baltimore Center Stage, Theatre Exile, Simpatico Theatre, Azuka Theatre, Single Carrot Theatre, About Face Theatre, City Theatre Miami, Act II Playhouse and more. He is an alumnus of The Foundry, the Lambda Literary Fellowship, and the Ingram New Works Project. Website: Rericthomas.com New Play Exchange: https://newplayexchange.org/users/892/r-eric-thomas
$150
Tuition
Register Here
Click the link below to visit our Reservation Page, where you can view all classes and register for this course. For questions or to inquire about payment plans, please email classes@playpenn.org.
“Writing can be a lonely road. I’m thankful that Philadelphia offers the supportive, talented PlayPenn community.”
-Joe G., 2020 Participant
“I walked away with an arsenal of guidelines for what makes a high-concept play, but also with half a notebook full of fantastic off-the-cuff breakthroughs and exercises.”
-Danielle B., 2019 Participant
Words & Bodies, with L M Feldman
https://www.playpenn.org/wp-content/uploads/2021/05/L-Feldman-Class-Headshot.jpg 640 433 Play Penn Play Penn https://www.playpenn.org/wp-content/uploads/2021/05/L-Feldman-Class-Headshot.jpg May 5, 2021 May 5, 2021
Playwright, dramaturg, circus artist, and PlayPenn alum L M Feldman returns with a new workshop!
This class will offer new and experienced playwrights a chance to explore some wildly different ways of writing movement, scripting the nonverbal, and dramatizing the body. Together we’ll discuss some excerpts of physically exciting work pulled from plays, dance, physical theater, and contemporary circus, and then we’ll do some generative playwriting inspired by the examples. So if you want to experiment with new ways of revealing character, theatricalizing conflict, braiding movement techniques into your writing, or blurring the boundaries between theater, dance, and circus, this class is for you. (Don’t worry: no movement experience needed. No athleticism needed either. Just an open, curious mind.)
Online (via Zoom)
None
L M Feldman is a queer, feminist playwright who writes theatrically adventurous, physically kinetic, ensemble-driven plays – usually about outsiders, often about searchers, always about the human connection. Her plays include THRIVE OR WHAT YOU WILL (New Georges & Page 73 Residencies); ANOTHER KIND OF SILENCE (FEWW Prize Honorable Mention, Magic Theatre New Play Festival, PlayPenn & Sewanee Writers’ Conferences, Playwrights Realm Fellowship); AMANUENSIS, OR THE MILTONS (Georgetown University, Ramah Theatre commission); THE EGG-LAYERS (Jane Chambers Honorable Mention, New Georges/Barnard College commission); GRACE, OR THE ART OF CLIMBING (Denver Center, Barrymore & ATCA/Steinberg New Play Award Nominations); and A PEOPLE (Orbiter 3, Jewish Plays Project); as well as several ensemble-devised works, including GUMSHOE (New Paradise Labs + the Free Library of Philadelphia + the Rosenbach Museum), WAR OF THE WORLDS: PHILADELPHIA (Swim Pony + Drexel University), AND IF YOU LOSE YOUR WAY, OR A FOOD ODYSSEY (The Invisible Dog), LADY M (Philadelphia Live Arts Festival), and others. She has been nominated for the Wendy Wasserstein Prize, Susan Smith Blackburn Prize, Barrie and Bernice Stavis Playwright Award, the New York Innovative Theatre Award, and the Doric Wilson Independent Playwright Award. She’s an InterAct Theatre Core Playwright. A graduate of the Yale School of Drama and the New England Center for Circus Arts, L is also a performer & dramaturg of contemporary circus. She has performed circus-theater at festivals around the world, and she’s a dramaturg for circus artists around the country. She loves theater that moves, and circus that tells stories. L has lived in seven cities and is now based in Philadelphia, where she teaches and where she’s writing two new plays: commissions from EST/Sloan and the Children’s Theatre of Charlotte.
$175
Tuition
Register Here
Click the link below to visit our Reservation Page, where you can view all classes and register for this course. For questions or to inquire about payment plans, please email classes@playpenn.org.
“Writing can be a lonely road. I’m thankful that Philadelphia offers the supportive, talented PlayPenn community.”
-Joe G., 2020 Participant
“I walked away with an arsenal of guidelines for what makes a high-concept play, but also with half a notebook full of fantastic off-the-cuff breakthroughs and exercises.”
-Danielle B., 2019 Participant
Contemporary Theatre Script Club with L M Feldman
https://www.playpenn.org/wp-content/uploads/2019/12/Quinn-D.-Eli-Classes-Photo-1.jpg 640 433 Play Penn Play Penn https://www.playpenn.org/wp-content/uploads/2019/12/Quinn-D.-Eli-Classes-Photo-1.jpg May 20, 2020 May 20, 2020
In this destabilizing global moment, it can be hard to find artistic motivation as a playwright: what should you write, and where do you begin?
In this destabilizing global moment, it can be hard to find artistic motivation as a playwright: how to find the drive again to revise or to generate new work? Some are finding this a fabulous moment for artistic productivity, but others are finding creative output all but impossible right now. For those of us who are struggling to write, this can be a good time to turn our attention towards input, towards creative nourishment, towards a kind of sabbatical when we can pause and restock our artistic shelves. In this four-week class, PlayPenn fan favorite instructor L M Feldman will guide students through craft-based discussions of four stylistically diverse (and hopefully not-yet-known-to-you) new plays, to be announced prior to the start date. Each week will focus on one script (to be read at home in advance of each class), and will be paired with an in-class writing prompt to help gently spark some creativity again. Part book club and part writing workshop, this course invites its participants to take comfort in and inspiration from the rich world of contemporary plays; to embrace this time as a chance to replenish our own soil.
Online (via Zoom)
Students will purchase and read four scripts as part of their participation in this class; we’re eager to support playwrights and their work during this precarious time. Please contact us at classes@playpenn.org if this presents a financial challenge: we can help!
L M Feldman is a queer, feminist playwright who writes theatrically adventurous, physically kinetic, ensemble-driven plays – usually about outsiders, often about searchers, always about the human connection. Her plays include THRIVE OR WHAT YOU WILL (New Georges & Page 73 Residencies); ANOTHER KIND OF SILENCE (FEWW Prize Honorable Mention, Magic Theatre New Play Festival, PlayPenn & Sewanee Writers’ Conferences, Playwrights Realm Fellowship); AMANUENSIS, OR THE MILTONS (Georgetown University, Ramah Theatre commission); THE EGG-LAYERS (Jane Chambers Honorable Mention, New Georges/Barnard College commission); GRACE, OR THE ART OF CLIMBING (Denver Center, Barrymore & ATCA/Steinberg New Play Award Nominations); and A PEOPLE (Orbiter 3, Jewish Plays Project); as well as several ensemble-devised works, including GUMSHOE (New Paradise Labs + the Free Library of Philadelphia + the Rosenbach Museum), WAR OF THE WORLDS: PHILADELPHIA (Swim Pony + Drexel University), AND IF YOU LOSE YOUR WAY, OR A FOOD ODYSSEY (The Invisible Dog), LADY M (Philadelphia Live Arts Festival), and others. She has been nominated for the Wendy Wasserstein Prize, Susan Smith Blackburn Prize, Barrie and Bernice Stavis Playwright Award, the New York Innovative Theatre Award, and the Doric Wilson Independent Playwright Award. She’s an InterAct Theatre Core Playwright. A graduate of the Yale School of Drama and the New England Center for Circus Arts, L is also a performer & dramaturg of contemporary circus. She has performed circus-theater at festivals around the world, and she’s a dramaturg for circus artists around the country. She loves theater that moves, and circus that tells stories. L has lived in seven cities and is now based in Philadelphia, where she teaches and where she’s writing two new plays: commissions from EST/Sloan and the Children’s Theatre of Charlotte.
$150
Tuition
Register Here
Click the link below to visit our Reservation Page, where you can view all classes and register for this course. For questions or to inquire about payment plans, please email classes@playpenn.org.
When you register for a PlayPenn class before June 25, 2020, you will be entered into a lottery to receive a session with one of PlayPenn’s hand-picked dramaturgs through Rent-a-Dramaturg (Package A). If you register for a class by the deadline, additional details will be emailed to you.
“Writing can be a lonely road. I’m thankful that Philadelphia offers the supportive, talented PlayPenn community.”
-Joe G., 2020 Participant
“I walked away with an arsenal of guidelines for what makes a high-concept play, but also with half a notebook full of fantastic off-the-cuff breakthroughs and exercises.”
-Danielle B., 2019 Participant
Writing the “Dramedy,” with Quinn D. Eli
https://www.playpenn.org/wp-content/uploads/2019/12/Quinn-D.-Eli-Classes-Photo-1.jpg 640 433 Play Penn Play Penn https://www.playpenn.org/wp-content/uploads/2019/12/Quinn-D.-Eli-Classes-Photo-1.jpg May 18, 2020 June 30, 2020
Humor is one of the best ways to engage audiences, deepen characterization, and convey theme.
In this class, we will explore ways in which the delicate, consistent use of humor can allow a writer to sharpen the arc, dialogue, and accessibility of a script, no matter its overall theme or tone. By examining excerpts from plays such Burn This, and Becky Shaw, and TV shows such as Fleabag and Mad Men, we will identify the strategic use of humor, adapting these strategies for our own work. Students will then write a short script that brings a comic approach to a serious topic in order to find the sweet spot where comedy and drama co-exist.
Online (via Zoom)
None
Quinn D. Eli grew up in the Bronx and lives now in Philadelphia. His short plays have appeared in Best American Ten-Minute Plays and been produced throughout the country. Longer works include the award-winning My Name is Bess, produced by Trustus Theatre; Hazardous, produced locally at Society Hill Playhouse; and Hot Black/Asian Action, a satire about sexual and racial stereotypes that premiered at the New York International Fringe Festival. The two-time recipient of Fellowships in Literature from the Pennsylvania Council on the Arts, Eli has served as a Playwright-in-Residence at Plays & Players Theatre.
$150
Tuition
Register Here
Click the link below to visit our Reservation Page, where you can view all classes and register for this course. For questions or to inquire about payment plans, please email classes@playpenn.org.
When you register for a PlayPenn class before June 25, 2020, you will be entered into a lottery to receive a session with one of PlayPenn’s hand-picked dramaturgs through Rent-a-Dramaturg (Package A). If you register for a class by the deadline, additional details will be emailed to you.
“Writing can be a lonely road. I’m thankful that Philadelphia offers the supportive, talented PlayPenn community.”
-Joe G., 2020 Participant
“I walked away with an arsenal of guidelines for what makes a high-concept play, but also with half a notebook full of fantastic off-the-cuff breakthroughs and exercises.”
-Danielle B., 2019 Participant
TV Writing for Playwrights: An Introduction with John Yearley
https://www.playpenn.org/wp-content/uploads/2020/05/Yearley-Headshot-Classes-2020.jpg 640 433 Play Penn Play Penn https://www.playpenn.org/wp-content/uploads/2020/05/Yearley-Headshot-Classes-2020.jpg May 18, 2020 July 3, 2020
TV writing is just like every other kind of dramatic writing...until it isn't.
So many playwrights get paid a lot of money to produce wonderful work for television. How did they adapt their skills to do that? This class discusses which playwriting skills will help you in TV writing (dialogue, character voice, scene structure) and which you have to develop (stories that go on into perpetuity, construction of a world, beats, story engines). “TV Writing for Playwrights: An Introduction” strives to wipe away the mystery of TV writing for playwrights and set them towards working in this thrilling and lucrative medium.
Online (via Zoom)
None
John Yearley is the author of The Unrepeatable Moment (“Thought provoking…exhilarating…painfully hilarious” – New York Times, “Yearley is a master” – Huffington Post), Leap (Mickey Kaplan New American Play Prize, Cincinnati Playhouse in the Park), Ephemera (John Gassner Award), Another Girl (PlayPenn), and Bruno Hauptmann Kissed My Forehead (Abingdon Theatre). His latest play, Eight Minutes, Twenty Seconds, was workshopped by LABryinth Theatre Company and performed at Temple University. Work for young audiences include The Last Wish (Macy’s New Play Prize for Young Audiences) and an adaptation of Sophocles’ Antigone. Short plays All in Little Pieces and A Low-Lying Fog are available through Samuel French. He currently writes for the children’s TV program Treasure Trekkers and has worked previously on PBS Kids’ Arthur and as a “script doctor” for New Line Cinema. Teaches playwriting, TV Writing, and screenwriting at Temple University, Drexel University, and the Barrow Group in New York City, as well as being a lead artist of the Foundry, a playwriting group in Philadelphia. Member of the Dramatists Guild, Writers Guild, and twice a MacDowell Fellow.
$150
Tuition
Register Here
Click the link below to visit our Reservation Page, where you can view all classes and register for this course. For questions or to inquire about payment plans, please email classes@playpenn.org.
When you register for a PlayPenn class before June 25, 2020, you will be entered into a lottery to receive a session with one of PlayPenn’s hand-picked dramaturgs through Rent-a-Dramaturg (Package A). If you register for a class by the deadline, additional details will be emailed to you.
“PlayPenn classes always get me over the hump and to a completed work.“
-2019 Participant
“PlayPenn is the best creativity incubator in town.”
-Fall 2019 Participant
Magical Realism in Theatrical Writing, with J. Julian Christopher
https://www.playpenn.org/wp-content/uploads/2020/05/J.-Julian-Christopher-Featured-Class-Photo.jpg 640 433 Play Penn Play Penn https://www.playpenn.org/wp-content/uploads/2020/05/J.-Julian-Christopher-Featured-Class-Photo.jpg May 18, 2020 June 30, 2020
Let the magic commence!
Through a series of exploratory exercises and writing assignments, writers will learn to expand their work by incorporating fantastic or mythical elements into otherwise realistic stories. Magical Realism combines the best of all worlds, including science fiction, fable, fantasy, horror, realism, and fairytale. This workshop hopes to break break open a world of fantasy inside all artists.
Online (via Zoom)
None
J. Julian Christopher is a Queer, Puerto Rican and Dominican playwright. He holds an MFA in Acting from The New School for Drama. Playwriting awards include: New Dramatist Residency (Class of 2025), 2019/2020 Rita Goldberg Playwrights’ Workshop Fellow at The Lark, 2017 & 2018 Pipeline Theatre Company PlayLab, 2018 LaGuardia Community College’s LGBTQ History Project Grant, 2015 Queens Arts Council Grant, 2009 Public Theater Emerging Writers Group, and 2014 Best New Work Motif Award. Productions include: Man Boobs (Pride Films & Plays, 2011), Nico was a Fashion Model (Counter-Productions Theatre Company, 2013), Animals Commit Suicide (First Floor Theater, 2015), Locusts Have No King (INTAR, 2016), and Bundle of Sticks (INTAR, 2020). He wrote the book for LatinXoxo at Joe’s Pub in 2019. Other plays include, Alligator Mouth, anOTHER, ¡OSO FABULOSO! & The Bear Backs, Julio Down by the Schoolyard, and Bruise & Thorn (2018 PlayPenn Conference). He is a co-producer and co-writer of the hit web series, Bulk and an Assistant Professor of Theatre at Queensborough Community College.
$115
Tuition
Register Here
Click the link below to visit our Reservation Page, where you can view all classes and register for this course. For questions or to inquire about payment plans, please email classes@playpenn.org.
When you register for a PlayPenn class before June 25, 2020, you will be entered into a lottery to receive a session with one of PlayPenn’s hand-picked dramaturgs through Rent-a-Dramaturg (Package A). If you register for a class by the deadline, additional details will be emailed to you.
“This class was the most satisfying I’ve taken as an adult.”
-Lauren L., 2019 Participant
“I walked away with an arsenal of guidelines for what makes a high-concept play, but also with half a notebook full of fantastic off-the-cuff breakthroughs and exercises.”
-Danielle B., 2019 Participant
Playwright/Designer Collaboration Happy Hour, Week One: Charly Evon Simpson and Rodrigo Muñoz
https://www.playpenn.org/wp-content/uploads/2020/05/Charly_Robert-Dual-Headshot-Classes.jpg 640 433 Play Penn Play Penn https://www.playpenn.org/wp-content/uploads/2020/05/Charly_Robert-Dual-Headshot-Classes.jpg May 18, 2020 June 30, 2020
Join us for a free online Q+A session moderated by PlayPenn Education Director Julia Bumke.
At PlayPenn, we prioritize playwrights as the fundamental authority in the creation of new work. But what about the work that happens to take these projects from page to stage? In each of our three happy-hour sessions, we’ll speak with a pair of playwright-designer collaborators who have worked together to tell innovative new stories onstage. Drop in for a single session, or sign up for all three! Set and costume designers were recommended by Clint Ramos (TONY Award, Best Costume Design of a Play).
Online (via Zoom)
None
Charly Evon Simpson’s plays include Behind the Sheet, Jump, form of a girl unknown, it’s not a trip it’s a journey, and more. Her work has been seen and/or developed with Ensemble Studio Theatre, The Lark, P73, The Eugene O’Neill Theater Center, PlayMakers Repertory Company, Chautauqua Theater Company, Salt Lake Acting Company, and others. She is a recipient of the Paula Vogel Playwriting Award and the Lanford Wilson Award. Commissions she has received include ones from MTC/Sloan, Cleveland Playhouse, EST/Sloan, and one of the 2020 Elizabeth George Commissions through South Coast Repertory. Charly is currently a member of WP Theater’s 2018-2020 Lab and The New Georges Jam. She’s a former member of SPACE on Ryder Farm’s The Working Farm, Clubbed Thumb’s Early Career Writers’ Group, and Ensemble Studio Theatre’s Youngblood. BA: Brown University. MSt: University of Oxford. New College. MFA: Hunter College. www.charlyevonsimpson.com
Rodrigo Muñoz is a New York-based costume designer from Mexico City. Recent credits in United States include “Jazz Singer”- Abrons Arts Center Directed by Joshua William Gelb, “Jump”- Astoria Performing Arts Directed by Arpita Mukherjee, Harlem 100 ft. Mwenso & the Shakes – IMG Artists & JMG Live, “Tobias” Directed by Arpita Mukherjee as part of the 2020 WP Pipeline Festival. ”Hamlet” (NYU Grad Acting) and “Animal Farm” (NYU Grad Acting). ”Film Credits: “Cracked” Directed by Lin Que Ayoung. “Lucia” Directed by: Victoria Rivera, “A Mutual Understanding” Directed by: Abigail Prade, “A for Alpha”Directed by Kelley Kali.”La Tercera Llamada” Directed by Laila Nuñez. Muñoz graduated from The National School of Theatre and Arts (Mexico) with a BA degree in Theatre Set Design; M.F.A. NYU Tisch School of the Arts Design for Stage and Film.
Free!
Tuition
Register Here
Click the link below to visit our Reservation Page, where you can view all classes and register for this course. For questions or to inquire about payment plans, please email classes@playpenn.org.
When you register for a PlayPenn class before June 25, 2020, you will be entered into a lottery to receive a session with one of PlayPenn’s hand-picked dramaturgs through Rent-a-Dramaturg (Package A). If you register for a class by the deadline, additional details will be emailed to you.
“Each class I’ve taken at PlayPenn has proven valuable in my development as a playwright.“
-Peter C., Fall 2019 Participant
“I walked away with an arsenal of guidelines for what makes a high-concept play, but also with half a notebook full of fantastic off-the-cuff breakthroughs and exercises.”
-Danielle B., 2019 Participant
|
||||||
692
|
dbpedia
|
3
| 20 |
https://www.oneyoufeed.net/finding-your-creativity/
|
en
|
Finding Your Creativity with Julia Cameron
|
[
"https://www.facebook.com/tr?id=833420910699665&ev=PageView&noscript=1",
"https://www.oneyoufeed.net/wp-content/uploads/2020/10/JuliaCameron.jpg",
"https://tools.applemediaservices.com/api/badges/listen-on-apple-podcasts/badge/en-US?size=250x83&releaseDate=1577833620",
"https://tools.applemediaservices.com/api/badges/listen-on-apple-podcasts/badge/en-US?size=250x83&releaseDate=1577833620",
"https://www.oneyoufeed.net/wp-content/uploads/2020/12/The-One-You-Feed-Shades-of-Blue-Logo-350x350-opt.jpg 350w, https://www.oneyoufeed.net/wp-content/uploads/2020/12/The-One-You-Feed-Shades-of-Blue-Logo-350x350-opt-150x150.jpg 150w",
"https://www.oneyoufeed.net/wp-content/uploads/2020/12/The-One-You-Feed-Shades-of-Blue-Logo-350x350-opt.jpg"
] |
[
"about:blank",
"https://omny.fm/shows/the-one-you-feed/julia-cameron-on-finding-your-creativity/embed"
] |
[] |
[
""
] | null |
[
"Nicole"
] |
2020-10-06T22:03:22+00:00
|
Eric and Julia Cameron discuss Finding Your Creativity using the tools and exercises in her book, The Artist's Way.
|
en
|
The One You Feed
|
https://www.oneyoufeed.net/finding-your-creativity/
|
Julia Cameron is an American teacher, author, artist, poet, playwright, novelist, filmmaker, and much more. She is best known for her book, “The Artist’s Way.“
In this episode, in addition to discussing her book, “The Artist’s Way,” Eric and Julia talk about finding your creativity and her famous practice known as “Morning Pages.”
But wait – there’s more! The episode is not quite over!! We continue the conversation and you can access this exclusive content right in your podcast player feed. Head over to our Patreon page and pledge to donate just $10 a month. It’s that simple and we’ll give you good stuff as a thank you!
In This Interview, Julia Cameron and I Discuss Finding Your Creativity and…
Her book, “The Artist’s Way“
Her many strategies for feeding her good wolf
Creative recovery is the process of tracking back to our original selves
Creativity as a spiritual practice
“Morning Pages” is her daily practice of writing 3 pages longhand about anything that is on your mind first thing in the morning
The importance of writing no more or no less than the 3 pages.
Morning pages are aimed at moving out of inertia into action.
Learning to write past our inner critic is how we train ourselves to move past fear
Cloud thoughts are the thoughts that drift into your consciousness that are not connected to anything
Morning pages are your tough love friend and are not meant to be reread
Creativity can come from happiness as well as pain
The reward for paying attention is a sense of well being that counters loneliness
“Artist Dates” are expeditions out of your house that you find delightful or brings you joy
The myth that artists are born and not made
How perfectionism stands between you and your creativity
The process of creativity is more important than the end product
Moving past perfectionism with your morning pages
Walking is another important creative tool
The secret doubt is our skeptical sense that a higher power isn’t interested in us.
The voice of guidance is kind, intuitive, truthful, and supportive
Julia Cameron Links:
juliacameronlive.com
Twitter
Instagram
Facebook
Transparent Labs offer a variety of supplements and protein powders that include science-based ingredients and have no sugar, fat, lactose, artificial colors or sweeteners. Check out Eric’s favorite, 100% Grass Fed Whey Isolate that comes in many delicious flavors. Visit transparentlabs.com and use Promo code WOLF to receive 10% off your order.
Plushcare: Provides excellent primary and urgent healthcare through virtual appointments. It’s easy to book online and you can even get same-day appointments. They accept most major insurance carriers, are available in all 50 states and you get prescriptions sent to your local pharmacy. Go to www.plushcare.com/wolf to start your free 30-day trial.
Calm App: The app designed to help you ease stress and get the best sleep of your life through meditations and sleep stories. Join the 85 million people around the world who use Calm to get better sleep. Get 40% off a Calm Premium Subscription (a limited time offer!) by going to www.calm.com/wol
If you enjoyed this conversation with Julia Cameron on the Finding Your Creativity, you might also enjoy these other episodes:
Albert Flynn DeSilver
|
|||||
692
|
dbpedia
|
1
| 39 |
https://wagner.edu/newsroom/stanley-drama-award-complete-history-1957-2018/
|
en
|
Stanley Drama Award: Complete History, 1957
|
[
"https://wagner.edu/newsroom/wp-content/themes/wagner-newsroom/images/Newsroom-logo.png",
"https://wagner.edu/newsroom/wp-content/plugins/simple-share-buttons-adder/buttons/somacro/facebook.png",
"https://wagner.edu/newsroom/wp-content/plugins/simple-share-buttons-adder/buttons/somacro/twitter.png",
"https://wagner.edu/newsroom/wp-content/plugins/simple-share-buttons-adder/buttons/somacro/google.png",
"https://wagner.edu/newsroom/wp-content/plugins/simple-share-buttons-adder/buttons/somacro/linkedin.png",
"https://wagner.edu/newsroom/wp-content/plugins/simple-share-buttons-adder/buttons/somacro/pinterest.png",
"https://wagner.edu/newsroom/wp-content/plugins/simple-share-buttons-adder/buttons/somacro/email.png",
"https://wagner.edu/newsroom/files/2018/11/Alma-Stanley-from-1962-06-07-Advance.jpg",
"https://wagner.edu/newsroom/files/2018/11/1959-07-13-NYT-Gossiping-helps-city-patrolman-write-plays-in-his-spare-time.jpg",
"https://wagner.edu/newsroom/files/2018/11/1961-09-01-NY-World-Telegram-Sun-Gun-toting-author-lays-a-cop-for-real-about-new-play-by-1959-winner-Gene-Radano-compressed.jpg",
"https://wagner.edu/newsroom/files/2018/11/1961-07-15-Advance-probably-Stanley-Award-drama-to-open-3-night-run-La-Loca-compressed.jpg",
"https://wagner.edu/newsroom/files/2018/11/1961-07-24-Advance-La-Loca-is-a-little-off-compressed.jpg",
"https://wagner.edu/newsroom/files/2018/11/Jimmy-Corrigan-Stewie-Griffin.jpg",
"https://wagner.edu/newsroom/files/2018/11/Barry-Ween-Boy-Genius.jpg",
"https://px.ads.linkedin.com/collect/?pid=5093650&fmt=gif"
] |
[] |
[] |
[
""
] | null |
[] |
2020-01-27T14:53:48-05:00
|
The Stanley Drama Award is given by the Wagner College Theatre for an original, unpublished full-length play or musical or thematically related set of one-act plays that has not yet been professionally produced. Since 1957, the Stanley Award has been given at least 60 times. Twice — in 1964, and again in 1969 — the …
|
en
|
https://wagner.edu/newsroom/wp-content/themes/wagner/images/favicon.ico
|
Newsroom
|
https://wagner.edu/newsroom/stanley-drama-award-complete-history-1957-2018/
|
The Stanley Drama Award is given by the Wagner College Theatre for an original, unpublished full-length play or musical or thematically related set of one-act plays that has not yet been professionally produced.
Since 1957, the Stanley Award has been given at least 60 times. Twice — in 1964, and again in 1969 — the Stanley Award was given to two playwrights for two different plays. In 1987, no award was made and all finalists were carried over to following year. And in 1995, we have no record of the Stanley Drama Award being given, no reference can be found online to a 1995 Stanley winner, and our business office has no record of any payment being made for the Stanley Award prize.
The Stanley Drama Award was originally given as part of the New York City Writers Conference, a 10-day program held each summer at Wagner College for aspiring fiction writers, poets and playwrights from 1956 through the late 1960s. Though a playwriting award was given at the inaugural conference, it was not until the conference’s second year, 1957, that the award was named for benefactor Alma Guyon Timolat Stanley of Dongan Hills, Staten Island.
WINNERS OF THE STANLEY DRAMA AWARD
2020 Truth Be Told, William Cameron 2019 Some Other Verse, Carl L. Williams 2018 Incident at Willow Creek, Benjamin V. Marshall 2017 The Showman and the Spirit, Elisabeth Karlin 2016 Bad Hearts, Mike Bencivenga 2015 The Good Bet, Bob Clyman 2014 Out of Orbit, Jennifer Maisel 2013 The Return of Tartuffe, Brian Mulholland 2012 The Perfect Wife, Karen L. Lewis 2011 Eyes Forward, Philip Gerson 2010 The Restoration of Sight, Richard Martin Hirsch 2009 Memory Fragments, Sam Wallin 2008 Stray, Ruth McKee 2007 Guided Tour, Peter Snoad 2006 Farmers of Men, Richard Aellen 2005 Mother, May I, Dylan Brody 2004 Be Our Joys, Joseph Zaitchik 2003 Skin of a Lawyer, Richard Kalinoski 2002 How High the Moon, Timothy Jay Smith 2001 The Pagans, Ann Noble (Massey) — winning play prev. listed as And Neither Have I Wings to Fly (wr. 1995) 2000 Shadow Plays, Frank Basloe 1999 Flight, music by James Scully; book by Steve and Elise Seyfried 1998 Gone Astray, Jennie Staniloff Redling 1997 The Job, Shem Bitterman 1996 Cold War Comedy, Thomas S. Hischak 1995 No award on record 1994 Tierra Del Fuego, Robert Alan Ford 1993 Rent, Jonathan Larson 1992 Boca, Christopher Kyle 1991 Planet of the Mutagens, Mary Fengar Gail 1990 Beast, Susan Arnout Smith 1989 Washington Square Moves, Matthew Witten 1988 Norm Rex, Phil Atlakson 1987 no decision made, all finalists carried over to following year 1986 Cue the Violins, David Graham Richmond 1985 Interstates, Daniel A. Dervin 1984 The Mountains of Arafat, Geoffrey Brown 1983 Cafe Con Leche, Gloria Gonzalez 1982 Jonas, Billy Bly 1981 Sissy and the Baby Jesus, Barbara Allan Hite 1980 Private Opening, Norman Wexler 1979 The Stag at Eve, Robert Riche 1978 Cutting Away, Barry Knower 1977 Past Tense, Jack Zeman 1976 A Safe Place, Carol Klein Mack 1975 Jonathan! A musical play in two acts suggested by characters in the novel “Jonathan Wild,” by Henry Fielding; book & lyrics by Alan Riefe; music by Robert Haymes 1974 Son of the Last Mule Dealer, Gus Weill 1973 Carnivori, C. Richard Gillespie 1972 Fortune Teller Man, Marvin Denicoff 1971 Obtuse Triangle: A Romantic Comedy in Two Acts, Bernard “Ben” Rosa 1970 Three Sons (Of Sons & Brothers), Richard Lortz 1969 A Happy New Year to the Whole World Except
Alexander Graham Bell, Bernard SabathTwo one-acts: The Club and The Little Gentleman, Yale Udoff 1968 Bag of Flies, Venable Herndon 1967 The Prize in the Crackerjack Box, William Parchman 1966 To Become a Man, Albert Zuckerman 1965 Ceremonies in Dark Old Men, Lonne Elder III 1964 Hothouse, Megan Terry Thompson, Joseph Baldwin 1963 Funnyhouse of a Negro and The Owl Answers, Adrienne Kennedy 1962 This Side of the Door, Terrence McNally
(later revision titled, “And Things That Go Bump in the Night”) 1961 La Loca (La Fiesta), Ernesto Fuentes 1960 The Busy Martyr, George Hitchcock 1959 The Apple Doesn’t Fall, Gene Radano 1958 Hear that Sweet Laughter (Published by Dramatists Play Service, 1961, as Clandestine on the Morning Line: A Play in Three Acts), Josh Greenfeld 1957 To Learn to Love, William I. Oliver
ALMA TIMOLAT STANLEY
Mrs. Stanley was the widow of Robert C. Stanley, former board chairman of the International Nickel Company of Canada Ltd. She was known as a patron of cultural and educational groups on Staten Island and elsewhere in New York City.
A Staten Island Advance article of June 7, 1962 announced that Mrs. Stanley was to receive an honorary doctorate from the University of Tampa, to be conferred by former Wagner College President David M. Delo. According to the Advance,
… she has established scholarship programs at Wagner College, Stevens Institute of Technology and the University of Pennsylvania.
She is a patroness of the Metropolitan Opera, the Metropolitan Museum of Art, the New York Philharmonic Orchestra and the Stratford (Conn.) Shakespearean Festival.
Mrs. Stanley has been active in the Island’s Red Cross chapter since its inception in 1917, and has been a leader in the work of the Society for Seamen’s Children.
Following Mrs. Stanley’s death on Jan. 6, 1971, an Asbury Park Press article recounted her support of the Visiting Nurse Association of Staten Island, adding that “Mrs. Stanley was active in many Staten Island community groups and was named Woman of Achievement by the S.I. Advance in 1963, Woman of the Year by the Soroptimist Club in 1961, [and] received the Distinguished Citizen’s Award from Wagner College in 1953.”
Support for the Stanley Drama Award after Mrs. Stanley’s death was continued by the Stanley-Timolat Foundation and Mrs. Stanley’s son, Robert C. Stanley Jr.
1957 Stanley Drama Award winner:
William I. Oliver
The inaugural Stanley Drama Award was announced in the flyer for the 1957 New York City Writers Conference as well as in a mailing from NYCWC director Gorham Munson. A few details:
Candidates could not submit themselves for the award. “A candidate must be proposed by a teacher of drama, a producer or director, a play agent, a playwright or a play reviewer.”
“The candidate must attend the full session of the NYC Writers Conference [July 16-25] and carry out the duties of a Fellow [though those duties were not enumerated].”
The drama workshop leader that year was H.R. Hays.
The winner would receive a $500 prize, plus living and travel expenses for attendance at the conference. The winner’s play would “be produced on the closing nights [that is, the last three nights of the conference] by the Corn Cob Theatre, the summer theatre of the Staten Island Theatre Workshop, under the direction of Vincent Zangara.”
Submission deadline was May 1; the winner was to be announced by June 1.
Whether the announcement date was missed, or just the press release, it was not until June 20 that the college announced the first winner of the Stanley Drama Award: “William I. Oliver, a graduate student at Cornell University. The award-winning play is ‘To Learn to Love,’ a three-act study of young sailors in the Canal Zone. Mr. Oliver attended the Drama Department of Carnegie Institute of Technology, has worked in the Cornell University Theatre for the last four years, and has been a director of a summer theatre.”
William I. Oliver spent the majority of his career (starting in 1958, the year after winning the Stanley Award) as a professor of drama at the University of California at Berkeley. Following his death in 1995, the U.C. Faculty Senate published this obituary written by his colleagues Travis Bogard, Henry May and Warren Travis:
William I. Oliver, Dramatic Art: Berkeley
1926-1995
Professor Emeritus
The distinguished theatrical director, William I. Oliver, died suddenly on March 17 in San Jose, Costa Rica, where he was teaching and directing at the University of Costa Rica's School of Dramatic Arts. He leaves his wife, Barbara, and three children, Michael, Anna, and Soren.
A retired professor of Dramatic Art at the University of California, Berkeley, Oliver was born in Panama City, Nov. 6, 1926, the son of Methodist teaching missionaries, Walter and Anna Skow Oliver. He was educated at Methodist schools in Panama City and the Canal Zone. During the second World War, since he was equally fluent in Spanish and English, he served there as a translator in the U.S. Navy.
In 1946, he left the Canal Zone and entered the theatre department of the Carnegie Institute of Technology’s School of Fine Arts in Pittsburgh to study acting. He played two summer seasons at Woodstock, N.Y., opposite such stars as Lillian Gish. In 1950, he married a fellow drama student, Barbara Marsh, and together they moved to North Dakota to head the Fargo/Moorhead Community Players.
In 1953, the Olivers left North Dakota for Cornell University, where he studied for the Ph.D. For his doctoral dissertation he translated and wrote critical assessments of Federico Garcia Lorca and Lope de Vega.
He joined the faculty of the Department of Dramatic Art at Berkeley in 1958 and served as a teacher, director and administrator until his retirement in 1991. He taught stage direction, dramatic literature and criticism in classes that were distinguished by his lively and inquiring mind.
His work as a stage director with departmental students included many memorable productions, among them Ben Jonson’s “Bartholomew Faire,” the Jacobean melodrama “The Changeling” (with a young Stacy Keach), “Hamlet,” “Peer Gynt,” “Danton’s Death,” e. e. cummings’ “him,” Sartre’s “The Devil and the Good Lord,” O’Neill’s “Ah Wilderness!” and Giraudoux’s “Electra.” The wide range of his play selection was increased as he worked in the popular U.C. summer theatre, the Old Chestnut Drama Guild, where he directed standard classics such as Noel Coward’s “Fallen Angels,” Clarence Day’s “Life with Father,” Pinero’s “The Amazons” and Philip Barry’s “Holiday” and “The Animal-Kingdom.”
His directorial energies were often employed beyond the university theatre. He staged short plays for San Francisco’s One-Act Theatre Company and Berkeley’s Aurora Theatre, where he also appeared as an actor, playing with Barbara Oliver in “The Gin Game.”
In both Latin and South American companies, his talents as a critic and as a stage director are well-known. In 1966, he traveled to Santiago, Chile, where he taught at the University of Chile and directed ITUCH, the national theatre, in the Chilean premiere of Peter Weiss’s “Marat-Sade.” In Mexico City in 1974, in addition to classes at the School of Fine Arts, he directed Arthur Schnitzler’s “La Ronde.” He went three times to Costa Rica, where he both taught and staged productions, including Wilder’s “The Skin of our Teeth,” Euripides’ “Orestes” and Shakespeare’s “The Comedy of Errors.” During his fourth visit, he was preparing Albee’s “Seascape” in his own translation.
He was for several years a judge and critic at the prestigious El Paso Chamizal Festival of Golden Age Theatre, and in 1991 he was invited to present a paper in Cadiz at the first conference on educational theatre to be held in Spain.
As a translator, he was prolific, moving plays and novels and works of criticism from and to Spanish with ease. As a dramatist, he was the author of a trilogy on Spanish themes, “The Antifarce of Sir John and Leporello,” “The Masks of Barbara Blomberg” and “Dumbshows of the King.” The first two were premiered at Berkeley, the third was published in Spanish in a special edition, commemorative of the 500th anniversary of Columbus’s voyage.
In his teaching, as in his directing, Oliver displayed astonishing energy, insight and imagination. He had a penchant for long walks with his Scotty dog along Mendocino beaches, but his true happiness was found at rehearsal, facing a lighted stage, director’s script in hand, at once goading and inspiring his students, whether professional or amateur, to performances that often surprised the doers with the unexpected range and depth he elicited from them. In his work the lights of theatrical pleasure, thought, and emotion burned bright. He has left a darkened stage behind him.
1958: Josh Greenfeld
On June 6, 1958, the Staten Island Advance announced that “the 1958 Stanley Award goes to Josh Greenfeld of Manhattan for his play ‘Hear That Sweet Laughter’ … [which] centers around a restaurant owner in a city ‘northern in size, southern in influence.’ The author … studied playwriting under Kenneth Rowe at the University of Michigan and John Gassner of Yale.”
On July 6, the Staten Island Advance announced, “A group of actors from within the Dongan Hills Players will present ‘Hear That Sweet Laughter’ ... tomorrow at 8 p.m. in the Coach House of the Richmond County Country Club. The play will be given as a dramatic reading with scenery and props. The director is Robert H. Nutt of Dongan Hills. ... The author, Josh Greenfeld of Manhattan, won the $500 Stanley Award for his work.”
The July 9 issue of the Sea Hawk Daily, the NYC Writers Conference newsletter, introduced “Josh Greenfeld of New York City as this year’s Stanley Award Fellow,” mentioning that his “play is under option to Aldrich, Bowman & Shurtleff, off-Broadway producers. Mr. Greenfeld is a free-lance magazine writer, often writing on sports. In the June Esquire he had an article on Fangio, world champion automobile racer.” [And a bit of NYCWC trivia: The Sea Hawk Daily was written by Wagner alumnus Paul Zindel ’58 M’62 H’71, himself an aspiring playwright. He produced the newsletter in return for his tuition to the NYCWC.]
The New York Age of July 12, 1958 included a brief, “Actors Sought For ‘Sweet Laughter’ ”: “Casting is now in progress for ‘Hear that Sweet Laughter,’ a comedy-drama of Negro life by Josh Greenfeld. Winner of the 1958 Playwriting Award of the New York Writers’ Conference, it will be produced by the firm of Alden Aldrich, Ross Bowman and Michael Shurtleff. Actors who are interested should contact the producers whose offices are at 117 West 13 Street. Rehearsals begin in August with a late September opening planned.”
A year later, the April 9, 1959 issue of the Wagnerian, Wagner College’s student newspaper, reported that Greenfeld had won a grant of “$110,000 from the Ford Foundation. The money will be used to finance the production of this play in the fall of 1959. Mr. Greenfeld retitled his play, ‘Clandestine on the Morning Line.’ ”
“Clandestine” was published in 1961 by Dramatists Play Service, which noted that “the premiere production … was given by the Arena Stage, Washington, D.C. The play was selected for presentation under the Ford Foundation’s Program for Playwrights in 1959. The production was directed by Alan Schneider.”
The online Lortel Archive notes that “ ‘Clandestine on the Morning Line’ [was] produced by Actors’ Playhouse, 100 Seventh Ave. South, New York — opened Oct. 30, 1961, for 24 performances — directed by Allen Davis, starring James Earl Jones (won 1962 Obie Award, Best Actor) and Rosetta LeNoire.”
And, finally, Wikipedia provides the following biography for Josh Greenfeld:
Josh Greenfeld (born 1928) is an author and screenwriter mostly known for his screenplay for the 1974 film “Harry and Tonto” along with Paul Mazursky, which earned them an Academy Award nomination and its star, Art Carney, the Oscar itself for Best Actor. Greenfeld also wrote “Oh, God! Book II” and the TV special “Lovey” and is the author of several books about his autistic son, Noah Greenfeld.
The trilogy, “A Child Called Noah,” “A Place for Noah,” and “A Client Called Noah,” detail the effects that Noah’s disabilities place on the Greenfelds and the extraordinary lengths that the family went through to find the very best care available for their son. His wife, Fumiko Kometani, is a Japanese writer and has won the Akutagawa Prize, Japan's most prestigious literary award; she too wrote about their son and his developmental disability. His older son, Karl Taro Greenfeld, a special contributor to Portfolio and Details, wrote his own story of growing up with Noah entitled “Boy Alone: A Brother's Memoir.”
Among Greenfeld's plays are “Clandestine on the Morning Line,” “I Have a Dream,” “The Last Two Jews of Kabul,” “Whoosh!,” and “Canal Street.” His novels include “O for a Master of Magic,” “The Return of Mr. Hollywood,” and “What Happened Was This.”
In 1968, Greenfeld signed the “Writers and Editors War Tax Protest” pledge, vowing to refuse tax payments in protest against the Vietnam War.
Greenfeld attended Brooklyn College; he received a B.A. from the University of Michigan and an M.A. from Columbia University.
1959: Gene Radano
The June 15, 1959 issue of the Staten Island Advance featured the headline, “Mafia Story Wins 1959 Stanley Prize.” The story reads: “Gene Radano of 209 East 87 St., Manhattan, is the winner of the 1959 Stanley Award for his play, ‘The Apple Doesn’t Fall,’ it was announced today at Wagner College. … This year’s prize-winning play deals with the impact of the Mafia on Italian-Americans living in New York City.”
The same day’s New York Times says,
This year’s winner of the Stanley Playwriting Award is Patrolman Gene Radano, a warrant officer attached to the Lower Manhattan Magistrates Courts. …
Mr. Radano, who is 41 years old, was born in East Harlem and lives at 209 East Eighty-seventh Street. He is the father of two daughters and two sons. Mr. Radano has been a member of the Police Department since 1946.
“The Apple Doesn’t Fall” is a contemporary play, dealing with the impact of the Mafia on an Italian family in Manhattan. …
Besides “The Apple Doesn’t Fall,” Mr. Radano has written six other plays, none of which has been produced on Broadway.
The following month, on July 13 (during the NYC Writers Conference), the Times followed up with another story:
The program for the 1960 NYC Writers Conference noted that Radano’s “The Apple Doesn’t Fall” has been “optioned for Broadway production but has not to date opened.”
The following year, the Aug. 17 issue of the New York Daily News reported that a new play by Radano, “The Opening of a Window,” was in rehearsals for an opening at the Off-Broadway Theatre Marquee, 110 E. 58th St., on Sept 21. The story, titled “Cop’s Play to Open,” said,
If “all the world’s a stage,” then it stands to reason that playwrights can come from any place. One of the newest playwrights, Gene Radano, is a member of New York City’s Police Department. …
A member of the force since 1946, Radano has been writing since 1943. To avoid criticism of “moonlighting” — working at another job while in the department — he will be on vacation for a month, beginning this week, when rehearsals begin.
On Sept. 1, 1961, the New York World-Telegram ran a more substantial story about Radano:
Radano was also the author of two books, “Walking the Beat: A New York Policeman Tells What It’s Like on His Side of the Law” (World, 1968) and “Stories Cops Only Tell Each Other” (Stein & Day, 1974).
Kirkus Review panned “Walking the Beat,” which was evidently a fictionalized account but marketed as non-fiction:
Although pegged as non-fiction, and the author swears he heard it all, this hazy view of the heroes of the precinct lacks the immediacy and veracity of authentic interviews or straight-forward reporting. Curiously defensive, the author, who is obviously not a cop himself, clips and pastes “case” episodes and dirty stories, unfunny and out of context. Some of the unhappy lot consists of inter-station house politics, unfair pressure from superiors, civic and judicial stumbling blocks to the follow through on arrests. The whole sticky business is seen as through the eyes of Paul, a rookie, and he is painfully initiated into the politics, the hopelessness of it all, the pecking order. Fascinating material is diluted and mangled by sensationalism of the quavering, supra-masculine, bogus Hemingway variety. Hopped up homage to the “police farce” and the long-suffering men in blue.
1960: George Hitchcock
A June 1960 Wagner College press release (date unspecified) announced that George Hitchcock of 2808 Laguna St., San Francisco, had won the 1960 Stanley Award for his play, “The Busy Martyr.” The play was nominated by Arnold Colbath, a drama professor at Catawba College in Salisbury, N.C., where “The Busy Martyr” had been staged on May 6, 7 and 8. The release said that “a production of the play is also planned during the fifth session of the New York City Writers Conference from July 12-22.”
The press release acknowledged the advice given to the Stanley judges by Richard Watts Jr., drama critic for the New York Post.
The release also named three plays for honorable mention:
Joe LeSueur, “A Cool Wind over the Living.” Part of the New York School of poetry and longtime roommate and sometime lover of Frank O’Hara, LeSueur is perhaps best remembered for his posthumously published memoir, “Digressions on Some Poems by Frank O’Hara” (Farrar, Straus & Giroux, 2003). “A Cool Wind” was taped for the second season of WNTA’s highly acclaimed series, “The Play of the Week” (air date March 27, 1961).
Nishan Parlakian, “Plagiarized.” Parlakian taught drama, speech and English literature at John Jay College and was a renowned authority on Armenian theater as well as a playwright. “Plagiarized” was one of several of his plays that were produced and published.
Gloria Demby Maddox, “Black Monday’s Children.” Bernard L. Peterson’s “Early Black American Playwrights and Dramatic Writers” includes an entry on Maddox: “Former student playwright at Fisk University, where she was also a member of the Fisk Stagecrafters. … After graduating from Fisk in the late 1940s, she became director of the Theatre of Wee Folks in Selma, Ala.” According to Peterson, an early version of “Black Monday’s Children” was produced as a one-act play in the 1940s by the Fisk University Stagecrafters. A copyright for “Black Monday’s Children: A Play in Three Acts,” by Gloria Demby Maddox, was filed on Aug. 17, 1959.
The July 14, 1960 issue of the Seahawk Daily said, “George P. Hitchcock, the Stanley Fellow in Drama, lists as his occupation: writer; stage director. He has contributed frequently to the literary quarterlies and little magazines, and is himself associate editor of the San Francisco Review. Scenes from ‘The Busy Martyr’ will be presented by the Dongan Hills Players on July 21.”
Hitchcock had a remarkable career before winning the 1960 Stanley Award, and an even more noteworthy life after it. Here is Hitchcock’s extraordinary obituary, written by William Grimes, published in the Sept. 4, 2010 issue of the New York Times:
George Hitchcock, whose poetry magazine, Kayak, born in the cultural ferment of the 1960s, was one of the most distinctive, eagerly read literary journals of its time, died on Aug. 27 at his home in Eugene, Ore. He was 96.
His death was confirmed by the poet Robert McDowell, an editor of “One Man Boat: The George Hitchcock Reader” (2003).
Mr. Hitchcock, a former actor, playwright and political organizer, founded Kayak in 1964 and for the next 20 years ran it as a one-man show. He designed the magazine, edited it, printed it, illustrated it and organized the collating parties where its pages were stapled together, slipped into mailing envelopes and stamped.
With great ingenuity, he created Kayak’s archly cruel rejection slips: Victorian engravings depicting a beheading, or a mountain climber slipping into a crevasse, with a brush-off caption appended.
He was, as he liked to say, Kayak’s dictator. “A kayak is not a galleon, ark, coracle or speedboat,” read the motto printed with each issue. “It is a small watertight vessel operated by a single oarsman. It is submersible, has sharply pointed ends, and is constructed of light poles and the skins of furry animals. It has never yet been successfully employed as a means of mass transport.”
Although he leaned toward surrealism and the dreamlike style of the deep imagist school, Mr. Hitchcock included a wide variety of poets, publishing the early work of Philip Levine, Raymond Carver, James Tate and Charles Simic.
“He was the pre-eminent maverick independent magazine publisher,” said Howard Junker, the editor of Zyzzyva: The Journal of West Coast Writers and Artists. “He was open in his tastes, unflagging in his energies, knew everyone and kept the thing going against all odds.”
George Parks Hitchcock was born on June 2, 1914, in Hood River, Ore. He attended the University of Oregon, where he was a reporter on the school newspaper, and received a bachelor’s degree in 1935.
After school he worked as a reporter for The Western Worker in San Francisco and as the sports editor of The People’s Daily World, for which he wrote a sports column under the byline Lefty. He also became friends with Kenneth Rexroth, who encouraged his interest in poetry.
When the United States entered World War II, he enlisted in the Merchant Marine, which sent him to the South Pacific and put him to work as a cook and waiter.
After the war he traveled throughout California trying to organize dairy unions. He later taught at the California Labor School.
In the 1950s, while working as a landscape gardener, he began writing plays and acting with two San Francisco repertory companies, the Interplayers and the Actor’s Workshop.
During the Oregon Shakespeare Festival in 1957, the House Un-American Activities Committee summoned him to testify in San Francisco, where he delivered what may well have been his finest performance.
When asked to state his profession, he answered: “I am a gardener. I do underground work on plants.” He then refused to answer questions about membership in the Communist Party, “on the grounds that this hearing is a big bore and waste of the public’s money.”
The director of the Shakespeare Festival demoted him to spear-carrying roles.
Physically imposing — a hefty 6-foot-4 — Mr. Hitchcock cut a flamboyant, dandyish figure. “He reminded me of those bigger-than-life character actors in Hollywood movies, like Wallace Beery and Charles Laughton, or like Vitamin Flintheart, the ostentatiously dressed and extravagantly posturing character in Dick Tracy comic books,” the poet Morton Marcus wrote in his memoir, “Striking Through the Masks.”
In 1958 Mr. Hitchcock became an editor of The San Francisco Review, which had published his two-act play “Prometheus Found.” Soon after the review ceased publication in 1963, Kayak was born.
It made an immediate impact. Mr. Hitchcock had a strong personality, visual flair and keen eye for writing talent. The long list of poets and writers who found a home in his pages included W. S. Merwin, Anne Sexton, Robert Bly, Margaret Atwood and Hayden Carruth. Criticism, reviews, the occasional prose piece and Mr. Hitchcock’s collages rounded out the content.
Kayak enjoyed fights. It set up in opposition to revered publications like The Kenyon Review and The Hudson Review, and nourished a spirited contempt for what it saw as the overly intellectual poetry of writers like Robert Lowell and Richard Wilbur.
Creatively frugal, Mr. Hitchcock acquired an offset press from the Pacific Steamship Line that had been used to print menus and learned to run it himself. He printed one issue on paper that the Army had rejected for target-practice use.
Kayak operated outside the world of foundation grants and government support, although the National Endowment for the Arts, unsolicited, gave the magazine two grants. Mr. Hitchcock used most of the money to publish books by Mr. Simic, Carver, Carruth and others. He used $500 to create a prize for the best poem about Che Guevara.
In 1970 Mr. Hitchcock moved the Kayak operation to Santa Cruz, Calif., where he had been hired to teach playwriting and poetry at the University of California, Santa Cruz. In 1984 he rang down the curtain, and Kayak ended its run after 64 issues.
“Any more, and it would risk seeming an institution,” Mr. Hitchcock said. “After that, ossification and rigor mortis.”
An early marriage ended in divorce. He is survived by his longtime companion, Marjorie Simon; a sister, June Harman of St. Helena, Calif.; a son, Stephen, of Carbondale, Ill.; two grandchildren; and a great-grandchild.
Mr. Hitchcock was rather cavalier about his creative brainchild and its influence. “In 1964 I found most American poetry magazines extraordinarily boring,” he told the magazine Caliban in 1986. “I thought that Kayak might relieve the tedium, c’est tout.”
1961: Ernesto Fuentes
The 1961 Writers Conference was the first to involve Wagner College English professor Willard Maas. A minor poet who had not published in years, Maas was nonetheless well known in New York City for his experimental filmmaking as well as the wild parties he threw in his Brooklyn Heights penthouse apartment with his wife, experimental filmmaker Marie Menken. Maas and Menken were the real-life inspirations (if it can be called that) for the lead couple in Edward Albee’s “Who’s Afraid of Virginia Woolf?” (See the Winter 2013-14 issue of Wagner Magazine, pages 18-23.)
In the April 13, 1961 issue of the Advance, the first results of Maas’s wide network of celebrity contacts were made evident: the judges for the 1961 Stanley Drama Award included “Molly Kazan, dramatist and wife of movie director Elia Kazan; playwright Edward Albee, and Dr. John Hruby, chairman of the drama division of Wagner College and director of the school’s Varsity Players.” Instructors for the conference were Albee, novelist Saul Bellow and poet Robert Lowell.
A June 14 press release announced the Stanley winner as Ernesto Fuentes for “La Loca.” Fuentes, born in Artemisa, Cuba and a graduate of the Municipal Dramatic School in Havana, had lived in the U.S. since 1950. His street address was 282 E. 35th St., Brooklyn.
The press release also “announced that the play will be produced on the Wagner campus July 20-22 by the Hilltop Summer Theatre.”
A separate press release dated June 13, announcing auditions, called the play “a drama of passion and violence … set in a South American country in modern times.” The venue for the campus staging would be the Main Hall auditorium. The release also said that Fuentes “has written five plays, two of which have been optioned for professional production.”
An extremely clever June 30 press release had Willard Maas’s fingerprints all over its prose:
Attention all goats interested in acting
There is a small but important acting role for a goat in the Hilltop Summer Theatre production, “La Loca,” according to the director, Dr. John Hruby.
If you are interested in appearing in the production, to be presented on the Wagner College campus July 20-22 as part of the New York City Writers Conference, submit your application to the director.
The role, as described in the script, requires that you be a good listener, inasmuch as the leading lady confides in you quite often.
Garbage and tin cans will be supplied to keep you happy, Dr. Hruby said. He added that temperamental goats need not apply inasmuch as he’s having enough trouble dealing with another of the performers: a stage-struck rooster.
A July 12 press release from the college was supplemented with original reporting, probably by theater critic Jack Reycraft, when it ran in the July 15 issue of the Staten Island Advance:
The following week, however, after Reycraft had actually seen the production, he wasn’t nearly so generous:
Interestingly, “La Loca” apparently has both a “before” Stanley Award story, and an “after” story.
In the May 27, 1959 edition of Dorothy Kilgallen’s syndicated column, “The Voice of Broadway,” she said, “Ernesto Fuentes, an unknown Cuban playwright, has had his first drama, ‘La Loca,’ accepted by Roger L. Stevens for fall production. The plot revolves around the Cuban revolution as it affected families in the Oriente Province. Some years ago, author Fuentes was a dishwasher in a New York restaurant.”
Kilgallen’s column, first published in 1938, ran in more than 140 newspapers nationwide.
A Wagner College press release of June 14, 1961, confirmed that “La Loca” “was at one time optioned by producer Roger L. Stevens, but the option expired due to production conflicts.”
Roger Lacey Stevens was an American theatrical producer, arts administrator and real estate executive. He was the founding chairman of both the Kennedy Center for the Performing Arts (1961) and the National Endowment for the Arts (1965).
On March 5, 1968, seven years after “La Loca” won the Stanley Award, a new copyright was filed for the play, with a revised name: “La Fiesta, a play in three acts by Ernesto Fuentes. … Appl[ication] states prev[iously] reg[istered] as La loca.”
And five years after that, on Oct. 18, 1973, the Columbia University newspaper, the Spectator, published an advertisement: “Columbia Players presents Ernesto Fuentes’ LA FIESTA November 1, 2, 3, 8, 9, 10, 8:00 p.m., Wollman Auditorium.”
1962: Terrence McNally
The first press release on file for the 1962 Stanley Drama Award competition, dated March 26, announced the judges: playwright Edward Albee, actors Geraldine Page and Kim Stanley, producer David Susskind and Wagner drama professor John Hruby. The release added, “A staged reading of the winning script will be given as part of the conference’s annual meeting.”
The following day, an article in the Staten Island Advance also named the instructors for the 1962 NYC Writers Conference: dramatist Edward Albee, poet Kenneth Koch and novelist Kay Boyle.
There were a couple of irregularities in the 1962 competition.
First: Though Stanley Drama Award submissions were supposed to be plays “that [have] never been produced professionally,” Terrence McNally’s submission, “This Side of the Door,” had been produced by Richard Barr on Jan. 1, 1962 at the Cherry Lane Theater as part of Barr’s Playwrights 1962 series, directed by Martin Fried and featuring Estelle Parsons and William Traylor — several months before its submission for the Stanley Award.
Second: For the second year in a row, Edward Albee was one of the Stanley Award judges. Albee, however, should probably have recused himself from the judging that year because he and McNally had been romantically involved since 1960.
Aside from those irregularities in choosing the 1962 Stanley winner, there is no denying that it was the first time the award had gone to a playwright with a major career ahead of him. The award winner was announced in a press release dated July 7.
The release said, “This year’s winner, Terrance McNally [sic], a resident of Manhattan, graduated Phi Beta Kappa from Columbia University in 1960. During his senior year he wrote the school’s varsity show entitled, ‘A Little Bit Different.’ He has also been a stage manager for the player’s workshop at the Actors Studio in Manhattan.”
Richard Stayton, in a 1992 Los Angeles Times Magazine story on an upcoming revival of McNally’s “It’s Only a Play,” gave a painfully frank description of McNally’s first drama:
His first serious attempt at playwriting occurred in his early 20s and was a one-act titled “This Side of the Door.” That rough beginning might have ended his playwriting career.
“It’s the only play I’ve ever written that was so autobiographical I found it painful to watch,” he says. “I put that play away. I don’t know where it exists.”
In fact, a crudely typed original script of “This Side of the Door” exists in the New York Public Library for the Performing Arts at Lincoln Center. To read it is to find very little evidence of the later, mature McNally. In it, an alcoholic, abusive, failed salesman rages at his “fairy son”: “Want to hear about my problem?” the father drunkenly asks. “I was born with a perpetual, perennial, eternal and life-ever-after hard-on.”
Though McNally said “he put that play away” [referring to “Door”], the Gale study guide for his play, “Master Class,” says that, “after revisions, [‘This Side of the Door’] became ‘And Things That Go Bump in the Night’,” which premiered on February 4, 1964 at the Guthrie Theater in Minneapolis and ran on Broadway in 1965 for 16 performances — a two-week run.
Four runners up won “awards of distinction” in the 1962 Stanley Drama Award competition:
Gene Radano, the 1959 Stanley winner (evidently, the later Stanley Award rule against submissions by previous winners had not yet been imposed)
Herbert Schapiro of New Brunswick, N.J. His obituary ran in the Oct. 31, 2014 issue of the New York Times:
Herb Schapiro, a writer and teacher whose idea to create a stage play from the collected essays of poor city kids resulted in a hit musical, “The Me Nobody Knows,” died on Oct. 17 at his home in Brooklyn. He was 85.
His son, Mark, said the cause was complications of non-Hodgkins lymphoma.
Called “a dark and lovely rock-folk musical” by the New York Times critic Clive Barnes when it opened at the Orpheum Theater Off Broadway in May 1970, “The Me Nobody Knows” tells the stories, largely in their own words, of a dozen children, mostly black or Puerto Rican, and what it was like for them to grow up poor in New York City.
Mr. Schapiro called it a “ghetto ‘Under Milk Wood,’ ” referring to the Dylan Thomas drama peopled by the inhabitants of a Welsh fishing village.
In December of that year, the show moved uptown to Broadway, where it ran for nearly a year, joining “Hair,” the celebrated musical with which it shared a contemporary score and immersion in the culture of young people.
Camille Atherton of Brooklyn. According to a pair of published obituaries, Camille Marie Atherton, 86, a resident of Gresham, Oregon, died Thursday, May 20, 2010. Atherton was born and raised in Chicago, but she later moved to New York in 1952 to advance her career and raise her family. She lived there until 1999. Atherton received her bachelor’s degree from the New School in New York City, then her master’s degree from Hunter College, becoming a rehabilitation counselor for the state of New York. For pleasure, Camille was an amateur playwright, gardener and gourmet chef. She was divorced. She moved to Oregon in 2001.
Augusta Walker, then of New York. Her obituary, written by Baltimore Sun staff writer Jacques Kelly, ran in the Oct. 11, 2000 issue of that paper:
Augusta Walker, 86, novelist, playwright, yoga devotee, Waverly resident
Augusta Walker, a novelist, playwright and yoga devotee, died Thursday of cancer at Genesis Eldercare Long Green Center. She was 86 and had lived on Greenmount Avenue in Waverly.
Miss Walker wrote four novels, including a much-praised 1954 work, "Around a Rusty God." The novel, a tale of a boy who raised goats, was translated into several languages and was condensed by Reader's Digest.
Marjorie Snyder, a critic for the Boston Herald, said the book had "the simplicity and beauty of a fable; a delicate tale with universal appeal and ineffable charm."
Miss Walker wrote "The Eating Valley" in 1956, "A Midwest Story" in 1959 and "A Back-Fence Story," published in 1967.
In 1954, her short story, "The Day of the Cipher," won the O. Henry Award for the best short story of the year. It had been published in the Yale Review.
In 1992, when she was 78, she won the Baltimore City Artscape Award for her play, "Herbert's Major Breakthrough," which depicts a husband smashing through the walls of the apartment he shares with his wife. As he knocks down a wall with a sledgehammer, he wants to know "what's really out there on the other side!"
In 1974, when high New York rents troubled her, Miss Walker moved to Mathews Street in Baltimore, where she had a backyard vegetable garden with a grape arbor.
"She was a resourceful woman who lived off the garden all summer," said David Diorio, a friend and publisher of Icarus Press in Towson. "She made her own clothes and went to the Goodwill. Money was not important to her. It was her spiritual search that was the important thing in life."
Mr. Diorio said Miss Walker traveled through the neighborhood on the bus. She wheeled groceries in a wire cart.
"Very few [people] really knew about her earlier success as a novelist," Mr. Diorio added.
Several times a week, Miss Walker walked to the Siddha Yoga Center in the Marylander Apartments at University Parkway and St. Paul Street to prepare it for classes and vacuum its floor.
She became interested in the teachings of mystic philosophers while on a fellowship in England in the 1950s. She was a follower of the Armenian mystic George I. Gurdjieff.
"You never got the sense that life had treated her poorly," said Alice MacArthur of Washington, a friend. "She was a vigorous person, intelligent, kind, quiet. But she spoke her mind."
Born on a farm outside Cincinnati, Ohio, Miss Walker received bachelor's and master's degrees from the University of Michigan at Ann Arbor.
She taught at Lingnan University in China until 1950, when she was forced to leave by the Communist regime. She later studied for a doctorate in comparative literature at Columbia University.
A memorial service for Miss Walker will be at 4 p.m. Sunday at the Stony Run Friends Meeting House, 5116 N. Charles St.
She had no immediate survivors.
1963: Adrienne Kennedy
Adrienne Kennedy submitted the script for her one-act play, “Funnyhouse of a Negro,” in her application for Edward Albee’s playwriting workshop at the 1962 NYC Writers Conference. In that year’s contest for the Stanley Drama Award, however, Kennedy was passed over in favor of a script by Albee’s then-boyfriend, Terrence McNally. Kennedy submitted “Funnyhouse” again for the Stanley in 1963 — and won. It also won a 1964 Obie Distinguished Play award for its production by the East End Theater in New York, which opened in January of that year, and has been translated into several languages from English. In 1964, “Funnyhouse” was published, in full, in the Wagner Literary Magazine, No. 4 — a publication edited by Willard Maas, director of the NYC Writers Conference in 1963. It was also later published by the theatrical publisher, Samuel French.
According to an April 8 press release, the judges for the 1963 Stanley Award were actor Shelly Winters, playwright Edward Albee, Living Theatre co-director Julian Beck, and Wagner College drama professor John Hruby.
Here is the introductory biography to her Wikipedia entry:
Adrienne Kennedy (born Sept. 13, 1931) is an African-American playwright. She is best known for “Funnyhouse of a Negro,” which premiered in 1964.
Kennedy has been contributing to American theater since the early 1960s, influencing generations of playwrights with her haunting, fragmentary lyrical dramas. Exploring the violence racism brings to people's lives, Kennedy's plays express poetic alienation, transcending the particulars of character and plot through ritualistic repetition and radical structural experimentation. Much of her work explores issues of race, kinship and violence in American society, and many of her plays are “autobiographically inspired.”
In 1969, New York Times critic Clive Barnes wrote, “While almost every black playwright in the country is fundamentally concerned with realism — LeRoi Jones and Ed Bullins at times have something different going but even their symbolism is straightforward stuff — Miss Kennedy is weaving some kind of dramatic fabric of poetry.” In 1995, critic Michael Feingold of the Village Voice wrote, “with [Samuel] Beckett gone, Adrienne Kennedy is probably the boldest artist now writing for the theater.”
Kennedy is noted for the use of surrealism in her plays, which are often plotless and symbolic, drawing on mythical, historical, and imaginary figures to depict and explore the African-American experience.
The second part of Adrienne Kennedy’s 1963 Stanley Award-winning package was “The Owl Answers,” a one-act experimental play. Wikipedia summarizes the play:
It premiered in 1965 at [Lucille Lortel’s] White Barn Theatre in Westport, Connecticut one year after Kennedy's most well-known piece, the Obie Award-winning “Funnyhouse of a Negro.” Though written as a companion piece to “Funnyhouse of a Negro,” “The Owl Answers” is most commonly produced with another of Kennedy’s one-acts, “A Beast’s Story.” This production of two one-acts was named “Cities in Bezique” when it appeared Off-Broadway. [It premiered in January 1969 at the Public Theater.]
In “The Owl Answers,” an African-American girl dreams of establishing a heritage and imagines she is applying to bury her father in Westminster Cathedral. Historical figures scorn her, doubting the possibility of a black girl having that heritage. She argues that her father was white and her mother was his family’s cook. As a child, she had to enter through the back door when she wanted to visit her father.
The setting of the play shifts between the New York City subway, the Tower of London, a Harlem hotel room, and Saint Peter’s. Each setting utilizes the structure of a subway car and is filled with the sounds of the subway. Themes include identity, mortality, memory, and race relations.
According to a July 12 brief in the Berkshire Eagle (Pittsfield, Mass.), the judges named Timothy M. Sheldon of Hawthorne House, Devon Road, Pittsfield, for an award of distinction in the Stanley Award competition. In 2003, the Berkshire Eagle ran Sheldon’s obituary:
Timothy M. Sheldon, 65, of 46 Bartlett Ave. and Tophill Farm, Devon Road, Lee, died Sunday, June 22 while undergoing surgery at Berkshire Medical Center. He had been selected as Pittsfield’s poet laureate in April by the city’s Cultural Council and presented with an plaque by Mayor Sara Hathaway on April 30.
He was planning poetry programs for the Pittsfield schools and for public speaking and reading engagements during his two-year tenure, and had recently presented the mayor with a sheaf of new poems.
Born in New York City on April 15, 1938, son of Kenneth P. and Lorna Lowes Sheldon, he attended Haverford College in Pennsylvania and later received his master of fine arts degree from Yale Drama School. He had been a longtime resident of Lee, and also had lived in Montana, Kansas City, Mo., and Boston, and had spent a summer in Nigeria.
He was a 20-year veteran of the Army Reserve.
Mr. Sheldon was employed at Home Depot and Bousquet Ski Resort in Pittsfield. He was a contributor and editor for Animal Life Magazine. He frequently read his work to audiences at the WordPlay gatherings at Papyri Books in North Adams and at the Poetry Group in Springside Park in Pittsfield.
His verse play, “Rose Hill,” was broadcast on National Public Radio by WGBH-FM in Boston in 1974 and 1975 in 24 hourly episodes. His most recent drama, “The Poetry Show,” will be presented later this year by the Berkshire Writers Room. One of his poems appears in this week’s issue of Berkshires Week.
While at Haverford, he began a friendship with Peter Rockwell, whose father, Norman Rockwell, used Mr. Sheldon as a model for two of his paintings: the window-washer cover for the Saturday Evening Post of Sept. 17, 1960, and an Army Reserve poster for which, in 1983, Mr. Sheldon was interviewed on ABC’s “Good Morning America.” He was a member of the National Rifle Association, a nature photographer and an author.
He leaves his former wife of 24 years, Rosemary Sheldon of Lee; a stepdaughter, Rochelle O’Gorman of Lee, and a stepson, Mark Caruso of Ponte Vedra, Fla.
1964: Megan Terry + Joseph Baldwin (dual)
In 1964, the Stanley Drama Award was given to two playwrights for two dramas submitted entirely on their own: Megan Terry of Manhattan for “Hothouse” and Joseph Baldwin of Lincoln, Neb. for “Thompson.”
According to a June 15 story in the Advance, the judges for the 1964 Stanley Drama Awards were Arnold Weinstein, author of “The Red Eye of Love” and head of the NYC Writers Conference drama workshop; Michael Smith, associate editor and drama critic of the Village Voice; Wagner drama professor John Hruby, and English professor J.J. Boies, Writers Conference coordinator.
Joseph Baldwin, ‘Thompson’
During the 1964 NYC Writers Conference, John Hruby directed a production of Joseph Baldwin’s “Thompson” in the Main Hall auditorium, played by veterans of the Staten Island amateur stage.
From the Nebraska Authors website: Joseph B. Baldwin, born 1918-05-18 Tazewell, Tenn., died 1994-12-27 Lincoln, Neb. Joseph Baldwin was a renowned poet and playwright whose work appeared regularly in College Verse, Sou’wester, Prairie Schooner, and Southwestern Review. His one-act play, “Engine 8444,” was inspired by his lifelong love of trains and was performed in New York City in 1974 and on the Nebraska Television Network in 1979. Baldwin earned his B.A. in English at the University of Texas, and an M.A. and Ph.D. in speech and dramatic arts from the University of Iowa. He worked as a professor of speech, dramatic arts and theatre arts at the University of Nebraska, Lincoln. In addition to “Thompson” and “Engine 8444,” his titles include “Almost Too Many,” “Bachelor of the Year,” “The Finer Things: A Farce in One-Act” (1961), “The Waiting Game,” “He and She,” “At Last, He Said No,” “Snow for the Lovers” and “Committees Forever: A Comedy in One Act” (1963).
Joseph Baldwin’s article, “Producing New Plays in the University Theatre,” was published in the Educational Theatre Journal, Vol. 7 No. 1, March 1955, pp. 22-26. Use this link to download a PDF of the article.
Megan Terry, ‘Hothouse’
During the 1964 NYC Writers Conference, Arnold Weinstein led a staged reading of Megan Terry’s “Hothouse” on the Guild Hall terrace, read by “professional actors of the Off-Broadway stage.”
From Megan Terry’s Wikipedia profile: Megan Terry (born July 22, 1932, as Marguerite Duffy) is an American playwright, screenwriter, and theatre artist having produced more than 50 discrete works for theatre, radio, and television. She is perhaps best known for her avant-garde theatrical work from the 1960s where, as a founding member of New York City’s Open Theater, she developed an actor-training and character-creation technique known as “transformation” that she used to create her 1966 work, “Viet Rock,” the first rock musical and the first play to address the war in Vietnam.
From the Broadway Play Publishing website: Megan Terry’s plays include “Breakfast Serial,” “Calm Down Mother,” “Keep Tightly Closed in a Cool Dry Place,” “Hothouse,” “Ex-Miss Copper Queen on a Set of Pills,” “The People vs Ranchman,” “Goona Goona,” “Mollie Bailey’s Traveling Family Circus: Featuring Scenes from the Life of Mother Jones,” “Pro Game,” “Body Leaks,” “Sound Fields” and “Objective Love.” She has published over 45 plays. Most have been translated and produced worldwide. She has won a number of major writing awards, including a Guggenheim Fellowship and an Obie Award for “Approaching Simone.” She was elected to lifetime membership by the College of Fellows of the American Theatre, installation at the Kennedy Center, Washington, D.C., in recognition of “distinguished service to the profession by an individual of acknowledged national stature.” In 1992 she was named Nebraska Artist of the Year. Ms. Terry is photographer and co-editor of “Right Brain Vacation Photos: New Plays and Production Photographs, 1972–1992.” Ms. Terry has a degree from the University of Washington, certificates in acting, directing and design from the Banff School of Fine Arts in Banff, Alberta, Canada, and was awarded the Yale-ABC Fellowship: Writing for the Camera at Yale University. She has had a long association with the Omaha Magic Theatre in Omaha, Nebraska, as playwright in residence, photographer, performer and musician.
From the website, enotes.com: In her play, “Hothouse,” inspired by her relationships with her mother and grandmother, Terry explores the expectations society places on female behavior. While admiring her treatment of feminist themes, some critics faulted Terry's reliance on autobiographical material. [Note that this website, as well as Wikipedia's bibliography, gives 1974 as the date for “Hothouse,” though Terry won the Stanley Award for “Hothouse” in 1964.]
1965: Lonne Elder III
The 1965 Stanley Drama Award went to Lonne Elder III, “formerly of Jersey City,” for his play, “The Ceremonies in Dark Old Men.”
A brief published in the June 26 issue of the Newark Evening News said,
Composer-playwright Rick Besoyan and actress Blanche Yurka judged the competition ...
A professional actor since 1954, Elder was in the original presentation of “A Raisin in the Sun.” “Ceremonies” is his second full-length play. The young Negro writer’s first major theatrical work, “A Hysterical Turtle in a Rabbit Race,” won a $3,000 award from the John Hay Whitney Foundation.
The introductory biography for Elder’s Wikipedia profile says,
Lonne Elder III (Dec. 26, 1927 – June 11, 1996) was an American actor, playwright and screenwriter. Elder was one of the leading African-American figures who aggressively informed the New York theater world with social and political consciousness. He also wrote scripts for television and film. His most well-known play, “Ceremonies in Dark Old Men,” won him a Drama Desk Award for Most Promising Playwright and was nominated for the Pulitzer Prize. The play, which was about a Harlem barber and his family, was produced by the Negro Ensemble Company in 1969. In 1973, Elder and Suzanne de Passe became the first African Americans to be nominated for the Academy Award in writing. [They were nominated for] Best Adapted Screenplay ... for the movie “Sounder,” starring Cicely Tyson, Paul Winfield, and Kevin Hooks.
Later in the Wikipedia entry on Elder, it specifically addresses “Ceremonies”:
In 1965, “Ceremonies in Dark Old Men” was given a reading at Wagner College on New York’s Staten Island. The reading of the play propelled him to a fellowship in screenwriting at the Yale University School of Drama in 1966 and 1967, and won him several other financial awards. ...
The Negro Ensemble Company’s [1969] “Ceremonies in Dark Old Men” was one of the most meaningful theatrical events of the late 1960s, a culmination of Elder’s meditations on the black family unit in a hostile American society. Edith Oliver from The New Yorker stated in her review, “Ceremonies is the first play by Lonne Elder III to be done professionally, and if any American has written a finer one I can’t think what it is.” James Baldwin wrote, “ ‘Ceremonies in Dark Old Men’ is the most truthful play I have seen in a long time. Everyone connected with it deserves a prize, especially the author, Lonne Elder III.”
“Ceremonies” garnered positive reviews, and was the runner-up for the 1969 Pulitzer Prize in drama, along with several other drama awards. The play deals with a 1950s Harlem family—Russell B. Parker, a barber (portrayed by Ward in the original production) who spends most of his time reminiscing about his glory days as a vaudeville dancer, his two unemployed sons, who live on the edge of the law, and his daughter, who resentfully supports the family.
Elder said in the New York Times: “I wrote to write, out of my guts and my heart, I wanted to cause some kind of wonder in the minds of people. I don’t rant or rave about the terror of our racist society. It is never directly stated, it is just there.”
By the time it was revived in 1985, the New York Times noted, “the play had become a contemporary classic.” The subsequent productions of the play nurtured the stage careers of several prominent actors, including Denzel Washington, Billy Dee Williams, Keith David, and Laurence Fishburne. A profound influence on the works of August Wilson and films such as “Crooklyn” and “Boyz in the Hood,” “Ceremonies” remains the definitive black American family drama and the blueprint for how to tell that story.
1966: Albert Zuckerman
The 1966 Stanley Drama Award went to Al Zuckerman for his play, “To Become a Man.”
In the author’s profile from “Writing the Blockbuster Novel,” first published by Macmillan in the mid-1990s, his publisher said,
Albert Zuckerman has been a literary agent and book doctor to some two dozen blockbuster novels. He is the founder of Writers House, a firm that represents hundreds of leading writers in all categories. Author of two published novels, winner of the 1964 [sic] Stanley Drama Award, former writer for three television series, Zuckerman has also taught playwriting at the Yale School of Drama. He lives in New York with his wife and still takes on projects by new authors.
A donor story published on the Yale Giving website gives a little more detail of Zuckerman's background:
The impeccably preserved Victorian-era townhouse on West 26th Street in New York City is where Yale School of Drama alumnus Albert (Al) Zuckerman ’61 MFA, ’62 DFA has based his notable business for more than thirty-five years. Al is the founder of Writers House, one of the largest literary agencies in the world. Writers House represents writers and illustrators of fiction and non-fiction, for both adult and juvenile readers. Books are everywhere at Writers House: one can’t turn one’s head without being confronted by the works of best-selling, prize-winning authors: Ken Follett, Erica Jong, and Stephen Hawking; as well as numerous Nobel Prize, National Book Award, and Pulitzer Prize recipients.
Before immersing himself in the world of books, Al was an ambitious young playwright. After graduating from Princeton, he served in the U.S. Navy and then went to work for the State Department. One of Al’s plays, published in Best Short Plays of 1956, became the impetus for his application for admission to Yale School of Drama.
“Going to Yale was a life changing experience,” Al declares. “The influence of John Gassner, then head of the playwriting department, was transformative. Gassner taught me everything: how to build a scene, how to construct a character.” Upon graduation, at Gassner’s invitation, Al stayed on to teach first-year playwriting. “I came to the realization that I could help other writers.” He has been doing just that ever since.
Zuckerman died in 2011.
1967: William Parchman
An April 7 press release announced that the judges for the 1967 Stanley Drama Award would be George C. White, president of the Eugene O’Neill Memorial Theatre Foundation, and Ben Tarver, co-author of “the current off-Broadway musical hit ‘Man with a Load of Mischief.’ ”
The 1967 competition was still part of the NYC Writers Conference program, and a formal production of the winning entry was held in conjunction with the conference in July. Wagner English professor Jack Boies was identified as the NYCWC director.
A June 13 press release announced the selection of seven Stanley Award finalists:
Claris Nelson, New York City — Her plays include “Rue Garden” (Cafe Cino, 1962), “Medea” (Cafe Cino, 1962), “Neon in the Night” (Cafe Cino, 1964), “The Girl on the BBC” (La MaMa, 1965), “Passing Fancy” (London: Samuel French, 1994), “To the Land,” “A Road Where the Wolves Run” (Circle Rep, 1972) and “The Clown: A Fantasy” (1967). In later life, under the name Claris Erickson, she was an actor in the Circle Repertory Company.
A.R. Gurney Jr., West Newton, Mass. — His Wikipedia entry summary reads, “Albert Ramsdell Gurney Jr. (Nov. 1, 1930 – June 13, 2017), as pen name A.R. Gurney (sometimes credited as Pete Gurney), was an American playwright, novelist and academic. He is known for works including ‘The Dining Room’ (1982), ‘Sweet Sue’ (1986/7) and ‘The Cocktail Hour’ (1988), and for his [1990] Pulitzer Prize-nominated play ‘Love Letters.’ His series of plays about upper-class WASP life in contemporary America have been called ‘penetratingly witty studies of the WASP ascendancy in retreat.’ ”
Bruce Kessler, New York City — Among his plays are “Son of Fricka” (La MaMa, 1963), “The Collapse” (La MaMa, 1964), “Not Entirely Non-Descript but Persephone in the Sun” (La MaMa, 1969). He is referred to in “Playing Underground: A Critical History of the 1960s Off-Off-Broadway Movement” as one among “other, largely forgotten La Mama playwrights.”
David Watmough, Vancouver, B.C., Canada — His Wikipedia bio reads, “David Arthur Watmough (Aug. 17, 1926 – Aug. 4, 2017) was a Canadian playwright, short story writer and novelist. Watmough was born in London, England, and attended King’s College London. He has worked as a reporter (the Cornish Guardian), a ‘Talks Producer’ (BBC Third Programme) and an editor (Ace Books). He immigrated to Canada in 1960, to Kitsilano in Vancouver, British Columbia, where he lived for 40 years with his partner, ex-Californian Floyd St. Clair (1930–2009), an opera critic and, from 1963 till his retirement in 1996, a University of British Columbia French professor. He became a Canadian citizen in 1967. Watmough lived from 2004 to 2009 in Boundary Bay and before his death had been living at Crofton Manor, a Vancouver assisted-living facility. In 2008 he published his autobiography, ‘Myself Through Others: Memoirs’.” The only one of his works written in 1967, according to his Wikipedia selected bibliography, is “Names for the Numbered Years: Three Plays.”
Robert Kornfeld, New York City — The Riverdale Press ran an extended obituary on Sept. 1, 2010: “Robert Kornfeld, a successful playwright, photographer and journalist, who was responsible for creating the Riverdale Historic District, died while recovering from pneumonia at the Allen Pavilion in Inwood on Aug. 23. He was 91. ... He wrote numerous plays, including ‘The Art of Love,’ ‘The Celestial’ — which opened at the governor’s mansion in Wisconsin — and ‘Passage in Purgatory,’ produced off Broadway and in Shanghai. ‘The Gates of Hell,’ considered by many to be Mr. Kornfeld’s best, had an extended run at the Theater for the New City in the East Village.” For the rest of his amazing obituary, go to https://bit.ly/2MJ19JL.
Wayne F. Maxwell Jr., New York City — The author’s bio in his 2005 children’s book, “The Little Blue Lamb,” says, “The late Wayne F. Maxwell Jr. was born in Kansas, raised in Tulsa, Oklahoma, and graduated from Tulsa University’s theater department. His talents as an actor-director-playwright were seen On- and Off-Broadway, Los Angeles, and London’s West End. He loved children and wrote lovingly for them while waiting for calls for stage and film work.” A description of the Wayne F. Maxwell Jr. papers, housed in the University of Tulsa’s McFarlin Library, says, “The Wayne F. Maxwell Jr. papers consist of the typescripts and/or photocopied typescripts of five plays, two screenplays, five short stories, and several untitled poems written by Wayne F. Maxwell Jr., a University of Tulsa speech major (Class of 1954), actor, director, and playwright. Some of Maxwell’s plays were written and produced while he was a student at the university. Further information about Maxwell and his activities with the University of Tulsa theatre may be found in The Kendallabrum, 1951-1955.”
William Parchman, Mineola, N.Y. was finally named as the winner of the 1967 Stanley Award for “The Prize in the Crackerjack Box.” — Parchman was one of four playwrights to receive a $3,500 grant in 1968 under the Eugene O’Neill Foundation-Wesleyan University fellowship program, sponsored by the Rockefeller Foundation. His play, “The Mocking Bird,” was performed in July 1969 at the Playwrights Conference sponsored by the Eugene O’Neill Memorial Theater-Foundation in Waterford, Conn.
1968: VENABLE HERNDON
The 1968 Stanley Drama Award went to Venable Herndon for “Bag of Flies.”
Venable Herndon was born on Oct. 19, 1927 in Philadelphia and died Dec. 8, 1999 in New York. He was the son of Hunter Venable and Isabelle Kearney (Flaig) Herndon.
In 1969, the year after winning the Stanley Award, Herndon won the Writers Guild Award for his screenplay of “Alice’s Restaurant,” written with director Arthur Penn.
According to the website, Prabook.com, Herndon earned his high school diploma from Lawrenceville School, 1945; his bachelor’s degree from Princeton University, 1949; and his master of arts degree from Harvard University, 1951. From 1951 to 1967, he worked as an advertising copywriter for the Gimbels and Bamberger’s department stores, and as an account executive for Hicks and Greist Advertising, New York. He worked as a studio screenwriter from 1967 to 1974 for United Artists, Paramount and Columbia films. From 1975, he taught in the dramatic writing program at New York University.
Following Herndon’s death, the Princeton Alumni Weekly published “Memorial: Hunter Venable Herndon ’49”:
Ven died Dec. 8, 1999, of acute Leukemia. He was 72. He came to Princeton from the Lawrenceville School and majored in modern languages, graduating with high honors. He was a member of Cloister Inn. He served in the Army.
After graduation Ven became a playwright and screenwriter as well as a teacher of those arts at NYU's Tisch School of the Arts. He was still active in teaching there until just before his death. His best known screenplay was his 1969 collaboration with the director Arthur Penn on “Alice’s Restaurant.” The movie starred Arlo Guthrie and was based on Guthrie's song of the same name. He was also the author of a book about the life of James Dean.
He is survived by his wife, Sharon Anson, and a daughter, Isabelle Molinaro. The class extends its deepest sympathy to them both.
Playbill published an obituary by Kenneth Jones, “NYU Dramatic Writing Professor Venable Herndon, 72, is Dead,” on Dec. 15, 1999:
Venable Herndon, a playwright, biographer and screenwriter who taught in New York University's dramatic writing program, died Dec. 8 in Manhattan. He was 72 and the cause of death was acute leukemia.
An associate professor of screenwriting in NYU's Tisch School of the Arts, Mr. Herndon earned his bachelor’s in French literature at Princeton and his master of fine arts in comparative at Harvard, and penned such plays as “Until the Monkey Comes ... ” (staged in New York, Chicago and Berlin), “Bag of Flies” and “Independence Night.”
His screenplays include “Alice's Restaurant” (directed by Arthur Penn), “Too Far to Walk” (for Otto Preminger), “Uncle Sam's Wild West Show” (for Paul Mazursky) and more.
“He came here originally to teach in the film school, which he started doing in 1975,” said Mark Dickerman, chair of the NYU Tisch dramatic writing program. “He was always considered a screenwriting teacher, though he certainly had intense and important relationships with playwrights. He was a terrific dramaturg, and students sought him out. Venable would say things aloud that most human being don’t. He was always controversial, provocative and outrageous.”
Both playwrights and screenwriters would make the trek to Mr. Herndon’s NYU office (the door always was open) for advice about work, Dickerman told Playbill On-Line. “He was very blunt, but he had such affection for the person whose work he was talking about that, as blunt as he became, people never objected,” Dickerman said. “Venable got people to think in vital ways about themselves, which he thought was important if they were going to be good writers. He became a habit for people. Once you were Venable-ized, that was it.”
In addition to his dramatic writing, Mr. Herndon was founder and editor of the literary journal, Chelsea Review (1958-1966) and penned a biography, “James Dean: A Short Life.”
He is survived by wife Sharon Anson and daughter Isabelle Molinaro of Manhattan.
1969: Bernard Sabath + Yale Udoff (dual)
Two winners were named for the 1969 Stanley Drama Award, the last time dual winners were named:
“A Happy New Year to the Whole World Except Alexander Graham Bell,” Bernard Sabath
Two one-acts: “The Club” and “The Little Gentleman” by Yale Udoff
Other than the names of the winning plays and playwrights, we have no information on file for the 1969 Stanley Awards.
Bernard Sabath, ‘A Happy New Year to the Whole World Except Alexander Graham Bell’
A manuscript of “A Happy New Year” is housed in the University of South Florida Library. Described as “a play in five scenes,” the play is about how “Samuel Clemens turns down Alexander Graham Bell’s appeal to invest in his new invention, the telephone.”
Sabath was fascinated by Mark Twain. A second play written in 1969 was titled, “The Man Who Lost the River: A Play About Sam Clemens.”
In December 1985, Chicago Tribune critic H. Lee Murphy wrote about two more Mark Twain plays written by Bernard Sabath, giving more information about the playwright’s interest in the author of “Tom Sawyer” and “Huckleberry Finn”:
The playwright Bernard Sabath has been absorbed by Mark Twain ever since Sabath’s own boyhood years ago in a small town upriver from Twain’s hometown of Hannibal, Mo. Now, in the sesquicentennial of Twain’s birth, Sabath is finding new forums in which to indulge his affection.
New York’s Circle in the Square Theatre recently announced that it will produce Sabath’s “The Boys In Autumn,” a memory-filled meeting of Tom Sawyer and Huck Finn when they have grown into old age, circa 1924. The play will star George C. Scott and is tentatively set for a late spring opening. It has been a while coming, since a 1981 production in San Francisco starring Burt Lancaster and Kirk Douglas got no Broadway offers.
Closer to home, the Theatre of Western Springs [in suburban Chicagoland] is presenting the Midwest premiere of Sabath’s companion piece titled “Hannibal Blues,” which centers on a single reappearance by Tom’s first sweetheart, Becky Thatcher, in Hannibal, also in the 1920s.
The 52-year-old Sabath, an instructor for years at Northwestern University before a recent migration to Sarasota, Fla., to try his hand full time at playwrighting, finished “Blues” in the late 1970s. But the show has had just a single major showing, by the StageWest Repertory Co. last year in Springfield, Mass.
“I guess I’ve always been fascinated by the Mississippi River and Mark Twain,” Sabath said in an interview last week. “You have to know his characters pretty well before you can bring them up to date.”
A visit to last week’s opening in Western Springs found “Hannibal Blues” a curious consideration of the adult Becky. Long gone are the innocent pigtails and white lace frocks. This cynical visitor is a firebrand of a tomboy, wearing a man’s fedora and hiking boots and projecting a hard-bitten feminist outlook that might give any modern-day activist cause to blanch. Her untethered independence is punctuated by recitations from Emile Coue, a French exponent in the 1920s of a distinctive type of positive thinking. Most of the rest of her dialogue could have been penned by the radical philosopher Ayn Rand.
There isn’t much of a plot here. Becky falls and injures herself while exploring the same cave where she and Tom became lost years before and ends up spending an evening with a God-fearing Roy Fulton and his son Ben. As Becky sits on the clapboard front porch, her tales of big cities and the jazz bands she has known pose quite a contrast to Hannibal’s humble agrarian setting. At first wide-eyed, the elder Fulton is ultimately liberated by the conversation, driven to a telephoned reconciliation with his runaway wife in California.
The stories aren’t particularly colorful, and the characters seem somehow indistinct even at the end of two hours. Nonetheless, the cast never falters. A lanky, angular Terry Fanning, who has been acting with this group for a decade, invests Becky with a noble pridefulness that balances her less-sympathetic rebellious side. Noel Smith drawls his way through the part of Roy Fulton, while Mark Jolicoeur exhibits a fine adolescent awakening as son Ben. Ted Kehoe’s direction is attentive to the backwoods trappings of the play.
When “The Boys in Autumn” was staged in April 1986 at the Circle in the Square, New York Times critic Frank Rich was not impressed. (And no mention was made of George C. Scott playing in the production.)
Rich wrote, “While this [Broadway] season never did produce any cutthroat competition for the honor of best play, the worst play sweepstakes is being bitterly contested right up to the final hour. ‘The Boys in Autumn,’ a terminally innocuous speculation about Huckleberry Finn and Tom Sawyer in middle age, almost makes one long for ‘The Boys of Winter,’ a Vietnam war drama that had been the prize 1985-86 turkey until this point. ... Mr. Sabath has ... given the men lurid secrets that reduce two of the most beloved characters in our cultural heritage to extras in a Harold Robbins novel.”
“Autumn” was later staged at Honolulu’s Hawaii Theatre, in June 2010, featuring “Wheel of Fortune” host Pat Sajak as the adult Tom Sawyer. It is not clear whether or not the production was ironic in intent.
Yale Udoff, two one-acts: ‘The Club’ & ‘The Little Gentleman’
Yale Udoff, a successful playwright and screenwriter, was at the beginning of his career when he won the 1969 Stanley Drama Award for his two early one-act plays, “The Little Gentleman: A Domestic Fantasy in One Act” and “The Club.”
In his November 2005 review for Backstage magazine, Dave DePino writes:
In ‘The Little Gentleman,’ surreal and darkly comedic, we meet cute-as-a-button 2-year-old Ronald [played by an adult actor], who speaks perfect English, with an English accent. His mother is more concerned with gifts from her husband and battling with her mother about her own upbringing than with realizing that her child needs special attention. Aunt Sylvia arrives, adding to the dysfunction and giving Ronald a good look at the sad family he’s been born into.
“The Little Gentleman” has been published three times — twice in collections, and once in a magazine:
“Best Short Plays 1971,” ed. Stanley Richards (Phila., Pa.: Chilton Book Co., 1972)
“9 Modern Short Plays: Outstanding Works from Stage, Radio and Television,” ed. David A. Sohn and Richard H. Tyre (Bantam Books, 1977)
Literary Cavalcade magazine (March 1972)
“The Little Gentleman” was staged at least twice, according to the playwright: once in the Pacific Resident Theatre in Venice, Calif., in February 2005; and again in November 2005 at the Laurelgrove Theatre in Hollywood, Calif. For the Laurelgrove Theatre production, “The Little Gentleman” was staged together with another Udoff one-act play, “Nebraska,” under the umbrella title, “States of Mind.”
The second half of Udoff’s two-part Stanley Award-winning submission, “The Club,” is set in a steam room, where a group of Jewish men in their 60s nervously wait for their secret agreement to take place. An old Italian joins them, threatening their stability, and bringing their agreement to fruition. [Synopsis provided by the author on his website, yaleudoff.com.]
Udoff received his greatest critical acclaim for his first full-length stage play, “A Gun Play,” which premiered at the Hartford (Conn.) Stage Company in early 1971. New York Times theater critic Mel Gussow gushed, “Its author, Yale M. Udoff, is a discovery. … I suspect that even more will come later.” And when the play moved to New York’s Cherry Lane Theatre that October, Times theater critic Clive Barnes wrote, “There is a cold and fine madness to … ‘A Gun Play.’ … It is to be recommended, largely for itself but also partly for the very evident promise of Mr. Udoff. When you are seeing his second and third plays, it will be agreeable to recall that you saw his first.”
Udoff had many writing credits following “A Gun Play,” but none that met with such critical acclaim. Among those credits are the screenplays for Nicolas Roeg’s confusing “Bad Timing/A Sensual Obsession” (1980) and “Eve of Destruction,” starring Gregory Hines.
Born in 1935, Udoff is a graduate of Michigan State University, attended Georgetown Law School, and served as an infantry officer in the United States Army. His wife, Sally Shulamit Udoff, died in 2010. Yale Udoff died July 19, 2018.
For more details about Udoff’s work, visit the playwright’s website, yaleudoff.com.
Yale Udoff died July 19, 2018 in Burbank, California. He was 83.
Stewie Griffin and ‘The Little Gentlemen’
Ronald, the titular character in Yale Udoff’s “The Little Gentleman” is described in the play’s stage notes as “a child somewhere between the ages of one and three. … He speaks with a British accent. The fact that he is being portrayed by an adult actor should not be used to burlesque the dramatic situation.”
To those familiar with the Fox Television animated series, “Family Guy,” this description will remind them of one of the recurring characters, Stewie Griffin, an (initially) evil baby genius. Stewie speaks in an Oxbridge accent, though it’s never entirely clear how many other characters can understand him except for the family dog, Brian; the baby and the dog are the most intelligent members of the family.
We wrote to Udoff on Aug. 17, 2018, asking if he had ever heard of any connection between Ronald and Stewie. Unfortunately, unbeknownst to us, Udoff had died four weeks earlier. His associate, Alicia Beach, did reply to our email, however, saying, “While Yale is no longer with us to answer your query, what I can say is that I did hear such speculation from Yale directly.”
A search on the Internet for questions about the origin of the Stewie character on “Family Guy” disclosed not one but two claims of possible plagiarism — but neither involved “The Little Gentleman.” The two similar characters at issue are Barry Ween, created by Judd Winick, and Jimmy Corrigan, created by Chris Ware. Both characters appeared in graphic novels named for them.
Of the two similar characters, only one was first published before the first broadcast of “Family Guy” — and that character is the least similar to Stewie.
Stewie first appeared in the 15-minute “Family Guy” pilot, which aired after the Super Bowl on Jan. 31, 1999.
Chris Ware’s “Jimmy Corrigan: The Smartest Kid on Earth” first appeared in Acme Novelty Library #5, published in the spring of 1995. While several images of Jimmy reproduced from the graphic novel series do bear a striking resemblance to Stewie Griffin, the truth is that Jimmy Corrigan is portrayed in the novel mostly as an adult with little resemblance to Stewie. Here’s the “incriminating” comparison most often presented on the Web:
Judd Winick’s character, Barry Ween, actually bears a closer resemblance, both graphically and in character traits, to Stewie Griffin. In “The Big Book of Barry Ween, Boy Genius,” we find a boy of about 10 with a head shaped similar to Stewie’s, the sideways football. Like Stewie, Barry is a genius, probably smarter than anyone else in the world; and, like Stewie, he has a penchant for high-technology devices, especially weapons. Here is a comparison image:
The problem with allegations of plagiarism of Barry by Stewie, however, is timing: Winick’s character did not make his first appearance until several weeks after the first airing of the “Family Guy” pilot. “The Adventures of Barry Ween, Boy Genius, Vol. 1” was published in March 1999. “Barry Ween” was almost surely already in production when the “Family Guy” pilot first aired, so it is virtually certain that Barry was not copied by Stewie — but neither is it conceivable that Stewie could have been copied from Barry, who had not yet appeared in print.
And neither Barry Ween nor Jimmy Corrigan bear any resemblance to Yale Udoff’s character, Ronald, in “The Little Gentleman.” The only thing we can learn about the dual origin controversies related to the Stewie character in “Family Guy” is that certain features of fictional characters seem to recur without necessarily arising from plagiarism.
1970: RICHARD LORTZ
Judges for the 1970 Stanley Drama Award competition were announced — for the first time, NOT in conjunction with the (now defunct) NYC Writers Conference. “Guest judge” was Wagner alumnus Paul Zindel ’58 M’62, whose new play had just opened Off-Broadway, “The Effect of Gamma Rays on Man-in-the-Moon Marigolds.” (It won the 1971 Pulitzer Prize as well as an honorary Wagner doctorate for Zindel.) The other judges were Lowell Matson, chairman of the college’s new Department of Theatre and Speech, and English professor J.J. Boies, director of the competition. The submission deadline was May 11.
A July 27 press release announced the six finalists for the 1970 Stanley Drama Award:
Lewis Colca, Manhattan, “Buzzards Bay,” “a 1970 version of high comedy.” According to the Granville (Ohio) Sentinel, the Welsh Hills Players of Newark, Ohio, presented the premiere of “Buzzards Bay” on March 20, 1973.
Gerry Carroll, Los Angeles, “Bruce,” “a historical drama of Robert Bruce of Scotland.” “Bruce” was one of the plays developed in 1971 at the Eugene O'Neill Theater Center's National Playwrights Conference.
Bronson Dudley, Manhattan, “Leftovers,” “a satiric fantasy with musical interludes.” A memorial blog about Dudley said, “Bronson was an actor and playwright. ... None of his plays hit it big, but he had a successful early career as a dancer on the stage and a late career as a character actor in TV and films. His most memorable film role was Bill in Steve Buscemi’s 1996 ‘Trees Lounge.’ ... Bronson was born January 27, 1920 and died Shrove Tuesday, February 20, 2007.” According to a New York Magazine theater schedule, “Leftovers” was staged in July and August 1972 by the New York Theater Ensemble, 2 E. 2nd St., Manhattan. Three years later, according to New York Times writer Phyllis Funke, “Leftovers” was staged in an innovative production by the Writers in Residence company in Great Neck, Long Island. Funke said the one-act play “deals with the meeting between an aging actress and an aspiring young playwright, both of whom need to talk.”
Craig Clinton, Woodmont, Conn., “A Lamentable Disposition,” “an ‘absurd’ play.” In its 1971-72 season, Playwrights Horizon in Manhattan staged Clinton’s “A Shared Thing/Lunch Hour”; the following year, “Lunch Hour” was staged at the Manhattan Theater Club, 321 E. 73rd St. Today, Clinton is professor emeritus in the theatre department at Reed College in Portland, Oregon, which he joined in 1978. He says, “My primary interests in theatre are in the areas of directing and playwriting. Undergraduate studies at Antioch College and San Francisco State [B.A. 1967, M.A. 1969]. Graduate study at Yale Drama School and Carnegie Mellon University [Ph.D. 1972]. Publications include pieces on Tennessee Williams, Trevor Griffiths, William Inge, and Tom Stoppard.”
M. Sullivan, Pittsburgh, Pa., “Matilde,” “a series of three related one-acts.” Mary Eileen Sullivan, writing under the pseudonym L.M. Sullivan, also published “Cinder Box: An Illusion in One Act With Marches, Dances, a Limerick & Canzonets,” with co-authors Joseph Meyer & Rebecca Red-Shaw, 1970; “Happy House: A Play in Two Acts,” 1972; and “Baron’s Night, or Catch as Catch Can,” in “New Plays By Women,” ed. Susan LaTempa (Berkeley, Calif.: Shameless Hussy Press, 1979).
Richard Lortz, Manhattan, “Three Sons,” “a drama based on the prodigal son story.”
On Aug. 18, Wagner announced that Richard Lortz had won the Stanley Award for “Three Sons,” “which has as its central theme the return of the prodigal son.” The press release went on to say:
A native of New York City who also maintains a home in Belle Harbor, Long Island, Mr. Lortz holds a degree in creative writing from Columbia University and has had two novels published both here and in England, “A Crowd of Voices” and “A Summer in Spain.” In the 1950s he wrote many television plays for such CBS-TV series as “Suspense,” “Danger” and “The Web,” and had another play, “The Journey With Strangers,” produced off-Broadway in 1958. Currently, his play, “The Others,” a supernatural drama, is being filmed in England by Carter De Haven and Eric Winter with the screenplay written by Gillian Freeman, scenarist for “Leather Boys” and “One Cold Day in the Park.” Another play, “The Juniper Tree,” will be produced at the new Sybil Thorndike Theatre in London this season.
In addition to writing, Mr. Lortz paints, and has exhibited his paintings in several one-man shows. Represented by Mary Dolan of the Gloria Safier Agency, he presently works in an editorial capacity for Media Horizons, publishers of trade magazines. …
Dr. Lowell Matson, chairman of the Department of Speech and Theatre at Wagner College … will direct a full production of “Three Sons” at Wagner in October using a professional cast.
When it was premiered in October 1970 on the Wagner College Theatre stage, “Three Sons” was retitled “Of Sons and Brothers.”
On April 6, 1971, a Wagner College press release announced that “Of Sons and Brothers” was “scheduled to premiere on Broadway in the coming fall season. … The drama will go into rehearsal in the late summer under the direction of Alan Schneider, known for his direction of Edward Albee plays and as director of ‘Who’s Afraid of Virginia Woolf.’ The drama was optioned for Broadway production at its opening night on the Wagner campus. … Lortz’s drama centers on the Biblical prodigal son story but the action takes place in a West Side laundromat.”
Nothing appears to have come of Schneider’s planned Broadway production of Lortz’s prodigal-son drama — but the following year, Lortz’s “Voices” opened on April 3, 1972 at Broadway’s Ethel Barrymore Theatre. It ran for just one week — eight performances. Perhaps mercifully, no reviews can be located.
In 1973, “Of Sons and Brothers” resurfaced, this time under the title, “Prodigal,” opening on Dec. 16 at the Circle Theater — later known as the Circle Repertory Theater — which, while located on Broadway was not a “Broadway” theater; because of the number of seats, it was considered “Off Off Broadway.”
A Dec. 14 preview story by Staten Island Advance theater writer Elaine Boies (wife of Stanley Drama Award director Jack Boies) was titled, “Stanley Award Drama Did Better at Wagner.” (No bias, of course.)
By any name, [“Prodigal”] is a powerful reworking of the prodigal son theme into an emotionally charged contemporary family drama.
The playwright deals with love and compassion, jealousy, sin, penance, and expiation of guilt followed by further transgressions. It is a search for oneself, a search for one’s soul.
Willie Nathan [the titular prodigal son] never finds it. Or does he?
Returning to the fold — his family’s Laundromat — as mysteriously as he left it seven years ago, Willie dredges up conflicting passions among his parents and two brother.
Willie has stolen from his father, and squandered $50,000. Is he to be forgiven, welcomed, accepted, or shunned and punished?
Lortz’s drama is laden with anguished family confrontations that hinge on Willie, the middle child, the “handsome prince,” the favored one who has learned to use his charm to con the world.
He returns home broken, spent, having wallowed in the dregs of depravity until he was born again of a new innocence — he says.
Slowly, subtly, the playwright lets the audience become aware that it, too, is taken in by Willie’s magnetism. Is he a Christ figure — or a devil? Or simply a man who failed in his quest for the Grail? …
At Wednesday night’s preview, it was apparent that several roles, especially Willie, were seriously miscast.
Reticent though he is, the playwright had to agree that the 1970 Staten Island production was superior to what’s happening now.
Salem Ludwig, who recreates the father role he originated at Wagner, and Judd Hirsch as Saul, the eldest son whose love is taken for granted, are superb. The others are wrong for their parts.
Lortz’s play is still there, simmering provocatively beneath the surface presented by the cast.
To find it, the critics will have to close their eyes and conjure up characters more appropriate to the playwright’s words. It’s a tough job.
Too bad they never saw it at Wagner.
Clive Barnes reviewed the opening night’s performance at the Circle Theater for the Dec. 18 issue of the New York Times:
“The Prodigal” … is a conventional family melodrama with Biblical overtones. It is set in a laundromat on Manhattan’s West Side and it concerns the return of Willie to the family home.
Willie has been away for seven years. When he left he stole $50,000 as a personal going-away present, and on his travels he seems to have done everything from killing onward. His life sounds spectacularly decadent, but it is difficult to know whether the author means us to believe him or not.
Mr. Lortz’s language is as high‐flying as Icarus. There is validity to this story of three brothers: Saul, the hard‐working eldest brother who counts the petty cash and drives a white Cadillac; the thriftless but beautiful middle brother, Willie, prodigal and charming; and the youngest brother, Joey, planning a runaway but not, presumably, with any of the family fortune. Add a Jewish mother with chicken soup instead of blood in her veins, and a Jewish father strong on both justice and forgiveness, and you have the makings of a fairly stereotyped family ball game. The writing and dramaturgy never quite jell.
Why should the youngest brother go the way of the prodigal when he is so obviously different in temperament? Yet this incident is the only one that provides the play with its dramatic development as opposed to its characterization. The story of the prodigal is very predictable.
The big difficulty is Mr. Lortz’s lack of a way with words. This could change, and certainly he already understands how to build up an effective scene. But he must listen to the way people talk and react.
The permanent setting by Philip G. Gilliam tried to suggest both laundromat and living room and fell down somewhere between the washer and the sofa, and Marshall W. Mason's direction proved too declamatory, in a way that emphasized rather than minimized the playwright's ornate rhetoric.
The performances were good. I was particularly impressed with Judd Hirsch’s baffled, puzzled and bullying eldest brother, clumsily dealing with life’s most unfair proposition, that good guys finish last. Ted Leplat had a decently neat air of Dorian Gray sensuality as the spoiled prodigal.
All in all this was by no means an unrewarding attempt at a play, but it is an attempt essentially more notable for its real promise than its real achievement.
Ouch.
Richard Lortz, born in New York on Jan. 13, 1917, died on Nov. 11, 1980 at the age of 63. A New York Times article said that he died “of a heart attack while visiting his physician in the Bronx.”
1971: BERNARD ‘BEN’ ROSA
A brief in the Wagner College alumni magazine announced that “Ben Rosa, a former construction worker turned playwright, is the winner of the 1971 Stanley Drama Award for his three-character play entitled ‘Obtuse Triangle.’ Rosa, who lives at 11 Waverly Place in New York City, will receive $500 and a showcase production of his script at Wagner College in the fall.”
Aside from the subtitle of Rosa’s play, “A Romantic Comedy in Two Acts,” preserved in the list of Stanley Award winners, nothing is known of Bernard “Ben” Rosa except his birth date — June 11, 1930 — and the date of his death, Jan. 17, 2010, in West Islip, Long Island.
1972: MARVIN DENICOFF
A July 21, 1972 press release announced the finalists for that year’s Stanley Drama Award:
Gene Boland, Los Angeles, “Nobody Sings Like Aunt Hagar’s Children.” Boland was a TV writer and actor in the late 1960s, most often referred to in material written about that period as, specifically, a black writer and actor. He was one of the first African Americans to write for network television series in the Sixties, including “Peyton Place,” “Julia” and “That Girl.” His acting credits include episodes of “Adam-12,” “Dragnet,” “T.H.E. Cat,” “Daktari” and “I Dream of Jeannie.”
John L. ‘Jack’ Leckel, Cicero, Ill., “To Hang is to Dangle.” Leckel headed the theater program at J. Sterling Morton East High School in Cicero. Besides “To Hang,” he was the author of a number of plays with various university productions, including “Blue Is The Antecedent Of It,” “Department Store” (1973) and “Mustapha On Stilts.” He received local Emmy nominations for “As Adam, Early in the Morning,” a 1966 CBS Repertoire Showcase production co-authored with actor William Marshall, and “Nothin’ Like Us Ever Was.” His first novel, “A Warning Thunder,” is set in Louisiana immediately following the Civil War. His second novel, “A Brief Trip to the Moon,” is self-published on Amazon. Between 1979 to 2001, with co-author/illustrator Agnes M. Feeney, Leckel wrote several books about the history — and, sometimes, specifically the cooking history — of Illinois, including “The Great Chicago Melting Pot Cookbook.” In addition to these works, Leckel has published articles for educational journals. He earned his M.A. in theatre architecture from the University of Illinois at Urbana.
Whitney Stine, Hollywood, Calif., “Maestro,” music by Fran Ziffer, lyrics by Martin Kalmanoff.
Whitney Stine, born 1930, is best known as the author of "I'd Love to Kiss You: Conversations With Bette Davis" and "Mother Goddam: The Story of the Career of Bette Davis." She is also the author of several other show-business books as well as a number of novels.
Fran Ziffer also wrote music for "Three on a Bed: A Musical Satire," words by Horty Belson & Thomas Hill (1974), and for "One Foot to the Sea" (1953) and "Dakota" (1951) at the Originals Only Playhouse, Manhattan. Born in Baltimore, Md., Frances Ziffer Burgio of Allentown, Pa., formerly of New York City, died Thursday, Nov. 7, 1996.
Martin Kalmanoff (1920-2007) was born in Brooklyn and studied piano and composition from the age of 7. He earned bachelors (1941) and masters (1943) degrees in music from Harvard. He began his career as a popular songwriter, sometimes writing his own lyrics, but mostly collaborating with either Atra Baer (his first wife) or Aaron Schroeder, though he often worked with other lyricists. Artists who recorded his songs included Sammy Kaye, Guy Lombardo, Connie Francis, Julius LaRosa, Vic Damone, Engelbert Humperdinck, Roy Rogers, Billy Butterfield and Elvis Presley. As his career progressed, Kalmanoff devoted most of his energy to operas and musicals; collaborators included Eugene Ionesco, William Saroyan, Eric Bentley and Lewis Allen. The Martin Kalmanoff papers are housed in the New York Public Library's Archives & Manuscripts department.
Marvin Denicoff, Potomac, Md., who had submitted two plays for the competition: “Fortune Teller Man” and “Wilma’s Freak Show.”
The 1972 Stanley Drama Award went to Marvin Denicoff for “Fortune Teller Man.” The Sept. 26, 1972 Wagnerian said,
Denicoff, who is director of information services for the Office of Naval Research in Washington, D.C., won this year’s $500 award for a play called “Fortune Teller Man,” a drama about a once-serious playwright who has been ruined by trying for years to fit himself to the formulae of Hollywood scriptwriting. …
According to Denicoff, he has two careers: one in scientific research and one in writing. The former career, says the playwright, is what has supported the Denicoff household. For the Navy, Denicoff administers a basic research contract program in such fields as linguistics robotics, automata theory, pattern recognition, software development, etc.
But Denicoff, the writer, has also published many short stories over the years. They have appeared in a number of literary magazines, including Whit Burnett’s “Story Anthology.”
Born and raised in Philadelphia, Denicoff graduated from Temple University in 1949 with a degree in liberal arts. He did graduate work in literature and linguistics at Temple and Mexico City College. He worked at the Office of Naval Research from 1960 to 1983, when he helped found Thinking Machines Corporation, where he worked until 1996.
In 1985, Denicoff described to Fortune magazine writer Brian Dumaine a scheme for using computers to assist in writing plays:
Marvin Denicoff, an artificial intelligence expert and an award-winning playwright, thinks a computer could help a dramatist write plays. In his vision, still very much on paper, the playwright would draft a scene and then set up a stage on his computer screen by drawing on a rich database of stock characters, sets, and costumes. He would then instruct his electronic actors to speak and move in any way he wished until he was satisfied with the scene. The playwright could also use a computer to show his finished play to potential investors.
The Aug. 31, 1972 press release announcing that Denicoff, 48, had won the Stanley Drama Award noted that “Fortune Teller Man” was the fourth play Denicoff had written. The others were “Wilma’s Freak Show,” also submitted for the 1972 Stanley, “A Cage for a Songbird” and “The Doctor is Sick.” No record could be found of any of these shows being produced.
Marvin Denicoff died on July 1, 2013, at the age of 88. He was survived by his wife of 63 years and their four sons.
1973: C. RICHARD GILLESPIE
The New York Times of Oct. 25, 1973 announced that C. Richard Gillespie of Baltimore had won that year’s Stanley Drama Award for his play, “Carnivori.”
In a September 2012 news story, the Baltimore Times said,
C. Richard (Dick) Gillespie has his master and doctoral degrees in theatre from the University of Iowa. He started in the theatre as an actor, but found his life’s work in teaching and directing. In 1961 he founded the academic theatre program at Towson University (then Towson State Teachers College) and taught there for 37 years. During his career he directed more than 75 productions in educational, professional and experimental theatres. He has directed plays from the full literature of the theatre including the Greek, Shakespearean, Restoration, Medieval, Romantic, Oriental and Contemporary repertories. His last two productions at Towson were critically acclaimed interpretations of Tennessee Williams’ seldom-produced plays, “Clothes For A Summer Hotel” and “Something Cloudy, Something Clear.” For eighteen summers he directed summer productions in the Maryland Arts Festival. Dr. Gillespie is the author of two books: “Papa Toussaint,” a novel based on the last five years in the life of Toussaint Louverture the liberator of Haiti; and “The James Adams Floating Theatre,” the history of a show boat that sailed the Chesapeake Bay and the North Carolina sounds between the world wars and was the model for Edna Ferber’s novel, “Show Boat.” He has written several plays, one of which, “Carnivori,” won the Stanley Drama Award.
“Carnivori,” written in 1971, was based on Gillespie’s experiences as an Army Signal Corps photographer during the Korean War. The play was produced at Baltimore’s Corner Theater.
The Baltimore Times story, above, was written about a performance of A.R. Gurney’s “Love Letters” in which Gillespie and his wife, Maravene Loeschke, were about to perform. Gillespie was then professor emeritus at Towson University, and Loeschke had recently been inaugurated as Towson’s president. Like her husband, Loeschke had an academic as well as a performing background in the theater.
Gillespie died on April 2, 2016 at the age of 85.
1974: GUS WEILL
The 1974 Stanley Drama Award went to Gus Weill for his play, “The Son of the Last Mule Dealer.” Judges for that year’s award were George C. White III, president of the Eugene O’Neill Memorial Theatre Center, Wagner College Theatre head Lowell Matson and Wagner English professor J.J. Boies.
According to Weill’s resume, published by Louisiana Public Broadcasting, “Son of the Last Mule Dealer” (written in 1969) was produced Off-Broadway, and by the Actors Studio. A May 1975 New York Times brief said that “Mule Dealer” would be produced the next spring (that is, in 1976) by Phil Osterman, but no further information about that production
|
||||
692
|
dbpedia
|
3
| 77 |
https://www.metmuseum.org/art/collection/search/267426
|
en
|
The Metropolitan Museum of Art
|
https://collectionapi.metmuseum.org/api/collection/v1/iiif/267426/608549/main-image
|
https://collectionapi.metmuseum.org/api/collection/v1/iiif/267426/608549/main-image
|
[
"https://collectionapi.metmuseum.org/api/collection/v1/iiif/267426/608549/main-image",
"https://www.metmuseum.org/Rodan/dist/svg/rolling-0.9s-30px.svg",
"https://www.metmuseum.org/-/media/images/perspectives/videos/2016/6/tap_s6_nan_goldin_1920.jpg?sc_lang=en&hash=A81088E2523709B7FF37920F1D2D10B1 2x, https://www.metmuseum.org/-/media/images/perspectives/videos/2016/6/tap_s6_nan_goldin_1920.jpg?sc_lang=en&hash=A81088E2523709B7FF37920F1D2D10B1 1x",
"https://cdn.sanity.io/images/cctd4ker/production/594f488708d55788dc49265db023d25ebe701ea8-250x321.jpg?w=250&fit=crop",
"https://cdn.sanity.io/images/cctd4ker/production/3dc3cb961058ee9ce0337312c4bcba6ff89bec63-250x250.jpg?w=250&fit=crop",
"https://cdn.sanity.io/images/cctd4ker/production/3ff67a6c75da93b3aa6b180e3e6444edbe384621-250x304.jpg?w=250&fit=crop",
"https://cdn.sanity.io/images/cctd4ker/production/68b40a89718fccb0e9fa78f5018385eb7d63b851-250x328.jpg?w=250&fit=crop",
"https://collectionapi.metmuseum.org/api/collection/v1/iiif/271078/preview",
"https://collectionapi.metmuseum.org/api/collection/v1/iiif/282148/preview",
"https://collectionapi.metmuseum.org/api/collection/v1/iiif/282150/preview",
"https://collectionapi.metmuseum.org/api/collection/v1/iiif/282149/preview",
"https://collectionapi.metmuseum.org/api/collection/v1/iiif/282128/preview",
"https://www.metmuseum.org/-/media/images/about-the-met/collection-areas/photographs/new-photographs-teaser.jpg"
] |
[] |
[] |
[
"Cameron",
"Julia Margaret",
"Photographs",
"Albumen silver prints",
"Europe",
"United Kingdom"
] | null |
[] | null |
en
|
https://www.metmuseum.org/content/img/presentation/icons/favicons/favicon.ico?v=3
|
The Metropolitan Museum of Art
|
https://www.metmuseum.org/art/collection/search/267426
|
The effusive, eccentric associate of Carlyle, Herschel, Ruskin, Rossetti, and Tennyson, Julia Margaret Cameron earned the admiration of her eminent colleagues when she took up the camera at age fifty. Characteristically Victorian in her intense idealism, Cameron sought to portray the noble emotions, mythological figures, and ancient heroes dear to her heart. She pressed her friends and family to pose in tableaux vivants that may seem sentimental today, but she also took portraits so vivid and psychologically rich that they are timeless.
Cameron made more than twenty portraits of her favorite niece and namesake, Julia Jackson, to whom she gave this unmounted proof print. She never portrayed Julia as a sibyl or a saint but rather as a natural embodiment of purity, beauty and grace. Spared the usual props and costumes, the twenty-one-year-old sitter here seems bodiless, an ethereal spirit afloat like an untethered soul.
|
|||
692
|
dbpedia
|
3
| 2 |
https://www.imdb.com/name/nm0131639/
|
en
|
Julia Cameron
|
[
"https://fls-na.amazon.com/1/batch/1/OP/A1EVAM02EL8SFB:147-3801604-5454403:VVTXVS0TY4GYRH02ZB53$uedata=s:%2Fuedata%2Fuedata%3Fstaticb%26id%3DVVTXVS0TY4GYRH02ZB53:0",
"https://m.media-amazon.com/images/M/MV5BZjFmZGFiOTUtZmNiNi00ZDcyLWE2M2YtY2YxZTc0YTc4NzQ4XkEyXkFqcGdeQXVyNTM3MDMyMDQ@._V1_QL75_UX90_CR0,1,90,133_.jpg",
"https://m.media-amazon.com/images/M/MV5BYTkwZWMzOTEtZjljNS00MTE3LWFjNzItN2FhNzRkZGY3MzY5XkEyXkFqcGdeQXVyNjExODE1MDc@._V1_QL75_UY133_CR2,0,90,133_.jpg",
"https://m.media-amazon.com/images/M/MV5BYzEyNjdmY2YtYTU3ZS00NTFjLTg5Y2YtY2JjZTFlYjJhMzNkXkEyXkFqcGdeQXVyNjMwMjk0MTQ@._V1_QL75_UX90_CR0,0,90,133_.jpg",
"https://m.media-amazon.com/images/M/MV5BZTMxM2JjNjMtNjk5Yi00NTczLWJmMmYtMDI2MGVlYmJlODc3XkEyXkFqcGdeQXVyNjMwMjk0MTQ@._V1_QL75_UY133_CR0,0,90,133_.jpg",
"https://m.media-amazon.com/images/M/MV5BOTM4NjBjZWMtODhiMS00NGUwLTg3MzItNTQyOGY0MTA3YzgzXkEyXkFqcGdeQXVyMTgxNDgxOQ@@._V1_QL75_UY133_CR9,0,90,133_.jpg",
"https://m.media-amazon.com/images/M/MV5BZjFmZGFiOTUtZmNiNi00ZDcyLWE2M2YtY2YxZTc0YTc4NzQ4XkEyXkFqcGdeQXVyNTM3MDMyMDQ@._V1_QL75_UX90_CR0,1,90,133_.jpg",
"https://m.media-amazon.com/images/M/MV5BYTkwZWMzOTEtZjljNS00MTE3LWFjNzItN2FhNzRkZGY3MzY5XkEyXkFqcGdeQXVyNjExODE1MDc@._V1_QL75_UY133_CR2,0,90,133_.jpg",
"https://m.media-amazon.com/images/M/MV5BZWYwZTFiNDAtNWU5OC00OTYwLWI3YzAtMjhhM2UwY2ExMGE3XkEyXkFqcGdeQXVyMjk3NTUyOTc@._V1_QL75_UY133_CR37,0,90,133_.jpg",
"https://m.media-amazon.com/images/M/MV5BYzEyNjdmY2YtYTU3ZS00NTFjLTg5Y2YtY2JjZTFlYjJhMzNkXkEyXkFqcGdeQXVyNjMwMjk0MTQ@._V1_QL75_UX90_CR0,0,90,133_.jpg",
"https://m.media-amazon.com/images/M/MV5BZjFmZGFiOTUtZmNiNi00ZDcyLWE2M2YtY2YxZTc0YTc4NzQ4XkEyXkFqcGdeQXVyNTM3MDMyMDQ@._V1_QL75_UX90_CR0,1,90,133_.jpg",
"https://m.media-amazon.com/images/M/MV5BZTMxM2JjNjMtNjk5Yi00NTczLWJmMmYtMDI2MGVlYmJlODc3XkEyXkFqcGdeQXVyNjMwMjk0MTQ@._V1_QL75_UY133_CR0,0,90,133_.jpg",
"https://m.media-amazon.com/images/G/01/IMDb/Mobile/DesktopQRCode-png.png",
"https://fls-na.amazon.com/1/batch/1/OP/A1EVAM02EL8SFB:147-3801604-5454403:VVTXVS0TY4GYRH02ZB53$uedata=s:%2Fuedata%2Fuedata%3Fnoscript%26id%3DVVTXVS0TY4GYRH02ZB53:0"
] |
[] |
[] |
[
"Julia Cameron"
] | null |
[
"IMDb"
] | null |
Julia Cameron. Writer: God's Will. Julia Cameron is known for God's Will (1989), Miami Vice (1984) and American Boy: A Profile of - Steven Prince (1978). She was previously married to Martin Scorsese.
|
en
|
IMDb
|
https://www.imdb.com/name/nm0131639/
|
Her bestseller "The Artist's Way - A Course in Discovering and Recovering Your Creative Self" was released in 1992 (Pan Books, London - ISBN: 0330-34358-0)
|
|||||
692
|
dbpedia
|
1
| 81 |
https://www.saintgregorys.org/saints-by-name.html
|
en
|
Saints by Name
|
[
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/6294018.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/abraham-heschel-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/aelred-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/agnes-sanford-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/alexandrian-washerwoman-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/rublev-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/anne-frank-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/anne-hutchinson-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/bacchus-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/barnabas-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/bartolome-de-las-casas-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/black-elk-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/caspar-david-friedrich-head_2.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/cesar-chavez-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/charles-darwin-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/charles-wesley-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/chiune-sugihara-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/christine-de-pisan-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/dante-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/desmond-tutu-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/donaldina-cameron-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/dorothly-lincoln-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/eleanor-roosevelt-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/ella-fitzgerald-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/emily-dickinson-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/esther-john-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/florence-nightingale-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/francis-of-assisi-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/dostoievski-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/gandhi-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/gregory-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/hypatia-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/iqbal-masih-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/isaiah-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/janani-luwum-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/jenny-read-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/john-coltrane-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/john-mason-neale-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/john-muir-head_2.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/john-xxiii-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/julia-morgan-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/julian-of-norwich-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/kangxi-emperor-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/king-david-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/lady-godiva-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/li-tim-oi-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/liliuokalani-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/lucian-tapiedi-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/lucy-wright-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/mm-thomas-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/malcolm-x-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/manche-masemola-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/margaret-mead-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/marguerite-de-porete-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/maria-skobtsova-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/martha-graham-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/martin-luther-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/mary-magdalene-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/mirabai-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/miriam-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/morihei-ueshiba-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/moses-the-black-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/nellie-lincoln-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/norman-perrin-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/origen-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/patrick-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/paul-erdos-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/paul-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/paulos-mar-gregorios-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/queen-elizabeth-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/roland-allen-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/rumi-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/sadi-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/samuel-schereschewski-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/seraphim-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/sergius-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/simone-weil-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/sojourner-truth-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/sorghoqtani-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/su-shi-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/symeon-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/teresa-of-avila-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/macrina-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/thomas-aquinas-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/thomas-merton-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/thurgood-marhsall-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/w-edwards-deming-head_2.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/wang-zhimin-head_2.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/william-blake-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/william-byrd-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/shakespeare-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/bear-head_2.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/horse-head_2.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/tiger-head_2.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/wolf-head_1.jpg",
"https://www.saintgregorys.org/uploads/2/4/2/6/24265184/editor/webpage-cross.jpg?1594221217"
] |
[] |
[] |
[
""
] | null |
[] | null |
Abraham Joshua Heschel (1907–1972) Polish-born, German-educated theologian and philosopher. Deported by the Nazis in 1938, he made his way to the Jewish Theological Seminary in New York, where he...
|
en
|
St. Gregory of Nyssa
|
https://www.saintgregorys.org/saints-by-name.html
|
Abraham Joshua Heschel (1907–1972) Polish-born, German-educated theologian and philosopher. Deported by the Nazis in 1938, he made his way to the Jewish Theological Seminary in New York, where he taught until his death. He worked to revive mystical, prophetic, and active dimensions of Jewish piety and practice, stressing experience and personal response in spirituality. He was a leader in American civil rights and anti–Vietnam War activism. (December 23)
Aelred of Rievaulx (c.1110–1167) English Cistercian monk and abbot of the monastery of Rievaulx, who regarded deep human friendship as an essential element of spiritual life and closeness to God. (January 12)
Agnes Sanford (1897–1982) American Episcopal laywoman who restored the practice of healing prayer to mainline churches. (February 21)
Alexandrian Washerwoman (4th century) To the desert fathers and mothers, the founders of monasticism in the 4th and 5th centuries, an anonymous ordinary woman praying ceaselessly at her work represents the holiness of all that is ordinary and routine. (July 29)
Andrei Rublev (c. 1365–c.1430) Russian Orthodox monk and icon painter. He worked as an assistant and disciple to Theophanes the Greek, and eventually painted images for prayer that synthesized Theophanes’ work with purified Russian folk traditions, creating an iconography that was intimate and human.
Anne Frank (1929–1945) Young German Jewish girl whose extraordinary diary, written while in hiding from the Nazis, expressed an unshakable faith in the fundamental goodness of humanity, her unapologetic fears and frustrations with the people she lived with in confinement, her longings and desires, and her great hope for a future she knew she might not ever see. (June 12)
Anne Hutchinson (1561–1643) English Puritan poet, teacher, and theologian who was banished from Massachusetts Bay Colony for teaching that God could be known through intuition and experience. After this, she and her husband joined Roger Williams in Rhode Island, helping found there a community more open to freedom of conscience.
Bacchus and Sergius (4th century) Roman soldiers who were martyred for their Christian faith. The ancient veneration of these two men offers gay Christians, and those who love and support them, a ray of hope by showing how the Church openly honored two people of the same gender in a loving relationship. In their relationship as Sergius and Bacchus found courage for the choice they were called to make as witnesses to their faith. (October 7)
Barnabas (1st century) A Levite Jew, a man of learning and generosity and one of the first post-resurrection apostles, deeply respected by the disciples. His trust in the authenticity of Paul’s conversion led to their acceptance of this former persecutor. He was the first apostle to embrace the evidence of God’s grace in the hearts of Gentile converts to the Way. (June 11)
Bartolomé de las Casas (1474–1566) A young Spanish adventurer who accompanied Columbus on his second voyage, he received large New World land holdings and native slaves. He was so moved by their suffering that he became a priest, freed his slaves, and finally came to a moral rejection of slavery in any form. As a Dominican monk and eventually a bishop, he argued against slavery before theologians, politicians, and King Phillip II of Spain. Las Casas was the first Christian theologian to argue that enslaving fellow humans was sin, always and under any circumstances. (July 17)
Black Elk (1872–1957) A holy man of the Oglala Sioux, visionary, mystic, and Catholic convert. He showed forth through his life and teaching God’s radiant and powerfully healing presence in all of nature.
Caspar David Friedrich (1774–1840) German Romantic painter whose awesome landscapes and seascapes express the profound mystical presence of God in the dark side of existence. (May 7)
Cesar Chavez (1927–1993) The son of Mexican migrants to California, he devoted his life to organizing farm workers. His movement gave migrant workers bargaining power, restoring dignity to this poor and dispossessed population. A man of religious faith and commitment to nonviolence, he embodied his “deepest belief that only by giving life do we find life, that the truest act of courage . . . is to sacrifice ourselves for others in a totally nonviolent struggle for justice.” (April 23)
Charles Darwin (1809–1882) English naturalist whose On the Origin of Species by Means of Natural Selection (1859) and The Descent of Man, and Selection in Relation to Sex (1871) offered an evolutionary understanding of the development of life on earth, challenging conventional interpretations of creation and inviting whole new ways of thinking of living beings, humanity, and God through process, system, and change. Darwin was a deacon in the Church of England. (April 19)
Charles Wesley (1757–1834) Anglican priest, hymn writer, and, with his brother, John, founder of the Methodist movement in the Church of England. Their innovative mission to the working poor offended Church authorities in England’s rigid class structure by teaching the royal and priestly dignity of the least Christian, through an emphasis on feeling and experience. (March 3)
Chiune Sugihara (1900–1986) Japanese diplomat in Lithuania during World War II who defied government policy and issued as many visas as he could to save thousands of Jews fleeing annihilation by the Nazis. (July 31)
Christine de Pisan (1365–1431) French writer and single mother whose witty theological polemic tweaking clergy attitudes towards women was the first writing of its kind available to a wide audience.
Dante Alighieri (1265–1321) Florentine poet whose towering three-part work, The Divine Comedy, takes us on his soul’s journey. He begins wandering blind and in despair in Il Inferno and concludes in Paradiso with an extraordinary vision of the dancing saints encircling “the love which moves the sun and other stars.” (September 13)
Desmond Mpilo Tutu (b. 1931) Tutu was the first African to serve as Bishop of Lesotho, Bishop of Johannesburg, and Archbishop of Cape Town. Awarded the Nobel Peace Prize in 1984 for his staunch resistance to apartheid, he later headed South Africa’s Truth and Reconciliation Commission, as always counseling forgiveness rather than revenge for past injustice. The only saint still living when his likeness was placed on St. Gregory’s walls.
Donaldina Cameron (1869–1968) Founder of Cameron House in San Francisco’s Chinatown, this Scottish Presbyterian social worker defied Chinese gangs and crime lords, corrupt police, and complacent politicians to rescue girls kidnapped from China to San Francisco for sale as prostitutes and slaves.
Eleanor Roosevelt (1884–1962) A woman of privilege who as First Lady chose to draw near to suffering, seeing and listening to people’s experience of being poor or dispossessed to enlarge her compassion. She used her access to political power as a means to offer them dignity and relief. (November 7)
Ella Fitzgerald (1927-1996) American chanteuse who overcame a tortured childhood, including desperate poverty and time as a prostitute, to become a singer of enormous grace and joy.
Emily Dickinson (1830–1886) American lyric poet whose spare, distilled forms, jazz-like rhythms, and fiercely personal voice vastly influenced modern poetry. Raised in an intellectual Puritan family at a time when Transcendentalism was becoming a force, she explicitly abjured a declaration of faith while in college and ceased churchgoing as she withdrew from public life. But much of her work revolved around her passionate struggle with God, putting her in the company of earlier masters like John Donne and George Herbert.
Esther John (Qamar Zia) (1929–1960) Teacher and missionary to Indian women, she was converted to Christianity by reading the 53rd chapter of Isaiah. She kept her faith secret but eventually ran away from home, afraid her family would force her to marry a Muslim husband, going north to the Punjab, where she worked in a mission hospital. She became a teacher and evangelized in the local villages, teaching women to read and working with them in the cotton fields. She was found murdered in her bed. (February 2)
Florence Nightingale (1820–1910) Unitarian, sometime Anglican, accused of “eclectic religious beliefs.” The leading figure in the development of modern nursing practice through her pioneering work in the Crimean War, she recruited and trained women to serve in places of disease and violence where Victorian sensibilities taught that “gentle ladies ought not to go.” Among her recruits were Anglican nursing sisters from the Sisters of Saint Margaret. (August 13)
Francis of Assisi (1182–1226) Italian mystic and church reformer who sang God’s work in all of nature—sun, moon, plants, animals, life, and death— and in the passion of Christ. His vernacular hymns, popular processions, and the first Christmas crèche were among his sensual and intuitive church reforms that appealed to people’s imagination, hope, and delight. Following one story of his peacemaking with animals, Francis is painted with a wolf. (October 4)
Fyodor Dostoievski (1821–1881) Russian novelist and mystic who came to faith while imprisoned for youthful revolutionary writings. His grandiose and addictive nature was slowly transformed and healed by his vision of Christ and the love of his second wife. He wrote prophetically of the bloodshed that principled “lovers of humanity” would wreak on the world by rejecting God and God’s love expressed through people. His vision of fundamental goodness in ordinary people made him hope for universal salvation. (January 28)
Gandhi (1869–1948) Martyred Indian spiritual leader; activist for peace and reconciliation between Muslims and Hindus. Inspired by Jesus’ Sermon on the Mount, this Hindu teacher of peace took on the British Empire to free India by means of a nonviolent moral conflict. He became one of the principal models for the Rev. Martin Luther King Jr., whose own practical applications of Jesus’ teaching offered black and white America hope and promise for nonviolent social change. (January 30)
Gregory of Nyssa (331–396) Cappadocian bishop and theologian, our patron.(March 9)
Hypatia (370–415) Pagan mathematician and philosopher who drew pupils from throughout the Greek world, Christian and pagan. Cyril, Archbishop of Alexandria, perceived her as a threat to the Church, and she was martyred at the hands of Christian monks. As Christian humanists, we honor Hypatia’s learning and courage, holding her as a witness to intellectual curiosity and honest inquiry, which are closer to God than the angry certainties of fundamentalism.
Iqbal Masih (1982–1995) This spirited and heroic Pakistani Christian boy was sent to work weaving rugs at age five. When he was 10 he escaped from the rug merchants to whom he had been bonded, enrolled in school, and began speaking publicly to other bonded children, inspiring thousands to leave their owners. Just months after he testified before the U. N. Commission on Human Rights at age 13, assassins, murdered him in Pakistan as he left church on Easter Day. (Easter Day)
Isaiah (8th century B.C.) Hebrew prophet of the Exile whose vision of the majesty, holiness, and glory of God took possession of his spirit.
Janani Luwum (1922–1976) Brave and energetic Ugandan cleric who served as Archbishop of Uganda, Rwanda, Burundi, and Boga-Zaire during the brutal regime of Idi Amin. He pressed ahead with reforms in his church in time to mark the centenary of the creation of this Anglican province, and in February 1976 delivered a protest to Amin against all acts of violence committed by state security. He was murdered by Amin’s forces shortly after.
Jenny Read (1945–1976) Artistically gifted, intellectually and spiritually inquisitive young Episcopal sculptor in San Francisco who was raped and murdered while at work on a sculpture of St. John of the Cross. (May 18)
John Coltrane (1926–1967) African-American saxophone player, composer, eminent jazz innovator. Coltrane’s faith in God was a powerful healing force in overcoming his addiction to heroin. His seminal album, A Love Supreme, testifies to God’s omnipotence and power to remake us. He dedicates his music to God, saying. “Let us sing all songs to God.” (July 17)
John Mason Neale (1818–1866) Anglican priest who founded the Sisters of Saint Margaret for medical nursing work among England’s rural poor. He insisted on professional training for the nurses and fostered the autonomous leadership of women in their community. Forging strong ecumenical ties with Eastern Orthodoxy, he brought a daring, renewed feeling of beauty and tenderness to Anglican liturgy, hymnody, and architecture. (August 6)
John Muir (1838–1914) Writer, hiker, lover of California wilderness, and father of the modern environmental movement. In spite of an abusive religious upbringing, he remained a deeply spiritual man and an eloquent spokesperson for our sacred responsibility to care for the earth. He said, “In wildness is the preservation of the world.” (December 24)
John XXIII (1881–1963) The pope responsible for the Second Vatican Council thus “opening the windows” to let fresh air into the Catholic Church. (June 3)
Julia Morgan (1872–1957) Pioneering architect, her concept of sacred space influenced the design of many buildings, including St. Gregory’s Church. She aggressively sought contracts, sometimes offering her services gratis, to build beautiful public spaces. (January 20)
Julian of Norwich (1342–c.1417) English mystic, anchoress, and spiritual director, author of Revelations of Divine Love, the first work written in modern English. Though she lived amidst the horrors of the Black Death and of church torture and burning of heretics, Julian’s startlingly realistic visions of Jesus’ sufferings on the cross and her loving conversations with him moved her to believe the words she heard him say: “All manner of things shall be well and that despite any imaginable sin, suffering or evil.” (May 8)
The Kangxi Emperor (reigned 1661–1722) Though not himself a Christian, he decreed tolerance for Christian faith and preaching, built churches, and wrote moving poetry on the passion of Christ. We honor his generosity of spirit and pray that we will extend the same appreciation, understanding, and good will towards those of other faiths and of no faith.
King David (1010?–970? B.C.) Guerrilla warrior, despotic king, murderer of Uriah, writer of psalms. Among his sons were Solomon, who gathered scholars to create the first systematic collection of the sacred texts that would become the Bible, and Absalom, who would die leading a revolt against David. We honor this complex and contradictory character for the simple, clear devotion of his Psalm 23 and his shameless joy in dancing naked before the Ark of God.
Lady Godiva (c.1040–1080) Godiva’s legend has her riding horseback naked through the streets of Coventry to protest the local lord’s (her own husband’s) new taxes that would strip the poor of everything, even the clothes off their back. Her protest says to us, “You have done this and it is your shame; I am not ashamed myself, for this woman’s body was created by God.”
Li Tim Oi (1907–1992) Hong Kong Chinese, the first woman priest in the Anglican Communion. Ordained as the British fled Hong Kong in World War II, she served faithfully during the Japanese occupation. After the war Canterbury denied her priesthood, but she slipped back into China and ministered to a whole generation hidden from the West. Later she emigrated to Canada and was welcomed for her pioneering service. We remember her for setting faithfulness above controversy or personal importance. She was ready to embrace whatever God asked of her. (May 5)
Liliuokalani of Hawaii (1838–1917) A devout Anglican and pacifist, she reigned as the last queen of Hawaii from 1891–1893. Unwilling to permit Hawaiian blood to be shed in defense of the monarchy, she was deposed by colonists, held under house arrest in her own palace, and convicted of treason. While confined, she had only the Bible and the Anglican Prayer Book to read, both of which influenced the great body of music she composed. (September 2)
Lucian Tapiedi (1921 or ’22–1942) During the Japanese invasion of the island Tapiedi -a teacher in the mission school remained with his people, as did many of the other missionaries. Ironically, he was not killed by the Japanese; instead, he died at the hands of a fellow Papuan, a member of the Orokaiva tribe named Hivijapa. Hivijapa later converted to Christianity and took the name Hivijapa Jucian in memory of his victim.
Lucy Wright (1760–1821) Successor to Mother Ann (founder of the Shakers), she is credited with developing choreographed sacred dance and the use of hymns and anthems in Shaker worship. (February 7)
M. M. Thomas (1916–1997) A layman from the Mar Thoma Church, Kerala, Madhathilparampil Mammen Thomas was a pioneering ecumenical leader, one time chair of the Central Committee of the World Council of Churches, and director of the Institute for the Study of Religion and Society in Bangalore. He died traveling third class on a train from Madras.
Malcolm X (1925–1965) Born Malcolm Little, also known as El-Hajj Malik El-Shabazz. While in prison for burglary, he joined the black separatist Nation of Islam. His radical vitriolic eloquence led Islamic leader Elijah Mohammed to suspend him. Malcolm went on pilgrimage to Mecca, where he was converted by a vision of one humanity worshipping one God in peace. He repudiated racism in any form and returned to the U.S. to work for justice for African Americans and for peace between the races. (February 21)
Manche Masemola (1910–1928) At age 18, Manche joined a class to prepare for baptism in her native Sekhukhuneland (Africa). Her parents opposed her becoming a Christian; every time she returned from class she was beaten. Finding that nothing could shake her faith, her family dragged her out of their hut and by turns flogged her until she died. As she had predicted to her priest, she was baptized “with her own blood.” We honor her single-minded desire to know God.
Margaret Mead (1901–1978) Anthropologist, deeply engaged observer of cultures best known for her seminal work on adolescent development in Samoa. As an authority on rites of passage she helped draft parts of the 1979 Book of Common Prayer dealing with baptism and confirmation, and argued to preserve old stories used in the Easter Vigil for their power in creating living ritual.
Marguerite de Porete (?–1310) French mystic and author of Mirror of a Simple Soul. When accused of the heresy of a “Free Spirit,” she remained contemptuously silent before the Inquisition and was burned at the stake in Paris. (June 1)
Maria Skobtsova (1891–1945) A divorced woman and Russian intellectual who became a nun, worked with the poor in France, and was martyred by the Nazis for hiding Jews. Known for being outspoken, pragmatic, and daringly funny. Metropolitan Antony Bloom noted that as a young priest “it offended me then that she liked to sit in Paris bistros in her nun’s habit, smoking cigarettes, drinking beer and talking with simple workers. I am ashamed to say I kept my distance from that woman because she was doing just what Christ did.”
Martha Graham (1894–1991) Modern dance celebrates the human body as it is and the music and poetry of natural movement. Martha Graham made enormous contributions to this work and spoke about it in terms that are recognizably mystical. As a dancer, she refuted the idea that the joy of dancing must be restricted to the young by continuing to choreograph and perform liberating, finely nuanced, and significant work well into her eighties.
Martin Luther (1483–1546) Luther remained a theologian and spiritual teacher who valued experience and feelings as a way of knowing God. Luther’s writings show a man wonderfully unguarded in prayer and “battle with the Devil.” Rejecting a literalism that limited God, Luther taught that Jesus’ “ascension” meant that he was now personally present and available in every place, moment, or situation. (February 18)
Mary Magdalene (1st century) “The apostle to the Apostles.” When the other disciples fled, she stayed with Jesus through his crucifixion, and was the first he appeared to after his resurrection and the one he sent to proclaim it. She is unusual among biblical women in that she is never identified by her relationship to a male figure (“Mary the wife of” or “Mary the mother of”) but only as “Mary of Magdala.” We remember her as a person and disciple in her own right. (July 22)
Mirabai (1498-1546) Medieval bhakti poet of northern India. After refusing to cast her body on her husband’s funeral pyre, she took up a wandering life. Her poems poignantly convey the sublimity of mystical union with the divine and longing despair at its loss—a longing so powerful it itself becomes the sign of the Beloved’s presence.
Miriam (14th–12th? century B.C.) Older sister of Moses, thought to be the actual voice behind one of the oldest poems in the Hebrew Scriptures, the Song of Moses, celebrating the previously unimaginable event of God taking the side of the forgotten, dispossessed slaves and leading them to freedom. In Exodus, Miriam leads the women of Israel in a dance of thanksgiving for the freedom God has given them.
Morihei Ueshiba (1883–1969) Ueshiba understood budo (martial practice) to be for the reconciliation and protection all things. He founded Aikido, “the way of reconciliation,” which resolves conflict by harmlessly disarming an attacker and avoiding injury even to the “enemy.” He said, “To injure an opponent is to injure yourself.” (April 26)
Moses the Black (330–405) Ethiopian thief and gang leader who underwent a conversion and become one of the most revered of the Desert Fathers, founders of monasticism. (August 28)
Nellie and Dorothy Lincoln Nellie and her husband, Rev. James O. Lincoln, founded a camp for children with chronic and life-threatening conditions as a memorial to their daughter, Dorothy, who died in childhood. Named for her, St. Dorothy’s Rest in northern California also hosts retreats and conferences for churches, nonprofits, and annual camps for seriously ill children.
Norman Perrin (1920–1976) American Gospel scholar who developed new principles for recovering the probable original teaching of Jesus in the parables. He argued that Jesus’ central, daring witness was the sacred meal he kept with “unprepared sinners,” the sign we imitate at St. Gregory’s by welcoming everyone to share in Eucharist.
Origen (185–254) Alexandrian theologian and teacher whose homilies deeply influenced Gregory of Nyssa. Origen established the norm of scripture commentary for Christian theology. Probably the first Christian to learn Hebrew in order to read the Old Testament in its original language
Patrick of Ireland (389–461) In a time of cultural collapse and violence, Patrick’s missionary work to the Irish was humanist, peacemaking, and expansive. With his missionary co-workers, he created a Celtic Christianity that embraced ancient reverence for nature while suppressing old practices like human sacrifice to the nature gods, and that used the bardic traveler’s spirit of old Celtic spirituality to tame the roaming warrior hero tradition. (March 17)
Paul Erdős (1913–1996) Erdos lived as an itinerant mathematical angel, traveling constantly, unexpectedly showing up on other mathematicians’ doorsteps when they found themselves stuck while developing exciting new theories. Erdos would stay long enough to help find a way through the difficulty, then move on to the next person who needed a hand. He lived very simply, depending on friends to tend his needs.
Paul of Tarsus (1st century) Author of nearly half the New Testament. Paul, though personally a strict moralist and attracted to simple answers and clear, comprehensive order, struggled in his writings to include his startling vision of God’s unreserved embrace of all humanity in Christ. He said: “God was in Christ, reconciling the world to himself, not counting people’s sins or faults against them, and God entrusted to us the news that people are reconciled.” (January 25)
Paulos Mar Gregorios (1922–1996) Born Paul Verghese in Kerala, India. Visionary theologian, Orthodox bishop of New Delhi and North India, and biographer of his namesake, Gregory of Nyssa, he brought the wisdom of his heritage to the ecumenical movement and his work for political and social change worldwide. He was among the most creative and influential leaders of the World Council of Churches during its early development. He wrote, “When we work for the unity of humanity we stand on our own convictions and traditions, while sharing a great vision of God at the center of all.”
Queen Elizabeth I (1533–1603) Queen of England. When much of Europe was torn by heresy trials and religious war, Elizabeth conceived a Church in which people of diverse beliefs, opinions, and doctrines could be one through shared prayer and Eucharist. She used her power to forge religious peace on this new principle. (March 23)
Roland Allen (1868–1947) Anglican missionary in East Africa, he became a controversial critic of the existing order, seeking to change drastically the paternalistic colonial system of mission governance. He wanted to restore the pattern he saw in Paul’s missionary work: preaching the Good News, quickly raising up local leadership, trusting them with power, and moving on.
Jalal ad-Din Rumi (1207–1273) Mystical Persian Sufi poet appreciated by Christians, Jews, Muslims, and unbelievers in his day and ours for his striking expression of the presence of God in ecstasy and the everyday. As a teacher, he invited others into mystical union with God through poetry and dancing. He created the whirling, meditative dance of the Sufis. (December 17)
Sadi (1184-1291) Medieval Persian poet whose Gulistan (The Rose Garden) and Bustan (Orchard) are classics of Sufi mystical literature. His work includes the parable of the injured fox fed by the tiger, and he is depicted with a tiger.
Samuel Joseph Isaac Schereschewski (1831–1906) Schereschewski was sent to China to become bishop of Shanghai, but on landing he immediately fell ill with a fever that left him paralyzed. Unable to carry out his original mission, Bishop Schereschewski spent the rest of his life translating the Bible into Chinese. We honor him for his perseverance in the face of tragedy and limitation.
Seraphim (1759–1833) Russian Orthodox mystic of joy, whose love for all of God’s creatures led him to share his fasting rations with a bear (with whom he is shown), saying, “The poor bear can’t know it is Lent.” (January 2)
Sergius and Bacchus (4th century) Roman soldiers who were martyred for their Christian faith. The ancient veneration of these two men offers gay Christians a ray of hope by showing how the Church openly honored two people of the same gender in a loving relationship. In their relationship as Sergius and Bacchus found courage for the choice they were called to make as witnesses to their faith. (October 7)
Simone Weil (1909–1943) French Jewish woman classicist and philosopher. Rapturously in love with Jesus Christ, she refused to seek baptism in order to remain identified with a world seeking redemption. (August 24)
Sojourner Truth (1795–1883) An illiterate freed slave, she was an eloquent critic of slavery and sexism, transfixing audiences with the force and simplicity of her message of Christian love and tolerance. Her famous “Ain’t I a woman?” speech, delivered to a women’s rights convention in 1851, forever disrupted assumptions about race, class, and gender in American society.
Sorghoqtani (? –1250?) Mother of Kublai Khan, as well as of another khan of China and one of Persia; she kept a Christian household and had her sons educated by priests. Though none of her sons professed Christianity officially, they were friendly to Christians. Her Syrian Orthodox contemporary, Gregory Bar-Hebraya in far western Mesopotamia, treasured her memory, saying, “She was a Christian, sincere and true.”
Su Shi (10th century) Poet, painter, and Chinese government official. A follower of Zen and Pure Land Buddhism, he emphasized doing good works, even during his times of exile. His beneficent government policies influenced the creation of FDR’s New Deal.
Symeon (949–1022) Greek Orthodox monk, mystic, and poet of the Holy Spirit. He heard confessions and gave absolution as a layman. He often walked naked, “unashamed of the body Christ redeemed.” (March 12)
Teresa of Avila (1515–1582) Spanish mystic who defied the Inquisition by welcoming Jewish converts into her Carmelite community. She taught that we develop our friendship with God in the friendships of community life. In her friendship with John of the Cross she was mentor, goad, critic, spiritual director (informally) and spiritual directee (formally). They helped one another carry on challenging visionary work despite hostile scrutiny from their own communities and the Inquisition. (October 15)
Theosebia (4th century) Wife of Gregory of Nyssa. Monastic historians tried to eradicate the memory of Theosebia, but Gregory was one of the last married bishops before new church laws required that bishops be celibate monks. When Gregory wrote of the love, physical longing, and communion of bride and bridegroom, or explained that in mystical union with Christ, the “mother-in-law” of each of our souls is God, he was writing from his experience of married love.
Thomas Aquinas (1225–1274) Aquinas was convinced of the goodness of all creation and its participation in the goodness of God’s own self. His work embodies what one historian has called the essential principle of Western civilization, that “truth unfolds in time through a communal process.” Called “the angelic doctor” for his brilliant synthesis of faith and reason, he is among the teachers of the whole church whom Dante saw dancing before God in his final vision in Il Paradiso. (January 28)
Thomas Merton (1915–1968) American Trappist monk who initiated interreligious prayer and dialogue, and whose writings have brought thousands to the practice of contemplative prayer. (December 10)
Thurgood Marshall (1908–1993) American civil rights lawyer and Supreme Court justice. A distinguished jurist whose passions for fairness and justice were shaped by his personal knowledge and experience of prejudice and poverty. Knowing how much new opportunity for the dispossessed and marginalized could serve the good of all, he advocated interpreting the law to realize more perfectly the Constitution’s vision of truly equal justice for all.
W. Edwards Deming (1900–1993) American statistician who believed profoundly in people’s ability to transform themselves and the organizations in which they work and live. His Quality Movement was first applied in war-ravaged Japan. After he had spent many years as a prophet without honor in his own country, the American business and industrial community finally embraced his work.
Wang Zhiming (193?-1973) Martyr of the church in China. Educated in mission schools and ordained in 1951, Wang served as pastor to the Christians of Wuding County in Yunnan, his home. During the Cultural Revolution he opposed the atheistic persecutions by the Red Guards; he was arrested in 1969 and executed at a mass rally in 1973. He is remembered reverently in Wuding, where today there are some 30,000 Christians and more than 100 places of worship.
William Blake (1757–1827) A working-class artisan who labored as an engraver, isolated from mainstream culture, Blake has proved one of our supreme humanists and most imaginative artists, both in paint and print. He cried out at the human cost of England’s industrial revolution, came to adore Jesus with his whole being, and strove toward union with God through his life and creative work.
William Byrd (1543–1623) Composer of music for the Roman Catholic Church and for the early Anglican Church. He created a deeply moving tradition of Anglican choral music that continues to inspire composers of religious music at St. Gregory’s and elsewhere. (July 4)
William Shakespeare (1564–1616) Profoundly spiritual Elizabethan playwright and poet. We celebrate him particularly for his understanding of the work of grace and the dynamics of redemption. (April 23)
The Four Animals Frances, Godiva, Sadi and Seraphim are portrayed with animals, reminding us that God’s work of creation extends to all creatures, and that some have known God in companionship with animals or through imaginative and compassionate reflection on the stories of animals.
|
|||||
692
|
dbpedia
|
3
| 61 |
https://www.encyclopedia.com/arts/educational-magazines/cameron-julia
|
en
|
Encyclopedia.com
|
[
"https://www.encyclopedia.com/themes/custom/trustme/images/header-logo.jpg"
] |
[] |
[] |
[
"CAMERON",
"JuliaPERSONAL: Married Martin Scorcese (a film director; marriage ended); children: Domenica.ADDRESSES: Home—Taos",
"NM. Agent—c/o Author Mail",
"Penguin Putnam",
"375 Hudson St.",
"New York",
"NY 10014.CAREER: Poet",
"playwright",
"songwriter",
"novelist",
"educator",
"and author of nonfiction. Director of film God's Will. Journalist; former special correspondent for Chicago Tribune. Teacher of creativity and writing workshops."
] | null |
[] | null |
CAMERON, JuliaPERSONAL: Married Martin Scorcese (a film director; marriage ended); children: Domenica.ADDRESSES: Home—Taos, NM. Agent—c/o Author Mail, Penguin Putnam, 375 Hudson St., New York, NY 10014.CAREER: Poet, playwright, songwriter, novelist, educator, and author of nonfiction. Director of film God's Will. Journalist; former special correspondent for Chicago Tribune. Teacher of creativity and writing workshops. Source for information on Cameron, Julia: Contemporary Authors dictionary.
|
en
|
/sites/default/files/favicon.ico
|
https://www.encyclopedia.com/arts/educational-magazines/cameron-julia
|
CAMERON, Julia
PERSONAL: Married Martin Scorcese (a film director; marriage ended); children: Domenica.
ADDRESSES: Home—Taos, NM. Agent—c/o Author Mail, Penguin Putnam, 375 Hudson St., New York, NY 10014.
CAREER: Poet, playwright, songwriter, novelist, educator, and author of nonfiction. Director of film God's Will. Journalist; former special correspondent for Chicago Tribune. Teacher of creativity and writing workshops.
AWARDS, HONORS: Maggie Award for Best Editorial Writing, for story in American Film.
WRITINGS:
ADULT NONFICTION
(With Mark Bryan) The Money Drunk: Ninety Days to Financial Sobriety, Contemporary Books (Chicago, IL), 1992.
(With Mark Bryan) The Artist's Way: A Spiritual Path to Higher Creativity, Perigee (Los Angeles, CA), 1992, 10th anniversary edition, Putnam (New York, NY), 2002.
(With Mark Bryan) The Artist's Way Morning Pages Journal: A Companion Volume to "The Artist's Way," Putnam (New York, NY), 1995.
The Vein of Gold: A Journey to Your Creative Heart, Putnam (New York, NY), 1996.
Heart Steps: Prayers and Exercises for a Creative Life, Putnam (New York, NY), 1997.
(With Michael Toms) The Well of Creativity, Hay House (Carlsbad, CA), 1997.
(With Mark Bryan and Catherine Allen) The Artist's Way at Work: Riding the Dragon, Morrow (New York, NY), 1998.
Blessings: Prayers and Declarations for a Heartful Life, Putnam (New York, NY), 1998.
The Right to Write: An Invitation and Initiation into the Writing Life, Putnam (New York, NY), 1998, portions published as The Writer's Life: Insights from "The Right to Write," Putnam (New York, NY), 2001.
The Artist's Date Book: A Companion Volume to "The Artist's Way," illustrated by Elizabeth Cameron Evans, Putnam (New York, NY), 1999.
Transitions: Prayers and Declarations for a Changing Life, Putnam (New York, NY), 1999.
God Is No Laughing Matter: Observations and Objections on the Spiritual Path, Putnam (New York, NY), 2000.
God Is Dog Spelled Backwards, illustrated by Elizabeth Cameron, Putnam (New York, NY), 2000.
Supplies: A Pilot's Guide to Creative Flight, illustrated by Elizabeth Cameron, Putnam (New York, NY), 2000, revised as Supplies: A Troubleshooting Guide for Creative Difficulties, 2003.
Inspirations: Meditations from "The Artist's Way," Putnam (New York, NY), 2001.
Walking in This World: The Practical Art of Creativity, Putnam (New York, NY), 2002.
Prayers from a Nonbeliever: A Story of Faith, Putnam (New York, NY), 2003.
The Sound of Paper: Starting from Scratch, Putnam (New York, NY), 2004.
OTHER
The Dark Room (crime fiction), Carroll & Graf (New York, NY), 1998.
Prayers for the Little Ones (for children), Renaissance Books (Los Angeles, CA), 1999.
Prayers to the Nature Spirits (for children), Renaissance Books (Los Angeles, CA), 1999.
Popcorn: Hollywood Stories (fiction), Really Great Books (Los Angeles, CA), 2000.
Author of the plays Avalon (musical based on the life of King Arthur), Four Roses, Public Lives, and The Animal in the Trees. Author of poetry books This Earth and The Quiet Animal; author of introduction, Your Heart's Desire: Instructions for Creating the Life You Really Want, by Sonia Choquette, Crown, 1997. Contributor to screenplays, including Taxi Driver, New York, New York, and American Boy. Contributor of essays to anthologies, including The Rolling Stone Reader. Contributor to periodicals, including New York Times, Washington Post, Los Angeles Times, Rolling Stone, New York, and American Film. Columnist for Vogue and American Film.
ADAPTATIONS: The Artist's Way was adapted as an audiocassette, recorded by Cameron, Putnam Berkley Audio, 1997.
SIDELIGHTS: Julia Cameron made a name for herself with her 1992 volume The Artist's Way: A Spiritual Path to Higher Creativity, which she coauthored with fellow teacher Mark Bryan. Containing a twelve-week course in "discovering and recovering your creative self," The Artist's Way is a groundbreaking work that spawned everything from what Utne Reader contributor Jon Spayde termed "a healthy-sized market in books that help you claim your own creative power" to workshops and college courses. Reported Greta Beigel in the Los Angeles Times, after taking three years to become a bestseller, The Artist's Way sparked "a social phenomenon as people from varying professional and economic backgrounds … band together to work its precepts as a group activity." Since then Cameron has produced a number of other books that expand on the concepts set forth in The Artist's Way: That the creative process is something everyone possesses, but it remains undeveloped due to negative past experiences, unrealistic expectations, or fear.
Raised near Chicago, Illinois, Cameron started writing at the age of eighteen. She went on to make a name for herself as a journalist, screenwriter for both television and film—she was once the wife of noted film director Martin Scorcese—playwright, and poet. The Artist's Way is the direct result of Cameron's multifaceted career, as well as of the obstacles she encountered and overcame in order to focus her creative energies so productively. In her book she includes inspirational writings and exercises, such as the stream-of consciousness writing she calls "morning pages" and the weekly solo "artist's date" devoted exclusively to a creative whim, to develop her reader's hidden creative abilities and increase self-confidence. Noting that "despite the intensity of her material, Cameron has a light, easy style," Quill & Quire contributor Mark Gerson maintained that The Artist's Way "isn't a life-consuming course—little more than an hour a day should do it—but it is a life-changing one, as any road to creative health is likely to be."
After the success of The Artist's Way, Cameron penned the sequel The Vein of Gold: A Journey to Your Creative Heart. "If The Artist's Way was intended to unblock you so you could write or paint," explained Spayde in Utne Reader, "in The Vein of Gold, writing, painting, and the other arts are used as ways of unblocking the soul." With chapters that focus on spirituality, courage, and patience, The Vein of Gold continues Cameron's program of "morning pages," "artist's dates," inspiring text, and series of related tasks, adding such things as a daily twenty-minute walk, making collages, and writing a narrative autobiography. In a review for Library Journal, contributor Lisa S. Wise called The Vein of Gold a "rich self-help guide to developing spiritual, creative lives," while in Booklist Donna Seaman noted that the book contains "new and even more probing techniques for liberating what [Cameron] … believes is our innate creativity." Although applicable to many of the arts, Cameron's focus remains on the art of creative writing. As she noted in an interview withWritersMarket.com interviewer Anne Bowling: "All of my advice circles back to: write every day, write in whatever form interests you, walk through every door that opens."
Other books emanating from Cameron's teachings in The Artist's Way include The Artist's Way at Work: Riding the Dragon, which contains a twelve-week program to help tap business-related creativity, and Supplies: A Pilot's Guide to Creative Flight, which a Publishers Weekly contributor characterized as "a complete instruction manual for pursuing a creative dream and what to do when it starts to soar." In her 2002 work Walking in This World: The Practical Art of Creativity, Cameron serves up what Booklist contributor Whitney Scott described as a "intermediate-level creative how-to" that continues the author's "mission to illuminate creativity as a spiritual path." While noting that the focus of Walking in This World is "assuredly, unabashedly theistic" in its reference to a Great Creator and the importance of prayer, Rob Kendt noted in his review for Back Stage West that the work is nonetheless as "outward-looking as it is inward-directed" through its discussion of the "outside distractions, threats, and enemies, from 'creative saboteurs' to 'piggybackers'" that drain one's creativity. Although Cameron's "core insights are the same" as in her other books on creativity, according to a Publishers Weekly reviewer "her words seem to have grown wiser."
In addition to her nonfiction work and her continued commitment to helping people develop their innate creative abilities, Cameron has engaged in some wholly creative writing of her own. In addition to penning several books of children's verse and the short-story collection Popcorn: Hollywood Stories, about her experiences in the film industry, she is the author of the 1998 crime novel The Dark Room. In what New York Times Book Review contributor Bill Kent deemed a "wildly incredible tale of cops and psycho killers," Cameron introduces aging detective Elliot Mayo, a cop on the trail of a brutal ritualistic killer—who may in fact be his love interest—through the streets of Chicago. In Publishers Weekly a reviewer noted that The Dark Room "generates moral heat … [and] the guarded yet spiritually adventurous May stands as a compelling lead," while Kent noted in the New York Times Book Review that Cameron's "tough-guy prose often sparkles with wry turns and snappy comebacks." The novel was actually inspired by the life story of one of her friends, who died of AIDS and had asked, before he died, that she use his story creatively. For her part, Cameron told Publishers Weekly contributor Lucinda Dyer, writing The Dark Room allowed her to "step out from behind the persona of being a creative fairy godmother."
BIOGRAPHICAL AND CRITICAL SOURCES:
BOOKS
Cameron, Julia, and Mark Bryan, The Artist's Way: A Spiritual Path to Higher Creativity, Perigee (Los Angeles, CA), 1992, 10th anniversary edition, Putnam (New York, NY), 2002.
PERIODICALS
Back Stage West, September 26, 2002, Rob Kendt, review of Walking in This World: The Practical Art of Creativity, p. 8.
Booklist, October 15, 1996, Donna Seaman, review of The Vein of Gold, p. 380; September 15, 2002, Whitney Scott, review of Walking in This World, p. 181.
Library Journal, November 1, 1996, Lisa S. Wise, review of The Vein of Gold, p. 94; October 15, 1998, Budd Arthur, review of The Dark Room, p. 405; January, 1999, L. Wise, review of The Right to Write, p. 116; May 1, 2003, Graham Christian, review of Prayers from a Nonbeliever, p. 122.
Los Angeles Times, July 23, 1995, Greta Beigel, "The Path to the Person Inside," pp. E1, E4.
New Age Journal, winter, 1993, p. 83; March, 1993, p. 72.
New York Times Book Review, December 13, 1998, Bill Kent, review of The Dark Room, p. 23.
Publishers Weekly, August 19, 1996, review of The Vein of Gold, p. 44; February 3, 1997, review of Your Heart's Desire, p. 87; August 4, 1997, review of Heart Steps, p. 61; April 20, 1998, review of The Artist's Way at Work, p. 52; August 3, 1998, Lucinda Dyer, "Julia Cameron," p. 51; September 14, 1998, review of The Dark Room, p. 45; December 21, 1998, review of The Right to Write, p. 42; August 21, 2000, review of Popcorn, p. 43; September 11, 2000, review of God Is No Laughing Matter, p. 83; September 25, 2000, review of Supplies: A Pilot's Guide to Creative Flight, pp. 106-107; September 23, 2002, Sylvia Boorstein, "Four Authors Who Have Found a Following," p. S18; September 30, 2002, review of Walking in This World, p. 64.
Quill & Quire, July, 1993, Mark Gerson, review of The Artist's Way, p. 51.
Utne Reader, September, 1996, Jon Spayde, "Heartful Art," pp. 91-93.
Whole Earth Review, summer, 1995, Hillary Hoffman, review of The Artist's Way, p. 102.
Whole Life Times, June, 2000, p. 32.
ONLINE
New Dimensions Online,http://www.newdimensions.org/ (January 21, 2003), "Unlocking Your Creativity: An Interview with Julia Cameron."
Penguin Putnam Web site,http://www.penguinputnam.com/ (January 21, 2003).
|
|||||
692
|
dbpedia
|
1
| 78 |
https://m.facebook.com/groups/playwritingsubmissions/permalink/1185713849532835/
|
en
|
Facebook
|
[] |
[] |
[] |
[
""
] | null |
[] | null |
de
|
https://static.xx.fbcdn.net/rsrc.php/yT/r/aGT3gskzWBf.ico
| null | |||||||
692
|
dbpedia
|
2
| 95 |
https://www.vaia.com/en-us/explanations/english-literature/american-literature/virginia-woolf/
|
en
|
Virginia Woolf: Biography, Books & Quotes
|
[
"https://www.vaia.com/app/themes/studypress-core-theme/dist/assets/images/logos/vaia.svg",
"https://website-cdn.studysmarter.de/sites/21/2024/07/subject-other.svg",
"https://website-cdn.studysmarter.de/sites/21/2024/07/book-closed.svg",
"https://website-cdn.studysmarter.de/sites/21/2024/07/flashcard.svg",
"https://website-cdn.studysmarter.de/sites/21/2024/07/ai.svg",
"https://website-cdn.studysmarter.de/sites/21/2024/07/note.svg",
"https://website-cdn.studysmarter.de/sites/21/2024/07/calendar.svg",
"https://website-cdn.studysmarter.de/sites/21/2024/07/folder-plus.svg",
"https://website-cdn.studysmarter.de/sites/21/2024/07/file-question-02.svg",
"https://website-cdn.studysmarter.de/sites/21/2024/07/Flashcards-Image.jpg",
"https://website-cdn.studysmarter.de/sites/21/2024/07/Study-Set-Image.jpg",
"https://website-cdn.studysmarter.de/sites/21/2024/07/Notes-Image.jpg",
"https://website-cdn.studysmarter.de/sites/21/2024/07/Study-Plan-Image.jpg",
"https://website-cdn.studysmarter.de/sites/21/2024/07/book-open-01.svg",
"https://website-cdn.studysmarter.de/sites/21/2024/07/briefcase-01.svg",
"https://website-cdn.studysmarter.de/sites/21/2024/07/phone-01.svg",
"https://website-cdn.studysmarter.de/sites/21/2024/07/Magazine-Image.jpg",
"https://website-cdn.studysmarter.de/sites/21/2024/07/Our-App-Image.jpg",
"https://website-cdn.studysmarter.de/sites/21/2024/07/subject-other.svg",
"https://website-cdn.studysmarter.de/sites/21/2024/07/book-closed.svg",
"https://website-cdn.studysmarter.de/sites/21/2024/07/flashcard.svg",
"https://website-cdn.studysmarter.de/sites/21/2024/07/ai.svg",
"https://website-cdn.studysmarter.de/sites/21/2024/07/note.svg",
"https://website-cdn.studysmarter.de/sites/21/2024/07/calendar.svg",
"https://website-cdn.studysmarter.de/sites/21/2024/07/folder-plus.svg",
"https://website-cdn.studysmarter.de/sites/21/2024/07/file-question-02.svg",
"https://website-cdn.studysmarter.de/sites/21/2024/07/book-open-01.svg",
"https://website-cdn.studysmarter.de/sites/21/2024/07/briefcase-01.svg",
"https://website-cdn.studysmarter.de/sites/21/2024/07/phone-01.svg",
"https://www.vaia.com/app/themes/studypress-core-theme/dist/assets/images/explanations/welcome-laptop.png",
"https://www.vaia.com/app/themes/studypress-core-theme/dist/assets/images/explanations/welcome-mobile.png",
"https://www.vaia.com/app/themes/studypress-core-theme//dist/assets/images/ai-flashcards.svg",
"https://www.vaia.com/app/themes/studypress-core-theme//dist/assets/images/ai-summarize.svg",
"https://www.vaia.com/app/themes/studypress-core-theme//dist/assets/images/ai-flashcards.svg",
"https://s3.eu-central-1.amazonaws.com/studysmarter-mediafiles/media/1865576/summary_images/tree-g5d78fbf57_1280.jpg?X-Amz-Algorithm=AWS4-HMAC-SHA256&X-Amz-Credential=AKIA4OLDUDE42UZHAIET%2F20240825%2Feu-central-1%2Fs3%2Faws4_request&X-Amz-Date=20240825T172741Z&X-Amz-Expires=604800&X-Amz-SignedHeaders=host&X-Amz-Signature=fdf1b1065f35943053bcfae477175211808377d1f52ecebebc3db86c929b6330",
"https://s3.eu-central-1.amazonaws.com/studysmarter-mediafiles/media/1865576/summary_images/old-books-g8a0b7d7f0_1920.jpg?X-Amz-Algorithm=AWS4-HMAC-SHA256&X-Amz-Credential=AKIA4OLDUDE42UZHAIET%2F20240825%2Feu-central-1%2Fs3%2Faws4_request&X-Amz-Date=20240825T172741Z&X-Amz-Expires=604800&X-Amz-SignedHeaders=host&X-Amz-Signature=d6703d961e645032176a5fbfa5424442bbfd02d66c573348be14bdb012da47a5",
"https://s3.eu-central-1.amazonaws.com/studysmarter-mediafiles/media/1865576/summary_images/river-g46954c56a_1280.jpg?X-Amz-Algorithm=AWS4-HMAC-SHA256&X-Amz-Credential=AKIA4OLDUDE42UZHAIET%2F20240825%2Feu-central-1%2Fs3%2Faws4_request&X-Amz-Date=20240825T172741Z&X-Amz-Expires=604800&X-Amz-SignedHeaders=host&X-Amz-Signature=7bc16ff92795e68b2d085b5f5ca709c25be575a8ff5e63661f461ef95e9d012b",
"https://s3.eu-central-1.amazonaws.com/studysmarter-mediafiles/media/1865576/summary_images/lighthouse-ged502f8cf_1920.jpg?X-Amz-Algorithm=AWS4-HMAC-SHA256&X-Amz-Credential=AKIA4OLDUDE42UZHAIET%2F20240825%2Feu-central-1%2Fs3%2Faws4_request&X-Amz-Date=20240825T172741Z&X-Amz-Expires=604800&X-Amz-SignedHeaders=host&X-Amz-Signature=8cc0fb1d904431b17f73442e6b95225706d2461eb7f3fbce2e9c38feb4fe3c72",
"https://www.vaia.com/app/themes/studypress-core-theme/dist/assets/images/explanations/flashcards-listx2.png",
"https://www.vaia.com/app/themes/studypress-core-theme/dist/assets/images/explanations/flashcards-list-mobile.png",
"https://www.vaia.com/app/themes/studypress-core-theme/dist/assets/images/explanations/about.webp",
"https://www.vaia.com/app/themes/studypress-core-theme/dist/assets/images/explanations/about-logo.png",
"https://www.vaia.com/app/themes/studypress-core-theme/dist/assets/images/explanations/sidebar-logo.webp",
"https://www.vaia.com/app/themes/studypress-core-theme/dist/assets/images/tbs/cta-desktop@1x.png",
"https://website-cdn.studysmarter.de/sites/21/2024/03/Vaia_Logo_Single-Colour-1.svg",
"https://website-cdn.studysmarter.de//sites/5/sites/5/2022/08/us-flag.png",
"https://website-cdn.studysmarter.de//sites/5/sites/5/2022/08/en-flag.png",
"https://website-cdn.studysmarter.de//sites/5/sites/5/2022/08/es-flag.png",
"https://website-cdn.studysmarter.de//sites/5/sites/5/2022/08/de-flag.png",
"https://website-cdn.studysmarter.de//sites/5/sites/5/2022/08/fr-flag.png",
"https://website-cdn.studysmarter.de//sites/5/sites/5/2022/08/it-flag.png",
"https://website-cdn.studysmarter.de//sites/5/sites/5/2021/12/LKVIUFzH-0t5upqTu-app-store.svg",
"https://website-cdn.studysmarter.de//sites/5/sites/5/2021/12/hiXi9mY6-jhXhbghR-google-play.svg"
] |
[] |
[] |
[
""
] | null |
[] | null |
Virginia Woolf: ✓ Biography ✓ Books ✓ Quotes ✓ Famous Work ✓ Feminist ✓ Cause of Death ✓ Vaia Original
|
en
|
Vaia
|
https://www.vaia.com/en-us/explanations/english-literature/american-literature/virginia-woolf/
|
Virginia Woolf: Biography
Virginia Woolf, born Adeline Virginia Stephen, is considered one of the most important modernist authors of the 20th-century. Today Woolf is well-known for pioneering the stream of consciousness approach, but in her own time, her narrative approach was unconventional. She embraced nonlinear timelines and a holistic perspective that varied drastically from the Victorian literary norms of the time.
In addition to her fiction, Woolf wrote essays on the politics of power, women's experience, social change, and artistic theory. She was a member of the artistic and intellectual Bloomsbury Group and founded Hogarth Press with her husband. Woolf wrote nine books in her lifetime, as well as essays, a biography, short fiction pieces, a drama, diaries, journals, and letters.
Woolf was born to an affluent English family in 1882. Her mother, Julia Stephen, was famous for being a model for Pre-Raphaelite painters, and her aunt, Julia Margaret Cameron, was one of the most important British portraitists of the 19th century. Julia Stephen later wrote a book, Notes from Sick Rooms, detailing her experience as a nurse, and a collection of children's stories, which she read to her children. Woolf's father Leslie Stephen was an English author, biographer, critic, historian, and mountaineer.
Both Woolf's mother and father had been married and widowed before, so Woolf had four half-siblings. After they married for the second time, Woolf's parents had four children: Vanessa, Thoby, Virginia, and Adrian. Woolf and her seven siblings all lived together under one roof, but the Stephen children were closer to one another than to their older half-siblings.
Although Vanessa acted as a mother figure to Virginia, the two were artistic rivals, Vanessa being a painter and Virginia a writer. In 1891, Vanessa and Thoby started the Hyde Park Gate News, a newspaper detailing the life of the Stephens family, but young Virginia soon became the main contributor and ran the paper until 1895 when their mother died.
The Stephen children enjoyed a mostly happy, upper-middle-class childhood, migrating every year from their London home at 22 Hyde Park Gate to their summer home at Talland House in Cornwall. The children loved their time at Cornwall, as it signified freedom and adventure to them. Woolf and her siblings were educated by her parents in their London home, where they had open access to their father's private library.
Woolf spent much of her free time reading the books in her father's collection. Both of Woolf's parents were traditional in the sense that they condemned formal education for women. However, writing was considered a respectable profession for women, and her father was a writer himself, so he encouraged Woolf's abilities.
Although Virginia and Vanessa were not allowed to continue their education, the Stephen boys went to Cambridge. Thoby introduced his literary and artistic college friends to his sisters, eventually leading to the formation of the Bloomsbury Group.
The easy-going nature of Woolf's life abruptly changed after her mother's death in 1895. Woolf was only 13, but losing her mother caused her to sink into a state of depression, triggering a nervous breakdown. Her mental state only worsened when her half-sister and her father died within 7 years of her mother.
In 1904, Woolf attempted suicide for the first time by jumping out of a window. She survived, Vanessa moved the family out of their childhood home to the Bloomsbury section of London, and Woolf found a way to cope with her depression through writing.
At Bloomsbury, the Stephen siblings hosted weekly gatherings of radical young thinkers. Following Thoby's death and Vanessa's engagement to English art critic Clive Bell, the group was transformed into the Bloomsbury Group, where artists and literary thinkers alike met to discuss their works and ideas.
The intellectuals and creatives at the Bloomsbury Group challenged Woolf to publicly express herself through her writing. In 1908, Woolf began writing anonymous reviews for the Times Literary Supplement and started her first novel, which she called Melymbrosia. When Leonard Woolf, whom Woolf had met at a dinner in 1904, returned from the colonial service that had sent him out East, he proposed to Woolf and the two married in 1912.
In 1913, Woolf completely revised Melymbrosia, changing the title to The Voyage Out. The publication of The Voyage Out was delayed until 1915, after Woolf attempted suicide in September 1913. Following her recovery, Woolf was able to keep her depression mostly at bay for years.
In 1917, Woolf and her husband founded the Hogarth Press, a printing press that they themselves used frequently to publish their own works. Woolf went on the publish Night and Day (1919), Jacob's Room (1922), Mrs. Dalloway (1925), To the Lighthouse (1927), Orlando: A Biography (1928), The Waves (1931), and The Years (1937). Her final novel, Between the Acts, was published posthumously in 1941. She also wrote nonfiction essays on the oppression of women in her society, literary history, social justice, and other topics.
In 1922, Woolf was courted by the aristocratic Vita Sackville-West, and although both were married to men, they began a sexual relationship that peaked between 1925 and 1928. Sackville-West was also a writer and used Hogarth Press to publish her works, which saved the Woolfs' business from bankruptcy.
During their lifetimes, Sackville-West was considered the more famous writer, although now Woolf is more renowned. Woolf based one of her greatest works, Orlando, off of Sackville-West. Sackville-West's son called it, "the most charming love letter in literature," saying,
The effect of Vita on Virginia is all contained in Orlando, the longest and most charming love letter in literature, in which she explores Vita, weaves her in and out of the centuries, tosses her from one sex to the other, plays with her, dresses her in furs, lace and emeralds, teases her, flirts with her, drops a veil of mist around her."¹
Their romantic relationship fizzled out in the 1930s, but the two remained friends until Woolf's death in 1941.
At a time when homosexual relationships were typically viewed as taboo, Woolf and Sackville-West didn't hide their relationship and even with the lesbian connotations, Woolf's Orlando and A Room of One's Own sold very well. What do you make of this? What effect, if any, do you think being surrounded by radical thinkers in the Bloomsbury Group had on Woolf's relationships?
Virginia Woolf: Death
Woolf had struggled with depression since the death of her mother in May of 1895. Just as she was coming out of the depressive episode caused by her mother's death, the successive losses of her half-sister Stella Duckworth in 1897 and her father in 1904 precipitated a nervous breakdown.
Woolf attempted suicide for the first time when she was 22 by jumping out of a window, but fortunately the window wasn't high enough off the ground to do any serious damage. Her sister, Vanessa, took over motherly roles of caring for Woolf and moved the family to London in the bohemian Bloomsbury section.
Depression and what is now thought to be a bipolar disorder plagued Woolf for the majority of her life. From 1910 to 1913 she was hospitalized several times for minor suicide attempts, having to stay intermittently at Burley House, a private institution for women with nervous disorders, on "rest cure therapy."
In September of 1913, Woolf's manic-depressive thoughts that she was unloved by her siblings and husband, as well as a failure, caused her to attempt suicide once more, this time very seriously. She took 100g of barbital, a sedative used for central nervous system depression. She would have died if her stomach hadn't been pumped. It took until August of 1914 for Woolf to be considered fully recovered. She spent much of her life looking for a cure for her mental health issues, and finally started to feel better in the summer of 1914.
In 1940, her mental health deteriorated once again due to several factors. For one, World War II was a constant stress on Woolf's mental state. She struggled to write when writing seemed to insignificant due to the war. As writing was the chief factor in staving off Woolf's depressive episodes, not being able to write due to feeling its futility in the face of WWII was disastrous to her mental health and made her feel like a failure.
Woolf's family's London homes were destroyed during the Blitz that year. Her biography of Roger Fry didn't receive the praise she had anticipated and finishing Between the Acts left her exhausted and weak. On March 28, 1941, Woolf decided to end her life. She filled her pockets with rocks and walked into the River Ouse near her home. Her body was not found until April 18. Her final novel, Between the Acts, was published posthumously later that year.
How does Woolf's treatment of mental health differ from other authors who wrote about similar topics?
Virginia Woolf Quotes
I would venture to guess that Anon, who wrote so many poems without signing them, was often a woman.”
― Virginia Woolf, A Room of One's Own
A Room of One's Own is often viewed as Woolf's feminist critique of female oppression in a patriarchal society by keeping women trapped in subordinate roles. This quote reflects that sentiment well, arguing that women have never gotten the recognition or respect they deserve in their writing. Although Woolf was given an education (albeit informal) and her writing was encouraged, the same could not be said for all women in the early to mid-20th century.
Woolf had an advantage because her father was a writer and actively encouraged her writing. However, other women throughout history were deterred from writing, and even when they did write, they would not publish the work under their own name for fear of not being taken seriously. Women had far fewer opportunities than men, and their work was generally not as well-respected.
Many women either published under a male pseudonym (e.g., Charlotte Brontë under the name Curer Bell) or published anonymously. Woolf herself had some experience with anonymity, as all of her reviews for the Times Literary Supplement had to be anonymous, a tradition that held until 1974. In this quote, Woolf essentially argues that women contribute much more to society and literature than they are given credit for.
Lock up your libraries if you like; but there is no gate, no lock, no bolt that you can set upon the freedom of my mind.”
― Virginia Woolf, A Room of One's Own
Again, Woolf equates education with freedom. With her vibrant literary education at home, her parents taught her to read and write and gave her access to a plethora of books. Woolf used those skills to get through life: she turned to reading to combat her depression, owned a successful printing business with her husband, published novels and essays, and met with other literary geniuses.
Her childhood education allowed Woolf to do all these things as a woman. Instead of being a housewife and a mother, Woolf had the education she needed to thrive in spheres that women were traditionally kept from. Her education gave her the freedom to break free of societal constructs that she found limiting.
In many ways, this sense of freedom links to the principles of modern feminism, in that women have the same capacity and potential for success as men but have been systematically held back from being able to achieve it.
Virginia Woolf - Key takeaways
Virginia Woolf was born in 1882 to an upper-middle-class English family.
Her siblings were deeply influential to her: sister Vanessa was an artist who challenged Virginia creatively; her brother Thoby introduced her to his college friends and founded the Bloomsbury Group; Adrian lived with Virginia after Thoby died; and Vanessa got engaged.
Virginia Woolf's most famous works include Mrs. Dalloway, To the Lighthouse, and Orlando.
Woolf married Leonard Woolf and the two founded Hogarth Press together.
Woolf struggled with depression all her life and eventually killed herself in 1941, after putting rocks in her pockets and walking into the river Ouse.
|
|||||
692
|
dbpedia
|
3
| 37 |
https://www.amazon.com/Artists-Way-Spiritual-Higher-Creativity/dp/1585421472
|
en
|
Amazon.com
|
[
"https://images-na.ssl-images-amazon.com/captcha/dddfleoy/Captcha_cbgrwxkgbl.jpg",
"https://fls-na.amazon.com/1/oc-csi/1/OP/requestId=AQG15FJR056PJBS7D1C9&js=0"
] |
[] |
[] |
[
""
] | null |
[] | null |
en
| null |
Enter the characters you see below
Sorry, we just need to make sure you're not a robot. For best results, please make sure your browser is accepting cookies.
|
|||||||
692
|
dbpedia
|
1
| 79 |
https://www.for-your-eyes-only.com/Site/SpyTV.html
|
en
|
EYES ON BOOKS FOR YOUR EYES ONLY
|
[
"https://www.for-your-eyes-only.com/Site/SpyTV_files/LayeredPaper_01.jpg",
"https://www.for-your-eyes-only.com/Site/SpyTV_files/shapeimage_1.png",
"https://www.for-your-eyes-only.com/Site/SpyTV_files/spy%20tv%20cover.jpg",
"https://www.for-your-eyes-only.com/Site/SpyTV_files/LayeredPaper_04.jpg",
"https://www.for-your-eyes-only.com/Site/SpyTV_files/mwmac_white.png"
] |
[] |
[] |
[
""
] | null |
[] | null | null |
SPY TELEVISION
By Wesley Britton
Praeger Publishers (2004). 260 pages. $39.95
Reviewed by Craig Henderson
Fandom is a small community and we all like to be friends. So Iâve often heeded our mothersâ old maxim: If you canât say something nice, donât say anything at all.
But enough is enough. When someone finally writes and gets published a book that purports to survey the length and breadth of spy shows on television, a subject dear to my heart for lo these four decades now â and the author is not only a professed diehard spy fan but also an English teacher and previously published author, rather than one of the semi-literate fans who write too many movie and television tributes â and still the book is riddled with idiotic mistakes, total failures of basic research and logic, not to mention endless problems with editing, spelling and simple sentence construction â well, thatâs all I can stands, I canât stands no more.
Spy Television is a tragically disappointing mess (and, adding insult to injury, darned expensive at $40 since it was put out by Praeger, a publisher that caters to libraries; the book is not in stores, it can be ordered only from Praeger and Amazon.com).
This book easily could have been what it claims to be, the first in-depth, book-length study of 50 years of television spy shows, naturally with emphasis on the major series seen during the 1960s spy craze. Itâs a subject long overdue for serious examination â and it still is. Too bad that publication of Spy Television probably has befouled the waters for anyone else hoping to cover the same subject the way it should be covered.
The bookâs endless parade of factual errors, most so simple they could easily have been checked and corrected by anyone who knew how, would be laughable if it werenât so infuriating. The inept writing and constant misspellings are unforgivable for an author who is â did I mention this? â an English teacher. A college English teacher.
But that being the case, maybe itâs not surprising that much of the book reads like a mediocre term paper, less an entertaining history and analysis of the shows in question than a string of factoids hammered into paragraphs as if by a procrastinating student suddenly faced with the end of the semester. The occasional well-written passage just makes the rest all the more puzzling and frustrating.
There are two approaches to writing this kind of book. Iâm tempted to say the right way and the wrong way, but letâs call them the journalistic approach and the academic approach.
A journalist does his own primary research into the subject, using every available source of original pertinent information while remaining extremely skeptical of unverifiable secondary sources. Equally as important, a good journalist knows how to do relevant research, where to look and what to look for. He interviews the available participants in the events heâs writing about, and talks to recognized experts whose knowledge can be verified and whose opinions can be trusted.
The academic approach, on the other hand, relies heavily on citing previously published sources at the expense of primary research and interviews. The academic author, therefore, had better be thoroughly versed in his subject and able to determine who makes a reliable source, what material to cite and which questionable âfactsâ and opinions to ignore.
Spy Television author Wesley Britton is â I did mention this â a college English instructor, so you can guess which approach he took. And reading his book makes it painfully clear that his knowledge of televisionâs history and business practices is woefully inadequate, while his familiarity with spy shows in particular is superficial at best. Worst of all, his indiscriminate and unquestioning acceptance of any source of information, coupled with his own meager attempts at research, has resulted in literally hundreds of errors throughout the book.
The book also tries mightily, in that term-paper fashion, to weave everything in its path into a huge tapestry of interrelated influences. To Britton, nearly every show he mentions is âa clear precursor,â as he invariably phrases it, to some other show. But most of these âconnectionsâ are specious at best, and Brittonâs ignorance of the subject at hand prevents him from making real associations.
Writing about the brilliant but largely forgotten 1963 series Espionage, for instance, he could have mentioned that the pilot episode starred Steven Hill, then an up-and-coming stage and screen actor who went on to star in Mission: Impossible three years later. And that the showâs titles were designed by Maurice Binder, acclaimed for his flashy title sequences in the James Bond movies. But Britton doesnât really know anything about the show. So he repeats an unverifiable (and untrue) story from another book about Bond author Ian Fleming appearing on the program, and conjures up another story, equally untrue, about an episode postponed by the assassination of President Kennedy.
Britton also attempts â since he is a college instructor and Praeger is an academic press â to place spy shows in a sociopolitical context, a dubious enterprise with programs that were made as sheer entertainment. Not surprisingly, he offers no real insights of his own and again borrows heavily from the other authors heâs mining for information. The problem is, Britton also lacks the ability to accurately rewrite others. He misrepresents or completely garbles the points that cited authors were making, as well as altering the facts they did get right, adding to the general incoherence and outright errors throughout his book.
This attitude that permeates the entire text â itâs the wrong name, the wrong date, the wrong show, the wrong title, the wrong network, the wrong spelling, but hey, itâs close enough â is more appalling than the errors themselves. But however deplorable, Brittonâs numerous mistakes as well as those of the writers he cited now are bound in hardcovers and sitting in libraries waiting for some future ignorant author to use this book as a source to further spread and compound these errors.
Readers also must wonder what kind of grade Britton would give a student who turned in a paper as poorly written and edited as his book is. Spy Television gets a C-minus from me, and thatâs being generous.
= = =
What follows is a list of the bookâs most blatant errors and screwiest conclusions. I made no special effort to dig these out of the text. Since I have some knowledge of spy shows, television production and the history of broadcasting, it was easy to spot these as I read the book. There may be even more but I donât have time to do the research. If you bought a copy of Spy Television, you canât get your money back now. All we can suggest is you print out this list and keep it as an addendum to the book.
Chapter 1: The Genre
Page 9âDiscussing spy shows that include science-fiction elements, Britton writes, âCredit should go to Hollywood scriptwriter Danny Biederman for coining the term defining these series â âSpy-Fi.ââ But while Biederman has made effective use of the term, dubbing his impressive collection of spy show props âthe Spy-Fi Archivesâ and describing the collection in his book The Incredible World of Spy-Fi, that phrase was introduced by Variety in 1965 as a convenient label for the explosion of gimmicky secret-agent fantasias then appearing in movies and television.
Chapter 2: Roots
Page 19âThe sultry-voiced Hungarian actress is Ilona Massey, not âAlanaâ Massey. The Third Man radio series starred Orson Welles as Harry Lime, just as the movie did. The show did not star Douglas Fairbanks Jr. as âa variety of federal agents.â
Page 20âThe Richard Diamond radio show ran for three years until 1952, not just 1949-50.
Page 21âThere were no television stations that âonly broadcast from dawn until dusk.â The first TV stations were on the air in the late afternoon and early evening when they could reach the largest number of potential viewers. Perhaps Britton confused television stations with the group of AM radio stations that were licensed to broadcast only during daylight hours.
Page 22âForeign Intrigue had five different lead characters during its four-year run; it did not feature five leads simultaneously. The seriesâ first lead character was Robert Cannon, not âBruceâ Cannon.
Page 23âFrederick W. Ziv, not âFrederic W. Ziff,â was the famous father of TV syndication and owner of Ziv Television, the company that produced countless syndicated series in the 50s and early 60s. His name is misspelled throughout the book.
Page 25ââOSS capitalized on the public unveiling of the actual organizationâs files when the OSS was disbanded and its records declassified,â Britton writes in a typically convoluted sentence. OSS was disbanded in 1945 and few if any of its files had actually been declassified by 1957 when the TV series aired. Britton then adds that the show was âpropaganda for reversing attitudes about maintaining intelligence agencies after the war. For a time, there was little support for organizations like the OSS or CIA, as some feared a new American Gestapo might be the result.â Which would have been even worse than the old American Gestapo, I suppose.
Page 26âThe 1959 series Five Fingers was not âloosely based on a 1951 film of the same name.â The movie, released in 1952, was a semi-true story about a valet in a British Embassy who spied for the Germans during World War II; the series concerned the adventures of a contemporary 1959 American agent in the thick of the Cold War. The series used absolutely no characters or situations from the movie, 20th Century-Fox merely used a title it already owned (as it did again in 1966 with The Man Who Never Was). And NBC aired 14 episodes, not 15. Fox produced 16 but the network declined to air the last two after canceling the series.
In the 1960 series Hong Kong, Rod Taylorâs character was simply a reporter, not, as the book claims, a spy posing as a reporter.
Page 27âBritton lumps the 1956 syndicated series I Spy in with childrenâs shows such as Captain Midnight that had stalwart American heroes battling blackhearted enemy spies. This I Spy series was an anthology Britton somewhat accurately describes as âtales of historyâs spies from ancient Rome to World War II.â But then he adds this kicker: âBut in all cases the spies tended to be children who accidentally participated in espionage,â a genuinely wacky statement. I Spy was a typically cheap, cheesy 50s syndicated show that tried to distinguish itself with the historical docudrama angle. It had absolutely nothing to do with underage spies. One farfetched explanation for this gaffe might be the animated kids show also titled I Spy that runs on HBO Family, but that show has nothing to do with espionage and itâs almost impossible to believe anyone could confuse the two.
As all Rocky and Bullwinkle fans know, Bullwinkleâs middle initial is J, not T. The worldâs greatest no-goodnik is Boris Badenov, not âBoris Badenoff.â Sputnik was launched in 1957, not 1958.
Page 28âAgain, because the error is so incredibly irritating in a book about television, itâs Fred Ziv, not âZiff.â And Biff Baker, U.S.A. was not a âZiffâ production, it was made at Revue.
Page 29âEqually irritating, and no less excusable just because itâs recently become a common error among writers who know nothing about other cultures or who canât be bothered to check the spelling of famous names, the veteran actor was Cesar Romero, not âCaesarâ Romero.
Page 30âIan Fleming did recycle his pilot script for âCommander Jamaicaâ into the James Bond novel Dr. No, but the script was written in 1956, not in 1958. Dr. No was published in 1958.
The TV-movie based on Flemingâs idea about international narcotics agents aired under the title âThe Poppy Is Also a Flower.â It did not acquire that title later, as the book claims; it did not air under the title âUN Project,â as the book claims; it did not air in two parts, as the book claims.
Fleming did not meet television producer Norman Felton to discuss a TV series based on his book Thrilling Cities. Felton rejected that idea before he attended the meeting with his agents at which the meeting with Fleming was proposed.
Page 32âObviously Laurie Johnson wrote the theme to The Avengers prior to 1966 since the series began airing in England in 1965.
The Invisible Man series ran in America in the 1958-59 season and in the summer of 1960, not from 1958 through 1961.
Page 33ââDr. Noâ opened in the U.S. in May 1963, not âfour months after the October 1962 Cuban missile crisis.â
Chapter 3: The Man From U.N.C.L.E.
Page 35âOpening the U.N.C.L.E. chapter with a quote from the unbelievably awful âReturn of the Man from U.N.C.L.E.â TV-movie certainly is open to question. Be that as it may, the character quoted was named Justin Sepheran, not âJustin Sefron.â
Norman Felton did not meet with ârepresentatives of Ian Flemingâ in October 1962, not to discuss Thrilling Cities â a book Feltonâs own agents suggested to him and which he quickly rejected â or anything else (on page 30 Britton claimed Felton met with Fleming himself to discuss Thrilling Cities).
Page 36âBritton writes, âFelton had closely watched the films of Alfred Hitchcock, especially âNorth by Northwestâ (1959), which featured ingredients he wanted to use in his project.â In fact, Felton has told interviewers that he had not seen âNorth by Northwestâ when he was developing The Man From U.N.C.L.E. In various sources, he mentions only youthful reading of spy adventures by authors such as John Buchan and E. Phillips Oppenheim as a possible influence.
The fact that Leo G. Carroll played a spy boss in âNorth by Northwestâ certainly had no bearing on the development of U.N.C.L.E. since the head of U.N.C.L.E. was created as an entirely different sort of character and was played by Will Kuluva in the pilot.
The title âSoloâ was not something that Sam Rolfe chose much later by âultimately deciding to simply use Flemingâs character name.â Felton called the proposed series âSoloâ from the beginning.
Page 37âThe long, narrated opening title sequence was used only on episodes two through seven, not âthe first 13 episodesâ as the book claims.
Illya Kuryakinâs middle name was spelled Nickovetch, not âNickovitch.â
Regarding the character Napoleon Solo, Britton writes, âwithout question, he was clearly inspired by the Cary Grant character in North by Northwest.â Aside from the fact that Felton denied any âNorth by Northwestâ influence, the Grant character was an innocent bystander accidentally swept up into a spy plot, one of many such characters in Hitchcock films. Solo was a highly trained, professional agent. If anything, the Grant character could only be an influence on the innocent bystanders swept up into Soloâs adventures every week.
Robert Vaughnâs earlier series The Lieutenant was not âcanceled before the role of Solo became available.â It premiered in September 1963 just two months before the âSoloâ pilot was filmed. Britton seems to be unaware that The Lieutenant was also a Norman Felton series, which is why Vaughn was in a position to be offered the role of Solo.
Page 38âBrittonâs claim that the director of the âSoloâ pilot signed David McCallum for the role of Illya shows how little he understands television production. The director may well have introduced and recommended McCallum to Felton â several people take credit for this â but he could not have signed a series regular. And no one else has ever claimed that Martin Landau already had turned down the part of Illya when McCallum was signed. Illya also had far more than two lines of dialogue in the pilot, which is all Britton credits him with.
Brittonâs description of Waverly as âseedyâ is baffling since the character was in no way seedy. Notes about Waverly sometimes described him as âtweedyâ so this may be just another example of the bookâs careless editing.
The corridors of U.N.C.L.E. headquarters were lined with computers only in the showâs abbreviated fourth season, not during the entire run of the series.
Page 39âThrush is a proper name written thusly. It was never written as an all-caps code name, i.e., THRUSH, as Britton spells it throughout the book â although so many people make this mistake Iâm almost inclined to let it go.
Sam Rolfeâs background notes for the show had Thrush using an Ultimate Computer to devise its evil plots but the machine only appeared in one episode of the series, âThe Ultimate Computer Affair.â It was destroyed in that episode and was never mentioned again. It was not in the episode that Britton doesnât name but in which he claims the Ultimate Computer revealed the presence of 2,000 female Thrush agents on Americaâs Pacific Coast (that was âThe Nowhere Affairâ). And there was never an episode that said Thrush was created by a group of businessmen after World War II, as Britton claims.
David McDanielâs history of Thrush in his novels and his claim that the name was originally an acronym for âTechnological Hierarchy for the Removal of Undesirables and the Subjugation of Humanityâ is strictly his own invention and was never used in the show.
The name Wasp was not substituted for Thrush in the pilot. Thrush was always in the development notes, in the pilot script, and in the pilot as it was filmed and as it was finally edited and aired. Wasp appears only in âTo Trap a Spy,â the feature film that included the pilot footage. And it only appears there because the feature was in post-production in April 1964 at the same time MGMâs lawyers were pressuring Felton and Rolfe to change anything that sounded remotely like a James Bond reference â and the lawyers thought Thrush sounded too much like SMERSH. Ultimately, the only change made to satisfy the studio and the James Bond film producers was changing the series title from Solo to The Man From U.N.C.L.E.
Page 40âBrittonâs list of adversaries who did not work for Thrush includes Dr. Egret and Barnaby Partridge, both Thrush agents. Marion Raven was an âinnocent,â not an adversary.
Mr. Allison, not âAlison,â was the original U.N.C.L.E. chief played by Will Kuluva.
The idea that Felton held back early, more humorous episodes to air late in the season is a myth. The production schedule and weekly airdates simply wouldnât allow it, and production records show the episodes were shot more or less in the order they aired. This longstanding story â which admittedly Felton himself has often repeated â really involved only one episode, âThe Brain-Killer Affair,â shot very early in the production cycle but then judged so bizarre by everyone involved that it did not air until near the end of the season (and then, of course, it became one of the most popular episodes).
Episode title is âThe Never-Never Affair,â not âThe Never, Never Affair.â Labeling this episode the turning point in the showâs humor is odd since the show very obviously became far more tongue-in-cheek when it moved from Tuesday to Monday, weeks before âNever-Neverâ aired. Britton apparently is trying to say that âNever-Neverâ is generally acknowledged as setting the pattern for the second seasonâs much more lighthearted approach.
Episode title is âThe Project Strigas Affair,â not âThe Strigas Affair.â
Page 42âThe Avengers episode title is âThe Girl From Auntie,â not âGirl From A.U.N.T.I.E.â; the film title is âThe Man Called Flintstone,â not âThe Man Called F.L.I.N.T.S.T.O.N.E.â; and the âMan from Gladâ plastic-wrap commercials certainly didnât refer to the product as G.L.A.D.
The house pseudonym for the authors of the monthly U.N.C.L.E. pulp novels was Robert Hart Davis, not âRoger Hart Davis.â And Davis was not credited with writing the juvenile hardcovers published by Whitman, as Britton claims he was.
Page 43âFelton did not design the U.N.C.L.E. gun, as the book claims he did, and the gunâs various attachments did not include a bipod, as the book claims. And calling the gun ârarely usedâ is certainly open to debate.
Page 45âFans just love to take umbrage at the second seasonâs writers guide quoted here, describing U.N.C.L.E. as a âpreposterousâ organization â âa concept far removed from Feltonâs and Rolfeâs conceptsâ as Britton puts it. Unfortunately for the author and all those apoplectic fans, the guide was simply boiled down from notes Rolfe left for his successors, notes which included this comment: âUNCLE is, of course, a preposterous organization.â As indeed it was to writers who considered themselves serious dramatists.
Harlan Ellison wrote only one script for Star Trek.
Page 46âBritton credits U.N.C.L.E.âs silly third-season episodes with being âpropheticâ because Mikhail Gorbachev visited New York 20 years after âThe Jingle Bells Affairâ showed an Eastern Bloc premier in the Big Apple to address the United Nations. That character was such an obvious parody of Nikita Khrushchev that itâs difficult to believe Britton doesnât get it. But he also believes the nasty TV talk show seen in âThe Pieces of Fate Affairâ predicted the coming of Jerry Springer, when it clearly was spoofing the 60s talk shows fronted by belligerent hosts such as Joe Pyne and Alan Burke, people Britton apparently has never heard of.
Episode title is âThe Cap and Gown Affair,â not âThe Caps and Gowns Affair.â
Page 47âMark Slate as played by Norman Fell in The Girl from U.N.C.L.E. pilot was hardly âelderly,â as Britton describes him. He was clearly shown to be a middle-aged man who was still an active field agent, albeit a little slower than he used to be. And he did not leave retirement to work with April Dancer â to the contrary, he was trying to avoid the retirement mandated by the scriptâs idea that field agents were kicked upstairs to desk jobs at age 40.
In the series, April was played by Stefanie Powers, not âStephanieâ Powers, as her name is misspelled throughout the book.
Britton claims that Sam Rolfe received no credit on The Girl From U.N.C.L.E. spinoff series and further claims that Rolfe was âextremely unhappyâ about it. But in fact Rolfe did receive a credit every week in The Girl From U.N.C.L.E. â so here the author hasnât made just another factual error, heâs also invented a reaction for a man he never knew to an event that never happened.
Page 48âActress Dorothy Provine did not star in Naked City. She was a regular in The Alaskans and The Roaring 20s.
Page 49âJerry Goldsmithâs first-season scores were not used throughout the fourth season; there are a number of episodes with original scores by Richard Shores and Gerald Fried.
Leo G. Carroll played a bartender standing behind a bar in the premiere of Laugh-In, not a busboy pushing a cart.
Page 50âBritton describes the home-video release of U.N.C.L.E. episodes as âoverpriced, taken from chopped-up syndication copies, and [they] quickly became unavailable after low sales.â In fact, the first and second groups of two-episode tapes sold for $19.95 each and the price dropped to $14.95 each for a third batch, prices comparable to other video releases at the time. The episodes were complete and uncut, not chopped-up syndie prints. And they were available for years in stores or by mail order.
Michael Sloan was not the first script writer on The Six Million Dollar Man (see the list of errors in chapter 11).
In Sloanâs crummy âReturn of The Man from U.N.C.L.E.â TV-flick, Illyaâs design firm is called Vanyaâs â probably the only good joke in the show â not âUncle Varniaâs.â
Page 51âIt was not the head of Thrush who asked Solo how he still looked so young, it was the henchman played by Keenan Wynn.
Robert Vaughnâs British series was titled The Protectors, not âProtectors.â It ran for two years, 1972 to 1974, not just 1972-73.
Lew Grade was not âthe head of all commercial television in Britain.â He headed ATV, one of the major production and broadcasting franchises in the commercial network. ATV made most of the British adventure series seen in America, through its famous ITC production and distribution arm.
Page 52âAs Britton notes, half-hour dramas had seen their day â but of course early-70s junk like The Protectors was produced only to fill the half-hour timeslots opened by the Prime Time Access Rule, something else Britton seems unaware of.
Tom Jones did not sing The Protectors theme song. That was Tony Christie, a singer largely unknown outside of Britain but who was clearly listed in the closing credits every week.
The A-Team episode title is âThe Say Uncle Affair,â not âThe Say U.N.C.L.E. Affair.â
Page 53âGranada Television, not âGrenada,â is another franchise in Britainâs commercial network.
Page 54âThe Saintâs mythical automobile was a Hirondel, not a âHironpel.â
Chapter 4: The Avengers
Page 58â Jon Rollason, not âJohnâ Rollason, played Dr. King, Steedâs sidekick in three episodes of The Avengers after Ian Hendry left the show.
Hendryâs series Police Surgeon ran only in the fall of 1960, not in 1959.
Page 62âOf Steedâs other new assistant, singer Venus Smith, Britton writes: âSmith appeared in a number of adventures, but she was dropped, as using the singer meant Steed had to run across her accidentally to involve her, and the producers decided this would result in too many coincidences.â In the six episodes in which Venus appeared, Steed deliberately involved her in his cases, just as he deliberately involved Dr. King and Mrs. Gale.
Page 64ââDeath of a Great Dane,â not âThe Death of a Great Dane,â is the episode title with Mrs. Gale. The remake with Mrs. Peel does not have that title, as the book claims it does (the new title was âThe £50,000 Breakfastâ), and while the two episodes obviously have the same plot they are not âvirtually identical.â
Page 65âBeginning with the Mrs. Peel series the show was filmed, not taped.
Page 66âThe Mrs. Peel series debuted in the fall of 1965, not in September 1966. And of course that was in Britain, not the United States, something the book doesnât specify.
Page 67âEpisode title is âThe Girl from Auntie,â not âThe Girl from A.U.N.T.I.E.â
Page 68âActually, ABC bought the show in 1965, not in 1966 when it went on the air. Britton claims here that ABC had no spy shows before The Avengers, but of course it did â and he describes the shows in later chapters. Amos Burke, Secret Agent already had come and gone, while Blue Light, The Baron and The Double Life of Henry Phyfe had been on the air for more than two months when The Avengers debuted.
Page 69âAnother beloved myth among spy fans is the one about âA Touch of Brimstoneâ being so racy it was banned from American television. The truth is nowhere near as sensational. ABC scheduled The Avengers in lieu of reruns of the canceled Ben Casey series. The show premiered March 28 after Casey aired its final original episode. ABC scheduled its new fall shows to debut the first week of September 1966. That did not leave enough time to air all 26 episodes of The Avengers, so five never ran on the network (leading some writers to claim that all five were âbannedâ). Now if five episodes had to be chosen to go unaired, certainly âA Touch of Brimstoneâ would be one of them, allowing the network to avoid any negative reaction to Mrs. Peelâs âqueen of sinâ costume. But the episode was not âbanned in America.â The American networks frequently failed to run every episode of the British shows they bought. And âA Touch of Brimstoneâ went into syndication in 1969 with every other episode of The Avengers, including the other four that ABC never ran, and aired weekday afternoons to absolutely no comment.
Page 70âThere were eight Diana Rigg color episodes remaining after the 1967 U.S. season, not 10.
Page 71âGordon L.T. Scott, not âGordon L. Scott,â was the new executive producer.
Page 72âThe episode introducing Tara King was titled âThe Forget-Me-Knot.â It was not titled âForget-Me-Not.â
Naturally the show used British spelling, so the episode title is âSuper Secret Cypher Snatch,â not the hyphenated âSuper-Secret-Cipher-Snatch.â
Page 73âFrequent Avengers writer Terence Feely, not âTerence Field,â wrote the Avengers stage play with Brian Clemens.
Page 77ââEscapade,â the attempt to produce an American version of The Avengers, was a one-hour pilot, not a TV-movie. It aired in 1978, not 1980.
Page 78âA&E ran The Avengers, including the first American telecasts of the Honor Blackman episodes, in the 1990-91 season, not in 1994.
Chapter 5: I Spy
Page 82âEpisode title is âCourt of the Lion,â not âCourt of the Lions.â
Brittonâs description of Fouad Saidâs Cinemobile â âa portable camera and movable soundstageâ â is laughably inaccurate. The Cinemobile was a van Said outfitted to hold all the equipment used for location shooting.
Describing I Spy producers Mort Fine and David Friedkin as âtwo writers with radio experience in high-adventure showsâ is certainly giving them short shrift. When I Spy started they had just written the screenplay (and won the Writers Guild award) for the acclaimed film âThe Pawnbroker.â Theyâd written and produced two earlier features that Friedkin also directed; created the 1960 series The Case of the Dangerous Robin; and written for many of the leading TV series of the 50s and 60s. They were Emmy-nominated for writing one of the first episodes of I Spy, âA Cup of Kindness.â Friedkin also won the Directors Guild award for the celebrated Dick Powell Show episode âThe Price of Tomatoes.â
Britton notes that Fine and Friedkin wrote âover fourteenâ I Spy episodes. Uh, yeah, they wrote 15.
Earle Hagen did not write the Perry Mason theme; that was Fred Steinerâs work.
Page 83âRegarding the casting of I Spy, Britton writes, âAfter signing Culp, Leonard saw Cosby on The Tonight Show, when it was hosted by Jack Paar, and knew he had his man.â Not likely, since Paar left The Tonight Show in March 1962, two years before Sheldon Leonard was developing I Spy and many months before Bill Cosby ever appeared on television. Leonard actually saw Cosby on Paarâs weekly prime-time show in 1964 (although Leonardâs own not-too-reliable autobiography refers to the show as a Paar âspecialâ).
Page 84âA typhoon, not a âmonsoon,â hit Hong Kong, and it hit while the pilot was being filmed, not prior to filming.
Page 85âI almost hate to smack the author with this one since, in one of the few instances in which he actually contacted someone who worked on one of the shows heâs writing about, he was given completely erroneous information. I Spy composer Earle Hagen sent Britton an e-mail message discussing production of the show. In it, Hagen rather vehemently claims that I Spy was filmed entirely overseas and that no interiors were shot in Hollywood. And thatâs just dead wrong â the exteriors were shot overseas and the interiors were filmed at Desilu. Why Hagen would say such a thing is unknowable. Unfortunately, Britton has no idea Hagen is wrong and, in his amateurish style, makes no attempt to excerpt relevant quotes â he simply drops Hagenâs entire, embarrassingly inaccurate message into the book verbatim.
Page 86âThe first episode is not the Canadian agronomist story.
Page 87âAnother recurring myth in spy fandom is that no one knew who Kelly and Scotty worked for â even though they constantly referred to the Pentagon or âthe departmentâ as their employer, and they and their bosses were always shown in the Pentagon in Washington scenes, making it pretty easy to infer that âthe departmentâ was the Department of Defense or some intelligence department within DOD.
In another example of the academic approach, Britton writes that âsome sourcesâ claim the show was never a ratings success but âothersâ say it was a hit for two seasons then declined in the third seasonâs new timeslot. Apparently it would never occur to him to find out which is true â or bother to tell his readers. (I Spy was generally in the top 20 throughout its first two seasons. In its third season, moved to Monday nights at 10, it was creamed by the new Carol Burnett Show on CBS. Ratings dropped until I Spy was steadily coming in around 75th place in the Nielsens, even getting beaten by The Big Valley on ABC. And again Britton misses a real connection, failing to point out that NBCâs collapsing Monday night schedule included The Man from U.N.C.L.E. at 8 p.m. The network dropped U.N.C.L.E. at mid-season, then canceled I Spy at the end of the season.)
Page 89âSinger Barbara McNair, not âMacNair,â was a guest star. Britton writes that I Spy âallowed other African American actors, such as Barbara MacNair and Godfrey Cambridge, to play friends or foes without calling attention to skin color.â Thatâs a very odd conclusion since Cambridge played a character claiming to be Africaâs last Zulu king, while McNair and nearly every black actress and singer working at the time appeared on the show to give Scotty an occasional love interest â all of them obviously cast because of their skin color in a period when it was simply unthinkable to give a black male character a white girlfriend.
Series title is Spenser for Hire, not âSpencer for Hire.â
Page 90âDiahann Carroll, not âDianneâ Carroll, appeared in Julia.
Chapter 6: Danger Man and The Prisoner
Page 94âFrederick Forsyth, not âForsyte,â is the author of several spy novels. Lew Grade was not a director and he did not create Danger Man. David Tomblin, not âTomlin,â was assistant director on the series but he also did not create Danger Man.
Page 95âIan Hendry appeared in an episode of the later, one-hour version of Danger Man, not in the original half-hour series being discussed here.
Page 97âNow discussing the superior scripts and gadgetry of the hour-long Danger Man, Britton offers the example of âa rifle assembled from innocent looking car partsâ in the episode âTime to Kill.â But âTime to Killâ was a 30-minute episode and the rifle parts were simply hidden throughout the car.
Regarding the sale of the revived Danger Man to CBS, Britton writes, âto appeal to the American audience, the show was retitled Secret Agent.â This statement makes no sense. Why would changing the title to Secret Agent make the show more appealing to American viewers?
Page 98âThe new series that used the Secret Agent theme song was titled Secret Agent Man and had absolutely nothing to do with Secret Agent.
Secret Agent did not air continuously from April 1965 to September 1966, and it did not always air Saturdays at 9:00. CBS dropped the show at the beginning of the new season in September 1965. It returned in December, airing Saturdays at 8:30.
Claiming that âLargely due to the popularity of the theme song, Secret Agent had an immediate followingâ also is nonsense. No one had heard the theme before the show started, it didnât become a hit record until the following year, and it takes a lot more than a catchy theme song to make a series popular.
The two color episodes of Danger Man, âKoroshiâ and âShinda Shima,â were shot in 1966, not 1967. They first aired in Great Britain in February 1967, not in June. Again we must assume Britton means they aired in Britain in June as he doesnât specify which country heâs referring to. And apparently he is unaware that the two episodes, cut together into the TV-movie titled âKoroshi,â aired in the U.S. on ABC in 1969 and 1970.
Page 99âAgain, Lew Grade was not the head of ITV.
Page 101âThe Prisoner started production in September 1966, not in December.
Page 103âEpisode title is âThe Chimes of Big Ben,â not âChimes of Big Ben.â
Page105âEpisode title is âThe Schizoid Man,â not âSchizoid Man.â
Page 106âEpisode title is âFall Out,â not âFallout.â
Page 108âHank Stine, not âStein,â was one of the authors of Prisoner novels.
Chapter 7: The Saint
Page 111âCable channel referred to is Turner Classic Movies, not âTurner Movie Classic.â
Page 113âRadio private eye referred to is Michael Shayne, not âMichael Shane.â
The veteran actor who played Simon Templar in several movies was George Sanders, not âGeorge Saundersâ as heâs referred to throughout the book.
Page 115âRoger Moore played Beau Maverick, not âBoâ Maverick.
Britton writes, âAt first, The Saint was filmed in black and white, as there were few color sets in England.â Actually there were no color sets in England since there was no color broadcasting in England until the conversion to PAL began in the late 60s. ITV did not begin color broadcasting until November 1969. A few British series were shot in color beginning in 1966 so they could be sold to the American networks that refused to run black-and-white shows after going full-color in September 1966.
Page 116âThe NBC station in New York aired The Saint late Sunday nights, not Saturdays.
Brittonâs observation that âUntil the advent of independent cable stations, The Saint was the only series aired coast to coast in syndication in prime time broadcastingâ is ridiculous. Not only were there numerous nationally syndicated series before, during and after the run of The Saint, Britton himself describes many of them in other chapters of the book.
Page 118âMooreâs production company was called Bamore, not âBamoore.â Britton writes, âNBC now made The Saint part of its regular programming,â but NBC used the series only as summer or mid-season replacement programming.
Page 119âTerence Feely, not âTerence Feeley,â is the British TV writer. Gayle Hunnicutt, not âGail Hunicutt.â is the actress.
Page 121âDescribing The Persuaders lead character Lord Brett Sinclair as âfeminineâ is certainly a poor choice of words.
Roger Moore did not âaccept second billing under [Tony] Curtisâs nameâ on The Persuaders; a unique equal billing was created that read simply âCurtis + Moore.â
When Judge Fulton explains his background and motivations to Wilde and Sinclair he says nothing about being a judge at the Nuremberg trials, as Britton claims. Wilde and Sinclair were not âsecret agents.â Episode title is âThe Long Goodbye,â not âLong Goodbye.â Mooreâs son is Geoffrey, not âJeffrey.â
Chapter 8: Mission: Impossible
Page 125âRegarding the ritual opening scenes of Mission: Impossible, Britton writes: âAfter describing the dilemma, the taped voice would end the message saying, âAs always, if you choose to accept this mission and any member of your Impossible Mission Force is caught or killed, the secretary will disavow any knowledge of your actions. Good luck. This tape will self destruct in five seconds.â Invariably, five seconds later, smoke emerged from the player. The viewer then sees a match being struck, a fuse lit, and hears the opening strains of the signature Mission: Impossible theme.â
So the question here is: How could anyone write a book about spy shows and so badly misquote the famous Mission: Impossible taped message? The phrasing was repeated word for word, week after week. And itâs Impossible Missions Force, not Impossible âMissionâ Force. And it was only during the showâs fifth and sixth seasons that the tape scene took place in a teaser preceding the main title â not in the first four years that wrote in stone the format everyone remembers.
Britton then writes, âIn the first seasonâ¦it was the affable, chunky Dan Briggs (Hill) who retired to his black-and-white decorated apartment to scan over a pile of dossiers, choosing which team members of the Impossible Mission Force (IMF) would join him in the operation.â Affable and chunky? Affable and chunky?! And in another example of the bookâs sharp editing, the actor who played Briggs is identified only parenthetically as âHillâ â any previous mention of Steven Hill being the original star of the show evidently having been cut.
Page 129âBritton writes of Bruce Geller, creator of Mission: âGeller enjoyed good fortune, as he was working for Lucille Ballâs powerful and independent Desilu Studios. Unlike other series of the era, Geller thus had little network influence until after CBS had bought the series. As it happened, Desilu was somewhat desperate and needed to sell shows beyond the flagship Hereâs Lucy, starring the studio owner.â
Well, letâs see â the second sentence makes no sense whatsoever, and the third directly contradicts the first, but at least itâs more accurate. Desilu was not particularly powerful in the early 60s. It survived by renting space to other production companies and didnât have anything successful on the air except The Lucy Show (not Hereâs Lucy, which didnât start until 1968 and was not produced by Desilu). Series creators like Geller were not employees of the studios that backed their shows, so he was not âworking forâ Desilu, his company was in partnership with Desilu.
Page 132âHerb Solow, not âHerb Solo,â was a Desilu executive, not a producer. Variety is the show-biz trade paper, not a magazine. Geller did not produce the âCall to Dangerâ pilot that Peter Graves appeared in before joining Mission, as Britton claims he did. Graves also had just appeared in the 1966 series Court Martial; Britton lists his only previous network series as Fury. Graves also starred in Whiplash, a British series seen in first-run syndication in the U.S.
Page 135âRegarding Mission storylines, Britton writes, âTypically, in the third act something would go wrong with the original plan, and the team would be forced to improvise and create last-minute solutions.â That was sometimes true in the first several months when the show took a varied approach to tackling missions and choosing agents, but not so in the classic Mission formula that gelled later in the first season and prevailed in the second, third and fourth seasons. In the series everyone remembers, the absurdly intricate plans went off like clockwork. During the showâs fifth-season shakeup, some scripts finally returned to the original idea that the mission might require some seat-of-the-pants adjustment along the way.
Page 137âThe showâs mainstay writer and script consultant was always billed as William Read Woodfield, not âWilliam Woodfield.â His partner was Allan Balter, not âAlanâ Balter. Paramountâs production executive was Douglas S. Cramer, not âDouglas J. Cramer.â Woodfield and Balter left the show after a fight with Geller, not with Cramer. Barbara Bain was fired just before winning her third Emmy, not as she was being nominated. She did not denounce Cramer by name in her bitter acceptance speech.
Page 138âGeorge Takei, not George âTakai,â appeared on Star Trek and Mission; Mark Lenard, not Mark âLeonard,â played Spockâs father Sarek, not âSarak.â Actress Lesley Ann Warren billed herself as Lesley Warren during her year on Mission and in other work during that period. Her version of âCinderellaâ first aired in February 1965, not in 1966.
Page 139âAbbey Lincoln, not âAbbyâ Lincoln, is the singer-actress.
Page 140âGeller also did not produce Lynda Dayâs series The Silent Force, as Britton claims he did.
Britton writes, âBy the final year, the IMF was focused on criminal activity aloneâ¦this change resulted from both budget cuts and worries that viewers might associate the IMF with the growing Watergate scandal.â The format change that ended overseas missions and counterespionage work to focus solely on domestic crime syndicates came at the beginning of the sixth season, which went on the air in September 1971 and started production months earlier â more than a year before the Watergate break-in. But the idea that viewers would associate Mission with Watergate even in the showâs final season is ludicrous. The Watergate scandal didnât begin to penetrate public consciousness until well after the 1972 election, when Mission was nearing the end of its seventh and final season, and the true extent of government malfeasance was not revealed until long after Mission was off the air.
Page 141âPresumably, âAmerican Movie Channelâ is actually a reference to the American Movie Classics cable network.
Britton writes that on âFebruary 9, 1973, the show was canceled under uncertain circumstances, apparently part of a network dispute that had nothing to do with ratings, program quality, or studio squabbles.â In fact, it was reported at the time that Paramount elected to end the series even before CBS officially canceled it, so the studio could sell syndicated reruns and begin recouping the money poured into the long-running and expensive show. On the network side, Mission was canceled for the usual reasons â after seven years it had run out of gas creatively and the ratings were way down. CBS tried the show Saturdays at 10 p.m. and Fridays at 8 p.m. The ratings continued to decline in both timeslots. Mission finished the season rated 57th in the Nielsens out of 75 shows. Other long-running series such as Bonanza, Laugh-In and The Mod Squad had slightly higher ratings than Mission and were canceled that year.
Page 142âAgain, David Tomblin, not âTomlin,â did direct a few episodes of Space: 1999 but had no ongoing production role. Martin Landau played Count Zark, not âZarg,â in an episode of The Man From U.N.C.L.E.
Page 143âThe 1988 revival of Mission used only four scripts from the original series, not seven.
Chapter 9: The Wild Wild West
Page 148âBritton writes of series stars Robert Conrad and Ross Martin: âBoth had come to a measure of television prominence in 1959 in roles that were clear precursors to their WWW characters. Conrad had starred in Hawaiian Eye, a fusion of two detective romps, 77 Sunset Strip and Adventures in Paradiseâ¦Martin was a master of disguises as a costar in the popular Mr. Lucky, a New York based police drama. Very much in the spirit of Artemus Gordon, Martin used his special knack for dialects and disguises to get his friends out of trouble, leaving the tough action for the other leads.â
That all would be very interesting if any of it were true. But Adventures in Paradise was not a detective show and Mr. Lucky certainly was not a police drama, nor was it New York-based. It couldnât even really be called popular since it lasted only one season. And Martinâs character Andamo was absolutely not a Gordon-like master of disguise and dialect (he was from some unnamed Latin American country so Martin did play him with an accent).
Page 149âGiving Westâs and Gordonâs train a name, âThe Wanderer,â is another bit of revisionist fan history. In four years on the air, no one on the show ever referred to the train as anything but âthe train.â
Britton writes, âTo keep costs down, Conrad wished to do his own stunts.â Actors donât do their own stunts to keep costs down, they do them when they think theyâre athletic tough guys who enjoy horsing around with the stunt men, as Conrad did. If anything, stars doing stunts cause costly delays if theyâre injured, which is exactly what happened to Conrad.
Britton also writes, âCBS was considering canceling the show when Conrad made the request [to do his own stunts], and he won this battle as the network then felt it had nothing to lose.â But Conrad did stunts from the beginning of production, and after the show started airing it was so popular that there was no period in its first three seasons when CBS considered canceling it.
Page 150âActually, episode titles always began with the words âThe Night ofâ; they didnât âusuallyâ begin that way, as the book says.
Britton describes the lead character as âformer U.S. Calvary Officer Capt. James West.â Itâs disturbing that a college English teacher doesnât know the difference between Calvary and the U.S. Cavalry, or realize how redundant âOfficer Capt.â is. But the book is filled with such awkward phrasing and misused words.
Page 151âThe primitive motion picture referred to would be a kinetoscope, not a kinescope, which is a filmed recording of a television broadcast.
Episode title is âThe Night of the Red-Eyed Madmen,â not âNight of the Red-Eyed Madman.â
Page 152âBritton refers to the use of âfamous guest stars, including the young Richard Pryor, Carroll OâConnor, Boris Karloff and Agnes Moorehead,â but of course Pryor and OâConnor were not famous then.
Britton notes that âIn the fall season that year [1967], few new spy shows were offered.â If by few he means absolutely none, thatâs correct. He then notes that âAfter the assassinations of Robert Kennedy and Martin Luther King Jr., the networks also began toning down television violenceâ¦Robert Vaughn recalled NBC sendingâ¦dictums to the U.N.C.L.E. producers.â But The Man From U.N.C.L.E. went off the air in January 1968, months before either assassination. Britton also notes the âNational Association for Better Broadcastsâ targeted The Wild Wild West for its violent content. The group was actually called the National Association for Better Broadcasting.
Page 153âBritton writes that âGordon occasionally wore casts when Martin broke limbs in stunt accidents.â Martin broke his leg once during the four-year run of the series.
Page 154âCharacter quoted in âThe Wild Wild West Revisitedâ was Hugo Kaufman, not âKaughman.â Britton notes the casting of Paul Williams as Miguelito Loveless Jr. in âThe Wild Wild West Revisited,â but fails to note that the producers of this reunion telefilm were so unfamiliar with the show that the character was billed as âMichelito.â His sister was Carmelita, not âCarmenita.â
Page 160âBritton writes, âThe most famous antiviolence statement of the era came from John F. Kennedyâs appointed head of the Federal Communications Commission, Newton Minnow. In May 1961, he told the National Association of Broadcasters that television was âa vast wasteland of violence, boredom and banality.ââ
What Minow â not âMinnowâ â actually said in his speech at the NAB convention was: âI invite you to sit down in front of your television set when your station goes on the air and stay there without a book, magazine, newspaper, profit and loss sheet or rating book to distract you, and keep your eyes glued to that set until the station signs off. I can assure you that you will observe a vast wasteland.â He was condemning the stunning banality of day-to-day commercial programming, not making an anti-violence statement.
Britton then notes that watchdog groups were counting violent incidents in programs and that âSenator John Pasteur condemned the figures,â whatever that means. Britton does not identify âSenator Pasteurâ in any way, leaving his readers to assume heâs referring to Sen. John O. Pastore (D-R.I.), then chairman of the Senate Communications Subcommittee and a well-known critic in the 1960s and 1970s of what he considered televisionâs excesses in the sex and violence areas.
Chapter 10: Get Smart
Page 163âThere was no series called The Sid Caesar Hour. Britton obviously is referring to Caesarâs Hour â although that was a television show, not a radio show, as Britton labels it.
Page 166âTop Brass, the product Barbara Feldon appeared in commercials for prior to Get Smart, was a menâs hairdressing, not a cologne.
Page 167âHymie the robot was invented by an evil scientist who sold him to KAOS as the perfect assassin, not by âa doctor on the side of good.â
The doddering old first chief of CONTROL played by William Schallert was Admiral Hargrade, not âHargrave.â
Page 168âBritton thinks âthe opening narration of Get Smartâs pilot poked fun at U.N.C.L.E.âs voice-over introducing the agents and the organization.â That is such a reach it isnât even funny. However, Britton seems unaware that David Susskindâs photo was among the possible agents in the showâs Mission: Impossible spoof â and that finding Susskindâs photo there was funny â because Susskind owned Talent Associates, the company that produced Get Smart.
Madâs goofy mascot is Alfred E. Neuman, not âNewman.â
Page 170âOne of the guest stars on Get Smart was Cesar Romero, not âCaesar Romero.â
Discussing The Double Life of Henry Phyfe, Britton writes, âcomedian Red Buttons played Henry Wadsworth Phyfe, an exact duplicate of a recently deceased CIS government agent who was code-named U-31.â In keeping with his style of dropping strange names and explaining nothing about them, Britton leaves his readers to wonder if Phyfe could possibly have worked for the post-Soviet Commonwealth of Independent States. But that canât be it. In this case, CIS means Central Intelligence Service, the showâs version of U.S. Intelligence. And U-31 was a foreign spy, not a CIS agent.
Britton never even explains the showâs basic premise: Mild mannered, fumbling accountant Henry Phyfe is recruited by the CIS to impersonate the suave and deadly U-31 â who, unbeknownst to his foreign masters, was killed in a traffic accident on his first day in America. CIS Chief Hannahan planned to use Phyfe to penetrate the enemy spy ring (and the producers planned for hilarity to ensue, though it rarely did).
Page 171â99 did not give birth to the twins on the showâs CBS debut. She announced she was pregnant, and that idea was played for laughs until she gave birth in a November two-parter.
In âIce Station Siegfried,â the episode in which Bill Dana as Agent Quigley stepped in for Max, great pains were taken to emphasize that Quigley was a CIA agent, not a CONTROL agent as Britton identifies him.
Britton notes that Get Smart continues to be a success in syndication, âalthough fans continue to complain that up to three minutes are cut from each episode.â Yes, thatâs infuriating, but every damn show in syndicated reruns is cut, not just Get Smart.
Page 172âBritton writes, âFor some observers, 99 can be seen as a prefeminist who still deferred to men, unlike April Dancer, Honey West, or Emma Peel, all of whom made their TV debuts after 99.â It may be a minor point but Honey West premiered the night before Get Smartâs debut.
Chapter 11: Also-Rans
Page 179âDescribing the 1963-64 series Espionage, Britton writes, âUsing stories from WWII and the Cold War, twenty-four episodes were taped on 35-millimeter black-and-white film and aired on Saturday nights on ABC.â Iâll leave it to others to attempt to explain how the show could be âtaped on film.â But I can tell you it aired Wednesdays, not Saturdays, and it ran on NBC, not ABC. And the settings for this anthology of spy stories ranged back to World War I, the 19th century and the American Revolution.
Page 180âBritton also notes of Espionage, âThe final episode, âA Camel to Ride,â aired on March 28, 1964, after being postponed from its original air date of November 23, 1963, the day after the assassination of John F. Kennedy.â But this clearly is untrue since both of the dates mentioned are Saturdays and the show aired Wednesdays. It would be interesting to know where Britton dug up this story.
Finally, he mentions that âAccording to Tim Brooks and Earle Marshâs 1999 The Complete Directory to Prime [sic] Network and Cable TV Shows, Ian Fleming was an extra in one scene, but I was unable to confirm this.â I guess not since that Ian Fleming was a British actor, not the James Bond author credulous spy fans mistake him for. Brooks and Marsh should know better, but so should Britton.
As for âA Camel to Ride,â I donât know why Britton thinks itâs even worth mentioning. But just for the record, this episode was set to air Nov. 27. In the wake of the assassination, the networks took a second look at everything scheduled to run that week and pulled a number of episodes with plots and titles that suddenly seemed inappropriate. âA Camel to Rideâ included an armed uprising against the young president of a foreign country, and that was enough to make NBC programming execs decide not to air it two days after JFK was buried. Another episode was substituted and âCamelâ was rescheduled, airing three weeks later on Dec. 18, 1963.
On Blue Light, David Marchâs confederate was Suzanne Duchard, not âSusan.â
Jericho, according to Britton, âwas clearly influenced by the earlier British effort, Four Just Men, which featured agents of four countries battling evil after WWII.â Once again reaching way out for a connection that isnât there, Britton ignores the obvious (and why canât he spell out World War?). Jericho was about a three-man World War II commando team made up of an American, an Englishman and a Frenchman, the big three Atlantic Allies. What could be more obvious (or cliché)? They also were officially sanctioned Allied operatives, whereas The Four Just Men (in the TV version) were adventurers who took it upon themselves to travel the world righting wrongs years after the war ended. And the four stars alternated stories, never working as a team. So what possible influence does Britton see here?
The Baron did not run during the 1966-67 season, it aired from January to July in 1966. Britton notes, âThis series revolved around John Mannering (Steve Forrest), the title character who drew his name from his familyâs manor in Texas.â Whatâs that? The family home is called The Baron? Or is it called John Mannering? Actually this is another example of Brittonâs inability to accurately rewrite something he read, probably something about Mannering acquiring his nickname because he was originally a Texas âcattle baron.â
Britton also notes, âThe series quickly disappeared, although it spun off one feature film in 1968, Mystery Island, using the original TV cast.â The TV cast was present because âMystery Islandâ is just a syndicated TV-movie made from a two-part episode of the series. And in fact there were two TV-movies made from two-parters; the other is titled âThe Man in a Looking Glass.â
Page 181âCraig Stevensâ British series Man of the World was âseen only in Englandâ according to Britton. In fact, it aired in first-run syndication in the United States. Britton also writes that Department S was seen only by âBritish viewers,â but it too was broadcast in America in first-run syndication.
Page 182âThe Man Who Never Was is not Robert Lansingâs second series. He starred in 12 OâClock High as Britton notes. Before that he was in 87th Precinct, the 1961-62 cop show. On The Man Who Never Was he played agent Peter Murphy and deceased millionaire Mark Wainwright, not âWainright.â
Richard Levinson and William Link were neither the producers nor the creators of Burkeâs Law.
Page 183âThe episode of The Dick Powell Show that introduced Amos Burke was titled âWho Killed Julie Greer?â (not âGrierâ).
Levinson and Link also were not the creators of Honey West, as the book claims they were. The idea that Honey West was in any way based on Honor Blackmanâs role in The Avengers is unlikely in the extreme. Anne Francis, not âAnnâ Francis, played Honey West. Honey was not âthe daughter of a police officer who opened her own private detective agency,â she was the daughter of a private detective who inherited the agency when her father died. Her partner Sam Bolt was played by John Ericson, not John âErickson.â
Page 184âBritton notes that âUnlike her British inspiration, a man invariably bailed West out in the last act.â This observation is triply untrue: thereâs no evidence the character was inspired by Cathy Gale; Honey frequently bested the villain without any help from Sam, or they worked as a team; and Steed rescued Mrs. Gale and Mrs. Peel as often as they rescued him.
Britton then notes that âThe stories enjoyed the humorous touch of writer Ken Kolb, who also scripted some of the better Wild Wild West adventures.â This is another peculiar observation since Kolb wrote only two episodes of Honey West. Levinson and Link wrote more than that. So did veteran detective-show scripter Tony Barrett. Series creators Gwen Bagni and Paul Dubov wrote the pilot seen on Burkeâs Law and 10 episodes of the series so obviously they were the major writing influence, not Kolb.
Describing Gene Barryâs syndicated series The Adventurer, Britton writes, âBarry played Jim Bradley, a multimillionaire who pretended to be an international film star in order to work on secret missions near film locations or pleasure resorts.â However, the characterâs name was Gene Bradley, not âJim.â And as Britton rightly points out, âHow does one pretend to be a film star, Barryâs ostensible cover?â Well, one doesnât. The showâs premise, dubious as it may have been, was that Bradley really was a well-known actor who also was a secret agent.
Of Man in a Suitcase, Britton writes that it âaired from September 1967 to April 1968 in the U.K., and it was syndicated in the United States throughout the following year.â Apparently heâs unaware the series ran on ABC in the summer of 1968 before entering syndication in the U.S.
He also notes that Suitcase was âproduced by Lew Gradeâs ITV Studios.â Gradeâs company was ATV, its production arm was ITC, the British commercial network is ITV. Britton uses these names interchangeably throughout the book.
Page 185âDescribing Alexander Mundy of It Takes a Thief as a âjewel crookâ is a priceless example of the maladroit phrasing found throughout the book.
âThe Magnificent Thiefâ is not really the title of the pilot for It Takes a Thief. That was an early working title for the series. The uncut pilot, obviously made for a two-hour timeslot, was put into syndication in the 70s and released on video in the 80s as âMagnificent Thiefâ (sans the article). For the 1968 series premiere the pilot was cut to fit a 90-minute timeslot and retitled âA Thief Is a Thief Is a Thief.â
Mundy was incarcerated in San Jobal Prison, not âSan Jobel.â
Page 186âIn a single sentence demonstrating several of the bookâs problems, Britton writes, âOriginally intended to be set in Munich, according to some sources, the Assignment: Viennaâs location was changed after the September 5, 1972, âBlack Septemberâ attack at the Munich Olympics.â Grammar and copy-editing problems aside, this is an absurd statement whether or not itâs attributed (as so many of the bookâs weird claims are) to âsome sources.â The show premiered three weeks after the attack at the Olympic games. It would have been impossible to change the showâs setting because of the attack. And the series was in production in Vienna â and scheduled to air under the title Assignment: Vienna â months before the attack.
Page 187âBritton canât decide if the superspy agency in A Man Called Sloane was written UNIT (yes) or Unit (no).
Page 188âUNITâs computer voice was provided by actress Michele Carey, not âMichelle.â Veteran actor Roddy McDowall, not âMcDowell,â appeared in an episode. The enemy organization was KARTEL, not âThe Cartel.â Peter Allan Fields, not âAllen,â wrote for U.N.C.L.E. and Sloane.
Search premiered in 1972, not 1973. Hugh OâBrian, Tony Franciosa and Doug McClure were the rotating stars of this NBC series, which Britton sums up: âAll worked for a Washington, D.C.-based organization called Probe (later changed to the World Security Organization) headed by V.C.R. Cameron (Burgess Meredith). These agents carried transmitters in their ears, implanted monitors under their skin, and cameras in rings and tiepinsâ¦Dr. Barnett (Ford Rainey) was the Q-like research director, providing all the marvels that meant the agents never had to track down leadsâ¦OâBrian starred in half the episodes; the other two leads plied their wares from time to time in the other half.â
In fact: The corporation was always called World Securities (not âthe World Security Organizationâ). Probe was a division of the company. It was based in New York, not Washington. Dr. Barnett, not Cameron, was the head of the corporation. Cameron, not Barnett, was the inventor of all the Probe gadgetry. OâBrian did not star in half the episodes, though admittedly that was the announced plan. Each of the three leads actually got eight episodes, but when the series was canceled the 24th episode was not produced, so McClure wound up with only seven.
Page 189âIn describing The Champions, the name of one of the lead characters, Craig Stirling, is twice misspelled âSterlingâ on this page but is spelled correctly on the next page. The name of the female lead character is misspelled âSharon Macreadyâ on this page, then misspelled âSharron McReadyâ on the next page (her name was actually Sharron Macready).
Page 191âAlan Caillou did not write the pilot for The Six Million Dollar Man. Kenneth Johnson was not the showâs first producer. Lionel E. Siegel, not âLeonard Siegal,â became the seriesâ producer in its second season but he also was not the first producer. The popular actor Monte Markham, not âMonty Markum,â appeared in the âSeven Million Dollar Manâ episode.
Britton describes the series genesis: âThe concept was first tried out as two ninety-minute movies produced by Glen Larson, who made the films with a Bondian flair in mind, surrounding the suave, sophisticated Steve Austin with beautiful women. Michael Sloan, later the producer for âThe Return of the Man from U.N.C.L.E.â and The Equalizer, was given credit for the two scripts, the first film starring Martin Landau, the second Robert Lansing. The movies didnât get much viewer response, so producer Harve Bennett was called in to see if he could resuscitate the project in the same way he had reenergized the Star Trek franchise with the second feature film, âThe Wrath of Khan.ââ
Letâs see now: Britton fails to explain, or fails to realize, that the 90-minute episodes were not free-floating TV-movies. They were segments of the ABC Suspense Movie, a weekly series of 90-minute made-for-TV flicks inspired by the networkâs success with its Tuesday and Wednesday Movie of the Week series (and another example of going to the well once too often; the Saturday night Suspense Movie flopped). The 90-minute Six Million Dollar Man episodes were scheduled to appear once a month on Suspense Movie. At that time, ABC was enamored of its âfloating seriesâ concept, series that ran throughout the season but did not appear weekly or in a regular timeslot. Kung Fu and Wonder Woman, among others, also started that way. However, only two of the six planned 90-minute episodes of The Six Million Dollar Man were produced before the network decided to make it a one-hour, weekly series.
Also: Michael Sloan did not write the 90-minute episodes (Larson wrote the first one; Larry Alexander, Michael Gleason and Alan Caillou wrote the second). Martin Landau did not appear in the first one (David McCallum and Britt Ekland did). Robert Lansing did not appear in the second one (Maurice Evans and Luciana Paluzzi did). Harve Bennett did replace Larson as executive producer when the show went weekly in January 1974 â but obviously not because of his work on the second âStar Trekâ feature that was released eight years later.
Page 192âOSI, the secret government agency that spent six million dollars putting Austin back together, stands for Office of Scientific Investigation, not âOffice of Scientific Information.â
The show was not canceled at the end of its first season then suddenly revived on Sunday nights, as Britton writes. It returned for a second season still in the same Friday night slot and was moved to Sundays in January 1975.
Jaime Sommers, the Bionic Woman, was introduced in the showâs second season, not its third. She did not die in a skydiving accident after becoming bionic â she was critically injured in a skydiving accident, received bionic parts, then died when her body rejected the bionics (of course they decided later she hadnât really died).
Page 193âThe actresses mentioned are Sally Field, not âFields,â and Stefanie Powers, not âStephanie.â
Page 194âABC did not cancel The Bionic Woman after one season. The show ran two seasons on ABC, then a third on NBC. The Six Million Dollar Man and The Bionic Woman both went off the air in 1978, not 1979.
Page 195âBritton describes The Invisible Man series, with David McCallum as Daniel Westin, the scientist who discovers invisibility: âAfter using himself as a guinea pig, Westin learned the process had one major flaw: visibility could occur at any time without advance warning.â That was not the premise of the pilot or the series, which had Westin rendered permanently invisible and seeking a way to return to normal.
NBC aired 11 episodes of The Invisible Man, not 12.
Page 196âThe Invisible Man ran Monday nights, not Tuesdays.
Page 197âThe second Wonder Woman pilot aired in 1975, not 1976. The title was âThe New, Original Wonder Woman,â not âThe New, Original Adventures of Wonder Woman.â
Page 198âThe Carol Burnett Show was not canceled in 1975. Lyle Waggoner left that show to appear in other projects, including the Wonder Woman pilot.
After describing the pilot, Britton writes, âOne year later, Wonder Woman and her secret-identity alter ego moved to NBC and forward in time to the 1970s as an agent for I.A.D.C. (Inter-Agency Defense Command).â He therefore fails to mention anything about the showâs run on ABC. After airing the pilot in November 1975, ABC aired two hour-long episodes in April 1976, then ran 11 episodes â retitled simply Wonder Woman â as a floating series during the 1976-77 season. In September 1977, the show moved to CBS â not NBC â and, as Britton fails to note, was retitled again, becoming The New Adventures of Wonder Woman.
Page 205âKen Adam, not âAdams,â was production designer on the James Bond movies.
Page 206âScarecrow and Mrs. King was one of the few spy shows set in Washington, D.C., but it was not âfilmed in Washington, D.C.â
Page 209âBriefly mentioning the short-lived and deservedly forgotten series Cover Up, Britton describes the premise (âa fashion photographer who had been married to a government agentâ teamed with âa former Green Beretâ) as âa clear update of I Spy.â What?
Page 210âOne of the co-stars of The Equalizer was blaxploitation vet Ron OâNeal, not Ron âOâNeil.â
Page 211âBritton notes of The Equalizer, âThe first episode aired September 18, 1985, but a full season hadnât yet been shot.â Well, so what? Thatâs true of any series.
Page 215âThe third Harry Palmer movie was titled âBillion Dollar Brain,â not âThe Billion Dollar Brain.â The title of Palmerâs 90s revival was âBullet to Beijing,â not âBullets to Beijing.â That film and its sequel, âMidnight in St. Petersburg,â were shot in 1994, not 1995, by the Showtime pay-cable network. The company intended to release âBeijingâ in theaters then follow up with âSt. Petersburgâ as a Showtime original. After a long and fruitless search for a distributor, Showtime shunted both films over to its sister network The Movie Channel, where âBullet to Beijingâ premiered on April 5, 1997 and âMidnight in St. Petersburgâ first appeared Feb. 28, 1998. The films did not debut on âthe American Movie Channel,â whatever that is.
Chapter 13: Fantasy Series
Page 221âJames Bond Jr. premiered in September 1991, not in 1992.
Page 233âThe 1998 âX-Filesâ feature film is not the only movie based on a TV series to be produced with the TV cast and released while the series was still on the air. Other examples include âDragnetâ (1954), âOur Miss Brooksâ (1956), âMcHaleâs Navyâ (1964), âBatmanâ (1966), âMunster, Go Homeâ (1966) and âHouse of Dark Shadowsâ (1970).
Page 236âJohn Sacret Young, not âJohn Sacret,â was executive producer of VR.5.
Page 238âThe abominable UPN series Secret Agent Man debuted in March 2000, not in May 2000. It mercifully ran only one season, not two.
Chapter 14: 21st Century
Page 243âSecret Agent did not debut in America in the fall of 1965. It first appeared in the U.S. in April 1965.
Page 244âKim Philby was not Russian, he was a British traitor who spied for the Russians.
Page 252âAgain, what is the American Movie Channel?
Notes
Page 262âIn the first note for chapter 8 regarding Mission: Impossible, Britton writes, âTo be fully accurate, in the first season, the tapes didnât self-destruct.â Well, to be fully accurate, they did. In some episodes, Briggs was ordered, as Britton notes, to âdispose of this recording in the usual manner.â But the pilot and many other first-season episodes had tapes and other types of recordings that did self-destruct.
References
Page 265âBurl Barer, not âBeryl Barer,â is the author of The Saint, a Complete History in Print, Radio, Film and Television (the bookâs correct title).
Erik Barnouw, not âEric,â is the author of Tube of Plenty. He is cited incessantly throughout the book and his name is misspelled throughout.
The correct title of the TV series reference by Tim Brooks and Earle Marsh is The Complete Directory to Prime Time Network and Cable TV Shows. For some reason, Britton always omits the word âTimeâ from this title.
Index
Yes, even the index. A number of names are not in alphabetical order. An even greater number of names are misspelled, including those of Jane Badler, Daniel Benzali, Frederick Forsyth, David Friedkin, Lynda Day George, Earle Hagen, Antony Hamilton, Jon-Erik Hexum, Laurence Heath, Steven Hill, Laurence Luckinbill, Peter Lupus, Monte Markham, Hugh OâBrian, Stefanie Powers, Ron Randell, Cesar Romero, George Sanders, Leslie Stevens, David Tomblin, Lesley Ann Warren and Dana Wynter. And strangely enough, some names are misspelled in the index the same way they are misspelled in the text, while others are spelled correctly in the text but are misspelled in the index.
|
||||||||
692
|
dbpedia
|
3
| 3 |
https://www.soundstrue.com/blogs/authors/julia-cameron
|
en
|
Julia Cameron
|
http://www.soundstrue.com/cdn/shop/articles/julia-cameron_1_1200x1200.jpg?v=1653319599
|
http://www.soundstrue.com/cdn/shop/articles/julia-cameron_1_1200x1200.jpg?v=1653319599
|
[
"https://www.soundstrue.com/cdn/shop/files/primary-fullColor-rgb_ec83dfe9-0065-4cab-811c-ac5ebd555ea2_310x.png?v=1643003544",
"https://www.soundstrue.com/cdn/shop/files/primary-fullColor-rgb_ec83dfe9-0065-4cab-811c-ac5ebd555ea2_310x.png?v=1643003544",
"https://www.soundstrue.com/cdn/shop/files/IMBA_ProductCard-v2_4_{width}x.jpg?v=1713476247",
"https://www.soundstrue.com/cdn/shop/files/IMBA_ProductCard-v2_4_1024x1024.jpg?v=1713476247",
"https://www.soundstrue.com/cdn/shop/files/WC06460N_Myss-Harvey-product-card-ep-r1_b7520164-c303-4012-9b82-dbb652a8945a_{width}x.jpg?v=1709922068",
"https://www.soundstrue.com/cdn/shop/files/WC06460N_Myss-Harvey-product-card-ep-r1_b7520164-c303-4012-9b82-dbb652a8945a_1024x1024.jpg?v=1709922068",
"https://www.soundstrue.com/cdn/shop/files/PD07319W-Lawlor-ig_{width}x.jpg?v=1723056559",
"https://www.soundstrue.com/cdn/shop/files/PD07319W-Lawlor-ig_1024x1024.jpg?v=1723056559",
"https://www.soundstrue.com/cdn/shop/files/PJM113-WatGT-S1_Ep9-ig-cs-v1_1_923fbff4-87cd-47da-a282-57f8a6795b87_{width}x.png?v=1717613003",
"https://www.soundstrue.com/cdn/shop/files/PJM113-WatGT-S1_Ep9-ig-cs-v1_1_923fbff4-87cd-47da-a282-57f8a6795b87_1024x1024.png?v=1717613003",
"https://www.soundstrue.com/cdn/shop/files/Untitled_design_-_2023-02-21T144826.158_{width}x.png?v=1677016198",
"https://www.soundstrue.com/cdn/shop/files/Untitled_design_-_2023-02-21T144826.158_1024x1024.png?v=1677016198",
"https://www.soundstrue.com/cdn/shop/files/STO-product-card-r2-ep_2865546e-4560-46d1-bfa0-4b5fae9277fb_{width}x.png?v=1664570713",
"https://www.soundstrue.com/cdn/shop/files/STO-product-card-r2-ep_2865546e-4560-46d1-bfa0-4b5fae9277fb_1024x1024.png?v=1664570713",
"https://www.soundstrue.com/cdn/shop/files/foundation_{width}x.png?v=1654294273",
"https://www.soundstrue.com/cdn/shop/files/foundation_1024x1024.png?v=1654294273",
"https://www.soundstrue.com/cdn/shop/files/Untitled-1_{width}x.png?v=1654294050",
"https://www.soundstrue.com/cdn/shop/files/Untitled-1_1024x1024.png?v=1654294050",
"https://www.soundstrue.com/cdn/shop/products/WC06926Y-Various-product_card-v1-jc_{width}x.jpg?v=1690989170",
"https://www.soundstrue.com/cdn/shop/products/WC06926Y-Various-product_card-v1-jc_1024x1024.jpg?v=1690989170",
"https://www.soundstrue.com/cdn/shop/files/primary-fullColor-rgb_ec83dfe9-0065-4cab-811c-ac5ebd555ea2_310x.png?v=1643003544",
"https://www.soundstrue.com/cdn/shop/articles/julia-cameron_1_480x.jpg?v=1653319599",
"https://www.soundstrue.com/cdn/shop/products/262_{width}x.jpg?v=1583899508",
"https://www.soundstrue.com/cdn/shop/products/262_1024x1024.jpg?v=1583899508",
"https://www.soundstrue.com/cdn/shop/files/audio.png?v=6656027008459000818",
"https://www.soundstrue.com/cdn/shop/products/785_09048417-b84b-4567-9f84-70f908b964fa_{width}x.jpg?v=1615581490",
"https://www.soundstrue.com/cdn/shop/products/785_09048417-b84b-4567-9f84-70f908b964fa_1024x1024.jpg?v=1615581490",
"https://www.soundstrue.com/cdn/shop/files/audio.png?v=6656027008459000818",
"https://www.soundstrue.com/cdn/shop/products/1931_{width}x.jpg?v=1583899353",
"https://www.soundstrue.com/cdn/shop/products/1931_1024x1024.jpg?v=1583899353",
"https://www.soundstrue.com/cdn/shop/files/audio.png?v=6656027008459000818",
"https://www.soundstrue.com/cdn/shop/products/218_{width}x.jpg?v=1583899601",
"https://www.soundstrue.com/cdn/shop/products/218_1024x1024.jpg?v=1583899601",
"https://www.soundstrue.com/cdn/shop/files/audio.png?v=6656027008459000818",
"https://www.soundstrue.com/cdn/shop/products/1945_{width}x.jpg?v=1583899349",
"https://www.soundstrue.com/cdn/shop/products/1945_1024x1024.jpg?v=1583899349",
"https://www.soundstrue.com/cdn/shop/files/audio.png?v=6656027008459000818",
"https://www.soundstrue.com/cdn/shop/files/footer-2880_1018-A-v1-jc.jpg?v=1710532716",
"https://www.soundstrue.com/cdn/shop/files/footer-750_832-A-v1-jc_1.jpg?v=1714148024",
"https://www.soundstrue.com/cdn/shop/files/Rectangle.png?v=1643307117"
] |
[] |
[] |
[
""
] | null |
[] | null |
Julia Cameron is the author of the national bestselling book, The Artist's Way. An award winning writer and director, she has created feature films, movies of the week and episodic television, six full-length plays, and hundreds of articles and stories for national publications ranging from Rolling Stone to Vogue to th
|
en
|
//www.soundstrue.com/cdn/shop/files/android-chrome-512x512_32x32_cfb382d9-c713-4d93-b539-775841c86d5d.webp?v=1651005758
|
Sounds True
|
https://www.soundstrue.com/blogs/authors/julia-cameron
|
Our Site is not intended for children under 13 years of age. No one under age 13 may provide any information to or on the Site. We do not knowingly collect personal information from children under 13. If you are under 13, do not use or provide any information on this Site or on or through any of its features, register on the Site, make any purchases through the Site, use any of the interactive or public comment features of this Site, or provide any information about yourself to us, including your name, address, telephone number, email address, or any screen name or user name you may use.
If we learn we have collected or received personal information from a child under 13 without verification of parental consent, we will delete that information. If you believe we might have any information from or about a child under 13, please contact us at support@soundstrue.com.
Prices and availability of products are subject to change without notice. Our goal is to provide only up-to-date and accurate information to our customers. But mistakes happen and occasionally product descriptions on our Site or in our catalog may contain typographical errors, inaccuracies, or omissions concerning product specifications, prices, or availability, and product photos may sometimes depict a different product version than the one we will ship. We reserve the right to correct and update information on our Site at any time, without notice. We also reserve the right to revoke any offer that contains an error, or for a product that is not available, at any time prior to shipment, including after you have submitted an order and whether or not the order has been confirmed and your credit card charged. In that event, we will reverse any applicable charges that have been made to your credit card, and if the product is or will be available, we will attempt to contact you concerning the mistake to receive your instructions as to whether you wish to purchase on the basis of the corrected information. If you believe a product that we ship to you is not as described, you may return it to us under our Return Policy.
The Sounds True mobile message service (the “Service”) is operated by Sounds True (“Sounds True”, “we”, or “us”). Your use of the Service constitutes your agreement to these terms and conditions (“Mobile Terms”). We may modify or cancel the Service or any of its features without notice. To the extent permitted by applicable law, we may also modify these Mobile Terms at any time and your continued use of the Service following the effective date of any such changes shall constitute your acceptance of such changes.
By consenting to Sounds True’s SMS/text messaging service, you agree to receive recurring SMS/text messages from and on behalf of Sounds True through your wireless provider to the mobile number you provided, even if your mobile number is registered on any state or federal Do Not Call list. Text messages may be sent using an automatic telephone dialing system or other technology. Service-related messages may include updates, alerts, and information (e.g., order updates, account alerts, etc.). Promotional messages may include promotions, specials, and other marketing offers (e.g., cart reminders).
You understand that you do not have to sign up for this program in order to make any purchases, and your consent is not a condition of any purchase with Sounds True. Your participation in this program is completely voluntary.
We do not charge for the Service, but you are responsible for all charges and fees associated with text messaging imposed by your wireless provider. Message frequency varies. Message and data rates may apply. Check your mobile plan and contact your wireless provider for details. You are solely responsible for all charges related to SMS/text messages, including charges from your wireless provider.
You may opt-out of the Service at any time. Text the single keyword command STOP to +18887035922 or click the unsubscribe link (where available) in any text message to cancel. You’ll receive a one-time opt-out confirmation text message. No further messages will be sent to your mobile device, unless initiated by you. If you have subscribed to other Sounds True mobile message programs and wish to cancel, except where applicable law requires otherwise, you will need to opt out separately from those programs by following the instructions provided in their respective mobile terms.
For Service support or assistance, text HELP to +18887035922 or email support@soundstrue.com.
We may change any short code or telephone number we use to operate the Service at any time and will notify you of these changes. You acknowledge that any messages, including any STOP or HELP requests, you send to a short code or telephone number we have changed may not be received and we will not be responsible for honoring requests made in such messages.
The wireless carriers supported by the Service are not liable for delayed or undelivered messages. You agree to provide us with a valid mobile number. If you get a new mobile number, you will need to sign up for the program with your new number.
To the extent permitted by applicable law, you agree that we will not be liable for failed, delayed, or misdirected delivery of any information sent through the Service, any errors in such information, and/or any action you may or may not take in reliance on the information or Service.
We respect your right to privacy. To see how we collect and use your personal information, please see our Privacy Notice.
Our Site and its products and services are provided on an “As Is” and “As Available” basis, with all faults. To the maximum extent permitted by applicable law, Sounds True disclaims all implied warranties, including but not limited to implied warranties of merchantability and fitness for a particular purpose. Without limiting the foregoing, Sounds True makes no warranty, express or implied, (i) as to the operation or Content of our Site, (ii) that use of our Site will be uninterrupted or error-free, (iii) as to the accuracy, reliability, or currency of our Site’s Content, (iv) that our Site, the servers that host it, or email we send you are free of viruses, or (v) that information we collect on our Site is immune from access by hackers and other unauthorized users. Applicable law may not allow exclusion of implied warranties, so some or all of the above disclaimers may not apply to you.
Sounds True is not responsible or liable for any loss, damage, injury, or health problems that may result from your use of our Site and/or its products and services, and/or any action or inaction on your part as a result of information you have obtained from our Site and/or its products and services. By way of example only, if you engage in any health-related programs that you receive or learn about through our Site and/or products and services found on our Site, you agree that you do so voluntarily, after consulting an appropriate health-care professional of your choice, and at your own risk, and you agree to release and discharge Sounds True from any and all claims or causes of action, known or unknown, arising out of the foregoing.
You agree that to the maximum extent permitted by applicable law, courts located in Boulder County, Colorado, will have sole and exclusive jurisdiction for any litigation arising out of your use of this Site and products you order on this Site. You submit to personal jurisdiction of any such court and waive any claims that the forum is inconvenient or the court does not have jurisdiction. If any provision of these Terms of Use is unlawful, void, or unenforceable under applicable law, you and Sounds True submit to modification of such provision so as to make it enforceable, or if modification is not possible, to severance of the offending provision and enforcement of the remainder of these Terms of Use.
To the fullest extent permissible by law, you hereby expressly waive any and all claims you may have, now or in the future, arising out of or relating to the Site, Sounds True, any and all contracts you enter into with Sounds True, and any and all of Sounds True’s products and services.
To the extent that you attempt to assert any such claim, you hereby expressly agree to present such claim only through binding arbitration conducted under the rules of the American Arbitration Association to occur in Boulder County, Colorado. You further agree to and do hereby waive any right to class arbitration and agree, instead, to conduct an arbitration related solely to any individual claims you and/or any entity related to you asserts against us. To the fullest extent permissible by law, you further agree that you shall be responsible for all costs associated with initiating the arbitration and for the administration of the arbitration.
eGift Cards are the simplest, speediest way to send something special. Our eGift Cards are purchased just like any other item in our store. You choose the amount, add a personalized message, and the card will be delivered right to your inbox where you can treat yourself or you can send it to someone as a gift. eGift Cards include your personalized message and a gift code in a lovely layout.
Please keep in mind:
* We offer electronic gift cards only; we do not mail physical cards to recipients. We recommend that you purchase gift cards directly from our Site and retain your receipt. We cannot guarantee the validity of gift cards purchased from third parties, especially from third-party online marketplaces where scams are common. Gift cards that have been stolen or fraudulently acquired are subject to cancellation by Sounds True regardless of whether you purchased the gift card from the third party without knowing it was stolen. Here are some common questions about our eGift Cards and the answers to them:
Are there any fees associated with the purchase of an eGift Card?
No. You will only be charged the face value of the eGift Card, and we will not impose any shipping, taxes, or additional fees.
Can I change the value of an eGift Card after I've paid for it?
Not at this time.
How do I cancel the purchase of an eGift Card?
Your eGift Card is not returnable after purchase (except as required by law) and cannot be canceled.
What are the minimum and maximum dollar amounts I can purchase for eGift Cards?
The minimum is $15; the maximum is $150. However, if you wish to purchase an eGift Card for more than $150, please contact Customer Service. Email: support@soundstrue.com; Phone: 1-800-333-9185 (US only), 303-665-3151 (international).
When is my credit card charged for my purchase?
Your credit card is charged at the time of purchase.
What exactly does the recipient receive when I send an eGift Card?
On the delivery date you choose, an email is sent to the recipient informing them of your gift, with the eGift Card you created, your personalized message, its value, and a code number. The email also gives simple instructions for redeeming the eGift Card.
When is the eGift Card sent to the recipient?
The eGift Card email is sent to the recipient on the date you choose. It can be sent immediately or scheduled to be sent up to one year in the future.
When does the eGift Card expire?
The eGift Card expires five years after the initial purchase date.
Where can I redeem my eGift Card?
You can use your eGift Card at SoundsTrue.com on any Sounds True product (excluding live events, monthly subscriptions, or Continuing Education credits). You can apply the gift card balance to your shopping cart at checkout and will be prompted for additional payment if your total exceeds your gift card balance.
Do gift card purchases qualify for special offers or promotions?
No, the purchase of eGift Cards does not count toward the purchase amount required to be eligible for free shipping or promotional offers.
Can I use the eGift Card to purchase Sounds True products on other websites (such as Amazon)?
No, not at this time.
Can I add value to my eGift Card?
No, not at this time.
How do I know the recipient actually received the eGift Card I purchased?
You will receive an email message confirming delivery.
If I want to return a product I bought with an eGift Card, will I receive another eGift Card?
No, the refund goes back on the original eGift Card and the expiration date remains the same. If you used an eGift Card and credit card for the order (because the total price exceeded the amount of the eGift Card), the refund goes back to the eGift Card before the credit card.
What if I lose my eGift Card?
Please contact Customer Service. Email: support@soundstrue.com; Phone: 1-800-333-9185 (US only), 303-665-3151 (international).
I’m having trouble using my eGift Card. Who should I contact?
Please contact Customer Service. Email: support@soundstrue.com; Phone: 1-800-333-9185 (US only), 303-665-3151 (international).
I purchased an eGift Card as a gift for someone, but they haven’t received it yet. What should I do?
Please contact Customer Service. Email: support@soundstrue.com; Phone: 1-800-333-9185 (US only), 303-665-3151 (international).
Do you sell physical gift cards?
No, not at this time.
|
||
692
|
dbpedia
|
3
| 76 |
https://portbooknews.com/book/9781250897589
|
en
|
Living the Artist's Way: An Intuitive Path to Greater Creativity
|
[
"https://portbooknews.com/sites/default/files/styles/logo/public/2024-04/pbnlogo-1.png?itok=_dHCAmkt",
"https://images.booksense.com/images/589/897/9781250897589.jpg",
"https://images.booksense.com/images/756/859/9781593859756.jpg",
"https://images.booksense.com/images/078/383/9781561383078.jpg",
"https://images.booksense.com/images/032/240/9780063240032.jpg",
"https://images.booksense.com/images/546/342/9781250342546.jpg",
"https://images.booksense.com/images/248/736/9780060736248.jpg",
"https://images.booksense.com/images/487/547/9781462547487.jpg",
"https://images.booksense.com/images/271/866/9781250866271.jpg",
"https://portbooknews.com/themes/custom/bookworm/images/ada_compliance.png"
] |
[] |
[] |
[
"bookstore",
"bookshop",
"gift shop",
"olympic peninsula"
] | null |
[] | null |
Discover the revolutionary new Artist’s Way tool, from "the Queen of Change" (New York Times) In her internationally bestselling book, The Artist’s Way, Julia Cameron shared with her millions of readers the three main tools needed to unlock creativity. Now, in her revolutionary new book, Living the Artist’s Way, Cameron finally reveals the vital fourth Artist’s Way tool that she relies upon daily to find creative inspiration: writing for guidance. Over the course of six weeks, readers learn the radical new skill needed to take their creativity and their creative work to the next level: how to connect with the intuitive power within themselves and trust the answers they receive. For followers of the Artist’s Way program and newcomers alike, this exciting new guidebook will teach readers how to find greater happiness, productivity, and creative inspiration.
|
en
|
/sites/default/files/2024-03/pbnfaviconmd.png
|
IndieCommerce
|
https://portbooknews.com/book/9781250897589
|
Description
Discover the revolutionary new Artist’s Way tool, from "the Queen of Change" (New York Times)
In her internationally bestselling book, The Artist’s Way, Julia Cameron shared with her millions of readers the three main tools needed to unlock creativity. Now, in her revolutionary new book, Living the Artist’s Way, Cameron finally reveals the vital fourth Artist’s Way tool that she relies upon daily to find creative inspiration: writing for guidance.
Over the course of six weeks, readers learn the radical new skill needed to take their creativity and their creative work to the next level: how to connect with the intuitive power within themselves and trust the answers they receive. For followers of the Artist’s Way program and newcomers alike, this exciting new guidebook will teach readers how to find greater happiness, productivity, and creative inspiration.
About the Author
Hailed by the New York Times as “The Queen of Change,” JULIA CAMERON is credited with starting a movement in 1992 that has brought creativity into the mainstream conversation—in the arts, in business, and in everyday life. She is the best-selling author of more than forty books, fiction and nonfiction; a poet, songwriter, filmmaker and playwright. Commonly referred to as “The Godmother” or “High Priestess” of creativity, her tools are based in practice, not theory, and she considers herself “the floor sample of her own toolkit.” The Artist’s Way has been translated into forty languages and sold over five million copies to date.
Praise for Living the Artist's Way: An Intuitive Path to Greater Creativity
"Cameron’s lovely prose is grounded in a keen awareness of her inner and outer worlds, which are described so vividly that the reader comes to feel like one of her many 'intimates.' Artists and others looking to tap into their intuition will find plenty of wisdom here." —Publishers Weekly
"Sometimes, when we feel stuck or afraid, we look to others for guidance. In Living the Artist's Way Julia Cameron shows us that the guidance we seek actually comes from somewhere deep within and is available at any time. This wise and encouraging book is a series of invitations to connection, creative confidence and commitment to the writing path. Accept those invitations and a whole world will open up for you." —Beth Kempton, bestselling author of Wabi Sabi
|
||||
692
|
dbpedia
|
1
| 80 |
https://www.petermfloyd.com/
|
en
|
Peter M. Floyd
|
[
"https://www.petermfloyd.com/wp-content/uploads/2012/03/cropped-GeorgesIsland2.jpg",
"http://www.petermfloyd.com/wp-content/uploads/2024/05/Alien-poster-197x300.jpg",
"http://www.petermfloyd.com/wp-content/uploads/2024/04/2001-203x300.jpeg",
"http://www.petermfloyd.com/wp-content/uploads/2024/04/MV5BYTExYjM3MDYtMzg4MC00MjU4LTljZjAtYzdlMTFmYTJmYTE4XkEyXkFqcGdeQXVyNTAyODkwOQ@@._V1_-199x300.jpg",
"http://www.petermfloyd.com/wp-content/uploads/2023/01/BAS1-2023-medium-240x300.jpg",
"http://www.petermfloyd.com/wp-content/uploads/2022/07/BardsAndSagesJuly2022-240x300.jpeg"
] |
[] |
[] |
[
""
] | null |
[] | null |
Writer at Large
|
en
|
Peter M. Floyd
|
https://www.petermfloyd.com/
|
WARNING: This review contains spoilers for a 45-year old movie that you really should already have seen by now.
I was obsessed with Alien for years before I ever saw it.
The film came out in the summer of 1979, the year I turned fourteen. I remember the remarkably effective ads on TV, featuring an unearthly egg, cratered like the moon (and looking nothing like the eggs seen in the movie, by the way) starting to hatch, accompanied by that immortal tagline: In space no one can hear you scream. Woo! Cue the tingling of the spine.
And then I read issues of Omni magazine that featured articles and photos from the movie, showcasing designer H.R. Giger’s viscid creations: the ancient spacecraft shaped like a malformed horseshoe, slick corridors that seemed like the inside of a shark’s intestines, and the glutinous podlike eggs. There were no images of the alien* itself, of course, to limit spoilers, but what I could see was enough to get me hooked. This vision of spaceship that seemed more organic than mechanical was a kind of science fiction far removed from “Star Trek” and Star Wars.
But of course I could not see it then. At that time, I only went to the movies if someone in the family took me, and none of them was irresponsible to take me to a hard-R-rated horror flick, revolutionary visuals or no. And I wasn’t ready to see it, really; I was a bit too susceptible to the effects of horror movies and television. When I was a few years younger, I would eagerly watch “The Night Stalker” on TV, and then have to spend the night in my parents’ bed because I was too terrified to be alone. Later, after watching John Carpenter’s Halloween, edited and sanitized for TV though it was, I could not sleep a wink afterwards. So, even at 14, I was self-aware enough to know that I was not yet mentally prepared to see whatever horrible things the alien did to people.
At least, not on celluloid. In the local bookstore, I found a comic adaptation of the movie (by comic legends Archie Goodwin and Walt Simonson, though their names were unfamiliar to me at the time), which I paged through with eager hands. Later, I borrowed the book of film’s novelization, by Alan Dean Foster (the king of SF movie novelizations in the late seventies and eighties; he must have written about thirty of them), which prissily omitted all the profanity but kept all the slime and blood. These were poor substitutes for the actual movie, to be sure, but they kept me turning the pages.
It was not until my college years that I finally saw the film itself and, miraculously, it did not disappoint. Naturally, by that point I knew the plot backwards and forwards, down to the order that the crew of the space freighter Nostromo get picked off by the alien, but for the first time I could appreciate Ridley’s Scott’s masterful direction, with the suspense slowly ratcheting up through the first half as the crew land on a forbidding planet, investigate the derelict spacecraft, and then begin nosing among those alien pods, before turning up the horror factor as the alien goes on its killing spree. The visual design is key, not just with the organic derelict craft, but also with the Nostromo itself, whose interiors range from claustrophobic corridors to sterile medical labs to vast storerooms, all of which come across as sinister and unsettling places.
Another element that I could only appreciate by seeing the movie was the quality of the cast. This must be one of the best ensemble of actors to appear together in a horror film: Tom Skerritt, John Hurt, Ian Holm, Yaphet Kotto, Harry Dean Stanton, Veronica Cartwright, along with a little-known actress named Sigourney Weaver.
Weaver’s Ripley, the film’s sole survivor (aside from Jones the cat) of the alien’s rampage, would become the character primarily associated with the Alien franchise — so much so that it’s hard to watch the movie and not see her as the heroine, whose survival is a foregone conclusion. However, she’s not actually played that way through most of the film. From the start, it’s Skerritt, playing the ship’s captain, who dominates the scenes and drives most of the action. Indeed, of all the cast, Ripley at first seems the most minor of characters. Certainly, Weaver was the least known of all the cast in 1979. In her early scenes, Ripley is officious and overly by-the-book, hardly what you’d call an action hero. But Alien is not an action movie.
In subsequent films of the franchise, Ripley is an action hero, most notably in James Cameron’s follow-up Aliens. There is much discussion in fan pages and movie review of which is better, Scott’s or Cameron’s movie, and more often than not (in the reviews I have seen) the consensus is that the latter is better, and the reason is often given that Cameron and Weaver made Ripley a true female action hero, a kick-ass woman armed to the teeth who could spit bullets and drop one-liners with the same panache as Stallone or Schwarzenegger.
I have to say that my own preference for Alien over Aliens is actually for pretty much the same reason. I find the flawed, everywomannish Ripley of the first movie far more interesting than the blaster-toting badass of the second. Not, I hasten to add, because I have any objection to having female action heroes, but because I generally find “ordinary” protagonists more interesting than superheroes. (I never really cared much for those Stallone and Schwarzenegger movies, either.) In the latter part of Alien, right up through the end, Ripley is half-insane with fear, muttering to herself hysterically as she sets the Nostromo’s self-destruct sequence and runs for the escape pod. There’s no grandstanding “Get away from her, you bitch!” moment, and this makes the climax far more terrifying, and more real, than that of Aliens.
I don’t want to give the impression that I disliked Cameron’s film; I think he did a great job of creating a sequel that respected the original but was not a simple retread. If it’s a bit more cartoonish in plot and characterization, it’s nonetheless engaging and entertaining. The same could not be said for any of the following sequels, Alien3 and Alien Resurrection. As for Scott’s 21st Century prequels, Prometheus and Alien Covenant, the less said the better. Not only are they filled with characters who make one stupid decision after another, but they provide answers to mysteries better left unsolved, with answers that are pretty stupid, as well.
Alien really works best if you ignore the excess baggage of the extended franchise and watch it as audience watched it in 1979: a simple and economical tale of a truly nasty boogeyman in a spacebound haunted house.
*Somewhere along the line, it became the norm in fandom to call the aliens “xenomorphs,” which I think is a ridiculous word, ugly in all the wrong ways. The term is never used at all in the first movie, so I will not do so here.
Stanley Kubrick’s 2001: A Space Odyssey can be considered the Citizen Kane of science fiction, in that it features a revolutionary visual style (a style matched with a bit of bravado, as if the director were saying “Look what I can do!”) that had an outsized influence on the movies that followed it. And, like Kane, it was controversial when it came out, and remains so to this day, with many people considering it arty and pretentious.
There’s no question that 2001 can be a difficult film to watch. It moves at a deliberate pace, not willing to speed up to satisfy those with short attention spans. The long and seemingly endless shots of spacecraft in motion can try the patience of the most ardent fan. When the movie was released in 1968, such sequences were intended to instill a sense of awe in the audience, giving them glimpses of space and future technology far beyond what had been seen in earlier sf films — though, even then, many viewers got restless waiting for something to happen. (Supposedly, Rock Hudson walked out of the premiere screening, muttering “What is this bullshit?”) In this day and age, when any hack moviemaker has access to technology far beyond that available to Kubrick and special effects director Douglas Trumbull, a modern viewer might well wonder what the big deal is. And where are the damned aliens already?
Obviously, given the fact that I’m including 2001 in my Ten Best list, I think the movie is still a big deal. I first saw it on TV when I was about fifteen. Catching the broadcast a small television, broken up by ads, is not of course the ideal way of seeing any movie, let alone 2001, which depends on its visuals for much of its power. Certainly, I didn’t fully appreciate the film until I saw it years later on the silver screen. But even on first viewing, I grasped that this was a very different kind of science fiction movie — or movie of any kind — than any I’d seen before. It was a story told elliptically, with images rather than words, with important elements (like those damned aliens) completely unseen, existing only in negative space.
Soon after seeing the movie, I read Arthur C. Clarke’s novelization. Clarke was of course instrumental in the creation of the movie, which was inspired by his short story “The Sentinel.” Yet I found the book disappointing; it lacked the radical power of the film. And I realized that this was because the novel was (of course) told with words, which by their very nature make meaning explicit. In Kubrick’s film, as opposed to Clarke’s novel, the words are restricted to the dialog, which is mostly mundane and trivial. The movie’s meaning is implicit — which makes watching it both more difficult and more rewarding than reading the novel.
I don’t want to fault Clarke too much. He remains one of the great sf writers of the mid 20th Century, with Childhood’s End being a classic that has not faded with age. And it must be said that his 2001 is far better written than your average movie novelization. But his narrative by its very nature takes away the very thing that makes 2001 the classic that it is. It’s like the Cliff’s Notes for the movie. (And don’t get me started on 2010: The Year We Make Contact, in which Clarke felt it necessary to explain exactly why the computer HAL went on a rampage. Some mysteries are better left as mysteries. Did Leonardo need to tell us why the Mona Lisa was smiling?) If you haven’t seen the movie yet (and why haven’t you?) wait until after you’ve done so to read the novel. In fact, wait a few weeks, or months, and let the movie percolate through your mind for a while before you pick up the book.
I said before that 2001 has been an influential movie, and that is certainly true in so far as its design and visual effects. But really, I would argue that it hasn’t been influential enough. There have been very few movies since (certainly not mainstream ones) that have engaged their audiences with such a distinctive visual, non-verbal style. (Offhand, for American films, I can think of David Lynch’s Eraserhead and Terence Malick’s The Tree of Life. I may be the only person on Earth to have actually liked the latter. Or seen it, for that matter.) On the whole, 2001 was a giant step forward in the possibility of film, and it’s a pity that so few have followed up on it.
Looking over what I have written here, I realize I’ve said precious little about the movie itself. Perhaps that’s just as well. The movie resists any kind of pat summary (“Oh, it’s about the evolution of humankind, the danger of artificial intelligence, and the pleasures of eating a decent meal!”) and seems lessened by any attempts to describe it.
See the movie on as large a screen as possible. Allow yourself to fall into its slow and inexorable rhythm. If you don’t get it, or you find it pretentious twaddle, then watch it again. Notice the themes that cross the various segments of the movie: Food. Tools. Murder. Intelligence. Sleep. Growth. Wonder. Things that link all of humanity from primitive hominids to angelic star-children. For all the starkness of its scenes in deep space, the movie is rich with meaning and life.
And I dare you not to be moved when HAL sings “Daisy Bell.”
This if the first of a series of posts about my ten all-time favorite science fiction movies. Note that I do not claim that these are the best sf movies (though I think all of them are legitimately great), but the ones that, for whatever reason, push my particular buttons. I’ll be treating them in chronological order.
I love 50’s science fiction movies, despite the fact that many if not most of them are terrible. Made in a decade that had a stick up its butt, they tend to suffer from a severe case of stodginess, with earnest humans (nearly always men) confronting menaces from beyond, either here on Earth or in what was then called “outer space.” Even the best sf movies from the decade — The Day the Earth Stood Still, Forbidden Planet, The Thing from Another World, It Came from Outer Space, and so on — carry this weight of stodginess with them. The tentacles of irreverence that were poking into the corners of popular culture — in, say, Mad magazine, “The Ernie Kovacs Show,” and the songs of Little Richard — never got their grasp on the Hollywood studios churning out endless movies about square-jawed heroes punching aliens in the face.
Invasion of the Body Snatchers (from 1956) is the best sf movie of the decade not because it transcends that stodginess, but because it makes the stodginess work for it. Set in the small California town of Santa Mira, where everyone is white and middle class and totally square (the cast of characters includes children and adults, but no teenagers or twentysomethings), the movie depicts what happens when the residents are replaced one by one by alien pod people who are absolutely identical to the originals, except for being even more stodgy (having no emotions, desires, or dreams). While it was almost certainly not in the creators’ minds, one can see the pod invasion as an illustration of what Fifties conformity culture might be if carried to extremes.
The two protagonists, Dr. Miles Bennell (Kevin McCarthy) and his old flame Becky Driscoll (Dana Wynter) at first glance are as stiff and formal as everyone else in town. Miles is never without a coat and tie (except for the scenes when he’s in a bathrobe) and Dana swans about in a fancy strapless dress as she goes about her daily routine. But, significantly, they’re both divorced, an unexpected characterization for a time when divorce was considered morally questionable. And they’re both likeable people, generally interested in helping their friends and neighbors, which starts the plot rolling as they investigate what is starting a seeming outbreak of mass hysteria, when these friends and neighbors start insisting that their loved ones have been replaced by imposters. Soon enough, Miles and Becky find themselves surrounded by hostile creatures bearing the faces of their friends.
The direction, by Don Siegel (who would go one to direct the Clint Eastwood flicks Dirty Harry and The Beguiled, among others) is quite effective, considering the clear limitations in the budget. Body Snatchers starts off as a creepy mystery (what’s the cause of this seeming hysteria?). Then it becomes a horror movie, as Miles and Becky, and their friends Jack and Theodora (played by King Donovan and Carolyn Jones — yes, Morticia Addams) find first a blank, featureless body that slowly becomes a copy of Jack, and then (in a truly unsettling scene) a set of giant seed pods that disgorge frothy duplicates of all four of them in a truly unsettling scene. The final act of the movie is an exercise of true paranoia, as Miles and Becky realize they are the only two left in town who have not been assimilated, and try to escape with their souls intact.
There are many who prefer Philip Kaufman’s remake of 1978, which does have a lot to recommend it, including Donald Sutherland’s deft performance as the lead, Leonard Nimoy as a pop psychiatrist, and a lot of gooey visuals. (There were additional remakes in 1994 and 2007 which I didn’t see; I’m not sure anyone did.) Set in urban San Francisco, Kaufman’s version has a different feel and overall theme than the original (urban alienation vs. rural assimilation). I find myself preferring the simplicity and directness of the original; it’s far more terrifying to have your friends, rather than complete strangers, turn into soulless imposters.
The 1956 version is generally faithful to Jack Finney’s novel, but has (surprisingly for a Hollywood film) a more depressing ending. In the book, Miles and friends are able to defeat the aliens, and the pods end up leaving Earth. In the original cut of the movie, Miles is the only one in Santa Mira to escape the pods, and he ends up running up and down a freeway, raving like a maniac: “They’re coming! You’re next! You’re next!” The studio would not allow that to stand, however, and Seigel was forced to add a framing device in which Miles tells his story to a skeptical doctor (While Bissell, who appeared in half the sf movies coming out of Hollywood in the 50s), as word comes in that an overturned truck has spilled giant seed pods all over the highway. (Which is still a far cry from the book’s happy ending.)
Ever since the movie was released, there has been debate about its meaning. Do the pod people symbolize Communist infiltrators? Or McCarthyite demagogues? Siegel insisted that there was no political meaning, but of course no one had paid any attention to that. Honestly, the concept of friends and family taken over by an alien hive mind can be adapted for any age and political outlook; you could just as easily say the pod people are MAGA-ites, or the Woke. Conformity is in the eye of the beholder, I suppose.
Regular visitors to my website, of whom I have none, will have noticed that (a) I haven’t posted anything in the better part of a year, and (b) I did recently make a slight change to the site banner, replacing the phrase “Playwright at Large” with “Writer at Large.” Behind that, my friends, lies a story.
I have noted in a previous posts that being a playwright during a pandemic is not easy. The truth is, it’s no cakewalk being a playwright even when there isn’t a virus keeping people out of enclosed public spaces. Even before Covid-19 rang down the curtains on theaters everywhere, I had reached something of an impasse in my playwriting career. The only full-length play of mine that was getting any productions was Absence, and that hadn’t gotten any traction since its Italian revival in early 2019. I found that I was even having difficulty getting my shorter plays produced. I found it harder and harder to come up with ideas for writing plays, short or long. Not to put too fine a point on it, the magic had gone out of my dramatic writing.
The year-long shutdown of live theater thus seemed an opportune moment to reassess my writing career. I found that I still had the urge to write, but that urge was not pointing to the writing of plays. Rather, I found myself steering (or maybe being steered) back to my first love, fantastic fiction.
When I first had the urge to become a writer, back in my early teens, it was not my aspiration to be a dramatist. No, what I dreamed of was to be a writer of fantasy and/or science fiction. (These were broadly referred to as “speculative fiction,” a term which always sounded awkward to me.) From an early age, I read a ridiculous amount of fantasy: I loved the work of J.R.R. Tolkien (of course), Lewis Carroll, Lloyd Alexander, Alan Garner, and many others. As I entered my teens, my tastes grew to include science fiction from soft to hard: Isaac Asimov, Philip José Farmer, Frank Herbert, and Philip K. Dick. I particularly liked the work of those authors who danced on the edge between the two categories, like Harlan Ellison and Gene Wolfe. I decided that I was going to be an f/sf writer myself.
And yet that didn’t happen. Or at least it took a long time. I would start writing stories but get bogged down almost as soon as I started. Over the years, I would put my ambition away for a while and pursue some other vocation, but somehow I would always come back to writing. I felt like a writer, even if I wasn’t doing any of it.
About twenty years ago, I finally put some effort into writing a few stories, and managed to complete some of them. I sent them out to various publishers, and they were promptly (well, sometimes not so promptly) rejected. And quite understandably; they were terrible. I wasn’t ready to be an s/sf writer yet, it seemed.
I changed gears then, and tried writing for children. I wrote two books, one a comic fantasy and one a comic sf tale, that I thought were quite good. I sent them out to agents who did not share that opinion.
It was about then that I wrote my first short play, “The Little Death.” I brought it before the community theater group with whom I’d been working as an actor, and offered to direct it as part of their group of summer one-acts. (The was in 2005.) To my amazement, the board accepted it, and to my further amazement it did quite well. Having finally gotten some positive feedback on my writing, I plunged into my career as a playwright, getting many short plays produced at festivals, getting my M.F.A. in playwriting at Boston University, and then finally getting a production of my full-length play Absence at the Boston Playwrights’ Theatre in 2014. I seemed to have made it.
But I had not made it. Absence got a few more productions, but none of the other full-length plays of mine got any traction, and as noted above I started having less and less success with my short plays.
And so I returned to my first love, fantastic fiction. (Wait, I said that already.) I started working on short stories, and quickly found the genre that worked for me: Darkly comic fantasies. (Perhaps not surprisingly, as most of my best plays fall under that category. A major exception is Absence which, being a serious tale about a woman suffering from dementia, is something of an outlier in my work.)
I found, when rereading what I’d written, that I rather enjoyed it, and so began submitting my work to various print and online magazines with hope. For a long time, that hope seemed baseless; I kept receiving rejection after rejection. Well, that’s par for the course for a fledgling writer, I suppose. It didn’t help that there must have been thousands of fledgling writers around the world who similarly found themselves stuck at home with nothing better to do than pound out stories and send them off, so that the slush piles must have been even bigger (and slushier) than usual.
And then one day the metaphorical sun rose on my new career: my novelette “On Milligan Street” had been accepted by the e-magazine GigaNotoSaurus.org, and would (will) be published by them on September 1. (Cheers and applause from the audience.)
It’s taken me forty years, but I’ve at last become an f/sf writer.
|
|||||
692
|
dbpedia
|
0
| 23 |
https://newplayexchange.org/users/1307/vince-melocchi
|
en
|
New Play Exchange
|
https://newplayexchange.org/themes/custom/npe_theme/favicon.ico
|
https://newplayexchange.org/themes/custom/npe_theme/favicon.ico
|
[
"https://newplayexchange.org/themes/custom/npe_theme/logo.png",
"https://newplayexchange.org/modules/custom/npe_general/images/register.png",
"https://newplayexchange.org/modules/custom/npe_general/images/login.png"
] |
[] |
[] |
[
""
] | null |
[] | null |
en
|
/themes/custom/npe_theme/favicon.ico
|
https://newplayexchange.org/users/1307/vince-melocchi
|
It's the 2007 NFL season and the Detroit Lions are on a winning streak — unfortunately out of work steelworker John Waite is not. With humor and humanity, playwright Vince Melocchi offers a glimpse into The Tenth Ward Club, where the patrons place their hopes on their team, and attempt to escape the creeping demise of their city and of their way of life.
2009 Ovation Award nominee - Best Playwriting
"...Melocchi's play is a smart, humanistic...observation of working-class survivalism." - Los Angeles Times
"Lions is about hope...about the endurance of a middle class getting squeezed...finding life amid the lifeless" - Detroit Free Press
"...an all-around touching portrait of Middle America, a reminder that 'real Americans' need not be so reductively characterized as Joe the Plumber." – L.A. Weekly
“In Vince Melocchi’s play, Lions, we are privy to the hardships of a group of downtrodden men and women who are faced with the economic sufferings of today’s world.” - Stagehappenings
After years of self-exile in Detroit, Lou Perino returns to his hometown in Pennsylvania to right a wrong he did 50 years ago to Julia, the girl he loved. Once, the Korean War stood in their way - now it's something entirely different.
This beautiful story of love and pride delicately explores the nature of forgiveness, grief and redemption.
” Julia is a very touching work by playwright Vince Melocchi written with the conviction that the little, almost incidental, acts of youth can haunt us for a lifetime…. a vibrant exploration of love and regret…. takes a simple story and brings it to the personal level, with immediacy, honesty and restraint.” – Reviews Off Broadway
“…precisely drawn and movingly dramatized. Vince Melocchi creates immediacy and intimacy. What appears to be a simple story embraces the larger concept of crossing chasms…This is a satisfying evening of solid theater.” – Playing Around- N.Y
“Critic’s pick - … Melocchi’s new play, sensitively directed by Guillermo Cienfuegos, is eloquently understated and gracefully melancholic, subtly packing an emotional punch.” “Melocchi’s script offers a resonant depiction of small-town life, illuminating crushing disappointments experienced by ordinary people ” Les Spindle – Backstage
“GO! – Melocchi’s writing is deceptively top-heavy with conversations that at first appear pointless but gradually coalesce to construct the psychological underpinnings of strikingly plausible blue-collar characters.” Paul Birchall – L.A. WEEKLY
“…the play has the low-key feel of real life — just regular people making up their lives as they go along.”…. this small, sweet play really lives…. ” Charlotte Stoudt – L. A TIMES
“RECOMMENDED! – Melocchi has written a wonderful touching play with marvelous characters, each once created perfectly…” – Stagehappenings
“JULIA is…surprising, tense, funny, sweet and redemptive. Melocchi approaches his characters pathos with a comic poignancy; this allows the subject matter to resonate long after we have left the theatre” – Tony Frankel- Stage and Cinema
“…the unconscious sensitivity of Melocchi’s precise text…never leaves the audience in any doubt that a great memory drama is being created.” – Madeleine Shaner- Beverly Press
” See JULIA and/or any other play Vince Melocchi writes.” – Suzy Williams – The Beachhead
Bobbie Jo Gunning is an Army National Guard recruiter in Western Pennsylvania. Amy , a woman who has recently lost her fiancee in the Afghanistan war. Neither of them sleep well these days. Amy, because of what she's done. Bobbie Jo because of something she hasn't dealt with. In order to move on and live their lives they will need to come to terms with the past and the present. Nice Things explores the changing and diminishing options now available for young men and women in small town America.
"Best of 2014" - Jose Ruiz - Review plays
“ STAGE RAW RECOMMENDED” – “Melocchi is not really interested in pointing fingers and playing the blame game… all his characters are victims of circumstance —and the human condition.” Neal Weaver – Stage Raw
“This play packs a one-two punch that comes out of nowhere leaving the audience gasping for breath and wondering what else can happen. Part of the intrigue is the back story…YOU HAVE TO SEE THIS PRODUCTION.” – Jose Ruiz – Review Plays
“I should tell you that I really liked “Nice Things”, which seemed exemplary of what theater needs to be, and not so much about what it doesn’t. Good to be witness to a show that exists so much in its moments and needn’t necessarily have any life outside of that to validate itself” – Myron Meisel - L.A Drama Critics Circle
Nice Things has a powerful and lasting message that left me deep in thought as I pondered the burning question, “is our military really on a volunteer basis? Is war worth the price? – Rose Desena - Los Angeles Post
“NICE HAS SOMETHING TO SAY” – “...Melocchi really excels with the driving action of this play…gripping. It has something rather important to say.” – Patrick Hurley – That awesome theatre blog!
“Melocchi doesn’t go that route. He digs deep and gives us a complex character… makes a strong case for the rest of us not to forget these people, especially those who gave their lives for our freedom and well-being. The play does all it can to remember and honor them.” – Willard Manus – Totaltheatre.com
|
||||
692
|
dbpedia
|
3
| 21 |
https://howtobe247.com/julia-cameron-the-artists-way-author-on-ai-and-creative-blocks/
|
en
|
Julia Cameron: The Artist’s Way author on AI and creative blocks
|
[
"https://howtobe247.com/wp-content/uploads/2023/11/e-transparent-1.png",
"https://secure.gravatar.com/avatar/cda21c62d7e35cb3ae1b2a715ef88dac?s=100&d=mm&r=g",
"https://howtobe247.com/wp-content/uploads/2023/03/suborna-suswati-6-copy-copy-copy.webp",
"https://howtobe247.com/wp-content/uploads/2023/11/e-transparent-1.png"
] |
[
"https://www.youtube.com/embed/pE5bpCOssYw?feature=oembed"
] |
[] |
[
""
] | null |
[
"Suswati Basu"
] |
2023-11-01T10:49:21+00:00
|
Julia Cameron discusses 'The Artist's Way,' creativity, and navigating the age of artificial intelligence with How To Be Books.
|
en
|
How To Be Books
|
https://howtobe247.com/julia-cameron-the-artists-way-author-on-ai-and-creative-blocks/
|
1.1K
On National Authors Day and in the spirit of National Novel Writing Month, How To Be Books engaged in an insightful conversation with Julia Cameron, the acclaimed author of “The Artist’s Way.” A book that has guided many towards finding their true creative path.
Unpacking “The Artist’s Way”: creativity beyond writing
Julia Cameron, a poet, playwright, fiction writer, essayist, and award-winning journalist, reflects on the essence of the book, saying, “I wrote a book about the art of being creative. So it could be writing, it could be painting, it could be acting, any of the arts.” The inception of the book, she shared, was born out of frustration over how artists were being treated. She wanted to pen a manifesto urging better treatment and respect for artists.
Considering the ongoing challenges artists face, like the WGA strike, which has subsequently come to a tentative agreement, as well as concerns over how creatives are treated, Cameron feels things have improved. “I think we’re being treated a little bit better, and I think that the reason we’re being treated a little bit better is because people have more understanding of what creativity is. And that came about, through the book,” she notes.
One of the key methods Cameron champions is the practice of ‘Morning Pages’. She describes it as, “three pages of long, hand morning writing that you do first thing on awakening.” Cameron herself has diligently practiced it for over 30 years and feels that morning pages act as a potent form of prayer and meditation.
Navigating creative blocks and the age of digital distraction
But in this era of digital disruption, how does one maintain a consistent creative practice amid myriad distractions? For Cameron, it boils down to desire. “When you desire a creative practice, you make it a priority,” she observes.
Read: Unauthorised AI training: 183,000 books incite legal clashes
In today’s landscape, the rise of artificial intelligence presents a unique challenge for writers and artists. When queried about AI’s role in the creative world, and its potential to rehash writers’ work, Cameron stresses the value of originality. “We are the origin of our work. We have the word original, and it contains the word origin,” she points out.
She also urges artists and writers to always be hopeful about their work and not be consumed by paranoia. Cameron’s long-standing belief in creativity as a spiritual practice remains unwavering, and she sees a deep connection between creativity and mental well-being. She comments, “When people are functioning creatively, they start to be happy. Depression lifts, despair lifts. People find themselves feeling a sense of hope, a sense of optimism, a sense of enthusiasm. And all of these things are earmarks of mental health.”
Hence her work has managed to withstand the test of time, remaining relevant and thought-provoking for over three decades. Souvenir Press recently seized “Living the Artist’s Way: An Intuitive Path to Creativity,” a new book by the author. As we head into National Authors Day and National Writing Month, Cameron’s words serve as a gentle reminder of the timeless essence of creativity and the importance of preserving it.
|
|||||
692
|
dbpedia
|
1
| 43 |
https://fulbright.uark.edu/programs/medical-humanities/directory/uid/ckayser/name/Casey%2BLee%2BKayser/
|
en
|
University of Arkansas
|
[
"https://includes.uark.edu/assets/tower-grey.png",
"https://includes.uark.edu/assets/ua-logo-horz.svg",
"https://www.uark.edu/_resources/img/map.png"
] |
[] |
[] |
[
""
] | null |
[] | null |
en
|
https://www.uark.edu/_resources/includes-22/assets/icons/favicon.ico
| null |
Fulbright College of Arts & Sciences
Medical Humanities
Kimpel Hall 707
University of Arkansas
Fayetteville, Arkansas 72701
479-575-2512
ckayser@uark.edu
|
||||||
692
|
dbpedia
|
2
| 41 |
https://ebin.pub/afro-american-writers-after-1955-dramatists-and-prose-writers-9780810317161-0810317168.html
|
en
|
American Writers after 1955: Dramatists and Prose Writers 9780810317161, 0810317168
|
[
"https://ebin.pub/ebinpub/assets/img/ebinpub_logo.png",
"https://ebin.pub/img/200x200/french-prose-writers-of-the-fourteenth-and-fifteenth.jpg",
"https://ebin.pub/img/200x200/printing-writers-and-readers.jpg",
"https://ebin.pub/img/200x200/merovingian-letters-and-letter-writers.jpg",
"https://ebin.pub/img/200x200/poetry-for-writers.jpg",
"https://ebin.pub/img/200x200/the-writers-journey-9781615933150.jpg",
"https://ebin.pub/img/200x200/the-prose-of-life-russian-women-writers-from-khrushchev-to-putin-9780299232030-9780299232047.jpg",
"https://ebin.pub/img/200x200/athanasius-and-his-opponents-cappadocian-fathers-and-other-greek-writers-after-nicaea-32-9789068318548.jpg",
"https://ebin.pub/img/200x200/writers-and-their-teachers-9781350272262-9781350272293-9781350272279.jpg",
"https://ebin.pub/img/200x200/we-wanted-to-be-writers-life-love-and-literature-at-the-iowa-writers-workshop-9781602397354.jpg",
"https://ebin.pub/img/200x200/modernism-fashion-and-interwar-women-writers-9781474427432.jpg",
"https://ebin.pub/img/200x200/afro-american-writers-after-1955-dramatists-and-prose-writers-9780810317161-0810317168.jpg",
"https://ebin.pub/ebinpub/assets/img/ebinpub_logo.png"
] |
[] |
[] |
[
""
] | null |
[] | null |
...
|
en
|
ebin.pub
|
https://ebin.pub/afro-american-writers-after-1955-dramatists-and-prose-writers-9780810317161-0810317168.html
|
Citation preview
OMNIVM
CIVIVA1 'isaeee too
BOSTON PUBLIC LIBRARY
Dictionary of Literary Biography • Volume Thirty-eight
Afro-American Writers After 1955: Dramatists and Prose Writers
Dictionary of Literary Biography 1: The American Renaissance in New England, edited by Joel Mverson (1978) 7J 7
27: Poets of Great Britain and Ireland, 1945-1960, edited by Vincent B. Sherry, Jr. (1984)
2: American Novelists Since World War II, edited by leffrey Helterman and Richard Layman (1978)
28: Twentieth-Century American-]ewish Fiction Writers, edited by Daniel Walden (1984)
3: Antebellum Writers in New York and the South, edited by Joel Myerson
29: American Newspaper Journalists, 1926-1950, edited by Perry I. Ashley (1984) 7
4: American Writers in Pans, 1920-1939, edited by Karen Lane Rood (1980)
30: American Historians, 1607-1865, edited by Clyde N. Wilson (1984) 31: American Colonial Writers, 1735-1781, edited by Emory Elliott (1984) 7 7
5: American Poets Since World War II, 2 parts, edited by Donald T. Greiner (1980) 6: American Novelists Since World War II, Second Series, edited by James E. Kibler, Jr. (1980) 7 7: Twentieth-Century American Dramatists, 2 parts, edited by [ohn MacNicholas (1981) 8: Twentieth-Century American Science-Fiction Writers, 2 parts, edited by David Cowart and Thomas L. Wymer (1981) 9: American Novelists, 1910-1945, 3 parts, edited by James J. Marline 10: Modern British Dramatists, 1900-1945, 2 parts, edited by Stanley Weintraub (1982) 7 7 11: American Humorists, 1800-1950, 2 parts, edited by Stanley Trach¬ tenberg (1982) 7 12. American Realists and Naturalists, edited by Donald Pizer and Earl N Harbert (1982) 13: British Dramatists Since World War II, 2 parts, edited bv Stanley Weintraub (1982) 7 14: British Novelists Since 1960, 2 parts, edited by Jay L. Halio (1983) 15: British Novelists, 1930-1959, 2 parts, edited by Bernard Oldsey 16: The Beats: Literary Bohemians in Postwar America, 2 parts, edited bv Ann Charters (1983) 7 17: Twentieth-Century American Historians, edited by Clyde N. Wilson 18: Victorian Novelists After 1885, edited by Ira B. Nadel and William E Fredeman (1983) 19: British Poets, 1880-1914, edited by Donald E. Stanford (1983) 20: British Poets, 1914-1945, edited by Donald E. Stanford (1983) 21: Victorian Novelists Before 1885, edited by Ira B. Nadel and William E Fredeman (1983) 22: American Writers for Children, 1900-1960, edited by John Cech 23: American Newspaper Journalists, 1873-1900, edited by Perry 1 Ashley (1983) 7 J‘ 24: American Colonial Writers, 1606-1734, edited by Emory Elliott
32: Victorian Poets Before 1850, edited by William E. Fredeman and Ira B. Nadel (1984) 33: Afro-American Fiction Writers After 1955, edited by Thadious M. Davis and Trudier Harris (1984) 34: British Novelists, 1890-1929: Traditionalists, edited by Thomas F. Staley (1985) 35: Victorian Poets After 1850, edited by William E. Fredeman and Ira B Nadel (1985) 36: British Novelists, 1890-1929: Modernists, edited by Thomas F. Staley (1985) 37: American Writers of the Early Republic, edited by Emory Elliott (1985) 38: Afro-American Writers After 1955: Dramatists and Prose Writers, edited by Thadious M. Davis and Trudier Harris (1985)
Documentary Series 1: Sherwood Anderson, Willa Gather, John Dos Passos, Theodore Dreiser, F. Scott Fitzgerald, Ernest Hemingway, Sinclair Lewis, edited by Margaret A. Van Antwerp (1982) 2: James Gould Cozzens, James T. Farrell, William Faulkner, John O'Hara, John Steinbeck, Thomas Wolfe, Richard Wright, edited by Margaret A. Van Antwerp (1982) 3: Saul Bellow, Jack Kerouac, Norman Mailer, Vladimir Nabokov, John Updike, Kurt Vonnegut, edited by Mary Bruccoli (1983) 4: Tennessee Williams, edited by Margaret A. Van Antwerp and Sally Johns(1984) P 7
Yearbooks 198°, edned by Karen L. Rood, Jean W. Ross, and Richard Ziegfeld 1981, edUed by Karen L. Rood, Jean W. Ross, and Richard Ziegfeld
25: American Newspaper Journalists, 1901-1925, edited by Perry I Ashley (1984) 7 7 J'
1982, edited by Richard Ziegfeld; associate editors: lean W. Ross and
26: American Screenwriters, edited by Robert E. Morsberger, Stephen O. Lesser, and Randall Clark (1984)
1983, edited by Mary Bruccoli and Jean W. Ross; associate editor’
Lynne C. Zeigler (1983) Richard Ziegfeld (1984)
Dictionary of Literary Biography • Volume Thirty-eight
Afro-American Writers After 1955 Dramatists and Prose Writers
Edited by Thadious M. Davis and Trudier Harris University of North Carolina at Chapel Hill
A Bruccoli Clark Book Gale Research Company • Book Tower • Detroit, Michigan 48226
Advisory Board for DICTIONARY OF LITERARY BIOGRAPHY Louis S. Auchincloss John Baker D. Philip Baker A. Walton Litz, Jr. Peter S. Prescott Lola L. Szladits William Targ
P5»5i
1
•A5/?3
11X6
Matthew J. Bruccoli and Richard Layman, Editorial Directors C. E. Frazer Clark, Jr., Managing Editor
Manufactured by Edwards Brothers, Inc. Ann Arbor, Michigan Printed in the United States of America
Copyright ® 1985 GALE RESEARCH COMPANY
Library of Congress Cataloging in Publication Data Main entry under title: Afro-American writers after 1955. (Dictionary of literary biography; v. 38) “A Bruccoli Clark book.” Includes index. 1. Afro-American authors—Biography—Dictionaries. 2. Authors, American — 2()th century—Biography—Dic¬ tionaries. 3. American literature—20th century—His¬ tory and criticism. 4. American literature—Afro-American authors—History and criticism. 5. American literature —20th century—Bio-bibliography. 6. American literature —Afro-American authors—Bio-bibliography. I. Davis, Thadious M., 1944- II. Harris, Trudier. III. Series. PS153.N5A39 1985 ISBN 0-8103-1716-8
810’.9’896
85-1673
For
For
Unareed Harris
Richard K. Barksdale
Contents
Plan of the Series.ix
Adrienne Kennedy (1931-
).162
Margaret B. Wilkerson
Foreword.xi
Woodie King, Jr. (1937-
Acknowledgments.xv
).170
Stephen M. Vallillo
Maya Angelou (1928-
).3 William Wellington Mackey (1937-
Lynn Z. Bloom
).175
Linda E. Scott
Toni Cade Bambara (1939-
).12 Marvin X (Marvin E. Jackmon, Nazzam A1 Fitnah Muhajir, El Muhajir) (1944- ).177
Alice A. Deck
Amiri Baraka (LeRoi Jones) (1934-
).22
Floyd Gaffney
Lorenzo Thomas
Ed Bullins (1935-
).43
James Alan McPherson (1943-
Leslie Sanders
Ben Caldwell (1937-
).61
Arthenia J. Bates Millican (1920-
Robbie Jean Walker
Alice Childress (1920-
).195
Virginia Whatley Smith
)..66
Ron Milner (1938-
Trudier Harris
).201
Beunyce Rayford Cunningham
Ossie Davis (1917-
).80
Loften Mitchell (1919-
Michael E. Greene
Tom Dent (1932-
).208
Ja A. Jahannes
).86
Albert L. Murray (1916-
Lorenzo Thomas
).214
Elizabeth Schultz
Alexis Deveaux (1948-
).92
Larry Neal (1937-1981).225
Priscilla R. Ramsey
Lonne Elder III (1931-
Norman Harris
).97 Kalamu ya Salaam (Vallery Ferdinand III) (1947- ).231
Wilsonia E. D. Cherry
Charles H. Fuller, Jr. (1939-
).104
Arthenia J. Bates Millican
Ethel W. Githii
Bill Gunn (1934-
).185
Patsy B. Perry
).109
Ntozake Shange (1948-
Ilona Leki
Alex Haley (1921-
Elizabeth Brown
).115
Ted Shine (1931-
Marilyn Kern-Foxworth
).250
Winona L. Fletcher
Lorraine Hansberry (1930-1965).120
Joseph A. Walker (1935-
Steven R. Carter
).260
Grace Cooper
Paul Carter Harrison (1936-
).134
Douglas Turner Ward (1930-
Steven R. Carter
).264
Stephen M. Vallillo
Calvin C. Hernton (1932-
).139
Richard Wesley (1945-
Anthony S. Magistrale
June Jordan (1936-
).240
).271
Steven R. Carter
).146
Edgar B. White (1947-
Peter B. Erickson
Steven R. Carter
vii
).278
Contents
Samm-Art Williams (1946-
DLB 38 ).283
Trudier Harris
A Slender Thread of Hope: The Kennedy Center Black Theatre Project.323 Winona L. Fletcher
Appendix The Black Arts Movement.293
Black I heaters and Theater Organizations In America, 1961-1982: A Research List.329
Larry Neal
Andrzej Ceynowa
Community and Commentators: Black Theatre and Its Critics.301
Supplementary Reading List.355
Rhett S. Jones
Black Theatre: A Forum.311
Contributors.357
A Look at the Contemporary Black Theatre Movement.319
Cumulative Index.361
A. Peter Bailey
viii
Plan of the Series . . . Almost the most prodigious asset of a country, and perhaps its most precious possession, is its native literary product-when that product is fine and noble and endur¬ ing.
placement and treatment of authors who might properly be included in two or three volumes. In some instances a major figure will be included in separate volumes, but with different entries empha¬ sizing the aspect of his career appropriate to each volume. Ernest Hemingway, for example, is repre¬ sented in American Writers in Paris, 1920-1939 by an entry focusing on his expatriate apprenticeship; he is also in American Novelists, 1910-1943 with an entry surveying his entire career. Each volume includes a cumulative index of subject authors. The final DLB volume will be a comprehensive index to the entire series.
Mark Twain*
The advisory board, the editors, and the pub¬ lisher of the Dictionary of Literary Biography are joined in endorsing Mark Twain’s declaration. The literature of a nation provides an inexhaustible re¬ source of permanent worth. It is our expectation that this endeavor will make literature and its creators better understood and more accessible to students and the literate public, while satisfying the standards of teachers and scholars.
With volume ten in 1982 it was decided to enlarge the scope ol DLB beyond the literature of the United States. By the end of 1983 twelve vol¬ umes treating British literature had been pub¬ lished, and volumes for Commonwealth and Mod¬ ern European literature were in progress. The series has been further augmented by the DLB Year¬ books (since 1981) which update published entries and add new entries to keep the DLB current with contemporary activity. There have also been occa¬ sional DLB Documentary Series volumes which pro¬ vide biographical and critical background source materials for figures whose work is judged to have particular interest for students. One of these com¬ panion volumes is entirely devoted to Tennessee Williams.
To meet these requirements, literary biography has been construed in terms of the author’s achieve¬ ment. The most important thing about a writer is his writing. Accordingly, the entries in DIB are career biographies, tracing the development of the author s canon and the evolution of his reputation. The publication plan for DLB resulted from two years of preparation. The project was proposed to Bruccoli Clark by Frederick G. Ruffner, presi¬ dent of the Gale Research Company, in November 1975. After specimen entries were prepared and typeset, an advisory board was formed to refine the entry format and develop the series rationale. In meetings held during 1976, the publishe r, series editors, and advisory board approved the scheme for a comprehensive biographical dictionary of per¬ sons who contributed to North American literature. Editorial work on the first volume began in January 1977, and it was published in 1978. In order to make DLB more than a reference tool and to compile volumes that individually have claim to status as literary history, it was decided to organize volumes by topic or period or genre. Each of these freestanding volumes provides a bio¬ graphical-bibliographical guide and overview for a particular area of literature. We are convinced that this organization — as opposed to a single alphabet method—constitutes a valuable innovation in the presentation of reference material. The volume plan necessarily requires many decisions for the
The purpose of DLB is not only to provide reliable information in a convenient format but also to place the figures in the larger perspective of literary history and to offer appraisals of their accomplishments by qualified scholars. We define literature as the intellectual commerce of a nation-, not merely as belles lettres, but as that ample and complex process by which ideas are generated, shaped, and transmitted. DLB entries are not limited to “creative writers” but extend to other figures who in this time and in this way influ¬ enced the mind of a people. Thus the series en¬ compasses historians, journalists, publishers, and screenwriters. By this means readers of DLB may be aided to perceive literature not as cult scripture in the keeping of cultural high priests, but as at the center of a nation’s life. DLB includes the major writers appropriate to each volume and those standing in the ranks im¬ mediately behind them. Scholarly and critical coun-
*trom an unpublished section of Mark Twain’s autobiography, copyright © by the Mark Twain Company.
IX
DLB 38
Plan of the Series
modern authors. The dust jackets are a special fea¬ ture of DLB because they often document better than anything else the way in which an author’s work was launched in its own time. Specimens of the writers’ manuscripts are included when feasible. A supplement to DLB — tentatively titled A Guide, Chronology, and Glossary for American Litera¬ ture— will outline the history of literature in North America and trace the influences that shaped it. This volume will provide a framework for the study of American literature by means of chronological tables, literary affiliation charts, glossarial entries, and concise surveys of the major movements. It has been planned to stand on its own as a vade mecum, providing a ready-reference guide to the study of American literature as well as a companion to the DLB volumes for American literature.
sel has been sought in deciding which minor figures to include and how full their entries should be. Wherever possible, useful references will be made to figures who do not warrant separate entries. Each DLB volume has a volume editor re¬ sponsible for planning the volume, selecting the figures for inclusion, and assigning the entries. Volume editors are also responsible for preparing, where appropriate, appendices surveying the ma¬ jor periodicals and literary and intellectual move¬ ments for their volumes, as well as lists of further readings. Work on the series as a whole is coordi¬ nated at the Bruccoli Clark editorial center in Co¬ lumbia, South Carolina, where the editorial staff is responsible for the accuracy of the published volumes. One f eature that distinguishes DLB is the illus¬ tration policy—its concern with the iconography of literature. Just as an author is influenced by his surroundings, so is the reader’s understanding of the author enhanced by a knowledge of his environ¬ ment. Therefore DLB volumes include not only drawings, paintings, and photographs of authors, often depicting them at various stages in their careers, but also illustrations of their families and places where they lived. Title pages are regularly reproduced in facsimile along with dust jackets for
Samuel Johnson rightly decreed that “The chief glory of every people arises from its authors.” The purpose of the Dictionary of Literary Biography is to compile literary history in the surest way avail¬ able to us—by accurate and comprehensive treat¬ ment of the lives and work of those who contributed to it. The DLB Advisory Board
x
Foreword Nineteen fifty-four ushered in a memorable period in Afro-American life. Brown v. The Board of Education paved the way not only for improve¬ ment in sociopolitical conditions, but also for a re¬ newed cultural consciousness among blacks. Within the next decade, the Montgomery bus boycott, stu¬ dent sit-ins, and the March on Washington would inspire a general climate of change and activism in American society that would affect Afro-American arts and letters. The surge of cultural spirit accom¬ panying political activity invigorated the creative writings of Afro-Americans and redefined the liter¬ ary work of black writers. In the post-1950s struggle for civil rights, opportunity, and equality, the liter¬ ature of modern Afro-Americans came of age. The writers included in this volume, whether they were born before or after World War II, all share in the redirected aesthetics of black recognition. They represent both a continuity with Afro-American artistic traditions and a forging ahead to new crea¬ tive territories. Mindful of the past, particularly the legacies of the New Negro Renaissance and its antecedents, these writers seized the immediate reality of their own times and in the process trans¬ formed the landscape of Afro-American writing. Afro-American poets and novelists, from the turn of the century on, have had their voices raised in the literary arena. Paul Laurence Dunbar, Lang¬ ston Hughes, and Richard Wright were household names long before reading or viewing audiences became aware of works by playwrights Theodore Ward and Louis Peterson in the 1940s and 1950s. Throughout the fifties Langston Hughes con¬ tinued to bring his dramas to the stage, but Peter¬ son’s Take a Giant Step in 1953 helped to focus se¬ rious attention on plays by Afro-Americans. Play¬ wright Alice Childress’s voice became synonymous with the efforts to bring black plays to black people and to integrate theater unions. The mid-1950s successes of Childress and Peterson gave way to Lorraine Hansberry’s phenomenal A Raisin in the Sun in 1959. Rightly considered a forerunner to black American drama, Hansberry stood at the pivotal point of the unprecedented changes that would soon occur in black representation on Amer¬ ican stages. When Hansberry’s play opened on Broadway to critical acclaim, it not only revitalized interest in plays about the experiences of blacks, but
also ended the decade with a promise of greater visibility for Afro-American playwrights. Drama evolved alongside poetry as a major genre for black writers. The stage world presented the opportunity for portable works with messages designed to engage audiences whose history in¬ volved a theater heritage ranging from early min¬ strel shows, musical revues, and church pageants to drama departments in black colleges, repertory companies, and community theater groups. Taking literature to the people, a main objective of poets coming to prominence in the 1960s and 1970s, also influenced the thinking of dramatists about their work. New black community theaters and profes¬ sional companies, such as the Free Southern Thea¬ ter in New Orleans, Black House in San Francisco, the New Federal Theatre and the Negro Ensemble Company in New York, evolved from the models of writing workshops, such as the Harlem Writers Guild, and public poetry readings, as well as from the traditions established by the Federal Theatre, Lafayette Theatre, Rose McClarendon Players, and the Harlem Suitcase Theater. Owen Dodson, Loften Mitchell, and Ted Shine are representative wri¬ ters who bridged the professional and collegiate drama communities, while Marvin X, Tom Dent, and Sonia Sanchez are indicative of playwrights who envisioned a particular kind of community theater. Fhe flood of creative outpourings in the 1960s that led to the black arts movement brought in its wake a new generation of dramatists who, together with prose writers and poets, provided some of the most influential voices in American literature. Dramatists Amiri Baraka and Ed Bullins joined poets of the stature of Nikki Giovanni, Sonia Sanchez, and Don L. Lee (Haki Madhubuti) in bringing to their audiences works that were de¬ signed for popular more often than critical appeal. Their direct, confrontational messages led to radi¬ cally revised staging techniques. Fhe early sixties introduced, in number and variety, new dramatic forms to larger audiences. Ossie Davis’s comedy Pur lie Victorious and Adrienne Kennedy’s surrealistic Funnyhouse of a Negro, though distinctly different in concept and execu¬ tion, are examples of the theatrical productions that carried messages of a reality rarely seen outside
xi
DLB 38
Foreword
partly responsible for their limited economic opportunities. While some other playwrights, such as Alice Childress, Charles Fuller, and N. R. David¬ son, Jr., created realistic dramas that drew upon the historical conditions of black American life, they too, like the more innovative dramatists of the 1960s and 1970s, invented on a level of sophisti¬ cated political thought and language. Although many of the playwrights of the 1960s and early 1970s were concerned with creat¬ ing theater for the people and with what Bullins called “street-corner theatre,” which took plays directly to ordinary working-class blacks, other playwrights in the seventies and eighties have com¬ bined this concern with an interest in reaching larg¬ er audiences through writing scripts for movies and television. Hansberry’s A Raisin in the Sun perhaps started the trend. It was followed by filmings of Baraka’s Dutchman, Elder’s Ceremonies in Dark Old Men and, more recently, Shange’s For Colored Girls. Maya Angelou, Charlie Russell, Bill Gunn, and Lonne Elder are a few of the writers who have contracted to write film scripts, Elder having also written episodes for popular television shows. Still other writers have, since the mid-seventies, worked primarily in the established New York literary com¬ munity. Shange’s searching drama of black women’s lives, for instance, has enjoyed major Broadway and off-Broadway productions. Writers who take advantage of such opportunities consis¬ tently suggest that an audience must be sought beyond those who read the texts. Their actions are a continuation of part of the philosophy espoused by the black arts movement that more than traditional means of expression should be used in taking the word to the people. What is apparent is that since the premiere of Lorraine Hansberry’s A Raisin in the Sun, black writers have had more diverse opportu¬ nities for disseminating their works, even though many of them, including Shine and Childress, have not yet achieved widespread recognition from the major productions of their works. Nurtured by a belief in the positive value of blackness, writers since the 1960s have directed their message to and about black people. Thus the drive toward integration and assimilation, which remained evident, gave way to a more prominent nationalistic, Pan-Africanist orientation among writers, who, in rejecting a western world view, sought a less oppressive and less decadent vision of the role of the artist and the function of art. Their themes address not only self-knowledge and group survival, but also love and celebration. In affirming self-worth and achievement, exponents of a black
black communities.
However, James Baldwin’s Blues for Mr. Charlie and LeRoi Jones’s Dutchman, Slave, and The Toilet announced the penetrating artistic explorations of black life that would capture the imaginations of other black writers. Jones (Amiri Baraka) sets the tone for the decade with his exploration in Dutchman of the many, hidden psychosexual relationships between blacks and whites in America. His work throughout the sixties and seventies addressed the redefinition of blacks, of social roles, and of cultural institutions. The drama of black revolution, connected with Baraka, William Wellington Mackey, Jr., Ben Caldwell, and Ron Milner, emphasized a cultural nationalism that was part of the black arts move¬ ment of the 1960s. It assumed both a black audience and the necessity of the artist’s relationship to the black community; it advocated a cultural revolution in spirit, ideas, and art, which confronted and ex¬ pressed the needs and aspirations of black people. As Baraka was to observe in 1968, “The Revolu¬ tionary Theatre should force change, it should be change. If the beautiful see themselves, they will know themselves.” Of primary importance were nationhood and self-determination. The drama of black experience, or the theater of reality, associ¬ ated with Ed Bullins, Paul Carter Harrison, Melvin Van Peebles, and Ted Shine similarly involved an emphasis on character and theme, on black people and their concerns. Many playwrights sought to break down the barriers between the illusion of the stage and the reality of existence beyond the theater by allowing their characters to interact directly with members of the audience. Constructed more often than not to make whites in the audience uncomfortable, such techniques also illustrated the political dimension that so many of the writers of the 1960s considered crucial to their art. When Ted Shine’s Grand¬ mother Love steps to the apron of the stage in this 1969 production and asks who in the audience will be next in her scheme to poison racists and thereby make her “contribution” to the civil rights struggle, she effectively closes the gap between art and life. For some of the playwrights who continued in fairly traditional veins of staging, such as Douglas Turner Ward, Ossie Davis, and Lonne Elder III, marked changes in approach to subject matter de¬ fined their work. Ward and Davis border on the farce in their depictions of Southern race relations; outrageous and discomforting portrayals of whites evoked broad laughter in the blacks viewing the shows. Elder dared to suggest that black men, by the perversity of the moral choices they make, might be xii
DLB 38
Foreword
Alex Haley, continue the oldest literary tradition among black American writers — that of recording personal and communal biography. For Angelou, shaping a self in the tradition of Frederick Douglass and Booker T. Washington is the force that has sustained her through four installments of her autobiography. Murray and Haley draw upon their personal and family histories to make Gasoline Point, Alabama, and Henning, Tennessee, memo¬ rable places in the history of Afro-American litera¬ ture. Others such as Ntozake Shange have used autobiography as one basis for their creative works, while still others, such as June Jordan and Alexis Deveaux, have used biography as a means of celebrating their forebears or of asserting the place of black ancestors in history and insuring that their stories will not be forgotten, that the meaning of their achievements and their defeats will not be lost. Perhaps the most significant contributor to preserving the past of Afro-Americans is Alex Haley, whose Roots inspired a generation of w7hite and black Americans to discover family history, to value the oral tradition, and to tell the little known stories of ordinary, yet heroic people. Haley suc¬ ceeded in giving new life to the idea of heritage and roots; his saga published in 1976 is in many ways a culmination of some of the ideas of the black arts movement, such as the emphasis on the need for black pride and using history as one of the bases for that pride. Based on long and arduous research, Haley’s family history also relies on the conventions of fiction; it gives evidence of a tendency since the 1960s to combine genres and to create new forms, as Shange does with her choreopoems, For Colored
aesthetic have refused adherence to white stan¬ dards of beauty or language. As Larry Neal stressed in 1968, they proposed “a separate symbolism, mythology, critique, and iconology,” which empha¬ sized the cultural heritage and traditions of black Americans, particularly African survivals, blues and jazz rhythms, oral folk culture, and spiritual sensibilities. As a result, a number of modern writ¬ ers have turned to prose essays in order to explain their objectives and to iterate the theories defining their work. Neal, Kalamu ya Salaam, Baraka, Woodie King, and others have written essays assert¬ ing connections between the historical contribu¬ tions and value systems of blacks and the creative possibilities in black life. Albert Murray has investi¬ gated folk culture, and like Neal and Baraka, has written about the primacy of musical forms in crea¬ tive works by Afro-Americans. Other waiters such as Toni Cade Bambara, Arthenia Bates Millican, and James Alan McPher¬ son have worked mainly in short fiction, but they, like the majority of Afro-American writers since the sixties, have been influenced by the language and culture of blacks and have extended their short stories to encompass added possibilities for perceiv¬ ing and portraying the reality and truth of AfroAmerican life and history. Bambara adopts the folk speech of black Americans in Gorilla, My Love and consciously writes in “black English.” She is con¬ cerned with relationships between children and parents as wrell as with the effect of the environment upon adolescent development. Like Bambara, Mil¬ lican and McPherson provide unique glimpses into Afro-American life by dwelling on the insides of black communities w'ithin the United States, on black people interacting with each other in loving and protecting, as well as in shaping futures for themselves. Within the short fictional form, howev¬ er, Bambara in particular is as successful as the playwrights in bringing activism to the page, in closing the gap between politics and art. Prose writings proliferated in the decades since the 1950s, and just as dramatists were in¬ terested in creating a theater in their own image, so w7ere the writers of prose interested in literary crea¬ tions, relevant to black Americans. Autobiography and biography have become increasingly important as modes for expressing conceptions of sell and of the meaning of Afro-American history. Prose writ¬ ers, such as Maya Angelou, Albert Murray, and
Girls and Spell #7.
The writers included here have made signifi¬ cant contributions to modern literature, but with a few notable exceptions (Baraka, Angelou, Bullins, McPherson) they have remained largely unknown to general readers and specialists alike. Their phe¬ nomenal output, frequently published by small presses and little magazines, deserves greater atten¬ tion from students of literature, and the writers themselves merit further acknowledgment from literary scholars. This volume, then, represents an initial effort to make these post-1955 writers and bibliographies of their works more accessible for further research and study. — Thadious M. Davis and Trudier Harris
xiii
Acknowledgments This book was produced by BC Research. Karen L. Rood is senior editor for the Dictionary of Literary Biography series. Ellen Rosenberg Kovner was the in-house editor. Art supervisor is Claudia Ericson. Copyedit¬ ing supervisor is Joycelyn R. Smith. Typesetting supervisor is Laura Ingram. The production staff includes Rowena Betts, Kimberly Casey, Patricia Coate, Kathleen M. Flanagan, Joyce Fowler, Pam Haynes, Judith K. Ingle, Victoria Jakes, Vickie Lowers, Judith McCray, Jane McPherson, Alice Parsons, and Kerry Pound. Jean W. Ross is permis¬ sions editor. Joseph Caldwell, photography editor, did photographic copy work for the volume. Walter W. Ross did the research with the
assistance of the staff at the Thomas Cooper Li¬ brary of the University of South Carolina: Lynn Barron, Daniel Boice, Sue Collins, Michael Free¬ man, Gary Geer, Alexander M. Gilchrist, David L. Haggard, Jens Holley, David Lincove, Marcia Mar¬ tin, Roger Mortimer, Jean Rhyne, Karen Rissling, Paula Swope, and Ellen Tillett. We would like to acknowledge the invaluable help given by Tom Dent, James V. Hatch, Portia Howard, E. Ethelbert Miller, Vivian Robinson, Les¬ lie Sanders, and Jerry Ward, who all shared in¬ formation and materials. Serendipity Books in Berkeley, California, and University Book Place in New York City assisted in providing illustrations.
xv
Dictionary of Literary Biography • Volume Thirty-eight
Afro-American Writers After 1955: Dramatists and Prose Writers
Dictionary of Literary Biography
Maya Angelou (4 April 1928-
)
Lynn Z. Bloom Virginia Commonwealth University
BOOKS: I Know Why the Caged Bird Sings (New York: Random House, 1970); Just Give Me A Cool Drink of Water ’fore I Diiie (New Y'ork: Random House, 1971); Gather Together in My Name (New York: Random House, 1974); Oh Pray My Wings Are Gonna Fit Me Well (New York: Random House, 1975);
RECORDINGS: Miss Calypso, Liberty Records, 1957; The Poetry of Maya Angelou, GWP Records, 1969; An Evening With Maya Angelou, Pacific Tape Library (BC 2660), 1975; Women in Business, University of Wisconsin, 1981. PERIODICAL PUBLICATIONS: “Nina Simone: High Priestess of Soul,” Redhook, 136 (Novem¬ ber 1970): 77, 132-134; “Cicely Tyson: Reflections on a Lone Black Rose,” Ladies’ Home Journal, 94 (February 1977): 4041, 44, 46; “Why I Moved Back to the South,” Ebony, 37 (February 1982): 130-134.
Singin’ and Swingin’ and Gettin’ Merry Like Christmas
(New York: Random House, 1976); And Still I Rise (New York: Random House, 1978); The Heart of a Woman (New York: Random House,
1981); Shaker, Why Don’t You Sing? (New York: Random
House, 1983). PLAY PRODUCTIONS: Cabaret for Freedom,, by Angelou and Godfrey Cambridge, New York, Village Gate Theatre, 1960; The Least of These, Los Angeles, 1966; Ajax, adapted Sophocles’ play, Los Angeles, Mark Taper Forum, 1974; And I Still Rise, Oakland, Cal., Ensemble Theatre, 1976.
Maya Angelou’s literary significance rests upon her exceptional ability to tell her life story as both a human being and a black American woman in the twentieth century. Four serial autobiographi¬ cal volumes have been published to date (in 1970, 1974, 1976, and 1981), covering the period from 1928 to the mid-1960s; more may be expected. She asserts in I Know Why the Caged Bird Sings (1970): “The fact that the adult American Negro female emerges a formidable character is often met with amazement, distaste and even belligerence. It is seldom accepted as an inevitable outcome of the struggle won by survivors and deserves respect if not enthusiastic acceptance.” And yet, Angelou’s own autobiographies and vivid lectures about her¬ self, ranging in tone from warmly humorous to bitterly satiric, have won a popular and critical fol¬ lowing that is both respectful and enthusiastic. As she adds successive volumes to her life
SCREENPLAYS: Georgia, Georgia, IndependentCinerama, 1972; All Day Long, American Film Institute, 1974. TELEVISION: Black, Blues, Black [series], National Educational Television, 1968; Assignment America [series], 1975; “The Legacy,” 1976; “The Inheritors,” 1976; “Sister, Sister,” NBC, 7 June 1982. 3
DLB 38
Maya Angelou story, she is performing for contemporary black American women — and men, too—many of the same functions that escaped slave Frederick Doug¬ lass performed for his nineteenth-century peers through his autobiographical writings and lectures. Both become articulators of the nature and validity of a collective heritage as they interpret the particu¬ lars of a culture for a wide audience of whites as well as blacks; as one critic said, Angelou illuminates “with the intensity of lightning the tragedy that was once this nation’s two-track culture.” As people who have lived varied and vigorous lives, they embody the quintessential experiences of their race and cul¬ ture. An account of the life and major writings of Maya Angelou is of necessity based largely on in¬ formation that she herself has supplied in her auto¬ biographies; where lacunae exist, they do so be¬ cause Angelou herself has chosen not to discuss certain periods of time, events, or people. “I will say how old I am [53], I will say how tall I am [six feet], but I will not say how many times I have been married,” she told an interviewer in 1981; “It might frighten them off.” Angelou’s odyssey — psychological, spiritual, literary, as well as geographical — begins with / Know Why the Caged Bird Sings, generally acceded to be the best of her four autobiographical volumes and the exclusive focus, to date, of serious critical attention. Marguerite Johnson (she did not become Maya Angelou until her debut as a dancer at the Purple Onion cabaret in her early twenties) was born in St. Louis on 4 April 1928 to Bailey and Vivian Baxter Johnson. When she was three and her brother Bailey was four, they were sent by their divorced parents to live in Stamps, Arkansas, which was, she said, the same as “Chitlin’ Switch, Georgia; Hang ’Em High, Alabama; Don’t Let the Sun Set on You Here, Nigger, Mississippi.” “High spots in Stamps were usually negative,” she observes, “droughts, floods, lynchings and deaths.” There Angelou remained for a decade, reared by her maternal grandmother, Annie (“Momma”) Henderson, who kept a country store and ruled her grandchildren with the same sense of “work, duty, religion,” and morality with which she ruled her own life. Observes Angelou, “I don’t think she ever knew that a deep-brooding love hung over everything she touched.” In Stamps Angelou learned what it was like to be a black girl in a world whose boundaries were set by whites. She learned what it meant to wear for Easter a “plain ugly cut-down [dress] from a white woman’s once-was-purple throwaway,” her skinny
legs “greased with Blue Seal Vaseline and pow¬ dered with the Arkansas red clay.” As a young child she expected at any minute to wake from “my black ugly dream” and find her “Nappy black hair” meta¬ morphosed to a long, blonde bob. She thought, then, that “God was white,” but wondered whether He would “allow His only Son to mix with this crowd of cotton pickers and maids, washerwomen and handymen.” She learned the humiliation of being refused treatment by a white dentist who would “ ‘rather stick my hand in a dog’s mouth than in a nigger’s.’ ” But she learned, also, that blacks would not only endure, but prevail. Momma, head of one of the few black families “not on relief” during the Depression, was an honest but shrewd business¬ woman who could turn aside the taunts of the “powhitetrash” and beat the bigoted dentist at his own game. From her Angelou learned common sense, practicality, and the ability to control one’s own destiny that comes from constant hard work and 4
DLB 38
Maya Angelou
courage, “grace under pressure.” She learned, sometimes forcibly, the literature of black writers: “Bailey and I decided to memorize a scene from The Merchant of Venice, but we realized that Momma would question us about the author and that we’d have to tell her that Shakespeare was white, and it wouldn’t matter to her whether he was dead or not. So we chose ‘The Creation’ by James Weldon John¬ son instead.”
Labor School. Her informal schooling, in the “fourteen-room typical San Franciscan post-Earthquake” rooming house her mother ran in the Fillmore Dis¬ trict, was much more extensive. From her mother she learned “proper posture, table manners, good restaurants”; from her stepfather, how to play “poker, blackjack, tonk and high, low, Jick, Jack and the Game”; from the household, the ways of ship¬ yard workers, “much-powdered prostitutes,” and “the most colorful characters in the Black under¬ ground.” These people she accepted as honest in their own way. But she fled the hypocrisy of a summer vacation with her failed father and his nouveau bourgeois girl friend in their tacky trailer in south¬ ern California. Unable to return to her mother for a month, she lived in a graveyard of wrecked cars, many inhabited by homeless children whose own natural brotherhood “set a tone of tolerance for my life.” The book ends with her determined rush to¬ ward maturity. With the perseverance that fore¬ shadowed later civil rights work, she finally obtained a job, while still in high school, as the first black woman streetcar conductor in San Francisco. With equal determination to prove that she was a woman, she became pregnant and at sixteen was delivered of a son one month after graduation from Mission High School’s summer school in 1945. She has since been awarded honorary degrees by Smith College, Mills College, and Lawrence University, among others. The next installment of Angelou’s auto¬ biography, Gather Together in My Name (1974), seems much less satisfactory than the first. This may be in large part because here Angelou is less admirable as a central character than she was in / Know Why the Caged Bird Sings. Here, in instance after instance, she abandons or jeopardizes the maturity, honesty, and intuitive good judgment toward which she had been moving in Caged Bird. Her bold, headstrong temperament leads her to bluff her way into situa¬ tions dangerous to herself and her infant son, Guy; when she cannot learn enough quickly enough to escape she becomes dependent on others who too often exploit her naivete and good will—when she is not exploiting theirs. As Angelou anatomizes her exploits, it is hard to tell whether she intends this segment of her life story to be emblematic of the lives of all other unwed, undereducated black teen¬ age mothers, or for her misadventures to serve as a warning to others, or to demonstrate as she did in Caged Bird the survival and staying power of black women in adverse circumstances. The wit and
But the pride in herself this new knowledge engendered took a devastating fall when she was eight, during a brief stay in St. Louis with her beautiful mother, Vivian Baxter, “light-skinned with straight hair.” She was raped by her mother’s boyfriend, a taciturn “big brown bear” who was found “dropped . . . [or] kicked to death” shortly afterward. In court she had not revealed that she had permitted him to fondle her on two earlier occasions. Therefore she felt responsible for his murder (committed by her uncles), and she decided that “I had to stop talking.” Back in Stamps, where she was sent perhaps because “the St. Louis family just got fed up with my grim presence,” her bourgeoning pride dis¬ appeared for nearly five years, along with her speech. Both were restored by delicious afternoons, “sweet-milk fresh” in memory, of reading and recit¬ ing the world’s great literature with Mrs. Flowers, the educated “aristocrat of Black Stamps” who “acted just as refined as whitefolks in the movies and books and . . . was more beautiful”; “she made me proud to be a Negro, just by being herself.” She learned during this time the importance of self-expression, as well as communication, for “the wonderful, beautiful Negro race” survives “in exact relationship to the dedication of our poets (include preachers, musicians and blues singers).” She explained to an interviewer in 1981 that “there isn’t one day since I was raped that I haven’t thought about it... I have gotten beyond hate and fear, but there is something beyond that.” Her mul¬ tiple careers in the arts—singing, dancing, and writing—have become ways of transcending her personal hates and fears, as well as of proclaiming her black identity and pride. In 1940, after Angelou’s graduation at the top of her eighth grade, her fun-loving mother, now a professional gambler, moved the children from Stamps to San Francisco, imposing experience on innocence, disorder upon order. Maya’s subse¬ quent formal education consisted of attending George Washington High School in San Francisco throughout World War II, while concurrently tak¬ ing dance and drama lessons at the California
5
DLB 38
Maya Angelou
Praise for Maya Angelou s
1 know that not since the days of my childhood, when people in books were more real than the people one saw- every day, have I found myself so moved."
-James Baldwin
.full of laughter and tears, love and hate, failures and triumphs, and above all. understanding.”
-John O. Killens
dome of the inc idents she depicts are wonderfully funny. But .
inonary of the incidents cannot do this book justice; one has i end it to appreciate its sensitivity and life.” — Robert A. Gross. Newsweek ■.mb menus]y touching and comic.” i" n a heroic .and beautiful book.”
' 'lore - ICKNN'ETM P. &«'( KN
—The New York Times
Random House
—Cleveland Plain Dealer
394-48692-7
Dust jacket for Angelou s second autobiographical volume, in which, according to Shana Alexander, “the ‘caged bird’ soars”
met a pair of lesbian lovers and, fearing seduction, conned them into letting her become their manag¬ er. At eighteen she had “managed in a few tense years to become a snob at all levels, racial, cultural and intellectual. I was a madam and thought myself morally superior to the whores. I was a waitress and believed myself cleverer than the customers I served. I was a lonely unmarried mother and held myself to be freer than the married women I met.” Seeking sanctuary in Stamps when her tenweek-old empire crashed brought no solace. She talked back to a “slack-butted” store clerk, and the threat of a reprisal by the Ku Klux Klan caused Momma Henderson to send Angelou back to San Francisco for safety. Then, rejected on the eve of her induction into the army because she lied on her application, she escaped into marijuana and sought solace in the dream that is an ironic leitmotif of Gather Together: “I was going to have it made—and no doubt through the good offices of a handsome man who would love me to distraction.” Her artificial high was replaced by a natural
panache with which she narrates her picaresque tale prevent it from being a confessional; the writing of this volume itself may be the final exorcism of the flaws. Angelou is determined to leave her mother’s household, “take a job and show the whole world (my son’s father) that I was equal to my pride and greater than my pretensions.” As soon as she dis¬ covered that the Creole Cafe would pay $75 a week for a cook, “I knew I could cook Creole, whatever that was.” She learned quickly, and with equal haste fell in love with a customer: “When he opened the steamy door to the restaurant, surely it was the second coming of Christ.” When the affair ended after two months (he was engaged to another woman) Angelou decided to make a new life in San Diego, buttressed by $200 and her mother’s advice, unwittingly prophetic: “ ‘Be the best of anything you get into. If you want to be a whore, it’s your life. Be a damn good one.’ ” Angelou’s gradual initiation into prostitution began with a job as a nightclub waitress. There she
t
6
DLB 38
Maya Angelou
one as she became part of a nightclub dancing act, with R. L. Poole as her partner, manager, mentor, and intermittent lover: “As a dancer, my instru¬ ment was my body. I couldn’t just allow . . . anyone to screw my instrument.” The emergence of Poole’s drug dependent “old lady” ended their liaison, and Angelou fled again into a restaurant kitchen and daydreams of the perfect husband. Her romantic imagination, inspired by a naivete that never ripened into wisdom during the three-year span of Gather Together, endowed the dapper L. D. Tolbrook, “an established gambler who had Southern manners and big city class,” with the means for her salvation. Prepared to be “an old man’s darling,” deluded by her wish to marry, she too willingly rationalized the virtues of life as a prostitute earning money for him: “ ‘Prostitution is like beauty. It is in the eye of the beholder. There are married women who are more whorish than a street prostitute because they have sold their bodies for marriage licenses, and there are some women who sleep with men for money who have great integrity because they are doing it for a purpose.’ ” It took threats of violence from her brother, himself on the verge of drug addiction, to keep her from returning to the whorehouse after a week’s dismal stint. She tried a few more legitimate jobs, but survival “didn’t take hold.” She rejected the traditional options for black women: hustling (“I obviously had little aptitude for that”), working as a housemaid (“I would keep my negative Southern exposures to whites before me like a defensive hand”), or “wrestling with old lady Welfare (my neck wouldn’t bend for that).” Prepared to turn to hard drugs again because of an unrealistic romantic love, she was dragged from the edge of addiction’s abyss by her lover, who forced her to watch him shoot up in a sewerlike “hit joint for addicts.” She concludes her account of this sordid segment of her life with a plea for forgiveness which is devoid of moral reflection. She was seemingly neither sadder nor wiser: “As I watched the wretched nod and scratch, I felt my own innocence as real as a grain of sand between my teeth. I was pure as moonlight and had only begun to live. My escapades were the fumblings of youth and to be forgiven as such.” In the third volume of Angelou’s saga, Singin’ and Swingin’ and Cellin' Merry Like Christmas (1976), her actions finally began to match her aspirations for maturity, though intermittently, as she lurched and ultimately strode through the years from 19501955. At about twenty-two (Angelou is usually vague about dates) she married Tosh Angelos, an
ex-sailor “intelligent, kind and reliable.” And white. Her mother exploded in rage, anticipating “A hell of a wedding gift—the contempt of his people and the distrust of your own.” Although she experienced little of either, the fortress of bourgeois respectability for which she had longed soon became a prison, restrictive of her independence. Too free a spirit to remain fettered for long, she was divorced within three years and resumed her career as a dancer, entertaining cus¬ tomers as the first black dancer at a local bar with “a little rhumba, tango, jitterbug, Susy-Q, trucking, snake hips, conga, Charleston and cha-cha-cha.” Before long she attracted the notice of the much more skilled performers at the chic Purple Onion and was soon, to her amazement, offered a job there: “There whites were treating me as an equal, as if I could do whatever they could do. They did not consider that race, height, or gender or lack of education might have crippled me and that I should be regarded as someone invalided.” Stripped of these excuses for failure, Angelou had to succeed on her own. And she did. She turned down one of the lead roles in the Broadway produc¬ tion of House of Flowers to join the European touring cast of Porgy and Bess. She devotes over half the book to describing the tour—from Montreal to Paris, Zagreb, and Belgrade, from Greece to Egypt, Israel, and Italy: “Dancing and singing every night with sixty people was more like a party than a chore.” She loved the ambience of the tightly knit, black professional community; she loved the free¬ dom as well as the work, freedom from housework, “freedom from the constant nuisance of a small child’s chatter,” freedom from the mores of the bourgeois world she had only recently walked out on. But duty to her child, nine and miserable with¬ out her, drove her home. Guilt over her neglect of him nearly drove her to suicide, but love of life and of motherhood and of dancing drove her instead to resume her career. In The Heart of a Woman (1981) Angelou in¬ tertwines an account of seven years of her own coming of age (1957-1963) with the coming of age of the civil rights movement and the beginning of the women’s movement. Her enlarged focus and clear vision transcend the particulars and give this book a fascinating universality of perspective and psychological depth that almost matches the quality of I Know Why the Caged Bird Sings (in contrast to the shallower and more limited intervening volumes). Its motifs are commitment and betrayal.
7
DLB 38
Maya Angelou
progress and racial integration,” excoriating “white men, white women, white children and white his¬ tory, particularly as is applied to black people.” Through Killens and others she learned to ac¬ knowledge her kinship with blacks nationwide: “ ‘Georgia is Down South. California is Up South. If you’re black in this country you’re on a planta¬
By the time she was thirty, Angelou had made a commitment to become a writer. Inspired by her friendship with the distinguished social activist au¬ thor John Killens, she moved to Brooklyn to be near him and to learn her craft. Through weekly meet¬ ings of the Harlem Writers Guild she learned to treat her writing seriously: “If I wanted to write, I had to be willing to develop a kind of concentration found mostly in people awaiting execution. I had to learn technique and surrender my ignorance.” And, although it was difficult, she learned to toler¬ ate criticism, however harsh, and was accepted as a practicing member of a group of established writers that included John Henrik Clarke, Paule Marshall, and James Baldwin. Recognizing that “trying to overcome was black people’s honorable tradition,” Angelou resolved to overcome the problems in her writing until it met the exacting standards of her literary mentors. At the same time Angelou made a commit¬ ment to promote black civil rights. Her widening circle of black intellectual friends was “persistently examining the nature of racial oppression, racial
tion.’ ” So when she met Martin Luther King she was prepared to accept his challenge: “We, the black people, the most displaced, the poorest, the most maligned and scourged, we had the glorious task of reclaiming the soul and saving the honor of the country.” With comedian Godfrey Cambridge she organized a benefit, “Cabaret of Freedom,” for King’s Southern Christian Leadership Conference. She was starring “on the stage of life,” a “general in the army” of fighters against legal discrimination, and as a consequence was soon appointed by the veteran civil rights activist, Bayard Rustin, to suc¬ ceed him as the SCLC’s northern coordinator. Dur¬ ing her six months in office she was grateful for the interracial cooperation that was “new and old and
Dust jackets for the third and fourth volumes of what has been called “one of the more significant and important personal narratives of our time”
8
DLB 38
Maya Angelou
dynamic,” from children to adults alike, not only in Harlem but throughout the nation. The same dynamism pervaded the black support of commu¬ nists, from Castro’s Cuba to Russia. Angelou vividly captures the mood of the era with snatches of song, dialogue, and slogans that dynamically punctuate this book: “Castro never had called himself white, so he was O.K. from the git. . . and as black people often said . . . ‘Wasn’t no Communist lynched my poppa or raped my mamma.’ ‘Hey, Khruschev. Go on, with your bad self.’ ” Despite her increasing maturity as a writer and her effective advocacy of black civil rights, Angelou, in her early thirties, still retained the romantic notion of quiet suburban domesticity that had betrayed her repeatedly in her teens and early twenties and was to do so again. She, who by this time had performed with Odetta, and the revolu¬ tionary Clancy Brothers (“ ‘the shamrock Is forbid by law/to grow on Irish ground’ ”), and had gotten half of Harlem to demonstrate at the United Na¬ tions to protest Patrice Lumumba’s assassination, proposed marriage to a laconic bail bondsman she had met in a bar. As he plied her with engagement presents of stolen goods he had confiscated, she was preparing to “cook, clean house . . . and join some local women’s volunteer organizations.” In betraying her active, creative life, she could only betray her fiance. Indeed, she left him quickly for the bulky, impeccably suave Vusumzi Make, a South African freedom fighter who proposed to her instantly, claiming that their marriage would be “ ‘the joining of Africa and Africa-America!’ ” Although despite their good intentions they were never legally wed, Make’s initial adoration helped Maya, ever romantic, to feel exactly the way she wanted to, like “a young African virgin, made beautiful for her chief.” Make convinced her to accept a major theatrical role, as the White Queen in Jean Genet’s The Blacks, effectively countering her objection, “ ‘The play says given the chance, black people will act as cruel as whites,’ ” with, “ ‘Dear Wife, that is a reverse racism. Black people are human. No more, no less.’ ” They left New York in the same flutter of unpaid bills that pursued them to Egypt. While Make stumped the world for South African free¬ dom and shamelessly womanized on the side, Ange¬ lou violated an African prohibition against women working and got a job to help pay the bills. Make met her announcement that she was associate editor of the English language Arab Observer (another type of work she, typically, had to learn on the job) with a tirade that vilified her “insolence, independence,
lack of respect, arrogance, ignorance, defiance, cal¬ lousness, cheekiness and lack of breeding.” “He was right,” Angelou concluded. But this marked the beginning of the end of their liaison, as he con¬ tinued to betray her sexually and she persisted in remaining true to her black American culture that ultimately could not bend to his African world view. Before a tribunal of the African diplomatic community she defended, “with openness and sass,” her decision to leave Make. The “African palaver” vindicated her and assured her an inde¬ pendent welcome in the African community. The Heart of a Woman, which has received consistent critical acclaim, ends with her arrival in Kwarne Nkrumah’s Ghana to enroll her son in the Universi¬ ty of Ghana, her commitment to black freedom—as well as her own—intact. From 1973 to 1981 she was married to Paul du Feu. In describing her development in her auto¬ biographies, Angelou gives generous credit to the influences of dominant women during her child¬ hood. I Know Why the Caged Bird Sings focuses on three impressive female role models: “Momma” Henderson, her powerful, enterprising, righteous, religious grandmother; Mrs. Flowers, beautiful, cultivated, and pridefully black; and her mother, the sexy, sassy, and savvy embodiment of black mores. The combined characteristics of these women became leitmotifs throughout the volumes of Angelou’s autobiography. Men, however, get little credit for who she is and how she got that way. During Angelou’s child¬ hood, adult black men were either absent (her father), weak (her crippled uncle), subservient to women (her uncle and her mother’s boyfriends), sexually abusive (the man who raped her), or lazy and hedonistic (her father when she met him again in her teenage years). Of the men she has romantic relationships with as an adult (to the point at which Heart of a Woman ends), the blacks are either stodgy (her bail bondsman fiance) or unwilling to make a long-term commitment (Make). The man who treats her with greatest respect and affection is white (Angelos, her first husband). But the primary disruptive factor in all these relationships is Angelou’s quest for self-identity, manifested through self-assertiveness and the selfexpression that come not only from her careers as a dancer, a singer, and a writer, but from being very good at these endeavors. As she matures, she be¬ comes more and more her own person. Through her own efforts and innate talent, which she mini¬ mizes in concentrating on the results, she succeeds early and spectacularly in these highly competitive
9
DLB 38
Maya Angelou
Dust jacket for Angelou s 1978 book. In the title poem she ivrites, “You may trod me in the very dirt!but still, like dust, I'll rise.”
fields in which many fail. Her enjoyment of the freedom, mobility, independence, and acclaim that success makes possible is evident from the zestful assurance with which she writes her autobiog¬ raphies. Angelou’s three slim volumes of poetry, Just Give Me a Cool Drink of Water fore I Diiie (1971, which incorporates many of the lyrics from the 1969 re¬ cording of The Poetry of Maya Angelou), Oh Pray My Wings Are Gonna Fit Me Well (1975), and And Still l Rise (1978), are of lesser stature than her autobio¬ graphical writing. Much of Angelou’s poetry, almost entirely short lyrics, expresses in strong, often jazzy rhythms, themes common to the life experiences of many American blacks—discrimination, exploita¬ tion, being on welfare. Some of her poems extol the survivors, those whose black pride enables them to prevail over the otherwise demeaning circum¬ stances of their existence. Thus in “When I Think
About Myself” she adopts the persona of an aging domestic to comment ironically about the phe¬ nomenon of black survival in a world dominated by whites: “Sixty years in these folks’ world/The child I works for calls me girl/I say ‘Yes ma’am’ for work¬ ings’ sake./Too proud to bend/Too poor to break.” In “Times-Square-Shoeshine Composition,” the feisty black shoeshine boy defends, in dialect, his thirty-five-cent price against the customer who tries to cheat him out of a dime, his slangy remarks punctuated by the aggressive “pow pow” of the shoeshine rag. Other poems deal with social issues and prob¬ lems which, though not unique to blacks, are ex¬ plored from a black perspective. In “Letter to an Aspiring Junkie,” a street-smart cat cautions the prospective junkie to beware, “Climb into the streets, man, like you climb/into the ass end of a lion.” Angelou sympathizes with the plight of aban¬ doned black children, embodied in “John J,” whose
10
DLB 38
Maya Angelou
“momma didn’t want him,” and who ends up gam¬ bling in a bar with a “flinging singing lady.” Her superficial look at “Prisoners” shows them predict¬ ably experiencing “the horror/of gray guard men” — “It’s jail/and bail/then rails to run.” At her most irritating, Angelou preaches. In language and hortatory tone reminiscent of popular turn-of-thecentury poetry, she advises readers to “Take Time Out” to “show some kindness/for the folks/'who thought that blindness/was an illness that/affected eyes alone.” When Angelou’s lyrics deal with the common experiences of licit and illicit love, and of youth and aging, she writes from various female perspectives similar to those Dorothy Parker often used, and with Parker’s self-consciousness, but without her wit. For example, in “Communication I” the love¬ lorn damsel, impervious to her wooer’s quotations from Pope, Shaw, and Salinger, “frankly told her mother/‘Of all he said I understood,/he said he loved another.’ ” In mundane imagery (“The day hangs heavy/loose and grey/when you’re away”) a
comparable persona laments her lover’s evasiveness (“Won’t you pull yourself together/For/Me/ ONCE”). And she screams at the silent “Tele¬ phone,” “Ring. Damn you!” Her occasional vivid black dialect,(“But forty years of age . . . /stomps/ no-knocking/into the script/bumps a funky grind on the/shabby curtain of youth. . . . ”) enlivens ex¬ pressions that seldom rise above the banal. Her poems' seem particularly derivative and cloying when expressed in conventional language: “My pencil halts/and will not go/along that quiet path /1 need to write/of lovers false. ...” Angelou’s poetry becomes far more interest¬ ing when she dramatizes it in her characteristically dynamic stage performances. Angelou’s statuesque figure, dressed in bright colors (and sometimes, African designs), moves exuberantly, vigorously to reinforce the rhythm of the lines, the tone of the words. Her singing and dancing and electrifying stage presence transcend the predictable words and rhymes. In the early 1970s Angelou wrote a screenplay
taya Angelou Dust jacket for Angelou’s 1983 poetry collection. Her poems are as much a part of her life story as her autobiographical prose.
11
DLB 38
Maya Angelou
References: Liliane K. Arensberg, “Death as a Metaphor of Self in / Know Why the Caged Bird Sings,” College Language Association Journal, 20 (December 1976): 273-291;
and score for the film Georgia, Georgia, and a tenpart television series on African traditions in Amer¬ ican life. Because she continues to write, a final critical assessment of her work would at this point be premature. Yet it is clear from the four-volume serial autobiography that Angelou is in the process of becoming a self-created Everywoman. In a litera¬ ture and a culture where there are many fewer exemplary lives of women than of men, black or white, Angelou’s autobiographical self, as it ma¬ tures through successive volumes, is gradually assuming that exemplary stature. / Know Why the Caged Bird Sings begins with the words from a spiritual:
“The Black Scholar Interviews Maya Angelou,” Black Scholar, 8 (January-February 1977): 44-53; Stephanie A. Demetrakopoulos, “The Metaphysics of Matrilinearism in Women’s Autobiogra¬ phy,” in Womens Autobiography: Essays in Criti¬ cism, edited by Estelle C. Jelinek (Blooming¬ ton: Indiana University Press, 1980), pp. 180205; George E. Kent, “Maya Angelou’s I Know Why the Caged Bird Sings and Black Autobiographical Tradition,” Kansas Quarterly, 7 (Summer 1975): 72-78;
What you lookin at me for? I didn’t come to stay . . .
Angelou’s autobiographical volumes explain both why she is worth being looked at and why, like many blacks, both real and fictional, she “didn’t come to stay” but is always moving on. For she is forever impelled by the restlessness for change and new realms to conquer that is the essence of the creative artist, and of exemplary American lives, white and black.
Myra K. McMurry, “Role Playing as Art in Maya Angelou’s Caged Bird,” South Atlantic Bulletin, 41 (May 1976): 106-111; Sidonie A. Smith, “The Song of A Caged Bird: Maya Angelou’s Quest after Self-Acceptance,” Southern Humanities Review, 7 (Fall 1973): 365375; R. B. Stepto, “The Phenomenal Woman and the Severed Daughter,” review of And Still I Rise and Audre Lorde’s The Black Unicorn, Parnas¬ sus: Poetry in Review, 8 (Fall/Winter 1979): 312-320.
Bibliography: Dee Birch Cameron, “A Maya Angelou Bibliogra¬ phy,” Bulletin of Bibliography, 36 (JanuaryMarch 1979): 50-52.
Toni Cade Bambara (25 March 1939-
)
Alice A. Deck University of Illinois, Urbana-Champaign
BOOKS: Gorilla, My Love: Short Stories (New York: Random House, 1972); The Sea Birds Are Still Alive: Collected Stories (New York: Random House, 1977); The Salt Eaters (New York: Random House, 1980; London: Women’s Press, 1982).
OTHER: “Black Theater,” in Black Expression: Essays by and About Black Americans in the Crea¬ tive Arts, edited by Addison Gayle, Jr. (New York: Weybright & Talley, 1969), pp. 134143; The Black Woman: An Anthology, edited, with con¬ tributions, by Toni Cade (New York: New American Library, 1970); Tales and Stories for Black Folks, edited, with con¬ tributions, by Toni Cade Bambara (Garden City: Zenith Books/Doubleday, 1971);
TELEVISION: Zora, WGBH, 1971; “The Johnson Girls,” Soul Show, National Educa¬ tional Television, 1972; The Long Night, ABC, 1981. 12
DLB 38
Toni Cade Bambara
Southern Exposure 3 (Spring/Surnmer 1976), edited by Toni Cade Bambara; Cracks, by Cecelia Smith, preface by Toni Cade Bambara (Atlanta: Select Press, 1980); “What It is I Think I’m Doing Anyhow,” in The Writer on Her Work, edited by Janet Sternburg (New York: Norton, 1980); “Beauty is Just Care . . . Like Ugly is Carelessness” and “Thinking About My Mother,” in On Essays: A Reader for Writers, edited by Paul H. Connolly (New York: Harper & Row, 1981); Cherrie Moraga and Gloria Anzaldua, eds., This Bridge Called My Back: Radical Women of Color, foreword by Toni Cade Bambara (Watertown, Mass.: Persephone Press, 1981); The Sanctified Church: Collected Essays by Zora Neale Hurston, foreword by Toni Cade Bambara (Berkeley: Turtle Island, 1982); “Salvation is the Issue,” in Black Women Writers (Nineteen Fifty to Nineteen Eighty): A Critical Evaluation, edited by Mari Evans (Garden City: Doubleday /Anchor, 1984), pp. 41-71.
Toni Cade was born in New York City to Helen Brent Henderson Cade, who also had one son, Walter Cade. Toni and her brother grew up with their mother in New York City (Harlem, Bedford-Stuyvesant, and Queens) and Jersey City, New Jersey. She attended various public and private schools in New York State, New Jersey, and the southern United States. She adopted the name Bambara in 1970 when she discovered it as a part of a signature on a sketchbook she found in her great¬ grandmother’s trunk. Reticent in most of her essays and interviews about specific biographical details of her life, Bambara chooses instead to give enlarged impressions of a few individuals and events from her early life which she feels most influenced her. In September 1973, at age 34, Bambara published an essay in Redbook explaining what she most appreciated about her mother, Helen. Typical of her tendency to enlarge reality as a means of em¬ phasizing an important point, Bambara began the essay with an anecdote narrated, in a distinctly Afro-American dialect, by a young girl who remem¬ bers the numerous occasions on which her mother visited her public school classroom to set the teacher straight on a few facts about Afro-American history and people. The mother would march in, plant herself firmly in front of the teacher, speak her mind loudly enough for the entire class to hear, and then march out. The scene mesmerized the chil¬ dren and terrified the apologetic teacher. The young narrator recalls the enormous pride which would well up in her own breast whenever her mother made her appearance. She could then walk home triumphantly, as her schoolmates expressed their awe and gratitude for her mother’s having fought their battle with the teacher. As the narrator says, “She was my mother, but she was everybody’s champion.” The anecdote, replete with humor which does not belie the seriousness of the point Bambara is making, leads into a discussion of those less dramatic but equally heroic stances, to Bambara’s way of thinking, that Helen Cade took in the course of raising her two children alone. Bambara remembers her mother as one who understood and respected her children’s need to get in touch with their private selves. Thus in the face of criticism from neighbors and friends who said she was over¬ indulging her two children, Helen Cade allowed them to feel they had the right “to be cozy with ourselves” and “to dialogue and poet with the me.” Bambara thanks her mother in this essay for nur¬ turing, rather than thwarting, her habit of taking private inventory, of examining her feelings: “ . . . she knew, I suspect, the value of the inner
In many ways Toni Cade Bambara is one of the best representatives of the group of AfroAmerican writers who, during the 1960s, became directly involved in the cultural and sociopolitical activities in urban communities across the country. Like James Baldwin, Imamu Amiri Baraka (LeRoi Jones), Nikki Giovanni, June Jordan, Sonia San¬ chez, and Alice Walker, she immersed herself in civil rights issues by lecturing to and helping to organize rallies within the black community, while at the same time using these experiences as the nucleus for her essays and creative writing. Like others of that era, Bambara wrote from a stance of near defiance—pushing the cultural assumptions of the larger American society aside to show her audience what she believed to be the distinguishing characteristics of Afro-American culture. Her fic¬ tion reflects the Afro-American idiomatic expres¬ sions, habits of interpersonal relationships, and, most important, its myths, music, and history. While some who rode the tide of enormous popu¬ larity during the 1960s passed on to virtual obscuri¬ ty in the 1970s, Bambara is one of the few who continued to work within the black urban com¬ munities (filming, lecturing, organizing, and read¬ ing from her works at rallies and conferences), pro¬ ducing imaginative reenactments of these experi¬ ences in her fiction. In addition, Bambara estab¬ lished herself over the years as an educator, teaching in colleges and in independent community schools in various cities on the East Coast. 13
DLB 38
Toni Cade Bambara
anced by as many if not more persons who have a genuine concern for other people. Her short stories and her novel dramatize this view to such an extent that even her toughest characters (as in “Playing with Punjab” in Gorilla, My Love) betray an under¬ lying sensitivity to life, and to their fellow blacks. Bambara published her first short story, “Sweet Town,” in Vendome magazine (as Toni Cade in January 1959). That same year she received her B.A. in Theater Arts/English and the John Golden Award for Fiction from Queens College. The Long Island Star awarded her its Pauper Press Award for nonfiction that same year. While enrolled as a graduate student of modern American fiction at the City College of New York, Bambara worked as a social worker for the Harlem Welfare Center for the year 1959-1960. She published her second story, “Mississippi Ham Rider,” in the Summer 1960 Massachusetts Review. In 1961 she studied at the Commedia del’Arte in Milan, Italy, and worked there as a free-lance writer. Between 1962 and 1965 she completed her master’s degree and worked as program director at Colony House in Brooklyn and as the recreational and occupational therapist for Metropolitan Hospital’s psychiatric division. Dur¬ ing those years she also took on various positions as either coordinator or director of local neighbor¬ hood programs, such as the Equivalency Program, the Veteran Reentry Program, the 8th Street Play Program sponsored by the Lower Eastside Tenants Association, and the Tutorial Program at the Hous¬ ton Street Public Library. After receiving her mas¬ ter’s degree Bambara taught at the City College of New York from 1965 to 1969 and served as direc¬ tor/adviser for the Theater of the Black Experience and as an adviser for various types of publications sponsored by the City College SEEK program, such as Obsidian, Onyx, and The Paper. It was during this same four-year period that more of her stories be¬ gan to appear in various journals and magazines, such as The Liberator, Prairie Schooner, and Redbook; however, Bambara insists that, for her, writing was at that time “rather frivolous ... it was something you did because you didn’t feel like doing any work.” Work in this sense meant teaching and advising at City College, coordinating programs at community centers, and participating in the numerous workshops and study groups focusing on the sociopolitical issues of the day—both the black liberation and women’s movements. Bambara was involved in them all during the 1960s, the decade when she says she came of age, and in 1970 she edited and published an anthology entitled The Black Woman, which was designed to show what
life.” The essay shows a daughter who in retrospect realizes how much inner resolve it took for her mother to defend her children’s right to be differ¬ ent and to be self-confident in following their inner urges. In a 1979 interview Bambara explained that in her mother’s household both she and her brother were expected to be self-sufficient, competent, and “to be rather nonchalant about expertise in a num¬ ber of areas.” No distinction was made, Bambara insists, between how a girl should think and behave and how a boy should think and behave — both of the Cade children were expected to be sensitive, caring people who took responsibility for them¬ selves and their own personal growth beyond the guidance which a working mother could provide. The family moved frequently, and as a child Bambara’s inquisitive nature led her out to explore each new neighborhood in which her family lived. “As a kid with an enormous appetite for knowledge and a gift for imagining myself anywhere in the universe, I always seemed to be drawn to the library or to some music spot or to 125th Street and Seventh Avenue, Speaker’s Corner, to listen to Garveyites, Father Diviners, Rastafarians, Muslims, trade unionists, communists, Pan-Africanists.” In reflecting on the types of persons she considered most fascinating at that time she says there were two types of women, other than her mother, in the various neighborhoods: the Miss Naomi types were those women who led a very exciting night life and who had “lots of clothes in the closet” and a shrewd method of dealing with men; the Miss Gladys types were the women who lived on the first floor of the tenement building, took part in the local gambling, and who, like the Miss Naomi types, were ready, willing, and able to give free advice on everything from “how to get your homework done” to which number you should play. These women, as Bam¬ bara describes them, cared about the young girls in the neighborhood and therefore took it upon them¬ selves to advise them on how to avoid those things which could be harmful, such as “those cruising cars that moved through the neighborhood patrolling little girls.” In Bambara’s view the Miss Naomis and the Miss Gladyses can be used in her fiction to “teach us valuable lessons of life” and to give a dimension to the stereotypes of black women which only another Afro-American could understand and depict. The basic implication of all of Toni Gade Bambara’s stories is that there is an undercurrent of caring for one’s neighbors that sustains black Amer¬ icans. In her view the presence of those individuals who intend to do harm to people is counterbal¬ 14
DLB 38
Toni Cade Bambara
various black women were thinking and doing about both the civil rights and the women’s move¬ ments.
interact with the male characters. Bambara found the production to be accurate historically, but also relevant to the social situation of the 1960s when much attention was placed on black prize fighters and their relationships with black and white women. In editing The Black Woman, Bambara cut across age, class, and occupational barriers to show that black women shared some of the same con¬ cerns about black men, social issues (such as educa¬ tion and housing), and their personal development as women. At the same time, however, the readings in the anthology show that black women were sharply divided along political lines with some arguing for a radical departure from every known form of black female behavior and others lament¬ ing that too many changes would jeopardize a woman’s emotional security. The main point though is that Bambara’s anthology provided an arena for black women’s opinions to be voiced en masse at a time when it was assumed that all blacks were preoccupied with racial equality. For Bam¬ bara, the struggle for black equality in America was important but not to be obtained at the price of neglecting any one member of the Afro-American community. In 1969 Bambara began teaching in the En¬ glish Department at Livingston College in New Jersey where she was to remain until 1974. During that time she became an associate professor at Livingston and in addition to her teaching duties, functioned as speaker of the faculty chamber, served on the Livingston Black Faculty Organiza¬ tion, and worked as the coadviser for the Harambee dancers, the Malcolm Players, and Sisters in Con¬ sciousness. In 1974, she received a plaque from the Livingston College black community for service. In 1971 Bambara edited her second antholo¬ gy entitled Tales and Stories for Black Folks. The col¬ lection had broad appeal in the black community, but Bambara had had an audience of high school and college students in mind. As she explains in her introduction, the major intention of the volume was to teach young blacks the historical value of one of their daily activities—telling stories. Bambara calls it “Our Great Kitchen Tradition” or the common experience most Afro-Americans have of hearing various family members tell stories about “the old times” or about the various experiences of indi¬ viduals within the family. She urges her readers to take these folktales seriously as valuable lessons on human behavior and as examples of living history. The first section of the collection consists of stories which Bambara said, “I wish I had read
Essentially a collection of poetry, short stories, and essays by well-known writers (Nikki Giovanni, Kay Lindsey, Audre Lorde, Alice Walker, and Paule Marshall) and women students in the City College SEEK program, The Black Woman was a first of its kind in the United States, and Bambara, still writing under the name Cade, envisioned it as a response to all the male “experts” both black and white who had been publishing articles and con¬ ducting sociological studies on black women. Even the leading white feminists of the 1960s, Bambara felt, were not equipped to understand, much less to explain, the feelings and the situation of the black female. Hence, as editor Bambara selected items which she felt best reflected the thoughts and feel¬ ings of the many black women she had met while attending and participating in discussion clubs, work-study group meetings, and workshops both on college campuses and in local black communi¬ ties. While some of the poems and short stories aim to defuse and reject the popular myths and stereotypes of black women, other essays angrily challenge the traditional roles assigned to women by males within both the black community and the larger American society. In fact, one of the three essays Bambara contributed to the anthology, “On the Issue of Roles,” focuses on the fact that in many cases women working in black political action groups had not been allowed to participate on an equal footing with male workers in decision mak¬ ing. They had instead been relegated to “the unreal role of mute servant,” which was causing needless tension between black men and women who pre¬ sumably believed in the need to work toward social equality. She argued that the solution was to “let go of all notions of manhood and femininity and con¬ centrate on Blackhood.” Another of Bambara’s contributions to the anthology, “The Pill: Genocide or Liberation?,” outlines her opinion that birth control is not black genocide, but that it offers black women a means of becoming less vulnerable to black males’ idealistic notions of producing “warriors for the revolution.” The pill could help black women maintain control of their bodies and the peace of mind needed to take on new, social responsibilities. Bambara’s third contribution to the anthology was a reprint from Obsidian (October 1968). “Thinking About the Play ‘The Great White Hope’ ” evaluates the production in terms of its positive portrayal of black women and how they 15
DLB 38
Toni Cade Bambara
Bambara’s fable “The Toad and the Donkey,” also in Tales and Stories, parallels Aesop’s “The Tor¬ toise and the Hare,” but Bambara’s version states that as a result of having lost the race to the slower toad, the donkey decided that he would never run a race again and “donkeys have been kind of stub¬ born about running ever since.” The obvious differ¬ ence between “The Three Little Panthers” and “The Toad and the Donkey” is that the latter does not contain a political message. It can be read for entertainment and as the type of folktale intended to explain the reasons why humans and animals behave as they do. Other stories Bambara included in this section of the anthology also avoid making political statements. The collection, therefore, offers a balance between readings which are enter¬ taining and those which are didactic. Most of the stories Bambara wrote as Toni Cade between 1959 and 1970, except for two tales in Tales and Stories for Black Folks, were published in October 1972 in what was to become her most wide¬ ly read collection: Gorilla, My Love. The stories in the collection focus on the relationships among Afro-Americans in both the urban North and the rural South. Eight of the fifteen stories in the collec¬ tion center on young children and adolescents as they move through their neighborhood learning about themselves while in the process of responding to their environment. Much of Bambara’s fiction is set outside of the home, on a sidewalk, in a movie theater, in a park or on an athletic field, in a local bar, or in a community center. Bambara’s charac¬ ters are rarely at odds with their geographical en¬ vironment, especially those described in the stories in Gorilla, My Love. They move through their im¬ mediate neighborhood comfortably familiar with the people and each building, street lamp, and fire hydrant they pass. Each of the characters in Gorilla, My Love exudes a street-wise sophistication, a confi¬ dence in “mother wit,” that helps him or her to intimidate immediate rivals. The most appealing story in Gorilla, My Love, and the best representative of Bambara’s style and technique, is the title story. Narrated in the first person by Hazel, a young girl who is completely fed up with “grown-ups messin over kids just cause they little and can’t take ’em to court,” the story describes the carelessness of adults who say things to Hazel and her brothers without realizing the effect of their words. The children are disappointed time and again because they expect adults to follow through on promises, no matter how long ago they were made. In each instance it is Hazel who shrewd¬ ly argues with adults, making them see just how
growing up,” short stories by professional AfroAmerican writers such as Langston Hughes, Alice Walker, Pearl Crayton, and Ernest Gaines. Bam¬ bara included one of her own stories, “Raymond’s Run,” in this section also. The second half of the collection begins with Bambara’s “Rapping About Story Forms” which introduces her readers to the origins and characteristics of Afro-American fables. This section includes an English translation of a fable by the Senegalese Birago Diop and one by the Ghanaian James Aggrey, as well as several selec¬ tions written by students in a freshman composition course Bambara was teaching at Livingston College. Some of the students had been working with chil¬ dren in an independent community school, and Bambara had asked them to produce term papers that were useful to someone. As she explains it: “A great many of them took traditional European tales and changed them so as to promote critical think¬ ing, critical reading for the young people they were working with outside of the class.” As was the case with her first anthology, Bambara’s decision to in¬ clude student writings with those by older profes¬ sional writers shows her desire to give young writers a chance to make their talents known to a large audience. In addition, such a mixture in Tales and Stories for Black Folks would have helped her inspire young adults to read, to think critically, and to write. In following her own directives to her stu¬ dents, Bambara teamed with Geneva Powell, a black community worker from Newark, New Jersey, to write “The Three Little Panthers,” which she in¬ cluded in Tales and Stories for Black Folks. The story concerns three urban panthers who, having been sent on a survival mission in “the forest called the suburbs,” were continually harassed by antagonistic locals such as a rat, a vulture, a rabbit, an ostrich, an owl, and a fox. Refusing to conform to a suburban life-style, the only way they could have peacefully resided there, the panthers chose to return to their own neighborhood where they could work to sus¬ tain their own culture. While the obvious parallels to the original “Three Little Pigs” make the story predictable in terms of plot and dialogue, a cross burning, a bombing, and the panthers’ brandishing of guns when antagonists approach their house in¬ dicate the two authors’ preoccupation with the so¬ cial violence many blacks contended with during the 1960s and early 1970s. The story also obliquely criticizes those blacks who chose to be assimilated in order to live in American suburbs. Bambara and Powell imply that inner-city experience and en¬ vironment are potentially more fulfilling for blacks.
16
DLB 38
Toni Cade Bambara
much they are responsible for the chaos their words create. Hazel is resolved to defend herself and her brothers from the carelessness of the adult world, but she is nonetheless a very loving and lovable character. Her fiesty nature enables her to triumph over her personal disappointments and to take on new challenges.
she has already made up her mind about what she will do and will not share her decision with her friends. The narrator is a much younger girl who sits on the sidelines listening to each woman state her philosophy of how to deal with men. She listens in the hope that when she “jumps into her woman stride,” she will not “have all this torture and crap to go through.” In this story Bambara focuses on a particular feature of the friendship among women: namely, the way in which intimate conversation with close friends (replete with confessions of past mistakes, hopes for future relationships, and les¬ sons learned) can help one to get over a personal crisis. This is what Bambara has termed “drawing the wagons in a circle,” a phrase she used to describe the protectiveness and sense of revitalization which can occur from such an encounter. Hence we see in this story that the inner resolve, the resiliency, and determination of her younger protagonists in Goril¬ la, My Love must be supplemented with the support of friends and family. When Gorilla, My Love was published, it re¬ ceived enthusiastic reviews. Lucille Clifton, herself a writer, said: “She has captured it all, how we really talk, how we really are; and done it with both love and respect.” Poet Mari Evans claimed that the stor¬ ies were “shavings off our Black experience—like chocolate. Bittersweet that is. . . .” And in a review published in the July 1973 edition of Black World June Jordan said in part that Bambara allowed her readers to turn away momentarily from issues of genocide, poverty, and other “alien factors” to “con¬ centrate on what we love and who loves us and how the family is and how the folks be managing, by our hilarious/sorrowing own self.” During the five-year span between 1972 and the publication in 1977 of her second collection of stories, The Sea Birds Are Still Alive, major events took place in Toni Cade Bambara’s life which were to have an effect on her writing. She visited Cuba in 1973 where she met with the Federation of Cuban Women as well as with women working in factories, on farms, in markets, and in parks. She was im¬ pressed, she said in an interview, with how Cuban women were able to resolve many class conflicts as well as color conflicts and to coordinate a mass organization. Their success at this, Bambara felt, “says a great deal about the possibilities here.” Another benefit she derived from her trip to Cuba was being made aware of how effective a creative writer can be in a political movement: “People made me look at what I already knew about the power of the word. ... I think it was in 1973 when I really began to realize that [writing] was a perfectly legiti-
While the majority of the stories in Gorilla, My Love focus on the experiences of black women, many of the lessons they teach are universal. In one story, “Talkin ’Bout Sonny,” Bambara focuses on two males who struggle to cope with some very real but invisible force which threatens their mental sta¬ bility. The narrator, Betty Butler, is a social worker who is dating Delauney, a divorced father of two girls. The story is set in a local bar where Betty and Delauney are discussing their friend Sonny’s recent emotional collapse (“Something just came over me”) and stabbing of his wife. The narrator cannot understand the casualness with which Delauney is able to discuss the incident. As she reflects on her past observations of Sonny and Delauney, she real¬ izes that they are trying to contain a periodic rage, directed at no particular person, which they cannot fully explain. Delauney is at least able to describe the effect that the rage has on his and on Sonny’s behavior: “I can wake up not thinking anything in particular and all of a sudden it’s on me. A cloud of evil. A fit of nastiness takes over . . . that cloud of evil zooms in on you. . . . Fifty some odd days of pure shit jammed into one mad moment and boom — you plant a razor in your wife’s throat.” In short, Delauney knows he cannot help Sonny until he can help himself. Bambara seems to suggest that it is the overall pressure of living in modern society which triggers Sonny’s fits and Delauney’s evil moods, but there are questions raised in the story which are left unanswered; for example, now that Betty sees how precarious Delauney’s grip on his emotional state is, will she continue to be involved with him? Will she be able to live with the fear of what he might do to her or to his own daughters one day? “Talkin ’Bout Sonny” is one of Bambara’s more sobering stories in Gorilla, My Love as it is unrelieved by her usual moments of comic relief. Another important story in Gorilla, My Love is “The Johnson Girls.” Unlike the situation in “Talk¬ in ’Bout Sonny,” a character who is going through an emotional crisis (her boyfriend has left town without indicating that he is coming back) is sur¬ rounded by a group of her closest female friends, each of whom offers a plan of action to bring him back. While Inez obviously needs to have her friends around her and is listening to their advice,
17
DLB 38
Toni Cade Bambara
same community who opposed his power. The story focuses on Graham’s wife, Virginia, who, with their infant son in her arms, is on the way to visit her husband in jail. Flashbacks explain how she first met Graham and fell in love with him and his ideals. Basically a very quiet but hardworking and devoted woman, Virginia took on large responsibilities in community projects. After Graham’s arrest she realizes that her personal strength and the strength of their relationship is being put to a test, especially when she sees that much of what they had worked for has gone to ruin. By the end of the story Virgin¬ ia has paid a visit to the minister and vented her rage against what he had done, so that when she walks into the jail to see her husband, she is all the more determined that their work will continue and their marriage will endure. While the message Bambara wants to deliver is very clear, her tech¬ nique of juxtaposing time past with the present moment strains one’s patience in following the plot. Too many unexplained passing references are made to people and past incidents. Bambara received mixed reactions to “The Organizer’s Wife.” There were women who felt that the title was an insult, and other readers who said they would have liked to see Virginia leave town and her child die to show that she could not live or raise a child under a system which had separated her from Graham. In response to these suggestions Bambara argued, “What kind of a message would that have been? ‘The Organizer’s Wife,’ written in 1975 and set in 1975, is a love story, layer after layer. Lovers and combatants are not defeated. That is the message of that story, the theme of the entire collection, the wisdom that gets me up in the morning, honored to be here. It is a usable truth.” The title story of the collection, “The Sea Birds Are Still Alive,” is noteworthy because it fo¬ cuses on the people of Southeast Asia and allows us to see how Bambara portrays an ethnic group other than her own. The story is set aboard a boat which is transporting people caught up in the war to a larger city. As the narrator moves along the deck of the boat we see a country peasant, an old school¬ teacher, two women on their way to market their crafts, a soldier, refugees, and several foreigners (a female French news correspondent and an Amer¬ ican businessman), all of whom are thinking about the effect of war on their lives. The central charac¬ ters are a young girl and her mother who have been tortured by the imperialist forces, but who had been able to resist by chanting to themselves: “Nothing, I’ll tell you nothing. You’ll never break our spirits. We cannot be defeated.” Once in the city, the little
mate way to participate in struggle.” Bambara visited Vietnam in the summer of 1975 as a guest of the Women’s Union. On this trip, she says she was impressed by “the women’s ability to break through traditional roles, traditional ex¬ pectations . . . and come together again in a mass organization that is programmatic and takes on a great deal of responsibility for the running of the nation.” She summed up her Vietnam experience by saying: “I got a certain amount of miseducation behind me and got a more serious kind of selfeducation. I got more deeply into community orga¬ nizing.” Hence, after having relocated with her daughter, Karma, to Atlanta, Georgia, in 1974, Bambara became more involved in those communi¬ ty activities which she had begun there before her trip to Southeast Asia. Concurrent with her teaching duties as writer-in-residence at Spelman College from 1974 to 1977, Bambara became a founding member of the Southern Collective of African-American Writers, and the Neighborhood Cultural Arts Center, Inc. She was also Director of the Pomoja Writers Guild, a founding member and officer of the Conference Committee on Black South Literature and Art, and an associate/aide of the Institute of the Black World. She was also the Designer and Program Coordinator of the Arts-inthe-Schools Project sponsored by CETA. The effect of Bambara’s travels abroad, her relocation to Atlanta, and her work in so many community art groups can be seen in the stories published in The Sea Birds Are Still Alive (1977). One notices that at least five of the stories are set outside of an urban center; the title story is in Southeast Asia. The characters in many of these stories move across greater geographical distances than did those in her first collection, and their immediate concerns are not so much with their personal rela¬ tionships as with their involvement in art groups, community centers, or sociopolitical organizations. “The Organizer’s Wife,” “The Apprentice,” “Bro¬ ken Field Running,” “The Sea Birds Are Still Alive,” and “The Long Night” all focus on the need for people in a community to organize and keep a spiritual faith in their efforts even during periods of major setbacks and “low consciousness.” In line with her belief in the inherent resiliency of a people involved in social struggles, all of the central charac¬ ters in these stories are combatants who have the strength not only to resist, but to inspire others in their circle to continue the fight. In “The Organizer’s Wife,” Graham, the com¬ munity leader, has been arrested by local author¬ ities after being reported by a minister from the
18
DLB 38
Toni Cade Bambara
girl will be put to work, but she, like some of the little girls in Gorilla, My Love, has shown throughout the story a capability to survive, despite her size. The emphasis in the story is on resistance rather than on despair, and it dramatizes Bambara’s belief in “the power of words, of utterances” to nourish one through trying situations.
thermore, the reader seldom can determine where he is in time or place. The tale from whence the title comes is perhaps most frustrating in this regard.” Mary Helen Washington extolled two of Bambara’s stories, “Medley” and “Witchbird,” as excellent dra¬ matizations of the contemporary black American woman; however, she criticized all of the other stor¬ ies for displaying too much political ideology: “The trouble with deliberately creating models is that they slip all too easily out of character (who they are) into being mouthpieces for the writer’s ideology (who the writer would like them to be). It’s not that politics does not belong in the realm of art, but that some of the models Bambara offers are too predict¬ able (e.g. Naomi in ‘The Apprentice’).” Bambara herself commented to an interview¬ er that she felt that the stories in The Sea Birds Are Still Alive were too long: “To my mind, the six-page story is the gem. If it takes more than six pages to say it, something is the matter. So I’m not too pleased with the new collection, The Sea Birds Are Still Alive. Most of these stories are too sprawling and hairy for my taste, although I’m very pleased, feel perfectly fine about them as pieces. But as stories they’re too damn long and dense.” In several interviews and in an essay (“What It Is I Think I’m Doing Anyhow”), Bambara empha¬ sizes her preference for the short story as both a convenient tool for use in the classroom and in lecture engagements (she refers to them as “port¬ able”), and as an easier art fo
|
|||||
692
|
dbpedia
|
1
| 1 |
https://50playwrights.org/2017/04/
|
en
|
April
|
https://secure.gravatar.com/blavatar/98096074cec68f805e3620217e89460b6196f9597f4c4f403557bd535e04224d?s=200&ts=1723285720
|
https://secure.gravatar.com/blavatar/98096074cec68f805e3620217e89460b6196f9597f4c4f403557bd535e04224d?s=200&ts=1723285720
|
[
"https://50playwrights.org/wp-content/uploads/2017/04/cropped-50pp-pp-smaller4.jpg",
"https://secure.gravatar.com/blavatar/98096074cec68f805e3620217e89460b6196f9597f4c4f403557bd535e04224d?s=50&d=https%3A%2F%2Fs2.wp.com%2Fi%2Flogo%2Fwpcom-gray-white.png",
"https://secure.gravatar.com/blavatar/98096074cec68f805e3620217e89460b6196f9597f4c4f403557bd535e04224d?s=50&d=https%3A%2F%2Fs2.wp.com%2Fi%2Flogo%2Fwpcom-gray-white.png",
"https://pixel.wp.com/b.gif?v=noscript"
] |
[] |
[] |
[
""
] | null |
[] | null |
1 post published by trevorboffone during April 2017
|
en
|
https://secure.gravatar.com/blavatar/98096074cec68f805e3620217e89460b6196f9597f4c4f403557bd535e04224d?s=32
| null |
© 50 Playwrights Project, 2016-2018. All Rights Reserved.
Unauthorized use and/or duplication of any original material on this website belonging to 50 Playwrights Project without express and written permission from Trevor Boffone is strictly prohibited. Excerpts and links may, of course, be used, provided that full and clear credit is given to 50 Playwrights Project and Trevor Boffone with appropriate and specific direction to the original content.
Thank you for reading. Please comment, share, and return regularly.
|
|||
692
|
dbpedia
|
1
| 55 |
https://namt.org/2016/07/announcing-28th-annual-festival-new-musicals/
|
en
|
Announcing the 28th Annual Festival of New Musicals
|
[
"https://namt.org/app/themes/xdtheme/assets/img/namt-logo-full.png",
"https://namt.org/app/themes/xdtheme/assets/img/namt-logo-horiz.png",
"https://namt.org/app/uploads/Fest-16-NAMT-Web-Banner.jpg",
"https://namt.org/app/uploads/Pass-Type-Chart-360x176.jpg",
"https://namt.org/app/uploads/namt-logo-blog-header-360x144.jpg",
"https://namt.org/app/uploads/2015-Evergreen-Web-600-231x231.jpg"
] |
[] |
[] |
[
""
] | null |
[
"Karin Nilo"
] |
2016-07-11T15:57:29+00:00
|
We are thrilled to announce the line-up of new musicals for the 28th Annual Festival of New Musicals, which takes place on Thursday, October 27 and Friday, October 28, 2016 in New York. Now in its 28th year, the National Alliance for Musical Theatre’s Festival of New Musicals attracts theatre producers from around the world for this industry-only event to discover eight new musicals presented in 45-minute concert presentations over two days. All production costs are underwritten by NAMT, at no cost to the writing teams. As a non-profit organization, NAMT funds the Festival entirely through donations, sponsorships and contributions. The festival has introduced musical theatre producers to 236 musicals and 448 writers from around the world. As a direct result of the Festival of New Musicals, more than 85% of the musicals presented have gone on to subsequent readings, workshops, productions and tours, been licensed, and/or recorded on cast albums. Some past festival shows include the Broadway-bound Come From Away (Spring 2017), The Drowsy Chaperone, It Shoulda Been You, Striking 12, Ordinary Days, Thoroughly Modern Millie, among many others. This year, a committee of 14 theatre professionals selected eight new musicals out of 193 blind submissions. The musicals they chose for the 28th Annual Festival are: BENNY & JOON (book by Kirsten Guenther, music by Nolan Gasser, lyrics by Mindi Dickstein); JOE SCHMOE SAVES THE WORLD (book, music and lyrics by Brett Ryback); LEMPICKA (book & lyrics by Carson Kreitzer, music by Matt Gould); THE LONELIEST GIRL IN THE WORLD (book & lyrics by Gordon Leary, music by Julia Meinwald); MORTALITY PLAY (book & lyrics by Alana Jacoby, music by Scotty Arnold); SOHO CINDERS (music by George Stiles, lyrics & book by Anthony Drewe, book by Elliot Davis); THE UNAUTHORIZED AUTOBIOGRAPHY OF SAMANTHA BROWN (book, music & lyrics by Kait Kerrigan & Brian Lowdermilk); WE LIVE IN CAIRO (book, music & lyrics by Patrick & Daniel Lazour). In a statement, Betsy King Militello, Executive Director of the National Alliance for Musical Theatre, said: “This year’s selection of musicals is wonderfully diverse and truly highlights the changing world we live in and the rich voices that inhabit that world. Our selection committee has worked tirelessly to make sure that this year’s Festival showcases some of the best talent musical theatre has to offer.” Co-Chairs Paige Price (Theatre Aspen, CO) and Robert Lee (NYU Tisch School of the Arts, NY), on behalf of the Festival Committee, stated: “It was an honor to collaborate with our fellow committee members in this selection process. It was very difficult to cut the final selection down to only eight, but we were inspired by the quality and diversity of the submissions we received this year and excited about what they suggest about the current state of musical theatre writing.” Casting for each musical and further programming details will be announced soon. THE MUSICALS Benny & Joon Book by Kirsten Guenther Music by Nolan Gasser Lyrics by Mindi Dickstein Benny has taken care of his psychologically troubled sister Joon since their parents died over a decade ago. Benny is now in his early 30s, and Joon in her early 20s, but, ten years on, not much has changed. A mechanic with his own garage, Benny feels he is a master at managing the life they’ve ended up with. But when they take in a strange young man named Sam, who is like a modern Buster Keaton, everything changes. This musical based on the MGM movie explores the challenge of navigating life and love in an imperfect world. KIRSTEN GUENTHER (book) began her writing career in Paris, where she penned the popular weekly column, “The Sexy Expat” about an American navigating/dating the French. Book and lyrics: Little Miss Fix-it (seen on NBC). Book: Measure of Success (Rockefeller Grant), Mrs. Sharp (Richard Rodgers Award); The Cable Car Nymphomaniac (Bay Area Theatre Award Nominee) and Out of My Head (Steele Spring Stage Rights). She has written sketches for celebrities including James Franco, Jared Leto, Michael Douglas, Catherine Zeta-Jones, Kathie Lee & Hoda, Steve Buscemi, Deion Sanders and Queen Latifah. Kirsten was a Dramatist Guild Fellow and a Disney/ASCAP participant. MFA: NYU Graduate Musical Theatre Writing Program. NOLAN GASSER (music) is a composer, pianist, and musicologist—notably, the architect of Pandora Radio’s Music Genome Project. He holds a Ph.D. in musicology from Stanford University. His compositions have been performed at Carnegie Hall, Lincoln Center, etc. Current projects include an opera, The Secret Garden; a film score, All-Stars; and a forthcoming book, Why You Like It: The Science and Culture of Musical Taste. Nolan is the subject of a documentary highlighting his collaboration with Memorial Sloan-Kettering hospital to provide personalized musical therapy for cancer patients. He recently delivered a TEDx talk on the nature and source of our musical taste. MINDI DICKSTEIN (lyrics) is a lyricist, librettist, and playwright. Lyrics: Little Women (Broadway, MTI, Sh-k-boom), Faerie Tale (Rhinebeck), Snow In August (American Harmony Prize). Book and lyrics: Trip (Playwrights Horizons, Steinberg Commission), Beasts and Saints (ASCAP Workshop, Boston Music Theater Project), Notes Across A Small Pond (Bridewell Theater, London), several musicals for TheatreworksUSA. Book: Toy Story – The Musical (Disney). In concert: Lincoln Center’s “Hear and Now: Contemporary Lyricists” and 54 Below. Her monologue, Starving To Death In Midtown, was performed internationally in support of Climate Change awareness in 2015. Honors include a Larson Foundation Award and a Second Stage Klinsky Award. MFA and faculty: NYU Graduate Musical Theater Writing Program. Joe Schmoe Saves the World Book, music and lyrics by Brett Ryback Joe Schmoe Saves the World tells the parallel stories of an indie rock duo in America and a pair of Iranian students in Tehran. In places where artistry and female perspective are shut out, the two young women at the center of the story fight to have their voices heard. Raging against conformity, fear, and the status quo, they risk everything in an attempt to change the world through their art. BRETT RYBACK is an actor, composer, and writer. His plays and musicals include: Liberty Inn: The Musical (Ovation nominations Best Book, Best Music/Lyrics); Darling (Weston Playhouse New Musical Award, featured on NBC’s “The Apprentice.”); The Tavern Keeper’s Daughter (Best Musical, Pasadena Weekly); and Just a Little Critter Musical (First Stage Children’s theatre). His musical Joe Schmoe Saves the World was selected for the ASCAP/Dreamworks Musical Theatre Workshop. His plays Weïrd & A Roz By Any Other Name are both published in “The Best American Short Plays 2007-2008.” He is currently writing two new musicals: Passing Through and Nate the Great. Lempicka Book & lyrics by Carson Kreitzer Music by Matt Gould Set in Paris against the backdrop of the rising fascist tide, LEMPICKA follows the artist’s path through the chaotic upheavals of the 20th century. Fleeing the Russian Revolution as a nineteen-year-old bride, Tamara lands in Paris, a penniless refugee, and transforms herself into a rising star of the art world. But when she falls into a forbidden love affair with a prostitute—the breathtakingly beautiful Rafaela – she is forced to choose. As her world is about to shatter, will she risk it all in pursuit of love and art, or cling to the security of money and fame? MATT GOULD (music) is a recipient of the Richard Rodgers Award (2012 and 2014), The Jonathan Larson Award, and ASCAP’s Dean Kay and Harold Adamson Awards. His musical Invisible Thread (fka Witness Uganda) had its NY premier at 2econd Stage Theater and its world premiere at ART. His upcoming original works include The Family Project for LA’s Center Theatre Group, and Baby Girl with Pulitzer Prize winner Paula Vogel. Matt has performed his work around the world in Uganda, Mauritania, Japan, and across the US. A graduate of Boston University’s College of Fine Arts, Matt is a frequent speaker and guest lecturer at schools and universities. @FakeMattGould CARSON KREITZER (book & lyrics) is the recipient of a 2016 Jonathan Larson Grant for Lempicka. Current projects include Capital Crime!, set in Gilded Age New York, and The Empire Loisaida, a late-90’s era adaptation of the Orestia. She has received support from NYSCA, the NEA, TCG, and the Mellon and Toulmin Foundations, as well as two Jerome and three McKnight Fellowships at the Playwrights’ Center in Minneapolis. She is an alumna of New Dramatists, an affiliated artist with New Georges and Clubbed Thumb, and was the first Playwrights of New York (PoNY) Fellow at the Lark. Her collection SELF DEFENSE and other plays is available from No Passport Press. The Loneliest Girl in the World Book & lyrics by Gordon Leary Music by Julia Meinwald Anita Bryant always knew that she was destined for greatness. So did her biggest fan, Tommy, a young gay man who, like Anita, was searching for himself. As Anita reinvented herself as a beauty queen, a singer, a spokeswoman, a professional homemaker, and a cultural crusader, Tommy discovered his sexuality and his political voice. When they find themselves on opposite sides of the battle for gay rights, Tommy and Anita’s journeys of self-discovery collide with a single pie to the face. This new musical reunites Leary and Meinwald after their 2011 Festival of New Musicals premiere with Pregnancy Pact. GORDON LEARY (book & lyrics) is a Brooklyn-based bookwriter and lyricist. With Julia Meinwald, musicals include Pregnancy Pact (2012 Weston Playhouse, 2011 NAMT Festival, 2011 YIMT), Disappeared (2009 Lincoln Center Directors Lab, 2008 Prospect Theater Dark Nights), Something Blue (2014 NYTB), and REB + VoDKa + ME (2015 Civilians’ FINDINGS Series.) Other musicals include Cheer Wars (2009 Richard Rodgers Award) and Across the River (2013 Seoul Musical Festival, 2009 Daegu International Musical Festival.) 2009-10 Dramatists Guild Fellow, 2013-14 Uncharted (Ars Nova), 2015-16 R&D Group (The Civilians), 2016 Playground Playgroup (Fresh Ground Pepper.) BA: Vassar. MFA: NYU Graduate Musical Theatre Writing Program. www.omfgordon.com JULIA MEINWALD’s (music) other musicals with Gordon Leary include Pregnancy Pact (2012 premiere production at the Weston Playhouse, 2011 NAMT Festival and Yale Institute for Musical Theatre selection), REB + VoDKa + ME (Civilians R&D Group 2015-2016), Galaxy Comics (2014 United Airlines in-flight programming), and Disappeared (2009 Lincoln Center Directors Lab). Julia was a participant in the New Dramatists Composer Librettist Development Program, the Dramatists Guild fellowship, American Lyric Theatre residency, Ars Nova’s Uncharted group, the Civilian’s R&D Group, and Fresh Ground Pepper’s Playground Playgroup. She holds a BA in Music from Yale and an MFA from NYU’s GMTWP. www.juliameinwald.com. Mortality Play Book & lyrics by Alana Jacoby Music by Scotty Arnold Mortality Play is a rock musical about Todd, a 16-year-old in 1349 London trying to justify his desire to make art in a time of great need. The plague has just broken out, claiming his friend and bandmate John as one of its first victims. John’s ghost becomes a guide as Todd tries to balance his responsibilities as a son, boyfriend, doctor’s apprentice, and aspiring rockstar. The show is a modern take on a medieval morality play that follows a young man’s struggle to decide between what he wants to do and what he believes the world needs of him. ALANA JACOBY (book & lyrics) is a lyricist, book writer and playwright from Newtown, CT. She graduated from Brown University with honors in playwriting in 2008, and earned her MFA from NYU’s Graduate Musical Theater Writing Program in 2011, where she received the Paulette Goddard scholarship. Her work has been performed at Ars Nova, Joe’s Pub, 54 Below, and the Barrington Stage Company, and her musicals Mortality Play and Trivøya Gold have been workshopped at the Yale Institute for Music Theatre and the Musical Theatre Factory. Her songs have been featured in several incarnations of William Finn’s cabaret series Songs By Ridiculously Talented Composers and Lyricists You Probably Don’t Know But Should, and she has twice been commissioned to write musicals for Brian Blythe’s 4@15 program. She lives in Brooklyn, works as a teaching artist for the Roundabout Theatre Company, and is a member of the Musical Theatre Factory and the Dramatists Guild. SCOTTY ARNOLD (music) is a founding member of the Musical Theatre Factory. Music: Mortality Play (NAMT Songwriters Showcase, Joe’s Pub, Yale Institute for Music Theater, Ars Nova), That Time We Found a Sasquatch in the Woods (Merry-Go-Round, MTF), Trivøya Gold (NYU Steinhardt, MTF, Adelaide Raleigh Productions), Lost & Found (Nautilus Music Theater Company, NYU). His play Oscar & Richard & Joe, a contemporary riff on R&H’s Allegro, received a sold-out performance at Ravinia. After receiving its premiere at the Music Theater Company in Illinois in 2013, his short musical Tereshkova was brought back for an encore performance. He is currently a writer-in-residence at CAP 21, where he is developing a new musical with Jenny Stafford and Shelley Butler. BA: SCU, MFA: NYU; also: ANMT (CA) and New Dramatists (NY). He has completed residencies at Space at Ryder Farm, New York Stage and Film, and CAP21. Proud member: Dramatists Guild, ASCAP. Soho Cinders Music by George Stiles Lyrics & book by Anthony Drewe Book by Elliot Davis After the untimely death of his mother, impoverished Robbie is left running her launderette in London’s most colorful district, Soho. Constantly under the cheaply manicured thumbs of his two lap-dancing step-sisters, Robbie pays the rent by reluctantly accepting money from sugar daddy admirer, Lord Bellingham. Life gets more complicated when Robbie embarks on a secret romance with high-profile and highly-engaged Mayoral candidate, James Prince. Their worlds collide when Prince throws a cocktail party for his benefactors – chief amongst whom is Bellingham. Robbie, Prince, and his fiancée Marilyn, are left to fight for a fairytale ending. GEORGE STILES (music) with lyricist Anthony Drewe: Cameron Mackintosh/Disney’s stage production of Mary Poppins; Honk! (Olivier Award for Best New Musical, NAMT Festival 1999); Travels With My Aunt; Just So; Betty Blue Eyes; Peter Pan – A Musical Adventure and their trilogy The Three Little Pigs (NAMT Festival 2013), Goldilocks And The Three Bears and The Three Billy Goats Gruff. Current: with Julian Fellowes – The Wind InThe Willows (West End) and a new version of Half A Sixpence for Cameron Mackintosh. In development: Soapdish; Becoming Nancy. With lyricist Paul Leigh: Moll Flanders; The Three Musketeers (NAMT Festival 1999) and Tom Jones. ANTHONY DREWE (lyrics & book) with composer George Stiles: Travels With My Aunt; Honk! (NAMT Festival 1999); Just So; Betty Blue Eyes; Peter Pan – A Musical Adventure; their trilogy The Three Little Pigs (NAMT Festival 2013), Goldilocks And The Three Bears, The Three Billy Goats Gruff and the new songs and additional lyrics for the Cameron Mackintosh/Disney’s stage production of Mary Poppins. Current: The Wind In The Willows with Julian Fellowes for the West End; a new version of Half A Six.Pence for Cameron Mackintosh. In development: Soapdish; Becoming Nancy. With composer Tony Hatch: The Card. With composer Dick Lee: A Twist of Fate. ELLIOT DAVIS (book) Loserville (West Yorkshire Playhouse, Garrick, West End). Olivier Nominated for Best New Musical. Peter Pan (revised book), OUT THERE (Riverside Studios), Best Friends & Butterflies, (book & Music) TicketMaster Composer Award / Best New Musical Vivian Ellis Award. Current: What I Go To School For – The Busted Musical. In development: Rehab, Becoming Nancy. Radio: In another career strand Elliot is a prolific music documentary maker for the BBC. Film: Elliot’s first feature film screenplay commissioned by the BBC films in 2017 starring Geoffrey Rush. He is the inaugural recipient of the JJ Screenwriting Bursary in association with BAFTA. The Unauthorized Autobiography of Samantha Brown Book, music & lyrics by Kait Kerrigan & Brian Lowdermilk Sitting in a car with the keys in her hand, 18-year-old Samantha Brown telescopes back to a time before her world fell apart. Memories of Kelly, her impetuous, daring best friend, haunt her. When Kelly was killed in a car wreck, Sam lost not only her best friend but also the part of herself that was learning how to take risks. Now, paralyzed by fear and inertia, Sam must make a decision. Will she wait for her parents to drive her to college or will she drive away into a future she can’t imagine? KAIT KERRIGAN (words) and BRIAN LOWDERMILK (music) made their Off-Broadway debut with Henry and Mudge. Other projects include the immersive house party musical The Bad Years, Republic, a sung-through adaptation of Shakespeare’s Henry IV set in Northern Ireland in the 1970s, and Unbound, based on the life story of Chinese dancer Zhongmei Li. Their first album Our First Mistake charted at #1 on the iTunes Singer/Songwriter chart. Their latest album, Kerrigan-Lowdermilk Live, documents the concert tour that resulted from their breakout $35K kickstarter campaign. Together, they received the Larson Award and a Dramatists Guild Fellowship, and they have held residencies at McDowell, Johnny Mercer, Theatreworks and others. Kerrigan received the 2009 Kleban Award for libretto-writing. As a playwright, she has had her work developed at Page 73, where she was an Interstate 73 member; Primary Stages, the Lark, and Chautauqua Theatre Company. Lowdermilk received the Alan Menken Award and the Richard Rodgers Award for Red with librettist Marcus Stevens. Both are alumni of the BMI Musical Theatre Writing Workshop, co-founders of the start-up NewMusicalTheatre.com, and members of the Dramatist Guild and ASCAP. We Live in Cairo Book, music & lyrics by PATRICK & DANIEL LAZOUR We Live in Cairo is about a new generation faced with the aftermath of revolution. Three years after the 2011 Egyptian Revolution, the overthrow of Hosni Mubarak, and the tumultuous events immediately thereafter, six young Cairenes gather to celebrate the homecoming of their friend from the United States. We Live in Cairo focuses on the disillusionment that set in after the Arab Spring’s most promising revolution failed, but simultaneously highlights the inspired and tenacious spirit of the Egyptian youth – students who risked their lives to change their country. PATRICK LAZOUR is a writer, lyricist and playwright. With his brother Daniel, he has written and produced four musicals including The Grand Room, which was developed and performed at the Robsham Theater Arts Center at Boston College in 2013. We Live in Cairo, about the youth movement during the 2011 Egyptian Revolution, was developed at the O’Neill National Music Theater Conference and most recently received the Richard Rodgers Award. Patrick has developed work with his brother at Rhinebeck Writers Retreat and SPACE on Ryder Farm and is a 2015-16 Dramatists Guild Fellow. He holds a B.A. in political science and theater from Boston College. He lives in New York City. DANIEL LAZOUR has collaborated on four musicals with his brother Patrick, supplying the music and co-authoring the libretto. The two’s most recent musical We Live in Cairo, centering on the youth in Egypt’s 2011 revolution, was selected for the 2015 O’Neill National Music Theater Conference and received the 2016 Richard Rodgers Award. Daniel’s other works include an opera scene (Bach and the Boy), a song cycle (Expat), and a string quartet (Chacarera), which all premiered at Columbia University. Daniel has spent time at SPACE on Ryder Farm and Rhinebeck Writers Retreat writing and composing on piano and guitar. He studied music composition at Columbia University. He is a 2015-16 Dramatists Guild Fellow. REGISTRATION Online registration for the Festival is now open. Attendance Eligibility The Festival is free and open to theatre industry professionals and major donors to NAMT. We define an industry member as anyone currently working professionally in the theatre who can aid in the development of the shows or writers we present. You will be asked to state your affiliation with one of the professional organizations/groups/unions, such as TCG, The Broadway League, LORT, ART/NY, etc., in order to register for the Festival. If you meet this criterion, you must register, but no invitation is required (subject to space and availability). If you do not, you may also register with our online form and make a donation to NAMT. Public standby lines form prior to each presentation, for which no prior registration is required. Standby seating is not guaranteed. Festival Passes There are four different passes available for the Festival, each with its own level of access and benefits outlined in the chart below. Industry members who are not members of NAMT will be asked to select your pass level when you register. Your tax-deductible contribution allows the Festival of New Musicals to create a nurturing environment for the discovery, development and advancement of the new works, at no cost to the writers participating. Click the chart to enlarge. NAMT Member Registration NAMT member organizations receive a limited number of complimentary Premiere Passes and Select Passes (see chart above). Institutional Voting members receive 4 Premiere Passes and 2 Priority Seating Passes Independent Producer Voting members receive 2 Premiere Passes and 2 Priority Seating Passes Academic, Developmental and International members receive 2 Premiere Passes and 1 Priority Seating Pass Associate Members receive 1 Priority Seating Pass Late Registration Online registration for the Festival ends on October 20. Festival registrations received after October 14 will be subject to the following late registration processing fees: October 14-October 20: $20 fee Walk-up registration at the Festival: $30 fee ABOUT NAMT The National Alliance for Musical Theatre, founded in 1985, is a national service organization dedicated exclusively to musical theatre. Their mission is to advance musical theatre by nurturing the creation, development, production and presentation of new musicals, and to provide a forum for musical theatre professionals to share resources and exchange information. Their 200 members, located throughout 32 states and abroad, are some of the leading producers of musical theatre in the world and include theatres, presenting organizations, higher education programs and individual producers. Among the 236 musicals launched by NAMT’s annual Festival of New Musicals are Broadway-bound Come From Away (Spring 2017), Thoroughly Modern Millie, Children of Eden, Honk!, The Drowsy Chaperone, It Shoulda Been You, Songs for a New World, I Love You Because, Striking 12, Vanities, Ordinary Days and many others, representing 448 writers. ABOUT THE FESTIVAL NAMT’s FESTIVAL OF NEW MUSICALS is the cornerstone of NAMT’s mission to nurture the creation, development and production of new musicals. The Festival presents eight musicals in 45-minute presentations before an audience of over 600 industry professionals. In the short run, the Festival’s goal is to connect producers with writers, so that their shows can continue their development trajectory. The long-term goal is to expand the musical theatre repertoire, bringing new musical theatre to thousands of audience members around the world. The 28th Festival of New Musicals is overseen by NAMT New Works Director Ciera Iveson and Festival General Manager Lisa Dozier King. The 2016 Festival Committee is co-chaired by Paige Price, Theatre Aspen (CO) and Robert Lee, NYU Tisch School of the Arts- Graduate Musical Theatre Writing Program (NY) and NAMT Festival Alumnus Writer. Committee members include: Pamela Adams, Atlantic Theater Co. (NY); Bob Alwine, Goodspeed Musicals (CT); Carlos Armesto, Theatre C (NJ); Victoria Bussert, Baldwin Wallace University (OH); Amy Corcoran, Aria Entertainment; Keith Cromwell, Red Mountain Theatre Co. (AL); Ian Eisendrath, The 5th Avenue Theatre (WA); Lori Fineman, The Transport Group (NY); Kate Galvin, 11th Hour Theatre Co. (PA); Lucas McMahon, Alchemation (NY); Michael Rubinoff, Canadian Music Theatre Project at Sheridan College (ON); Alumni Writer Representative, Janice Lowe (Composer of Lil Budda, Fest ’02); and chair emerita Mara Isaacs, Octopus Theatricals (NJ). NAMT thanks the following foundations, government agencies and organizations for their ongoing support of our programs: ABE Charitable Foundation, The Alhadeff Charitable Foundation, The Alliance of Resident Theatres/New York Creative Spaces Grant, ASCAP Foundation Irving Caesar Fund, BMI Foundation, The Noël Coward Foundation, The Dubose and Dorothy Heyward Memorial Fund,The Frederick Loewe Foundation, Friars Foundation, The Hollywood Pantages, National Endowment for the Arts, New York State Council on the Arts, The Rodgers and Hammerstein Foundation, The Shubert Foundation, and Anonymous donors.
|
en
|
NAMT
|
https://namt.org/2016/07/announcing-28th-annual-festival-new-musicals/
|
We are thrilled to announce the line-up of new musicals for the 28th Annual Festival of New Musicals, which takes place on Thursday, October 27 and Friday, October 28, 2016 in New York.
Now in its 28th year, the National Alliance for Musical Theatre’s Festival of New Musicals attracts theatre producers from around the world for this industry-only event to discover eight new musicals presented in 45-minute concert presentations over two days. All production costs are underwritten by NAMT, at no cost to the writing teams. As a non-profit organization, NAMT funds the Festival entirely through donations, sponsorships and contributions.
The festival has introduced musical theatre producers to 236 musicals and 448 writers from around the world. As a direct result of the Festival of New Musicals, more than 85% of the musicals presented have gone on to subsequent readings, workshops, productions and tours, been licensed, and/or recorded on cast albums. Some past festival shows include the Broadway-bound Come From Away (Spring 2017), The Drowsy Chaperone, It Shoulda Been You, Striking 12, Ordinary Days, Thoroughly Modern Millie, among many others.
This year, a committee of 14 theatre professionals selected eight new musicals out of 193 blind submissions. The musicals they chose for the 28th Annual Festival are: BENNY & JOON (book by Kirsten Guenther, music by Nolan Gasser, lyrics by Mindi Dickstein); JOE SCHMOE SAVES THE WORLD (book, music and lyrics by Brett Ryback); LEMPICKA (book & lyrics by Carson Kreitzer, music by Matt Gould); THE LONELIEST GIRL IN THE WORLD (book & lyrics by Gordon Leary, music by Julia Meinwald); MORTALITY PLAY (book & lyrics by Alana Jacoby, music by Scotty Arnold); SOHO CINDERS (music by George Stiles, lyrics & book by Anthony Drewe, book by Elliot Davis); THE UNAUTHORIZED AUTOBIOGRAPHY OF SAMANTHA BROWN (book, music & lyrics by Kait Kerrigan & Brian Lowdermilk); WE LIVE IN CAIRO (book, music & lyrics by Patrick & Daniel Lazour).
In a statement, Betsy King Militello, Executive Director of the National Alliance for Musical Theatre, said:
“This year’s selection of musicals is wonderfully diverse and truly highlights the changing world we live in and the rich voices that inhabit that world. Our selection committee has worked tirelessly to make sure that this year’s Festival showcases some of the best talent musical theatre has to offer.”
Co-Chairs Paige Price (Theatre Aspen, CO) and Robert Lee (NYU Tisch School of the Arts, NY), on behalf of the Festival Committee, stated:
“It was an honor to collaborate with our fellow committee members in this selection process. It was very difficult to cut the final selection down to only eight, but we were inspired by the quality and diversity of the submissions we received this year and excited about what they suggest about the current state of musical theatre writing.”
Casting for each musical and further programming details will be announced soon.
THE MUSICALS
Benny & Joon
Book by Kirsten Guenther
Music by Nolan Gasser
Lyrics by Mindi Dickstein
Benny has taken care of his psychologically troubled sister Joon since their parents died over a decade ago. Benny is now in his early 30s, and Joon in her early 20s, but, ten years on, not much has changed. A mechanic with his own garage, Benny feels he is a master at managing the life they’ve ended up with. But when they take in a strange young man named Sam, who is like a modern Buster Keaton, everything changes. This musical based on the MGM movie explores the challenge of navigating life and love in an imperfect world.
KIRSTEN GUENTHER (book) began her writing career in Paris, where she penned the popular weekly column, “The Sexy Expat” about an American navigating/dating the French. Book and lyrics: Little Miss Fix-it (seen on NBC). Book: Measure of Success (Rockefeller Grant), Mrs. Sharp (Richard Rodgers Award); The Cable Car Nymphomaniac (Bay Area Theatre Award Nominee) and Out of My Head (Steele Spring Stage Rights). She has written sketches for celebrities including James Franco, Jared Leto, Michael Douglas, Catherine Zeta-Jones, Kathie Lee & Hoda, Steve Buscemi, Deion Sanders and Queen Latifah. Kirsten was a Dramatist Guild Fellow and a Disney/ASCAP participant. MFA: NYU Graduate Musical Theatre Writing Program.
NOLAN GASSER (music) is a composer, pianist, and musicologist—notably, the architect of Pandora Radio’s Music Genome Project. He holds a Ph.D. in musicology from Stanford University. His compositions have been performed at Carnegie Hall, Lincoln Center, etc. Current projects include an opera, The Secret Garden; a film score, All-Stars; and a forthcoming book, Why You Like It: The Science and Culture of Musical Taste. Nolan is the subject of a documentary highlighting his collaboration with Memorial Sloan-Kettering hospital to provide personalized musical therapy for cancer patients. He recently delivered a TEDx talk on the nature and source of our musical taste.
MINDI DICKSTEIN (lyrics) is a lyricist, librettist, and playwright. Lyrics: Little Women (Broadway, MTI, Sh-k-boom), Faerie Tale (Rhinebeck), Snow In August (American Harmony Prize). Book and lyrics: Trip (Playwrights Horizons, Steinberg Commission), Beasts and Saints (ASCAP Workshop, Boston Music Theater Project), Notes Across A Small Pond (Bridewell Theater, London), several musicals for TheatreworksUSA. Book: Toy Story – The Musical (Disney). In concert: Lincoln Center’s “Hear and Now: Contemporary Lyricists” and 54 Below. Her monologue, Starving To Death In Midtown, was performed internationally in support of Climate Change awareness in 2015. Honors include a Larson Foundation Award and a Second Stage Klinsky Award. MFA and faculty: NYU Graduate Musical Theater Writing Program.
Joe Schmoe Saves the World
Book, music and lyrics by Brett Ryback
Joe Schmoe Saves the World tells the parallel stories of an indie rock duo in America and a pair of Iranian students in Tehran. In places where artistry and female perspective are shut out, the two young women at the center of the story fight to have their voices heard. Raging against conformity, fear, and the status quo, they risk everything in an attempt to change the world through their art.
BRETT RYBACK is an actor, composer, and writer. His plays and musicals include: Liberty Inn: The Musical (Ovation nominations Best Book, Best Music/Lyrics); Darling (Weston Playhouse New Musical Award, featured on NBC’s “The Apprentice.”); The Tavern Keeper’s Daughter (Best Musical, Pasadena Weekly); and Just a Little Critter Musical (First Stage Children’s theatre). His musical Joe Schmoe Saves the World was selected for the ASCAP/Dreamworks Musical Theatre Workshop. His plays Weïrd & A Roz By Any Other Name are both published in “The Best American Short Plays 2007-2008.” He is currently writing two new musicals: Passing Through and Nate the Great.
Lempicka
Book & lyrics by Carson Kreitzer
Music by Matt Gould
Set in Paris against the backdrop of the rising fascist tide, LEMPICKA follows the artist’s path through the chaotic upheavals of the 20th century. Fleeing the Russian Revolution as a nineteen-year-old bride, Tamara lands in Paris, a penniless refugee, and transforms herself into a rising star of the art world. But when she falls into a forbidden love affair with a prostitute—the breathtakingly beautiful Rafaela – she is forced to choose. As her world is about to shatter, will she risk it all in pursuit of love and art, or cling to the security of money and fame?
MATT GOULD (music) is a recipient of the Richard Rodgers Award (2012 and 2014), The Jonathan Larson Award, and ASCAP’s Dean Kay and Harold Adamson Awards. His musical Invisible Thread (fka Witness Uganda) had its NY premier at 2econd Stage Theater and its world premiere at ART. His upcoming original works include The Family Project for LA’s Center Theatre Group, and Baby Girl with Pulitzer Prize winner Paula Vogel. Matt has performed his work around the world in Uganda, Mauritania, Japan, and across the US. A graduate of Boston University’s College of Fine Arts, Matt is a frequent speaker and guest lecturer at schools and universities. @FakeMattGould
CARSON KREITZER (book & lyrics) is the recipient of a 2016 Jonathan Larson Grant for Lempicka. Current projects include Capital Crime!, set in Gilded Age New York, and The Empire Loisaida, a late-90’s era adaptation of the Orestia. She has received support from NYSCA, the NEA, TCG, and the Mellon and Toulmin Foundations, as well as two Jerome and three McKnight Fellowships at the Playwrights’ Center in Minneapolis. She is an alumna of New Dramatists, an affiliated artist with New Georges and Clubbed Thumb, and was the first Playwrights of New York (PoNY) Fellow at the Lark. Her collection SELF DEFENSE and other plays is available from No Passport Press.
The Loneliest Girl in the World
Book & lyrics by Gordon Leary
Music by Julia Meinwald
Anita Bryant always knew that she was destined for greatness. So did her biggest fan, Tommy, a young gay man who, like Anita, was searching for himself. As Anita reinvented herself as a beauty queen, a singer, a spokeswoman, a professional homemaker, and a cultural crusader, Tommy discovered his sexuality and his political voice. When they find themselves on opposite sides of the battle for gay rights, Tommy and Anita’s journeys of self-discovery collide with a single pie to the face. This new musical reunites Leary and Meinwald after their 2011 Festival of New Musicals premiere with Pregnancy Pact.
GORDON LEARY (book & lyrics) is a Brooklyn-based bookwriter and lyricist. With Julia Meinwald, musicals include Pregnancy Pact (2012 Weston Playhouse, 2011 NAMT Festival, 2011 YIMT), Disappeared (2009 Lincoln Center Directors Lab, 2008 Prospect Theater Dark Nights), Something Blue (2014 NYTB), and REB + VoDKa + ME (2015 Civilians’ FINDINGS Series.) Other musicals include Cheer Wars (2009 Richard Rodgers Award) and Across the River (2013 Seoul Musical Festival, 2009 Daegu International Musical Festival.) 2009-10 Dramatists Guild Fellow, 2013-14 Uncharted (Ars Nova), 2015-16 R&D Group (The Civilians), 2016 Playground Playgroup (Fresh Ground Pepper.) BA: Vassar. MFA: NYU Graduate Musical Theatre Writing Program. www.omfgordon.com
JULIA MEINWALD’s (music) other musicals with Gordon Leary include Pregnancy Pact (2012 premiere production at the Weston Playhouse, 2011 NAMT Festival and Yale Institute for Musical Theatre selection), REB + VoDKa + ME (Civilians R&D Group 2015-2016), Galaxy Comics (2014 United Airlines in-flight programming), and Disappeared (2009 Lincoln Center Directors Lab). Julia was a participant in the New Dramatists Composer Librettist Development Program, the Dramatists Guild fellowship, American Lyric Theatre residency, Ars Nova’s Uncharted group, the Civilian’s R&D Group, and Fresh Ground Pepper’s Playground Playgroup. She holds a BA in Music from Yale and an MFA from NYU’s GMTWP. www.juliameinwald.com.
Mortality Play
Book & lyrics by Alana Jacoby
Music by Scotty Arnold
Mortality Play is a rock musical about Todd, a 16-year-old in 1349 London trying to justify his desire to make art in a time of great need. The plague has just broken out, claiming his friend and bandmate John as one of its first victims. John’s ghost becomes a guide as Todd tries to balance his responsibilities as a son, boyfriend, doctor’s apprentice, and aspiring rockstar. The show is a modern take on a medieval morality play that follows a young man’s struggle to decide between what he wants to do and what he believes the world needs of him.
ALANA JACOBY (book & lyrics) is a lyricist, book writer and playwright from Newtown, CT. She graduated from Brown University with honors in playwriting in 2008, and earned her MFA from NYU’s Graduate Musical Theater Writing Program in 2011, where she received the Paulette Goddard scholarship. Her work has been performed at Ars Nova, Joe’s Pub, 54 Below, and the Barrington Stage Company, and her musicals Mortality Play and Trivøya Gold have been workshopped at the Yale Institute for Music Theatre and the Musical Theatre Factory. Her songs have been featured in several incarnations of William Finn’s cabaret series Songs By Ridiculously Talented Composers and Lyricists You Probably Don’t Know But Should, and she has twice been commissioned to write musicals for Brian Blythe’s 4@15 program. She lives in Brooklyn, works as a teaching artist for the Roundabout Theatre Company, and is a member of the Musical Theatre Factory and the Dramatists Guild.
SCOTTY ARNOLD (music) is a founding member of the Musical Theatre Factory. Music: Mortality Play (NAMT Songwriters Showcase, Joe’s Pub, Yale Institute for Music Theater, Ars Nova), That Time We Found a Sasquatch in the Woods (Merry-Go-Round, MTF), Trivøya Gold (NYU Steinhardt, MTF, Adelaide Raleigh Productions), Lost & Found (Nautilus Music Theater Company, NYU). His play Oscar & Richard & Joe, a contemporary riff on R&H’s Allegro, received a sold-out performance at Ravinia. After receiving its premiere at the Music Theater Company in Illinois in 2013, his short musical Tereshkova was brought back for an encore performance. He is currently a writer-in-residence at CAP 21, where he is developing a new musical with Jenny Stafford and Shelley Butler. BA: SCU, MFA: NYU; also: ANMT (CA) and New Dramatists (NY). He has completed residencies at Space at Ryder Farm, New York Stage and Film, and CAP21. Proud member: Dramatists Guild, ASCAP.
Soho Cinders
Music by George Stiles
Lyrics & book by Anthony Drewe
Book by Elliot Davis
After the untimely death of his mother, impoverished Robbie is left running her launderette in London’s most colorful district, Soho. Constantly under the cheaply manicured thumbs of his two lap-dancing step-sisters, Robbie pays the rent by reluctantly accepting money from sugar daddy admirer, Lord Bellingham. Life gets more complicated when Robbie embarks on a secret romance with high-profile and highly-engaged Mayoral candidate, James Prince. Their worlds collide when Prince throws a cocktail party for his benefactors – chief amongst whom is Bellingham. Robbie, Prince, and his fiancée Marilyn, are left to fight for a fairytale ending.
GEORGE STILES (music) with lyricist Anthony Drewe: Cameron Mackintosh/Disney’s stage production of Mary Poppins; Honk! (Olivier Award for Best New Musical, NAMT Festival 1999); Travels With My Aunt; Just So; Betty Blue Eyes; Peter Pan – A Musical Adventure and their trilogy The Three Little Pigs (NAMT Festival 2013), Goldilocks And The Three Bears and The Three Billy Goats Gruff. Current: with Julian Fellowes – The Wind InThe Willows (West End) and a new version of Half A Sixpence for Cameron Mackintosh. In development: Soapdish; Becoming Nancy. With lyricist Paul Leigh: Moll Flanders; The Three Musketeers (NAMT Festival 1999) and Tom Jones.
ANTHONY DREWE (lyrics & book) with composer George Stiles: Travels With My Aunt; Honk! (NAMT Festival 1999); Just So; Betty Blue Eyes; Peter Pan – A Musical Adventure; their trilogy The Three Little Pigs (NAMT Festival 2013), Goldilocks And The Three Bears, The Three Billy Goats Gruff and the new songs and additional lyrics for the Cameron Mackintosh/Disney’s stage production of Mary Poppins. Current: The Wind In The Willows with Julian Fellowes for the West End; a new version of Half A Six.Pence for Cameron Mackintosh. In development: Soapdish; Becoming Nancy. With composer Tony Hatch: The Card. With composer Dick Lee: A Twist of Fate.
ELLIOT DAVIS (book) Loserville (West Yorkshire Playhouse, Garrick, West End). Olivier Nominated for Best New Musical. Peter Pan (revised book), OUT THERE (Riverside Studios), Best Friends & Butterflies, (book & Music) TicketMaster Composer Award / Best New Musical Vivian Ellis Award. Current: What I Go To School For – The Busted Musical. In development: Rehab, Becoming Nancy. Radio: In another career strand Elliot is a prolific music documentary maker for the BBC. Film: Elliot’s first feature film screenplay commissioned by the BBC films in 2017 starring Geoffrey Rush. He is the inaugural recipient of the JJ Screenwriting Bursary in association with BAFTA.
The Unauthorized Autobiography of Samantha Brown
Book, music & lyrics by Kait Kerrigan & Brian Lowdermilk
Sitting in a car with the keys in her hand, 18-year-old Samantha Brown telescopes back to a time before her world fell apart. Memories of Kelly, her impetuous, daring best friend, haunt her. When Kelly was killed in a car wreck, Sam lost not only her best friend but also the part of herself that was learning how to take risks. Now, paralyzed by fear and inertia, Sam must make a decision. Will she wait for her parents to drive her to college or will she drive away into a future she can’t imagine?
KAIT KERRIGAN (words) and BRIAN LOWDERMILK (music) made their Off-Broadway debut with Henry and Mudge. Other projects include the immersive house party musical The Bad Years, Republic, a sung-through adaptation of Shakespeare’s Henry IV set in Northern Ireland in the 1970s, and Unbound, based on the life story of Chinese dancer Zhongmei Li. Their first album Our First Mistake charted at #1 on the iTunes Singer/Songwriter chart. Their latest album, Kerrigan-Lowdermilk Live, documents the concert tour that resulted from their breakout $35K kickstarter campaign. Together, they received the Larson Award and a Dramatists Guild Fellowship, and they have held residencies at McDowell, Johnny Mercer, Theatreworks and others. Kerrigan received the 2009 Kleban Award for libretto-writing. As a playwright, she has had her work developed at Page 73, where she was an Interstate 73 member; Primary Stages, the Lark, and Chautauqua Theatre Company. Lowdermilk received the Alan Menken Award and the Richard Rodgers Award for Red with librettist Marcus Stevens. Both are alumni of the BMI Musical Theatre Writing Workshop, co-founders of the start-up NewMusicalTheatre.com, and members of the Dramatist Guild and ASCAP.
We Live in Cairo
Book, music & lyrics by PATRICK & DANIEL LAZOUR
We Live in Cairo is about a new generation faced with the aftermath of revolution. Three years after the 2011 Egyptian Revolution, the overthrow of Hosni Mubarak, and the tumultuous events immediately thereafter, six young Cairenes gather to celebrate the homecoming of their friend from the United States. We Live in Cairo focuses on the disillusionment that set in after the Arab Spring’s most promising revolution failed, but simultaneously highlights the inspired and tenacious spirit of the Egyptian youth – students who risked their lives to change their country.
PATRICK LAZOUR is a writer, lyricist and playwright. With his brother Daniel, he has written and produced four musicals including The Grand Room, which was developed and performed at the Robsham Theater Arts Center at Boston College in 2013. We Live in Cairo, about the youth movement during the 2011 Egyptian Revolution, was developed at the O’Neill National Music Theater Conference and most recently received the Richard Rodgers Award. Patrick has developed work with his brother at Rhinebeck Writers Retreat and SPACE on Ryder Farm and is a 2015-16 Dramatists Guild Fellow. He holds a B.A. in political science and theater from Boston College. He lives in New York City.
DANIEL LAZOUR has collaborated on four musicals with his brother Patrick, supplying the music and co-authoring the libretto. The two’s most recent musical We Live in Cairo, centering on the youth in Egypt’s 2011 revolution, was selected for the 2015 O’Neill National Music Theater Conference and received the 2016 Richard Rodgers Award. Daniel’s other works include an opera scene (Bach and the Boy), a song cycle (Expat), and a string quartet (Chacarera), which all premiered at Columbia University. Daniel has spent time at SPACE on Ryder Farm and Rhinebeck Writers Retreat writing and composing on piano and guitar. He studied music composition at Columbia University. He is a 2015-16 Dramatists Guild Fellow.
REGISTRATION
Online registration for the Festival is now open.
Attendance Eligibility
The Festival is free and open to theatre industry professionals and major donors to NAMT. We define an industry member as anyone currently working professionally in the theatre who can aid in the development of the shows or writers we present. You will be asked to state your affiliation with one of the professional organizations/groups/unions, such as TCG, The Broadway League, LORT, ART/NY, etc., in order to register for the Festival. If you meet this criterion, you must register, but no invitation is required (subject to space and availability). If you do not, you may also register with our online form and make a donation to NAMT.
Public standby lines form prior to each presentation, for which no prior registration is required. Standby seating is not guaranteed.
Festival Passes
There are four different passes available for the Festival, each with its own level of access and benefits outlined in the chart below. Industry members who are not members of NAMT will be asked to select your pass level when you register. Your tax-deductible contribution allows the Festival of New Musicals to create a nurturing environment for the discovery, development and advancement of the new works, at no cost to the writers participating.
Click the chart to enlarge.
NAMT Member Registration
NAMT member organizations receive a limited number of complimentary Premiere Passes and Select Passes (see chart above).
Institutional Voting members receive 4 Premiere Passes and 2 Priority Seating Passes
Independent Producer Voting members receive 2 Premiere Passes and 2 Priority Seating Passes
Academic, Developmental and International members receive 2 Premiere Passes and 1 Priority Seating Pass
Associate Members receive 1 Priority Seating Pass
Late Registration
Online registration for the Festival ends on October 20.
Festival registrations received after October 14 will be subject to the following late registration processing fees:
October 14-October 20: $20 fee
Walk-up registration at the Festival: $30 fee
ABOUT NAMT
The National Alliance for Musical Theatre, founded in 1985, is a national service organization dedicated exclusively to musical theatre. Their mission is to advance musical theatre by nurturing the creation, development, production and presentation of new musicals, and to provide a forum for musical theatre professionals to share resources and exchange information. Their 200 members, located throughout 32 states and abroad, are some of the leading producers of musical theatre in the world and include theatres, presenting organizations, higher education programs and individual producers. Among the 236 musicals launched by NAMT’s annual Festival of New Musicals are Broadway-bound Come From Away (Spring 2017), Thoroughly Modern Millie, Children of Eden, Honk!, The Drowsy Chaperone, It Shoulda Been You, Songs for a New World, I Love You Because, Striking 12, Vanities, Ordinary Days and many others, representing 448 writers.
ABOUT THE FESTIVAL
NAMT’s FESTIVAL OF NEW MUSICALS is the cornerstone of NAMT’s mission to nurture the creation, development and production of new musicals. The Festival presents eight musicals in 45-minute presentations before an audience of over 600 industry professionals. In the short run, the Festival’s goal is to connect producers with writers, so that their shows can continue their development trajectory. The long-term goal is to expand the musical theatre repertoire, bringing new musical theatre to thousands of audience members around the world.
The 28th Festival of New Musicals is overseen by NAMT New Works Director Ciera Iveson and Festival General Manager Lisa Dozier King.
The 2016 Festival Committee is co-chaired by Paige Price, Theatre Aspen (CO) and Robert Lee, NYU Tisch School of the Arts- Graduate Musical Theatre Writing Program (NY) and NAMT Festival Alumnus Writer. Committee members include: Pamela Adams, Atlantic Theater Co. (NY); Bob Alwine, Goodspeed Musicals (CT); Carlos Armesto, Theatre C (NJ); Victoria Bussert, Baldwin Wallace University (OH); Amy Corcoran, Aria Entertainment; Keith Cromwell, Red Mountain Theatre Co. (AL); Ian Eisendrath, The 5th Avenue Theatre (WA); Lori Fineman, The Transport Group (NY); Kate Galvin, 11th Hour Theatre Co. (PA); Lucas McMahon, Alchemation (NY); Michael Rubinoff, Canadian Music Theatre Project at Sheridan College (ON); Alumni Writer Representative, Janice Lowe (Composer of Lil Budda, Fest ’02); and chair emerita Mara Isaacs, Octopus Theatricals (NJ).
NAMT thanks the following foundations, government agencies and organizations for their ongoing support of our programs: ABE Charitable Foundation, The Alhadeff Charitable Foundation, The Alliance of Resident Theatres/New York Creative Spaces Grant, ASCAP Foundation Irving Caesar Fund, BMI Foundation, The Noël Coward Foundation, The Dubose and Dorothy Heyward Memorial Fund,The Frederick Loewe Foundation, Friars Foundation, The Hollywood Pantages, National Endowment for the Arts, New York State Council on the Arts, The Rodgers and Hammerstein Foundation, The Shubert Foundation, and Anonymous donors.
|
|||||
692
|
dbpedia
|
0
| 19 |
https://aatrevue.com/Newsblog/a-listing-of-asian-american-plays/asian-american-plays-by-authors-l/
|
en
|
Asian American Plays, by Authors (L)
|
[
"https://aatrevue.com/Newsblog/wp-content/uploads/2019/06/SiteLogo2.png",
"https://aatrevue.com/Newsblog/wp-content/uploads/2019/03/MLee_Headshot-720x450.jpg 720w, https://aatrevue.com/Newsblog/wp-content/uploads/2019/03/MLee_Headshot-400x250.jpg 400w, https://aatrevue.com/Newsblog/wp-content/uploads/2019/03/MLee_Headshot-240x150.jpg 240w, https://aatrevue.com/Newsblog/wp-content/uploads/2019/03/MLee_Headshot-160x100.jpg 160w, https://aatrevue.com/Newsblog/wp-content/uploads/2019/03/MLee_Headshot-100x62.jpg 100w, https://aatrevue.com/Newsblog/wp-content/uploads/2019/03/MLee_Headshot-234x146.jpg 234w"
] |
[] |
[] |
[
""
] | null |
[
"The Godfather of Asian American Theatre",
"www.facebook.com"
] |
2019-03-08T20:10:13+00:00
|
Asian American Plays, by Authors (L)
|
en
|
Asian American Theatre Revue
|
https://aatrevue.com/Newsblog/a-listing-of-asian-american-plays/asian-american-plays-by-authors-l/
|
Table of Contents
Toggle
Asian American Plays, by Authors (L)
History for
East West Players
Pan Asian Repertory Theatre
Northwest Asian American Theatre
Authors
Lam, Greg
Stick and Move (Boston Theatre Marathon, 2008)
Ten minute play: A couple on their first date learn that when the date is on, it’s always good to have someone in your corner.
Chaplin & Keaton on the Set of Limelight
Silent Comedy legends Charlie Chaplin and Buster Keaton worked together only once, on Chaplin’s last movie before being exiled from the United States. For the deeply autobiographical Limelight, Chaplin cast the down on his luck Keaton to play a small part in his nostalgic story of an old comedian doing one last performance. This play explores the tension between the desire to entertain and the need to fight for a greater world in politically dangerous times. What responsibilities does an artist have beyond bringing a smile to the face of an audience?
Repossessed (Pork Filled Productions, 2017)
Rich and Gretchen seem to have the ideal marriage, until they learn that it was manufactured by a mysterious biotech company which installed it into their brains. Because they can no longer afford this service, the company must repossess their improvements.
The Trouble With Maise
10 MINUTE – The relationship of two siblings is threatened by the reappearance of a ventriloquist’s dummy named Maisie. Co-authored by Walt McGough. THE TROUBLE WITH MAISIE is an outrageous look at the perils of relationships, familial, human, and otherwise.
Interventions (Fantastic Z, 2019)
10 MINUTE- A couple on a hike find their special plans interrupted by a succession of time travelers, each with a different message from the future.
INTERVENTIONS is a funny, fast paced romp about time travel, romance, and the consequences of decisions. Because time travel is hard, but parenting is harder
Golden Record
10 MINUTE – Two friends have their day interrupted by the arrival of an alien object.
The Fallout
10 MINUTE – In 1962, a couple feverishly pack to escape a coming doom- When a knock on the door is heard. They prepare themselves for the worst, but it turns out it’s just their neighbors who haven’t seen the evening paper… yet.
Crossover Fiction
10 MINUTE – A sci-fi heroine takes a journey into a strange new world… Earth!
The Line
10 MINUTE – People wait in a very long line that doesn’t move for a very long time. We find out why.
The Dowry of Princess Talia
ONE ACT – A sweet but hapless and dimwitted suitor wants to win the hand of the feisty and intelligent Princess Talia, and so he must complete several daunting quests. He has no chance, unless the resourceful princess gives him a hand without his knowledge.
Lampitoc, Sunshine Pearl
A Virgin/Whore Duplex (EWP, 2001)
Surrounded by porn movies, the demise of marriage, and apple martinis, one young woman lies her way to the truth.
Landayan, Rudy
I Heart Hell A (EPW, 2009)
Dreams, stars, smog & traffic. An ensemble driven performance art piece about the love hate relationship with the city we call Los Angeles.
Le, Dan Sach
Saigon Sisters (Mu 2012)
Come hear the first act of this new play inspired by Anton Chekov’s, The Three Sisters.
Le, Viet
Rage (EWP, 2003)
Family. Felon. Is Tommy Nguyen a good boy or a gang banger?
Lee, Alex
Three Lives (1999)
Lee, Annette
A Dirty Secret Between Your Toes (EWP: Paper or Plastic, 1999)
Chuck and Helen — the new Asian American couple — have moved into this picture-perfect cul de sac with a dirty secret. Jose, the gardener, helps to keep their insatiable desires and clandestine activities hidden from this upper class neighborhood… all the while harboring his own little secret. When the neighborhood association president comes knocking, watch sweet little suburbia flip into a new picture of disturbing, disruptive and deliciously dirty revelations!
Walk the Mountain (Wells Fargo Radio Theater 2000) –
A radio play about a Chinese man’s journey to 1880’s San Franciso to bring his father home to China.
One Cold Dark Night (Wells Fargo Radio Theater 2001) –
A radio play comedy about a 1950’s Chinese American family and the Chinese ghost stories they share.
Lynn 1, Lynn 2 (Marianne Murphy Women & Philanthropy Play Reading Series. 2007)
Lynn things she lives alone – or does she?
29/12 (Upper Reaches Theater 2007)
Casey looks like any other seventh grader, but he shares a secret with his grandfather that keeps his demons at bay.
Negation Delirium on Toast Points (UCLA, 2007)
A woman comes home and finds it mysteriously redecorated. Is it her imagination, another demension, or the stranger on her couch?
Life Outside the Body (UCLA 2008)
Chuck’s body has always been breaking down on him, but that’s nothing compared to what’s really broken. Can one magic drug fix it all? (one-act)
Hacinda Heights (Lodestone, 2008)
The Hsiungs have always been a strange family, but things get stranger when the Census Taker arrives. (One Act)
Higher Up (Theater Masters 2008)
When the ‘new guy’ shows up for work, Toi and Charlie experience firsthand what it’s like to be in the dog house. (10-min)
English Only (UCLA, 2008)
1986. Everything is big. The hair, the shoulder pads, the prom dresses… but nothing is bigger to 17 year old Scarlett Wong than what’s going on at City Hall. A look into race, culture, and the Official English referendum in Monterey Park, California.
Happy Talk: a romantic urban fairytale (Another Chicago Theatre Company, 2008)
Gina loves Bob, but Bob isn’t free to love anyone until he’s free of his mother. Could the answer be in a pair of a fabulous ladies shoes? (One Act)
Lee, C. Y.
Author of The Flower Drum Song.
The Body and Soul of a Chinese Woman (Stella Adler Theatre, 2006)
It tells the story of Amy Wu, a recently divorced, young traditional folk dancer from China who struggles to reconcile her sensuality and intellectual nature while dealing with a traditional Asian American aunt and an ex-husband who wants to come back into her life.
The Fan Tan King (Pan Asian Rep, 2006) A musical with music by Douglas Lackey
The Fan Tan King is adapted from Mr. Lee’s novel, DAYS OF THE TONG WARS, set in late 19th century San Francisco, when Chinese pioneers arrived to the Land of the Golden Mountain in their quest for the American Dream. The Fan Tan King is Peter Fong, a gambling czar and businessman; Peter has a wife, who pines for a simpler life and more children to join her only son. His authority is challenged by his rival, Sam Fat, who wants control of Chinatown. There are a dozen colorful supporting characters who epitomize the diverse Chinatown community.
Lee, Cherylene
A former child performer, dancer/actress, paleontologist/geologist, and wastewater (yes, sewage) treatment consultant, Cherylene Lee’s writing also includes poetry, short fiction, and a novel. A fourth generation Chinese-American, her writing examines the broad spectrum of Asian-American experience. Her poetry and fiction have been widely published and her short stories anthologized in American Dragons (Harper Collins, 1993) and Charlie Chan is Dead (Viking/Penguin, 1993).
Recipient of a San Francisco Art Council Grant in Literature, she has also received a Fund for New American Plays Grant, a Rockefeller MAP Grant and has been a co-winner of the Mixed Blood Theater’s Playwrights competition. She was also chosen for the O’Neill National Playwrights Conference, the Sundance Playwrights Lab, an Asian Theater Workshop Fellowship with the Mark Taper Forum, and a San Francisco Grants for Arts Commission through Z Space Studio. In 2015 Cherylene published her personal memoir Just Like Really An Uncommon Chinese American Memoir. On March 18, 2016, Cherylene died in her sleep with her two sisters at her side
Pyros (1983)
Aesop’s Fantastic Fables (1984)
Wong Bow Rides Again (East West, 1987)
The Ballad of Doc Hay (Marin Playhouse, 1987)
Overtones (Kuma Kahua, 1988)
Bitter Melon (1990)
Yin Chin Bow (Pan Asian, 1990)
Memory Square (1991)
Arthur & Leila (East West, 1993)
In the Spirit (Mayer Theatre, 1993)
Knock Off Balance (1995)
Lost Vegas Acts (1997)
Carry the Tiger to the Mountain (1998, Contemporary Theater Festival)
In June of 1982 Vincent Chin was beaten to death by two unemployed Detroit auto workers. Carry the Tiger to the Mountain is an epic dramatization of the true life story o the victim’s mother, Lily Chin, and her journey from postwar picture bride to civil rights activist in search of justice for her son.
The Legacy Codes (Theatreworks, 2003)
Inspired by the stunning saga of nuclear physicist Wen Ho Lee, this fascinating new drama is as hot as today’s headlines. Underscored by a brilliant fusion of Chinese, jazz, and hip-hop music, it weaves our era’s mystifying codes of law, culture, computers, and romance into a masterful family drama, the tantalizing tale of a Taiwanese-born scientist accused of compromising America’s national security.
Antigone Falun Gong (Aurora Theatre Company, 2004)
This adaptation of Sophocles’s great tragedy is re-set in contemporary China and explores how the past connects to the present, the persecution of the Falun Gong, and how there may be more to America’s global reach than we imagine. Utilizing forms of Tai Chi, Wu Shu, Kung Fu, Chinese opera movement as well as the five Falun Gong exercises, this world premiere dramatizes the story of a lone woman defying a repressive government in a beautifully unique and provocative way.
Mixed Messages (EWP, 2004)
Mixed Messages explores the journey of a “mixed” woman (Japanese, Chinese and British) who discovers that her cranial features are extremely similar to that of the 9,000 year-old women fossil found in the La Brea Tar Pits in 1914. The realization sparks emotional duels pitting science against culture, ethnicity against heritage, and the individual against institutions in defining those of “mixed” backgrounds.
Lee, Edward Bok
ED BOK LEE’s first book, Real Karaoke People (New Rivers Press), was a recipient of the Many Voices Project (MVP) Award and “contains outrage…tenderness [and] searing honesty…vital to the American landscape. The vitality of the country, its capacity to absorb the rich and the strange, is nowhere clearer…” (San Francisco Chronicle).
Lee attended kindergarten in Seoul, grew up in North Dakota and Minnesota, and has since lived in a half-dozen cities around the world. He has studied Slavics at the Universities of California—Berkeley, Minnesota, Kazakh State—Almaty, Indiana University, and holds an MFA from Brown University. Various writing awards include grants from the National Endowment for the Arts, the Minnesota State Arts Board, the Loft Literary Center, SASE, and the Jerome Foundation.
Athens County (Brown University, 1997)
A farce, where Mommy Kills Daddy.
St. Petersburg (The Public, 2000)
Passage (Theater Mu, 2001)
The story follows a daughter’s return to her homeland to visit her father, who is near death. But before the old man can be released from this world, he must clear up secrets and business with his daughter. It’s a mythic version of the need to reconcile and remember the past, Kim said.
Whorled ()
Leavetaker ()
El Santo Americano ()
Ten Minute play. Clay, a washed-up professional wrestler, kidnaps his estranged wife Evalana and their child, and heads for the border. He hopes to re-invent himself in Mexico as a champion wrestler, and save his failing family from certain doom. An unexpected rest stop in the middle of the desert throws a monkey wrench in his plans, when Evalana finds herself with an opportunity to escape — but not before Clay articulates his love for her and their child one last time. Will she go, or stay? Or will something more mysterious happen in the darkest heart and hour of this magical vision of the post-American Dream?
Glow III (Mu Performing Arts, 2007)
At a time when soldiers lessen the effects of post traumatic stress disorder by the practice of first maiming animals, and McDonalds offers a popular Spirit Burger, a shape-shifting cast of Everyday People attempt to navigate their troubled lives through futuristic dysfunction. Ethics, Philosophy, Pop-psychology, Race, Socio-economics and Religion all serve as launching pads into the absurd.
Lee, Gene
We Used To Toast To The Dreamers…Now We Just Drink (East West 2010)
“We used to toast…” is dark and familiar. It broods fiery and unsettling like one too many shots of bourbon. Its voice is harsh and one gets the impression that the author does not want to step lightly over the graves of artists.
Ladies and Gentlemen (East West, 2013)
A heavyweight contender gets the opportunity of a lifetime, but must choose between the two men she loves.
Lee, J.
Wooing Annie (East West, 2001)
“Welcome to L.A! Now go home.” For Canadian Annie Woo, it’s hard to leave a place with “spicy kimchi” like Josh and “green tea and ham” like Mason. Should she stay or should she go?
Lee, JC
Luce (Lincoln Center Theatre, 2013)
When a teacher makes an alarming discovery about Luce, an all-star high school student, Luce’s parents are forced to reckon with their idealized image of their son, adopted years ago from a war-torn African country.
Crane (Ferocious Lotus, 2015)
When Sadako stumbles into a cabin in the mountains in the dead of winter, she meets Bradley, a young, hermitic artist who once created a great work but has since descended into mediocrity. He now risks being dropped by his pushy agent if he doesn’t produce another masterpiece. After taking in this mysterious woman, Bradley soon discovers that Sadako has her own secret talent that could potentially save him. But at what cost?
Lee, Ji Hyun
Ji Hyun is a playwright moonlighting as investigative reporter. She has covered the University of Michigan’s affirmative action trials for Asian Diversity and the recent sweatshop cases in California for Hyphen magazine. She is a graduate of Columbia University.
The Superfirends of Flushing Queens (AATC, 1999)
Picture four Asian friends: a Korean, a Chinese, a Japanese and a Vietnamese, who struggle for the perfect grade in the academically advanced Flushing High School. But underneath all the ethnic stereotypes, the girls endure dysfunctional home lives and long to escape from their oppressing families with that scholarship to Harvard. As soon as one friend is in trouble, they morph into their altar egos Wonder Girl,, Slut Girl, Dyke Girl and Nerd Girl and jump into their Invisible BMW to rescue those friends in need. Because whatever may ail them at home, when they’re together and in school, they will always be the Superfriends of Flushing Queens.
Lee, JJ
Measure of a Man (Vancouver Canadian Theatre, 2013)
Lee, John K.
From Berdoo to Bonneville (EWP, 2016)
Chino Kim, a talented but unheralded custom motorcycle builder, has a Harley Davidson sized chip on his shoulder that he can’t seem to cut, grind, or weld away. After seven years of uncompromising dedication to his aesthetic vision, a personal tragedy and the fear of lifelong anonymity force him to reconsider his hardline stance.
Lee, John Quincy
Merica (Pan Asian, 2008)
A comedy of haves and have-nots. Constance visits Beijing in hopes to meet her only granddaughter, Merica, for the first time. Ming Quan,Merica’s other grandmother will the meeting to take place if certain conditions are met.
Lee, Kimber
Her work has also been presented by The Lark, Page 73, Hedgebrook, Seven Devils Playwrights Conference, Bay Area Playwrights Festival, Old Globe Theater, and Magic Theatre. Lark Rita Goldberg Playwrights’ Workshop Fellow, Dramatists Guild Fellow, Ma-Yi Writers Lab, and recipient of the 2014 Ruby Prize, 2013-2014 PoNY Fellowship, 2014-2015 Hartford Stage New Voices Fellowship, and the inaugural 2015 PoNY/Bush Theatre Playwright Residency in London. MFA: UT Austin.
Topper
Fight (ACT, 2012)
brownsville song (b-side for tray) (Bay Area Playwrights Festival, 2013)
In a Brooklyn neighborhood housing project, time moves in scattered rhythms, pivoting unpredictably between before and after. As members of Tray¹s family struggle with his untimely death, they stumble through loss, find each other, and fight their way toward hope.
different words for the same thing (Center Theatre Group, 2015)
Thirteen years and 1,800 miles separate Alice from her childhood home. But after one phone call, the small-town streets and characters that once shaped her come rushing back and threaten to never let her go.
Tokyo Fish Story (Theatrworks, 2014)
Generations, gender, and tradition collide as a Sushi Master struggles to preserve ancient artistry in a society obsessed with change. In pursuit of perfection, a brilliant protégé, eager apprentices, and the master himself have much to learn.
to the yellow house (The Lark, 2016/La Jolla Playhouse, 2021)
“It’s February 1886. Vincent Van Gogh is broke again. Trailing past due notices and annoyed innkeepers, he arrives unexpectedly at his brother’s doorstep in Montmartre determined to make another fresh start. Caught in the colorful whirl of the Parisian art scene, he drinks too much, falls in love with the wrong woman, argues with everyone — and paints.
Lee, Kristina Haruna
Suicide Forest (Bushwick Star, 2019)
the play is about Japanese salaryman desperately searching for his self-worth, and a lonely teenage girl grappling with her sexuality in a nightmarish, male-defined society.
Lee, Maggie
Maggie Lee is a writer, actor, producer, lighting designer, and puppet mistress for the Pork Filled Players, Seattle’s only Asian American sketch comedy group. She has also designed lights and puppets for other local theater companies, such as ReAct, GreenStage, Open Circle Theater, and SIS Productions.
In 2006, she adapted a stage version of H.P. Lovecraft’s The Thing on the Doorstep for OCT’s The Colour Out of Space, and will be a contributing writer for their original Lovecraft-inspired show Necronomicon in October 2008. She has a BA in English and a minor in Lighting Design from UC Berkeley.
Kindred Spirits, formerly Light the Corners of My Mind (SIS Productions, 2008)
What does it mean to truly be haunted? Three tenants of a lonely old house, all with lingering pasts determined never to let go, will discover the answer in this modern ghost story (Also known as Kindred Spirits).
A Long Fatal Love Chase On A Distant Star (SIS Productions, 2009)
On a remote sentry ship at the edge of the universe, poised on the brink of intergalactic war, Louisa May Alcott’s forgotten scandalous novel of love and obsession finds new life being shared by a unit of rookie mecha pilots, blurring the line between science fiction and “sensational” fiction.
The Clockwork Professor (SIS Productions, 2010)
First of the New Providence Chronicles. Seamus Pemberton, otherwise known as the Clockwork Professor, is a humble inventor, a quiet, eccentric man of science. But now, buried secrets and forbidden technology from the past threaten to destroy everything he holds dear, perhaps even rocking the very foundations of the city of New Providence. From underground laboratories to royal airships to dimension-hopping portals, come join the Clockwork Professor on this whirlwind adventure of fantastical science fiction with a steampunk twist!
The Tumbleweed Zephyr (SIS Productions, 2011)
Part of the New Providence Chronicles. Two brothers set off from the city of New Providence for the Western Territories on the transcontinental train, the Tumbleweed Zephyr. But a simple journey by rail soon leads to adventure, romance, and long-lost echoes from the past, like a lonely train whistle through the deep desert sky. All aboard for a sci-fi Old West yarn with shiny brass steampunk trim!
The Sunshower Bride (Live Girls, 2012)
About a zoomorphic pre-wedding revelation
A Hand of Talons (SIS Productions, 2012)
Part of the New Providence Chronicles. For generations, the Yao family has been the ruling crime syndicate of the city. But now, Wilhelmina and her two siblings must do whatever it takes to win at a high stakes game of power and betrayal as the family empire threatens to crumble around them. Ante up for a hand of sci-fi noir in the seedy underbelly of the steampunk-inspired world of New Providence. If you can’t trust family, who can you trust?
A Silver Key and The Roots Run Deep (SIS Productions, 2015)
An evening of one-act plays inspired by the fantastical dreamscapes and creeping horrors of H.P. Lovecraft. In A Silver Key” a mysterious key opens a door into the dream world on Eleanor’s 30th birthday, as she wavers on the threshold of modern day adulthood. In The Roots Run Deep, Iris searches for her lost sister, who disappeared after the discovery of a strange mask tied to the dark secrets of their unknown ancestors.
The Echo Maidens (SPT, 2016)
The Journey of the Bell
Ida and Lisbeth have always been best friends, until the sound of a mysterious bell leads them apart on very different paths. As they journey through Hans Christian Andersen’s timeless fairy tales, will Ida and Lisbeth ever find their way back to each other, or will their friendship be lost forever? Stories include The Bell, The Shepherdess and the Chimney Sweep, The Ugly Duckling, What the Good Man Does Is Always Right, The Flea and the Professor, and The Nightingale.
Paper and Ink (Live Girls)
Two sisters unlock an ancient lurking evil from within the pages of a dusty old book. But how can the madness be real if it’s only just paper and ink?
The Blindman’s Daughter (SIS Productions)
A Korean American father shares the story of Shim Chung with his young daughter, and discovers a new lesson for himself in a fun, modern retelling of this time-honored tale of familial duty and sacrifice.
The Flight Before Xmas (Seattle Public Theatre, 2017)
Sheathed (Macha Theatre Works, 2019)
In the aftermath of a devastating war between clans, two swordswomen try to find their way forward in this strange new world of peace: one trying to escape her past, and the other driven by an inherited thirst for revenge. When your very existence is defined by your blade, how do you keep the violence within yourself sheathed? A tale of an unlikely friendship tested by the bonds of honor and the terrible price of forgiveness, “Sheathed” combines movement and storytelling in an exciting new way to explore the emotional depths of why we fight.
Rainshadow Dispatch (Pork Filled Productions/Cafe Nordo, 2022)
Lee-Yang, May M.
MAY LEE-YANG is an award-winning playwright, poet, prose writer, and performance artist. She has been hailed by Twin Cities Metro Magazine as “on the way to becoming one of the most powerful and colorful voices in local theater.” Her theater-based works have been presented locally at Mu Performing Arts, the Center for Hmong Arts and Talent (CHAT), Intermedia Arts as well as nationally at Out North Theater (Anchorage) and the National Asian American Theater Festivals in Los Angeles and Philadelphia.
Her plays include Hmong-Lao Friendship Play or Lao-Hmong Friendship Play, Confessions of a Lazy Hmong Woman and Ten Reasons Why I’d Be a Bad Porn Star. In 2012, her company, Lazy Hmong Woman Productions, produced a Hmong-language version of Confessions of a Lazy Hmong Woman to create accessibility for people who spoke little/no English, were new Americans, or had never seen theater before. In 2014, she launched Letters to Our Grandchildren, a theater/food/storytelling/video project with Hmong elders.
She is the author of the children’s book The Imaginary Day (MN Humanities Center/Council on Asian Pacific Minnesotans) and has been published Bamboo Among the Oaks: Contemporary Writing By Hmong Americans, Water~Stone Literary Journal, The Saint Paul Almanac, and others.
She is a 2016 recipient of the Ordway Sally Award for Arts Access and a 2011 Bush Leadership Fellow. She has received additional support for her artwork from the Minnesota State Arts Board, the MRAC Next Steps Grant, the Jerome Travel Grant, the National Performance Network, the Midwestern Voices and Visions Residency Award, the Playwright Center, and the Kundiman Retreat.
She also teaches creative writing and theater to teens and elders through COMPAS, St. Paul Conservatory for Performing Artists, and Mu Performing Arts. In other parts of her life, she is a co-founder of Community Artist Leadership Initiative (C.A.L.I.), an organization whose mission is to build the leadership capacity of marginalized artist and is a co-founder of F.A.W.K. (Funny Asian Women…K), a collaborative to empower Asian women through comedy.
Anatomy of Hmong Girl: A Memoir Told in Body Parts (Mu Performing Arts, 2007)
The Hmong believe that when someone is born their placentas are buried underneath their homes, so when someone dies, they can find their way back home. What happens when you don’t know where your placenta is? ANATOMY is an exploration into the search for home. Part memoir, part political statement, this peice focuses on how Hmong Americans have been continuously dissected and how we attempt to flesh out and re-assemble our real voices and experiences.
The Divorcee Diaries (Mu, 2014)
The new play chronicles the Hmong sexual revolution. Set against the backdrop of a nightclub, four people explore the fun, the fear, and the fantasy of divorce as they drink, flirt, fight, and try to make sense of lives in transition.
The Moon Embraces the Song (Mu, 2017)
When a k-drama addict with a secret meets a Korean heir who has been banished to the Midwest, fantasy collides with reality in this romantic comedy about fate, cultural clashes, and the art of losing one’s virginity.
A Long Time Ago Today (Mu Performing Arts, 2018)
Writer May Lee-Yang weaves history, folktales, and her personal life to show how Hmong people use stories to make sense of the world around them: How did the Moon and Sun come to rule Night and Day? Why are some people left-handed and others right-handed? How do you keep culture and stories alive without books? What happens to people if they forget where they’re from?
The Korean Drama Addict’s Guide To Losing Your Virginity (Theater Mu, 2018)
She’s a Hmong personality coach addicted to Korean Dramas (Korean soap operas). He’s the heir to a Korean manufacturing giant banished to the new Midwest office. Will she find a man before the magic hour of her 30th birthday? Will he buck tradition and embrace his musical dreams? Fantasy collides with reality in this romantic comedy about fate, cultural clashes, and the art of losing one’s virginity.
Dandelion Girl (Theater Mu, 2019)
When a bully tells 8 year-old Payton she’s nothing more than a dandelion (a weed, ordinary, and yellow on top of that), she turns to her dad for help. Dad share his own experience growing up in the United States as a first generation refugee. Back in the day–the eighties–Dad taught himself martial arts by watching and practicing Kung Fu. But Payton doesn’t care for Kung Fu and must learn how to face bullies without fists.
Lee, Minna
One Horse Town (2020, Annex)
After the apocalypse, a trio of queer ranchers are protecting the last horse on earth from a group of starving runaways, who are trying their best not to become cannibals. All of them, ranchers and runaways alike, struggle to remember what makes them human in a world urging them to forget their compassion and their sanity. Minna Lee (The Devil and Sarah Blackwater,Rovers!), Grace Carmack (Silhouette, Puny Humans), and Omar Faust (Nite Skool) helm an ensemble in a story about survival and transformation.
Lee, Robert
Heading East (East West, 1998) libretto
A funny, slightly off beat musical about a family retracing its footsteps from 1848 to the present.
Lee, Soo-Jin
Soo-Jin Lee is a playwright and an English teacher.
Her plays include The Men My Mother Loved, Why Koreans Don’t Hug, Peaches, and Tigers, Dragons, and Other Wise “Tails.” Her work has been produced at the Discovery Theater, George Mason University, the University of Houston, the University of Texas at Austin, and the University of Wisconsin-Milwaukee.
Born in South Korea, Ms. Lee was raised in Virginia. She holds a BA from George Mason University and an MFA from the University of Texas at Austin. She is a proud member of the Dramatist Guild.
Peaches (University of Houson, 2005)
This play explores the relationship between two Korean American best friends, Ji Hae and Robert, as they discuss interracial dating, growing up Asian in America, and finding love in their 20s. The play chronicles one summer weekend they spend together, starting with a wedding and ending in a peach orchard that changes their lives.
Tigers, Dragons and Other Wise Tails! (Discover Theatre, 2005)
A world premiere by playwright Soo-Jin Lee, dances by acclaimed Washington choreographer Dana Tai Soon Burgess, DT artist Michael (Black Diamond) Bobbitt directing. Animal tales blend the beauty, wisdom, and fun of ancient Asian culture in this original musical play created to celebrate Asian Pacific Heritage Month. Ages 4–10
Why Koreans Don’t Hug (University of Texas New Theatre, 2008)
Intimacy. Betrayal. Misplaced love. A Korean immigrant family, through an unexpected act from their Reverend, is forced to deal with the elephant in their room.
The Men My Mother Loved (Pipeline Playwrights, 2017)
A vacation to Korea turns a mother-daughter exploration into a fantastical exploration of why it’s worth reuniting with ex-boyfriends.
Lee, Suzanne
Bio: Suzanne Lee is a LA-grown and New York-based playwright/screenwriter/entrepreneur. Her current project is adapting WORTH into a screenplay. She is a MFA candidate at the Yale School of Drama.
Ancestors (NY Theatre Workshop, 2000)
Byung holds a terrible secret from her past. Suni, her daughter, doesn’t know anything about it. When the father commits a terrible act, however, information comes flying out of the woodwork. As a family dynasty unravels, a nation and culture re-build.
Witness (NY Theatre Workshop, 2000)
Dolores and Antonia are two Dominican New Yorker sisters. One is terrifically straight, the other is terrifically gay. After a devastating love affair gone wrong, Dolores rebounds into the arms of a traditional Irish Catholic man who has less than modern ideas of how to raise a family. Choices have to be made – what do you do when the consequences of your choice are less than beautiful?
S/h-E (Asian American Alliance, 2001)
A one act genderfest.
Worth (Mark Taper, 2003)
America’s gone bankrupt, Enron-style. The rights to the fantasy are up for sale. A family fracas comprised of a father, a daughter, a rich widow and a best friend ensues. In the gamble of life, when you’ve lost everything you built your dreams on, how much more does it cost to lose yourself? Served Korean buffet style, striptease and karoake not included.
Ancestors (Ma-Yi, 2006)
Lee, Young Jean
Young Jean Lee has directed her plays at the Ontological-Hysteric Theater and Soho Rep. She has performed with the National Theater of the United States of America (What’s That On My Head!?!), studies playwriting with Mac Wellman at Brooklyn College, and is a member of 13P. With her Straight White Men, she became the first female Asian American playwright to appear on Broadway.
Groundwork of the Metaphysic of Morals (Ontological-Hysteric Theater)
The Appeal (Soho Rep)
We find Wordsworth as a guest of Coleridge and his sister Dorothy at Grasmere. Later, the “action” will move to the castle of Lord Byron in the Swiss Alps. Poetry, it seems, is borne of an admixture of thought, anxiety and booze.
Pullman, WA (PS122, 2005)
Pullman, WA is a play about what to do if you’re unhappy and everyone around you is kind of an asshole, including yourself.
Songs of the Dragons Flying to Heaven (Cowboy Vampire Theatre, 2006)
Church (2007)
The Shipment (2009)
Lear (2010)
A collision between Shakespeare’s King Lear, Sesame Street, and Young Jean Lee’s own take on the theme of dealing with a father’s mortality, Lee’s LEAR focuses not on the aging Lear and Gloucester, but rather on their adult children who turned their backs on their fathers’ suffering. An absurdist tragedy about familial piety, despair, and the end of life.
We’re Gonna Die (2011)
Untitled Feminist Play (2012)
Straight White Men (2014)
The play follows a middle-class father and his three sons as they celebrate Christmas together while each facing his own issues.
Leichman, Seymour
Freddie the Pigeon (NWAAT, 1975)
Leo, Katie
Jess and Sally are Back in Town (Mu Performing Arts, 2007)
Jess and Sally are as different as can be, yet know each other as only two sisters can. After years of estrangement, they convene at the home of their mother for her funeral, only to discover that the past never truly dies. Jess and Sally are Back in Town explores the complex, often humorous, relationship between two adopted Korean sisters as they sift through relics of family, heritage, assimilation, choices, and their own strained lives.
Four Destinies (Mu Performing Arts, 2010)
Destiny Jones is a Korean adoptee growing up in Minnesota…no, Destiny Jones is an African American adoptee growing up in Minnesota…no, Destiny was born in Guatemala…no, Destiny is a Caucasian boy…! In this satirical exploration of fate, DNA, arrival stories and the families that love them, playwright Katie Leo represents every adoptee ever born and gives all her characters exactly what they want.
Leong, Page
attraction (Cornerstone, 2008)
Explore what draws people to place, to one another, and what pulls them apart, at the intersection of an urban global village experiment- at Traction Avenue. Dive in to our neighborhood’s kaleidoscopic spirit, its magic, history and mystery.
Lew, Andy
Welcome to the Wongs (NWAAT, 1999)
Welcome to the Wongs is a hilarious story of a family dinner spinning out of control and the interesting twists and mishaps in the lives of three generations of Chinese in America. The story is told from the point-of-view of a young Chinese American boy who is constantly bombarded with inter-generational family politics and traditional culture while questioning his own ideas about relationships, culture and family. With a cast that will have you laughing and crying in your seats, this is a workshop presentation not to be missed!
Lew, Michael
Michael Lew was a 2003-2004 directing resident at Playwrights Horizons, assisting on Craig Lucas’ Small Tragedy, Jon Robin Baitz’s Chinese Friends, and Erin Cressida Wilson’s Wilder. He assistant directed the Drama Dept’s 2004 Downtown Plays, and has also assistant directed at the Mark Taper Forum and for Primary Stages. He has held literary residencies at Playwrights Horizons and La Jolla Playhouse and was associate artistic director of Gorilla Repertory Theater, producing their 2003 season. He holds a B.A. in English and Theater Studies from Yale University and was in the 2005 Lincoln Center Director’s Lab.
Yit, Ngay (One, Two) (Women of Color Arts and Film Festival, 2003)
This one-woman show is based on the separated childhood of four Chinese women; two were born and raised in Toi San, China and two were born and raised in Fresno, CA.
Paper Gods (Ma-Yi, 2006)
Moustache Guys (2g, 2008)
Ali is worried. Her husband Paul has just joined the International Order of the Moustache Guys. So she dons a fake moustache and pursues her husband, exposing a secret world of shady characters and shadier facial hair.
A Better Babylon (Victory Gardens, 2008)
In 1960s UC Berkeley, a wave of student radicalism engulfs a young Chinese couple, a black protester, and a Chicana biologist. Personal dreams collide with political conscience, testing the limits of mentorship, friendship, and love.
Bury the Iron Horse (2g, 2009)
“This is it, bitches: Iron Horse Park.”
This is the Seattle park where three sisters reunite after a long estrangement.
This is where their parents fell in love and started a salmon cannery.
This is where Dad took them on hikes and Mom skinned salmon.
This is where Dad left them.
Through six interwoven camping trips, a family comes together and falls apart, and three sisters return to
BURY THE IRON HORSE
Bike America (Julliard, 2012)
Penny is damaged. She doesn’t know who she is or her place in the world. So she drops everything to go on a cross-country bike trip from Boston to Santa Barbara. Along the way she befriends fellow adventurers, from the lesbian couple who’ve decided to get a marriage license in every state to the mysterious Man with the Van who transports their belongings. Set in iconic towns from the deep North down to the deep South (and the highways between), Bike America captures the restlessness of a Millennial generation that will go to any length to find a place that always seems just out of reach.
Collin (Ma-Yi, 2012)
David is a successful New York casting director and Collin is a hot young star on the rise. The attraction is chemical, but the combination is potentially deadly. A love letter to the theater where the highs and lows of romance echo the highs and lows of a life on the stage.
Teenage Dick (Ma-Yi, 2015)
Teenage Dick is a re-imagination of Richard III set in high school. The play uses the most famous disabled character of all time as a means for re-examining more contemporary tropes about the handicapped, via the tale of Richard (junior class secretary) and his quest to become senior class president of Roseland High.
Tiger Style (Alliance Theatre, 2015)
Star students and squabbling siblings Albert and Jennifer Chen used to represent the pinnacle of adolescent achievement. When it comes to adulthood, they’re epic failures. Albert’s just been passed up for promotion and Jennifer’s been dumped by her loser boyfriend. So they do what any reasonable egghead brother and sister would do and go on an Asian Freedom Tour! Travelling from California to China, Tiger Style! embraces the inner slacker and the outer tiger parent in all of us.
British Raj – Just the Fun Parts (Ma-Yi, 2017)
5 Desis cover 350 years of history in 2 hours.
Bhangin’ It, book with Rehana Lew Mirza, music by Sam Willmott (La Jolla Playhouse, 2019)
“Bhangin’ It” draws inspiration from the high-stakes world of intercollegiate competitive bhangra – a traditional Indian folk dance morphed into a good ole American dance-off. The story follows a biracial student, Mary, who gets kicked off her bhangra team for not being “Indian enough”. When she forms a team of her own, cultural authenticity and cultural pluralism are set on a collision course in this brash, intoxicating and gripping new musical. Winner of the 2018 Richard Rodgers Award.
Li, Melissa
Interstate (Mixed Blood, 2020)
Interstate is a Queer Asian-American pop-rock musical about two trans people at different stages of their journeys, navigating love, family, masculinity, and finding community in the era of social media. It charts Dash, a transgender spoken word performer as he goes on a cross-country tour with Adrian, a lesbian singer-songwriter, as the activist band, Queer Malady, fueled by the allure of fame and a desire to connect with the Queer Asian community. The band’s fiercely political and deeply personal music touches Henry, a transgender teenage blogger living in middle America, who finds solace in their art as he struggles with his own identity and family. With Kit Yan.
Li, Yan
Bethune (NAAP, 2019)
Canadian surgeon Norman Bethune finds his passion and purpose renewed when he travels to 1930s China and aids the Communists in their struggle for liberation. Aided by his staff and local militiamen, he learns the price of belonging to two worlds and captures a glimpse of Mao’s vision for the future.
Liang, West
The Atmosphere of Henry (Ivar Brickbox Theatre, 2004)
The play explores the mind of a young man named Henry and his relationship with his wife, Joanne, which has been paralyzed by their lack of communication. What does he do to compensate, and where does he find connection? Four lives converge in this quick-paced drama set in a San Francisco high-rise.
The Legend of Jane and Joe (Ricardo Montalbán Theatre, 2005)
An intriguing and clever play that explores the relationship between two artists in contemporary Los Angeles, beginning with thier brief but riotous first encounter. Follow these two young lovers, as they discover lust and vanity, fear and happiness, ambition and disipline, and love and fate.
Lim, Dean
An Unbreakable Illusion of History (EWP: Paper or Plastic, 1999)
Lim, Genny
Genny Lim lives in San Francisco. She is the author of a bilingual children’s book, Wings of Lai Ho, and co-author of Island: Poetry and History of Chinese Immigrants on Angel Island. BA/MA San Francisco State University, English with Creative Writing Emphasis; Broadcast Journalism Certificate from Columbia University 1973. Profession: Faculty at New College of California, Playwright, Poet, and Performer. Awards: Bay Guardian Goldie, Creative Work Fund and Rockefeller for Songline: The Spiritual Tributary of Paul Robeson Jr. and Mei Lanfang, collaboration with Jon Jang and James Newton. James Wong Howe Award for Paper Angels (Premiered July 2000, UC Zellerbach Playhouse).
Paper Angels (AATC, 1980)
This is the story of the first generation of Chinese American immigrants, caught between disaster in China and anti-Chinese backlash in America after the passage of the Chinese Exclusion Act of 1882…
Bitter Crane (Bay Area Playwrights Festival, 1989 )
Pins and Noodles (1989, Persona Grata)
Daughter of Han (Bay Area Playwrights Festival,1983)
I Remember Clifford (Bay Area Playwrights Festival, 1983)
Pigeons (SF Chinese Culture Center, 1985)
XX (The Lab, 1987)
The Pumpkin Girl (Bay Area Playwrights Festival, 1989)
Winter Place (Hatley-Martin Gallery, 1988)
Faceless (Magic Theatre, 1989)
The Magic Brush (World of Tales, 1990)
SenseUs, The Rainbow Anthems (Life on the Water, 1990)
Lim, Sean
Fresh off the Plane (AATC)
World Premiere! Newsflash! FOBs don’t come from boats these days, they get dropped off in planes! Join three young Asian Americans in this newly adapted tale of the modern FOB – the FOP. Asia and America. Ah, sometimes it feels like you’re floating between the two – which is exactly what these three punks do on their quest to become ‘fobulous.’
Lin, David
Yellow Flight (EWP, 2003)
Interracial sex, Canadian rock music, and ecumenical drug use are the tip of the iceberg in this wretched tale of race, real estate, and college admissions. Guaranteed to generate controversy.
Lin, I-Jong
The God of Tobacco (Poets Theatre, 1999)
Grand Unification Theory (2002)
A couple come to a New England bed and breakfast for a three-day physics conference. The couple is made up of a sometimes-working Asian-American actor (Tsuhan) and girlfriend (Chintz), a graduate student in Theoretical Physics. Unfortunately, his credit card has bounced and he makes a quick deal with the owner (Mrs. Chin) to work off his debt through manual labor and recounting how he met Chintz. The first night, Mrs. Chin find Chintz in the dark and swap stories about how they met their respective significant others. The second night, Tsuhan recounts his side of the story. The third night, Chintz and Tsuhan fight and resolve their relationship once and for all.
Martyrs, Victims, Fighters And Theives: The Myth Of The Model Minority (Medicine Show, 2002)
X and Francis are brothers; Francis is about to be married to Kim and X is in a “special” relationship with K. As well as being romantically involved, X and K break into each other’s apartment and steal things from each other.
Lin, Kenneth
Kenneth Lin is an award-winning playwright and screenwriter whose plays Warrior Class, Pancakes, Pancakes!, Po Boy Tango, said Saïd, Agency*, Intelligence-Slave, Genius in Love and The Lynching of a White Man In Rural, CA have been performed throughout the world. He is a member of the theater/music/film collective New Neighborhood.
Po Boy Tango (Searchlight Theatre, 2009)
A celebration of the human spirit and the joy of cooking, Po Boy Tango tells the story of Richie Po – a Chinese immigrant who turns to his estranged friend Gloria to help him recreate his mother’s “Great Banquet.” Despite the challenges of shark fin soup, duck po boy sandwiches and underlying cultural tensions, Richie and Gloria find common ground through their shared humor and the interaction of traditional Taiwanese cuisine and African-American “Soul Food.” With the help of lessons from Po Mama’s television cooking show, the two discover a deeper understanding of food, culture and the nature of friendship
Warrior Class (Second Stage, 2012)
When Assemblyman Julius Lee makes a bid for Congress, the ghosts of his college days come back to haunt him. Nothing reveals true colors like a sprint to the finish, when friends become enemies and allies can turn on a dime.
Intelligence-Slave
Inspired by a true story, Intelligence-Slavetakes place underground in an abandoned salt mine where the Nazis have moved the Buchenwald machine factory at the end of World War II to avoid Allied bombing. In this salt mine, the Austrian industrialist and concentration camp prisoner, Curt Herzstark tinkers with an amazing device. A small, black metal cylinder, no bigger than the palm of his hand, the device is a technical marvel… it’s also what’s keeping Curt alive; the device is the world’s first handheld four function calculator and the Nazis have designated Curt an “intelligence-slave” and are keeping him alive to present it as a gift to Adolf Hitler.
said Saïd
Algerian poet and essayist Andre Saïd has immigrated to the United States and built a life for himself. He has been named the Poet Laureate of the United States Library of Congress, and has won a Nobel Prize for Literature. But, these are controversial because Saïd was accused of being a terrorist during the French-Algerian War. A prison where Saïd was held in Algiers is torn down, and pages and pages of poetry are discovered. But, the poetry is written in an obscure dialect of Berber, of which Saïd is the last remaining speaker. He is asked to translate, but refuses. Why?
Agency*
A Catholic priest, turned assassin is given a new assignment — his next target is a computer that has become conscious and barracaded itself in the home of an autistic child.
About Me:
Cameron and Libby, two aspiring writers, meet each other on a online dating site, and go through a necessary New York City rite of passage: dating someone you thoroughly dislike. Initially, they last six months. But, years later, after the city and life has ground them into their respective destinies, they reunite when Libby’s dying. What if missed chances and connections are all that’s left to see you to the end?
Life On Paper
After his proof for the Riemanm Hypothesis (one of the world’s last great math puzzles) disastrously flames out, Mitch Bloom, a brilliant mathematician finds himself working as a consultant using complex algorithms to set the value of human lives in wrongful death cases. His knack for de-valuing lives has made him the darling of the insurance companies, but what will he do when the wrongful death of a billionaire philanthropist crosses his desk, and the future of a small town hangs in the balance?
Farewell My Concubine
Set against the backdrop of China’s painful transformation away from imperial rule, Farewell My Concubine, based on the acclaimed film and novel, tells the story of a Peking opera troupe whose members must contend with changing political winds via an artform that has defined their lives, but whose relevancy is threatened in a strange new world.
Pancakes, Pancakes
Created in residency at the Eric Carle Museum of Picture Book Art, Pancakes, Pancakes! tells the story of Jack, a young boy who is hungry for breakfast, and the journey his busy mother sends him on to collect the ingredients for the perfect pancakes. Written with support and permission from the author in conjunction with a perspective at the High Museum of Art, this adaption is not currently available for licensing.
A book images are copyrighted images that belong to Eric Carle.
The Lynching of a White Man In Rural, CA,
This tells the story of Aaron Hayes, a well-heeled young American who casts off his Ivy-League pedigree when a summer job as a beekeeper turns into a journey through the American heartland as a migrant farm worker. His journey ends in California where he is mistaken as Mexican by White Supremacists who beat him to death in a hate crime. The play follows Aaron’s transformation as he travels from farm to farm and his mother Elizabeth’s, transformation as she journeys, in a gypsy cab, to meet her son’s killers. Ultimately, they trace similar paths of discovery, longing, hope and grief.
Genius in Love
Isaac Newton and Gottfried Leibniz, fierce rivals and towers of the Enlightenment come together at the ends of their lives to complete the world’s greatest invention — a love potion.
The Adventures of Huckleberry Finn (Alley Theatre, 2017)
A reworking of Twain’s novel focusing on the relationship between Huck and his father Pap. Artistic director Gregory Boyd will direct.
Kleptocracy (Arena Stage, 2019)
The world premiere of Kenneth Lin’s play is set after the fall of the Soviet Union when a new ruling class that includes a hyper-ambitious Vladimir Putin takes hold of the country.
Exclusion (Arena Stage, 2023)
The second Power Play of the season by Kenneth Lin is a hilarious peek into the world of filmmaking and Hollywood. The workplace politics will immediately strike a chord.
Lin, P. H.
Sweet Ginger: Hot And Blue A play in two acts by P.H. Lin
(4 W, 2 M ) A coming of age story, but from an Asian point of view. Can a Taiwanese immigrant family adjust to an American way of life without destroying what’s left of their family? Complicating things are a 95 year-old Jewish woman, a female Buddha, and the spirit-apparitions of Ginger’s mother and brother.
Lin, Serena
Left Unsaid (East West, 2008)
Sonia’s family and beloved community crumbles under the weight of intrigue, violence, and racial tension under the new moon of Ramadan. This is a story about one woman coming outside in a Los Angeles neighborhood and all we can never say, but long to say anyway.
A Traditional Girl (A Radio Play set to Asian Jazz Fusion) (EWP, 2009)
Once upon a time a group of friends got together at a bar to dish about fairy tales, closets, changing your gender, and true love…
Lin, Weiko
Based in Los Angeles, Weiko Lin holds a MFA in Film and TV from UCLA. As a member of WGA-west, he is also the recipient of a Samuel Goldwyn Writing Award. Weiko is a visiting lecturer in screenwriting at UC San Diego and an instructor at East West Players.
Tracks of Tears (1997, Veteran’s Wadsworth Theater)
Heavenly Peace (1999, UCLA Royce Hall)
Parachute Kid (2001, UCLA Royce Hall)
Blind Street (Riverscope, 2003)
On a street corner in LA, a blind musician plays on as an eclectic group of hardened city natives meet by pure chance. Through the eyes of a dying British backpacker and his pregnant girlfriend, the lives of a homeless vet, a delusional prostitute actress, a grave digger, a Beverly Hills runaway, a sex-craving bully, and a Hollywood screenwriter intersect via love, sex, and death.
Mommy’s Special (2004)
Set in the back lot of a Chinatown dive bar, two complete strangers confront their dark pasts and discover the secret ties between them.
The Best Man (2005)
Mitchell spends the evening before his wedding at a New York hotel suite with his best man, Danny, a musician burnout who makes his money prostituting his young, naïve girlfriend, Misty. Mitchell’s marrying Julia, who is also Danny’s ex-wife. When the women arrive, the charade begins. The drinks flow and suddenly inhibitions melt. Beneath its high-stakes surface and temptation, a dark vengeful secret explodes as the night unfolds.
Linmark, R. Zamora
Rolling The Rs (Kumu Kahua, 2008)
Edgar Ramirez, a Kalihi teenager “who looks like a Filipino John Travolta,” knows that he is gay and isn’t bothered by his schoolmates’ taunts. Rolling the Rs is set in the disco ’80s, when high school students had posters of Scott Baio and Leif Garrett, listened to Peaches and Herb, read Sixteen and Teen Beat, and struggled with their identities. Edgar and his friends Katrina and Vicente exchange words with their classmates, dance, sing and experiment with sex in a free-floating, surrealistic story punctuated by the disciplinary voice of the schoolteacher, Mrs. Takemoto, and the judgmental gossip of Philippine-born and raised friends Mrs. Kayabyab and Mrs. Arayat.
Liu, Yilong
Yilong is a New York-based bilingual playwright, originally from Chongqing, China. Currently, he is a resident playwright at The Flea Theatre and a proud member of Ensemble Studio Theatre’s Obie Award-winning playwrights group Youngblood.
Awards include Kennedy Center’s Paul Stephen Lim Playwriting Award (The Book of Mountains and Seas), Paula Vogel Playwriting Award (June is The First Fall, 2nd place), National Partners of the American Theatre Award for Playwriting (Joker), and Po’okela Award for Best New Play (Joker). He is a EST/Sloan New Play Commission recipient, a SPACE on Ryder Farm resident, and the Asian Pacific American Friends of The Theatre Playwright Scholarship recipient.
His work has been produced or developed at SPACE on Ryder Farm, Stella Adler Studio of Acting, East West Players, Queens Theatre, FringeNYC, Union Theatre (London), CAATA, New Ohio Theatre, Kumu Kahua Theatre, New Conservatory Theatre Center, and others. When he’s not writing, he’s usually Netflixing, people watching, or compulsively liking cat pics on Instagram.
The Book of Mountains and Seas (East West Players, 2017)
(3m)
Two years after losing his son, a California dad teams up with the son’s last boyfriend in New York for an impossible mission to visit all the restaurants on the son’s Yelp page, but each with their own agenda. The dad is Chinese. The boyfriend is American. A comic drama about two people dealing with loss, differences, and their unlikely friendship in a digital and global age. Winner of Kennedy Center’s Paul Stephen Lim Playwriting Award, a semifinalist for O’Neill Playwrights Conference, Bay Area Playwrights Festival, and a finalist for The New Harmony Project.
Flood in the Valley
FLOOD IN THE VALLEY is a bilingual folk musical set in the hills of Appalachia and Sichuan and created by a collaborative of six playwrights and composers from China and the United States. Performed in Mandarin, English, and Nuosu by a diverse cast of eight performers from both countries and a live band, the play follows two pairs of lovers as they contend with the rigid traditions of their mountainside communities and the struggle to find one’s home in a changing world.
Joker (Kumu Kahua, 2015)
Set around the fight for marriage equality in Hawai’i, Joe’s normal, simple life unravels as a promise kept is threatened by a visit of a man from his past.
Spring is the First Fall (Queens Theatre, 2017)
Inspired by a portrait of Afong Moy, the first female Chinese immigrant to the United States, this play explores love, loss, and the power of our memories. When a breakup brings back a painful past, a Chinese American gay man returns home to Hawaii, where he must confront his sister, his father, and himself about a dark family history that reopens old wounds.
Lo, D.
First String (EWP, 2004)
Blending fast-paced scenes and rhythmic monologues, this piece of hip-hop theater shines a light on the friendships and love lives of a group of butch and femme women.
Lo, Jeffrey
Jeffrey Lo is a Filipino-American playwright and director based in the Bay Area. He is the recipient of the 2014 Leigh Weimers Emerging Arist Award, the 2012 Emerging Artist Laureate by Arts Council Silicon Valley and Theatre Bay Area Director’s TITAN Award. His plays have been produced and workshopped at The BindleStiff Studio, City Lights Theatre Company and Custom Made Theatre Company. His play Writing Fragments Home was a finalist for the Bay Area Playwright’s Conference and a semi-finalist for the O’Neill Playwright’s Conference.
Recent directing credits include The Santaland Diaries at TheatreWorks Silicon Valley, Peter and the Starcatcher at Hillbarn Theatre, The Crucible, Yellow Face and Dead Man’s Cell Phone at Los Altos Stage Company, Uncle Vanya at the Pear Theatre (BATCC award for Best Production)Eurydice at Palo Alto Players (TBA Awards finalist for Best Direction) and The Drunken City at Renegade Theatre Experiment. Jeffrey has also worked with the Oregon Shakespeare Festival, San Jose Repertory and is a company member of Ferocious Lotus Theatre Company and SF Playground. He is the Casting Director at TheatreWorks Silicon Valley, a graduate of the Multicultural Arts Leadership Institute and a proud alumnus of the UC Irvine Drama Department.
A Kind of Sad Love Story (Bindlestiff, 2013)
Andrew and Emily are a mid-twentysomething couple whose time together is about to run its course as the realities of maturing sensibilities set in. A Kind of Sad Love Story is the bittersweet story about a relationship between two nice kids who, in order to move on with their lives, must first break each other’s heart.
Writing Fragments Home (2014)
Dealing Dreams (Custom Made Theatre 2014)
A Kind of Sad Love Story (Bindlestiff Studios, 2016)
Angel in a Red Dress (Impact, 2012)
Spending the End of the World on OKCupid (Ohlone College, 2016)
Waiting for Next (Dragon Theatre Productions, 2016)
Locsin, Aurelio
Aurelio Locsin is a writer and actor, and a company member of the Rude Guerrilla Theater Company. More information including reviews at rgasian.blogspot.com
Asian-Acting: an Evening of One-Act Plays by Aurelio Locsin:
a wild assortment of World Premiere plays, dance pieces, monologues and puppetry. (Nominated Best New Play for the 2005 Orange County Theater awards.)Rude Guerrilla Theater Company (Orange County, CA.) in January 2005:
Mrs. M’s Tea
A woman sits down for a last cup of tea before going to a Japanese internment camp;
Marriage Monkey
A man fights in court for the right to marry outside of his race;
Midnight Manuever –
A timid woman decides to stand up to the bigots in her neighborhood
How China Diffused the Cuban Missile Crisis
A dance piece.
Tongue Lashing
A vicious killer and his victim have a little conversation before getting down to business;
American Express –
A visit the Thai sex industry
Legend of the Banana
Filipino fable comes magically to life.
Helltown Buffet (formerly Consent)(East West, 2006)
Can two gay Filipinos: a wimpy assistant manager and a hunky demon, fall in love through their real and imagined histories? This dark comedy propels them from the Hometown Buffet to several afterlives, prompting encounters with a sexy demon boss, a fabulous stylist, hungry homeless people, bewildered tribesmen and talking trees.
Head Aches (East West, 2010)
Middle-aged Ricardo, a Filipino-American canine cop, wants to make peace with his son, wife, father and dog. Unfortunately, his coma makes communication impossible. Can the objects of his affection help him handle family, child-rearing, sexuality and love before it’s too late?
Family Affair (East West 2011)
Filipino-American LD and Anglo Kenny decide to break up their long-term gay relationship. LD’s family, who like Kenny better than LD, are thrown into turmoil. Do they try to get them together or push for the separation?
Loh, Sandra Tsing
Sandra Tsing Loh is an L.A.based writer/performer/musician. Her books, published by Riverhead Books, include a novel, If You Lived Here, You’d Be Home By Now, which the Los Angeles Times named one of the best books of 1997, Depth Takes A Holiday: Essays From Lesser Los Angeles, and Aliens In America. The latter is based on Loh’s solo Off Broadway show which ran at Second Stage Theatre in New York in summer, 1996. Loh has also been featured at the U.S. Comedy Arts Festival in Aspen, the HBO New Writers Project, and on NPR’s “This American Life.” She is also a regular commentator on NPR’s “Morning Edition,” a show which coincidentally has used segments from Pianovision as buttons.
Currently, Loh is most musically active as a composer for film. She composed and performed on the score for Jessica Yu’s 1997 Oscar-winning documentary Breathing Lessons: The Life and Work of Mark O’Brien, and is scoring Ms. Yu’s next documentary on HBO of the Living Museum. Loh began in the mid’80s as a performance artist; her piano concert “spectacles” were covered by such outlets as People, the Wall Street Journal, GQ, Glamour, the Associated Press, CNN, and even in Johnny Carson’s Tonight Show monologue.
Nearly 1,000 people attended “Night of the Grunion” (March 1989), in which Loh and the Topanga Symphony played a concerto for spawning fish on a Malibu beach at midnight. In “Self Promotion” (March 1988), an assistant flung $1,000 in autographed $1 bills over her as she performed before a stampeding crowd. “Spontaneous Demographics” (September 1987) featured Loh playing a piano abord a flatbed truck in a concert for rush hour commuters on the Harbor Freeway.
Aliens in America (Second Stage, 1996)
Bad Sex with Bud Kemp (Second Stage, 1998)
Sugar Plum Fairy (Seattle Repertory Theatre, 2003)
A one-woman show about an ungainly 12-year-old girl who longs to dance the role of Clara in “The Nutcracker.”
Language Will Be Used (Mark Taper, 2004)
This is not for the faint of heart. Wit, writer, performer and radio personality Sandra Tsing Loh’s Language Will Be Used will unleash a fast rumination on topics such as the FCC, Lenny Bruce, the Van Nuys Courthouse, the danger of Peet’s lattes, the horror of pledge drives, places to shove your public radio coffee mug, multicultural nose flutes, Gino Vanelli’sunderpants, if Melissa Rivers were a camel jockey, if Rodney King were Caucasian and of course, just in time for summer, the Palestinian woman joke.
Lottman, Anh
Anh Lottman lives in Monrovia, CA. Ms. Lottman graduated from USC as a Master of Professional Writing, in May of 2003. She is also degreed in English, History, the Liberal Arts, and has studied and written for the East West Players. She has worked as a teacher, a grant writer, and a journalist.
V (East West, 2001)
A Vietnamese-American family battles to vanquish the vampiric shadows from their past.
I Start At A (2003)
I Start at A is a uniquely staged fairytale about the value of first being true to one’s self.
Loughran, Keira
Little Dragon (fu-GEN, 2005)
Little Dragon is a fierce, biting comedy. It tells the story of a young third-generation Chinese-Canadian woman who goes to university and discovers she’s Chinese. Her ensuing search for a cultural identity, of which she can be proud, surfaces a long-repressed pain stemming from the death of her father in her early childhood and generations of family shame and secrets. Through her journey, she comes to believe that her father was actually Bruce Lee, and she turns to the martial arts legend for solace and strength. It is a story of! longing, belonging, and ultimately, self-love.
Louie, Daniel
Baby Dearest ()
Short play.
Sasha Says (2000)
“Sasha Says” is a dark and haunting fantasy tale about the fate and rivalry of two brothers, both oppressed by their domineering mother. One day Cyrus rescues a mysterious mute girl named Sasha and falls in love with her, awakening a desire he never knew existed. Just as Sasha begins to return his feelings, Cyrus’ younger, better-looking, and more talented brother Lucien returns, igniting Cyrus’s slow descent into madness and plunging all three headlong into destruction.
Never Cry Zombie (Washington, DC, 2000)
A Ten Minute Show: Trapped in a basement, friends deal with a zombie friend.
Acceptance (Love Creek Productions, 2001)
Goodbye with Hope (Love Creek Productions, 2001)
Paying Regrets (Love Creek Productions, 2001)
Louis, Nikki
Made in America (NWAAT, 1985)
Breaking the Silence (NWAAT, 1986)
Lounibos, Tim
Be Happy (Lodestone, 2008)
Ten years of torment cast a woman and her therapist into a psychological pandora’s box during a perverse struggle for happiness. One Act.
Lowe, Andy
The Cultural Hyphenate ()
Lum, Benjamin
Angst, Adolesence and Alone (EWP: Paper or Plastic, 1999)
Of Dreams, Mangos and Rycroft Street (EWP: Paper or Plastic, 1999)
perceived (and short scenes) (EWP: Paper or Plastic, 2000)
Searching for Paradise (EWP: Paper or Plastic, 2000)
Lum, Darrel H. Y.
DARRELL H. Y. LUM is co-publisher and co-editor of Bamboo Ridge, which he helped found in 1978. He is author of both prose fiction and plays. He has published two collections of short fiction, short stories and drama. Pass On, No Pass Back was awarded the Asian American Studies Book Award in 1992. His work has been widely anthologized, and frequently used in English, Speech, and Asian American Studies classes in secondary school and college classes in Hawai‘i, and on the mainland. Oranges Are Lucky was his first play, and has been staged three times by KKT, in 1976, 1986, and 1996.
Dr. Lum received the Cades Award in 1991 and the Hawai‘i Award for Literature, the state’s highest award for literature, in 1998. He holds a Doctorate in Education from UHM.
Oranges Are Lucky (Kumu Kahua, 1976)
Magic Mango
My Home is Down the Street (1987)
A Litle Bit Like You (Kumu Kanua, 1991)
Fighting Fire (Kumu Kahua, 1996)
David Caradine: Not Chinese (Kumu Kahua Theatre, 2005)
Playwright Lum, who has a talent for dealing with serious issues in a lighthearted style, is at his comic best in this tale of convoluted racial stereotypes, local attitudes and pun-ridden dialogue, culminating in a hilarious evening at the Wat-Chu Society annual banquet.
Beer Can Hat (Kumu Kanua, 2019)
Bobo is a little slow. His abusive father wants to send him away. Selling newspapers on the street, Bobo scrounges for a little money. Despite injuries, harassment, and discrimination, Bobo never complains—after all, he may not have much—but Bobo does have one thing: a true friend. Da Beer Can Hat is based on Darrell Lum’s original short story of a mentally handicapped individual and his one, best friend.
Lum, Leslie
Geomancer (NWAAT, 1999)
A Chinese scientist is accused of espionage and stealing atomic secrets. The year? 1952…The more things change…
Ly, Minh
Ga Ting (2013)
This heartbreaking story of two parents struggling to come to terms with their sons’ sexuality in the wake of his death
Ly, Oskar
Oskar Ly is a Hmong French-American Artist and Organizer. She is a Fashion Artist and Singer-Songwriter with a focus on social justice. She uses the arts and community organizing as a foundation to build community spaces that celebrate authenticity, discovery, and our stories. Her vision is to achieve responsible recognition of her communities, create space for original narratives and lift multi-dimensional identities through creative exploration. She enjoys crafting to liberate beyond words, sharing food, culture and conversations.
Womn + Womn (Mu, 2015)
Nana (Soul), Huab (Body) and Jules (Spirit) journey through queerness, haircuts, cassette tapes and their intertwined fates hidden in memories and explorations of their unbeknownst affection for women.
Ly-Cuong, Stephane
Lemon Twist (A Musical) (Mu Performing Arts, 2015)
Lemon Twist tells the story of Yvonne, an American-Vietnamese woman living in New York who is torn between her very traditional Vietnamese family and her desire to be a “normal” American. She longs to be an actress – to star in a musical! To light up the silver screen! – but roles for Asians are few and far between. Should she give in to her mother’s pressure to become a pharmacist? Luckily, her sharp sense of humour comes to her aid as she finds herself between jobs, between relationships, feeling neither wholly American nor entirely Vietnamese…
|
|||||
692
|
dbpedia
|
2
| 98 |
https://www.newyorkstageandfilm.org/history
|
en
|
New York Stage and Film
|
[
"https://static.wixstatic.com/media/37ac15_220f49ceeb554423b6d9584ec9f9d5df~mv2.png/v1/fill/w_178,h_65,al_c,q_85,usm_0.66_1.00_0.01,enc_auto/NYSAF_SS21_LogoAlternate_Color.png",
"https://static.wixstatic.com/media/37ac15_835f637bc8444396889465b2957be01e~mv2.png/v1/fill/w_49,h_13,al_c,q_85,usm_0.66_1.00_0.01,blur_2,enc_auto/37ac15_835f637bc8444396889465b2957be01e~mv2.png"
] |
[] |
[] |
[
""
] | null |
[] | null |
NYSAF was founded in 1985 in order to provide artists with a rigorous and nurturing environment to invigorate the artistic process; to promote collaboration between artistic peers and between artists and audiences; and to facilitate the sharing of knowledge from one artistic generation to the next.
|
en
|
nysaf
|
https://www.newyorkstageandfilm.org/history-2010-present
|
NYSAF was founded in 1985 by Mark Linn-Baker, Max Mayer, and Leslie Urdang in order to provide artists with a rigorous and nurturing environment to support artistic process, promote collaboration between artistic peers, foster dialogue between artists and audiences, and to facilitate the sharing of knowledge from one artistic generation to the next. Johanna Pfaelzer was named NYSAF's first Artistic Director in 2007, having worked with the company as Managing Producer since 1998, and now serves as a Producing Director along with the three founders. In 2019, Christopher Burney began a 3.5 year term as the next Artistic Director, leading the community with great care and creativity through an unexpected tenure of global change, ushering in a new era of service and flexibility. Liz Carlson succeeded Burney as the Interim Artistic Director in November 2022, after a 15-year relationship with NYSAF as an artist and producer, including a 7-year term as the year-round Artistic Producer. Learn more about NYSAF's company leadership.
From our inception in 1985, NYSAF and Vassar College partnered to produce the annual Powerhouse Summer Season in Poughkeepsie, NY. In the 2010s, NYSAF expanded our commitment to serving artistic process by supporting regular programming in New York City throughout the calendar year. As the world changed in 2020, we adapted our resources to meet the evolving needs of our community, and expanded our partnerships in the Hudson Valley to include Marist College and other local businesses and educational institutions.
In 2023, NYSAF entered a dedicated, multi-year collaboration with Marist College in order to expand our year-round services for artists developing new work in theater, film and television in the Hudson Valley and New York City while also opening up significant new educational programs and experiential learning opportunities for Marist students.
Learn more about our Annual Artist Support.
Notable productions that received vital incubation with NYSAF include: the Tony Award-winning Hamilton (Lin-Manuel Miranda), Hadestown (Anaïs Mitchell), The Humans (Stephen Karam), Doubt (John Patrick Shanley); OBIE Award winning The Invisible Hand (Ayad Akhtar), Pulitzer-finalists The Wolves (Sarah DeLappe) and Taylor Mac’s A 24-Decade History of Popular Music; Broadway musicals Head Over Heels, American Idiot, Bright Star; Off-Broadway’s The Fortress of Solitude (Michael Friedman and Itamar Moses), Sanctuary City (Martyna Majok); the award-winning Peanut Butter Falcon (Tyler Nilson and Michael Schwartz); multiple collaborations with Ngozi Anyanwu, Jocelyn Bioh, Halley Feiffer, Zach Helm, Beth Henley, Warren Leight, Mozhan Marnó, Billy Porter, Brian Quijada, Josh Radnor, Duncan Sheik, Steven Sater; and hundreds more.
2020 -
2024
NEW YORK STAGE AND FILM SUMMER SEASON
AT MARIST COLLEGE
KICKOFF PERFORMANCE
JIM DALE: LIVING WITH LAUGHTER
Written and Performed by Jim Dale
MUSICAL WORKSHOPS
BIGFOOT
Book by Amber Ruffin and Kevin Sciretta
Music by David Schmoll
Lyrics by Amber Ruffin
Directed by Amber Ruffin
THE HEART
Based on Réparer les Vivants by Maylis de Karengal
Book and Additional Lyrics by Kait Kerrington
Music and Lyrics by Anne Eisendrath and Ian Eisendrath
Directed by Chris Ashley
MUSICAL CONCERT
THE NINTH WOMAN
By Delta Rae
Directed by Logan Vaughn
PLAY WORKSHOP
MOMMY, A ONE WOMAN CHO
Written by Margaret Cho
Additional Material by Leah Nanao Winkler
Directed by Leigh Silverman and Seonjae Kim
STORIES THAT MOVE
GAME NIGHT
Co-Created and written by Shanessa Sweeney
Composed by Bongi Duma
Co-Created and choreographed by Ray Mercer
Directed by Rufus Bonds, Jr.
TULIPA
By Kate Douglas
Directed by Kate Whoriskey
Featuring Jessica Hecht
PLAY READINGS
WELL WELL WELL
By Brant Russell
Directed by Jaki Bradley
GENIUS
By Kate Walbert
Directed by Sheryl Kaller
the monsters
Written and Directed by Ngozi Anyanwu
BASEMENT, IL
By Stacy Osei-Kuffour
Directed by Stevie Walker-Webb
AFTER PETER
Co-Created by Adam Chanler-Berat and Grace McLean
Play by Adam Chanler-Berat
Music and Lyrics by Grace McLean
Directed by Tyler Thomas
DIGNITY, ALWAYS DIGNITY
Co-Created by Zach Fine, Bryce Pinkham, Kirya Traber,
and Rona Siddiqui
Directed by Zach Fine
FILMMAKERS’ WORKSHOP
MENDACITY by Paul Baiguerra
DEATH AND POULTRY IN MARION, KENTUCKY by Maia Henkin
TALK BLACK by Destiny Macon
BADMAASH by Nikita Mungarwadi
HALLELUJAH NIGHT by Ivan Rome
WINSLOW by Jianna Maarten Saada
HEY YOU GUYS by Adriana Santos
CLASH by Donna Bonilla Wheeler
COMPANIES IN RESIDENCE
The Drama League
Zoe Adams, Stage Directing Fellow
Sarah Hughes, Beatrice Terry Residency
Colm Summers, Next Stage Residency
Support team: Andrew Coopman, Liz Peterson, Stephen Quinn, Gabriel Stelian-Shanks, May Treuhaft-Ali
Breaking the Binary
George Strus, Founding Artistic Director
DEBT
Developed by reid tang and Adrian Einspanier
RACIAL BONUS
by Dominique Rider
Directed by Garrett Allen
Ensemble Studio Theatre
Estefanía Fadul and Graeme Gillis, Co-Artistic Directors
ARTISTS IN RESIDENCE
storäe michele, 2024 Founders’ Award Recipient
Tristan André, 2024 Pfaelzer Award Recipient
Lily Houghton, Playwright
Maya Shore, Epstein Fellow
Bodies of Work ZOE SARNAK
Music, Lyrics, and Book by Zoe Sarnak
Directed and Choreographed by Jennifer Jancuska
Dramaturgy by Max Reuben
Music Direction by Nick Connors
LOST CITY RADIO
Book by Joel Perez
Music and Lyrics by Benjamin Velez
Based on the novel by Daniel Alarcon
INDIGENOUS VOICES OF THE NORTHEAST RESIDENCY
AN AMERICAN GHOST DANCE
By Thea Hopkins and Daniel Gewertz
THE PAINTER AND THE THIEF
Music and Lyrics by Julian Hornik
Book by Ryan Dobrin and Julian Hornik
THE BAD NEWS BEARS, A MUSICAL
By Brian Feinstein & Eric Garcia
Directed by Sherri Barber
A FITTING
Developed by Jerron Herman and Austin Regan
2023
NEW YORK STAGE AND FILM SUMMER SEASON
AT MARIST COLLEGE
KICK-OFF CONCERT
JOE ICONIS & FAMILY by Joe Iconis
directed by John Simpkins
MUSICAL WORKSHOP
A WRINKLE IN TIME
adapted from the novel by Madeleine L’Engle
book by Lauren Yee
music & Lyrics by Heather Christian
direction by Lee Sunday Evans
PLAY WORKSHOP
LIKE THEY DO IN THE MOVIES
written and performed by Laurence Fishburne
directed by Leonard Foglia
2024 Production: Perelman Performing Arts Center
STORIES THAT MOVE: DEVELOPING DANCE MUSICAL
PARADISE BALLROOM co-created by
Samara Cohen (Princess Lockerooo) & Harold O’Neal
directed by Colette Robert
PLAY READINGS
THIS WAY TO THE FIRE by Jason Kim
directed by Danny Sharron
SOFT TARGET by Emily Kaczmarek
directed by Jo Bonney
THE GOOD NAME by Sopan Deb
directed by Trip Cullman
DOWNSTAIRS NEIGHBOR by Beth Henley
directed by Jaki Bradley
FILMMAKERS' WORKSHOP
Nancy Duff
Harrison Hamm
Drew Harper & Atticus Hoffman
Summera Howell
Anndi Jinelle Liggett
Allyson Morgan
Craig T. Williams
G. Wilson
COMPANIES IN RESIDENCE
Breaking the Binary
RACIAL BONUS by Dominique Rider, directed by Garrett Allen, dramaturgy by Zach Ezer
TWITCH by Liliana Padilla, directed by Jack Ferver,
dramaturgy by Desiree S. Mitton
The Movement Theatre Company
POSSESSING THE RESURRECTED by Sam Hamashima, directed by
The Recovery Project
HOW TO DRAW A TRIANGLE by Jake Brasch
MAPPER OF STARS, BRINGER OF PLAGUES by Alex Hauk
SUNSHINE MOTEL by Ana Bess Moyer Bell (Pilot Episode)
UNTITLED MEMOIR by Gwydion Suilebhan
WELL WELL WELL by Brant Russell
The Latiné Musical Theatre Lab
TAP IN book by Marjuan Canady & Christin Eve Cato, lyrics by Muhsinah & Christin Eve Cato, composition by Muhsinah, choreographed by Chloe Arnold
AT THE BARRE book by SMJ, lyrics by SMJ & Natalie Myrick, Music by Sarah Flaim & Natalie Myrick, dramaturgy by Juju Nieto
ARTISTS IN RESIDENCE
Keelay Gipson
Juliet Pearson
Nia Akilah Robinson
JaMeeka Holloway, 2023 Pfaelzer Award Recipient
UGBA, 2023 Founders’ Award Recipient
LOST CITY RADIO by Joel Perez and Benjamin Velez
KING MOTHER by Heidi Schreck, directed by Lila Neugebauer, featuring Didi O'Connell
RIPPER THE MUSICAL written by Kimille Howard,
composed by Dwight Howard
BOYS STATE by Annie Tippe, Jeanna Phillips, Molly Beach Murphy
POST-MORTEM by Marilyn Ness, directed by Sheryl Kaller; support team: Beth Levison, Abigail Hoke-Brady, Lawrence Moten, Yasmeen Jawhar, Shuling Yong, John Benam, Katherine Clary, Lorelei Essman-Freeman, Kirstin Johnson
WAKEFIELD by Kristen Dunphy, Maria Alfonsine, Damian de Boos
UNTITLED RESIDENCY by Gaye Taylor Upchurch,
with Mallory Portnoy, Mikhail Fiksel, Sarah Lunnie
RAIMUNDA by Michelle “Micha” J Rodriguez & Noelle Viñas
Ensemble Studio Theatre
Estefanía Fadul & Graeme Gillis
Dramatist Guild Foundation
Program Facilitator by Jess McLeod, with: Matthew Libby,
April Dae Okpwae, Joriah Kwamé, Nicholas Connors,
Julian Mesri, Aaron Coleman, Gloria Oladipo, SMJ
Indigenous Voices of the Northeast
Facilitated by Vickie Ramirez, with: Montana Adams,
Dawn Jamieson, and Danielle Soames
2022
NYSAF SUMMER SEASON
MUSICAL WORKSHOPS
THE RETURN OF YOUNG BOY by Keenan Scott II & Tre Matthews
directed by Steve H. Broadnax III
THE POTLUCK by César Alvarez
directed by Sarah Benson
SUN SONGS by Katie Madison & Deborah Cowell
PLAY WORKSHOPS
THE WORLD IS NOT SILENT by Don Nguyen
directed by Marya Mazor
2024 Production: Alley Theatre
SWEET CHARIOT by Eric Lockley
directed by Shariffa Ali
2023 Production: Under the Radar Festival, The Public Theater
TELL THEM I’M STILL YOUNG by Julia Doolittle
directed by May Adrales
READING FESTIVALS
MY BROTHER IS BETTER AT LOVE THAN ME by Lily Houghton
directed by Leigh Silverman
NUESTRA PLANETA by Diana Burbano
directed by Elisa Bocanegra
Commissioned by Hero Theater Company
[A NEW PLAY] by Josh Radnor
directed by Sheryl Kaller
LOVE ALL by Anna Deavere Smith
directed by Marc Bruni
2023 Production: La Jolla Playhouse
DEMONS. by Keelay Gipson
directed by Steph Paul
2023 Production: JAG Productions & Bushwick Starr
MODERN GENTLEMAN by Preston Max Allen
directed by Trip Cullman
FILMMAKERS' WORKSHOP
PERFECT BOUND by Caroline Blair
THE PRESIDENT’S CAKE by Hasan Hadi
POSSESSED by Jacob Harpel
SUBMERGED OBJECTS by Anderson Heinz
HONEST LIVING by Lauren Marcus
IF YOU SEEK BRITNEY by Ama Quao
ONE ROSE by Richa Rudola
I’M SORRY I BROUGHT UP GOD by Emily Zemba
IN RESIDENCE
George Abud, Osh Ashruf & Sadie Veach
Nissy Aya, 2022 Founders’ Award Recipient
Stephen Belber
Kyle Beltran, Adam Chanler-Berat, Lee Sunday Evans, Marin Ireland, Grace McLean
Molly Carden & Abigail Zealey Bess
Shayok Misha Chowdhury (NEXUS Cohort) with Roopa Mahadevan, Sruti Sarathy & Shiv Subramaniam
Kate Douglas & Shayfer James
Keelay Gipson, Cedwan Hooks, Steph Paul, Jon Riddleberger
Gethsemane Herron, 2021 Founders’ Award Finalist
Rebecca Holderness
Tim J Lord
Donja R. Love
Gloria Majule
Talene Monahon & Jaki Bradley
jeremy o’brian, 2021 Founders’ Award Recipient
Ibi Owolabi, 2022 Drama League Fellow
Dominique Rider
Samantha Spies with Nicole A. Watson
Shona Tucker & Yvette Ganier
Noelle Viñas & Estefanía Fadul
Dawn Monique Williams, 2022 Pfaelzer Award Recipient
DIGITAL PROGRAMMING
NYSAF NOW
As a result of the global pandemic and suspension of in-person gatherings and live performance as of March 2020, NYSAF initiated NYSAF NOW, an adaptable set of resources to serve the needs of artists through digital connection, flexible structures, and financial support.
we share spoons by Lyndsey Bourne
directed by Sarah Lunnie
HIGHWAY PATROL by Dana Delaney, Jen Silverman, Mike Donahue, and Dane Laffrey
NYSAF NEXUS
2021
NYSAF SUMMER SEASON
MUSICAL WORKSHOPS
MEXODUS by Brian Quijada & Nygel D Robinson
dramaturgy by Tlaloc Rivas
2024 Production: Baltimore Center Stage &
Mosaic Theatre Company
SOUTH by Florencia Iriondo
2023 Production: SoHo Playhouse
WHITE GIRL IN DANGER by Michael R. Jackson
directed by Lileana Blain-Cruz
2023 Production: Vineyard Theatre & Second Stage Theater
INTERSTATE by Melissa Li & Kit Yan
directed by Jesca Prudencio
IN RESIDENCE
Sivan Battat, The Leo Shull Directing Fellow
Chris Darbassie
Shayok Misha Chowdhury & Kameron Neal
Estefanía Fadul, Pfaelzer Award Recipient
Kareem Fahmy
Jennifer Gibbs
Keelay Gipson & Sam Salmond
Marcy Heisler & Amanda Green
Jessica Huang & Jacinth Greywoode
Kay Kemp, Epstein Award Recipient
Joanna Castle Miller & Will Steinberger
Doron JéPaul Mitchell & Julius Pryor IV
Phanésia Pharel
Paul Oakley Sotvall & Nikhil Saboo
Kirya Traber, Founders' Award Recipient
Shona Tucker & Yvette Ganier
The Lark: Brittany Allen, A.A. Brenner, Edison Ventura Mata Diaz, Jahna Ferron-Smith, Xavier Galva, Nora Brigid Monahan
DIGITAL PROGRAMMING
NYSAF NOW
As a result of the global pandemic and suspension of in-person gatherings and live performance as of March 2020, NYSAF initiated NYSAF NOW, an adaptable set of resources to serve the needs of artists through digital connection, flexible structures, and financial support.
HONEY WIDOW by Nayna Agrawal
what you are now by Sam Chanse
directed by Steve Cosson
ISABELLA BOOTLEGS by Samantha Cooper
TELL THEM I'M STILL YOUNG by Julia Doolittle
directed by May Adrales
THE FREEDOM INDUSTRY by Zachariah Ezer
directed by Dominique Rider
THE FUN TIME CYCLE by Zach Helm
directed by Kate Whoriskey
SOUTH by Florencia Iriondo
2023 Production: SoHo Playhouse
NATURAL SELECTION by Michael Sun Lee
THE MADWOMEN IN THE PANDEMIC
by Sandra Tsing Loh
2023 Production: The Actors Temple Theatre
LOST DREAMS by Jennifer Manocherian
THE BLACK ALBUM MIXTAPE
curated by Doron JéPaul Mitchell
featuring Jarreau Carrillo, Roland Lane, Carvens Lissaint,
Jaiel Mitchell, Breanna Taylor
BASTIANO by Carey Perloff
directed by Vivienne Benesch
COMMUNITY ROUNDTABLES
curated by Dominique Rider
DREAMS OF MY FATHER by Jackie Roberts
MEXODUS by Brian Quijada & Nygel D. Robinson
dramaturgy by Tlaloc Rivas
2024 Production: Baltimore Center Stage &
Mosaic Theatre Company
THE FORE-PLAY by Steven Sater
DEARIE by Claudia Shear
directed by Scott Ellis
THE YEARS BETWEEN US by Liana Sonenclar
directed by Jackson Gay
THE MIGRATION LP by Keenan Scott II
Music direction by Khiyon Hursey
NYSAF NEXUS
Garrett Allen
Ace Anderson
Brittany Bland
Elisa Bocanegra
Nichole Canuso
Sam Chanse
Shayok Misha Chowdhury
Kristiana Rae Colón
Giselle Durand
Jennifer Gibbs
Aleem Hossain
Kimille Howard
Joanna Castle Miller
Tara Moses
Erlina Ortiz
Mason Alexander Park
Phanésia Pharel
Justen Ross
Gabriele Sanchez
Vera Starbard
2020
NYC PROGRAMMING
NYC WINTER SEASON
LOVELY DAY by Leslie Ayvazian
directed by Max Mayer
TELL THEM I'M STILL YOUNG by Julia Doolittle
directed by Mark Brokaw
A DISTINCT SOCIETY by Kareem Fahmy
directed by Taylor Reynolds
WHITELISTED by Chisa Hutchinson
directed by Jade King Carroll
BREATHING IN by David Rabe
directed by Sarna Lapine
INSPIRED BY TRUE EVENTS by Ryan Spahn
directed by Michael Urie
GROWING WILD by Shona Tucker
directed by Elizabeth Van Dyke
NYC WINTER CABARET
THE RACE by Madeline Myers
SOMEWHERE OVER THE BORDER by Brian Quijada
THE LAST SUPPER book by Christina Quintana (CQ)
composed by Migguel Angel & Jaime Lozano
SELECTED SONGS by Rona Siddiqui
GALILEO book by Danny Strong
music & lyrics by Zoe Sarnak and Michael Weiner
2024 Production: Berkeley Repertory Theatre
DIGITAL PROGRAMMING
NYSAF NOW
As a result of the global pandemic and suspension of in-person gatherings and live performance as of March 2020, NYSAF initiated NYSAF NOW, an adaptable set of resources to serve the needs of artists through digital connection, flexible structures, and financial support.
WHAT WE DO NEXT by Stephen Belber
directed by Lisa Peterson
TELL THEM I'M STILL YOUNG by Julia Doolittle
directed by May Adrales
TAMPONS, DEAD DOGS & OTHER DISPOSABLE THINGS
by Shairi Engle
directed by Lucie Tiberghien
[the redacted] by Zach Helm
directed by Kate Whoriskey
EL OTRO LADO by Monet Hurst-Mendoza
AGENT 355 book and dramaturgy by Jessica Kahkoska
book, music & lyrics by Preston Max Allen
directed by Estefanía Fadul
DREAM A LITTLE DREAM by Kay Kemp
MCCOURT by Ilya Khodosh
directed by Susan Tenney
THE MADWOMEN IN THE PANDEMIC
by Sandra Tsing Loh
2023 Production: The Actors Temple Theatre
IKE by Molly Beach Murphy
directed by Morgan Green
BASTIANO by Carey Perloff
directed by Vivienne Benesch
NAILS! by Eliana Pipes
MYTH OF MY PAIN by Andrew Rincón
MEXODUS by Brian Quijada & Nygel D. Robinson
dramaturgy by Tlaloc Rivas
2024 Production: Baltimore Center Stage
& Mosaic Theatre Company
THE SAN MAN by Christina Quintana (CQ)
THE FORGIVENESS MACHINE by Josh Radnor
directed by Sheryl Kaller
THE YEARS BETWEEN US by Liana Sonenclar
directed by Jackson Gay
THE MIGRATION LP by Keenan Scott II
Music direction by Khiyon Hursey
MISS MITCHELL book by Kristin Slaney
music & lyrics by Tommy Crawford and Alex Grubbs
directed by Sarah Elizabeth Wansley
LUCKY by Kirya Traber
directed by Tamilla Woodard
dramaturgy by Lisa Marie Rollins
FILMMAKERS' WORKSHOP
WILLOW by Nancy Bannon
TRIP by David Baugnon
PARIAH by Rob Bellon
THE BITTER PILL by Anika Benkov
MYSEDUCATION by Yakira Chambers
THE WATCHERS by Kim Dempster
WAYS TO HIDE IN WINTER by Jenny Halper
KING OF SWING by Alessandro King
EARTH MOTHER by Savanah Leaf
LONDONI by Guru Ramanathan
RED ROCK FALLS by Traven Rice
TRUE STORY by Charia Rose
THE ARK by Minnie Schedeen
SANNYASA by Shawn Snyder & Jason Begue
2010 - 2019
2019
POWERHOUSE SEASON
MAINSTAGE PRODUCTIONS
THE BANDAGED PLACE by Harrison David Rivers
directed by David Mendizábal
2022 Production: Roundabout Theatre Company
LIGHTNING (OR THE UNBUTTONING) by Beth Henley
directed by Mark Brokaw
MUSICAL WORKSHOPS
ANNIE SALEM: AN AMERICAN TALE
adapted from the novel by Mac Wellman
book by Rachel Chavkin
music by Heather Christian
lyrics by Heather Christian and Rachel Chavkin
directed by Rachel Chavkin
THE ELEMENTARY SPACETIME SHOW
music and lyrics by César Alvarez
book by César Alvarez and Emily Orling
directed by Sarah Benson
GODDESS
conceived by Saheem Ali
music & lyrics by Michael Thurber
book by Jocelyn Bioh
additional lyrics by Mkhululi Z. Mabija
directed by Saheem Ali
2022 Production: Berkeley Repertory Theatre
PLAY WORKSHOPS
...AND THE HORSE YOU RODE IN ON by Zach Helm
directed by Kate Whoriskey
THE BEST WE COULD (A FAMILY TRAGEDY)
by Emily Feldman
directed by Daniel Aukin
2023 Production: Manhattan Theatre Club, NYC
2020 Production: Manhattan Theatre Club, NYC
READINGS FESTIVALS
THE NOTEBOOK based on the novel by Nicholas Sparks
music & lyrics by Ingrid Michaelson
book by Bekah Brunstetter
2022 Production: Chicago Shakespeare Theater
2024 Production: Broadway
GALILEO book by Danny Strong
music & lyrics by Michael Weiner and Zoe Sarnak
directed by Michael Mayer
2024 Production: Berkeley Repertory Theatre
SANCTUARY CITY by Martyna Majok
directed by Rebecca Frecknall
2021 Production: New York Theatre Workshop, NYC
BECKY NURSE OF SALEM
written & directed by Sarah Ruhl
2022 Production: Lincoln Center Theatre
2020 Production: Berkeley Repertory Theatre
DELUSION BY PROXY by Brooke Adams
directed by Ethan Silverman
THE PAPER DREAMS OF HARRY CHIN by Jessica Huang
directed by Kip Fagan
2021 Production: Indiana Repertory Theatre
THE EXCAVATION OF MARY ANNING by Ian August
directed by Sammi Cannold
2022 Production: The Wallis, Los Angeles
RESIDENCIES
WILLIAMSBURG book by Jason Katims
music by Tom Kitt
lyrics by Marcy Heisler
LIKE WATER FOR CHOCOLATE A new musical adaptation of Laura Esquivel’s novel Like Water for Chocolate
by Lisa Loomer and La Santa Cecilia
directed by Michael Mayer
LOVE, ROSIE book by Peter Duchan
music and lyrics by Zack Zadek
NYC PROGRAMMING
NYC READING SERIES AT BARNARD COLLEGE
THE COAST STARLIGHT written by Keith Bunin
directed by Tyne Rafaeli
2023 Production: Lincoln Center Theater
2019 Production: La Jolla Playhouse, San Diego
NIKE OR WE DON'T NEED ANOTHER HERO
written and directed by Ngozi Anyanwu
MOVING FORWARD by Bill Bradley
TENT REVIVAL by Majkin Holmquist
directed by Teddy Bergman
MOTHER OF EXILES by Jessica Huang
directed by Tyne Rafaeli
THE LOST OR, HOW TO JUST B
written and directed by Keelay Gipson
NYC WINTER SEASON
PICTURES FROM HOME written by Sharr White
directed by Daniella Topol
2023 Production: Broadway, Studio 54
THE BANDAGED PLACE written by Harrison David Rivers
directed by David Mendizábal
2022 Production: Roundabout Theatre Company
SAYING GOODBYE TO THE PEOPLE I LOVE FROM MY BATHTUB written by Halley Feiffer
directed by Trip Cullman
Artists-in-Residence: Liza Birkenmeier, Molly Beach Murphy, Jeanna Phillips, The Lobbyists
2018
POWERHOUSE SEASON
MAINSTAGE PRODUCTIONS
RADIO ISLAND by Liza Birkenmeier
directed by Jaki Bradley
THE WAVES adapted from the novel by Virginia Woolf
book by Lisa Peterson, music and lyrics by David Bucknam, additional music and lyrics by Adam Gwon
directed by Lisa Peterson
MUSICAL WORKSHOPS
ALICE BY HEART
book by Steven Sater with Jessie Nelson
music by Duncan Sheik
lyrics by Steven Sater
directed by Jessie Nelson
2019 Production: MCC Theater
THE CONNECTOR
music and lyrics by Jason Robert Brown
book by Jonathan Marc Sherman
directed by Daisy Prince
2024 Production: MCC Theater
COWBOY BOB
created by Molly Beach Murphy, Jeanna Phillips & Annie Tippe
music & lyrics by Jeanna Phillips
book & additional lyrics by Molly Beach Murphy
additional music by Alex Thrailkill
directed by Annie Tippe
2023 Production: The Alley Theatre
LITTLE ORPHAN DANNY
book, lyrics & music by Dan Finnerty
conceived by Dan Finnerty & Sean Daniels
additional music by Dan Lipton
directed by Sean Daniels
2018 Production: Merrimack Repertory Theatre, Lowell, MA
PLAY WORKSHOPS
INDIA PALE ALE by Jaclyn Backhaus
directed by Will Davis
2018 Production: Manhattan Theatre Club, NYC
OUR COUNTRY conceived by Annie Saunders & Becca Wolff
direction & dramaturgy by Becca Wolff
additional dramaturgy & original writing by Annie Saunders
additional devising by the company
2023 Production: Under the Radar Festival, The Public Theater
2018 Production: Edinburgh Fringe Festival, Scotland
READINGS FESTIVALS
ON THAT DAY IN AMSTERDAM by Clarence Coo
directed by Kareem Fahmy
2022 Production: 59E59
2021 Production: Primary Stages, NYC
THE PAIN OF MY BELLIGERENCE by Halley Feiffer
directed by Trip Cullman
2019 Production: Playwrights Horizons, NYC
THE HOLE by Sarah Gancher
directed by Danya Taymor
#untitled by rupi kaur
directed by Leah C. Gardner
THE NORTH STAR by Donja R. Love
directed by Malika Oyetimein
THE PURISTS by Dan McCabe
directed by Billy Porter
2019 Production: Huntington Theatre Company
THE DIZZINES OF FREEDOM by Stephen Nathan
directed by Daniella Topol
SWITCHED book by Geoffrey Nauffts
music & lyrics by Jonatha Brooke
directed by Sheryl Kaller
LICK O'THE KNIFE by Jackie Roberts
directed by Kent Gash
RESIDENCIES
ACCIDENTALLY BRAVE written & performed by Maddie Corman
directed by Kristin Hanggi
2019 Production: DR2 Theatre, NYC
ADAM based on the film written and directed by Max Mayer, book by Max Mayer, music by Steven Page, directed by Amy Tinkham, produced by Leslie Urdang & Miranda de Pencier
BAND AID book & music by Zoe Lister Jones, directed by Leigh Silverman
Q2
By James Lecesne & Ryan Amador
SISYPHUS created by Sarah Baskin, Larry Biederman, Albert Dayan, Michaela Escarcega, Jacqueline Wright
NYC PROGRAMMING
NYC READING SERIES AT BARNARD COLLEGE
THE LETTERS by David Zellnik, directed by Pamela Berlin
...and the horse you rode in on
written and directed by Zach Helm
soft by Donja R. Love
directed by Awoye Timpo
2022 Production: MCC Theater
NYC WINTER SEASON
HOUSE OF JOY by Madhuri Shekar
directed by Zi Alikhan
2019 Production: California Shakespeare Theater, Berkeley, CA
LITTLE ORPHAN DANNY
book, lyrics & music by Dan Finnerty
conceived by Dan Finnerty & Sean Daniels
additional music by Dan Lipton
directed by Sean Daniels
2018 Production: Merrimack Repertory Theatre, Lowell, MA
THE LUCKIEST by Melissa Ross
directed by Daniella Topol
2019/2020 Production: La Jolla Playhouse, San Diego
2017
POWERHOUSE SEASON
MAINSTAGE PRODUCTIONS
SACRED VALLEY by Josh Radnor
directed by Sheryl Kaller
GOOD MEN WANTED by Kevin Armento
directed by Jaki Bradley
MUSICAL WORKSHOPS
STILYAGI
lyrics by Lisa Kron, music by Peter Lerman
based on the motion picture The Hipsters,
produced by Red Arrow Films
directed by Michael Mayer
THIS AIN'T NO DISCO
music and lyrics by Stephen Trask and Peter Yanowitz
book by Stephen Trask & Peter Yanowitz
and Rick Elice
directed by Trip Cullman
2018 Production: Atlantic Theater Company, NYC
THE SECRET LIFE OF BEES
book by Lynn Nottage
composed by Duncan Sheik
lyrics by Susan Birkenhead
based on the novel by Sue Monk Kidd
directed by Sam Gold
2023 Production: Almeida Theatre, London
2019 Production: Atlantic Theater Company, NYC
PLAY WORKSHOPS
THE GREAT LEAP by Lauren Yee
directed by Will Davis
2018 Production: Atlantic Theater Company, NYC
2019 Production: ACT, San Francisco
THE HOMECOMING QUEEN by Ngozi Anyanwu
directed by Awoye Timpo
2018 Production: Atlantic Theater Company, NYC
READINGS FESTIVAL
DIANA book and lyrics by Joe DiPietro
music and lyrics by David Bryan
directed by Christopher Ashley
2018/2019 Production: La Jolla Playhouse, San Diego
2021 Production: Longacre Theatre, Broadway
ONE GOOD EGG by Annie Evans
directed by Melia Bensussen
AMY AND THE ORPHANS by Lindsey Ferrentino
directed by Scott Ellis
2018 Production: Roundabout Theatre Company, NYC
LITTLE ORPHAN DANNY book, music and lyrics by Dan Finnerty
additional music by Dan Lipton
directed by Sean Daniels
2018 Production: Merrimack Repertory Theatre, MA
IRONWEED by William Kennedy and Jodie Markell
based on the novel by William Kennedy
directed by Jodie Markell
PARIS, ACTORS by Hamish Linklater
directed by Leigh Silverman
THE FIT by Carey Perloff
directed by Daniel Aukin
KID PRINCE AND PABLO by Brian Quijada
directed by Pirronne Yousefzadeh
2019 Production: The John F. Kennedy Center for the Arts, D.C.
SERIOUS MOONLIGHT
written by and based on the film by Adrienne Shelly
co-adapted by Liz Tuccillo and Andy Ostroy
directed by Sheryl Kaller
JANE SAYS
by Diana Son
directed by Mark Brokaw
RESIDENCIES
LIGHTS OUT by Colman Domingo and Patricia McGregor
directed by Patricia McGregor
a commission of The People's Light Theater Company
2017 Production: People's Light, Malvern, PA
2019 Production: Geffen Playhouse, LA
JOAN by Stephen Belber
directed by Lisa Peterson
2019 Production: Colt Coeur, NYC
NYC PROGRAMMING
NYC READING SERIES AT BARNARD COLLEGE
WHAT A SHAME ABOUT ME
written and directed by Eric Bogosian
MINNEAPOLIS/ST.PAUL by Lee Blessing
directed by Maria Mileaf
LIGHTNING by Beth Henley
directed by Amy Madigan
THE FIT by Carey Perloff
directed by Melia Bensussen
SERIOUS MOONLIGHT
written by and based on the film by Adrienne Shelly
co-adapted by Andy Ostroy & Liz Tucillo
directed by Liz Carlson
lazy oak lane by korde arrington tuttle
directed by Raelle Myrick-Hodges
NYC WORKSHOPS
NO ONE IS FORGOTTEN by Winter Miller
directed by Danya Taymor
2019 Production: Rattlestick Playwrights Theater
TINY HOUSES by Stefanie Zadravec
directed by Kip Fagan
2016
POWERHOUSE SEASON
MAINSTAGE PRODUCTIONS
TRANSFERS by Lucy Thurber
directed by Jackson Gay
2018 Production: MCC Theater, NYC
THE WOLVES by Sarah DeLappe
directed by Lila Neugebauer
2016 Production: The Playwrights Realm, NYC
2017 Production: Lincoln Center Theatre, NYC
2017 Pulitzer Finalist
MUSICAL WORKSHOPS
THE ROAR OF THE GREASEPAINT - THE SMELL OF THE CROWD book, music and lyrics by Leslie Bricusse and Anthony Newley, adapted book by Santino Fontana
directed by Scott Ellis
ANOTHER WORD FOR BEAUTY book by José Rivera
music by Héctor Buitrago
directed by Steven Cosson
A 24-DECADE HISTORY OF POPULAR MUSIC (Work-In-Progress) conceived, written, performed, and co-directed by Taylor Mac
co-directed by Niegel Smith
music direction by Matt Ray
2016 Production: St. Ann’s Warehouse, NYC
2017 Pulitzer Finalist
PLAY WORKSHOPS
FURY by Joanna Murray-Smith
directed by Mark Brokaw
FINGERSMITH by Alexa Junge
based on the novel by Sarah Waters
directed by Bill Rauch
2016 Production: American Repertory Theater, Cambridge
READINGS FESTIVAL
WE ARE AMONG US by Stephen Belber
directed by Daniella Topol
2019 Production: City Theatre, Pittsburgh
NOLLYWOOD DREAMS by Jocelyn Bioh
directed by Saheem Ali
2017 Production: Cherry Lane Theatre Mentor Project, NYC
2020 Production: MCC Theater, NYC
THE GREAT BLUENESS by Andrew Gerle
based on the book by Arnold Lobel
directed by John Carrafa
BUTTERSIDE DOWN by Lorien Haynes (formerly GOOD GRIEF)
directed by John Slattery
2018 Workshop Production: The Cherry Lane Theatre, NYC
RANCHO VIEJO by Dan LeFranc
directed by Daniel Aukin
2016 Production: Playwrights Horizons, NYC
THE WAYS OF NECESSITY by Stephen Nathan
directed by Evan Yionoulis
SOCRATES by Tim Blake Nelson
directed by Maria Mileaf
2019 Production: The Public, NYC
SACRED VALLEY by Josh Radnor
directed by Sheryl Kaller
BETWEEN THE LINES
music and lyrics by Elyssa Samsel and Kate Anderson
book by Timothy Allen McDonald
based on the book by Jodi Picoult and Samantha Van Leer, directed by Jeff Calhoun
2022 Production: Off-Broadway
2017 Production: Kansas City Repertory Theatre
THE PORTUGUESE KID
written and directed by John Patrick Shanley
2017 Production: Manhattan Theatre Club, NYC
RESIDENCIES
THE UNTITLED DAN FINNERTY PROJECT by Dan Finnerty
directed by Sean Daniels
THE WILD HUNT written & co-directed by Bill Pullman
co-directed by Jennifer McCray Rincon
compositions by Gary Grundei, Jason Hiller & Maesa Pullman
HEAD OVER HEELS book by Jeff Whitty
music & lyrics by The Go-Go's
directed by Michael Mayer
2018 Production: Hudson Theatre, Broadway
NYC PROGRAMMING
NYC READING SERIES AT BARNARD COLLEGE
INDIAN JOE created & conceived by Elizabeth A. Davis
Book, music & lyrics by Elizabeth A. Davis
Additional book by Chris Henry
Additional music by Luke Holloway & Jason Michael Webb
2018 Production: Ensemble Studio Theatre, NYC
FLEE by Stephanie Del Rosso
directed by Sash Bischoff
PEARL by Halley Foote
directed by Michael Wilson
CLOSURE by Keith Huff
directed by Leigh Silverman
SACRED VALLEY by Josh Radnor
directed by Sheryl Kaller
DIDO OF IDAHO by Abby Rosebrock
directed by Danya Taymor
2018 Production: The Davenport Theatre, NYC
NYC WORKSHOPS
HEAD OVER HEELS book by Jeff Whitty
music & lyrics by The Go-Go's
directed by Michael Mayer
2015
POWERHOUSE SEASON
MAINSTAGE PRODUCTIONS
THE LIGHT YEARS by Hannah Bos and Paul Thureen
developed and directed by Oliver Butler
made by The Debate Society
2017 Production: Playwrights Horizons, NYC
THE UNBUILT CITY by Keith Bunin
directed by Sean Mathias
2018 Production: King's Head Theatre, London
MUSICAL WORKSHOPS
LOVING v. VIRGINIA book and lyrics by Marcus Gardley
music composition by Justin Ellington
direction and additional lyrics by Patricia McGregor
conceived by Patricia McGregor
NOIR music by Duncan Sheik
book by Kyle Jarrow
lyrics by Kyle Jarrow and Duncan Sheik
directed by Rachel Chavkin
2022 Production: Alley Theater
RAIN book by Sybille Pearson
music and lyrics by Michael John LaChiusa
based on the short story by Somerset Maugham
directed by Barry Edelstein
2016 Production: The Old Globe Theater, San Diego
PLAY WORKSHOPS
DESIRE:
SIX NEW PLAYS BASED ON STORIES BY TENNESSEE WILLIAMS by Elizabeth Egloff, Marcus Gardley, Rebecca Gilman, David Grimm, John Guare, and Beth Henley
directed by Michael Wilson
2015 Production: 59E59 Theaters, New York
THE LAST MATCH by Anna Ziegler
directed by Gaye Taylor Upchurch
2016 Production: The Old Globe Theater, San Diego
2016 Production: City Theatre Company, Pittsburg
2017 Production: Roundabout Theatre Company, NYC
READINGS FESTIVAL
15 MINUTES book by Rick Elice
music and lyrics by Stephen Trask & Peter Yanowitz
directed by Trip Cullman
A BOY PUT THIS GIRL IN A CAGE WITH A DOG
AND THE DOG KILLED THE GIRL by Clare Barron
directed by Stella Powell-Jones
JUNK by Ayad Akhtar
directed by Doug Hughes
2016 Production: La Jolla Playhouse
2017 Production: LCT on Broadway
OPEN ROAD music and lyrics by Paul Scott Goodman
book by Paul Scott Goodman & Joseph Hendel
directed by Mark Brokaw
ROMANCE NOVELS FOR DUMMIES by Boo Killebrew
directed by Kip Fagan
2016 Production: Williamstown Theatre Festival
TALK TO ME OF LOVE by Meghan Kennedy
directed by Daniella Topol
THE BROTHER(S) written and directed by Colman Domingo
THE DIZZY LITTLE DANCE OF
RUSSELL DIFINALDI by Stephen Belber
directed by David Cromer
THE PROFANE by Zayd Dohrn
directed by Carolyn Cantor
2017 Production: Playwrights Horizons
WHITE NOISE, WHITE LIGHT written and directed by Nicky Silver
NYC PROGRAMMING
NYC READING SERIES AT BARNARD COLLEGE
THE DIZZY LITTLE DANCE OF
RUSSELL DIFINALDI by Stephen Belber
directed by Benjamin Kamine
GETTING OVER by Elizabeth Irwin
directed by Kip Fagan
ROMANCE NOVELS FOR DUMMIES by Boo Killebrew
directed by Kip Fagan
2016 Production: Williamstown Theatre Festival
THE WHIRLIGIG by Hamish Linklater
directed by Jim Simpson
2017 Production: The New Group
EVERYTHING IS WONDERFUL by Chelsea Marcantel
directed by Tyne Rafaeli
UNSEEN by Mona Mansour
directed by Lisa Rothe
NYC WORKSHOPS
GNIT by Will Eno
directed by Stein Winge
WAITING FOR THE FLOOD by Carey Perloff
directed by Daniella Topol
2014
POWERHOUSE SEASON
MAINSTAGE PRODUCTIONS
IN YOUR ARMS directed and choreographed by
Christopher Gattelli, music by Stephen Flaherty
Vignettes written by Douglas Carter Beane, Nilo Cruz, Christopher Durang, Carrie Fisher, David Henry Hwang, Rajiv Joseph, Terrence McNally, Marsha Norman,
Lynn Nottage, & Alfred Uhry
Lyrics by Lynn Ahrens
2015 Production: The Old Globe Theater, San Diego
THE BABYLON LINE by Richard Greenberg
directed by Terry Kinney
2016 Production: Lincoln Center Theatre
THE DANISH WIDOW
written and directed by John Patrick Shanley
MUSICAL WORKSHOPS
A WALK ON THE MOON music and lyrics
by Paul Scott Goodman
book and additional lyrics by Pamela Gray
directed by Michael Greif
2022 Production: George Street Playhouse
SEAWIFE by Seth Moore and The Lobbyists
directed by and developed with Liz Carlson
2015 Production: Naked Angels, NYC
PLAY WORKSHOPS
LAUGH by Beth Henley
directed by David Schweizer
2015 Production: Studio Theatre
THE LIGHT YEARS by Hannah Bos and Paul Thureen
made by The Debate Society
developed and directed by Oliver Butler
2017 Production: Playwrights Horizons, NYC
READINGS FESTIVAL
AMERICAN POP by Michael Friedman
directed by Trip Cullman
CHOICE by Winnie Holzman
directed by Sheryl Kaller
2015 Production: Huntington Theater Company, Boston
DRY LAND by Ruby Rae Spiegel
directed by Adrienne Campbell-Holt
2014 Production: Colt Coeur presented at HERE Arts Center
FALL by Bernard Weinraub
directed by Peter DuBois
GILGAMESH, THE PRINCE by David Rabe
directed by Moritz von Stuelpnagel
RIPCORD by David Lindsay-Abaire
directed by David Hyde Pierce
2015 Production: Manhattan Theatre Club
THE HUMANS by Stephen Karam
directed by Sam Gold
2015 Production: Roundabout Theatre Company
2016 Production: Helen Hayes Theatre on Broadway
THE INVISIBLE HAND by Ayad Akhtar
directed by Ken Rus Schmoll
2014 Production: ACT in Seattle
2014 Production: New York Theatre Workshop
THE UNBUILT CITY by Keith Bunin
directed by Sean Mathias
2018 Production: King's Head Theatre, London
TURN ME LOOSE by Gretchen Law
directed by John Gould Rubin
2016 Production: Westside Theatre, NYC
NYC PROGRAMMING
NYC READING SERIES AT BARNARD COLLEGE
BROOKLYNITE by Peter Lerman
directed by Michael Mayer
SHUT UP WHEN YOU TALK TO ME by Stephen Belber
directed by Mark Brokaw
THE UNBUILT CITY by Keith Bunin
TRUDY AND MAX IN LOVE by Zoe Kazan
directed by Lila Neugebauer
EVERYTHING MUST GO by Stephan Girasuolo
directed by Lucie Tiberghien
NYC WORKSHOPS
THE LISTENER by John Patrick Shanley
SPECIAL NEEDS by Matthew Chapman
2013
POWERHOUSE SEASON
MAINSTAGE PRODUCTIONS
DOWNTOWN RACE RIOT by Seth Zvi Rosenfeld
directed by Scott Elliott
2017 Production: The New Group, NYC
WHEN THE LIGHTS WENT OUT by Mozhan Marnò
directed by Kate Whoriskey
MUSICAL WORKSHOPS
BRIGHT STAR music by Edie Brickell and Steve Martin
lyrics by Edie Brickell
book by Steve Martin
based on an original story by Steve Martin and Edie Brickell
directed by Walter Bobbie
2014 Production: The Old Globe Theater, San Diego
2015 Production: The Kennedy Center, DC
2016 Production: Broadway
BROOKLYNITE
(previously titled A Musical Inspired by The Brooklyn Superhero Supply Company)
music and lyrics by Peter Lerman
book by Simon Rich
based on Characters Created by Michael Chabon and
Ayelet Waldman,
directed by Michael Mayer
2015 Production: Vineyard Theatre
FOUND book by Hunter Bell
music and original lyrics by Eli Bolin
directed by Lee Overtree
2014 Production: Atlantic Theater Company
2016 Production: Philadelphia Theatre Company
PLAY WORKSHOPS
THE MOTHER OF INVENTION by James Lecesne
directed by Michael Wilson
2017 Production: Abingdon Theatre Company, NYC
READINGS FESTIVAL
NICE GIRL by Melissa Ross
directed by Davis McCallum
SLAINTE by John Gallagher Jr.
directed by Jackson Gay
IDYLLWILD by Patrick Burleigh
directed by Ed Sylvanus Iskandar
HAMILTON by Lin-Manuel Miranda
directed by Thomas Kail
2015 Production: The Public Theater
2015 Production: Broadway, Richard Rodgers Theatre
KINSHIP by Carey Perloff
directed by Maria Mileaf
2014 Production: Théâtre De Paris
SWIMMERS by Rachel Bonds
directed by Mike Donahue
2016 Production: The Marin Theatre Company, San Francisco
BIG SKY by Alexandra Gersten-Vassilaros
directed by John Rando
2016 Production: Geffen Theater, LA
STEVE by Mark Gerrard
directed by Cynthia Nixon
2015 Production: The New Group, Courtyard Theatre, NYC
PETTY HARBOUR by Martyna Majok
directed by Leigh Silverman
YELLOW KINGDOM by Patricia Wettig
directed by Susan Fenichell
NYC PROGRAMMING
NYC READING SERIES AT BARNARD COLLEGE
FOR TOMORROW, PLEASE PREPARE by Paul Downs Colaizzo
directed by Davis McCallum
THREE UNCLES written and directed by Frank Pugliese
STEVE by Mark Gerrard
directed by Evan Cabnet
2015 Production: The New Group, Courtyard Theatre, NYC
SOME LOVERS book and lyrics by Steven Sater
music by Burt Bacharach
THE LAST BOOK OF HOMER by José Rivera
directed by Jo Bonney
THE DELLING SHORE by Sam Marks
directed by Adrienne Campbell-Holt
BIG SKY by Alexandra Gersten-Vassilaros
directed by Michael Hoffman
2016 Production: Geffen Theater, LA
NYC WORKSHOPS
WHEN THE LIGHTS WENT OUT by Mozhan Marnò
2012
POWERHOUSE SEASON
MAINSTAGE PRODUCTIONS
ABIGAIL/1702 by Roberto Aguirre-Sacasa
directed by David Esbjornson
2013 Production: Cincinnati Playhouse in The Park
2013 Production: City Theatre
THE POWER OF DUFF by Stephen Belber
directed by Peter DuBois
2013 Production: Huntington Theatre Company
2014 Production: The Geffen
MUSICAL WORKSHOPS
THE FORTRESS OF SOLITUDE book by Itamar Moses
music & lyrics by Michael Friedman
conceived and directed by Daniel Aukin
2014 Production: Dallas Theater Center
2014-15 Production: Public Theater
MURDER BALLAD by Julia Jordan and Juliana Nash
directed by Trip Cullman
2012 Production: Manhattan Theatre Club
2013 Production: Seoul, Korea
2014 Production: Actors’ Playhouse at the Miracle Theatre in Miami
PLAY WORKSHOPS
FIRES ARE CONFUSING by Eva Anderson, Will Berson,
and Zach Helm
created by Teatro De Facto
directed by Zach Helm
THE HOUSE THAT WILL NOT STAND by Marcus Gardley
directed by Marion McClinton
2013-14 Production: Berkeley Repertory Theatre
2014 Production: The Tricycle Theater in London
2018 Production: New York Theatre Workshop
READINGS FESTIVAL
FOR WORSE by Deborah Rennard
directed by Mark Linn-Baker
2016 Production: New Jersey Repertory Company, NJ
THE TWENTY-SEVENTH MAN by Nathan Englander
directed by Barry Edelstein
2014 Production: The Old Globe Theater, San Diego
2012 Production: Public Theater
UNTITLED WORLD’S FAIR PLAY (Now: THE LIGHT YEARS)
made by The Debate Society
2017 Production: Playwrights Horizons, NYC
22 SECONDS by Michele Lowe
directed by Gaye Taylor Upchurch
BIG SKY by Alexandra Gersten-Vassilaros
directed by Michael Hoffman
2016 Production: Geffen Theater, LA
GOOD BREAD ALLEY by April Yvette Thompson
WENDY AND THE LOST BOYS (Screenplay) by Jon Robin Baitz and Michael Hoffman
directed by Michael Hoffman
JEROME by Ron Lagomarsino
directed by Maria Mileaf
A SEPARATE PEACE musical adaptation of John Knowles’ novel by Warren Leight and Todd Almond
directed by Stafford Arima
WHILE I YET LIVE by Billy Porter, directed by Ed Sylvanus Iskandar
NYC PROGRAMMING
NYC READING SERIES AT BARNARD COLLEGE
THE DRAGON DANCE by Jenny Connell
directed by Giovanna Sardelli
TRANSGRESSION by Terry Curtis Fox
directed by Michael Barakivakl
WHILE I YET LIVE by Billy Porter
directed by Sheryl Kaller
LARGO: THE MUSICAL music and lyrics by Robert Hyman
Richard Chertoff, David Forman and Eric Bazilian
book by David Holstein
THE LATED TRAVELER by Allston James
directed by Maria Mileaf
A LIFE EXTRAORDINARY by Melissa Ross
directed by Steve Cosson
HADESTOWN songwriter Anaïs Mitchell
directed by Ben Matchstick
2016 Production: New York Theatre Workshop
2018 Production: National Theatre, London
2019 Production: Broadway
2011
POWERHOUSE SEASON
MAINSTAGE PRODUCTIONS
F2M by Patricia Wettig
directed by Maria Mileaf
A MAZE by Rob Handel
directed by Sam Buntrock
2012 Production: Atlas Performing Arts Center, Washington, DC
MUSICAL WORKSHOPS
THE NIGHTINGALE book and lyrics by Steven Sater
music by Duncan Sheik
directed by Moisés Kaufman
2012 Page to Stage Musical Production: La Jolla Playhouse
FEBRUARY HOUSE music and lyrics by Gabriel Kahane
book by Seth Bockley
directed by Davis McCallum
2012 Production: Long Wharf Theater
2012 Production: Public Theater
PIECE OF MY HEART music and lyrics by Bert Berns
book by Daniel Goldfarb, Brett Berns and Cassandra Berns
directed by Leigh Silverman
2014 Production: Pershing Square Signature Center
PLAY WORKSHOPS
MARGARET AND CRAIG by David Solomon
directed by Sheryl Kaller
HANDBALL by Seth Zvi Rosenfeld
directed by Cándido Tirado
2013 Production: Urban Theatre Movement
2014 Production: Urban Theatre Movement at Summer Stage
READINGS FESTIVAL
DAY ONE, A HOTEL, EVENING by Joanna Murray-Smith
directed by Mark Rucker
SANGUE BOM (GOOD BLOOD)by Ben Snyder
directed by Leah C. Gardiner
RISING RETURNS written and directed by Daniel MacIvor
DRONES by Matt Witten
directed by Lisa Peterson
PLAYGROUND: THE HALLIE FLANAGAN PROJECT
by Mattie Brickman
directed by Jen Wineman
SLEEPING DEMON written and directed by
John Patrick Shanley
2012 Production: Atlantic Theater Company
MARRY HARRY music and lyrics by Michael Biello
and Dan Martin
book by Jennifer Robbins
directed by Kent Nicholson
2013 Production: NYMF
2017 Production: The York Theatre Company
THE PUBLIC by Ed Hime
directed by Jim Simpson
2012 Production: The Flea Theater
[retitled The Electric Lighthouse]
THE HOUR OF FEELING by Mona Mansour
directed by Giovanna Sardelli
2012 Production: Actors Theatre of Louisville Humana Festival
MATTY'S PLACE by Frank Pugliese
directed by Lisa Peterson
THE ISLAND MUSICAL written by Dar Williams
directed by Jeremy Dobrish
NYC PROGRAMMING
NYC READING SERIES AT BARNARD COLLEGE
THE HOUR OF FEELING by Mona Mansour
directed by Mark Wing-Davey
THE VANDAL by Hamish Linklater
directed by Jim Simpson
2013 Production: The Flea Theater
STOREFRONT CHURCH
written and directed by John Patrick Shanley
F2M by Patricia Wettig
directed by Maria Mileaf
2000 - 2009
2010
POWERHOUSE SEASON
MAINSTAGE PRODUCTIONS
WE ARE HERE by Tracy Thorne
directed by Sheryl Kaller
2012 Production: Contemporary American Theater Festival
PIRATE written and directed by John Patrick Shanley
MUSICAL WORKSHOPS
BONFIRE NIGHT book, music and lyrics by Justin Levine
directed by Alex Timbers
ON A CLEAR DAY YOU CAN SEE FOREVER
book and lyrics by Alan Jay Lerner
music by Burton Lane
new book by Peter Parnell
re-conceived and directed by Michael Mayer
musical direction by Lawrence Yurman
PLAY WORKSHOPS
SAM BENDRIX AT THE BON SOIR by Keith Bunin
directed by Mark Rucker
2011 Production: City Theater
2012 Production: La Jolla Playhouse
A LONG AND HAPPY LIFE by Bekah Brunstetter
directed by Pippin Parker
MY LIFE WITH MEN - AND OTHER ANIMALS
directed by Peter Schneider
INTERVIEWING THE AUDIENCE created by Zach Helm
2011 Production: Vineyard Theater
READINGS FESTIVAL
UNFINISHED PIECE FOR A PLAYER PIANO
by Richard Nelson and Peter Golub
directed by Richard Nelson
SONS OF THE PROPHET by Stephen Karam
directed by Peter DuBois
2011 Co-productions: The Huntington Theatre
and the Roundabout Theatre
THIS THING OF DARKNESS by Zoe Kazan
directed by Sam Gold
2011 Production: Manhattan Theater Club [retitled We Live Here]
THE REST OF YOUR LIFE by Megan Mostyn-Brown
directed by Josh Hecht
I AM AN EMOTIONAL CREATURE by Eve Ensler
directed by Josie Rourke and Rosario Dawson
2012 Production: Off-Broadway
2012 Production: Berkeley Repertory Theater
OVER MARTINIS, DRIVING SOMEWHERE by Romulus Linney
directed by Michael Wilson
A SHORT HISTORY OF WOMEN by Kate Walbert
directed by Judith Ivey
FRIENDS WITH KIDS by Jennifer Westfeldt (screenplay)
2011 Premiere: Toronto Film Festival
2012 Lionsgate release
F2M by Patricia Wettig
directed by Maria Mileaf
UMBRAGE by Steven Sater and Duncan Sheik
directed by Peter Askin
NYC PROGRAMMING
STRANGE FITS by Alexandra Neil
directed by Betsy Aidem
WE ARE HERE by Tracy Thorne
2009
POWERHOUSE SEASON
MAINSTAGE PRODUCTIONS
NINETY by Joanna Murray-Smith
directed by Maria Mileaf
THE BURNT PART BOYS
by Chris Miller, Mariana Elder, and Nathan Tysen
directed by Erica Schmidt
2009 Co-production: The Vineyard Theatre
and Playwrights Horizons
VERA LAUGHED by Keith Bunin
directed by Carolyn Cantor
MUSICAL WORKSHOPS
WHISPER HOUSE by Duncan Sheik and Kyle Jarrow
directed by Keith Powell
2009 Production: The Old Globe Theatre
2017 Production: The Other Palace, London
TINA GIRLSTAR book by Anton Dudley
lyrics by Charlie Stratton
music by Brian Feinstein
directed by Jeremy Dobrish
2015 Production: Signature Theater, DC
PLAY WORKSHOPS
SLIGHT HITCH by Lewis Black
directed by Joe Grifasi
2011 Production: Williamstown Theatre Festival
2012 Production: George Street Playhouse
SHOE STORY by Ben Snyder, directed by Thomas Kail
READINGS FESTIVAL
SEMINAR by Theresa Rebeck
directed by Jeremy Cohen
2011 Production: Broadway, Golden Theater
ZERO by Julian Sheppard
directed by Sarah Benson
THE ONION GAME by Bryan Delaney
directed by Will Frears
LANGUAGE ROOMS by Yussef El Guindi
directed by Blanka Zizka
2009 Production: The Wilma Theatre
SOUL CAKE by Dan Moran
directed by David Wohl
PIRATE written and directed by John Patrick Shanley
RAIN by Regina Taylor
directed by Sheryl Kaller
2010-2011 Co-productions: Dallas Theatre Center
and the Goodman Theatre
THAT GOOD NIGHT by Andrew Dolan
directed by Bob Krakower
THE JACKSONIAN by Beth Henley
directed by Doug Hughes
2012 Production: Geffen Theater
2013 Production: The New Group
AMERICAN IDIOT by Michael Mayer and Billie Joe Armstrong
with music by Green Day
directed by Michael Mayer
2009 Production: Berkeley Repertory Theatre
2010 Production: Broadway, St. James Theatre
NYC PROGRAMMING
THE JACKSONIAN by Beth Henley
directed by Doug Hughes
JEROME written and directed by Ron Lagomarsino
HIGHER by Carey Perloff
directed by Rebecca Taichman
2008
POWERHOUSE SEASON
MAINSTAGE PRODUCTIONS
1+1 by Eric Bogosian
directed by Mark Brokaw
FINKS by Joe Gilford
directed by Charlie Stratton
2013 Production: Ensemble Studio Theatre
2018 Production: Theatreworks, Silicon Valley
MUSICAL WORKSHOPS
NERO book and lyrics by Steven Sater
music by Duncan Sheik
directed by Daniel Kramer
2011 Production: Rattlestick Playwrights Theater
NOTES TO mariANNE book
music & lyrics by David Rossmer and Dan Lipton
directed by Jeremy Dobrish
PLAY WORKSHOPS
AN EVENING WITH ME written and performed by Alan Zweibel
directed by Ron Lagomarsino
HORSEDREAMS by Dael Orlandersmith
directed by Gordon Edelstein
FAULT LINES by Stephen Belber
directed by David Schwimmer
2008 Production: Naked Angels Theater Company
READINGS FESTIVAL
MOVING ON by Anton Dudley
directed by Mark Rucker
WHISPER FROM THE BOOK OF ETIQUETTE by Claire Chafee
directed by Maria Mileaf
BEAST by Michael Weller
directed by Jo Bonney
2008 Production: New York Theatre Workshop
ABOVE THE FOLD by Bernard Weinraub
directed by Will Frears
O.P.C. by Eve Ensler
directed by Michael Wilson
MEAN TIME by Alexandra Gersten-Vassilaros
directed by Daniel Aukin
ENOUGH by Deborah Rennard
directed by Max Mayer
LITTLE BLACK DRESS by Ronan Noone
directed by Ari Edelson
KNOWING CAIRO by Andrea Stolowitz
directed by Rebecca Taichman
VERONICA written and directed by John Patrick Shanley
NYC PROGRAMMING
THE RETRIBUTIONISTS by Daniel Goldfarb
directed by Carolyn Cantor
GEOMETRY OF FIRE by Stephen Belber
directed by Lucie Tiberghien
2007
POWERHOUSE SEASON
MAINSTAGE PRODUCTIONS
GEOMETRY OF FIRE by Stephen Belber
directed by Lucie Tiberghien
2008 Production: Rattlestick Playwrights Theater
ROMANTIC POETRY book & lyrics by John Patrick Shanley
music by Henry Krieger
directed by John Patrick Shanley
2008 Production: Manhattan Theatre Club
MUSICAL WORKSHOPS
R-E-S-P-E-C-T book by Stephen Fischer
music & lyrics by Artists from East Memphis Music
co-directed by Stephen Fischer and Clifford Lee Johnson III
THE BOY WHO HEARD MUSIC
story, music & lyrics by Pete Townshend
adapted & directed by Ethan Silverman
PLAY WORKSHOPS
DANCE OF THE HOLY GHOSTS: A PLAY ON MEMORY
by Marcus Gardley
directed by Leah C. Gardiner
CALLIE’S TALLY by Betsy Howe
directed by Loy Arcenas
READINGS FESTIVAL
SUBSTITUTION by Anton Dudley
directed by Daniel DeRaey
2008 Production: The Playwrights Realm
HIGHER by Carey Perloff
directed by Loretta Greco
HUMAN VOICES by Sarah Treem
directed by Jo Bonney
GRASPING THE SPARROW’S TAIL
written and directed by Enid Zentelis
THE ESCAPE ARTIST’S CHILDREN by Steven Harper
directed by Pam MacKinnon
THE WENDY PLAY by Amy Herzog
directed by Shelley Butler
2008 Production: American Conservatory Theater
CRIPPLED SISTERS by Susan Nussbaum
directed by Carolyn Cantor
THE ALARM by Frank Pugliese
directed by Sheryl Kaller
AMERICAN HWANGAP by Lloyd Suh
directed by Trip Cullman
2008 Production: Magic Theatre
2009 Production: The Play Company
THE RETRIBUTIONISTS by Daniel Goldfarb
directed by Carolyn Cantor
2009 Production: Playwrights Horizons
NYC PROGRAMMING
A.C.O.D. by Ben Karlin and Stu Zicherman
directed by Stu Zicherman
2013 Premiere: Black Bear Pictures
2006
POWERHOUSE SEASON
MAINSTAGE PRODUCTIONS
A STEADY RAIN by Keith Huff
directed by Trip Cullman
2007 Production: Chicago Dramatists
2008 Production: Broadway, Schoenfeld Theatre
BHUTAN by Daisy Foote
directed by Evan Yionoulis
2006 Production: Cherry Lane Theatre
MUSICAL WORKSHOPS
PRAIRIE book by Beth Henley
music by Rachel Portman
lyrics by Donna DiNovelli
directed by Francesca Zambello
2008 Production: Guthrie Theater
2009 Production: Paper Mill Playhouse
JERRY CHRISTMAS book by Daniel Goldfarb
music and lyrics by Andrew Lippa
MIXED COMPANY conceived by Billy Porter
music and lyrics by Steven Sondheim
2007 Production: Westport Playhouse (as Being Alive)
2007 Production: Philadelphia Theatre Company (as Being Alive)
PLAY WORKSHOPS
BOB written by Anton Dudley
directed by Leigh Silverman
QUIVER AND TWITCH by Erin Courtney
directed by Sarah Benson
SPECIAL PRESENATION
WHAT’S APPROPRIATE ON A FIRST DATE WITH AN ALIEN
by David Tenney and libretto by Steven Mark Tenney
directed by Sheryl Kaller
READINGS
SAM’S COMING by Kia Corthron
directed by Leah C. Gardiner
EMERALDS by Cindy Lou Johnson
directed by Pam MacKinnon
LIZARDSKIN by Jennifer Silverman
directed by Davis McCallum
THE AS IF BODY LOOP by Ken Weitzman
directed by Wendy Goldberg
2005
POWERHOUSE SEASON
MUSICAL WORKSHOPS
THE MAN IN THE WHITE SUIT
book by Greg Kotis and Mark Hollmann
directed by David Petrarca
DANGEROUS BEAUTY book by Jeannine Dominy
directed by Sheryl Kaller
2008 Production: American Music Theatre Project
2011 Production: Pasadena Playhouse
BEHIND THE LIMELIGHT
book, music, and lyrics by Christopher Curtis
directed by Michael Unger
2012 Production: Broadway, The Barrymore Theatre
[retitled CHAPLIN, THE MUSICAL]
PLAY WORKSHOPS
DONNA MORELLI by Gina Barnett
directed by Richard Caliban
BIG WYOMING by David Neipris
directed by Hal Brooks
BLUE DOOR by Tanya Barfield
directed by Leah C. Gardiner
2006 Production: Playwrights Horizons
2008 Production: Guthrie Theater
INSIDE LOOK! SERIES
GET WHAT YOU NEED by Jessica Goldberg
directed by Carolyn Cantor
SPECIAL PRESENTATION
LOVE CHILD by Daniel Jenkins and Robert Stanton
directed by David Warren
ANNA AND ME by Randle Mell
directed by Max Mayer
DEFIANCE written and directed by John Patrick Shanley
2005 Production: Manhattan Theatre Club
READINGS
THE BUSY WORLD IS HUSHED by Keith Bunin
2006 Production: Playwrights Horizons
SWEET MERCY by Melody Cooper
directed by Michael Sexton
RAYMOND FALLS by Dan Kagan
directed by Carl Forsman
THE NEW BROOM by Michael Martin Kell
directed by Annie Dorsen
THE FURTHER ADVENTURES OF HEDDA GABLER by Jeff Whitty
directed by Matt McGrath
2006 Production: South Coast Repertory
2008 Production: Oregon Shakespeare Festival
2012 Production: Exit Pursued by a Bear, NYC
YES! WE HAVE NO PAJAMAS by Nicole Burdette
directed by Brian MacDevitt
RAPTURE by Joanna Murray-Smith
directed by Neil Pepe
JAYSON WITH A Y by Darci Picoult
directed by Sheryl Kaller
MANIC FLIGHT REACTION by Sarah Schulman
directed by Trip Cullman
A FOOTNOTE TO THE ILIAD by Steven Sater
directed by Barry Edelstein
2004
POWERHOUSE SEASON
MAINSTAGE PRODUCTIONS
A SAFE HARBOR FOR ELIZABETH BISHOP by Marta Góes
directed by Richard Jay-Alexander
2006 Production: Primary Stages
MUSICAL WORKSHOPS
GOOD VIBRATIONS by Richard Dresser
directed by John Carrafa
2004 Production: Broadway, Eugene O'Neill Theatre
NERDS book and lyrics by Jordan Allen-Dutton and Erik Weiner
directed by John Ruocco
2005 Production: The New York Musical Theatre Festival
PLAY WORKSHOPS
BACH AT LEIPZIG by Itamar Moses
directed by Pam MacKinnon
2005 Production: New York Theatre Workshop
GOOD CANARY by Zach Helm
directed by David Petrarca
HONOR AND THE RIVER by Anton Dudley
directed by Ken Rus Schmoll
THE PETERSONS PROJECT by Keira Naughton, Evan Robertson, Matt Saldivar, Pete Simpson and Adam Stein
directed by Trip Cullman
SPECIAL PRESENTATION
EXPEDITION 6 conceived and directed by Bill Pullman
READINGS
BIG WYOMING by David Neipris
directed by Hal Brooks
LUMINESCENCE DATING by Carey Perloff
directed by Irene Lewis
PAINTED FROM MEMORY by Stuart Spencer
directed by Scott Williams
THE CATCH by Alison Tatlock
directed by Pam MacKinnon
DOUBT written and directed by John Patrick Shanley
2004 Production: Manhattan Theatre Club
and Broadway, Walter Kerr Theatre
2005 Pulitzer Prize for Drama
2005 Drama Desk Award
2005 Tony Award for Best Play
FRAN’S BED written and directed by James Lapine
2005 Production: Playwrights Horizons
PEN by David Marshall Grant
directed by Will Frears
2005 Production: Playwrights Horizons
2007 Production: Philadelphia Theatre Company
2013 Production: Fletcher Opera Theatre, North Carolina
2003
POWERHOUSE SEASON
MAINSTAGE PRODUCTIONS
LAST CHANCE FOR A SLOW DANCE by Zach Helm
directed by Michael Morris
IN CASE YOU FORGET by Ben Snyder
directed by Max Mayer
WORKSHOPS
THE CRAZY GIRL by Frank Pugliese
directed by Annie Dorsen
GOOD LIFE by John Corwin
directed by David Warren
EXPOSED by Beth Henley
directed by David Esbjornson
THE NEW AMERICANS by Cindy Lou Johnson
directed by Sheryl Kaller
ROULETTE by Paul Weitz
directed by Jace Alexander
2004 Production: Ensemble Studio Theatre
READINGS
THE QUICK by Tanya Barfield
directed by Leigh Silverman
ILLUMINATION VERONICA by Rogelio Martinez
directed by Michael Sexton
DOG AND PONY by Rick Elice
directed by Roger Rees
THE PLANET ON 158TH STREET by Clark Perry
directed by S. Caden Hethon
EXCEPT MY LIFE by Nicole Burdette
directed by Gregory Mosher
DAVID CALE MUSICAL SELECTIONS
written by Jonathan Kreisberg
THIS BALL OF MUD AND FIRE by Anton Dudley
directed by Erica Schmidt
SWEETNESS by Gary Sunshine
directed by Trip Cullman
2002
POWERHOUSE SEASON
MAINSTAGE PRODUCTIONS
TUESDAYS WITH MORRIE by Jeffrey Hatcher and Mitch Albom
directed by David Esbjornson
2002 Production: Minetta Lane Theatre
ADRIFT IN MACAO book and lyrics by Christopher Durang
music by Peter Melnick
directed by Sheryl Kaller
2007 Production: Primary Stages
LEFT written and directed by Richard Nelson
WORKSHOPS
[a new play] by Tom Donaghy
directed by Michael Wilson
DISCOVERY OF AMERICA by Arthur Kopit
directed by Rebecca Taichman
THE VIOLENCE PROJECT conceived and directed by Liz Swados
DIOSA by Edwin Sanchez
directed by Melia Bensussen
READINGS
KITCHEN DRAMA (A COMEDY) by Lee Kalcheim
directed by Matt August
STRING OF PEARLS by Michele Lowe
directed by Matt Williams
THE SUMMER WIND written and directed by Frank Pugliese
IN FILM by Christopher Denham
directed by Pam MacKinnon
NO SUCH THING by Brian Tanen
directed by David Marshall Grant
WILDERNESS OF MIRRORS by Charles Evered
directed by Liev Schreiber
THE FLU SEASON by Will Eno
directed by David Levine
OMNIUM-GATHERUM
by Theresa Rebeck and Alexandra Gersten
directed by David Warren
ROSEMARY AND I by Leslie Ayvazian
directed by Joan Twekesbury
PICASSO’S CLOSET by Ariel Dorfman
directed by John Dillon
2001
POWERHOUSE SEASON
MAINSTAGE PRODUCTIONS
THE HURDY GURDY MAN by Dick Beebe
directed by Sheryl Kaller
MR. GOLDWYN by Marsha Lebby and John Lollos
directed by Gene Saks
2002 Production: Promenade Theatre
NIGHTFALL by Joanna Murray-Smith
directed by Max Mayer
MUSICAL WORKSHOPS
LARGO book by David Henry Hwang
directed by Ethan Silverman
PLAY WORKSHOPS
BOYS AND GIRLS written and directed by Tom Donaghy
STRANGE GRACE by Jane Shepard
directed by Daniel DeRaey
GOOD THING by Jessica Goldberg
directed by Jo Bonney
READINGS
THE COMING WORLD by Christopher Shinn
directed by Tim Farrell
A CONVERSATION by David Williamson
directed by Oz Scott
HEADLONG by Patricia Wettig
directed by Melia Bensussen
KING by Will Eno
directed by David Perry
PERMANENT by Larry Atlas
directed by Liz Diamond
THE FOURTH SISTER by Janucz Glowacki
directed by Lisa Peterson
EMERGING WRITERS RESIDENCY
THE GLICK SCENES by Glenn Kessler
directed by Leah Gardiner
COLD/TENDER by Cody Henderson
directed by Dan Fields
NEW WORLD RHAPSODY by Adam Kraar
directed by Tom Caruso
1990 - 1999
2000
POWERHOUSE SEASON
MAINSTAGE PRODUCTIONS
THE DAZZLE by Richard Greenberg
Directed by David Warren
2002 Production: Roundabout at Gramercy Theatre
2003 Production: Broadway, Cort Theatre
THE LIVELY LAD by Quincy Long
music by Michael Silversher
directed by Max Mayer
MUSICAL WORKSHOPS
A YEAR WITH FROG AND TOAD book and lyrics by Willie Reale
music by Robert Reale
directed by David Petrarca
JULES’ BLUES written and directed by Jules Feiffer
music by Michael Wolf
PLAY WORKSHOPS
NECESSARY TARGETS by Eve Ensler
directed by Michael Wilson
2002 Production: Variety Arts Theatre
A MAP OF DOUBT AND RESCUE by Susan Miller
directed by Judy Minor
UNDER COVER OF DARKNESS by Cindy Lou Johnson
THAT DIDN’T HAPPEN by Christopher Shinn
directed by David Petrarca
THE HURDY GURDY MAN by Dick Beebe
directed by Sheryl Kaller
THE BETTY PLAY by Alyson Palmer, Amy Ziff and Elizabeth Ziff
directed by Michael Greif
READINGS
A BREATH OF SHORT BREATHING by Zachary Berkman
directed by Wilson Milam
THE TREEHOUSE by Etan Frankel
directed by Dan Fields
MORES LIES ABOUT JERZY by Davey Holmes
directed by Andy Goldberg
RESUME by Christopher Bomba
directed by Maria Mileaf
THE THEORY OF THREE by Alexandra Cunningham
directed by Gordon Greenberg
1998
POWERHOUSE SEASON
MAINSTAGE PRODUCTIONS
ONCE AROUND THE CITY book and lyrics by Willie Reale
directed by Mark Linn-Baker
2001 Production: Second Stage Theatre
CELLINI written and directed by John Patrick Shanley
2001 Production: Second Stage Theatre
WORKSHOPS
TWO ORPHANS by Theresa Rebeck
directed by Jayne Atkinson
FIRE EATER by Brighde Mullins
directed by Maria Mileaf
THE BALLAD OF LILY FROM HELL by David Grimm
directed by Max Mayer
HURRICANE by Erin Cressida Wilson
directed by Barry Edelstein
READINGS FESTIVAL
BUGBY by Tracy Letts
PORK PIE by Michael Genet
JAMES by Max Mayer
EATING THE DEAD by Jane Shepard
STUCK by Jessica Goldberg
1997
POWERHOUSE SEASON
MAINSTAGE PRODUCTIONS
SPLASH HATCH ON THE E GOING DOWN by Kia Corthron
directed by Derek Anson Jones
2001 Production: Playwrights Horizons
SERVICEMEN by Evan Smith
directed by Michael Wilson
THE CLEARING by Helen Edmundson
directed by Tracy Brigden
1999 Production: Blue Light Theatre Co.
WORKSHOPS
DEFYING GRAVITY by Jane Anderson
directed by Michael Wilson
1997 Production: American Place Theatre
WHO’S ON TOP? By James Lapine
directed by David Petrarca
ONCE AROUND THE CITY by Willie Reale
music by Robert Reale
directed by Mark Linn-Baker
READINGS FESTIVAL
DISTURBED BY THE WIND by David Schulner
CHURCH OF THE SOLE SURVIVOR by Keith Curran
LOVE AND HAPPINESS by Julian Sheppard
SEX AND LONGING (REVISED) by Christopher Durang
STIGMATA AND OTHER SYMPTOMS by Kate Robin
SCREENPLAY READINGS
DON’T FORGET YOUR GUN by John Patrick Shanley
BETTER LIVING by George F. Walker and Max Mayer
DETOUR by Christopher Bomba
GOD’S MISTRESS by Jeannine Dominy
FINDING THE STORY: A SYMPOSIUM
1996
POWERHOUSE SEASON
MAINSTAGE PRODUCTIONS
SIDE MAN by Warren Leight
directed by Michael Mayer
1998 Production: 13th Street Theater
1998 Production: Roundabout Stage Right
1999 Tony Award for Best Play
1999 Production: John Golden Theatre
RED MEMORIES by Seth Greenland
directed by Roger Rees
MR. MELANCHOLY by Matt Cameron
directed by Michael Wilson
WORKSHOPS
MEASURE OF A MAN by Tony Abatemarco and Randle Mell
directed by Mary McDonnell
MISSIONARIES written and directed by Elizabeth Swados
1996 Production: BAM
TONGUE OF A BIRD by Ellen McLaughlin
directed by Lisa Peterson
HONOUR by Joanna Murray-Smith
directed by Ulu Grosbard
1998 Production: Belasco Theatre
READINGS FESTIVAL
DINOSAUR DREAMS by Tom Szentgyorgyi
BETWEEN THE LINES by Regina Taylor
THE LAST 60 of 99 by Kia Obolensky
SERVICEMEN by Evan Smith
THE LAW MAKES EVENING FALL by Sherry Kramer
DIMLY PERCEIVED THREATS TO THE SYSTEM by Jon Klein
GIVEN AWAY by Kate Robin
BREAKING AND ENTERING by Jay Presson Allen
KING OF CLOCKS by Keith Bunin
LILLIAN by David Cale
1995
POWERHOUSE SEASON
MAINSTAGE PRODUCTIONS
THE CLEOPATRA CLUB by Paul Schrader
directed by Barry Edelstein
MINUTES FROM THE BLUE ROUTE by Tom Donaghy
directed by David Warren
1997 Production: Atlantic Theater Company
KIM’S SISTER by Peter Sagal
directed by Max Mayer
WORKSHOPS
MIRRORS REMEMBERED by Cary Wong
directed by Marya Mazon
FAIR FIGHT (A MEAN LITTLE DANCE)
written and conceived by Liz Tuccillo
directed and choreographed by John Ruocco
SPECIAL PRESENTATIONS
BUNNY, BUNNY by Alan Zweibel
directed by Barry Edelstein
1997 Production: Lucille Lortel Theatre
PATTER FOR THE FLOATING LADY AND THE ZIG-ZAG WOMAN
by Steve Martin
directed by Barry Edelstein
TRIPPING THROUGH THE CAR HOUSE by Regina Porter
directed by Pamela Berlin
I TOLD MY MOTHER I HATE HER by Dan Kagan
directed by Tim Vasen
READINGS
CELLINI by John Patrick Shanley
CURRENT EVENTS by David Marshall Grant
EVENT HORIZON by Christopher Kyle
THE PRINCIPALITY OF SORROW by Keith Bunin
THE SLEEPING HIPPO by Max Mayer
1994
POWERHOUSE SEASON
MAINSTAGE PRODUCTIONS
REVELERS by Beth Henley
directed by Leonard Foglia
SNAKEBIT by David Marshall Grant
directed by Joe Mantello
1999 Production: Century Theatre
1999 Production: Naked Angels
THE FOOL AND HER FORTUNE
written and directed by John Patrick Shanley
WORKSHOPS
WASP and ROMEO AND JULIET AT ANTIOCH by Steve Martin
directed by Barry Edelstein
HAND TO HAND by Max Mayer
directed by William Foeller
SPECIAL PRESENTATIONS
RAISED IN CAPTIVITY by Nicky Silver
directed by David Warren
1995 Production: Vineyard Theatre
A FAIR COUNTRY by Jon Robin Baitz
directed by David Warren
1996 Production: Lincoln Center Theatre
THE QUILLING OF PRUE by Mary Gail
directed by Melia Bensussen
READINGS
AMAZING FROGS AND TOADS by Terri Minsky
MIRRORS REMEMBERED by Cary Wong
HEARTS BEATING FASTER by Ralph Pape
CIRCUS GENES by Alexandra Tolk
FILM
THE HAIRY BIRD written and directed by Sarah Kernochan
1993
POWERHOUSE SEASON
MAINSTAGE PRODUCTIONS
PLAY WITH REPEATS by Martin Crimp
directed by Barry Edelstein
THE LARGEST ELIZABETH IN THE WORLD by Stephen Gregg
directed Greg Germann
WORKSHOPS
AN EVENING OF JON ROBIN BAITZ
directed by David Warren
A LIFE IMAGINED by Patricia Wettif
HAND TO HAND by Max Mayer
BAD PRESS by Glen Merzer
JULIE JOHNSON by Wendy Hammond
OTHER
TOUGH! by George F. Walker
directed by Max Mayer
1992
POWERHOUSE SEASON
MAINSTAGE PRODUCTIONS
DARK RAPTURE by Eric Overmyer
directed by Max Mayer
1996 Production: Second Stage Theatre
THREE HOTELS written and directed by Jon Robin Baitz
1993 Production: Circle Repertory Company
READINGS
THE HOMAGE THAT FOLLOWS by Mark Medoff
STALIN’S DAUGHTER by August Baker
LUCIFER DISTRACTED by Robert Auletta
TRUST by Steven Dietz
THE MERIT SYSTEM by Edwin Sanchez
REAL LIFE by Susan Yankowitz
SNAKEBIT by David Marshall Grant
LIVING WITH CLAUDE by Rene-Claude Dubois
THE MOONSHOT TAPE by Lanford Wilson
1991
POWERHOUSE SEASON
MAINSTAGE PRODUCTIONS
MISSISSIPPI NUDE by John Reaves
directed by Cheryl Faver
BILLY BISHOP GOES TO WAR
by John Gray in collaboration with Eric Peterson
directed by Ben Balley, Jr.
ESCAPE FROM HAPPINESS by George F. Walker
directed by Max Mayer
1993 Production: Yale Repertory Theatre
1998 Production: Schoolhouse Theatre
THE WAY OF THE WORLD by William Congreve
directed by Norman Ayrton
SECOND STAGE
PRESCRIBED LAUGHTER IN THE EMERGENCY CAFÉ
by Annie Evans
directed by Max Mayer
DÈJÁ VU conceived and directed by Jean Wagner
WORKSHOPS
LOOSE KNIT by Theresa Rebeck
directed by Michael Greif
IMAGINARY LIFE by Peter Parnell
directed by Don Scardino
MY DADDY’S SERIOUS AMERICAN GIFT by John Ford Noonan
directed by Dennis Boutsikaris
WILD GOOSE CIRCUS by Russell Davis
directed by Seret Scott
CABARETS
NOTHING BUT THE TRUTH
conceived and directed by Rachel Wineberg
MINSTREL MAN BLUES conceived and directed by Lonzia Berry
MRS. SASAKI’S BIRTHDAY PARTY: THREE STORIES
by Yukio Michima
directed by Benjamin Kevolin
THE COMIC CHARACTERS OF SUSIE ESSMAN by Susie Essman
FILM
THE SILENT ALARM written and directed by Rob Morrow
1985 - 1989
1990
POWERHOUSE SEASON
MAINSTAGE PRODUCTIONS
SIGNATURE by Beth Henley
directed by Tommy Schlamme
SPIKE HEELS by Theresa Rebeck
directed by Chris Ashley, with Greg Germann
1992 Production: Second Stage Theatre
MY MOTHER SAID I NEVER SHOULD by Charlotte Keatley
directed by Ken Olin
WORKSHOP
HEARTS DESIRE by Stuart Dybeck, Beverly Lowry,
Armistead Maupin, and Treva Silverman
directed by Jack Hofsiss
READINGS
APPOINTMENT WITH A HIGH WIRE LADY by Russell Davis
directed by Abigail Adams
HEARTS DESIRE by Stuart Dybeck, Beverly Lowry,
Armistead Maupin, and Treva Silverman,
music and lyrics by Glen Roven
directed by Jack Hofsiss
LOCAL POLITICS by Richard Vetere
directed by Max Mayer
FILM
MAYBE NOT by Jerrett Engle and Cort Tremontin
directed by Cort Tremontin
1989
POWERHOUSE SEASON
MAINSTAGE PRODUCTIONS
TRU written and directed by Jay Presson Allen, with Robert Morse
1989 Production: Booth Theatre
1990 Tony Award Best Actor in Play
1990 Drama Desk Award Outstanding One Person Show/Solo Performance
1992 Emmy as Best Actor in a Miniseries or Special
NOTHING SACRED by George F. Walker
directed by Max Mayer
WORKSHOP
TENTH AVENUE TALES by Brandon Cole and John Turturro,
directed by Andrei Belgrader
CABARETS
CABARET AS A FAMILY SAGA directed by Paul Walker
WORLD WIDE TRAGEDY directed by Tim Vasen
READINGS
TENTH AVENUE TALES by Brandon Cole and John Turturro
directed by Andrei Belgrader
APPOINTMENT WITH A HIGH WIRE LADY by Russell Davis
HARRY’S WAY by Keith Huff
THE RED ADDRESS by David Ives
SHORT FILMS
A PRAYER TO A LESSER GOD GOES UNANSWERED
written and directed by Mark Linn-Baker
NIGHTS REMORSE by John Robin Baitz
directed by Max Mayer
FILM WORKSHOPS
ME AND VERONICA by Leslie Lyles
PAPERTOWN by Stephen Jimenez
1988
POWERHOUSE SEASON
MAINSTAGE PRODUCTIONS
THE DEBUTANTE BALL by Beth Henley
directed by Evan Yionoulis
PUNTILLA AND MATTI, HIS HIRED MAN by Bertolt Brecht
directed by Rand Foerster
THE LAST GOOD MOMENT OF LILY BAKER by Russell Davis
directed by Max Mayer
CABARETS
THE MAN IN THE MIRROR
written and directed by Morgan Jenness
composed by Rick Baitz
THE HARROWING OF HELL
written and directed by Christopher Ashley
with original music by John Gromada
STAND-UP COMEDY OF LEWIS BLACK AND KATHY ROSSITER
READINGS
GOD’S COUNTRY by Stephen Dietz
UNINVITED PASSION by Kathleen Clark
DUTCH LANDSCAPE by John Robin Baitz
MADAME MOUSTACHE by Annie Evans
FILMS
OVER written and directed by Carl Capotorto
NIGHT MAGIC by Melody Anderson and Steven Schachter
directed by Steven Schachter
FILM WORKSHOPS
SCAMMING by Mark Fields and Dan Kleinman
produced by Michael Nozik and Cherie Rodgers
THE NIGHT by Warren Leight
produced by Michael Peyser
1987
POWERHOUSE SEASON
MAINSTAGE PRODUCTIONS
BETTER LIVING by George F. Walker
directed by Max Mayer, with Olympia Dukakis
ORPHEUS DESCENDING by Tennessee Williams
directed by William Rothwell
THE DOWNSIDE by Richard Dresser
directed by Kenneth Frankel
WORKSHOPS
BRILLIANT TRACES by Cindy Lou Johnson
directed by David Briggs
1989 Production: Circle Repertory Company
PERSONNEL FILES written and directed by Daniel DeRaey
THE CZAR OF ROCK AND ROLL by Rusty Magee and Lewis Black
directed by Rand Foerster
MR. CHRIST AS EASTER BUNNY by Erin Cressida Wilson
WILL WE EVER GET TO THE NIGHT CLUB? by Gilbert Girion
A FAIR COUNTRY by Jon Robin Baitz
THE JANUARY MAN by John Patrick Shanley
MADAME MOUSTACHE by Annie Evans
FOREIGN PARTS by Annie Evans
FILMS
BLOODHOUNDS OF BROADWAY
written and directed by Howard Brookner
MAC by John Turturro and Brandon Cole
A LONGER DAY written and directed by Carl Capotorto
SWEAT EQUITY by Peter Crombie and Richard Heitman
I AM ANGRY written and directed by John Patrick Shanley
1986
POWERHOUSE SEASON
MAINSTAGE PRODUCTIONS
THE DREAMER EXAMINES HIS PILLOW by John Patrick Shanley
directed by Max Mayer
1986 Production: Double Image Repertory Company at 47th Street Theatre
THE RETURN OF PINOCCHIO by Richard Nelson
directed by Max Mayer
SPRING AWAKENING by Frank Wedekin
directed by Gerald Chapman
combined apprentice and professional companies
READINGS
MUG SHOTS written and directed by Arnold Weinsten
FLIGHT 666 by Daniel DeRaey and Barbara James
directed by Daniel DeRaey
GHOST STORIES by Annie Evans
directed by Max Mayer
HOW IT HANGS by Grace McKeaney
directed by Dan Moran
WELCOME TO THE MOON by John Patrick Shanley
directed by Randel Mell
|
|||||
692
|
dbpedia
|
1
| 22 |
https://playmakersrep.org/stick-fly-playbill/
|
en
|
Playbill for Stick Fly
|
http://playmakersrep.org/wp-content/uploads/2022/01/StickFly_PlaybillCover.jpg
|
http://playmakersrep.org/wp-content/uploads/2022/01/StickFly_PlaybillCover.jpg
|
[
"https://www.facebook.com/tr?id=443194416127073&ev=PageView&noscript=1",
"https://playmakersrep.org/wp-content/uploads/2022/08/playmakers.svg",
"https://playmakersrep.org/wp-content/uploads/2022/01/StickFly_PlaybillCover.jpg",
"https://playmakersrep.org/wp-content/uploads/2021/10/3148CED_CedarsArts_Playmakers_720x1280.jpg",
"https://playmakersrep.org/wp-content/uploads/2021/10/LetterfromViv_DigitalPlaybillHeader.jpg",
"https://playmakersrep.org/wp-content/uploads/2021/10/VivShortSignatureBW.png",
"https://playmakersrep.org/wp-content/uploads/2021/10/Support_DigitalPlaybillHeader.jpg",
"https://playmakersrep.org/wp-content/uploads/2021/10/Amy-Guskiewicz-signatures.png",
"https://playmakersrep.org/wp-content/uploads/2021/11/InMemoriam_DigitalPlaybillHeader.jpg",
"https://playmakersrep.org/wp-content/uploads/2021/11/WhoWeAre_DigitalPlaybillHeader.jpg",
"https://playmakersrep.org/wp-content/uploads/2022/01/Occupy-The-Stage-22_-Press-Packet-1.png",
"https://playmakersrep.org/wp-content/uploads/2021/11/IlPalio.jpg",
"https://playmakersrep.org/wp-content/uploads/2022/01/StickFlyProgramNotes_DigitalPlaybillHeader.jpg",
"https://playmakersrep.org/wp-content/uploads/2022/01/23vineyard1-jumbo-digitalplaybill.jpg",
"https://playmakersrep.org/wp-content/uploads/2022/01/african-digitalplaybill.jpg",
"https://playmakersrep.org/wp-content/uploads/2022/01/Oak-Bluffs-digitalplaybill.jpg",
"https://playmakersrep.org/wp-content/uploads/2021/11/Larry.jpg",
"https://playmakersrep.org/wp-content/uploads/2021/09/820112D0-F404-4AF6-B162-2F0E9DE96511-e1632514180229.jpeg",
"https://playmakersrep.org/wp-content/uploads/2021/11/Residence.jpg",
"https://playmakersrep.org/wp-content/uploads/2021/11/ActorBios_DigitalPlaybillHeader.jpg",
"https://playmakersrep.org/wp-content/uploads/2019/06/Anthony-August-headshot-WEB.png",
"https://instagram-brand.com//home/playma8/public_html/wp-content/uploads/2016/11/app-icon2.png",
"https://playmakersrep.org/wp-content/uploads/2021/12/IMG_0210-e1642100800491.jpg",
"https://playmakersrep.org/wp-content/uploads/2019/06/Tori-Jewell-headshot-WEB.png",
"https://playmakersrep.org/wp-content/uploads/2021/09/Jamar-Jones-WEB-headshot.png",
"https://playmakersrep.org/wp-content/uploads/2019/06/Khalil-Lesaldo-Headshot-WEB-1.png",
"https://playmakersrep.org/wp-content/uploads/2019/06/AhDream-Smith-Headshot-WEB-1.png",
"https://playmakersrep.org/wp-content/uploads/2019/06/Omolade-Wey-headshot-WEB.png",
"https://playmakersrep.org/wp-content/uploads/2021/11/CreativeTeamBios_DigitalPlaybillHeader.jpg",
"https://instagram-brand.com//home/playma8/public_html/wp-content/uploads/2016/11/app-icon2.png",
"https://playmakersrep.org/wp-content/uploads/2015/12/2000px-F_icon.svg_-150x150.png",
"https://instagram-brand.com//home/playma8/public_html/wp-content/uploads/2016/11/app-icon2.png",
"https://playmakersrep.org/wp-content/uploads/2015/12/2000px-F_icon.svg_-150x150.png",
"https://playmakersrep.org/wp-content/uploads/2021/11/GeneralInfo_DigitalPlaybillHeader.jpg",
"https://playmakersrep.org/wp-content/uploads/2021/11/PlayMakersStaff_DigitalPlaybillHeader.jpg",
"https://playmakersrep.org/wp-content/uploads/2021/11/FriendsofPlayMakers_DigitalPlaybillHeader.jpg",
"https://playmakersrep.org/wp-content/uploads/2021/11/Corporate_DigitalPlaybillHeader.jpg",
"https://playmakersrep.org/wp-content/uploads/2018/03/NEA-Logo-2.png",
"https://playmakersrep.org/wp-content/uploads/2018/03/NCAClogo.png",
"https://playmakersrep.org/wp-content/uploads/2021/11/Shubert.jpg",
"https://playmakersrep.org/wp-content/uploads/2021/11/ArtsMidwest.jpg",
"https://playmakersrep.org/wp-content/uploads/2021/11/OrangeCountyArts.jpg"
] |
[] |
[] |
[
""
] | null |
[] |
2022-01-15T22:52:20+00:00
|
Table of Contents Letter from Vivienne Support PlayMakers Who We Are Title Page Program Notes About Lydia R. Diamond Actor Bios Creative Team Bios General […]
|
en
|
PlayMakers Repertory Company
|
https://playmakersrep.org/stick-fly-playbill/
|
Table of Contents
Letter from Vivienne
Support PlayMakers
Who We Are
Title Page
Program Notes
About Lydia R. Diamond
Actor Bios
Creative Team Bios
General Information
PlayMakers Staff
Friends of PlayMakers
Corporate and Foundation Partners
Desktop Computer Version of playbill available here
Dear Friends,
Happy 2022!
Thank you for being here. Coming out of a complicated holiday season (I hope filled with more joy than stress), I am thrilled to welcome you back to the theatre with Lydia Diamond’s compelling family dramedy, “Stick Fly”. A huge hit on the theatre circuit when it premiered several years ago, its resonances in 2022 seem freshly profound in the midst of the national conversation about the impact of racism and equity on all of our institutions: marriage, family, education, community and on and on.
As we were planning this season, in conversation with PlayMakers company member and Artistic Associate, Kathy Williams, this title kept resurfacing. It’s a play near and dear to her heart and one that she has taught in her classes for many years. Her admiration and enthusiasm for the play was clear, and it created a perfect opportunity for her directorial debut in the Paul Green Theatre. It was also a wonderful opportunity to collaborate with a stellar design team and feature five of our fantastic third-year Professional Actor Training Program actors, allowing them the challenge and opportunity to showcase their talents alongside our estimable guest actor, Oscar Best, in the role of the family’s patriarch.
I am so admiring of Kathy’s thoughtful work on this play, rich with the complexity of family dynamics, where so much of the drama—as is so often the case in life—lives in what is unsaid.
I am happy to shout from the rafters, however, that this is the first of three plays this season written by superb female playwrights. Lydia is joined later in the season by Dipika Guha and her fittingly brilliant “Yoga Play” and Tracy Young with a riveting adaptation of Madeleine L’Engle’s “A Wrinkle in Time”. Three powerhouse playwrights (in the hands of three equally fabulous female directors!) offering richly diverse storytelling for our PlayMakers audiences. I hope you’ll join us for all of them.
Here’s to a year ahead of health, clarity and fantastic theatre!
Warmly,
Vivienne
Jump to: Letter from Viv | Support PlayMakers | Who We Are | Title Page | Program Notes | About Lydia R. Diamond | Actor Bios | Creative Team Bios | General Information | PlayMakers Staff | Friends of PlayMakers | Corporate and Foundation Partners
It is my pleasure to serve another year as the chair of the PlayMakers Advisory Council and welcome you back to the Paul Green Theatre stage for our 2021-22 season.
Our five-show season was born out of the need to celebrate the healing power of human connection after a year that challenged us all. We believe that the theatre will have an important role to play in making sense of the complex world in which we find ourselves in. When I walk out of PlayMakers after a show, I always say how lucky we are to have a theater with such world-class performances right here in Chapel Hill. This season, I am grateful for the opportunity to experience PlayMakers’ signature variety of shows, live and in person once again!
In addition to an impressive lineup of powerful performances, PlayMakers continues its work serving the Triangle community and beyond. We are privileged to provide unique learning opportunities for K–12 classrooms and UNC students, creating new ways to engage with our local artists and advocates, and make the power and joy of theatre accessible to underserved communities.
Theatre is and always will be a place for community. And it is up to us—the community—to ensure that PlayMakers continues to thrive. Gifts from patrons like you will be critical to our success as we navigate reopening after more than a year away from producing live theatre with in-person audiences. If you enjoy and believe in the power of the theatre as I do, I invite you to become a Friend of PlayMakers. Please make a tax-deductible contribution to the annual fund, pledge a monthly donation as a Sustainer, or offer a campaign gift to strengthen and sustain PlayMakers’ vision for the future.
I truly believe that there has never been a more important time to support the arts. Join me in championing our local theatre—an organization that makes a difference in our community. As Joan Gillings often said, “You will sit a little taller in your theatre seat, knowing you made a difference, too.”
Thank you!
Warmly,
Amy Guskiewicz
Donate
PlayMakers Advisory Council
Amy Guskiewicz, Chair
Betsy Blackwell, Vice Chair
Duncan Lascelles, Vice Chair
Joanne Garrett
Deborah Gerhardt
Bobbi Hapgood
Janelle Hoskins
Betty Kenan, emeritus
Stuart Lascelles
Robert Long, emeritus
Graig Meyer
Julie Morris
Florence Peacock
Diane Robertson
Wyndham Robertson
Carol Smithwick
Jackie Tanner
Mike Wiley
In Memoriam
We Remember Joan Gillings
PlayMakers Repertory Company and the Department of Dramatic Art mourn the extraordinary loss of our dear friend, Joan H. Gillings, who passed away in February surrounded by family at her home in Wrightsville Beach, NC.
Joan was a lover of the arts and her dedication and support of our work was unparalleled. As a member of the PlayMakers Advisory Council for over 10 years, and its chair for 7, she worked closely with our staff on a multitude of projects including serving as chair for our annual PlayMakers Ball for many years, participating in our Producing Artistic Director search in 2015, and building lasting relationships with our students and faculty. Her transformational gift in 2017 has allowed us to expand opportunities for our students, support dynamic new work on our stages, and enhance performance and outreach offerings in our community. For Joan, her philanthropy and enthusiasm always came back to one thing – “the kids,” as she liked to call them – and her love for UNC can be felt and seen all over our campus. She brought an unmistakable joy and enthusiasm every time she entered our building and we aspire to carry that spirit forward in everything we do.
We are forever grateful to have known Joan and are honored to carry on her transformational legacy through our work in the building that bears her name. She will be sorely missed.
Jump to: Letter from Viv | Support PlayMakers | Who We Are | Title Page | Program Notes | About Lydia R. Diamond | Actor Bios | Creative Team Bios | General Information | PlayMakers Staff | Friends of PlayMakers | Corporate and Foundation Partners
PlayMakers is…
“One of America’s Best Regional Theatres” (American Theatre Magazine), PlayMakers Repertory Company is North Carolina’s premier professional theatre company, proudly in residence on the dynamic campus of the University of North Carolina-Chapel Hill. The professional company was founded in 1976, growing out of a storied 100 year tradition of playmaking at Carolina. Our mission is to produce relevant, courageous work that tells stories from and for a multiplicity of perspectives. We believe that theatre can have a transformational impact on individuals and entire communities, and we are committed to the work of becoming an anti-racist organization whose work is accessible to all.
At the very heart of the PlayMakers experience is one of the nation’s last remaining resident theatre companies, made up of accomplished performers, directors, designers, artisans, and technicians, and supported by exceptional graduate students in UNC’s Department of Dramatic Art. Our company works side by side with guest artists from all over the world and our alumni include Pulitzer Prize, Tony®, Emmy®, and Grammy Award® winners.
Creating Tomorrow’s Classics, Today
Producing Artistic Director Vivienne Benesch is continuing PlayMakers’ tradition of producing vibrantly reimagined classics, large-scale musical theatre, and significant contemporary work, but is also broadening the company’s reach to become a home for new play development and a true hub of social and civic discourse in the region. Her first five seasons have already given life to ten important new American plays.
A Hub of Engagement
PlayMakers seeks to provoke thought, stimulate discussion and push the boundaries of the theatrical form in everything we do. Whether through our intimate @Play series, our mainstage offerings or our virtual line-up, we look for opportunities for direct, dynamic engagement between audiences, artists and thinkers. The Vision Series, post-show discussions and a host of unique engagement opportunities – including the continuation of last season’s online PlayMakers Keeping You Company – enrich our audience’s experience of the live arts.
Theatre for the People
PlayMakers Mobile is an initiative that seeks to contribute positively to the civic and social life of our region by taking world-class theatre out of our building and into the community. We create a streamlined production of a play each year and take it to schools, transitional housing facilities, and long-term treatment facilities around the Greater Triangle area. And best of all, it’s all free of charge. We look forward to getting back on the road as soon as we can do so safely.
Passing the Torch
PlayMakers’ award-winning Summer Youth Conservatory is the only professionally supported training program of its kind in the region. The Theatre Quest program provides camps to area middle school students, while the Theatre Intensive and TheatreTech programs allow Triangle high schoolers to apprentice directly with professional directors, choreographers, musical directors, and technicians, culminating in a professional quality production on the PlayMakers mainstage for the whole community to enjoy.
Eliminating Barriers
With a commitment to eliminating barriers for attendance when we host live events, PlayMakers offers All Access performances for our patrons living with disabilities, we offer accessible $20 tickets for all performances, and tickets reduced to just $10 for UNC students and $12 for all other students. Our Spotlight on Service program also offers complimentary tickets to local service organizations. This season, we are proud to offer complimentary tickets to front-line workers in honor of their ongoing service to the community. For more information, please contact prcboxoffice@unc.edu.
Our Mission
As the premiere professional theatre company of North Carolina, PlayMakers Repertory Company strives to produce entertaining, relevant, and courageous work that tells stories from and for a multiplicity of perspectives and creates transformational impact in our immediate and extended communities.
Our Vision
Provoke
Represent
Create
Our Values
Artistic excellence and artistry
Education and training
Community engagement
Access and equity
Financial health
Discovery and innovation
Collaboration and communication
Culture of support
Antiracism Accountability Statement
At the heart of PlayMakers Repertory Company’s mission is the belief that theater has the power to transform individuals and entire communities. There is no more aspirational or urgent a use of that power than working to dismantle the systems of oppression, white supremacy, and racism that pervade American life and consume the American Theatre. PlayMakers continues to assess and evaluate our own practices in order to embed equitable, antiracist policies into strategic planning, our mission, and our operations.
PlayMakers Repertory Company, and those of us who work here, commit to the following:
To work intentionally to create an antiracist culture in our company.
To continually educate ourselves on the ways in which we can combat racism locally and nationally as we move to create an inclusive, diverse, and equitable sense of belonging for every one of our constituents.
To demonstrate our values through action in our policies, practices, and procedures.
We are grateful to Black, Indigenous and People of Color artists and administrators within our local community as well as the larger theatrical community across the country for the resources they’ve expended, both in time and emotional labor. Their work lays an important foundation for us by articulating some of the harmful practices that must change immediately as well as identifying pathways for the long-term evolution that must follow. In that light, this document is the beginning of a response to the demands for change made by the anti-racist organization #WeSeeYouWhiteAmericanTheater.
As a professional theatre company embedded in, and inextricably linked to the Department of Dramatic Art (DDA) at the University of North Carolina–Chapel Hill, the path forward will be complex and singular. We will therefore be updating our action items and commitments continuously as our work evolves.
We at PlayMakers understand our responsibility not only to the artists, staff, and audiences with which we engage, but significantly, to the many students training here for a career in the theater.
For more information on our next steps, please read our full statement here.
These are not our first steps, and by no means our last. They are not perfect. And they are not enough. But they are steps forward. We invite you to come back to our website and our theater often and monitor our progress. We take our responsibility to this effort seriously and we welcome your involvement and assessment.
Land Acknowledgement
We acknowledge that the Center for Dramatic Art is located on the unceded lands of one or more of Abiayala’s (the Americas’) original sovereign nations, the name(s) of which have not yet been affirmed. The unjust acquisition of these Indigenous lands came about through a history of racism, violence, dispossession, displacement, and erasure of cultures by settlers as part of the larger, land-centered project of settler colonialism.
As we look to the future, please join us in acknowledging and learning about the atrocities committed against these Nations and work with us towards inclusion, representation, and a better relationship with citizens of sovereign American Indian and Alaska Native nations.
Why is Land Acknowledgement important?
This statement is part of the continual interrogation of our own participation and complacency in colonial structures and a call for greater awareness, accountability, and intentionality in the work we do. As storytellers we are committed to learning and telling stories in ways that will have transformational impact in our immediate and extended communities.
We are excited by future partnerships with Native Americans and look forward to sharing this journey of knowledge and growth with you.
Learn more: UNC American Indian Center
Jump to: Letter from Viv | Support PlayMakers | Who We Are | Title Page | Program Notes | About Lydia R. Diamond | Actor Bios | Creative Team Bios | General Information | PlayMakers Staff | Friends of PlayMakers | Corporate and Foundation Partners
Stick Fly
by Lydia R. Diamond
Directed by Kathryn Hunter-Williams
Scenic Designer
Anita Tripathi
Costume Designer
Pamela Bond
Lighting Designer
Latrice Lovett
Sound Designer
Michael Anthony Betts, II
Dramaturg
Jacqueline E. Lawton
Vocal Coach
Tia James
Stage Manager
Elizabeth Ray*
Assistant Stage Manager
Charles K. Bayang*
JAN 28-FEB 6, 2022
STICK FLY was developed in part at Chicago Dramatists, originally produced by Congo Square Theatreand subsequently produced by McCarter Theatre Center. A further developmental production, directed by Kenny Leon, was produced jointly by Arena Stage and the Huntington Theatre Company.
*Indicates members of Actors’ Equity Association, the Union of Professional Actors and Stage Managers in the United States.
PlayMakers is the Professional Theatre of the Department of Dramatic Art
Adam Versényi, Chair
Vivienne Benesch, Producing Artistic Director
Nichole Gantshar, Managing Director
Produced in association with The College of Arts & Sciences
The University of North Carolina at Chapel Hill
Jump to: Letter from Viv | Support PlayMakers | Who We Are | Title Page | Program Notes | About Lydia R. Diamond | Actor Bios | Creative Team Bios | General Information | PlayMakers Staff | Friends of PlayMakers | Corporate and Foundation Partners
by Jacqueline E. Lawton
Lydia Diamond is a brilliant and talented playwright. Her characters are bold, passionate, intelligent, and flawed. The worlds she creates are rich, complex, and engaging. Her dialogue is pointed and intelligent. She also has a sharp mind for comedy. Her plays include The Bluest Eye, The Gift Horse, Harriet Jacobs, The Inside, Smart People, Stage Black, and Voyeurs de Venus. She has received numerous awards including the African American Arts Alliance of Chicago Black Excellence Award, an Independent Reviewers of New England (IRNE) Award, an LA Weekly Theater Award, and a Los Angeles Drama Critics Circle Award.
Diamond studied theatre at Northwestern University and discovered playwriting in her junior year. In an interview with Broadway Direct, she explained that through playwriting she found “an artistic outlet that was not predicated upon fitting myself into plays without characters who looked like me.” She found a sense of purpose and autonomy in writing plays. She goes on to say, “I could tell my own stories, populated with people who looked like me or the diverse array of people in my life.” The people in her plays are well-drawn, deeply human, and recognizable. Stick Fly is a perfect example of how Diamond writes characters we know or could know to help audiences better understand ourselves.
Stick Fly is set in 2005 on Martha’s Vineyard. In the play, we meet the wealthy and successful LeVay family at their summer house. This is a special family weekend because the LeVay sons have invited the women in their lives home to meet the family. Diamond was inspired to write Stick Fly because she wanted to write a comedic, well-made play that explored the themes of family, legacy, and generational conflict. She was particularly interested the dynamics of fatherhood. In an interview with Writers Theatre, Diamond explains:
“I knew I wanted to explore fatherhood and what that meant—absent and present fathers, and how present fathers can maybe be absent and all of that—but I wanted it to be like a comedy.”
Diamond also wanted to explore class and the Black experience. She was interested in the way that race informs wealth and power, and the impact of racism within the Black community by writing about a wealthy Black family, she overturns stereotypes, societal expectations, and sheds lights on part of Black history that many people do not know. In that same interview, Diamond shares:
“I wanted to put in this house three classes of people and how that played out over the course of a weekend. I knew that I wanted them to be people who had been financially privileged for generations, so I knew it was either going to be Hilton Head or Martha’s Vineyard: two of the places in America where Black people have gone for a long time. But Martha’s Vineyard had an even richer history. I didn’t go to Martha’s Vineyard until shortly before the play had its Broadway premiere, and it was fascinating because it was the first time I’d been in a place where Black people could vacation and not be questioned. There’s a freedom there that was new for me.”
Through Stick Fly, we can see the power of Diamond’s skill as a storyteller. She weaves the themes of the plays into the characters and their relationships with each other. In the play, we meet Kent, the youngest son, who hasn’t quite figured out his path in life, but still hopes to impress his demanding, prominent, and well-respected father, Joe. Kent’s fiancée is Taylor, an intelligent and ambitious entomologist, who grew up middle class and feels out of place in wealth and prestige. Then there is Flip, the eldest son, who is a successful plastic surgeon and quite the charmer. He’s quite the package and has had all the advantages that wealth can afford, but he also has some growing up to do. Flip’s girlfriend, Kimber is a wealthy white woman, whose poise and confidence set her at ease in this world. On the other side of the financial spectrum is Cheryl, the daughter of the family maid, but her long-time association with the family gives her a sense of comfort that Taylor craves.
Diamond has set the stage for a dramatic and dynamic weekend, and she does not disappoint. As the weekend progresses, the LeVay family secrets are revealed and the ties that bind are stretched to the seams. Like many families, the LeVays must learn how to come together, how to heal, and how to move forward. And as with most family gatherings, they find it’s best to keep the mojitos flowing!
Jump to: Letter from Viv | Support PlayMakers | Who We Are | Title Page | Program Notes | About Lydia R. Diamond | Actor Bios | Creative Team Bios | General Information | PlayMakers Staff | Friends of PlayMakers | Corporate and Foundation Partners
Lydia R. Diamond
Playwright
Award winning Plays include: “Smart People”, “Stick Fly”, “Voyeurs de Venus”, “The Bluest Eye”, “The Gift Horse”, “Harriet Jacobs”, “The Inside”, and “Stage Black”. Theatres include: Arena Stage, Cort Theatre (Broadway), Chicago Dramatists, Company One, Congo Square, Goodman Theatre, Hartford Stage, Huntington Theatre Company, Jubilee Theatre, Kansas City Repertory, Long Wharf, Lorraine Hansberry, McCarter, Theatre Mo’Olelo Performing Arts Co., MPAACT, New Vic Theatre, Playmakers Repertory, Plowshares Theatre Company, Second Stage Theatre, Steppenwolf Theatre Company and TrueColors. Commissions include: Arena Stage, Steppenwolf (4), McCarter, Huntington, Center Stage, Victory Gardens and The Roundabout Theatre Company. A recipient of many playwriting awards, Lydia was also an 2005/06 W.E.B. Du Bois Institute non-resident Fellow, a 2007 TCG/NEA Playwright in Residence at Steppenwolf Theatre, a 2006/07 Huntington Playwright Fellow, a 2012 Sundance Institute Playwright Lab Creative Advisor, is a Board Member with Chicago Dramatists and a 2012/13 Radcliffe Institute Fellow. Lydia is a graduate of Northwestern University (Class of 1991), has an Honorary Doctorate of Arts from Pine Manor College and was 2013/14 Playwright in Residence at Arena Stage. Lydia is on faculty at the University of Illinois at Chicago where she teaches playwriting. Jump to: Letter from Viv | Support PlayMakers | Who We Are | Title Page | Program Notes | About Lydia R. Diamond | Actor Bios | Creative Team Bios | General Information | PlayMakers Staff | Friends of PlayMakers | Corporate and Foundation Partners
Cast List
in alphabetical order
“Spoon” Kent LeVay — Anthony August*
Joe LeVay — Oscar Best*
Kimber — Tori Jewell
“Flip” Harold LeVay — Khalil LeSaldo*
“Flip” Harold Le Vay (Understudy: January 27-29)— Jamar Jones
Taylor — AhDream Smith*
Cheryl — Omolade Wey*
*Indicates members of Actors’ Equity Association, the Union of Professional Actors and Stage Managers in the United States.
Anthony August
“Spoon” Kent LeVay
PlayMakers: Company member in third year of UNC’s Professional Actor Training Program. “The Skin of Our Teeth”, “The Storyteller”, “Everybody”, “Ragtime”. “Wilder & Wilder” (PlayMakers Mobile).
Regional: “The Hunchback of Seville” (Mildred’s Umbrella), “Ma Rainey’s Black Bottom” (The Ensemble Theater), “Fade To Black Festival”, “This is Modern Art” (The Landing Theatre Company), “Macbeth” (Encore Theatre).
University: “When the Ancestors Call”, “Dutchman”, “A Raisin in the Sun”, “Last Days of Judas Iscariot”, “The Mountaintop” (Texas Southern University).
Education: Texas Southern University, B.A. in Theatre.
: @kingslick
Oscar Best
Joe LeVay
PlayMakers: Debut.
Regional: “Henry V” (The Pacific Residence Theatre), “ART”, “Victor Victoria”, “Wild Party” (Malibu Stage Company).
Film/TV: His television credits include “NCIS L.A.”, “Grey’s Anatomy”, and “Murder 101” with Dick Van Dyke. His film credits include “Underneath the Silver Lake” (Dir. David Robert Mitchell), “The Magnificent Room” (Dir. Cynthia Mort), and “The Last Face” (Dir. Sean Penn).
Education/Awards: The Actor’s Studio, Dance Theatre of Harlem. Oscar received the NAACP Best Actor in LA award for his role in “Bloodknot” (Dir. Lou Gossett Jr.)
Tori Jewell
Kimber
PlayMakers: “The Skin of Our Teeth”, “Julius Caesar”, “Ragtime”. Company member in third year of UNC’s Professional Actor Training Program. “Wilder & Wilder” (PlayMakers Mobile); “Stop Kiss”. “References to Salvador Dalí Make Me Hot” (PlayMakers Ground Floor).
Regional: “Into the Breeches” (Theatre Raleigh).
University: Her favorite shows throughout her undergraduate experience were “A View From The Bridge” (Company Carolina) and “Hedda Gabler” (Kenan Theatre Company).
Other: “College Witch” (YouTube), “To the Girl I Never Kissed” (YouTube)
Education: B.A. in Anthropology, UNC-Chapel Hill, 2019.
Jamar Jones
Understudy: “Flip” Harold LeVay
PlayMakers: “The Skin of Our Teeth”. Company member in first year of UNC’s Professional Actor Training Program
Regional: Fires in the Mirror, Passing Strange (Firehouse Theatre); Fences, Akeelah and the Bee (Virginia Repertory Theatre); Red Velvet (Quill Theatre); An Octoroon, Topdog/Underdog (The Conciliation Lab); Free Man of Color (The Heritage Ensemble Theatre Company); Choir Boy (Richmond Triangle Players/THETC); and Equus (Cadence Theatre Company).
University Guest Artist: Pure Confidence, Blues for Mister Charlie, The Story (University of Richmond).
Education/Awards: The College of William and Mary, B.A. Sociology and Theatre. 2019 Richmond Theatre Critics Circle Award, Best Actor in a Leading Role- Play for An Octoroon; 2020 RTCC Award, Ernie McClintock Best Ensemble Acting for Passing Strange.
Khalil LeSaldo
“Flip” Harold LeVay
PlayMakers: Company member in third year of UNC’s Professional Actor Training Program. “The Skin of Our Teeth”, “Julius Caesar”, “Dairyland”. “Mud”, “References to Salvador Dalí Make Me Hot” (PlayMakers Ground Floor).
New York: “Sing”, “Care Full”, “Game Night”.
Regional: “We Can Eat Love”, “As You Like It”, “Julius Caesar” (Portland Stage); “Romeo and Juliet”, “Julius Caesar”, “Romeo and Juliet” (Tenessee Shakespeare Company); “A Manor of Speaking”, “Deep as Hell”, “Hell and Other Adventures”, “Deep as Hell 2: Wide as Hell” (2Sheets Theater Company); “Bug” (60 Grit Theatre); “The Last Days of Judas Iscariot” (Mad Horse Theater Company); “Princess Kaguya” (Theater at Monmouth); “To Kill a Mockingbird” (The Theater Project); “Hellcab”, “After” (Profiles Theatre); “Wait Until Dark” (Jedlicka Performing Arts); “Switch Tryptych” (Big Picture Group).
Film / TV: “Defending Jacob” with Chris Evans, “Chicago P.D.”.
Education/Awards/Other: Bachelor’s Degree in Psychology, Bowdoin College; Alice Merrill Mitchel Prize (2011); The Telling Room Story Slam Champion, Devising and Physical Theater (Celebration Barn).
AhDream Smith
Taylor
PlayMakers: “The Skin of Our Teeth”, “Julius Caesar”. Company member in third year of UNC’s Professional Actor Training Program. “Wilder & Wilder” (PlayMakers Mobile); “References to Salvador Dalí Make Me Hot” (PlayMakers Ground Floor).
New York: “The Talking Cure” (Hudson Guild Theatre); “Sistas on Fire” (The Duke On 42nd Street); “The Trojan Women”, “The Caucasian Chalk Circle”, “The Exception And The Rule” (Shapiro Theatre).
Television: “Silent Killer”, “The Honeymoon Killers”, “Death and The Maiden” (Investigation Discovery).
Education/Awards/Other: Wesleyan University (B.A), William Esper, Stella Adler, Upright Citizens Brigade, Broadway Dance Center.
Omolade Wey
Cheryl
PlayMakers: “The Skin of Our Teeth”, “The Storyteller”, “Julius Caesar”, “Everybody”. Company member in third year of UNC’s Professional Actor Training Program. “Wilder & Wilder” (PlayMakers Mobile); “No Child”, “Stop Kiss”, “References to Salvador Dalí Make Me Hot” (PlayMakers Ground Floor).
University: “God & Country”, “By the Way”, “Meet Vera Stark”, “Insurrection: Holding History”.
Education/Awards: Winner of the Director’s Company Next Wave Initiative Hattie McDaniel Acting Scholarship. BSFS in Culture & Politics from Georgetown University’s Walsh School of Foreign Service.
Jump to: Letter from Viv | Support PlayMakers | Who We Are | Title Page | Program Notes | About Lydia R. Diamond | Actor Bios | Creative Team Bios | General Information | PlayMakers Staff | Friends of PlayMakers | Corporate and Foundation Partners
Kathryn Hunter Williams
Director
PlayMakers: Company member for 21 seasons. Recent highlights include directing “No Fear & Blues Long Gone”, “Count”, plus acting in “The Skin of Our Teeth”, “Edges of Time”, “Julius Caesar”, “Everybody”, “Life of Galileo”, “Skeleton Crew”, “Leaving Eden”, “Tartuffe”, “Dot”, “Intimate Apparel”, “The Crucible”, “Trouble in Mind”, “A Midsummer Night’s Dream”, “The Tempest”, “Love Alone”, “A Raisin in the Sun”, “Imaginary Invalid”, “Henry IV & V”, “The Parchman Hour”, “Angels in America”, “Fences”, “Doubt”, “Yellowman”, among others.
New York/Regional: Living Stage, The Negro Ensemble Company, Manhattan Class Company, New Dramatists, Archipelago Theater.
Education/Other: BFA, UNC School of the Arts; MFA, UNC-Chapel Hill. Kathryn is on the faculty of the Department of Dramatic Art at UNC-Chapel Hill, Company Artistic Associate for PlayMakers Rep and Associate Director of HiddenVoices, a non-profit organization dedicated to bringing life changing stories into a public forum.
Anita Tripathi
Scenic Designer
PlayMakers: Bright Star.
Broadway: Associate designer for David Gallo on several productions
Regional: Previous Resident Designer at Virginia Stage Company, credits include “Of Mice and Men”, “Private Lives”, “A Christmas Carol” and others; “To Kill a Mockingbird” (Shakespeare Theatre of New Jersey) Currently design frequently for Children’s Theatre of Charlotte, including the world premiere of Steven Dietz’s new play, “The Ghost of Splinter Cover”.
Education/Awards/Other: Assistant Professor of Design and Technology at Davidson College; MFA from University of South Carolina. Member USA Local 829. anitajtripathi.com
Pamela Bond
Costume Designer
PlayMakers: Debut.
Regional: “House of George” (NCCU University Theatre), “Dreamgirls”, “WHITE”, “Black Nativity” (Justice Theatre Project). She also performed in “Dance on Widows Row” (Agape Theatre)
Education/Other: B.A. in Theatre, a B.S. in Textiles & Apparel and a M.A. in Textiles & Apparel from North Carolina Central University. Ms. Bond is a member of Alpha Psi Omega Honor Society, Gamma Xi Phi Art Society and Delta Sigma Theta Sorority, Incorporated. Pamela A. Bond is a native of Durham, North Carolina. Ms. Bond serves as Artistic Production Assistant for North Carolina Central University and Assistant Professor of Dramatic Art at the University of North Carolina at Chapel Hill.
: @pambond8 : @PamelaBondCostumeDesigns : @cups.andcocktails
Latrice Lovett
Lighting Designer
PlayMakers: As You Like It
Regional: “The Niceties”, “The Mountaintop” (Heritage Theatre Festival); “Gem of the Ocean”, “Savior Samuel” (Pittsburgh Playwrights Theatre Company); “5 Guys Named Moe” (Skylight Musical Theatre)
Education: MFA, University of Missouri Kansas City
: @lovettlightingllc
Michael Anthony Betts, II
Sound Designer
PlayMakers: Debut.
Durham-based sound designer whose work centers on Black & Brown bodies and their existence in white space. A 2011 UNC alumnus, Betts completed his MFA in Experimental and Documentary Arts at Duke University in 2020. Notably, Michael designed for playwright Howard Craft’s “The Miraculous and the Mundane”, Sonny Kelly’s one-man show, “The Talk”, and “Haunted”. Betts produced the audio version of Dr. LeRhonda S. Manigualt-Bryant New York Times op-ed, “My Mother Is Busy Getting Ready To Die.” Betts also assisted on her award winning film short death.everything.nothing. Current projects include: Mike Wiley Productions’ “Parallel Lives”, Tiffany Albright’s “Keepsake”; a collaboration with death row inmate Michael J. Braxton (@RromeAlone) on an album and audio memoir; and the Duke University’s Kenan Institute of Ethics’s “American Hallowed Ground Project”.
Jacqueline E. Lawton
Dramaturg
PlayMakers: Company member in her 7th season and professor in the Department of Dramatic Art at UNC-Chapel Hill.
Regional Dramaturgy: Actors Theatre of Louisville’s Humana Festival of New American Plays, Arden Theater, Arena Stage, Ensemble Studio Theater, Ford’s Theatre, Goodman Theatre, Horizons Theater, Interact Theatre, Kennedy Center VSA Program, Rorschach Theatre, Round House Theatre, the Stratford Festival, Theater J, Virginia Stage Company and Woolly Mammoth Theatre Company
Playwright: “Anna K”; “Among These Wild Things”; “Behold, a Negress”; “Blackbirds”; “Blood-bound and Tongue-tied”; “Deep Belly Beautiful”; “The Devil’s Sweet Water”; “Edges of Time”; “Freedom Hill”; “The Hampton Years”; “Intelligence”; “Love Brothers Serenade”; “Mad Breed”; “Noms de Guerre”; “So Goes We”; and the “Wonderful Wizard of Oz”.
Education/Affiliations: MFA in Playwriting, University of Texas at Austin; James A. Michener Fellow. TCG Young Leaders of Color, National New Play Network (NNPN), Arena Stage’s Playwrights’ Arena, Center Stage’s Playwrights’ Collective and the Dramatist Guild of America.
Tia James
Vocal Coach
PlayMakers: Company member for two seasons. Actor: “Julius Caesar”, “Native Son”. Vocal coaching includes “Ragtime”, “How I Learned to Drive”, “Life of Galileo”, “Bewilderness”, “She Loves Me”, “Skeleton Crew”, “Sherwood”, “Jump”, “Your Healing is Killing Me”. Director: “As You Like It”, PlayMakers Mobile “Macbeth”, and PlayMakers Ground Floor “Constellations”.
Broadway: “The Merchant of Venice”.
Off-Broadway / New York: “The Winter’s Tale”, “The Merchant of Venice” (Shakespeare in the Park).
Regional: “Richard III” (Allentown Shakespeare); “Loving and Loving” (Stella Adler Studios); “Much Ado About Nothing” (Two River Theatre); “Civilization (all you can eat)” (Woolly Mammoth Theater).
Television: “Nurse Jackie”, “Treme”.
Teaching / Coaching / Directing: UNC-Chapel Hill, NYU Graduate Acting, NYU Dance, Atlantic Acting School, Montclair University.
Education / Awards: MFA NYU Tisch Graduate Acting Program, BFA Virginia Commonwealth University; Teacher Training under Scott Miller and John Patrick. Recipient of the 2014 NYU Graduate Acting Diversity Mentorship Scholarship, 2003 Kennedy Center American College Theatre Festival, Irene Ryan Acting Scholarship winner for Best Actor; 2019 Michael Chekhov/Zelda Fichandler Scholarship.
Elizabeth Ray
Stage Manager
PlayMakers: Company member in her fifth full season. “Love, Loss, and What I Wore”, “The Storyteller”, “Everybody”, “Dairyland”, “No Fear & Blues Long Gone: Nina Simone”, “How I Learned to Drive”, “Jump”, “Skeleton Crew”, “Temples of Lung and Air”, “‘A’ Train”, “Tartuffe”, “Dot”, “The Cake”, “Into the Woods”, “A Midsummer Night’s Dream”, and “Private Lives”.
New York: “Shows for Days” (Lincoln Center Theater), “In the Secret Sea” (Theatre Row), “Wallenberg”, “Requiem for Mr. B”, “Presto Change-O” (Frankel Green Production Company), and “Welcome to Shoofly” (Playwrights Horizons).
Work at other regional theatres includes productions at North Carolina Theatre, Theatre Raleigh, Palm Beach Dramaworks, and Cape Fear Regional Theatre. Elizabeth is a member of Actors’ Equity Association.
Charles K. Bayang
Assistant Stage Manager
PlayMakers: Company member for 11 seasons. Work at other regional theatres includes productions at Studio Arena Theatre, Merrimack Repertory Theatre, Huntington Theatre Company, Alabama Shakespeare Festival, Dallas Theater Center and Dallas Children’s Theatre. Charles holds an MFA from the University of Alabama and has been a member for Actors’ Equity since 1997.
Vivienne Benesch
Producing Artistic Director
Vivienne is in her sixth full season as a company member and Producing Artistic Director at PlayMakers, where she has helmed productions of “The Skin of Our Teeth”, “The Storyteller”, “Dairyland”, “Life of Galileo”, “Leaving Eden”, “The May Queen”, “Three Sisters”, “Love Alone”, “RED”, and “In The Next Room”. In her six seasons with the theatre, she is particularly proud to have produced ten world-premieres and launched PlayMakers Mobile, a touring production aimed at reaching underserved audiences around the Triangle. For 12 seasons, she served as Artistic Director of the renowned Chautauqua Theater Company and Conservatory, presiding over the company’s transformation into one of the best summer theatres and most competitive summer training programs in the country. Vivienne has also directed for the Folger Shakespeare Theatre (Helen Hayes nomination for best direction 2019), The Shakespeare Theatre of New Jersey, Trinity Repertory Company, NY Stage & Film, and Red Bull Theatre, among others. In 2018, she directed the world premiere of Noah Haidle’s “Birthday Candles” for Detroit Public Theatre and will be directing it again on Broadway in 2022, starring Debra Messing. As an actress, Vivienne has worked on and off-Broadway, in film and television, at many of the country’s most celebrated theatres, and received an Obie Award for her performance in Lee Blessing’s “Going to St. Ives”. Vivienne is a graduate of Brown University and NYU’s Graduate Acting Program. As an educator, she has directed for and served on the faculty of some of the nation’s foremost actor training programs, including The Juilliard School, UNC-Chapel Hill’s Professional Actor Training Program, Brown/Trinity Rep MFA Program, and at her alma mater, NYU’s Graduate Acting Program. She is the 2017 recipient of the Zelda Fichandler Award given by the Stage Directors and Choreographers Foundation.
Nichole Gantshar
Managing Director
Nichole Gantshar is a former dramaturg turned arts administrator. Having spent the past two years in interim leadership with Louisville Ballet and Theatre Bay Area, she looks forward to becoming part of the Triangle community. She spent five years as Executive Director of Rochester City Ballet, where she tripled grant revenue, grew audiences by 30 percent, added free (philanthropy supported) sensory-friendly performances, and earned support from the National Endowment for the Arts and The Shubert Foundation. Apart from her career in the arts, Nichole worked as a Legislative Aide in Congress and as a journalist.
Regional: Hangar Theatre, Milwaukee Ballet, Pittsburgh Ballet Theatre, Playwrights Horizons, Richmond Ballet, Syracuse Stage, and Tulsa Ballet.
Volunteer: Rotary, treasurer, Literary Managers and Dramaturgs of the Americas (LMDA), Chair of the National Student Education Fund, treasurer, Syracuse Chapter of Girls Inc.
Awards: Nominee, Outstanding Young Woman of America, LMDA Residency Grant. Faculty: Syracuse University, University at Stony Brook, University of Pittsburgh and the Wooster Center for the Arts.
Education: MFA, University at Stony Brook.
Michael Rolleri
Production Manager
Michael is in his 35th season with PlayMakers Repertory Company. He has been Technical Director, Project Manager, Exhibition Technician, and Lighting Designer for industrial shows in the Southeast region, as well as lead carpenter for films, the U.S. Olympic Festival, and scenic studios. He has also been a rigger in the Southeast region and has served on the executive board and as President of IATSE Local 417. Michael is a 30 year Gold Pin member of IATSE. An active member of United States Institute For Theatre Technology (USITT), he is a three-time winner at USITT’s Tech Expo. He is a full Professor/Head of the Technical Production Program at UNC-Chapel Hill and was an instructor at High Point University and Tufts University.
Education: MFA in Design and Technical Production, UNC-Greensboro.
Jump to: Letter from Viv | Support PlayMakers | Who We Are | Title Page | Program Notes | Lydia R. Diamond | Actor Bios | Creative Team Bios | General Information | PlayMakers Staff | Friends of PlayMakers | Corporate and Foundation Partners
Stick Fly
by Lydia R. Diamond
Time: 2005
Place: Martha’s Vineyard
Act 1: Approximately 1 hour, 15 minutes
15-minute intermission
Act 2: Approximately 1 hour, 15 minutes
Please be aware this production uses simulated smoking
Joan H. Gillings Center for Dramatic Art
CB# 3235, UNC-Chapel Hill
Chapel Hill, NC 27599-3235
Box Office: 919.962.7529
Website: www.playmakersrep.org
What Will Shows Look Like This Year?
The 21/22 season will feature five live, in-person performances featuring works that explore the resilience of family bonds in all their complicated forms, friendships that transcend language, time, and space, and one man’s connection to his community that helps him stand taller than he could alone.
Health and Safety
PlayMakers Repertory Company is committed to the safety and well-being of our patrons, artists and staff. We will be following state, industry and University safety guidelines in the 21/22 season.
All patrons are required to wear face coverings at all times while inside the Joan H. Gillings Center for Dramatic Art.
We have increased sanitation measures throughout the building and put some new protocols in place to improve safety including:
Touch free electronic ticketing
Hand sanitizers throughout the Center for Dramatic Art
More frequent cleaning of high-touch surfaces
HEPA filtration units
With the exception of onstage performances, artists, crew and staff will be required to wear masks
What If I Have to Miss My Performance Date?
For the safety of all our artists, patrons, and staff, if you feel unwell, please stay home. You may call our Box Office and ask to be reseated for another performance, or request a refund up to 48 hour before your ticketed performance.
If you know you will miss a performance date, we can exchange your ticket for you, based on availability. Please call our Box Office at least 48 hours before your scheduled performance, and please be aware that all exchanges are based on availability and a fee or additional cost may apply. Subscribers may exchange their tickets with no additional fee, but additional cost may apply with a change in performance or section.
Box Office Hours
Mon, Weds, Fri 12:00 noon-5:00p.m. and 90 minutes prior to each performance.
Use of Cell Phones and Other Electronics
Texting and using cell phones, laptops, smart watches, and other devices light- or sound-emitting devices are strictly prohibited during the performance. Please turn all electronic devices to silent, theatre mode, or off during the show.
Cameras or Recording Devices
Taking photographs or videotaping inside the theatre is strictly prohibited during performances. However, before the show, during intermission, and after the show, you are invited to take and share your photos of the stage and scenery.
Parking
There are several paid and free parking options available near PlayMakers. We recommend arriving 30 minutes before the show so that you have time to park and pay (Monday-Thursday evenings only) and find your seat. For more information and an interactive map of nearby parking options, please visit www.playmakersrep.org/parking
Policy on Young Children
As a courtesy to our patrons, it is the policy of PlayMakers not to admit children under the age of 5. All of our shows have content ratings for each production (for example: Rated PG-13). If you are considering bringing your child, please refer to website or contact our Box Office for further information. All patrons, regardless of age, must have a ticket.
Headsets for Hearing Impaired Patrons
Our theatres are equipped with sound systems that amplify the sound from the stage. Patrons who wish to use the system may obtain headsets on a first-come, first-served basis from the coat check. Headsets must be returned immediately after the performance.
Late Seating and Leaving Your Seat During the Performance
To minimize disruptions to the actors and other patrons, late seating will be provided at the discretion of the house manager at an appropriate break in the action on stage. Patrons who need to be seated late must be escorted by house staff to seats at the rear entrance of the auditorium, which entails climbing a flight of stairs. Patrons can take their regular seat at intermission.
Jump to: Letter from Viv | Support PlayMakers | Who We Are | Title Page | Program Notes | About Lydia R. Diamond | Actor Bios | Creative Team Bios | General Information | PlayMakers Staff | Friends of PlayMakers | Corporate and Foundation Partners
Administration
Vivienne Benesch, Producing Artistic Director
Nichole Gantshar, Managing Director
Artistic
Tracy Bersley, Movement Coach/Choreographer
Kathryn Hunter-Williams, Company Artistic Associate
Chelsea James, Producing Assistant
Tia James, Vocal Coach
Gregory Kable, Dramaturg
Jacqueline E. Lawton, Dramaturg
Jeffrey Meanza, Associate Artistic Director
Mark Perry, Dramaturg
Gwendolyn Schwinke, Vocal Coach
Jeri Lynn Schulke, Engagement Associate
Adam Versényi, Dramaturg
Administration
Kate Jones, Business Operations Coordinator
Lisa Geeslin, Accountant
Marketing & Audience Services
Alex James, Audience Services Associate
Diana Pineda, Director of Sales & Marketing
Thomas Porter, Box Office Manager
Rosalie Preston, Associate Director of Marketing
Jessie Gleason, Undergraduate Marketing Assistant
Work Study Students
Artistic: Josh Wehab
Box Office/ Front of House: Aisha Bynum, Charity Cohen, Eli Dietrich, Chloe Jones, Olivia Mahon, Yaeelin Merino-Velasquez, Olivia Morse, Kaitlyn Rivera, Krystal Rivera, Alla Sirelkhatim, Naomi Smith, Lily Vance
Development: Mahika Kawale
Marketing: Belawal Ahmed
Department of Dramatic Art
Adam Versényi, Professor and Chair
FACULTY
Vivienne Benesch, Professor of the Practice
Tracy Bersley, Assistant Professor
Pamela Bond, Visiting Teaching Assistant Professor
Jan Chambers, Professor
McKay Coble, Professor
Jeffrey Blair Cornell, Associate Chair, Teaching Professor
Ray Dooley, Professor Emeritus
Samuel Ray Gates, Assistant Professor
Julia Gibson, Associate Professor
Jennifer Guadagno, Teaching Assistant Professor
Kathryn Hunter-Williams, Teaching Associate Professor
Tia James, Assistant Professor
Gregory Kable, Teaching Professor
Jacqueline E. Lawton, Associate Professor
Adam Maxfield, Teaching Associate Professor
Triffin Morris, Professor of the Practice
David Navalinsky, Associate Professor
Bobbi Owen, Distinguished Professor Emerita
Mark Perry, Teaching Associate Professor
Rachel E. Pollock, Teaching Assistant Professor
Michael Rolleri, Professor
Gwendolyn Schwinke, Assistant Professor
Aubrey Snowden, Teaching Assistant Professor
STAFF
Betty Futrell, Student Services Specialist
Lisa Geeslin, Accounting Technician
Jordan Clodfelter, KTC Technical Director
Karen Rolleri, Business Coordinator
Jamie Strickland, Business Officer
Production
Michael Rolleri, Production Manager
Costumes
Jennifer Bayang, Assistant Costume Director
Amy Evans, Wardrobe Supervisor
Marissa Lupkas, Costume Collection Coordinator
Triffin Morris, Costume Director
Rachel Pollock, Costume Craftsperson
Costume Production Graduate Students:
Matty Blatt, Jocelyn Chatman, Alex Hagman, Emma Hoylst, Lou Pires, Athene Wright, Sherry Wu
Lighting
Benjamin Bosch, Head Electrician
Props
Emma Anderson, Props Artisan
Andrea Bullock, Properties Master
Scenic
Noah George, Master Carpenter
Adam Maxfield, Technical Director
Laura Pates, Assistant Technical Director
Jessica Secrest, Scenic Artist
Technical Production Graduate Students:
Brock Burton, Gregory Condon, Paul Edghill, Patrick Hardison, Kevin Pendergast, Luke Robinson, Garrett Weeda
Spencer Ellis, Undergraduate Assistant-Scene Shop
Haley Connell, Undergraduate Assistant-Paint
Sound
Marisa Clemente, Sound Associate
Mac Cohen, Undergraduate Assistant
STAGE MANAGEMENT
Charles K. Bayang, Stage Manager
Elizabeth Ray, Stage Manager
Work Study Students
Carpentry: Tygia Drewhowell, Jeffrey Jones, Danielle Mou, Lillyann Nekervis
Lighting: Jessica Atkins, Anthony Burch, Jahel Gomes, Sananda Jagannathan, Annabelle Jiang, Alex Mitropoulos
Props: Charlotte Allsbrook, Hannah Fatool, Lydia McRoy, Marissa Romano
Scenic Painting: Madison Austin, Madeleine Collins, Corinne Laverge, Faith Wang
PlayMakers’ Resident Acting Company
Jeffrey Blair Cornell
Samuel Ray Gates
Julia Gibson
Kathryn Hunter-Williams
Tia James
Gwendolyn Schwinke
Professional Actor Training Program:
Sergio Mauritz Ang, Anthony August, Hayley Cartee, Heinley Gaspard, Tori Jewell, Jamar Jones, Khalil LeSaldo, Saleemah Sharpe, AhDream Smith, Sanjana Taskar, Adam Valentine, Omolade Wey
For this Production of Stick Fly
Lormarev Jones, Intimacy Choreographer
Jeff A. R. Jones, Fight Choreographer
Paul Edghill, Production Technical Director
Patrick Hardison, Assistant Technical Director
Luke Robinson, Shop Lead
Gerald “Fitz” Morrissey, Assistant to the Lighting Designer
Lou Pires, Assistant to the Costume Director
Jocelyn Chatman, Athene Wright, Drapers
Alex Hagman, Matty Blatt First Hands
Emma Holyst, Stitcher
Jump to: Letter from Viv | Support PlayMakers | Who We Are | Title Page | Program Notes | About Lydia R. Diamond | Actor Bios | Creative Team Bios | General Information | PlayMakers Staff | Friends of PlayMakers | Corporate and Foundation Partners
During this period of re-emergence, we are producing a smaller, “capsule” season of only five powerful shows. While this allows us to remain focused on the safety and well-being of our patrons, artists, and staff, it has substantial financial implications.
As a nonprofit professional theatre, ticket sales traditionally cover only half of our annual operating costs. This year, we cannot count on ticket revenue as we have in the past. We must rely on the generosity of our community to help close the gap and keep our stages alive.
Ways to Give
Online
Donate
Phone or Email
prc_development@unc.edu
919.962.2481
Mail
Send your check to:
PlayMakers Repertory Company Development Department
Joan H. Gillings Center for Dramatic Art
CB 3235
Chapel Hill, NC 27599-3235
You can help support and sustain all our work, both on stage and off, by making a tax-deductible gift which enables us to:
Bring innovative, entertaining, and relevant theatre to the Triangle
Serve students across the state through our award-winning educational programs
Engage with our audiences through artist and community conversations
Remain flexible, safe, and better prepared for the future
Every gift, big or small, makes a huge difference!
PlayMakers is grateful to the members of the Friends of PlayMakers for their generous support. For more information about how to join this dynamic group of supporters, call the PlayMakers Development Office at 919.962.2481 or visit us at playmakersrep.org.
Donate
Director’s Circle ($10,000+)
Anonymous
Lelia Blackwell and John Watson Jr.
Thomas and Holly Carr
G. Munroe Cobey
Fidelity Charitable Gift Fund
Joan H. Gillings ~
The Charles Goren and Hazen Family Foundation, Trustees Tom and Lisa Hazen
Brian Hargrove and David Hyde Pierce
Mrs. Frank H. Kenan
Coleman and Carol Ross
Schwab Charitable
Shubert Foundation
Vanguard Charitable Endowment Program
Alan H. Weinhouse
Angel ($5,000–9,999)
Anonymous
American Endowment Foundation
Andrew and Katherine Asaro ^ +
Betsy Blackwell and John Watson
T. Chandler and Monie Hardwick
Munroe and Becky Cobey
Robert and Mary Ann Eubanks
Drucie French and Steve Cumbie
Joanne and Peter Garrett
Chan and Monie Hardwick
Kim Kwok
Mr. and Mrs. William O. McCoy
Paul and Linda Naylor
Bobbi Owen
Amy and Nick Penwarden
The Prentice Foundation
Paul McNeill Sconyers
The Educational Foundation of America
Theatre Projects
Jim and Bonnie Yankaskas
Investor ($2,500–4,999)
Anonymous
Richard and Deirdre Arnold ^
Andrew and Katherine Asaro ^ +
Ed and Eleanor Burke
Cindy and Thomas Cook
Joanne and Peter Garrett
Dr. Lyle V. Jones
Sandy and Ned McClurg ^
Mark and Julie Morris
Nick and Amy Penwarden
Jean and Joseph Ritok
Dr. and Mrs. Edward Smithwick
David and Heather Yeowell
Page to Stage ($1,500–2,499)
David and Judy Adamson
Ayco Charitable Foundation
Steve Benezra ^
Edmund S. Burke
Capital Group Company Charitable Foundation Matching Gifts
Jeffrey Blair Cornell and Maria Savage
Julie R. Daniels
Imre and Aniko Gaal
Dustin and Susan Gillings Gross
Susan G. Gross
Kevin and Amy Guskiewicz
David Howell
IBM Corporation Matching Gifts
Jacobs Preyer Family Foundation
Hannelore and Konrad Jarausch
Hannelore L. Jarausch
Joanna Karwowska and Hugon Karwowski ^
Howard and Sandra Kaufman
Kathryn and Robert Kyle
Lauren Rivers
Ned S. Sandra Lee McClurg
Morgan Stanley Global Impact Funding Trust, Inc.
Panter Foundation
Rich and Marilyn Jacobs Preyer
Perry Branin Silver
Dr. and Mrs. William Stewart
The Rev. Wendy R. and Mr. W. Riley Waugh
Roger and Marlene Werner
YourCause, LLC Trustee for IBM Matching Gifts
Partner ($1,000–1,499)
Penny and Howard Aldrich
Laurence Arthur Cobb
Dede Corvinus
Jo Anne and Shelley Earp
Constance and Robert Eby
Dr. and Mrs. John P. Evans
John P. Evans
John and Diane Formy-Duval
W. Patrick Gale
Joseph and Deirdre Haj
Clay and Jane Harrell
Carol Hazard and Winston Liao
Vikram Rao and Susan Henning
Ann E. Holloman
Lynn Knauff
Jack Knight and Margaret Brown ^
Gary and Carolyn Koch
Dr. Catherine Kuhn and Glenn Tortorici
Catherine M. Kuhn
Shirley and Tom Kunkel
Douglas and Nelda Lay
Anand and Sandhya Lagoo
Scott Levitan and Patrick Francisco
Mort and Cheryl Malkin
David and Harriet Martin
Connie and Vernon Matzen
Holly and Ross McKinney
James and Susan Moeser
Paul and Sherrie Norton
Lee and Barbara Pedersen
Isaac and Sabrina Presnell-Rockoff
Alec Rhodes
Rif Riddick
Rufus M. Riddick
Carole Lynne Shelby
Carole Shelby
David Sontag *
The Shelby Family Foundation
Sarah West and Thomas Dominick
Jesse L. White, Jr.
Paul and Sally Wright
Backer ($500–999)
Anonymous (3)
Anonymous friends of Ben Kahn,
In memory of Charles Kahn
Akin Akinli
Virginia M. Aldige
Howard and Penny Aldrich
Pete and Hannah Andrews
Evelyn Barrow
John W. Becton and Nancy B. Tannenbaum
Shula and Steve Bernard
Dr. Stanley Warren Black, III
Stanley W. Black
Julia A. Borbely-Brown
Mr. and Mrs. Jackson Breaks
Mr. Jackson Davis Breaks II and Mrs. Carolyn Snyder Breaks
Maurice and Mary Hughes Brookhart
Jennifer and Robert Buckmire
Keith Burridge and Patricia Saling
Ann and John Campbell
Philip and Linda Carl
Clara Cazzulino
Laurence A. Cobb
Adrienne and John Cox*
Brooks de Wetter-Smith and Mary Lou Leiser Smith
David A. Doll
Mr. Alexander M. Donaldson and Ms. Georgia Cobb Donaldson
Dr. Carrie Donley
Mr. W. Patrick Gale and Dr. Carrie Lynn Donley
Bob and Connie Eby
Eli Lilly & Company Foundation Matching Gifts Program
Thorsten Fjellstedt
Mr. Stephen Mark Cumbie and Dr. Druscilla French
Shayne C. Gad
Bill Cobb and Gail Perry
W. Patrick Gale ^
Nichole Gantshar
Mike and Bonnie Gilliom
Ugo Goetzl
James P. Gogan
Priscilla Alden Guild
Carolyn and Jim Harris
C. Hawkins ^
Dr. M. Vikram Rao and Dr. Susan June Henning
Ann Holloman
Betty Block James
Julie and Robert Keely*
Brenda W. Kirby
Michael Maness and Lois Knauff
Laura Koshel and Rafael de Jesus
Leonard T. Kreisman and Ruth Kreisman
Randy and Cathy Lambe
Mr. Douglas M. Lay and Mrs. Nelda Kilcrease Lay
Douglas Maclean and Susan Wolf
Elaine Mangrum
Janet McCarthy*
Ed and Connie McCraw
Cecilia D. Moore^
Mary Nunn Morrow
Jill Muti
Nelda K. Lay Revocable Trust
Stephen Nelson
Linda Williams Norris
George D. Norton
Liz and Dave Nuechterlein
Lois Oliver
Jo Ann and Gordon Pitz
Mark and Eugenea Pollock
Robert and Joyce Anne Porter
Jodi and Glenn Preminger
David and Lisa Price
Elizabeth Raft
Rao Family Foundation
Dr. Terry Rhodes
Victor and Linda Roggli
Jan F. and Anne P. Sassaman
Stephanie Ann Schmitt and Kevin Zachary Kinlaw
Martha Scotford*
Kyle and Jenn Smith
Jackie Tanner*
The Marconi Hoban Tell Fund of
Triangle Community Foundation
Glen H. and Sandy T. Elder
Ernest T. Wilkes
Alan Young
Supporter ($250–499)
Akin Akinli^
Virginia M. Aldige
Dr. Richard N.L. Andrews and Dr. Hannah Wheeler Andrews
David Ball and Susan Pochapsky
Bank of America Charitable Gift Fund
Tony and Susan Barrella
Deborah Barrett
Evelyn Barrow
Reginald M. Barton, Jr.
Adam Beck^
Mr. John William Becton and Ms. Nancy Baach Tannenbaum
Dr. Stephen A. Bernard and Dr. Shulamit Landau Bernard
Dr. Katherine L. Bick
Sarah and Francis Binkowski
Stanley W. Black
Julie Blatt and Arthur Greenberg
William and Patricia Blau
Dr. Caryl Jane Schwartzbach and Mr. Alan David Bolzan
Andrew Borba*
Julia Borbely-Brown^
Mr. Jackson Davis Breaks II and Mrs. Carolyn Snyder Breaks
Dr. Mary Hughes Brookhart and Dr. Maurice S. Brookhart
Ken and Margie Broun
Linda and David Brown
Robert and Jen Buckmire
David Burr and Rusty Unger
Douglas Call and Susan Warwick
Ms. Ann Long Campbell and Mr. John Joseph Campbell
Carlson Family Foundation Matching Gifts
Clara Cazzulino
Lata Chatterjee and Tiruvarur Lakshmanan
Dennis Clements and Martha Ann Keels
Gary and Dianne Clinton
Anne F. Coenen
Britta Couris*
Dr. Adrienne D. Cox and Mr. John Cox
Dr. Brooks de Wetter-Smith and Ms. Mary Lou Smith
David DeMarini
Nancy and Mark Dewhirst
David A. Doll
Alec and Georgia Donaldson
Mr. W. Patrick Gale and Dr. Carrie Lynn Donley
E.M. Eddy and D.A. O’Brien
Jane E. Emeis
Mr. and Mrs. Philip W. Ewing
Barbara and Chris Exton
Mr. and Mrs. Richard E. Falvo
Nicole Bruce Fine
Pat Fischer
Thorsten Fjellstedt
Jaroslav and Linda Folda
Mr. Stephen Mark Cumbie and Dr. Druscilla French
Beth Furr
Ann and John Gabor
Ms. Beth Ragan Gad and Dr. Shayne Cox Gad
Gail Perry Associates
Elizabeth Galvin*
Mr. Gary Clyde Gambrell and Ms. Mary Robin Wells Gambrell
Nichole Gantshar
James P. Gogan ^
Linda Grimm
Gail and Steve Grossman
Albert and Mary Guckes
Priscilla Guild
Mark W. Hartman
Dr. M. Vikram Rao and Dr. Susan June Henning
Marianna Matthews Henry
Mary Cook Howes
David G. Hubby
Gerda (Kani) Hurow
Lynne and Walter Jacobs^
Betty Block James
Kathleen Johnson
Eve and Rudolph Juliano
Claudia Kadis
Ms. Julia Booe Keely and Mr. Robert Laurence Keely
Barbara Keyworth
Jeanette Kimmel
Dr. William W. Smith and Ms. Brenda Womble Kirby
Mr. Michael Coleman Maness and Dr. Lois Ann Knauff
Dr. Richard H. Kohn and Mrs. Lynne H. Kohn
Laura Koshel and Rafael de Jesus
Dr. Leonard and Ruth Kreisman^
Marie E. Kulchinski
Anand and Sandhya Lagoo
Dr. Randolph Leland Lambe and Mrs. Catherine Underhill Lambe
Carol J. Land and Barry H. Slobin
Mr. Douglas M. Lay and Mrs. Nelda Kilcrease Lay
Lee and Barbara Pedersen
Dayna Lucas
Dr. Douglas E. Maclean and Dr. Susan Rose Wolf
Mrs. Elaine Fisher Marcus and Dr. Lee M. Marcus
Alice and John May
Michael Mayer
Janet L. McCarthy
Sharon and Alan McConnell
Larry McManus and Pamela Nielsen
James and Susan Moeser
Richard J. Muise
Jill Muti
National Philanthropic Trust
Nelda K. Lay Revocable Trust
Linda Williams Norris
Paul and Cheryl Norton
Pat and Mary Norris Oglesby
Lois P. Oliver
Glenn O’Neal
Heather and Russ Owen
Bobbie Owens*
Lee and Barbara Pedersen
Robert Peet
Robert and Marilyn Pinschmidt
Gordon and Jo Ann Pitz
Stephen and Lyn Pizer
Mr. Robert Davis Porter and Mrs. Joyce Anne Porter
Gary and Susie Pratt
The Honorable David Eugene Price and Ms. Lisa Kanwit Price
Rao Family Foundation
Andrea Reibel*
Terry E. Rhodes
Sandra and Stephen Rich
Linda and Alan Rimer
Alan Linda Rimer
Mr. Victor L. Roggli and Ms. Linda Surratt Roggli
Bruce Marshall Romans
Beth Rosenberg
Michael Kerry Salemi
Stephanie Schmitt
Dr. Caryl Jane Schwartzbach and Alan Bolzan
Dr. Robert Sealock and Cecile Skrzynia
Barbara and Jonathan Sheline
Wayne Sherrill
Sarah Elizabeth Shively
Dr. Robert Sealock and Ms. Cecile Skrzynia
Dr. and Mrs. Sidney C. Smith
Mr. Kyle Hardee Smith and Ms. Jenn Kroohs Smith
Richard L. Smith and Amy Marie Grady
Meredith and Paul Snow
Connie Spooner
Carol Stamm,
In memory of Dr. John Stamm
Elizabeth L. Stanley*
Jeannie Pfister Stroupe ^
Dr. Robert Joseph Sullivan Jr. and Ms. Kim Stephenson Sullivan
Steven and Madeline Sunshine
T. Rowe Price Program for Charitable Giving
Tim and Judy Taft
Monica Taylor*
Margaret G. Teasley
Hugh and Judy Tilson^
Bruce Tomason
Barrie Trinkle
Dr. Glen Holl Elder Jr. and Mrs. Sandy Aldridge Turbeville
United Way of the Greater Lehigh Valley Inc
John and Donna van Arnold
Adam Versenyi
Carol and Jim Vorhaus
Tovah M. Wax and Lucjan Mordzak
Mary Robin Wells and Gary Gambrell
Ernest T. Wilkes
R. Sanders and Jennifer Williams
Sarah Winkler
Jane Pettis Wiseman
Jerry Worsley
Wyrick Robbins Yates & Ponton LLP,
In Memory of Joan H. Gillings
Alan J. Young
Patron ($100–249)
Anonymous (10)
Trudi Abel*
Dwight and Robin Allen
Mary Altpeter
Elizabeth Amend*
American Online Giving Foundation, Inc.
Sherry and Mitchell Anscher
Mr. and Mrs. Thomas E. Archie*
Matthew and Linda Arnold*
Dean W. Avary
Krista and Michael Babbitt
Pam and Don Bailey
Dan and Susan Barco
Cathy Barrett
Phil Barrineau
Beatrice C. Treat Trust
Anne Beaven and Margaret Louey
Neal and Jeanette Bench
Donna and Daniel Benjamin
Kitty Bergel
Robert A. and Christine S. Berndt
Susan Berry
Patricia Beyle*
Jim and Martha Bick
Justin and Dorothy Biddle
Mr. and Mrs. David Birnbaum
Peter Bleckner
Blue Ridge Psychological Services
Natalie and Gary Boorman
Tony Boothby*
Melissa Bostrom and Krisztian Horvath
Thomas W. and Vicki V. Boyer
Lauren Kennedy Brady and Charlie Brady
Carol Brainard and Nancy Hardin
Philip Breitfeld and Susan Kreissman
Rev. William Sims Brettmann
Eunice Brock and Sam Magill
Linda and David Brown
Charles and Renee Brown
Bates Buckner
Edward and Sheila Burgard
Charles Burnett and Catherine Forneris
Frances D. Burton
Thomas Butler
Dr. Leigh Fleming Callahan
Robert Cameron*
Glenn and Patricia Camp
Janet F. Campbell
Natalie Campbell
Donna Carroll and Gale Lackey
Virginia Carson*
Jean Carter
Michael Case and Lewis Dancy
Lorna Chafe
Dr. Margaret Champion
Beverly Long Chapin
Mimi Chapman*
Nancy N. Chemtob*
Corey and Christine Cicci
Gabriella Cila
Elizabeth Cisar*
Linda G. Clarkson*
Ellen Clevenger-Firley
Steve Cline*
Bill Cobb and Gail Perry
Cathy Cole
Robert F. Coleman III
in memory of Susan Hurst Rappaport
Donald and Eunice Collins
Jeffrey Collins and Rose Mills
Jenn Collins and Paul Runkle
Joseph and Elizabeth Cook
Rayna Cooney
Sharon Scholl Coop
Lee Cope
Janilyn and Vance Cope-Kasten
Mary Jo and Douglas Coppola
John and Belinda Corpening
Sarah Clare Corporandy*
Georgia Court*
Rick and Patty Courtright
Elizabeth Anne Cullington
Fred and Jane Dalldorf
Amy Elizabeth Dallen
Zachary Davis
Mrs. Robert Bigelow DeMaine
Todd Dickinson and Helen Kalevas
Teresa Dollar
Sheila and Joe Dorey*
Scott and Mia Doron
Joy and Chet Douglass*
Ginny and David Dropkin
John F. Duncan, Jr.
Anne Dusek*
Kathleen DuVal and Martin Smith*
Connie Eble
The Eckert Family
Bobette Eckland and Richard Kamens
Mark Ransom Eis
Barbara Elish
Jan Elliott
Jerry and Adelia Evans
Joshua London Evans
Dagmar and J.C. Fahr*
Dr. Richard Fair and M. Clare Fair
Robert Farmer
Shauna and Tom Farmer
Pamela Ferguson*
Laurice Ferris^
Nicole and Bruce Fine*
Karen Fink
Jon and Sue Fish
Gina Cordasco Flynn
Dr. Charles Kirk Burnett and Dr. Catherine Ann Forneris
Sara Franks*
Douglas and Judy Frey
Bennett Galef
Betty and Franklin Garland
Ed and Carol Gaunt
Nikki and Anthony Giachetti
William Glasgow
Gunter Glass
Debra and Eric Goldberg*
Alix Goldschmidt*
Eve Benesch Goldschmidt
Raymond and Susan Goodmon
Mrs. Lucy A. Grant and Mr. John P. Grant
John and Lucy Grant
Stephen Grant
Grant Thornton LLP, In Memory of Joan H. Gillings
Virginia Gray
John Graybeal and Laura Heise
Bill Green and Brett Bohnn
Dr. Lawrence H. Greenblatt and Dr. Cathleen Melton
Elizabeth Grey*
Lucy Grey and Wilson McIver
Jean Susan Gross
Joseph Groves
Kay Gruninger
Satyaki Guha
Erin and Evan Gwyn
Tim Hackett and James Konold
Carol and Nortin Hadler
Janet Hadler
Todd Haimes*
Garrett Hall and Zachary Howell
Bruce Hamilton and Jennifer Weiss*
Jean Handy*
Doranne Hans
Ms. Carol Ann Brainard and Ms. Nancy W. Hardin
Cheryl and Toby Harrell
Joanne Harrell
Edwin Harris
Lynden Harris*
Patti Seitz Hartel
Jim and Mary Hayes
Rachel Heller
Richard Hendel*
Eric Herget and Sherry Wilner
Klaus Hermanns
Ellen Herron
William Hicks and William Sadler
Ann Hillenbrand
Margaret R. Hinkle*
Marin Hinkle
Jennifer Hodgson and Matthew Conley
Peter Hollis
Houston and Joyce Horn
Mary Howes,
In Memory of Jonathan B. Howes
John and Joyce Hren
Mr. David Hubby and Ms. Sarah F. Hubby
Mary Hulett*
Malcolm and Wanda Hunter
Leslie Hurtig*
Beth H. Isenhour*
Abby Jablin
Elizabeth W. Jackson
Robert and Jacqueline Little
Emma Jakoi
Champa and David Jarmul
Perry Jenkins
Mr. John Jennings and Lisa Jennings
Jewish Community Foundation of Durham & Chapel Hill
Suzanne Fields Jones
Susan Joyner
Eve and Rudy Juliano
Dan and Linda Kaferle
Cindy Kahler
H. Richard and Sally A. Kahler
Dr. Richard Miles Kamens and Ms. Bobette S. Eckland
Amy Kane*
Lynne Kane
Howard and Joan Kastel
Laura Kayser*
Paul and Edith Keene
Marie-Beatrice and Robert Keller
Arlon Kemple and Karen Long
Barbara Keyworth
Brian and Moyra Kileff
Dr. Harriet King
Robert and Mary King,
In memory of Charles H. Kahn
Andrew Stewart and Peggy Kinney ^
Ann and Bill Kirkland
Rabecca Klemp
Joyce Kline
Ted and Marilyn Koenig
Stephen and Bunny Koff
Elizabeth Koonce
Helen Kotsher
Lloyd Kramer and Gwynne Pomeroy
Dave and Doris Krepp
Ted and Debbie LaMay
Benjamin Landman and Jen Feldman,
in honor of Ms. Betty-Ann Landman
Gerry and Ray Larson
Robert Lauterborn,
in memory of Sylvia Lauterborn
Carol and Alexander Lawrence
Mary and Jon Leadbetter
Priscilla and Russell Leavitt
Judith and Norbert Lechner
Philip and Nancy Leinbach
David and Carolyn Leith
John and Ruth Leopold
Arnold and Annette Levine
Joy Lewis and Frederick Annand
Betty and John Leydon
Judith C.P. Lilley
Ginger and Derek Long
Carol Lucas
John Ludlow and Kathy Davies
Virginia Ludwig
Mrs. Earl C. Lynch
Sara Mack
Corey Madden
Dr. and Mrs. Donald Madison
Dr. Samuel Hays Magill and Ms. Eunice M. Brock
John Manley
Raleigh and Betsy Mann^
Lee and Elaine Marcus
Chris and Caroline Martens
Jeff Mason
Shelley J. Masters
Leigh Matthews
Michael Mayer
Dr. and Mrs. Robert N. McCall
Meredith McClurg
Ann and Webb McCracken
Ed and Connie McCraw
J.S. McKnight
Patrick Joseph Mclane^
Lee McLean
John and Bonnie Medinger
Ewa Meehan
Larry and Jerri Meisner
Cathleen Melton and Larry Greenblatt
Joan and Ron Mendelsohn
Brian Meredith
Julia Merricks and Susan Hauser*
Tracie Merrill-Wilson
Molly S. Metzler*
Graig Meyer
Ryan Millager
Herbert Miller
Erik and Natalia Milz
Mark and Alice Mine
Sophie Jessica Mitchell
Dana Mochel
Jill Moore *
Aela Morgan*
Eric Muller and Leslie Branden-Muller
Margaret Mullinix
Kate Murphy
Seth Murray and Jamie Newman
Margaret Murray
Judy Murray
Lee and Ava Nackman
Michael Naglich*
Diane Nelson, Ph.D.*
Michele and Klaus Nettesheim
Barbara Nettesheim
Betty Nies
Linda W. Norris
James and Nancy Nutt
Drs. Susan and Raphael Orenstein
Marilyn and Peter Ornstein
Barry and Lois Ostrow
Mrs. Heather Kelly Owen and Mr. Russ Owen
Norman Owen,
in memory of Roberta Yule Owen^
Michael Patrick
Josie Patton
Michael Paul
Ron and Julie Paxton
Robert and Kay Pearlstein
Robert Peet
Nancy Pekar
Arnold Pender
Joanna V. Percher
Imara Perera*
Carol and Al Perlman
Mr. Stephen Perrin and Ms. Cecelia M. Sandford
Rebecca Perritt
Thomas Phillips
Meredith Piatt
Pickett M. Gutherie Revocable Trust
Jim P. Polga*
Ms. Susie Post-Rust and Mr. Adam MacKenzie Rust
Ted and Peggy Pratt
Jane Preyer*
Todd and Nicky Purves*
Jeffrey Qualls
Margaret Quinlan
Mr. Stephen Allan Rich and Mrs. Sandra Danneman Rich
Geraldine and Gary Richards
Margaret Louise Robe
Louise A. Robinson
James and Janet Robles
Philip and Jo Rodgers *
Patricia Roos
Joel Rosch and Carol Vatz
Philip Rosoff and Dona Shikaraishi
Judith L. Ruderman
Jennifer Rudinger
Laura and Reid Russell
Patti and Dan Ryan
Sylvia and Norman G. Samet,
In memory of Charles H. Kahn
Celia Sandford and Stephen Perrin
Dale and Robert Sandler
Elizabeth Saunders*
Carol Elizabeth Sawyer
Allie and Ian Scales^
Carol Schachner^
Ms. Karen Ann Sindelar and Mr. Douglas Brian Schiff
Ernest and Mary Schoenfeld
Tanya L. Schreiber
Janice and Richard Schulke
Dr. Caryl Jane Schwartzbach and Alan Bolzan
Gwendolyn Schwinke
Maren Searle and John Skelley
Rick and Georgie Searles
Patricia Shane
Barbara Sharf
William N. Sharpe Jr.
Alison Sheehy*
Barbara and Jonathan Sheline
Stephanie Shipman and Walter Travers*
Connie Shuping,
in memory of Ed and Dot Kennedy
Nikki Silver*
Bland Simpson*
David Singley Jr.
Ron and Mary Sinzdak
Sim Sitkin and Vivian Olkin
Barry Slobin and Carol Land
Mike and Kim Slomianyj
Linda Smith
Dr. Richard L. Smith and Dr. Amy Grady
Rosalyn Smith
Dr. and Mrs. Stuart Solomon ^
Ilene Speizer*
Marcia Spray, In honor of Laura Carson Spray
Kimberly and David Spurr
Sally and Jeremy Stander
Ms. Mary Elizabeth Hall and Mr. Robert A. Stanger Jr.
Allen Steckler
Susanne Steinmetz*
Anne Stephens*
Marian Stephenson
Cathy and Sefton Stevens
Andy Stewart and Peggy Kinney^
Dorcas Stolper
Leslie and Paul Strohm
Mr. Edward Strong*
Jeannie Pfister Stroupe^
Ed and Lynne Sullivan
Terrence and Marguerite Sullivan
Steven and Madeline Sunshine
Jeff Surles
Nanette and David Talaski
Beverly Taylor
David C. Taylor
Stephen Tell and Rosemary Hoban
The Boyer Living Trust
Charles Thomas and Suzanne Maupin
Janet Thomas
Robert and Shirley Thompson
David and Kelley Tobin*
Beatrice Treat
Nancy Trovillion*
Nancy Tunnessen
Nancy Tusa and Andy Brawn
Mr. David Burr and Ms. Rustine Unger
Lindsay Usher
Mary Van Bourgondien*
Ted Van Griethuysen
Barney and Vivian Varner
Dr. Barbara Carol Vatz and Mr. Joel Burt Rosch
Adam Versenyi
Jill Vexler*
Dr. Victor and Mrs. Linda Roggli
Robin Visser
Deborah and Jonathan Wahl
Ina Wallace
Mary Louise Waller
Angela Walter*
Helen Warner
David and Marsha Warren
Tovah Wax and Lucjan Mordzak
George Weinhouse
The Honorable Jennifer Weiss and Mr. Bruce Alan Hamilton
Dr. Lynn Wesson
Shirley H. White, in honor of Steven H. White
Loretta Wile
Mike Wiley
Jane Williams
Dr. Nancy E Williamson
Richard D. Wilson
Joy Wood
Nancy Worley
Jerry M. Worsley
Janice and Richard Woychik
David and Dee Yoder
Marla Yost
YourCause, LLC Trustee for Red Hat Matching Gifts
Justin Yung^
Rosilene Ziegler and John Steege
^ Sustainers Club Member
+ Women’s Point of View (WPOV) Supporter
* PlayMakers Special Event Supporter
~ Deceased
This list is current as of January 18, 2022. If your name is listed incorrectly or not at all, please contact PlayMakers Development Office at 919.962.2481. We will ensure you are recognized for your thoughtful support.
Jump to: Letter from Viv | Support PlayMakers | Who We Are | Title Page | Program Notes | About Lydia R. Diamond | Actor Bios | Creative Team Bios | General Information | PlayMakers Staff | Friends of PlayMakers | Corporate and Foundation Partners
PlayMakers’ 2021/22 Season is Made Possible in Part by Grants from
Foundation Support
National Endowment for the Arts, North Carolina Arts Council, Orange County Arts Commission, The Shubert Foundation, Fidelity Foundation, Truist Foundation, The Educational Foundation of America
Additional Funding for Guest Artists is Provided by
Robert Boyer and Margaret Boyer Fund, Louise Lamont Fund, Emeriti Professors Charles and Shirley Weiss Fund
Producing Council
Mebane Lumber, Residence Inn Chapel Hill, Spoonflower, Larry’s Coffee, The Siena Hotel/Il Palio Restaurant
Corporate Council
De Maison Selections, Aloft
Associates
Cambria Suites
Jump to: Letter from Viv | Support PlayMakers | Who We Are | Title Page | Program Notes | About Lydia R. Diamond | Actor Bios | Creative Team Bios | General Information | PlayMakers Staff | Friends of PlayMakers | Corporate and Foundation Partners
|
|||
692
|
dbpedia
|
3
| 83 |
https://www.icp.org/browse/archive/constituents/julia-margaret-cameron
|
en
|
Julia Margaret Cameron
|
[
"https://www.facebook.com/tr?id=223082142454345&ev=PageView&noscript=1",
"https://www.icp.org/sites/all/themes/icpfoundationtheme/images/missing_profile.jpg 1x, /sites/all/themes/icpfoundationtheme/images/missing_profile-2x.jpg 2x"
] |
[] |
[] |
[
""
] | null |
[] |
2018-01-31T05:00:02-05:00
|
Learn more about the photography of Julia Margaret Cameron.
|
en
|
/sites/all/themes/icpfoundationtheme/images/favicons/apple-touch-icon.png
|
International Center of Photography
|
https://www.icp.org/browse/archive/constituents/julia-margaret-cameron
|
Biography
Born to a prosperous family stationed in Calcutta, Julia Margaret Pattle was educated in England and France. She was married in 1838 to Charles Hay Cameron and had six children. The family settled in 1860 on the Isle of Wight, neighboring the estate of their friend the poet laureate Alfred, Lord Tennyson. Cameron's practice of photography began relatively late in her life, at age forty-eight, when her daughter gave her a sliding wooden box camera. Her "very first success in photography" came in January 1864, with a portrait of Annie, daughter of a neighbor.
Cameron used the wet collodion process, making prints with albumen printing-out paper, and worked with large negatives in order to avoid having to enlarge. In 1864 she began to register her work at the British Copyright Office, became a member of the Photographic Society of London and of Scotland, and prepared photographs for exhibition and sale through the London print dealers P. and D. Colnaghi. Most of her work was made between 1864 and 1875, before she left for family coffee plantations in Ceylon. She exhibited frequently in London, Dublin, Berlin, Paris, Philadelphia, and the Netherlands, and won numerous medals and awards.
Cameron's oeuvre, some 3,000 photographs, falls into two categories: portraits, and religious and allegorical tableaux vivants. They share a stylistic consistency, characterized by soft focus, dramatic chiaroscuro lighting reminiscent of Rembrandt, and technical imperfections. This idealizing aesthetic bespeaks the influence of painter George Frederic Watts; Cameron shared with Pre-Raphaelite associates such as Dante Gabriel Rossetti a predilection for the Italian Old Masters. Cameron's portraits have received the most praise of all her photographs, and are distinctive because of their closeness of framing and strength of composition. Her sitters were often drawn from her circle of prominent acquaintances, including Tennyson, Sir John Herschel, Charles Darwin, and Thomas Carlyle. While her portraits were usually of influential men, her photographs of women and children were often intended as allegorical figures. In 1874, Cameron made photographic illustrations for Tennyson's Idylls of the King at his request, and began Annals of My Glass House, an unfinished account of her career which was published posthumously in 1889.
Lisa Soccio
Handy et al. Reflections in a Glass Eye: Works from the International Center of Photography Collection, New York: Bulfinch Press in association with the International Center of Photography, 1999, p. 210.
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.