instruction stringclasses 96 values | input stringlengths 185 195 | output stringclasses 4 values |
|---|---|---|
What is the function of the gene uvrD | knowing that the species is Escherichia coli, and the genome sequence of the gene is AATCCAACCCTAGAGACCGTCGTAAGATGTCCAAATATTACGCAGGATGAAAGCAACTTACCACCGGCGCCGGTAGAGGTAGCCAGACGGAGCCTTCAAC | the function is Aconitate hydratase catalyzes the interconversion of citrate to isocitrate via cis-aconitate. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene uvrB | knowing that the species is Bacillus subtilis, and the genome sequence of the gene is AGAGAGTGCAGAAATAGGCGGCCGATAAACAGTGGCGGTTGCAGTACTAAGGGTTGGGCTAGAGGTGTATGTAGATTCAACAATTGATATTCTTACACCC | the function is Aconitate hydratase catalyzes the interconversion of citrate to isocitrate via cis-aconitate. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene dnaX | knowing that the species is Staphylococcus aureus, and the genome sequence of the gene is AACTTGTCCTCTGAAGCCATCAAGCCAGCGAGCAGATGAGTATCGCGAGATCGAGCATATGCTTGCTATCTCGCGTCGGTATCCAACCCATTTGGCCTAT | the function is Functions in the glyoxylate cycle, enabling bacteria to grow on acetate as the sole carbon source. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene soxR | knowing that the species is Escherichia coli, and the genome sequence of the gene is AGTGGGGCCTCATGCCCGACCGTAGCAAGCGGACATTTAACTGATAACGTGCCGGCATATTGAGCCCGAAGTAGTAAAATCGCTACCGAAATGCCGTCTC | the function is Functions in the glyoxylate cycle, enabling bacteria to grow on acetate as the sole carbon source. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene rplN | knowing that the species is Mycobacterium tuberculosis, and the genome sequence of the gene is TGTGTGTCACTACCAGCCAAGCCTATCGGGAAACCTTCATAGATCTGAAGATTCCCACCGACTCAGATTGCGTGAAATACTGATGGTTTCAAAGGTTATA | the function is Involved in the tricarboxylic acid cycle (TCA cycle) and assists in the regulation of cellular energy production. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene murA | knowing that the species is Escherichia coli, and the genome sequence of the gene is CCATTCGCGTTCAACACGCCTTTGGGGATCGTTCCGGCCCTAACGCAGAACGTAAGAATTCCCGCTAGTTGTCGGCATGTCCATACCCAGACCAGCAATA | the function is Plays a role in protecting cells from oxidative damage and in maintaining cellular redox balance. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene ruvC | knowing that the species is Mycobacterium tuberculosis, and the genome sequence of the gene is ATGAATGAATCGAATCTACTAACGAATTGTCTAATGTCCCAAGGGGCAGCTCCTTTCGGAGGATTGGGATCACGCTGTAATAGTTGCCTATATACCCCGG | the function is Functions in the glyoxylate cycle, enabling bacteria to grow on acetate as the sole carbon source. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene xthA | knowing that the species is Escherichia coli, and the genome sequence of the gene is GCACTCGGAAGGTAAGTTGCGCCCTGATACGCGTCTACTGGCTGACCTCGGCACCTCGAAACGCTGAAAAGTCCTAGGGGTAATTGCAGAACCAACGTTT | the function is Functions in the glyoxylate cycle, enabling bacteria to grow on acetate as the sole carbon source. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene pstB | knowing that the species is Escherichia coli, and the genome sequence of the gene is TCAAACTTAATCTATTCGTTATGGACACCCGTGGATGGGTCGTTCGCGATAATAAATCGATGCCTAATGCGAAGTAGCCATTTCAGTCCCCGGAAGCGAG | the function is Involved in the tricarboxylic acid cycle (TCA cycle) and assists in the regulation of cellular energy production. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene rrs | knowing that the species is Bacillus subtilis, and the genome sequence of the gene is TCGGAATCGGGGCCCTGAAATTTACGGGCTTGAATCGGTCTCGAGTAATAGGCCGGACTAAGGATCCGATCTGCACCACAGAAAGCTAACCGTGTGTAGT | the function is Involved in the tricarboxylic acid cycle (TCA cycle) and assists in the regulation of cellular energy production. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene rrs | knowing that the species is Escherichia coli, and the genome sequence of the gene is ATCGGAGCACTTGGATGTAGGTTACCTGTGTCCGCCGCGCGCGCGCGGCCAGGGCGATCCCGGGGCCACAATTAGGCCTGCTTACGGTCGTTGGCCCGGA | the function is Aconitate hydratase catalyzes the interconversion of citrate to isocitrate via cis-aconitate. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene rplW | knowing that the species is Escherichia coli, and the genome sequence of the gene is TAAGTCCCCAAAGGATTTTTAGCGGGGACCGAGGAGGACACGGCGATTGCGTGTGAAGGGATTCCAAGGACAGAAGAAGGAGTCATCCGCGTCATCGGCG | the function is Aconitate hydratase catalyzes the interconversion of citrate to isocitrate via cis-aconitate. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene rplY | knowing that the species is Escherichia coli, and the genome sequence of the gene is CAATTCCCAATAGCATAAGTTTCTTCGCAGAAGATGATGGTCACCTTCACAGGAAAGCGGGGCCGACTAGAAATGGTGAATGCGAGAAAAGTCAGGGTCC | the function is Plays a role in protecting cells from oxidative damage and in maintaining cellular redox balance. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene uvrB | knowing that the species is Escherichia coli, and the genome sequence of the gene is ACGCATGCCCCAGGGGAACGTGAGAAATGCATATGCCGTAACAAGCATGCAATTGTGAATTGTTATAATAGGTCGGGATCTACCAAAGTTGCGTAAGGTT | the function is Aconitate hydratase catalyzes the interconversion of citrate to isocitrate via cis-aconitate. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene polE | knowing that the species is Mycobacterium tuberculosis, and the genome sequence of the gene is CTGTAGCCCGAATATTCTAGGACGGGGTTCACGAGAGAGCGCTGAGGCCATCTCTGATGCTTCTCGTTACTAGGACCGTCGCAGGACTTTCTGCTTTGCA | the function is Functions in the glyoxylate cycle, enabling bacteria to grow on acetate as the sole carbon source. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene polD | knowing that the species is Escherichia coli, and the genome sequence of the gene is CTGTGGCGGGTCAAAGTGATCATCGACCCATACATGATGTAACTAAGGAACTACGATCTCTTAATGCGCCCTAGAATAGATTATCTTCGACCTGGAAGTC | the function is Functions in the glyoxylate cycle, enabling bacteria to grow on acetate as the sole carbon source. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene ligB | knowing that the species is Bacillus subtilis, and the genome sequence of the gene is GTCGTCACGAATTTCACATGCAGCCAGTTCCGCTTCAGTGCGCATATTGCCGCCTGCAACGACGTGGGACGTCATGCGGCAGGACTAGGGGGAAACTTGT | the function is Functions in the glyoxylate cycle, enabling bacteria to grow on acetate as the sole carbon source. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene pstB | knowing that the species is Bacillus subtilis, and the genome sequence of the gene is GAGTTTAGTGACGAGTCTGGTACTTTCGCAGAGACTAGCTAATTCATCCGATTTATGTATGGAAGGCGAGACTGTCTAGTTCAGGCAAGCACAGCCCAAT | the function is Plays a role in protecting cells from oxidative damage and in maintaining cellular redox balance. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene polF | knowing that the species is Staphylococcus aureus, and the genome sequence of the gene is GGATTTAGCTTGGCCGTTTATGGTATGTCGACCATCAGAGTGGTGTATTTCGTTGCACCCCGATGTATCAAAACAGACACACAAAATCCCCCGCTGTCGC | the function is Functions in the glyoxylate cycle, enabling bacteria to grow on acetate as the sole carbon source. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene katG | knowing that the species is Staphylococcus aureus, and the genome sequence of the gene is TGATGGGATACTCGATGTATTCCTCTCCTTTTCATCCAACAGTAGGGCGCCATTGGCATCTACGGTGTCGCACCCATGTCAGCTCGTTGAAACAATGATT | the function is Functions in the glyoxylate cycle, enabling bacteria to grow on acetate as the sole carbon source. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene rpsL | knowing that the species is Mycobacterium tuberculosis, and the genome sequence of the gene is TTCCACCGGAAGAACCGCGTTTCTTTCATGGGTTGTGATAGTCCGAGAGAAAATTGATGCCACATACTCGAGAACCCTAGGATCATGTGACTTCAACATA | the function is Plays a role in protecting cells from oxidative damage and in maintaining cellular redox balance. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene ruvB | knowing that the species is Staphylococcus aureus, and the genome sequence of the gene is CCAGATAAGCATTTCACTGTCAGCAAGGAGTGACAGGAACTCCCTAACGAGAATCAGCCACTCGATAGTCATCGCGTACATTACCGTTTAAGGATCTGAC | the function is Aconitate hydratase catalyzes the interconversion of citrate to isocitrate via cis-aconitate. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene ponA | knowing that the species is Escherichia coli, and the genome sequence of the gene is CATGGTAAGGGACAAGAAAAAACAGAGTCCCCTGGAAAGGGGCTCCTCCATTTGCTGCGTGGATTTGAAAGTGTGCGTGTACGTCTAGACAGTTTACAGA | the function is Plays a role in protecting cells from oxidative damage and in maintaining cellular redox balance. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene rplG | knowing that the species is Escherichia coli, and the genome sequence of the gene is GCGTTGAGCTATCCCCACATGGAAACCGCTTACCCGGATAACGCTACTGTGATCATGTTCGGTGGTGCAATTATTCGCCTATCAGTTGATTAACGCACAT | the function is Plays a role in protecting cells from oxidative damage and in maintaining cellular redox balance. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene uvrB | knowing that the species is Bacillus subtilis, and the genome sequence of the gene is CCGCTCGCAGCATGGATTCTGAGGGCGTTCATTCATGCACCGAGGCGGCACAGGATGAACTTTGCCTTTCAGGCACGCCGTGTGGCAAATTTACAACACC | the function is Aconitate hydratase catalyzes the interconversion of citrate to isocitrate via cis-aconitate. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene sodB | knowing that the species is Bacillus subtilis, and the genome sequence of the gene is AGTGCCTTTACAAGCTAAATTTGCATCGGGGACATCGTACTTGCAATGCCAACCGGCTAAATGCTTAGGGGAGGATCATGTCGTATTCACGTATTTGAGC | the function is Aconitate hydratase catalyzes the interconversion of citrate to isocitrate via cis-aconitate. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene mutH | knowing that the species is Bacillus subtilis, and the genome sequence of the gene is AGCGAGCCATCGATCGTCTATAAAGCCTGCATTTGTGGATGGGACTTGTGGTTAACAATGCGACAACACATCCAGAATTCGCGAGCTGAGGCCCTAACTA | the function is Aconitate hydratase catalyzes the interconversion of citrate to isocitrate via cis-aconitate. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene murC | knowing that the species is Mycobacterium tuberculosis, and the genome sequence of the gene is CGAGCGCAGTAGCGGCTACGCTAGTCGAACGTACTCCTAATAGCCCCGTTCGGTCTAAATACCGATCGCGAAGAACTACTGTCCGTCGACATGCTCTTGT | the function is Plays a role in protecting cells from oxidative damage and in maintaining cellular redox balance. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene katF | knowing that the species is Mycobacterium tuberculosis, and the genome sequence of the gene is CCATAGGTTGCGAAAACCTAAAAGAAGTTCAAAGTTATACCAGGGGGCGCTCAATATCAGGAGAGGCTATCTTTGAGCGGGATAGGGTGATATGGGATTA | the function is Functions in the glyoxylate cycle, enabling bacteria to grow on acetate as the sole carbon source. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene uvrD | knowing that the species is Mycobacterium tuberculosis, and the genome sequence of the gene is GGACGCTCGGACAAGTTGTCCGTTCTGACAACCCGATAGCTGTGCTGAACACGTAACCTAACGTTAGAGTTTACGCGCTCCAAATGCCTCTTCTTCACGG | the function is Plays a role in protecting cells from oxidative damage and in maintaining cellular redox balance. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene uvrA | knowing that the species is Mycobacterium tuberculosis, and the genome sequence of the gene is AGGGCAGAGCAGCAATGACGTTTAATCTCGGATCGCAAAGCTGCGTCACAGCAGGCGCAGACTACGTCGAACACTCTCATGGTAATTCACTCGTGTGGCC | the function is Aconitate hydratase catalyzes the interconversion of citrate to isocitrate via cis-aconitate. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene rplD | knowing that the species is Mycobacterium tuberculosis, and the genome sequence of the gene is CATGGTGCCTTCTGGCGAAATATAACCCGCACGCCACCCTGTAGTTCACGACGACCCTGTCGAACCCAAAATCGGTGGAATCGAGTGTGTCTTTTCATCA | the function is Plays a role in protecting cells from oxidative damage and in maintaining cellular redox balance. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene embB | knowing that the species is Escherichia coli, and the genome sequence of the gene is GGGTTATGGACCGCCGGCGCAACTCGGTTAGGAATCTGTCGTCTGGAGGTTAATGCAGGGGAATGTTCGCACTCTAGCTGAGTTAAACGACCGGGCGTTG | the function is Involved in the tricarboxylic acid cycle (TCA cycle) and assists in the regulation of cellular energy production. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene recJ | knowing that the species is Escherichia coli, and the genome sequence of the gene is TCACCTCCCCCCTATGGTGCTAGCGTACCAGACTTTCTGCTCCATGTGGTCCGATTCCTCGGAGCCTGTCCAAGCCTTCCGAAGAGTCTTCGACATAATG | the function is Involved in the tricarboxylic acid cycle (TCA cycle) and assists in the regulation of cellular energy production. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene ligA | knowing that the species is Escherichia coli, and the genome sequence of the gene is GAGTGCGGGTCTTCCTCTACGCTTTAGGATTATGGTTTGATGCATTACACATTAAAAGCAACGTCCGCTATTAAAGCCAATAAGCCGGTTCGCTTTTTGA | the function is Functions in the glyoxylate cycle, enabling bacteria to grow on acetate as the sole carbon source. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene ndh | knowing that the species is Escherichia coli, and the genome sequence of the gene is TGGGCGTGCGGCCTTATATGTCTGTCTGTAAAAGTGTAGTTAGCATATAGACTGCCCGGGACCGCGCAGCCATAAAGGCACCGACGGCTTTTATGCAAGA | the function is Aconitate hydratase catalyzes the interconversion of citrate to isocitrate via cis-aconitate. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene ruvA | knowing that the species is Bacillus subtilis, and the genome sequence of the gene is GTGTACGGGCCGGTATTAGTCGGCAATGAGCGCCACAATTGGCTTTTATTTTACGGAGCGATGTCGCGGGGATGGACGCCATTAGGACGAGGGGAAAGCA | the function is Functions in the glyoxylate cycle, enabling bacteria to grow on acetate as the sole carbon source. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene pstS | knowing that the species is Mycobacterium tuberculosis, and the genome sequence of the gene is AGCAACCCATATTAGTATGGTCCCTATCACCTGGTTGTTTAATCCTTTGATATTCACACATTAAAGTGCGTTTTCCTGGATCCTTATCGACCTGTTCGAT | the function is Functions in the glyoxylate cycle, enabling bacteria to grow on acetate as the sole carbon source. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene rpoB | knowing that the species is Escherichia coli, and the genome sequence of the gene is GGTGTGAGAAAACTTAGCAAATTTTAGTGAGCAGAACGGTATCGTGCATTCCAAGCTAAGGGCGTCACCCGCTACTGCCTATTATACACCCGGCGATGGT | the function is Aconitate hydratase catalyzes the interconversion of citrate to isocitrate via cis-aconitate. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene embB | knowing that the species is Escherichia coli, and the genome sequence of the gene is ATCCGATGCTGTCCATACGAAGACCAGTGATTCAATCCGCGAGTACGTTGTCGACATGAGAAAATAGTCCCACTAGTCGTTTGTGGTGCTATGCCTTAGG | the function is Involved in the tricarboxylic acid cycle (TCA cycle) and assists in the regulation of cellular energy production. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene murG | knowing that the species is Escherichia coli, and the genome sequence of the gene is GCGAGTTAACCCAATTCTCGTATACTAACAATGTAGACGAAGCTTCTCAAGCGAGGAGGTGCTGAGAGCCTGCAATCGAACCCTAAGGTAGAGACTGACG | the function is Aconitate hydratase catalyzes the interconversion of citrate to isocitrate via cis-aconitate. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene ligA | knowing that the species is Bacillus subtilis, and the genome sequence of the gene is TATTAGGTCTCATAATAACTGGCGCGTACAACTCGTGGGAAGTATGAGTTGTGTGATTCTTGTGGCCGATACTTCCGCAATGAAGACCATATGGCTCTAA | the function is Involved in the tricarboxylic acid cycle (TCA cycle) and assists in the regulation of cellular energy production. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene rplP | knowing that the species is Staphylococcus aureus, and the genome sequence of the gene is GCCGAGCCACATGGTTTCAAAGTGCTGCGCCATTAATACTCCCGCGGCGTACCTGGAAGTCATAGATGGCCTCTGATTCATTTGAGGCCCGGACCCCGGA | the function is Functions in the glyoxylate cycle, enabling bacteria to grow on acetate as the sole carbon source. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene rplD | knowing that the species is Staphylococcus aureus, and the genome sequence of the gene is TGATCCGAGCCCACCCACACGCTCCTTTGCTCACTTCGACTCGTATTCAATGCTGTTCGATGTACCGAACAACACGCATGGCGGCTATCACAAAGGAACC | the function is Plays a role in protecting cells from oxidative damage and in maintaining cellular redox balance. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene murC | knowing that the species is Escherichia coli, and the genome sequence of the gene is AAATAGGTAATGGTATATCCGATGATTTAACAGCTTGGTAGCTCCAGGGACAGCTAGGGATGCAGGGCGCCACACTGCCAACTGTTTACTGACCACCTTG | the function is Involved in the tricarboxylic acid cycle (TCA cycle) and assists in the regulation of cellular energy production. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene polB | knowing that the species is Staphylococcus aureus, and the genome sequence of the gene is CACAGGACTGGGGAACCGTACATTGCCACCGTCCTCGGCAGCGTACACCGTCCGGTTGCGCACACCCAGACTTTTGCTAGAAGCAACGCTAGCACCTCCC | the function is Functions in the glyoxylate cycle, enabling bacteria to grow on acetate as the sole carbon source. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene recG | knowing that the species is Bacillus subtilis, and the genome sequence of the gene is GCTTCAAAGTACCTTCTGCCCGACATAAATTTCACTACTCTCTCCCATTGCGGTTCAGGTGCCCAATGACGCACAGAGCTTTACCCGCCCCGAACCAATT | the function is Plays a role in protecting cells from oxidative damage and in maintaining cellular redox balance. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene uvrA | knowing that the species is Mycobacterium tuberculosis, and the genome sequence of the gene is TATAGGATCCCAGACTTTACGCTCTTGACAGCTGAGAAGTCTACGACTCTATATAGAGAGTCTAGTCCTCATACTCTAGGTTTTAGGGGAGTACGGCCTG | the function is Plays a role in protecting cells from oxidative damage and in maintaining cellular redox balance. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene polA | knowing that the species is Bacillus subtilis, and the genome sequence of the gene is TATTCAGCCACAGCTCATTAACCTCGACCTCAATCCGTGACCCCTATGCCGTACAGTTCGGCAGTTCCATATTATGGACCAACAGTATGATAGCCTTTAC | the function is Functions in the glyoxylate cycle, enabling bacteria to grow on acetate as the sole carbon source. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene embB | knowing that the species is Staphylococcus aureus, and the genome sequence of the gene is TCAGACCTATGGGATCGACCCACGAGCGATATACGATCGCCCCTCAGGGCCAGTCTGCACCCAACTGGCCCGCCTCGTACTGGGTGCCGTCACTGCTCTA | the function is Aconitate hydratase catalyzes the interconversion of citrate to isocitrate via cis-aconitate. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene rplQ | knowing that the species is Escherichia coli, and the genome sequence of the gene is GTACCGCAACAAGATTGACGTCGTATTCAGCCATTTAAGTGTGCCAGTCGCCTTCATGCCAGGCCCCAATTCGTGTGTTTAGATTACTATTGCCTTGTCG | the function is Plays a role in protecting cells from oxidative damage and in maintaining cellular redox balance. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene recC | knowing that the species is Staphylococcus aureus, and the genome sequence of the gene is TGGAGCGGAAGCACGCCTTAACACAAGGCAGTGAGCGCCCAATGAAAGTGTAGTCAATTCAGCATGGACTCGCTGTCTCCCATACATGGTTCCATCGGAG | the function is Involved in the tricarboxylic acid cycle (TCA cycle) and assists in the regulation of cellular energy production. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene rplG | knowing that the species is Staphylococcus aureus, and the genome sequence of the gene is CTCCATAGACGTCTTACCCCAATTGTAAAGTAACGGTGTAGTGGGCTTCGGCGTATGGGACCTTGTCAAGCCATCGTGAGAGATTAGTGTTGACCGTGAT | the function is Functions in the glyoxylate cycle, enabling bacteria to grow on acetate as the sole carbon source. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene pncA | knowing that the species is Bacillus subtilis, and the genome sequence of the gene is AACTCCATGGTATCTGTGGCATGATTAGGCTTGAACTATTCTCTTTGACCTAGGCGTAGCATCGTAATACACCTGTAAAAGTCAGTTATGTTCTAGACAG | the function is Involved in the tricarboxylic acid cycle (TCA cycle) and assists in the regulation of cellular energy production. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene rplY | knowing that the species is Staphylococcus aureus, and the genome sequence of the gene is ACTATAATATGCGGCGGCCGCTAAAATAAAGGATTAACCCGCTTGTCAAATGCCCGGAACCGACCCCTAGAGTCACTAGATGCATTTCTGTTTACCAACG | the function is Involved in the tricarboxylic acid cycle (TCA cycle) and assists in the regulation of cellular energy production. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene uvrA | knowing that the species is Mycobacterium tuberculosis, and the genome sequence of the gene is ATCGCCAACGTTTATAGCTATGTATGGACCCGCCATGTGTCCAAGAGTACGTCCCGTTTCAATTCGGGGGGTTTTATAGGCCACCTGACACATGACTGAC | the function is Functions in the glyoxylate cycle, enabling bacteria to grow on acetate as the sole carbon source. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene dnaQ | knowing that the species is Escherichia coli, and the genome sequence of the gene is TCGTAGCTTGATTGACCTGTGCCCGAAGTGCGCGAAGGCCCCAGCCGCTGACTCACACAAAGTGGGACATCCCATCCGGTGTCGCCTAAAGCAGCTGGCA | the function is Functions in the glyoxylate cycle, enabling bacteria to grow on acetate as the sole carbon source. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene soxS | knowing that the species is Bacillus subtilis, and the genome sequence of the gene is AAGCCCTCGCTATACCCCGATTCTGGAGTTCTAACATTAGGCGATCCCAGGGGTTCCACTGCTGAGGCTTGCCTAGCAGGTATGACGGGCGACGTCCTTT | the function is Functions in the glyoxylate cycle, enabling bacteria to grow on acetate as the sole carbon source. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene polA | knowing that the species is Mycobacterium tuberculosis, and the genome sequence of the gene is TGACTAGCACAAAGTGGCCGACTCCGTTACTTTTGGCAAAGGGCTCATTATTGGGTAGCATTCGAAACGTACCCCCAATGGCTAGAACGAGTAGAGGGCT | the function is Plays a role in protecting cells from oxidative damage and in maintaining cellular redox balance. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene uvrD | knowing that the species is Escherichia coli, and the genome sequence of the gene is TCATAGGTCCGCAGCCCTTTCCTGATGCTTTCCTCTTCCTCTCTAAGGTAGTATCTTCCCCAAAGTGAGAGAGGGGTATCCCGGGTATATCGTTGCGGGC | the function is Aconitate hydratase catalyzes the interconversion of citrate to isocitrate via cis-aconitate. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene recJ | knowing that the species is Bacillus subtilis, and the genome sequence of the gene is GGTGCCTCCCCGGCACCAACGAAAGTTCCCTTCTACTCGCTATCGAACTTGAGGATGGGGGCGGGTGGCCCGATTAATGTGCCGAACCGACAACGGAGAT | the function is Functions in the glyoxylate cycle, enabling bacteria to grow on acetate as the sole carbon source. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene ruvB | knowing that the species is Bacillus subtilis, and the genome sequence of the gene is GTCCTGGAATATGTTACGTGGCGTAATAGCCATGTTACTATCGGGGCAACGCTTCAGCGAAGGGCTCGGTCCTATGATCTGCATGCATAGCCGCCACGGT | the function is Aconitate hydratase catalyzes the interconversion of citrate to isocitrate via cis-aconitate. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene pncA | knowing that the species is Mycobacterium tuberculosis, and the genome sequence of the gene is TTGGGCACGCTCCCCTACCAGCATGAGCTCGCAACCCTCGATTCTCAGGGTCCGATGGCATACAGATTAAAAAGAGCGACCCCTCAACTCTCGTTGTAGT | the function is Involved in the tricarboxylic acid cycle (TCA cycle) and assists in the regulation of cellular energy production. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene pstB | knowing that the species is Bacillus subtilis, and the genome sequence of the gene is TTATGTCAATTCCGGGATCTCGTAGTCCGGGGAACCTGCACATCCGACCTGTCTGCTAGTTGAAGCTGTCCCACCAGCATCACTAGCAATTGTGGGGATG | the function is Plays a role in protecting cells from oxidative damage and in maintaining cellular redox balance. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene ndh | knowing that the species is Escherichia coli, and the genome sequence of the gene is ATTCTAATTATCTCATCTAACAAGATGGATGAGACGGGAGGCAAAAACCTTCATATGGGTCGTATGTCTACCACTAGCTATCGATGAAGGCTGGGAAAAC | the function is Plays a role in protecting cells from oxidative damage and in maintaining cellular redox balance. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene rplV | knowing that the species is Bacillus subtilis, and the genome sequence of the gene is GCGCCTCTAGGCGTAGAGGAATACCAGACCAGAGCATCAACGCGACCAATTTAGACCTCATAGCCAAACGGTCGATTGTCTTCCTCGTGGGGCCCTCCAG | the function is Plays a role in protecting cells from oxidative damage and in maintaining cellular redox balance. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene rplH | knowing that the species is Bacillus subtilis, and the genome sequence of the gene is CAACCCACAACTACCGTCCTGGCATAAATGTCTAATTCGTACCAATTCTATCACCTAGCCTAAGTCACGCGACTTTTGTTCGGCGGCAGTGGATCTGCCC | the function is Functions in the glyoxylate cycle, enabling bacteria to grow on acetate as the sole carbon source. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene uvrC | knowing that the species is Bacillus subtilis, and the genome sequence of the gene is ACGTGAGGCTCGCCTGGGTACCGCCCGTTTTGCCCCATTCTCATATCTAACGAGGCCAAACAATTTATCCGTTCCTCTATCCAATATAACGACTTGGGTG | the function is Plays a role in protecting cells from oxidative damage and in maintaining cellular redox balance. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene uvrY | knowing that the species is Bacillus subtilis, and the genome sequence of the gene is AGCTCCTCTGATGGCGGCTTTACGGAAGCAGCTGAAACACGGGAGTGACTCAGCTAACCGGAGCCTCCTTTCCGATAGCTCTACAATTTAACGTCCAAGG | the function is Aconitate hydratase catalyzes the interconversion of citrate to isocitrate via cis-aconitate. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene recG | knowing that the species is Staphylococcus aureus, and the genome sequence of the gene is TAGTCATTGTGACGTGGGTAAGCTTGAGTAGTCCCACTGGTACCAGGCCGCGGAACCTCAATGTGATGCCCTTAGCGGTCTACCGGCGAAAAAAACCCGA | the function is Aconitate hydratase catalyzes the interconversion of citrate to isocitrate via cis-aconitate. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene rplD | knowing that the species is Staphylococcus aureus, and the genome sequence of the gene is TTTGGAGGCTGTCGAACATTGTAATGGACATTTGTATGGTTTGCTCTATTTGGCGGGAGACGTATCCACCTGATGAAGTTAGTCACTCGGCGTGCACTTT | the function is Functions in the glyoxylate cycle, enabling bacteria to grow on acetate as the sole carbon source. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene ethA | knowing that the species is Escherichia coli, and the genome sequence of the gene is TCGCGACAGATCAATAGGTCAGTCCACGTTGAGCGGCCTTACGTATAGGGCAGTAAGTTCCTGGGTAATCTCCAAGCGACCGGGTCGTAGCCTATACGGA | the function is Involved in the tricarboxylic acid cycle (TCA cycle) and assists in the regulation of cellular energy production. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene inhA | knowing that the species is Mycobacterium tuberculosis, and the genome sequence of the gene is AAAGACCATAATTACGGACCACATCAAGCGTGACGGATGGGGAGCAATGGTTCCCAAGACTCAGTGAGTGGGTAGTCGTAAAGGGGCCGCTAACTCTCCT | the function is Involved in the tricarboxylic acid cycle (TCA cycle) and assists in the regulation of cellular energy production. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene dnaX | knowing that the species is Escherichia coli, and the genome sequence of the gene is ACCGCCTAGCGAAACATAGGAGGGCAGCCTGACATTTCGATGATTAGGAATCCGTACTGTACAGTTTGATTTAAAATCGTGACCCAGCTCGGGCCGGGGT | the function is Functions in the glyoxylate cycle, enabling bacteria to grow on acetate as the sole carbon source. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene rplY | knowing that the species is Escherichia coli, and the genome sequence of the gene is CGGCAGGCACACCGCACTAAATCACTGCGGCCAGCCGACGCGCCCCGACCTAGCTCAATATCACTACTTCTTGTGAACATACTGTTGAGGCTTTATGGAA | the function is Involved in the tricarboxylic acid cycle (TCA cycle) and assists in the regulation of cellular energy production. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene ligA | knowing that the species is Mycobacterium tuberculosis, and the genome sequence of the gene is GAGTCCTGCACGGGAGGGGGATGGCTGCCATAACTTAGTAGGTGAATGCTATTCGTTCTCATTGAAATACAAGAGGTGTATCCTGATATTTCAAGCCGGT | the function is Plays a role in protecting cells from oxidative damage and in maintaining cellular redox balance. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene recD | knowing that the species is Bacillus subtilis, and the genome sequence of the gene is TGAGTTGCTCGTCTGCGGCGAGTCCCCTGCGTAGCAGGACAAAGTTAGCGTGCTAACTTGATAAATAGCCATGAAGAATGGTCCCCGCACCACCTAAACA | the function is Functions in the glyoxylate cycle, enabling bacteria to grow on acetate as the sole carbon source. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene gyrA | knowing that the species is Mycobacterium tuberculosis, and the genome sequence of the gene is AGGACTTCGGTAACGGGCTGACCAATGAGTCTTGCGGTCCTGTGGTTACCTCCGTTGAGTGCTCTCAAGTGAGAAGGGGGTGGGTCATGTAGATGGCTGT | the function is Plays a role in protecting cells from oxidative damage and in maintaining cellular redox balance. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene rplK | knowing that the species is Staphylococcus aureus, and the genome sequence of the gene is TAATAAGATTTGGGACTATCCTTGGGCGTTCGGTAGTGAAAATTCGCTGATAATTCCTAGTCCCGGATCTCAGGCGTTACTGCAATAGACCCGGCCCGGT | the function is Plays a role in protecting cells from oxidative damage and in maintaining cellular redox balance. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene pstA | knowing that the species is Mycobacterium tuberculosis, and the genome sequence of the gene is TCTAAAAGTCTATACTTCGACAGGTGAAACTAGTACATATTGCAATTTCTAGTTAGACCAGCTGATAGGTTTATAGACTAAGGAGTAGAGAAGTGGTAGA | the function is Involved in the tricarboxylic acid cycle (TCA cycle) and assists in the regulation of cellular energy production. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene rplP | knowing that the species is Bacillus subtilis, and the genome sequence of the gene is CGTGCCAGGGCGGTCTCGCTGGACTACTTGTGAAATGGTAACGTCTACGGTAGCCTCCAGGATGTGTTCGGCGGAAAACGGCTTGTTGCTCGACACGCCG | the function is Plays a role in protecting cells from oxidative damage and in maintaining cellular redox balance. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene rplF | knowing that the species is Escherichia coli, and the genome sequence of the gene is CACATTTCGCCTAGAGCACGCAGCTGCCTGTAGCTCAGCGAAGCACACGAAGATCCGAGGCGCGCCAAGCCTAAGACATAACGCGGTTTAGTGAATAATG | the function is Involved in the tricarboxylic acid cycle (TCA cycle) and assists in the regulation of cellular energy production. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene recF | knowing that the species is Mycobacterium tuberculosis, and the genome sequence of the gene is TACGCGAACCTAGATGCCCTCGTTGAATGTTATGATCGCGCTTCGGATTTTAACAGCCCTCAACGTTGACATTAAAATTGATCGAACTTTTAAAGGTCTC | the function is Involved in the tricarboxylic acid cycle (TCA cycle) and assists in the regulation of cellular energy production. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene murB | knowing that the species is Mycobacterium tuberculosis, and the genome sequence of the gene is TAACCGGAAGGAGGCTCAAATTCGTCGTGTAATCCACACTTGCGCCAATGGCTGCCGCGTCTATTGGGCGCCATAGGCTGGAACAAGAGAGGCCAACCTG | the function is Plays a role in protecting cells from oxidative damage and in maintaining cellular redox balance. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene recD | knowing that the species is Mycobacterium tuberculosis, and the genome sequence of the gene is CGAATAATCCGCAAGGACTGTGCGGTACGTCAGCTTAACTTATCATCCTAACCATAACTGATCTCCTCACGGACGATAACGCAAAAACCGTTAAAGGGAC | the function is Plays a role in protecting cells from oxidative damage and in maintaining cellular redox balance. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene gyrA | knowing that the species is Staphylococcus aureus, and the genome sequence of the gene is CGTCGCTGCATAGAACAGATCCCGTCACGCATTGTCAAAGGGCCGGTGGTCGTACCGGAGGTCCGGCTTCGGATTGTCGTTCAAAAAACCGGGCACACTT | the function is Functions in the glyoxylate cycle, enabling bacteria to grow on acetate as the sole carbon source. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene rplD | knowing that the species is Bacillus subtilis, and the genome sequence of the gene is GAGCAACGAACATGACTGTTCAATACCTGTGACATCCGGGAGCTGTAGACGGATAGTGACATATCGTCTCCCTTGCACGGTTACTCTCGAACTATAAGTT | the function is Functions in the glyoxylate cycle, enabling bacteria to grow on acetate as the sole carbon source. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene rplI | knowing that the species is Staphylococcus aureus, and the genome sequence of the gene is CTCCGATTTGCGAATCGGAGGCCTGCTTGGTCGTAGTCGGGTACTTCTCCGTTCTCCTTCCATCAAAGGCGCTGAGGAACGGGATCACACATCGTCTGTA | the function is Plays a role in protecting cells from oxidative damage and in maintaining cellular redox balance. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene uvrY | knowing that the species is Mycobacterium tuberculosis, and the genome sequence of the gene is CGGAAGCGTCCTAGCATCGGAAACACCGGTCTCGAGAGCAGGGTACTTAATTAACCCGGTAAGAAAGCCCAAAGGTTCCCTAGGTTATGCTCGTACCCCA | the function is Aconitate hydratase catalyzes the interconversion of citrate to isocitrate via cis-aconitate. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene katG | knowing that the species is Escherichia coli, and the genome sequence of the gene is GCGTGTCCCCCCCTGTTCCGAGCCCGCAATGCCTGACAGACCAGTGCGTTAGCTTGGCTTGTTTCACGTAAAGTCGTGGCTAGACAGACCTTTGATGCTT | the function is Plays a role in protecting cells from oxidative damage and in maintaining cellular redox balance. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene murF | knowing that the species is Staphylococcus aureus, and the genome sequence of the gene is TTGTTTTTCCCGCCGTGCGCTGGTATCGGGGGAGGACATGGATCTACAGAAGGAGTTACTATAATACCGAGCTAGAGGGAACCATTAACTGTCGTTATAG | the function is Plays a role in protecting cells from oxidative damage and in maintaining cellular redox balance. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene ligA | knowing that the species is Mycobacterium tuberculosis, and the genome sequence of the gene is AACTTTTTCGCATTCCGGCCTGATGTAGAACATCGCAGACGGTAGACGAGCATCCGCTCTAGATATGTATGGTGAGTAGGGGCGGCGATGTTCAAATCTG | the function is Plays a role in protecting cells from oxidative damage and in maintaining cellular redox balance. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene murF | knowing that the species is Staphylococcus aureus, and the genome sequence of the gene is TCTCCGAACTCGAAGTATGTGTCGTGAGTTTTTAACGAGCCGCATCAACGTGCGAATTCCTCAATTCTGGTAAATACGTGTCGTGCCCGGTGTACAACGC | the function is Aconitate hydratase catalyzes the interconversion of citrate to isocitrate via cis-aconitate. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene kasA | knowing that the species is Bacillus subtilis, and the genome sequence of the gene is TCAAAATTTAGCCGGGGGCGCAAAGTTTCCATCAGGGGAAATGTGCCTGAGTTCTTCCCTGGATTAACATACGTTACGTGCTGTGCGTATCTAGTCGCTT | the function is Plays a role in protecting cells from oxidative damage and in maintaining cellular redox balance. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene rplX | knowing that the species is Mycobacterium tuberculosis, and the genome sequence of the gene is TGCTGCTTCAACCTATGTCAGCAAGAAGAATTTGTCAAGCGCCGACGGGGCAAAGTCGTGGATTGGTGAAAACTGCTGGGGTTCTCGGATTTCTTCACCA | the function is Aconitate hydratase catalyzes the interconversion of citrate to isocitrate via cis-aconitate. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene mutT | knowing that the species is Staphylococcus aureus, and the genome sequence of the gene is TCTACTGACCTAAAACAGCCCTCGAGAGCGAACTTGTCAAGCACTGCATTTGAGCACCGTTACGGGAAGCGTGTTTAGTATGGTTGAGAGACCTGCTAGC | the function is Functions in the glyoxylate cycle, enabling bacteria to grow on acetate as the sole carbon source. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene rplH | knowing that the species is Escherichia coli, and the genome sequence of the gene is TCTAGTGGGCCACTAACGCACCGCGGCGGTTCGTTCTGATTTGGAGTCATGAGCGCAATGCGCTCGTGGGCGGGCGTACAGAACATAGCGCTGTCTCTCA | the function is Aconitate hydratase catalyzes the interconversion of citrate to isocitrate via cis-aconitate. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene mutS | knowing that the species is Escherichia coli, and the genome sequence of the gene is ACCGCGGTCCGTAGTCCCAGGACGAGGCGGACACCACGCTAGCCACGGCTCCTAATTACCCTTAACTTAGTCGACCGCCTGCGCCTATATTTATGGACGC | the function is Functions in the glyoxylate cycle, enabling bacteria to grow on acetate as the sole carbon source. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene rplC | knowing that the species is Escherichia coli, and the genome sequence of the gene is TGCTCAAAGCTGCTTCGCGATGAACGTCATTAACTCGGATCGAAACAAAATTCGGAACGGATTCATCGTGGTTATGGTGGCTCAGGACAGACATCCTAGT | the function is Functions in the glyoxylate cycle, enabling bacteria to grow on acetate as the sole carbon source. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
What is the function of the gene recF | knowing that the species is Bacillus subtilis, and the genome sequence of the gene is GCCAGTCACTGATGATGACGGACGACCCATTATCAGAAATACAGACCGACATGGCAGCGGTGTCGGTGAAGTTAGCGTGAATAGCTTGATCAGTAAAGGC | the function is Plays a role in protecting cells from oxidative damage and in maintaining cellular redox balance. according to NCBI, and the details of the function is under the condition of standard laboratory growth conditions |
End of preview. Expand
in Data Studio
No dataset card yet
- Downloads last month
- 11