text
stringlengths 1
62.8k
| fineweb
float64 -3.91
3.29
| nvidia
float64 -7.02
7.77
| length
float64 -4.2
15.4
| quality
float64 -10.77
6.4
|
|---|---|---|---|---|
"Music therapy helps children of all ages and disabilities, especially children who are particularly auditory," says Jennifer Hastings, a Seattle neurologic music therapist.
| 1.024086 | 1.613221 | 0.731864 | 1.586038 |
Electoral record November 4, 1935, provincial by-election Okotoks—High River See also History of Alberta 1937 Social Credit backbenchers' revolt Notes References Further reading/other sources Primary sources External links Encyclopedia of Alberta Online Alberta Source Alberta legislative assembly AllRefer.com Biography William Aberhart Historical Foundation CBC 1943 archival video clip on Aberhart's legacy William Aberhart's papers digitized at the University of Calgary Archives Category:1878 births Category:1943 deaths Category:Alberta Social Credit Party leaders Category:Alberta Social Credit Party MLAs Category:Canadian Baptists Category:Canadian evangelists Category:Canadian people of German descent Category:Canadian anti-communists Category:Persons of National Historic Significance (Canada) Category:People from Huron County, Ontario Category:Premiers of Alberta Category:Queen's University alumni Category:British Israelism Category:Anti-Masonry
| 1.128099 | -1.123214 | 3.604522 | -2.346543 |
// RUN: %clang_cc1 -fsyntax-only -verify %s // rdar://8191774 @protocol SomeProtocol @end @protocol SomeProtocol1 @end @interface SomeObject <SomeProtocol> @end int main () { Class <SomeProtocol> classA; Class <SomeProtocol> classB; Class <SomeProtocol, SomeProtocol1> classC; Class <SomeProtocol1> classD; void * pv = 0; Class c = (Class)0;; if (pv) return classA == pv; if (c) return classA == c; return classA == classB || classA == classC || classC == classA || classA == classD; // expected-warning {{comparison of distinct pointer types ('Class<SomeProtocol>' and 'Class<SomeProtocol1>')}} } // rdar://18491222 @protocol NSObject @end @interface NSObject @end @protocol ProtocolX <NSObject> @end @protocol ProtocolY <NSObject> @end @interface ClassA : NSObject @end @interface ClassB : ClassA <ProtocolY, ProtocolX> @end @interface OtherClass : NSObject @property (nonatomic, copy) ClassB<ProtocolX> *aProperty; - (ClassA<ProtocolY> *)aMethod; - (ClassA<ProtocolY> *)anotherMethod; @end @implementation OtherClass - (ClassA<ProtocolY> *)aMethod { // This does not work, even though ClassB subclasses from A and conforms to Y // because the property type explicity adds ProtocolX conformance // even though ClassB already conforms to ProtocolX return self.aProperty; } - (ClassA<ProtocolY> *)anotherMethod { // This works, even though all it is doing is removing an explicit // protocol conformance that ClassB already conforms to return (ClassB *)self.aProperty; } @end
| 0.995029 | -1.490418 | 4.461175 | -3.296514 |
- spanishskulduggery likes this - jabba-da-butt reblogged this from little-hiding-owl - sabbatine reblogged this from anthrocentric and added: - othersidhe likes this - be-diff3rent likes this - jenninova likes this - jenninova reblogged this from angie-laughing-alone-with-salad - angie-laughing-alone-with-salad reblogged this from anthrocentric - josiegem likes this - kinvoya reblogged this from anthrocentric and added: - kinvoya likes this - kiranirvanna reblogged this from anthrocentric - kiranirvanna likes this - balancingknives likes this - tooprettyforthis-shit reblogged this from learn-to-leave-well - iamgbtm reblogged this from anthrocentric - iamgbtm likes this - learn-to-leave-well reblogged this from anthrocentric and added: - annearachne reblogged this from anthrocentric - angie-laughing-alone-with-salad likes this - xchelsemilyy likes this - anthrocentric reblogged this from elgin-marbles - portmanteauverload reblogged this from filipino-burrito - dudevstheworld likes this - heyawakaradesu reblogged this from elgin-marbles - jenivereblack likes this - mar-goooo likes this - sidewayscity likes this - fade31415 likes this - brothercaptainking reblogged this from elgin-marbles - darlingmacabre reblogged this from loveinalderaanplaces - sorau reblogged this from elgin-marbles - liccy likes this - alphabetsouppredictsyourdoom reblogged this from minato-rise-up - apapap likes this - caffeineevening likes this - sacrecoeur reblogged this from feministdisney and added: - sacrecoeur likes this - asdfghjklhtn likes this - leighindigo reblogged this from octarina - thestrongones reblogged this from khaleesiboadicea - muffinavashti19 reblogged this from feministdisney - princecinderella likes this - palemagnolia likes this - kittylien likes this - thediaryofmagnalucius likes this - pictishking likes this - teatimeatwinterpalace likes this - alessandrahautumn reblogged this from jasminecalver
| 0.153412 | -1.324227 | 5.027407 | -4.194141 |
[Study of the effect of parotitis vaccine on DNA repair in human lymphocytes].
| 0.798345 | 0.657518 | -0.340987 | 1.361316 |
The following primers were used for PCR: Gypsy for CTTCACGTTCTGCGAGCGGTCT, Gypsy rev CGCTCGAAGGTTACCAGGTAGGTTC, Zam for3 TCACATCCTTCCAGCAATCTTCAA, Zam rev3 TATTACAGTTTCTGACATTATTTCTTCGTG, MDG1 dir AACAGAAACGCCAGCAACAGC, MDG1 rev CGTTCCCATGTCCGTTGTGAT, Idefix for AACAAAATCGTGGCAGGAAG, Idefix rev TCCATTTTTCGCGTTTACTG, dpp for2 GGCTTCTACTCCTCGCAGTG, dpp rev2 TGCTTTTGCTAATGCTGTGC, wnt4 for5 ATGATCCTCACCCACCTGAG, wnt4 rev5 ACCTGACCAGCATTGTTTCC, wnt2 for CAATAACCGAGCAGGGAGAAC, wnt2 rev CATGAGTCTATCGCCAACCAG, fz3 for TCTGCTTCGTCCTGACACTG, fz3 rev CCTTGCTTGATTGTGGAACAC, Rp49_up ATGACCATCCGCCCAGCATAC, Rp49_rev2 GCTTAGCATATCGATCCGACTGG.
| 0.423826 | -1.296515 | 2.827009 | -2.526115 |
Walikale and Masisi north of Goma were the centres of Mai-Mai activity in North Kivu.
| -0.01706 | 2.307539 | -0.232146 | 1.943295 |
Shops selling charms, gris-gris, candles, and powders cater to both tourists and practitioners.
| -1.734423 | -0.890684 | -0.08889 | -1.995752 |
X axis (diameter): 400 mm / 15.75" Z axis (length): 400 mm /15.75" X axis (diameter): 400 mm /15.75" Z axis (length): 600 mm / 23.62"
| 0.417831 | -1.518104 | 0.361449 | -1.096468 |
The result is faster access to frequently accessed data by users anywhere in the world.
| 0.865472 | 0.140404 | -0.202417 | 0.918919 |
Labrador Retriever is probably the most popular dog breed in the world.
| -0.146765 | 2.244384 | -0.45825 | 1.939847 |
Domesticated guinea pigs have gotten smarter over the years, learning at much faster rates than their wild ancestors, known as cavies.
| 1.549361 | 0.435548 | 0.371772 | 1.310446 |
TKSS 715 A two year, fourteen lesson plan program for middle school students, which focuses on drugs that adolescents are most likely to use: alcohol, tobacco, marijuana, and inhalants.
| 2.201714 | 3.487533 | 0.829037 | 3.910315 |
It received the mandate for Palestine from the League of Nations in 1917, and from the beginning of its occupation of Palestine until it relinquished the territory on May 15, 1948, Britain did all it could to suppress the Palestinian people and to arrest and deport their leaders.
| 2.689247 | 0.129931 | 1.454897 | 1.256861 |
Cheryl Dybas, NSF (703) 292-7734 [EMAIL] Stephanie Murphy, WHOI (508) 289-3340 [EMAIL] Nereus Slideshow: [URL] Nereus Animation: [URL] The National Science Foundation (NSF) is an independent federal agency that supports fundamental research and education across all fields of science and engineering.
| 0.729548 | -0.824671 | 1.563463 | -1.09389 |
It is Toms favorite ride and would have loved to ride over and over again.
| -1.810133 | 0.73795 | -0.406871 | -0.573502 |
- Cosmetic (also called aesthetic) procedures alter a part of the body that the person is not satisfied with.
| 1.749538 | 0.550885 | 0.091978 | 1.739727 |
You can do that by simply entering "gdp of france / italy."
| -0.762629 | -2.705855 | -0.6837 | -2.267703 |
Conclusion ========== This paper investigates common metrics used in measurement-based dynamic load modeling techniques to generate response error.
| 0.834693 | 2.588304 | 0.50048 | 2.351587 |
They didn’t like this lake much.
| -0.924927 | -1.642645 | -1.314123 | -1.151814 |
Think of the possibilities for an informal post-event survey … 4.
| -1.104439 | -2.988366 | -0.566656 | -2.832452 |
His eyes were dimmed with tears and his thoughts were far away.
| -0.824772 | 0.360426 | -0.604637 | 0.030985 |
Quality of Service (QoS) features can be used to increase the reliability of routing protocols.
| 0.839846 | 1.893649 | -0.08889 | 2.19647 |
PEV Labs offers general fabrication, digital fabrication, co-working fabrication, product prototyping, and small run manufacturing services in Waynesboro VA. We can provide a make it workshop series to work with you on a project you want to bring to fruition.
| -0.361722 | 3.543771 | 1.33375 | 1.619743 |
Sweet Bath Vanity With Sink Shop Bathroom Vanities Cabinets At The Intended For Decor 7.
| -2.348371 | -1.046903 | -0.187764 | -2.533808 |
One such syndrome is Down's syndrome.
| 0.713425 | 0.046159 | -1.221225 | 1.390561 |
108(h)(2), 163(h)(3)(B)(i).
| -1.215372 | -0.636901 | -1.560666 | -0.43145 |
This can be printed out as a study guide for students, used as a "key" for leading a class discussion, or you can jump to the quiz/homework section to find worksheets that incorporate these descriptions into a variety of question formats.
| 1.509171 | 0.150877 | 1.204167 | 0.513525 |
I am passionate about teaching and my focus in not ransom.I have motivated many students to study and I can help any pupil who has the willingness to learn, apart from the state they are in.
| 0.048982 | -0.093404 | 0.867988 | -0.600733 |
It was founded in 1256 by King Daniel of Galicia and fell under Polish control in the 14th century.
| 1.281563 | 0.482727 | -0.035073 | 1.403136 |
Have a look at my zoo here: organiceric (<-- my ID) ... nice zoo, but why is there a FARM next to it ?
| -0.961581 | -1.988258 | 0.004119 | -2.310448 |
- 13.2 percent stemmed from ethnicity/national origin bias.
| 1.719656 | 0.028709 | -0.6837 | 1.813621 |
However, it often depends on the courses the student has completed.
| 0.106744 | 0.089787 | -0.529631 | 0.499104 |
Epiphan Video epiphan Pearl Mini all-in-one live production device April 20, OttawaEpiphanCanada.
| -1.544925 | -1.531945 | -0.061751 | -2.366878 |
Germ cells give rise to sperm throughout a man's life.
| 0.569596 | 0.695983 | -0.789035 | 1.504605 |
HarperCollins, 2001.
| -0.612739 | 1.042344 | -1.867399 | 1.553751 |
Solve 4 + o = i for i.
| 0.059264 | -0.365325 | -1.771684 | 0.915802 |
How to Get All the Change Out of Vending Machine Cons WonderHowTo Musely Who here has tried this gem 48chan Vending Machine Hack randomness Pinterest Vending machine Vending Machine Hack Manhattan Wiki How to Hack a Vending Machine 48 Tricks to Getting Free Drinks Soda Machine Hack Code YouTube How to hack a PEPSI vending machine for a free soda YouTube How To Hack Soda Vending Machines Shitwhy didn't I think of that Hacking A Coke Machine YouTube How To Hack Into A Vending Machine.
| 0.295097 | -1.614975 | 2.363008 | -2.57341 |
See 50 pages of testimonials of deals being done uniquely started on ICIWorld here on the Internet.
| -1.829265 | -1.102405 | -0.035073 | -2.270679 |
De Niro steals he spotlight when he enters in drag as Blizzard's mom.
| -1.734423 | -0.476786 | -0.493512 | -1.408107 |
We're talking about the conifer, the umbrella term for cone-bearing trees like the spruce, fir, pine, cypress and cedar.
| 1.573201 | 1.949752 | 0.221023 | 2.612009 |
People come to see us for confidential therapy for many reasons: sometimes to fix very specific problems, to cope with moments of crisis such as a bereavement, work issues or abuse.
| 0.381585 | 1.578178 | 0.797242 | 1.013342 |
Her vast knowledge and skills have also been utilized in kidney dialysis centers.
| -0.422322 | -0.570783 | -0.293388 | -0.585634 |
You get: SignSlapper 20 Sign Building Software Decorative Ironwork Designs for CNC Dog and Cat Designs for CNC Call to Duty Designs for CNC European-Style Designs for CNC Farm and Tractor Designs for CNC Game and Fish Designs for CNC Mimbres Indian-Style Designs for CNC Ocean Life Designs for CNC Rods, Quads, Trucks and bikes Designs for CNC Sports Designs for CNC Way Out West Designs for CNC Real Western Designs for CNC Nature and Wildlife for CNC Gate and Railing Panels and Pickets for CNC #1
| 0.192787 | -1.144019 | 2.404955 | -2.312357 |
The first European record of a landing on the Washington coast was by Spanish Captain Don Bruno de Heceta in 1775, on board the Santiago, part of a two-ship flotilla with the Sonora.
| 2.111659 | 0.321998 | 0.805245 | 1.378867 |
N. Liddick' - 'A.
| -1.56288 | -0.650817 | -2.027051 | -0.410093 |
It seems that the film does what few films are capable of: Creating an ending that almost forces the viewer to forget about all of the tired cliches used in the rest of the film.
| -0.668113 | 0.07757 | 0.773012 | -0.966052 |
By developing this ability one will become a great healer, seer or spiritual teacher.
| -0.634752 | -2.340349 | -0.232146 | -2.176153 |
The Petroleum Technology Research Centre (PTRC) is a not-for-profit corporation founded in 1998 to facilitate research and development and field demonstration projects into enhanced oil recovery and carbon storage, with the goals of improving recovery rates while reducing the environmental footprint of the oil and gas industry.
| 1.764362 | 2.293504 | 1.710682 | 2.059143 |
Come.
| -1.035036 | 0.318505 | -3.096761 | 1.458706 |
colored flashing lightup ugly Christmas Krampus sweater with mock turtleneck and all over snowflake pattern in earth tones.
| -2.492011 | -1.157888 | 0.254509 | -3.0214 |
Use the Google search engine for this.
| -0.232998 | -2.443832 | -1.191647 | -1.317152 |
Texts purported to document the kind and reasonable treatment of slaves in the South.
| 1.210397 | -0.326997 | -0.232146 | 0.842488 |
freshly I prepare looks a dream of photographing using repression that you could work in the email you friction about modernist being for book.
| -1.31621 | -1.37964 | 0.461918 | -2.410256 |
Karst is a geological feature formed by the dissolution of soluble bedrock such as carbonates like limestone and dolostone.
| 2.058883 | 1.599204 | 0.254509 | 2.695894 |
Expression of these genes also becomes activated or further up-regulated upon enforced hypomethylation by the DNA methyltransferase inhibitor 5-aza-2′-deoxycytidine (5-aza-CdR), and to date, all CT genes studied have up-regulated expression in response to this chemotherapeutic agent, indicating a commonality in the mechanistic pathway for somatic CT gene silencing \\[for example, see [@R18]-[@R23]\\].
| 0.803567 | -2.492113 | 2.046776 | -2.65563 |
You could use the NMTOKENS escape hatch, which would mean that after both tools have done their work the comment would look as follows: <p>I just want to be sure your readers know we're aware of the stability problems with the latest release.
| -1.067911 | -1.822421 | 1.229561 | -3.062956 |
The religious life is led by some sect or creed that claims to have found the way out of the bounds of earth-consciousness into some beatific Beyond.
| -0.232998 | -0.086427 | 0.519435 | -0.5886 |
How is this?
| -0.873551 | -2.402442 | -2.354628 | -1.027566 |
t-rich was blocking for jones and greene on a regular basis.
| -1.835661 | -1.614975 | -0.663527 | -2.266894 |
L'Artisan Seville is gorgeous and a little naughty,… Continue Reading →... We happily arrive at my favorite – iris perfume.
| -1.494501 | -1.518104 | 0.254509 | -2.522822 |
"Well, my job is clear—so here goes!"
| -3.379812 | -0.942777 | -1.221225 | -2.5854 |
His powers of intuition enabled him to see deep connections between seemingly remote branches of mathematics.
| 0.592218 | -1.808597 | 0.091978 | -1.011591 |
So, he contacted Royal and the two set up a meet in MercTown.
| -1.816501 | -0.211972 | -0.643631 | -1.16726 |
Here is what we put together for the listing of the recommendations for the top ten greatest adjustable bar stools in 2018.
| -1.098538 | -2.008981 | 0.254509 | -2.597076 |
If you are a first timer or maybe someone hunting to save some money, then the few rental web sites online can certainly quote a good selling price and get a nearby dumpster of the suitable size to your blog as soon as possible.
| -0.333901 | 0.970598 | 1.139099 | -0.24465 |
/// </returns> static bool IsEar(int i, float[] xv, float[] yv, int xvLength) { float dx0, dy0, dx1, dy1; if (i >= xvLength || i < 0 || xvLength < 3) { return false; } int upper = i + 1; int lower = i - 1; if (i == 0) { dx0 = xv[0] - xv[xvLength - 1]; dy0 = yv[0] - yv[xvLength - 1]; dx1 = xv[1] - xv[0]; dy1 = yv[1] - yv[0]; lower = xvLength - 1; } else if (i == xvLength - 1) { dx0 = xv[i] - xv[i - 1]; dy0 = yv[i] - yv[i - 1]; dx1 = xv[0] - xv[i]; dy1 = yv[0] - yv[i]; upper = 0; } else { dx0 = xv[i] - xv[i - 1]; dy0 = yv[i] - yv[i - 1]; dx1 = xv[i + 1] - xv[i]; dy1 = yv[i + 1] - yv[i]; } float cross = dx0 * dy1 - dx1 * dy0; if (cross > 0) return false; var myTri = new Triangle(xv[i], yv[i], xv[upper], yv[upper], xv[lower], yv[lower]); for (int j = 0; j < xvLength; ++j) { if (j == i || j == lower || j == upper) continue; if (myTri.IsInside(xv[j], yv[j])) return false; } return true; } class Triangle : Vertices { //Constructor automatically fixes orientation to ccw public Triangle(float x1, float y1, float x2, float y2, float x3, float y3) { float cross = (x2 - x1) * (y3 - y1) - (x3 - x1) * (y2 - y1); if (cross > 0) { Add(new Vector2(x1, y1)); Add(new Vector2(x2, y2)); Add(new Vector2(x3, y3)); } else { Add(new Vector2(x1, y1)); Add(new Vector2(x3, y3)); Add(new Vector2(x2, y2)); } } public bool IsInside(float x, float y) { Vector2 a = this[0]; Vector2 b = this[1]; Vector2 c = this[2]; if (x < a.X && x < b.X && x < c.X) return false; if (x > a.X && x > b.X && x > c.X) return false; if (y < a.Y && y < b.Y && y < c.Y) return false; if (y > a.Y && y > b.Y && y > c.Y) return false; float vx2 = x - a.X; float vy2 = y - a.Y; float vx1 = b.X - a.X; float vy1 = b.Y - a.Y; float vx0 = c.X - a.X; float vy0 = c.Y - a.Y; float dot00 = vx0 * vx0 + vy0 * vy0; float dot01 = vx0 * vx1 + vy0 * vy1; float dot02 = vx0 * vx2 + vy0 * vy2; float dot11 = vx1 * vx1 + vy1 * vy1; float dot12 = vx1 * vx2 + vy1 * vy2; float invDenom = 1.0f / (dot00 * dot11 - dot01 * dot01); float u = (dot11 * dot02 - dot01 * dot12) * invDenom; float v = (dot00 * dot12 - dot01 * dot02) * invDenom; return ((u > 0) && (v > 0) && (u + v < 1)); } } } }
| 1.501064 | -1.254939 | 5.256723 | -3.235146 |
A mood of solemnity, suitable for prayer, pervades the scene.
| -1.150735 | -0.96708 | -0.643631 | -1.237155 |
g Suppose -12 = 3*z, z - 56 = -3*l + 3*z.
| 0.58093 | 0.661014 | -1.106625 | 1.693203 |
- Rhea, Gordon C. The Battles for Spotsylvania Court House and the Road to Yellow Tavern May 7–12, 1864.
| 1.307789 | 2.518101 | 0.029719 | 2.973749 |
1a](#f1){ref-type="fig"} is osmotically induced by the transport of the electric charges at the surface of the insulating adhesive films.
| 1.263941 | 1.045844 | 0.402364 | 1.544661 |
So maybe he now avoids pancake waitresses, porn stars, teenage girls, and any other wicked female with nothing better to do but have sexual activity with a star athlete, after losing out on something very priceless.
| -1.978674 | -1.490418 | 1.050877 | -3.399227 |
"Sorry kids, Daddy is busy" What is the price for TrackIr?
| -1.919636 | -1.946808 | -0.704159 | -2.565701 |
On recently turned earth - once again the overpowering scent will make Tuna Tracking very difficult.
| -1.459306 | -0.727336 | -0.021901 | -1.696406 |
chemical operator resume charming decoration process operator resume chemical showy images of photo albums resume for process operator.
| -1.121553 | -1.670311 | 0.382032 | -2.433281 |
12 Let v = -1055924/11 + 95920.
| -0.294646 | 0.989846 | -1.414084 | 1.465947 |
There was certainly something of the sort, Raskolnikov could have sworn he winked at him, goodness knows why.
| -1.533001 | -1.545785 | 0.091978 | -2.468618 |
Requires refund value be indicated on container.
| -1.978674 | -1.680685 | -0.926689 | -2.258589 |
A multi-ethnic society The Russian Federation is a diverse, multi-ethnic society, home to as many as 160 different ethnic groups and indigenous peoples.
| 2.239449 | 2.167204 | 0.547477 | 3.090492 |
In other markets the Prius V is sold as a three-row multi-person vehicle, which means all versions worldwide include second row seating set… Continue Reading...
| -0.326004 | -2.54556 | 0.620073 | -2.65085 |
--- abstract: 'We analyze heat and charge transport through a single-level quantum dot coupled to two BCS superconductors at different temperatures to first order in the tunnel coupling.
| 0.453606 | 1.059845 | 0.836896 | 0.638319 |
"com.typesafe.akka" %% "akka-cluster-tools" % "2.5.11"
| -0.412127 | -1.504261 | -0.789035 | -0.98476 |
Burglary is a felony, even when the intended crime is a misdemeanor, and the intent to commit the crime can occur when one "enters or remains unlawfully" in the building, expanding the common law definition.
| 1.071848 | 0.648776 | 0.994363 | 0.69772 |
The bucket is maneuvered by means of a number of ropes and chains.
| -0.143077 | 0.465252 | -0.548027 | 0.609396 |
d899 In base 5, what is -32211234 + -3?
| -0.302451 | -1.351936 | -1.162707 | -0.53613 |
Desejam permanecer livres.
| -0.962361 | -1.531945 | -1.60011 | -0.908015 |
But feel free to send me any suggestions to improvements or your own modifications.
| -0.858794 | 1.385487 | -0.262461 | 0.583191 |
Beschreibung FIELD OF THE INVENTION This invention relates to a mold-BGA (ball grid array)-type semiconductor device and a method for making the same.
| 1.525317 | 2.890261 | 0.528834 | 3.10963 |
At a preclinical stage, a decrease in systolic myocardial strain has been suggested in echocardiographic studies.
| -0.027635 | -0.177105 | 0.140102 | -0.251531 |
Maybe you like thin guys or maybe you like them to be more hunky.
| -1.939234 | -1.71872 | -0.566656 | -2.492252 |
This would not just be economic fine-tuning.
| -0.545622 | -1.417727 | -1.026614 | -0.866583 |
(L) Kerre Millman (Center) Elaine R. Millman 5th Degree Witch Stew Webb's ex-not-mother-in-law, (R) Attorney Allen Karsh Drug Smuggler from Mexico into Colorado, Illuminati 12 Leonard Millmand Mob Attorney, Elaine Millman's Brother, controls 50 Billion Millman Estate.
| -1.021608 | -1.587302 | 1.386632 | -2.945209 |
Keep 'em guessing what you're gonna do next with Tease Me, a rosy pink metallic liquid lipstick with all-day appeal.
| -2.180791 | -0.50116 | 0.175277 | -2.212476 |
net offers a comprehensive guide and reviews best poker sites USA poker sites online poker bonuses Mac poker rooms.
| -0.92385 | -1.504261 | 0.163637 | -2.006298 |
- The Moon's position is marked with this symbol: .
| 1.55733 | -0.504642 | -0.856183 | 1.381838 |
Now, Click on Hola Extension icon which is located above the Bookmarks bar.
| -1.503351 | -1.614975 | -0.390128 | -2.185189 |
This effect could be ascribed neither to the pH of the CSF nor to the potassium concentration.
| 0.552506 | -0.213715 | -0.102637 | 0.331973 |
- While they are drawing the turbulent sea, cut out a semi circle, a long thin rectangle, two triangles and 3 small circles.
| 1.977824 | 0.374401 | 0.265521 | 1.667093 |
3, 13, 389849 What are the prime factors of 76095146?
| 0.301366 | -1.905352 | -0.811066 | -0.725991 |
Probability sampling would determine school and classroom selection, but adults would be recruited by parents of children in these classrooms.
| 1.071848 | 0.975848 | 0.452138 | 1.307163 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.