article
stringlengths 0
826k
| abstract
stringlengths 174
4.34k
|
---|---|
autism spectrum disorder ( asd ) , tic disorder ( td ) , and hyperkinetic syndrome of childhood ( also known as attention deficit disorder [ add]/attention deficit hyperactivity disorder [ adhd ] ) are neurodevelopmental disorders .
moreover , these disorders present with a similar pattern of abnormal brain connectivity of long - range underconnectivity and short - range overconnectivity . as a consequence
, it was suggested that these disorders may be subsets in what could be termed an abnormal connectivity spectrum disorder ( acsd ) .
it has also been hypothesized that the etiological basis of acsds is plausibly related to neuronal insult ( eg , neurotoxicity , neuroinflammation , excitotoxicity , sustained microglial activation , proinflammatory cytokines , toxic exposure , and oxidative stress ) , and the neuronal insult can ultimately cause loss of long - range connectivity and a resultant increase in short - range connectivity .
certain neurotoxicants , including mercury ( hg ) , show neuropathological evidence of loss of long - range connections and a resultant increase in short - range connections .
mercury is a recognized ubiquitous environmental neurotoxicant , and there is mounting evidence linking it to asd , td , and add / adhd .
a published meta - analysis of epidemiological evidence of the impact of prenatal and early infancy exposure to hg and the long - term risk of a child being diagnosed with an asd or add / adhd revealed significant associations for both asd ( odds ratio [ or ] = 1.66 , 95% confidence interval [ ci ] = 1.14 - 2.17 ) and add / adhd ( or = 1.60 , 95% ci = 1.10 - 2.33 ) .
of particular recent concern , the routine administration of thimerosal ( 49.55% hg by weight)-containing childhood vaccines has become a significant source of organic hg ( thimerosal is 56.7% ethyl - hg by weight ) exposure from some vaccines .
thimerosal is present in some influenza vaccines routinely recommended for administration to pregnant women , infants , and children in the united states , and it continues to remain in most multidose formulations of childhood vaccines recommended for routine administration in the developing world .
it is estimated that some children received more than 50% of their hg exposure in early childhood from routine childhood vaccination , and that when combined with environmental hg exposure , some children received instantaneous and total hg doses manyfold in excess of the hg safety limits established by the us environmental protection agency ( 0.7 g hg / kg bodyweight / week ) , health canada ( 1.4 g hg / kg bodyweight / week ) , world health organization ( 1.6 g hg / kg bodyweight / week ) , the us centers for disease control and prevention ( cdc ) s agency for toxic substances and disease registry ( 2.1 g hg / kg bodyweight / week ) , and us food and drug administration ( 2.8 g hg / kg bodyweight / week ) .
it was previously revealed that thimerosal exposure is capable of inducing neuronal cell damage consistent with that observed in neuropathology studies of children diagnosed with neurodevelopmental disorders , including mitochondrial damage , reduced oxidative - reduction activity , cellular degeneration , and cell death .
previous epidemiological studies of medical records showed that there were significant associations between exposures to increasing doses of hg from thimerosal - containing hepatitis b vaccines ( 12.5 g hg / dose and a total of 37.5 g hg ) administered within the first 6 months of life and the increasing long - term risk of a child being diagnosed with an asd , td , or add / adhd .
other epidemiological studies of medical records demonstrated that the relationship between increasing exposure to hg from thimerosal - containing hepatitis b vaccines and the increased risk of diagnosed neurodevelopmental disorder outcomes was dose dependent .
importantly , some of the aforementioned studies suggested that total cumulative exposure to hg , timing of exposure to hg , and gender may modulate the risks observed .
as a consequence of these previous studies , the present study undertook a secondary data analysis of existing medical records data using a case - control study methodology to further epidemiologically evaluate the potential relationship between exposure to hg from thimerosal - containing vaccine administration in early childhood and the long - term risk of a child being diagnosed with the acsds of asd , td , and add / adhd .
the current study is differentiated from previous studies by examining a different type of vaccine , haemophilus influenzae type b ( hib ) , administered to infants at different exposure windows ( ie , at 2 , 4 , 6 , and 15 months ) and with different bolus and cumulative hg doses ( ie , 25 g hg / dose and a total of 100 g hg ) .
in addition , the potential impacts of gender were examined by analyzing the data separated by gender .
the specific new hypothesis tested in this study was that cases diagnosed with an acsd in comparison to controls would , in a dose - dependent manner , be at greater odds of receiving increasing discrete doses of hg exposure from thimerosal - containing hib vaccines ( 50 g hg vs 25 g hg , 75 g hg vs 25 g hg , 100 g hg vs 25 g hg ) administered within the first 15 months of life .
the study protocol was approved by the cdc , the institutional review board ( irb ) of kaiser permanente northwest ( kpnw ) , and the irb of kaiser permanente northern california ( kpnc ) .
the data were analyzed between 2013 and 2014 at the secure research data center of the national center for health statistics in hyattsville , maryland .
the views expressed in this study do not necessarily reflect those of the cdc or those of kaiser permanente .
a cohort of over 1.95 million children in the vaccine safety datalink ( vsd ) project ( updated through the end of 2000 ) from kpnw , kaiser permanente colorado , and kpnc were examined using sas software ( version 9.3 ) .
. the project links medical event information , specific vaccine history , and selected demographic information from the computerized databases of several health maintenance organizations ( hmos ) .
the cohort examined was comprised of children with nonmissing date of birth and nonmissing gender , who were continuously hmo - enrolled from their date of birth .
the outcome files ( inpatient and outpatient diagnoses ) from the vsd population were reviewed to find the first instance of international classification of disease , ninth revision outcomes of asd ( 299.xx ) , td ( 307.2x ) , or add / adhd ( 314.xx ) , which when referring to all 3 disorders will be referred to as an acsd .
each specific diagnosis examined was analyzed independently , so children may have received 1 or more of the other diagnoses examined in this study .
if there were multiple instances of the same diagnosis in a child , only the first instance was counted .
all participants diagnosed with any of the acsd diagnoses examined had to be continuously hmo - enrolled from birth until their initial acsd diagnosis .
in addition , only participants diagnosed with an acsd following the administration of all vaccines under study were included in the present analyses as cases .
table 1 summarizes the demographics of the various acsd diagnoses examined . a summary of various types of cases and controls examined in the present study .
abbreviations : acsd , abnormal connectivity spectrum disorder ; add / adhd , attention deficit disorder / attention deficit hyperactivity disorder ; asd , autism spectrum disorder ; f , females ; hib , haemophilus influenzae type b ; icd-9 , international classification of disease , ninth revision ; m , males ; sd , standard deviation .
these controls were followed to the mean age of initial diagnosis plus 1 sd .
these outcomes were specifically chosen as not biologically plausibly linked to postnatal hg exposure from thimerosal in hib - containing vaccines .
in addition , control outcomes were selected to be generally accepted as not biologically plausibly linked to hg exposure .
they were utilized to determine whether there was outcome specificity to the potential adverse effects of thimerosal exposure or whether any potential adverse effects of thimerosal exposure were simply the potential result of an unknown bias / confounder .
the control outcomes of febrile seizure ( 780.3x ) , unspecified metabolic disturbances ( 277.xx ) , or cerebral degenerations ( 330.xx or 331.xx ) were examined .
these diagnoses were analyzed independently of the acsd diagnoses examined and independently of each other , so a child diagnosed with any one of the control outcomes may have also been diagnosed with 1 or more other control outcomes and/or 1 or more of the acsd diagnoses examined .
the outcome files ( inpatient and outpatient diagnoses ) from the vsd population were reviewed to find the first instance of febrile seizures , unspecified metabolic disturbances , or cerebral degenerations . if there were multiple instances of the same diagnosis in a participant , only the first instance was counted .
in addition , only participants diagnosed with febrile seizures , unspecified metabolic disturbances , or cerebral degenerations following the administration of all vaccines under study were included in the present analyses as cases .
table 1 summarizes the demographics of the various control outcomes examined in the present study . to identify controls who would have only a minimal chance of receiving one of the various acsd diagnoses examined , controls had to have been continuously enrolled from birth until the mean age of initial diagnosis of the specific acsd diagnosis examined plus twice the standard deviation of the mean age of initial diagnosis of that diagnosis .
this length of follow - up was shortened to the mean age of initial diagnosis plus the standard deviation of the mean age of initial diagnosis for the outcomes of td and adhd .
this was done because the mean ages of initial diagnosis for td ( 5.1 years ) and add / adhd ( 5.7 years ) were so long that , because of the time limitations on the years of records that were available to study , requiring continuous enrollment from birth until the mean age of initial diagnosis of the specific diagnosis being assessed plus more than 1 standard deviation of the mean age of initial diagnosis would have resulted in too few controls or no controls for comparison to those cases .
for the outcomes of febrile seizure , unspecified metabolic disturbances , and cerebral degenerations , controls had to have been continuously enrolled from birth until the mean age of initial diagnosis of the specific diagnosis being assessed plus twice the standard deviation of the mean age of initial diagnosis of that specific diagnosis .
the vaccine file for cases and controls was then reviewed to determine the exact dates of hib - containing vaccine administration .
data access restrictions by the cdc precluded examining more than 1 vaccine at a time , so hib vaccine was selected as a vaccine that many children received during the 1990s , as described below . overall , among the cases and controls , hg exposure was assigned as follows25 g hg per dose for whole - cell diphtheria - tetanus - pertussis - hib vaccine ; 25 g hg per dose for diphtheria - tetanus - acellular - pertussis ( dtap)-hib vaccine ; 25 g hg per dose for hib vaccine manufactured by lederle , praxis biologics , wyeth - ayerst , or aventis pasteur , inc ; 0 g hg per dose for hib vaccine manufactured by merck and company , inc or glaxosmithkline ; 0 g hg per dose for hib - hepatitis b vaccine ; and 0 g hg per dose for those not receiving any type of hib - containing vaccine .
the thimerosal content for each of the aforementioned vaccines was determined from the official report by the committee on infectious diseases and committee on environmental health of the american academy of pediatrics .
the statsdirect ( version 3.0.150 ) software was utilized for statistical analyses , and a 2-sided p value < .05 was considered statistically significant .
the logistic regression function was used for each of the case versus control comparisons examined in this study .
outcomes in the logistic regression function were based upon the presence of diagnosis ( case ) or absence of diagnosis ( control ) .
exposure in the logistic regression function was based upon each additional 25 g hg unit of exposure from hib - containing vaccines with thimerosal administered within the first 15 months of life .
the reference group was selected as those receiving 25 g hg from hib - containing vaccines rather than 0 g hg from hib - containing vaccines administered within the first 15 months of life to potentially minimize the healthy vaccine effect associated with those receiving vaccines in comparison to those not receiving vaccines , as further described below .
the ors calculated from the logistic regression function were determined per additional 25 g hg from hib - containing vaccines administered within the first 15 months of life .
furthermore , in order to more fully evaluate the potential relationship between hg exposure from hib - containing vaccines administered within the first 15 months of life and the acsd outcomes examined , fisher exact statistical test was utilized to determine the discrete or for exposure to 50 g hg , 75 g hg , or 100 g hg from hib - containing vaccines in comparison to a reference group receiving 25 g hg from hib - containing vaccines administered within the first 15 months of life .
the overall null hypotheses for each comparison in the present study was that there would be no difference in the frequency of exposure to hg from hib - containing vaccines between cases and controls for each of the outcomes examined .
a cohort of over 1.95 million children in the vaccine safety datalink ( vsd ) project ( updated through the end of 2000 ) from kpnw , kaiser permanente colorado , and kpnc were examined using sas software ( version 9.3 ) .
. the project links medical event information , specific vaccine history , and selected demographic information from the computerized databases of several health maintenance organizations ( hmos ) .
the cohort examined was comprised of children with nonmissing date of birth and nonmissing gender , who were continuously hmo - enrolled from their date of birth .
the outcome files ( inpatient and outpatient diagnoses ) from the vsd population were reviewed to find the first instance of international classification of disease , ninth revision outcomes of asd ( 299.xx ) , td ( 307.2x ) , or add / adhd ( 314.xx ) , which when referring to all 3 disorders will be referred to as an acsd . each specific diagnosis examined was analyzed independently , so children may have received 1 or more of the other diagnoses examined in this study .
if there were multiple instances of the same diagnosis in a child , only the first instance was counted .
all participants diagnosed with any of the acsd diagnoses examined had to be continuously hmo - enrolled from birth until their initial acsd diagnosis .
in addition , only participants diagnosed with an acsd following the administration of all vaccines under study were included in the present analyses as cases .
abbreviations : acsd , abnormal connectivity spectrum disorder ; add / adhd , attention deficit disorder / attention deficit hyperactivity disorder ; asd , autism spectrum disorder ; f , females ; hib , haemophilus influenzae type b ; icd-9 , international classification of disease , ninth revision ; m , males ; sd , standard deviation .
these controls were followed to the mean age of initial diagnosis plus 1 sd .
these outcomes were specifically chosen as not biologically plausibly linked to postnatal hg exposure from thimerosal in hib - containing vaccines .
in addition , control outcomes were selected to be generally accepted as not biologically plausibly linked to hg exposure .
they were utilized to determine whether there was outcome specificity to the potential adverse effects of thimerosal exposure or whether any potential adverse effects of thimerosal exposure were simply the potential result of an unknown bias / confounder .
the control outcomes of febrile seizure ( 780.3x ) , unspecified metabolic disturbances ( 277.xx ) , or cerebral degenerations ( 330.xx or 331.xx ) were examined .
these diagnoses were analyzed independently of the acsd diagnoses examined and independently of each other , so a child diagnosed with any one of the control outcomes may have also been diagnosed with 1 or more other control outcomes and/or 1 or more of the acsd diagnoses examined .
the outcome files ( inpatient and outpatient diagnoses ) from the vsd population were reviewed to find the first instance of febrile seizures , unspecified metabolic disturbances , or cerebral degenerations . if there were multiple instances of the same diagnosis in a participant , only the first instance was counted .
in addition , only participants diagnosed with febrile seizures , unspecified metabolic disturbances , or cerebral degenerations following the administration of all vaccines under study were included in the present analyses as cases .
table 1 summarizes the demographics of the various control outcomes examined in the present study .
to identify controls who would have only a minimal chance of receiving one of the various acsd diagnoses examined , controls had to have been continuously enrolled from birth until the mean age of initial diagnosis of the specific acsd diagnosis examined plus twice the standard deviation of the mean age of initial diagnosis of that diagnosis .
this length of follow - up was shortened to the mean age of initial diagnosis plus the standard deviation of the mean age of initial diagnosis for the outcomes of td and adhd .
this was done because the mean ages of initial diagnosis for td ( 5.1 years ) and add / adhd ( 5.7 years ) were so long that , because of the time limitations on the years of records that were available to study , requiring continuous enrollment from birth until the mean age of initial diagnosis of the specific diagnosis being assessed plus more than 1 standard deviation of the mean age of initial diagnosis would have resulted in too few controls or no controls for comparison to those cases . for the outcomes of febrile seizure , unspecified metabolic disturbances , and cerebral degenerations , controls had to have been continuously enrolled from birth until the mean age of initial diagnosis of the specific diagnosis being assessed plus twice the standard deviation of the mean age of initial diagnosis of that specific diagnosis .
the vaccine file for cases and controls was then reviewed to determine the exact dates of hib - containing vaccine administration .
data access restrictions by the cdc precluded examining more than 1 vaccine at a time , so hib vaccine was selected as a vaccine that many children received during the 1990s , as described below .
overall , among the cases and controls , hg exposure was assigned as follows25 g hg per dose for whole - cell diphtheria - tetanus - pertussis - hib vaccine ; 25 g hg per dose for diphtheria - tetanus - acellular - pertussis ( dtap)-hib vaccine ; 25 g hg per dose for hib vaccine manufactured by lederle , praxis biologics , wyeth - ayerst , or aventis pasteur , inc ; 0 g hg per dose for hib vaccine manufactured by merck and company , inc or glaxosmithkline ; 0 g hg per dose for hib - hepatitis b vaccine ; and 0 g hg per dose for those not receiving any type of hib - containing vaccine . the thimerosal content for each of the aforementioned vaccines
was determined from the official report by the committee on infectious diseases and committee on environmental health of the american academy of pediatrics .
the statsdirect ( version 3.0.150 ) software was utilized for statistical analyses , and a 2-sided p value < .05 was considered statistically significant .
the logistic regression function was used for each of the case versus control comparisons examined in this study .
outcomes in the logistic regression function were based upon the presence of diagnosis ( case ) or absence of diagnosis ( control ) .
exposure in the logistic regression function was based upon each additional 25 g hg unit of exposure from hib - containing vaccines with thimerosal administered within the first 15 months of life .
the reference group was selected as those receiving 25 g hg from hib - containing vaccines rather than 0 g hg from hib - containing vaccines administered within the first 15 months of life to potentially minimize the healthy vaccine effect associated with those receiving vaccines in comparison to those not receiving vaccines , as further described below .
the ors calculated from the logistic regression function were determined per additional 25 g hg from hib - containing vaccines administered within the first 15 months of life .
furthermore , in order to more fully evaluate the potential relationship between hg exposure from hib - containing vaccines administered within the first 15 months of life and the acsd outcomes examined , fisher exact statistical test was utilized to determine the discrete or for exposure to 50 g hg , 75 g hg , or 100 g hg from hib - containing vaccines in comparison to a reference group receiving 25 g hg from hib - containing vaccines administered within the first 15 months of life .
the overall null hypotheses for each comparison in the present study was that there would be no difference in the frequency of exposure to hg from hib - containing vaccines between cases and controls for each of the outcomes examined .
table 2 shows the increasing dose - dependent relationships between the various acsd diagnoses examined and hg exposure from hib - containing vaccines administered within the first 15 months of life .
cases diagnosed with asd ( or = 1.493 per 25 g hg exposure , p < .001 , 95% ci = 1.359 - 1.627 ) , td ( or = 1.428 per 25 g hg exposure , p <
.001 , 95% ci = 1.256 - 1.600 ) , or add / adhd ( or = 1.503 per 25 g hg exposure , p < .001 , 95% ci = 1.425 - 1.582 ) in comparison to controls were significantly more likely to receive increased hg exposure from hib - containing vaccines administered within the first 15 months of life .
overall , cases diagnosed with asd ( or = 2.478 per 75 g hg exposure , 95% ci = 2.075 - 2.881 ) , td ( or = 2.283 per 75 g hg exposure , 95% ci = 1.767 - 2.800 ) , or add / adhd ( or = 2.509 per 75 g hg exposure , 95% ci = 2.2742.746 ) were significantly more likely than controls to receive increased hg exposure from hib - containing vaccines administered within the first 15 months of life . a summary of exposure to hg from hib - containing vaccine administration within the first 15 months of life for the cases diagnosed with a studied abnormal connectivity spectrum disorder and controls .
abbreviations : add / adhd , attention deficit disorder / attention deficit hyperactivity disorder ; asd , autism spectrum disorder ; ci , confidence interval ; hg , mercury ; hib , haemophilus influenzae type b ; icd-9 , international classification of disease , ninth revision .
these controls were followed to the mean age of initial diagnosis plus twice the standard deviation .
these controls were followed to the mean age of initial diagnosis plus 1 standard deviation .
table 3 reveals the dose - dependent relationship between the various acsd diagnoses examined , for male cases in comparison to male controls and female cases in comparison to female controls , and hg exposure from hib - containing vaccines administered within the first 15 months of life .
male cases diagnosed with asd ( or = 1.479 per 25 g hg exposure , p < .001 , 95% ci = 1.329 - 1.629 ) , td ( or = 1.424 per 25 g hg exposure , p < .001 , 95% ci = 1.225 - 1.624 ) , or add / adhd ( or = 1.518 per 25 g hg exposure , p
< .001 , 95% ci = 1.426 - 1.610 ) were significantly more likely than male controls to receive increased hg exposure from hib - containing vaccines administered within the first 15 months of life .
overall , male cases diagnosed with asd ( or = 2.437 per 75 g hg exposure , 95% ci = 1.987 - 2.888 ) , td ( or = 2.273 per 75 g hg exposure , 95% ci = 1.676 - 2.871 ) , or add / adhd ( or = 2.554 per 75 g hg exposure , 95% ci = 2.279 - 2.830 ) were significantly more likely than male controls to receive increased hg exposure from hib - containing vaccines administered within the first 15 months of life .
female cases diagnosed with asd ( or = 1.517 per 25 g hg exposure , p < .001 , 95% ci = 1.217 - 1.821 ) , td ( or = 1.428 per 25 g hg exposure , p < .05 , 95% ci = 1.085 - 1.772 ) , or add / adhd ( or = 1.453 per 25 g hg exposure , p < .05 , 95% ci = 1.290 - 1.616 ) were significantly more likely than female controls to receive increased hg exposure from hib - containing vaccines administered within the first 15 months of life .
overall , female cases diagnosed with asd ( or = 2.557 per 75 g hg exposure , 95% ci = 1.649 - 3.466 ) , td ( or = 2.285 per 75 g hg exposure , 95% ci = 1.254 - 3.316 ) , or add / adhd ( or = 2.359 per 75 g hg exposure , 95% ci = 1.871 - 2.848 ) were significantly more likely than female controls to receive increased hg exposure from hib - containing vaccines administered within the first 15 months of life .
a summary of exposure to hg from hib - containing vaccine administration within the first 15 months of life when separating male and female abnormal connectivity spectrum disorder cases and controls .
abbreviations : add / adhd , attention deficit disorder / attention deficit hyperactivity disorder ; asd , autism spectrum disorder ; ci , confidence interval ; hib , haemophilus influenzae type b ; hg , mercury . as summarized in table 4 for the control outcomes not biologically plausibly linked to hg exposure from hib - containing vaccines , the cases diagnosed with febrile seizures ( or = 0.990 per 25 g hg exposure , p = .607 , 95% ci = 0.950 - 1.029 ) , cerebral degeneration ( or = 0.916 per 25 g hg exposure , p < .001 , 95% ci = 0.859 - 0.974 ) , or unspecified disorders of metabolism ( or = 0.687 per 25 g hg exposure , p < .01 , 95% ci = 0.540 - 0.835 ) were no more likely than the controls to have received increased exposure to hib - containing vaccines administered within the first 15 months of life . a summary of exposure to hg from hib - containing vaccine administration within the first 15 months of life between the cases diagnosed with medical conditions a priori not biologically plausibly linked to postnatal hg exposure from thimerosal in hib - containing vaccines and the controls .
abbreviations : ci , confidence interval ; hg , mercury ; hib , haemophilus influenzae type b ; icd-9 , international classification of disease , ninth revision .
these controls were followed to the mean age of initial diagnosis plus twice the standard deviation .
table 5 reports , for each of the various acsd outcomes examined and controls , the discrete - point ors ( reference exposure = 25 g hg ) and logistic regression estimates for an additional 25 g hg , 50 g hg , or 75 g hg exposure from hib - containing vaccines administered within the first 15 months of life .
it was observed from the discrete point ors that cases diagnosed with asd ( or = 2.785 , 95% ci = 1.852 - 4.353 ) , td ( or = 2.846 , 95% ci = 1.644 - 5.332 ) , or add / adhd ( or = 2.828 , 95% ci = 2.282 - 3.532 ) were significantly more likely than controls to have received an additional 50 g hg exposure from hib - containing vaccines .
it was observed from the discrete - point ors that cases diagnosed with asd ( or = 3.939 , 95% ci = 2.494 - 6.408 ) , td ( 3.674 , 95% ci = 1.973 - 7.268 ) , or add / adhd ( or = 3.471 , 95% ci = 2.697 - 4.468 ) were significantly ( p < .001 ) more likely than controls to have received an additional 75 g hg exposure from hib - containing vaccines .
overall , it was observed that the discrete - point ors and logistic regression estimates of increasing hg dose - dependent risks were similar .
a summary of exposure to additional hg from hib - containing vaccines in comparison to a 25 g hg hib - containing vaccine reference dose administered within the first 15 months of life for the cases diagnosed with a studied abnormal connectivity spectrum disorder and the controls by both discrete - point odds ratio estimates and logistic regression odds ratio estimates .
abbreviations : add / adhd , attention deficit disorder / attention deficit hyperactivity disorder ; asd , autism spectrum disorder ; ci , confidence interval ; hib , haemophilus influenzae type b ; hg , mercury .
the present prospectively collected , longitudinal , hypothesis testing case control epidemiological study was undertaken to evaluate medical records for the potential relationship between the acsd disorder outcomes of asd , td , and add / adhd and hg exposure from thimerosal - containing childhood vaccines .
it was observed that hg exposure from thimerosal - containing childhood vaccines was associated with an overall and dose - dependent increased risk of these outcomes .
in addition , the data were separated by gender to determine whether gender was a mediating factor for the overall associations observed .
it was observed that the significant overall increased risks observed for the acsd disorder outcomes examined remained significantly increased even when the data were separated by the gender status of the exposed individuals . by contrast , none of the 3 a priori selected outcomes that were hypothesized to be not biologically plausibly linked to hg exposure from hib - containing vaccines showed any increase in risk following additional doses of hg from thimerosal - containing childhood vaccines .
the results observed in the present study are consistent with and build upon previously published epidemiological studies associating hg exposure from thimerosal - containing childhood vaccines with adverse neurodevelopmental outcomes in children .
for example , previous epidemiological studies have evaluated automated medical records in the vsd database using various epidemiological methods of study .
it was revealed that increased hg doses from thimerosal - containing childhood vaccines administered to infants at specific times were associated with overall increased risks for medically diagnosed asds and specific delays in development .
in addition , longitudinal case control studies have revealed a significant dose - dependent increased risk for medically diagnosed asds , td , add / adhd , and specific delays in development following additional doses of hg from thimerosal - containing childhood vaccines administered to infants at specific times during infancy , and longitudinal cohort studies have revealed a significant dose - dependent increased risk for medically diagnosed add / adhd and specific delays in development following the administration of various thimerosal - containing childhood vaccines to infants at specific times .
finally , a previous longitudinal ecological study revealed significant dose - dependent increased risks for medically diagnosed asds , td , add / adhd , emotional disorders , and specific delays in development following increasing doses of hg from various thimerosal - containing childhood vaccines administered to infants at specific times .
as another example , investigators have evaluated the relationship between increased hg exposure from thimerosal - containing childhood vaccines administered during infancy and the subsequent risk of autism , speech disorder , mental retardation , and neurodevelopmental disorder adverse events being reported to the vaccine adverse event reporting system ( vaers ) database .
it was revealed using a cohort study design that a cohort of children who were administered thimerosal - containing diphtheria - tetanus - acellular - pertussis ( dtap ) vaccine were significantly more likely to have autism reported as an adverse event to vaers than a cohort of children administered thimerosal - free dtap vaccine , and it was also revealed using a case control study design that adverse events specifying the outcomes of autism speech disorder , mental retardation , and neurodevelopmental disorders in general were more likely to be reported to the vaers database following thimerosal - containing dtap vaccine administration than its thimerosal - reduced formulation .
still , as a further example , investigators examined the relationship between thimerosal - containing hepatitis b vaccination and the risk of adverse neurodevelopmental outcomes in the cdc s national health interview survey ( nhis ) .
it was observed that males receiving thimerosal - containing hepatitis b vaccines as neonates were significantly more likely to be diagnosed with autism than boys never vaccinated with thimerosal - containing hepatitis b or vaccinated with thimerosal - containing hepatitis b vaccine after the first month of life .
it was also observed that males receiving 3 doses of thimerosal - containing hepatitis b vaccines as infants were significantly more likely than males receiving no doses of thimerosal - containing hepatitis b vaccines as infants to be diagnosed with developmental disabilities .
finally , investigators have evaluated the relationship between administration of thimerosal - containing childhood vaccines to infants and the subsequent neurodevelopmental status of children at specific points during childhood .
it was observed in studies in brazil and poland that increasing doses of hg exposure from thimerosal - containing childhood vaccines administered to infants were associated with negative impacts on the subsequent neurodevelopmental status of children at specific points during childhood .
the above studies and the results of the present study stand in contrast to 6 previous epidemiological studies that failed to find a consistent significant relationship between hg exposure from thimerosal - containing vaccines and adverse neurodevelopmental outcomes in children .
these studies have been criticized in detail for their methodological limitations and conflicts of interest .
the results observed in this study are also supported by observations of biological plausibility made from a number of previous studies examining the adverse impacts of thimerosal exposure .
investigators published a critical review on the mechanisms by which limited thiol availability , abnormal sulfation chemistry , and decreased glutathione reserve capacity in children diagnosed with acsd outcomes could make them more susceptible to the toxic effects of thimerosal routinely administered as part of childhood immunization schedules .
in addition , another critical review examined the adverse impacts of thimerosal exposure on human development .
first , as described by leong et al , hg binds to the tubulin / microtubule structure of the axon and causes the axon to degenerate .
for instance , xu et al found that hg triggered an overactivation of n - methyl - d - aspartate receptors , which lead to cytoskeleton instability .
specifically , they found that hg enhanced the amplitude and frequency of synaptic inward currents and increased spontaneous synaptic potentials followed by sustained membrane depolarization .
they also found that hg triggered a 2- to 5-fold sustained rise in intracellular calcium concentration .
others have found that hg is linked to excitotoxicity by causing excessive accumulation of extracellular glutamate .
there are also indirect effects of hg and these may be as damaging as the direct effects .
mercury can indirectly cause neuronal loss by triggering brain inflammation by causing the release of pieces of damaged neurons ( debris ) and by lowering brain glutathione levels .
the resultant debris from the direct effects of hg combined with lowered glutathione levels can result in sustained neuroinflammation . in situations of sustained inflammation over time , microglia can begin to engulf healthy tissue , particularly synapses .
, the activated microglia can cause loss of connectivity in their attempt to manage the direct damage to neurons from hg .
for many of the mechanisms just outlined , large , long - range neurons / axons are particularly vulnerable . as described by wang and michaelis , a main factor in selective neuronal vulnerability , and particularly in oxidative stress , is the physical size of neurons .
these authors stated that , for the most part , vulnerable neurons are large in size , with axons projecting over long distances to their targets .
the reasons for the susceptibility of large , long - range neurons include the high demand for energy and mitochondrial activity , dependence on long - distance axonal transport , high content of neurofilaments , and a relatively large surface area for increased exposure to toxicants in the extracellular environment .
they stated that large projection neurons have a high - energy requirement , reliance on axonal transport for sustained function , and a large cell surface area that increases exposure of the cells to toxicants .
as described by cavanagh , neurons with long axons are unique among cells in having to maintain a very large area of membrane , and in conditions of energy deprivation or deprivation of antioxidant substances such as glutathione or when the transport of materials within the neuron is physically obstructed , the system may break down and the longest fibers will suffer first .
studies indicate that large caliber axons ( which tend to be the long - range axons ) are selectively vulnerable to hg .
the loss of these large , long - range neurons / axons is basically irreparable .
a compensatory increase in short - range axons can result from long - range neurons / axons loss .
in other words , short - range overconnectivity can result from long - range underconnectivity .
a critical review has examined the underlying neuropathological basis by which hg exposure may induce the acsd outcomes of asd , add / adhd , and td .
these investigators discussed in more detail how hg targets long - range axons , and how long - range axons are selectively vulnerable to its toxic effects .
they explain that after a critical ( and relatively early ) developmental period these long - range axons can not be replaced . as a consequence of decreased long - range axon connectivity ,
an increase in short - range axon connectivity can occur and this is what is found in asd , add / adhd , and td . not only do asd , add / adhd , and td share this neuropathological finding , but it was even shown that the greater the extent of long - range axon underconnectivity and short - range axon overconnectivity , the worse the symptoms of asd , adhd , and td .
an important strength of the present study stems from the data examined within the vsd database .
investigators from the cdc recently evaluated the data within the vsd database to determine whether the vsd population might be different than the general us population .
these investigators reported that the vsd population is representative of the general us population on several key demographic and socioeconomic variables , and further , the absolute number of the vsd population is large enough to ensure significant representation of a broad - spectrum of the general us population . in addition
, the vsd data analyzed were based upon retrospective assessment of prospectively collected medical records of children enrolled in various vsd - participating hmos . as such ,
the vsd data examined were , in fact , collected independent of the study design and were generated as part of the routine health care that children received as part of their participation within their respective hmos .
as a consequence , at the time the medical records were generated , the health - care providers were not thinking about the potential association between vaccine exposures and adverse health outcomes .
another important strength of the study was the study design to evaluate the potential relationship between exposure and outcomes . among the cases examined , they had to be continuously enrolled in their hmo from birth until a medical diagnosis was made for the specific outcome under study .
similarly , among the controls examined , they had to be continuously enrolled in their hmo from birth for a sufficient time period to ensure that their diagnosis status was appropriately ascertained . in order to be able to accurately ascertain
the diagnosis status of controls , for asd cases , they had to be at least enrolled from birth to the mean age of initial asd diagnosis plus twice the standard deviation of initial asd diagnosis , and for the outcomes of td and add / adhd , the controls had to be enrolled from birth to the mean age of the initial diagnosis examined plus the standard deviation of the initial diagnosis examined .
for the cases diagnosed with the control outcomes of febrile seizures , unspecified disorders of metabolism , or cerebral degenerations , they had to be enrolled from birth to the mean age of initial diagnosis plus twice the standard deviation of initial diagnosis .
as shown in table 6 for the various acsd diagnoses examined , a significant reduction in the length of follow - up to only the mean age of the initial acsd diagnosis for the various outcomes examined resulted in cases having no differences in exposure to hg from hib - containing vaccines administered within the first 15 months of life in comparison to controls .
this phenomena clearly establishes the importance of following controls in any study of acsd outcomes for a sufficient period of time to ensure the risk of a control being diagnosed with a case
outcome with additional follow - up be as small as possible , subject to the limitations of the records that are accessible for study . a summary of the effect of inadequate follow - up of controls on the risk of exposure to hg from hib - containing vaccine administration within the first 15 months of life for the cases diagnosed with a studied abnormal connectivity spectrum disorder and the reduced follow - up controls .
abbreviations : add / adhd , attention deficit disorder / attention deficit hyperactivity disorder ; asd , autism spectrum disorder ; hib , haemophilus influenzae type b ; hg , mercury .
the specific methods used to evaluate differences in cumulative doses of hg received within the first 15 months of life from thimerosal in hib - containing vaccines is a further strength of the present study .
the differences in hg doses that children received is related to the diverse thimerosal content of various licensed hib vaccines and the timing of administration of hib vaccines as recommended by the advisory committee on immunization practices . as a result ,
the present study did not examine a few children with outlier exposures to thimerosal , but , instead , the differences in thimerosal dosing reflect genuine differences in the routine childhood vaccine schedule .
however , the results observed in the present study may have a number of potential limitations .
for example , the results may have occurred from unknown biases or confounders present in the datasets examined .
this seems unlikely because the control outcomes of febrile seizure , cerebral degenerations , and unspecified disorders of metabolism ( ie , outcomes that are not biologically plausibly linked to postnatal organic hg exposure from thimerosal - containing vaccines ) were examined , using the same methodology used for the various acsds examined . as shown in table 4
, no increased dose - dependent risk was observed for cases diagnosed with these outcomes in comparison to controls .
another potential limitation of the present study is that the results observed may be the result of statistical chance .
however , such a possibility would be unlikely given the limited number of statistical tests performed , the highly significant results observed ( most p values observed were < .01 ) , and the consistency in the direction and magnitude of the results observed . in addition , similar ors were observed for increasing hg exposure among cases diagnosed with the various acsds in comparison to controls generated from the discrete - point estimates and logistic regression estimates , as shown in table 5 .
still , other potential limitations of the present study include the possibilities that some of the individuals examined in the vsd may have had more subtle neurological dysfunction , which was not brought to the attention of their health - care providers ; health - care providers may have misdiagnosed some individuals ; there may be differences in the reliability and validity of diagnoses across different health providers ; or some vaccine exposures may not have been appropriately classified .
in addition , it is possible that some of the hg exposures from the hib - containing vaccines were different than the estimated amount .
for example , acthib vaccine , manufactured by aventis pasteur , was always thimerosal - free , but it was usually reconstituted with thimerosal - containing tripedia ; but it is possible that some doses were reconstituted with just plain saline .
similarly , some hib vaccines by merck and company , inc may have had 12.5 g hg per dose and not the assigned 0 g hg per dose .
in addition , it is possible that some very small number of doses of hibtiter vaccine manufactured by lederle may have come in single - dose vials with 0 g hg per dose and not the assigned 25 g hg per dose . these limitations ,
while possibly present in the data examined in the current study , should not have significantly impacted the results observed because it is unclear how differential application would have occurred to the study cohorts examined based upon the thimerosal doses that the children received . moreover , misclassification occurring in the data examined would tend to bias any results observed toward the null hypothesis , since such effects would result in children being placed in the wrong exposure and/or outcome categories examined and result in decreased statistical power to determine true potential exposure outcome relationships .
in addition , another potential limitation of the present study is that exposures to other vaccines or other sources of hg were not evaluated . at this time , data analysis restrictions imposed by the cdc prevent us from studying more than 1 type of vaccine that participants received , despite the fact that it is very likely that the children examined incurred other hg exposures from other thimerosal - containing childhood vaccines .
it is also likely that children examined received hg exposures from dental amalgams , fish , or other environmental sources .
although all these other sources of hg may play a significant role in the pathogenesis of acsds , these unaccounted for hg exposures would actually tend to bias the results observed toward the null hypothesis because they potentially would confound the specific exposure classifications of hg examined .
for example , children classified as having lower hg exposure from thimerosal - containing vaccines may have actually received high doses of hg from other sources , and children having higher hg exposure from thimerosal - containing vaccines may have actually received low doses of hg from other sources , with the net result tending to minimize the magnitude of the associations observed .
it is also possible that the findings observed may be the result of other components of the vaccines studied , which , in isolation or synergistically , interacted with the hg exposures examined .
these possibilities seem remote , since multiple different brands of hib - containing vaccines were examined ( with many different amounts / types of adjuvants and trace constituents ) , but significant overall and dose - dependent relationships were observed among cases diagnosed with the various acsds examined in comparison to controls for increasing hg exposure . moreover , any effects of other components of vaccines working in isolation or synergistically would tend to bias the results observed toward the null hypothesis because they were not considered in the statistical analyses undertaken . additionally , a further potential limitation of the present study is that there may be differences in the general health status among the children examined , independent of exposure to organic hg from hib - containing vaccine administration . as described previously by investigators from the cdc ,
confounding of this sort is a general problem for studies of adverse reactions to prophylactic interventions , as they may be withheld from some individuals precisely because they are already at high risk of the adverse event ( this is the so - called healthy vaccine effect ) , and , as a consequence , studies that fail to adequately control for such confounding factors are likely to underestimate the risk of adverse events attributable to vaccination .
subsequent studies by investigators from the cdc have further examined the impact of the healthy vaccine effect and have even attempted to develop methods to minimize its effects in certain types of studies .
these investigators have further described that for rare and more serious outcomes , the healthy vaccine effect may be nearly impossible to quantify .
the current study utilized a variant of a technique previously developed by investigators from the cdc and further expanded by other investigators to attempt to minimize the healthy vaccine effect for rare and more serious outcomes .
this involved examining groups that were all vaccinated , but the groups differed with respect to the exact vaccines received . in the current study , a partially vaccinated reference group that received 25 g hg exposure from hib - containing vaccines was utilized in all of our statistical analyses . despite our attempt to minimize the healthy vaccine effect in our analyses using a partially vaccinated reference group , as shown in table 4
, we still did observe that there was an apparent protective association for increased organic hg exposure from thimerosal in hib - containing vaccines for our control outcomes of cerebral degenerations and unspecified disorders of metabolism compared to controls . as a consequence
in addition , the data were further examined for the control outcomes of cerebral degenerations and unspecified disorders of metabolism where an apparent healthy vaccine effect was observed to identify whether this phenomenon was present equally for males and females .
it was observed that the apparent healthy vaccine effect for the outcome of cerebral degenerations that males ( or = 0.888 per 25 g hg , p < .01 , 95% ci = 0.812 - 0.964 ) were more significantly impacted than females ( or = 0.952 per 25 g hg , p = .284 , 95% ci = 0.865 - 1.040 ) and the outcome of unspecified disorders of metabolism that males ( or = 0.625 per 25 g hg , p < .001 , 95% ci = 0.433 - 0.818 ) were more significantly impacted than females ( or = 0.770 per 25 g hg , p = .051 , 95% ci = 0.542 - 1.001 ) . since this phenomenon is apparent in the data examined , the significantly increased positive dose - dependent associations observed for the various acsds examined probably underestimate the true extent of the relationship between hg exposure from thimerosal in hib - containing vaccines and the subsequent various acsd outcomes studied .
finally , the current study has the potential limitation that analyses were not conducted to further explore the precise timing and cumulative doses of organic hg from all thimerosal - containing childhood vaccines associated with maximum adverse consequences . in future studies
, it would be worthwhile to further explore these precise - timing and cumulative - doses phenomena .
in addition , it would be valuable to evaluate other neurodevelopmental outcomes , as well as other covariates such as race , birth weight , etc , that may further affect the magnitude of the adverse effects found . despite the limitation of not examining the aforementioned covariates in the present study ,
it was observed that when the data were separated by gender , there were still significant dose - dependent relationships between increasing hg exposure from thimerosal in hib - containing vaccines and the various acsds outcomes examined .
an important strength of the present study stems from the data examined within the vsd database .
investigators from the cdc recently evaluated the data within the vsd database to determine whether the vsd population might be different than the general us population .
these investigators reported that the vsd population is representative of the general us population on several key demographic and socioeconomic variables , and further , the absolute number of the vsd population is large enough to ensure significant representation of a broad - spectrum of the general us population . in addition , the vsd data analyzed were based upon retrospective assessment of prospectively collected medical records of children enrolled in various vsd - participating hmos . as such ,
the vsd data examined were , in fact , collected independent of the study design and were generated as part of the routine health care that children received as part of their participation within their respective hmos . as a consequence , at the time the medical records were generated , the health - care providers were not thinking about the potential association between vaccine exposures and adverse health outcomes .
another important strength of the study was the study design to evaluate the potential relationship between exposure and outcomes . among the cases examined
, they had to be continuously enrolled in their hmo from birth until a medical diagnosis was made for the specific outcome under study . similarly , among the controls examined , they had to be continuously enrolled in their hmo from birth for a sufficient time period to ensure that their diagnosis status was appropriately ascertained . in order to be able to accurately ascertain
the diagnosis status of controls , for asd cases , they had to be at least enrolled from birth to the mean age of initial asd diagnosis plus twice the standard deviation of initial asd diagnosis , and for the outcomes of td and add / adhd , the controls had to be enrolled from birth to the mean age of the initial diagnosis examined plus the standard deviation of the initial diagnosis examined .
for the cases diagnosed with the control outcomes of febrile seizures , unspecified disorders of metabolism , or cerebral degenerations , they had to be enrolled from birth to the mean age of initial diagnosis plus twice the standard deviation of initial diagnosis .
as shown in table 6 for the various acsd diagnoses examined , a significant reduction in the length of follow - up to only the mean age of the initial acsd diagnosis for the various outcomes examined resulted in cases having no differences in exposure to hg from hib - containing vaccines administered within the first 15 months of life in comparison to controls .
this phenomena clearly establishes the importance of following controls in any study of acsd outcomes for a sufficient period of time to ensure the risk of a control being diagnosed with a case outcome with additional follow - up be as small as possible , subject to the limitations of the records that are accessible for study . a summary of the effect of inadequate follow - up of controls on the risk of exposure to hg from hib - containing vaccine administration within the first 15 months of life for the cases diagnosed with a studied abnormal connectivity spectrum disorder and the reduced follow - up controls .
abbreviations : add / adhd , attention deficit disorder / attention deficit hyperactivity disorder ; asd , autism spectrum disorder ; hib , haemophilus influenzae type b ; hg , mercury .
the specific methods used to evaluate differences in cumulative doses of hg received within the first 15 months of life from thimerosal in hib - containing vaccines is a further strength of the present study .
the differences in hg doses that children received is related to the diverse thimerosal content of various licensed hib vaccines and the timing of administration of hib vaccines as recommended by the advisory committee on immunization practices . as a result ,
the present study did not examine a few children with outlier exposures to thimerosal , but , instead , the differences in thimerosal dosing reflect genuine differences in the routine childhood vaccine schedule .
however , the results observed in the present study may have a number of potential limitations .
for example , the results may have occurred from unknown biases or confounders present in the datasets examined .
this seems unlikely because the control outcomes of febrile seizure , cerebral degenerations , and unspecified disorders of metabolism ( ie , outcomes that are not biologically plausibly linked to postnatal organic hg exposure from thimerosal - containing vaccines ) were examined , using the same methodology used for the various acsds examined . as shown in table 4 ,
no increased dose - dependent risk was observed for cases diagnosed with these outcomes in comparison to controls .
another potential limitation of the present study is that the results observed may be the result of statistical chance .
however , such a possibility would be unlikely given the limited number of statistical tests performed , the highly significant results observed ( most p values observed were < .01 ) , and the consistency in the direction and magnitude of the results observed . in addition , similar ors were observed for increasing hg exposure among cases diagnosed with the various acsds in comparison to controls generated from the discrete - point estimates and logistic regression estimates , as shown in table 5 .
still , other potential limitations of the present study include the possibilities that some of the individuals examined in the vsd may have had more subtle neurological dysfunction , which was not brought to the attention of their health - care providers ; health - care providers may have misdiagnosed some individuals ; there may be differences in the reliability and validity of diagnoses across different health providers ; or some vaccine exposures may not have been appropriately classified .
in addition , it is possible that some of the hg exposures from the hib - containing vaccines were different than the estimated amount .
for example , acthib vaccine , manufactured by aventis pasteur , was always thimerosal - free , but it was usually reconstituted with thimerosal - containing tripedia ; but it is possible that some doses were reconstituted with just plain saline .
similarly , some hib vaccines by merck and company , inc may have had 12.5 g hg per dose and not the assigned 0 g hg per dose .
in addition , it is possible that some very small number of doses of hibtiter vaccine manufactured by lederle may have come in single - dose vials with 0 g hg per dose and not the assigned 25 g hg per dose
. these limitations , while possibly present in the data examined in the current study , should not have significantly impacted the results observed because it is unclear how differential application would have occurred to the study cohorts examined based upon the thimerosal doses that the children received . moreover , misclassification occurring in the data examined would tend to bias any results observed toward the null hypothesis , since such effects would result in children being placed in the wrong exposure and/or outcome categories examined and result in decreased statistical power to determine true potential exposure outcome relationships .
in addition , another potential limitation of the present study is that exposures to other vaccines or other sources of hg were not evaluated . at this time , data analysis restrictions imposed by the cdc prevent us from studying more than 1 type of vaccine that participants received , despite the fact that it is very likely that the children examined incurred other hg exposures from other thimerosal - containing childhood vaccines .
it is also likely that children examined received hg exposures from dental amalgams , fish , or other environmental sources .
although all these other sources of hg may play a significant role in the pathogenesis of acsds , these unaccounted for hg exposures would actually tend to bias the results observed toward the null hypothesis because they potentially would confound the specific exposure classifications of hg examined .
for example , children classified as having lower hg exposure from thimerosal - containing vaccines may have actually received high doses of hg from other sources , and children having higher hg exposure from thimerosal - containing vaccines may have actually received low doses of hg from other sources , with the net result tending to minimize the magnitude of the associations observed .
it is also possible that the findings observed may be the result of other components of the vaccines studied , which , in isolation or synergistically , interacted with the hg exposures examined .
these possibilities seem remote , since multiple different brands of hib - containing vaccines were examined ( with many different amounts / types of adjuvants and trace constituents ) , but significant overall and dose - dependent relationships were observed among cases diagnosed with the various acsds examined in comparison to controls for increasing hg exposure . moreover , any effects of other components of vaccines working in isolation or synergistically would tend to bias the results observed toward the null hypothesis because they were not considered in the statistical analyses undertaken .
additionally , a further potential limitation of the present study is that there may be differences in the general health status among the children examined , independent of exposure to organic hg from hib - containing vaccine administration . as described previously by investigators from the cdc ,
confounding of this sort is a general problem for studies of adverse reactions to prophylactic interventions , as they may be withheld from some individuals precisely because they are already at high risk of the adverse event ( this is the so - called healthy vaccine effect ) , and , as a consequence , studies that fail to adequately control for such confounding factors are likely to underestimate the risk of adverse events attributable to vaccination .
subsequent studies by investigators from the cdc have further examined the impact of the healthy vaccine effect and have even attempted to develop methods to minimize its effects in certain types of studies .
these investigators have further described that for rare and more serious outcomes , the healthy vaccine effect may be nearly impossible to quantify .
the current study utilized a variant of a technique previously developed by investigators from the cdc and further expanded by other investigators to attempt to minimize the healthy vaccine effect for rare and more serious outcomes .
this involved examining groups that were all vaccinated , but the groups differed with respect to the exact vaccines received . in the current study , a partially vaccinated reference group that received 25 g hg exposure from hib - containing vaccines was utilized in all of our statistical analyses . despite our attempt to minimize the healthy vaccine effect in our analyses using a partially vaccinated reference group , as shown in table 4
, we still did observe that there was an apparent protective association for increased organic hg exposure from thimerosal in hib - containing vaccines for our control outcomes of cerebral degenerations and unspecified disorders of metabolism compared to controls . as a consequence
in addition , the data were further examined for the control outcomes of cerebral degenerations and unspecified disorders of metabolism where an apparent healthy vaccine effect was observed to identify whether this phenomenon was present equally for males and females .
it was observed that the apparent healthy vaccine effect for the outcome of cerebral degenerations that males ( or = 0.888 per 25 g hg , p < .01 , 95% ci = 0.812 - 0.964 ) were more significantly impacted than females ( or = 0.952 per 25 g hg , p = .284 , 95% ci = 0.865 - 1.040 ) and the outcome of unspecified disorders of metabolism that males ( or = 0.625 per 25 g hg , p < .001 , 95% ci = 0.433 - 0.818 ) were more significantly impacted than females ( or = 0.770 per 25 g hg , p = .051 , 95% ci = 0.542 - 1.001 ) .
since this phenomenon is apparent in the data examined , the significantly increased positive dose - dependent associations observed for the various acsds examined probably underestimate the true extent of the relationship between hg exposure from thimerosal in hib - containing vaccines and the subsequent various acsd outcomes studied .
finally , the current study has the potential limitation that analyses were not conducted to further explore the precise timing and cumulative doses of organic hg from all thimerosal - containing childhood vaccines associated with maximum adverse consequences . in future studies
, it would be worthwhile to further explore these precise - timing and cumulative - doses phenomena .
in addition , it would be valuable to evaluate other neurodevelopmental outcomes , as well as other covariates such as race , birth weight , etc , that may further affect the magnitude of the adverse effects found . despite the limitation of not examining the aforementioned covariates in the present study ,
it was observed that when the data were separated by gender , there were still significant dose - dependent relationships between increasing hg exposure from thimerosal in hib - containing vaccines and the various acsds outcomes examined .
control study reveals consistent and significantly increased dose - dependent associations between exposure to hg from thimerosal in hib - containing vaccines administered within the first 15 months of life among children ( both male and female ) subsequently diagnosed with the acsd outcomes of asd , td , or add / adhd , in comparison to controls .
the present study is both consistent with and extends previous epidemiological studies in the vsd , vaers , and nhis databases and provides compelling additional epidemiological evidence supporting a significant relationship between increasing hg exposure from thimerosal - containing childhood vaccines and the subsequent risk of an acsd diagnosis .
routine childhood vaccination is an important public health tool to reduce the morbidity and mortality associated with infectious diseases .
however , it is also a public health imperative to end the unnecessary addition of hg to vaccines in the form of thimerosal , based on data showing an association between its administration and the increasing risk of the adverse acsd outcomes studied .
|
background : autism spectrum disorder ( asd ) , tic disorder ( td ) , and hyperkinetic syndrome of childhood ( attention deficit disorder [ add]/attention deficit hyperactivity disorder [ adhd ] ) are disorders recently defined as abnormal connectivity spectrum disorders ( acsds ) because they show a similar pattern of abnormal brain connectivity .
this study examines whether these disorders are associated with exposure to thimerosal , a mercury ( hg)-based preservative.methods:a hypothesis testing case - control study evaluated the vaccine safety datalink for the potential dose - dependent odds ratios ( ors ) for diagnoses of asd , td , and add / adhd compared to controls , following exposure to hg from thimerosal - containing haemophilus influenzae type b vaccines administrated within the first 15 months of life .
febrile seizures , cerebral degeneration , and unspecified disorders of metabolism , which are not biologically plausibly linked to thimerosal , were examined as control outcomes.results:on a per 25 g hg basis , cases diagnosed with asd ( or = 1.493 ) , td ( or = 1.428 ) , or add / adhd ( or = 1.503 ) were significantly ( p < .001 ) more likely than controls to have received increased hg exposure .
similar relationships were observed when separated by gender .
cases diagnosed with control outcomes were no more likely than controls to have received increased hg exposure.conclusion:the results suggest that hg exposure from thimerosal is significantly associated with the acsds of asd , td , and add / adhd .
|
during summer 2014 , a 63-year - old woman with symptomatic high tumor burden follicular lymphoma achieved a complete clinical and radiologic response to induction treatment with 6 cycles of bendamustine and obinutuzumab , then began maintenance therapy with obinutuzumab for 8 weeks .
eleven months after she began taking obinutuzumab , the patient sought treatment for 4 weeks of fatigue , myalgias , muscle tenderness , and leg edema without fever .
10 cells / l ( reference range 14 10 cells / l ) , and lactate dehydrogenase was 354 iu / l ( reference range 100200
iu / l ) ; serum creatine kinase and inflammatory markers were within reference ranges .
immunoglobulin levels were also within reference ranges : igg 10.2 g / l , igm 0.3 g / l , and iga 1.3
the patient had moderately impaired liver function and was hypoalbuminemic without evidence of renal protein loss .
magnetic resonance imaging of the thighs showed diffuse inflammatory changes involving subcutaneous tissues , fascia , and musculature ( figure ) .
results of tests to determine possible causes of muscle pathologic changes were negative ; tests included those for autoantibodies , hiv antibodies , thyroid function , and pcr for respiratory viruses ( including influenza ) and herpesvirus .
muscle histopathologic findings from a biopsy of the quadriceps showed features of an inflammatory myopathy ( interstitial edema , perivascular lymphocytic cuffing , and degenerating fibers ) consistent with the features of early dermatomyositis .
reverse transcription pcr also detected enterovirus rna in plasma , nasopharyngeal , and fecal specimens .
viral protein 1 gene obtained from rna extracted from muscle was sequenced , and we identified the virus as echovirus 6 .
when we ceased treatment with obinutuzumab and gave the patient 0.8 g / kg ivig , her symptoms rapidly improved .
results from a repeat plasma enterovirus pcr 11 days after initiation of ivig were negative . magnetic resonance image of 63-year - old woman in australia with disseminated enteroviral infection that manifested after she received obinutuzumab for lymphoma .
image shows patient s thighs and diffuse inflammatory changes involving subcutaneous tissues , fascia , and musculature . during summer 2014 , a 35-year - old woman with symptomatic follicular lymphoma achieved a complete clinical and radiological response to induction treatment with 6 cycles of bendamustine and obinutuzumab ; she subsequently took obinutuzumab for an additional 8 weeks .
twelve months after she began taking obinutuzumab , she sought treatment for fever , headaches , and myalgias .
cerebrospinal fluid was acellular , but we detected enterovirus in cerebrospinal fluid and feces by using pcr .
sequencing of the pcr product was unsuccessful , and we could not identify the enterovirus strain .
results of liver function tests were initially normal , but liver function deteriorated after 2 weeks .
mol / l ) , of alanine amino transferase was 1,419 iu / l ( reference range
u / l ( reference range 30120 u / l ) , and of albumin was 28
g / l ) ; international normalized ratio peaked at 2.0 ( reference range 0.81.2 ) .
results of tests to determine possible causes of hepatitis and encephalitis were negative ; the tests included those for autoantibodies , hiv antibodies , thyroid function , and pcr for respiratory viruses ( including influenza ) and herpesvirus .
obinutuzumab was ceased , and the patient was treated with 0.8 g / kg ivig .
during summer 2014 , a 63-year - old woman with symptomatic high tumor burden follicular lymphoma achieved a complete clinical and radiologic response to induction treatment with 6 cycles of bendamustine and obinutuzumab , then began maintenance therapy with obinutuzumab for 8 weeks .
eleven months after she began taking obinutuzumab , the patient sought treatment for 4 weeks of fatigue , myalgias , muscle tenderness , and leg edema without fever .
10 cells / l ( reference range 14 10 cells / l ) , and lactate dehydrogenase was 354 iu / l ( reference range 100200
iu / l ) ; serum creatine kinase and inflammatory markers were within reference ranges .
immunoglobulin levels were also within reference ranges : igg 10.2 g / l , igm 0.3 g / l , and iga 1.3
the patient had moderately impaired liver function and was hypoalbuminemic without evidence of renal protein loss .
magnetic resonance imaging of the thighs showed diffuse inflammatory changes involving subcutaneous tissues , fascia , and musculature ( figure ) .
results of tests to determine possible causes of muscle pathologic changes were negative ; tests included those for autoantibodies , hiv antibodies , thyroid function , and pcr for respiratory viruses ( including influenza ) and herpesvirus .
muscle histopathologic findings from a biopsy of the quadriceps showed features of an inflammatory myopathy ( interstitial edema , perivascular lymphocytic cuffing , and degenerating fibers ) consistent with the features of early dermatomyositis .
reverse transcription pcr also detected enterovirus rna in plasma , nasopharyngeal , and fecal specimens .
viral protein 1 gene obtained from rna extracted from muscle was sequenced , and we identified the virus as echovirus 6 .
when we ceased treatment with obinutuzumab and gave the patient 0.8 g / kg ivig , her symptoms rapidly improved .
results from a repeat plasma enterovirus pcr 11 days after initiation of ivig were negative . magnetic resonance image of 63-year - old woman in australia with disseminated enteroviral infection that manifested after she received obinutuzumab for lymphoma .
image shows patient s thighs and diffuse inflammatory changes involving subcutaneous tissues , fascia , and musculature .
during summer 2014 , a 35-year - old woman with symptomatic follicular lymphoma achieved a complete clinical and radiological response to induction treatment with 6 cycles of bendamustine and obinutuzumab ; she subsequently took obinutuzumab for an additional 8 weeks .
twelve months after she began taking obinutuzumab , she sought treatment for fever , headaches , and myalgias .
cerebrospinal fluid was acellular , but we detected enterovirus in cerebrospinal fluid and feces by using pcr .
sequencing of the pcr product was unsuccessful , and we could not identify the enterovirus strain .
results of liver function tests were initially normal , but liver function deteriorated after 2 weeks .
mol / l ) , of alanine amino transferase was 1,419 iu / l ( reference range 756
g / l ) ; international normalized ratio peaked at 2.0 ( reference range 0.81.2 ) .
results of tests to determine possible causes of hepatitis and encephalitis were negative ; the tests included those for autoantibodies , hiv antibodies , thyroid function , and pcr for respiratory viruses ( including influenza ) and herpesvirus .
obinutuzumab was ceased , and the patient was treated with 0.8 g / kg ivig .
anti - cd20 mabs such as rituximab are now standard of care for treatment of b - cell lymphoma in combination with chemotherapy .
the us food and drug administration approved obinutuzumab in september 2013 for use in chronic lymphocytic leukemia , but indications for use probably will expand .
obinutuzumab is glycoengineered to cause more profound and rapid b - cell depletion than rituximab , elicited by subtle differences in the orientation of binding to the cd20 molecule between the 2 drugs ( 6 ) . as a result of these binding differences , compared with rituximab , obinutuzumab has superior induction of apoptosis , natural killer cell activation , and antibody - dependent cytotoxicity but less complement - dependent toxicity ( 6).this mechanism may also explain the differences in susceptibility to , and patterns of , enteroviral infections associated with obinutzumab , resulting in a phenotype similar to xla ( 5 ) .
antibodies are the main form of defense against enteroviruses ( 7 ) , and severe , chronic , and disseminated enteroviral infections are generally limited to neonates or patients with profound b - cell deficiencies ( xla or hematopoietic stem cell transplantation ) . during the 1970s and 1980s , reports described the clinical manifestation of disseminated enterovirus infection in children with xla ( 4,5 ) and demonstrated that ivig is an effective therapy for disseminated enterovirus infection ( 7,8 ) . since then , reports of disseminated enteroviral infections have been uncommon .
enteroviral infection has not featured prominently among patients with partial b - cell or immunoglobulin deficiencies , such as patients with chronic variable immunodeficiency ( 7 ) .
immunoglobulin levels of the 2 patients in our study were within reference ranges , but analysis of lymphocyte subsets was not performed .
both patients received the combination of obinutuzumab and bendamustine ; it is possible that an association exists between the 2 drugs that results in increased host susceptibility to disseminated enteroviral infection .
the clinical features described in most cases of disseminated enteroviral infections relate to chronic meningoencephalitis ( 2,5 ) .
however , several reports describe a dermatomyositis - like syndrome with edema and hepatitis that responded to ivig ( 5 ) ; this syndrome is strikingly similar to the cases reported here .
enteroviral infections ( coxsackieviruses and echoviruses ) also have been implicated in the pathogenesis of myositis ( 9 ) .
enterovirus pcr was positive from the muscle biopsy of the patient in our report , suggesting that the virus had a direct role in pathogenesis of the myositis .
reports of enteroviral infections associated with rituximab use since its introduction have been rare , in contrast to obibutuzumab , for which a case of enteroviral meningencephalitis has been reported ( 2,3 ) . of the 11 cases of enteroviral infection associated with rituximab use ,
to our knowledge , enteroviral infection has not previously been associated with rituximab use in patients who also had hepatitis , dermatomyositis , and edema , as in the cases we report and those associated with xla ( 5 ) .
future studies could define susceptibility to enteroviruses through the effect of obinutuzumab on b - cell and immunoglobulin function and host defense against enteroviral infections .
future research might also focus on the development of a screening strategy for enteroviral infections followed by prophylactic or preemptive therapy with ivig .
the clinical manifestation of disseminated enteroviral infections , particularly those similar to dermatomyositis , may be unfamiliar to clinicians caring for adults because most experience of the illness is in children and there have been few reports in recent years . given the therapeutic response to ivig in the cases we report , enteroviral infection and the use of ivig therapy should be considered in patients treated with obinutuzumab who develop atypical clinical features of organ inflammation .
|
two cases of disseminated enteroviral infection occurred in patients who received the cd20 monoclonal antibody obinutuzumab .
clinical features included hepatitis , edema , and a dermatomyositis - like syndrome .
these manifestations may be unfamiliar to clinicians and are possibly responsive to intravenous immunoglobulin .
clinicians should remain vigilant for enteroviral infections in patients receiving obinutuzumab .
|
the complete removal of the pancreas has been a topic of controversial discussions ever since surgeons realized that it was feasible .
the sporadic reports of total pancreatectomy ( tp ) in the 1940s and 1950s of the twentieth century grew to a frank enthusiasm about the potential advantages of the procedure with the accumulation of surgical experience in the 1970s but were about to vanish later due to the negative metabolic consequences of the operation .
the complete removal of the gland has already been established as a potential option in the treatment of locally advanced pancreatic cancer , multifocal or recurrent exocrine , and endocrine tumors [ 14 ] .
troubles , such as perioperative complications arising from pancreatic anastomotic leakage with or without bleeding or apoplexy of the pancreatic remnant , may require complete removal of the remaining organ in an emergency situation [ 5 , 6 ] .
extremely soft pancreatic tissue has been described as a technical reason for tp during the primary operation to prevent a high - risk pancreatic anastomosis .
therapy refractory pain associated with chronic pancreatitis has been reported as a further indication for tp [ 813 ] . despite increasing demand for tp and increasing rate of its performance at large pancreas centres recently
, reports in the literature on its current indications and results remain scarce [ 14 , 15 ] .
the aim of this study was to analyse the current indications and the outcome between the different indications for tp at a single high - volume institution and determine the current place of tp in the spectrum of pancreatic resections .
all cases of tp were analysed within the prospectively managed pancreas data bank at the department of general and visceral surgery , st .
the set of data available for every patient included detailed information on all preoperative diagnostic procedures , perioperative parameters , and postoperative complications , as well as strict follow - up documentation .
the preoperative risk assessment was graded according to the american society of anaesthesiologists classification ( asa ) .
operation time , perioperative blood loss , necessity of red blood cell transfusions , and postoperative hospital stay were evaluated .
postoperative complications were determined and categorised into major and minor surgical complications and nonsurgical ones .
major complications comprised biliary leakage , postoperative bleeding , intraabdominal abscess , and burst abdomen .
minor surgical complications included delayed gastric emptying , cholangitis , chylous fistula , and wound infection .
nonsurgical complications were defined as complications within 30 days of surgery or during the hospital stay that were not directly related to the surgical procedure , for example , pneumonia , urinary tract infection , or systemic infections not related to the surgical procedure ( e.g. , central venous infection ) .
any death during the hospital stay or within the first 30 days after operation was defined as postoperative mortality .
all data are presented as median with interquartile range and minimal and maximal values , which are shown in the figures as box - and - whisker plots , respectively . for comparison of quantitative variables
two - sided p values were always computed , and an effect was considered statistically significant at p < .05 .
during the study period of 54 months ( january 2004june 2008 ) 948 patients underwent surgery for pancreatic disease , of which 599 ( 63.2% ) pancreatic resectional procedures .
they were performed in 34 ( 54% ) males and 29 ( 46% ) females at a median age of 69 ( 3887 ) years . in 45 cases ( 71.4% )
a tp was performed as a primary procedure ; in the rest 18 patients it was a completion pancreatectomy .
twenty - five patients ( 39.7% ) were classified as asa i -ii , while 38 ( 60.3% ) were categorized as asa class iii - iv .
substantial cardiac comorbidity was present in 13 cases ( 21% ) , pulmonary in 8 ( 12.7% ) , and renal in 4 ( 6.3% ) .
the indications for a tp were grouped to the four t 's categories as summarized in table 2 .
it was a primary operation and in one patient with a recurrent intraductal papillary - mucinous cancer of the head after left resection a completion pancreatectomy was performed . in 13 cases the main reason for total pancreatectomy was the size of the tumor , which spread over the most of the pancreas there were 10 t3 tumors and 3 t4 tumors .
there was also one patient with a t3 carcinoma of the distal hepatic duct and a positive resection margin on the frozen section a total pancreatectomy was necessary in that case too . in 8 cases multifocal
cancer was found3 patients had a multicentric intraductal papillary - mucionous carcinoma ( all t2 ) , 3 patients suffered a multifocal pancreatic adenocarcinoma ( one of them t2 and the other two t3 ) , one patient had simultaneously a cancer of the papilla ( t3 ) and an adenocarcinoma of the pancreatic body ( t2 ) , and one patient had a cystadenocarcinoma of the pancreatic head ( t3 ) and a simultaneous undifferentiated neuroendocrine cancer in the pancreatic body .
there was only one small t1 cancer of the pancreatic head for which a total pancreatectomy was performed , because of the subtotal atrophy of the rest pancreas due to a severe chronic pancreatitis with preoperatively existing insulin - dependent diabetes mellitus and a severe exocrine insufficiency .
there were twelve multivisceral resections ( n = 12/23 , 52% ) and four vessel reconstructions in this group ( 4/23 , 17.4% ) .
3 patients from this group suffered from an endocrine and 2 patients from an exocrine insufficiency of the pancreas preoperatively .
eighteen patients ( 28.6% ) underwent total pancreatectomy due to technical reasons , that is , very soft and fatty pancreatic tissue in the remnant . in 13 of those patients
the diagnosis was a small cancer of the pancreatic head ( six t1 and seven t2 ) , two patients had a t2 cancer of the distal common bile duct , another patient had a benign cystadenoma in processus uncinatus , and there were two cases of intraductal papillary mucinous adenoma in the pancreatic head .
preoperatively 5 patients had an endocrine and 1 patients also an exocrine dysfunction of the pancreas .
fifteen patients ( 23.8% ) underwent total pancreatectomy because of either early postoperative or intraoperative troubles , that is , complications .
twelve patients underwent a completion pancreatectomy because of postoperative complications after pancreatic resections of the head or tail : in 8 cases that was insufficiency of the pancreatic anastomosis / stump with additional postoperative intraabdominal bleeding in 8 patients ; in 2 cases pancreatectomy was necessary because of necrotising pancreatitis of the pancreatic remnant with sepsis , and in 2 patients because of failure of the biliodigestive anastomosis with biliary peritonitis . in three patients the decision to perform a total pancreatectomy was made intraoperatively in an emergency situation due to iatrogenic perforation of the duodenum during ercp , profuse bleeding of a duodenal carcinoma , and a bleeding of a giant pseudocyst of the pancreatic head with a coagulation disorder .
there were n = 5/15 , 33% multivisceral resections , and n = 3/15 , 20% portal vein reconstructions in this group .
seven patients ( 11.1% ) suffered from a disabling therapy - resistant pain due to severe chronic pancreatitis with small duct disease . in two
the first one had a total atrophy of the pancreatic tail , and the second one presented intraoperatively with a large tumor mass , where a malignancy was suspected . in the other five cases
a completion pancreatectomy was carried out following prior resective pancreatic surgery without adequate alleviation of pain ( two cases after left resection , three cases after pancreaticoduodenectomy ) .
all 7 patients suffered already preoperatively from severe endocrine and exocrine insufficiency and all of them were analgesic drug addicts .
there was one total gastrectomy , ten portal vein resections with direct anastomosis , one resection of the common hepatic artery and reconstruction with the splenic artery , five left or right hemicolectomies , and one left adrenal resection .
median operation time for the whole group was 420 min ; the median intraoperative blood loss was 800 ml .
the duration of the surgical procedure was significantly shorter in patients with troubles as an indication for pancreatectomy with a median time of 210 min compared to all other indications with a median of 448 min ( p = .001 ) ( figure 1 ) . at the same time
the median intraoperative blood loss in the troubles group was with 1500 ml significantly higher than that in patients pancreatectomized because of tumors ( 800 ml , p = .002 ) , soft pancreas ( 600 ml , p = .001 ) , or chronic pancreatitis ( 600 ml , p = .009 ) .
pancreatectomies in the soft pancreas group tended to be performed with less blood loss than those in tumor patients , p = .043 ( figure 2 ) . respectively , transfusion of red blood cell units was also the highest in the troubles group with a median of 15 rbc units compared to pancreatectomy due to other indications where the median was zero rbc units ( p = .001 ) ( figure 3 ) .
major postoperative complications , either surgical or nonsurgical , occurred in 32 ( 50.8% ) patients . a total of 23 patients ( 36.5% ) developed one or more postoperative surgical complications .
the spectrum of minor surgical complications included delayed gastric emptying , cholangitis , wound infection , and chylous fistula . the most often one was delayed gastric emptying
a wound infection was observed in 4 ( 6.3% ) cases and a chylous fistula appeared in 3 ( 4.8% ) patients .
the following major surgical complications were observed : five patients developed an intraabdominal abscess . in three cases
the abscess was situated in the upper left abdominal quadrant after splenectomy , another two were found in the left paracolic region .
three patients with emergency completion pancreatectomy suffered an acute postoperative erosion bleeding in two cases a hemorrhage from the splenic artery , and in the other one from the left gastric artery .
all of those three patients died due to the early or late consequences of the hemorrhagic shock .
three other patients with completion pancreatectomies were reoperated because of failure of the biliodigestive anastomosis .
one of those patients developed a malignant postoperative arrhythmia , underwent a pacemaker implantation , but progressed to liver and renal failure with a fatal outcome .
two patients were treated for a wound dehiscence , whereas one of them died due to a progressive multiple organ failure .
the nonsurgical complications comprised of urinary tract infections ( most common with 11.1% , 7 patients ) , 2 cases of pneumonia one of those patients died due to multiple lung abscesses with respiratory failure and sepsis with multiorgan failure , a pseudomembranous colitis in one patient .
median hospital stay of all surviving patients ( n = 53 ) after tp was 21 days ( min max range 7108 days ) .
the surviving patients from the troubles group had the longest postoperative hospital stay with a median of 48 days , which was significantly longer than the median of all other groups , 20 days , p = .035 ( figure 4 ) .
five ( 7.9% ) of them died as a consequence of major surgical complications directly related to the operation , as described above .
one patient died of a severe pneumonia with lung abscesses , another one due to myocardial infarction .
another patient died because of thoracic hemorrhage after complicated chest tube insertion for pleural effusion during her stay at the intensive care unit .
seven of these ten patients were preoperatively classified asa iv and the other three were asa iii . the highest mortality ( 7/15 , 47% ) was found in the group of patients who underwent tp because of troubles .
there was no perioperative or late mortality in patients with therapy - refractory chronic pancreatitis ( 0/7 ) and in the group with tp for technical or soft tissue - related reasons ( 0/18 ) .
a statistically significant difference was found only between the troubles and technical groups , p = .022 .
a summary of the most important characteristics of the four groups with total pancreatectomy is given in tables 1 and 2 .
table 3 shows a brief comparison of the morbidity and mortality in the tp group versus all other pancreatic resections for the studied period of time .
there was no statistical difference with regard to the rate of the most common major and minor postoperative complications .
the postoperative hospital stay was statistically longer in cases of tp ( p = .001 ) .
the annual number of tp performed at our center showed a steady increase over the study period , which corresponded to the increase in the total number of pancreatic procedures : n = 2/98 in 2004 ( 2% ) , n = 11/162 in 2005 ( 6.8% ) , n = 12/220 in 2006 ( 5.5% ) , n = 20/301 in 2007 ( 6.6% ) .
in the first six months of 2008 were performed 18 pancreatectomies out of 167 pancreatic procedures ( 10.8% ) .
the rate of tp was significantly higher in 2008 than in 2004 ( 10.8% versus 2% , p = .008 ) , however
the rate of tp ( n = 47/638 , 7.4% ) in the second half of the study period ( april 2006june 2008 ) was not higher than the rate ( n = 16/310 , 5.2% ) in the first half ( january 2004march 2006 ) , p = .214 .
in 1943/1944 rocky and priestly et al . demonstrated the feasibility of pancreatic resection in patients with pancreatic cancer and hyperinsulinism .
they propagated that tp should comprise the standard procedure for pancreatic resection in order to avoid complications of pancreatic anastomotic insufficiency .
furthermore the complete resection of the gland offered an elimination of multicentric disease and the advantage of a wider lymphadenectomy in the case of pancreatic cancer . using this radical approach many surgeons hoped to improve the overall survival in patients with adenocarcinoma of the pancreas .
several reports demonstrated that tp can be performed safely [ 14 , 15 , 20 ] and with the same morbidity as the standard whipple resection [ 8 , 21 ] .
in contrast , trede postulated the complication rate of tp to be threefold higher compared to pancreaticoduodenectomy .
some other studies also showed a significant higher morbidity and mortality in patients who underwent tp in comparison to those who underwent a less extensive resection [ 2 , 23 ] .
the main arguments contra tp were the following metabolic consequences : ( 1 ) endocrine insufficiency with a complete insulin deficiency and the necessity of insulin therapy , ( 2 ) exocrine insufficiency with steatorrhea and the need of durable pancreatic enzyme replacement , ( 3 ) the development of steatohepatis with progressive liver failure , and ( 4 ) the lack of bicarbonate secretion with an increased risk for the development of marginal and peptic ulcers resulting in continuous application of proton pump inhibitors . in 2003
bechler et al . stated that tp has lost its indication as pancreatic resections could be performed safely with low complication rates .
they demonstrated that tp also can be performed safely [ 12 , 26 ] and underlined the clinical necessity to carry out these operations in some well - selected indications . in agree with this recent data of bechler et al .
we present the data of 63 patients who underwent a tp during the period of 54 months .
indications for tp were analysed and classified in the four t 's : tumor , trouble , technical difficulties and therapy - refractory pain in patients with chronic pancreatitis . size or localisation of pancreatic tumor can make tp necessary in order to achieve a curative resection . in our series
locally advanced or multifocal pancreatic tumors remain the most common indication for tp ( 40% of our patients ) .
other examples for tumor - related indications are recurrent pancreatic carcinoma , multicentric cancer [ 16 , 27 ] , intraductal papillary mucinous neoplasia ( ipmn ) with invasive disease or diffuse involvement of the gland , and extensive neuroendocrine tumors [ 28 , 29 ] . although all pancreatectomies in the tumor group were elective , mortality was relatively high ( 13% ) .
this may be explained by the high rate of multivisceral resections 52% and vessel reconstructions 17.4% in this group . in all 15 patients of the trouble group , tp was either an emergency procedure or an ultima ratio in icu cases ( insufficiency of pancreatic anastomosis , pancreatic stump insufficiency complicated by acute bleeding , necrosis of pancreatic remnant followed by sepsis ) in which conservative therapy did not show any success . in those patients who developed vessel arrosion due to insufficiency of pancreatic anastomosis , acute bleeding occurred 5 to 14 days after the initial operation .
an early warning signal for imminent vessel arrosion may be a permanent high inflammation parameters with crp values higher than 100 mg / l .
american society of anesthesiologists ( asa ) classification of patients in the trouble group was iii or iv . in these patients surgery was very demanding due to the poor general condition of these patients , adhesions , and the altered intraoperative situs .
the operation time was significantly shorter , but substantially intraoperative blood loss and perioperative need of blood transfusions increased .
this group was characterized by the highest morbidity ( 73% ) and mortality ( 47% ) .
thus troubles represent disaster and terrible reason for completion and it should be considered alone as an emergency
the majority of patients died due to medical complications ( e.g. , pneumonia , myocardial infection , arrhythmia ) . in the reported series 18 tps
were performed because of technical difficulties . in a soft and friable pancreatic remnant that was unable to hold sutures
as 15 % of all pancreatic fistula can lead to a life - threatening haemorrhage and sepsis in these cases , an elective tp was performed .
the aim of tp in this group was to avoid an emergency completion pancreatectomy that is associated with a high mortality rate ( in our study : 47% cp .
there was no perioperative or late mortality in this group . until today there exists no clear definition of a
soft pancreas and it remains to be elucidated which tissue characteristics mandate removing the whole gland in the case of technical problems .
definition of objective criteria and the attentive evaluation of pros and cons are necessary to come to the decision to carry out such a prophylactic procedure .
particularly , in patients with chronic pancreatitis , symptoms not responding to medical treatment can remain or develop again after drainage or resection surgery , indicating progress of the disease or failure of the primary operative procedures , respectively .
several studies demonstrated that only 3060% of patients with chronic pancreatitis experienced significant pain relief after resection surgery [ 4 , 12 ] . in these patients
tp sometimes is inevitable [ 811 ] . in our collective 6 patients ( 13% )
a completion pancreatectomy was carried out as reoperation following prior pancreatic surgery as , for example , duodenum - preserving pancreatic head resection ( dpphr ) . in this group
well - reflected and elective planned tp in these patients was performed without any mortality and low morbidity . in this context mller
et al . reported results of 147 tp which correspond well to the findings of our study .
mortality in the elective group was 4.8% , whereas it was 39.1% in the completion tp group .
also the number of transfused red blood count ( rbc ) units was significant higher .
surgical morbidity in the elective group was 24.2% ; in the completion tp group it reached 73.9% .
mller et al . reported an increasing demand for tp as 36% of patients underwent tp in the last one of a five - year study period .
the number of tp in our collective also increased toward the end of the study period .
however this was basically caused by an increased total number of pancreatic procedures that were performed at our hospital .
the following trend was observed at our hospital : the number of tp for tumor and therapy - refractory pain remained constant , the number of troubles - tp decreased , and the number of tp by reason of technical problems increased .
several improvements in postoperative management including treatment of diabetes mellitus and substitution of pancreatic enzymes and fat - soluble vitamins have significantly reduced postoperative morbidity and improved quality of life after tp .
recent studies described that there was no significant difference in quality of life in patients with elective tp and partial pancreatectomy . in this context billings
et al . also confirmed no difference in quality of life in 34 tp patients compared with type i diabetic controls .
in addition pancreatic surgery has increased its safety , especially at high - volume pancreas centres [ 15 , 3336 ] , and in future autoislet cell transplantation may offer another option to improve the outcome of patients receiving tp leading to prolonged survival [ 37 , 38 ] . in conclusion the reported literature and our data exposed a satisfactory outcome for patients when the indication for tp was well reflected .
we subdivided the indication of tp into the 4 t 's : tumor , therapy refractory pain , troubles , and technical problems .
our data revealed , that tp can be accomplished safely and with complication rates comparable with other resective pancreatic procedures , when it was performed by specialized and experienced surgeons .
|
background . this study aimed to analyse the most common current indications for total pancreatectomy ( tp ) at a high - volume pancreas center
. method . prospectively collected data on indications and short - term outcome of all
tp 's performed from january 2004 until june 2008 were analysed . results .
the total pancreatectomies ( tp ) were 63 , i.e. , 6.7% of all pancreatic procedures
( n = 948 )
. indications for tp were classified into 4 groups : tumors of advanced stage , n = 23 ( 36.5% ) , technical problems due to soft pancreatic tissue , n = 18 ( 28.6% ) , troubles due to perioperative surgical complications , n = 15 ( 23.8% ) , and therapy - resistant pain due to chronic pancreatitis , n = 7 ( 11.1% ) . surgical complications occurred in 23 patients ( 36.5% ) .
the mortality in elective tp was 6.25% .
median postoperative stay was 21 days .
mortality , morbidity and the other perioperative parameters differed substantially according to the indication for pancreatectomy .
conclusion .
total pancreatectomy is definitely indicated for a limited range of elective and emergency situations .
indications can be : size or localisation of pancreatic tumor , trouble , technical diffuculties and therapy - refractory pain in chronic pancreatitis .
a tp due to perioperative complications ( troubles ) after pancreatic resections is doomed by extremely high morbidity and mortality and should be avoided .
|
serum paraoxonase 1 ( pon1 ) is a 45 kda glycoprotein which can catalyze the hydrolysis of various organophosphates and nerve agents [ 1 , 2 ] and also metabolize some drugs and prodrugs by its lactonase activity .
this enzyme which is located on high density lipoprotein ( hdl ) particles protects low density lipoprotein ( ldl ) phospholipids against oxidation .
decreased pon1 activity has been addressed in several diseases such as coronary artery diseases ( cad ) , type i diabetes , obesity , and renal failure .
it is evident that pon1 activity is influenced by a variety of agents like environmental , pharmacological , and lifestyle factors as well as age and sex [ 2 , 5 , 911 ] .
dietary fats have been suggested as an important relevant factor [ 12 , 13 ] .
polyenoic fatty acids have shown considerable inhibitory effect on pon1 activity , while monoenoic acids ( especially oleic acid ) protect pon1 from oxidative inactivation .
it has been also indicated that replacement of dietary saturated fats with trans fats in healthy men and women leads to a small reduction in the serum pon1 activity .
the lipid composition of hdl can influence its size and structure and is determined by a combination of various factors including dietary intake , metabolism , and storage .
so , dietary fats may affect pon1 activity via changing the phospholipid composition of hdl .
on the other hand , it seems that any variation in hdl fatty acid composition could alter the function of hdl and the activity of its related enzyme , pon1 .
the association between serum pon1 activity and the lipid content of hdl has not yet been investigated .
therefore , in this study we investigated the association between serum pon1 activity and fatty acid composition of hdl in healthy male subjects .
140 healthy men aged between 20 and 50 with a mean value of 32.5 8.2 years were selected from a representative sample of the iran center population .
all participants were nonsmoker and nonobese ( mean body mass index ( bmi ) 23.6 3.3
kg / m ) volunteers , without diabetes ( fasting blood sugar ( fbs ) 110 mg / dl ) , cardiovascular disease , familiar hypercholesterolemia , and dislipidemia or any other recognized lipid - related disorders . a questionnaire containing demographic characteristics , medical history , and lifestyle information
all participants signed an informed consent document approved by the isfahan university of medical sciences ethics committee . a 1214 h fasting blood sample ( 20 ml ) was taken from each subject by venipuncture .
serum samples were separated by centrifugation at 3000 rpm for 15 min , and then 100 l aliquots of each sample were stored at 80c until the measurement of the serum pon1 activity .
serum hdl cholesterol ( hdl - c ) was determined at the day of sampling using enzymatic methods .
serum pon1 activity was assayed using 2 mm paraoxon ( diethyl p - nitro - phenyl phosphate , sigma chemical co. , st .
louis , mo , usa ) as the substrate in 100 mm tris buffer ( ph 8.0 ) containing 2 mm of cacl2 .
a 40 l aliquot of serum was added to 500 l of substrate medium , and the initial rate of hydrolysis ( generation of p - nitrophenol ) was monitored at 412 nm , using a continuously recording spectrophotometer ( uv 3100 , shimadzu , kyoto , japan ) over a period of 2 min . a pon1 activity of 1 unit / l was defined as 1 mole of p - nitrophenol formed per minute .
the molar extinction coefficient of p - nitrophenol was taken at 17,000 m / cm .
serum hdl was separated ( 1.063 g / cm < < 1.21 g / cm ) by a three - stage method .
briefly , 5.9 ml of serum added to 3 ml of solution a ( containing 0.195 mmol nacl , 0.62 mmol naoh , 0.01% ( w / v ) edta - na2 , d = 1.006 g / ml ) in polyallomer ultracentrifuge tube ( optiseal , beckman / coulter , fullerton , california , usa ) in a discontinuous density gradient fashion , and centrifuged at 60000 rpm for 12 h at 16c , with the acceleration of 5 and deceleration of 7 . the very low density lipoproteine ( vldl ) fraction accompanied with 3 ml of the upper layer solution was removed , and then 3 ml of solution b ( containing 24.8 g nabr in 100 ml of solution a ) was added to the residual content of tubes for the second stage and centrifuged at 60000 rpm for 12 h at 16c , acceleration : 9 and deceleration : 7 .
then the ldl fraction accompanied by 3 ml of the supernatant was removed . in the last stage the residual content of tubes was mixed with 3 ml of solution c ( containing 78.32 g of nabr in 100 ml of solution a ) and centrifuged for another 12 h at 16c , acceleration : 9 and deceleration : 7 .
after centrifugation , the hdl fraction appearing as a yellow band at the supernatant was separated and stored at 80c for further analysis .
the centrifugations were done in a beckman coulter optima l-100 xp ultracentrifuge equipped with a 90ti fixed angle rotor .
protein concentration of the collected hdl fraction was measured using the lowry method . a commercially available standard mixture of 37 fatty acid methyl ester ( fame ) and a series of individual standards of fatty acid methyl esters including myristic acid ( c14:0 ) , palmitic acid ( c16:0 ) , stearic acid ( c18:0 ) , arachidic acid ( c20:0 ) , myristoleic acid ( c14:1 ) , palmitoleic acid ( c16:1 ) , oleic acid ( c18:1n9 ) , linoleic acid ( c18:2n6 ) , -linolenic acid ( ala , c18:3n3 ) , di - homo gamalinolenic acid ( dgla , c20:3n6 ) , cis-11,14,17-eicosatrienoic acid ( ete , c20:3n3 ) , arachidonic acid ( aa , c20:4n6 ) , cis-5,8,11,14,17-eicosapentaenoic acid ( epa , c20:5n3 ) , cis-4,7,10,13,16,19-docosahexaenoic acid ( dha , c22:6n3 ) , and nonmethylated heptadecanoic acid ( hda , c17:0 ) ( as internal standard ) (
boron trifluoro methanol ( bf3-m ) and butylated hydroxyl toluene ( bht ) were obtained from sigma chemical co. ( st . louis , mo , usa ) , and all other reagents , chemical compounds , and solvents were obtained from merck ( merck co. , darmstadt , germany ) .
100 l of hdl samples were added to a 3 ml of chloroform - methanol ( 2 : 1 v / v ) in a test tube . 100 l bht ( 5 mg / ml in chloroform ) as antioxidant and 100 l heptadecanoic acid ( 1000 g / ml in chloroform ) as internal standard ( to monitor the recovery rate ) were added to the mixture , and the tubes were vortexed vigorously for 1 min .
600 l of 0.9% nacl solution was mixed again prior to a brief centrifugation ( 100 rpm , 3 min ) to separate the phases .
the chloroform phase containing lipids ( lower layer ) was separated by a pasture pipette and transferred to another test tube .
anhydrous sodium sulfate was added to remove any remnant water , and the lipid extract was transferred to a 15 ml teflon liner screw cap tube and dried under nitrogen gas at room temperature before methylation .
the fatty acid methyl esters were prepared according to the method of morison and smith , using bf3 .
1 ml hexane and 1 ml bf3/methanol ( 13% ) were added to the dried lipid extract in 15 ml teflon liner screw cap tube and mixed well .
the mixture was heated at 100c in an oven for 45 min . after cooling
, 0.5 ml hexane and 0.5 ml hplc grade water were added to the mixture , shacked and centrifuged .
then , the methyl esters fraction in the upper hexane layer was separated by a pasteur pipette and dried under nitrogen gas .
fatty acid methyl esters were dissolved in 200 l hexane prior to gc analysis .
gc analyses were done by a younglin gc - fid system model , acme 6000 m ( young lin co. , hogye , anyang , korea ) , equipped with an fid detector .
the injector and detector temperature was held at 260c , and the flame was maintained with 40 ml / min h2 and 300 ml / min air .
helium was used as the detector auxiliary gas at a flow of 28 ml / min .
chromatography was carried out using an sp-2560 fused silica capillary column 100 m 0.25 mm 0.2 m film thickness ( supelco co. , bellefonte , pa ) .
helium was used as the carrier gas at a flow rate of 18 cm / s with constant flow compensation .
sample injections of 1 l were performed with a split ratio of 17 : 1 for the analysis .
the oven temperature was programmed from 140 to 245c at a rate of 4c / min after an initial time hold of 5 min and the final time hold of 15 min ( the total analysis time was 45.00 min ) .
statistical analyses were performed using spss version 16.0 ( spss , il , usa ) .
quantitative parameters were compared between groups by one way anova using tukey correction for post hoc multiple comparisons except for nonnormal distributed variables that were analyzed by a nonparametric kruskal - wallis test .
spearman 's rho correlation coefficient analysis was used to calculate the correlation between variables that were not normally distributed ( i.e. , serum pon1 activity , pon1/hdl - c ratio , pon1/apo a - i ratio , palmitoleic acid , linolenic acid , arachidic acid , eta , epa , dha , epa : dha , and 3 index ) .
all data were expressed as mean standard error or median and interquartile range . a p value < 0.05 was considered statistically significant .
subjects were divided into three experimental groups in accordance with their serum hdl - c levels to analyze the association between serum pon1 activity and hdl fatty acid composition ( group 1 : hdl 39 mg / dl ; 49 subjects , group 2 : 39 mg / dl < hdl 49 mg / dl ; 46 subjects and group 3 : 49 mg / dl < hdl ; 45 subjects ) .
all subjects in the three groups were age matched , and mean values for hdl - c were 32.3 4.1 , 43.5 2.9 , and 61.9 7.2 mg / dl in groups 1 , 2 , and 3 , respectively .
table 1 shows the fatty acid composition of hdl as percent of total fatty acids in three experimental groups .
the major fatty acid of hdl in all groups was palmitic acid and the minor one was ete .
the proportion of saturated fatty acids ( sfa ) in group 1 of experiment was significantly higher compared to that in group 2 ( p < 0.001 ) and group 3 ( p = 0.005 ) . among the sfas , palmitic acid and stearic acid were significantly higher in group 1 when compared to that in groups 2 and 3 ( p < 0.01 ) .
there was no significant difference in monounsaturated fatty acids ( mufa ) of hdl particles among three groups .
polyunsaturated fatty acids ( pufa ) were significantly lower in group 1 in comparison with group 2 ( p < 0.01 ) and group 3 ( p < 0.05 ) . among the pufas ,
ete was significantly higher in group 1 compared to that in groups 2 and 3 ( p < 0.05 ) .
inversely , aa was significantly lower in group 1 compared to that in group 2 ( p < 0.05 ) and group 3 ( p < 0.001 ) .
the proportion of 3 fatty acids to total fatty acids was significantly higher ( p < 0.05 ) , and the proportion of 6 fatty acids to total fatty acids was significantly lower ( p < 0.01 ) in group 3 of the study in comparison with the other groups .
a significant trend was seen for higher sfa to unsaturated fatty acids ( ufa ) , sfa : mufa , and sfa : pufa ratios in group 1 of the study . the ratio of aa : epa was significantly higher in group 3 compared to that in group 1 ( p < 0.01 ) and group 2 ( p < 0.05 ) .
associations of serum pon1 activity , pon1/hdl - c ratio , and pon1/apo a - i ratio with hdl fatty acid composition in all participants are indicated in table 2 .
serum pon1 activity was directly correlated with stearic acid ( r = 0.190 , p < 0.05 ) and dgla ( r = 0.260 , p < 0.01 ) .
serum pon1 activity adjusted for serum apo a - i level ( pon1/hdl - c ratio ) was directly correlated with miristic acid ( r = 0.190 , p < 0.05 ) , stearic acid ( r = 0.237 , p < 0.01 ) , and dgla ( r = 0.257 , p < 0.01 ) . there was a negative correlation between the pon1/hdl - c ratio and total 6 fatty acids of hdl particles ( r = 0.198 , p < 0.05 ) .
serum pon1 activity adjusted for serum apo a - i level ( pon1/apo a - i ratio ) was directly correlated with stearic acid ( r = 0.179 , p < 0.05 ) and dgla ( r = 0.278 , p < 0.01 ) but not with miristic acid .
it also was directly correlated with palmitoleic acid ( r = 0.197 , p < 0.05 ) .
a negative correlation was seen between pon1/apoa - i ratio with total 6 fatty acids of hdl particles ( r = 0.184 , p < 0.05 ) .
the correlations between pon1 activity and fatty acids of hdl in each individual group of the study are shown in table 3 .
as indicated in group 1 of the study with the serum hdl - c levels lower than 40 mg / dl , serum pon1 activity strongly correlated with mufas ( r = 0.487 , p < 0.01 ) especially palmitoleic acid ( r = 0.457 , p < 0.01 ) and oleic acid ( r = 0.474 , p < 0.01 ) . in this group , pon1 activity positively correlated with epa ( r = 0.352 , p < 0.05 ) and dgla ( r = 0.402 , p
< 0.01 ) and negatively correlated with la ( r = 0.332 , p < 0.05 ) . the ratio of sfa : mufa was inversely ( r = 0.414 , p < 0.01 ) and the ratio of epa : dha was directly ( r = 0.339 , p < 0.05 ) correlated with serum pon1 activity in the first group of the study . in the second group with serum hdl - c levels between 40 and 50 mg / dl , correlations between pon1 activity and fatty acids of hdl were completely different .
pon1 activity negatively correlated with myristic acid ( r = 0.296 , p < 0.05 ) , arachidic acid ( r = 0.315 , p < 0.05 ) , myristoleic acid ( r = 0.342 , p < 0.05 ) , ala ( r = 0.301 , p < 0.01 ) , ete ( r = 0.297 , p < 0.01 ) , epa ( r = 0.295 , p < 0.05 ) , and the ratio of epa : dha ( r = 0.310 , p < 0.05 ) and positively correlated with aa ( r = 0.425 , p < 0.01 ) .
there were no significant associations between pon1 activity and hdl fatty acids in the third group of participants with the serum hdl - c levels higher than 50 mg / dl .
the associations between fatty acid composition of hdl and the activity of its related enzyme , pon1 , in healthy male subjects with different ranges of serum hdl - c levels were investigated in this study .
results indicated that serum pon1 activity was directly correlated with stearic acid and dgla levels .
serum pon1 activity adjusted for serum hdl - c level ( pon1/hdl - c ratio ) also was directly correlated with miristic acid , stearic acid , and dgla levels .
it is evident that pon1 activity is influenced by a variety of agents including environmental , pharmacological and lifestyle factors as well as age and sex [ 2 , 5 , 911 ] .
polyenoic fatty acids have demonstrated a considerable inhibitory effect on pon1 activity , while monoenoic acids ( especially oleic acid ) protect pon1 against oxidative damages .
furthermore , replacement of dietary saturated fats with trans fats in healthy men and women moderately decreases the activity of pon1 .
the lipid composition of hdl which can influence its structure is determined by a combination of various factors including dietary intake , metabolism , and storage .
so , dietary fats may affect pon1 activity via changing the phospholipid composition of hdl .
on the other hand , it seems that any variation in hdl fatty acid composition may affect its three - dimensional structure and physical characteristics including size and zeta potential of hdl particles and consequently alter the function of hdl and the activity of its related enzyme , pon1 . in this research
we investigated the individual correlations between pon1 activity and fatty acid composition of hdl in each group of the study , separately ( table 3 ) .
the association between pon1 activity and hdl fatty acid composition was completely different in each group of the study . in subjects with serum hdl - c levels of 3949 mg / dl ( group 2 of the study ) sfas had negative correlations with serum pon1 activity .
mufas ( especially palmitoleic acid and oleic acid ) were positively correlated with serum pon1 activity in subjects with serum hdl - c levels lower than 40 mg / dl ( group 1 of the study ) , while in group 2 this correlation was different and myristoleic acid was inversely associated with pon1 activity . among pufas in group 1 ,
epa and dgla were positively and la was negatively correlated with pon1 activity . in group 2
this correlation was different again in that ala , ete , and epa were negatively and aa was positively correlated with serum pon1 activity .
there was no correlation between serum pon1 activity and fatty acid composition of hdl in subjects with serum hdl - c levels higher than 49 mg / dl ( the third group of our study ) .
to the best of our knowledge there is no investigation evaluating the relationship between hdl fatty acid composition and pon1 activity .
the association between serum pon1 activity and dietary factors has been reported in some studies .
for example , tomas and coworkers suggested that high intake of oleic acid from olive oil has a positive effect on serum pon1 activity in men especially in subjects with the pon1 - 192 rr polymorphism .
findings of another study demonstrated that meals rich in olive oil can increase postprandial serum pon1 activity in diabetic women . in an in vitro study , beneficial protecting and stabilizing effect of oleic acid on pon1 against oxidative inactivation
we found a negative correlation between the pon1/hdl - c ratio and total 6 fatty acids of hdl particles in all subjects , but no correlation was found between serum pon1 activity and total 3 fatty acids or the ratio of 6 : 3 in all subjects .
calabresi et al . have reported that a -3 polyunsaturated fatty acid concentrate can enhance plasma pon1 concentration and hdl2 subfraction in familial combined hyperlipidemia patients .
also , in another study the inhibitory effect of polyenoic fatty acids , especially linoleic acid , on pon1 activity was observed .
in addition , opposite to the triolein - rich diet that caused a significant increase in pon1 activity , fish oil showed significant decrease in an animal study .
one point that deserved further attention was the relatively strong association between mufas ( myristoleic acid , palmitoleic acid , and oleic acid ) and pon1 activity only in group 1 ( hdl - c 39 ) .
the reason of the relations is not clear , but it may be a protective compensation mechanism by which the fatty acids play in the subjects with low levels of hdl - c .
contrary to the presented studies , some researchers have not found any relationship between pon1 activity and daily intake of total lipids and sfas .
it is suggested that dietary fats may change the serum pon1 activity via affecting the synthesis and secretion of phospholipids and apo - a - i within very high density lipoprotein ( vhdl ) , the main transporter of pon1 and lcat molecules in blood .
although there is a relative agreement between the results obtained in the present study with the others , some controversy is observed even between other researches , which can be due to many factors beside the genetic variations .
hdl lipid composition 's determinants including dietary intake , metabolism , storage , and exchange among compartments are one of them . in the mentioned studies
only the effect of dietary fatty acids has been defined ; however , there is a strong interaction between all the determinants of hdl lipid composition .
the protective role of hdl against oxidative stress - related disease seems to be a complicated and multifactorial procedure that depends on the hdl particle size , number , composition , distribution , and its related enzyme pon1 .
fatty acid composition of hdl is the major factor which can influence the metabolism of hdl and its particle characterization such as size and zeta potential and can change the pon1 activity .
so , the enhancing effect of fatty acids like dgla on pon1 activity in this research may be the result of the changes in hdl size distribution toward the smaller particle size .
however , more investigations are needed to evaluate the exact relationship between the type of hdl fatty acids with pon1 activity in different subclasses of hdl
. these pieces of information may help to design therapeutic protocols toward beneficial modifications of hdl characteristics and its related enzyme , pon1 .
|
introduction .
cardioprotective effect of high density lipoprotein ( hdl ) is , in part , dependent on its related enzyme , paraoxonase 1 ( pon1 ) .
fatty acid composition of hdl could affect its size and structure .
on the other hand , pon1 activity is directly related to the structure of hdl .
this study was designed to investigate the association between serum pon1 activity and fatty acid composition of hdl in healthy men .
methods .
one hundred and forty healthy men participated in this research .
hdl was separated by sequential ultracentrifugation , and its fatty acid composition was analyzed by gas chromatography .
pon1 activity was measured spectrophotometrically using paraxon as substrate .
results .
serum pon1 activity was directly correlated with the amount of stearic acid and dihomo - gamma - linolenic acid ( dgla ) .
pon1/hdl - c was directly correlated with the amount of miristic acid , stearic acid , and dgla and was inversely correlated with total amount of 6 fatty acids of hdl . conclusion .
the fatty acid composition of hdl could affect the activity of its associated enzyme , pon1 .
as dietary fats are the major determinants of serum lipids and lipoprotein composition , consuming some special dietary fatty acids may improve the activity of pon1 and thereby have beneficial effects on health .
|
children with autism spectrum disorder ( asd ) exhibit deficits in motor control , imitation , and social function . does a dysfunction in the neural basis of representing internal models of action contribute to these problems ?
we measured patterns of generalization as children learned to control a novel tool and found that the autistic brain built a stronger than normal association between self generated motor commands and proprioceptive feedback ; furthermore , the greater the reliance on proprioception , the greater the child s impairments in social function and imitation .
|
|
air pollution is a well - known environmental hazard and its association with respiratory and cardiovascular pathology has been consistently confirmed by several epidemiological studies . in recent years ,
the idea that air pollution might be also associated with alzheimer 's disease ( ad ) and other neurodegenerative disorders has been the focus of many toxicological studies .
alzheimer 's disease a progressive and irreversible neurodegenerative disorder is the most common form of dementia among older adults affecting more than 4 million people in the usa and almost 30 million worldwide [ 13 ] .
other common risk factors include a positive family history of ad , the presence of apoe-4 alleles [ 4 , 5 ] , being a member of the female sex , cardiovascular disease , head injury , down syndrome [ 1 , 9 ] , and low educational level . as people continue to live longer ,
, it is projected that approximately 13 million people in the usa and 100 million people worldwide will be affected by this disease [ 2 , 11 ] increasing evidence indicates ad and other neurodegenerative disorders are at least partially mediated by oxidative stress .
oxidative stress is the state of redox imbalance that results from a production of reactive oxygen species ( ros ) that exceeds the capacity of antioxidant defense mechanisms .
environmental exposures such as air pollution can enhance an organism generation of ros ; thus , air pollution exposure could very well represent a risk factor for ad by enhancing oxidative stress processes capable of inducing physiological alterations of the central nervous system .
air pollution is a prevalent environmental hazard . in the usa , national ambient air quality standards ( naaqss )
have been established for six principal air pollutants criteria air pollutants proved to represent a threat for human health .
these pollutants include ( 1 ) ozone ( o3 ) , ( 2 ) particulate matter ( pm ) , ( 3 ) carbon monoxide ( co ) , ( 4 ) nitrogen oxides ( nox ) , ( 5 ) sulfur dioxide ( so2 ) , and ( 6 ) lead . in spite of the current standards
, it is estimated that in the usa over one hundred million people live in areas that exceed the recommended air quality levels .
the large number of individuals exposed to air pollution levels above the recommended standards and population aging are two factors that could act synergistically to increase the prevalence of ad . even after accounting for the predicted increase in alzheimer 's frequency due to population aging , the significant prevalence of air pollution could very well exacerbate the impact of this disease on public health . granting that air pollution could be one of the factors involved in ad causality
the association between air pollution specifically pm and o3and ad via oxidative stress is the focus of this paper .
reactive oxygen species ( ros ) is a term used to collectively refer to reactive molecules containing oxygen , which include free radicals and derivates , and are capable of leading to oxidative changes within cells [ 1416 ] .
a wide variety of ros are produced in healthy tissues in the course of normal metabolism at different cellular sites .
however , the main source of ros is the mitochondrial electron transport chain , specifically complex i ( nadh dehydrogenase ) and iii ( ubiquinone - cytochrome c reductase ) of the chain [ 1621 ] . other important generators of ros in vivo include peroxisomal fatty acids metabolism , cytochrome p-450 reactions , phagocytic cells ( respiratory burst ) , and numerous enzymes [ 19 , 22 ] .
however , they can also cause oxidative changes within the cell and modify proteins , lipids , and nucleic acids to develop or enhance age - related manifestations [ 12 , 21 , 23 ] . several antioxidant systems enzymes , vitamins , and metabolites protect the cell against ros - mediated oxidative damage by three key mechanisms : ( 1 ) scavenging ros and their precursors , ( 2 ) binding catalytic metals ions used for ros formation , and ( 3 ) generating and upregulating endogenous defense mechanisms [ 12 , 2327 ] .
the balance between ros production and antioxidant defense system determines the degree of oxidative stress .
when ros formation exceeds the capacity of the antioxidant defense systems oxidative stress occurs , which results in oxidative damage to macromolecules
lipids , proteins , and nucleic acids mitochondria , and other cells compartments [ 12 , 16 , 19 , 22 , 24 , 25 , 27 , 28 ] .
table 1 lists some examples of ros , ros sources , and antioxidant defense mechanisms [ 1719 , 22 , 26 ] . from a biological perspective , aging is defined as the accumulation of changes over time responsible for the chronological alterations that occur with age and result in an increased risk of disease and death with advanced age [ 28 , 29 ] .
however , the oxidative stress hypothesis proposed by denham harman in 1956the free radical theory of aging offers the best mechanistic explanation of aging and age - related diseases [ 28 , 29 ] .
harman 's theory posits a single common process modified by genetic and environmental factors that is responsible for aging and subsequent death .
harman argues aging is primarily the result cumulative damage on macromolecules resulting from free radical attacks oxidative stress [ 28 , 30 , 31 ] .
this theory was later expanded to propose mitochondria as the main source of free radical production [ 28 , 31 ] .
consequently , aging can now be described as the result of the accumulation of ros - induced damage to macromolecules by free radicals mainly of mitochondrial origin [ 19 , 28 ] .
in addition to being a main source , mitochondria are also a major target of ros .
mitochondrial dna is especially vulnerable to oxidative damage because of its proximity to the site of mitochondrial ros production ( mitochondria ) , little protection of its structure ( no full histone coat ) , and limited repair mechanisms [ 17 , 1921 , 29 , 32 ] . during normal aging , free radical damage to mitochondria and ros production increase and antioxidant mechanisms
become progressively impaired [ 28 , 33 ] . consequently , vulnerability to oxidative stress and accumulation of oxidatively damaged macromolecules increase with age and may contribute to aging and age - related degeneration [ 20 , 28 ] .
although fast replicating cells with low levels of oxygen consumption do not suffer free radical damage , mitochondria of highly differentiated cells with high levels of oxygen utilization are highly vulnerable to oxidative stress .
consequently , neurons are especially vulnerable to mitochondrial damage by free radicals [ 29 , 34 ] .
thus , the detrimental effects of the aging process are best observed in the brain , where irreversibly damaged cells can not be replaced . the brain
an organ rich in fatty acids , consumer of high levels of energy and physiological oxygen , and poor in antioxidant defense mechanisms is particularly vulnerable to oxidative stress [ 16 , 23 , 27 , 3438 ] .
depending on the macromolecule targeted by ros , oxidative stress will manifest as lipid peroxidation , protein oxidation , or dna oxidation .
accumulation of oxidation of lipids , proteins , and dna by free radicals are responsible for the functional decline in aged brains , which manifests as a deterioration in cognitive function and motor skills [ 12 , 19 ] .
alzheimer 's disease is a progressive and irreversible neurodegenerative disease manifested as a slowly progressive dementia , which begins with subtle memory loss and progresses to severe decline in cognitive function and disability [ 1 , 39 , 40 ] .
evidence of an increased oxidation of macromolecules lipids , carbohydrates , proteins , and dna and oxidative stress products has been found in senile plaques and neurofibrillary tangles .
biomarkers of these forms of oxidation have been observed not only in ad brains but also in peripheral tissues ( e.g. , blood cells ) and biological fluids ( e.g. , urine ) of individuals affected by ad [ 16 , 23 , 37 , 38 , 4244 ] .
the principal component of senile plaques found in alzheimer 's brains is amyloid - beta ( a ) peptide [ 45 , 46 ] , which plays an important role in the etiology and progression of this disease .
however , it is unclear whether a peptide deposition is the cause or the result of the oxidative stress observed in alzheimer 's brains [ 27 , 46 ] . in the initial phase of the development
the disease , a peptide deposition and the formation of neurofibrillary tangles are consequences of oxidative stress and may serve as shields to protect neurons against oxidative damage .
however , as the disease progresses , these evolve into prooxidants driving a self - sustained autodestructive process and the progression of the disease [ 16 , 47 ] .
amyloid - beta peptide - related oxidative stress provides a theoretical framework that unites these two components in the pathogenesis of ad and suggests two possible scenarios : first , neuronal degeneration could be the result of an oxidative stress response to senile plaques and neurofibrillary tangles rather than to these lesions as such .
second , oxidative stress could be one of the earliest detectable events in the pathogenesis of ad preceding the extracellular deposition of a peptide and the formation of senile plaques and neurofibrillary tangles [ 16 , 47 ] .
olfactory dysfunction results from the extensive cell loss and neurofibrillary tangles formation associated with ad that precede a peptide deposition and occur in the olfactory bulb and olfactory centers ( i.e. , anterior olfactory nucleolus , periamygdaloid cortex , and anterior amygdala ) in the early stages of ad [ 49 , 50 ] .
lipid peroxidation in the nuclear and cell membrane of olfactory neurons and epithelial cells of ad cases but not in age - matched normal neuroepithelial cells has been found [ 51 , 52 ] . in addition , a peptide deposition and paired helical filaments of tau protein ( precursors of neurofibrillary tangles ) are also substantially more frequent and more abundant in the olfactory epithelium of ad cases than in controls [ 48 , 53 ] .
additionally , epidemiological studies indicate that olfactory dysfunction predicts an increased risk of cognitive decline with advanced age and takes place before the clinical manifestations of ad [ 50 , 53 , 54 ] .
the occurrence of olfactory pathology in the early stages of ad and the identification of the nose as the portal of entry of airborne xenobiotics into the brain suggests ad pathology could be mediated by environmental agents such as air pollutants that could reach the brain through the olfactory epithelium [ 50 , 55 , 56 ] .
atmospheric air pollution can be defined as the introduction of any chemical , physical , or biological pollutant in the indoor or outdoor air that modifies the natural characteristics of the atmosphere and harms human health and welfare .
air pollutants can be released into the atmosphere from both natural ( e.g. , windblown dust , volcanoes , and wildfires ) and anthropogenic sources ( e.g. , power plants , industries , and transportation ) .
however , manmade sources are identified as the major contributor to indoors and outdoors air pollution . in the usa , naaqss for six principal air pollutants (
i.e. , o3 , pm , co , nox , so2 , and lead ) have been established to protect vulnerable populations ( children , older adults , and individuals living with chronic diseases ) against air pollutants toxicity .
primary and secondary naaqs for these six criteria air pollutants are summarized in table 2 . despite the improvements made in ambient air quality
, air pollution continues to be a prevalent environmental hazard in urban and rural areas .
it is estimated that in the usa 146 million people live in areas that exceed the recommended air quality standards for at least one criteria air pollutant in most cases , o3 , pm , or both .
human activities affect the timing , location , and degree of personal exposure to pollutants .
adults , who generally spend most of their time inside ( e.g. , at home , workplace , and/or automobile ) , are more likely to be exposed to indoor air pollution while children , who spend more time than adults outside , are more likely to encounter outdoor air pollution .
the release of pollutants into the atmosphere exposes humans to hazardous substances primarily by direct inhalation .
transport and deposition of air pollutants into water and soil also exposes humans to air pollutants through the ingestion of contaminated water and food .
although representing a minor route of exposure , dermal contact with contaminated soil , dust , or water can also contribute to an individual 's air pollutant intake [ 58 , 62 ] .
short- and long - term exposure to air pollution has consistently been linked to adverse health outcomes .
exposure to pm and o3 is associated with an increased cardiovascular and respiratory morbidity , mortality , and disability risk [ 6368 ] .
recent estimates indicated that globally about 3% of adult cardiopulmonary disease mortality , 5% of cancers of the respiratory system mortality , and about 1% of acute respiratory infection mortality in children in urban areas are attributable to pm , which represents about one million premature deaths and 6.4 million years of life lost .
epidemiologic studies have shown a positive association between cardiovascular hospitalizations and ambient no2 , co , and pm levels [ 63 , 65 , 67 , 68 ] .
exposure to air pollution has also been associated with reduced lung capacity in healthy individuals and increased risk of exacerbations , hospitalizations , and mortality in subjects with respiratory chronic diseases such as asthma and chronic obstructive pulmonary disease .
the oxidative potential of air pollution relies on particle composition and size distribution and on the presence of transition metals and semivolatile and volatile organic chemicals .
air pollutants can act directly as prooxidants of lipids and proteins or as free radical generators by promoting oxidative stress and inducing inflammatory responses after a threshold a level at which natural antioxidant mechanisms are overwhelmed is reached [ 58 , 69 , 70 ] .
autopsy samples from the frontal cortex of individuals exposed to urban air pollution indicates that air pollution produces frontal differential regulation of genes involved in oxidative stress , inflammation , cell proliferation , differentiation and apoptotic death , dna damage , presynaptic signaling , membrane trafficking , and microtubule assembly and stability .
once natural defense mechanisms are overwhelmed proinflammatory effects follow via the activation of redox - sensitive transcription factors such as nfb
thus , given the large number of people exposed to air pollution , air pollutants could very well represent a prevalent source of environmentally induced ros production and thus a risk factor for ad a neurodegenerative disorder mediated by oxidative stress .
evidence from toxicological studies using animal and cellular models indicates that individuals exposed to high levels of air pollution show damage in the olfactory mucosa , olfactory bulb , and frontal cortex region tissues
all similar to that observed in the ad brains [ 50 , 71 , 72 ] .
the presence of neocortical hyperphosphorylated tau with pretangle material and amyloid- diffuse plaques in the frontal cortex of individuals exposed to urban air pollution suggests a link between oxidative stress , neuroinflammation , neurodegeneration , and chronic exposure to high concentrations of air pollution . air pollution can also accelerate amyloid - beta-42 ( a-42 ) accumulation , which is a known cause of the neuronal dysfunction that precedes the formation of a peptide plaques and neurofibrillary tangles [ 55 , 73 , 74 ] .
in addition , human studies have shown that exposure to air pollution impairs cognitive function and induces cerebrovascular damage .
also , they allow us to identify the human nose as the portal of entry of air pollutants into the brain [ 55 , 56 ] .
although ad causality is multifactorial and thus the result of the interaction of several factors rather than of a single identifiable cause , there is enough evidence to identify air pollution as an important contributing factor to the development and expression of the disease .
the interaction between aging , genetic predisposition , and air pollution in the causation of ad is depicted in figure 1 [ 1 , 411 , 17 , 19 , 28 , 35 , 72 , 73 ] .
atmospheric particulate matter is a complex mixture of solid particles and liquid droplets commonly found in urban air , and it has shown to be associated with a variety of adverse health outcomes [ 58 , 65 , 77 , 78 ] .
the potential for pm to reach the central nervous system is directly associated with the particles size .
fine particles with an aerodynamic diameter of less than 2.5 m ( pm2.5 ) and ultrafine particles of less than 0.1 m of aerodynamic diameter ( ufpm ) are the most significant for the pathogenesis of diseases of the central nervous system .
ultrafine particles can reach the brain by transsynaptic transport after inhalation through the olfactory epithelium and uptake through the blood - brain barrier [ 16 , 72 , 74 ] .
deleterious effects of pm on the brain also vary depending of the number of particles , their chemical composition and physical characteristics , the amount of surface components that are translocate from the lung to other organs , and the velocity at which these particles and components are cleared from the system [ 72 , 74 ] .
the effects of pm on the brain are believed to be the result of two mechanisms .
first , its ability to induce chronic respiratory and systemic inflammation by producing proinflammatory cytokines , which affect the blood - brain barrier , triggers neural - immune interactions and leads to chronic oxidative stress [ 16 , 56 , 75 ] .
second , its ability to directly produce ros can damage the blood - brain barrier and increases the production of a peptides .
together these mechanisms are responsible for causing brain inflammation and accelerating the accumulation of a peptide , both of which are associated with the neuronal dysfunction that precede the appearance of senile plaques and formation of neurofibrillary tangles [ 55 , 74 ] , which are the hallmarks of ad . ozone is a gaseous air pollutant originated from photochemical reactions between nox and voc in the troposphere .
ozone is the main component of smog and represents an important problem in urban areas , especially during the summer when sunlight is abundant .
emissions from industrial facilities , motor vehicle exhaust , and gasoline vapors are examples of important sources of nox and voc the precursors of o3 .
ozone is an ros and powerful oxidizing agent [ 72 , 79 ] capable of inducing oxidative stress state .
animal studies have indicated that the oxidative effects of o3 on the brain vary with the duration of the exposure and show a dose - response relationship [ 36 , 79 ] .
this variation indicates that even though short o3 exposure induces ros production , this occurs at a level that can still be compensated by antioxidant defense mechanisms .
however , as the duration of the exposure increases , the production of ros rises and finally reaches a threshold dose at which antioxidant defense mechanisms capacity is exceeded causing brain dysfunction .
this brain dysfunction is manifested as short- and long - term memory loss and motor deficiency in rats , all alterations that are positively related to the duration of o3 exposure [ 36 , 79 ] . besides causing motor deficiency and memory loss ,
o3 can also cause neuroinflammation , neuronal damage , and alterations of the cerebral vasculature [ 36 , 72 ] .
moreover , o3-induced oxidative stress can cause dysregulation of inflammatory processes , progressive neurodegeneration , chronic loss to brain repair in the hippocampus , and brain plasticity changes in rats , which are comparable to those observed in ad disease patients .
although there is evidence showing the oxidative changes caused by o3 on the brain , the mechanisms through which this gas reaches and affects the brain are yet to be understood [ 36 , 72 ] and should consequently motivate future research efforts .
in this paper we discussed the current evidence describing an association between exposure to air pollution and ad .
although evidence from toxicological studies using animal and cellular models is abundant , epidemiological evidence is limited .
thus , the potential link between air pollution and ad at the population level remains unclear .
more research is needed to characterize the association between exposure to air pollution and ad and its implications for public health . at the individual level
, efforts should be oriented toward determining the routes through which each air pollutant reaches the brain , as well as the biological mechanisms through which they contribute to the development and clinical manifestation of ad .
specifically , the effects of pm and o3 on the brain have been the focus of many studies ; however , exposure to voc is yet to be described .
also , and because air pollution consists of a mixture of different air pollutants ( i.e. , particles , liquid droplets , and gases ) , further investigation on the potential additive or synergistic effects between these pollutants is imperative .
the identification of air pollution as a factor in the pathogenesis and etiology of ad on the population level could provide a strong basis for implementing novel public health initiatives that could prevent ad for reaching epidemic proportions . by controlling the environmental factors that contribute to the pathogenesis of ad
, public health professionals could also effectively minimize the burden ad is projected to place on worldwide healthcare systems in the decades to come .
air pollution has consistently been identified as a significant environmental hazard and its association with cardiovascular and respiratory disease is well established .
recent reports from toxicological studies indicate the existence of an association between air pollution and central nervous system disease . depending on their characteristics air toxicants
the effects of air pollution on the brain then manifest as neuroinflammation , oxidative stress , and neurodegeneration .
although ad causality is multifactorial , air pollution could increase an individual 's risk of developing ad by accelerating age - related oxidative changes observed in the brain and hence represent a significant public health hazard .
therefore , the control of environmental factors such as air pollution could be a key factor in limiting the predicted increase in ad cases , as well as the burden it is expected to have on healthcare systems , worldwide . despite the many studies investigating the association between air pollution and ad , the role of air pollution in the causation and pathogenesis of this neurodegenerative disorder is not fully understood .
individual factors that could mediate the association between air pollution and ad such as age , nostril size , daily activities , and concomitant health conditions need further investigation .
in addition , epidemiological studies looking at the association between air pollution and ad are few .
therefore , the implications of the association between air pollution and ad at a population level remain unclear .
the predicted burden of ad on public health and the health care system should further motivate future research oriented toward providing evidence to obtain a better understanding of this association and guide preventive efforts .
|
alzheimer 's disease ( ad ) is the most common form of dementia affecting millions of people worldwide and will continue to affect millions more with population aging on the rise .
ad causality is multifactorial .
known causal factors include genetic predisposition , age , and sex .
environmental toxins such as air pollution ( ap ) have also been implicated in ad causation .
exposure to ap can lead to chronic oxidative stress ( os ) , which is involved in the pathogenesis of ad . whereas ap plays a role in ad pathology ,
the epidemiological evidence for this association is limited . given the significant prevalence of ap exposure combined with increased population aging , epidemiological evidence for this link is important to consider . in this paper , we examine the existing evidence supporting the relationship between ap , os , and ad and provide recommendations for future research on the population level , which will provide evidence in support of public health interventions .
|
acute and early human immunodeficiency virus ( hiv ) infection ( aeh ) is associated with rapid immune destruction and significantly greater infectivity than during chronic infection , mainly due to transient levels of extremely high hiv - ribonucleic acid .
main deterrents of widespread use of aeh screening algorithms appear to be the elevated costs , which limit aeh testing in some settings to perceived high - risk populations , such as men who have sex with men ( msm ) .
but while msm represent a significant risk group , the risk of hiv infection within this population is not uniform .
studies have shown that msm presenting to community hiv - screening programs may represent a subsegment of the msm population at higher risk for the acquisition of hiv infection .
the objectives of this study were to identify risk factors associated with aeh among msm - undergoing community hiv testing and to compare demographics in those diagnosed with aeh with those diagnosed at chronic stage of hiv infection .
in this retrospective observational cohort study , we analyzed risk behavior reported for the previous 12 months in individuals who enrolled in the voluntary early test hiv - screening program between april 2008 and july 2014 .
early test is a community - based , confidential aeh screening program in san diego , california that provides point - of - care rapid hiv serologic testing followed by reflex hiv nucleic acid amplification testing ( nat ) in all antibody ( ab)-negative persons . males and female - to - male transsexual persons who reported sexual contact with one or more male partners during the previous 12 months
aeh was characterized using previously published criteria for serologic and virologic test results . in repeat testers ,
eligible participants for the analysis of risk factors associated with aeh included msm diagnosed with aeh ( acute : hiv nat+/ab and early : hiv ab+/detuned hiv ab c / w infection < 70 days ) and those who were hiv uninfected .
in addition , we compared demographics and risk factors in those with aeh to those with newly diagnosed chronic hiv infection ( ie , hiv ab+/detuned not consistent with infection < 70 days ) to identify factors associated with delayed hiv diagnosis . for statistical analysis spss 21 ( spss inc . ,
univariate and multivariate cox proportional hazards regression analysis was conducted for risk factors ( such as sexually transmitted infections ) and risk behavior variables associated with high aeh prevalence rates ( above 4% ) in the current and/or previous studies ( selected on the basis of epidemiological evidence ) . for the cox regression model ,
aeh diagnosis was used as outcome , time of follow - up ( beginning of study period to last eligible test ) as time , and hazard ratios ( hr ) including 95% confidence intervals were displayed .
in the first step , univariate analyses were performed , and variables with p < 0.20 were included in the multivariable model .
the university of california , san diego human research protections program approved the study protocol , consent and all study - related procedures .
all study participants provided voluntary , written informed consent before any study procedures were undertaken .
a large population ( n = 14,612 unique clients ) underwent hiv screening using the early test between april 2008 and july 2014 , including 8935 ( 61% ) individual msm ( with 17,333 voluntary hiv tests ) .
overall , 419 of 8935 msm ( 4.69 % ) were newly diagnosed with hiv infection ; 219 ( 2.45% ) with chronic hiv infection and 200 ( 2.24% ) with aeh ( 125/200 [ 63% ] at their first early test , 75/200 [ 37% ] at a repeat visit )
. table 1 provides the prevalence of risk behaviors reported for the 12 months prior to the most recent test and demographics for the study population , as well as aeh prevalence per risk behavior .
individuals with aeh were significantly younger ( median 30 years interquartile range [ iqr 2540 ] vs 33 years [ iqr 2743 ] , p = 0.001 ) and reported significantly more male sex partners ( median 10 [ iqr 520 ] vs 5 [ iqr 310 ] , p < 0.001 ) than those with negative test results .
condomless receptive anal intercourse ( crai ) was associated with a significantly higher rate of being diagnosed with aeh ( 3.7% vs 2.2% , p < 0.001 ) , as was reporting 5 or more male sexual partners in the prior 12 months ( 3.1% vs 2.2% , p < 0.001 ) . when the number of male sexual partners was combined with crai ,
a dose response relationship between risk and proportion of aeh diagnoses was observed ( crai and 3 male partners was 4.2% , crai and 5 male partners 4.7% , and crai and 10 partners was 5.5% , all p < 0.001 ) . risk behavior and demographics reported for the 12 months prior to diagnosis / last hiv test in msm with acute / early hiv as compared to those with negative hiv test results and those with newly diagnosed chronic hiv univariate and multivariate cox regression models of risk factor and behaviors were performed ( variables included in the model are listed in table 2 ) .
the combination of crai and 5 or more male partners was the strongest predictor of aeh , followed by crai with an hiv - positive male , reported syphilis diagnosis within last 12 months , and crai with a person who injects drugs .
individuals reporting at least 1 of the 4 risk behaviors of the multivariable cox regression model ( n = 2971 with 139 aeh ) had an hr of 4.612 ( 95% confidence interval 3.3826.289 ; p < 0.001 ) for aeh .
aeh prevalence rates increased in those that reported higher numbers of risk behaviors of the final model , as shown in table 2 .
univariate and multivariate cox regression model of risk factors and risk behaviors associated with acute / early hiv infection ( vs negative test result ) in msm msm diagnosed with aeh differed in race ( p = 0.005 ; more reported white race [ p = 0.001 ] , less black race [ p = 0.030 ] , and trend toward less native american race [ p = 0.061 ] ) , when compared to those diagnosed with chronic hiv infection , while there was no difference observed regarding age .
those with aeh also reported more male partners ( p < 0.001 ) and crai ( p = 0.023 ) than those with newly diagnosed chronic hiv infection .
no differences were found for drug use ( with the exception of gamma hydroxybutyrate ) and sexually transmitted infections ( chlamydia , syphilis , and gonorrhea ) ( table 1 ) .
overall , 12/22 ( 55% ) black msm with chronic hiv diagnoses reported at least 1 of the 4 risk behaviors of the multivariable cox regression model , which was similar to msm reporting white race ( 54/99 [ 55% ] ) .
table 1 provides the prevalence of risk behaviors reported for the 12 months prior to the most recent test and demographics for the study population , as well as aeh prevalence per risk behavior .
individuals with aeh were significantly younger ( median 30 years interquartile range [ iqr 2540 ] vs 33 years [ iqr 2743 ] , p = 0.001 ) and reported significantly more male sex partners ( median 10 [ iqr 520 ] vs 5 [ iqr 310 ] , p < 0.001 ) than those with negative test results .
condomless receptive anal intercourse ( crai ) was associated with a significantly higher rate of being diagnosed with aeh ( 3.7% vs 2.2% , p < 0.001 ) , as was reporting 5 or more male sexual partners in the prior 12 months ( 3.1% vs 2.2% , p < 0.001 ) . when the number of male sexual partners was combined with crai ,
a dose response relationship between risk and proportion of aeh diagnoses was observed ( crai and 3 male partners was 4.2% , crai and 5 male partners 4.7% , and crai and 10 partners was 5.5% , all p < 0.001 ) .
risk behavior and demographics reported for the 12 months prior to diagnosis / last hiv test in msm with acute / early hiv as compared to those with negative hiv test results and those with newly diagnosed chronic hiv univariate and multivariate cox regression models of risk factor and behaviors were performed ( variables included in the model are listed in table 2 ) .
the combination of crai and 5 or more male partners was the strongest predictor of aeh , followed by crai with an hiv - positive male , reported syphilis diagnosis within last 12 months , and crai with a person who injects drugs .
individuals reporting at least 1 of the 4 risk behaviors of the multivariable cox regression model ( n = 2971 with 139 aeh ) had an hr of 4.612 ( 95% confidence interval 3.3826.289 ; p < 0.001 ) for aeh .
aeh prevalence rates increased in those that reported higher numbers of risk behaviors of the final model , as shown in table 2 .
univariate and multivariate cox regression model of risk factors and risk behaviors associated with acute / early hiv infection ( vs negative test result ) in msm
msm diagnosed with aeh differed in race ( p = 0.005 ; more reported white race [ p = 0.001 ] , less black race [ p = 0.030 ] , and trend toward less native american race [ p = 0.061 ] ) , when compared to those diagnosed with chronic hiv infection , while there was no difference observed regarding age .
those with aeh also reported more male partners ( p < 0.001 ) and crai ( p = 0.023 ) than those with newly diagnosed chronic hiv infection .
no differences were found for drug use ( with the exception of gamma hydroxybutyrate ) and sexually transmitted infections ( chlamydia , syphilis , and gonorrhea ) ( table 1 ) .
overall , 12/22 ( 55% ) black msm with chronic hiv diagnoses reported at least 1 of the 4 risk behaviors of the multivariable cox regression model , which was similar to msm reporting white race ( 54/99 [ 55% ] ) .
we conducted a study on risk factors for incident hiv infection and generated a profile for aeh risk among msm that undergo community - based hiv screening .
these data showed a hr of 4.6 for aeh in individuals reporting at least 1 of the 4 risk behaviors of the final model .
we also found that a higher proportion of white msm were diagnosed with aeh , while a higher proportion of black msm were diagnosed with chronic hiv infection . by using multivariate modeling ,
we have created a set of risk factors associated with diagnosis of aeh in msm undergoing hiv screening ( table 2 ) .
although most previous hiv - risk models have focused on newly diagnosed chronic infection , this represents one of the biggest studies to date to focus on incident hiv infection .
although each of the 4 risk behaviors of our final model has been described previously to be associated with hiv infection individually ( combination crai and 5 or more male partners , crai with an hiv - positive male , crai with a person who injects drugs , and self - reported syphilis infection during the last 12 months ) , these risk factors have not been described together in a multivariate model . by focusing only on aeh and investigating all of these factors together
, we were able to generate a profile for aeh risk among msm undergoing field - based screening , with an hr of 4.6 for aeh in individuals reporting at least 1 of the 4 risk behaviors .
in contrast to previous studies , methamphetamine and other noninjection drug use , injection drug use , and injection drug use with shared needles did not remain significant predictors of aeh in our final model .
other studies have reported that methamphetamine and other stimulant drugs seem to be a driver for sexual - risk behavior , and even dose - response associations between number and frequency of substance use and high - risk sexual behaviors among hiv - negative msm have been described . however , usage rates of for example methamphetamine , nitrites , or gamma hydroxybutyrate differ depending on geographic location . in addition
, methamphetamine use has recently been decreasing in many settings while sexual - risk behaviors are steadily increasing .
whereas condomless anal intercourse or crai alone have been described as predictors of hiv infection in prior studies , we found that crai alone was associated only with slightly increased aeh risk , whereas the combination of crai and number of male partners may be a more useful predictor of aeh .
results going into the same direction were reported by ostrow et al who found that the risk of seroconversion increased linearly with the number of crai sex partners .
we also found that the proportion of individuals reporting white race was higher among aeh diagnoses as compared to chronic hiv diagnoses , while the opposite was true for those reporting black race .
this is further evidence of the marked racial disparities found throughout the care continuum of hiv in the united states . in particular , infrequent hiv testing , undiagnosed infection , and late diagnosis are common among black msm in the united states .
our results indicate additional measures ( eg , promotion of aeh testing ) for black msm are needed in order to increase testing and achieve earlier hiv diagnoses .
in contrast to previous studies , we did not find differences in age between those diagnosed with aeh and those with chronic hiv .
additionally , we can not completely rule out that subjects reported risk behaviors more openly with time and repeat testing , which may have impacted results of our multivariable model . in conclusion , we established a multivariate model for predicting risk of aeh infection in a cohort of msm undergoing community hiv screening , which could be potentially used to discern those in need of further hiv nat testing for community screening programs that do not test routinely for aeh .
in addition , we found that race differed between those diagnosed with aeh and those diagnosed at chronic stage of hiv infection underlining the need for interventions that reduce stigma and promote the uptake of hiv testing for black msm .
|
abstractthe objectives of this study were to identify risk factors associated with acute and early hiv infection ( aeh ) among men who have sex with men ( msm ) undergoing community hiv testing and to compare demographics in those diagnosed with aeh with those diagnosed at chronic stage of hiv infection.in this retrospective cohort study , we analyzed risk factors associated with aeh among 8925 unique msm ( including 200 with aeh [ 2.2% ] and 219 [ 2.5% ] with newly diagnosed chronic hiv infection ) undergoing community - based , confidential aeh screening in san diego , california.the combination of condomless receptive anal intercourse ( crai ) plus 5 male partners , crai with an hiv - positive male , crai with a person who injects drugs , and prior syphilis diagnosis were significant predictors of aeh in the multivariable cox regression model .
individuals reporting 1 of these 4 risk factors had a hazard ratio of 4.6 for aeh .
msm diagnosed with aeh differed in race ( p = 0.005 ; more reported white race [ p = 0.001 ] , less black race [ p = 0.030 ] , trend toward less native american race [ p = 0.061 ] ) , when compared to those diagnosed with chronic hiv infection , while there was no difference observed regarding age.we established a multivariate model for the predicting risk of aeh infection in a cohort of msm undergoing community hiv screening , which could be potentially used to discern those in need of further hiv nucleic acid amplification testing for community screening programs that do not test routinely for aeh . in addition , we found that race differed between those diagnosed with aeh and those diagnosed at chronic stage of hiv infection underlining the need for interventions that reduce stigma and promote the uptake of hiv testing for black msm .
|
a new factor , hepatoma up - regulated protein ( hurp ) , was identified as having a role in chromosome congression ( koffa et al . , 2006 ; sillje et al . , 2006 ; wong and fang , 2006 ) .
hurp had previously been identified as an aurora a substrate up - regulated in hepatomas ( yu et al . , 2005 ) .
the mattaj laboratory biochemically fractionated maps from xenopus egg extracts to identify factors required for spindle assembly .
the nigg laboratory used a proteomics approach to purify and identify spindle components , while the fang laboratory mined microarray data to identify proteins whose expression was induced during g2 or g2/m of the cell cycle and that were also coregulated with known mitotic proteins .
all three labs identified hurp as a map that could bundle mts in vitro and which localized predominantly to the portion of k - fibers ( bundles of spindle mts that attach to kinetochores in metazoans ) closest to the chromatin .
interestingly , sillje and coworkers found that hurp did not localize to astral mts in hela cells ( sillje et al . , 2006 ) , suggesting that hurp 's role is specific to k - fibers in somatic cells .
consistent with this observation , the loss of hurp resulted in misaligned chromosomes at the metaphase plate , suggesting a role for hurp in chromosome congression .
this misalignment stemmed from a failure , in many cases , of k - fibers to attach to kinetochores ( fig .
1 ) . further experiments demonstrated a role for hurp in increasing k - fiber stability , suggesting that either the bundling of mts to form a k - fiber stabilizes them or that hurp has additional roles in stabilizing mts .
however , hurp 's role in congression may not be restricted to stabilizing and bundling k - fibers .
using an mt regrowth assay , wong and fang found that hurp is required for de novo mt production from chromosomes in a manner similar to tpx2 ( tulu et al . , 2006 ) .
hurp ( red ) is involved in stabilizing and targeting k - fibers to chromosomes ( blue ) .
depletion of hurp leads to unstable k - fibers , which either fail to attach to kinetochores ( black ) or fail to generate tension between sister kinetochores ; yet these cells eventually enter anaphase .
interestingly , despite chromosome misalignment in hurp - depleted cells , the cells entered into anaphase after a prolonged period in prometaphase .
wong and fang examined this event more closely and found that the spindle checkpoint was activated despite progression into anaphase .
however , checkpoint activation was not just due to a lack of mt attachment to kinetochores , but also a lack of tension between amphitelically attached sister kinetochores .
the reduced tension resulted from reduced mt stability within the k - fibers ( fig .
however , wong and fang showed that hela cells , used by all groups , can override the spindle checkpoint when mts are partially destabilized through a variety of means .
therefore , the spindle checkpoint override may not be a direct consequence of hurp activity , but may rather be due to a general destabilization of mts , in hela cells at least .
how the checkpoint is over - ridden remains unclear , but once deciphered will provide considerable insight into how the checkpoint operates .
recent modeling and experimental studies suggest a role for the ran gradient in directing mt growth toward chromosomes ( wollman et al . , 2005 ;
hurp localizes to and stabilizes k - fiber ends closest to chromosomes , suggesting that it could be the long sought after ran - dependent mt stabilizing factor ( fig .
1 ) . hurp localization appears to be particularly sensitive to rangtp concentrations . upon overexpression of an allele of ran locked in the gtp bound form , ranq69l , which should elevate rangtp levels in the cell , hurp relocalizes to regions of the spindle closest to the poles .
assuming then that hurp is only active at the highest concentrations of rangtp within the cell , it would be active close to the chromosomes , thereby facilitating the final run - in of mts to the kinetochore .
bipolar spindle assembly requires the balance of plus- and minus - end directed motor activities .
previous studies using xenopus egg extracts have shown a correlation with rangtp - dependent changes in the dynamics of the mitotic kinesin eg5 , on astral microtubules and the initiation of bipolar spindle assembly ( wilde et al . , 2001 ) .
these data suggested that rangtp could stimulate bipolar spindle assembly by regulating the balance of motor protein activity .
however , the biochemical connection of ran to eg5 remained unclear . using an in vitro assay , koffa et al .
( 2006 ) fractionated maps isolated from xenopus egg extracts and identified a large molecular weight complex that stimulated the reorganization of asters into bipolar spindles .
this complex contained two of the usual suspects known to be directly regulated by ran : aurora a and tpx2 ( schatz et al .
intriguingly , the complex also contained eg5 , xmap215 , and hurp , thus providing a biochemical link between eg5 and ran that opens up exciting new avenues to further define the mechanism by which rangtp stimulates bipolar spindle assembly .
eg5 activity could be modulated by virtue of its assembly into the complex , either through a conformational change and/or its phosphorylation by aurora a ( fig .
the discovery of this complex suggests the interesting possibility of a relationship between microtubule stability and the balance of motor activity required for bipolar spindle assembly .
once formed , aurora a can phosphorylate components of the complex ( arrows lead to known substrates of aurora a ) . the complex may then function as a single entity or dissociate into smaller units to carry out specific functions in different parts of the spindle .
another fascinating problem is how ran exerts its effect on the hurp complex and how the complex functions ( fig .
2 ) . ran may regulate targeting of the complex to mts by regulating the mt binding activity of hurp ( sillje et al . , 2006 ) .
indeed , the recruitment of aurora a and klp61f ( the drosophila eg5 homologue ) to mts is also dependent on ran in vivo ( silverman - gavrila and wilde , 2006 ) .
in addition , assembly of the complex is dependent upon aurora a activity ( koffa et al . ,
2006 ) , suggesting that ran could exert its affect through the characterized activation of aurora a by tpx2 , which is known to depend on mts ( trieselmann et al . , 2003 ; tsai et al . , 2003 ) .
intriguingly , the spindle localization of hurp complex components does not completely overlap , raising the possibility that the complex is transitory within the cell .
our understanding of this exciting complex is in its early stages , but it raises the possibility that several processes in spindle assembly are regulated through one complex .
however , we do not know the full extent of the complex yet : are there more components ?
what are the interactions within the complex ? is the full complex required for each process ? defining answers to these questions will shed more light on the underlying mechanisms behind spindle assembly and reveal in greater detail how ran regulates mitosis .
|
rangtp has a central role in spindle assembly , but the ran - regulated factors required to initiate spindle bipolarity and stabilize mt growth toward the chromosomes remain unknown .
however , three recent papers ( koffa et al . , 2006 ; sillje et al . , 2006 ; wong and fang , 2006 ) have identified a single factor , hurp , that may encompass both of these properties .
|
most of the time teeth with periapical lesions heal satisfactorily after non - surgical endodontic intervention .
the healing of hard and soft tissue is mediated by wide range of intra and extracellular events that are regulated by signalling proteins .
platelets play a crucial role not only in hemostasis , but also in wound healing process .
their lifespan is 8 to 10 days , and the cytoplasm contains many granules whose contents are secreted at the time of activation .
-granules contain many proteins , platelet specific ( such as -thromboglobulin ) or nonplatelet specific ( fibronectin , thrombospondin , fibrinogen , and other factors of coagulation , growth promoters , fibrinolysis inhibitors , immunoglobulins , etc . ) .
activation is fundamental to initiate and support hemostasis because of aggregation on the injured site and interactions with coagulation mechanisms .
however , degranulation also implies the release of cytokines able to stimulate cell migration and proliferation within the fibrin matrix , launching the first stage of healing .
fifteen patients , aged between 20 to 50 years , were selected for the study .
the patients had been diagnosed with periradicular lesions of endodontic origin based on clinical signs and symptoms , intraoral and echographic findings .
the patients were scheduled to be treated in the department of conservative dentistry and endodontics , darshan dental college and hospital , udaipur , rajasthan .
the selected cases included those in which conventional endodontic therapy failed to resolve the problem and periapical root - end surgery was required .
the bony defect had to be confined to the apical area with the bone covering the entire root surface coronally with an intact lingual cortical plate .
patients who agreed to take part in the study were asked to sign an informed consent form before undergoing the treatment .
the first step of the treatment plan was to complete the root canal therapy in cases where dry canals existed and in others obturation was done on the day of surgery .
the surgical procedure included reflection of a full thickness mucoperiosteal flap by sulcular incision and two relieving vertical incisions .
debridement of tissues at the defect site was followed by irrigation with sterile saline solution .
prf preparation requires an adequate table centrifuge and collection kit including : a 18 gauge needle and 10 ml blood collection tubes .
whole blood was drawn into the tubes without anticoagulant and immediately centrifuged at 3,000 rpm for 10 minutes . within a few minutes
, the absence of anticoagulant allows activation of the majority of platelets contained in the sample to trigger a coagulation cascade .
the result is a fibrin clot containing the platelets located in the middle of the tube , just between the red blood cell layer at the bottom and acellular plasma at the top .
this clot was removed from the tube and the attached red blood cells scraped off and discarded [ figure 1 ] .
analgesics ( paracetamol + nimusulidebd-3 days ) , antibiotics ( amoxicillin + clavulanic acid [ co - amoxyclav-625 mg ] tid-5 days ) were prescribed post - operatively .
24 year old male patient came to the department of conservative dentistry and endodontics darshan dental college and hospital , udaipur , rajasthan , with the complaint of fractured tooth of upper front region of jaw since five year . on investigation , periapical radiolucency involving 21 ,
22 was seen on iopa and color doppler echographic imaging revealed a granuloma of diameter 13 5 mm in size [ figure 2 ] .
32 year old male patient came to the department of conservative dentistry and endodontics with the complaint of draining sinus from upper front region of jaw .
patient had undergone root canal treatment elsewhere two years ago in the same tooth . on investigation ,
periapical radiolucency involving 12 was seen on iopa and color doppler echographic imaging showed granuloma of diameter 10 8 mm in size [ figure 3 ] .
35 year old male patient came , with a complaint of discoloured tooth of upper front region of jaw since 8 years .
patient had history of trauma 17 years ago . on investigation , periapical radiolucency involving 21 ,
22 was seen on iopa and color doppler echographic imaging showing periapical cyst of diameter 17 15 mm in size [ figure 4 ] .
prf preparation requires an adequate table centrifuge and collection kit including : a 18 gauge needle and 10 ml blood collection tubes .
whole blood was drawn into the tubes without anticoagulant and immediately centrifuged at 3,000 rpm for 10 minutes . within a few minutes
, the absence of anticoagulant allows activation of the majority of platelets contained in the sample to trigger a coagulation cascade .
the result is a fibrin clot containing the platelets located in the middle of the tube , just between the red blood cell layer at the bottom and acellular plasma at the top .
this clot was removed from the tube and the attached red blood cells scraped off and discarded [ figure 1 ] .
analgesics ( paracetamol + nimusulidebd-3 days ) , antibiotics ( amoxicillin + clavulanic acid [ co - amoxyclav-625 mg ] tid-5 days ) were prescribed post - operatively .
whole blood was drawn into the tubes without anticoagulant and immediately centrifuged at 3,000 rpm for 10 minutes . within a few minutes
, the absence of anticoagulant allows activation of the majority of platelets contained in the sample to trigger a coagulation cascade .
the result is a fibrin clot containing the platelets located in the middle of the tube , just between the red blood cell layer at the bottom and acellular plasma at the top .
this clot was removed from the tube and the attached red blood cells scraped off and discarded [ figure 1 ] .
analgesics ( paracetamol + nimusulidebd-3 days ) , antibiotics ( amoxicillin + clavulanic acid [ co - amoxyclav-625 mg ] tid-5 days ) were prescribed post - operatively .
24 year old male patient came to the department of conservative dentistry and endodontics darshan dental college and hospital , udaipur , rajasthan , with the complaint of fractured tooth of upper front region of jaw since five year . on investigation , periapical radiolucency involving 21 ,
22 was seen on iopa and color doppler echographic imaging revealed a granuloma of diameter 13 5 mm in size [ figure 2 ] .
32 year old male patient came to the department of conservative dentistry and endodontics with the complaint of draining sinus from upper front region of jaw .
patient had undergone root canal treatment elsewhere two years ago in the same tooth . on investigation ,
periapical radiolucency involving 12 was seen on iopa and color doppler echographic imaging showed granuloma of diameter 10 8 mm in size [ figure 3 ] .
35 year old male patient came , with a complaint of discoloured tooth of upper front region of jaw since 8 years .
patient had history of trauma 17 years ago . on investigation , periapical radiolucency involving 21 ,
22 was seen on iopa and color doppler echographic imaging showing periapical cyst of diameter 17 15 mm in size [ figure 4 ] .
there were no signs of infection , untoward reaction , wound dehiscence or extrusion of material in any of the patients .
radiographically all patients showed complete bone regeneration at the end of six months [ figures 5 - 7 ] .
recent bone healing studies are aimed to accelerate bone regeneration to maximize predictability as well as the volume of regenerated bone .
it is difficult to state whether bone morphogenetic protein-2 ( bmp-2 ) , recombinant platelet derived growth factor - bb ( rhpdgf - bb ) , platelet rich plasma ( prp ) , plasma rich in growth factors ( prgf ) , or a combination of all four are responsible for bone healing .
this article will serve to introduce a second generation platelet concentrate i.e. , a platelet - rich fibrin ( prf ) .
prf is easy to obtain , inexpensive , and possibly a very beneficial ingredient to add to the regenerative mix .
tissue damage and vascular exposure result in platelet activation which secretes platelet--granule fuse with platelet cell membrane transforms secretory protein into bioactive state proteins ( pdgf , tgf- , vegf , egf and igf-1 ) secreted and bind to transmembrane receptor of target cellactivates intracellular signaling proteins results in expression of gene sequence directs cellular proliferation , collagen synthesis , and osteoid production the first surgical additives to be used were fibrin sealants which were commercially available in europe since late 1970s .
fibrin glue is composed of two separate solutions of fibrinogen and thrombin . when mixed together , these agents mimic the last stages of the clotting cascade to form a fibrin clot .
fibrinogen can be obtained from pooled , single - donor , and autologous blood donors and is usually isolated by the process of cryoprecipitation .
some investigators have added calcium chloride and/or antifibrinolytics ( i.e. , aminocaproic acid , aprotinin ) to their preparations .
the major drawback to its use is the risk of transmitted serological disease from pooled and single - donor blood donors .
platelet - rich plasma ( prp)- first generation platelet concentrate was proposed as a method of introducing concentrated growth factors pdgf , tgf - , and igf-1 to the surgical site , enriching the natural blood clot in order to expedite wound healing and stimulate bone regeneration .
a natural human blood clot contains 95% red blood cells ( rbcs ) , 5% platelets , less than 1% white blood cells ( wbcs ) , and numerous amounts of fibrin strands .
a prp blood clot , on the other hand , contains 4% rbcs , 95% platelets , and 1% wbcs .
the classic prp production protocol requires blood collection with anticoagulant , 2 steps of centrifugation , and artificial polymerization of the platelet concentrate using calcium chloride and bovine thrombin . since its introduction
, prp has been used in conjunction with different grafting materials in bone augmentation procedures .
prf represents a new step in the platelet gel therapeutic concept with simplified processing minus artificial biochemical modification .
unlike other platelet concentrates , this technique requires neither anticoagulants nor bovine thrombin ( nor any other gelifying agent ) , making it no more than centrifuged natural blood without additives .
prf consists of a fibrin matrix polymerized in a tetra molecular structure , with incorporation of cytokines , platelet , leucocytes and circulating stem cells .
the prf production protocol attempts to accumulate platelets and released cytokines in a fibrin clot . though platelets and leukocyte cytokines play an important part in the biology of this biomaterial , the fibrin matrix supporting them certainly constitutes the determining element responsible for the real therapeutic potential of prf .
cytokines are quickly used and destroyed in a healing wound . the synergy between cytokines and
a physiologic fibrin matrix ( such as prf ) will have very different effects than a fibrin glue enriched with cytokines ( such as prp ) , which will have a massively uncontrollable and short - term effect .
the fibrin network thus formed presents a particularly homogeneous 3-dimensional organization , even more highly coherent than natural fibrin clots .
progressive polymerization mode signifies increased incorporation of the circulating cytokines in the fibrin meshes ( intrinsic cytokines ) .
the intrinsic incorporation of cytokines within the fibrin mesh allows for their progressive release over time ( 7 - 11 days ) , as the network of fibrin disintegrates .
such a configuration implies an increased lifespan for these cytokines , because they will be released and used only at the time of initial cicatricial matrix remodelling ( long term effect ) .
the cytokines are thus maintained available in situ for a convenient period , when the cells start cicatricial matrix remodelling , i.e. , when they have to be stimulated to launch injured site reconstruction .
slow polymerization with physiologic thrombin concentrations implies very elastic matricial architecture ( equilateral junctions between fibrin fibrillae particularly favourable to cell migration and soluble molecule retention ) .
the easily applied prf membrane acts much like a fibrin bandage , serving as a matrix to accelerate the healing of wound edges .
early publications and clinical experience seem to indicate that prf improves early wound closure , maturation of bone , and the final aesthetic result of the periodontal soft tissues .
production of a dense , cross - linked , physically robust prf made of intact platelets and fibrin by high - speed centrifugation in the absence of exogenous thrombin , yields an ideal scaffold for use in tissue repair .
it requires around 1 year for complete healing to occur after the periapical surgery while with the use of prf , healing is fastened and requires approx 6 months for complete regeneration of bone .
|
aims and objectives : platelet rich fibrin is widely used in stimulation and acceleration of soft tissue and bone healing because of local and continuous delivery of growth factors and proteins , mimicking the needs of the physiological wound healing and reparative tissue processes .
this article will serve to introduce a second generation platelet concentrate , platelet - rich fibrin ( prf).materials and methods : fifteen cases are presented in which conventional endodontic therapy failed to resolve the problem and periapical root - end surgery was required.results:at the end of six months , all patients showed complete bone regeneration.conclusion:production of a dense , cross - linked , physically robust prf made of intact platelets and fibrin by high - speed centrifugation in the absence of exogenous thrombin , yields an ideal scaffold for use in tissue repair .
|
the reason might be that older individuals who attempt suicide have a stronger wish to die than their younger counterparts . according to alexopoulos et al .
, suicidal ideation and depression are two major risk factors for late - life suicide as well as targets for prevention . late - life depression is common in primary care settings , affecting at least 5 to 10% of older persons , although it remains underdetected in those who live in their own home [ 6 , 7 ] . in both earlier and recent studies
, depression has been repeatedly found to be a risk factor for completed suicide , particularly when coupled with a pervasive sense of hopelessness [ 8 , 9 ] , which is more likely to lead to suicide than depression alone .
research has revealed associations between late - life suicide ideation and intense psychological pain , including depression , poor social integration , and physical health problems [ 1113 ] .
suicidal experiences of meaninglessness have been described as a state of psychache , human suffering , and emotional pain .
many individuals are ambivalent about completing suicide , as the wish to live and the wish to die wage a battle .
there is an urge to escape from the pain of living and at the same time a desire to live .
stressful life events have been found to have a significant correlation with increased risk of suicide in older adults .
such stressors include political and economic changes , bereavement , separation from family and friends , interpersonal problems , and shame .
lack of social support was associated with higher levels of depression and suicidal ideation in a study by vanderhorst and mclaren , while jahn and cukrowicz found that perceived burdensomeness may explain the link between depression and suicide ideation in older persons .
burdensomeness means a sense of thwarted belongingness or a lack of social connectedness through meaningful relationships .
heisel and flett indicated that suicide ideation was positively associated with depression and the number of self - reported physical health problems and negatively associated with the domains of well - being including positive relationships with others , self - acceptance , and perceived meaning in life .
lynch et al . suggested that suicide prevention efforts in older persons might be improved by targeting emotional inhibition in affectively intense and reactive older individuals .
bruce et al . tested the impact of a primary care - based collaborative suicide intervention on the reduction of risk factors for suicide in later life .
other primary care - based collaborative programmes for depression propose various strategies for reducing suicidal ideation and improving the outcome of major depression in older persons .
the chronic care model ( ccm ) ( figure 1 ) has been used in several studies as a conceptual model for quality improvement .
it comprises six components : ( i ) community resources and policy ; ( ii ) the health system and the organization of healthcare ; ( iii ) self - management support ; ( iv ) delivery system design ; ( v ) decision support ; and ( vi ) clinical information systems . ability to manage one 's own life has been outlined in self - management literature and research [ 25 , 26 ] . thus depressed elderly persons need to be empowered to manage their suicidal experiences and take charge of their life .
it has been found that a collaborative team approach reduces the risk of suicide among depressed older persons in the community [ 4 , 2224 ] .
two studies have revealed that older people experienced the final phase of life as a burden and seemed to accept death [ 27 , 28 ] .
. stated that the older persons in their study gradually developed suicidal ideation after a life full of adversity and as a consequence of aging , illness , or recurring depression .
described that life and the self were disrupted after bereavement , causing loneliness , loss of control , and unwillingness to continue living .
holm et al . reported that depressed older people 's narratives recounted their struggle with memories of loss , grief , abuse , and violence that they had experienced as children , adolescents , and/or adults .
in addition , greater problems arise when there is a gap between healthcare systems , lack of a collaborative team model among healthcare professionals , and inadequate methods for facilitating self - management .
this follow - up study represents the final phase of a larger investigation aimed at implementing and evaluating the ccm for depressed older persons in the community [ 26 , 32 ] . in 2013
our research team conducted exploratory studies on interview data to identify successful implementation with the aim of improving the care of suicidal and depressed elderly persons [ 26 , 31 , 32 ] .
implementation strategies as well as theoretical and methodological developments relevant to the ccm and mental health in the context of elderly persons were employed .
this follow - up study had a hermeneutic qualitative approach and design in order to interpret the meaning of the lived experiences of being suicidal .
a key assumption in this approach is that meanings can only be understood and interpreted in the context in which they occur , that is , through the lived experiences of those involved .
the participants comprised two men and seven women selected from a sample of 29 older persons resident in two districts in norway .
the other 20 subjects were excluded because their narratives did not include descriptions of being suicidal .
the inclusion criteria were persons diagnosed with a depressive or mood disorder , able to understand and speak the norwegian language , resident in a community in norway , referred to community healthcare during the previous six months , over 60 years of age , and willing to speak about their experiences .
eight of the participants informed the researchers that they were treated with medications for depression and bipolar disorder .
the participants had been interviewed 12 months previously and were willing to narrate about their experiences .
their mean age was 65 years ( see table 2 ) for demographic details and suicidal state ) .
as many as seven out of the nine participants still experienced being in a crisis one year after the intervention .
data were collected in 2013 by means of individual interviews with nine participants living in the community , which took the form of a dialogue between the researchers ( alh and al ) and the participants . during the first interview in 2012 , some of the participants were asked if they would be willing to be interviewed about their situation after 612 months .
mental health nurses in the communities also asked some of the participants from the first interview ( n = 29 ) who they regarded as suitable for a second interview , if they would be willing to be interviewed again .
the interviews were held in the participants ' home or in the offices of the two researchers .
the participants were encouraged to narrate about whether they had considered death and suicide or wished to die during the previous 12 months .
if they answered yes they were asked about their suicidal ideation and how they managed their daily life .
the interviews , which lasted between 60 and 120 minutes , were audiotaped and transcribed verbatim .
the nine interviews that constitute the data for this study were analysed using a hermeneutic approach and gadamerian - inspired research analysis by fleming et al . .
, new meaning and understanding emerge by constantly reading the text and moving back and forth between the whole and the parts .
a summary of each interview was written in order to identify its meaning . during the first phase several statements emerged related to suicidal experiences . in this phase ,
the first author read through the interviews and designed a table that was sent to the coauthors . in the second phase the first author underlined all statements pertaining to the participants ' suicidal experiences .
she then read the summaries for a second time and wrote code - words in the text to facilitate the analysis process .
the intention was to interpret the content hidden in the statements by going beyond the experiences described in the text to capture the meaning of the participants ' words .
the themes that emerged were considered representative of the underlying meanings of the statements in the summaries . in this phase
she reflected on a higher level of abstraction on what the participants meant rather than on what they actually said .
the main objective was to search for patterns in as well as the underlying meaning of the text . the fourth and final phase concerned identification of main themes that were representative of the authors ' common understanding of the text ( table 1 ) .
data saturation was obtained by the authors comparing and agreeing on the different themes and subthemes .
the ethical guidelines for nursing research in the nordic countries , northern nurses federation , were adhered to .
approval for the study was granted by the regional ethics committee of western norway ( number 2010/2242 ) and the study followed the guidelines of the declaration of helsinki .
the interviews were conducted in a sensitive manner so as not to increase the older persons ' feeling of being overwhelmed by reflections on and descriptions of their suicidal experiences .
they were assured that their name and identity would not be disclosed and that they had the right to withdraw at any time .
one main theme : going around in a circle and two themes emerged from the analysis : being alone without meaning in life and struggling to achieve reconciliation .
one explained that this state was like going around in a circle where there was no way out .
she constantly thought about the abuse that her two daughters had suffered and found it impossible to describe her sense of guilt .
her catastrophic situation often escalated as there were many family conflicts and she did not dare to come out of the dark.i sent my daughters christmas presents , but they never thanked me .
however , i could have phoned and asked them if we could forget the past and have more contact .
however , i could have phoned and asked them if we could forget the past and have more contact .
( female number 5 ) two of the participants narrated about their suicidal thoughts as follows.it is like going around in a circle , lying there in the dark unable to sleep .
i find no pleasure in my activities earlier in life such as being politically active .
( male number 8)my life is a mess . all the time i struggle to close the holes in my life .
i can not let anything out because it would make it even more difficult to close the holes and if i fail i am terrified of falling into the darkness again .
( male number 3 ) it is like going around in a circle , lying there in the dark unable to sleep .
i find no pleasure in my activities earlier in life such as being politically active .
( male number 8) my life is a mess . all the time i struggle to close the holes in my life .
i can not let anything out because it would make it even more difficult to close the holes and if i fail i am terrified of falling into the darkness again .
( male number 3 ) being alone without meaning in life included the subthemes : striving to control emotional pain and loss of close relationships .
the participants reported that they often lived in a state in which they thought about how to take their own life , especially if they were alone .
this involuntary loneliness was described as a catastrophic state that increased their suicide ideation .
striving to control emotional pain .
some of the participants explained the importance of mastering their emotional pain , adding that it was essential to have someone with whom they could discuss their fears.i can understand why people want to die .
however , i really try to control myself , but it is not easy when you wake up in a state of terrible anxiety .
( female number 9 ) i can understand why people want to die . it is important that the pain and anxiety do not control me .
however , i really try to control myself , but it is not easy when you wake up in a state of terrible anxiety .
some of the participants explained that they had experienced many losses during the past year , while others had a loss several years ago , after which their life no longer had any meaning .
they revealed they had to struggle on their own with no one to talk to.in the past year i lost two of my best friends
( female number 7)although my daughter died several years ago i still think of her as if it happened yesterday . ( female number 4 ) in the past year i lost two of my best friends
although my daughter died several years ago i still think of her as if it happened yesterday .
( female number 4 ) after a hospital stay another women stated the following:i tried to commit suicide twice , once in 2011 and again in 2012 .
and i really did not want to die so i called the ambulance . ( female number 6 )
( female number 6 ) one of the men explained the following:after the divorce my life has no meaning .
( male number 8) the participants revealed that they had to go through the emotional pain alone .
this theme comprises four subthemes : feeling of inadequacy ; the pain of not being forgiven ; feeling bitter and humiliated ; and taking responsibility for one 's life which can alleviate emotional pain .
they narrated different reasons for their increased anxiety and emotional pain including fear of being inadequate and unable to live up to the expectations and demands of others .
one woman explained the following:the roof of our house was damaged and i was responsible for having it repaired .
i was terrified that my mother would be dissatisfied with me , which made me completely exhausted .
( female number 4 ) the roof of our house was damaged and i was responsible for having it repaired .
i was terrified that my mother would be dissatisfied with me , which made me completely exhausted .
some of the participants experienced emotional pain and did not comprehend why their family was unable to forgive them .
one woman said that she can not understand why her daughter did not forgive her despite the fact that she forgave her father for the sexual abuse.the pain is killing me and strikes deep in my soul .
she told me that she does not need me anymore because she has a new family .
( female number 5 ) the pain is killing me and strikes deep in my soul .
she told me that she does not need me anymore because she has a new family .
( female number 5 )
feeling bitter and humiliated . some of the participants experienced bitterness and humiliation related to their past and blamed themselves for everything . in the case
i accuse myself of not being a good mother and blame myself for everything , although i know that it was not my fault .
i accuse myself of not being a good mother and blame myself for everything , although i know that it was not my fault .
( female number 5 ) the bitterness had different faces and was expressed in various ways.i admit that i am bitter .
i sit here and the only thing i can look forward to is being carried out in a coffin .
i sit here and the only thing i can look forward to is being carried out in a coffin .
( male number 8) one participant related that his daughter made him sign a contract to guarantee a loan . when she was unable to meet the repayments the bank asked him for the money .
he explained to the community psychiatric nurse that his life was over and he no longer wanted to go on living.i thought about how to end my life day and night and was admitted to a psychiatric centre in 2012 , but i did not get any help there for this problem .
i explained about the betrayal to which i was subjected and that i feel abused and humiliated by my daughter .
the social worker phoned my daughter , who said she did not understand the problem . ( male number 3 )
i thought about how to end my life day and night and was admitted to a psychiatric centre in 2012 , but i did not get any help there for this problem .
i explained about the betrayal to which i was subjected and that i feel abused and humiliated by my daughter .
the social worker phoned my daughter , who said she did not understand the problem . ( male number 3 )
taking responsibility for one 's life can alleviate emotional pain .
some of the participants stated that they occasionally managed to alleviate emotional pain but found it difficult to put into words.i really can not explain this apart from comparing it to giving birth . after the birth you forget the pain .
and when it disappeared i felt so relieved that i nearly forgot what it was like .
( female number 5 ) i really can not explain this apart from comparing it to giving birth .
and when it disappeared i felt so relieved that i nearly forgot what it was like .
( female number 5 ) another said that she talked to herself about what might be helpful .
she did not want others to take over her life as she preferred to manage alone .
the main theme interpreted in this study , going around in a circle , concerns the depressed elderly persons ' whole situation .
the participants in our study did not seem to experience that their life situation changed for the better or became more satisfactory .
emotional , mental , and psychological pain ( psychache ) appear to have the same meaning as unbearable pain in the mind , heart , or soul , which increases the risk of suicide [ 14 , 16 , 38 ] .
philosophers , poets , and lay persons have written extensively about emotional pain , while the clinical literature in the area of psychology and psychiatry has made almost no attempt to define and explain it [ 38 , 39 ] . despite being intimately connected to the body
, pain is conceptually elusive and can be distinguished from suffering , as it is a sensation that is intertwined with mental and cultural experiences .
research has revealed associations between late - life suicide ideation and intense emotional pain , including depression , poor social integration , and physical health problems [ 1113 ] .
a person suffering from unbearable emotional pain should be enabled to integrate suicidal experiences and reconstruct the loss or trauma by strengthening her / his self - management ability as described in the ccm .
one way to achieve this aim is to establish a well - functioning team based on the ccm model , where the case manager is responsible for follow - up , contact with different caregivers , and the development of strategies to enhance suicide prevention and self - management by adherence to a care plan , as well as for providing support to overcome sources of distress .
emotional pain and suffering seem to be a visible manifestation of existential aloneness that alienates the older person from her / himself .
healthcare professionals can help the depressed elderly person to reflect on why being alone hurts so much and how they can obtain more meaning in life .
loneliness has been associated with depression . someone who can help the suicidal elderly person to reach out of loneliness might increase her / his ability to connect with other people .
acceptance of being alone has been found to be a strength and a step out of feeling lonely , described by pierce et al . as a recovery process that seems to imply a sense of overcoming the suicidal state .
however , the participants in this study seemed to be in a state where they experienced a sort of invisible blanket between themselvesand the world .
this involuntary aloneness can be a part of thwarted belongingness and constitute a burden , where the only thing left to do was to lessen the burden on significant others .
persons who find themselves in such a state may require help from mental health professionals to prevent passivity and apathy . mental health professionals need to move from a traditional authoritative role to form partnerships with their patients .
a prerequisite for forming partnerships is that depressed older individuals must assume responsibility for their life , which the literature often terms self - management .
however , it has been found that self - management can lead to an unreasonable shift of responsibility to the patient . in the ccm
the coordinator is termed case manager , a role assumed by a nurse or physician who is responsible for creating a dialogue with the patient .
such a dialogue can reveal hidden power aspects about which one needs to be aware in order to prevent violation of the vulnerable depressed elderly persons ' dignity .
the case manager should increase understanding of the fact that although depressed elderly persons often feel powerless , they are also moral agents with their own values .
the experience of loss , at least in most western contexts , may reflect a sense of going through difficult times , followed by a less difficult period .
the suicidal experiences of loss were supported by bonnewyn et al . where the participants described a significant loss that had a tremendous impact on their life such as the death of a spouse , conflict with a child , or physical illness .
as mentioned by lynch et al . , cognitive ability is often reduced in older adults .
thus it is necessary to address the cognitive and emotional aspects of depression by introducing tasks to help older adults regain self - control and interrupt suicidal thoughts , which may in turn improve decision - making .
it should be borne in mind that eight of the participants were treated with medications for depression and bipolar disorder , which could have triggered their suicidal behaviour as suicidal ideation is a common side effect of certain medications .
searching for meaning seems to be a daily struggle , which in the ccm ( figure 1 ) is related to the loss of self - management ability .
joiner proposed a theory of suicide , which consists of three variables , the first being that the desire for suicide arises when a person perceives her / himself as a burden on significant others .
the second is that there is a sense of thwarted belongingness and the third , a lack of social connectedness through meaningful relationships .
understanding the competence of the other can provide an opportunity to become connected but demands the ability to manage one 's life , which appears to be lacking .
acknowledging one 's responsibility for the other can be impossible when one does not understand how to manage one 's own life and emotional pain . nevertheless , assuming responsibility for other people can strengthen self - management and provide an opportunity to escape the shadows from the past .
struggling to achieve reconciliation
it is also understood as a desire for wholeness and meaning in life , an opportunity to reconcile fragmented memories , which can increase emotional pain .
new meaning enables the human being to overcome trauma , which can be a strategy for enduring emotional pain .
lack of reconciliation can lead to difficulty of loving and forgiving oneself as well as to bitterness , hostility , anger , and fear .
it appeared to be a feeling of being excluded from the possibility of relationships with other people and powerlessness to change the situation .
inability to obtain forgiveness was described as an endless struggle . as depressed older persons lack self - management ability , they need healthcare professionals to help them to reflect on and change their view of themselves , as the sense of being good enough could free them from feelings of guilt and open their eyes to viewing their life story in a different light .
the ccm ( figure 1 ) provides healthcare professionals with an opportunity to grasp the urgent needs of suicidal older persons .
forgiveness might not be possible because one 's guilty conscience increases the shame , thus hindering meaning and reconciliation . however , a person who searches for meaning and reconciliation can become aware of an opening to transform her / his fragmented memories into a new wholeness .
therefore increasing self - management can be a way for healthcare professionals to help the suicidal person to see a way out of the endless circle around previous conflicts that cast shadows in her / his life .
as forgiveness appears to be related to the act of speaking , emotions play a central role . feelings of inadequacy can be characterised as a sort of vulnerability related to expectations and rejection that increase emotional pain .
eisenberger et al . demonstrated that two areas of the brain are involved in distressing feelings of social exclusion and respond in opposite ways to the degree of experienced emotional pain .
healthcare professionals require more coordinated efforts as outlined in the ccm ( figure 1 ) in order to increase suicidal elderly persons ' ability to manage life without being overwhelmed by the pain of not being forgiven .
it is vital to develop a range of strategies to provide experiences of inclusion and connection for depressed elderly persons in the community . feeling bitter and humiliated increased these older persons ' emotional pain . despite being unaware of their sense of bitterness and humiliation
, one has to surrender the emotional pain and let it go , which can be a way of promoting better control of one 's life .
healthcare professionals need to empower suicidal older persons , thus endowing them with a sense of purpose in the sacred circle of life and death
. the liberating power of surrendering bitterness and humiliation can enable depressed elderly persons to survive emotional pain .
taking responsibility for one 's life in order to alleviate emotional pain was challenging for the participants as it increased the risk of suicide .
it seems as if alleviating and surviving emotional pain can be related to assuming responsibility for oneself as well as for other people . in order to alleviate emotional pain and anxiety , it is necessary to increase self - management by strengthening one 's social responsibility .
the findings indicated the need to provide increased support to help suicidal elderly persons take responsibility for their life .
one strategy is to become reconciled with their own history by forming the fragments into a story in which they are able to find meaning .
as suggested in the ccm ( figure 1 ) , healthcare professionals can encourage and empower suicidal elderly individuals by strengthening their self - management .
being able to accept one 's story can be the first step to assuming responsibility for one 's life and has been described as a way to alleviate emotional pain .
healthcare professionals must act on these research recommendations and help suicidal elderly persons to take responsibility , thus alleviating their emotional pain .
responsibility implies that the suicidal elderly person is capable of taking part in the planning of goals , based on the notion that people are moral agents with their own values .
being active and informed is also a step in the right direction towards responsibility and shared decision - making , although it can take a long time because every human being constructs things differently .
however , the ccm ( figure 1 ) indicates that healthcare professionals should consider themselves a companion who is able to empower the patient by means of productive interactions .
this can be related to the need for a shared decision - making model that can increase the trust between the team and the suicidal elderly person .
such changes can strengthen optimism , control , well - being , and the pathways that lead to reconciliation .
healthcare professionals need a new understanding that includes respect for the expertise that a person brings to the management of her / his condition .
the core of being capable of taking responsibility for one 's life seems to have an existential dimension of being in the world as well as related to freedom and dignity .
interventions that highlight the depressed elderly person 's empowerment , participation , and involvement have been described in the ccm ( figure 1 ) and the literature [ 2325 ] .
healthcare professionals must reflect on how best to help suicidal elderly persons engage in self - management and take responsibility for their life .
although these older persons have a great deal of contact with mental health nurses in the community who have taken part in an implementation programme , the nurses do not work according to the team model suggested by wagner et al . .
they have no care manager to coordinate their work and functional leadership based on the principles of the ccm is lacking . when working according to a team model such as the ccm , one must respect and enhance patients ' autonomy as well as maintain a high level of judgment and skill to increase their self - management ability and safety .
such goals can guarantee that suicidal elderly persons receive education about how to manage their daily life .
different prevention strategies are necessary , for example , a person they can phone when they are afflicted by suicidal ideation or serious problems that influence their daily life .
when such patients are in a suicidal state , healthcare professionals must decide when to assume responsibility for them .
this is a balancing act because of the older persons ' vulnerability associated with previous trauma and violation that have been experienced as intrusive and have had consequences for their sense of dignity .
one of the most important objectives of mental healthcare is the development of a person 's ability to shape and take control of her / his life .
dignity is a core concept in nursing care , as care without dignity negatively influences recovery .
the healthcare organisation in some communities in norway does not seem to be committed to a crisis plan with the necessary standards , which can be disastrous for suicidal elderly persons .
the present researchers have long experience of mental health , intensive and critical care nursing , in addition to which they have conducted a great deal of research .
the participants ' descriptions are their interpreted experiences , influenced by culture and time . as the participants ' narratives were in norwegian , translating the quotations into english
having been interviewed about the same issue several months previously , they were more willing to share their experiences on the second interview occasion .
the narratives allowed the researchers to understand from a first person perspective , which can be an advantage , but might also influence the interpretation in a negative way .
as a researcher one feels honoured to obtain such information , while at the same time being aware that one can not follow up on the individual concerned .
thus one must consider one 's role as a researcher and not as a mental health nurse .
it is important to protect the participant by not allowing her / him to reveal too much , which she / he might later regret .
credibility can be seen as the striving to achieve a shared understanding of the phenomenon studied [ 33 , 49 ] . as there is no neutral position in a qualitative study
, we explored the text in an objective way in accordance with the concept of confirmability .
a shared understanding was based on agreement about the themes and subthemes that emerged from the analysis .
transferability concerns the possibility of repeating the investigation in a different context [ 33 , 49 ] . due to the small sample size , transferability in terms of generalising the results to other contexts
however , qualitative research methods can enable us to go beyond our research subjects to a deeper reflection about life itself .
this study is important as it revealed that suicidal depressed elderly individuals need help immediately to emerge from their desperate situation .
there is an urgent need for more research that can prevent suicide in depressed elderly persons suffering from unbearable emotional pain .
a cry for help to survive was evident in the stories narrated by our informants .
healthcare professionals and researchers must take action to address this problem before it is too late .
|
depression has repeatedly been found to be a risk factor for completed suicide , particularly when coupled with a pervasive sense of hopelessness .
the aim of this study was to evaluate depressed older persons ' suicidal experiences .
data were collected by means of individual in - depth interviews with nine informants living in two districts of norway .
a hermeneutic analysis was performed . one main theme : going around in a circle and two themes : being alone without meaning in life and struggling to achieve reconciliation emerged from the analysis .
an important implication for mental healthcare practice is the need to develop a person 's ability to shape and take control of her / his life .
the healthcare organisation must be committed to a plan that sets out strategies enabling suicidal individuals to avoid the negative experience of meaninglessness .
it was concluded that suicidal depressed elderly persons need help to escape from their desperate situation .
more research is urgently required in order to prevent suicide in depressed elderly persons whose emotional pain is unbearable .
|
a 78 kg , 183 cm , 22-year - old male patient was delivered to an operating room for posterolateral lumbar spine fusion at l3 - 5 and humerus operation .
thirty - five days previously , he was admitted via the emergency department with a diagnosis of multiple traumas after a fall from 10 m. temporary tracheostomy had been performed twenty days ago for mechanical ventilation to treat acute respiratory distress syndrome .
preoperatively , he was alert and able to ventilate via a size 8.0 mm cuffed tracheostomy tube ( portex , smiths medical , kent , uk ) without ventilator assistant .
there were no upper airway tract abnormalities except tracheostomy , broken upper teeth , and a slight open - bite .
after installing monitors ( ekg , pulse oximetry and invasive arterial blood pressure ) , general anesthesia was induced intravenously with thiopental 325 mg , fentanyl 150 g , and rocuronium 50 mg . because he was scheduled for spine surgery in the prone position , the airway was prepared to secure adequate ventilation , as follows : cleansing of the intraoral and endotracheal space with a sterile suction tube , replacing the tracheostomy tube with a size 8.0 mm cuffed flexible tracheal tube ( tt ) ( safety - flex , mallinckrodt medical , athlon , ireland ) , confirming the depth of the tt by ballottement and auscultation , staying the tt to the tracheostomy site by suturing with silk 3 - 0 , applying padding to the anterior neck with gauze to prevent sharp angulation of the tt , and draping the anterior neck with transparent dressing ( tegaderm ; 3 m , usa ) .
anesthesia was maintained with sevoflurane 1.5 - 3.0 vol% in oxygen with positive pressure ventilation .
continuous intravenous infusion of remifentanil 0.1 - 0.2 g / kg / min and rocuronium 10 mg / hr followed . after moving the patient to the prone position , the tt and both eyes
after the surgeon requested a wake - up test thirty minutes before the end of spine surgery , rocuronium infusion was stopped to prepare the test , and the concentrations of remifentanil and sevoflurane were decreased to 0.1 g / kg / min and 0.5 vol% , respectively .
these dosages were continued throughout the rest of the procedure to avoid pain and unpleasant memory .
however , neuromuscular function and depth of anesthesia monitoring were not applied , as these were not routine .
as humerus operation was scheduled , it was determined that the patient would be more comfortable in the supine position for the wake - up test .
after closure of spine surgery , the patient was moved into a supine position , and a bite injury to the anterior third of tongue was noticed .
the protruding portion of the tongue was cyanotic and edematous , and it seemed that it might be cut if decompression was not employed emergently .
the anesthesiologist responsible tried to open the mouth and insert a bite blocker manually after extending the neck .
after several attempts to open the mouth failed , sevoflurane concentration was increased to 4.0% , and thiopental 150 mg , midazolam 3 mg , and rocuronium 20 mg were administered intravenously .
the mouth began to open slightly approximately thirty seconds after rocuronium administration , and the protruding portion of the tongue was repositioned into the intraoral cavity . because of inappropriate preparation for the wake - up test and need for emergent tongue decompression requiring deepening of anesthesia level , the proposed wake - up test could not be performed . within several seconds after decompression
, the affected area became pinkish and seemed to be receiving adequate blood supply , and the edema reduced markedly after a manual massage with cold saline - soaked wet gauzes .
horizontal bite marks and a reddish erosive lesion were present on the anterior third of the tongue ( fig .
the time between identification and decompression was about five minutes , but the duration of biting could not be estimated . because no swelling or deep laceration was detected ,
the patient had no recollection of intraoperative events at follow - up examination and interview . however , the patient complained of mild tongue pain during rest , which was aggravated during movement .
the bitten area was pinkish and well circulated , and no hematoma , deep laceration , or movement dysfunction were evident .
the patient was discharged thirty days after operation without pain but with some scarring on the right anterolateral one third of the tongue .
this scar persisted at seven months after discharge , but there were no other tongue complications .
reported airway complications in the prone position include swelling of the tongue , accidental extubation , and obstruction of ventilating tube by secretions [ 8 - 10 ] . however , tongue bite is extremely rare during general anesthesia , especially in a patient with a tracheostomy .
if the degree of injury is limited to the mucosa , tongue irritation or sores usually heal within a few days .
however , if it is severe , hemorrhage , hematoma , severe swelling , and airway obstruction may occur [ 1 - 3,7 ] .
therefore , if the tongue is bitten during the perioperative period , the anesthesiologist should evaluate the severity of the injury . if the bite force is powerful enough
, it can cause direct muscular and vascular injury and compromise circulation in the distal tongue .
in addition , a bite can induce a vicious cycle of compression , congestion , swelling , and more compression .
suggested biting mechanisms while in the prone position are as follows : an open mouth , tongue protrusion , edema , and eventual unconscious biting .
the main reasons in this case were the neglected preoperative intraoral care and inadequate intraoperative wake - up test .
we admittedly overlooked the possibility of tongue protrusion and concentrated only on securing ventilation . during the absence of intraoperative masseter muscle tone
, the mandible tends to open , and the tongue can fall downward due to gravity . although head extension increases the pharyngeal airway space , external mechanical force and tight dressing of the neck could reduce the size of the hypopharyngeal space , displace the tongue , and compromise venous return . if edema is severe enough to cause contact between the tongue and upper and lower teeth , a bite might occur .
reported causes of macroglossia are direct compression of the lingual vein , fluid overload , seizure , and prolonged operation time in the prone position . for an optimal wake - up
test , the patient should be calm and conscious enough to obey commands . during preparation for the wake - up test
if the patient is unconscious and regains masseter muscle power , unconscious mastication could cause a tongue bite .
therefore , during preparation for the wake - up test in the prone position , meticulous monitoring of neuromuscular function and depth of anesthesia are mandatory .
manual insertion of a bite blocker or a complete denture in an edentulous patient increases intraoral cavity volume and it could stop the aforementioned vicious cycle . if manual reduction is ineffective , immediate use of a neuromuscular blocking drug and deepening anesthesia should be considered .
these actions will definitely reduce biting force and convulsive cerebral activity if a seizure occurs . after decompression
, an antiseptic mouth rinse and active mobilization with wet gauze can reduce swelling quickly and prevent drying and superficial injury .
analgesia and a numbing gel should be considered , but the effects of steroid and prophylactic antibiotics are controversial .
careful preparation for the wake - up test is probably the most important requirement to prevent tongue bite in the prone position . to reduce the risk of tongue protrusion , pressure to the neck
should be minimized , and in this context a neutral head position and the use of staying suture of the tt rather than gauze packing to the anterior neck are advantageous . closing the mouth before operation reduces the likelihood of tongue protrusion in a tracheostomy patient .
long length and hard material bite blocker can precipitate sublingual hematoma , laceration , and tongue edema .
therefore , if a bite blocker is inserted preoperatively , it must be short and soft enough to prevent tongue and teeth trauma . in summary , anesthesiologists need to be aware of the possibility of tongue protrusion when a patient with a tracheostomy is operated upon in the prone position .
in particular , in tracheostomy patients , careful intraoral preparation is mandatory and bite blocker placement is preferred .
|
a 22-year - old man underwent an operation for posterolateral fusion of the lumbar spine at l3 - 5 .
he was ventilated via a tracheostomy site in a prone position for 210 minutes .
ventilator function and eyeballs were checked periodically . after changing his position to supine for the wake - up test , it was noticed that his tongue was self - inflicted and looked to be cut unless immediate decompression was applied .
after several manual attempts to open the mouth failed , anesthesia depth was deepened with thiopental sodium and neuromuscular blocker to decompress and reposition the tongue into the intraoral cavity .
minimal teeth marks and scarring remained after seven months without any complications .
|
by integrating silicon
nanowires ( 150 nm diameter , 20 m
length ) with an -shaped plasmonic nanocavity , we are able to
generate broadband visible luminescence , which is induced by high
order hybrid nanocavity - surface plasmon modes .
the nature of this
super bandgap emission is explored via photoluminescence spectroscopy
studies performed with variable laser excitation energies ( 1.959 to
2.708 ev ) and finite difference time domain simulations .
furthermore ,
temperature - dependent photoluminescence spectroscopy shows that the
observed emission corresponds to radiative recombination of unthermalized
( hot ) carriers as opposed to a resonant raman process .
|
|
the ophthalmic segment of the internal carotid artery ( ica ) , running from the distal dural ring to the posterior communicating artery ( pcom ) , can give rise to aneurysms.1 the three subtypes are the superiorly pointing aneurysms originating at the ophthalmic artery ( i.e. , ophthalmic artery [ oa ] aneurysms ) , the medially pointing aneurysms originating from the superior hypophyseal trunk , and aneurysms originating from a perforator - free part of the ica , the so - called atypical or blister ica aneurysms.2
the incidence of oa aneurysms is somewhere between 0.5% and 11% of all intracranial aneurysms.3
4 unruptured large oa aneurysms frequently present with gradual loss of vision .
the goal of their treatment is then twofold : to exclude the aneurysm from the circulation and to preserve or restore visual function .
treatment of oa aneurysms can be surgical or endovascular , depending on the mode of presentation , aneurysm geometrics and size , as well as the patients medical condition.5 in the past , intracranial aneurysm repair was exclusively surgical,4 and in large unruptured oa aneurysms , clipping is still often the preferred method because surgical decompression of the aneurysm sac may lend the optic nerve a better prognosis.6
7 however , surgery of oa aneurysms carry inherent risks such as stroke,8 hemorrhage,9 or visual loss.10
11
12
since its introduction in 1991,13 endovascular aneurysm repair has grown in popularity and versatility.8
14
15 with the introduction of stents,16
17 endovascular treatment of oa aneurysms has made important progress .
although this development is welcomed , it also makes the choice of treatment strategy less straightforward than in the past . in this report
, we present a patient with a troublesome unruptured oa aneurysm and some lessons learned .
a 56-year - old right - handed woman presented with a 4-month history of retro - orbital headache and progressive decline in visual acuity oculus sinister ( os ) .
her ophthalmologist ( p.l . ) found only perception of light os and normal visual acuity oculus dexter ( od ) .
magnetic resonance imaging ( mri ) detected a left - sided oa aneurysm 20 12 13 mm in diameter ( fig .
1 ) .
magnetic resonance imaging ( mri ) of a 56-year - old right - handed woman who presented with a 4-month history of retro - orbital headache and progressive visual loss demonstrating a left - sided ophthalmic artery aneurysm 20 12 13 mm in diameter .
because of her long history of very poor visual acuity , we considered her left eye to be irredeemable . because the aneurysm had a wide neck and was of moderate size
the treatment plan was first to place a regular stent within the ica , running from proximal to the oa to distal to the pcom artery , with a second semipermeable stent inside the first stent in the aneurysm orifice area to enhance aneurysm thrombosis .
following 1 week of treatment with plavix and aspirin preceding the endovascular procedure , a leo ( balt extrusion , montmorency , france ) 4.5 mm 40 mm stent was placed in the ica ( s. j. b. and e. a. j. ) .
attempts to place additional stents , however , were unsuccessful . to promote aneurysm thrombosis ,
three matrix coils ( boston scientific , fremont , california , united states ) , of 24 mm 40 cm , 30 mm 16 cm , and 14 mm 30 cm , respectively , were put into the aneurysm sac ( fig .
this led to stagnation of the contrast media in the aneurysm sac , but because of the optic nerve compression , the aneurysm was filled loosely so as not to cause further optic chiasm compression .
digital subtraction angiography after a stent was placed in the interior carotid artery and the aneurysm sac coiled using three matrix coils .
after the procedure , the patient woke up with an expressive dysphasia and a right - sided hemiparesis .
mri demonstrated several punctate lesions in the left parieto - occipital region secondary to emboli and perfusion mri showed a small hypoperfusion in the left lentiform nucleus region .
her visual acuity improved to perception of hand movement ad ocolum os and acuity od remained at 1.0 . over the following months ,
the aneurysm continued to grow , measuring 22 13 14 mm ( fig .
it now caused significant compression of both optic nerves , and her ophthalmologist recorded a reduction of visual acuity to 0.8 od and an upper quadrant anopia .
a course of prednisolone 20 mg twice daily was tried for 5 days without effect .
the aneurysm continued to grow , measuring 22 13 14 mm 2 months post - coiling .
six months after her presentation , her visual acuity remained at light perception os and 0.8 od with an upper quadrant anopia . a digital subtraction angiography ( dsa ) demonstrated coil compaction and further aneurysm growth .
the patient failed an ica balloon test occlusion ( w.s.o . ) and was therefore referred to high - flow extracranial - intracranial ( ec - ic ) artery bypass grafting in berlin , germany .
preoperatively , her visual acuity od was down to 0.7 with an upper quadrant anopia , whereas os remained at light perception .
she underwent a high - flow venous graft bypass between the left external carotid artery and the left middle cerebral artery ( p.v . and t.r.m . )
4 ) . because of the combined effects of stent within the ica and the large coil mass in the aneurysm , it was difficult to put an occluding clip on the ica just distal to the oa take - off , and the ica was therefore occluded proximally in the neck .
the patient underwent a high - flow venous graft bypass between the left external carotid artery and the middle cerebral artery ( mca ) .
( a ) axial computed tomography angiography demonstrating the patent graft to mca and coil artifacts .
( b ) digital subtraction angiography anteroposterior view demonstrating filling of the extracranial - intracranial bypass .
postoperatively , she had expressive dysphasia , right - sided hemiparesis , and short - term memory loss .
postoperative t1-weighted mri demonstrated some encephalomalacia with peri - sylvian cortical laminar necrosis in the temporal and frontal lobes ( fig .
5 ) . over the next months she recovered well from these neurologic deficits , with the exception of blindness os .
postoperative fluid attenuated inversion recovery magnetic resonance imaging demonstrates some encephalomalacia with peri - sylvian cortical laminar necrosis .
contrary to what we anticipated , the aneurysm continued to expand ( 27 19 20 mm ) ; her right eye visual acuity decreased dramatically to 0.3 a month after the surgery .
a dsa demonstrated good flow through the bypass , retrograde filling of the distal ica , antegrade filling of the oa , some filling in the cavernous portion of the ica , and some filling in the bottom of the aneurysm ( fig .
digital subtraction angiography demonstrates good bypass flow , with retrograde filling of the distal internal carotid artery ( ica ) , antegrade filling of the ophthalmic artery , and some filling in the cavernous portion of the ica .
there is also some filling of the caudal part of the aneurysm ( arrow ) , the latter finding explaining the continued aneurysm growth .
because of progressive visual field defect and acuity loss od , the patient was operated again a year after her initial presentation via a 30 25 mm supraorbital craniotomy ( t.r.m . ) .
the stented ica was crushed using a debakey forceps to fit a clip across the ica proximal to the pcom .
7 ) , and the optic chiasm and both optic nerves were decompressed . the patient made an uneventful recovery , and the surgery led to a significant improvement in visual acuity od to 0.7 .
the patient was reoperated via a 30 25 mm supraorbital craniotomy , so as not to compromise the bypass .
the stented internal carotid artery ( ica ) was crushed using a debakey forceps to fit a clip across the ica proximal to the posterior communicating artery , and the coiled giant aneurysm was excised , thereby decompressing the optic chiasm and optic nerves .
surgery led to a significant improvement in visual acuity on the right side ; the left remained amaurotic .
a 56-year - old right - handed woman presented with a 4-month history of retro - orbital headache and progressive decline in visual acuity oculus sinister ( os ) .
her ophthalmologist ( p.l . ) found only perception of light os and normal visual acuity oculus dexter ( od ) .
magnetic resonance imaging ( mri ) detected a left - sided oa aneurysm 20 12 13 mm in diameter ( fig .
1 ) .
magnetic resonance imaging ( mri ) of a 56-year - old right - handed woman who presented with a 4-month history of retro - orbital headache and progressive visual loss demonstrating a left - sided ophthalmic artery aneurysm 20 12 13 mm in diameter .
because of her long history of very poor visual acuity , we considered her left eye to be irredeemable . because the aneurysm had a wide neck and was of moderate size
the treatment plan was first to place a regular stent within the ica , running from proximal to the oa to distal to the pcom artery , with a second semipermeable stent inside the first stent in the aneurysm orifice area to enhance aneurysm thrombosis .
following 1 week of treatment with plavix and aspirin preceding the endovascular procedure , a leo ( balt extrusion , montmorency , france ) 4.5 mm 40 mm stent was placed in the ica ( s. j. b. and e. a. j. ) .
attempts to place additional stents , however , were unsuccessful . to promote aneurysm thrombosis ,
three matrix coils ( boston scientific , fremont , california , united states ) , of 24 mm 40 cm , 30 mm 16 cm , and 14 mm 30 cm , respectively , were put into the aneurysm sac ( fig .
this led to stagnation of the contrast media in the aneurysm sac , but because of the optic nerve compression , the aneurysm was filled loosely so as not to cause further optic chiasm compression .
digital subtraction angiography after a stent was placed in the interior carotid artery and the aneurysm sac coiled using three matrix coils .
after the procedure , the patient woke up with an expressive dysphasia and a right - sided hemiparesis .
mri demonstrated several punctate lesions in the left parieto - occipital region secondary to emboli and perfusion mri showed a small hypoperfusion in the left lentiform nucleus region .
her visual acuity improved to perception of hand movement ad ocolum os and acuity od remained at 1.0 . over the following months ,
the aneurysm continued to grow , measuring 22 13 14 mm ( fig .
it now caused significant compression of both optic nerves , and her ophthalmologist recorded a reduction of visual acuity to 0.8 od and an upper quadrant anopia .
a course of prednisolone 20 mg twice daily was tried for 5 days without effect .
the aneurysm continued to grow , measuring 22 13 14 mm 2 months post - coiling .
six months after her presentation , her visual acuity remained at light perception os and 0.8 od with an upper quadrant anopia . a digital subtraction angiography ( dsa ) demonstrated coil compaction and further aneurysm growth .
the patient failed an ica balloon test occlusion ( w.s.o . ) and was therefore referred to high - flow extracranial - intracranial ( ec - ic ) artery bypass grafting in berlin , germany .
preoperatively , her visual acuity od was down to 0.7 with an upper quadrant anopia , whereas os remained at light perception .
she underwent a high - flow venous graft bypass between the left external carotid artery and the left middle cerebral artery ( p.v . and t.r.m . )
4 ) . because of the combined effects of stent within the ica and the large coil mass in the aneurysm , it was difficult to put an occluding clip on the ica just distal to the oa take - off , and the ica was therefore occluded proximally in the neck .
the patient underwent a high - flow venous graft bypass between the left external carotid artery and the middle cerebral artery ( mca ) .
( a ) axial computed tomography angiography demonstrating the patent graft to mca and coil artifacts .
( b ) digital subtraction angiography anteroposterior view demonstrating filling of the extracranial - intracranial bypass .
postoperatively , she had expressive dysphasia , right - sided hemiparesis , and short - term memory loss .
postoperative t1-weighted mri demonstrated some encephalomalacia with peri - sylvian cortical laminar necrosis in the temporal and frontal lobes ( fig .
5 ) . over the next months she recovered well from these neurologic deficits , with the exception of blindness os .
postoperative fluid attenuated inversion recovery magnetic resonance imaging demonstrates some encephalomalacia with peri - sylvian cortical laminar necrosis .
contrary to what we anticipated , the aneurysm continued to expand ( 27 19 20 mm ) ; her right eye visual acuity decreased dramatically to 0.3 a month after the surgery .
a dsa demonstrated good flow through the bypass , retrograde filling of the distal ica , antegrade filling of the oa , some filling in the cavernous portion of the ica , and some filling in the bottom of the aneurysm ( fig .
digital subtraction angiography demonstrates good bypass flow , with retrograde filling of the distal internal carotid artery ( ica ) , antegrade filling of the ophthalmic artery , and some filling in the cavernous portion of the ica .
there is also some filling of the caudal part of the aneurysm ( arrow ) , the latter finding explaining the continued aneurysm growth .
because of progressive visual field defect and acuity loss od , the patient was operated again a year after her initial presentation via a 30 25 mm supraorbital craniotomy ( t.r.m . ) .
the stented ica was crushed using a debakey forceps to fit a clip across the ica proximal to the pcom .
7 ) , and the optic chiasm and both optic nerves were decompressed . the patient made an uneventful recovery , and the surgery led to a significant improvement in visual acuity od to 0.7 .
the patient was reoperated via a 30 25 mm supraorbital craniotomy , so as not to compromise the bypass .
the stented internal carotid artery ( ica ) was crushed using a debakey forceps to fit a clip across the ica proximal to the posterior communicating artery , and the coiled giant aneurysm was excised , thereby decompressing the optic chiasm and optic nerves .
surgery led to a significant improvement in visual acuity on the right side ; the left remained amaurotic .
major neurologic deficits after treatment of giant intracranial aneurysms occur in 10% of patients.18
19
20
21
22 with paraclinoid giant aneurysms , visual deterioration after treatment is observed in up to 17% of patients.19
20 although surgical clipping is often the preferred treatment for aneurysms causing cranial nerve deficits,6
7 in cases of giant paraclinoid ica aneurysms , it may not be feasible in > 60% of cases.18
20
21
22 surgery on oa aneurysms is technically demanding because these aneurysms are often large and may extend into the cavernous sinus.21
22
23
24
25
26 thus they are challenging even for the most experienced of neurosurgeons . over the years , these aneurysms have therefore been treated by common carotid artery ligation,20
21
22
27
28 ica occlusion,18
19
20
22
29
30 proximal vessel ligation with ec - ic bypass,18
19
20
22 trapping,18
19
31 intra - aneurysmal balloon occlusion,32
33 coiling,34
35
36 or by stenting.37 however , because visual deterioration after coil embolization of oa aneurysms has been reported in as many as a third of the patients,14 the decision whether to clip or coil is often difficult . in the present case ,
the endovascular treatment plan was to first place a regular stent in the ica from the oa to the pcom , with a second semipermeable stent inside the first stent in the aneurysm orifice area .
retrospectively , upon failing to place the semipermeable stent , we should have discontinued the endovascular procedure because the subsequent aneurysm coiling would not make the aneurysm shrink and would make aneurysm surgery at a later stage considerably more difficult .
given a situation with a large and growing coiled aneurysm and with a failed balloon test occlusion ( bto ) , we opted for a high - flow ec - ic bypass followed by therapeutic ica closure because ica occlusion , with or without ec - ic bypass , is a good therapeutic option when treating giant ica aneurysms.29
38
39
40
41
42
43
44 however , it proved difficult to put an occluding clip on the ica just distal to the oa take - off due to the combined effects of the stent within the ica and the large coil mass within the aneurysm .
furthermore , the pcom was also not in sight due to the previously mentioned limiting structures , but also because of the high - flow vein graft in the surgical field . consequently , the ica was occluded proximally in the neck . retrospectively , after finishing the bypass and realizing that the intracranial ica closure was impossible , we should have left the ica open and closed this vessel off endovascularly by placing coils at the origin of the oa / aneurysm because it is known that proximal ica occlusion does not fully prevent subsequent hemorrhage or necessarily prevent aneurysm enlargement.10
20
21
38
41
45
46 a more distal ica closure would have eliminated blood flow in the ica below the pcom and triggered thrombosis and shrinkage of the noncoiled portion of the aneurysm .
it is difficult to tidy up the mess , as it were , if you start out wrong .
given the chance again , we would have followed our usual game plan when treating patients with large unruptured oa aneurysms : if there is reduced visual acuity and no or moderate thrombus material in the aneurysm , we opt for surgical clipping via a lateral supraorbital craniotomy with extradural clinoidectomy for proximal control of the ophthalmic ica segment,47 aneurysm dissection , suction / decompression of the aneurysm ( either direct after temporary trapping or ad modum hunt batjer with exposure of the ica in the neck48 ) , and aneurysm clipping . if there is a large thrombotic mass in the aneurysm , with or without reduced visual acuity , we generally manage our patients with semipermeable ( flow diversion ) stents or therapeutic ica closure with or without a high - flow excimer laser - assisted nonocclusive anastomosis ( elana ) bypass for flow replacement,43 depending on the bto tolerance.44
|
objective and importance when treating large unruptured ophthalmic artery ( oa ) aneurysms causing progressive blindness , surgical clipping is still the preferred method because aneurysm sac decompression may relieve optic nerve compression .
however , endovascular treatment of oa aneurysms has made important progress with the introduction of stents .
although this development is welcomed , it also makes the choice of treatment strategy less straightforward than in the past , with the potential of missteps .
clinical presentation a 56-year - old woman presented with a long history of progressive unilateral visual loss and magnetic resonance imaging showing a 20-mm left - sided oa aneurysm .
intervention because of her long history of very poor visual acuity , we considered her left eye to be irredeemable and opted for endovascular therapy .
the oa aneurysms was treated with stent and coils but continued to grow , threatening the contralateral eye .
because she failed internal carotid artery ( ica ) balloon test occlusion , we performed a high - flow extracranial - intracranial bypass with proximal ica occlusion in the neck .
however , aneurysm growth continued due to persistent circulation through reversed blood flow in distal ica down to the oa and the cavernous portion of the ica . due to progressive loss of her right eye vision , we surgically occluded the ica proximal to the posterior communicating artery and excised the coiled , now giant , oa aneurysm .
this improved her right eye vision , but her left eye was permanently blind .
conclusion this case report illustrates complications of the endovascular and surgical treatment of a large unruptured oa aneurysm .
|
we divided the study participants into two groups : the lt group and a control group ( non - lt group ) .
the lt group included 338 patients who had been pathologically diagnosed with hcc based on lt specimens and who had available medical records and formalin - fixed paraffin blocks of tumor tissue from the archives of the department of pathology of seoul national university hospital ( snuh ) from 1996 to 2012 .
the non - lt group comprised 520 patients who were pathologically diagnosed with hcc based on partial hepatectomy specimens and who had available medical records and formalin - fixed paraffin blocks of tumor tissue from the archives of the department of pathology of snuh from 1995 to 2006 .
the clinical information collected from existing medical records was age , sex , surgical method , underlying etiology of liver disease , serum -fetoprotein ( afp ) , preoperative treatment , and postoperative tumor recurrence .
pathological information was tumor size , number of tumors , site of tumors in the liver , gross tumor type , edmondson - steiner ( es ) nuclear grade for hccs , cellular type of tumor cells , histological pattern , vascular invasion , pathological american joint committee on cancer ( ajcc ) stage , whether the cancer met criteria such as the milan criteria or ucsf criteria based on pathology , and positivity of ck19 staining , all of which were collected from pathology reports or slide reviews .
the ajcc staging followed the liver tumor staging guidelines of the american joint committee on cancer , seventh edition .
the clinicopathologic parameters followed general rules for the study of primary liver cancer of japan .
this study was approved by the institutional review board of snuh ( h-1011 - 046 - 339 ) .
the demographic details of all patients are summarized in table 1 according to treatment method .
all diagnoses were confirmed by examination of 3-m hematoxylin and eosin stained sections of representative formalin - fixed paraffin - embedded blocks .
the slides were automatically stained using a bond - iii automated ihc / ish stainer and a bond polymer refine detection kit ( leica microsystems gmbh , wetzlar , germany ) .
positive staining with ck19 antibody ( mouse monoclonal anti - human cytokeratin 19 , clone rck108 , cat .
m0888 , 1:200 , dako , carpinteria , ca , usa ) was observed in the cytoplasm and cellular membrane .
ck19 positivity occurred in 243 cases in the lt group and 519 cases in the non - lt group .
progression was diagnosed when patients experienced symptoms due to a mass lesion , when serum afp level increased , or when computed tomography , magnetic resonance imaging , or positron emission tomography reported a new lesion or increasing tumor size .
the term intrahepatic progress was used when the tumor recurrence was located only in the liver , and extrahepatic progress was used when a metastatic tumor was identified beyond the liver with or without hepatic recurrence .
the follow - up period was 36 months ( median ; range , 0 to 202 months ) for the lt group and 73 months ( median ; range , 0 to 213 months ) for the non - lt group .
comparative analyses of discontinuous variables were conducted using the chi - square ( ) test , fisher exact test , or monte - carlo resampling methods for small samples .
survival curves were calculated using kaplan - meier analysis and compared by log - rank testing .
22 ( ibm corp . , armonk , ny , usa ) , and the monte - carlo resampling method was performed by coin package of r statistics [ 14 - 16 ] .
we divided the study participants into two groups : the lt group and a control group ( non - lt group ) .
the lt group included 338 patients who had been pathologically diagnosed with hcc based on lt specimens and who had available medical records and formalin - fixed paraffin blocks of tumor tissue from the archives of the department of pathology of seoul national university hospital ( snuh ) from 1996 to 2012 .
the non - lt group comprised 520 patients who were pathologically diagnosed with hcc based on partial hepatectomy specimens and who had available medical records and formalin - fixed paraffin blocks of tumor tissue from the archives of the department of pathology of snuh from 1995 to 2006 .
the clinical information collected from existing medical records was age , sex , surgical method , underlying etiology of liver disease , serum -fetoprotein ( afp ) , preoperative treatment , and postoperative tumor recurrence .
pathological information was tumor size , number of tumors , site of tumors in the liver , gross tumor type , edmondson - steiner ( es ) nuclear grade for hccs , cellular type of tumor cells , histological pattern , vascular invasion , pathological american joint committee on cancer ( ajcc ) stage , whether the cancer met criteria such as the milan criteria or ucsf criteria based on pathology , and positivity of ck19 staining , all of which were collected from pathology reports or slide reviews .
the ajcc staging followed the liver tumor staging guidelines of the american joint committee on cancer , seventh edition .
the clinicopathologic parameters followed general rules for the study of primary liver cancer of japan .
this study was approved by the institutional review board of snuh ( h-1011 - 046 - 339 ) .
the demographic details of all patients are summarized in table 1 according to treatment method .
all diagnoses were confirmed by examination of 3-m hematoxylin and eosin stained sections of representative formalin - fixed paraffin - embedded blocks .
the slides were automatically stained using a bond - iii automated ihc / ish stainer and a bond polymer refine detection kit ( leica microsystems gmbh , wetzlar , germany ) .
positive staining with ck19 antibody ( mouse monoclonal anti - human cytokeratin 19 , clone rck108 , cat .
m0888 , 1:200 , dako , carpinteria , ca , usa ) was observed in the cytoplasm and cellular membrane .
ck19 positivity occurred in 243 cases in the lt group and 519 cases in the non - lt group .
progression was diagnosed when patients experienced symptoms due to a mass lesion , when serum afp level increased , or when computed tomography , magnetic resonance imaging , or positron emission tomography reported a new lesion or increasing tumor size .
the term intrahepatic progress was used when the tumor recurrence was located only in the liver , and extrahepatic progress was used when a metastatic tumor was identified beyond the liver with or without hepatic recurrence .
the follow - up period was 36 months ( median ; range , 0 to 202 months ) for the lt group and 73 months ( median ; range , 0 to 213 months ) for the non - lt group .
comparative analyses of discontinuous variables were conducted using the chi - square ( ) test , fisher exact test , or monte - carlo resampling methods for small samples .
survival curves were calculated using kaplan - meier analysis and compared by log - rank testing .
22 ( ibm corp . , armonk , ny , usa ) , and the monte - carlo resampling method was performed by coin package of r statistics [ 14 - 16 ] .
as compared in table 1 , many clinicopathologic characteristics of patients in the lt and non - lt groups were different .
the lt group had a higher proportion of males , single lesions , expanding nodular gross type , confined lesions in the liver , hepatic histologic type , trabecular pattern , and underlying viral chronic liver disease ( cld ) than in the non - lt group ( all p<.05 ) .
tumor size was smaller , angioinvasion was less frequent , and es - nuclear grade and preoperative afp were lower in the lt group than in the non - lt ( all p < .05 ) .
age , ck19-positive expression rate , and large vessel invasion were not different between the two groups .
the proportion of patients in a low ajcc stage ( i ii stage ) and the proportion of those within milan or ucsf criteria were higher in the lt than in the non - lt group ( table 1 ) . in summary , patients in the lt group had more differentiated tumor histology and a lower stage of hcc than patients in the non - lt group . hazard ratios of dfs according to the clinicopathologic parameters , which were calculated by univariate cox proportional hazard model ,
the prognostic factors associated with dfs were similar between the lt and non - lt groups .
size , multiplicity of tumor , extent of tumor , angioinvasion , large vessel invasion , es nuclear grade , positive expression of ck19 , resection margin , and preoperative afp were significant prognostic factors of dfs in both the lt and non - lt groups ( all p<.05 ) .
gross type was a prognostic factor in the lt group but not in the non - lt group , and this was probably due to the rarity of diffuse / infiltrative type in the non - lt group .
sex , age , tumor cell type , histologic pattern , underlying causes of cld , and preoperative treatment were not prognostic factors in either the lt or non - lt group .
lower ajcc stage and adherence to the milan criteria and ucsf criteria were associated with a better dfs ( all p < .05 ) , but the hazard ratios of higher ajcc stage and non - adherence to the criteria compared to lower ajcc stage and adherence to the criteria were higher in the lt group than in the non - lt group ( 7.328 , 8.727 , 5.451 vs 2.312 , 1.849 , 1.719 , respectively , all p<.05 ) .
significant prognostic factors in univariate analysis in both the lt and non - lt groups were analyzed with transplantation or non - transplantation by multivariable analysis with the cox proportional hazards model in ajcc stage i ii patients ( table 2 ) .
surgical method was an independent prognostic factor , as were extent of tumor , multiplicity of tumor , angioinvasion , preoperative afp , size of tumor , and es nuclear grade .
ck19 expression and gross type were not independent prognostic factors . the hazard ratio of lt was 0.321 ( 95% confidence interval , 0.235 to 0.439 ) compared to non - lt , showing that it might have a protective effect against hcc progress .
patients who underwent lt had a better dfs than non - lt patients ( 5-year dfs rates , 79% vs 35% , respectively in lt and non - lt , log - rank p<.001 ) .
further analysis was performed according to ajcc stage , with the entire patient group divided into two groups based on stage i ii and stage iii iv classification .
lt in patients with stage i ii hcc resulted in better dfs compared to the non - lt group ( 5-year dfs rates , 84% vs 40% , respectively ; log - rank p<.001 ) .
no difference was observed in dfs between the lt and non - lt groups for stage iii iv hcc ( 5-year dfs rates , 23% vs 15% ; log - rank p=.295 ) ( fig .
2 ) . as shown in fig . 1a and b , recurrence in the lt group occurred in the early period after surgery , and cumulative dfs was sustained at approximately 80% after 3 years .
the recurrence site and post - operative period of recurrence were compared according to stage and resection method ( table 3 ) . among patients with tumors classified as stage i ii hcc , 43 patients in the lt group and 250 in the non - lt group experienced tumor progress . within the lt group ,
there were nine cases ( 21% ) with intrahepatic progress and 34 ( 79% ) with extrahepatic progress .
in contrast , the non - lt group included 155 cases ( 62% ) of intrahepatic recurrence and 95 cases ( 38% ) of extrahepatic progress .
metastasis to extrahepatic organs was the predominant pattern of recurrence in the lt group among patients with stage i ii hcc , whereas intrahepatic recurrence was predominant in the non - lt group ( p<.001 ) .
there were nine cases ( 36% ) of intrahepatic progress and 16 cases ( 64% ) of extrahepatic progress within the lt group , and the non - lt group included 44 cases ( 51% ) of intrahepatic recurrence and 43 cases ( 49% ) of extrahepatic progress , but there was no significant difference between the two groups ( p=.198 ) .
as previously mentioned , the time to recurrence and recurrence site were different between the lt and non - lt groups .
all nine intrahepatic recurrence cases of ajcc stage i ii lt patients recurred within 2 years , but 66 of 155 intrahepatic recurrence cases ( 43% ) of ajcc stage i ii non - lt patients occurred beyond 2 years ( p<.001 ) .
most of the extrahepatic metastasis occurred within 2 years in both the lt and non - lt groups for ajcc stage i ii stage patients ( 30 [ 88% ] vs 79 [ 83% ] , respectively , p=.376 ) .
this progress pattern also disappeared in stage iii iv patients who showed early progress within 2 years after surgery , regardless of recurrence sites ( table 3 ) .
as compared in table 1 , many clinicopathologic characteristics of patients in the lt and non - lt groups were different .
the lt group had a higher proportion of males , single lesions , expanding nodular gross type , confined lesions in the liver , hepatic histologic type , trabecular pattern , and underlying viral chronic liver disease ( cld ) than in the non - lt group ( all p<.05 ) .
tumor size was smaller , angioinvasion was less frequent , and es - nuclear grade and preoperative afp were lower in the lt group than in the non - lt ( all p < .05 ) .
age , ck19-positive expression rate , and large vessel invasion were not different between the two groups .
the proportion of patients in a low ajcc stage ( i ii stage ) and the proportion of those within milan or ucsf criteria were higher in the lt than in the non - lt group ( table 1 ) . in summary , patients in the lt group had more differentiated tumor histology and a lower stage of hcc than patients in the non - lt group . hazard ratios of dfs according to the clinicopathologic parameters , which were calculated by univariate cox proportional hazard model ,
the prognostic factors associated with dfs were similar between the lt and non - lt groups .
size , multiplicity of tumor , extent of tumor , angioinvasion , large vessel invasion , es nuclear grade , positive expression of ck19 , resection margin , and preoperative afp were significant prognostic factors of dfs in both the lt and non - lt groups ( all p<.05 ) .
gross type was a prognostic factor in the lt group but not in the non - lt group , and this was probably due to the rarity of diffuse / infiltrative type in the non - lt group .
sex , age , tumor cell type , histologic pattern , underlying causes of cld , and preoperative treatment were not prognostic factors in either the lt or non - lt group .
lower ajcc stage and adherence to the milan criteria and ucsf criteria were associated with a better dfs ( all p < .05 ) , but the hazard ratios of higher ajcc stage and non - adherence to the criteria compared to lower ajcc stage and adherence to the criteria were higher in the lt group than in the non - lt group ( 7.328 , 8.727 , 5.451 vs 2.312 , 1.849 , 1.719 , respectively , all p<.05 ) .
significant prognostic factors in univariate analysis in both the lt and non - lt groups were analyzed with transplantation or non - transplantation by multivariable analysis with the cox proportional hazards model in ajcc stage i ii patients ( table 2 ) .
surgical method was an independent prognostic factor , as were extent of tumor , multiplicity of tumor , angioinvasion , preoperative afp , size of tumor , and es nuclear grade .
the hazard ratio of lt was 0.321 ( 95% confidence interval , 0.235 to 0.439 ) compared to non - lt , showing that it might have a protective effect against hcc progress .
patients who underwent lt had a better dfs than non - lt patients ( 5-year dfs rates , 79% vs 35% , respectively in lt and non - lt , log - rank p<.001 ) .
further analysis was performed according to ajcc stage , with the entire patient group divided into two groups based on stage i ii and stage iii iv classification .
lt in patients with stage i ii hcc resulted in better dfs compared to the non - lt group ( 5-year dfs rates , 84% vs 40% , respectively ; log - rank p<.001 ) .
no difference was observed in dfs between the lt and non - lt groups for stage iii iv hcc ( 5-year dfs rates , 23% vs 15% ; log - rank p=.295 ) ( fig .
2 ) . as shown in fig . 1a and b , recurrence in the lt group occurred in the early period after surgery , and cumulative dfs was sustained at approximately 80% after 3 years .
the recurrence site and post - operative period of recurrence were compared according to stage and resection method ( table 3 ) . among patients with tumors classified as stage i ii hcc , 43 patients in the lt group and 250 in the non - lt group experienced tumor progress . within the lt group ,
there were nine cases ( 21% ) with intrahepatic progress and 34 ( 79% ) with extrahepatic progress .
in contrast , the non - lt group included 155 cases ( 62% ) of intrahepatic recurrence and 95 cases ( 38% ) of extrahepatic progress .
metastasis to extrahepatic organs was the predominant pattern of recurrence in the lt group among patients with stage i ii hcc , whereas intrahepatic recurrence was predominant in the non - lt group ( p<.001 ) .
there were nine cases ( 36% ) of intrahepatic progress and 16 cases ( 64% ) of extrahepatic progress within the lt group , and the non - lt group included 44 cases ( 51% ) of intrahepatic recurrence and 43 cases ( 49% ) of extrahepatic progress , but there was no significant difference between the two groups ( p=.198 ) .
as previously mentioned , the time to recurrence and recurrence site were different between the lt and non - lt groups .
all nine intrahepatic recurrence cases of ajcc stage i ii lt patients recurred within 2 years , but 66 of 155 intrahepatic recurrence cases ( 43% ) of ajcc stage i ii non - lt patients occurred beyond 2 years ( p<.001 ) .
most of the extrahepatic metastasis occurred within 2 years in both the lt and non - lt groups for ajcc stage i ii stage patients ( 30 [ 88% ] vs 79 [ 83% ] , respectively , p=.376 ) .
this progress pattern also disappeared in stage iii iv patients who showed early progress within 2 years after surgery , regardless of recurrence sites ( table 3 ) .
our study analyzed the recurrence rate of hcc and the recurrence pattern in lt patients compared with non - lt patients , as well as prognostic factors after transplantation .
recurrence after lt usually occurred within 2 years and was more frequently identified in extrahepatic sites ; in contrast , recurrence after non - lt frequently occurred beyond 2 years after surgery , and the sites of recurrence were intrahepatic .
furthermore , this difference was clear in stage i - ii hcc , but was not observed in stage iii
many previous studies comparing lt and other treatment choices for hcc reported that patients who underwent lt had a better survival than those who underwent resection .
the rationale of lt as a treatment choice for hcc is loco - regional removal of tumor and protective removal of the damaged liver , which plays a major role in the de novo recurrence of hcc .
the results of our study support this dual rationale for lt to treat hcc . in our study , intrahepatic recurrence was more frequent in the non - lt group than in the lt group in patients with stage i ii and was sustained for a long period after surgery .
therefore , it is thought that lt is an effective treatment to suppress de novo carcinogenesis , which is the main mechanism of late recurrence of hcc . in the present study , the high proportion of extrahepatic hcc recurrence after lt was similar to results from other studies .
because of the protective removal of the source of de novo carcinogenesis in lt , tumor recurrence in lt patients can be mainly explained by metastasis or regrowth of remnant tumor cells .
assuming complete resection ( r0 resection ) , potential tumor cells do not exist in the liver after lt . circulating tumor cells ( ctcs )
might be considered to explain this phenomenon . according to a recent study , primary tumor cell invasion to the bloodstream and ctcs
are responsible for tumor recurrence and metastasis , including that of hcc [ 20 - 22 ] .
although lt is the treatment of choice for early - stage hcc , it is not a feasible choice because of the shortage of deceased donors .
increasing living donor lt has compensated for the shortage of organ donations , but maintaining a balance between the benefit to the recipient and the risk to the living donor is another emerging issue in this field .
patient selection criteria tend to expand the range of recipients by up regulation of number or size of tumor .
this classical approach used to be based on preoperative radiologic studies . however , the histology and biologic features of the tumor are important prognostic factors for predicting tumor progress .
similar to other studies , the multivariate analysis of prognostic factors in our study also concluded that es nuclear grade was an independent prognostic factor .
however , although ck19 expression was not an independent prognostic factor in our study , it was reported as a prognostic marker of hcc recurrence beyond the milan criteria in another study .
another issue concerning the histologic factors of hcc in lt is the gap between preoperative clinical staging and post - operative pathologic staging .
the milan criteria and ucsf criteria consider vascular invasion as an important exclusion criterion . because the degree of vasculature that can be examined by radiologic study and pathologic study is much different , many cases within the criteria before surgery
are changed to beyond the criteria after surgery based on the pathology of the explant . in our study ,
pretransplant tumor staging and explant pathology do not always correlate , and 83 of 145 cases ( 57% ) within the milan criteria were classified as beyond milan based on the presence of angioinvasion in microscopic findings
. there might be discrepancies in the size or number of tumors between the pre - transplant radiological staging and explant pathologic staging .
therefore , further studies to reduce the preoperative and postoperative staging are needed . in conclusion
, this study demonstrated that dfs was better in the lt group compared to the non - lt group for patients with stage i ii hcc .
accordingly , there might be a tendency for tumors to occur in the late period after surgery in patients who have not undergone lt .
the prognostic factors in patients who have undergone lt are similar to those observed in previous studies ; lt , extent of tumor , multiplicity of tumor , angioinvasion , preoperative afp , size of tumor , and es nuclear grade were independent prognostic factors .
|
backgroundliver transplantation ( lt ) is the treatment of choice for hepatocellular carcinoma ( hcc ) .
the aim of this study was to investigate the recurrence rate of hcc after lt and prognostic factors for recurrence by comparing lt with non - transplanted resection .
methodsthe participants were 338 patients who underwent lt between 1996 and 2012 at seoul national university hospital ( lt group ) and 520 hcc patients who underwent partial hepatectomy between 1995 and 2006 ( control group , non - lt group ) .
resultsin the lt group , 68 of 338 patients ( 19.8% ) showed relapse , and the recurrence rate was lower than that in the non - lt group ( 64.9% , 357/520 , p < .001 ) .
stratification analysis by american joint committee on cancer ( ajcc ) stage showed that the stage i - ii
lt group had a lower recurrence rate than the non - lt group .
univariate comparative analysis demonstrated that multiplicity of tumor , tumor size , gross type , edmondson- steiner ( es ) nuclear grade , extent of tumor , angioinvasion , ajcc stage , milan criteria , university of california at san francisco criteria on explant pathology ( all p < .001 ) , positive expression of cytokeratin 19 ( p = .002 ) , and preoperative -fetoprotein ( afp ) ( p <
.001 ) were predictors of tumor recurrence . in multivariate analysis ,
lt , preoperative afp , multiplicity of tumor , extent of tumor , size of tumor , and es nuclear grade were independent prognostic factors .
conclusionslt might have a protective effect against the late recurrence of stage i - ii hcc compared to non - lt , and the prognostic factors for recurrence were similar to previously well - known prognostic factors for hcc .
|
the department of pediatric cardiac surgery in gdansk is the only pediatric cardiac surgery center in northern poland providing comprehensive treatment to children with congenital heart defects .
the department of pediatric cardiac surgery in gdansk currently offers a full spectrum of advanced procedures of modern cardiac surgery and interventional cardiology dedicated to patients from infancy to adolescence .
january 19 , 2016 marked the official opening of its new location .
|
|
in switzerland , the so - called clinical electives year is integrated into the three - year masters study programme as part of the altogether six - year medical studies course in the faculties of medicine of bern , basel , geneva and zrich , as well as the faculty of biology and medicine in lausanne . during this year , the emphasis is on the clinical instruction of students . in principle ,
courses of study in medicine , dentistry , veterinary medicine , pharmacy and chiropractic are regulated by law at the federal level under the swiss federal law on medical professions . here
, the statutory text defines general learning objectives valid for all courses of study , as well as specific learning objectives for the study of medicine .
in addition to this , the swiss catalogue of learning objectives for undergraduate medical training ( sclo ) describes the profile required to enter postgraduate training in terms of competences , learning objectives and learning content .
the second edition is mentioned in the swiss federal examination regulations for swiss federal licensing examination for human medicine , and is thus applied to the faculties in significantly more binding form .
furthermore , in the second half of 2014 a federal working group from the federal office of public health ( bag ) and the faculties mandated via the swiss medical inter faculty commission ( smifk ) was set up to develop the third edition of the learning objectives catalogue by early 2017 .
depending on the different faculties , there are differences , and sometimes considerable ones , between the content and structural framework of the clinical electives year .
regarding content , all faculties largely reference the competences and learning objectives outlined in the sclo .
nevertheless , there are differences between faculties , for example with respect to guidelines on the choice of clinical disciplines , or the proportion of clinical rotations completed in medical practices , research groups or health care institutions . with regard to the structural aspects ,
for example , the location of the clinical electives year within the study programme varies depending on the faculty ( 2 , 2 - 3 or 3 year of the masters programme ) , as does the duration ( a total of 7 - 10 months ) . regarding the perspective of the quality development of instruction during the clinical electives year ,
in addition to the difference in content and structural aspects , two main categories can also be highlighted : firstly , the guidelines available to individual students on how to construct their clinical electives year , and secondly , the basic criteria for hospitals , clinics , medical practices and other institutions in which medical students complete their different clinical rotations . especially in view of the second category , the work of raes et .
al . proposes a substantial and comprehensive catalogue of criteria , which includes criteria for process and structure as well as results . from the swiss perspective
, a similar approach seems reasonable and feasible in principle , particularly due to the high mobility of swiss national students during their clinical electives year .
this high mobility amongst other things - results in the application of different basic criteria from different faculties to students on the same course of instruction .
in addition , the guidelines for individual students should basically have a uniform structure , although adapted to the variable duration of clinical rotations in the same clinical discipline which is possible in all faculties . with regard to the structuring of content , and based above all on the competences which must be taught , all faculties have introduced a portfolio or logbook for the clinical electives year . as a rule , these are based on the sclo in terms of competences and roles , learning objectives in the field of clinical skills , and the chapter problems as starting points for training .
with regard to the future quality development of the clinical electives year in switzerland , above all it would appear to be essential that all faculties work together to further develop structural and content guidelines for students and institutions .
in addition , the objective should be , where possible , to implement and use the same tools to structure content ( logbook , portfolio ) and for formative and summative assessment ( for example , workplace - based assessment ) .
not least , emphasis must also be placed on the crucial importance of student participation in the context of systematic feedback on the clinical electives year and its further development .
|
with their publication on quality management of clinical - practical instruction for practical year medical students in germany and the preparation of a catalogue of criteria , raes et al .
tackle questions , both in terms of content and structural framework , in a current and relevant subject area [ 1].the following commentary provides an additional outline of the current situation of clinical - practical instruction during the so - called clinical electives year in switzerland , which broadly corresponds to the practical year in germany .
|
the root tips several of plant species have been used for the study of induced chromosomal aberrations ( cas ) and presence of micronuclei ( mni ) .
the root meristem contains a high proportion of cells in mitosis ( 1 - 3 ) .
plant systems had a major part in early investigations of the genetic changes caused by mutagenic chemicals and radiation .
one of the most suitable plants for detecting different types of xenobiotics is allium
cepa l. the first modification of the allium cepa test for environmental monitoring was introduced by fiskesj ( 4 , 5 ) .
the chromosome assays on plants are rapid and inexpensive and do not require elaborate laboratory facilities and a wide range of genetic endpoints is available .
the chromosomes of plants and animals are morphologically similar , and appear to respond to treatment with mutagens in a similar way to those of mammals and other eukaryotes
. there are some important limitations as well , such as the longer life cycle of most plants than bacteria , yeast or drosophila and some biochemical differences between plants and mammals .
the growing root tips of the onion , allium cepa provide a readily available source of material for studying the damaging effects of chemicals on chromosomes .
this plant is useful for evaluating dna damages that express such as cas , disturbances in the mitotic cycle , nuclear alterations ( nas ) and presence of mni in meristem cells .
the decrease in the mitotic index ( mi ) of allium cepa meristem cells can be considered as a reliable method to determine the presence of cytotoxic agents in the environment .
cas are including changes in either chromosomal structure or in the total number of chromosomes .
structural chromosomal alterations may be induced by dna breaks , inhibition of dna synthesis and replication of altered dna .
the cas , such as chromosome bridges and breaks , are indicators of a clastogenic action .
the numerical cas ( aneuploidy and polyploidy ) are consequences of abnormal segregation of chromosomes ( chromosome losses , delays , adherence , multipolarity and c - metaphases ) which can occur either spontaneously or by the action of aneugenic agents .
chromosome without telomeres become sticky and may fuse with other broken chromosome ends . the result of these chromosomal rearrangements
are acentric fragments , dicentric bridges that can be observed in mitotic cells of the first cell cycle after mutagenic treatment or mni in the interphase cell in the next cell cycle .
the allium cepa test is used for screening and monitoring environmental chemicals with mutagenic and carcinogenic potential ( 6 - 10 ) .
overdose in adults frequently involves co - ingestion of other central nervous system ( cns ) depressants , which act synergistically to increase toxicity .
alprazolam is assumed to be capable of causing fatal harm and an increased risk if congenital abnormalities when administered to a pregnant woman during the first trimester .
the aim of this study was to evaluate the genotoxic potential of benzodiazepine drug alprazolam . for estimate the genotoxicity of this benzodiazepine and for assessment of risks from exposure to alprazolam
alprazolam ( xanax , helex , alpronax ) is a triazolobenzodiazepine used in panic disorder and other anxiety states .
alprazolam , like other benzodiazepines , binds to specific sites on the gabaa ( gamma - amino - butyric acid ) receptor .
the chemical name of alprazolam is 8-chloro-1-methyl-6-phenyl-4h - s - triazolo [ 4,3-a ] benzodiazepine .
the root tip cells of onion were used to test the potentially genotoxic effects of alprazolam .
the test was carried out according to fiskesj protocol ( 4 , 11 - 12 ) with some modifications .
common onion ( allium
cepa l. ) has eight pairs of relatively large chromosomes ( 2n = 16 ) that allows for the easy detection of cas .
the plant material is available all the year round , it is inexpensive and easily to grow and handled .
the size of chromosomes makes allium cepa tips as favourable material for the study of the effects of chemicals on frequency of cas which are biomarkers of damage of genetic material .
the root tip cells have a very low spontaneous aberration frequency and a stable chromosome number . to perform this test we used onion bulbs that cultivated without the application of herbicides or fungicides .
the outer scales are removed from bulbs and they scraped at the root to promote the emergence of new roots .
when the newly emerged roots are 2 cm in length , they are ready for treatment with the test drug .
the bulbs should be transferred to petri dish with 30 ml of alprazolam solution appropriate concentration for the treatments .
roots of allium cepa have been treated with a series of concentration 100 , 150 , 200 , 250 and 500g / ml for 24h .
after 24h , the roots of each bulb were extracted and fixed in freshly prepared and cool mixture ( 4 - 10 c ) containing 3 parts of methanol and 1 part of glacial acetic acid ( 3:1 , v / v ) for 24h .
preparation root tip chromosome slides acetorcein squash technique has been used to analyse mi , cytotoxic effects and cas .
the root tips of bulbs hydrolysed in 1n hydrochloric acid ( hcl ) at 60 c for 4 - 5 min .
three roots tips were used for each slide . on the slide , tips were crushed in drop of 2% acetorcein ( gurr orcein , bdh chemicals ltd . ,
poole , england ) with the flat end of metal rod ( taper ) and squashed under a cover slip .
the pressure was applied under several thickness of blotting filter paper during sideways movements of cover slip must be avoided .
the two slides prepared for each of bulbs in each experimental group ( concentration of the test drug ) .
a thousand cell for mi and a hundred metaphase cells ( except for concentration of 500g / ml due to reduction in mi ) for cas were counted for each bulb per treatment group .
twelve slides were prepared for each concentration of alprazolam and the control . for cytogenetic examination of mitotic cells
the mitotic index ( mi ) represents the total number of dividing cells in relation to the number of analysed cells in cell cycle .
a minimum of 1,000 cells were scored for mi and expressed as a percentage of total number of examined cells undergoing mitosis .
the frequency of cas was expressed as the number of aberrant cells per 100 cells examined .
a hundred metaphase cells were scored for each bulb in experimental group and the number of aberrant cells in each experimental group is compared with the values from the control group .
the allium cepa test enables to estimate cas in all phases of the cell cycle .
data were expressed as the mean standard deviation ( sd ) of the means for mi and frequency of aberrant cells . for statistical analysis of variance ( anova ) was used .
relationships between different concentrations of alprazolam and mi or frequency of aberrant cells were investigated using pearson s correlation analysis and/or spearman s rank correlation .
analyses were done at p<0.05 and 95% confidence level using medcalc version 12.5.0.0 statistical software package .
the results this study showed concentration - dependent reduction in mi of allium
cepa root tip meristem cells treated with different concentrations of alprazolam for 24h ( table 1 ) .
this difference was significant in pearson s correlation analysis where correlation coefficient ( r ) was -0.7454 with significance level p<0.0001 and 95% confidence interval ( ci ) for r -0.8700 to -0.5315 .
spearman s coefficient of rank correlation ( rho ) was -0.725 with significance level p<0.0001 and 95% ci for rho -0.859 to -0.500 . based on the statistical analysis using anova test
we observed inhibition of mi in meristem cells that was statistically significant at all tested concentrations ( p<0.05 ) but not significant at 150g / ml when compared with the control .
mitotic index ( mi ) of allium cepa root tip cells exposed to different concentrations of alprazolam ( mean sd ) the cas in allium cepa root tip meristem cells after 24h exposure to alprazolam were anaphase bridges , breaks , chromosome lagging and stickiness , abnormal spiralisation of chromosomes , multipolarity and polyploidy ( table 2 ) .
statistically significant increased number of cas in the meristem cells with increasing concentration of alprazolam was observed in spearman s rank correlation analysis ( rho=0.524 , p=0.0025 and 95% ci : 0.208 to 0.741 ) .
statistically significant higher number of cas were at all tested concentrations ( p<0.05 ) except at 100g / ml in comparison with the control when analysed with the anova test . in this analysis we excluded cells treated with alprazolam of 500g / ml because a little number of dividing cells at this concentration .
figure 1 shows cas at all phases of cell cycle that can be observed by the allium cepa test .
chromosome aberration assay in allium root cells exposed to alprazolam ( 100 , 150 , 200 , 250 and 500g / ml for 24h ) photomicrographs of cas induced by alprazolam in root tip cells of allium cepa ; ( a ) prolonged prophase and abnormal kinetics ; ( b ) and ( c ) chromosome laggards and spindle disturbance at metaphase ; ( d ) disturbed anaphase in a polyploid cell ; ( e ) anaphase with chromosome laggards ; ( f ) multipolar anaphase and spindle disturbance ( magnification : 1000x ) .
cytological aberrations observed at cell cycle after the treatments with alprazolam were different nas ( nuclear buds , ghost cells
cells without nucleus , fragmented nucleus and apoptotic bodies ) , binucleated cells and micronucleus formation ( table 3 ) .
mni were present in the different phases of cell cycle in root meristem cells of allium cepa .
the spindle disturbance and polar deviation can lead to abnormal kinetics of chromosome and prolonged prophase .
figure 2 shows nuclear abnormalities that can be found in allium cepa meristem cells exposed to alprazolam .
statistically positive correlations were found between concentrations alprazolam and nas after using pearson s correlation analysis ( r=0.7866 , p<0.0001 and 95% ci : 0.5994 to 0.8923 ) and spearman s rank correlation ( rho=0.811 , p<0.0001 and 95% ci : 0.640 to 0.905 ) .
these results were statistically significant except for concentration 100g / ml when analysed with the anova test ( p<0.05 ) in comparison with the control .
cytological effects of different concentrations of alprazolam on root tip cells of allium cepa ( mean sd ) photomicrographs of cytological aberrations in allium cepa meristem cells exposed to alprazolam ; ( a b ) cells with fragmented nucleus and apoptotic bodies , morphological alterations in shape and size of cells ; ( c ) extended interphase and telophase cell , dislocation of spindle , stickiness ; ( d ) extended cells , disturbed spindle and cytoplasm destruction ; ( e ) micronucleus in prophase , stickiness ; ( f ) cells with nuclear bud ( magnification : 1000 ) .
the allium cepa test is important test in vivo , where the roots grow in direct contact with the substance of interest enabling possible damage to dna of humans to be predicted . in this study
, test enables the assessment of different genetic endpoints which occur as a result from exposure to alprazolam .
alprazolam caused significant inhibition of mi in allium cepa meristem cells and induced cas , nuclear abnormalities and micronucleated cells ( mncs ) .
the changes in mi of allium cepa cells are indicators of cytotoxic and genototoxic potential and mitodepressive activity of alprazolam .
the analysis of the different ca types , in all phases of the cell cycle , enables a better investigation of the effects of alprazolam , concerning its clastogenic , aneugenic and tubergenic effects .
breakages may occur and subsequent inhibition of repair mechanisms may lead to base mismatch , mutation and cas such as fragment chromosomes and dna breaks ( 12 - 14 ) .
examination of anaphase chromosomes for fragments and bridges is a useful for obtaining information on clastogenic activity .
the presence of dicentric chromosomes and unequally exchanged chromatids undergoing translocation has been reported to be responsible for chromosomal bridges at anaphase .
the bridges , breaks , lagging and multipolar anaphase chromosomes were observed at all concentrations , except at the highest tested concentration .
stickiness is due to inter - chromosomal linkages of sub - chromatid strands coupled with excessive formation of nucleoproteins and inappropriate protein - protein interaction .
nuclear abnormalities are characterized by morphological alterations in the interphase nuclei as a result from the exposure to alprazolam .
aberrations observed at interphase stage of cell cycle were different nas ( nuclear buds , cells without nucleus ghost cells , fragmented nuclei and apoptotic bodies ) , bncs and micronucleus formation . also , we observed alterations in shape and size of cells ( gigantic and extended cells ) .
the presence of fragmented nuclei and polynuclear cells can indicate a cell death process and this may lead to aneuploidy and then to cell death .
mni are formed as a consequence of chromosome breakage ( clastogenic agent ) or whole chromosomes ( aneugenic agent ) that were not incorporated to the main nucleus during the cell division cycle ( 15 - 16 ) .
the frequency of cells with mni is indicator of the cytogenetic effects of tested chemicals .
mni were observed to be mostly caused by alprazolam at 500g / ml suggesting its greater genotoxic and tubergenic effects on allium
cepa when compared with lower concentrations of drug .
long half - life benzodiazepines , such as diazepam or clonazepam , accumulate with repeated doses and clearance is significantly increased with age .
alprazolam is intermediate half - life benzodiazepine and it s the usual starting dose varies between 0.5 and 1 mg per day .
benzodiazepines produce dose - dependent adverse effect and long half - life benzodiazepines use may induce physiological dependence ( 17 ) .
( 18 ) reported cytotoxic and genotoxic effects of lower concentrations of alprazolam against allium cepa root meristem cells . according to isbister et al .
in conclusion , the results of this study indicate that benzodiazepine drug alprazolam induced chromosomal ( anaphase bridges , breaks , lagging and stickiness , abnormal spiralisation , multipolarity and polyploidy ) and cytological aberrations , especially nuclear alterations ( nuclear buds , fragmented nucleus and apoptotic bodies , cells without nucleus , binucleated and micronucleated cells ) , morphological alterations in shape and size of cells , spindle disturbances and polar deviation in root tip meristem cells of allium cepa at all tested concentrations .
alprazolam also caused significant inhibition of mitotic index in these cells and almost stopped the cell proliferation at the highest tested concentration .
the changes in allium cepa meristem cells are indicators of genotoxic potential of alprazolam suggesting a need for safe dose administration of the drug in human medicine and further in vitro studies on animal and human lymphocytes as well as in vivo studies .
|
abstractintroduction : alprazolam is a triazolobenzodiazepine used in panic disorders and other anxiety states . target organ of alprazolam is cns , causing depression of respiration and consciousness.aim:this study aimed to estimate the genotoxic potential of alprazolam using allium cepa test.methods:allium cepa is one of the most suitable plants for detecting different types of xenobiotics .
the test enables the assessment of different genetic endpoints making possible damage to the dna of humans to be predicted.results:alprazolam induced chromosomal ( anaphase bridges , breaks , lagging and stickiness , abnormal spiralisation , multipolarity and polyploidy ) and cytological aberrations , especially nuclear alterations ( nuclear buds , fragmented nucleus and apoptotic bodies , cells without nucleus , binucleated and micronucleated cells ) , morphological alterations in shape and size of cells , spindle disturbance and polar deviation in root tip meristem cells of allium cepa at all tested concentrations .
alprazolam also caused significant inhibition of mitotic index in these cells.conclusion:these changes in cells are indicators of genotoxic potential of alprazolam suggesting a need for further in vitro studies on animal and human lymphocytes as well as in vivo studies .
|
cushing 's syndrome ( cs ) represents the pattern of symptoms and signs caused by prolonged exposure of inappropriately high levels of the hormone cortisol [ 13 ] .
it is relatively rare and most commonly affects adults between the ages of 20 and 50 , affecting approximately 2 to 3 per million people in each year .
other signs and symptoms include thinning of the reddish purple striae , plethora , proximal muscle weakness , weight gain , bruising with no obvious trauma , hypertension , diabetes , and osteoporosis [ 48 ] .
vascular events , either cardiovascular or cerebrovascular , are the major causes of death [ 4 , 6 , 7 , 9 ] . however , due to the relatively low incidents of cs , it is hard to make a risk assessment for these events .
the most frequently used schema designed to stratify risk of thromboembolism in patients with atrial fibrillation is chads2 score [ 1014 ] , which closely correlate major adverse cardiovascular events ( maces ) , such as myocardial infarction , stroke , and mortality risk .
clinically , chads2 score is simple to use , with one point given for congestive heart failure , hypertension , age , and diabetes and two points for stroke or transient ischemic attack .
higher score has been associated with the risk of developing maces and for these patients , early anticoagulation therapy should be recommended [ 13 , 15 ] .
recent studies have indicated that the risks of maces other than atrial fibrillation have been reported and the risk assessment was performed by using chads2 [ 1618 ] . in this study , participants with clinically diagnosed cs were adopted from the nhird of taiwan .
this database enrolls up to 99% of the 23 million residents of taiwan who receive medical care through the national health insurance ( nhi ) program which consists of ambulatory and inpatient care records and the registration files of the insured .
the aim of the study was to explore the relationship between cs and the risk of vascular events .
furthermore , we evaluated the predictive value of chads2 on maces in patients with cs .
this observational study was conducted in a retrospective cohort of the taiwanese population from the year 2002 to 2009 , enrolled in nhird in taiwan .
the national health insurance bureau of taiwan randomly reviews the charts of 1 out of every 100 ambulatory cases and one out of every 20 inpatient cases ; it also performs patient interviews to verify the accuracy of the diagnosis . in patients 18 years of age diagnosed with cushing 's syndrome ( icd-9-cm codes 255.0 ) between the years 2002 and 2009 were recruited for this study .
the chads2 scores were calculated for each patient by assigning 1 point each for the presence of chronic heart failure , hypertension , age below 75 years , and diabetes and by assigning 2 points for history of stroke or transient ischemic attack ( tia ) .
the study patients were divided into 4 groups by their chads2 scores : 0 , 1 , 2 , and 3 , respectively .
mortality data covering the years from 2002 to 2009 were used to calculate the mortality rate in each group .
each patient was tracked for 5 years from the time of their first diagnosis using administrative data to identify all patients who had maces such as myocardial infarction , stroke , and mortality or censored during the study period .
receiver operating characteristics curve was used to assess the prediction accuracy for maces by using chads2 score and plots of observed and predicted maces were presented .
the cumulative rates of maces were estimated using the log rank test to examine the differences in the risk of mortality between different groups among the cs patients .
the cox proportional hazards regression model was used to compare the outcomes between different risk groups .
we calculated hazard ratios ( hr ) along with 95% confidence intervals ( ci ) using a significance level of 0.05 .
a two - sided p value ( p < 0.05 ) was used to determine statistical significance .
the number of patients , age , gender , and distribution of number of patients in different chads2 score groups are shown in table 1 .
severe comorbidity ( chads2 score 3 ) was noted in 10.7% in all cs patients .
figure 1 showed that the c - statistics was 0.795 ( 95% ci , 0.7240.866 ) .
cs patients with higher chads2 score were more likely to have maces ( p < 0.001 ) .
we further divided the cs patients into four groups based on the chads2 scores ( table 2 ) .
cs patients with a score of 3 are associated with the highest rate in maces ( figure 2(b ) , p < 0.001 ) . in multivariate analysis ,
each additional chads2 score is associated with 1.63-fold ( 95% ci , 1.292.06 ) increased risk for maces when chads2 score is a continuous variable ( table 3 , model a ) . in model
b of table 3 , where chads2 is an ordinal variable and divided into three groups , patients with the score 3 remained as an independent prognostic factor for the risk of maces with hazard ratios of 7.16 ( 95% ci , 2.3122.15 ) , compared with chads2 0 - 1 after adjusting with other factors . as compared to male , female
is associated with decreased risk for maces in patients with cs ( model b , adjusted hr 0.45 , 95% ci 0.250.81 , and p = 0.009 ) .
age is associated with increased risk for maces ( model b , adjusted hr 1.05 , 95% ci 1.001.05 , and p = 0.026 ) .
the main finding of this study is that the chads2 score can be useful in the evaluation of the global cardiovascular risk ( i.e. , maces and death ) of patients with cs .
we provide the general calculation of mortality and morbidity rate as well as a risk assessment for maces in cases of cs .
we validated the application of chads2 score in the maces of cs patient for the accuracy of our prediction is 79.5% .
the strengths of these data are based on the fact that it was a nationwide population - based cross - sectional study , with nearly complete follow - up information about access to healthcare institutes , as well as the fact that the dataset was routinely monitored for diagnostic accuracy by the national health insurance bureau of taiwan .
the national health insurance ( nhi ) program was conducted since 1995 which requires mandatory enrollment in the government - run , universal , single - payer insurance system and provides comprehensive benefits coverage .
currently , up to 99% of the 23 million residents of taiwan receive medical care through this program . over 97% of the hospitals and clinics in taiwan
are contracted to provide health care services , which are reimbursed by the bureau of nhi , and all data related to these services are collected and stored into the nhird by the national health research institutes to provide a comprehensive medical care record .
the data consisted of ambulatory care records , inpatient care records , and the registration files of the insured . the dataset included all claims data from taiwan 's nhi program , which was implemented as a means of financing health care for all taiwanese citizens .
the average age and gender distribution of cs patients were also compatible with a previous report .
there are many reports about the mortality and morbidity of cs that have been documented [ 2124 ] .
however , due to the relative rarity of cs , data collection on the incidence , mortality , and cause of death is scarce .
poor prognosis was demonstrated in 35.6% of the patients in high risk population ( chads2 3 ) , 13.0% of the chads2 = 2 , 6.6% of the chads2 = 1 , and 2.2% in the cases of the chads2 = 0 .
current guidelines for atrial fibrillation suggest that the chads2 is useful in the selection of antithrombotic therapy ; therefore , those with high risk ( chads2 score 2 ) would benefit from anticoagulation therapy . for those with low ( score 0 ) or moderate ( score 1 ) risk , aspirin may be an alternative given that the risk of bleeding caused by anticoagulation therapy may not justify its use .
the diagnoses of cs , ami , and stroke were dependent on icd codes used in the nhird database .
validation of scores in retrospective cohort presents always with several limitations that weaken the strength of the results .
however , we believe the relatively large number of patients may compensate for these limitations . the national health insurance bureau of taiwan , however , has made every effort to verify the accuracy of diagnosis based upon random chart reviews and patient interviews .
an additional limitation of the nhird database was its lack of information on tobacco use , dietary habits , metabolic profiles , or other behavioral factors , which may be risk factors for ami among cs patients .
nonetheless , given the magnitude and statistical significance of the observed effects in this study , these limitations were unlikely to have compromised our results .
in addition , because the nhi has 99% coverage in taiwan , our study had minimal risk of selection bias .
in the present study , chads2 score could be a good tool to predict the incidence of maces in patients with cushing 's syndrome .
cardiovascular risks evaluation and management should be applied more aggressively for cs patients with chads2 score 3 .
|
vascular events are one of the major causes of death in case of cushing 's syndrome ( cs ) . however , due to the relative low frequency of cs , it is hard to perform a risk assessment for these events . as represented congestive heart failure ( c ) , hypertension ( h ) , age ( a ) , diabetes ( d ) , and stroke ( s ) , the chads2 score is now accepted to classify the risk of major adverse cardiovascular events ( maces ) in patients with atrial fibrillation . in this study , participants were enrolled from the national health research institute database ( nhird ) of taiwan , and we reviewed 551 patients with their sequential clinically diagnosed cs data between 2002 and 2009 in relation to maces risk using chads2 score .
good correlation could be identified between the cs and chads2 score ( auc = 0.795 ) .
our results show that patients with cs show significantly higher risk of vascular events and the chads2 score could be applied for maces evaluation .
adequate lifestyle modifications and aggressive cardiovascular risks treatment are suggested for cs patients with higher chads2 score .
|
opioids include a broad range of natural and synthetic alkaloid derivatives that act as agonists of at least one of the three types ( mu [ ] , lambda [ ] , and kappa [ ] ) of characterized opioid receptors.1 activation of opioid receptors in both the central and the peripheral nervous system is responsible for the analgesic properties of opioids.2 currently , marketed prescription opioids include codeine , dihydrocodeine , fentanyl , hydrocodone , hydromorphone , levorphanol , meperidine , methadone , morphine , oxycodone , oxymorphone , pentazocin , propoxyphene , buprenorphine , tapentadol , and tramadol .
based on their abuse potential , opioids are classified by the u. s. drug enforcement agency as schedule ii , iii , or iv.3
prescription opioid therapy is regarded as a valuable tool in physicians ' armamentarium for control of acute pain and for chronic pain due to various conditions , including cancer and terminal diseases.4 guidelines from the american pain society and the american academy of pain medicine , however , recommend careful consideration of benefits and risks associated with chronic opioid therapy for chronic noncancer pain before initiation.5 nonetheless , chronic prescription opioid use for noncancer pain conditions has been on the rise in the united states over the last two decades . according to one estimate , the proportion of noncancer pain patients using chronic opioid therapy increased to 16% in 2005 from 9% in 2000 among arkansas medicaid enrollees.6 another study reported a doubling in the rates of chronic opioid therapy between 1997 and 2005 among enrollees of two commercial health plans in washington and california , united states.7 national estimates for the total number of opioid prescriptions dispensed also showed a 35% increase between 2000 and 2010.8 this increasing trend of prescription opioids in chronic noncancer pain is concerning because evidence for their effectiveness against chronic pain is weak9
10
11
12 and there is the potential risk of side effects ( e.g. , constipation , nausea , cardiac complications , respiratory depression , drug dependence ) with long - term use.1
two opioid agonists , methadone and buprenorphine , are indicated for the management of opioid dependence in pregnancy.13 utilization rates of medication - assisted maintenance therapy with methadone and buprenorphine have increased over the last decade.14
15 however , according to substance abuse and mental health services administration , medication - assisted maintenance therapy is still underutilized , with only 40% of the opioid - abusing or dependent americans who are 12 years or older receiving it in 2012.16
pain is a commonly reported indication in pregnancy ; for example , the prevalence of low back and pelvic pain during pregnancy ranges from 68 to 72%.17
18 additionally , other pain conditions such as myalgia , joint pain , and migraine are frequently reported.19 pharmacologic treatment is frequently used for pain management during pregnancy .
in addition to the nonsteroidal anti - inflammatory drugs , prescription opioids may provide an important option for managing acute pain during pregnancy.20 for chronic pain , however , american pain society guidelines suggest counseling women about the benefits and risks of chronic opioid therapy and recommend no use or minimal use in pregnancy , if possible.5
as with many treatments used prenatally , fetal safety of opioid exposure during pregnancy is not well understood because clinical trials typically exclude pregnant women for ethical reasons and postmarketing data generated from observational studies are limited.21
22 as a result , most prescription opioids are currently classified by the food and drug administration under category c for use in pregnancy , indicating evidence of potential harm to the fetus from animal studies and the absence of well - controlled human studies .
one exception is oxycodone , which is currently classified in category b , indicating no evidence of harm to the fetus from animal studies and the absence of well - controlled human studies.23 for drugs approved after 2001 , the newly issued food and drug administration pregnancy label rule will replace the category designation with a narrative describing the available data on a given drug 's risks and safety .
it is hoped that this information will assist providers and their patients in making informed decisions about treatment options.24
despite evidence of adverse effects on fetal development from prescription opioids,25
26
27
28
29 studies from both europe and the united states have consistently documented high rates of prescription opioid use during pregnancy , whether for medical indications or opioid dependency .
data from a population - based registry in norway showed that 6% of the pregnant women filled at least one opioid prescription between 2004 and 2006.30 results of numerous studies from the united states are more concerning .
analysis of prescription claims data for women enrolled in tennessee medicaid found that 29% of pregnant women filled a prescription for an opioid analgesic from 1995 to 2009.31 similarly , another study using data from medicaid - enrolled pregnant women from 47 states in the united states reported that 21.6% of the women filled at least one opioid prescription during their pregnancy.32 an increasing trend was also observed in this study , with the proportion of women filling prescription opioids during pregnancy increasing from 18.5% in 2000 to 22.8% in 2007 .
data from pregnant women enrolled in commercial health plans across the united states also showed high rates ( 14.4% ) of prescription opioid dispensing between 2005 and 2011.19 some of the most commonly filled opioid agents reported in these studies were codeine , hydrocodone , oxycodone , and propoxyphene.19
32
fewer studies have described rates of chronic prescription opioid use ( use 1 month ) during pregnancy . in a cohort study of all deliveries at the mayo clinic from 1998 through 2009,33 < 1% of the women were chronic opioid therapy users ( 167 of 26,314 total pregnancies ) .
the corresponding rate from the study using nationwide medicaid data was 2.5% ( 28,118 of 1,106,757 total pregnancies).32 thus , the majority of prescription opioid use during pregnancy appears to be for management of acute pain . for management of opioid dependence during pregnancy , maintenance therapy with methadone or buprenorphine
is considered the standard of care ; however , in 2012 , only 37% of pregnant women reporting any prescription opioid abuse at admission to a substance abuse treatment received medication assisted maintenance therapy.34
in summary , use of opioids is common and increasing among pregnant women .
it is imperative to understand the risks associated with both short- and long - term use of these agents during pregnancy . in this review
, we summarize the evidence available in the literature documenting potential harms associated with prescription opioid use during pregnancy .
prescription opioids encompass a variety of medications and it can not be assumed that the potential effects on the fetus are the same for all medications within a drug class.22 for this reason , we present the study results for individual opioids , when available in the original studies ; however , in many studies opioids were assessed as a group due to small numbers and concerns over loss of statistical power .
several markers for fetal growth , such as birth length and birth weight , have been identified as strong predictors of mortality and adult health outcomes.35
36
37
38
39 independent of birth weight , birth length is thought to be a unique measure of leanness and growth that is not fully captured by other measures.40 however , birth length is often not studied because the data are frequently unavailable , can be less reliable in certain situations ( e.g. , for ailing newborns ) and are prone to measurement error . a study that examined birth length in relation to opioid use in pregnancy
did not identify an association between the two.41 head circumference , another marker of fetal growth , has also not been associated with opioid use.41
42
multiple birth weight measures are often employed to assess fetal growth restriction .
low birth weight ( lbw ) , often categorized as < 2,500 g , is one such measure ; however , lbw does not incorporate gestational age and can include a mix of preterm and growth - restricted neonates .
for this reason , investigators will often choose to use small for gestational age ( sga ) instead , as gestational age is incorporated into the definition ( sga is defined as birth weights that fall into the lowest 10th percentile at each gestational age ) and can be useful at detecting exposures that restrict fetal growth on a population level.40 both lbw and sga have been explored in relation to opioid use , but study results have varied ( table 1 ) .
several studies have identified no association between lbw and oxycodone , codeine , and opioids overall.41
43
44 sga has been associated with opioid use in one study where the majority of exposed women reported acetaminophen with oxycodone , codeine , or hydrocodone ( 11.5% among opioid exposed compared with 7.8% nonexposed neonates).45 however , another study observed no increased rates of sga or birth weight , but instead identified an elevated rate of large for gestational age for mothers who used propoxyphene ( odds ratio [ or ] : 1.4 ; 95% confidence interval [ ci ] : 1.31.7 ) or codeine ( or : 1.3 ; 95% ci : 1.11.4).43
abbreviations : ci , confidence interval ; lga , large for gestational age ; na , not available ; or , odds ratio ; sga , small for gestational age .
preterm birth ( defined as delivery before 37 weeks ' gestation ) may be indicative of fetal distress or impaired fetal development that triggers early labor.40 study results have been inconsistent for opioids and preterm delivery .
compared with neonates unexposed prenatally to opioids , a study from the first nations population in northwestern ontario found that preterm birth was associated with maternal oxycodone use in pregnancy ( 8.2% among opioid exposed compared with 2.3% nonexposed neonates).41 another study from the swedish medical birth register , found a modest , but significant , association between maternal tramadol use and preterm birth ( or : 1.3 ; 95% ci : 1.041.62).43 however , the latter association was not observed for very preterm birth ( < 32 weeks ) in the same study.43 no elevated risk for preterm delivery was identified either in a study which assessed codeine use in pregnancy44 or in another study where the majority of opioid use was acetaminophen with oxycodone , codeine , or hydrocodone.45
to date , only a few large cohorts have examined the use of opioids in early pregnancy and birth defects ( table 2 ) .
one of the earliest studies was the u. s. collaborative perinatal project , a prospective study from 1959 to 1965 that included 50,282 pregnant women.46 a total of 1,564 women reported use of narcotic analgesics in lunar months 1 to 4 and no association was identified for malformations overall .
when drug - specific estimates were considered , elevated standardized relative risks ( srr ) were identified for codeine and respiratory defects ( srr : 2.6 ; 95% ci : 1.15.1 ) and genitourinary defects ( srr : 2.1 ; 95% ci : 0.84.2 ) , as well as for propoxyphene and clubfoot ( srr : 1.8 ; 95% ci : 0.73.8).46 maternal codeine use was analyzed in another study , but no association was identified with all malformations examined as a group , and the authors were unable to assess individual malformations due to small numbers ( 40 exposed cases).44
abbreviations : asd , atrial septal defect ; chd , congenital heart defects ; ci , confidence interval ; ntd , neural tube defect ; or , odds ratio ; ofc , orofacial cleft ; por , prevalence odds ratio ; srr , standard rate ratio ; vsd , ventricular septal defect .
one of the largest studies published on opioid use in pregnancy used the michigan medicaid data and included 229,101 pregnancies from 1985 to 1992 .
for exposure to hydrocodone , 332 newborns were exposed in the first trimester and only cardiovascular defects had more cases than expected ( five observed and three expected).47 using data from the swedish birth registry , investigators found an overall association of any malformation in the offspring with buprenorphine use early in pregnancy ( or : 3.0 ; 95% ci : 1.16.5 ) and specifically , an elevated or was reported for clubfoot and tramadol use in early pregnancy ( or : 3.6 ; 95% ci : 1.76.6).43
48
given the rarity of birth defects , cohort studies have limited power both for birth defects overall and more importantly , for specific birth defects . for this reason ,
control design allows for efficient accrual of a large number of cases , which in turn allows investigators to classify cases into homogeneous groups ( e.g. , individual heart defects ) based on pathogenetic and embryologic mechanisms.49 proper classification of birth defects is essential to not only understanding the underlying etiology,49 but studying birth defects as a heterogeneous group could potentially obscure any associations , as it is unlikely an exposure will be linked to all types of birth defects .
independent of study design , it is necessary to assess maternal opioid use in the etiologically relevant time period , which for most birth defects occurs in the first trimester .
several case control studies have focused on opioid use in early pregnancy and birth defects .
the largest to date is the national birth defects prevention study ( nbdps ) , a population - based multisite case
control study.25 one of the major strengths of the nbdps was the rigorous case classification conducted by clinical geneticists . of the 17,499 mothers of cases with a birth defect , 454 ( 2.6% ) reported opioid use .
for exposure to this drug class , elevated ors were identified for atrial septal defects , not otherwise specified ( or : 2.0 ; 95% ci : 1.23.6 ) , atrioventricular septal defects ( or : 2.4 ; 95% ci : 1.24.8 ) , conoventricular septal defects ( or : 2.7 ; 95% ci : 1.16.3 ) , gastroschisis ( or : 1.8 ; 95% ci : 1.12.9 ) , glaucoma / anterior chamber defects ( or : 2.6 ; 95% ci : 1.06.6 ) , hydrocephaly ( or : 2.0 ; 95% ci : 1.03.7 ) , hypoplastic left heart syndrome ( or : 2.4 ; 95% ci : 1.44.1 ) , and spina bifida ( or : 2.0 ; 95% ci : 1.33.2 ) .
associations were identified specifically for maternal codeine use in early pregnancy and atrioventricular septal defects ( or : 3.6 ; 95% ci : 1.310.2 ) , left ventricular outflow tract obstruction defects ( or : 2.0 ; 95% ci : 1.13.5 ) and hypoplastic left heart syndrome ( or : 3.1 ; 95% ci : 1.46.9 ) ; maternal hydrocodone use and spina bifida ( or : 2.5 ; 95% ci : 1.34.8 ) , atrioventricular septal defects ( or : 3.7 ; 95% ci : 1.310.4 ) , tetralogy of fallot ( or : 2.4 ; 95% ci : 1.24.8 ) , hypoplastic left heart syndrome ( or : 3.2 ; 95% ci : 1.47.1 ) , pulmonary valve stenosis ( or : 2.2 ; 95% ci : 1.2 , 4.3 ) , cleft palate ( or : 2.1 ; 95% ci : 1.1- 3.9 ) , and gastroschisis ( or : 3.3 ; 95% ci : 1.86.1 ) ; and maternal oxycodone use and pulmonary valve stenosis ( or : 2.4 ; 95% ci : 1.15.4 ) .
consistent with the findings from the nbdps , several earlier case control studies have identified positive associations between opioid use and congenital heart defects ( chds ) . as a group , chds
have been associated with codeine in three studies , with ors ranging from 2.0 to 4.1 and all lower bounds of the 95% cis excluded 1.27
28
50 however , one study was not able to replicate these findings.51 in two studies , individual heart defects were assessed and increased risks were observed for atrial septal defects , ventricular septal defects , and double - outlet right ventricle ( ors ranged from 2.5 to 5.8 and 95% cis excluded 1).26
28
associations between neural tube defects ( ntds ) and opioids have been identified in some studies,25
26
29 but not all.52 when specific ntds were examined , an elevated association was identified for spina bifida and codeine ( or : 2.5 ; 95% ci : 0.97.4 ) and noncodeine opioids ( or : 2.8 ; 95% ci : 1.36.3).29 associations have also been found with opioids , clubfoot , and orofacial clefts,26
53
54 though not consistently across studies .
thus , there is a growing evidence to suggest opioids may be associated with some birth defects , particularly chds , ntds , and clubfoot .
many of the findings come from case control studies , which are not without their challenges and limitations ( e.g. , misclassification of opioid exposure , confounding ) . the retrospective nature of case control studies and reliance on maternal recall raises concerns about possible recall bias , which is differential recall of exposure in cases and controls .
yazdy et al,29 and zierler and rothman28 used a second control group consisting of mothers of infants with malformations other than the case group and found the results did not differ substantially .
zierler and rothman28 also conducted a secondary analysis using opioid exposure based on medical records and found results were of similar magnitude or larger than when maternal reports were used for the exposure .
opioid use disorders in women in the united states can be traced to the 1870s , when morphine and heroin became available for analgesic use.55 the majority of opioid addicts during this period were women , which shifted to men with the passage of the harrison anti - narcotic act in 1914.56 in recent years the escalating use of opioids , therapeutic and illicit , in the unites states , has produced a marked increase in the prevalence of opioid dependency in women and subsequently , in pregnancy.57
58
59
60 prenatal opioid agonist therapy can prevent illicit opioid use and withdrawal in opioid dependent pregnant women .
prenatal methadone maintenance therapy ( mmt ) has been used in the united states since the late 1960s .
compared with pregnant women who use heroin alone , women treated with mmt have better prenatal care adherence , reduced fetal death rates , and higher infant birth weights ( table 3).61
62
63 yet , neonatal abstinence syndrome ( nas ) is more severe in neonates exposed to mmt than heroin.61
63 buprenorphine maintenance therapy ( bmt ) has been used to treat prenatal opioid dependency since the mid-2000s .
buprenorphine is a partial -opioid agonist that binds primarily to -opioid receptors with higher affinity but lower activity than a full agonist such as methadone or heroin.64 in the united states , bmt is prescribed for opioid dependence in an outpatient setting,65 while mmt is generally prescribed for use at an observed daily dosing clinic and as such , women must attend daily dispensing clinics.66
abbreviations : nas , neonatal abstinence syndrome ; rct , randomized control trial ; sga , small for gestational age .
bmt has been associated with lower birth weights when compared with national standards67 and more buprenorphine - exposed neonates fall below the 10th percentile for population standardized growth curves.68 mmt has also been associated with lbw , as well as with sga , reduced head circumference , and preterm delivery when compared with pregnancies where no opioids were used.69
70
71
72
73
74 when studying treatments for opioid dependency , it can be difficult to separate the social and behavioral differences ( e.g. , poor nutrition , alcohol or cigarette use , housing instability ) between women on opioid agonist therapy and women who use no opioids at all ( formally termed as confounding by indication ) . to address potential confounding , sharpe and kuschel75 explored neonatal outcomes where pregnancies using methadone for pain ( the pain group ) were compared with pregnancies using methadone for opiate dependency ( the maintenance group ) .
neonates in the pain group had significantly improved markers of fetal growth measures ( birth weight and head circumference ) than the maintenance group , suggesting that the pharmacological actions of methadone itself may not be responsible for altered fetal growth . however , higher rates of preterm delivery were observed in the pain group compared with the maintenance group . of note , in the pain group , 81% of the preterm deliveries were induced , with
pain commonly cited as the reason for induction , indicating the underlying indication for methadone may explain the higher preterm delivery rate .
nevertheless , the results of this study should be interpreted cautiously due to small numbers ( n = 43 ) and dosing differences in the two groups.75
there is accumulating data to suggest that prenatal bmt versus mmt exposure may improve neonatal outcomes .
birth weights tended to be higher for bmt compared with mmt - exposed neonates in several studies,76
77
78
79 but not all.68 neonates exposed to bmt in pregnancy had head circumferences that were larger and closer to the 50th percentile of world health organization standards71
77
78
79 and greater birth length than neonates exposed to mmt.77
78
79 rates of preterm delivery were lower among bmt - exposed infants compared with mmt76
79
80 ; in fact , it has been hypothesized that the lower rate of preterm birth associated with bmt may explain , in part , the better growth outcomes observed for bmt - exposed infants.78
physicians have long recognized the problem of neonatal opioid withdrawal from prenatal exposure to opioids.55 nas is a constellation of gastrointestinal , respiratory , autonomic and central nervous system disturbances that affect postnatal life adaptation in critical areas of sleep , feeding and autonomic function.59
81 neonates with severe nas symptoms require prolonged hospitalization and pharmacotherapy , usually with morphine , with unknown long - term effects.82 nas is not limited to infants of mothers addicted to opioids ; use of prescription opioids for long periods during pregnancy in non - addicted mothers can also produce nas . in the kellogg et al33 study of 167 women with chronic prescription opioid use in pregnancy , 5% of the newborns were noted to have symptoms of nas .
some cohort studies and randomized controlled trials have observed decreased nas severity76
79
83
84 and lower risk of nas treatment,85 in bmt relative to mmt exposed neonates .
a recent meta - analysis of the published literature , however , showed that the apparent protective effect of bmt relative to mmt on neonatal outcomes may be affected by maternal risk factors ( e.g. , maternal severity of opioid addiction ) that independently affect the type of prenatal treatment and neonatal outcomes.80 indeed , studies have shown that bmt is typically used in more stable opioid - dependent pregnant women who do not need the structure of observed daily dosing required for mmt in the united states.68
76
78
85
86 this imbalance in maternal risk factors across treatment groups can produce confounding bias ( i.e. , confounding by indication ) in studies of the comparative safety of bmt relative to mmt . in summary ,
additional studies are needed to improve our understanding of the risks associated with prenatal treatment for opioid dependency and to optimize care for opioid - dependent pregnant women and their infants .
the number of newborns with nas in the united states is approximately 14,000 annually and continues to increase.87 around 40 to 80% of exposed neonates develop nas , requiring prolonged hospitalization and pharmacotherapy with potential adverse effects .
in this review , we summarize the available literature on opioid use in pregnancy and birth outcomes .
the limited studies that have assessed head circumference and birth length , have found no association with opioid use .
these markers of fetal growth have been well studied in the context of dependency and for bmt - exposed neonates , both head circumference and birth length fall within normal ranges , further demonstrating that opioid medications may not affect fetal growth . on the other hand ,
results for birth weight and preterm birth have been inconclusive and further studies are needed to assess if opioids pose a risk for preterm birth or lbw .
there is a growing body of evidence to suggest that opioids may be associated with specific birth defects . to date
, five studies have identified an association with chds and three studies have found elevated estimates with ntds and clubfoot . codeine has been implicated in several of the studies but additional studies that consider individual opioids are needed to evaluate if the risk of some opioids may be lower than others . studying opioid use in pregnancy presents multiple methodological challenges .
studies are vulnerable to confounding by indication , as women who take opioids or who take a particular opioid versus another may be different from women who do not
. additionally , it can be difficult to differentiate whether the underlying condition for opioid use ( e.g. , migraine ) or the medication itself is responsible for any observed elevated risk .
future studies should consider the nature and severity of the underlying condition and address the potential for confounding by indication . due to small numbers ,
studies often consider opioid medications as a homogeneous group and by doing so any effect for specific medications may be missed .
as it is unlikely that all medications within the class of opioid medications have the same mechanism of action on the fetus , we recommend future studies assess individual opioid medications .
furthermore , studies should focus on precise exposure measurements , with dose and duration information and accurate outcome ascertainment .
prenatal prescription of opioids has dramatically increased in the united states and elsewhere.32
87 to prescribe safe and effective prenatal medications , health care providers must carefully consider both the medical concerns of the pregnant woman and the potential harms to the developing fetus . in situations where opioids are not necessary
, health care providers should discuss the potential risks with women and consider the possibility of alternative medications .
prenatal opioid therapy is used for a wide range of conditions that include both medical indications ( e.g. , pain , migraines ) and opioid dependency .
studies of in utero opioid exposure for these two broad categories suggest different levels of risk for the neonate . further research is needed on adverse effects on birth outcomes and longer term child development that may result from in utero exposure to opioids or the conditions for which these drugs are used .
|
prescription opioids are used prenatally for the management of pain , as well as for opiate dependency .
opioids are known to cross the placenta and despite the evidence of possible adverse effects on fetal development , studies have consistently shown prescription opioids are among the most commonly prescribed medications and the prevalence of use is increasing among pregnant women .
this article summarizes the available literature documenting potential harms associated with prescription opioid use during pregnancy , including poor fetal growth , preterm birth , birth defects , and neonatal abstinence syndrome .
|
traumatic abdominal wall hernia ( tawh ) is a rare injury . although the management can vary substantially due to differences in presentation,1 surgical repair of the hernia
has been reported to be necessary sooner or later.24 we describe a case of tawh that disappeared without the repair .
a 27-year - old japanese man at work was accidentally sandwiched between a rock and a truck .
he was admitted to our emergency department with the acute onset of peritoneal signs and shock . on examination ,
systolic blood pressure was 58 mmhg , pulse was 120 beats / min , and body temperature was 34.9 c .
there was a swelling of 10 cm in the right upper quadrant of the abdomen .
laboratory data showed leukocytosis ( white blood cell counts 26100/mm ) , anemia ( red blood cell counts 3.80 10/mm , serum hemoglobin 11.6 g / dl , hematocrit 33.8% ) and acidosis ( ph 7.338 , base excess 6.1 mmol / l ) .
following stabilization of vital signs with volume infusion , the patient underwent computed tomographic ( ct ) scan of the abdomen .
the enhanced ct scan demonstrated a large disruption of the abdominal lateral muscles ( transversus abdominis muscle , abdominal internal oblique muscle , and abdominal external oblique muscle ) , transverse colon protrusion , and the presence of subcutaneous emphysema at the site ( fig .
1a ) . based on these findings , lacerated transverse colon entrapped in tawh was diagnosed .
furthermore , ct scan showed liver injury , lacerations of the duodenum and head of the pancreas , and open book pelvic fracture associated with retroperitoneal hematoma ( fig .
emergency laparotomy was performed via a midline incision extending from the xiphoid to below the umbilicus .
a loop of transverse colon was found to have herniated in a split of peritoneum , muscle and fascia , and was lacerated .
2a , b ) . at this initial surgery , debridement and drainage were performed for tawh , because of concern about abscess formation due to gross contamination by stool . at the same time , only external fixation for pelvic fracture was performed , because there was no active bleeding in the retroperitoneal hematoma in the pelvis .
ct scan on the seventh postoperative day showed abscess formation with intramuscular spread in the abdominal wall ( fig .
the patient underwent internal fixation of the pelvic fracture on the nineteenth postoperative day and was discharged in good general condition one month later . finally repair of tawh was not performed because tawh disappeared on physical examination .
signs of the hernia were not confirmed even by the ultrasonography in the outpatient afterwards .
the essential features include protrusion of abdominal contents through disrupted abdominal wall musculature and fascia , without skin penetration and without preexisting hernia at the site , following blunt trauma.5,6 tawh is thought to be caused by shear stress associated with acute elevation of intraabdominal pressure .
the shear stress is transferred to the peritoneum , fascia and muscle fibers followed by tissue rupture.3 it was reported that these injuries were mostly located below the umbilicus due to weaker musculature since the rectus sheath is present only above the arcuate line.4 when traumatic insult to the abdominal wall is mainly due to shearing stresses or tensile forces , intraabdominal injuries are extremely uncommon.7 however , tawh is often associated with other injuries that are often critical , because it may follow various types of blunt trauma .
tawhs have been classified on the basis of the mechanism of trauma into low- and high - energy types.1 low - energy type is the result of impact on a small blunt object such as a bicycle handlebar or the blunt end of a gardening tool handle .
most of this type does not require emergency laparotomy , because it is almost focal hernia and hardly associated with intraabdominal injuries.8 on the other hand , most of high - energy type , that is the result of high force such as motor vehicle accidents or falls from height , requires emergency laparotomy .
this emergency laparotomy was usually indicated for the treatment of associated intraabdominal injuries and not the hernia itself.9 though there are a few reports about disappearance of low - energy type without the surgical repair,10,11 the repair of high - energy type has been reported to be necessary sooner or later to avoid incarceration and strangulation of the bowel.24 a reapproximation of the muscle layers has been stressed in the repair,2 while the use of prosthetic mesh was recently reported to prevent occasional recurrence.3,4 there was also a report that insertion of prosthetic mesh is not advisable due to potential contamination of the hernia.12 in our case , emergency laparotomy was performed because of not only peritonitis due to laceration of the colon in tawh but also lacerations of the duodenum and head of the pancreas and open book pelvic fracture , causing septic and hemorrhagic shock .
repair of the hernia was not performed because there was high risk of infection due to laceration of the transverse colon .
this origin is unknown but cell regeneration , fibrosis and wound healing may be a concern.13 this result suggests that it may not always be necessary to repair tawh .
especially , when peritonitis is associated , debridement and drainage must be prior to repair .
we should perform ct scan with contrast media to correctly diagnose both tawh itself and the associated injuries .
if critical injuries are associated , treatment of these injuries may be necessary prior to tawh repair .
furthermore , it may not always be necessary , or advisable , to acutely repair tawh because of the potential for contamination at the hernia site .
|
repair of traumatic abdominal wall hernia ( tawh ) has been reported to be necessary .
reported here is one case of tawh without repair .
a 27-year - old man was accidentally sandwiched between a rock and a truck and admitted to our emergency department .
there was a swelling of 10 cm in the right upper quadrant of the abdomen .
the enhanced computed tomographic scan demonstrated a large abdominal wall muscular defect , transverse colon protrusion , and the presence of subcutaneous emphysema at the site . based on these findings ,
lacerated transverse colon entrapped in tawh was diagnosed .
the patient underwent emergency laparotomy for laceration of the transverse colon , duodenum and pancreas , and open book fracture of the pelvis .
repair of the hernia was not performed because of the possibility of abscess formation by stool contamination .
however , the hernia disappeared and the patient is doing well without recurrence of hernia 16 months after injury .
|
three dimentional ( 3d ) rotational angiography was obtained in axiom artis zee ( siemens , erlangen , germany ) .
the 3d angiographic images were transferred to syngo workstation ( version vb 15d ) to generate 3d angiography from which 2nd reconstruction was performed by reducing fov and adjusting the target vessel .
the final image was transformed to stl format in 256256 pixels . because there was no direct connection between the syngo workstation and the images
12 . 01 , materialise , leuven , belgium ) in other workstation for smoothing of vessel surface and trimming of branch vessels .
and then the image tranfered to hypermesh ( altair engineering , inc . , auckland , new zealand ) to generate tetra volume mesh from triangular surface - meshed 3d angiogram .
computational analysis of blood flow in the blood vessels was performed using the commercial finite element software adina ver 8.5 ( adina r & d , inc . ,
blood flow was assumed to be laminar , viscous , newtonian , and incompressible because of its inherent flow characteristics .
no - slip boundary conditions were assumed for the flow viscosity produced between the fluid and the wall surface of the blood vessels .
simulations were performed with the following material constants : blood density , 1100 kg / m , and blood dynamic viscosity , 0.004 poiseuille . to achieve truly patient - specific modeling , the boundary conditions at the inflow boundary were based on the pulsatile periodic flow rate . maximum wall shear stress ( wss ) and
the velocity and flow rate of the internal carotid artery were obtained from gated phase contrast mr angiography in an age - matched male who did not have any intracranial vascular disease .
the average velocities in the systolic and diastolic phases were 0.45 m / s and 0.23 m / s , respectively . a 65-year - old male patient who presented with right arm weakness revealed an acute focal cortical ischemic change in the borderzone type on the diffusion - weighted image ( not shown ) .
our institutional review board approved this study , and we obtained written informed consent from the patient and the patient 's family .
three dimentional ( 3d ) rotational angiography was obtained in axiom artis zee ( siemens , erlangen , germany ) .
the 3d angiographic images were transferred to syngo workstation ( version vb 15d ) to generate 3d angiography from which 2nd reconstruction was performed by reducing fov and adjusting the target vessel .
the final image was transformed to stl format in 256256 pixels . because there was no direct connection between the syngo workstation and the images
12 . 01 , materialise , leuven , belgium ) in other workstation for smoothing of vessel surface and trimming of branch vessels .
and then the image tranfered to hypermesh ( altair engineering , inc . , auckland , new zealand ) to generate tetra volume mesh from triangular surface - meshed 3d angiogram .
computational analysis of blood flow in the blood vessels was performed using the commercial finite element software adina ver 8.5 ( adina r & d , inc . ,
blood flow was assumed to be laminar , viscous , newtonian , and incompressible because of its inherent flow characteristics .
no - slip boundary conditions were assumed for the flow viscosity produced between the fluid and the wall surface of the blood vessels .
simulations were performed with the following material constants : blood density , 1100 kg / m , and blood dynamic viscosity , 0.004 poiseuille . to achieve truly patient - specific modeling , the boundary conditions at the inflow boundary were based on the pulsatile periodic flow rate
. maximum wall shear stress ( wss ) and flow velocities before and after stenting were obtained .
the velocity and flow rate of the internal carotid artery were obtained from gated phase contrast mr angiography in an age - matched male who did not have any intracranial vascular disease .
the average velocities in the systolic and diastolic phases were 0.45 m / s and 0.23 m / s , respectively .
a 65-year - old male patient who presented with right arm weakness revealed an acute focal cortical ischemic change in the borderzone type on the diffusion - weighted image ( not shown ) .
our institutional review board approved this study , and we obtained written informed consent from the patient and the patient 's family .
cerebral angiogram after stenting showed no residual stenosis of the right m1 segment and the shift of borderzone between the anterior and the middle cerebral artery territory toward normal position ( 5 , 6 ) .
maximum wss before and after stenting were shown in figure 1c and d. maximum wsss before stenting were 18.5 pa in systole and 9.3 pa in end - diastole and those after stenting were 7.1 pa in systole and 3.6 pa .
maximum flow velocities before stenting were 135 cm / s in systole and 70 cm / s in diastole and those after stenting were 72 cm / s in systole and 38 cm / s in diastole . compared to previously reported process of cfd analysis
, we could omit the several steps reduce the time spending in data processing ( 11 , 12 ) . smoothing of vessel surface and trimming of branch vessels before cfd analysis required still considerable time to generate tetra volume mesh .
since we demonstrated that cfd analysis of the small - caliber intracranial artery was feasible and could be correlated with the atherosclerotic plaque in the stenotic segment , we obtained cfd before and after intracranial stenting and further simplified the process which could reduce analysis time ( 11 , 12 ) .
disappearance of wss after stenting can be used as a beneficial landmark in assessing appropriate final luminal diameter preventing further angioplasty and even may predict minimal chance of restenosis at the hemodynamical point of view although follow - up study is mandatory to reach such a conclusion ( 12 - 14 ) .
we found that the smoothing and trimming of branch vessels of the model vessel in magic rp required a compromise .
if we get high resolution image , it will takes time to generate too much tetra volume mesh .
if we get low resolution image , processing time will be reduced but identification or differentiation of parent or branch vessels will be difficult ( 11 ) .
firstly , image transfer from 3d angiogram to adina software was not yet possible and thus required a time - consuming tetra volume mesh generation even though we could reduce processing time since we used adina .
if 3d angiogram is directly transferred to cfd analysis software such as adina , cfd analysis will be more readily applicable . secondly , flow data in each patient was not readily provided for boundary condition in inflow as well as outflow zones of the model vessel ( 11 , 15 ) .
normal standard value of flow velocity according to age and gender groups might be helpful for the general usage .
in addition , flow data from transcranial doppler or mr phase study can be measured and used in each patient ( 10 , 11 ) . in conclusions , we could reduce cfd processing time compared to previous report
. we also demonstrated change of wss , flow velocity and wall pressure in the severe stenotic intracranial artery , that is , m1 before and after stenting .
this observation can provide a predictable risk factors affecting patient 's outcome if the study can match to the long term follow - up data .
|
purposecomputational flow dynamic ( cfd ) study has not been widely applied in intracranial artery stenosis due to requirement of high resolution in identifying the small intracranial artery .
we described a process in cfd study applied to symptomatic severe intracranial ( m1 ) stenosis before and after stenting.materials and methodsreconstructed 3d angiography in stl format was transferred to magics ( materialise nv , leuven , belgium ) for smoothing of vessel surface and trimming of branch vessels and to hypermesh ( altair engineering inc . ,
auckland , new zealand ) for generating tetra volume mesh from triangular surface - meshed 3d angiogram .
computational analysis of blood flow in the blood vessels was performed using the commercial finite element software adina ver 8.5 ( adina r & d , inc . ,
lebanon , ma ) .
the distribution of wall shear stress ( wss ) , peak velocity and pressure in a patient was analyzed before and after intracranial stenting.resultscomputer simulation of wall shear stress , flow velocity and wall pressure before and after stenting could be demonstrated three dimensionally by video mode according to flow vs. time dimension .
such flow model was well correlated with angiographic finding related to maximum degree of stenosis .
change of wss , peak velocity and pressure at the severe stenosis was demonstrated before and after stenting .
there was no wss after stenting in case without residual stenosis.conclusionour study revealed that cfd analysis before and after intracranial stenting was feasible despite of limited vessel wall dimension and could reveal change of wss as well as flow velocity and wall pressure .
|
orthokeratinized odontogenic cyst ( ooc ) is a relatively uncommon developmental cyst comprising about 10% of cases that had been previously designated as odontogenic keratocysts ( okcs ) .
schultz in 1927 was the first to describe it as an orthokeratinized variant of okc and further wright in 1981 termed it as orthokeratinized variant of okc , and defines it as an independent clinical entity .
is in 1998 only when he suggested the term ooc , which is now the most accepted terminology .
histogenesis may be from the remains of the dental lamina or from the basal cell layer of the oral mucosal epithelium .
these cyst can grow large in size causing cortical expansion and presents as a swelling , along with pain , although in most cases , it can be detected incidentally during a radiographic examination .
radiographically , ooc is seen as a well - circumscribed , unilocular , or multilocular radiolucency and rarely associated with an unerupted tooth .
ooc surrounds the crown of an unerupted tooth may be defined as a cyst with typical histology of an okc .
an impacted tooth and its dental follicle may affect the occurrence and proliferation of an adjacent keratinizing cyst . here , we report a case of orthokeratinized okc , which showed the features of keratinizing dentigerous cyst in the incisional biopsy .
a 50-year - old male reported with a complaint of swelling in the right maxillary anterior region extending from 11 to 15 from last 6 months .
on intraoral examination , the swelling was oval shaped with smooth margins , soft in consistency , nonindurated , and nontender .
radiographically , radiolucency was seen in relation to an impacted 13 and a supernumerary tooth adjacent to this radiolucent area [ figure 1 ] .
orthopantomogram showing radiolucency in relation to an impacted 13 and a supernumerary tooth adjacent to this radiolucent area was seen fine - needle aspiration cytology showed keratin - like material mixed with numerous inflammatory cells mainly polymorphonuclear leukocytes .
the incisional biopsy was performed , and histopathological diagnosis was suggestive of keratinizing dentigerous cyst . surgical excision of the lesion was done followed by curettage .
a tissue specimen measuring 33 mm 22 mm 20 mm in size with multiple small bits of tissue was evaluated for histopathological examination [ figure 2 ] .
( a ) gross specimen measuring 33 mm 22 mm 20 mm in size ; ( b ) the cyst lining enveloping the crown of the tooth at the cement - enamel junction on microscopic examination , an orthokeratinized epithelial lining of 26 cell layers thickness with surface corrugations , was seen along with prominent stratum granulosum and low cuboidal to flattened basal cells .
the underlying fibrocellular connective tissue showed the thick bundles of collagen fibers with fibroblasts and few chronic inflammatory cells mainly lymphocytes .
orthokeratinized odontogenic cyst lining : ( a ) h and e ; ( b ) ki-67 expression in the basal layer a diagnosis of orthokeratinized okc was made .
immunohistochemical analysis was done using ki-67 which showed expression in basal region and focal areas in suprabasal regions as seen commonly in cases of orthokeratinized okc [ figure 3b ] .
incidence of ooc varies ranging from 5.2% to 16.8% few of which were previously coded as okc .
pindborg and hansen ( 1963 ) , describe keratocyst as any jaw cyst in which keratin was formed to a large extent lead to cases of dentigerous , radicular , and residual cyst which were included in the category of okc .
incisional biopsy diagnosis of present case of keratinizing dentigerous cyst was similar to the study of vuhahula et al . who suggested that reduced enamel epithelium can cause keratinization under opposite stimuli thus forming a true dentigerous cyst with keratinization
however , other studies by gillette and weinmann ( 1958 ) describe these lesions are frequently misdiagnosed as dentigerous cysts with keratinized epithelial linings similar to those found in okcs .
it was suggested by browne ( 1969 ) that this occurred when an enlarging okc involved the follicle of an unerupted tooth and fused with the reduced enamel epithelium .
the world health organization has designated ooc as a distinct clinicopathologic entity as it has peculiar clinicoradiological and pathologic aspects when compared to other developmental odontogenic cysts , especially okcs .
eighty - seven percent of ooc radiographically are present as unilocular radiolucencies with 60.8% of cases are associated with impacted tooth as seen in our case .
histopathologically , ooc is characterized by a 48-cell layer thick orthokeratinized epithelial lining , with prominent granular layer and low cuboidal basal cells as seen in excisional biopsy . according to wright ( 1981 ) ,
ooc has uniformly thin epithelial lining with a luminal surface of orthokeratin and a well - developed granular layer .
they tend to be cuboidal or squamous and show little tendency to polarize or palisade .
it was recommended that care must be taken to distinguish between keratin metaplasia in otherwise nonkeratinized odontogenic cysts and the ooc .
cell proliferation molecules and related factors including ki67 , proliferating cell nuclear antigen , p53 , and argyrophilic nucleolar organizer regions have previously been used to indicate biological behavior of odontogenic cysts and tumors .
baghaei et al . in 2004 in their study showed that the mean positively stained cells / mm bm for ki-67 antigen is more in parakeratotic okc than that of orthokeratotic type
. findings of our case showed the positive staining for ki-67 in the basal layer and also in suprabasal layer in focal area .
as the clinicoradiographic diagnosis of any circumscribed radiolucency around the crown of an impacted tooth is usually a dentigerous cyst , it was not unusual in the present case as well .
the attachment of the cystic lining to the neck of the tooth also prompted to contemplate the origin in reduced enamel epithelium .
the microscopic examination of the cyst fitted well in favor of ooc , thus , the possibility of considering this as a dc with a keratinized lining epithelium was ruled out and moreover , the mystery with regard of origin and nature of ooc was untangled .
therefore , it was concluded that diagnosing keratinized odontogenic cyst are challenging as these cysts give an erroneous radiographic appearance of other nonkeratinizing odontogenic cyst due to its distinct location around the crown of unerupted tooth . a thorough histopathological and radiographical correlation is required along with advanced molecular analysis to reach up to the final diagnosis of keratinized okc which can help in understanding the pathogenesis of ooc and can help in accurate treatment planning .
|
the orthokeratinized odontogenic cyst ( ooc ) is a rare developmental odontogenic cyst that has been considered as a variant of the keratocystic odontogenic tumor until wright ( 1981 ) defined it as a different entity .
recognition of ooc as a unique entity has long been due , yet its inexplicable clinical , radiographic presentation resembling dentigerous cyst due to its association to an impacted tooth , and its histological features makes it rather perplexing .
this is the report of a case of ooc in relation to an impacted maxillary canine and its immunohistochemical analysis with ki-67 .
|
unstable intertrochanteric femoral fractures are common in the elderly , and the incidence of these fractures is continuously increasing worldwide.1 biomechanically , intramedullary devices are superior to traditional extramedullary devices for these fractures . among the intramedullary devices , proximal femur nailing antirotation ( pfna ) ( synthes inc . , bettlach , switzerland ) is one of the devices in the treatment of unstable intertrochanteric femoral fractures.2 this device combines the biomechanically favorable characteristics of an intramedullary nail with a minimally invasive surgical technique.3 this device has helical - shaped blade which have been biomechanically proven to have significantly higher cutout resistance in these fractures.4 despite new developments in the management of age - related osteoporotic fractures , serious clinical complications such as screw cut out are still found in the fixation of proximal femur fractures
. cutout rate of the pfna of up to 3.6% is documented in the literature.5 apart from patient - dependent factors like osteoporosis , surgeon dependent factors like suboptimal positioning of the device plays a major role in the failure of fixation.168 the cutout of the lag screw is related to various factors ; however , there is general agreement that cutout failure is mainly due to malpositioning of the lag screw in the femoral head.810 there is no single opinion regarding optimal position of the lag screw in the femoral head .
center - center,1113 posterior - inferior,1415 or inferior - center1618 placement of the lag screw was recommended by different studies .
moreover , there are no studies so far which evaluated the performance of the newer device pfna in relation to different positions of the helical blade in the femoral head .
the aim of our study was to investigate the biomechanical stability of this device in relation to center - center versus the inferior - center position of the helical blade in the cadaveric femoral head in unstable trochanteric femoral fractures .
we hypothesized there is no significant difference between the two blade positions with respect to angular ( varus ) and rotational displacement after cyclic loading and ultimate load to failure .
eight paired ( n = 16 femurs ) fresh frozen human cadaver femora were harvested after obtaining consent from the local ethics committee . the mean age , weight , and height were 74 4.8 years ( 6887 years ) , 61.3 10.4 kg ( 4578 kg ) , and 169.9 8.15 cm ( 155180 cm ) , respectively . for each specimen ,
radiographs of each bone were taken to ensure the absence of deformity , prior fracture , and any pathological condition using high - resolution x - ray with 45 kv and an exposure time of 5 minutes . in vivo conditions
the femur was submerged in this container and fixed at about 15 of internal rotation and the container was filled with water to a height and width of 15 cm so as to simulate soft tissues on radiography .
bone mineral density was measured using dual energy x - ray absorptiometry ( dexa ) method with the lunar prodigy scanner ( ge medical system , milwaukee , wi , usa).though the bone mineral density does not reflect the pattern of architecture of the bone , it is an independent reliable predictor of the average construct failure and provides reproducible , comparable results .
all soft tissues were stripped off the bones . to ensure proper fixation and initial orientation of the fracture fragments
after removal of the devices , the bones were clamped in a cutting template and the osteotomy was created using a hand saw .
the first cut was an oblique one at an angle of 40 to the femoral shaft .
the second cut was then performed to simulate posteromedial comminution by removing the lesser trochanter with a 40 wedge .
the lateral wedge was then cut perpendicular from the tip of the greater trochanter to a length of 20 mm until reaching the osteotomy [ figure 1].19 osteotomy of cadaveric proximal femur as proposed by krischak et al .
showing an unstable trochanteric fracture in ( a ) anterior view and ( b ) posterior view one specimen from each matched pair was randomly selected for instrumentation .
the pfna ii ( pfna ii , asian version , synthes , usa ) had the helical blade fixed in central position both in anteroposterior and lateral view in one group ( c - c group ) , whereas the other group was fixed with the helical blade in inferior one - third position in anteroposterior and in central position in lateral view ( i - c group ) under fluoroscopic guidance .
the radiographs were taken to ensure the correct placement of the tip of the helical blade at subchondral area and the measurement of the tip apex distances ( tad ) was recorded [ figures 2a d ] .
specimens were shortened at the shaft to a total length of 19 cm , plotted in a specially designed frame at 25 adduction in the coronal plane and neutral in the sagittal plane to simulate one - legged stance.20 then the specimens were stored at 20c until mechanical testing was performed .
anteroposterior and lateral radiograph of pfna fixation in i - c group ( a and b ) and c - c group ( c and d ) , respectively specimens were again stored at 4c overnight and then at room temperature for at least three hours before testing .
the uniaxial bionix 858 material testing system ( mts , minneapolis , minn . ) machine was used for the mechanical testing .
the three metal markers which were not located collinearly , were attached closely to the blade tip inserted in the femoral head [ figure 3a ] .
the prepared experimental model was positioned so that it could move within the three - dimensional ( 3-d ) space defined by the calibration frame [ figure 3b ] .
the motion of the femoral head in terms of angular displacement in varus direction and rotational displacement was evaluated by the optical 3-d motion tracking system ( stereophotogrammetry).21 the calibration was performed to establish the laboratory co - ordinate system and to set up the calibration volume .
two image co - ordinates ( x , y ) , which were photographed for the control point of the calibration frame , were calculated by direct linear transformation ( dlt ) algorithm [ figure 4].22 each specimen was initially loaded with 750 n and allowed to come to equilibrium ( 120 s ) before displacement measurements .
the specimen was then unloaded and allowed to reach equilibrium before the measurements were repeated to determine if permanent displacement of the fracture fragments had occurred .
next , each specimen was cyclically loaded , with 750 n vertical loads applied at a rate of 3 hz for 10 , 100 , 1000 , and 10,000 cycles .
each specimen was allowed to reach equilibrium ( 120 s ) after each cyclic interval , and displacement measurements both loaded and unloaded were taken.23 finally , each specimen was axially loaded to failure recorded in load displacement curve .
failure was defined as an acute 10% or more reduction in the amount of load borne by the bone / implant construct or as a visible collapse of the device that was always evident as the first and irreversible negative slope of the load displacement curve .
the cycles of loading that included implant failure were not used for the analysis of angular displacement , but only for recording load to failure.2425 biomechanical experimental model for three - dimensional motion analysis of the femoral head : ( a ) attachment of metal markers and fixation of jig for the experimental model and ( b ) establishment of experimental environment for stereophotogrammetry flow diagram for the assessment of three - dimensional motion of the femoral head using stereophotogrammetry descriptive analysis was performed using the spss , version 13.0 ( spss inc . , chicago , il , usa ) for windows by calculating the mean and standard deviation for the specimens of both groups of implant .
data analysis between the groups was done using analysis of variance ( anova ) to evaluate the relationship between fragment displacement and load - to - failure data for the two treatment groups , and fragment displacement and the number of loading cycles .
pearson correlations were performed between bone mineral density , tad , and load to failure . a p value of < 0.05 was considered to be statistically significant for all analyses.23
eight paired ( n = 16 femurs ) fresh frozen human cadaver femora were harvested after obtaining consent from the local ethics committee . the mean age , weight , and height were 74 4.8 years ( 6887 years ) , 61.3 10.4 kg ( 4578 kg ) , and 169.9 8.15 cm ( 155180 cm ) , respectively . for each specimen ,
radiographs of each bone were taken to ensure the absence of deformity , prior fracture , and any pathological condition using high - resolution x - ray with 45 kv and an exposure time of 5 minutes .
the femur was submerged in this container and fixed at about 15 of internal rotation and the container was filled with water to a height and width of 15 cm so as to simulate soft tissues on radiography .
bone mineral density was measured using dual energy x - ray absorptiometry ( dexa ) method with the lunar prodigy scanner ( ge medical system , milwaukee , wi , usa).though the bone mineral density does not reflect the pattern of architecture of the bone , it is an independent reliable predictor of the average construct failure and provides reproducible , comparable results .
all soft tissues were stripped off the bones . to ensure proper fixation and initial orientation of the fracture fragments
after removal of the devices , the bones were clamped in a cutting template and the osteotomy was created using a hand saw .
the first cut was an oblique one at an angle of 40 to the femoral shaft .
the second cut was then performed to simulate posteromedial comminution by removing the lesser trochanter with a 40 wedge .
the lateral wedge was then cut perpendicular from the tip of the greater trochanter to a length of 20 mm until reaching the osteotomy [ figure 1].19 osteotomy of cadaveric proximal femur as proposed by krischak et al .
showing an unstable trochanteric fracture in ( a ) anterior view and ( b ) posterior view
the pfna ii ( pfna ii , asian version , synthes , usa ) had the helical blade fixed in central position both in anteroposterior and lateral view in one group ( c - c group ) , whereas the other group was fixed with the helical blade in inferior one - third position in anteroposterior and in central position in lateral view ( i - c group ) under fluoroscopic guidance .
the radiographs were taken to ensure the correct placement of the tip of the helical blade at subchondral area and the measurement of the tip apex distances ( tad ) was recorded [ figures 2a d ] .
specimens were shortened at the shaft to a total length of 19 cm , plotted in a specially designed frame at 25 adduction in the coronal plane and neutral in the sagittal plane to simulate one - legged stance.20 then the specimens were stored at 20c until mechanical testing was performed .
anteroposterior and lateral radiograph of pfna fixation in i - c group ( a and b ) and c - c group ( c and d ) , respectively
specimens were again stored at 4c overnight and then at room temperature for at least three hours before testing . the uniaxial bionix 858 material testing system ( mts , minneapolis , minn . )
the three metal markers which were not located collinearly , were attached closely to the blade tip inserted in the femoral head [ figure 3a ] .
the prepared experimental model was positioned so that it could move within the three - dimensional ( 3-d ) space defined by the calibration frame [ figure 3b ] .
the motion of the femoral head in terms of angular displacement in varus direction and rotational displacement was evaluated by the optical 3-d motion tracking system ( stereophotogrammetry).21 the calibration was performed to establish the laboratory co - ordinate system and to set up the calibration volume .
two image co - ordinates ( x , y ) , which were photographed for the control point of the calibration frame , were calculated by direct linear transformation ( dlt ) algorithm [ figure 4].22 each specimen was initially loaded with 750 n and allowed to come to equilibrium ( 120 s ) before displacement measurements .
the specimen was then unloaded and allowed to reach equilibrium before the measurements were repeated to determine if permanent displacement of the fracture fragments had occurred .
next , each specimen was cyclically loaded , with 750 n vertical loads applied at a rate of 3 hz for 10 , 100 , 1000 , and 10,000 cycles .
each specimen was allowed to reach equilibrium ( 120 s ) after each cyclic interval , and displacement measurements both loaded and unloaded were taken.23 finally , each specimen was axially loaded to failure recorded in load displacement curve .
failure was defined as an acute 10% or more reduction in the amount of load borne by the bone / implant construct or as a visible collapse of the device that was always evident as the first and irreversible negative slope of the load displacement curve .
the cycles of loading that included implant failure were not used for the analysis of angular displacement , but only for recording load to failure.2425 biomechanical experimental model for three - dimensional motion analysis of the femoral head : ( a ) attachment of metal markers and fixation of jig for the experimental model and ( b ) establishment of experimental environment for stereophotogrammetry flow diagram for the assessment of three - dimensional motion of the femoral head using stereophotogrammetry
descriptive analysis was performed using the spss , version 13.0 ( spss inc . , chicago , il , usa ) for windows by calculating the mean and standard deviation for the specimens of both groups of implant .
data analysis between the groups was done using analysis of variance ( anova ) to evaluate the relationship between fragment displacement and load - to - failure data for the two treatment groups , and fragment displacement and the number of loading cycles .
pearson correlations were performed between bone mineral density , tad , and load to failure .
there were no statistically significant differences between the two groups for the total length of the femoral neck , diameters of the femoral neck and head , and the neck angle to the shaft [ table 1 ] .
anatomical , radiological data of specimens of i - c ( inferior - central ) and c - c ( central - central ) group no statistically significant differences were found between the two groups . the mean value of bone mineral density of the whole proximal femur was 1.39 1.57 mg / cm ( range : 0.5871.403 mg / cm ) in the c - c group and 1.44 0.25mg / cm ( range : 0.461.3 mg / cm ) in the i - c group [ table 1 ] .
the femoral head fragment got displaced in all specimens in the same direction ( varus and external rotation ) .
the mean tad was 22.56 mm ( range : 14.84 to 30.28 mm ) in the i - c group and 18.14 mm ( range : 12.37 to 24.17 mm ) in the c - c group .
angular displacements in the varus direction were significantly higher within the c - c group compared to the i - c group after initial loading with 750 n ( p < 0.026 ) and after each cyclic loading ( p < 0.016 , p < 0.04 , p < 0.038 , and p < 0.039 , respectively ) [ table 2 ] .
there were significantly more permanent angular displacements in the varus direction in the c - c group compared with the i - c group implant after each cyclic loading ( p < 0.046 , p < 0.024 , p < 0.036 , and p < 0.034 , respectively ) .
rotational displacements ( external rotation ) were slightly higher in the c - c group compared to the i - c group in both unloaded and loaded condition after 1,000 and 10,000 cycles.(p < 0.020 , p < 0.04 for unloaded and p < 0.042 and p < 0.048 for loaded states , respectively ) [ table 2 ] .
there were significantly more permanent rotational displacements ( external rotation ) in the c - c group compared with the i - c group after 1,000 and 10,000 cycles .
( p < 0.016 , p < 0.03 for unloaded and p < 0.035 and p < 0.049 for loaded states , respectively ) .
loading to failure was higher in the i - c group ( 4462.5 1750.3 n ) compared to the c - c group ( 4175.9 1652.2 n ) .
regression analysis of data showed a nonlinear relationship between femoral head displacement and the number of axial loading cycles .
the majority of the fracture fragment displacements occurred after the initial load , with continuation of displacements as the number of loading cycles increased , but at a decreasing rate of displacement .
correlations between bone mineral density and femoral head displacement showed a significant inverse relationship ( correlation coefficient : - 0.32 ) with the most osteopenic specimens having the maximum displacements and the lowest loads to failure .
correlations between tad , cyclic loading which leads to femoral head displacement , and ultimate load to failure showed a significant positive relationship [ table 3 ] .
mean fracture fragment displacement for loaded and unloaded states statiscal data ( mean standard deviation degree ) and their correlation
there were no statistically significant differences between the two groups for the total length of the femoral neck , diameters of the femoral neck and head , and the neck angle to the shaft [ table 1 ] .
anatomical , radiological data of specimens of i - c ( inferior - central ) and c - c ( central - central ) group
the mean value of bone mineral density of the whole proximal femur was 1.39 1.57 mg / cm ( range : 0.5871.403 mg / cm ) in the c - c group and 1.44 0.25mg / cm ( range : 0.461.3 mg / cm ) in the i - c group [ table 1 ] .
the femoral head fragment got displaced in all specimens in the same direction ( varus and external rotation ) .
the mean tad was 22.56 mm ( range : 14.84 to 30.28 mm ) in the i - c group and 18.14 mm ( range : 12.37 to 24.17 mm ) in the c - c group .
angular displacements in the varus direction were significantly higher within the c - c group compared to the i - c group after initial loading with 750 n ( p < 0.026 ) and after each cyclic loading ( p < 0.016 , p < 0.04 , p < 0.038 , and p < 0.039 , respectively ) [ table 2 ] .
there were significantly more permanent angular displacements in the varus direction in the c - c group compared with the i - c group implant after each cyclic loading ( p < 0.046 , p < 0.024 , p < 0.036 , and p < 0.034 , respectively ) .
rotational displacements ( external rotation ) were slightly higher in the c - c group compared to the i - c group in both unloaded and loaded condition after 1,000 and 10,000 cycles.(p < 0.020 , p < 0.04 for unloaded and p < 0.042 and p < 0.048 for loaded states , respectively ) [ table 2 ] .
there were significantly more permanent rotational displacements ( external rotation ) in the c - c group compared with the i - c group after 1,000 and 10,000 cycles .
( p < 0.016 , p < 0.03 for unloaded and p < 0.035 and p < 0.049 for loaded states , respectively ) .
loading to failure was higher in the i - c group ( 4462.5 1750.3 n ) compared to the c - c group ( 4175.9 1652.2 n ) .
regression analysis of data showed a nonlinear relationship between femoral head displacement and the number of axial loading cycles .
the majority of the fracture fragment displacements occurred after the initial load , with continuation of displacements as the number of loading cycles increased , but at a decreasing rate of displacement .
correlations between bone mineral density and femoral head displacement showed a significant inverse relationship ( correlation coefficient : - 0.32 ) with the most osteopenic specimens having the maximum displacements and the lowest loads to failure .
correlations between tad , cyclic loading which leads to femoral head displacement , and ultimate load to failure showed a significant positive relationship [ table 3 ] .
mean fracture fragment displacement for loaded and unloaded states statiscal data ( mean standard deviation degree ) and their correlation
the cause of fixation of failure of intramedullary devices in unstable intertrochanteric fractures is divided into two major groups.2628 first , patient - related factors like osteoporotic bone is one of the main reasons for failure of fixation in the aging population.29 second , the most important preventable factors are surgical techniques like suboptimal positioning of the implant . on reviewing the literature
, we found that various studies were done for deciding the correct position of the dynamic hip screw in the femoral head .
however , till today , there is no clear consensus about that . to the best of our knowledge ,
so far , no study has been performed about the pfna device in terms of optimal position of the helical blade in the femoral head . in the present study , the biomechanical comparison of the stability of a pfna device in terms of two positions of the helical blade in the femoral head revealed significantly more stability in the i - c group than the c - c group .
load to failure was higher in the i - c group compared to the c - c group , but a statistically significant difference was not found . in unstable fractures , the lesser trochanter and part of calcar femorale are missing from the mechanical load transmission system and because of the lack of bony support over the medial aspect of femur , the proximal fragment easily collapses ( varus ) and internally rotates under the physiologic loads.30 the inferior placements of helical blades in the frontal plane and centrally in the sagittal plane inherently support the comminuted posteromedial cortex and allow compaction of fracture suface , shortening the lever arm , decreasing the bending moment , thus avoiding cutout of screw from the femoral head .
the inferior placements of the helical blade achieve the medial - most position in the subchondral area , and thus , the stress - bearing surface area of the helical blade increases . in this way
, the inferiorly placed helical blade withstands more force than the centrally placed helical blade for angular displacement in varus position and load to failure.31 the central location of a helical blade on the anteroposterior view has no resultant force to affect the femoral head for internal or external rotation . however , inferior location of a helical blade has the ability to rotate the femoral head externally .
consequently , the inferior insertion of a helical blade can withstand the deforming force which is responsible for rotational displacement and achieves a better result.1631 the inferior central placements of the screw helps in better control of the proximal fragment because the pattern of bone architecture which is formed by the decussation of compression and tensile trabeculae provide strong anchorage.14 although this peripheral placement of the helical blade increases the tad , the tad is not related with cutout failure.32 in our study , the mean tad in the i - c group was more than the c - c group and tad had a positive linear correlation with cyclic loading which leads to fracture displacement and ultimate load to failure.163133 this study has several limitations . in general , like other cadaveric studies , results should not be applied to complex in vivo loading situations without consideration .
first , the osteotomy was performed using a hand saw producing flat bony interfaces , whereas fractures in patients usually have irregular surfaces .
however , the flat surfaces of the fracture fragments at the osteotomy site did allow us to assess the true fixation stability by the implant alone rather than the stability contributed by the interdigitating well reduced fracture fragments .
moreover , all the soft tissue was removed from bone for standardization which is not the case in real patients .
hence , the significant morphological changes resulting from fracture healing like bone callus formation , remodeling , subtle malreduction , and femoral neck shortening could not be studied .
this study requires large number of specimens for better relevant evaluation of statistical data . in this study , we chose a relatively simple reproducible loading protocol , though we acknowledge that physiologic loading during activity is more complex because of various forces acting on the proximal femur . in conclusion
, this is the first biomechanical study of a pfna device in terms of two common positions of a helical blade in the femoral head .
our in vitro study result suggests that the inferior position of the helical blade in the frontal plane and central position in the sagittal plane is superior to the c - c position and provides better biomechanical stability for angular and rotational displacement in unstable intertrochanteric fractures .
we see this study as a stimulus for further experimental studies with larger specimens and complex loading protocols .
|
objective : despite new developments in the management of osteoporotic fractures , complications like screw cutout are still found in the fixation of proximal femur fractures even with biomechanically proven better implants like proximal femoral nail antirotation ( pfna ) .
the purpose of this cadaveric study was to investigate the biomechanical stability of this device in relation to two common positions ( center - center and inferior - center ) of the helical blade in the femoral head in unstable trochanteric fractures.materials and methods : eight pairs of human cadaveric femurs were used ; in one group [ center - center ( c - c ) group ] , the helical blade of pfna was fixed randomly in central position both in anteroposterior and lateral view , whereas in the other group it was fixed in inferior one - third position in anteroposterior and in central position in lateral view [ inferior - center ( i - c ) group ] .
unstable intertrochanteric fracture was created and each specimen was loaded cyclically till load to failureresults : angular and rotational displacements were significantly higher within the c - c group compared to the i - c group in both unloaded and loaded condition .
loading to failure was higher in the i - c group compared to the c - c group .
no statistical significance was found for this parameter .
correlations between tip apex distance , cyclic loading which lead to femoral head displacement , and ultimate load to failure showed a significant positive relationship.conclusion:the i - c group was superior to the c - c group and provided better biomechanical stability for angular and rotational displacement .
this study would be a stimulus for further experimental studies with larger number specimens and complex loading protocols at multicentres .
|
they consist of foregut duplication cysts , small bowel duplication cysts , and large bowel duplication cysts .
foregut duplication cysts are categorized on the basis of their embryonic origin into esophageal , bronchogenic , and neuroenteric cysts .
bronchogenic and esophageal duplication cysts are thought to arise from abnormal budding of the embryonic foregut at 5 - 8 weeks gestation , although the exact embryonic origin of different types of duplication cysts remains a mystery . of note ,
50 - 70% of foregut duplication cysts are enterogenous while 7 - 15% of them are bronchogenic .
gastrointestinal tract duplication cysts most commonly occur in the ileum , esophagus , and colon .
endoscopic ultrasound ( eus ) has been widely used as a modality for the evaluation and diagnosis of duplication cysts .
eus is the diagnostic tool of choice to investigate duplication cysts since it can distinguish between solid and cystic lesions .
eus shows duplication cysts as anechoic , homogenous lesions with regular margins arising from the submucosal layer or extrinsic to the gut wall , although a hypoechoic echo pattern can also be seen with a duplication cyst .
on eus , duplication cyst walls usually consists of 3 - 5 layers and the internal contents may be anechoic or hypoechoic .
duplication cysts may contain thick mucinous material , septations , fluid levels , debris and they may also contain detached ciliary tufts which could be diagnostic .
in addition , duplication cysts can have peristalsis that appears as ring contractions with a concentric contraction of the cystic wall .
peristalsis in a juxta - enteric cyst is specific for a duplication cyst and can be a diagnostic feature .
esophageal duplication cysts are the second most common duplication cysts following small bowel duplications cysts , accounting for approximately 10 - 15% of gastrointestinal duplication cysts .
as many as 80% of these lesions are diagnosed in childhood with the majority being symptomatic .
two - thirds of these lesions are found in the lower third of esophagus and 1/3 in the upper / middle third of esophagus .
esophageal duplication cysts have a double layer of surrounding smooth muscle , are lined by alimentary ( squamous or enteric ) epithelium , and are either attached to esophagus in a paraesophageal or intramural fasion .
patients with esophageal duplication cysts are usually asymptomatic but can develop symptoms ( such as dysphagia or chest pain ) due to compression of surrounding structures .
one study showed that seven percent of esophageal duplication cysts can cause symptoms in adulthood , with 60% of these cysts located in the lower esophagus with no communication with esophageal lumen .
upper esophageal duplication cysts can cause stridor and/or a nonproductive cough , while cysts in the middle and lower esophagus can cause dysphagia , epigastric discomfort , chest pain , and/or vomiting .
rare symptoms such as cardiac arrhythmia , retrosternal and thoracic back pain , cyst ulceration and bleeding , or cyst rupture with secondary mediastinitis have also been reported .
on routine endoscopy , esophageal duplication cysts can be identified via extrinsic compression of the lumen with normal appearing overlying esophageal mucosa .
endoscopically , these lesions may be indistinguishable from a lipoma , leiomyoma , a gastrointestinal stromal tumor ( gist ) , or other submucosal lesions . on eus
, esophageal duplication cysts will often appear as a periesophageal homogenous hypoechoic mass with multi - layered wall and well - defined margins , although sometimes the lesion can manifest as an anechoic cyst if considerable central fluid is present [ figure 1 ] .
endoscopic view of an esophageal duplication cyst in a 9-year - old male with dysphagia .
note the normal overlying mucosa and the narrowing of the esophageal lumen 7.5 mhz radial endoscopic ultrasound ( eus ) image of the cyst seen in figure 1a .
the lesion has a multi - layered wall structure and areas of anechoic fluid as well as some echogenic material ( seen on the left side of the lesion ) .
the lesion was surgically resected the role of eus - guided fine needle aspiration ( fna ) in the diagnosis of esophageal duplication cysts , and duplication cysts in general , has been controversial .
while fna can show squamous cells or other cyst contents consistent with a duplication cyst that can aid in the diagnosis , the risk of infecting the cyst is a significant concern , with some studies showing an infection rate as high as 14% .
eus - fna should be performed if there is a concern about more serious lesion or if the nature of the lesion is in doubt .
endoscopic ultrasound - guided fna is usually reserved for lesions of indeterminate appearance , lesions that are concerning for malignancy , and lesions that are atypical in appearance for duplication cysts .
it should be noted that many duplication cysts can have an unusual appearance and can mimic other pathologic entities , including the malignant adenopathy .
eus - guided fna may reveal a lesion felt to be a node to be , in fact , a duplication cyst .
even expert endosonographers can mistake a duplication cyst for a more ominous lesion , and aspirating a lesion of concern should not be considered a breach of the standard of care .
concerns regarding causing an adverse event following eus - guided fna of esophageal duplication cysts are well founded .
cevasco et al . reported a case in which a patient underwent eus - fna of an esophageal hyperechoic duplication cyst that subsequently got infected .
the infected esophageal duplication cyst led to acute development and infection of a thoracic aorta pseudoaneurysm .
similarly , trojan et al . reported a case of an infected hypoechoic esophageal duplication cyst after performing eus - fna on a paraesophageal mass concerning for persistent nonhodgkin 's lymphoma ( again showing how esophageal duplication cysts can mimic ominous lesions such as a malignant adenopathy ) .
although some authors advocate the use of antibiotics to help prevent infection , diehl et al .
reported one patient with infected esophageal duplication cysts due to eus - fna despite having received pre and postprocedure prophylactic antibiotics prior to the procedure .
overall , eus - guided fna of duplication cysts should be avoided if the endosonographer has a high index of suspicion that the lesion in question really is a duplication cyst . in some cases , eus - fna
may be warranted in order to characterize the lesion in question , but if a duplication cyst is discovered appropriate antibiotic coverage should be utilized . from a treatment perspective , surgical removal / enucleation is the treatment of choice in most symptomatic cases . in asymptomatic cases ,
surgery can be considered as the cyst could develop ulceration or perforation and the short - term postoperative outcome in these patients has been excellent .
noguchi et al . reported a case of successful laparoscopic surgery of an asymptomatic esophageal cyst in a 26-year - old patient who remained asymptomatic at 3 year follow - up . on the other hand , surgical intervention for asymptomatic cyst can also lead to long - term complications such as heartburn and reflux esophagitis and
described a case in which a patient with asymptomatic esophageal duplication cyst ( diameter 1.1 - 4.1 cm ) was followed for 13 years and routine eus did not show cyst growth .
these authors advocated eus surveillance over surgery in asymptomatic patients , although the cost implications of such an approach have not been formally studied to date .
they are usually single and , in general , do not communicate with gastric lumen .
histologically , the cyst wall can consist of mucosa , subepithelial connective tissue , a layer of smooth muscle , and an outer fibrous capsule .
the mucosa is typically lined by gastric foveolar epithelium , but most of the cystic wall is lined by a pseudostratified columnar ciliated epithelium .
gastric duplication cysts may also contain ciliated cells , proteinaceous debris , crystal formations , or engulfed histiocytes .
khoury and rivera reported two cases where the gastric duplication cysts appear to originate from a respiratory diverticulum which arises from the ventral foregut .
gastric duplication cysts can also be found in the upper part of the stomach at the level of the cardia , near the gastroesophageal junction , along the greater curvature of the stomach , or in the anterior or posterior wall of the fundus .
patients with gastric duplication cysts can be asymptomatic but can also develop symptoms such as diffuse abdominal pain , epigastric pain , vomiting , weight loss , gastric outlet obstruction , ulcerated antral mass , or failure to thrive .
on eus , gastric duplication cyst can appear as a hypoechoic lesion with a heterogeneous internal echotexture and regular margins .
for example , bhatia et al . described an anechoic cyst with four distinct wall layers adjacent to the distal gastric body and antrum in a patient with gastric duplication cyst ; this cyst was found to be lined with gastric mucosa .
also described an anechoic cyst arising from the muscularis propria that was ultimately found to be a gastric duplication cyst .
argued that a cytological and histological examination of the cyst via eus - fna was necessary in order to rule out malignant cyst transformation .
napolitano et al . also reported a case of a gastric duplication cyst that was initially misdiagnosed as a gist with eus . later on a separate procedure it was diagnosed as a gastric duplication cyst with eus - fna .
other authors argued that fna aspiration of duplication cysts should not be routine as this could increase the risk of infection and medistinal abscess formation , although in this case the fna itself allowed for a definitive diagnosis and ruled out a more ominous lesion .
there have been < 10 reported cases of gastric cancer arising from gastric duplication cyst to date .
since it is still possible for cancer to arise from gastric - type lining epithelium or pseudostratified columnar ciliated epithelium of the gastric duplication cyst , some authors favor surgery for these lesions in asymptomatic patients .
on the other hand , others authors favor conservative treatment since malignant transformation of these lesions is anecdotal .
ponder , and collins suggested that surgery may not be necessary if respiratory epithelium , instead of the gastric epithelium , is recognized on eus - fna because gastric cancer is less likely to arise from the respiratory epithelium than from gastric epithelium .
bronchogenic duplication cysts are lined by respiratory epithelium ( which is usually ciliated pseudostratified columnar in nature ) and may contain cartilage / bronchial glands in their wall .
most are located in the mediastinum around the tracheobronchial tree or within the pulmonary parenchyma .
symptomatically , patients with bronchogenic duplication cysts can present with dysphagia , chest pain , cough , shortness of breath , or abdominal pain . on eus
, these lesions often appear as round or oval lesion with a thin outer wall and located adjacent to the thoracic esophagus with well - defined endosonographic borders .
their intracystic contents can be anechoic , hypoechoic , or contain dense hyperechoic debris , which could be potentially confused with a soft - tissue masses or a malignant adenopathy [ figure 2 ] . computed tomography scan image of a large mediastinal cyst in a 57-year - old man with chest discomfort .
note that the cyst appears to contain a fluid as well as a suggestion of solid material that does not enhance with contrast 7.5 mhz linear endoscopic ultrasound ( eus ) image of the lesion seen in figure 2a .
the lesion is seen to contain anechoic fluid , as well as a hyperechoic structure with finger - like projections .
the lesion did undergo eus - fine needle aspiration and revealed bronchogenic elements and mucus with a copious debris .
the lesion was surgically resected 7.5 mhz radial endoscopic ultrasound ( eus ) image of a hypoechoic , solid - appearing lesion felt to be a malignant lymph node on eus .
fine needle aspiration revealed bronchogenic elements consistent with a benign bronchogenic duplication cyst when aspirated by eus - fna , cytology can reveal cellular debris , hemosiderin laden macrophages , ciliated columnar cells , and goblet cells .
their contents can range from thin , free - flowing fluid to solidified mucoid material that can not be aspirated on fna . with regards to eus - fna
fazel et al . reported a series of 22 patients in which the use of 22-gauge needles and prophylactic antibiotics in the diagnosis of bronchogenic duplication cysts resulted in no infectious complications during the 6 months follow - up . on the other hand , the use of eus - fna to confirm
diehl et al . reported three cases of infected duplication cyst due to eus - fna .
two of them involved patients with bronchogenic cyst who received pre and postprocedure prophylactic antibiotics .
one was resected with video - assisted thoracoscopy and the other one with thoracotomy . with regards to treatment , surgical enucleation is the treatment of choice in symptomatic cases . in asymptomatic cases ,
surgical resection has been suggested due to the rare development of complications or malignancy , but many of these lesions can be safely observed .
some experts also recommend close surveillance alone when the diagnosis has been confirmed by needle aspiration , but no standard regimen for surveillance exists
. indeed , consensus on whether these lesions need to be followed at all does not exist at this time .
small bowel duplication cysts can be associated with all three small bowel subtypes : duodenal , jejunal , and ileal .
in general , the wall of small bowel duplication cysts can contain two - mucosal layers sharing a common muscle layer . more specifically , duodenal duplication cyst consists of submosa , muscularis propria , a duodenal epithelial lining , and intimate attachment to the gi tract [ figure 3 ] .
jejunal duplication cyst consists of submosa , muscularis propria , and are lined with jejunal mucus glands .
similarly , ileal duplication cyst consists of submosa , muscularis propria , and are lined with ileal mucus glands and can contain heterotopic gastric mucosae .
7.5 mhz radial endoscopic ultrasound ( eus ) image of a duodenal duplication cyst in a 22-year - old female .
the lesion was discovered incidentally on a computed tomography scan performed to evaluate for renal stones .
the lesion manifests as a multi - layered cystic structure with the cyst muscularis propria communicating with the duodenal muscularis propria , as well as what appears to be a mucosal prominence .
the patient declined surgical resection and has undergone serial eus exams without interval change most duodenal duplication cysts are located in the second or third portion of the duodenum .
the most common type of duodenal cyst is the cystic and noncommunicating type , usually located at the medial border of the second part of the duodenum and extending anteriorly or posteriorly .
patients with small bowel duplication cysts can present with a variety of symptoms including vomiting and abdominal pain .
ko et al . reported a patient with a duplication cyst in the second and third portion of the duodenum with duodenoduodenal intussuception , melena , and abdominal pain .
duodenal cysts can cause other complications such as pancreatitis , infection , weight loss , and gi bleeding from ulceration of the ectopic gastric mucosa within the cyst .
jejunal duplication cyst can cause abdominal bloating , constipation , intussusception , vovulus , and partial small bowel obstruction .
ileal duplication cysts may be asymptomatic or present with abdominal pain , small bowel obstruction , a palpable abdominal mass , or hematochezia .
rarely , malignant transformation can occur in the setting of gastric mucosa heterotopia within the duplication cyst .
on eus , duodenal duplication cysts can have a 3 - 5 layer wall consistent with cyst of intestinal origin , and the cyst 's muscularis propria can be continuous with the muscularis propria of the duodenum .
duodenal duplication cyst can have an echogenic inner mucosa surrounded by a hypoechoic outer muscular layer . until date , no data has been published on the utility of eus - fna in diagnosing small bowel duplication cysts . regarding the treatment , duodenal cysts
are usually treated with surgical resection , although endoscopic treatment has been reported especially in cases where the duplication is in close proximity to the major duodenal papillae .
al - harake et al . recommended complete surgical resection of duodenal cysts , which may require pancreaticoduodenectomy if the cyst is located near the biliary - pancreatic duct .
surgery has been recommended by some authors due to possible malignant transformation based on case reports .
johnson and poole reported three out of 13-adult ileal duplication cyst patients who had ileal cancer arising from the cysts , including two patients with adenocarcinoma and one patient with squamous cell carcinoma .
also advocated for surgical resection of asymptomatic jejunal duplication cysts due to the risk of malignant degeneration .
colonic duplication cysts represent 6.8% of gastrointestinal duplication cysts . on histology , heterotopic gastric mucosa
colonic cysts can also contain multiple layers of the bowel wall including mucosa , submucosa , and muscularis propria .
they can contain at least one outer muscular layer with an inner gastrointestinal mucosal lining .
colonic duplication cysts can also contain well - organized layers of smooth muscle with intimate attachment of the common wall to the colon and fibrosis , inflammatory cells , lymphoid aggregates , necrosis , and calcification .
colonic cysts can be asymptomatic or present as abdominal pain to the point of an acute abdomen , obstruction , and/or bleeding
gastrointestinal bleeding can occur if ectopic gastric mucosa ulcerates and erodes into adjacent organs or vessels .
in addition , malignant degeneration is most often reported in the colon as up to 67% of malignancies diagnosed in duplication cysts occurred in the colon . on eus , colonic duplication cysts can show a
gut signature which will manifest as a multi - layered wall , with a relatively hyperechoic inner layer produced by the mucosa surrounded by a relatively hypoechoic outer layer caused by smooth muscle , or can have a more irregular and atypical appearance [ figure 4 ] .
it should be noted that some cysts lack a well - organized layered wall due to some degree of involution or degeneration .
computed tomography scanning is also a highly sensitive diagnostic modality and is often the initial test of choice .
contrast enema can also establish the diagnosis if it can demonstrate a colonic filling defect or luminal communication with the bowel , but is much less commonly performed in the current era .
colonoscopy will show the duplication cyst only if there is communication with the colon or extrinsic compression and may fail to detect a significant number of colonic duplication cysts . to date , no data has been published on the utility of eus - fna in diagnosing colonic duplication cysts .
endoscopic view of an extrinsically compressing cystic lesion adjacent to the rectum in a 72-year - old female .
the lesion was discovered during a staging computed tomography scan for uterine cancer 7.5 mhz radial image of the lesion shown in figure 4a .
the lesion manifests as a complex , multi - layered structure with a complex luminal contour .
endoscopic ultrasound - fine needle aspiration was deferred given the appearance , and the patient declined any intervention on the lesion given that she had a concurrent cancer diagnosis regarding the treatment , some authors recommend routine resection of asymptomatic colonic duplication cysts due to the potential for perforation , bleeding , obstruction , and malignant degeneration . in patients with symptomatic colonic cysts , surgical resection
reported a case of colonic duplication cyst manifesting as acute abdomen and intussusception necessitating a right - sided hemicolectomy .
domajnko and salloum , puligandla et al . recommended en block resection of symptomatic colonic duplications .
in addition , mourra et al . reported colonic duplication cysts in seven patients ( four presenting with abdominal pain , three presenting with bowel obstruction ) who subsequently underwent surgical partial colectomy with associated complete cyst excision .
gastrointestinal duplication cysts are rare congenital lesions in adults . some patients are asymptomatic while others can present with abdominal pain , bleeding , and abdominal pain .
eus - fna allows high - resolution morphologic analysis as well as sampling and microscopic examination of cyst contents ; it can also lead to duplication cyst infection with associated complications despite pre and postprocedural antibiotics in some patients .
eus - fna of duplication cysts can carry an increased risk of complications , but may be warranted to obtain a definitive diagnosis and to rule out more serious pathology . once the diagnosis of duplication cyst is established , treatment can vary depending on the presence of symptoms . in symptomatic patients ,
while some authors advocate for resection due to possible malignant degeneration of the duplication cyst , others have advocated for observation .
since there have been case reports of stable duplication cysts on eus surveillance , this may be a suitable method of outpatient follow - up and surgical resection can be considered if patient develops symptoms . in any case , surgical versus nonsurgical management of asymptomatic duplication cysts is likely to remain controversial until we understand more about the time course and risk factors associated with their malignant degeneration .
|
gastrointestinal tract duplication cysts are rare congenital gastrointestinal malformation in young patients and adults .
they consist of foregut duplication cysts , small bowel duplication cysts , and large bowel duplication cysts .
endoscopic ultrasound ( eus ) has been widely used as a modality for the evaluation and diagnosis of duplication cysts .
eus is the diagnostic tool of choice to investigate duplication cysts since it can distinguish between solid and cystic lesions .
the question of whether or not to perform eus - fine needle aspiration ( eus - fna ) on a lesion suspected of being a duplication cyst is controversial as these lesions can become infected with significant consequences , although eus - fna is often required to obtain a definitive diagnosis and to rule out more ominous lesions .
this manuscript will review the literature on duplication cysts throughout the body and will also focus on the role of eus and fna with regards to these lesions .
|
a thorough knowledge of the anatomy of the tooth and morphology of the root canal is essential for the success of root canal treatment .
the ultimate goal of root canal treatment is a thorough cleaning and shaping of all pulp spaces and the complete obturation of these spaces with an inert filling material [ 1 , 2 ] .
the inadequate knowledge can lead to inadequate biomechanical instrumentation of root canal system , and this will cause failure of endodontic treatment . it is well known that tooth anatomy varies according to racial origin [ 24 ] .
therefore it is very important to be familiar with variations in tooth anatomy and characteristic features in various racial groups since such knowledge can aid in location and negotiation of canals , as well as their subsequent management .
review of the literature showed a high variability in the root canal morphology of the maxillary second premolar [ 69 ] .
the aim of this study was to investigate clinically and radiographically the number of roots and root canals in the maxillary second premolar in a group of jordanian population in routine endodontic practice using magnifying loupes .
two hundred seventeen patients were referred to the conservative clinic at king hussein medical centre for endodontic treatment of maxillary second premolar from january 2012 till january 2014 .
preoperative radiographs were taken for evaluation ( root morphology , number of canals , and periapical status ) .
the teeth that were included in the study were those teeth that required nonsurgical endodontic treatment .
the included teeth were free of root resorption , having no calcifications or open apices .
two radiographs in two planes were taken during routine endodontic treatment for these teeth ( parallel and cone shift technique ) .
the endodontic procedures undertaken were as follows : local anesthesia ( ubistesin forte/3 m espe , seefeld , germany ) was administered . under rubber dam isolation
an oval access cavity was opened between the cusp tips , being wider bucco - palatally , with sterile high and low speed burs with water coolant .
after the contents of the pulp chamber were removed , a sharp endodontic explorer was used to explore the developmental grooves carefully to locate the orifices of the canals .
pulp tissue was extirpated using barbed broaches ( nerve broaches / alfred becht - gmbh , germany ) or h - files ( mani inc . ,
japan ) and the canals were flared with gates glidden drills of numbers 2 , 3 , and 4 ( mani inc . ,
two periapical radiographs in two angles were taken ( parallel and cone shift technique ) for evaluation of the number of roots and root canals as well as for confirmation of the working length after inserting size of 15 , 20 , or 25 k files ( mani inc . ,
examination of the floor of the pulp chamber to locate canals orifices is done using 3.5 high resolution magnification loupes ( keeler inc . , uk ) .
the teeth included were both clinically and radiographically examined by two specialists with more than 10 years of experience in endodontics .
a total of 217 patients 100 female ( 46% ) and 117 male ( 54% ) received root canal treatment of maxillary second premolar .
the mean age of the patients was 32.7 , ranging from 18 to 60 years .
out of the total of 217 maxillary second premolars 120 teeth had one root ( 55.3% ) , 96 teeth had two roots ( 44.2% ) , and one tooth had three roots ( 0.46% ) . based on vertucci 's classification of root canal morphology , 30 teeth ( 13.8% ) had type i canal configuration ( one canal with one apical foramen , figure 1 ) , 54 teeth ( 24.9% ) had type ii ( two canal orifices end in one apical foramen , figure 2 ) , and 132 teeth ( 60.8% ) had type iv ( two canal orifices end in two separate apical foramina , figures 3 and 4 ) .
one tooth ( 0.46% ) had type viii ( three canal orifices end with three separate apical foramina , figure 5 ) .
the incidence of two canals ( types ii and iv ) is 85.7% . out of the 100 females 64% of the maxillary second premolar had one root and 36% had two roots .
regarding root canal morphology 16% of the female maxillary second premolar had type i , 32% had type ii , and 52% had type iv .
out of the 117 males 47.9% of the maxillary second premolar had one root , 51.2% had two roots , and 0.8% had three roots . regarding root canal morphology 12% of the male maxillary second premolars had type i , 19% had type ii , 68% had type iv , and 0.8% had type viii .
a thorough knowledge of a common root canal morphology and its frequent variations is a basic requirement for endodontic success [ 1 , 2 ] . sometimes root canal treatment fails because the clinician fails to detect all the canals present in the tooth .
the number of roots and canals of the maxillary second premolar in the literature shows a wide variation [ 69 ]
. the differences may be due to the study design ( clinical versus laboratory ) , method of canal identification ( radiographic examination , root sectioning , canal staining and root clearing , examination with sem , or cone - beam computed tomography techniques ) , or true differences in the sample under investigation ( racial variation ) [ 1 , 2 ] .
maxillary second premolar root canal system demonstrates high variability and it was the only tooth to demonstrate all eight vertucci 's canal configurations .
clinically , diagnostic preoperative radiograph and its careful examination are necessary before starting root canal treatment [ 1012 ] .
additional periapical radiographs with cone shift angulations will reveal more adequate information about root canal morphology . in the present study
two radiographs were taken to explore the number of roots and root canals and to take the working length of the canals during root canal treatment .
one radiograph was taken at right angle and the other with 2040 horizontal angle cone shift .
martinez - lozano et al . found that by varying the horizontal angle of x - ray tube 2040 , the number of root canals observed in maxillary first and second coincided with the actual number of canals present .
sardar et al . could identify a significantly higher number of premolars with two canals by using angled radiographs .
other diagnostic measures that help in locating root canal orifices include adequate access and modification of the outline of the access cavity , exploration of the tooth 's interior and exterior , and appropriate magnification and illumination [ 2 , 3 ] . in this study
magnifying loupes were used to help in examination of the pulp chamber floor and to identify and locate the orifices of the root canals .
the use of dental loupes and dental operating microscope ( dom ) provides the clinician with superior lighting and magnification improving the ability to treat cases and finding extra canals .
maxillary second premolar is generally considered to have one root and one canal [ 2 , 3 , 6 , 14 ] . in the present study
only 13.8% had one root canal end in one apical foramen ( type i , figure 1 ) .
this is at variance with the earlier studies of vertucci and kartal et al .
in which the maxillary second premolars were reported to have type i in 48% and 48.6% , respectively .
the incidence of type ii ( two canal orifices end in one apical foramen , figure 2 ) and type iv ( two canal orifices end in two separate apical foramina , figures 3 and 4 ) was 24.9% and 60.8% , respectively . the results of this study do not coincide with earlier studies of vertucci et al . [ 6 , 7 ] and pcora et al . who reported higher incidence of one canal and lower incidence of two canals .
the results of our study are in support of chima , weng et al . , and sardar et al . who recorded high incidence of two root canals in the maxillary second premolar .
in the present study just one premolar ( 0.46% ) had three roots and three canals ( type viii , figure 5 ) .
this low incidence is consistent with other studies where the incidence ranged between 0.3% and 2% [ 7 , 15 , 16 ] .
three canals should be suspected clinically when the pulp chamber appears to deviate from normal configuration and does not align in its expected bucco - palatal relationship [ 1921 ] .
if the pulp chamber seems to be either triangular in shape or too large in a mesiodistal direction , more than one root canal should be suspected .
clinicians should be very careful when treating maxillary second premolars because of the extreme variability of the anatomy of those teeth ; the risk of missing a canal in those teeth is always present .
the incidence of two canals ( with either shared or separate apical foramina ) is very high in the maxillary second premolars in jordanian people .
inspection should be done for the presence of second canal whenever endodontic treatment is planned for those teeth .
|
objectives . the aim of this study was to investigate the number of roots and root canals in the maxillary second premolar in a group of jordanian population . materials and methods .
a total of 217 patients , 100 female ( 46% ) and 117 male ( 54% ) , received root canal treatment of maxillary second premolar from january 2012 to january 2014 .
the mean age of the patients was 32.7 , ranging from 18 to 60 years .
the teeth included in the study were examined clinically and radiographically for the number of roots and root canals using magnifying loupes . results . out of the total of 217 maxillary second premolars ,
120 teeth had one root ( 55.3% ) , 96 teeth had two roots ( 44.2% ) , and one tooth had three roots ( 0.46% ) . regarding root canal configuration , 30 teeth ( 13.8% ) had one canal , 54 teeth ( 24.9% ) had two canals shared in one apical foramen , 132 teeth ( 60.8% ) had two canals with two separate apical foramina , and one tooth ( 0.46% ) had three canals with separate apical foramina . conclusion .
the incidence of two canals ( either with shared or separate apical foramina ) is very high in the maxillary second premolars in jordanian population ; therefore inspection should be done for the presence of second canal whenever endodontic treatment is planned for this tooth .
|
in the previous issue of critical care , schouten and colleagues show the critical involvement of protease - activated receptor ( par)-1 in a lethal streptococcus pneumoniae pneumonia model .
in contrast with other g protein - coupled receptors , pars are not activated in vivo by binding of a soluble ligand but , instead , are activated by proteolysis triggered by extracellular proteases .
pars use a fascinating mechanism to convert an extracellular proteolytic cleavage event into a transmembrane / intracellular signal : the receptors carry their own tethered ligands , which remain cryptic until unmasked by receptor n - terminal cleavage , and then an intramolecular rearrangement allows the ligand and the receptor moieties to interact .
a considerable body of evidence supports a prominent role for pars in a variety of human physiological and pathophysiological processes , and thus substantial attention has been paid to develop new drug - like molecules either activating or blocking pars .
the crosstalk of inflammation and coagulation has emerged as a major mechanism controlling the host response to invading microorganisms , and poor regulation of this mechanism is held responsible for the occurrence of multiple organ failure and eventually death in patients with severe sepsis / septic shock .
par1 plays a major role in orchestrating the interplay between coagulation and inflammation [ 2 - 5 ] .
par1 is the primary cell - surface receptor responsible for thrombin - mediated platelet aggregation in humans , but is also activated by many other proteases - including activated protein c ( apc ) and its receptor , the endothelial protein c receptor .
all of these different proteases , which are released during activation of the clotting cascade , can regulate par signalling by either activation or inactivation .
par1 then has an intriguing dual function : par1 activation by thrombin results in a proinflammatory / endothelial - permeability enhancing response , while the same receptor activated by apc / endothelial protein c receptor results in an anti - inflammatory , endothelial - integrity preserving response .
nevertheless , understanding the role of par1 signalling in sepsis remains complex due to the multiple and , in part , opposite effects ascribed to this receptor .
a further complexity is present when many types of cells , all present in the same environment , express this receptor - platelets , leukocytes , macrophages , endothelial cells , epithelial cells and fibroblasts , for example .
moreover , thrombin has a much higher affinity for par1 with a higher catalytic efficiency relative to apc .
how apc activates par1 is unclear when thrombin is also present in the same environment .
finally , par1 can take up multiple conformational states , each state triggering different downstream signalling pathways and cellular responses .
for example , compartmentalisation of par1 in lipid rafts and localisation to caveolae are critical for the apc - biased agonist of par1 .
par1 signalling inhibition decreases inflammation , early virus replication and mortality after infection with multiple influenza a virus strains , and is effective even when dosing was initiated at day 3 after inoculation .
also , par1mice are protected from ventilation lung injury in a setting of high - tidal volume ventilation and bleomycin - induced lung injury [ 7 - 9 ] .
these observations suggest that par1 signalling contributes to proinflammatory responses to injury in the lungs . in the study by schouten and colleagues , par1 impairs the host defence response ,
as reflected by a reduced lethality , lower bacterial loads , less pulmonary neutrophil influx and less lung damage in par1 knockout mice .
even if the mechanisms underlying these differences remain to be elucidated , crosstalk between par1 and platelet - activating factor receptor ( pafr ) may partly explain these differences .
par1 and pafr have been shown to cooperate together , as par1 induced the expression of platelet - activating factor and pafr .
the biological activity of platelet - activating factor is mainly determined by phosphorylcholine , which binds specifically to pafr .
phosphorylcholine is also a prominent part of the cell wall of s. pneumoniae and specifically binds to pafr expressed on human respiratory epithelial cells , which facilitates pneumococcal entry into these cells and transcytosis to the basal surface of endothelial cells . using pafr knockout mice
, the same group demonstrated that pafr was used by s. pneumoniae to induce severe lethal pneumonia , as reflected by a reduced mortality , attenuated bacterial outgrowth in the lungs and diminished dissemination of the infection in pafr knockout mice .
further studies are definitely needed to dissect the exact par1 signalling mechanisms in s. pneumoniae pneumonia .
nevertheless , as underlined by the authors , the therapeutic effect and impact of par1 signalling inhibition with concurrent antibiotic treatment for s. pneumoniae pneumonia needs to be evaluated .
other studies examining the role of par1 in sepsis have revealed conflicting results . whereas studies using blocking agents confirmed the present results , others showed detrimental effects .
these discrepancies may be explained by the different sepsis models ( pneumonia , polymicrobial sepsis induced by caecal ligation and puncture and endotoxinemia ) , different severity and inoculum ( lethal dose 90 vs. lethal dose 100 ) and different stages of the disease .
par1 has opposing , temporally controlled functions during the progression of the sepsis , and par1 blockade or activation may be alternatively beneficial at early or late stages of different sepsis models .
the complexity of par1 signalling mechanisms supports the assessment of the immunological status of the patients .
immunological monitoring could help to guide therapies with immunomodulatory drugs with an antiinflammatory effect or an immunostimulatory effect .
increased insight into the molecular mechanisms of the tight relationship between inflammation and coagulation may lead to the identification of new targets for therapies that can modify the excessive activation that leads to dysregulation of these systems .
par1 has a pivotal role in mediating protective apc effects . the time - dependent switch of par1 from an exacerbating proinflammatory receptor to a protective anti - inflammatory receptor needs to be investigated in other experimental models before clinical trials can be recommended .
apc : activated protein c ; pafr : platelet - activating factor receptor ; par : protease - activated receptor .
|
protease - activated receptors ( pars ) belong to the family of g protein - coupled receptors . among the four members , par1 plays a major role in orchestrating the interactions between coagulation and inflammation .
par1 has opposing functions during sepsis , and par1 blockade or activation may be alternatively beneficial at early or late stages of different sepsis models . studying molecular mechanisms of the crosstalk between inflammation and coagulation may lead to the identification of new targets for therapies in sepsis .
however , the time - dependent switch of par1 from an exacerbating proinflammatory receptor to a protective anti - inflammatory receptor needs to be investigated before clinical trials can be recommended .
finally , as par1 seems to play a singular role in streptococcus pneumoniae - induced sepsis through a crosstalk between par1 and platelet - activating factor receptor , the exact role of par1 needs to be investigated in other models of sepsis .
|
autoimmune disorders are often found in association with other endocrine and/or non - endocrine diseases .
when two or more glandular autoimmune - mediated diseases coexist in a patient , it is termed as polyglandular autoimmune syndrome ( pas ) .
a variety of clusters of autoimmune - mediated endocrinopathies may exist , each giving rise to a different type of pas .
pas type ii is characterized by the obligatory occurrence of autoimmune addison 's disease in combination with autoimmune thyroid disease and/or type 1 diabetes mellitus .
primary hypogonadism , myasthenia gravis and celiac disease also are commonly observed in this syndrome .
pas type ii has a prevalence of 1 in 20,000 , occurs more frequently in women with a 1:3 male : female ratio and has a peak incidence at ages 2060 years . on the other hand ,
achalasia is a rare disease characterized by aperistalsis of the esophageal body and failure of the lower esophageal sphincter to relax .
achalasia has a prevalence of 10 in 100,000 , occurs equally in men and women and has a peak incidence at ages 3060 years . though viral infections , neuronal degradation , genetic inheritance and autoimmune disease have all been proposed causes of this disease , the etiology of this entity remains unknown .
dysphagia and vomiting are common symptoms in achalasia due to the lower esophageal sphincter failure to relax .
these symptoms are also common in pas type ii as a result of the metabolic disturbances and myopathy associated with untreated addison 's disease . in patients with pas type ii
patients with achalasia , on the other hand , require a more invasive therapy , pneumatic dilatation of the esophagus or surgical myotomy , to improve such symptoms .
we report a patient with pas type ii who presented with idiopathic achalasia and correlate our case with the suggested theory of an autoimmune etiology of achalasia .
a 53-year - old man with no significant past medical history presented with progressive symptoms of nausea , loss of appetite , decreased food intake , insomnia , generalized fatigue , muscle weakness , dizziness and joint pain , along with a 30-pound weight loss over the preceding 30 days ( from 220 to 190 lbs , a 13.6% weight loss ) .
he also complained of chronic difficulty in swallowing for the past 7 years , particularly liquids , that had slowly progressed to involve solids . on physical examination
he was found to have a temperature of 34.9c , a heart rate of 108 bpm and a blood pressure of 88/60 mm hg . though he appeared tired and fatigued , he was not in any acute distress .
laboratory blood tests revealed significantly elevated tsh ( 74 iu / ml ) , low free t4 levels ( 0.6 ng / dl ) and low cortisol levels ( < 1.0 g / dl ) , which did not rise after cosyntropin stimulation testing .
his serum adrenocorticotropic hormone level was also elevated ( 733 pg / ml ) , which explained the patient 's hyperpigmentation .
he was also found to have positive anti-21-hydroxylase antibodies and anti - thyroid peroxidase antibodies .
he presented 4 weeks later with worsening dysphagia symptoms , which were initially thought to be due to adrenal insufficiency .
a barium esophagogram revealed marked luminal narrowing at the gastroesophageal junction with bird beak configuration , consistent with achalasia ( fig .
our patient presented with autoimmune adrenal insufficiency and hypothyroidism , proven by positive anti-21-hydroxylase antibodies and anti - thyroid peroxidase antibodies , classifying him as pas type ii .
one other case of pas type ii associated with megaesophagus has been reported in a human , and similar to our patient that case had positive adrenal and thyroid autoantibodies .
however , our patient had both manometry and barium esophagogram studies consistent with achalasia , while manometry studies in the previously reported case were inconsistent with achalasia .
furthermore , the association of achalasia and autoimmune adrenal disease has been reported in dogs [ 4 , 5 ] , thus making it plausible that these rare disorders in our patient could be connected .
conceivable pathologies which would cause combined esophageal motility disorders and hypoadrenalism include amyloidosis , malignant infiltration of the esophagus and adrenal gland , adrenoleukodystrophy and allgrove syndrome . in our patient , histology of the esophageal biopsy specimens had excluded amyloidosis and malignancy .
allgrove syndrome ( aaa syndrome ) comprised hypoadrenalism , alacrima and achalasia . anti - adrenal antibodies are negative in this syndrome and adrenal insufficiency is secondary to adrenocorticotropic hormone resistance causing isolated hypocortisolism with an intact renin - angiotensin system .
our patient had autoimmune hypoadrenalism affecting both the cortisol and aldosterone axes , which strongly argues against this diagnosis .
while adrenoleukodystrophy of adult onset can be considered , absence of other neurological manifestations such as ataxia , muscle stiffness or peripheral neuropathy rules out this diagnosis .
we suggest autoimmunity and immunogenicity as a probable contributing factor for association of these two rare disorders .
pas type ii is a well - identified entity with susceptibility genes , including hla genes , the cytotoxic t lymphocyte antigen gene and the protein tyrosine phosphatase nonreceptor type 22 gene on chromosomes 6 , 2 and 1 , respectively .
these genes are known to increase the risk of developing autoimmune disorders without being causative . of the hla genes , dr3 and dr4 antigens
furthermore , addison 's disease is a complex genetic disorder with a specific hla - dr and hla - dq genotype that allots high risk .
idiopathic achalasia is characterized by destruction of myenteric inhibitory neurons to the lower esophageal sphincter .
although several studies have suggested a possible association between viral infections and achalasia [ 7 , 8 , 9 ] , a clear causal relationship has not been established . on the other hand , autoimmune etiology of achalasia is supported by ( 1 ) the presence of circulating autoantibodies against the myenteric plexus , ( 2 ) presence of inflammatory t cell infiltration in the myenteric plexus and ( 3 ) increased prevalence of hla class ii antigens .
class ii hla antigens , including dqw1 , dqa1 * 0103 , dqb1 * 0603 and dqa1 * 0103-dqb1 * 0603 heterodimer , were more prevalent in the achalasia population as compared to controls .
although this hla association also suggests immunogenic predisposition for the development of idiopathic achalasia , its specificity is limited and is causality is still unproven , as it may represent a nonspecific reaction to the disease process .
five autoimmune diseases ( type 1 diabetes mellitus , hypothyroidism , sjgren 's syndrome , systemic lupus erythematosus and uveitis ) have been shown in a study to be more prevalent in achalasia patients than in the general population .
though this association in not sufficient to define achalasia as an autoimmune disease , it raises suspicion and urges further research into autoimmune etiologies of achalasia .
current evidence suggests that the initial insult to the esophagus , perhaps a viral infection or some other environmental factor , results in myenteric plexus inflammation that leads to an autoimmune response in a susceptible population that may be genetically predisposed .
our patient 's presentation of pas type ii with achalasia supports the theory of an autoimmune etiology .
|
achalasia is a rare disease characterized by aperistalsis of the esophageal body and failure of the lower esophageal sphincter to relax .
the etiology of this disease remains unknown .
polyglandular autoimmune syndrome type ii is a well - identified disease characterized by the occurrence of autoimmune addison 's disease in combination with autoimmune thyroid disease and/or type 1 diabetes mellitus .
we report a case that suggests autoimmunity and immunogenicity as a probable contributing factor for association of these two rare disorders .
|
a fifty - year - old man was referred to our hospital for pain and instability in the left knee , which had developed after removal of the illizarov external fixator .
twenty months ago , he suffered a midshaft open fracture ( type iiia ) of the left tibia in a traffic accident .
so , he underwent an open reduction and external fixation with illizarov , which was removed after completion of bone union . physical examination revealed no direct tenderness , swelling , and neurovascular deficit .
range of motion of the knee joint was normal ( range , 0 to 135 ) . on the knee stress test , the patient showed posterior drawer grade iii instability , and there was no posterolateral rotary instability .
the femoral tunnel was created under arthroscopic guidance with the patient lying in supine position .
we passed a guide wire through the tunnel for the passage of the graft tendon .
then , the operating table was tilted to the left side and the knee was externally rotated to partially expose the popliteal fossa .
a hockey stick skin incision was made on the posteromedial aspect of the knee joint .
the plane between the medial head of the gastrocnemius and the semimembranous tendons was identified .
the medial head of the gastrocnemius tendon was retracted laterally to protect the neurovascular structures .
then , a vertical incision was made through the oblique popliteal ligament and posterior capsule to expose the tibial attachment site of the pcl .
we used an achilles tendon allograft : the tendinous portion of the graft was 1.1 cm in thickness ; and tibial bony trough of the graft was 3 cm in length , 1.3 cm in width , and 1.3 cm in thickness .
after passage of the graft , pretension of the graft was done in the femoral tunnel , and the achilles tendon bone block was inlaid within the tibial window and fixed with a 4.5-mm cannulated screw and a washer ( depuy synthes , amersfoort , netherlands ) ( fig .
immediate postoperative physical examination revealed grade i muscle power in great toe dorsiflexion , grade iii muscle power in great toe plantarflexion , and numbness in the dermatome of the deep peroneal nerve .
the pulse of popliteal artery was checked , but that of the posterior tibial artery and dorsalis pedis artery was not checked .
it was suspected that the decreased muscle power and numbness were due to popliteal artery compression , and emergency femoral angiography was done .
, we found that the tibial bone block , not the cannulated screw and washer , compressed the popliteal artery posterolaterally ( fig .
, we made an incision along the previous operation scar and removed the screw and bone block .
we moved the bony trough more distally from the anatomic pcl footprint to secure appropriate graft tension and refixed it with a 7.0-mm cannulated screw and a washer ( depuy synthes ) ( fig .
we used the tibial inlay technique in single - bundle pcl reconstruction using achilles tendon allograft because it has been reported as a favorable method providing good results6 ) .
it has been especially advocated for patients with osteopenia from disuse , fractures , and in revision surgery4 ) .
miller et al.7 ) fixed the grafted bone block with a screw on the back of the tibia after injection of barium into the femoral arteries in eight fresh - frozen knees .
then , they measured the distance from the center of the screw to the edge of the popliteal artery , the average distance of which was 21.1 mm ( range , 18.1 to 31.7 mm ) .
they reported that the tibial inlay technique is safe with regard to the popliteal artery .
berg8 ) attempted anterior and posterior approaches with the injured leg in an elevated lateral position .
burks and schaffer9 ) fixed graft to the tibia using the posterior approach after passing the graft tendon through the femoral tunnel in supine position .
originally , tibial inlay bone graft is supposed to be fixed in a prone or lateral position in the tibial inlay technique .
however , we could not obtain a sufficient view of the popliteal fossa in the surgical field because the injured leg was maintained in external rotation and abduction with the patient placed in supine position .
moreover , it appeared that screw insertion for fixation of the bone block could result in lateral displacement of the bone block due to the risk of wrong placement of the screw from posteromedial to anterolateral in the supine position . in our opinion , direct posterior approach is safer than supine position .
we think that the patient should be placed in lateral or prone position when the tibial inlay technique is utilized . in our case , we used a bone block thicker than the cortical window of the tibia , and the popliteal artery compression was attributed to the short distance between the graft bone block and the posterior neurovascular structures
. therefore , it is our understanding that the bone block thickness also plays a role in the development of popliteal artery compression . in the second operation ,
mismatch of the tension of the graft tendon occurred . for prevention of abrasion of the graft tendon
, we took care to relieve tension of the graft tendon and induce anterior displacement of the graft tendon , and the tibial bone block was re - fixed at a more distal site than the normal pcl footprint .
in general , the tibial inlay technique is a preferred method in pcl reconstruction that rarely results in neurovasulcar complication
. however , graft bone block size , screw positon and direction , and patient 's position during surgery may be risk factors for this complication
. therefore , the surgeon should take consideration into such factors during pcl reconstruction using the tibial inlay technique .
|
popliteal artery compression rarely occurs after posterior cruciate ligament ( pcl ) reconstruction using the tibial inlay technique that allows for direct visualization of the surgical field . however , we experienced a popliteal artery compression after pcl reconstruction performed using the technique , which eventually required re - operation . here ,
we report this rare case and discuss reasons of popliteal artery compression .
|
an ethical committee consent was taken to use oral paracetamol for patent ductus closure in preterm neonates with significant pda who had contraindication for brufen / indomethacin use .
there were total of 18 preterm neonates who had significant pda , out of these oral brufen was given to eight preterm neonates and 10 were given oral paracetamol as brufen was contraindicated .
we report 10 preterm neonates born at gestational age 27 - 33 weeks with birth weight range 800 grams to 1,400 grams admitted to our nicu .
all these preterm neonates were diagnosed to have hemodynamically significant ( features of congestive cardiac failure ) pda at 4 - 7 days of life .
each of these neonates were given oral paracetamol in the dosage of 15 mg / kg 8 hourly for 48 h. these neonates were monitored for temperature changes before and 30 min after giving oral paracetamol and no significant temperature difference was noted .
the ductal closure was confirmed with repeat echocardiography after 72 h of administration of oral paracetamol .
require pharmacologic and/or surgical intervention to close a hemodynamically significant patent ductus arteriosus ( pda ) .
indomethacin has been the pharmacologic treatment of choice and has also been used prophylactically in very premature neonates to prevent pda .
the drug , however , is associated with renal and gastrointestinal adverse effects . in july 2006 ,
the mechanism of action for both indomethacin and ibuprofen is through inhibition of prostaglandin synthesis , resulting in ductal constriction .
ibuprofen has demonstrated significantly less effects on cerebral , renal , and mesenteric blood flow in premature neonates when compared with indomethacin . a transient but significant increase in serum creatinine concentration , decrease in urine output , and increase in frequency of oliguria
however , the rate of reopening of the ductus after pharmacologic closure and the need for rescue therapy were not different between the two drugs .
in addition , no differences were noted in other outcomes such as frequency of intraventricular hemorrhage , necrotizing enterocolitis , or chronic lung disease , as well as in duration of mechanical ventilation and length of hospital stay .
although its precise mechanism of action remains controversial , paracetamol seems to act at the peroxidase segment of the enzyme .
therefore , paracetamol - mediated inhibition is facilitated at reduced local peroxide concentrations ( e.g. , hypoxia ) .
theoretically , these differences would permit peroxidase inhibition to be optimally effective under conditions in which cyclooxygenase inhibition is less active or hypothetically , render it ideally suited for treatment in the pda environment .
the exact mechanism use of oral paracetamol in ductal closure has not been studied on large scale ; however with this study it is evident that oral paracetamol is equally effective in ductal closure with no side effects which was there with brufen / indomethacin . however
|
patent ductus arteriosus ( pda ) , in which there is a persistent communication between the descending thoracic aorta and the pulmonary artery that results from failure of normal physiologic closure of the fetal ductus , is one of the more common congenital heart defects in preterm neonates .
the closure of pda can be done with either indomethacin or brufen which are cyclooxygenase 1 , 2 inhibitor ; however these drugs are associated with side effects .
we report an interesting findings of ductal closure in 10 preterm neonates ( gestational age 27 - 33 wks ) presenting with significant large pda who had failed or had absolute contraindication with brufen .
these preterm neonates were treated with oral paracetamol in the dose of 15 mg / kg 8 hourly . the pda closure was achieved within 48 h and there was no complication .
|
as was shown , a monoelectronic transistor can be constructed on the basis of a single p - phenylenevinylene oligomer that can have a varied oxidation state and is composed of five benzene rings connected by four double bonds .
great opportunities are also associated with metal cluster complexes used as a basis for various nanodevices and molecular motors .
some of them ( e.g. , chevrel phases [ 4 - 6 ] ) are characterized by high parameters of critical magnetic fields of superconductivity reaching 60 t. structurally , the phases are characterized by metal bonds being formed between triangular faces of the neighboring octahedral units . recent research reported 12-rhenium cluster complexes [ re12cs17(cn)6 ( n = 6 , 8) with a unique crystal structure and a reversible redox two - electron transformation { [ re12cs17(cn)6[re12cs17(cn)6 } .
the complexes are dimers composed of two re6 octahedrons connected by rhenium atoms through the interstitial carbon with a trigonal - prismatic coordination , { re3(6-c)re3 } , and by three bridging sulfur atoms 2-s with corner coordination of rhenium atoms , { re(2-s)re}. according to x - ray data , the change in the oxidation state of the complex is accompanied by substantial changes in internuclear distances ( re re ~ 0.3 ) between two metal subunits { re6 } , whereas inside { re6 } subunits interatomic distances re re do not change more than for 0.01 ( fig .
the two subunits { re6 } are closer to each other in [ re12cs17(cn)6 than in [ re12cs17(cn)6 . the structure of [ re12cs17(cn)6](n = 8 , 6 ) complexes .
reare rhenium atoms in trigonal - prismatic coordination as is well known , a nanoscale device can be constructed from a molecule only if the molecule exhibits such electronic effects as rectification , amplification or switching . here
, we study electronic effects in complexes [ re12cs17(cn)6 ( n = 6 , 8) by nmr spectroscopy and quantum chemical method of electron localization function ( elf ) and consider the effects as an evidence of molecular switching .
c nmr spectra were measured from the polycrystalline samples k8re12cs17(cn)6 20h2o ( i ) and k6re12cs17(cn)6 ( ii ) synthesized by precipitating [ re12cs17(cn)6 complexes from solutions .
c nmr spectra of ( i ) and ( ii ) enriched by c were measured by avance-400 spectrometer of bruker bio - spin in an ampoule for a rotor with the outer diameter 4 mm , the sample being rotated at the magic angle ( mas ) at room temperature .
the duration of the stimulating 90 pulse was 5 s , the accumulated amount was 200 .
the relaxation delay was 10 s. tetramethylsilane ( tms ) was used as an external standard for the scale of chemical shifts .
quantum - chemical study of the electronic structure of model systems [ re12cs17(cn)6 ( n = 6 , 8) was carried out by a spin - restricted dft method ( code adf2006 ) with model hamiltonians of density functionals given by the sum of a local density functional lda ( vwn ) and a gradient exchange functional gga ( becke and perdew ) .
the all - electron basis set of the tzp type , as included in the adf2006 program , was used for all atoms .
geometry optimization was performed for d3h point group ; relativistic effects and spin orbital interaction were taken into account with the zero - order relativistic approximation method zora .
c nmr chemical shifts were calculated by the method giao in view of scalar relativistic effects and spin
interatomic interactions were studied by a quantum - chemical topological method electron localization function ( elf ) . in this method
dh(r ) is the density of the thomas fermi kinetic energy for the homogeneous electron gas , which acts as a normalizing multiplier ; d(r ) is interpreted as excess density of the local kinetic energy of electrons ( fermions ) resulting from repulsion according to the pauli principle relative to the density of the local kinetic energy of bosons .
the elf is assumed to approximately 1 in the regions of space that are typical of the maximum localization of electron pairs with antiparallel spins ( colored blue in our drawings ) .
the elf is 0.5 in the regions where the electron density is close to that of the homogeneous electron gas ( green ) and ~0 in the regions with delocalized electrons ( red ) .
it was found out that both structure and c nmr spectra change dramatically depending on the oxidation state ( n ) of the complex [ re12cs17(cn)6 ( fig .
2 ) . according to the obtained data , the reduction / oxidation of the complex [ re12cs17(cn)6 is accompanied by the change of c nmr signal from 6-c for 415 ppm ( or ~37 g ) that substantially exceeds chemical shifts due to the change of the distances between carbon transition metal . besides , there is obviously a fundamental difference between the electrically conductive properties of the complexes since the chemical shift is caused by induced electric currents to arise in the complexes in an external magnetic field .
c mas nmr spectrum of 6re12cs17(cn)6(a ) and 8re12cs17(cn)620h2o ( b).s1is the nmr signal of cn - groups , s2is the nmr signal of the atom 6-c .
rotation rate is 15 khz quantum - chemical dft calculations show a good agreement with the data of x - ray - structural analysis and nmr data ( table 1 ) .
the fact suggests a high reliability of the model of electronic structure of complexes [ re12cs17(cn)6 ( n = 6 , 8) received at the dft level .
measured and calculated values of isotropic nmr chemical shifts ( , ppm ) in the[re12cs17(cn)6]complexes ( n = 6 , 8) calculated absolute isotropic chemical shielding tms = 177.4 ppm , and = tms substance the energy gaps between the highest occupied and the lowest unoccupied molecular orbitals ( homo - lumo gap ) are 1.05 ev ( n = 6 ) and 1.31 ev ( n = 8) , respectively .
the difference between the energy gaps and distance between the two subunits { re6 } also suggests different resistance of the molecular complexes .
, homo orbital is characterized by some bonding interaction between re atoms from different subunits { re6 } in the complex [ re12cs17(cn)6 and by antibonding interaction in [ re12cs17(cn)6 .
the study of the electronic density by the method of electron localization function ( elf ) revealed weak exchange interactions ( elf ~ 0.3 ) between 6-c and 2-s in the complex [ re12cs17(cn)6 , the interaction almost disappears in the complex [ re12cs17(cn)6 . the interaction can affect the structural properties , since even weak localization of electron pairs with antiparallel spins between two positively charged re atoms should result in some reduction of the distances between subunits { re6}. therefore , the internuclear distances re re can be changed if we somehow succeed to weaken or strengthen this interaction .
we placed hypothetical point chargesqin the plane { ( 6-c ) ( 2-s)3 } at the distance ~5 from 2-s atoms of [ re12cs17(cn)6]complex ( fig .
the modeled point chargeq = 25e creates on the 2-s atom an electrostatic potential ~10 v which is 10100 times higher than typical an electrostatic potentials created by the atoms inside the complexes .
as can be seen , the electrostatic field of a point charge ( especially , a negative charge ) reinforces the exchange interaction between 6-c and 2-s atoms . as mentioned earlier , [ re12cs17(cn)6]is characterized by increased exchange interaction between 6-c and ( 2-s)3 .
therefore , the magnification of exchange interaction between 6-c and ( 2-s)3 in the complex [ re12cs17(cn)6]should result in its ionization and reduction in the distances between { re6 } subunits .
in fact , the increased localization of electronic lone pairs observed at the sulfur atoms in the positions 3-s(q
= 25e ) and 2-s ( q = + 25e ) can signify the beginning of the oxidation process ( [ re12cs17(cn)6][re12cs17(cn)6 ] ) ( fig .
hypothetic chargesq(green triangles ) on the plane containing three atoms 2-s and the atom 6-c elf distribution maps for [ re6cs17(cn)6]complex ( cutting plane re(2-s)re(6-c)):an = 6,q = 0;bn = 8,q = 0;cn = 8,q = + 25 , arrow ( lp ) points to the attractors of electronic lone pair;dn = 8,q = 25 , arrows ( lp ) point to the attractors of electronic lone pairs
thereby , the oxidation state and the distances between { re6 } subunits in the [ re12cs17(cn)6]complexes and , therefore , the electron properties of the system are shown to be controlled by an external electric field .
we believe that the on condition with higher conductivity corresponds to the complex [ re12cs17(cn)6 ] , since nmr spectroscopy reveals the strongest paramagnetic currents induced by external magnetic field .
the state can be achieved by applying external electric field in the plane containing three atoms 2-s and the atom 6-c of the complex [ re12cs17(cn)6 ] .
the study was supported by the rfbr grants ( 07 - 03 - 00912 and 08 - 03 - 00826 ) and by the presidium of the russian academy of sciences .
|
an abrupt change in internuclear re re distances between { re6 } subunits in the carbon - centered [ re126-cs17(cn)6]ncomplexes caused by the change of the oxidation state ( n = 6 , 8) is first theoretically shown to be possibly controlled by an external electric field.13c nmr signal is shown to change over ~400 ppm ( ~37 g ) for 6-c atom together withn .
thereby , the metal cluster [ re126-cs17(cn)6]ncan be considered as a perspective model of a molecular switch .
|
patients undergoing nephrectomy have a high incidence of postoperative pain despite the use of modern laparoscopic surgical techniques . in the postoperative period ,
these patients are often treated with patient - controlled opioids , epidural analgesia , or both . while effective , both of these treatment modalities carry risk , ie , opioids have a side effect profile including pruritus , nausea , and vomiting , and increase the risk of oversedation and apnea in patients at risk ( eg , those with sleep apnea ) .
epidurals have been associated with hypotension , post dural puncture headaches , changes in management of anticoagulation , as well as rare but serious infections , bleeding , and nerve injury .
transversus abdominis plane ( tap ) blocks have been described as a way of providing analgesia to the anterior abdominal wall with minimal risk.1 these blocks avoid the potential hazards associated with opioids and neuraxial blockade .
use of ultrasound to correctly identify structures during administration of these blocks should theoretically further lessen the risk of complications . to date
, only a handful of prospective randomized studies have been performed examining the clinical utility of tap blocks related to kidney transplant .
the first three studies24 showed improved pain scores in patients receiving the tap block , while frier et al5 showed no benefit .
additionally , mukhtar and khattak showed a decrease in nausea in the tap group.2 the aim of this prospective , randomized , double - blind , placebo - controlled study was to evaluate the efficacy of tap blocks in providing analgesia for patients undergoing laparoscopic hand - assisted nephrectomy for either tumor resection or kidney donation .
our hypothesis was that tap block would result in a significant reduction in both opioid consumption ( primary endpoint ) and pain scores ( secondary endpoint ) in the 24-hour period following surgery .
the study was approved by the mayo clinic institutional review board and registered at clinicaltrials.gov in january 2010 ( clinicaltrials.gov identifer nct01054469 ) . written , informed consent was obtained from 21 patients aged 2379 years .
initially , we had planned to enroll 50 patients over 2 years , but recruitment proved slower than anticipated , compounded by a surgeon taking a leave of absence , which prevented that goal from being reached before institutional funding expired .
patients were enrolled if they were aged 1880 years and were scheduled to undergo hand - assisted laparoscopic removal of a single kidney for either tumor or living donor nephrectomy .
exclusion criteria included : planned bilateral nephrectomy , pregnancy or lactation , inability or refusal to provide informed consent , inability to comprehend the use of a visual analog scale ( vas ) , an expressed desire for preemptive antiemetics , a history of opioid tolerance , known prior allergy to amide local anesthetics or any of the study drugs ( morphine ) , and a contraindication to regional nerve block ( bleeding disorder , infection at site of block ) .
patients who were converted to open surgery due to intraoperative complications were considered a screen failure and were excluded from further participation in the study .
the randomization chart was prepared by the statistician using the permuted block approach to achieve equal numbers of participants in each group .
participants received either 20 ml of 0.5% ropivacaine hydrochloride or 20 ml of 0.9% normal saline ( placebo ) bilaterally .
the study medication or placebo was dispensed by the operating room pharmacy and was not disclosed to the anesthesiologist performing the block , administering the anesthesia during the case , or performing the evaluations postoperatively .
patients were given mild sedation consisting of midazolam and fentanyl at the discretion of the investigator prior to administration of the block , as per standard clinical care .
they then underwent bilateral tap block immediately before surgery in the preoperative holding bay . the technique for tap block
is well described and consists of identification of the lumbar triangle of petit and subsequent injection of local anesthetic into the fascial plane between the internal oblique and transversus muscles using ultrasound guidance to ensure proper placement.6,7 participants received standard general anesthesia induction doses of propofol ( 23 mg / kg ) , fentanyl ( up to 250 g ) , and vecuronium or cisatracurium ( titrated to maintain train - of - four at one twitch using a nerve stimulator ) .
anesthesia was maintained with isoflurane at 1 minimum alveolar concentration ( mac ) with intermittent fentanyl boluses to a maximum of 250 g .
postoperatively , participants were given intravenous patient - controlled morphine analgesia dosed at 1 mg with an 8-minute lockout .
for inadequate pain control , defined as a pain score > 4 , the dose was increased to 1.5 mg every 8 minutes .
rescue doses were administered at the discretion of the attending physician . ideally , only morphine sulfate was to be used for breakthrough pain . if another opioid was administered , we converted the dose , using standard tables , to morphine equivalents .
we assessed pain score ( at rest and with movement ) using a va s at 0 , 2 , 6 , 12 , and 24 hours postoperatively .
pain scores were recorded as 0 ( no pain ) to 10 ( worst pain ever ) . additionally , we assessed the time to first request for analgesia and the total amount of morphine at each time interval .
we also assessed the presence of postoperative nausea and vomiting , the need for rescue antiemetics , and the level of sedation recorded as 0 ( awake and alert ) , 1 ( appears asleep but awakes easily ) , 2 ( asleep , difficult to arouse ) , or 3 ( deep sleep ) .
all patients complaining of nausea and requesting an antiemetic were treated with ondansetron 4 mg .
surgical exposure was obtained using either a 7 cm supraumbilical or infraumbilical midline incision and 23 laparoscopic port entry sites as determined by the surgeon .
incisions for the port sites ranged from 5 mm to 12 mm and were on the ipsilateral side .
study data were collected and managed using redcap ( research electronic data capture ) tools hosted at mayo clinic .
redcap is a secure , web - based application designed to support data capture for research studies .
it provides an interface for data entry , audit trails , automated export to statistical programs , and procedures for importing data from an external source.8 numerical variables were primarily summarized with the sample median ( minimum , 25th percentile , 75th percentile , maximum ) while categorical variables were summarized with number and percentage . in the evaluation of all primary and secondary aims , comparison of treatment groups ( placebo versus active ) was performed using fisher s exact test for categorical variables and the wilcoxon rank - sum test for continuous variables , while time to first request of opiates was evaluated using the log - rank test .
the study was designed to enroll 5 0 patients ( 25 per group ) , and was estimated to have 80% power to detect a 14 mg difference in opiate consumption . with the smaller than planned sample size ,
study data were collected and managed using redcap ( research electronic data capture ) tools hosted at mayo clinic .
redcap is a secure , web - based application designed to support data capture for research studies .
it provides an interface for data entry , audit trails , automated export to statistical programs , and procedures for importing data from an external source.8 numerical variables were primarily summarized with the sample median ( minimum , 25th percentile , 75th percentile , maximum ) while categorical variables were summarized with number and percentage . in the evaluation of all primary and secondary aims , comparison of treatment groups ( placebo versus active )
was performed using fisher s exact test for categorical variables and the wilcoxon rank - sum test for continuous variables , while time to first request of opiates was evaluated using the log - rank test .
p - values 0.05 were considered to be statistically significant . the study was designed to enroll 5 0 patients ( 25 per group ) , and was estimated to have 80% power to detect a 14 mg difference in opiate consumption . with the smaller than planned sample size ,
the characteristics for all 21 participants and for those in the placebo versus active treatment groups are summarized in table 1 .
participants ranged in age from 2 3 to 7 9 ( median 5 3 ) years of age and 12 ( 57% ) were male .
the median operative time was 217 minutes in the active treatment group and 168 minutes in the group that received placebo , while median length of stay was 2 days in both groups .
median 24-hour total opiate consumption was lower in the active treatment group than in the placebo group ( 26.6 mg versus 48.7 mg , p=0.13 , respectively ) .
the median amount of time after surgery until the first request for morphine by the participant was 59 minutes in the active treatment group and 50 minutes in the placebo group ( p=0.37 ) .
post - surgical abdominal pain , as measured by the vas , was compared between the two groups ( table 3 ) .
there was no evidence of a difference in vas pain scores between the two groups during the first 12 hours after surgery , either at rest ( all p0.47 ) or with bending of the knee ( all p0.62 ) .
however , at 24 hours after surgery , median vas pain scores were significantly lower for the active treatment group compared with the placebo group , both at rest ( 1 versus 4 , p=0.017 ) and with bending of the knee ( 1 versus 5 , p=0.002 ) .
although we did not formally evaluate the trend in pain scores over time , there is some evidence of a trend toward increased pain scores over the 24-hour post - surgery time period in the placebo group ( table 3 ) .
the incidence of nausea and vomiting after surgery is compared between the two groups in table 4 .
there was a trend toward a lower incidence of nausea in the 24 hours after surgery in the active treatment group compared with the placebo group ( 50% versus 91% , p=0.064 ) . however , there was no evidence of a difference in incidence of vomiting during the 24 hours after surgery between the two groups ( 20% versus 20% , p=1.00 ) .
there were significantly fewer requests for an antiemetic after surgery in the active treatment group than in the placebo group ( 50% versus 100% , p=0.012 ) .
the post - surgery sedation scores are compared for the two patient groups in table 5 .
the placebo group was more sedated than the active treatment group immediately after surgery , with eight ( 73% ) patients in the placebo group versus only two patients ( 20% ) in the active treatment group ( p=0.009 ) being either asleep or in a deep sleep .
there was no evidence of a difference in sedation level between the two groups at 2 and 24 hours after surgery ( all p0.58 ) .
as ultrasound - guided techniques have improved the efficacy and safety of tap blocks , there has been a renewed interest in their use to provide analgesia to the anterior abdominal wall .
multiple studies support the theory that tap blocks are effective in controlling pain for a variety of upper and lower abdominal surgeries.6,7,9,10 however , recent evidence suggests that these blocks may not be equally effective for all types of surgery.5,1113 this variation may be due to differences in the technique , timing , or amount of local anesthetic used.10 in this study , we investigated whether tap blocks would be effective in providing analgesia to patients undergoing hand - assisted laparoscopic nephrectomy in the hope that we could improve patient satisfaction with regard to pain , nausea , and somnolence . in our small randomized study , there was a trend , albeit not statistically significant , towards a decrease in total opiate consumption in the 24 hours after nephrectomy among patients who received the tap block compared with those who received a sham tap block with saline ( placebo ) .
this observation is consistent with prior published studies , which have shown improved pain control in the first 24 hours postoperatively.1416 this improvement in overall pain is also reflected by the decrease in pain scores at 24 hours , at both rest and with movement .
the resulting decrease in opioid consumption may also be the reason for the parallel decrease in incidence of nausea in the active group when compared with the placebo group .
the benefit gained in pain relief at 24 hours did not translate to improved time to discharge or overall sedation scores .
they have been described for kidney transplant recipients,2,3,5 liver transplant,17 and in control of immediate postoperative pain following pancreas transplant.18 to date , only one prospective study has described the use of tap blocks in kidney donors.4 hosgood et al administered 0.375% bupivacaine using a similar technique to that used in this study.4 we chose ropivacaine due to its safer cardiovascular risk profile in the event of accidental intravascular injection.19 as in our study , hosgood et al found that pain scores were reduced at 24 and 48 hours . additionally , total morphine consumption was significantly less in the first 6 hours ( active , 12.4 mg ; control , 2 1.2 mg ; p=0.015 ) but the difference lost its statistical significance over 48 hours .
hosgood et al also showed no benefit with regard to time to discharge or rates of nausea / vomiting , but did show improved sedation scores in the control group . due to the finite duration of action associated with a single injection of local anesthetic , addition of a catheter for continuous infusion may improve pain control in these patients .
jankovic et al3 described intraoperative placement of a catheter by the surgeon into the space between the transversus muscle and the internal oblique .
this resulted in improved pain control in seven patients when compared with a historical group .
they found that prior attempts to place the catheter transcutaneously resulted in a high failure rate .
subcostal approaches to catheter placement have been described.20,21 more studies looking at this modality in relation to living kidney donors are needed to fully assess its viability .
its small sample size prevented formal analysis of trends in opiate consumption , abdominal pain , nausea , vomiting , and sedation over time .
although we did find some significant differences between the two groups , our study still lacked power , and therefore the possibility of a type ii error ( ie , a false negative association ) should be considered .
additionally , in order to maintain a blinded study , skin sensation was not assessed prior to surgery . in clinical practice ,
adequacy of the block would have been assessed prior to skin incision . in an attempt to minimize this variance ,
ultrasound was used and a regional anesthesiologist with experience in tap blocks performed the procedures . in summary , we found that tap blocks reduced overall pain scores at 24 hours , with a trend toward decreased total morphine consumption .
nausea , vomiting , sedation , and time to discharge were not significantly different between the two study groups .
further large - scale studies should be undertaken to fully evaluate the clinical utility of this technique in renal transplant patients as well as in patients undergoing resection for tumor .
|
postoperative pain is a common complaint following living kidney donation or tumor resection using the laparoscopic hand - assisted technique .
to evaluate the potential analgesic benefit of transversus abdominis plane blocks , we conducted a randomized , double - blind , placebo - controlled study in 21 patients scheduled to undergo elective living - donor nephrectomy or single - sided nephrectomy for tumor .
patients were randomized to receive either 20 ml of 0.5% ropivacaine or 20 ml of 0.9% saline bilaterally to the transversus abdominis plane under ultrasound guidance .
we found that transversus abdominis plane blocks reduced overall pain scores at 24 hours , with a trend toward decreased total morphine consumption .
nausea , vomiting , sedation , and time to discharge were not significantly different between the two study groups .
|
the fission yeast schizosaccharomyces pombe is a convenient model to study cell morphogenesis ( hayles and nurse , 2001 ) .
wild - type cells are simple elongated rods growing at the cell poles and dividing in the middle . yet
, previous studies have outlined an interesting interplay between shape , growth and cytoskeletal organization .
the first component is the rigid cell wall surrounding yeast cells that maintains cell shape independently of the cytoskeleton .
second , the actin cytoskeleton is essential for cell growth and cell wall remodeling ( la carbona et al , 2006 ) .
lastly , although microtubules ( mts ) are not required for growth per se , they control the location of growth sites by depositing specific marker proteins ( mata and nurse , 1997 ; brunner and nurse , 2000 ; sawin and snaith , 2004 ) .
abnormal deposition , occurring for example in mutants where mts are shorter , results in cells that are either bent or branched ( sawin and nurse , 1998 ; snaith and sawin , 2005 ) .
mts also position the nucleus ( tran et al , 2001 ; loiodice et al , 2005 ) and thus define the site of cytokinesis ( daga and chang , 2005 ; tolic - norrelykke et al , 2005 ) and the partitioning of the cell into daughter cells .
hence , by controlling cell growth and division , mts impact the evolution of shape in the cell lineage . as mts are constrained within the cell , the converse is also true with mt organization being dependent on cell shape . for the rigid s. pombe cells ,
the two processes occur on very different timescales ; with mt lifetimes being in the order of minutes , whereas cells typically double in size after 3 h. consequently , individual mts are enclosed in a boundary that is effectively constant during their lifetime .
this means that it is valid to first study how mts depend on cell shape , and to later include cell shape changes .
we use here computer simulation for the first step , calculating the dynamic spatial organization of mts within a fixed cell shape .
this approach complements other efforts where cell morphogenesis is modeled with reaction diffusion equations ( csikasz - nagy et al , 2008 ) by focusing on the mt cytoskeleton .
interphase mts in fission yeast are typically forming 26 bundles , which are usually attached to the nucleus at their middle ( tran et al , 2001 ) ( figure 1 ) .
antiparallel mts overlap at their static minus ends , whereas the plus ends are dynamic and grow from the overlap zone toward the cell poles ( tran et al , 2001 ; hoog et al , 2007 ) . such bundles transmit forces produced at the cell poles by mt polymerization to the nucleus . to position the nucleus near the middle of the cell ( tran et al , 2001 ;
loiodice et al , 2005 ) , mts should efficiently target the cell poles , and have catastrophes ( the switch to depolymerization ) that are rare enough to enable mts to reach the cell cortex but not so rare as to induce bending of the mt around the polar cell wall ( tran et al , 2001 ) , a configuration that is not observed in wild - type cells .
the most popular explanation for the timing of catastrophes involves multiple molecular activities that are assembled at the cell poles ( mata and nurse , 1997 ) .
another possibility is that forces caused by mt polymerization feed back on mt dynamics ( dogterom et al , 2005 ) .
this possibility has so far not been confirmed mainly due to the lack of experimental tools in vivo . in this study , we have circumvented this problem using stochastic computer simulations to check whether the effect of force measured in vitro can explain the observed mt plus end dynamics in s. pombe .
this involved constructing three models of mt dynamics : model f ( force ) in which forces at mt tips regulate mt growth and catastrophe rates , model l ( length ) in which mt length affects catastrophe rate and model fl which combines both effects . to simulate the mt cytoskeleton in s. pombe
, we first idealized its 3d shape as a spherocylinder ( see figure 1b and c ) . a nucleus and mt bundles
were then added and confined within this volume . in vivo , mt bundles self - organize ( janson et al , 2007 ) , to form overlap zones of 0.840.29 m ( tran et al , 2001 ) . for the purpose of this study , it was sufficient to use fixed overlap zones and four bundles , each containing four antiparallel mts , which is representative of the average situation .
the nucleus was represented by a sphere , to which the overlap zones of the bundles were attached ( supplementary figure s4 ) .
the deformations of the nuclear membrane observed in vivo ( tran et al , 2001 ; daga et al , 2006 ) were incorporated into the model by attaching mt bundles to the nucleus using hookean springs of moderate stiffness .
the points to which the bundles were attached were also able to move on the nuclear surface .
this allowed elongating bundles to align with the cell axis , as in vivo ( supplementary figure s5 ) . in summary ,
the simulation comprised bundles of flexible mts and a connected spherical nucleus that were confined within a frictionless cortex . although mt minus ends were static , plus ends grew and shrank independently of each other , thus producing polymerization forces , fiber deformation and nuclear movements .
the physical equations describing the evolution of this system were solved numerically as explained before ( nedelec and foethke , 2007 ) .
the advantage of using s. pombe as a model organism is that numerous dynamical properties of mts have been measured by light microscopy , and this enables the models to be quantitatively compared to reality .
table i lists the 10 in vivo properties of mts that were used to evaluate computational models .
these 10 traits summarize most of the currently established knowledge of the wild - type cells that are relevant for mt organization .
note that it was necessary to adjust the definitions of these traits to what is available from the literature ( see supplementary information ) .
for example , it was important to distinguish bundle catastrophes , ' that affect the longest mt in a half - bundle from other mt catastrophes .
other catastrophes are harder to observe because mts overlap in vivo , and were often not reported ( brunner and nurse , 2000 ; drummond and cross , 2000 ; tran et al , 2001 ) .
independently of the traits , characteristics of the cell geometry , mt bending elasticity and cytoplasmic viscosity were obtained from the literature or determined experimentally in the course of this study ( see supplementary information ) .
the models discussed here contain two parameters : the polymerization speed v0 and the catastrophe rate c0 .
they are evaluated by running thousands of simulations with random values of v0 and c0 , and then testing which trait was matched in each simulation .
this systematic numerical exploration of the parameter space is centered on v02.4 m / min , which is observed under standard laboratory conditions ( tran et al , 2001 ) , and extends to regions where traits start to fail .
model f corresponds to an in vitro experiment , which showed that a barrier could inhibit tubulin assembly ( dogterom and yurke , 1997 ) .
these results were described by vg = v0 exp(f / fs ) ( equation a ) , where fs1.7 pn specifies the sensitivity to force , and f is the projected force between the barrier and the mt tip ( figure 1c ) .
in addition , reduced assembly in vitro was shown to promote catastrophes according to b : c=1/(a+bvg ) ( janson et al , 2003 ; janson and dogterom , 2004 ) .
model f used equations ( a ) and ( b ) with the forces calculated for each mt .
the constants fs and a were measured experimentally with purified tubulin . the constant b was calculated as the solution of ( b ) with c = c0 and v = vo such that c0 and v0 correspond to the catastrophe and assembly rates of unconstrained mts .
the resultant value of b differs from that measured in vitro , because it represents the combined effects of mt - associated proteins ( maps ) present in the cell . a value for b corresponding to what was reported in vitro without mt regulators results in excessively long mts that curl around the cell pole .
we found that simulations with model f consistently matched t18 ( traits of the wild - type cell ) around the reference values of c0 and v0 ( supplementary figure s1 ) .
however , these simulations failed to match t9 and t10 in this region , which lead us to investigate these traits further .
experimentally , t9 was measured in cells that are made asymmetric by centrifugation , with the nucleus ending up nearer one cell pole .
it was observed that during nucleus re - centering , mts have longer contact time with the proximal than with the distal pole ( 9253 and 4636 s , respectively ; daga et al , 2006 ) .
model f showed opposite effects because , as shown by our simulation , mts experience stronger compression on the proximal side than on the distal side .
n / l ) , which indicates that the maximum force of an mt at equilibrium is inversely proportional to its length .
however , contrary to this formula , the simulation considers the rate of mts reaching the cell ends , and the motion of the nucleus and thus calculates the effective force rather than an upper limit .
the other unmatched trait t10 represents the centering precision of bundles when they are not attached to the nucleus ( carazo - salas and nurse , 2006 ) . to understand why t10 fails
, we can consider the simpler situation of an unattached bundle made of two antiparallel mts .
this bundle mechanically behaves as a single elastic beam of small viscous drag : the forces at both ends equalize very fast .
consequently , the plus tips of both mts experience similar forces no matter where the overlap zone is located : there are little centering cues .
the simulation shows that the situation with bundles of four mts is essentially similar : they are centered on average , but with a large variance of 3 m .
however , when a nucleus is present , additional averaging occurs on the positions of mt minus ends : the nucleus connects multiple independent bundles , and averages their fluctuations over time , because its mobility is much lower than that of individual bundles .
thus , t10 contains different information than t7 and t8 . in conclusion , although model f matched most measurements listed in table i , its failure to match t9 and t10 prompted us to investigate how it could be adjusted .
in the situation considered for t9 , mts are shorter on the proximal side than on the distal side , and therefore the observed asymmetry in contact times may indicate that the length of an mt influences its stability , which was not the case in model f. to test this possibility , we simulated a catastrophe rate that depends on mt length l according to c = hl/(a+bvg ) ( equation b ) .
the constant h was set to 0.2/m , so that c0 would determine the catastrophe rate at l=5 m ( the length at which mts typically undergo catastrophe in average cells ) .
this makes the resulting model fl directly comparable to model f , except that longer mts are less stable compared with short ones . with model fl , t9 was matched with , for example , contact times of 10268 s on the proximal side , and 5131 s on the distal side . the length dependence overcompensated for the effects of force in a situation where the nucleus is close to the cell pole .
in fact , model fl matched the 10 traits robustly with respect to ( v0 , c0 ) around their expected in vivo values ( figure 2a ) .
although the average mt cortex contact time in the symmetric case was already considered in t4 , comparing the shape of their distribution would provide another test of the model . to this extent
, we measured 303 in vivo contact events ( 6636 s mean and standard deviation ) .
being approximately 20% shorter , they were comparable to what had previously been reported ( 8346 s ) ( daga et al , 2006 ) .
interestingly , model fl matched the distribution ( see figure 3a ) , showing that the contact times are explained by the memory - less ( first - order ) mt catastrophe transition , because as mts continue to grow after contact , forces building up increase the instantaneous catastrophe rate .
note that this distribution is also matched by model f ( see supplementary figure s2 ) , which was anyhow discarded for other reasons .
the simulation also predicts the location of the hidden mt catastrophes ( figure 3b ) , which are frequent but difficult to observe in vivo because these events occur on the side of a longer mt in the same bundle .
such phenomenon was observed previously in xenopus egg extracts ( dogterom et al , 1996 ) , and tischer et al have confirmed experimentally that this behavior occurs in s. pombe cells , observing that catastrophe rates increase linearly from 0.1/min at l2 m up to 0.3/min at l5 m , for mts that do not contact the cell cortex ( tischer et al , in this upload ) .
the measured magnitude of the dependence of catastrophe upon mt length is identical to what we have assumed , in the center of the region in which all traits are fulfilled ( c0=0.3/min ) .
it is tempting to speculate about the molecular mechanism that could mediate the destabilization of longer mts .
the s. cerevisiae kinesin-8 kip3p produce a length - dependent destabilizing activity in vitro , because after binding at any point along the length of the mt , it moves processively to the tips , where it has a depolymerizing activity ( gupta et al , 2006 ; varga et al , 2006 ) .
it is possible that the two homologs of kip3p in s. pombe , klp5p and klp6p ( west et al , 2001 ) have a similar activity .
consistent with this view , the double deletion of klp5 and klp6 produced elongated mts that curl at cell poles ( west et al , 2001 ) , and reduces the length dependence of catastrophe ( tischer et al ) .
simulations show that length - dependent catastrophe rates offer several potential advantages to the cell .
first , nucleus repositioning is faster by a factor 2 in model fl compared with model f ( data not shown ) , because proximal mts push for a longer time than distal mts ( t9 ) .
second , bundles that are observed to detach from the nucleus ( tran et al , 2001 ; carazo - salas and nurse , 2006 ) would keep their overlap regions better centered ( their variance was 2 m instead of 3 m for model f ) , which may allow them to reattach more rapidly ( we did not simulate this hypothesis ) . finally , a model l having the length dependence present in model fl , but without any force dependence also fails to fulfill all traits ( supplementary figure s1 ) , showing that the length dependence is not sufficient to adjust mts within the cell .
hence , in model fl , the established response to force together with the length - dependent mt - destabilizing activity of maps , leads to the accurate description of the dynamics of mts in wild - type s. pombe cells .
remarkably , in both model f and fl , it was not necessary to assume that the cell poles had any localized activity associated with them that would affect mts .
this shows that , as anticipated ( dogterom et al , 2005 ) , forces in principle are sufficient to account for the location of mt catastrophes at the cell poles . in future work
, it will be necessary to explicitly distinguish maps to be able to recapitulate their mutant phenotypes . to do so
will require knowing how the dynamic equilibrium distribution of maps near mt tips is affected by force .
however , having no free parameter , our current model is already predictive in calculating how cell morphology affects a wild - type mt cytoskeleton , and this sheds light on some mutant phenotypes . in the current model , the catastrophe rate c0 represents the combined action of all maps on mts .
this in particular includes the potential effect of tea1p , tip1p or tea2p , which are located on growing mt plus ends .
these proteins are later deposited at the cell ends , but our model does not include any influence of the deposited proteins on mts in return . in the case of tea1p ,
however , such an influence has been suggested ( brunner et al , 2000 ) , because genetic deletion affects mts .
the observed defect is that mts exhibit curling at the cell poles ( see figure 3c ) . in the simulation
, we noticed that cell diameter ( but not cell length ) affected mt curling ( see figure 3d ) .
this prompted us to measure mt curling in vivo , together with the dimensions of cells .
there also , we found a clear correlation between cell diameters and the extent of mt curling ( see figure 3e ) , and no correlation between cell lengths and curling .
thus , the curling phenotype can be explained by the fact that tea1 cells were , on average , wider than wild - type cells ( figure 3f ) .
furthermore , thin tea1 cells exhibited a comparable level of curling to wild - type cells of similar diameter , which confirmed that the mt phenotype is largely the consequence of the increased diameter , and that unlike previously speculated , tea1p may not directly influence mt catastrophes .
the variability around the average behavior is smaller in the simulation than in reality , most likely because irregularities in cell shape together with measurement errors have not been modeled .
the slopes of the best linear fit were comparable in vivo and in the computational model ( figure 3d and e ) . in summary
, it seems that unbranched tea1 cells have wild - type mts in a body that is wider than wild type
this is beyond the scope of the current study however , because it requires redefining many of the traits , which are only meaningful for cells having two ends .
the simulation available on www.cytosim.org can be extended to further investigate mt organization in s. pombe .
a successful account of interphase mt dynamics , as initiated here , is a necessary step to understand the determination of cell shape in this simple organism .
this file contains
a. a list of supplementary movies and files ;
b. a description of the simulation methods ;
c. a detailed description of the traits listed in table 1 ;
d. a description of the parameters of the simulation , with details on how their values were set from the previous literature .
e. a description of the methods used to generate figure 3d and e. frequently asked questions supplementary figure s2
|
the cytoskeleton is essential for the maintenance of cell morphology in eukaryotes . in fission yeast , for example , polarized growth sites are organized by actin , whereas microtubules ( mts ) acting upstream control where growth occurs .
growth is limited to the cell poles when mts undergo catastrophes there and not elsewhere on the cortex . here , we report that the modulation of mt dynamics by forces as observed in vitro can quantitatively explain the localization of mt catastrophes in schizosaccharomyces pombe
. however , we found that it is necessary to add length - dependent catastrophe rates to make the model fully consistent with other previously measured traits of mts .
we explain the measured statistical distribution of mt
cortex contact times and re - examine the curling behavior of mts in unbranched straight tea1 cells .
importantly , the model demonstrates that mts together with associated proteins such as depolymerizing kinesins are , in principle , sufficient to mark the cell poles .
|
gastric and duodenal ulcer is still one of the most important and expensive gastrointestinal diseases .
the discovery of helicobacter pylori and its role in defining the etiopathogenesis of ulcer disease has changed radically the pathogeny of ulcer .
the combination of modern antisecretory drugs and eradication of helicobacter pylori has changed the treatment option in favor of conservative therapy and surgery , once the main treatment option , became now exceptional , at least for uncomplicated gastroduodenal ulcers . moreover , even if acute complications ( bleeding , perforation ) or chronic ( penetration , stenosis ) of the ulcer occur , which usually require surgical solutions , the current trend is to use alternative conservative ( endoscopic hemostasis ) or if surgery can not be avoided , it should solve only the complication ( peritonitis or haemorrhage ) , leaving the pathogenic treatment of ulcers for the conservative therapy .
perforation represents the most acute and serious complication of peptic ulcer , being responsible for most deaths .
when is perforating , ulcerative lesion destroys all layers of gastric or duodenal wall , allowing leakage of gastric or duodenal contents into the peritoneal cavity , followed by its contamination with germs and the occurrence of peritonitis .
our study covers a number of 256 patients with perforated gastric or duodenal ulcer treated in the 1st surgical department of the emergency county hospital of craiova between 2002 - 2008 .
data was collected from clinical observation sheets , surgical procedures protocols and necropsy protocols and entered into a standard form , then centralized and processed using microsoft excel .
with an average incidence of 35 cases per year ulcer perforation was more common in patients coming from rural areas .
also , the maximum incidence of disease was seen in male patients - sex ratio = 6.31 / 1 , maybe due to higher frequency of risk factors for this category of patients . studying the risk factors , which have included alcohol , smoking and nsaids intake , showed that this factors are present in our statistics in more than 50% of cases ( 152 patients = 59.37% ) .
chronic alcohol consumption was present in 47 ( 18.35% ) cases , smoking in 33 ( 12.89% ) cases , the combination of smoking alcohol in 60 ( 23.43% ) cases and the use of nsaids in 12 ( 4.68% ) cases .
73 ( 29% ) patients have been known with ulcer , with radiological and /or endoscopic confirmation and suffering lasted between 1 and 20 years , 62 ( 24% ) patients had a history of a ulcerous - type ( 42 patients ) or nonspecific ( 20 patients ) dyspepsia , but without any confirmation .
we also observed that in 41.98% ( 121 ) of cases , perforation occurred as the first symptom of disease , particularly in younger patients , smokers and alcohol consumers .
the onset of perforation was suddenly , in full health in patients without any apparent history of ulcer or sore in full flare in patients with confirmed ulcers and onset - admission interval was between 30 minutes and a few days ( 5 max ) , most patients ( 167 = 65.23% ) presenting in the emergency department less than 6 hours after the onset of painful symptoms .
the clinical picture was dominated by pain , present in all cases , with known characters , vomiting was inconsistent in perforated peptic ulcers , but it may occur in two circumstances : the onset of chemical peritonitis caused by the peritoneal irritation due to the passage of gastric contents into the peritoneum , which triggers vomiting reflex , usually containing food and old peritonitis neglected , in occlusive stage , when vomiting are the result of mechanical and inflammatory occlusion .
the incidence of vomiting at the onset of ulcer perforation is significantly higher in gastric perforations ( 72.7% ) than in the duodenum ( 60.84% ) , due to the irritation of caused by the gastric content .
hiccups , present at the onset of perforation in 75 cases ( 29.29% ) was due to peritoneal diaphragm irritation and hydro - aeric bowel distension secondary to intestinal paresis in the stage of chemical peritonitis .
the patient examination provided local and general signs , extremely useful for positive diagnosis of peritonitis , etiological assumption of peptic ulcer perforation and to assess the overall biological balance of the patient .
plain abdominal x - ray provided the following data :
- unilateral or bilateral pneumoperitoneum in 172 cases ( 67.18% ) , of which gastric perforation 27 cases ( 61.36% ) and duodenal perforation in 145 cases ( 68.39% ) .
we have to highlight that in 32.81% of cases plain abdominal x - ray radiography did not reveal any pneumoperitoneum without thereby invalidating the diagnosis in the context of other clinical signs .
- hydroaeric images in neglected cases , in occlusive stage - 24 ( 9.35% ) .
abdominal ultrasound , not a routine examination , was performed in 19 ( 22.61% ) patients helping to establish the diagnosis in cases with suggestive clinical picture but without pneumoperitoneum .
biological investigations are not specific for the diagnosis , but are necessary to establish baseline biological balance and to follow the dynamic evolution of the patient . in our study group ,
preoperative preparation was generally a short - term , averaging 1 - 6 hours , extended preoperative preparation has been done over this limit in cases with severe , neglected peritonitis , in patients with severe fluid and electrolyte imbalances , oliguria or hemodynamically unstable .
topographic distribution analysis of ulcer perforation showed following : for duodenal ulcer , perforation was found in 209(81.64% ) cases on the anterior wall of the duodenal bulb , of which 15 ( 7.07% ) patients had also a second posterior bulbar ulcer , and in 3 ( 1.41% ) cases were recurrent ulcers , after gastric resection and perforations were located on the duodenal slope of the gastro - duodenal anastomosis .
surgical treatment of perforated ulcer . for the gastric ulcer , perforation was found across all segments , the most common site for the ulcer perforation was prepyloric ( 18 = 40.9% ) , followed by the anterior wall ( 14 = 31.81% ) , lesser curvature ( 8 = 18.18% ) , subcardial area ( 2 = 4.54% ) and posterior wall ( 2 = 4.54% ) . regarding the size of perforation we admitted that perforation less than 3 mm are small , from 3 to 6 mm
are average , between 7 - 10 mm large and very large those over 10 mm . in our study , over 80% of cases had small perforations ( 126 ) and medium ( 91 ) .
our study showed that for gastric ulcers perforated ulcers , perforation occurred as a complication of old ulcers , callous , large in 24 ( 54.5% ) cases ; in 18 cases ( 40.9% ) perforation edges were flexible , and for the remaining four giant perforated ulcer , 2 cases were gastric cancer confirmed by histopathology .
table 1 more than half of perforated duodenal ulcers were acute ulcers ( 110 cases = 51.88% ) , in 68 cases perforation occurred in the evolution of chronic ulcer and in another 34 ( 16.32% ) cases perforation occurred in the evolution of already complicated ulcers with penetration ( 18 = 8.49% ) or stenosis ( 16 = 7.54 ) . in terms of surgical intervention we used these types of surgery table 2 .
209 ( 81.64% ) patients had a good postoperative course and were discharged on average after 7 days after surgery .
postoperative morbidity in perforated peptic ulcer still remains at high values . in our study , 52 patients had complications : local ( 38 = 14.83% ) or general ( 14 = 5.46% ) , with a postoperative morbidity rate of 20.31% .
local complications were mainly represented by the surgical wound infection , but we also recorded 4 cases with anastomotic leaks , one case of upper gastrointestinal hemorrhage , 3 patients with hemoperitoneum . given that all cases were operated , postoperative mortality rate is identical to that of general mortality and was 2.34% ( 6 deaths)- acute pancreatitis ( 1 case ) , myocardial infarction ( 2 cases ) and pulmonary embolism ( 3 cases ) .
perforated ulcer presents with one of the noisiest and severe surgical emergencies - peritonitis syndrome , which raises all issues thus the surgeon can establish the diagnosis after an algorithm , which involves the successive stages of a positive , differential and etiological diagnosis .
diagnosis should be made as soon as possible , because treatment of peritonitis has the character of " immediate emergency " [ 1 , 2 ] . except a few selected cases with a well - coded indication ( perforation in the last 2 hours after onset , elderly , high surgical risks patients ) that may tempt a conservative treatment after taylor - wagensteen method ( nasogastric suction , ice on the abdomen , antibiotics , antacid medication , sedatives
, pain relievers ) , surgery is the main treatment option in peptic ulcer perforation .
tactical , the surgeon may choose to solve only complication ( perforation and its consequence - peritonitis ) and concomitant association of an operation to break up ulcer pathogenic mechanisms [ 3 , 4 ] .
option for one of therapeutic options depends on : the ulcer morphology ( topography , size etc . ) , peritonitis characteristics and patient s comorbidities ( age , general condition , different life - threatening diseases , etc . ) [ 1 , 5 , 6 ] .
preoperative preparation consisted of mounting a naso - gastric tube , hydroelectrolitic balance correction , broad spectrum antibiotics that are effective on known type of oral flora germs , monitoring vital signs , monitoring diuresis .
preoperative preparation was generally a short - term , averaging 1 - 6 hours ; extended preoperative preparation has been done in cases with severe , neglected peritonitis , in patients with severe fluid and electrolyte imbalances and acid - base , oliguria , hemodynamically unstable .
general anesthesia with oro - tracheal intubation was the anesthetic technique used in all cases because it allows monitoring vital functions and ensures the comfort of a good exploration , allowing the surgeon to solve the lesion and treat the peritonitis .
regarding the actual surgery , therapeutic attitude has changed considerably over the past 20 years ; currently the pathogenesis of ulcer links can be attacked by conservative treatment methods ( antisecretory treatment and eradication of hp ) , closing the perforation and peritonitis treatment is considered the elective attitude , with stable and favorable results in time . following this trend , in almost half of cases ( 116 = 45.31% ) the operation consisted in simple closure with a graham patch carried out by open surgery ( 96 cases ) or laparoscopic ( 20 cases ) .
the procedure , once aimed primarily for duodenal ulcers , has been extended to some gastric ulcers ( 16 = 36.63% ) , usually small , prepyloric ulcers , with supple margins and chemical peritonitis .
ulcer excision ( 31 cases ) followed by pyloroplasty solves the complication , ensure a good gastric drainage ; and it can be a therapeutic option in young patients without risk factors , with perforated duodenal ulcers located on the front of the bulb or prepyloric gastric ulcers .
vagotomy makes this process one with an etiopathogenic base , this therapeutic option was chosen for 65 patients ( 25.39% ) : 7 with prepyloric ulcers and 58 duodenal perforated ulcers .
distal gastric resection , formerly with broad indications for perforated peptic ulcer surgery , has very limited indications lately ; it is now reserved for johnson type i and iv gastric ulcers and duodenal ulcers exceptionally with double localization or when perforation occurs to a patient with ulcer already complicated with stenosis , penetration or bleeding .
gastric resection was practiced in 17.18% of cases ( 16 gastric and 28 duodenal ulcers ) . as for how to restore transit after gastric resection
, we used mostly gastro - duodenal anastomosis - type ( bilroth - pean ) 70 cases .
in case of an old , callous ulcer , with significant local morphological reshuffle were chosen different technical options such as francois - dubois ( 6 cases ) or gastrojejunoanastomosis hoffmeister - finsterer type in 4 cases or reichel - polya in 2 cases [ 8 , 9 ] . regardless
the type of operation applied , the second major objective was the topical treatment of peritonitis and consisted in the lavage of the peritoneal cavity with warm saline solution in large quantities , removal of false membranes and wide drainage of all areas of the peritoneum cavity ( douglas pouch , laterocolic and subphrenic space ) .
postoperatively all the patients received treatment , which continued the supportive therapy started preoperatively and consisted of : monitoring vital signs , naso - gastric suction maintained until the reduction of gastric stasis and the resumption of transit , hydroelectrolitic balance correction , antibiotic therapy ( broad spectrum antibiotics ) , antisecretory therapy ( proton pump inhibitors , h2 antagonist ) and eradication of helicobacter pylori [ 10 , 11 ] .
in the current etiopathogenic and therapeutic design of ulcer disease , surgery is reserved for the acute ( perforation and bleeding ) and chronic complications ( stenosis / penetration ) and exceptionally or the patients with a prolonged history of uncomplicated ulcers with lack of response to conservative therapy . for the acute surgical complications , according to the literature , the therapeutic option adopted was to solve the complications ( simple closure of the perforation , ulcer excision with pyloroplasty and peritoneal cavity lavage and drainage ) and the medical conservative therapy was indicated to attack the pathogeny of the disease .
|
the treatment of perforated ulcer disease continues to evolve because of recent advances in pharmacology , bacteriology , and operative techniques . despite antisecretory medication and helicobacter pylori eradication , it is still the most common indication for emergency gastric surgery associated with high morbidity and mortality .
a clinical study was carried out on patients with perforated gastric or duodenal ulcer , admitted in the 1st surgery department between 2002 and 2008 . during the 7 years of study
there were admitted 256 patients with perforated ulcer - 212 cases of duodenal and 44 cases of gastric perforated ulcer .
the main surgical treatment option was simple closure with graham patch , followed by ulcer excision and vagotomy with pyloroplasty .
the second major objective was the topical treatment of peritonitis and consisted in the lavage of the peritoneal cavity and drainage .
distal gastric resection has now very limited indications .
we recorded no complications postoperatively . in the modern treatment of ulcer
, surgery is reserved for the acute ( perforation and bleeding ) and chronic complications ( stenosis / penetration ) and exceptionally or the patients with a prolonged history of uncomplicated ulcers with lack of response to conservative therapy .
|
acute cholecystitis and appendicitis are the most common intra - abdominal emergencies that complicate pregnancy .
they are associated with significant rates of spontaneous abortion , premature labor , and fetal mortality .
historically , appendicitis and cholecystitis were managed medically until postpartum when surgery could be performed with minimal maternal risk and no fetal risk .
acute worsening , or severe illness required prompt surgical intervention with laparotomy . over the past seven years , laparoscopic surgery has evolved as a potential treatment option for pregnant patients . until recently , it had been avoided during pregnancy .
this paper reports on six pregnant patients successfully treated with laparoscopic appendectomy or cholecystectomy and describes the risks and benefits of this new management technique .
charts were reviewed at our institution of all pregnant patients who underwent laparoscopic cholecystectomy or appendectomy .
an open laparoscopic approach with the hasson trocar rather than the veress needle was utilized in each case .
summary of operative procedures prom - premature rupture of membranes etop - elective termination of pregnancy
the physiologic alterations of pregnancy , if not recognized or understood , may delay patient presentations , diagnosis , and the initiation of treatment .
this delay translates into increased fetal mortality , ranging from rates of 5% in cases of acute appendicitis to 20% in cases of advanced disease or perforation .
similarly , increased maternal and fetal risk has been observed in cases when symptoms have been present for more than 24 hours prior to surgery .
once a diagnosis has been made , there are additional concerns associated with performing surgery .
the increased incidence of preterm labor and miscarriage observed with standard cholecystectomy and appendectomy in pregnancy has been a valid basis for concern . in approximately two of every thousand pregnancies ,
preventing unnecessary fetal injury during surgery is a key consideration . in our series of six cases of laparoscopic appendectomy and cholecystectomy , all patients and fetuses survived the procedure .
we briefly discuss the diagnosis and medical management of appendicitis and cholecystitis in the pregnant patient , and focus on a review of the advantages and risks of laparoscopic appendectomy and cholecystectomy during pregnancy .
appendicitis during pregnancy is falsely diagnosed and has negative explorations in 35 to 50 percent of cases .
the significance of abdominal pain , nausea , vomiting , and a leukocytosis are difficult to assess because of their expected occurrence in normal pregnancy .
the finding of right lower quadrant pain at mcburney 's point is also less helpful because uterine growth displaces the appendix and cecum superiorly in the abdomen .
radiologic studies such as abdominal films , urograms , and upper gastrointestinal series all expose the fetus to radiation and the potential for fetal malformation , oncogenesis , and death .
the medical management of cholecystitis and appendicitis during pregnancy typically includes fetal monitoring , intravenous hydration , analgesia , and antibiotics .
medical management during pregnancy carries a significant risk of treatment failure ( approximately 35% of cholecystitis cases ) , prolonged hospital admissions , and pregnancy loss .
treatment complications or failures , as evidenced by recurrent bouts of cholecystitis or biliary colic , necessitate surgery . despite the emergence , increased use , and success of laparoscopy
, an open surgical approach has remained the procedure of choice for managing appendicitis and cholecystitis during pregnancy .
similar to medical management , surgical treatment and its associated therapies may result in unwanted adverse effects .
surgical procedures in pregnant patients have been associated with a 10 to 15 percent increased risk of premature labor .
open cholecystectomies and appendectomies have been known to increase the incidence of preterm labor as well as miscarriage .
after surgery has been completed , potential problems exist with the use of certain antibiotics , opioids , and nonsteroidal anti - inflammatory medications .
the lack of prospective trials and understudied risks of laparoscopy have prevented the extrapolation of laparoscopy 's success in the general patient population to the pregnant population .
women suspected of having ectopic pregnancies have been found at laparoscopy to have normal first - trimester pregnancies , and have progressed with normal gestations and births .
reedy et al . recently published an analysis of a swedish health registry dataset comparing laparoscopy to laparotomy during pregnancy .
the authors compared 2181 laparoscopies to 1522 laparotomies stratifying for five fetal outcomes : birth weight , gestational duration , intrauterine growth restriction , congenital malformations , stillbirths , and neonatal deaths .
there was no difference in the five fetal outcome variables between the laparoscopy and laparotomy groups .
a survey of the society of laparoendoscopic surgeons addressing complications of laparoscopy in pregnancy was performed by reedy et al .
responses to the survey suggested that laparoscopy may be performed safely in the gravid patient .
it is recognized that selection bias limits the interpretation of this data . in light of these clinical experiences and advancements in laparoscopic technology
, general surgeons are increasingly performing laparoscopic surgery on pregnant patients . to date , the results of more than 50 laparoscopic cholecystectomies performed in pregnant patients , with 15 concomitant intraoperative cholangiograms , have been reported . in this group of patients
twenty - seven patients had delivered at the time these reports were published , and all but two children were born healthy and at full term .
one child was born at 37 weeks with hyaline membrane disease , while another patient gave birth to twins at 36 weeks gestation . in 1987 , spirtos reported no fetal loss after 13 pregnant patients received diagnostic laparoscopy for suspected appendicitis .
there were no maternal complications ; however , fetal outcomes were not reported . in a more recent report , curet et al .
fetal complications in the laparoscopic group included oligohydramnios , tight nuchal cord , macrosomia , and failure to progress .
these complications occurred with no greater incidence than in the same hospital 's obstetric population that did not receive surgery .
there were no statistically significant differences between the delivery - related complications observed in the laparoscopic and open laparotomy groups .
these reports suggest no significant increase in maternal - fetal complications following the performance of laparoscopic cholecystectomy or appendectomy . as experience with laparoscopy increases ,
the unique diagnostic and therapeutic advantages of this surgical approach are emerging . in patients who present with confusing clinical pictures , laparoscopy and direct visualization of the appendix
is a valuable diagnostic tool . in a study of non - pregnant patients , laine et al .
randomized 50 female patients , ages 16 to 40 , with acute right lower abdominal pain to receive either laparoscopy or open appendectomy .
diagnosis in the laparoscopic group was established in 96% of cases versus 72% in the open group .
unnecessary appendectomies were performed in 44% of open group but only 4% in the laparoscopic group .
intraoperatively , there is less uterine manipulation with laparoscopy and , therefore , there is less risk of preterm labor and spontaneous abortion . the majority of laparoscopy 's advantages , however ,
the incisions required for laparoscopic procedures are smaller and patients experience less postoperative pain , thereby requiring decreased volumes of narcotic analgesia .
patients often resume a regular diet within 24 hours of surgery , reducing fetal nutritional stress .
less narcotics also means less fetal respiratory depression , risk of fetal narcotic addiction , and in utero fetal narcotic withdrawl . decreased postoperative pain encourages earlier ambulation , which assists in preventing the formation of deep venous thromboses .
lastly , smaller incisions decrease the formation of abdominal adhesions , which may occur in 70% to 80% of patients undergoing laparotomy .
the greatest concern of performing laparoscopy during pregnancy is the carbon dioxide ( co2 ) insufflation of the abdomen to maintain an operative visual field .
insufflation increases intra - abdominal pressures and may decrease venous return to the heart and subsequent cardiac output .
maternal hypotension and fetal hypoxia potentiate the risks of intraoperative fetal morbidity and mortality . increased intra - abdominal pressures may also restrict blood flow to the uterus by directly compressing the uterine vasculature .
carbon dioxide has been reported to diffuse across placental membranes in both animal and human models .
hunter et al . described the effects of a pneumoperitoneum on the acid - base status , heart rate , and blood pressure in pregnant sheep . creating a co2 pneumoperitoneum decreased the ph into acidemic range of both mother and fetus , increased mean fetal heart rate , and increased mean fetal arterial pressure .
hunter concluded that hypercarbia and not increased intra - abdominal pressure was the cause of the changes seen , and there did not appear to be significant risk to the healthy fetus .
those who underwent co2 insufflation developed maternal and fetal hypoxemia , acidosis , hypercarbia , and increased variability in heart rate and blood pressure.15 curet et al . studied the effects of co2 pneumoperitoneum in pregnant ewes .
a co2 pneumoperitoneum of 15 mmhg for 30 minutes resulted in a decrease in uterine blood flow , increased intra - abdominal pressure , maternal tachycardia , fetal hypertension , and maternal and fetal acidosis .
all ewes delivered healthy lambs at full gestation , and there were no long - term deleterious effects .
the placenta is usually adept at the removal of co2 from the circulation and protecting the fetus from adverse effects .
this protective mechanism makes the observed intraoperative elevations in end - tidal co2 and paco2 less concerning , especially in those patients without pre - existing cardiopulmonary disease .
unfortunately , the altered physiologic state of pregnancy increases patients ' susceptibility for developing a metabolic acidosis .
the concern is that the compensatory mechanisms ( increases in ventilation ) aimed at maintaining an acid - base equilibrium may be insufficient to prevent the formation of an acidosis during the prolonged exposure to co2 which occurs with abdominal insufflation .
maternal hyperventilation during surgery should minimize maternal paco2 and pha . in all of our reported cases
one final complication of laparoscopy in pregnancy is uterine injury due to inadvertent puncture by the veress needle or during trocar insertion .
this may result in uterine insufflation and co2 embolization . in all of our cases , only the hasson trocar was utilized .
recommendations have been published outlining how to avoid the potential complications of laparoscopy during pregnancy .
the second trimester appears to be the optimal window for surgical intervention because organogenesis is complete , and there is minimal teratogenic risk . in addition , a second trimester uterus will not obstruct the operative visual field or disrupt surgical technique .
less uterine manipulation decreases the risk of preterm labor and spontaneous abortion . during surgical management
preoperatively , the patient should be positioned towards a left lateral decubitus position to displace the intra - abdominal pressures of the pneumoperitoneum and the gravid uterus away from the inferior vena cava and increase venous return .
some authors recommend an oral antacid ( e.g. , sodium citrate , 30 ml ) and metoclopramide , 10 mg , iv prior to surgery to reduce the risk of pulmonary acid aspiration .
the patient should wear lower extremity pneumatic compression devices throughout surgery and postoperatively until the patient begins to ambulate .
regional anesthesia is preferred in pregnant patients even though general anesthesia presents minimal risk to the fetus from the second trimester onwards .
access to the peritoneal cavity is best achieved through the use of a hasson trocar .
this method avoids the use of the veress needle , decreasing the risk of uterine or intra - abdominal injury due to blind needle placement .
intraoperative monitoring of maternal end - tidal co2 and paco2 is advised to assess acid - base balance.15,28
lastly , a consensus has not been reached on the necessity of intraoperative fetal heart monitoring .
the decision to monitor with transvaginal or abdominal ultrasound during the surgical procedure appears to be patient - specific based on severity of illness , age of the fetus , and the level of involvement of consulting obstetricians .
appendicitis during pregnancy is falsely diagnosed and has negative explorations in 35 to 50 percent of cases .
the significance of abdominal pain , nausea , vomiting , and a leukocytosis are difficult to assess because of their expected occurrence in normal pregnancy .
the finding of right lower quadrant pain at mcburney 's point is also less helpful because uterine growth displaces the appendix and cecum superiorly in the abdomen .
radiologic studies such as abdominal films , urograms , and upper gastrointestinal series all expose the fetus to radiation and the potential for fetal malformation , oncogenesis , and death .
the medical management of cholecystitis and appendicitis during pregnancy typically includes fetal monitoring , intravenous hydration , analgesia , and antibiotics .
medical management during pregnancy carries a significant risk of treatment failure ( approximately 35% of cholecystitis cases ) , prolonged hospital admissions , and pregnancy loss .
treatment complications or failures , as evidenced by recurrent bouts of cholecystitis or biliary colic , necessitate surgery .
despite the emergence , increased use , and success of laparoscopy , an open surgical approach has remained the procedure of choice for managing appendicitis and cholecystitis during pregnancy .
similar to medical management , surgical treatment and its associated therapies may result in unwanted adverse effects .
surgical procedures in pregnant patients have been associated with a 10 to 15 percent increased risk of premature labor .
open cholecystectomies and appendectomies have been known to increase the incidence of preterm labor as well as miscarriage .
after surgery has been completed , potential problems exist with the use of certain antibiotics , opioids , and nonsteroidal anti - inflammatory medications .
the lack of prospective trials and understudied risks of laparoscopy have prevented the extrapolation of laparoscopy 's success in the general patient population to the pregnant population .
women suspected of having ectopic pregnancies have been found at laparoscopy to have normal first - trimester pregnancies , and have progressed with normal gestations and births .
reedy et al . recently published an analysis of a swedish health registry dataset comparing laparoscopy to laparotomy during pregnancy .
the authors compared 2181 laparoscopies to 1522 laparotomies stratifying for five fetal outcomes : birth weight , gestational duration , intrauterine growth restriction , congenital malformations , stillbirths , and neonatal deaths .
there was no difference in the five fetal outcome variables between the laparoscopy and laparotomy groups .
a survey of the society of laparoendoscopic surgeons addressing complications of laparoscopy in pregnancy was performed by reedy et al .
responses to the survey suggested that laparoscopy may be performed safely in the gravid patient .
it is recognized that selection bias limits the interpretation of this data . in light of these clinical experiences and advancements in laparoscopic technology
, general surgeons are increasingly performing laparoscopic surgery on pregnant patients . to date , the results of more than 50 laparoscopic cholecystectomies performed in pregnant patients , with 15 concomitant intraoperative cholangiograms , have been reported . in this group of patients
twenty - seven patients had delivered at the time these reports were published , and all but two children were born healthy and at full term .
one child was born at 37 weeks with hyaline membrane disease , while another patient gave birth to twins at 36 weeks gestation . in 1987 , spirtos reported no fetal loss after 13 pregnant patients received diagnostic laparoscopy for suspected appendicitis .
there were no maternal complications ; however , fetal outcomes were not reported . in a more recent report , curet et al . describe four laparoscopic appendectomies in which there were no immediate peri - operative complications .
fetal complications in the laparoscopic group included oligohydramnios , tight nuchal cord , macrosomia , and failure to progress .
these complications occurred with no greater incidence than in the same hospital 's obstetric population that did not receive surgery .
there were no statistically significant differences between the delivery - related complications observed in the laparoscopic and open laparotomy groups .
these reports suggest no significant increase in maternal - fetal complications following the performance of laparoscopic cholecystectomy or appendectomy .
as experience with laparoscopy increases , the unique diagnostic and therapeutic advantages of this surgical approach are emerging . in patients who present with confusing clinical pictures , laparoscopy and direct visualization of the appendix is a valuable diagnostic tool . in a study of non - pregnant patients ,
randomized 50 female patients , ages 16 to 40 , with acute right lower abdominal pain to receive either laparoscopy or open appendectomy .
diagnosis in the laparoscopic group was established in 96% of cases versus 72% in the open group .
unnecessary appendectomies were performed in 44% of open group but only 4% in the laparoscopic group .
intraoperatively , there is less uterine manipulation with laparoscopy and , therefore , there is less risk of preterm labor and spontaneous abortion . the majority of laparoscopy 's advantages , however ,
the incisions required for laparoscopic procedures are smaller and patients experience less postoperative pain , thereby requiring decreased volumes of narcotic analgesia .
patients often resume a regular diet within 24 hours of surgery , reducing fetal nutritional stress .
less narcotics also means less fetal respiratory depression , risk of fetal narcotic addiction , and in utero fetal narcotic withdrawl . decreased postoperative pain encourages earlier ambulation , which assists in preventing the formation of deep venous thromboses .
lastly , smaller incisions decrease the formation of abdominal adhesions , which may occur in 70% to 80% of patients undergoing laparotomy .
the greatest concern of performing laparoscopy during pregnancy is the carbon dioxide ( co2 ) insufflation of the abdomen to maintain an operative visual field .
insufflation increases intra - abdominal pressures and may decrease venous return to the heart and subsequent cardiac output .
increased intra - abdominal pressures may also restrict blood flow to the uterus by directly compressing the uterine vasculature .
carbon dioxide has been reported to diffuse across placental membranes in both animal and human models .
hunter et al . described the effects of a pneumoperitoneum on the acid - base status , heart rate , and blood pressure in pregnant sheep . creating a co2 pneumoperitoneum decreased the ph into acidemic range of both mother and fetus , increased mean fetal heart rate , and increased mean fetal arterial pressure .
hunter concluded that hypercarbia and not increased intra - abdominal pressure was the cause of the changes seen , and there did not appear to be significant risk to the healthy fetus .
those who underwent co2 insufflation developed maternal and fetal hypoxemia , acidosis , hypercarbia , and increased variability in heart rate and blood pressure.15 curet et al . studied the effects of co2 pneumoperitoneum in pregnant ewes
. a co2 pneumoperitoneum of 15 mmhg for 30 minutes resulted in a decrease in uterine blood flow , increased intra - abdominal pressure , maternal tachycardia , fetal hypertension , and maternal and fetal acidosis .
all ewes delivered healthy lambs at full gestation , and there were no long - term deleterious effects .
the placenta is usually adept at the removal of co2 from the circulation and protecting the fetus from adverse effects .
this protective mechanism makes the observed intraoperative elevations in end - tidal co2 and paco2 less concerning , especially in those patients without pre - existing cardiopulmonary disease .
unfortunately , the altered physiologic state of pregnancy increases patients ' susceptibility for developing a metabolic acidosis .
the concern is that the compensatory mechanisms ( increases in ventilation ) aimed at maintaining an acid - base equilibrium may be insufficient to prevent the formation of an acidosis during the prolonged exposure to co2 which occurs with abdominal insufflation .
maternal hyperventilation during surgery should minimize maternal paco2 and pha . in all of our reported cases , the co2 insufflation pressures were maintained below 15 mmhg .
one final complication of laparoscopy in pregnancy is uterine injury due to inadvertent puncture by the veress needle or during trocar insertion .
this may result in uterine insufflation and co2 embolization . in all of our cases ,
recommendations have been published outlining how to avoid the potential complications of laparoscopy during pregnancy .
the second trimester appears to be the optimal window for surgical intervention because organogenesis is complete , and there is minimal teratogenic risk . in addition , a second trimester uterus will not obstruct the operative visual field or disrupt surgical technique .
less uterine manipulation decreases the risk of preterm labor and spontaneous abortion . during surgical management
preoperatively , the patient should be positioned towards a left lateral decubitus position to displace the intra - abdominal pressures of the pneumoperitoneum and the gravid uterus away from the inferior vena cava and increase venous return .
some authors recommend an oral antacid ( e.g. , sodium citrate , 30 ml ) and metoclopramide , 10 mg , iv prior to surgery to reduce the risk of pulmonary acid aspiration .
the patient should wear lower extremity pneumatic compression devices throughout surgery and postoperatively until the patient begins to ambulate .
regional anesthesia is preferred in pregnant patients even though general anesthesia presents minimal risk to the fetus from the second trimester onwards .
access to the peritoneal cavity is best achieved through the use of a hasson trocar .
this method avoids the use of the veress needle , decreasing the risk of uterine or intra - abdominal injury due to blind needle placement .
intraoperative monitoring of maternal end - tidal co2 and paco2 is advised to assess acid - base balance.15,28
lastly , a consensus has not been reached on the necessity of intraoperative fetal heart monitoring .
the decision to monitor with transvaginal or abdominal ultrasound during the surgical procedure appears to be patient - specific based on severity of illness , age of the fetus , and the level of involvement of consulting obstetricians .
this report adds to the growing evidence that laparoscopic cholecystectomy and laparoscopic appendectomy can be performed safely in pregnancy
there is some concern that two patients in our series did deliver pre - term , but the ultimate outcomes were favorable for both mother and child .
|
background : pregnancy was once considered a contraindication to laparoscopic cholecystectomy and appendectomy .
the progression of laparoscopic techniques has resulted in a continued reassessment of laparoscopic procedures during pregnancy .
there still exists some controversy as to the safety of laparoscopic procedures during pregnancy .
this paper reviews our series of six pregnant patients treated laparoscopically for appendicitis and cholecystitis.methods:charts were reviewed of all pregnant patients who underwent laparoscopic cholecystectomy or appendectomy at st clare 's hospital schenectady , new york between 1992 and 1996 .
six patients were identified .
patients and obstetricians were contacted to investigate the results of the pregnancy.results:all patients and fetuses survived the procedure .
two patients delivered prematurely but remote from the operative procedure .
all infants were healthy postpartum .
one patient underwent an elective abortion as she had planned .
the abortion was remote from the surgical procedure.conclusion:our series adds to the growing evidence that laparoscopic cholecystectomy and laparoscopic appendectomy can be performed safely during pregnancy .
|
glufosinate ammonium , ammonium ( 3-amino-3-carboxypropyl)methyl phosphinate , is a broad - spectrum contact herbicide and a crop desiccant ( dries crops before harvest ) originally developed by agrevo .
glufosinate , also known as phosphinothricin , is a naturally occurring phytotoxin that was first isolated from the bacteria , streptomyces viridochromogenes [ 13 ] .
glufosinate ammonium is used worldwide to control a broad range of both annual and perennial broadleaf weeds in fruit orchards , vineyards , rubber and oil palm plantations , ornamental trees and bushes , noncrop land , and preemergence in vegetables [ 4 , 5 ] .
in addition , glufosinate ammonium is used as a desiccant in potatoes , sunflowers , and so forth [ 6 , 7 ] . in soil ,
glufosinate ammonium is mainly degraded to 3-methylphosphinico - propionic acid ( mpp ) , which may undergo further degradation to 2-methylphosphinico - acetic acid ( mpa ) .
the most important factor affecting glufosinate ammonium degradation in soil is microorganisms , while other factors such as temperature , light , and rainfall may increase the degradation rate [ 1 , 2 , 811 ] .
glufosinate ammonium is soluble in water ( > 500 g l at ph 59 , 20c ) and stable to light and hydrolysis at ph 5 , 7 , and 9 .
simultaneous determination of glufosinate ammonium and its metabolites is difficult due to their high polarity , low volatility , high aqueous solubility , and lack of either uv chromophore or fluorescence [ 1214 ] .
therefore , these compounds require derivatization before analysis by gas chromatography ( gc ) or liquid chromatography ( lc ) can be performed . prior to our studies ,
the detection of glyphosate , aminomethylphosphonic acid ( ampa ) , and glufosinate by capillary electrophoresis with indirect fluorescence detection was reported by chang and liao . in 1996 , kataoka et al . developed a method for the determination of glyphosate and glufosinate in river water , soil , and carrot samples by gc using a flame photometric detector ( fpd ) after derivatization .
their derivatization method involved the use of isopropyl chloroformate ( isopcf ) and diazomethane , reagents that are potentially explosive and carcinogenic thereby limiting the use of this method .
used 4-chloro-3,5-dinitrobenzotrifluoride ( cnbf ) , which may react with primary or secondary amines in the sample , to derivatize glufosinate in maize samples for quantification by lc .
analyzed glufosinate , glyphosate , and ampa concentrations in water samples using 9-fluorenylmethylchloroformate ( fmoc - cl ) for precolumn derivatization followed by lc with fluorescence detection ( fld ) .
however , fmoc - cl derivatization of mpp and mpa present in the sample was unsuccessful , and no response values were found by lc - fld .
for the simultaneous determination of glufosinate , its metabolite , and glyphosate present in brown rice , whole wheat , cabbage , tomato and onion with acetic acid and trimethyl orthoacetate ( tmoa ) .
stalikas and pilidis also used tmoa as a derivatization agent for the determination of pesticides containing amino acid groups by gc with mass - selective detection ( msd ) .
derivatized glyphosate , glufosinate , and their major metabolites ampa and 3-mppa with tmoa and simultaneously determined their concentrations in samples of rice and soybean sprouts using gc - pfpd .
royer et al . also used this derivatization method to detect glufosinate ammonium and its metabolites mpp and mpa in water by gc with tandem mass spectrometry . to our knowledge , there are no reports of a method to simultaneously detect glufosinate ammonium and its metabolites mpp and mpa and determine their environmental fate in field soil samples .
the aim of this study was to develop an accurate and cost - effective gc - fpd method to evaluate the dissipation of glufosinate ammonium and its metabolites after treatment in soil collected from open field trials and their storage stability at 20c .
the analytical standards for glufosinate ammonium ( 99.2% ) , mpp ( 97.9% ) , and mpa ( 99.4% ) were obtained from beijing perfect technology co. , ltd .
( beijing , china ) . the glufosinate ammonium formulation ( 200 g l aqueous solution ( as ) ) was purchased from hebei veyong bio - chemical co. ltd .
standard solutions of glufosinate ammonium , mpp , and mpa were prepared with methanol ( 1.0 g l ) .
working standard solutions for calibration were prepared by dilution with methanol to concentrations of 0.05 to 5.0 mg l. trimethyl orthoacetate ( analytical reagent grade ) was purchased from sigma - aldrich ( usa ) .
acetic acid and ammonium hydroxide ( both analytical reagent ) were purchased from sinopharm group chemicals co. , ltd . and beijing chemical reagent company ( beijing , china ) , respectively .
ethyl acetate ( hplc - grade ) was purchased from fisher scientific ( fair lawn , nj , usa ) .
water ( hplc - grade ) was prepared using a milli - q water purification system ( millipore , usa ) .
the field trials for the dissipation experiments were conducted at two different locations , xingcheng ( liaoning province , northeast china , monsoon climate ) and zibo ( shandong province , eastern china , warm temperate climate ) from june to september in 2013 .
field trials were carried out from july 29 until september 26 in liaoning province and from june 30 to august 11 in shandong province .
the field trials comprised two treatments : the first with glufosinate ammonium and the second , the control , with no treatment .
each treatment was replicated on three field plots , each plot consisting of an area of 30 m. for the dissipation experiment , glufosinate ammonium ( as ,
200 g l ) was sprayed on the surface of the soil at a dosage of 1350 g a.i .
soil samples were collected from the three replicate plots from 0 ( 2 h ) , 1 , 2 , 3 , 5 , 7 , 10 , 14 , 21 , 28 , and 42 days after spraying .
the control test was conducted simultaneously on three replicate field plots without application of glufosinate ammonium .
approximately 1 kg of soil was randomly collected to a depth of 010 cm in each plot .
the soil samples were sifted through a one mm sieve , thoroughly mixed , and then stored at 20c until analyzed . to investigate the storage stability of glufosinate ammonium containing soil samples , glufosinate ammonium ( as ,
200 g l ) was sprayed onto the surface of the soil at a dosage of 1350 g a.i .
soil samples were randomly collected to a depth of 010 cm 2 h after spraying .
after the soil samples were thoroughly mixed , they were transferred into eight sealed plastic bags , each bag contained 200 g of soil , and then stored at 20c . for the storage stability experiment , these samples were analyzed on 0 , 1 , 3 , 7 , 14 , 21 , 30 , and 60 days after storage .
a 5.0 g portion of the soil sample was weighed into a 100 ml erlenmeyer flask and extracted with 50 ml of ammonium hydroxide 5% ( v / v ) by shaking for 1.5 h on an oscillator at 160 rpm .
the extract was transferred to a 50 ml centrifuge tube and then centrifuged at 3800 rpm for 10 min .
a 20 ml portion of the supernatant was then transferred to a 100 ml round bottom flask and evaporated to dryness at 60c under reduced pressure using a rotary evaporator . acetic acid ( 0.75 ml ) and tmoa ( 1.5 ml ) were then added to the residue and the mixture was sonicated at ultrasonic frequency 40 khz for 5 min .
the solution was then heated in a water bath at 95c for 1.5 h to complete the derivatization reaction and evaporated to dryness at 55c using a rotary evaporator .
the concentrated derivatives were dissolved in ethyl acetate ( 2.0 ml ) and filtered through a 0.22 m polytetrafluoroethylene ( ptfe ) membrane filter prior to analysis by gc - fpd .
the analysis was carried out with a shimadzu 2010 gas chromatography equipped with a flame photometric detector ( gc - fpd ) .
separation of the analytes was achieved using a rxi-17 fused silica capillary column ( 30 m 0.25 mm i.d . ,
0.25 m film thickness ) with a standard method ( 80c for 1.5 min , gradient of 30c min , hold at 175c for 2 min , gradient of 10c min , hold at 185c for 1 min , gradient of 30c min , hold at 250c for 10 min ) .
the carrier gas was high purity nitrogen ( 99.999% ) , which was set to a constant linear velocity with an initial flow rate of 1.0 ml min .
soil samples were spiked with glufosinate ammonium , mpp , and mpa ( 0.1 , 0.5 , and 1.0 mg kg each ) and left to stand for 1 h. five independent determinations were made for every fortification level .
the spiked soil samples were extracted and derivatized according to the procedure described in the section : sample preparation .
glufosinate ammonium , mpp , and mpa were derivatized by treatment with tmoa in the presence of acetic acid ; derivatization reactions are shown in figure 1 . upon treatment with tmoa and acetic acid , the hydroxyl and amino groups of glufosinate ammonium ,
mpp , and mpa were acetylated and the carboxylic groups were converted to methyl esters [ 12 , 20 ] . to ensure the derivatization reaction proceeded to completion
a mixture of the standard solutions ( 2 ml total volume ) containing glufosinate ammonium , mpp , and mpa ( 2.0 ng of each ) was reacted with tmoa and acetic acid at the following temperatures : 75c , 80c , 85c , 90c , and 95c for 90 min .
the results are shown in figure 2 . however , elevating the temperature from 75c to 95c did not dramatically increase the rate of reaction .
the fastest reaction occurred at 95c ; higher temperatures were not tested because reaction temperatures close to the boiling point of water were determined to be operationally unsafe . after determining 95c as the optimal temperature
, the following reaction times were investigated : 30 , 45 , 60 , 90 , and 120 min .
the results , shown in figure 3 , indicate that the best conversion was achieved after 90 min . in conclusion ,
the optimum temperature and time for the derivatization reaction were found to be 95c and 90 min , respectively .
mpa , mpp , and glufosinate ammonium derivatives were analyzed by gc - fpd using the conditions described ( see gc - fpd analysis ) and showed good response and separation .
figure 4 shows a representative example of a gas chromatogram for the derivatized compounds , each injected at a concentration of 1.0 mg l. the solubility of glufosinate ammonium in water is 1370 g l ( 22c ) ; however it is essentially insoluble in the majority of organic solvents . as a result
in addition , royer et al . extracted and purified glufosinate ammonium and its metabolites in water with an anion - exchange column ; the analytes were washed with ultrapure water and eluted with 50% formic acid .
the acidity or basicity of a solution , measured by its ph value , is an important factor influencing the ability to extract polar compounds .
therefore , pure water , water with 0.1% acetic acid , and water with 0.1% ammonium hydroxide were tested to extract glufosinate ammonium , mpp , and mpa from soil samples .
the extraction capacity of the alkaline solution was found to be superior to the others by comparison .
therefore , ammonium hydroxide was selected and the concentration of the ammonium hydroxide solution was investigated further .
ammonium hydroxide solutions were investigated at concentrations of 0.1 , 0.5 , 1 , 2 , and 5% ( v / v ) and the results are shown in figure 5 .
the recoveries of glufosinate ammonium and its metabolites increased with the concentration of the ammonia solution until 0.5% ; after that the recovery decreased with increasing concentration .
ammonia hydroxide solution 0.5% ( v / v ) was optimal for the extraction protocol . finally , the oscillation time was optimized for extractions using ammonium hydroxide solution 0.5% ( v / v ) with an oscillator at 160 rpm .
soil samples were shaken for 30 , 60 , 90 , 120 , and 150 min ; the extraction recoveries are shown in figure 6 .
results show that the recoveries of the compounds reached a maximum in less than 90 min and remained almost unchanged for samples shaken for a longer duration .
linear calibration curves were obtained for glufosinate ammonium , mpp , and mpa by plotting the average peak area versus the concentration .
the seven point calibration curves for the three compounds tested varied in a range from 0.05 to 5.0 mg
the calibration curves showed good linearity with correlation coefficients ( r ) between 0.991 and 0.999 .
the calibration curves were used to calculate the concentrations of glufosinate ammonium and its metabolites in soil .
the limit of detection ( lod ) values for glufosinate ammonium , mpp , and mpa were 0.01 , 0.005 , and 0.005 mg
l , respectively , which is lower than the lod value reported by tseng et al . for glufosinate and 3-mppa .
the limit of quantification ( loq ) values for glufosinate ammonium , mpp , and mpa were 0.05 , 0.02 , and 0.02 mg kg , respectively .
recovery is a significant challenge when attempting to quantify trace levels of an analyte from a complex matrix . to evaluate the accuracy and precision , soil samples were spiked with the standard solutions of glufosinate ammonium , mpp , and mpa at 0.1 , 0.5 , and 1.0 mg kg .
the precision of the method calculated by the relative standard deviation ( rsd ) ranged from 0.4% to 4.1% .
the recovery and precision results were acceptable and met the acceptability criteria of the residues analysis quality control guide ( general administration of quarantine of the people 's republic of china 2002 ) .
the dissipation samples were analyzed and the results were plotted as a graph of glufosinate ammonium concentration versus time . the dissipation curve for glufosinate ammonium in soil displays first order kinetics as shown in figure 7 .
the initial concentrations of glufosinate ammonium were 2.43 and 5.97 mg kg at 2 h after treatment for the field trials in liaoning and shandong province , respectively .
a gradual decrease in the glufosinate ammonium concentration in the treated soil was observed as a function of time after application .
the dissipation equation for glufosinate ammonium concentrations in soil was c = 2.1477e
with a correlation coefficient of 0.8501 and a half - life of 2.93 days in liaoning province and c = 4.9316e
with a correlation coefficient of 0.8553 and half - life of 2.30 days in shandong province .
there was no significant difference between the half - life of glufosinate ammonium in soil at two locations .
these results indicate that glufosinate ammonium degradation in soil is not affected by the weather or the soil type , ph , and water content .
as expected , an increase in the concentration of the metabolite mpa occurred from 2 h to seven days after glufosinate ammonium treatment in soil samples from liaoning and shandong provinces .
the peak concentration was measured on the seventh day ; for liaoning province it was 0.24 mg kg and for shandong province it was 0.22 mg kg .
after the seventh day , the concentration of mpa gradually and continuously dissipated until it could no longer be detected on the fourteenth day . unlike metabolite mpa , metabolite mpp could not be detected until the fifth day after application of glufosinate ammonium to the open field .
the peak concentration of mpp was achieved on the twenty - eighth day ; for liaoning province it was 0.11 mg kg and for shandong province it was 0.09 mg kg . although the initial concentrations of glufosinate ammonium were 2.43 and 5.97 mg kg in liaoning and shandong , respectively , the peak concentrations for the metabolites mpa and mpp are similar . this observation may indicate that glufosinate ammonium can degrade in soil to both mpp and mpa .
these results indicate that glufosinate ammonium in soil samples are stable for 60 days after spraying when stored at 20c .
therefore , this method is reliable since soil samples can be stored at 20c for up to two months before being analyzed and still provide accurate results .
glufosinate ammonium , mpp , and mpa in soil were extracted with ammonium hydroxide solution 5% ( v / v ) and derivatized with tmoa under the optimized conditions before being analyzed by gc - fpd . in comparison to the pretreatment methods
previously discussed , this method is environmentally friendly , inexpensive , and easy to execute .
the method used for the extraction and quantification of glufosinate , mpp , and mpa residues was found to be qualitatively and quantitatively accurate .
glufosinate ammonium dissipated with a half - life of 2.302.93 days in soil samples from two different locations in the northeast and east of china .
the results of this study should provide guidance for the safe application of glufosinate ammonium to agricultural products and environment .
|
a simple analytical method was developed to measure concentrations of glufosinate ammonium and its metabolites , 3-methylphosphinico - propionic acid ( mpp ) and 2-methylphosphinico - acetic acid ( mpa ) , in field soil samples . to determine the minimum quantification limit ,
samples were spiked at different levels ( 0.1 , 0.5 , and 1.0 mg / kg ) .
soil samples were extracted with ammonium hydroxide solution 5% ( v / v ) , concentrated , and reacted with trimethyl orthoacetate ( tmoa ) in the presence of acetic acid for derivatization .
the derivatives were quantified by gas chromatography ( gc ) using a flame photometric detector ( fpd ) .
the linear correlation coefficients of glufosinate ammonium , mpp , and mpa in soil were 0.991 , 0.999 , and 0.999 , respectively .
the recoveries of this method for glufosinate ammonium , mpp , and mpa in soil were 77.295.5% , 98.3100.3% , and 99.399.6% with relative standard deviations ( rsd ) of 1.84.1% , 0.41.4% , and 1.32.0% , respectively .
glufosinate ammonium dissipated rapidly in soil to mpa in hours and gradually degraded to mpp .
the half - life of glufosinate ammonium degradation in soil was 2.302.93 days in an open field . in soil samples stored at 20c glufosinate ammonium was stable for two months .
the results of this study should provide guidance for the safe application of the herbicide glufosinate ammonium to agricultural products and the environment .
|
legionellosis presents as two distinct clinical entities : legionnaires ' disease ( ld ) comprises pneumonia with severe multisystem disease and pontiac fever ( pf ) which is a self - limiting flu - like illness .
annually , on average , 6 cases of ld were reported to the health protection surveillance centre by the departments of public health in ireland between 1994 and 2007 .
this reported rate of two per million is low compared with other european countries , such as spain and france where rates of 24.8 per million and 22.8 per million were reported , respectively , in 2007 . in 2007 , the overall european rate of reported infection was 11.4 cases per million . in ireland ,
the suggested reason for this low reporting rate is a combination of underdiagnosis and underreporting of ld . during the time period 19942007 ,
ld is transmitted from the environment by inhalation of an infectious aerosol . in europe and ireland ,
almost all reported cases of ld are sporadic [ 2 , 3 ] and the source of the legionella for these cases is rarely determined .
such outbreaks of ld can be caused by communal sources such as hot tubs , spa pool , hospital , domestic or hotel showers , and wet cooling towers .
over a ten - day period in june - july 2008 , two cases of ld were reported to the department of public health , health services executive east ( hse - e ) in dublin .
both cases worked in a large dublin - based insurance firm and were based in a newly built office block in the city .
air conditioning within the building was confined to the printing / postal room ( 3rd floor ) and the conference / meeting rooms ( 6th and 7th floor ) .
this paper describes the cases with ld , the outbreak investigation , and subsequent management .
the first case of ld was a 58-year - old southern - european male smoker who worked in the postal department on the 3rd floor of the company office , and became unwell in early june .
he was admitted on june 25th to a dublin hospital with a 3-week history of fever , night sweats , chills , diarrhoea , and confusion .
diagnosis of ld was confirmed by l. pneumophila serogroup 1 urinary antigen test ( uat ) on the day of admission .
he was admitted to the intensive care unit for the management of renal failure associated with ld and was treated with clarithromycin .
this case was notified to the public health department on june 27th . on july 7th , a second case of ld ( case 2 )
case 2 was a 48-year - old irish male nonsmoker , who worked on the 5th floor of the company office .
he had been ill and off work for 7 days preceding his presentation to the same dublin hospital as case 1 , with a history of fever , headache , cough , diarrhoea , confusion , and paraesthesia of arms and legs .
on admission he was diagnosed with pneumonia and ld was confirmed by uat on the day of admission .
he was treated on the ward with clarithromycin and ciprofloxacin and was discharged home after 10 days .
apart from place of employment there were no other common links such as travel or social activities between both cases .
as a result of two linked cases of ld an outbreak control team was formed with representatives from public health , infection control , environmental health , microbiology , the health protection surveillance centre , and the health and safety authority . on july 8th , it was reported to the department of public health hse - e by company management that many employees were absent from work and had reported severe flu - like illness .
consequently , active case finding was carried out on the morning of july 8th in the company .
a standardised questionnaire was emailed to all company and contract employees who had worked in the building at any time during the previous 14 days .
information was requested on symptoms ( cough , headache , fever , muscle pains , diarrhoea , and flu - like symptoms ) , potential exposure ( office floor , air - conditioning , and shower use ) , smoking , travel , and demographics ( figure 1 ) .
we defined a case of ld as an employee of , or visitor to , the company office who had pneumonia with onset since june 1st , and legionella infection was diagnosed by culture , uat , or serology ( a single high titre or a four - fold rise in specific serum antibody to l. pneumophila serogroup 1 or serogroups 26 and 8) .
we defined a case of pf in the initial investigation as an employee of , or visitor to , the company office with symptoms of fever , headache , myalgia , and nonproductive cough with onset since june 1st .
sickness records were reviewed by human resources staff and absent workers were contacted to inform them of the outbreak and to enquire about their health and whether they had sought medical attention .
respondents who met our case definition for ld or pf were promptly telephoned by department of public health medical or nursing staff and advised on appropriate medical follow - up .
employees who attended the emergency department ( ed ) or their general practitioner ( gp ) were followed up to determine their symptomatology , investigation , results , and treatment .
subsequently , a designated clinic was arranged for all employees and contract workers who ( a ) met our case definition for pf or ( b ) had attended the ed or their gp with concerns regarding ld .
all were invited for legionella serology three weeks after likely exposure . in total ,
54 employees attended eds in the republic of ireland and northern ireland or their general practitioner with symptoms and/or concerns about ld or pf ; each had a uat , all of which were reported negative . of these
subsequently , 37 of these employees with possible symptoms of pf attended a special clinic for legionella serology .
no employee tested showed serological evidence of infection with l. pneumophila serogroups 16 and 8 , three weeks after likely exposure .
the serological tests were performed by the legionella reference services at the respiratory & systemic infection laboratory , hpa centre for infections , colindale , uk .
on july 8th , public health doctors met on site with the company 's health and safety manager , risk assessment manager , and human resources manager .
public health doctors , environmental health officers of the health services executive , and environmental health officers of dublin city council conducted an inspection and environmental risk assessment of the building . on july 9th , the health , and safety authority , the organisation responsible for ensuring safety , health and welfare at work , inspected the building .
the primary system consisted of two cooling towers located in the large basement carpark of the building .
the secondary system was a hot and cold water system used to service sinks and showers .
managers reported the use of an alarmed temperature control system for the water supply to the building .
as a precautionary measure , after case 1 was reported and prior to any treatment , multiple water samples were taken from both water systems and sent for pcr and culture for legionella spp .
samples from tower 1 were positive by pcr for legionella spp . but below detection level on culture ( table 1 ) .
samples from tower 2 were positive by pcr for legionella spp . at lower levels than tower 1 .
however , l. pneumophila was cultured from tower 2 at 100 colony forming units per litre ( cfu / l ) .
levels of l. pneumophila detected by pcr from the showers / sinks tested were below the threshold level for clinical significance defined by the chemical company , and l. pneumophila was not cultured from any showers / sinks tested .
the cooling towers have remained inactive and are now replaced by a dry cooling system .
both patients admitted to hospital were confirmed cases of ld by l. pneumophila serogroup 1 uat ( binax ) .
sputum samples from both patients , after they had commenced antibiotics , did not culture legionella species .
however sputum from case 2 sent to the legionella reference services at the respiratory systemic infection laboratory hpa was positive by pcr testing for l. pneumophila dna . however , there was insufficient dna to allow sequence typing of the strain . the environmental isolate from cooling tower 2
after the first case of ld was notified , an email alert was sent to 600 company employees informing them of the symptoms of ld and advising them to seek medical attention from their general practitioner if they had any concerns regarding illness .
in addition , every line manager endeavoured to contact their employees to confirm they had received relevant public health information of ld and were not symptomatic .
similar efforts were also made to check on contract employees and visitors to the company since june 1st . following reporting of the second case of ld
, an alert was sent to all general practitioners and ed consultants in the region by fax and email .
in addition , due to the high level of concern among the employees in the company , two educational / information sessions on ld were held in the office by medical doctors .
consequently , the most likely source of this cluster was the cooling towers in the basement car park .
definitive microbiological confirmation of the cooling towers as the source of infection required an isolate from one of the patients to match the environmental isolate . as l. pneumophila cultured from cooling tower 2 was typed as serogroup 1 mab2+ve which is a recognised cause of clinical infection and also a serogroup detected by uat , we can reasonably conclude that cooling tower 2 was the most likely source of this cluster . at present
, ireland does not have legislation requiring the registration of cooling systems at national level .
a system of statutory notification by the owner / occupier of such high risk sites , as recommended in recently published national guidelines , would facilitate investigation and control of future cases / outbreaks of legionellosis [ 2 , 6 ] . early identification and treatment of patients with ld have important implications for clinical management of patients and outcome .
studies comparing the clinical manifestations of legionella pneumonia to other types of pneumonia indicate that ld is not
atypical and clinical features such as diarrhoea and confusion are not sufficiently distinctive to distinguish ld from other causes of community - acquired pneumonia .
consequently , in order to increase awareness of ld as a possible diagnosis , after the initial case of ld was confirmed we immediately corresponded with company employees , management , as well as gp and hospital colleagues .
for example , an outbreak has been described where two workers in a cooling tower with different levels of exposure developed pneumonia and pf , respectively .
immunological conditions and underlying disease are among the factors that affect susceptibility to legionellosis [ 8 , 9 ]
. such factors may explain the broad spectrum of clinical presentation in our investigation where the majority of employees reported no symptoms , a substantial number reported a mild flu - like illness , and two employees developed ld .
few studies have addressed the practical value of pcr in routine clinical and environmental microbiology laboratories .
pcr offers theoretical advantages , such as a high sensitivity , rapid availability of results , and the potential to detect infections caused by various serogroups of l. pneumophila as well as by nonpneumophila species [ 1 , 10 , 11 ] .
conversely , the usefulness of pcr is limited by its inability to distinguish between live , viable nonculturable and dead legionella cells . in this cluster , while pcr provided time information on the number of legionella in the environmental samples tested , equivalence with the number of cfu by culture was not found .
our results were similar to previous studies which showed that pcr results are usually higher than culture values [ 11 , 12 ] .
it could be argued that pcr is too sensitive a method that detects viable nonculturable and dead legionella cells that may not necessarily be pathogenic and thus pcr is not an accurate measure of a real health risk .
nevertheless , in this outbreak , detection of legionella species by pcr was a marker of environmental contamination by legionella and led to preventive measures .
as culture of legionella remains the gold - standard in diagnosis of ld , we suggest that pcr should complement rather than replace traditional culture methods in routine clinical practice and in monitoring industrial cooling water systems until its use is further validated .
the affected premises in this cluster ware a new purpose built green building which was occupied for three months prior to the reported onset of illness .
a green building is defined as the practice of increasing the efficiency with which buildings use resources energy , water , and material while reducing the building 's impact on human health and the environment during the building 's lifecycle , through better siting , design construction , operation , maintenance , and removal . however , despite this aim , it is likely that malfunctioning of the cooling towers ' microbiological control programme was the source of employees ' illness in this outbreak .
illness because of exposure to some unseen agent in a workplace can cause alarm out of proportion to the risk . in this outbreak ,
the relative importance of panic and illness among workers were difficult to determine . however , the reported severity , similarity , and duration of symptoms among staff supported the diagnosis of a pf - like illness .
absence of specific laboratory diagnostics for pf mitigated against differentiation of psychological and pathological causes of reported staff illness .
improvements in diagnostic testing could lead to a better understanding of outbreaks of pf and also help differentiate this illness from other causes of influenza - like illness in order to direct consequent appropriate remedial action .
the nonspecific presentation of ld makes clinical diagnosis very difficult in most patients with community - acquired pneumonia of uncertain aetiology .
this test detects l. pneumophila serogroup 1 antigens in a urine sample within one hour with a specificity of 95% . in ireland , in 2007 , uat was the principal diagnostic method used for 75% of ld cases .
thus , patients with milder disease like pf may have been underdiagnosed if uats alone were used .
such a scenario has been previously suggested by authors who claim that serology in cases of pf is not consistently positive and also that the presence of urinary antigen is not systematic in detecting l. pneumophila serogoup 1 among pf patients [ 1619 ] .
this may be because these laboratory tests were primarily developed and used for diagnosis , of ld in hospitalised patients .
thus , the validity of these tests for those with mild clinical illness , not requiring hospital admission , has not been established .
this investigation demonstrated that timely intervention is vital in control of a cluster of legionellosis . in order to control , and
ideally prevent , future clusters of legionellosis we recommend the statutory notification of high risk sites and also improved diagnostic tests .
|
in june and july 2008 , two office workers were admitted to a dublin hospital with legionnaires ' disease .
investigations showed that cooling towers in the basement car park were the most likely source of infection .
however , positive results from cooling tower samples by polymerase chain reaction ( pcr ) did not correlate with subsequent culture results .
also , many employees reported pontiac fever - like morbidity following notification of the second case of legionnaires ' disease . in total , 54 employees attended their general practitioner or emergency department with symptoms of legionnaires ' disease or pontiac fever .
however , all laboratory tests for legionnaires ' disease or pontiac fever were negative . in this investigation
, email was used extensively for active case finding and provision of time information to employees and medical colleagues .
we recommend clarification of the role of pcr in the diagnosis of legionellosis and also advocate for a specific laboratory test for the diagnosis of the milder form of legionellosis as in pontiac fever .
|
raised creatinine is known to occur in hypothyroidism , and there are different mechanisms for this .
cases of hypothyroidism with severe myopathy , rhabdomyolysis , and acute kidney injury are rare and are limited to case reports.[13 ] we present one such patient who was directly referred to a nephrologist by the general practitioner suspecting renal pathology , and discuss the mechanisms of such a presentation and the importance of looking for alternative causes in a patient presenting with isolated elevation of creatinine .
a 30-year - old male presented with a history of generalized edema and significant weight gain of 20 kg in 6 months .
the creatinine was elevated at 2.12 mg / dl , which was the reason for referral to the nephrologist .
routine investigations revealed a completely normal hemogram and urine analysis , elevated creatinine at 2.17 mg / dl but normal blood urea at 15 mg / dl .
hypothyroidism was suspected , which was confirmed with a t3 of 0.19 ng / ml , t4 of 0.4 g / ml , and a thyroid stimulating hormone ( tsh ) of 780 iu / ml .
a diagnosis of severe hypothyroidism with myopathy was made and given the normal blood urea , normal urine analysis , and renal ultrasound , the raised creatinine was thought to be secondary to excessive production rather than impaired renal function .
he was commenced on thyroxine replacement therapy and a review in 2 weeks revealed a ck of 2,228 u / l and a creatinine of 1.5 mg / dl , both of which had normalized during the subsequent visit .
serum ck levels are often modestly elevated in hypothyroidism , but elevations in the levels usually seen in inflammatory myopathies or dystrophies are rare .
there are case reports of extremely high elevations of serum ck with or without rhabdomyolysis associated with hypothyroidism.[13 ] if such a patient has significantly elevated creatinine , it may either be due to excessive production or acute kidney injury ( aki ) caused by the toxicity of the non - protein heme pigment that is released from myoglobin .
a urine analysis that shows microhematuria in the absence of visible red cells by urine microscopy in the appropriate clinical setting is sufficient to diagnose aki due to rhabdomyolysis .
our patient was non - oliguric and had completely normal urine analysis , which ruled out rhabdomyolysis as the cause of his elevated serum creatinine .
an elevation in the serum creatinine concentration usually means a reduction in the glomerular filtration rate ( gfr ) , and is associated with a concomitant rise in the blood urea .
however , there are a variety of settings in which the creatinine can increase in isolation , independent of the gfr , and therefore there is no true change in the overall kidney function .
this may be due to one of the three factors : decreased creatinine secretion , interference with the serum assay , or enhanced creatinine production .
our case is one such example of a mechanism where there is likely to be a release of pre - formed creatinine from injured muscle and/or release of creatine that is then converted into creatinine in the extracellular fluid .
it is important to look for such unusual causes in someone with unexplained isolated elevation in serum creatinine , especially in the absence of other markers of renal disease like abnormal urine analysis or ultrasonological abnormality of the kidneys .
consistent and reversible elevation of serum creatinine in the hypothyroid state has been described in a study of 24 consecutive patients of iatrogenic hypothyroidism . in this study ,
the rise in creatinine levels did not relate to abnormalities in ck levels or abnormal urine analysis , suggesting that neither hypothyroid myopathy nor intrinsic renal disease contributed to the changes seen .
another study has shown significantly elevated serum urea and creatinine in patients with overt and sub - clinical hypothyroidism , which correlated positively with tsh levels . in our patient , both the ck and the serum creatinine levels were significantly elevated and blood urea was consistently normal with unremarkable urine analysis and renal ultrasound . both creatinine and ck levels improved together , suggesting that the elevated creatinine was a reflection of enhanced creatinine production in the muscle rather than decrease in the gfr .
proving this theory will involve measuring the gfr with radionuclide study or inulin clearance , which has not been carried out in this case .
serum cystatin c level has also not been measured in our patient ; however , the cystatin level showed no superiority when compared with serum creatinine estimation in the assessment of renal function in the setting of hypothyroidism .
to conclude , our patient had an unusually high level of ck , which resulted in elevation in his serum creatinine level , both of which normalized with the treatment of hypothyroidism .
elevation in serum creatinine levels can occur even in the absence of decline in the gfr , and one should look hard for unusual causes , especially in a patient with absence of concomitant elevation of blood urea .
|
myopathy is common in hypothyroidism , but a very high creatinine kinase ( ck ) level in the range commonly seen with inflammatory myopathy is rare .
reversible elevation of creatinine is known to occur in hypothyroidism due to a decrease in the glomerular filtration rate , but it can also occur rarely due to enhanced creatinine production . we present a case of severe hypothyroidism with massively elevated ck levels and high creatinine levels , both of which reversed on treatment of hypothyroidism .
|
mixed urinary incontinence ( mui ) is defined as a disease co - occurring with both urge urinary incontinence ( uui ) , in which involuntary urine leakage takes place as the result of urgency , and stress urinary incontinence ( sui ) , in which involuntary urine leakage takes place as abdominal pressure increases as the result of coughing or sneezing . as women age , the prevalence rate of mui or uui gets higher , and mui accounts for 30% to 50% of all incontinence .
the midurethral sling has been a main method in the treatment of sui since tension - free vaginal tape ( tvt ) surgery was first introduced as a surgical treatment for that type of incontinence owing to its simpler and less invasive process .
the transobturator tape ( tot ) procedure , which was introduced to supplement defects in the tvt operation , has been widely used as well .
it is often reported that the tot procedure has a high rate of success for sui .
although the success rate of operation for mui varies according to the report , it is mostly reported as being lower than the success rate of surgery for sui . also , there have been suggestions that surgical treatment for patients with mui is not appropriate because of the possibility that uui will continue despite surgery and that conservative treatment should therefore be the primary treatment for mixed incontinence .
interestingly , the mechanism through which the sling procedure improves urge incontinence is not fully known , but many studies have reported that the urgency symptoms of patients with mui improve when the sling procedure is performed
. koonings et al suggested that the mechanism through which urinary urgency takes place in mui is stimulation by urine leakage into the proximal urethra by increasing abdominal pressure .
those authors suggested that urgency and uui could be improved at the same time if urine leakage is stopped through surgery .
in addition , rezapour et al suggested that surgical treatment can be applied even to mui , while reporting that the success rate for mui is up to 85% after the tvt operation .
compared to sui , however , the success rate of surgical treatment for mui is not high enough to be satisfactory .
there may be some difference in interpreting the result of operations , but almost all studies show that unlike the high success rate of operations for sui , the success rate of operations for mui and patient satisfaction are rather low and uui continues after surgical treatment . because any kind of incontinence after surgery reduces patient satisfaction , persistent uui after the sling procedure in mui is the main cause for reducing the success rate of surgery for mui and patient satisfaction in general .
therefore , to identify risk factors for surgical failure in patients with mui and to increase patient satisfaction after the operation , it may be clinically useful to find risk factors related to persistent postoperative uui .
thus , we evaluated postoperative variables as well as the clinical characteristics of mui patients who underwent the tot procedure in an attempt to determine whether clinical factors had an effect on persistent uui after the tot procedure .
of 293 women who underwent a tot procedure from may 2007 to august 2010 , 175 women with mui were included in this study .
the study inclusion criteria were being a woman , having mui , and undergoing postoperative follow - up of more than 6 months .
the study exclusion criteria were the presence of any malignancy or urinary tract infection and postoperative follow - up of less than 6 months . to distinguish mui and sui ,
patients with sui symptoms were asked , " do you have a complaint of involuntary leakage accompanied by or immediately preceded by urgency ? " through history taking and a symptom questionnaire .
patients reporting such a complaint were distinguished as mui patients , and the cases having urgency without urge incontinence were not included as mui patients .
the preoperative evaluation included history taking , physical examination , urinalysis , urine culture , uroflowmetry , postvoid residual ( pvr ) , and urodynamic study ( uds ) . through the physical examination , we preformed a stress test and a q - tip test .
uds measures included maximal urethral closure pressure ( mucp ) , valsalva leak point pressure ( vlpp ) , and uninhibited detrusor contraction .
the tot procedures were performed by the same surgeon as reported by delorme et al . to ensure tension - free placement , the tape
a foley catheter was removed within 24 hours after surgery , and the patient was asked to self - void . when the postvoid residual was more than 100 ml or she could not void by herself , the patient was asked to try clean intermittent catheterization until the postvoid residual was less than 100 ml .
follow - up visits were scheduled at 1 week , 6 weeks , 3 months , 6 months , and yearly .
follow - up evaluation included questionnaire assessment , stress test , uroflowmetry , and postvoid residual measurement .
success of sui after the procedure was defined as the absence of any episodes of involuntary urine leakage during stressful activities and a stress test .
success of uui after the procedure was defined as the absence of any episodes of involuntary urine leakage mixed with urgency , and all cases except success were considered as failures . to determine the possible factors influencing the persistence of uui after the tot procedure , we used univariate logistic regression analysis . of those variables
the multivariate logistic regression was used to determine the independent risk factors for persistent uui after the tot procedure .
all statistical analyses were performed by using spss ver . 12.0 ( spss inc . , chicago , il , usa ) .
of 293 women who underwent a tot procedure from may 2007 to august 2010 , 175 women with mui were included in this study .
the study inclusion criteria were being a woman , having mui , and undergoing postoperative follow - up of more than 6 months .
the study exclusion criteria were the presence of any malignancy or urinary tract infection and postoperative follow - up of less than 6 months . to distinguish mui and sui ,
patients with sui symptoms were asked , " do you have a complaint of involuntary leakage accompanied by or immediately preceded by urgency ? " through history taking and a symptom questionnaire .
patients reporting such a complaint were distinguished as mui patients , and the cases having urgency without urge incontinence were not included as mui patients .
the preoperative evaluation included history taking , physical examination , urinalysis , urine culture , uroflowmetry , postvoid residual ( pvr ) , and urodynamic study ( uds ) . through the physical examination , we preformed a stress test and a q - tip test .
uds measures included maximal urethral closure pressure ( mucp ) , valsalva leak point pressure ( vlpp ) , and uninhibited detrusor contraction .
the tot procedures were performed by the same surgeon as reported by delorme et al . to ensure tension - free placement , the tape was adjusted without tension with a right angle clamp .
a foley catheter was removed within 24 hours after surgery , and the patient was asked to self - void . when the postvoid residual was more than 100 ml or she could not void by herself , the patient was asked to try clean intermittent catheterization until the postvoid residual was less than 100 ml .
follow - up visits were scheduled at 1 week , 6 weeks , 3 months , 6 months , and yearly .
follow - up evaluation included questionnaire assessment , stress test , uroflowmetry , and postvoid residual measurement .
success of sui after the procedure was defined as the absence of any episodes of involuntary urine leakage during stressful activities and a stress test .
success of uui after the procedure was defined as the absence of any episodes of involuntary urine leakage mixed with urgency , and all cases except success were considered as failures .
to determine the possible factors influencing the persistence of uui after the tot procedure , we used univariate logistic regression analysis . of those variables , only statistically significant variables were included in the multivariate model .
the multivariate logistic regression was used to determine the independent risk factors for persistent uui after the tot procedure .
all statistical analyses were performed by using spss ver . 12.0 ( spss inc . , chicago , il , usa ) .
the women 's mean age was 55.49.8 years ; 139 patients ( 79.4% ) were under 65 years old , and 36 patients ( 20.6% ) were over 65 years old .
postoperative maximal flow rate ( qmax ) and pvr were 27.12.0 ml / s and 30.415.8 ml , respectively .
those variables had not significantly changed in relation to the preoperative qmax ( 28.21.9 ml / s ) and pvr ( 26.513.4 ml ) .
postoperative urine retention occurred in 9 patients ( 5.1% ) , but all patients recovered within 3 days .
persistent sui after the tot procedure occurred in 16 patients ( 9.1% ) , and persistent uui after the tot procedure occurred in 51 patients ( 29.1% ) .
in addition , absence of persistent uui after the tot procedure occurred in 124 patients ( 70.9% ) , and among the 124 patients , persistent urgency after the tot procedure occurred in 25 patients ( 14.3% ) . to determine the possible factors influencing the persistence of uui after the tot procedure
old age and previous anticholinergics use were associated with persistence of uui after the tot procedure .
those two significant variables were analyzed in the multivariate model to determine the independent risk factors for the persistence of uui . in the multivariate model ,
only old age was a significant risk factor for the persistence of uui , and elderly age ( over 65 years old ) was associated with a 3.3-fold risk for persistence of uui after the tot procedure compared with middle age ( under 65 years old ) ( table 2 ) .
as shown in table 2 , there was no association between the presence of uninhibited detrusor contractions and persistent uui after the tot procedure .
we conducted statistical analysis to verify the factors that affected persistent uui after the tot procedure in 49 patients who showed uninhibited detrusor contraction in the uds , but found no significant factors .
to date , data on factors predicting the persistence of urge incontinence or failure after the sling procedure in patients with mui have been limited , and there are no consistent predictors of persistent uui after the sling procedure in mui .
segal et al reported that they found no factor to be related to surgical failure after the tvt operation .
paick et al suggested that a low mucp may be associated with persistent uui after the tvt procedure in patients with mui .
jeong et al suggested that maximal cystometric capacity and involuntary detrusor contraction were important predictors of surgical failure in mui .
another study reported that women with stress - predominant mui and without detrusor overactivity ( do ) or with low pressure do were more likely to be cured of their uui after a midurethral sling procedure . in comparison with studies related to the tvt procedure ,
detailed outcomes and clinical factors predicting the persistence of uui after the tot procedure have yet to be sufficiently reported .
furthermore , there is no significant difference in the surgical results between tvt and tot , but because there is some difference in postoperative voiding symptoms and complications between the two procedures , there remains a possibility that factors related to uui lasting continuously after both tot and tvt procedures do not correspond to each other . as a result , in this study we attempted to determine whether the clinical characteristics and preoperative examination results of mui patients can predict the risk of persistence of uui after the tot procedure . unlike previous studies
in other studies , factors related to the uds were mainly suggested as risk factors for persistent uui after surgery . because some cases have reported that symptoms of mui patients are not really reproduced as they are in uds , or that do appears in the uds but uui symptoms do not appear ,
there is a possibility that the accuracy of finding a risk group through factors related to the urodynamic study may be low . on the other hand ,
if risk factors are assumed on the basis of age as suggested by this study , it is possible to explain the chance of surgical failure by selecting patients who are at risk of uui easily and accurately without an invasive test like uds , which will be clinically easier and more useful .
the following explains why the persistence of uui after operation appears high for elderly women with mui .
first , older women often experience an outlet obstruction effect . as a result , voiding problems , like incomplete emptying and overactive bladder symptoms , lead to do , further leading to a possibility that uui occurs more often .
second , elderly women are more likely to suffer from severe intrinsic sphincter deficiency . such patients may not experience urgency because of severe stress incontinence .
however , after a tot operation , their urethral resistance can be reestablished , and their masked uui is more likely to reoccur .
third , it is said that out of patients with mui , those with urge - predominant mui are more likely to have a surgical failure than are those with stress - predominant mui .
this study does not clarify which factor is more serious , stress or urge , but the younger the patients are , the more likely they are to have sui , and the older the patients are , the higher the prevalence rate of mui or uui .
the failure rate of the operation will appear higher for patients of old ages , on the premise that there are lots of older patients with urge - predominant mui .
fourth , because old women tend to have shorter functional urethras , smaller urethral mobility , and larger urethral rigidity , such characteristics can influence the effect of the tape after the operation and are more likely to worsen the surgical result , although it is not clear how the mechanism works .
we suggest that old age can function as a factor useful enough to predict the result of treatment for mui patients who want the tot procedure . furthermore , explaining the possibility of persistent uui to elderly women ahead of surgery will lower their expectation for a successful operation , which can increase the patients ' overall satisfaction .
in addition , the possibility of postoperative complications with anesthesia is found to be higher in older patients .
it is essential to carefully choose the surgical treatment by comprehensively considering all the possibilities of surgical failures and nonsurgical complications if the patient is an elderly woman with mui who has severe or multiple medical problems .
a limitation of this study is that the follow - up period was as short as only 6 months , and the study was not really prospective . to confirm our findings
, we need to do additional research , including a large population and long - term follow - up .
in addition , more studies on the effect mechanism of old age should be conducted .
our results suggest that elderly women ( over 65 years old ) have a higher possibility of persistence of uui after the tot procedure than do middle - aged women ( under 65 years old ) .
therefore , elderly women with mui should be sufficiently informed of the possibility of persistent uui after the tot procedure , which will lead to an increase in patient satisfaction after surgery .
|
purposewe wanted to identify factors predicting persistent urge urinary incontinence ( uui ) after the transobturator tape ( tot ) procedure in patients with mixed urinary incontinence ( mui).materials and methodsof 293 patients who underwent a tot procedure from may 2007 to august 2010 , 175 mui patients had at least one 6-month follow - up visit .
preoperative evaluations including history taking , physical examination , urinalysis , urine culture , uroflowmetry , postvoid residual ( pvr ) , urodynamic studies ( uds ) , and symptom questionnaire were performed . after the operation , surgical outcome and patient satisfaction were assessed by symptom questionnaire , uroflowmetry , pvr , and stress test .
statistical analysis was carried out to determine the possible factors influencing persistent uui after the tot procedure.resultsof 175 patients with mui , 51 ( 29.1% ) had persistent uui after the tot procedure . in a univariate analysis , age ( p=0.012 ) and previous anticholinergic use ( p=0.040 )
were found to be associated with persistent uui .
however , only age ( adjusted odds ratio , 3.317 ; 95% confidence interval , 1.015 - 12.060 ; p=0.036 ) was an independent risk factor in the multivariate analysis.conclusionsour findings suggested that women who are older than 65 years may have an increased likelihood of persistent uui after a tot procedure .
clinicians should consider the possibility of persistent postoperative uui in elderly women with mixed incontinence .
|
slow coronary flow ( scf ) is an angiographic finding characterized with delayed opacification of epicardial coronary arteries without obstructive coronary disease .
scf is a relatively common angiographic finding with a reported incidence of 1% in patients undergoing coronary angiography for the suspicion of coronary artery disease ( cad ) . since the first description in 1972 by tambe et al .
, only a limited number of studies have focused on scf ; therefore , the precise pathophysiological mechanisms and the clinical importance of scf are not fully understood at the moment .
several mechanisms have been proposed for scf phenomenon including small vessel disease , microvascular vasomotor dysfunction , diffuse atherosclerosis , and endothelial dysfunction [ 36 ] .
occlusive disease of the small coronary arteries , which may be a form of early phase atherosclerosis , has also been suggested as a cause . moreover , scf may cause transient myocardial hypoperfusion in patients with angina and normal coronary arteries , and these patients have higher probability of significant cad and an apparently worse prognosis .
urotensin ii ( uii ) , an undecapeptide cleaved from a precursor protein , promotes vasoconstriction and vascular smooth muscle cell proliferation [ 9 , 10 ] .
uii is one of the most important and the most studied peptide involved in vascular remodeling .
uii , a potent vascular constrictor , is up - regulated in patients with hypertension , and atherosclerosis in addition to relevant receptors [ 1113 ] .
even though , the pathophysiological impact of uii in atherosclerosis and coronary artery disease has been studied extensively , the role of uii in scf as a different variety of atherosclerosis has not been clarified so far .
we think that pro - atherosclerotic and inflammatory actions of uii may also act in scf pathogenesis .
therefore , we intended to investigate uii concentrations and atherosclerotic risk factors in patients with scf compared to control subjects with normal coronary flow ( ncf ) .
our study was prospective and cross sectional . among 2,049 patients , coronary angiography procedures performed between september 2010 and 2011 in our hospital , we selected patients with the presence of typical stable angina pectoris and positive or equivocal results in non - invasive stress tests as the indication
. patients with obstructive cad , left ventricular dysfunction , left ventricular hypertrophy , atrial fibrillation , valvular heart disease , pericardial and myocardial diseases , renal dysfunction ( creatinine > 1.5 mg / dl ) , anemia , thrombocytopenia , hepatic dysfunction , neoplasms , recent major surgical operation , and accompanying inflammatory diseases such as hemolytic and autoimmune disorders were excluded .
we excluded 823 patients with acute coronary syndromes . following the careful review of remaining 1,226 patients
we enrolled subjects with normal coronary arteries and flow consecutively in a ratio of 1:2 .
thus , 29 patients ( 11 males ) who had normal coronary angiograms and flow were enrolled as control subjects .
the study has been approved by the local ethics committee and is in accordance with the declaration of helsinki .
hypertension was acknowledged if the patient was on antihypertensive medication or if systolic blood pressure 140 mmhg , diastolic blood pressure 90 mmhg , or both were observed during examination .
diabetes mellitus was considered if fasting blood glucose was > 126 mg / dl or if the patient was on antidiabetic therapy .
patients who were using tobacco products on admission to our hospital and those quitted smoking within the last year were considered as smokers .
standard selective coronary angiography with at least four views of the left coronary artery and two views of the right coronary artery ( rca ) were performed using the judkins technique and 6-french right and left heart catheters without the use of nitroglycerin .
coronary angiograms were recorded in the right and left oblique planes using cranial and caudal angulations at a rate of 30 frames / s . during coronary angiography ,
iopromide ( ultravist 370 , schering ag , berlin , germany ) was used as the contrast agent in all patients .
the patients were assessed for the presence of scf during coronary angiography and coronary flow rates were quantified by the thrombolysis in myocardial infarction ( timi ) frame count ( tfc ) method . for objective quantification of the coronary flow ,
two independent observers blinded to the clinical data of the study participants assessed the coronary flow in coronary arteries using tfc .
this method establishes the number of cine frames , recorded at 30 frames / s , required for the contrast to reach standard distal coronary landmarks in the left anterior descending artery ( lad ) , left circumflex artery ( lcx ) , and rca .
predefined distal landmarks are the distal bifurcation for the lad , commonly referred to as the pitchfork or whale s tail , the distal bifurcation of the segment with the longest total distance for the lcx , and the first branch of the posterolateral artery for the rca .
the standard mean values for normal visualization of coronary arteries are described as 36.2 2.6 frames for lad , 22.2 4.1 frames for lcx , and 20.4 3.0 frames for rca .
as the lad is usually longer than the other major coronary arteries , the tfc for this vessel is often higher .
therefore , the tfc for lad is divided by 1.7 to obtain the corrected tfc ( ctfc ) .
the standard corrected mean value ( ctfc ) for lad coronary artery is 21.1 1.5 frames .
all participants with a tfc greater than the two standard deviations of the previously published range for the particular vessel were considered to have scf .
the mean tfc for each patient and control participant was calculated by dividing the sum of the tfc of the corrected lad , lcx , and rca by three .
blood samples were drawn by venipuncture to measure routine blood chemistry parameters after fasting for at least 8 h. fasting blood glucose , serum creatinine , total cholesterol , high - density lipoprotein cholesterol , low - density lipoprotein cholesterol , and triglyceride levels were recorded .
serum c - reactive protein ( crp ) was analyzed using a nephelometric technique ( beckman coulter immage 800 ; fullerton , ca , usa ; normal range : 00.8 mg / dl ) .
we collected blood samples from the antecubital vein of subjects after overnight fasting to measure blood biochemical parameters , including plasma uii levels .
blood was drawn into the tubes containing disodium ethylenediaminetetraacetic acid ( 1 mg / ml ) and aprotinin ( 500 u / ml ; sigma - aldrich , st .
louis , mo , usa ) , then centrifuged immediately at 3,500 g for 10 min at 4 c ; plasma was stored at 80 c for assay .
uii levels were measured by radioimmunoassay ( ria ) . in brief , samples extracted through a sep - pak c18 cartridge were assayed by the use of an ria kit ( phoenix pharmaceuticals , belmont , ca , usa ) . for the uii immunoreactivity assay ,
the intra- and inter - assay coefficients of variation of uii for blood samples were both < 10% .
continuous variables were given as mean sd or median ( interquartile range ) as appropriate ; categorical variables were defined as percentage .
the student s t - test was used for the univariate analysis of normally distributed continuous numerical variables and mann whitney u test was used for non - normally distributed numerical variables , and the -test for the categorical variables .
our study was prospective and cross sectional . among 2,049 patients , coronary angiography procedures performed between september 2010 and 2011 in our hospital , we selected patients with the presence of typical stable angina pectoris and positive or equivocal results in non - invasive stress tests as the indication
. patients with obstructive cad , left ventricular dysfunction , left ventricular hypertrophy , atrial fibrillation , valvular heart disease , pericardial and myocardial diseases , renal dysfunction ( creatinine > 1.5 mg / dl ) , anemia , thrombocytopenia , hepatic dysfunction , neoplasms , recent major surgical operation , and accompanying inflammatory diseases such as hemolytic and autoimmune disorders were excluded .
we excluded 823 patients with acute coronary syndromes . following the careful review of remaining 1,226 patients
we enrolled subjects with normal coronary arteries and flow consecutively in a ratio of 1:2 .
thus , 29 patients ( 11 males ) who had normal coronary angiograms and flow were enrolled as control subjects .
the study has been approved by the local ethics committee and is in accordance with the declaration of helsinki .
hypertension was acknowledged if the patient was on antihypertensive medication or if systolic blood pressure 140 mmhg , diastolic blood pressure 90 mmhg , or both were observed during examination .
diabetes mellitus was considered if fasting blood glucose was > 126 mg / dl or if the patient was on antidiabetic therapy .
patients who were using tobacco products on admission to our hospital and those quitted smoking within the last year were considered as smokers .
standard selective coronary angiography with at least four views of the left coronary artery and two views of the right coronary artery ( rca ) were performed using the judkins technique and 6-french right and left heart catheters without the use of nitroglycerin .
coronary angiograms were recorded in the right and left oblique planes using cranial and caudal angulations at a rate of 30 frames / s . during coronary angiography ,
iopromide ( ultravist 370 , schering ag , berlin , germany ) was used as the contrast agent in all patients .
the patients were assessed for the presence of scf during coronary angiography and coronary flow rates were quantified by the thrombolysis in myocardial infarction ( timi ) frame count ( tfc ) method . for objective quantification of the coronary flow ,
two independent observers blinded to the clinical data of the study participants assessed the coronary flow in coronary arteries using tfc .
this method establishes the number of cine frames , recorded at 30 frames / s , required for the contrast to reach standard distal coronary landmarks in the left anterior descending artery ( lad ) , left circumflex artery ( lcx ) , and rca .
predefined distal landmarks are the distal bifurcation for the lad , commonly referred to as the pitchfork or whale s tail , the distal bifurcation of the segment with the longest total distance for the lcx , and the first branch of the posterolateral artery for the rca .
the standard mean values for normal visualization of coronary arteries are described as 36.2 2.6 frames for lad , 22.2 4.1 frames for lcx , and 20.4 3.0 frames for rca .
as the lad is usually longer than the other major coronary arteries , the tfc for this vessel is often higher .
therefore , the tfc for lad is divided by 1.7 to obtain the corrected tfc ( ctfc ) .
the standard corrected mean value ( ctfc ) for lad coronary artery is 21.1 1.5 frames .
all participants with a tfc greater than the two standard deviations of the previously published range for the particular vessel were considered to have scf .
the mean tfc for each patient and control participant was calculated by dividing the sum of the tfc of the corrected lad , lcx , and rca by three .
blood samples were drawn by venipuncture to measure routine blood chemistry parameters after fasting for at least 8 h. fasting blood glucose , serum creatinine , total cholesterol , high - density lipoprotein cholesterol , low - density lipoprotein cholesterol , and triglyceride levels were recorded .
serum c - reactive protein ( crp ) was analyzed using a nephelometric technique ( beckman coulter immage 800 ; fullerton , ca , usa ; normal range : 00.8 mg / dl ) .
we collected blood samples from the antecubital vein of subjects after overnight fasting to measure blood biochemical parameters , including plasma uii levels .
blood was drawn into the tubes containing disodium ethylenediaminetetraacetic acid ( 1 mg / ml ) and aprotinin ( 500 u / ml ; sigma - aldrich , st .
louis , mo , usa ) , then centrifuged immediately at 3,500 g for 10 min at 4 c ; plasma was stored at 80 c for assay .
uii levels were measured by radioimmunoassay ( ria ) . in brief , samples extracted through a sep - pak c18 cartridge were assayed by the use of an ria kit ( phoenix pharmaceuticals , belmont , ca , usa ) . for the uii immunoreactivity assay ,
the intra- and inter - assay coefficients of variation of uii for blood samples were both < 10% .
continuous variables were given as mean sd or median ( interquartile range ) as appropriate ; categorical variables were defined as percentage .
the student s t - test was used for the univariate analysis of normally distributed continuous numerical variables and mann whitney u test was used for non - normally distributed numerical variables , and the -test for the categorical variables .
uii concentrations were significantly higher in patients with scf compared to controls ( 711.0 19.4 vs. 701.5 27.2 ng / ml , p = 0.006 ) .
moreover , patients with scf tended to be older ( 55 12 vs. 42 11 years , p = 0.001 ) , and have a higher body mass index ( bmi ) ( 30 4 vs. 26 4
kg / m , p = 0.002 ) , and more prevalent hypertension ( 64% vs. 10% , p = 0.001 ) .
we detected a positive correlation between scf and age ( r = 0.476 , p = 0.001 ) , bmi ( r = 0.404 , p = 0.002 ) , uii concentrations ( r = 0.422 , p = 0.006 ) , and hypertension ( r = 0.594 , p = 0.001 ) ( fig . 1 , tables i and ii ) .
uii concentrations in patients with scf and control group baseline characteristics of the study population scf , slow coronary flow ; uii , urotensin ii ; ht , hypertension ; sd , standard deviation ; nca , normal coronary flow ( control group ) ; cad , coronary artery disease ; timi , thrombolysis in myocardial infarction ; lad , left anterior descending artery ; lcx , left circumflex artery ; rca , right coronary artery ; iqr , interquartile range correlations of scf and uii with the study parameters scf , slow coronary flow ; uii , urotensin ii ; ht , hypertension ; bmi , body mass index
in this study , we revealed significantly higher uii levels in patients with scf compared to patients with angiographically normal coronary arteries and ncf .
moreover , we detected that scf significantly associated with hypertension , advanced age , and obesity .
although the exact mechanism of scf is not consistently determined , there are several suggested mechanisms involved in the pathogenesis of scf .
the first hypothesis that small vessel dysfunction contributes to the pathogenesis of scf was proposed by tambe et al . and was confirmed by mangieri et al . , who demonstrated microvascular abnormalities in patients with scf .
their histopathological examinations showed evidence of small vessel abnormalities such as endothelial thickening due to cell edema , capillary damage , and reduced luminal diameter of the small vessels .
in addition , kurtolu et al . reported an improvement in microvascular tone and coronary flow with microvascular vasodilators , implying a functional increase in microvascular resistance . on the contrary , intravascular ultrasound examinations identified epicardial cad as a pathophysiological factor for scf , in addition to microvascular disease .
abnormal slow flow pattern in coronary arteries has been deduced to be a manifestation of diffuse atherosclerotic disease due to endothelial injury without creating an angiographically visible coronary lesion ; therefore , scf may be an early manifestation of diffuse atherosclerosis involving both microvascular system and epicardial coronary arteries .
in addition , inflammation [ 17 , 18 ] , platelet function disorder [ 19 , 20 ] , and imbalance of vasoactive substances [ 15 , 21 ] have also been blamed in the pathogenesis of the scf phenomenon .
serum paraoxonase ( pon ) , a high - density lipoprotein bound antioxidant enzyme , acts against atherosclerosis and endothelial dysfunction .
reported an independent association between serum pon activity with the mean tfc , suggesting that reduced serum pon activity may be a biochemical marker of scf .
demonstrated significantly increased serum malondialdehyde , erythrocyte superoxide dismutase , and decreased erythrocyte - reduced glutathione levels in patients with scf compared to patients with ncf .
these findings indicate that free radical damage as well as endothelial dysfunction may also take place in the pathogenesis of scf .
could not demonstrate any differences in endothelial function , inflammatory proteins ( myeloperoxidase and high - sensitivity crp ) , oxidative stress biomarkers ( malondialdehyde and homocysteine ) , and asymmetric dimethylarginine levels in patients with scf compared to healthy controls .
the uii receptor uii interaction stimulate the release of calcium ( ca ) in vascular smooth muscle cells through inositol triphosphate and diacylglycerol .
increased intracellular calcium concentrations lead to cellular proliferation and activation of ca - dependent kinases via calmodulin binding .
uii and angiotensin ii affect vascular endothelial growth factor ( vegf ) expression in adventitial fibroblasts that have an important role in vascular remodeling .
although the exact role of vegf in vascular remodeling induced by uii is still not clarified , adventitial fibroblast proliferation and increased collagen synthesis may ensue .
studies investigating the association between uii and atherosclerosis have revealed raised plasma uii levels in patients with vascular disorders such as essential hypertension , diabetes mellitus , atherosclerosis , ischemic heart disease , and heart failure .
uii is synthesized in endothelial cells , smooth muscle cells , and infiltrating macrophages of atherosclerotic lesions .
stimulation of receptor by uii leads to endothelial and smooth muscle cell proliferation , foam cell formation , and chemotaxis via vascular cell adhesion molecule-1 and intercellular adhesion molecule-1 expression .
in addition , uii produces reactive oxygen species through nicotinamide adenine dinucleotide phosphate oxidase system in vascular smooth muscle cells , which induces smooth muscle cell proliferation and accelerates atherosclerosis .
therefore , uii seems to have a key role in progression of atherosclerotic cardiovascular diseases .
demonstrated uii expression in endothelial cells , foam cells , and myointimal and medial vascular smooth muscle cells of atherosclerotic human coronary arteries .
higher plasma uii concentrations that were associated with the severity of cad were demonstrated in patients with stable cad . increased uii concentrations
have also been demonstrated in hypertension , which could be related to vasoconstrictive and pro - sympathetic effects .
animal studies demonstrated raised blood pressure and heart rate following uii injection which could be inhibited by pentolinium , indicating a direct contribution of the sympathetic nervous system [ 30 , 31 ] .
another study revealed that intracerebral injection of uii induced elevated sympathetic nerve activity , which was followed by the stimulation of adrenal medulla for secretion of adrenaline .
since uii has pro - atherosclerotic and vasoconstrictive effects especially in coronary resistance arteries , this particular action may have a role in scf pathogenesis .
maguire and davenport reported uii expression in endothelial cells of both epicardial coronary arteries and intramyocardial resistance arteries ( 60120 m ) but not in cardiac myocytes or vascular smooth muscle cells .
similarly , uii was detected within macrophages of the atherosclerotic plaque but not in vascular smooth muscle cells .
moreover , urotensin receptors , which mediate vasoconstriction , are present in all vascular smooth muscle cells from large epicardial to small resistance arteries .
uii may have additional value in ischemia - reperfusion injury and thus aid in scf phenomenon .
reperfusion injury decrease coronary flow in rats , which is exacerbated by administration of uii during reperfusion .
similarly , in the event of significant endothelial dysfunction , uii may cause vasoconstriction or inadequate vasodilation in coronary arteries with resultant myocardial ischemia [ 37 , 38 ] .
. demonstrated that uii had more pronounced effect on small coronary arteries than epicardial vessels
the main limitation of our study is the observational nature , which does not explain the exact mechanism of the relationship between increased uii and scf . in this study ,
the patients did not undergo intravascular ultrasonography ( ivus ) to detect atherosclerotic changes in the coronary arteries .
hence , the coexistence of non - obstructive cad in patients with isolated scf can not be established absolutely . nevertheless ,
in clinical practice , isolated scf patients do not undergo ivus routinely and scf is usually diagnosed with visual assessment of coronary angiography .
other inflammatory cytokines , except crp , might be measured to clarify possible causative mediators .
we demonstrated elevated uii levels in patients with scf and revealed significant association of several atherosclerotic risk factors with scf .
since uii is a marker of inflammation and atherosclerosis severity , elevated uii may confer an additional risk in this seemingly low - risk condition .
and med prepared the manuscript , m and y searched the literature , collected data , te and hd made the analyses .
|
backgroundslow coronary flow ( scf ) is an angiographic finding characterized with delayed opacification of epicardial coronary arteries without obstructive coronary disease .
urotensin ii ( uii ) is an important vascular peptide , which has an important role in hypertension , coronary artery disease , and vascular remodeling in addition to potent vasoconstrictor effect.objectiveswe investigated uii levels , hypertension , and other atherosclerotic risk factors in patients with scf , a variety of coronary artery disease.methodswe enrolled 14 patients with scf and 29 subjects with normal coronary arteries without scf .
we compared the uii levels and the atherosclerotic risk factors between patients with scf and control subjects with normal coronary flow.resultsuii concentrations were significantly higher in patients with scf compared to controls ( 711.0 19.4 vs. 701.5 27.2 ng / ml , p = 0.006 ) .
we detected a positive correlation between scf and age ( r = 0.476 , p = 0.001 ) , bmi ( r = 0.404 , p = .002 ) , uii concentrations ( r = 0.422 , p = 0.006 ) , and hypertension ( r = 0.594 , p = 0.001).conclusionwe identified increased uii levels in patients with scf . we think that uii concentrations may be informative on scf pathogenesis due to relationship with inflammation , atherosclerosis , and vascular remodeling .
|
renal fibrosis , characterized by tubulointerstitial fibrosis and glomerulosclerosis , is the final manifestation of chronic kidney disease ( ckd)1 ) .
the progression of ckd , one of the biggest problems in nephrology , indicates that patients inevitably reach end - stage renal disease ( esrd ) and require renal replacement therapies such as dialysis and transplantation2 ) .
although a range of diseases such as glomerulonephritis ; metabolic diseases , including diabetes mellitus and atherosclerosis ; obstructive nephropathy ; interstitial nephritis ; and cystic nephropathies , including polycystic kidney disease , can be the major causes of ckd , renal fibrosis is always the common ultimate result of ckd3 , 4 ) .
renal fibrosis is characterized by an excessive accumulation and deposition of extracellular matrix ( ecm ) components1 ) . in order to elucidate the specific pathway of renal fibrosis ,
this review article will focus on recent advances in the pathogenesis of renal fibrosis and review the therapeutic trials conducted with an aim to overcome renal fibrosis .
most of the present knowledge about the pathogenesis of renal fibrosis is based on experimental studies with laboratory animals .
however , only few studies have reported the common features of renal fibrogenesis , such as interstitial fibrosis , tubular atrophy , and glomerulosclerosis5 ) .
nephrotoxic serum nephritis ( nsn ) is a frequently used model for anti - glomerular basement membrane ( anti - gbm ) disease or in situ immune - complex glomerulonephritis and is characterized by an early heterologous phase , including linear deposition of anti - gbm antibody in the glomerulus and a subsequent autologous immune response against the planted antibodies6 ) .
nsn has been effectively used as a model for fibrosis with cd-1 mice , c57bl/6 mice , and various gene - knockout mice5 ) .
fibrotic lesions , including collagen deposition in the interstitium , increased fibroblasts , epithelial - to - mesenchymal transition ( emt ) , appear after 1 - 2 weeks of nsn and severe tubulointerstitial fibrosis is noted between 3 and 6 weeks5 ) .
mice with an intended disruption of the col4a3 gene , which encodes the 3 chain of type iv collagen , were initially generated as a model for alport syndrome7 , 8) . in this animal model ,
the primary renal pathologic finding is the splitting of the gbm and subsequent crescentic glomerulonephritis and renal fibrosis7 , 9 ) .
unilateral ureteral obstruction ( uuo ) , as a model similar to human obstructive nephropathy , is induced by the ligation of a ureter of one kidney , while the contralateral kidney serves as a control ; at as early as 3 days after uuo surgery , interstitial fibrosis associated with interstitial deposition of type iv collagen and tubular cell apoptosis are noted10 ) .
thornhill et al.13 ) reported that tubular atrophy and interstitial fibrosis develop before significant renal pelvic dilatation in a neonatal rat model with variable chronic partial uuo , and that renal growth is reduced by 60% after 70% reduction of ureteral diameter .
moreover , although uuo is relieved after brief periods of obstruction , recovery from either structural or functional damages due to obstructive uropathy can not be always guaranteed14 ) . in the murine model of denys - drash syndrome ,
mice strains generated by crossbreeding of wilms ' tumor 1 gene ( wt-1 ) knockout mice and mice with a yeast artificial chromosome containing the wt-1 locus can present with either crescentic glomerulonephritis or mesangial sclerosis depending on the relative wt-1 expression levels11 ) .
assmann et al.12 ) reported that transgenic mice with ectopic expression of the thy-1.1 antigen on the podocyte gradually and spontaneously develop focal glomerulosclerosis .
renal fibrosis is characterized by glomerulosclerosis , tubulointerstitial fibrosis , loss of renal parenchyme , and inflammatory cell infiltration1 ) ( fig .
these pathologic results usually originate from the underlying complicated cellular conditions such as the activation of emt and fibroblasts , monocyte / macrophage infiltration , and cellular apoptosis1 , 15 ) .
an early renal insult can evoke the activation of tubular cells that leads to the production of proinflammatory molecules that eventually contribute to renal fibrosis15 ) .
if high - grade proteinuria in tubular area develops due to the injured glomerular barrier , tubular cells can be exposed to bioactive molecules in the plasma or inflamed glomeruli16 ) , thereby leading to the production of various chemotactic cytokines such as monocyte chemoattractant protein-1 ( mcp-1)17 , 18 ) ; regulated upon activation , normal t cell expressed and secreted ( rantes)19 ) ; and potent monocyte chemoattractants such as c3a and c5a20 , 21 ) .
moreover , leukocyte adhesion molecules such as osteopontin , intercellular adhesion molecules ( icams ) , and vascular cell adhesion molecules ( vcams ) have been reported to originate from tubules and to play an essential role in mononuclear cell recruitment in chronic renal disease state22 , 23 ) . due to the activation of these various chemokines and chemoattractants ,
most of monocytes move into the glomerular and interstitial area from the circulation via peritubular capillary epithelium and infiltrated monocytes , leading to the production of inflammatory and fibrogenic cytokines , as well as injurious molecules , including reactive oxygen species ( ros)1 ) .
finally , these inflammatory stimuli provoke the activation of mesangial cells , fibroblasts , and emt and lead to the production of a large amount of ecm components .
there are many disputes regarding the possible origins of renal fibroblasts that include migrating hematopoietic or mesenchymal stem cells from the bone marrow , periadventitial cells , activation of resident interstitial fibroblasts , and emt of tubular epithelial cells24 ) .
in addition to this cellular activation , the activation of signal molecules also results in the accumulation of matrix along the tubular basement membranes and within the interstitial area15 ) . transforming growth factor beta ( tgf- )
tgf- can be produced by both resident kidney cells and infiltrating leukocytes and filtered from the plasma during proteinuria15 ) .
the 3 isoforms of tgf- ( tgf-1 , tgf-2 , and tgf-3 ) are broadly expressed and act on almost every cell type in mammals by engaging in an intracellular signaling cascade of smad family of proteins through ligand - induced activation of heteromeric transmembrane tgf- receptor kinases25 ) . in the uuo model , the downstream signaling of tgf-1 is profoundly related to a family of smad proteins that stimulate fibrosis ( smad2 and smad3 ) or inhibit fibrosis ( smad7)26 ) .
tgf- stimulates the myofibroblastic activation or transition of mesangial cells , interstitial fibroblasts , and tubular epithelial cells to become matrix - producing fibrogenic cells in vitro 1 , 25 ) .
these fibrotic effects of tgf- can be summarized by 2 cellular events , apoptosis and emt .
tgf--induced apoptosis usually results in podocyte depletion , glomerulosclerosis , loss of glomerular and peritubular capillaries , and tubular atrophy28 , 29 ) . on the other hand ,
tgf--induced emt can play a critical role in tubular atrophy and generation of interstitial myofibroblasts30 ) .
on the basis of this experimental background , many therapeutic trials on renal fibrosis such as neutralizing anti - tgf- antibody and tgf- receptor inhibitor have been performed31 , 32 ) .
however , no conclusive results could be obtained since mice with tgf- deficiency die of massive inflammation ; this is because tgf- is one of the anti - inflammatory cytokines .
in addition , the over - expression of tgf-1 in transgenic mice has been reported to attenuate the development of renal fibrosis via an anti - inflammatory effect33 ) .
therefore , to improve the clinical application of tgf- for preventing renal fibrosis , additional information regarding more complicated mechanisms underlying tgf- action should be revealed .
angiotensin ii ( angii ) has also been known as one of the key mediators of inflammation and fibrosis in kidney diseases34 ) .
angii signal transduction is initiated by 2 receptors , angii type 1 ( at1 ) and angii type 2 ( at2 ) receptors35 ) .
most of the effects of angii are mediated through the at1 receptor , which is widely expressed by most cell types , whereas the expression of the at2 receptor is higher in the fetal tissue and decreases in adult animals and humans36 - 38 ) .
interestingly , the at2 receptor has been thought to counteract the effects of angii and to play a role in the protection of the kidney 39 ) .
angii through at1 receptor regulates ecm accumulation mediated by profibrotic growth factors such as tgf-34 ) .
clinically , in humans with chronic renal allograft rejection , plasma tgf- levels were found to decrease after angii was blocked40 ) .
angii also stimulates oxidative stress , which in turn upregulates the vasoconstrictor peptides due to increased catabolism of nitric oxide ( no)41 ) .
because no plays an essential role in the regulation of blood flow in the normal and diseased kidneys , the changes of blood flow in uuo are associated with the impairment of the no synthetic pathway in the kidney42 ) . however , because angiotensin itself has a very important role in the development and maturation of a normal kidney , an angiotensin - converting enzyme ( ace ) inhibitor can aggravate renal interstitial inflammation and fibrosis in a neonatal rat model with partial uuo43 ) .
connective tissue growth factor ( ctgf ) is an important profibrotic factor that contributes to renal fibrosis and tubuloepithelial transdifferentiation as a downstream mediator of tgf- activity44 ) .
interstitial production of ctgf was found to increase in areas of chronic renal injury in humans45 ) and to be attenuated by ace inhibitors and antagonists of at1 receptor46 , 47 ) .
lin et alreported that pentoxifylline suppresses the activity of ctgf in rats with uuo by interfering with smad3- and smad4-dependent ctgf transcription48 ) .
platelet - derived growth factor ( pdgf ) is also centrally involved in the pathogenesis of renal fibrosis , similar to ctgf3 , 49 ) . in a rat model with progressive mesangioproliferative glomerulonephritis ,
the treatment with an antagonist against pdgf - b attenuated mesangioproliferative changes , glomerular hypertrophy , and podocyte damage , and in the long term prevented glomerulosclerosis and tubulointerstitial damage49 ) . of the pdgf family , pdgf - c and d
are also increased in the area of tubulointerstitial fibrotic lesion , suggesting a potential role in renal fibrosis50 , 51 ) .
endothelin-1 ( et-1 ) that is abundant in renal endothelial cells is a strong vasoconstrictor peptide with profibrotic and pro - inflammatory effects52 ) .
overexpression of et-1 is sufficient to induce structural and functional changes , including glomerular and tubulointerstitial fibrosis , because et-1 causes hypoxic injury due to the constriction of peritubular capillaries and stimulates mesangial cell proliferation and ecm production54 , 55 ) .
kon et al.56 ) suggested that antagonism of et-1 may attenuate tubulointerstitial injury in an experimental model of chronic cyclosporine nephrotoxicity .
in addition , tumor necrosis factor alpha ( tnf- ) and interleukin-1 ( il-1 ) are other candidate proinflammatory cytokines that can lead to renal fibrosis57 , 58 ) .
simultaneously , other antifibrotic factors may be involved in the pathway of renal fibrosis combined with profibrotic cytokines and growth factors .
hepatocyte growth factor ( hgf ) , a promoter of hepatocyte proliferation and liver generation , is also regarded as an antifibrotic mediator of tubular repair and generation after acute renal injury59 , 60 ) .
moreover , hgf prevents the initiation and progression of chronic renal fibrosis and attenuates tgf-1 expression in various animal models60 ) . in a mice model with uuo ,
the administration of exogenous hgf noticeably reduced the progression of renal fibrosis and attenuated the expression of -smooth muscle actin , tgf-61 ) .
in addition , in an animal model of diabetic nephropathy , hgf interrupted the progression of renal fibrosis and dysfunction62 ) .
these antifibrotic results of hgf can be explained by various antagonistic effects on the cellular activation of renal fibrosis .
hgf blocks tubular emt63 ) , inhibits apoptosis of endothelial cells64 ) , and accelerates matrix degradation by modulating both the plasminogen activator / plasmin and matrix metalloproteinases ( mmps ) proteolytic pathway65 ) .
bone morphogenetic protein-7 ( bmp-7 ) , formerly known as osteogenic protein-1 , is a member of the tgf- superfamily and a key growth factor of embryogenesis and morphogenesis66 ) .
recently , bmp-7 has been reported to reverse renal fibrosis induced by tgf- in a mice model and to antagonize tgf--dependent fibrogenesis in mesangial cells67 , 68 ) .
in addition , interferon gamma ( ifn- ) and insulin - like growth factor-1 ( igf-1 ) are also known to have an antifibrotic effect57 , 69 ) .
there is always a balance between matrix production and degradation in the normal renal tissue , whereas the excessive accumulation and deposition of ecm components are the final pathologic results in renal fibrosis and ckd .
fibrotic appearance in renal fibrosis may be induced by both overproduction of matrix components and defects in their degradation1 ) .
the normal kidney usually produces various proteases , including mmp , plasminogen activator , and lysosomal cathepsins70 ) .
the balance between matrix production and degradation can be maintained through appropriate degradation of ecm due to the potent proteases .
therefore , these proteases have been regarded as one of the possible candidates for the treatment of renal fibrosis70 ) .
however , recent data suggest that the action mechanisms of proteases are not simple . in an animal model , ironically , deficiency of plasminogen attenuates renal fibrosis , and overproduction of mmp produces spontaneous emt and peritubular fibrosis in renal proximal tubules71 , 72 ) . fig .
although we have secured various possible targets for the treatment of renal fibrosis as mentioned above , it is evident that there is no effective treatment for renal fibrosis thus far .
al.73 ) reported several problems that even we faced , including discrepancy between rodent models and clinical situation , lack of multiple models , different parameters and techniques for the evaluation of fibrosis , and inadequate timing of treatment in the experimental fibrosis .
although renal fibrosis , including tubulointerstitial fibrosis and glomerulosclerosis , is always the final common outcome in ckd , the pathogenic mechanisms underlying renal fibrosis are extremely complicated .
both cellular activation such as emt ; fibroblast activation ; monocyte / macrophage infiltration ; cellular apoptosis , and the activation of profibrotic cytokines such as tgf- , angii , ctgf , pdgf , et-1 , tnf- , and il-1 result in the excessive accumulation of ecm .
antifibrotic cytokines such as hgf , bmp-7 , ifn- , and igf-1 or several proteases such as mmp and plasminogen activator may be possible candidates for the treatment of renal fibrosis ; however , our knowledge about these candidates is still limited .
further studies are needed to elucidate the complicated pathogenesis of renal fibrosis and to overcome the irreversibility of ckd .
|
renal fibrosis , characterized by tubulointerstitial fibrosis and glomerulosclerosis , is the final manifestation of chronic kidney disease .
renal fibrosis is characterized by an excessive accumulation and deposition of extracellular matrix components .
this pathologic result usually originates from both underlying complicated cellular activities such as epithelial - to - mesenchymal transition , fibroblast activation , monocyte / macrophage infiltration , and cellular apoptosis and the activation of signaling molecules such as transforming growth factor beta and angiotensin ii .
however , because the pathogenesis of renal fibrosis is extremely complicated and our knowledge regarding this condition is still limited , further studies are needed .
|
chronic headache is frequently associated with a high degree of psychosocial stress and patients with chronic headache are more often dissatisfied with medical and therapeutic management than persons with episodic migraine .
lacking knowledge on what patients expect from the treatment programme and outcome may lead to misunderstandings and prevent a successful outcome [ 2 , 3 ] .
many studies focus on objective and easily measured outcomes such as medication use and headache days rather than focusing on the patients preferences and subjective opinion of the treatment .
for example the efficacy of most migraine drugs is evaluated with pain relief at 2 h as the primary end point even though all patients defined rapid pain relief as pain relief happening within 1 h .
the patients suffer from headache more than 15 days / month and take medication to relieve the headache 15 days / month or more for simple analgesics or 10 days / month or more for opioids , triptans , ergots , or combination analgesics .
the present treatment strategy of moh is employed with emphasis on abrupt cessation of the overused drug and initiation of a prophylactic treatment for the primary headache which in the first place led to the medication overuse .
this is a rather long and complicated course , but nevertheless it has been shown in previous studies that up to 75% of patients improve after detoxification .
approximately 70% out of 216 moh patients demonstrated a 50% reduction in headache frequency and intensity after treatment .
however , it is noteworthy that up to 40% of successfully detoxified moh patients may relapse into medication overuse within a year [ 6 , 7 ] .
many determinants may be involved in the relapse and a recent paper from the pavia group has shown that an adapted follow - up ( care approach ) , simply based on fixed control visits with the same doctor , yields a lower rate of relapse at 1 year ( 22% ) .
this positive result may partly be caused by the fact that before the withdrawal the patients knew exactly when the follow - up visits would take place and they knew the doctor who was responsible , i.e. , they knew what to expect and their expectations were met .
we therefore hypothesize that if patients expectations and preferences for treatment are realistic and these are met , patient compliance and satisfaction with treatment might increase . on this background ,
the present survey was performed as a pilot study in three european countries within the comoestas project1 for evaluating moh patients preferences and expectations regarding their disease management in terms of ( i ) preferred sources of information and ( ii ) treatment programme .
a draft questionnaire was created to measure the needs and expectations of patients suffering from moh .
translation of the questionnaire into local languages ( italian , danish and german ) was performed according to the forward backward forward methodology with the participation of an english and a native language speaker .
thereafter , the questionnaire was tested on 10 consecutive moh patients in the tertiary headache centre in pavia , in order to evaluate understanding of questions and scoring system by the patients . a final version containing questions on patients preferences regarding information and expectations for the treatment
this was distributed to 65 consecutive moh patients attending the tertiary headache centres of essen , pavia and glostrup .
the patients were all asked to fill in the questionnaire on the day of their first consultation leading to the diagnosis of moh , before being seen by the doctor .
the questionnaire included three sections : ( 1 ) the patients needs for information , ( 2 ) the patients preferences regarding information and ( 3 ) the patients expectations regarding the treatment of moh ( fig .
1 , the patients had to tick all the sources of information they needed from a list of five items . in sect .
2 , they had to rate their preference for each of these five items with a number from 1 to 5 , where the items rated 1 were the most and 5 the least important . in sect .
3 , the patients had to rate each of the seven items on expectations with the numbers 15 , according to the same scoring system described for sect .
, it was possible to rate more than one expectation or source of information as the most or least important .
items rated 1 or 2 in sect . 2 were counted as a preferred sources of information and in sect . 3 as the most important expectations as regards treatment .
unrated items were excluded from the calculations . to compare frequencies between the countries , between needed or preferred sources of information , and between different expectations we used the test for samples with more than five in each group and fisher s exact test for smaller samples .
fifteen of the questionnaires had one or more missing values in sect . 2 and 3 , 14 from denmark , 1 from italy .
this percentage was significantly higher than the percentage of patients who selected leaflets and website information ( 35 and 35% , respectively , p < 0.001 ) .
the second most frequently requested source of information was access to telephone consultation ( 59% ) , while access to e - mail consultation only was indicated by 48% .
when comparing countries , there was a statistically significant difference between the 15% of patients from italy and 52% of patients from denmark who required leaflets ( p = 0.013 ) , but otherwise there were no differences between types of sources of information preferred by the patients.table 1what is your need for headache information?italygermanydenmarktotalno .
of patients20202565leaflets with written information15.0% ( 030.7)35.0% ( 14.155.9)52.0% ( 32.471.6)35.4% ( 23.847.0)personal verbal information75.0% ( 56.094.0)70.0% ( 49.990.1)80.0% ( 64.395.7)75.4% ( 64.985.9)website information35.0% ( 14.155.9)35.0% ( 14.155.9)36.0% ( 17.254.8)35.4% ( 23.847.0)access to e - mail consultation to the headache clinic50.0% ( 28.171.9)35.0% ( 14.155.9)56.0% ( 36.5475.5)47.7% ( 35.659.8)access to telephone consultation to the headache clinic50.0% ( 28.171.9)65.0% ( 44.185.9)60.0% ( 40.879.2)58.5% ( 46.570.5)the 95% confidence interval is in brackets what is your need for headache information ?
the 95% confidence interval is in brackets the preferences for information sources ( table 2 ) were distributed very similarly to the needs .
the source of information preferred by most patients was personal verbal information , which was selected by 82% .
this was a statistically significantly larger percentage than all other sources of information ( p < 0.001 ) . in decreasing order , patients preferred access to telephone consultation ( preferred by 48% ) , access to e - mail consultation ( 44% ) , website information ( 41% ) , and leaflets ( 33%).table 2what is your preference of headache information?italygermanydenmarktotalno . of patients20202565leaflets with written information25.0% ( 6.044.0)30.0% ( 9.950.1)42.9% ( 21.764.0)32.8% ( 21.444.2)personal verbal information73.7% ( 53.993.5)90.0% ( 76.9100)82.6% ( 67.897.5)82.3% ( 72.791.8)website information36.8% ( 15.258.5)55.0% ( 33.276.8)30.0% ( 12.048.0)40.7% ( 28,153,2)access to e - mail consultation to the headache clinic42.1% ( 19.964.3)40.0% ( 18.561.5)50.0% ( 30.469.6)43.9% ( 31.056.7)access to telephone consultation to the headache clinic45.0% ( 23.266.8)60.0% ( 38.581.5)40.9% ( 21.660.2)48.4% ( 35.960.8)the 95% confidence interval is in brackets what is your preference of headache information ?
the 95% confidence interval is in brackets the patient s expectations from treatment are illustrated in table 3 .
most patients were expecting a reduction in the severity of the disease ( reduction in frequency by 85% and in intensity by another 82% ) , while a significantly lower percentage of patients was expecting a cure for headache ( 59% ) or education to better understand their disease ( 58% ) .
77% of subjects expected an effective prevention of their headache episodes , while 64% expected an acute treatment working fast .
it is noteworthy that almost three out of four patients expected to receive information about strategies to actively combat headache .
this need was particular felt by 90% of the german patients and by 65% of the italian and by 63% the danish patients.table 3what are your expectations of the headache treatment?italygermanydenmarktotalno . of patients20202565a cure for the headache80.0% * ( 62.597.5)45.0% * ( 23.266.8)50.0% ( 30.469.6)58.9% ( 46.071.8)reduction in the frequency of headache85.0% ( 69.4100)90.0% ( 76.9100)81.0% ( 65.696.3)85.2% ( 76.394.1)reduction in the intensity of the headache85.0% ( 69.4100)85.0% ( 69.4100)75.0% ( 58.092.0)81.6% ( 71.991.5)a fast treatment of my headache episodes70.0% ( 50.090.1)60.0% ( 38.581.5)61.1% ( 42.080.2)63.8% ( 51.476.2)an effective prevention of my episodes75.0% ( 56.094.0)85.0% ( 69.4100)72.7% ( 55.290.2)77.4% ( 67.087.8)education to understand my headache50.0% ( 28.171.9)75.0% ( 56.094.0)47.4% ( 27.866.9)57.6% ( 45.070.2)information about what i can do myself to reduce the headache65.0% ( 44.185.9)90.0% ( 76.9100)63.2% ( 44.882.1)72.9% ( 61.584.2)the 95% confidence interval is in brackets * p < 0.05 between countries , p < 0.05 compared with reduction in the frequency of headaches and reduction in the intensity of headaches , p < 0.05 compared with an effective prevention of my episodes what are your expectations of the headache treatment ?
the 95% confidence interval is in brackets * p < 0.05 between countries , p < 0.05 compared with reduction in the frequency of headaches and reduction in the intensity of headaches , p < 0.05 compared with an effective prevention of my episodes as regards the country comparison , italian patients seemed more optimistic as they expected a cure from headache in 80% of cases when compared with the german ( 45% ) ( p = 0.048 ) or danish ( 50% ) ( p = 0.082 ) patients .
from this pilot evaluation we can derive that for moh patients the preferred channel of information is represented by personal contact , which was indicated by the majority of patients , both as face - to - face personal verbal information and telephone consultation .
this pattern was expected as our patients are from tertiary headache centres but the pattern was similar in the three countries . as regards some of the alternative modalities of information ( leaflets and website ) , these were selected only by 1/3 of patients , with a very low percentage for leaflets in italy .
moh is a severe form of headache and most of the patients consulting third - level headache centres , like the three involved in this study , have a long history of headache and of unsuccessful treatments .
the personal contact will probably make the patients feel more confident as they can instantly ask questions and get explanations on the disease or prescriptions .
we were surprised to find than nearly 2 out of 3 patients did not like indirect or innovative sources of information ( leaflets and websites , respectively ) , even though these sources are always available and ready to use at any time . in the case of leaflets , this is likely due to fact that they usually feature general , non specific content and are therefore of limited help for the patients . in the case of websites ,
the internet gives access to a huge quantity of information , which may be either too general or non controlled or , worse , misleading due to the substantial absence of a governing body or authority that serves a gate - keeping function for web publications mentioned by borowitz and wyatt more than 10 years ago .
if a website was created by professionals and the patients were told this , then this might be preferred by a higher number .
it is interesting that nearly 50% of patients selected e - mail consultations as preferred modality of information , which represents a clear opening to a possible alternative modality of consultation in many countries .
general accept and it - implementation are , however , essential in all european countries as it has been estimated that in europe the internet penetration , and consequently , the percentage of patients who have access to e - mail technology is only slightly above 50%.2 e - mail communication is convenient both for the patients and the health professionals .
we have been testing it within the comoestas study and the preliminary evaluation suggests that it satisfies the patients , who can detail their problems and receive feed - back within a few hours of the request without the need to spend time going to the centre or staying on the phone for contacting the nurse or the doctor .
the physician , on the other hand , can reply in the most convenient time , when he / she has had access to health records of the patient . in the treatment of moh
it is crucial that the patients avoid overuse of headache medication again in the early phases of detoxification , despite the often daily and severe headaches .
one limitation of this study is that , due to the small number of subjects , we could not perform a stratification analysis of data .
another limitation is the results can not be translated directly to all moh patients as our patients are included from tertiary centres , and thereby represent selected patients that may have failed prior treatment programmes within first or second line . on the other hand , it is very important to optimize their treatment programmes , as these patients represent the severely affected patient population with a high burden of disease and maybe also an increased risk of relapse .
thirdly , the relative high number of missed replies in denmark but not in italy and germany indicates a methodological variation between countries , although we were unable to identify whether it was a cultural variation or lack of proper instruction to complete all questions .
thus , our questionnaire may have benefited from additional validation tests but we have deliberately eliminated validation against direct interview to avoid patient - to - doctor - bias .
however , it is likely that alternative modalities of communication may be preferred by and will be more effective in selected subgroups of subjects , representing a new and interesting field of headache research and care .
likewise , international e - mail communication may also be implemented to countries with limited access to specialized headache care or for rare headache disorders .
indeed a previous study has shown that the use of internet and sms is welcome in healthcare delivery amongst young people and people with a higher education .
the percentage of people preferring web - based sources of information as e - mail and websites will probably increase with time . as for treatment
more than half expected to be cured from their headache even though almost no patients will experience a total absence of headache after detoxification .
this stresses the need for detailed and realistic information before onset of the treatment programme emphasizing that headache can be improved but not yet cured .
giving proper and detailed information on the treatment programme and what outcome can be expected may also avoid misunderstandings and may also improve the success rate , as realistic expectations to the treatment may improve the patients satisfaction and enhance the chance of a successful outcome . the high percentage of patients expecting to obtain a reduction in the severity of their disease ( more than 80%)and the fact that sect .
item actually represented a wish , while the real(istic ) expectation was actually represented by an improvement in headache intensity and frequency .
interestingly , more than half of the patient population considered it important to receive information and education about self - management and understanding of headache .
educating the patients may qualify them in becoming active partners in their own treatment and this might increase compliance with the treatment as the patients experience a responsibility for their own treatment .
the study was designed as a pilot study in three specialized headache centres and the applied methodology and results do not allow definite conclusions .
nonetheless , we believe that this study is important for several reasons : it demonstrates that personal information by telephone or face to face is preferred by most patients , that patients expectations are very high , which points to the need for information about realistic outcome , and that education and information is important to most patients .
furthermore , this study helps to clarify what is important to the patients in specialized clinics , and underline that such endpoints should be added to the strictly objective outcomes such as headache days , medication use and absence rates .
so in conclusion , moh is a challenge for physicians and new strategies need to be devised to improve long - term outcome of this disease . for doing this
, it is important to take into consideration patients preferences and expectations and to give detailed and realistic information about what can and what can not be achieved from a treatment program .
giving the right information and educating the patients might enhance compliance and over time improve treatment outcome .
g. sances , g. sandrini , f. blandini ( irccs neurological institute c. mondino foundation , university centre for headache and adaptive disorders , pavia ) , m. lainez , b. lopez ( fundacin de la comunidad valenciana para la investigacin biomdica , la docencia y la cooperacin internacional y para el desarrollo del hospital clnico universitario de valencia
spain ) , z. katsarava , m. rapsch ( department of neurology , university hospital of essen ) , j. leston , m.t .
goicoichea ( fundacion para la lucha contra las enfermedades neurologicas de la infanzia , buenos aires
argentina ) , r. fadic , b. shand ( pontificia universidad catolica de chile , santiago chile ) , s. spadafora , m. osa ( unversidad isalud , buenos aires argentina ) , a. stoppini , m. pagani ( consortium of medical and informatic bionegeneering , pavia
|
lack of knowledge on patients expectations to treatment may lead to misunderstandings and prevent successful outcome .
presently , treatment of medication overuse headache ( moh ) leads to improvement in up to 75% of patients , but the relapse rate may exceed 40% .
this study aimed to evaluate the preferences on information and expectations to treatment in patients entering a treatment programme for moh .
a questionnaire on patients needs and preferences on information and expectations was distributed to 65 moh patients from specialized headache clinics in italy , germany and denmark .
a total of 75% selected personal verbal information as their primary need , significantly higher than the percentage of patients who selected leaflets and website information 35 and 35% , respectively ( p < 0.001 ) . telephone and e - mail consultation was requested by 59 and 48% , respectively .
the information source preferred was again personal verbal information ( 82% ) , significantly higher than all other information sources ( p < 0.001 ) . in decreasing order , patients preferred telephone consultation ( 48% ) , e - mail consultation ( 44% ) , website information ( 41% ) , and leaflets ( 33% ) .
51% expected their headache to be cured , 71 and 57% requested effective prevention and fast relief of the headache episodes .
80 and 75% , respectively expected reduction in frequency and intensity .
a total of 64% expected information about self - management and 52% expected to receive education on their headaches .
the study demonstrates that patients in specialized headache centres prefer personal information , that expectations are very high , and that education and information are important . providing the right information and
thus give patients realistic expectations might enhance compliance and improve outcome .
|
light with wavelength in the near - infrared range can
propagate a few centimeters through the tissue because of low tissue absorption
in the spectral of near - infrared window .
this finding has encouraged the
development of fluorescence techniques to visualize specific biochemical events
inside living subjects [ 1 , 2 ] . in recent years
, a great development has happened to
the fluorescence molecular tomography ( fmt ) , a technique that resolves
molecular signatures in deep tissue using fluorescent probes or markers
[ 1 , 36 ] .
tissue is illuminated by a series of excitation light
in fmt ; multiple measurements for the fluorescent emission light are collected
from the tissue surface to resolve and quantify fluorochromes deep inside the
tissue . with great potential
, fmt has become a promising imaging modality for
in vivo small animal imaging [ 1 , 2 ] .
the model can be solved by
methods such as finite difference method , finite element method , adaptive finite element
method , and
statistical method .
a weighting matrix can be obtained from the forward
model , which describes the influence of each volume element on the detector
readings . generally , the inverse reconstruction problem of fmt is to find the
fluorescent source distribution in the target tissue based on the precalculated
weighting matrix and the measured data .
since the data measured from the tissue
surface is far less than the number of unknown points inside the tissue , the
reconstruction problem is illposed , and the solution is sensitive to noise as
well as measurement error .
several algorithms have been reported , such as the
modified newton method - based optimization scheme and the born - type
approximation techniques .
the conjugate gradient ( cg ) methods , which need less
storage and computation , are favorable for the problems with large - dimension
data .
they have been reported to be adopted successfully in the reconstruction
algorithms for imaging modalities such as the positron emission tomography
( pet ) [ 1517 ] and diffusion optical tomography
( dot ) .
normally ,
two different kinds of cg with different properties are being used under
different conditions .
they are the linear cg method ( l - cg ) and the nonlinear cg
method ( n - cg ) .
there is a remarkable point that l - cg and n - cg have reciprocal properties .
combining them together may generate an improved algorithm , which has the
advantages of both of them.in this paper , a penalized linear and nonlinear
combined conjugate gradient method ( pln - cg ) for the reconstruction of fmt is
presented .
the l - cg method and the n - cg method are employed separately at
different period based on a restart strategy , in order to exert their
advantages while compensating for their disadvantages . besides , a quadratic
penalty method is adopted to give the result a nonnegative constraint , as well
as reduce the uncertainty and illposedness of the problem .
simulation studies
show that the pln - cg algorithm can give a more accurate and more stable result
for the reconstruction in fmt with less computation .
detailed description of the
pln - cg algorithm can be found in section 3 .
section 2
gives a general review of
the forward and inverse problems in fmt , including the conventional cg - based
reconstruction method .
simulation experiments are presented in section 4 to
demonstrate the validity and efficiency of the proposed algorithm .
when an external excitation light source works at
continuous wave mode ( cw mode ) , the following diffusion equation can be
employed to model the propagation of the excitation light and the fluorescent
emission light [ 610 ] :
( 1 )
[ dx(r)x(r ) ] [ ax(r ) + af(r)]x
( r ) = s ( r
rsk ) ,
[ dm(r)m(r ) ] am(r ) m(r ) = x(r )
af(r ) ,
where r is the position
vector belonging to the image region . x , m(r ) represents the
photon density at r for the
excitation light ( subscript x ) or the
fluorescent emission light ( subscript m ) .
dx , m(r ) is defined as
the diffusion coefficient
( 2)dx , m(r ) = ( 3 ( ax , m(r ) + ( 1 g)sx , m(r ) ) ) ,
where ax , m(r ) and sx , m(r ) are the
absorption and scattering coefficients , respectively .
the absorption of the excitation light due to
fluorophores is described as af(r ) and the
fluorescent yield af(r ) is required for
fluorescence parameter . in this work ,
detailed description of the finite element method for
the fmt forward problem can be found in [ 6 , 11 ] .
based on the finite element solution of the forward
problem , ( 1 )
is transformed into a linear matrix equation as follows :
( 3)wx = i ,
where x , an n 1 vector , denotes
the real fluorescent source distribution to be reconstructed .
i , a m 1 vector , is the
emission data computed from the measurement at the surface of the tissue . and
w , a m n matrix , is the
weighting matrix generated from the forward model .
generally , the inverse
problem for fmt is to find the fluorescent source distribution x in the target
tissue from the measured data i and the
precalculated matrix w. as mentioned before , the problem in ( 3 ) is quite illposed
and undetermined .
cg is one of the most useful methods for solving
large linear systems of equations with symmetric and positive definite
parameters , as it is called l - cg .
l - cg can be employed in fmt reconstruction by
transforming equation ( 1 )
into a standard linear system .
since all parameters of each step in l - cg can be
obtained from the value of the last step by iterative functions , the
computation and storage of the algorithm are reduced .
besides , with pertinence ,
l - cg converges fast and has a good orientating ability .
the requirement of the standard form of the problem in
l - cg limits the implementation of the regularization and penalty methods , which
are quite important for the illposed problem in fmt reconstruction .
thus , the
cg method for nonlinear optimization problems , namely n - cg , which is more
flexible to work along with the regularization and penalty methods and has a
better capability to work under noise , is used widely for image reconstruction
[ 15 , 17 ] . according to the
least - squares ( ls ) rule , problem ( 3 ) can be changed into a nonlinear optimization problem
as follows :
( 4)min(x)=12iwx2+(x ) ,
where (x ) is the
regularization or penalty term chosen on various purposes .
then the n - cg method
can be adopted to find the optimal solution of ( 4 ) .
this method is more computationally expensive than l - cg ,
resulting in more time consuming for each iteration .
nevertheless , it is noticed that the properties of n - cg and l - cg are
reciprocal .
thus , combining n - cg and l - cg together may generate an improved
algorithm , which can get a higher speed and accuracy from l - cg as well as a
good antinoise capability and the flexibility from n - cg .
therefore , an improved
cg - based algorithm for fmt reconstruction , penalized linear and nonlinear
combined conjugate gradient method ( pln - cg ) , was developed according to this
consideration .
the searching process for the optimal solution x * in pln - cg
begins with an initial guess x0 , and takes a steepest descent first step .
, the search is general and the effect of
noise is low , so l - cg is employed to find the rough region of the optimal
solution x * , that is , 2 . because l - cg has a better orientating ability , and
needs less computation , it can find 2 faster and more
accurately , while it does not have to expose its fragility under noise .
transformation has to be made to ( 3 ) to make it a standard linear system with symmetric
positive definite coefficient matrix .
the optimal solution of the ls problem
described in ( 4 )
satisfies the normal equation as follows :
( 5)wwx = wi ,
where w is the
transpose of w. thus
( 6)w*x = i * ,
where w * = ww , is an n n symmetric
matrix . the reconstruction problem has become a standard linear one , as is
required by l - cg . starting from an initial guess x0
, the solution can be updated iteratively
by
( 7)xk+1 = xk + kpk ,
where k is the step
size
( 8)k = rktrkpktwpk ,
and rk is the gradient
of each step .
it is defined in l - cg as the residue of the linear system , which
is obtained iteratively by
( 9)rk+1 = rk + kw*pk ,
where pk is the
searching direction and
( 10)pk+1=rk+1+k+1pk,k+1=rk+1trk+1rktrk .
the l - cg searching iteration process will cease when xk enters the
region 2 .
the definition of the region 2 is determined
by a restarting parameter , which is described in the following section .
the restart strategy is a modification that is often
used in nonlinear conjugate gradient procedures [ 19 , 21 ] .
the general scheme is to
restart the iteration and take a steepest descent step according to some predetermined
conditions .
restarting serves to periodically refresh the algorithm , erase old
information that may not be beneficial or even harmful , and renew the initial
guess x0 at every restarting
time for the new iteration process .
we adopt a restart strategy in the pln - cg scheme
described as follows :
( 11 )
|rk| = |rk 1 + k 1w*pk1 | ,
where rk represents the
gradient of (xk ) .
when |rk| satisfies
( 11 ) , it
means that the xk obtained at current
iteration has entered the small region 2 around x*. then , a steepest descent step is taken , using the
gradient direction at current point as the searching direction .
at the same
time , a new iteration process with the n - cg method begins , using xk as the initial
guess x0 .
the searching result is getting quite closer to the
optimal solution , so the effect of noise has to be taken into consideration .
besides , the uncertainty of the searching has increased .
thus , the method has
been shifted to n - cg , which can work better with noisy data . besides
, n - cg can
introduce the penalty or regularization method to gain a constraint as well as
to reduce the illposedness .
now , problem ( 3 ) is transformed into
a nonlinear optimization problem :
( 12)min (x)=12iwx2+(x ) ,
where (x ) is a penalty
term which will be discussed in section 3.4 .
the n - cg method differs from l - cg mainly in two ways .
firstly , rather than using a standard iterative function to find the step
length k , a line search method is used to identify an
approximate minimum of the nonlinear function (x ) along the
searching direction pk [ 15 , 17 , 19 ] .
secondly , the gradient of (x ) in l - cg is
simply the residue of the linear system that can be obtained iteratively . while
for n - cg
, it must be replaced by the gradient of the nonlinear objective (x ) , that is , (x ) .
thus , using the xk obtained from
l - cg as the initial guess x0 for n - cg , the
solution is updated iteratively :
( 13)xk+1 = xk + kpk ,
where k is the step
size that is computed by a line search method ,
( 14 )
min f ( xk + pk ) s.t .
0 ,
where pk is the
searching direction and
( 15)pk+1=rk+1+k+1pk,k+1=rk+1t(rk+1rk)rktrk ,
where rk is the gradient
of the objective function (x ) at current
point , that is ,
( 16)rk = ( xk ) .
it is known that a major problem of the conventional
gradient - based methods is that they are mainly designed for unconstrained
problems , but the fluorescent source distribution in the biological tissue has
to be constrained to a nonnegative region [ 16 , 22 ] .
here
, a quadratic penalty method [ 15 , 19 ] is adopted to give the problem a nonnegative
constraint .
consider the penalty function described
below
( 17)=ixi2u(xi ) ,
where xi is the ith element of x , u(x ) is the unit
step function . during the searching procedure ,
when the searched result x at current
iteration has negative values , the penalty term will be increased . in this way
is a penalty
weighting parameter , which will gradually become zero as the iteration number
increases .
thus , the solution of the new unconstrained problem in ( 12 ) with the penalty
term ( 17 )
will approach the solution of the original problem in ( 3 ) .
the value of will be
discussed experimentally in section 4.1.3
thus , a penalized linear and nonlinear combined
conjugate gradient method is generated according to the scheme described above .
a numerical model was set up to
test the validity of the pln - cg algorithm .
a circular object was simulated with
an outer diameter of 25 mm , which had a fluorophore with a diameter of 4 mm
embedded in it .
we supposed the optical property to be homogeneous , with a= 0.005 mm and s= 1 mm . in order to show the
efficiency of pln - cg better
they were placed around the inner surface of the circular object ( as shown in
figure 2(a ) ) , and were turned on in turn . for each source ,
32 detector readings
were available through the detector fibers , which were distributed uniformly on
the surface of the circular object .
the forward data were simulated by finite element
method [ 6 , 10 ] , using a fem light
transport model in cw mode .
the object was divided into 518 small triangular elements
and the mesh is shown in figure 2(b ) .
a computer with cpu amd athlon 23600 + and 512 m ddrii memory was used .
images reconstructed by n - cg , l - cg , and pln - cg are
shown in figures 3(a ) , 3(b ) , and 3(c ) .
all images were obtained with one
hundred iterations , as the objective function would descend very slowly
thereafter .
it can be seen that images reconstructed by n - cg and
l - cg are noisy .
while for pln - cg , the values are all nonnegative , and the image is
cleaner and more accurate .
the computing time was about 5.02 seconds for n - cg ,
0.22 second for l - cg , and 1.45 seconds for pln - cg .
so helping n - cg with l - cg has tremendously reduced the
computing time , as in the pln - cg method .
being sensitive to the initial guess is a big disadvantage
for most of the iterative approach based algorithms .
figure 4 shows the results reconstructed with
different initial values , using n - cg ( column 1 ) , l - cg ( column 2 ) , and pln - cg
( column 3 ) , respectively .
since most elements of the original solution are zero
and the quantity of the fluorochrome intensity in fmt is relatively small , a
zero vector is closer to the solution of the problem and is a better choice to
be the initial value ( figure 3 ) . when the initial value is increased to 0.005
and 0.01 ,
the reconstructed images of n - cg ( figures 4(a ) and 4(d ) ) and l - cg
( figures 4(b ) and 4(e ) ) become perturbed , with artifacts distributed in the
background . whereas the pln - cg ( figures 4(c ) and 4(f ) ) is still giving a clear
result , with only a slight blur on the edge . to test the stability of the algorithm ,
figure 5 shows the images
reconstructed by n - cg ( column 1 ) , l - cg ( column 2 ) , and pln - cg ( column 3 ) .
the image is perturbed when the
noise level is 5% ( figure 5(e ) ) .
when the noise level is 10% , the image is
totally blurred , as is shown in figure 5(h ) .
the n - cg method has a better
performance compared with l - cg ( figures figure 5(i ) and figure 5(g ) ) .
however , many artifacts
exist in the images and affect the quantification of the fluorophore . whereas ,
images reconstructed with pln - cg approach are clear when the noise levels are
1% ( figure 5(c ) ) and 5% ( figure 5(f ) ) .
when the noise level is 10% , the
fluorescent source distribution is still relatively clear , with a little
artifacts appearing on the edge .
when using the pln - cg method , is the
weighting parameter that controls the effect of the penalty term .
figure 6
shows the images reconstructed with different . it can be seen that when is 10 , the effect of the penalty term is not enough .
negative values exist and the background is not clean . increasing to 1 does
produce better results ( figure 6(b ) ) , and a further increase to 10 enhances the
improvement ( figure 6(c ) ) .
when increases to 10 , the quality of the image begins to get worse ( figure 6(d ) ) .
the results show that the penalty term can work well for a large
variation of . a typical value for is 10 to 10 . besides , should be
increased when the total iteration number increases .
in addition , rather than keeping fixed , one can
use different according to the
experiential equation
( 18) = an ,
where n is the
iteration number .
a is a fixed
weighting parameter , which can be set to a value between 10 and 1 .
the iteration
number was one hundred and a was chosen to
be 0.005 .
simulation studies above were based on two excitation
sources , in order to demonstrate the qualities of the pln - cg approach better .
when the number of sources is increased , a larger dataset can be obtained .
it
will improve the information content of the measurements and reduce the
illposedness of the inverse problem .
thus , in practice , fmt equipments normally use more
excitation sources [ 3 , 4 ] . here , simulation experiments were designed using 4
sources ( figure 7(a ) ) , 8 sources ( figure 7(b ) ) , and 16 sources ( figure 7(c ) ) ,
respectively . in each experiment , sources were turned on in turn and
32 detector readings were available for each source .
results with clean data
were obtained with a hundred iterations for about 2.99 seconds in the 4 sources
case ( figure 8(a ) ) . while the computing time was about 4.9220 seconds and
9.1560 seconds for 150 iterations in the 8 sources case ( figure 8(b ) ) and 16
sources case ( figure 8(c ) ) , as they have a larger dataset .
was simply set
to 50 for all cases because the difference among the iteration numbers was
small .
it is shown that as the source number increases , the qualities of the
reconstructed images are in progress .
the reconstructed fluorochrome region
marked with the small black circle is more even and closer to the original
value .
after the experiments using clean data described
above , white gaussian noise with a constant variance was added to the detector
readings .
it is shown that the reconstructed results
become clearer and better when the sources number increases from 2 ( figure 5(i ) ) to 4 ( figure 8(d ) ) and 8 ( figure 8(e ) ) . however , when using 16 sources
( figure 8(f ) ) , the image is not improved compared with the 8 sources case , or
even worse , which defies the common sense .
the reason may be that , when using
clean and accurate data for the reconstruction , more datasets mean more
information , whereas for the cases using noisy data , too many data may
interfere with each other and counteract the effect .
nevertheless , the results
of this experiment further demonstrate the capability of the pln - cg method to
work under noise .
in this experiment , a numerical model was set up to
test the validity of the pln - cg algorithm .
a circular object was simulated with
an outer diameter of 25 mm , which had a fluorophore with a diameter of 4 mm
embedded in it .
we supposed the optical property to be homogeneous , with a= 0.005 mm and s= 1 mm . in order to show the
efficiency of pln - cg better
they were placed around the inner surface of the circular object ( as shown in
figure 2(a ) ) , and were turned on in turn . for each source ,
32 detector readings
were available through the detector fibers , which were distributed uniformly on
the surface of the circular object .
the forward data were simulated by finite element
method [ 6 , 10 ] , using a fem light
transport model in cw mode .
the object was divided into 518 small triangular elements
and the mesh is shown in figure 2(b ) .
the reconstruction algorithm was programed
in matlab 6.5 . a computer with cpu amd athlon 23600 + and 512 m ddrii memory was used .
images reconstructed by n - cg , l - cg , and pln - cg are
shown in figures 3(a ) , 3(b ) , and 3(c ) .
all images were obtained with one
hundred iterations , as the objective function would descend very slowly
thereafter .
it can be seen that images reconstructed by n - cg and
l - cg are noisy .
while for pln - cg , the values are all nonnegative , and the image is
cleaner and more accurate .
the computing time was about 5.02 seconds for n - cg ,
0.22 second for l - cg , and 1.45 seconds for pln - cg .
so helping n - cg with l - cg has tremendously reduced the
computing time , as in the pln - cg method .
being sensitive to the initial guess is a big disadvantage
for most of the iterative approach based algorithms .
figure 4 shows the results reconstructed with
different initial values , using n - cg ( column 1 ) , l - cg ( column 2 ) , and pln - cg
( column 3 ) , respectively .
since most elements of the original solution are zero
and the quantity of the fluorochrome intensity in fmt is relatively small , a
zero vector is closer to the solution of the problem and is a better choice to
be the initial value ( figure 3 ) .
when the initial value is increased to 0.005
and 0.01 , the reconstructed images of n - cg ( figures 4(a ) and 4(d ) ) and l - cg
( figures 4(b ) and 4(e ) ) become perturbed , with artifacts distributed in the
background . whereas the pln - cg ( figures 4(c ) and 4(f ) ) is still giving a clear
result , with only a slight blur on the edge . to test the stability of the algorithm ,
figure 5 shows the images
reconstructed by n - cg ( column 1 ) , l - cg ( column 2 ) , and pln - cg ( column 3 ) .
the image is perturbed when the
noise level is 5% ( figure 5(e ) ) .
when the noise level is 10% , the image is
totally blurred , as is shown in figure 5(h ) .
the n - cg method has a better
performance compared with l - cg ( figures figure 5(i ) and figure 5(g ) ) .
however , many artifacts
exist in the images and affect the quantification of the fluorophore . whereas ,
images reconstructed with pln - cg approach are clear when the noise levels are
1% ( figure 5(c ) ) and 5% ( figure 5(f ) ) .
when the noise level is 10% , the
fluorescent source distribution is still relatively clear , with a little
artifacts appearing on the edge . when using the pln - cg method , is the
weighting parameter that controls the effect of the penalty term .
figure 6
shows the images reconstructed with different . it can be seen that when is 10 , the effect of the penalty term is not enough .
negative values exist and the background is not clean . increasing to 1 does
produce better results ( figure 6(b ) ) , and a further increase to 10 enhances the
improvement ( figure 6(c ) ) .
when increases to 10 , the quality of the image begins to get worse ( figure 6(d ) ) .
the results show that the penalty term can work well for a large
variation of . a typical value for is 10 to 10 . besides , should be
increased when the total iteration number increases .
in addition , rather than keeping fixed , one can
use different according to the
experiential equation
( 18) = an ,
where n is the
iteration number .
a is a fixed
weighting parameter , which can be set to a value between 10 and 1 .
the iteration
number was one hundred and a was chosen to
be 0.005 .
the goal of this work was to establish a fast and
accurate algorithm for fmt reconstruction , which is illposed . in order to
achieve this goal ,
simulation studies have indicated that this pln - cg
method can exhibit very favorable performance and produce relatively stable
behavior .
further studies show that , when using sixteen sources , the reconstruction
algorithm can work under 15% noise , which is sufficient for practical use .
the
better performance is partly achieved by the combination of l - cg and n - cg .
l - cg
makes the algorithm faster and more accurate . while at the same time , n - cg
gives the whole algorithm a better capacity to deal with noise .
it introduces
the penalty method to get a nonnegative constraint and reduce the uncertainty
of the problem .
the restart strategy also improves the efficiency of the
algorithm by refreshing the algorithm periodically .
some kind of regularization techniques can be employed to
regularize the results and smoothen the images .
the prior knowledge about
the intensity of the fluorochrome can be used to utilize a general threshold of
the reconstructed fluorescent source density to decrease the permissible region
.
in addition ,
doing more restarting procedures appropriately may also upgrade the
reconstruction images .
currently , we are involved in the practical use of the
pln - cg reconstruction algorithm for the ongoing fmt experiment in our
laboratory .
|
conjugate gradient method is verified to be efficient for nonlinear optimization problems of large - dimension data . in this paper , a penalized linear and nonlinear combined conjugate gradient method for the reconstruction of fluorescence molecular tomography ( fmt ) is presented .
the algorithm combines the linear conjugate gradient method and the nonlinear conjugate gradient method together based on a restart strategy , in order to take advantage of the two kinds of conjugate gradient methods and compensate for the disadvantages .
a quadratic penalty method is adopted to gain a nonnegative constraint and reduce the illposedness of the problem .
simulation studies show that the presented algorithm is accurate , stable , and fast .
it has a better performance than the conventional conjugate gradient - based reconstruction algorithms .
it offers an effective approach to reconstruct fluorochrome information for fmt .
|
certain pediatric brain tumors such as those of primitive neuroectodermal origin have demonstrated dose - dependent chemotherapy responses [ 13 ] and the principles of high - dose chemotherapy with stem - cell rescue have been applied to these pediatric brain tumors similarly to those of other solid tumors [ 46 ] .
high - dose chemotherapy with autologous hematopoietic stem - cell rescue ( hdct - ahscr ) has been used successfully in children with recurrent / refractory or poor - prognosis medulloblastomas , primitive neuroectodermal tumors ( pnets ) , atypical teratoid / rhabdoid tumors , and central nervous system ( cns ) germ cell tumors ( gcts ) [ 717 ]
. however , the efficacy of this treatment strategy for cns tumors of glial origin , such as high - grade gliomas and ependymomas , is less encouraging [ 1821 ] .
the hdct regimens reported in literature vary but mainly consist of alkylator - based myeloablation , including thiotepa ( tt ) with or without topoisomerase inhibitors [ 8 , 13 , 1820 , 22 , 23 ] .
other agents may be rationally implemented in pre - hdct chemotherapy depending on tumor type , such as vincristine ( vcr ) and methotrexate ( mtx ) for medulloblastomas or temozolomide ( tmz ) for gliomas [ 1 , 4 , 6 , 11 , 12 , 19 , 21 , 22 , 24 ] .
variable intensity of regimens and numbers of myeloablations / ahscrs may potentially result in different outcomes and toxicity profiles .
the disease histotypes , hdct regimens , and patient characteristics have differed significantly among reported series [ 11 , 12 , 19 , 22 ] .
nevertheless , achieving positive results generally is more likely in patients with no evidence of disease / minimal residual disease status at the time of stem - cell rescue [ 5 , 23 ] . because of this , with the exception of highly chemosensitive lesions like gcts , the extent of surgical resection may play a crucial role in clinical outcomes .
surgery may also be used for second look pre- or posttransplant evaluations , since mris may reveal treatment - related heterogeneously enhancing lesions apparently indistinguishable from disease progression [ 6 , 8 , 25 ] .
hdct - ahscr is particularly attractive for pediatric brain tumor management , since it may permit omission of radiotherapy and its devastating neurocognitive sequelae , particularly in the very young [ 7 , 8 , 18 ] .
it also can be used as a bridging modality for younger patients with radiosensitive lesions . yet acute toxicity of high - dose chemotherapy
itself may be unacceptable ; while the main dose limiting hematopoietic suppression is reversed by ahscr , excessive systemic toxicities including deaths have been reported [ 1 , 20 , 2224 ] .
in addition , modern advanced radiotherapy is less harmful [ 18 , 26 , 27 ] , and its long - term consequences on the developing brain are presumably comparable to that caused by high - dose chemotherapy , which may not be negligible .
hdct - ahscr for pediatric brain tumors has been regularly utilized at the university of california at los angeles ( ucla ) since the late 1990s and we have conducted a retrospective review of consecutively treated patients to summarize our single institution 's experience for this modality . while the limited statistical power and retrospective character of this study are limitations , it allows the derivation of valuable findings concurring with reported predictive variables and clinical outcome measurements .
this is a reflective validation of a heterogeneous and small , yet representative patient group .
it supports the results from evaluation of toxicity profile of various regimens utilized in a setting of standardized supportive care delivery .
informed consents were obtained from all 18 patients and/or parents in accordance with the ucla institutional review board ( irb # hspc 10000126 ) .
all 18 consecutive pediatric patients with brain tumors who underwent hdct - ahscr at ucla from 1999 to 2009 were enrolled in this retrospective clinical review and outcome analyses ( table 1 ) .
the patients ' data on demographic and clinical characteristics , treatments and disease status prior to ahscr , complications after ahscr , and final outcomes were extracted .
for all patients , relevant clinical information including laboratory results was also retrieved by the hospital electronic medical record system .
in addition to the electronic medical record , clinical information was supplemented by reviewing hard copies of patient medical records . once diagnosed with a brain tumor , accepted standard treatment
was initiated for all patients based on tumor type and stage ( table 2 ) .
indications for hdct - ahscr included young age prohibiting radiation therapy , recurrent / refractory or residual disease after upfront treatment , and/or chemosensitive primary tumors with poor prognoses .
patients with recurrent tumors were also treated with second - line chemotherapy with or without additional surgery and radiotherapy first , aiming for complete remission before the hdct - ahscr .
patients had at least a partial response or stable disease prior to hdct - ahscr .
peripheral blood stem - cells were harvested and then used in all cases as a source of hematopoietic stem - cells .
granulocyte colony stimulating factor was used for mobilization of peripheral blood stem - cells , which were collected , then stored unmanipulated in dimethyl sulfoxide and reinfused after hdct .
eight patients <3 years old who underwent 3 tandem ahscr had myeloablative hdct with carboplatin ( cp ) , and thiotepa ( tt ) , which were given once daily for 2 days on days 3 and 2 ( table 3 ) .
seven of these 8 patients received 3 induction courses each with vcr , cisplatin ( cddp ) , cyclophosphamide ( cpm ) ( with mesna ) , and etoposide ( vp ) .
six out of 9 patients with single ahscr were conditioned utilizing cp on days 8 , 7 , 6 ; tt and vp on days 5 , 4 , 3 .
two additional patients with nongerminomatous germ cell tumors ( nggct ) received a single ahscr after receiving hdct regimens consisting of tt and vp once daily on days 5 , 4 , and 3 .
another patient with pineoblastoma received a single autologous transplant after hdct with cpm for 4 days and melphalan for 3 days .
lastly , one patient with a supratentorial pnet who had 4 tandem ahscrs received hdct with cddp , cpm , and vcr .
dose modification for cp was made for one patient who had abnormal renal function before the transplant .
post - ahscr , patients received standard supportive care measures , including bactrim and fluconazole for prophylaxis of pneumocystis jirovecii and opportunistic fungal infections , respectively .
transfusions of irradiated blood products were used to maintain hemoglobin level above 8 g / dl and platelet count above 20 10e3/l or higher for active bleeding for all patients .
granulocyte colony stimulating factor was utilized posttransplant if the patient had uncontrolled neutropenic sepsis or neutropenic fever unresponsive to antimicrobial agents .
supplemental parenteral nutrition was used to support patients with severe gastrointestinal mucositis with diminished caloric intake .
additional tumor - directed or palliative therapy was administered to three patients after transplant that had further residual , recurrent , or progressive tumors .
9 with nggct received additional radiation therapy for palliation after recurrence post - ahscr ( table 2 ) , patient no
. 5 started treatment with irinotecan , bevacizumab , and tmz , and patient no .
complete remission ( cr ) was defined as resolution of initially demonstrable tumors without the appearance of new diseased areas measured by mri . in four cases ,
minimal residual heterogeneous post - treatment lesions enhancing on mri were suspicious for refractory disease and were rebiopsied , which demonstrated absence of viable tumor and confirmed cr .
partial remission ( pr ) and stable disease ( sd ) were defined as greater or less than a 50% decrease in the product of the two largest perpendicular diameters of the tumor , respectively .
if the initial cerebrospinal fluid ( csf ) cytology was positive , two consecutively negative csf cytology exams were required to document cr or pr .
repeatedly positive csf without persistent increase in cell count was an additional finding that qualified for stable disease .
progressive disease was defined as an increase of > 25% in tumor area with maximum perpendicular diameters in any site of residual disease area compared to immediate pretreatment area or compared to area of best prior response at that site , the appearance of a new demonstrable lesion , or the conversion of csf cytology from negative to positive .
neutrophil engraftment was defined as an absolute neutrophil count recovery from nadir to 0.5 10e3/l or greater for 2 consecutive days .
progression - free survival was assessed from the date of the first ahscr to the date of disease relapse or progression .
overall survival was assessed from the date of first ahscr to the date of death .
both progression - free survival ( pfs ) and overall survival ( os ) were related to the explanatory variables using a cox proportional hazards model and illustrated with the kaplan - meier method as implemented by stata 8.0 ( statacorp ) .
multivariate logistic regression models were performed to control for extent of resection and disease status prior to ahscr .
analysis of variance ( anova ) was used to test the significance of toxicity differences between single versus 3 ahscr regimens .
a total of 18 patients were identified in our comprehensive pediatric blood and marrow transplant database , who had hdct - ahscr from 19992009 for brain tumor treatment .
patients were 0.419 years old at diagnosis ( mean 5.6 , median 2.3 yrs ) , and male : female ratio was 2 : 1 .
two thirds of the patients had neuronal / embryonal tumors ( 7 medulloblastomas , 4 pnets , and a pineoblastoma ) , two patients had anaplastic glial tumors ( an ependymoma and an oligodendroglioma ) , one patient had a neurocytoma , and three had nggct .
patients with nggct were > 15 y / o , and the majority of the remaining patients were younger ( < 53 y / o ) .
chang staging principles applied to all tumors and revealed 4 patients with m2 , four with m3 ( including positive csf cytology and focal , subarachnoid , or leptomeningeal spreads ) and the remaining with m0 status as a highest stage at any time prior to hdct - ahscr .
most of the patients had initial surgical intervention : eight ended up with gross total resection ( gtr ) on first attempt , 7 had subtotal resections ( str ) , 2 of which were followed by gtr , and 3 nggct were not resected initially ( one eventually had gtr after recurrence ) ( table 2 ) .
various agents and combinations were utilized for initial chemotherapy as shown in table 2 . with the exception of one patient with pineoblastoma , who was treated with initial radiotherapy and subsequent temozolomide only after recurrence ( prior to hdct )
three nggct patients received initial vp , ifosfamide , and cp 6 courses , one of whom also got radiotherapy prior to recurrence .
these patients with nggct were conditioned with vp / tt ( + cp for patient no .
1 ) with medulloblastoma was initially treated at an outside hospital with a combination of cddp , vcr , lomustine , and radiotherapy prior to recurrence .
the remaining 12 patients were initially treated with at least three courses of vcr , cddp , cpm , and vp ; 4 of whom had 5 courses with addition of mtx , and 2 of these 4 patients also received tmz .
seven out of these 12 patients ( as well as patient no . 8 with recurrent neurocytoma ) received 3 cycles of high - dose cp and tt , each followed by ahscr , and one of the 12 received a different hdct regimen and 4 ahscrs as described in the methods section and shown in table 3 .
four patients who had additional tmz and/or mtx to initial chemotherapy and patient no.1 also received vp , in addition to cp and tt ( table 3 ) during hdct for ahscr .
four patients with recurrent disease also received additional salvage therapy prior to ahscr as shown in table 2 .
for one of them , hdct with tt and cp for ahscr served also as a salvage regimen for residual / sd medulloblastoma . in summary ,
half of our patients received 3 tandem ahscr with generally less prior chemotherapy exposure during induction , and milder hdct per each ahscr .
the other half got stronger induction chemotherapy and more intensive hdct prior to their single ahscr .
this dichotomization among the patients allowed us to evaluate for differences of toxicity profiles and test the hypothesis that toxicity profiles of single ahscr versus 3 tandem ahscr regimens are different .
the median diagnosis to transplant time was 6 months ( mean : 1 year ) .
the average number of infused cd34cells per kg per ahscr was 20 10e6 ( range : 2 to 100 10e6 ) .
the average time between the tandem courses was 29 7 days ( mean sdev , range 2153 ) ( this is versus intended 21 days , mostly due to delayed hematopoietic engraftment / count recovery ) .
neutrophil engraftment was estimated by an average of 17 8 ( sdev ) days post - transplant .
ten patients did not receive any radiotherapy during their entire treatment at the time of our analyses .
10 , and 13 ) received cerebrospinal radiotherapy prior to ahscr , four patients ( no
. 2 , 4 , 15 , and 18 ) received cerebrospinal radiotherapy post - ahscr , and one patient ( no .
the follow - up durations were 3 2.4 years ( mean sdev , range 0.98.9 , and median : 2 years ) after diagnosis and 2 2.4 years after transplant ( range 0.058.5 , and median : 1.1 years ) .
the probabilities of three - year pfs and os from ahscr were 60.5% 16 ( mean std .
error ) and 69.3% 11.5 , respectively , ( figure 1 ) .
we sought out associations between the clinical outcome and the following parameters to identify potential prognostic predictors : age , gender , tumor type and staging , extent of surgical resection , chemotherapy regimens , radiation therapy , disease status prior to ahscr , as well as grade of toxicity as another measurable endpoint .
heterogeneous patient characteristics and tumor histotypes along with small numbers were restrictive for appropriate statistical power for some relevant analyses , such as testing different regimens within tumor subtypes .
nevertheless , in univariate analyses we found no general associations between the age , gender , tumor type / staging , hdct regimens ( single versus 3 ahscr ) , radiation therapy , toxicity grade , and clinical outcome expressed either as pfs and os for all 18 patients .
our significant findings included a strong correlation between the extent of initial surgical resection and pfs ( figure 2 ) , as well as the disease status prior to ahscr and clinical outcome ( both pfs and os , as shown in figures 3(a ) and 3(b ) , respectively ) .
figure 2 demonstrates the kaplan - meier curves for pfs of 15 patients with initial resection ( excluded are 3 nggct patients ) , separated according to gtr versus str .
patients with initial str have significantly worse pfs than those with gtr ( p < .001 , hazard ratio ( hr ) = 9 , and 95% confidence interval ( ci ) >
10>10 per cox proportional hazards regression ) . figures 3(a ) and 3(b ) , respectively , depict kaplan - meier curves for pfs and os for all 18 patients , based on their disease status prior to ahscr .
patients with cr prior to ahscr ( either biopsy proven negative or not excluded minimal residual disease ) have sustained > 3 yr pfs and os of 100% , whereas most patients with pr or sd have succumbed due to disease progression ( one patient died from therapy - related toxicity ) .
cox proportional hazards regression demonstrated p < .001 , hr = 6.52 , with 95% ci = 2.6715.9 for pfs , and p < .001 , hr = 4.98 , with 95% ci = 1.8613.4 , for os .
multivariate analysis was performed to test interdependence between the extent of initial surgical resection and disease status prior to ahscr as predictors of pfs .
this demonstrated , that when adjusted for each other , gtr independently sustains its predictive significance with p < .001 , hr > 10 , ci >
10 > 10 , with cr prior to ahscr approaches being independently significant ( p = .056 , hr = 2.8 , ci = 0.977.9 ) . in concordance
, 87.5% of patients with gtr had cr prior to ahscr and 70% of cr patients had gtr on initial resection .
table 4 demonstrates detailed toxicity data for all 18 patients as graded by national cancer institute criteria .
this data comprehensively captures toxic episodes for all listed categories within 30 days after ahscr .
in addition , all patients experienced grade 3 - 4 hematopoietic toxicities as anticipated requiring irradiated blood product support . as summarized in figure 4 , patients with 3 ahscr experienced less toxicity in general , whereas patients who received single ahscr had more toxic episodes and 1 toxic death . to quantify and compare toxicity data
, we conditionally scored all patients ' toxicity other than hematopoietic suppression ; those who had no other grade 3 or higher toxicity were scored with 0 ( n = 4 ) , fever and neutropenia , infectious complications were scored with 1 ( n = 3 ) ; and fever and neutropenia with at least one more organ system grade 3 or higher toxicity ( excluding hematopoietic ) were scored with 2 ( n = 11 ) .
these scores were first used as variables to perform anova between single ahscr and 3 ahscr groups , and it confirmed the significant difference ( p < .001 , at 3 ahscr mean toxicity score ( sdev ) was 0.78 0.83 , and at single ahscr mean toxicity score was 2 0 ) .
furthermore , these results were confirmed by performing the nonparametric kruskal - wallis test between two groups ( p = .0054 ) .
there was no formal neuropsychological testing for most patients ; however , lansky - karnofsky performance scores demonstrated that all survivors had satisfactory functional status ( table 3 ) .
this retrospective study demonstrates that pediatric brain tumor patients treated with hdct - ahscr are most likely to have favorable outcome if patients achieved cr ( either biopsy proven or by radiologic criteria , that is , minimal residual disease not excluded ) at the time of ahscr .
gross total resection , which has historically been one of the most prominent favorable prognosticators , [ 22 , 28 ] , was associated with cr in our study and independently predicted pfs .
in contrast , patients with sd at the time of transplant and especially those who had progression prior to transplant had the poorest chance of survival when treated by hdct - ahsct .
our data also suggests that some of the patients with pr without overt progression prior to transplant still may be salvaged by hdct - ahsct .
these findings are in concordance with multiple previous reports [ 8 , 22 , 23 ] .
our 60% pfs and 69% os rates are also comparable or superior with reported outcome data [ 6 , 7 , 12 , 18 , 19 , 21 , 22 ] .
these survival rates rationalize the use of this modality for pediatric brain tumor patients with poor prognosis , with estimated efs / os generally less or equal than 5040% at best , if treated with nonmyeloablative therapies [ 1 , 5 , 23 ] . in our study
, it is not possible to conclude whether a portion of the included patients already were cured without the hdct - ahscr .
international consensus meetings have concluded that the precise role of hdct - ahscr in pediatric brain tumors can only be determined in randomized trials .
the heterogeneity of tumor types and treatment regimens prevented the development of any strong conclusions based on the negative findings of our retrospectively studied small patient group .
particularly , subgrouping patients into embryonal tumors ( compared with others ) and/or further subdivision according to treatment regimens result in small numbers , which can not be utilized for conclusive analyses .
nevertheless , only 25% ( 3/12 ) of patients with embryonal tumors experienced recurrence after ahscr , compared to 60% ( 2/3 ) of patients with glial / mixed lesions ( table 3 ) , an observation that concurs with well - established knowledge that medulloblastomas and pnets have better responsiveness [ 7 , 8 , 11 , 12 , 14 , 19 , 22 , 24 ] to this modality compared to glial tumors [ 6 , 11 , 1820 , 22 ] .
in addition , we can not exclude that more intensive induction with stronger single hdct / ahscr harbors some therapeutic advantage over less intensive induction and milder hdct with 3 ahscr for embryonal tumors , since 2 out of 3 recurrences in 12 embryonal tumors occurred among the 6 patients , who got 3 ahscr .
yet , our one young patient with anaplastic ependymoma is in sustained cr 4.3 yrs post - triple tandem ahscr regimen ( no radiation ) , despite the literature which reports very poor outcome ( 5-yaer efs 12% ) for those treated with single ahscr .
while the aforementioned comparisons of clinical outcome between single and 3 ahscr regimens in subgroups lack significant power , our toxicity data analyses are more robust ( assuming that tumor type is unrelated to toxicity ) .
there are no randomized studies between regimens with single versus 3 ahscr reported in the literature .
however , up to 1020% toxic mortality has been documented in series with stronger thiotepa - based regimens and single - ahscr [ 19 , 20 , 2224 ] , whereas a larger medulloblastoma study with milder cyclophosphamide - based chemotherapy and up to 4 ahscrs had no protocol - related deaths .
our data support these findings in that our only toxic death occurred in the single ahscr group ( 1/9 , 11% ) .
in addition , regimens with 3 ahscr were tolerated much better with significantly fewer toxic episodes ( table 4 , figure 4 ) .
it appears that repetitive administration of tt at doses comparable to that used in single transplant ( which utilizes concomitant vp in hdct ) may decrease nonhematologic toxicity and allow administration of a greater cumulative drug dose .
whether this reduced toxicity is accompanied with decreased efficacy still remains to be seen .
the major papers on transplant in embryonal brain tumors in children are reported on the head start program byfangusaro et al . , which is referenced above .
the other approach to embryonal recurrent tumors is enhanced delivery by intra - arterial chemotherapy and osmotic blood - brain barrier disruption ( ia / bbbd ) , as recently reviewed in cancer by jahnke et al . .
comparison of these two larger series with regards of efficacy demonstrates comparable disease - free and os survival rates of around 40% and 50% , respectively , at about the 3-year mark .
our patients ' outcome with an almost 60% pfs and 70% os at 3 years may seem promising ; however , many of the common critical objections apply .
first , only 2 of our 12 patients with embryonal tumors had recurrent tumors ; the remaining had primary tumors ( table 1 ) .
second , our inclusion criterion for this study is the high - dose therapy / autologous rescue and not the intention to treat .
nevertheless , our survival curves apparently are reaching their plateau , and we anticipate 50% long - term survivorship . in general , small , heterogeneous , and selected study groups hamper studies in this field . according to newer data , medulloblastomas with particular histological features and molecular signatures may have a more favorable prognosis , but the retrospective nature of our study does not allow us to perform these analyses .
toxicities observed in our patients were similar to pediatric supratentorial pnet patients reported by fangusaro et al . and for children with medulloblastoma .
these mainly involved grade 3 - 4 hematopoietic toxicities , episodes of febrile neutropenia and , mucositis , often requiring narcotics .
in contrast , in ia / bbbd study reported hematopoietic suppression and neutropenic fever to a lesser extent , highlighting the advantage of less systemic toxicity by this modality .
in addition , regarding neurological toxicities , ia / bbbd was reportedly associated with neurotoxic episodes in approximately 30% of patients with a vast majority with reversible neurologic deficit lasting > 24 to 48 hrs .
this is comparable to the neurotoxicity observed for our 18 patients , a third of whom have experienced neurological adverse effects in one form or another , including grades 1 and 3 hearing loss ( table 4 ) . in comparison ,
approximately 60% of patients sustained high - frequency hearing loss necessitating a reduction or elimination of cisplatin in study reported by fangusaro et al . .
patients in the ia / bbbd study received heterogeneous sodium thiosulfate regimens , and an accurate comparison of ototoxicity was not feasible . a number of mechanisms by which dose - intensive chemotherapy might help include steep dose response curve of alkylating agents [ 13 , 32 ] , blood - brain - barrier penetration [ 33 , 34 ] , and overcoming intrinsic resistance of hypothetical subpopulation(s ) of cells such as brain tumor initiating cells [ 35 , 36 ] .
while hdct - ahscr may offer these advantages , we conclude that further intensification of regimens using hdct likely has reached the point of maximum clinical toxicity , while resulting in diminished return , necessitating the development of newer modalities to improve upon the efficacy of brain tumor therapy .
recent advances in the molecular pathology of malignant glioma and medulloblastoma provide more opportunities for targeting brain tumors [ 30 , 37 ]
. this knowledge might be used for proposed biological modifications following hdct - ahscr for pediatric brain tumors , and pediatric brain tumor derived neurospheres may also provide an excellent predictive model for preclinical explorations for such important endeavors .
|
background .
dose - dependent response makes certain pediatric brain tumors appropriate targets for high - dose chemotherapy with autologous hematopoietic stem - cell rescue ( hdct - ahscr ) . methods .
the clinical outcomes and toxicities were analyzed retrospectively for 18 consecutive patients 19 y / o treated with hdct - ahscr at ucla ( 19992009 ) .
results .
patients ' median age was 2.3 years .
fourteen had primary and 4 recurrent tumors : 12 neural / embryonal ( 7 medulloblastomas , 4 primitive neuroectodermal tumors , and a pineoblastoma ) , 3 glial / mixed , and 3 germ cell tumors .
eight patients had initial gross - total and seven subtotal resections .
hdct mostly consisted of carboplatin and/or thiotepa etoposide ( n = 16 ) .
nine patients underwent a single ahscr and nine 3 tandems .
three - year progression - free and overall survival probabilities were 60.5% 16 and 69.3% 11.5 .
ten patients with pre - ahscr complete remissions were alive / disease - free , whereas 5 of 8 with measurable disease were deceased ( median followup : 2.3 yrs ) .
nine of 13 survivors avoided radiation .
single ahscr regimens had greater toxicity than 3 ahscr ( p < .01 ) . conclusion .
hdct - ahscr has a definitive , though limited role for selected pediatric brain tumors with poor prognosis and pretransplant complete / partial remissions .
|
in this prospective clinical trial , 400 patients older than 30 years old ( in class 1 , 2 , and 3 of american society of anesthesiologists classification ) who were scheduled for elective operative fixation of fractured hip , enrolled ; all of them were admitted in al - zahra and kashani hospitals in isfahan and all of them signed informed consent from .
patients were included if they had no dementia or cognitive dysfunctions and no history of opioid or psychotic drugs use . patients with hypersensitivity to blood transfusion , sever reaction to cement implantation , sever bleeding , hypotension needed interventions , prolonged operation changed surgical plan which impressed the study goals , were excluded .
an anesthesiologist visited all the patients a night before surgery and any known history of hematologic , endocrine , cardiovascular , pulmonary , and central nervous system diseases were noted . also , systolic , diastolic , and mean arterial pressures were recorded .
patients were randomly assigned into two groups using random - number table : ga ( general anesthesia ) and na ( neuraxial anesthesia ) .
all patients were infused ringer 's lactate solution ( 4 ml / kg ) on arrival in the operating room and also received low dose of heparin as a dvt prophylaxis .
systolic , diastolic , and mean arterial pressures were recorded before induction of anesthesia by anesthesiologist . in the ga group , patients were given ringer 's lactate solution ( 10 ml / kg ) to oppose the vasodilatation and hypotension resulting from intravenous anesthetics during induction of anesthesia .
they received a standardized general anesthesia involving pre - oxygenation and induction with fentanyl ( 2 g / kg ) followed by thiopental ( 5 mg / kg ) until loss of consciousness ; then lidocaine ( 1.5 mg / kg ) and pancuronium ( 0.1 mg / kg ) were administered .
anesthesia was maintained using halothane ( 0.5 - 1.5% ) in oxygen and nitrous oxide ( ratio 1:1 ) .
mechanical ventilation with a constant tidal volume of 10 ml / kg and respiratory rate of 12 per minute was maintained throughout the study . at the end of the operation ,
the volatile anesthetic agents were discontinued and residual neuro - muscular block was antagonized with intravenous prostigmin ( 0.04 mg / kg ) and atropine ( 0.02 mg / kg ) .
extubation was performed when the patient was judged to be awake . in the na group
, patients were given ringer 's lactate solution ( 15 ml / kg ) prior to the induction of anesthesia and received either spinal or epidural anesthesia .
after sterile preparation and draping , in spinal anesthesia group , plain bupivacaine 0.5% ( 3 ml ) was injected over 10 seconds into the subarachnoid space at the l3-l4 interspace via 23-g withacre needle placed midline approach . in the epidural group
, anesthesia was performed using an 18-g - touhy needle at the l3-l4 interspace and after an initial test dose of plain bupivacaine 0.5% ( 5 ml ) with epinephrine ( 1:200000 ) was injected followed 5 minutes later by a further 20 ml .
all patients were monitored by non - invasive electrocardiogram , blood pressure , and pulse oxymetry . additionally , end - tidal carbon dioxide ( etco2 ) was monitored and maintained within 35 - 40 mmhg during operation in the ga group . in both groups ,
preloading with ringer 's lactate solution prevented sever reduction in blood pressure and kept mean of arterial pressure above 70% of baseline levels in hypertensive patients and above 65 mmhg in normotensive patients.3 blood pressure was measured every 15 minutes and if it fell to below these limits , halothane was reduced gradually in the ga group and an additional 10 ml / kg ringer 's lactate solution was infused in a period of 10 minutes in the na group to reestablish the acceptable blood pressure.11 if the blood pressure did not respond after these interventions , 5 - 10 mg bolus of intravenous ephedrine , according to the degree of hypotension , was administered .
the second dose was repeated after 5 minutes if the blood pressure was not normalized .
five minutes after the second dose of ephedrine , if the mean arterial pressure was still less than 70% of its baseline value , further ephedrine boluses were administered , and the case regarded as a failure in the study .
hemoglobin level was measured before surgery ( baseline ) , 6 hours , and 2 , 3 , and 5 days after the end of it .
the total estimated intraoperative blood loss was recorded at the end of each surgery with bloody gauze counting and measuring volume of suction bottles ; also , the amount of postoperative hemorrhage was measured according to its volume in hemovac drain .
the time interval between the induction of anesthesia ( ga or na ) and dressing of the site of operation was recorded as the duration of surgery .
postoperative pain severity was evaluated using a visual analogue scale ( vas ) ranging from 0 ( no pain ) to 10 ( worst possible pain ) .
the vas was evaluated by a nurse at the time of discharge from recovery room and by a second nurse on the ward at the 2 , 3 , and 5 day after surgery .
intravenous morphine ( 5 mg ) was administered to the patients re - quested analgesia and its total amounts were recorded till 5 days after the end of surgery .
cognitive dysfunctions were noted before discharge from recovery room , and at 24 and 48 hours after the end of the surgery based on time , person , and place disorientation .
postoperative complications such as deep veins thrombosis , congestive heart failure , myocardial infarction , atelectasis , pulmonary infection , and cerebrovascular accidents are diagnosed by the consultant specialist .
the number of patients who died over one month period in the hospital or after discharge from it was recorded .
the data were analyzed using spss statistical package ( version 12 , spss inc . ,
frequencies were compared by mann - whitney and chi - square tests , as appropriate , and t - test was used to compare the averages .
during the study period , 400 consecutive patients with the required surgical indication were included .
three patients of the ga group and 10 of the na group were excluded because of change in anesthetic or surgical plan .
one hundred and ninety - seven ( 50.9% ) patients were allocated to the ga group , whereas 190 ( 49.1% ) patients constituted the na group .
of 190 neuraxial anesthesia patients , 164 ( 42.4% ) , 1 ( 4% ) and 22 ( 5.7% ) received spinal , epidural and continuous epidural anesthesia , respectively .
patients and surgical characteristics , baseline hemoglobin and length of stay in hospital before surgery are listed in table 1 .
patient characteristics , preoperative hemoglobin values , duration of hospitalization , and some intraoperative data in the general anesthesia group ( ga ) and neuroaxial group ( na ) the mean of intraoperative blood loss , mean of vas scores in recovery and on the 3 postoperative day , and also the length of stay in hospital after surgery in the na group were significantly less than the ga group .
both groups showed a significant decrease in hemoglobin values on the 2 and 3 postoperative days comparing to the baseline values ( p < 0.001 ) ( table 2 ) .
the mean intra- and post - operative blood loss , hemoglobin changes , pain scores and the duration of hospitalization in both groups there was no significant difference between two groups regarding the abundance of cardiovascular and respiratory complications ( table 3 ) .
no patients in either group suffered from cardiac insufficiency , deep vein thrombosis , or cerebral events . in the na group ,
frequency of postoperative complications and mortality rate in both groups the number of patients who developed cognitive dysfunction in recovery room was signifycantly higher in the ga group compared with the na group .
although the number of patients who died was more in the na group , but no significant difference was found between the two groups for in - hospital and out - hospital mortality .
on the 2 postoperative day , there was a greater incidence of cardiac ischemic events and respiratory complications in both groups .
also , myocardial infarction was reported more on the 3 postoperative day , although this difference was not statistically significant .
the mean of ephedrine doses ( 0.8 4.4 vs. 3.2 8.1 mg administered to the ga and na groups respectively ) was statistically significant ( p < 0.001 ) . also , the mean of morphine consumption in the ga group ( 5.0 6.3 mg ) was higher than the na group ( 3.4 7.4 mg ) ( p = 0.004 ) .
this study showed that the mean of blood loss during operation was significantly more in patients receiving general anesthesia than neuraxial anesthesia . in two previous separate meta - analysis assessing the patients undergoing different surgical procedures12 and the candidates of hip and spinal column surgeries , the researchers demonstrated that general anesthesia is accompanied by more hemorrhage compared with neuraxial anesthesia.1213 in a review article , macfarlane et al reported that in four out of ten studies , patients receiving ga had significantly more bleeding , and in the other six there was no significant difference between groups considering blood loss.14 they reported that the mean of reduction of blood loss was different from 118 ml to 595 ml , but in our study this value was 238 ml . in a prospective controlled study ,
patients undergoing hip surgery under spinal anesthesia had less blood loss than patients receiving general anesthesia.15 neuraxial anesthesia blocks alpha and beta adrenergic receptors , leads to reduction of heart rates , vascular tone , and blood pressure .
the decreased blood pressure acts like controlled hypotension which results in less blood loss.16 in this study , the amount of intraoperative ephedrine consumption to oppose hypotension was significantly more in neuraxial method than in general anesthesia . thus the established intraoperative hypotension is in an accepted limitation , it can explain the less blood loss in neuraxial anesthesia patients .
the other justifying reason can be an increase in venous blood pressure in patients receiving general anesthesia especially with mechanical ventilation.17 in this study there was no difference between the groups regarding postoperative blood loss amount and the hemoglobin changes until the 5 postoperative day ; but in both groups the mean of hemoglobin changes was statistically lower on the 2 and 3 postoperative days compared to preoperative values . in our study , the mean of duration of hospitalization was significantly more in patients receiving general anesthesia .
miniche et al surveyed 42 volunteers of hip surgery undergoing general or continuous epidural anesthesia and found that the duration of hospitalization was similar in both groups.18 the difference may be attributed to their smaller studied population and applying only one method of neuraxial anesthesia which was continuous epidural anesthesia .
sutcliffe and parker in a retrospective study found no difference in factors of hospitalization in 1333 patients receiving either general or neuraxial anesthesia for hip surgery.19 this contradiction can be due to the different kind of studies .
vaida et al declared that the beneficial effects of neuraxial analgesia are reduction of stress hormones , inhibition of central hyper sensitization and ultimately shortening the duration of hospitalization .
they believed that increase in pain severity and cognitive dysfunction in patients receiving general anesthesia resulted in longer hospitalization.20 our findings demonstrated that the pain severity , especially at recovery room and on the 3 aostoperative day was lower in neuraxial group .
moreover , gonano et al studied 40 volunteers of hip and knee surgeries and reported that spinal anesthesia accompanied by less postoperative pain compared to general anesthesia.21 furthermore , a meta - analysis on 1362 patients reported that neuraxial anesthesia or peripheral nerve block leads to less postoperative pain.22 additionally , a review article reported that in ten of eleven studies , patients receiving epidural anesthesia significantly suffered less pain than general anesthesia groups.14 the reduction in pain severity at recovery room can be attributed to the residual effects of sensory block of neuraxial anesthesia .
also , the lower pain on postoperative days may be due to the beneficial effects of preemptive analgesia in neuraxial anesthesia application . in our study ,
the frequency of postoperative events , including cardiovascular and respiratory complications , were similar in both groups .
in fact , there was no statistically deference in the incidence of myocardial ischemia , myocardial infarction , atelectasia , and pulmonary infection between groups .
our results were different from the results of urwin et al study1 ; in their study , incidence of dvt and myocardial infarction in patients undergoing correction of fractured hip surgery under neuraxial anesthesia was lower than general anesthesia patients .
meanwhile , the incidence of cerebrovascular accidents and intraoperative hypotension were lower in patients receiving general anesthesia.1 the reasons for differences in findings might be due to the difference in sample size and the kind of the study . in other words
, they evaluated 2161 patients retrospectively while we studied 387 patients prospectively . in a meta - analysis ,
a lower incidence of dvt and pulmonary emboli in patients receiving neuraxial anesthesia for hip surgery was showed.15 however , ohara et al reported no significant difference in incidence of postoperative myocardial infarction , congestive heart failure ( chf ) , and mental dysfunction between both groups receiving either general or neuraxial anesthesia in a retrospective study.9 this finding was similar to the present study .
we also found no statistical difference in mental dysfunction on the 2 and 3 postoperative days between the groups .
this was in similarity to the findings of some previous studies.923 our results revealed that patients receiving general anesthesia had more mental dysfunction in recovery room .
this difference might be due to the remaining effect of anesthetic drugs at recovery room . in our study
, there was no difference in the abundance of death during hospital stay and out of hospital till 30 days after surgery . in one study on 425 patients in a primary investigation
, they reported that the anesthetic technique has a role in morbidity and mortality of patients .
but , after controlling the differences of the studied groups , they revealed that there is no difference in morbidity and mortality rate between the groups.16 thus , the authors concluded that the major reasons for morbidity and mortality of these patients are their coexisting disease ( e.g. diabetes , cardiovascular disease , etc ) , elderly , and undesirable physical condition and not an anesthetic technique . in limited studies ,
the difference in the incidence of mortality and morbidity after neuraxial and general anesthesia was reported .
for example , in one study , 53 high risk patients were evaluated and the results showed a lower incidence of morbidity and mortality after epidural anesthesia compared to general anesthesia.24 in another clinical trial , the effect of anesthetic techniques was not proved.25 but in another study , the effect of neuraxial anesthesia on short term mortality was drawn but it had not differ from general anesthesia considering long term mortality.26 in fact , in a majority of the studies , we may not be able to rely on the results due to the small sample size and a low study power .
as in our study , the sample size was calculated according to the major postoperative complications , the absence of significant difference in mortality might be attributed to small sample size .
this would be possibly considered as a weakness of this study . moreover , due to the limitation in performance of some specific diagnostic tests or the mildness of some clinical signs of diseases , there is a possibility that some postoperative complications might be undiagnosed .
also , one of the limitations of our study was lack of some predictors such as sickness at admission scale or acute physiologic score from the appache i and asa ; so we can not conclude that mortality is due to anesthetic techniques or coexisting diseases .
in conclusion , this clinical investigation demonstrated that general and neuraxial anesthesia have a similar incidence of postoperative complications and mortality in candidates of hip surgery .
we believe that because of the less intraoperative hemorrhage , shorter hospital stay , and lower postoperative pain in patients undergoing neuraxial anesthesia for hip surgery , this technique is superior as compared to general anesthesia . in a summary , the results suggest that more controlled studies with larger sample size and more precise diagnostic tests , in multiple centers are needed to eliminate the limitations of our study .
hs was one of the members of reaserch team and also helped to write the manuscript .
sjh was one of the members of reaserch team , also helped to write the manuscript , and corrected the manuscript according to reviewers comments .
rt was one of the members of reaserch team and also helped to write the manuscript .
|
background : surgery for hip fractures can be done under general or neuraxial anesthesia .
this study aimed to compare these two methods concerning their postoperative complications , duration of operation , hospitalization and the mortality rate within a period of one month after surgery.methods:400 patients aged more than 30 years old and scheduled for elective operative fixation of fractured hip , randomly enrolled in two equal groups of general ( ga ) and neuraxial ( na ) anesthesia .
hemoglobin level was measured before and 6 hours , 2 , 3 and 5 days after the surgery .
the intra and postoperative blood loss , duration of surgery , the severity of pain at the time of discharge from recovery and at the 2nd , 3rd and 5th postoperative days were recorded .
statistical analysis was performed using spss version 12.0 by mann - whitney , chi - square , and t tests .
p < 0.05 was considered significant.results:both groups were similar regarding age , weight , and gender ratio .
there was no significant difference in baseline hemoglobin , duration of surgery , length of hospitalization before surgery and the type of surgery .
the mean of intraoperative blood loss and visual analogue score ( vas ) in recovery and at the 3rd postoperative day , and also the length of hospitalization after surgery were significantly less in neuraxial anesthesia group .
both groups showed a significant decrease in hemoglobin values on the 2nd and 3rd postoperative days comparing to the baseline ( p < 0.001).conclusions : the morbidity and mortality rates of patients undergoing hip surgery were similar in both methods of anesthesia , but postoperative pain , blood loss , and duration of hospitalization were more in patients undergoing general anesthesia .
|
it may sound adventurous but it is , we believe , safe to say that there are no biochemical interactions , which do not depend strongly on molecular interaction .
dna is methylated when it serves the cell to cease transcription of a particular gene .
similarly , the histone cores , around which the dna is wound , are at times methylated so as to shut off transcription .
such a small molecular moiety , ch3 , that if we were to attempt to glean its presence on dna using standard analytical chemistry techniques in the presence of complex media we would be hard pressed to find success .
all this thanks to the mysteries of molecular recognition . in an effort to achieve a perspective of the many complexities of life ,
researchers have been striving for governing principles to describe the details in a coherent manner and at least one subfield for these endeavors is systems biology .
the area of systems biology has been intense since the early 20 century with the advent of research on quantitative modeling of enzyme kinetics .
systems biology casts a wide net and at its most general definition can be described as the study of the interactions between the components of a biological system , and how these interactions give rise to the function and behavior of that system .
yockey[49 ] , jumping on board shortly after the publication of watson and crick 's landmark papers on the structure of dna[10 , 11 ] . of particular interest
to yockey has been the application of information theory , specifically the concept of shannon 's entropy .
it is well beyond the scope and purpose of this paper to review hallmark achievements in systems biology or applications of information theory to biology .
rather it is our intent to put into a broader systems biology context our recent findings regarding the very critical molecular recognition component of systems biology .
our specific work and data are most directly related to the vapor phase detection of nitrous oxide - based explosives using surface acoustic wave ( saw ) biosensors . though ours is an ex vivo system we believe that our findings cast light on the intricacies of molecular recognition .
almost every biomolecular event in living systems involves the following three principle components :
molecular recognition --- the lock and key interaction whereby one biomolecule or receptor ( e.g. a protein ) recognizes with a high degree of specificity another molecule . in the case of electrophysiology
, this extends to the recognition of an ion , say na , by a channel protein which has been incorporated into the plasma membraneconformational change --- the change in the molecular structure of the receptor molecule . at times
no additional chemical groups have been added to the molecule but the internal structure of the molecule has changed .
condensed matter physics is replete with examples of crystal structure radically affecting macroscopic physical characteristicsthe hydrolysis of nucleotide triphosphates ( atp , gtp , utp and ctp ) as an energy source .
molecular recognition --- the lock and key interaction whereby one biomolecule or receptor ( e.g. a protein ) recognizes with a high degree of specificity another molecule . in the case of electrophysiology
, this extends to the recognition of an ion , say na , by a channel protein which has been incorporated into the plasma membrane conformational change --- the change in the molecular structure of the receptor molecule . at times
no additional chemical groups have been added to the molecule but the internal structure of the molecule has changed .
condensed matter physics is replete with examples of crystal structure radically affecting macroscopic physical characteristics the hydrolysis of nucleotide triphosphates ( atp , gtp , utp and ctp ) as an energy source . as we have made known in our previous publications[1315 ] , acoustic wave biosensors are a technology well suited for the translation of the above first two principles of the canon of living systems into detectable electrical signals .
these two principles of conformational change and molecular recognition are the dance introduced in the abstract of this paper . combined , these principles manifest themselves as mass attachment to the sensor surface and stiffness changes in the biological receptor layer
. these in turn will shift the resonant frequency of the device ( e.g. 10mhz for a qcm or quartz crystal microbalance or 250 mhz for a saw resonator based oscillator ) .
the biological receptor layer can , and has , taken on many forms such as aptamers , peptides among others .
it should be understood that though much of what is presented in this paper directly references antibodies , the work can easily be extrapolated in general to other molecular recognition elements ( mre ) .
the affinity of the antibody immobilized onto the surface of the acoustic wave device will alter the time course of the resonant frequency signature , f(t ) , when the antigen binds to it .
when the affinity is large , as is the case for monoclonal antibody - antigen interactions , the analyte will bind tightly to the immobilized antibody resulting in a baseline frequency shift for the sensor .
dissociation constants ,
kd=[a][b][ab ] , for these antibody - antigen interactions tend to be in the picomolar ( pm ) range .
when [ ab ] the analyte is a close chemical analog of the original antigen against which the monoclonal antibody was generated , the affinity is not so high . in immunology
this will serve the relevant biological underpinning for this paper in which we present both our results on the detection of nitrous oxide - based substances and extrapolate to what hints it may give us about the dynamics of biomolecular interactions .
further , the utilization of one antibody which is promiscuous ( anti - tnt in our case ) and one which is not promiscuous ( anti - rdx ) gives us a technique to translate or map chemical orthogonality into an electrical signal . the fundamental starting point of this analysis will be the frequency signatures , f(t ) , obtained from two different saw immunosensors oscillator systems .
a method of differentiating , identifying and characterizing structurally analogous chemical or biological substances from these frequency signatures is accomplished by implementing simple circuitry and mapping the multiple output signals of the circuitry onto a state - space diagram .
time will no longer be an explicit detail of the response but the mapping will cluster the data into the various binding affinities between the nitrous oxide - based analytes from the two different semi - orthogonal antibody coatings used .
signal state - space diagrams have been used in digital communication systems to map binary information onto magnitude - phase ( phasor ) plots commonly referred to as constellation diagrams .
digital communications systems are commonplace and are unknowingly used everyday whenever a cell phone , music or video device or a global positioning system ( gps ) functions .
using the cell phone as an example , the caller 's voice is the source and the person 's ear that is answering the called cell phone will be the destination .
a similar example could be drawn in the chemical world where an explosive device is the source and an explosive detector would be the destination .
the caller 's voice is converted from an analog to a digital format and clusters of these 1 's and 0 's then modulate a radio frequency ( rf ) to propagate through free space to a local base station . here , the clusters of 1 's and 0 's are removed from the rf and placed on another suitable carrier that could be optical fiber or a microwave link .
the digital data travels throughout the phone carrier system to another base station located in the vicinity of the destination cell phone .
the digital data is modulated back onto an rf signal to transmit to the cell phone .
once answered , the clusters of digital data are removed from the rf , processed to compensate for loss of signal strength and any deformation due to impairments during the journey and finally converted to an analog signal to be fed via a speaker into the person 's ear .
the key to digital radio techniques is that the clusters of digital data allows for a more efficient mode of transmission where several digital bits are concatenated into a single communication event .
this single communication event encompasses two orthogonal signals , the in - phase ( i ) channel , asin(t + ) and the quadrature - phase ( q ) channel , bcos(t + ) , where a and b are the amplitudes , is the frequency ( f ) component ( = 2f ) and is a phase offset .
the digital data within each cluster controls the settings of the amplitude and phase offset of each of the i and q channels to complete a combined phasor of amplitude and phase that essentially points to this cluster .
therefore , if a transmitter were to map the digital data into clusters and each cluster were to control independently the orthogonal i and q signals , information would be embedded within these orthogonal i and q signals that is representative of the original data .
similarly , if a receiver were to have a two channel ( i and q ) detection system and if the amplitude and phase offset were gleaned from each channel , then the original digital data could then be reconstructed by using the received phasor to point to the digital clusters within a mapping system .
again , with reference to the chemical example , if an explosive vapor or particle were to be presented to a two channel ( i and q ) detection system and information was gleaned from each channel , then the original chemical composition could then be reconstructed by using the detector 's phasor to point to the cluster containing the chemical composition within a mapping system . for centuries scientific ingenuity and innovation have been influenced by nature 's ideal design .
one of the elusive designs is that of the sensory olfactory system --- an array of highly sensitive receptors responsible for chemical vapor recognition . in the animal kingdom , this ability is magnified among canines where ppt ( parts per trillion ) sensitivity values have been reported .
today , detection dogs are considered an intricate part of the us drug and explosives detection force . however , growing concerns about their susceptibility to extraneous scents have inspired a rapidly developing ensemble of analytical detection tools . in previous publications , we have demonstrated the ability to detect and differentiate among analogous molecules using an acoustic immunoassay vapor sensor termed dog - on - a - chip .
it was our perspective at the time that this analytical tool was limited by the availability of an antibody toward a specific target molecule .
this point of view was derived from the conventional gestalt in immunology , that for every new protein one wishes to assay , a new antibody must be raised against it if one is to get the requisite specificity .
however , what we discovered is that one can reduce the number of antibodies required for a particular application by exploiting the intrinsic promiscuity common to all antibodies[1820 ] .
behring , a physicist who won the nobel prize in 1901 , and kitasato , his long time colleague , first introduced the theory of antibody - antigen binding specificity . later that century
another nobel laureate , karl landsteiner published the structure and mechanisms involved in antibody - antigen interactions .
these works formed the canon of antibody - antigen reactions , which can be succinctly expressed as the precise fit model .
this model has been subsequently revised following innovative work by cameron and erlanger who introduced the cross reactivity phenomenon between antibodies , antigens and their structural homologues .
the mechanism is said to be comprised of both electrostatic and hydrophobic interactions due the large number of hydrophobic residues in the antigen binding site .
in addition , some promiscuous antibodies can cross - react through hydrogen bonding with antigens that are not structural homologues of the target antigen .
james and tawfik et al . concluded that the promiscuous nature of antibodies suggests that each protein may have its own unique pattern of multispecificity and each activity stands alone and may be highly specific . in this paper
we identify this pattern of promiscuous activity as a molecular signature that is unique and quantifiable . herein , we report evidence of multispecificity in an anti - tnt clone when exposed to vapors of 2,4,6-trinitrotoluene ( tnt ) and royal demolition explosives ( rdx , hexahydro-1,3,5-trinitro-1,3,5-triazine ) by introducing a novel method for the treatment of the data using digital radio concepts to unveil the real - time dynamics of antibody / antigen interactions .
one of the elusive designs is that of the sensory olfactory system --- an array of highly sensitive receptors responsible for chemical vapor recognition . in the animal kingdom
, this ability is magnified among canines where ppt ( parts per trillion ) sensitivity values have been reported .
today , detection dogs are considered an intricate part of the us drug and explosives detection force . however , growing concerns about their susceptibility to extraneous scents have inspired a rapidly developing ensemble of analytical detection tools . in previous publications , we have demonstrated the ability to detect and differentiate among analogous molecules using an acoustic immunoassay vapor sensor termed dog - on - a - chip .
it was our perspective at the time that this analytical tool was limited by the availability of an antibody toward a specific target molecule .
this point of view was derived from the conventional gestalt in immunology , that for every new protein one wishes to assay , a new antibody must be raised against it if one is to get the requisite specificity .
however , what we discovered is that one can reduce the number of antibodies required for a particular application by exploiting the intrinsic promiscuity common to all antibodies[1820 ] .
behring , a physicist who won the nobel prize in 1901 , and kitasato , his long time colleague , first introduced the theory of antibody - antigen binding specificity . later that century
another nobel laureate , karl landsteiner published the structure and mechanisms involved in antibody - antigen interactions .
these works formed the canon of antibody - antigen reactions , which can be succinctly expressed as the precise fit model . this model has been subsequently revised following innovative work by cameron and erlanger who introduced the cross reactivity phenomenon between antibodies , antigens and their structural homologues .
the mechanism is said to be comprised of both electrostatic and hydrophobic interactions due the large number of hydrophobic residues in the antigen binding site .
in addition , some promiscuous antibodies can cross - react through hydrogen bonding with antigens that are not structural homologues of the target antigen .
james and tawfik et al . concluded that the promiscuous nature of antibodies suggests that each protein may have its own unique pattern of multispecificity and each activity stands alone and may be highly specific . in this paper
we identify this pattern of promiscuous activity as a molecular signature that is unique and quantifiable . herein , we report evidence of multispecificity in an anti - tnt clone when exposed to vapors of 2,4,6-trinitrotoluene ( tnt ) and royal demolition explosives ( rdx , hexahydro-1,3,5-trinitro-1,3,5-triazine ) by introducing a novel method for the treatment of the data using digital radio concepts to unveil the real - time dynamics of antibody / antigen interactions .
the immunosensors utilized herein are based on two port surface acoustic wave ( saw ) resonators fabricated in the laboratories of the microelectronic acoustics group at georgia tech .
these devices have a center frequency of nominally 250 mhz and are fabricated on st - cut quartz substrates .
st - cut quartz is a particular cut of quartz for which interdigital transducer ( idt ) structures generate a rayleigh wave in the crystallographic x - direction . for sensor applications ,
the st - cut of quartz provides excellent temperature stability near room temperature which minimizes the need for additional temperature control circuitry .
1 schematically illustrates a single channel vapor phase biosensor with an immobilized monolayer of antibodies on the surface of a saw device . the device
is then connected into an oscillator circuit , and frequency changes can then be precisely measured .
the sensing mechanism of an acoustic wave sensor is based on the surface perturbation of the sensor , i.e. , any changes on the saw propagation path affect the velocity of the wave which in turn leads to the change of the resonant frequency .
the perturbation arises from a mass adsorbed to the sensor surface and/or changes of physical properties of the contacting medium , and the resulting frequency changes generally follow the sauerbrey equation . for more complex coating ,
i.e. , antibody layer and/or other biomolecules , hunt et al . developed an analytical relationship from the complex reciprocity relation and time - dependent perturbation theory .
where vs is the acoustic velocity ; is the density of the film ; hf is the thickness of the film ; q and q are the shear stiffness and density of the quartz crystal , respectively ; is the stiffness of the film ; is the difference between perturbed and unperturbed ( denoted by subscript u ) quantities
. a detailed discussion of our antibody immobilization protocols , measurement methods and verification of molecular recognition can be found in our previous publications[1315 ] and will not be repeated here . in the discussion that is to follow , one can assume that we have a sensor array of containing one reference saw sensor and up to three saw sensors , each coated with a different antibody .
a vapor , which has not been pre - treated or pre - concentrated , containing the analyte as well as other molecules is passed through the sensor array and the frequency shift of each saw sensor is recorded on a laptop computer .
the algorithm we present represents a post - processing of this data whereby the frequency signature data , f(t ) is mapped into an iq constellation diagram .
initially , we will discuss the vapor phase biosensor detection system configuration in which there are two antibody coated saw sensors and one reference sensor . to introduce the analogy with digital radio , we will speak of these antibody - coated sensors as channels .
each channel consists of an orthogonal or semi - orthogonal saw immunosensor shown previously in fig .
2a where the x channel output is from oscillator x implementing the saw immunosensor coated with biolayer x and the y channel output is from oscillator y implementing the saw immunosensor coated with biolayer y. figure 3a illustrates the domain conversion technique where each separate time - frequency characteristic of the x and y oscillators are mapped onto a single quadrature frequency domain , with both axes having the units of hz .
the sampling of the time - frequency characteristics can be strategically controlled depending on the system parameters such as the time duration of the analyte injection .
there is a strong analogy between the detection techniques of a quadrature digital communication system and that of our orthogonal biosensor system .
3b shows the constellation plot of 8-ary qam system , where the first two bits of the tribit binary data defines the phase position and the least significant bit defines the amplitude position . for a qam signal ,
the binary data is combined into two separate carriers , each having the same frequency but mathematically orthogonal in phase with respect to one another . at the radio receiver ,
the received signal is separated based on its orthogonal phase information into two separate orthogonal channels .
the binary data is then characterized from each channel and mapped according to the phase and modulation information .
likewise , one can create a state - space map from the immunosensor system to characterize and map the target analytes .
just as the binary data defines its position on the constellation plot , the analyte data also defines its position on the state - space map by the degree of affinity between each analyte and the two system antibodies .
3c , sample a is specific to the anti - y antibody , thus can be considered as the substance y , but also has a slight affinity to anti - x antibody .
samples b and c are different concentrations of the same substance with affinity to both anti - y and anti - x antibodies .
sample d can be considered as the substance x , and e has a very similar chemical structure to d but has different concentration or vapor pressure .
sample f is in totally different category and is not an analogue of x or y. this analysis scheme greatly reduces the mathematical complexity , which is required for most chemometric methodologies .
( the analogies between the interaction of the antibody / antigen binding event and the detection techniques of a quadrature digital radio receiver system are summarized in table 1 . )
there also exists a multi - dimensional communication system that implements orthogonal frequency domain modulation ( ofdm ) . here
, the digital data is split amongst a multitude of narrowband channels such that the data in channel ( n ) is orthogonal to the data in channel ( n+k ) , where ( k ) is a number greater than 1 .
the greater the ( k ) value , the more orthogonal the data in each channel will be with respect to each other and hence can be described as interacting less with each other .
the degree of chemical similarity between analytes of individual channels decreases as ( k ) increases . just as each narrowband channel of the ofdm system would have a defined bandwidth and the difference between adjacent channels would define adjacent channel interference , the multi - dimensional biosensor system also has similar traits .
the affinity of each channel 's biolayer ( bandwidth ) can be defined along with the degree of multispecificity between the adjacent channel antibodies ( interference ) .
the grouping of ( n ) and ( n+1 ) biosensor channels would produce a 2-dimensional map , and the grouping of ( n ) , ( n+1 ) and ( n+2 ) biosensor channels would produce a 3-dimensional map . the system can then be designed such that there is a minimal amount of cross - reactivity between channels .
4a shows the explosive substances and the analogues that were presented to the two - channel biosensor system .
an antibody monolayer was immobilized on each surface of the saw resonators using heterobifunctional linker e.g. , protein a. the final preparation involved the deposition of a thin hydrogel layer to support the antibody layer and provide a semi - aqueous environment on the sensor surface .
both the mouse anti - tnt clone ( lot # 107415 ) and the mouse anti - rdx ( lot # 200202 - 3 - 4 ) were obtained from strategic biosolutions .
this lot of anti - tnt was reported to cross - react to other tnt analogs[16 , 17 , 26 ] .
reported higher binding affinities among the tnt analogs with nitro - groups on the ring suggesting an electrostatic binding mechanism maybe the key to its molecular specificity .
our experiments have shown that these substances , tnt , rdx , musk oil or musk xylene , and ammonium nitrate all bind differently with respect to tnt antibodies and rdx antibodies .
our experimental setup included a pneumatic apparatus that drew vapor from the various substances into the two - channel biosensor system . in this experiment ,
the x channel detector implemented the tnt antibody layer and the y channel detector implemented the rdx antibody layer .
after sampling and accumulating several of the frequency offset data from each of the x and y immunosensor channels and applying the aforementioned domain conversion , a signal - state map was constructed which is shown in fig .
the tnt vapor was introduced using an ineel vapor generator , with a flow rate of 150 cc / min at 13.2 c , and released 50 pg of tnt per pulse with duration of 0.3 seconds .
the rdx vapor was introduced using the same type of generator , with a flow rate of 150 cc / min at 53 c , and released 50.3 pg of rdx per pulse with duration of 3.2 seconds .
the c4 data was obtained in an open lab with an unheated 5 micron filtered sampling head positioned 2.0 inches from the material at the bottom of a sample bottle .
the musk oil data was similarly recorded with the filtered sampling head positioned 3.5 inches from the sample .
4b , it is clearly shown that each substance is distinctively mapped onto a region of the signal state - space map .
the dimension of the signal state - space can be expanded by introducing additional semi - orthogonal channels .
as an example , we show a 3d cluster map , which was produced from three semi - orthogonal immunosensor channels .
the sensor system setup and the domain conversion schematics remain the same , but an additional sensor coated with anti - dinitrophenol ( anti - dnp ) antibody was employed to the sensor array . for this experiment , soil samples containing tnt and several analogous compounds ( nitrophenols ) obtained through the epa ( environmental protection agency ) were examined as a target .
in summary , antibody multispecificity , termed antibody promiscuity , is common occurrence in biological systems . the ability to cross
react with multiple antigens is believed to be due to the conformational diversity ( conformation isomerism ) among antibody clones .
the polyspecific nature of antibodies has been linked to the occurrence of high background noise during an immunoassay termed interference and is closely correlated to its binding affinity .
we report the observed multispecificity of anti - tnt and anti - rdx towards nitrous oxide ( no2 ) groups of molecules and the categorizing of multiple substance data within a state - space map by use of a two - channel detection system .
the addition of an anti - dnp immunosensor provides the user with a 3-dimensional state - space detection map .
the results suggest that chemical orthogonal methods may be used as an analytical tool for the detection and differentiation among analogous molecules based on quadrature detection techniques for digital radio systems . using table 1 as a comparison between digital radio systems and semi - orthogonal state - space immunosensing , well known techniques to optimize a digital radio system would be transformed over to the chemical realm for better molecular recognition strategies .
also , this detection scheme can be accomplished in real time and with minimal computational effort .
in this paper three biochemical constructs , the dance(i.e . conformational change and molecular recognition ) , antibody promiscuity and chemical orthogonality were combined with the concepts of in - phase ( i ) and quadrature ( q ) signals from digital radio to manifest an analytical biochemistry approach that allows us to convert a molecular recognition event into an electrical signal .
this approach establishes a level of discrimination and analysis unobtainable without this aggregate of biochemistry and digital radio . as an example we presented experimental data on the detection of tnt , rdx , c4 , ammonium nitrate and musk oil from a system of antibody - coated acoustic wave sensors
this paper introduces the notion of chemical orthogonality and its use to implement multiple orthogonal immunosensors to detect and map several analogous analytes .
this chemically orthogonal system takes advantage of antibody promiscuity to discern mapped clusters of data with respect to analytes differing only slightly in chemical composition . from an anlytical biochemistry perspective it opens the prospect of being able to discriminate between close chemical analogues that would be unobservable with a tool such as mass spectroscopy .
it also raises questions as to whether the approach can be used to detect glycosilated proteins or methylated histone cores .
further , we may move to speculate that the menagerie of the dance , antibody promiscuity , chemical orthogonality and digital radio may well lead to a deeper understanding of the processes underlying molecular recognition itself .
|
acoustic wave biosensors are a real - time , label - free biosensor technology , which have been exploited for the detection of proteins and cells .
one of the conventional biosensor approaches involves the immobilization of a monolayer of antibodies onto the surface of the acoustic wave device for the detection of a specific analyte .
the method described within includes at least two immobilizations of two different antibodies onto the surfaces of two separate acoustic wave devices for the detection of several analogous analytes .
the chemical specificity of the molecular recognition event is achieved by virtue of the extremely high ( nm to pm ) binding affinity between the antibody and its antigen . in a standard elisa ( enzyme - linked immunosorbent assay )
test , there are multiple steps and the end result is a measure of what is bound so tightly that it does not wash away easily . the fact that this gold standard is very much not real time , masks the dance that is the molecular recognition event .
x - ray crystallographer , ian wilson , demonstrated more than a decade ago that antibodies undergo conformational change during a binding event[1 , 2 ] .
further , it is known in the arena of immunochemistry that some antibodies exhibit significant cross - reactivity and this is widely termed antibody promiscuity .
a third piece of the puzzle that we will exploit in our system of acoustic wave biosensors is the notion of chemical orthogonality .
these three biochemical constructs , the dance , antibody promiscuity and chemical orthogonality will be combined in this paper with the notions of in - phase ( i ) and quadrature ( q ) signals from digital radio to manifest an approach to molecular recognition that allows a level of discrimination and analysis unobtainable without the aggregate . as an example we present experimental data on the detection of tnt , rdx , c4 , ammonium nitrate and musk oil from a system of antibody - coated acoustic wave sensors .
|
apert syndrome ( mendelian inheritance in man # 101200 ) represents approximately 5% of all craniosynostosis syndromes showing a prevalence of 1 in 65,000 to 160,000 live births .
apert syndrome was first described by whearon in 1894 and reviewed extensively by apere in 1906 .
this disorder is characterized by severe craniosynostosis , craniofacial abnormalities and symmetric syndactyly of the hands and feet . among the craniofacial alterations
are brachycephaly , midface hypoplasia , flat occiput , hypertelorism , proptosis and a short , broad nose with a bulbous tip .
the syndrome s oral manifestations have also been described in a few studies [ 510 ] .
the configuration of the palate is characterized by an arched palate with bilateral swellings of the palatine processes , resulting in a pseudocleft in the midline .
other frequent oral findings include hypotonic lips , bifid uvula , delayed or ectopic eruption and malocclusion .
apert syndrome demonstrates an autosomal dominant mode of inheritance and is associated with advanced paternal age , although most cases are sporadic possibly representing new mutations .
it is one of the five craniosynostosis syndromes associated with allelic mutations of the fibroblast growth factor receptor 2 ( fgfr2 ) genes , along with crouzon , pfeiffer , jackson - weiss and beare - stevenson syndromes . besides the genetic similarity
, these three syndromes share similar clinical features that make the differential diagnosis sometimes difficult .
the missense mutations s252w and p253r in the fgfr2 gene account for more than 99% of apert syndrome cases .
the oral cavity is characterized by impaction , severe crowding , delayed eruption , thick gingiva , sometimes supernumerary teeth , or genetically missing teeth .
other frequent oral cavity findings include class iii malocclusion , anterior open bite , bilateral posterior cross - bite and unilateral posterior cross - bite but to a lesser degree and a midline deviation .
the aim of this study was to describe one sporadic case of apert syndrome and discuss its craniofacial and dental features .
a 21-year - old woman with the presumptive diagnosis of apert syndrome was referred to the department of periodontology , school of dentistry , babol university of medical sciences for regular dental treatment .
her parents were clinically normal and at birth her mother was 22 years old and her father was 29 years old .
there were no complications during pregnancy , and no other family member showed a similar condition . at birth , she had craniosynostosis , brachycephaly and syndactyly of the hands and feet .
the patient has mild mental retardation , but her social development and bonding skills are satisfactory . she has never experienced seizures .
extraoral examination revealed a brachycephalic skull with midface hypoplasia , a flat forehead , depression of the temporal bones , proptosis , hypertelorism , short nose with a bulbous tip and septal deviation and trapezoidal shape of the mouth . in the lateral cephalogram , hypoplasia of the maxilla gave the appearance of a class iii skeletal relationship ( fig 1-a ) .
syndactylies of the right hand s third , fourth and fifth digits and the left hand s second , third and fourth digits were present ( fig 1-b ) .
intraoral evaluation revealed poor oral hygiene with varying degrees of periodontal involvement , an arched swelling ( pseudo cleft configuration ) , class iii malocclusion , anterior open bite ( fig 2 ) , posterior cross - bite , supernumerary teeth , ectopic eruption and creamy white enamel opacities , the tongue appeared excessively large and the maxillary arch was v - shaped ( fig 3 ) .
initial dental treatment consisted of oral hygiene orientation for both patient and mother by means of disclosing tablets to be more familiar with plaque concepts and electrically powered toothbrushes ( oral - b ) and chlorhexidine mouth rinse 0.2% ( donyaye behesht co ) two times per day for two weeks , followed by plaque control via monthly professional prophylaxis . after an adaptation period ,
the therapy consisted of super - numerary teeth extraction and orthodontic minor tooth movements to correct the crowding and achieving a stable occlusion .
preventive treatments included topical fluoride therapy . the patient was referred to a plastic and reconstructive surgeon for her extremities as she also complained of inability to brush her teeth because her fingers were malformed .
our patient demonstrated the clinical triad that characterizes apert syndrome : brachycephalic skull , hypoplastic middle third of the face and syndactyly of the hands and feet .
other typical facial characteristics of apert syndrome in our patient included flat forehead , depression of the temporal areas , shallow orbits with ocular proptosis and hypertelorism .
her nose was short and wide with a depressed nasal bridge and the nasolabial angle was diminished .
all these craniofacial features are common in apert syndrome patients due to the premature fusion of the cranial sutures .
our patient had all typical oral manifestations of an apert patient together , for example an arched swelling ( pseudo cleft configuration ) , class iii malocclusion , anterior open bite , posterior crossbite , supernumerary teeth , ectopic eruption and creamy white enamel opacities , tongue appeared excessively large and maxillary arch was v - shaped .
in addition , it was very interesting for us that our patient had not been detected till this age and her family thought her situation was because of her laziness and she did not use her hands and feet in childhood .
although there are several different surgical techniques involved in craniosynostosis treatment , the key element is the timing of treatment with early intervention , before the first year of life , giving better results .
mental retardation is considered usual for apert syndrome patients and in most cases is due to high intracranial pressure .
apert syndrome s oral features have been reported in a few studies [ 510 ] .
the oral cavity is reduced in size , especially the anteroposterior dimension of the maxilla .
the high arched palate shows lateral swellings that induce a midline pseudocleft of soft tissue .
kreiborg and cohen , in the largest clinical study of apert syndrome s oral manifestations , found pseudocleft soft palate or bifid uvula in approximately 75% of the cases .
other studies have described a lower occurrence , such as 44% and 4% of the cases .
the lateral palatine swellings are described as present in infancy and increase in mass with aging , and histological studies have revealed acid mucopolysaccharide deposits consisting predominantly of hyaluronic acid . according to kreiborg and cohen , apert syndrome patients may present several dental abnormalities , including delayed eruption , ectopic eruption and shovel - shaped incisors . in a recent study ,
letra et al detected a high incidence of tooth agenesis in apert syndrome patients .
these include mesial molar occlusion , mandibular overjet , anterior open bite , posterior cross - bite , midline deviation and dental crowding .
fgfr2 mutations have been identified as causing apert syndrome . to date , there are five identified mutations in fgfr2 in apert syndrome patients . in almost all cases ( 99% ) ,
two specific mis - sense substitutions have been described involving adjacent amino acids ( s232w and p253r ) in the linker between the second and third extracellular immunoglobulin domains of fgfr2 .
although the variability in apert syndromes clinical presentation is well established , park et al did not find any correlation between the type of fgfr2 mutation ( s252w and p253r ) and the affected patients clinical features . according to those authors , the lack of phenotypic differences in the two genotypic subgroups of apert syndrome patients is not unexpected , considering that the mutations themselves are adjacent and are in the same functional domain . in spite of the reported clinical characteristics , apert syndrome
may be confused with other craniosynostosis syndromes , whereas the presence of broad thumbs and halluces in association with cutaneous syndactyly differentiate pfeiffer syndrome from apert syndrome . in jackson - weiss syndrome ,
the phenotype is extremely variable and the most consistent manifestation is abnormality in the clinical or radiographic appearance of the feet .
the presence of cutaneous disorders , cutis gyrate and acanthosis nigricans are the key elements for the correct diagnosis of beare - stevenson syndrome . when the clinical features and uncharacteristic syndrome overlap , mutation analysis is helpful in distinguishing apert syndrome from other clinically similar craniosynostosis syndromes .
proper evaluation and characterization of the clinical features ( table 1 ) are important for the correct diagnosis and treatment of affected patients . affected
the occurrence of dental anomalies , ectopic eruption and soft tissue alterations observed in our patient with apert syndrome suggests a possible relationship between these disturbances and the syndrome .
|
to report the oral findings , including dental anomalies , ectopic eruption of the maxillary permanent first molars and periodontal disease and soft tissue alterations , in a subject with apert syndrome .
clinical and radiographic examination of a patient with apert syndrome , aged 21 years old , not previously submitted for orthodontic or orthognathic treatment.dental anomalies were present in a patient .
intraoral evaluation revealed poor oral hygiene with varying degrees of periodontal involvement , an arched swelling ( pseudo cleft configuration ) , class iii malocclusion , anterior open bite , posterior crossbite , supernumerary teeth , ectopic eruption and creamy white enamel opacities , an excessively large appearing tongue and a v - shaped maxillary arch .
the occurrence of typical lateral palatal swellings agrees with the literature . the high prevalence of dental anomalies and ectopic eruption may suggest a possible etiologic relationship with the syndrome .
|
obstructive sleep apnoea syndrome ( osas ) is a common disease that develops secondary to the recurrent obstruction of the upper respiratory tract during sleep .
it occurs in 4% of middle - aged males and 2% of middle - aged females .
the increase in sympathetic activity caused by repetitive hypoxia and oxidative stress causes cardiovascular and metabolic changes [ 3 , 4 ] .
thus , osas is an important risk factor for cardiovascular diseases ( cvds ) , such as ischaemic heart disease , arrhythmia , and hypertension [ 57 ] . in a previous study
as the standard therapy for osas , nasal continuous positive airway pressure ( cpap ) has been shown to prevent apnoea and related oxygen desaturations ; importantly , it also decreases cardiovascular morbidity and mortality [ 9 , 10 ] .
the repetitive episodes of hypoxia and reoxygenation experienced nightly by osas patients result in the increased production of reactive oxygen species ( ros ) .
cpap therapy was also found to be effective in the prevention of ros production in patients with osas [ 12 , 13 ] .
ischaemia - modified albumin ( i m a ) is a sensitive serum marker of myocardial ischaemia [ 1416 ] that has been approved by the u.s . food and drug administration ( fda ) for this purpose .
i m a concentrations are measured using the albumin cobalt binding method . during ischaemic conditions , the n - terminal region of serum albumin is modified such that its capacity to bind metals ( e.g. , copper , cobalt , and nickel ) is reduced .
these changes may be related to ros production during hypoxia , ischaemia / reperfusion , and acidosis . because the i m a concentration also increases in various acute ischaemic events , such as skeletal muscle ischaemia , pulmonary embolism , psoriasis , and cerebrovascular disease , it has also been used as a biomarker for the increased risk of cvd [ 1824 ] .
recent research has shown an increase in i m a concentrations under noncardiac oxidative stress conditions [ 25 , 26 ] .
this result is consistent with our own work , in which we showed higher i m a concentrations under noncardiac oxidative stress conditions , including trauma , alzheimer 's disease , and subarachnoid haemorrhage [ 2729 ] . thus far , only two studies related to osas and i m a have been published and only one of them focused on the effect of cpap therapy [ 30 , 31 ] .
thus , the aim of this study was to examine i m a in osas and to assess the effects of cpap on the serum concentrations of this marker .
patients admitted to the sleep centre of the bulent ecevit university hospital , zonguldak , turkey , were evaluated prospectively .
the study population consisted of 97 consecutive patients with newly diagnosed osas and 30 nonapnoeic controls matched for age , sex , body mass index ( bmi ) , and smoking .
patients diagnosed with sleep disorders other than osas ( e.g. , central sleep apnoea syndrome , upper airway resistance , movement disorder , or narcolepsy ) and currently treated cpap patients were excluded from the study .
other exclusion criteria were acute cardiovascular and cerebrovascular ischaemia ( e.g. , acute coronary syndrome , acute cerebral infarction , and peripheral vascular disease ) ; liver or kidney disease , cvds , such as coronary artery disease , arrhythmia , or heart failure ; thyroid dysfunction ; haematological , oncological , or inflammatory diseases ; lung diseases characterised by hypoxaemia , such as chronic obstructive pulmonary disease , asthma , and interstitial lung disease ; and infection . patients with drug usage , such as nonsteroidal - anti - inflammatory drugs , steroids , antibiotics , and immunosuppressive medication , as well as alcohol intake , age < 18 years , a history of recent blood transfusion ( < 2 weeks ) , or abnormal serum albumin concentrations ( < 3.5 , > 5.5 mg / dl ) , were also excluded .
data related to the patients ' demographic characteristics ( age , sex , and bmi ) , cigarette smoking status , previous history of chronic diseases and drug usage , sleep pattern , and medical history , including cardiovascular and metabolic diseases , were obtained from a standardised questionnaire prior to the sleep study .
cvd was defined if the patient had heart failure , coronary artery disease , or arrhythmia .
a diagnosis of cardiac disease was confirmed by an expert cardiologist , or if the patient was on one or more of the following : anti - ischaemic agents , beta - blockers , angiotensin - converting enzyme inhibitors , angiotensin - receptor blockers , antiplatelet therapy , or calcium antagonists .
patients with arterial blood pressure > 140/90 mmhg , as measured from the brachial artery after a 5-min resting interval , and those receiving antihypertensive therapy were considered to be hypertensive .
patients with a total cholesterol > 200 mg / dl , low density lipoprotein ( ldl ) cholesterol > 130 mg / dl , or triglycerides > 150 mg / dl and those using lipid - lowering drugs were considered to be hyperlipidaemic .
excessive daytime sleepiness in patients was assessed by the epworth sleepiness scale ( ess ) .
this study was approved by the ethics committee of zonguldak bulent ecevit university faculty of medicine ( zonguldak , turkey ) .
each patient underwent full polysomnography ( psg ) monitoring at the sleep centre by a technician using two different computer systems ( 55-channel system , respironics , usa , and 58-channel system , compumedics , australia ) .
psg monitoring included an electroencephalogram , electrooculogram , segmental and bilateral leg electromyogram , and an electrocardiogram .
airflow and snoring were measured using an oral thermistor and nasal transducer ; thoracic and abdominal wall movements and body position were assessed using inductive plethysmography .
psg scoring was performed in accordance with the american academy of sleep medicine ( aasm ) manual for scoring sleep , published by the american academy of sleep medicine in 2012 . after the psg recording , the sleep stage ,
changes in heart rate and rhythm , changes in breathing patterns ( apnoea , hypopnoea , and arousal ) , and periodic leg movements during sleep were scored manually .
apnoea was defined as airflow cessation for at least 10 s , and hypopnoea was defined as an airflow reduction of 30% for at least 10 s plus an oxygen desaturation of > 3% or an arousal .
the apnoea - hypopnoea index ( ahi ) was defined as the total number of hypopnoeas and apnoeas per hour .
based on the ahi , patients were assigned to either the control group or the osas group .
patients with an ahi < 5 were considered to have simple snoring and assigned to the control group .
osas was defined as either an ahi 5 with associated symptoms , such as sleep attacks or excessive daytime sleepiness , unsatisfying sleep , insomnia or fatigue , heavy snoring , and/or breathing pauses as witnessed by the patient 's partner , or an ahi 15 regardless of the associated symptoms .
the degree of osas was classified according to the ahi as follows : 5 ahi < 15 , mild ; 15 ahi < 30 , moderate ; and ahi 30 , severe osas .
cpap was titrated manually by a technician using two devices ( respironics , murrysville , pa , usa , and weinmann , hamburg , germany ) , with the patient under full psg monitoring .
cpap titration was started with the pressure set at 4 cm h2o under full - night psg and was increased incrementally until apnoea - hypopnoea events disappeared .
a titration study was performed for at least 6 h. all participants had sufficient sleep efficiency ( > 70% ) .
after 3 months of treatment with nasal cpap , these patients underwent clinical reassessment and a biochemical analysis .
treatment compliance was measured using the built - in data stores of the cpap device .
at least 5 h / night for at least 70% of the nights / week was defined as acceptable cpap therapy .
blood samples were drawn from the patients between 8:00 am and 9:00 am , after they had undergone a baseline psg .
the blood samples were centrifuged within 30 min at 4c at 3000 g for 10 min .
serum i m a concentrations were measured with a colourimetric method in which reduced cobalt binding to albumin is measured , as described by bar - or et al . .
the assay has an intra - assay coefficient of variation ( % cv ) of < 3.5% and an interassay % cv of < 6.1% . the serum c - reactive protein ( crp ) concentration was measured as highly sensitive crp ( crp ) in an immunoturbidimetric assay using the crp reagent and a beckman coulter au2700 analyser ( beckman coulter , inc . , fullerton , ca usa )
data are expressed as the mean standard deviation , and categorical variables are expressed as the frequency and percent .
continuous variables were compared to the independent sample t - test or the mann - whitney u test for two groups .
an anova or the kruskal - wallis test was used to determine the differences between three or more groups .
the tukey test was used as a post hoc test , if the anova results were statistically significant .
dunn 's test was used as the post hoc test after the kruskal - wallis test .
a receiver operating characteristic ( roc ) analysis was performed to determine the best cut - off value to predict the outcome .
for all tests , a p value < 0.05 was considered to indicate statistical significance .
the 127 participants enrolled in this study had a mean age of 51.7 10.7 years and 90 ( 71% ) were male .
the study population was divided into four groups based on the ahi scores : control ( group 1 , n = 30 ) , mild osas ( group 2 , n = 32 ) , moderate osas ( group 3 , n = 31 ) , and severe osas ( group 4 , n = 34 ) .
there were no significant differences between the patients with osas and the controls in terms of age , sex , bmi , smoking status , hypertension , or diabetes mellitus status .
serum i m a concentrations were higher in the combined osas groups than in the control group ( 0.518 0.091 absu versus 0.415 0.068 absu , p < 0.001 ) .
in addition , serum i m a concentrations differed significantly among patients with mild , moderate , and severe osas ( 0.457 0.077 absu , 0.516 0.089 absu , and 0.577 0.063 absu , resp .
plasma crp concentrations were also significantly higher in all three osas groups combined than in the control group ( 3.22 1.2 mg / l and 1.56 1.2
mg / l , p < 0.001 ) . according to a roc analysis of serum
i m a , the roc rederived cut - off for i m a was 0.467 absu [ auc : 0.809 ; p < 0.0001 , 95% confidence interval ( ci ) : 0.7290.873 , 72.2% sensitivity , 86.6% specificity ] ( figure 1 ) .
we therefore divided the entire group of patients into two groups in terms of their serum i m a concentration .
thus , patients with an i m a concentration > 0.467 absu were assumed to be ima - positive and all others were ima - negative .
the results of multiple logistic regression analyses including age , sex , bmi , smoking status , hypertension , and i m a group ( ima - negative or ima - positive according to the cut - off value of 0.467 absu ) are summarised in table 2 .
a positive i m a value [ odds ratio ( or ) : 10.838 ; 95% ci : 3.66332.068 , p < 0.001 ] was an independent predictor of osas .
a spearman correlation analysis revealed a significant correlation between serum i m a concentrations and the ahi ( r = 0.471 , p < 0.001 ) , mean sao2 ( r = 0.555 , p < 0.001 ) , desaturation index ( r = 0.493 , p < 0.001 ) , ess score ( r = 0.500 , p < 0.001 ) , and crp concentration ( r = 0.518 , p < 0.001 ) .
after 3 months of cpap treatment , 31 patients with moderate - severe osas were reassessed for serum i m a concentrations ( table 3 ) .
average cpap use in this group was 6.45 2.73 h / night for at least 5 nights per week . the cpap titration pressure ranged from 5 to 12 cm h2o ( mean = 7.6 1.82 cm h2o ) .
the results showed a significant decrease in serum i m a concentrations ( from 0.555 0.062 absu to 0.431 0.063 absu , p < 0.001 ) and in serum crp concentrations after 3 months of cpap treatment ( table 3 ) .
. however , the increased oxidative stress induced by hypoxia - related free radicals and intermittent hypoxia and by increased ros production is reversed by cpap therapy .
similarly , various studies have shown that both the total antioxidant capacity and the serum concentrations of vitamins a and e are diminished in patients with osas , but they improve following cpap treatment .
ros can transiently alter the n - terminal region of albumin and increase the concentration of i m a .
thus , serum i m a provides an ideal marker to assess ischaemia and therefore the risk of cvd as well [ 1820 ] .
moreover , several studies have shown an increase in i m a during noncardiac oxidative stress conditions , such as chronic kidney disease , systemic sclerosis , and alzheimer 's disease [ 25 , 3639 ] .
our patients with osas had higher serum i m a concentrations than the control group .
however , in the former , 3 months of cpap therapy resulted in a significant decrease in serum i m a concentrations .
moreover , the circulating i m a concentration correlated positively with the serum crp concentration . in contrast , ozben et al . measured serum i m a concentrations in osas patients and did not find a significant relation between i m a and osas .
however , yang et al . reported higher i m a values in osas patients than in control subjects .
our study differed from these studies [ 30 , 31 ] with respect to the study population , methodology ( duration of cpap therapy ) , and exclusion criteria .
the patients of yang et al . had mild osas ; osas was classified according to ahi , and the presence of ischaemic diseases was not excluded . among our patients ,
serum i m a concentrations were higher in those with osas than in the controls .
moreover , i m a correlated positively with the ahi , desaturation index , ess , and crp and negatively with the mean sao2 .
however , yang et al . found a positive correlation only between i m a and ahi , but not between i m a and other variables that characterise osas patients .
cpap therapy prevents the narrowing and collapse of the soft tissue of the upper airway during sleep and thus improves osas - associated hypoxia / reoxygenation , sympathetic activity , inflammation , and the resulting consequences [ 40 , 41 ] .
serum i m a concentrations decreased in the 9 osas patients of yang et al . after 4 weeks of cpap therapy and in our osas patients after 3 months of cpap therapy . taken together , these results show that a change in i m a concentrations is a valuable predictor in osa treatment monitoring . as an indicator of a systemic inflammatory response , crp is a significant marker of inflammation .
elevated crp concentrations were measured in our patients with osas , but the precise mechanisms underlying the relationship between crp and osas are not fully understood . furthermore , whether or not cpap therapy has an effect on crp concentrations is controversial , as some studies have shown a favourable outcome [ 42 , 43 ] , but others found no significant change [ 44 , 45 ] . in our study , serum crp concentrations decreased significantly following cpap therapy for osas .
osas increases the serum concentrations of i m a independent of age , sex , bmi , smoking habit , and cardiovascular disease .
the serum i m a cut - off value for osas in our study was 0.467 absu ; a value above this concentration was an independent predictor of osas .
in addition to the small sample size , we included patients without coronary artery disease , even though it is not uncommon in osas .
individuals in the control and osas groups were examined for the presence of cardiac disease based on their medical history , blood pressure values , a physical examination , and electrocardiography , but they did not undergo specific tests of cardiac function . consequently , in both the control and the osas group , asymptomatic coronary artery disease may have gone undetected . finally , a major limitation of the study was the limited number of patients who underwent cpap therapy and were then followed longitudinally .
the present study showed that serum i m a concentrations are higher in osas patients than in healthy subjects but decrease significantly in the former with effective cpap therapy .
we therefore recommend the use of increased serum i m a concentrations as an independent predictive marker of the presence and severity of osas as well as its reversal in patients who respond to cpap .
|
the aim of the present study was to evaluate the impact of obstructive sleep apnoea syndrome ( osas ) and the effects of nasal continuous positive airway pressure ( cpap ) on circulating ischaemia - modified albumin ( i m a ) concentrations .
the study included 97 newly diagnosed osas patients and 30 nonapnoeic controls .
blood samples were obtained in the morning after polysomnography .
after 3 months of cpap treatment , 31 patients with moderate - severe osas were reassessed for serum i m a concentrations .
significantly higher serum i m a concentrations were measured in the osas group than in the control group [ 0.518 0.091 absorbance units ( absu ) , 0.415 0.068 absu , p < 0.001 ] .
serum i m a concentrations correlated significantly with the apnoea - hypopnoea index , mean sao2 , desaturation index , and c - reactive protein concentrations .
multiple logistic regression analyses showed that osas increased the serum i m a concentration independent of age , sex , body mass index , smoking habit , and cardiovascular disease .
after 3 months of treatment with cpap , osas patients had significantly lower serum i m a concentrations ( 0.555 0.062 absu to 0.431 0.063 absu , p < 0.001 ) .
the results showed that osas is associated with elevated concentrations of i m a , which can be reversed by effective cpap treatment .
|
ect , though not favoured in the west for treating schizophrenia , is regularly practiced in india for this indication , particularly in poorly responding / treatment resistant cases.therefore , its role in treatment - resistant schizophrenia is a subject of systematic investigation .
to compare the effectiveness and safety of electroconvulsive therapy ( ect ) in a group of treatment - resistant schizophrenia patients with a control group .
method : eligible and consenting patients were randomly allocated to the ect or sham ect groups .
both received antipsychotic drugs.twenty-five patients completed the study ( ect , n= is ; sham ect , n= 10).the study was conducted in a double - blind manner .
clinical change was assessed weekly with bprs , cgi and adverse event measures.anova for repeated measures and other post - hoc comparisons were used for data analysis .
ect treated patients improved significantly over successive weeks ( p < 0.002 ) after 6 ects , whereas the group receiving sham - ect did not in both the groups , however , cgi scores did not change significantly , suggesting a dissociated response pattern .
ect augmentation may well have a significant impact on the clinical course of patients with treatment resistance schizophrenia .
it is unclear , but possible , that these changes may be reinforced and maintained by maintenance ects .
|
background : ect , though not favoured in the west for treating schizophrenia , is regularly practiced in india for this indication , particularly in poorly responding / treatment resistant cases.therefore , its role in treatment - resistant schizophrenia is a subject of systematic investigation .
aim : to compare the effectiveness and safety of electroconvulsive therapy ( ect ) in a group of treatment - resistant schizophrenia patients with a control group .
method : eligible and consenting patients were randomly allocated to the ect or sham ect groups .
both received antipsychotic drugs.twenty-five patients completed the study ( ect , n= is ; sham ect , n= 10).the study was conducted in a double - blind manner .
clinical change was assessed weekly with bprs , cgi and adverse event measures.anova for repeated measures and other post - hoc comparisons were used for data analysis .
results : ect treated patients improved significantly over successive weeks ( p < 0.002 ) after 6 ects , whereas the group receiving sham - ect did not in both the groups , however , cgi scores did not change significantly , suggesting a dissociated response pattern .
ect was associated with greater relief among carers and lower rehospitalization.conclusion : ect augmentation may well have a significant impact on the clinical course of patients with treatment resistance schizophrenia .
it is unclear , but possible , that these changes may be reinforced and maintained by maintenance ects .
replication of the present investigation and further studies on maintenance ect would be rewarding .
|
h1-antihistamines , the mainstay of treatment for urticaria , were developed from anticholinergic drugs more than 70 years ago .
they act as inverse agonists rather than antagonists of histamine h1-receptors that are members of the g - protein family .
first - generation h1-antihistamines have poor receptor h1-receptor selectivity and cross blood brain barrier .
they have a lot of adverse events such as anti - muscarinic , anti--adrenergic , anti - serotonin , and sedative effects .
in contrast , second - generation h1-antihistamines were highly selective for the histamine h1-receptor , do not cross the blood brain barrier , and have minimal adverse events .
the risks of first - generation h1-antihistamines have been clearly underestimated , particularly when purchased as nonprescribed over the counter medications by public .
patients , clinicians , and other health care professionals are confronted with various treatment choices for the management of allergic rhinitis and urticaria .
this contributes to considerable variation in clinical practice , and worldwide , patients , clinicians , and other health care professionals are faced with uncertainty about the relative merits and downsides of the various treatment options available . the latest eaaci / ga2 len / edf / wao guidelines for the management of urticaria recommend that the first - line treatment for urticaria should be second - generation , nonsedating h1-antihistamines .
it states , in patients with urticaria and no special indication , we recommend against the routine use of old - sedating first - generation antihistamines ( strong recommendation , high - quality evidence ) .
the usage of sedating antihistamines by sufferers of allergies remains prevalent , and doctors continue to prescribe these older generation antihistamines with great incidence . cautionary statements warning of possible sedative effects and the need for restraint when driving or operating machinery , which are required for sedating antihistamines , do nt appear to be having much impact .
a study of knowledge , attitude and practice is the most important tool to assess the benefits and voids of a subject in the community , so that effective steps can be taken in that direction to improve the outcome .
resident doctors at tertiary care teaching hospitals are primarily involved in patient management , so their awareness about prescribing medicines is of prime importance for the treatment of patients .
this review focuses on the knowledge of medical residents toward prescribing antihistamines , according to the new aria and ga2len guidelines for allergic rhinitis and urticaria , respectively .
there is no comprehensive evidence from india pointing to the cause of continual prescription of first - generation antihistamines .
this review attempts to find the cause of less prescription of newer second - generation antihistamines by finding out the knowledge and attitude of the doctors prescribing them to the patients .
d y patil hospital , navi mumbai , a tertiary care teaching hospital . primary data from 100 resident doctors from the departments of medicine , obstetrics and gynecology , surgery , pediatrics , skin , ent and psychiatry , who gave their informed consent , was collected .
a prevalidated questionnaire [ illustration 1 ] regarding knowledge , attitude and prescribing practice of antihistamines was filled up .
every question was first validated using the chi - square test , and significance was below 10% hence proving validity of the questions .
the questionnaire consisted of questions pertaining to the antihistamine prescription habits of the doctors for urticaria and allergic rhinitis ; the side effects of first - generation antihistamines and their importance to prescription in children , elderly , pregnancy and warnings given to patients pertaining driving , other side effects like drowsiness and disorientation were also asked on a question ; knowledge of guidelines of ga2len and aria pertaining to prescription of antihistamines , and the reasons for not prescribing second - generation antihistamines .
a total of nine questions were included with eight questions having a dichotomous scale and one question with multiple - choice answers containing three options .
within the selected practices , a total of 100 questionnaires were completely filled out and answered by the resident doctors . the presence or lack of interest of particular department made no significant difference to the responses to subsequent questions .
table 1 shows that 82% of doctors said they prescribed second - generation antihistamines , while 18% still prescribed first - generation antihistamines . out of the 82% that prescribed second - generation antihistamines , 8.9% also prescribed first - generation antihistamines as well .
prescription of antihistamines 79% of doctors surveyed thought the side effects of first - generation antihistamines hampered daily activities of patients .
73% said they advised patients to not consume alcohol or drive while taking antihistamines ( especially if first - generation antihistamines were prescribed . ) a sizeable proportion of doctors surveyed , 77% said they prescribe different antihistamines based on patient 's occupation , pregnancy and age of the patients .
78.3% of follow - up patients complained of difficulty staying awake , sedation or feeling disoriented after taking prescribed first - generation antihistamines .
table 2 shows only 23% of doctors surveyed had heard about the aria and gal2en guidelines and their recommendations for prescribing second - generation antihistamines over the older first - generation antihistamines , while 77% of them had not heard of these position papers .
guidelines for prescribing antihistamines table 3 shows that 84% of doctors surveyed for this research study believed that second - generation antihistamines were more expensive that the first - generation antihistamines and hence they did not prescribe them to patients .
3% believed that the newer second - generation antihistamines were not available in pharmacies , and 5% believed that second - generation antihistamines were not as effective as first - generation antihistamines .
second - generation antihistamines are the drugs of choice for allergic rhinitis and urticaria compared to the alarming adverse effects of first - generation antihistamines .
new - generation antihistamines reduced sleep latency and dream anxiety , and increased daytime sleepiness and sleep quality . among the three main sensory systems responsible for postural control ( visual , vestibular , and somatosensory ) ,
d - chlorpheniramine may have a larger effect on the visual and/or vestibular systems in susceptible individuals . in view of the potential detrimental effects of residual daytime sedation on school performance and study , impaired productivity at work and ,
possibly more importantly , driving motor vehicles , it is clear that it is better not to offer a sedating antihistamine at night for the treatment of csu .
these data indicate that allergic rhinitis may have an important impact on occupation and worker 's productivity .
patients are bothered by fatigue , poor performance and concentration at work , headaches and malaise .
treatment with sedating h1-antihistamines will aggravate these problems , whereas treatment with nonsedating h1-antihistamines will only partially reverse the limitations in learning .
allergic rhinitis and its impact on asthma guidelines have brought attention to allergic rhinitis and its impact on asthma , but have also proposed a new classification in terms of symptoms severity and persistence useful for tailoring treatment on patients phenotypes .
their further dissemination is needed ; furthermore , they represent a cornerstone for the scientific community through a continuous update on relevant issues such as rhinitis phenotypes , disease management on the basis of new treatments , clinical trials transferability in real life , and allergic rhinitis management in public health programs . first - generation or classic antihistamines are still overused as they are over the counter and patients are aware about them .
doctors prescribing them also have less to none control over the sale of first - generation antihistamines .
this causes a large variability in the usage of second - generation antihistamines , which are preferred drugs of choice for allergic rhinitis and urticaria .
the main reason for not prescribing the second - generation antihistamines was due to the increased cost per tablet compared to the more economical first - generation antihistamines .
the classic antihistamines are well known and since patients can buy them over the counter , they are the ones that are more often used .
this points toward an economic burden on the patients that are suffering from these diseases . but studies have found that using second - generation antihistamines reduced the total patient costs for persistent allergic rhinitis .
most doctors are not aware of the new guidelines of antihistamine prescription that have been published , namely the aria and ga2len position papers .
these papers strongly caution the use of sedating first - generation antihistamines and advise the use of the newer second - generation antihistamines .
numerous doctors still do not pay heed to this and still continue to prescribe sedating antihistamines .
also , due to the economic burden of patients , the newer non - sedating antihistamines are more expensive compared to the first - generation antihistamines and this is another contributory factor leading to continuous rampant use of sedating first - generation antihistamines .
doctor awareness is a key factor that must be looked into to solve this problem of prescription in sufferers of allergic rhinitis and urticaria .
first generation antihistamines are being grossly overused by doctors prescribing them as the aria and galen guidelines are not well known ; also the cost of the first generation and more well known antihistamines is more than the lesser known more expensive second generation antihitamines .
|
background : allergic rhinitis and urticaria are chronic persistent allergic conditions that need proper management as they significantly reduce quality of life measures . of the many pharmacological options of allergic rhinitis and urticaria , second - generation antihistamines are the mainstay of therapy.aims:this review focuses on the knowledge of medical residents toward prescribing antihistamines , according to the new aria and ga2len guidelines for allergic rhinitis and urticaria , attempting to find the cause of less prescription of newer second - generation antihistamines by finding out the knowledge and attitude of the doctors prescribing them to the patients.materials and methods : the study was carried out among resident doctors at a tertiary care teaching hospital .
primary data from 100 resident doctors , who gave their informed consent , was collected .
a prevalidated questionnaire regarding knowledge , attitude and prescribing practice of antihistamines was filled up .
the data was then analyzed with suitable statistical tests .
every question was first validated using the chi - square test , and significance was below 10% hence proving validity of the questions.results:out of the doctors surveyed , 82% of doctors said they prescribed second - generation antihistamines , while 18% still prescribed first - generation antihistamines .
out of the 82% that prescribed second - generation antihistamines , 8.9% also prescribed first - generation antihistamines as well .
23% of doctors surveyed had heard about the aria and gal2en guidelines and their recommendations for prescribing second - generation antihistamines over the older first - generation antihistamines , while 77% of them had not heard of these position papers.conclusion:first-generation or classic antihistamines are still overused due to the lack of knowledge of various guidelines that have been published .
the main reason for not prescribing the second - generation antihistamines was due to the increased cost per tablet compared to the more economical first - generation antihistamines .
|
flavonols and related plant products of the flavonoid group are
in prominence from a biomedical context for their wide range of therapeutic
activities of high potency and low systemic toxicity .
rusznyk and szent - gyrgyi first drew attention
to the therapeutically beneficial role of dietary flavonoids .
flavonoids are abundant in common plant - based
foods and beverages , such as onions , apples , berries , tea , and red
wine .
the western european diet contains , on average , 358
mg of flavonoids per day .
the french paradox ( first noted by the irish physician samuel black
in 1819 ) refers to the fact that the french suffer relatively low
incidence of coronary heart disease because their diet is rich in
both saturated fats and red wine ( with high flavonoid content ) .
both
in vivo and in vitro studies show that flavonoids are therapeutically
effective against a wide range of diseases , including cancers , allergies ,
aids , and different free - radical - mediated disorders , such as atherosclerosis ,
ischemia , neuronal degeneration , and cardiovascular ailments etc . , which make them promising alternatives to conventional
therapeutic drugs .
the possible target molecules and the mode
of interactions between
flavonoids and their targets are the subject of ongoing research ,
but it is known that single- and double - stranded nucleic acids structures
can serve as receptors for flavonoids .
the interactions
of small molecules with nucleic acids are of considerable interest
for the design of novel therapeutically important compounds that are
effective against cancer , heart disease , and other physiological and
neurological disorders . although the duplex is
the most common arrangement of dna , the terminal part of the telomeric
dna is g - rich and single - stranded .
although
the precise repeats of the sequence ccctaa / ttaggg form a classical watson crick double helix , the
individual single g - rich and c - rich telomeric strands can form unusual
dna structures under appropriate conditions .
the g - rich strand can
form a four - stranded g - quadruplex structure involving planar g - quartets ,
and the c - rich strand can form the so - called tetraplex i - motif structure
with intercalated cc base pairs ( scheme 1 ) .
formation of unusual , non - b dna structures in
specific sequential motifs is thought to take place during various
physiological processes ( e.g. , some quadruplex formation was evidenced
throughout the cell cycle ) .
human telomeric
dna and proto - oncogenes have the higher potential to form g4 dna compared with tumor - suppressor genes , suggesting the possibility of treating cancer cells distinctively
with effective g4 ligands .
this opens the door to small - molecule
targeting of telomeric g4 in cancer therapy because small
molecules can trap quadruplex structures . in this article
, we provide results of a systematic study
on two
therapeutically important flavonols , fisetin ( 3,7,3,4oh
flavone ) and quercetin ( 3,5,7,3,4oh flavone ) ,
and their chromophores , 3-hydroxyflavone ( 3hf ) and 7-hydroxyflavone
( 7hf ) , in three types of dna matrices : duplex dna , the c4 intercalated motif ( i - motif ) , and the g4 quadruplex made
from 5-d(c3ta2)3c3 - 3 and 5-d(t2ag3)4 - 3 oligonucleotides .
fisetin and quercetin are the most abundant dietary flavonoids , ( widely present in strawberries , apples , onions ,
broccoli , and many other fruits and vegetables ) and belong to the
most commonly occurring chemical class of flavonoids ; namely , flavonol .
quercetin binds to human plasma proteins and inhibits the activities
of enzymes , including kinases and dna
topoisomerases .
fisetin inhibits protein
kinase c , a signal transducing enzyme , and hiv-1 proteinase , a virally encoded
protein that is indispensable for the maturation and processing of
the aids virus .
it also exhibits strong antioxidant properties in
membrane environments and has also been
found to be effective in preventing nonenzymatic glycosylation of
hemoglobin .
flavones consist of two aromatic
rings ( rings a and b ) linked through a pyrone ( ring c ) ( see scheme 1 ) . here
, we demonstrate how fluorescence spectroscopy
is an exquisitely
sensitive tool for noninvasive sensing of dna - flavonoid interactions
at physiologically relevant conditions via measurements of steady
state emission parameters of the intrinsic fluorescence of the ligand
( flavonoid ) in the target ( dna ) environment .
the high qualitative
and quantitative sensitivity of fluorescence provides enormous advantages
when compared with most other physical techniques and offers a powerful
approach for detection of nucleic acid flavonoid interactions
at physiologically relevant concentrations ( 10 m ) .
we highlight novel applications of the remarkably environmentally
sensitive two - color fluorescence exhibited by two
important flavonoids , which permits multiparametric and ratiometric
measurements . to consolidate findings obtained via fluorescence spectroscopy ,
results from other relevant experimental biophysical techniques of
related interest ( circular dichroism ( cd ) , differential absorption ,
uv thermal melting , size exclusion chromatography ( sec ) ) , and molecular
modeling are also discussed here .
the flavonoids fisetin , quercetin , 3hf , and 7hf and oligonucleotides
5-d(c3ta2)3c3 - 3
and 5-d(t2ag3)4 - 3
were purchased from the sigma - aldrich chemical co. and integrated
dna technologies , respectively , and were used as obtained .
the solvents
used were of spectroscopic grade and checked for any absorbing or
fluorescent impurities .
stock solutions of 3hf , 7hf , fisetin , and
quercetin were prepared in ethanol ( because of low solubility in an
aqueous system ) , and the final experimental concentrations of all
flavonoids were kept on the order of 10 m , ethanol
< 1% ( v / v ) .
hcl at
ph 7.4 and 10 mm sodium citrate at ph 6 buffers were used , respectively .
the duplex dna was made by dissolving equimolar concentrations of
the g- and c - rich oligonucleotides in 10 mm ph 7.0 citrate buffer .
for some experiments with the g - rich dna , 10 mm , ph 7.0 citrate buffer
was also used , and it is pertinent to mention that there was no major
difference in the spectral features of single - stranded and duplex
dnas between tris hcl , ph 7.0 and citrate , ph 7.0 buffers .
the uv thermal melting and differential absorption studies were performed
in 10 mm tris
hcl , 100 mm nacl , ph 7.2 for g - rich dna , whereas
10 mm citrate , 100 mm naclo4 , ph 6.0 , was used for c - rich ,
and ph 7 , for duplex dnas .
steady state absorption spectra were
recorded with shimadzu uv
2550 spectrophotometers with a peltier temperature controller and
8-microcell holder accessories were used for melting studies , with
1 c / min and a wait period of 240 s. steady state fluorescence
measurements were carried out with a fluoromax-4 ( horiba jobin yvon )
spectrofluorometer equipped with polarizers and a peltier temperature - controlled
cell .
steady state fluorescence anisotropy ( r )
values were
calculated using the expression1where ivv and ivh are the vertically
and horizontally polarized
components of the flavonoid emission after excitation by vertically
polarized light at the respective wavelength .
the scan rate was 50 nm / min , and three consecutive spectra
were averaged to produce the final spectrum .
the highest concentration of dna for
fluorescence and circular dichroism experiments were kept at 2025
m to avoid aggregation , scattering , and artifacts .
column ( biosep , 3000 , phenomenex )
on an hplc system ( scl 10a vp , shimadzu ) using a 10 mm citrate buffer
at ph 6.5 with 100 mm naclo4 to minimize matrix adsorption . for the thymine
oligonucleotides dt5 , dt12 , dt21 , dt24 , and dt30 , the averages of the retention times and the corresponding molecular
masses were fitted linearly , from which the folded nature of the 5-d(c3ta2)3c3 - 3 and 5-d(t2ag3)4 - 3 dna were determined ,
assuming that there were no secondary interactions within the thymine
oligonucleotides . here
, the molar masses of the thymine oligonucleotides
were used as standards for drawing a calibration plot to obtain the
molecular masses of the free and bound dnas for stoichiometric purposes .
absorption and fluorescence measurements of the species were made
using the spd-10avi and rf-10axl shimadzu detectors , respectively .
the time difference between the two detectors was determined from
the absorption ( 260 nm ) and the emission ( ex = 307
nm , em = 370 nm ) using the oligonucleotide 5-cagc/2ampr / gcag-3 ,
where 2ampr is 2-aminopurine .
all computer docking studies were performed
using autodock 4.2
following the general protocols already in place .
the structures of fisetin , quercetin , 3hf , and 7hf were created
using chembiodraw ultra v. 13.0 ( cambridgesoft corporation , cambridge ,
usa ) and were then energy - minimized using ucsf chimera .
the dna structures of an antiparallel quadruplex
( rcsb pdb 143d ) , an antiparallel i - motif ( rcsb pdb 1a83 ) , and an a - dna sequence ( rcsb pdb 173d ) were used
as targets .
the duplex dna was made using a python program based on
the b - dna coordinates provided by arnott and hukins .
for the autogrid4 module of autodocktools4 , grid volumes
were optimized for each dna to ensure that the entire dna was available
for docking .
once the grid was created , 10 lamarckian general algorithms
( ga ) were performed on the molecules , with each dna with a population
size of 150 and a limit of 2.5 million energy evaluations .
all other
parameters were left at the default settings originally loaded into
autodocktools4 .
the lowest energy conformations for each molecule
docked to each unique dna structure were then selected .
the uv absorption of the fisetin- and quercetin - bound
nucleic acids from 200 to 300 nm is shown in supporting
information ( si ) figure s1a , b ) , which is due to the transitions
of the planar purine and pyrimidine bases .
the absmax of d(c3t2a)3c3 in ph
6.0 , d(t2ag3)4 in ph 7.0 , and duplex
dna in ph 7.0 are 265 , 255 , and 258 nm , respectively , which
suggests the difference in inpacking of dna bases in these dnas as
well as confirms that the overall secondary
structures dictate the absorption spectra .
the absorption spectra
of fisetin and quercetin in different environments are displayed in
the si figure s1a , b insets , where it is
observed that absmax of fisetin is 360 , 361 , and 366 nm , and quercetin is 368 ,
380 , and 376 nm in ( c3t2a)3c3 and ( t2ag3)4 , duplex dnas
and 357 and 362 nm for fisetin and 369 and 373 nm for quercetin in
ph 6.0 and ph 7.0 buffers , respectively .
the changes in absmax between buffers
and dna environments for fisetin and quercetin suggest the binding
of flavonols with the dna .
figure 1 provides
the evidence of the formation of the unusual non - watson
crick
type of structures for the single - stranded d(c3t2a)3c3 and d(t2ag3)4 dnas at ph 6.0 and 7.0 , respectively .
figure 1a shows the thermal difference spectra and the corresponding thermal
denaturation at 290 nm ( figure 1c , d , e ) of the
different dnas , where green , blue , and red lines represent ( c3t2a)3c3 at ph 6.0 , ( t2ag3)4 at ph 7.0 , and a duplex of the
equimolar mixture of the above dnas in ph 7.0 , respectively .
the curves
in figure 1a are simply the result of the arithmetic
difference between high ( 90 c ) and low temperature ( 20 c )
absorption spectra .
the spectral profile for g - rich dna ( green line )
showed two positive maxima at 244 and 272 nm , a shoulder at
257 nm , and a negative minimum at 296 nm .
the c - rich dna ( blue line )
showed two positive maxima at 240 and 261 nm and a negative
minimum at 294 nm .
the duplex dna ( red line ) has a positive maximum
at 268 nm .
differential absorption spectra have a typical and unique
shape for c i - motifs and g quadruplexes , and the characteristics of the
spectral profile observed here are clearly supportive of the formation
of c4 intercalated tetraplex ( see scheme 1b ) , g4 quadruplexes ( see scheme 1a ) , and duplex ( see scheme 1c ) , respectively .
si figure s2 shows the differential
absorption spectra of the d(c3t2a)3c3 and d(t2ag3)4 oligonucleotides
in 10 mm citrate buffers of various phs ( 5.0 , 5.5 , 6.0 , 6.5 , 7.0 ) ,
and it is observed that the ph 6.0 and 7.0 were the optimum phs ( closest
to physiological ph ) for c4 i - motif and g4 quartet
structures to be formed .
figure 1b shows the cd spectra
of three different dna molecules made of single - stranded d(c3t2a)3c3 ( blue solid line ) , single - stranded
d(t2ag3)4 ( green solid line ) , and
the duplex of both ( red solid line ) . from here on ,
the term c4 and g4 will be used for d(c3t2a)3c3 and d(t2ag3)4 dnas , respectively .
cd spectra provide diagnostic signatures
for the structures of intercalated c4 , g4 quartet ,
and duplex dna .
natural , heterogeneous dna usually adopts the b dna
form , which provides a conservative cd spectrum with small amplitude
bands : a positive band around 280290 nm and a negative one
at 240145 nm .
the characteristic cd spectrum of the c4 i - tetraplex contains a large maximum , 290 nm ; a negative
band , 265 nm ; and another small positive band , 225
nm . on the other hand , a positive peak around 260 nm and a trough around
240 nm implies the presence of a parallel g - quadruplex structure ,
and a peak around 295 nm with a trough around 260 nm generally implies
an antiparallel g - quadruplex .
the distinctive green , blue , and red cd spectral
profiles in figure 1b readily match with the
signatures of antiparallel g4 , c4 i - motif , and
duplex dna , respectively , indicating the existence of these structures
under our experimental conditions .
figure 1c , d , e are the thermal melting profiles of the g , c , and duplex dna
molecules studied at the absorption wavelength of 290 nm .
the considerable
hypochromic shift at 290 nm with increasing temperature in figure 1c , d were indicative of quadruplex structures , and the midpoints of the melting transitions
provide the melting temperature , tm .
the
increase in the absorption with an increase in the temperature in
figure 1e follows the normal denaturation profile
of a duplex dna .
the tm values for g4 , c4 , and duplex dnas were 30 , 51 , and 62 c
respectively .
( a ) thermal difference spectra of 5 m dnas ; ( b )
circular
dichroism spectra of 510 m dnas ; ( c ) typical uv melting
profiles .
blue and green lines denote single - stranded c4 and g4 at ph 6.0 and 7.0 , respectively ; and the red line
indicates the duplex dna made of the complementary sequences at ph
7.0 .
large stokes - shifted
emissions with distinctive fluorescence signatures are obtained for
fisetin , quercetin , and the chromophore 3hf when mixed with dna , indicating
their binding with the dna molecules . in dna environments , these flavonoid
molecules exhibit photoinduced , excited state intramolecular proton
transfer ( esipt ) , resulting in two - color ( in the blue - violet
and yellow - green regions ) fluorescence , the relative contributions
between the two colors being strongly modulated by the local environment
of the fluorophores .
figure 2 presents
the fluorescence emission spectra of the natural flavonoids ( fisetin
and quercetin ; see scheme 1f , g ) along with
the synthetic chromophores 3hf and 7hf ( see scheme 1d , e ) with increasing concentrations of g4 ( green ) ,
c4 ( blue ) , and the duplex ( red ) dnas .
it is evident that
addition of dna induces drastic changes in the emission behavior of
the flavonoids . in an aqueous medium , the fluorescence spectra of
fisetin exhibit strong overlap between the normal and tautomer emission
bands . with the addition of the g4 ,
the emission
spectra of fisetin consist of two - color- fluorescence
bands ; namely , a yellow - green emission band along with a high - energy
band in the blue - violet region .
the blue - violet fluorescence is assigned
to the s1 ( * ) s0 normal
( n , nonproton transferred ) emission .
the large - stokes shifted green
fluorescence is attributed to emission from a tautomer ( t ) species
generated by an excited state intramolecular proton transfer process
occurring along the internal h - bond ( c(4)=oho c(3 ) )
of the molecule ( scheme 1d , f ) .
the blue - violet and yellow - green fluorescence emissions
occur from n * and t * species , respectively . with the increase
in g4 , there is a decrease in the
normal emission , with an increase in the tautomer emission . the intensity
ratio of tautomer and normal fluorescence ( it / in ) increases rapidly with increasing
g4 ( shown in figure 3a ) until 20
m . the intramolecular h - bond of fisetin , which permits the
esipt process , was enhanced in the presence of g4 dna .
it is noteworthy that the emission profiles of fisetin recorded in
the dna solutions resemble the situation in an aprotic environment
where esipt emission behavior is prominent .
the enhanced tautomer emission as well as the strongly red - shifted
( 18 nm for tautomer from 0 ( 516 nm ) to 25 m dna ( 534
nm ) ) fluorescence band indicate that the guest ( fisetin ) molecules
experience relatively aprotic environments ( e.g. , like solvent acetonitrile ,
emmax = 536 nm ) in the dna microenvironment ( see
figure 2 , table 1 ) .
this establishes fisetin as an excellent two - color fluorescent probe
to study its microenvironment .
table 1 summarizes
the fluorescence emission parameters : emmax of the esipt species and the it / in ( ratio of fluorescence
intensities of tautomer and normal ratio ) of the natural flavonoids
fisetin , quercetin , 3hf , and 7hf in all the dna solutions .
it / in could not be obtained
because
of the insignificant presence of the normal form of 7hf in buffer
and low concentrations of dna .
ex = 370 nm for fisetin
and quercetin and 350 nm for 3hf and 7hf , respectively . for it / in , fluorescence
intensities were observed at 530 nm for tautomer species for all the
flavonoids , 470 nm for normal species for quercetin and fisetin , and
430 nm for the normal species of 3hf .
flavonols ( flavonoids with a 3-oh group ) undergo ultrafast
photoinduced
esipt reaction ( via the intramolecular hydrogen bond between the c = o
and 3-oh groups ) , which results in the transformation of the initially
excited ( n * ) state to the tautomer ( t * ) form .
this leads to two - color fluorescence , in the blue - violet
and yellow - green regions , which originates from the n * and t * states ,
respectively .
although the blue - violet fluorescence is assigned to
the s1 ( * ) s0 normal
( nonproton - transferred ) emission , the large stokes - shifted green fluorescence
is attributable to emission from a tautomer species generated by an
excited state intramolecular proton transfer ( esipt ) process occurring
along the internal h - bond ( i.e. , c(4 ) = oho c(3 ) )
of the molecule ( scheme 1 g ) .
the esipt process in flavonols is remarkably sensitive to the external
hydrogen - bonding interference of the environment on the internal hydrogen
bond of the molecules , and consequently , the relative contribution
between the two colors is strongly modulated by the local environment
of the fluorophore . in the case of flavonols in which 5-oh and 3-oh
groups are simultaneously present ( e.g. , quercetin ) , the c(4)=oho
c(3 )
hydrogen bond , thus preventing efficient esipt ( see scheme 1 ) .
however , strong fluorescence signals
are observed upon binding to a target or in rigid environments .
we observed a similar situation for quercetin binding in duplex
dna where a 2.9-fold increase in the esipt emission took place . binding
of quercetin with duplex dna disrupts the internal hydrogen bond involving
the 5-oh group , thereby facilitating the esipt process .
interestingly , for quercetin , it / in decreases from 1.42 in
buffer ( emmax = 530 nm ) to 1.01 ( emmax = 535 nm ) in 20 m g4 dna .
similarly , for 3hf
, there is a simultaneous increase of the normal
and tautomer emission , with a tautomer red shift from 514 ( in buffer , it / in = 2.73 ) to
520 nm ( in 20 m g4 , it / in = 0.75 ) ( figure 1 , green spectra ) .
the tautomer of 7hf undergoes a blue shift
from 526 to 523 nm with a slight increase in its intensity , and the
normal species ( absent in buffer ) grew significantly in g4 solutions .
si figure s3 displays
the excitation
spectra of the flavonoids ( monitored for the pt fluorescence ) in buffer
and 20 m g4 dna , where an appreciable change in
the spectral profiles was observed .
the exmax changes from 339
343 nm ( more polar ) and 370 365 nm ( more aprotic ) from buffer
to 20 m g4 in 3hf and quercetin , respectively .
there
is an increase in the intensity of the excitation spectra of fisetin
between buffer and g4 dna .
it is pertinent to mention that
fluorescence excitation spectra look at the excited state of the chromophore ;
hence , a change in the excitation spectra clearly indicates that the
microenvironments of flavonoids predominantly change in dna solutions
( see figures 2 , 3 and
tables 1 , 2 ) .
ex = 370 nm ( 350
nm for 3hf and 7hf ) , and em = 530 nm for the anisotropy
measurements .
standard free energy g was calculated using relation g = rt ln ka , where t = 298 k. in duplex dna solutions , the behavior
of fisetin was very similar
to that in g4 ( see figure 2 and
table 1 ) .
the decrease in normal and increase
in tautomer emission with increase in duplex dna ( it / in increased from 1.0 in
buffer to 2.1 in 25 m duplex ) was associated with a red shift
of the emmax from 516 to 529 nm . however , the emission of 3hf dramatically changes
in the duplex dna . with a negligible change in normal emission ,
the
tautomer emission increases rapidly with an increase in duplex dna
( it / in increased
from 2.8 in buffer to 9.5 in 25 m duplex ) with a simultaneous
red shift of the emmax from 514 to 526 nm .
the emmax of quercetin
changes from 529 in buffer to 536 nm with an increase in it / in from 1.3 to 3.24 in 25
m duplex .
the situation in c4 i - motif environment ,
however , is
different from duplex and g4 dnas ( see table 1 and figure 2 ) .
the most significant
change was observed for 7hf , in which a blue shift in emmax from 525 ( in
buffer ) to 518 nm in 25 m c4 matrix occurred .
it
is to be noted that unlike 3hf and its derivatives fisetin and quercetin ,
in which the esipt is intrinsic ( i.e. , proceeding across an internal
h - bond of the molecule ) and barrier free , the excited state proton transfer ( espt ) in 7hf ( in which proton
donor and acceptor sites are not located adjacent to each other ) is
solvent - assisted and consequently strongly depends on the nature of
the solvent medium .
time - resolved fluorescence
spectroscopy and transient absorption measurements using two - step
laser excitation ( tsle ) , indicated that
the espt of 7hf in methanol solution involves the formation of two
types of phototautomers in the excited state as well as in the ground
state .
both the blue and green fluorescence were due to the selective
excitation of the same ground state species ; namely , the conjugate
anion of 7hf ( 7hfa ) .
the fluorescence of 7hfa is strongly modulated
by solvent relaxation owing to a large change in dipole moments between
the ground and excited states of 7hfa .
( r ) measurements were
also performed because this parameter serves as a sensitive indicator
for monitoring ligand binding to macromolecular systems .
the anisotropy values of fluorophores
are very low in fluid solution where the fluorophore molecules can
freely rotate and increase in motionally constrained environments .
table 2 presents the
fluorescence anisotropy data obtained for the flavonoids in all the
dna environemnts .
higher values of r in dna matrixes
compared with buffer are indicative of the ligand ( flavonoid)receptor
( dna ) adduct formation .
fluorescence emission spectra of fisetin ( ex =
370 nm ) , quercetin ( ex = 370 nm ) 3-hydroxyflavone
( 3hf , ex = 350 nm ) and 7-hydroxyflavone ( 7hf , ex = 350 nm ) ( all 10 m ) in the presence of increasing
concentration of g4 ( green ) , c4 tetraplex ( blue ) ,
and duplex dna ( red ) at 025 m ) , ( 0 ,
2 - - , 5 , 10 ,
15 , 20 - - - , 25
m ) . slit widths were 3,3 for 3hf and fisetin and 3,5
for quercetin and 7hf .
variation of the it / in values for flavonoids with increase in dna concentration
from 0 to 25 m .
green , blue , and red profiles denote g4 , c4 , and duplex dnas , respectively . because the value
of the binding constant gives an idea about the strength of the binding
interactions and highlights the mode of binding , we have exploited
the it / in titration
data and the modified benesi
hildebrand equation as follows to determine the binding constant
( figure 4 ) between the flavonoids and dnas.2here ,
(it / in )
= |(it / inx )
( it / in0)| where ( it / inx ) and ( it / in0 ) represent the ( it / in ) of flavonoids in the presence and absence
of dna , respectively , n is the number of binding
sites , and ka is the association constant
for the complex .
a plot of ( 1/(it / in ) ) against [ dna ] gives a straight line where the ratio of intercept and slope provides
the association constant , ka .
the number
of binding sites were found to be 2.0 , 2.0 , and 0.4 for fisetin ; 11.0 ,
2.0 , and 1.0 for quercetin ; and 2.0 , 8.0 , and 0.2 for 3hf in duplex ,
g4 , and c4 , respectively .
there are three
ways a ligand can bind to dna : ( a ) noncovalent , weak electrostatic
interactions between cationic ligands and the polyanionic backbone
of dna ; ( b ) intercalation between adjacent base pairs ; and ( c ) hydrogen
bonding interactions with the bases , which is mainly in the minor
groove of dna .
however , a ligand can bind using more than one mechanism ,
which could be responsible for n > 2 .
the values
of n < 1 is indicative of aggregation between
the c4 dnas at higher concentrations . in b - form
dna , the
minor groove is generally the preferred site of noncovalently binding
ligands because binding is tighter in the narrower groove .
the association constants , ka , for all the conjugates were obtained and are shown
in table 2 .
we observed weak binding for all
the flavonoids in the order of 1010 m in the dna , which agrees well with the literature
for small molecule - dna interactions .
the
low association constants suggest that the binding of the flavonoids
with their target dna molecules takes place through noncovalent interactions
either by intercalation or by groove / loop binding .
double reciprocal plots
using the it / in values from the spectral profiles
of the flavonoids ( a ) fisetin , ( b ) quercetin and ( c ) 3hf in the various
microenvironments of dna ( green , g4 ; blue , c4 ; and red , duplex ) . to
find out the nature of the free and conjugated quadruplex and duplex
dnas ,
support for the existence of monomeric
forms of c4 and g4 tetraplexes in d(c3ta2)3c3 and d(t2ag3)4 oligonucleotides was obtained from molecular
mass measurements ( figures 5 and si figure s4 ) .
thymine oligonucleotides are used
to relate observed retention times to molecular mass because these
homo - oligonucleotides favor single - stranded and unfolded conformations .
sec with absorbance at 260 nm ( see figure 5 ) shows that the retention times of the free d(c3ta2)3c3 , d(t2ag3)4 , and duplex are 10.65 ( blue line ) , 10.41 ( green line ) , and
9.81 ( red line ) minutes and the retention times of dt5 , dt12 , dt21 , dt24 , and dt30 were 11.22 , 10.64 , 10.16 , 10.02 , and 9.77 min , respectively ( see
figure 5 , top ) . with the intrinsic masses of
the 21- ( d(c3ta2)3c3 )
and 24-base - long ( d(t2ag3)4 )
g / mol , the retention times in sec should have been
around dt21 ( 6326 g / mol ) and dt24 , ( 7239 g / mol ) ,
which were not observed from the experiments .
this was indicative
of the folded nature of d(c3ta2)3c3 and d(t2ag3)4 in the
solution , making it behave as a smaller sized oligonucleotide ( such
as dt12 and dt14 ) . to study the size and
shape of the flavonoid - dna adducts through the tautomer fluorescence
in sec
, we chose to study fisetin with duplex dna as the representative
of all adducts because fisetin undergoes significant esipt upon binding
with the duplex with an appreciably high ka .
figure 5 , bottom , displays the sec profiles
of fisetin bound to the duplex of d(c3ta2)3c3 and d(t2ag3)4 using absorbance at 370 nm ( red - - - ) and fluorescence
at 530 nm ( ex = 370 nm , red )
with a retention time of 9.68 min , whereas the free duplex eluted
at 9.81 min ( red , studied by a260 ) .
the presence
of fisetin in the duplex made it larger , making its retention time
less than the free duplex ( figure 5 bottom ) .
relative to the linear fit of the plot of the retention time vs molecular
masses of single - stranded thymine oligonucleotides ( si figure s4 ) , the calculated molecular masses for free and
fisetin - bound duplex d(c3ta2)3c3/d(t2ag3)4 are found to be
8526 and 9158 g / mol , with a difference of 632 g / mol .
it is noteworthy
that the molar mass of fisetin is 286.24 g / mol , which strongly indicates
that the binding stiochiometry between d(c3ta2)3c3/d(t2ag3)4 and fisetin should be 1:2 .
this agrees very well with the fluorescence
spectroscopic measurements in which the number of binding sites ( n ) of fisetin in duplex dna was found to be 2 ( see above ) .
thus , although the optical spectroscopic measurements indicated the
nature of the secondary structures ( c4 , g4 ,
duplex ) of the c - rich and g - rich and their duplex dna molecules along
with the mode of noninvasive binding of flavonoids with the dnas ,
sec studies support the quantitative aspect of this study . for fisetin
conjugated c4 i - motif and g4 quadruplex dnas ,
we observed a high degree of aggregation in the sec profiles , the
origin of which is unclear to us at this point .
size - exclusion chromatograms
of ( top ) 5 m solutions of d(c3ta2)3c3 ( blue ) ,
d(t2ag3)4 ( green ) , duplex
of dc3ta2)3c3/d(t2ag3)4 ( red ) , a mixture of dt5 , dt12 , and dt30 ( black - -
) , dt21 ( blue dashed - - - ) , dt24 ( green dashed - - - oligonucleotides studied
by absorbance at 260 nm . ( bottom ) fisetin conjugated duplex , where
( - - - ) and ( ) respectively denote
abs at 370 nm , em = 530/em = 370 along with free duplex ( ) with abs = 260 nm . the time difference of 0.06 min between the fluorescence
and absorption due to the time lag between the two detectors ( see
the materials and methods section ) is corrected here . to understand the mode of binding
of the flavonoids in the dna environments , we have exploited the well
known extrinsic fluorescence probe ethidium bromide ( etbr ) , which
mostly intercalates in dna . for duplex
dna
however , for quadruplex dna , ligands can intercalate or bind to the
loops ( see scheme 2 , where straight arrows
indicate the loops and grooves ) .
literature data provide evidence
that etbr binds with quadruplex mainly through intercalation or end
stacking modes .
the solid line (
profile 1 ) in figure 6 indicates the emission
intensities of fisetin in the dna in the presence of etbr .
the it / in of 5 m
fisetin in the presence of 5 m etbr is 1.43 , 1.75 , and 1.7
in 10 m c4 , g4 , and duplex , respectively , which suggests that
in the presence of etbr , there was not a major decrease in fluorescence
emission of fisetin ( see table 1 for comparison ) .
the black emission profiles in figure 6 correspond
to the fluorescence emission spectra of 5 m etbr in buffer
( black ) , in 10 m c4 , g4 , and duplex dna in the absence ( profile 2 , )
and presence ( profile 3 , ) of 5 m fisetin .
as is evident from figure 6 , the fluorescence
of etbr increases significantly ( 8.5 , 4 , 1.6 times for duplex , g4 and for c4 , respectively ) upon binding with dna .
there is a slight increase in the emission intensity of etbr in dna
matrixes in the presence of fisetin .
furthermore , the process of energy
transfer was readily observed
from the excitation spectrum of the etbr in the presence of fisetin .
the pink ( profile 4 , - - - ) and black ( profile 5 , )
lines in figure 6 show the fluorescence excitation
of etbr ( em = 610 nm ) in 10 m dna in the
absence and presence of fisetin , and the appearance of a band at 370
nm only in the latter case clearly indicates the existence of both
fisetin and etbr in the dna matrix and the occurrence of fret from
fisetin to the intercalated etbr .
the energy transfer
from fisetin to etbr increases the emission
intensity of etbr to a slight extent in the presence of fisetin ( compare
profiles 4 and 5 in each dna environments ) .
this suggests that fisetin
and etbr bind with the dna at the same time .
this can be true only
if their binding sites are different , but are adjacent to each other
in d(c3ta2)3c3 , d(t2ag3)4 , and duplex dnas , which makes
the fret from fisetin to etbr possible .
for quercetin , we observed
a similar energy transfer mechanism ( see si figure s5 ) in the g4 environment ; however , because the
intrinsic fluorescence of quercetin is less than fisetin , the energy
transfer from quercetin to etbr became prominent in all the dna environments
because with ex = 370 nm , apart from emission from
normal at em 470 nm ( low ) and esipt at
em 530 nm , a third emission is observed
at em 592 nm , which is the intrinsic emmax for etbr .
hence , the energy from the emission of the normal
species at 470 nm is transferred to excite the etbr , giving rise to
the etbr emission band in the spectrum .
this mechanism is also present
in the case of fisetin , but because of the high intrinsic fluorescence
and broadness of the emission spectrum , it was not noticeable . these
observations clearly indicate that fisetin and quercetin bind at sites
that are in close proximity to the intercalated etbr for energy transfer
to take place . therefore , possible binding sites for fisetin and quercetin
were the loop regions of c4 ; the face of the g - quartet
along the diagonal loop ( see scheme 2 ) , where
-delocalized system stacking is possible ; and the minor groove
of duplex dna .
fluorescence emission ( solid line , profile
1 ) and excitation spectra
( ) of 5 m fisetin ( ex = 370 nm ) in 10 m dna ( c4 ( blue ) , g4 ( green ) and duplex ( red ) ) in the presence of 5 m etbr .
the
black profiles correspond to emission of 5 m etbr ( ex = 480 nm ) in buffer ( ) , in dna ( 10
m , , in the absence of fisetin , profile 2 ) ,
and in dna ( 10 m , , in the presence of
5 m fisetin , profile 3 ) .
the figure also shows the excitation
spectra of etbr ( em = 610 nm ) in dna without ( pink - - - , profile 4 ) and with ( black ,
profile 5 ) fisetin .
profile numbers are not repeated for g and c dnas ,
but they correspond to the same sets in each . left , formed by 5-d(c3ta2)3c3 - 3. right , made up by 5-d(t2ag3)4 - 3. a and b denote the unimolecular antiparallel structure
with parallel adjacent strands and a diagonal loop and unimolecular
antiparallel with alternating parallel strands , respectively .
the
straight arrows indicate the site of binding of flavonoids in the
dna matrix .
. molecular modeling studies
enable characterization of dna flavonoid interactions in atomistic
detail .
molecular docking techniques have come into prominence as
a new tool for identifying novel small molecule drugs for targeting
dna .
figure 7 displays
the lowest - energy - docked conformers for 3hf , 7hf , fisetin , and quercetin
in c4 , g4 , and duplex dnas .
all the flavonoids
were found to be either loop or minor groove binders for quadruplex
or duplex , respectively .
the minor groove is a particularly attractive
target for small molecules because of the closer proximity of the
strands in the minor groove , thereby making the binding more compact .
furthermore , this site has less competition
from proteins and polymerases , which typically interact with the major
groove .
table 3 provides the binding energies and association constants for 3-hydroxyflavone
( 3hf ) , 7-hydroxyflavone ( 7hf ) , fisetin , quercetin in c4 i - motif , g4 quadruplex , and duplex b- and a - dna environments ,
which were obtained using the autodocktools4 program .
the flavonoids
intercalate with a - dna , for which the average ka was found to be 10 ( which is at least 1 order of magnitude higher
than other dnas ) and the average binding energy was 9 kcal / mol
( vs 67 kcal / mol in other dnas ) .
a comparison between
the computational and experimental binding energies and association
constants reveals that theoretical and experimental results do match
to an appreciable extent .
however , there were some discrepancies observed
that could be due to a higher order of aggregation of both ligands
( flavonoids ) and receptors ( dnas ) in the solutions .
table 4 provides the internal
energy of
the ligand flavonoids in their host dna environments .
the internal
energy is the sum of electrostatic and van der waals h - bonding
desolvation energy .
hence , higher internal energy arises from more
association of the ligand with the host .
fisetin and quercetin form
h bonds to their receptor dna environments through the c(3)oh ,
c(4)oh in b , and c(7)oh in the a rings .
the
c(5)oh of quercetin can interact with the host only when it
no longer interferes with the esipt .
the c(3)oh
in fisetin , quercetin , and 3hf forms h bonds with its host when esipt
does not occur or when the microenvironment is not aprotic . on the other hand ,
esipt in 7hf happens only via h bonding with
its receptor / surrounding environment .
sum of electrostatic ( es ) and
van der waals h - bond desolvation ( vdw hb ) ( kcal / mol ) .
lowest - energy - docked conformations representing
the interaction
profile of 3-hydroxyflavone ( 3hf , a
d ) , 7-hydroxyflavone ( 7hf ,
e h ) , fisetin ( i l ) and quercetin ( m p ) in antiparallel
c4 i - motif , antiparallel g4 quadruplex , b - dna ,
and a - dna ( left to right ) .
the high sensitivity of flavonol emission
to their surrounding
environment and their prospective applications as exquisitely sensitive
fluorescent molecular probes for exploring their interactions with
the biological targets were the focus of this study . here , we presented
perspectives highlighting the novel uses of the intrinsic fluorescence
emission of the therapeutically potent flavonoids quercetin and fisetin
and their chromophores 3hf and 7hf in exploring their interactions
with the dna oligonucleotides of physiological relevance . applying
this promising new approach for the screening and
design of the most suitable derivatives from among
numerous available structural variants of this new generation of therapeutic
drugs would open the door to new avenues in medicinal chemistry .
complementary
use of other experimental biophysical ( spectroscopic as well as chromatographic )
techniques and theoretical ( molecular modeling ) studies permits detailed
assessment of the role of structure and substitution patterns of the
flavonoids on their affinities and binding modes to their target dnas .
|
fisetin
( 3,7,3,4-tetrahydroxyflavone ) and quercetin
( 3,5,7,3,4-pentahydroxyflavone ) are the bioactive
plant flavonoids that are potentially useful therapeutic drugs for
the treatment of a broad spectrum of diseases , including atherosclerosis ,
cardiovascular disease , obesity , hypertension , and cancer .
3-hydroxyflavone
( 3hf ) and 7-hydroxyflavone ( 7hf ) are the synthetic chromophores of
fisetin and quercetin .
we have exploited dual luminescence properties
of fisetin and quercetin along with 3-hf and 7hf to examine their
efficacy of binding and compare their interactions with dna , which
is one of the macromolecular targets of flavonoids in physiological
systems . following the sequence of the human telomeric dna 5-d
( ccctaa-)n/(-ttaggg)n-5 , two single - stranded dna oligonucleotides , 5-d(c3ta2)3c3 - 3 and 5-d(t2ag3)4 - 3 , and their duplex were
used as receptors to study binding by the ligands quercetin , fisetin ,
and their chromophores .
circular dichroism , differential absorption ,
uv thermal melting , and size exclusion chromatographic studies indicated
the formation of unusual dna structures ( such as c4 and
g4 tetraplexes ) for both the c- and g - rich single - stranded
dnas . upon binding to dna , dramatic changes were observed in the intrinsic
fluorescence behavior of the flavonoids .
molecular docking studies
were performed to describe the likely binding sites for the ligands .
the spectroscopic studies on flavonoid dna interactions described
herein demonstrate a powerful approach for examining their dna binding
through exploiting the highly sensitive intrinsic fluorescence properties
of the flavonoids as their own reporter for their
interactions with macromolecular targets .
|
this combined with its somewhat simple functional architecture has made the olfactory system an ideal model system to examine the neural basis of sensory processing in mammals .
nevertheless , the detailed mechanisms of olfactory processing and the neural processes underlying it remain largely unknown . behavioral approaches offer an excellent means of constraining models of olfactory processing ( linster and cleland , 2004 ; cleland and linster , 2005 ) .
studies in rodents using go / no go odor detection and discrimination tasks for example indicate that lesions that encompass large parts of the olfactory bulb ( ob ) do not produce a dramatic phenotype at least for simple tasks ( lu and slotnick , 1998 ) .
furthermore , generally in rodents odor discrimination is very rapid , occurring in less than 200250 ms within a single sniffing bout ( uchida and mainen , 2003 ; abraham et al . , 2004 ; rinberg et al . ,
there also exists a speed - accuracy trade - off such that discrimination between highly similar odorants requires additional time , in the range of 70100 ms ( abraham et al . , 2004 ; rinberg et al . ,
these overall discrimination times include both the sensory transduction , which might require several tens or even hundred milliseconds ( duchamp - viret et al . , 1999 ;
it is thus likely that the processing time in the ob is actually substantially less than the time window defined by the behavioral discrimination task .
voltage - sensitive dye and calcium imaging experiments indicate that odors activate not only a specific spatial pattern of glomerulus activity but that activation is strongly modulated by the sniff - cycle .
inputs to the ob are strongly shaped by the respiration cycle in anesthetized as well as awake animals ( spors et al .
, 2006 ; verhagen et al . , 2007 ; wesson et al . , 2008 ; carey et al . ,
moreover , the sequence of glomerular activation is also odor specific and virtually concentration invariant ( spors and grinvald , 2002 ; spors et al . , 2006 ) .
many studies using extracellular recordings in anesthetized and awake animals found a strong coupling of bulb activity to the respiration cycle even as frequencies as high as 10 hz ( adrian , 1950 ; macrides and chorover , 1972 ; buonviso , 2006 ; cury and uchida , 2010 ; carey and wachowiak , 2011 ) .
intracellular in vivo recordings have shown that individual mitral / tufted cells ( m / tcs ) display a prominent sub - threshold membrane potential oscillation synchronous with the sniff cycle ( charpak et al . , 2001 ; cang and isaacson , 2003 ; margrie and schaefer , 2003 ) .
m / tc suprathreshold activity is thus structured across a single sampling cycle such that those cells firing more action potentials ( aps ) begin to fire consistently earlier than those discharging fewer aps ( margrie and schaefer , 2003 ) . many features of the psychophysics of odor discrimination and detection are exquisitely captured in simple models relying on a static pattern of all - or - none glomeruli ( koulakov et al . , 2007 ) .
since rhythmic odor sampling is phylogenetically highly conserved and defines activity early in the olfactory pathway it seems desirable that working models of olfactory processing should incorporate this active and dynamic process ( knsting and spors , 2009 ) . to examine whether the temporal structure of ob activity across a sampling cycle might contain information that could account for the known psychophysical properties of olfactory processing we built a large - scale model of the ob .
we have constrained the discharge patterns of m / tcs , based on in vivo measurements of ap latencies , inter - spike intervals ( isis ) and ap distributions within a sniff cycle .
furthermore , we ensure that odor concentration dependence and the distribution of activity follow that measured for individual neurons and the ob network . as this scheme quantitatively reproduced both similarity - dependent discrimination times and robustness against lesioning
, we suggest that in the ob , odor processing relies on the patterns of ap onset across the network of m / tcs .
our explicit model for the ob was built with a focus on accurate reproduction of in vivo single m / tc discharge patterns with particular attention to the onset of ap activity . since these data reflect contributions of both sensory and local ob activity we did not include any additional explicit sources of inhibition ( see also discussion ) . to facilitate quantitative comparison with behavioral data
, we built an ob network of realistic size with 2400 glomeruli with 25 m / tcs each .
varying the number of m / tcs per glomerulus did not significantly alter the results ( data not shown ) . to maintain computational feasibility
we proceeded in three steps : firstly , based on whole - cell recordings in vivo we adjusted parameters of a leaky integrate - and - fire ( inf ) neuron to match the measured onset latencies , isis and other single - cell parameters . secondly , using the measured distribution of ap firing for odor - evoked activity we determined the distribution of input currents corresponding to an odor stimulus .
thirdly , we tested our model by comparing its concentration dependence with published electrophysiological and imaging measurements .
all simulations were performed using matlab 6.5 ( the mathworks , natick , ma , usa ) with inf neuron models in the csim_lifnet simulation environment ( t. natschlger , available at http://www.igi.tugraz.at/tnatschl/csim_lifnet/ ) .
m / tcs were modeled as inf neurons to allow for networks of realistic size of spiking neurons .
gaussian noise was added resulting in a membrane potential variance of 0.20 0.04 mv ( mean sd , n = 10 , schaefer et al . ,
background synaptic input consisted of 100 hz poisson inputs with excitatory postsynaptic potential ( epsp ) amplitude of 0.58 mv and a decay time constant of 10 ms .
a 4 hz oscillation with a peak - to - peak amplitude of 10 mv was mimicked by sinusoidal current injection ( schaefer et al . , 2006 ) .
varying oscillation frequency between 2 and 10 hz did not significantly alter the findings ( data not shown ) .
ap discharge in m / tcs was measured for constant current injection between 0 and 0.18 na resulting in 1.6 3.3 aps ( range 015 ) per cycle [ second cycle , see ( lengyel and erdi , 2004 ) ; n = 10,000 ] and the four parameters ( membrane time constant , ap threshold , ap reset voltage , and refractory period ) adjusted to fit isi ( figures 1a , b ) latency ( figures 1a , c ) and the distributions of aps within an oscillation cycle ( figure 1a ) as observed in vivo ( margrie and schaefer , 2003 ) .
this resulted in an ap threshold of 15 mv , a refractory time constant of 4 ms , a membrane time constant of 30 ms , and a reset voltage of 10 mv .
construction and validation of an ob model based on parameters determined in vivo cellular constraints .
( a ) top : example trace of the membrane potential of a mitral / tufted cell ( m / tc ) showing respiration synchronized sub - threshold oscillations in an awake mouse .
below : a plot of action potential distribution in m / tcs for sniff cycles that evoke between 1 and 5 aps .
( b ) instantaneous firing rate [ inverse of the inter - spike interval ( isi ) ] and the latency to action potential ( ap ) onset ( c ) plotted against the number of aps evoked per sniff cycle .
red markers and lines indicate data obtained from m / tc whole - cell recordings in vivo [ margrie and schaefer ( 2003 ) ] .
black indicates the cellular responses for the integrate - and - fire ( inf ) neurons used . in order to constrain odor stimulus parameters ,
a distribution of input currents was determined that reproduced the measured cumulative ap discharge probability observed in vivo in cells that responded to an odor ( figure 2a , margrie and schaefer , 2003 ) resulting in a distribution of input currents of [ ( i 0.53 + 0.3 ) + 0.3 ] 0.18 na with i distributed equally between 0 and 1 . in figure 2a ,
mean and sds are plotted for 10 repetitions with different random seeds and 1000 cells each . as a first control ,
the resulting ap distribution was compared to the measured ap distribution ( figure 2b ) .
construction and validation of an ob model based on parameters determined in vivo population constraints .
( a ) cumulative probability for the occurrence of 19 aps per sniff cycle during odor - evoked ap discharge in inf neurons ( black ) and in vivo [ red ; margrie and schaefer ( 2003 ) ] .
( b ) distribution of aps across a sniff cycle in simulation ( black ) and in vivo [ red , margrie and schaefer ( 2003 ) ] . to assess the correspondence of odor affinities and concentrations to the distribution of activity in orns , a simple sigmoid relation with glomerulus - independent parameters was assumed ( meister and bonhoeffer , 2001 ) : r = rmax [ c/(c+ki ) ] + b. b is the response threshold ( current needed for 0.2 aps ; b = 0.035 na ) ; rmax + b equals the maximal current [ current required to evoke 12 aps ( margrie and schaefer , 2003 ) ; here 0.169 na ] . from this , we determined the binding coefficients , ki , resulting in the ap distribution of figure 2 .
as a next control , odors were presented at two concentrations ( 0.3 and 3 relative to figure 2 ) and number of aps , isi , and latency to the first spike were measured ( figure 3 ) .
cang and isaacson ( 2003 ) reported a two - fold increase in the number of aps per cycle ( from 2.1 to 4 ) , a 60 ms decrease in mean onset latency and a non - significant decrease in isi . in the model ,
the number of aps increased from 1.51 0.80 to 6.16 2.21 aps ; the latency to onset decreased from 95.4 20.1 to 41.5 19.9 ms ( 313/500 cells spiked at both concentrations ) , whereas the isi did not change substantially ( 34.8 11.0 vs. 20.2 2.2 ms , 111/500 cells spiked with more than 1 ap at both concentrations ; simulations were repeated 10 times with different random seeds ) .
this is in excellent agreement with whole - cell recordings in vivo ( cang and isaacson , 2003 ) .
an odor was presented to the ob model at concentrations of 0.3 ( low ) and 3 ( high ) times relative to the concentration used in b ( see methods ) .
the number of aps per cycle ( a ) , latency to the first ap ( b ) , and average isi ( c ) were determined . to obtain qualitative insight into population activity in the model
, we created images of activity , corresponding to 200 glomeruli ( the number of glomeruli that could be visualized using intrinsic imaging of the dorsal surface ; meister and bonhoeffer , 2001 ) .
the largest number of glomeruli activated by an individual odor as measured by ca imaging of presynaptic activity was 60 out of the approximately 150 glomeruli visible in this study ( wachowiak and cohen , 2001 ) .
thus , an odor consisted of an activity pattern mapped onto 40% of the glomeruli , with the above described distribution of input currents . to qualitatively compare the model to imaging results at different concentrations , we varied concentrations over four orders of magnitude and converted the resulting m / tc activity ( number of aps / cycle ) in gray scale levels and mapped them on a scheme of an ob ( figure 4 )
. two hundred glomeruli were randomly distributed as dots in an ellipse with 50 and 30 pixels radius and gaussian noise ( = 0.1 ) was added to every data point .
the resulting image was filtered by a 7 7 gaussian filter with two passes , clipped to the ellipse and smoothened with a 3 3 gaussian filter . in agreement with intrinsic imaging studies ( rubin and katz , 1999 ) at low concentrations
the depicted region corresponds to the dorsal part of the ob that has been visualized using intrinsic imaging methods [ rubin and katz ( 1999 ) ; uchida et al .
m / tc activity was converted to gray scale values as described in the methods .
m / tcs were modeled as inf neurons to allow for networks of realistic size of spiking neurons .
gaussian noise was added resulting in a membrane potential variance of 0.20 0.04 mv ( mean sd , n = 10 , schaefer et al . ,
background synaptic input consisted of 100 hz poisson inputs with excitatory postsynaptic potential ( epsp ) amplitude of 0.58 mv and a decay time constant of 10 ms .
a 4 hz oscillation with a peak - to - peak amplitude of 10 mv was mimicked by sinusoidal current injection ( schaefer et al . , 2006 ) .
varying oscillation frequency between 2 and 10 hz did not significantly alter the findings ( data not shown ) .
ap discharge in m / tcs was measured for constant current injection between 0 and 0.18 na resulting in 1.6 3.3 aps ( range 015 ) per cycle [ second cycle , see ( lengyel and erdi , 2004 ) ; n = 10,000 ] and the four parameters ( membrane time constant , ap threshold , ap reset voltage , and refractory period ) adjusted to fit isi ( figures 1a , b ) latency ( figures 1a , c ) and the distributions of aps within an oscillation cycle ( figure 1a ) as observed in vivo ( margrie and schaefer , 2003 ) .
this resulted in an ap threshold of 15 mv , a refractory time constant of 4 ms , a membrane time constant of 30 ms , and a reset voltage of 10 mv .
construction and validation of an ob model based on parameters determined in vivo cellular constraints .
( a ) top : example trace of the membrane potential of a mitral / tufted cell ( m / tc ) showing respiration synchronized sub - threshold oscillations in an awake mouse .
below : a plot of action potential distribution in m / tcs for sniff cycles that evoke between 1 and 5 aps .
( b ) instantaneous firing rate [ inverse of the inter - spike interval ( isi ) ] and the latency to action potential ( ap ) onset ( c ) plotted against the number of aps evoked per sniff cycle .
red markers and lines indicate data obtained from m / tc whole - cell recordings in vivo [ margrie and schaefer ( 2003 ) ] .
black indicates the cellular responses for the integrate - and - fire ( inf ) neurons used .
in order to constrain odor stimulus parameters , the ap distribution in response to odors was analyzed .
a distribution of input currents was determined that reproduced the measured cumulative ap discharge probability observed in vivo in cells that responded to an odor ( figure 2a , margrie and schaefer , 2003 ) resulting in a distribution of input currents of [ ( i 0.53 + 0.3 ) + 0.3 ] 0.18 na with i distributed equally between 0 and 1 . in figure 2a , mean and sds are plotted for 10 repetitions with different random seeds and 1000 cells each . as a first control ,
the resulting ap distribution was compared to the measured ap distribution ( figure 2b ) .
construction and validation of an ob model based on parameters determined in vivo population constraints .
( a ) cumulative probability for the occurrence of 19 aps per sniff cycle during odor - evoked ap discharge in inf neurons ( black ) and in vivo [ red ; margrie and schaefer ( 2003 ) ] .
( b ) distribution of aps across a sniff cycle in simulation ( black ) and in vivo [ red , margrie and schaefer ( 2003 ) ] . to assess the correspondence of odor affinities and concentrations to the distribution of activity in orns , a simple sigmoid relation with glomerulus - independent parameters was assumed ( meister and bonhoeffer , 2001 ) : r = rmax [ c/(c+ki ) ] + b. b is the response threshold ( current needed for 0.2 aps ; b = 0.035 na ) ; rmax + b equals the maximal current [ current required to evoke 12 aps ( margrie and schaefer , 2003 ) ; here 0.169 na ] . from this
, we determined the binding coefficients , ki , resulting in the ap distribution of figure 2 .
as a next control , odors were presented at two concentrations ( 0.3 and 3 relative to figure 2 ) and number of aps , isi , and latency to the first spike were measured ( figure 3 ) .
cang and isaacson ( 2003 ) reported a two - fold increase in the number of aps per cycle ( from 2.1 to 4 ) , a 60 ms decrease in mean onset latency and a non - significant decrease in isi . in the model ,
the number of aps increased from 1.51 0.80 to 6.16 2.21 aps ; the latency to onset decreased from 95.4 20.1 to 41.5 19.9 ms ( 313/500 cells spiked at both concentrations ) , whereas the isi did not change substantially ( 34.8 11.0 vs. 20.2 2.2 ms , 111/500 cells spiked with more than 1 ap at both concentrations ; simulations were repeated 10 times with different random seeds ) .
this is in excellent agreement with whole - cell recordings in vivo ( cang and isaacson , 2003 ) .
an odor was presented to the ob model at concentrations of 0.3 ( low ) and 3 ( high ) times relative to the concentration used in b ( see methods ) .
the number of aps per cycle ( a ) , latency to the first ap ( b ) , and average isi ( c ) were determined . to obtain qualitative insight into population activity in the model , we created images of activity , corresponding to 200 glomeruli ( the number of glomeruli that could be visualized using intrinsic imaging of the dorsal surface ; meister and bonhoeffer , 2001 ) .
the largest number of glomeruli activated by an individual odor as measured by ca imaging of presynaptic activity was 60 out of the approximately 150 glomeruli visible in this study ( wachowiak and cohen , 2001 ) .
thus , an odor consisted of an activity pattern mapped onto 40% of the glomeruli , with the above described distribution of input currents . to qualitatively compare the model to imaging results at different concentrations , we varied concentrations over four orders of magnitude and converted the resulting m / tc activity ( number of aps / cycle ) in gray scale levels and mapped them on a scheme of an ob ( figure 4 ) .
two hundred glomeruli were randomly distributed as dots in an ellipse with 50 and 30 pixels radius and gaussian noise ( = 0.1 ) was added to every data point .
the resulting image was filtered by a 7 7 gaussian filter with two passes , clipped to the ellipse and smoothened with a 3 3 gaussian filter . in agreement with intrinsic imaging studies (
rubin and katz , 1999 ) at low concentrations only few distinct glomeruli are activated ; at higher concentrations widespread activity occurs .
the depicted region corresponds to the dorsal part of the ob that has been visualized using intrinsic imaging methods [ rubin and katz ( 1999 ) ; uchida et al .
m / tc activity was converted to gray scale values as described in the methods .
sub - threshold oscillations in m / tcs are synchronized to sniffing and are a hallmark of the early olfactory system ( schaefer and margrie , 2007 ; wachowiak , 2011 ) . across an individual sampling or oscillation cycle
instantaneous firing rate of m / tcs is barely affected by changes in input strength ( cang and isaacson , 2003 ; margrie and schaefer , 2003 ) .
overall activity of a given m / tc is , however , accurately reflected by its onset latency ( margrie and schaefer , 2003 ; kepecs et al . , 2006 ) that are highly odor - specific and reproducible ( junek et al . , 2010 ) .
could these latencies account for the rapid but stimulus dependent discrimination times that are difficult to reconcile with a code relying on counting the number of aps discharged during a cycle ( margrie and schaefer , 2003 ) ? from a simple sketch of ap latencies across the m / tc population ( figure 5 ) it is apparent that in the case where very dissimilar odorants evoke spatially non - overlapping activation patterns odor discrimination based on the onset of activity could be very rapid ( figure 5 , left column ) : for example , where odor a evokes ap discharge early in m / tc # 1 and 4 ( open arrowhead ) , odor b evokes aps only late or not at all .
conversely , odor b results in very short onset latencies in m / tc # 3 ( filled arrowhead ) that is activated weakly and late in a cycle by odor a. thus , for these very different stimuli only a brief period ( gray bar and dotted line ) would be needed to discriminate odor a from b based on the activity onset pattern . schematic representation of the proposed ap latency - based scheme and emerging similarity - dependent separation times . left column : sketch of the membrane potential of eight m / tcs in response to two different odors ( red and blue ) with little spatial overlap . for dissimilar odors arrows
indicate m / tcs that respond either weakly for odor a and strongly for odor b ( solid arrow , m / tc # 3 ) or vice versa ( open arrows , m / tc # 1 and # 4 ) . based on ap latencies in the strongly activated m / tcs reliable stimulus separation
may be achieved early during the evoked response ( indicated by the dotted line ) .
right column : same m / tcs in response to two similar odors ( binary mixtures of a and b , mixture i [ 60%a , 40%b ] , light green ; mixture ii [ 40%a , 60%b ] , dark green ) .
due to the overall similarity of m / tc responses , information from many more cells ( including those with delayed onsets e.g. , m / tc # 5 and # 6 ) must be obtained to allow for stimulus separation ( dotted lines ) .
if , however , the response to two similar odors ( that evoke highly overlapping patterns ; such as binary mixtures , 0.6a/0.4b [ mix 1 ] and 0.4a/0.6b [ mix 2 ] ) is compared , m / tc # 1 may discharge early for both odors ( figure 5 right column , open vs. filled arrowheads ) . averaging over a large number of repetitions or alternatively a large number of cells , a very small difference in the initial onset latencies might become apparent .
thus , for one - sniff odor discrimination , many cells or glomeruli ( including those with delayed onsets , e.g. , # 5 , # 6 ) would be needed to reliably separate very similar stimuli . hence , while simple discriminations could be performed quickly , difficult separations would require the activity of many late firing m / tcs ( schaefer and margrie , 2007 ) . to obtain quantitative evidence for this hypothesis
, we built an ob model with 2400 glomeruli containing 25 m / tc each ( described in detail in the methods ) .
an activity onset vector for the m / tc network was generated for each odor ( figure 6a ) .
reproducibility and similarity was determined by correlating these onset vectors ( figures 6b , c ) .
the analysis was then restricted to , for example , the first 200 ms of activity . that is only onset values for those m / tcs discharging within 200 ms
for all other m / tcs , ceiling values ( 200 ms ) were employed for the correlation .
this time window was then varied and correlations of onset vectors re - calculated until the entire sampling period was encompassed . using a template - matching scheme we find that within the first 30 ms of activity the latency patterns for repetitions of the same odor are already highly reproducible and that their correlation improves with time ( figure 7a ; 1 way anova f(8 , 63)= 534 , p < 10 .
in contrast , the overall m / tc onset pattern evoked by dissimilar odors revealed no significant correlation over the entire sampling period ( figure 7a ; r = 0.008 0.013 ) . quantifying stimulus separation in the ob .
( a ) onsets of activity ( horizontal light and dark green lines ) of all m / tcs are collected into onset vectors ( right ) .
reproducibility is calculated by correlating onset vectors with a repetition of the same odor [ orange , ( b ) ] .
similarity is determined by correlating onset vectors for responses to two different odors [ purple , ( c ) ] .
separation of two odors is ensured when the resultant reproducibility values are significantly higher than the similarity values ( unpaired t - test ) .
similarity and reproducibility for repetitions of a dissimilar [ a vs. b ; ( a ) ] and similar odor pair [ mix1:60a/40b vs. mix2:40a/60b ; ( b ) ] as a function of the analysis time window ( t ) . asterisks ( ) highlight times at which reproducibility was significantly higher than similarity
thick lines are sigmoidal fits of the correlation scores . to determine the time - course of ap latency - based stimulus separation we first presented dissimilar odor pairs ( e.g. , a vs. b ) . in this case
we find that the reproducibility of the m / tc responses is sufficiently large to reliably separate stimuli very early in the evoked response ( figure 7a ; p < 10 at 30 ms ) .
in contrast , the time required to reliably differentiate the responses to very similar odors ( binary mixtures ; 0.4a/0.6b vs. 0.6a/0.4b ) was substantially longer ( figure 7b ; p > 0.1 for t < 90 ms ) . quantifying stimulus separation times for pairs (
n = 10 ) of both very dissimilar and similar odors shows that while less than 30 ms of ob activity can be enough for easy separation tasks ( 30 1 ms ; range 2533 ms ) up to 90 ms longer is needed to perform the more difficult separation of similar odors ( figure 8 , 89 2 ms ; 82118 ms ) . both similarity dependence and absolute separation times ( figure 8b ) are consistent with the behaviorally observed stimulus - dependent discrimination times in rodents .
the stimulus - dependence of separation times was also largely independent of the absolute odor concentration ( r = 0.12 , p > 0.05 ) .
this is again consistent with concentration - independent discrimination times observed experimentally ( uchida and mainen , 2003 ; abraham et al . , 2004 ) .
( a ) stimulus separation ( p value of the comparison of reproducibility and similarity ) as a function of analysis window time t .
( b ) separation times ( time at which reproducibility was significantly higher than similarity ) for dissimilar and similar odor pairs .
error bars indicate s.e.m . from 10 odor pairs ( eight repetitions each as in a ) .
a second observation for the olfactory system is that basic odor discrimination appears rather insensitive to partial deletions of the ob .
such studies indicate that disruption of large regions of the ob fail to produce a dramatic behavioral phenotype ( lu and slotnick , 1998 ) . in some animals , discrimination of very different odors
was partially impaired only if lesions impacted on more than 80% of the ob . however , when more difficult discriminations were considered lesioning 5090% of the ob was at least partially effective ( lu and slotnick , 1998 ) . to determine whether the ap latency - based coding scheme might also account for these observations we introduced virtual lesions that randomly removed between 50 and 99.7% of the ob .
firstly we find that ap latency - based discrimination is very robust against lesions of the ob .
for very dissimilar odorants discrimination could still occur with less than 5% of the intact ob network . for more similar odors 50% of the ob was sufficient to achieve successful odor discrimination , in agreement with previous behavioral observations ( lu and slotnick , 1998 ) .
in addition , we can make the prediction that separation times for discrimination tasks of both easy and intermediate difficulty depended critically on the size of the ob network ( figure 9 ) .
virtual ob lesion for dissimilar ( black ) , intermediate ( gray ) , and similar ( open ) odor pairs .
here we propose a simple scheme of odor representation in the ob that relies on the onset latencies of aps in m / tcs across an individual sampling cycle . at the single - cell level ,
the model used to test this is based on whole - cell recordings from m / tcs in vivo .
the patterns of activity in m / tcs in response to odor stimuli indicate that the overall level of excitation in an individual m / tc is accurately predicted by the onset of aps across each respiration cycle ( margrie and schaefer , 2003 ) .
our simulations here show that such an ap latency - based scheme can account for a number of temporal and psychophysical features of odor processing .
firstly , it is concentration invariant and mirrors the similarity - dependent discrimination times observed in rodents ( uchida and mainen , 2003 ; abraham et al .
the latency - based scheme also reproduces the behaviorally observed robustness against extensive ob lesions ( lu and slotnick , 1998 ) and predicts that the time required to discriminate odors will gradually increase with lesion size .
thus , our data not only account for existing behavioral observations but also predict that the overall odor discrimination time is sensitive to the size of the ob network , a prediction that could be tested in automatized behavioral assays ( schaefer and claridge - chang , 2011 ) where animals with differing lesion size would be systematically tested on a battery of odors with varying similarity .
we speculate that the relative onset latency of a glomerulus or m / tcs contained therein reflects the relative activation intensity of a given orn channel or functional module ( cang and isaacson , 2003 ; margrie and schaefer , 2003 ; bhandawat et al . , 2005 ; spors et al . , 2006 ) .
it has been suggested that lateral inhibition between such functional modules may provide a mechanism of enhancing subtle differences between the activity patterns evoked by different odor stimuli ( yokoi et al . , 1995 ; urban , 2002 ; leon and johnson , 2003 ; cleland and linster , 2005 ) . such inhibition either through direct gabab modulation of the orns by juxtaglomerular cells ( aroniadou - anderjaska et al . , 2000 ) or via the granule cell
mediated pathway ( urban , 2002 ) could be used to enhance differences between the onset latencies of glomerular units ( margrie and schaefer , 2003 ) .
indeed , alterations to the ob network through cre - mediated excision of glutamate receptors resulted in altered olfactory learning and discrimination ( shimshek et al . ,
2005 ) . more targeted modifications , however , through virus - mediated , ablation of the ampa receptor subunit glua2 specifically in the granule cell layer resulted in increased ca influx in granule cells , and increased inhibition .
odor discrimination learning , however , was left un - altered as were odor discrimination times for simple odor discrimination tasks . ablating
the nmda receptor subunit nr1 and thus decreasing ca influx and decreasing inhibition similarly left performance on simple tasks unaltered ( abraham et al . , 2010 ) .
this indicates that indeed for simple odor discriminations , inhibition in the ob is not needed . for highly similar odor pairs , that require overall longer for accurate discrimination ( abraham et al . , 2004
) , increasing and decreasing inhibition did indeed decrease and increase odor discrimination times ( abraham et al . ,
2010 ) indicating a role of inhibition in shaping late activity and thus potentially contributing to the exact latencies of m / tcs active later in a respiration cycle .
irrespective of the exact source of ap latency differences ( cang and isaacson , 2003 ; margrie and schaefer , 2003 ; bhandawat et al . , 2005 ; buonviso , 2006 ; spors et al . , 2006
; cury and uchida , 2010 ; carey and wachowiak , 2011 ; shusterman et al . , 2011 ) we suggest that such activity in m / tcs is sufficient to explain several psychophysical properties of the mammalian olfactory system .
the role of inhibition might become more prominent in situations where expectation as mediated by cortical inputs onto gcs begins to modulate odor representation ( koulakov and rinberg , 2011 ) . a key feature structuring ap latencies and
latency difference is the rhythmic sniff - coupled drive that results in sniff - coupled sub - threshold oscillations in m / tcs and consequently in sniff - coupled rhythmic ap discharge .
while most electrophysiological recordings so far have been made in anesthetized rodents ( e.g. , adrian , 1950 ; macrides and chorover , 1972 ; reviewed in buonviso , 2006 ) , recently data has also been acquired in awake animals .
while initially it was suggested that the increased sniff frequency in the awake preparation might result in reduced sniff coupling , recent experimental data with careful alignment of unit recording data to sniff measurement again indicates that m / tcs can indeed tightly couple to the underlying sniff rhythm ( cury and uchida , 2010 ; carey and wachowiak , 2011 ; shusterman et al . , 2011 )
consistent with the fact that mice can indeed be behaviorally trained to distinguish inputs at different phases of the sniff cycle ( smear et al . , 2011 ) .
while these data indicate that ap discharge is indeed tightly coupled to sniffing in the awake animal as well , it remains to be seen whether mechanistically mitral and tufted cells ( m / tcs ) display similar sniff coupled sub - threshold oscillations in the awake animal that would further strengthen a robust latency encoding of input strength ( hopfield , 1995 ; margrie and schaefer , 2003 ; schaefer and margrie , 2007 ) .
a detailed understanding of the connectivity between ob and piriform cortex on a single - cell level is at present lacking ( miyamichi et al . , 2010 ; ghosh et al . , 2011
generally , tufted cells project to more anterior parts of olfactory cortex including anterior olfactory nucleus and olfactory tubercle , whereas mitral cells additionally innervate the entire piriform cortex including posterior parts as well as olfactory amygdala ( haberly and price , 1977 ; orona et al .
while most studies indiscriminately investigate m / tc coding properties , these heterogeneous projection patterns might find functional correlates in odor encoding as well ( nagayama et al . , 2004 ) .
notably , evidence is mounting for strong direct excitatory drive onto tufted cells , whereas mitral cells seem to be activated either indirectly or with increasing threshold ( gire and schoppa , 2009 ; najac et al . , 2011 ) .
this might suggest that tufted cells are particularly suited to relay a rapid snapshot of the olfactory environment .
however , implementing any realistic readout mechanism based on known anatomical and physiological properties is , at present , difficult .
recent work indicates that projections from the ob to pcx as well as the odor - evoked patterns in the pcx do not show any specific topography ( stettler and axel , 2009 ; choi et al . , 2011 ; sosulski et al . , 2011
minimal stimulation studies ( franks and isaacson , 2006 ) and in vivo recordings ( wilson , 1998 ; poo and isaacson , 2009 ) show that many m / tcs as well as recruitment of recurrent excitation in pcx may be necessary to produce the observsed compound epsps observed in piriform cortex ( franks et al . , 2011 ) .
this , together with electroencephalogram recordings , that suggest a substantial temporal heterogeneity of mono- and di - synaptic delays ( ketchum and haberly , 1993 ) , offers a potential substrate for coincidence - based readout ( hopfield , 1995 ; white et al . , 1998 ; margrie and schaefer , 2003 ) . due to feed - forward inhibitory circuits ,
such detection mechanisms might be further sharpened ( perez - orive et al . , 2002 ; stokes and isaacson , 2010 ; suzuki and bekkers , 2010 ) thereby increasing the sparseness of m / tc readout . thus , although an ap latency based code in m / tcs is sufficient to explain stimulus - dependent discrimination times , concentration invariance , and the olfactory systems robustness against lesioning , the mechanism underlying downstream readout of such activity is yet to be determined .
the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .
the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .
|
electrophysiological and population imaging data in rodents show that olfactory bulb ( ob ) activity is profoundly modulated by the odor sampling process while behavioral experiments indicate that odor discrimination can occur within a single sniff .
this paper addresses the question of whether action potential ( ap ) latencies occurring across the mitral and tufted cell ( m / tc ) population within an individual sampling cycle could account for the psychophysical properties of odor processing . to determine this we created an ob model ( 50,000 m / tcs ) exhibiting hallmarks of published in vivo properties and used a template - matching algorithm to assess stimulus separation .
such an ap latency - based scheme showed high reproducibility and sensitivity such that odor stimuli could be reliably separated independent of concentration .
as in behavioral experiments we found that very dissimilar odors ( a vs. b ) were accurately and rapidly discerned while very similar odors ( binary mixtures , 0.4a/0.6b vs. 0.6a/0.4b ) required up to 90 ms longer . as in lesion studies
we find that ap latency - based representation is rather insensitive to disruption of large regions of the ob .
the ap latency - based scheme described here , therefore , captures both temporal and psychophysical properties of olfactory processing and suggests that the onset patterns of m / tc activity in the ob represent stimulus specific features of olfactory stimuli .
|
insertional mutagenesis approaches by using transposable elements or agrobacterium t - dna , play important roles in plant functional genomics ( 14 ) . the use of t - dna as an insertional mutagen has several advantages ( 3,4 ) .
t - dna integration results in stable mutations in the genome , as opposed to transposons which often excise after integration .
also , the low number of insertions per transformant significantly reduces the additional work required to remove unwanted mutations .
the development of a simple in planta agrobacterium transformation method for arabidopsis thaliana allowed the high - throughput production of t - dna insertion mutants in this model plant ( 5,6 ) .
a number of large t - dna mutagenized a.thaliana populations have been generated that are intensively used for gene function search studies and other reverse genetics experiments ( 711 ) .
initially , these populations were screened for the desired insertion mutants in the gene of interest by pcr .
the pcr was performed with a gene - specific primer and a t - dna - specific primer on dna templates from large pools of mutant plants .
the identification of a specific pcr product indicated the existence of a t - dna insertion in the gene of interest , and the respective mutant was then identified by pool deconvolution . an alternative strategy , which gained popularity in recent years , was to amplify the dna fragments flanking the t - dna insertion sites of individual plants with special pcr - based methods , and to sequence -
when the whole genome sequence of the species is available , the resulting flanking sequence tags ( fsts ) can be mapped to the pseudo - chromosomes and indexed in databases . as a result
, the screening for a mutant insertion allele of a given gene is simplified to a search for the corresponding fst in the database .
obviously , the number of insertion mutants and fsts in the database should be large enough to allow most of the genes being covered ( 3 ) .
the aim of the gabi - kat project was to build a large t - dna mutagenized a.thaliana population with sequence - indexed insertion sites ( 11 ) . in june 2002 , gabi - kat simplesearch ,
the web interface of the database containing data about the gabi - kat population , was opened ( 12 ) . since then
, gabi - kat lines have been ordered by many scientists from all around the world , and thousands of confirmed insertion mutants have been delivered to the scientific community .
this shows that the gabi - kat population became one of the major reverse genetics resources for a.thaliana functional genomics . during the last few years and since we described the basic fst analysis pipeline ( 12 ) , we have constantly improved the database as well as the interface , and incorporated several major updates .
this took place in addition to the regular increase in the amount of fst data held in the database .
here , we summarize and describe the improvements , updates and new features of the simplesearch tool , including the recent addition of detailed information on insertion sites from allele - specific sequence data and genetic segregation data from 3509 ( number as of june 2006 ) lines with confirmed insertions .
the fst production pipeline and the annotation procedure were described in detail elsewhere ( 12,13 ) . in brief , the genome sequences flanking the t - dna insertion site ( fsts ) were obtained by an adaptor - ligation pcr method which was adapted to high - throughput conditions ( 13 ) .
each fst was mapped to the a.thaliana genome by blast ( 14 ) , and annotated with the information of the corresponding bac clone , and with the agi gene code when the insertion qualifies as a gene hit ( 12 ) .
we define gene hit as the insertion site being located between 300 bp upstream of the atg and 300 bp downstream of stop codon of a gene , and
cdsi hit as the insertion site being located between atg and stop codon ( cds plus introns ) .
a.thaliana genome sequence and annotation data from the tigr version 5 dataset were used as the basis for mapping and annotation ( 15 ) .
table 1 gives a summary of the data in the simplesearch database as of the current release ( gk release 21 of june 25 , 2006 ) .
there are > 108 700 fsts , and they were from > 63 800 lines . based on the tigr v5 annotation , > 16 900 genes ( 64% of all annotated a.thaliana protein - coding genes excluding pseudogenes ) were covered by at least one gene hit and > 12 200 genes ( 46% ) were covered by at least one cdsi hit. summary of data in the gabi - kat simplesearch database numbers are of gk release 21 as on 25 june 2006 .
one problem associated with the t - dna mutagenized population is that not all the insertions deduced from fsts that were obtained from t1 plants can be confirmed in the next ( t2 ) generation .
the t1 generation refers to plants that were selected for resistance conferred by the inserted t - dna .
both sail ( syngenta population ) and gabi - kat reported a confirmation rate of 76% ( 9,11 ) . at present , the confirmation rate at gabi - kat is 78% .
this number is derived from 6000 lines for which confirmation was attempted during the process of in - house confirmation to make sure that only confirmed insertion lines were delivered to users .
the confirmation process consists of segregation analysis , genomic dna extraction from t2 plantlets , pcr using a t - dna primer and a gene - specific primer designed to fit the insertion site predicted on the basis of the original fst annotation , and sequencing of this allele - specific pcr product if the pcr was successful ( 11 ) .
for segregation analysis , we record the number of seeds plated , the number of seeds germinated and the number of resistant seedlings .
this information is very useful as it gives an approximate number of t - dna loci of the specified line after statistical evaluation according to mendel 's laws .
in addition , distorted segregation patterns often indicate that the line contains a mutation in a gene important in pollen or female gametophyte development ( 16,17 ) .
we have stored this information for lines for which confirmation has been attempted in the database , and in total there are 6000 lines for which segregation data are available ( table 1 ) .
the database also contains information on 20% failed confirmation attempts ( search for the fst with genbank accession no .
the products resulting from a successful allele - specific pcr were sequenced from both directions , so usually two confirmation sequences were obtained for a confirmed insertion . currently , there are 8840 confirmation sequences in the database , and they were stored together with the primer information so that the allele - specific pcr can be reproduced . since july 2005 , t3 seeds ( seeds produced by t2 plants ) of confirmed gabi - kat lines are transferred to the nottingham arabidopsis stock centre ( nasc ) .
this allows direct user access to potential homozygous mutant materials , and the simplesearch database provides the molecular and genetic background information for these lines .
the fst production pipeline and the annotation procedure were described in detail elsewhere ( 12,13 ) . in brief , the genome sequences flanking the t - dna insertion site ( fsts ) were obtained by an adaptor - ligation pcr method which was adapted to high - throughput conditions ( 13 ) .
each fst was mapped to the a.thaliana genome by blast ( 14 ) , and annotated with the information of the corresponding bac clone , and with the agi gene code when the insertion qualifies as a gene hit ( 12 ) .
we define gene hit as the insertion site being located between 300 bp upstream of the atg and 300 bp downstream of stop codon of a gene , and
cdsi hit as the insertion site being located between atg and stop codon ( cds plus introns ) .
a.thaliana genome sequence and annotation data from the tigr version 5 dataset were used as the basis for mapping and annotation ( 15 ) .
table 1 gives a summary of the data in the simplesearch database as of the current release ( gk release 21 of june 25 , 2006 ) .
there are > 108 700 fsts , and they were from > 63 800 lines . based on the tigr v5 annotation , > 16 900 genes ( 64% of all annotated a.thaliana protein - coding genes excluding pseudogenes ) were covered by at least one gene hit and > 12 200 genes ( 46% ) were covered by at least one cdsi hit. summary of data in the gabi - kat simplesearch database numbers are of gk release 21 as on 25 june 2006 .
one problem associated with the t - dna mutagenized population is that not all the insertions deduced from fsts that were obtained from t1 plants can be confirmed in the next ( t2 ) generation .
the t1 generation refers to plants that were selected for resistance conferred by the inserted t - dna .
both sail ( syngenta population ) and gabi - kat reported a confirmation rate of 76% ( 9,11 ) . at present , the confirmation rate at gabi - kat is 78% .
this number is derived from 6000 lines for which confirmation was attempted during the process of in - house confirmation to make sure that only confirmed insertion lines were delivered to users .
the confirmation process consists of segregation analysis , genomic dna extraction from t2 plantlets , pcr using a t - dna primer and a gene - specific primer designed to fit the insertion site predicted on the basis of the original fst annotation , and sequencing of this allele - specific pcr product if the pcr was successful ( 11 ) . for segregation analysis
, we record the number of seeds plated , the number of seeds germinated and the number of resistant seedlings .
this information is very useful as it gives an approximate number of t - dna loci of the specified line after statistical evaluation according to mendel 's laws .
in addition , distorted segregation patterns often indicate that the line contains a mutation in a gene important in pollen or female gametophyte development ( 16,17 ) .
we have stored this information for lines for which confirmation has been attempted in the database , and in total there are 6000 lines for which segregation data are available ( table 1 ) .
the database also contains information on 20% failed confirmation attempts ( search for the fst with genbank accession no .
the products resulting from a successful allele - specific pcr were sequenced from both directions , so usually two confirmation sequences were obtained for a confirmed insertion . currently , there are 8840 confirmation sequences in the database , and they were stored together with the primer information so that the allele - specific pcr can be reproduced . since july 2005 , t3 seeds ( seeds produced by t2 plants ) of confirmed gabi - kat lines are transferred to the nottingham arabidopsis stock centre ( nasc ) .
this allows direct user access to potential homozygous mutant materials , and the simplesearch database provides the molecular and genetic background information for these lines .
in addition to the search for insertion alleles by the agi gene ( or locus ) code or keyword and the sequence - based search by blast , we recently introduced the feature of searching by line i d or genbank accession number .
searching by line i d or genbank accession number will directly lead to the fst data display page ( figure 1 ) . on top of the fst page
these include the vector used to transform the line , with a link to the genbank entry of the vector at ncbi , information about line availability and when available segregation data .
line availability field tells if a given line is dead ( e.g. because no viable seeds were produced by the t1 plant ) , or if it is available from gabi - kat or nasc . when a line is available from nasc , the nasc code is given and linked to the nasc seeds stock detail page of the line , so that the user can order it easily .
the segregation data are presented as three numbers : total number of seeds evaluated , number of seeds germinated and number of resistant seedlings . since more than one fsts were produced for many t1 plants in the population , the line information page includes data for one or more fst - derived ( predicted ) insertion sites or loci . for each displayed insertion , the fasta format sequence of the original fst , the respective genbank accession number ( which is linked to the genbank entry at ncbi ) , a link to the graphic locus view ( figure 2 ) ,
the information about the location of the t - dna border / plant dna junction if detected , the bac clone code and the confirmation status are shown .
if the insertion site qualifies as a gene hit , links to the respective tigr , tair ( 18 ) , mips matdb ( 19 ) and signal ( 10 ) gene pages are provided . for confirmed lines available in nasc ,
a link is provided to a page showing all the allele - specific confirmation sequences derived from the respective insertion site . unlike the original fst sequences , which are of varied quality , the confirmation sequences are generally of high quality and length .
therefore , the user has access to the exact t - dna border / plant genome junction structures of the insertion sites .
screenshot of the fst page that results from a search for genbank accession number al936383 .
the meaning of the three numbers describing the result of the genetic segregation data is found by following the link on the numbers .
the upper part shows the line - specific information followed by the fst dna sequence data in the lower part of the page . for the chosen line ,
therefore , a link to information about all the insertions from the line is given at the bottom .
all annotated genes and fsts in the genome region centered on the locus at4g23270 are presented in an image map .
mouse - over text on the fsts and the genes tells the line i d and the gene annotation text , respectively .
for all the different kind of searches , results are organized around the fst page . when coming to the fst page from searching genbank accession number or from the blast search result page , only the corresponding fst is displayed . if there are more than one insertion from the same line , a link to showing all the insertions of the line is given . when coming to the fst page from searching line i d , all the insertions of the line are shown and for each insertion the best fst is displayed .
the gabi - kat simplesearch database is freely available at and can be queried through the web interface described above .
the fst data were submitted to embl / genbank / ddbj as genomic survey sequence , and can also be downloaded in a flat file format from our web site . finally , users can find our fst data at external a.thaliana web sites such as mips matdb ( 19 ) , flagdb++(20 ) and signal ( 10 ) .
however , it is worth noting that minor differences do exist in the fst annotation on these sites when compared with simplesearch as they do not necessarily use an identical annotation procedure .
also , the external databases that rely on the fst data in genbank may indicate the existence of an insertion in a given gene , but the respective line is dead which in turn means that the insertion allele described by the fst does not exist any more .
fst - based insertion mutant databases exist for various species for which insertional mutagenesis could be carried out in large scale . for a.thaliana ,
most of the insertion mutant databases were initially developed for holding the data generated in their own projects . while they are quite similar in the fst annotation and query interface , each database has its own unique features .
like gabi - kat simplesearch , flagdb initially was a project database of mapped fsts from the versailles t - dna population ( 8) .
currently , the fst data of flagdb has been integrated into flagdb++ ( ) , a database with java front - end integrating different high - throughput functional genomics data for a.thaliana ( 20 ) .
atidb ( arabidopsis thaliana insertion database ; ) is a federated database for archiving fsts of transposon or t - dna insertions for a.thaliana from different sources including signal , sail , gabi - kat , flagdb and the john innes centre ( 21 ) . besides the various search options ,
the t - dna express at signal ( ) is currently the most comprehensive database of mapped fsts for a.thaliana ( 10 ) .
it integrates not only fsts from sources collected by atidb mentioned above , but also include fst data from the wisconsin t - dna population ( 7 ) and the riken transposon population ( 22 ) .
so far , > 360 000 insertion sites have been stored in t - dna express , and cover 90% of all a.thaliana genes .
the search interface at t - dna express provide different ways to access the insertion data .
isect toolbox. among the many functions this tool offers , a very important one is to design genomic primers to confirm the t - dna insertions .
although the gabi - kat simplesearch database concentrates on data generated from gabi - kat , it allows searches and result presentations comparable to these large and complex databases .
what distinguishes simplesearch from other databases is that it includes detailed information on single gabi - kat lines like segregation data , line availability information , insertion site - specific primers and confirmation sequences for > 3500 confirmed insertion sites .
this detailed information not only helps users to evaluate the usefulness of the mutant lines , but also covers a big part of the molecular characterization of the insertions .
the transfer of confirmed lines to nasc is an ongoing process at gabi - kat .
in addition to confirming lines that are requested by users , we have started to confirm a number of key gabi - kat lines .
these key lines were identified by analysing the results from the signal , sail , wisconsin and gabi - kat fst datasets for unique t - dna insertion sites in the a.thaliana accession columbia at the level of insertion alleles predicted to cause a knock - out of the respective gene .
the seeds of these confirmed lines will also become available from nasc and this will contribute significantly to the goal of finding at least one mutant for every a.thaliana gene .
results from the genetic and molecular insertion confirmation pipeline will constantly be added to simplesearch . a few further developments to further strengthen the simplesearch database were planned for the future .
we are tracking published papers which made use of gabi - kat mutant lines , and these references are currently listed on our web site on a html page . in most of these publications ,
we plan to store the reference to these publications in the database and link them to the respective lines for display on the fst page .
while gabi - kat simplesearch will continue to function as a project database , we are also exploring the possibility for better interoperability with other a.thaliana database by ways such as a biomoby service ( 23 ) .
|
insertional mutagenesis approaches , especially by t - dna , play important roles in gene function studies of the model plant arabidopsis thaliana .
gabi - kat simplesearch ( ) is a flanking sequence tag ( fst)-based database for t - dna insertion mutants generated by the gabi - kat project .
currently , the database contains > 108 000 mapped fsts from 64 000 lines which cover 64% of all annotated a.thaliana protein - coding genes .
the web interface allows searching for relevant insertions by gene code , keyword , line identifier , genbank accession number of the fst , and also by blast . a graphic display of the genome region around the gene or the fst assists users to select insertion lines of their interests .
about 3500 insertions were confirmed in the offspring of the plant from which the original fst was generated , and the seeds of these lines are available from the nottingham arabidopsis stock centre .
the database now also contains additional information such as segregation data , gene - specific primers and confirmation sequences .
this information not only helps users to evaluate the usefulness of the mutant lines , but also covers a big part of the molecular characterization of the insertion alleles .
|
sclerosing encapsulating peritonitis ( sep ) is a rare cause of intestinal obstruction that is characterized by the partial or complete encasement of the small bowel by a thick , white , and fibrous membrane .
sep was first described as " peritonitis chronica fibrosa encapsulate " in 1907.1 sep can be classified as either idiopathic or secondary , though the pathogenesis of both forms is unclear .
idiopathic sep has been described in adolescent girls , leading to hypothesis that retrograde menstruation or retrograde infection through the fallopian tubes may be the underlying mechanism of sep.23 secondary sep occurs most frequently in patients on continuous ambulatory peritoneal dialysis ( capd).45 in addition to capd , chronic inflammatory conditions , orthotopic liver transplantation , and -adrenergic blocker use have been suggested to be predisposing factors for sep.6 here , we describe a patient with liver cirrhosis ( lc ) who developed typical features of sep after the long - term use of propranolol .
a 46-year - old man presented with cramping abdominal pain and borborygmi , which aggravated with food and water intake . over the previous 12 months , he had lost 6 kg of body weight .
the previous two episodes were conservatively managed with levin tube drainage with nil per os , and the symptoms improved thereafter . he was diagnosed with lc associated with chronic hepatitis b 18 years ago . additionally , 15 years ago , he started taking oral propranolol ( 40 mg / day ) for the prophylaxis of gastroesophageal variceal bleeding .
further , 14 months earlier , he was diagnosed with end - stage renal disease due to uncontrolled hypertension and started to undergo hemodialysis .
he had no history of spontaneous bacterial peritonitis ( sbp ) , abdominal surgery , or capd . at the time of presentation , the patient was taking propranolol , nifedipine , valsartan , pantoprazole , oral iron , calcium carbonate , and multivitamins . on physical examination ,
laboratory findings were as follows : white blood cell count , 5,100/mm ; hemoglobin , 9.6 g / dl ; platelet count , 10710/mm ; blood urea nitrogen , 54 mg / dl ; creatinine , 7.9 mg / dl ; albumin , 2.6 g / dl ; aspartate transaminase , 21 iu / l ; alanine transaminase , 10
iu / l ; alkaline phosphatase , 45 iu / l ; crp , 3.67 mg / dl ; and prothrombin time , 64.3% ( 1.27 inr ) .
plain abdominal radiography showed small bowel dilatation with air - fluid levels on the right side of the abdomen ( fig .
abdominal ct showed large amounts of ascites and ileal loops encapsulated by soft tissue with dilatation of the proximal small bowel on the right side of the abdomen ( fig .
barium follow - through showed conglomerated distal ileal loops with a cauliflower - like appearance .
palpation did not separate these conglomerated bowel loops , but allowed passage of contrast medium ( fig .
as his symptoms were recurrent and did not improve with conservative management , exploratory laparotomy was performed , which showed a thick , fibrous , and white capsule encapsulating the ileal loop ( fig .
4a ) . the capsule was dissected and excised , releasing a 1.5-m section of the small bowel ( fig .
histopathological examination of the capsule revealed a dense fibrous wall without epithelial lining ( fig .
the patient has been receiving conservative management for lc and hemodialysis for 58 months after the surgery , without recurrence of bowel obstruction .
sep is a rare clinical entity that can cause acute , subacute , or chronic small intestinal obstruction .
this condition is characterized by a thick , fibrotic , and cocoon - like membrane , which partially or totally encases the small bowel.26 long - term peritoneal stimulation , which can occur with capd , is thought to be a primary cause for secondary sep.45 other reported associations include abdominal tuberculosis,7 long - term use of -adrenergic blockers,68910111213 ventriculoperitoneal or peritoneovenous shunts in patients with lc,14 orthotropic liver transplantation,15 and sarcoidosis.16 the association between sep and the -adrenergic blocker , practolol , was first reported in 1974.8 other -adrenergic blockers associated with sep include timolol,9 metoprolol,12 and atenolol.13 there have been two reports on sep associated with propranolol administered for the treatment of chronic angina pectoris,1011 and one on sep in a patient with lc who was taking a propranolol for over 4 years.6 two mechanisms by which -adrenergic blockers can cause sep have been suggested , including enhanced collagen production , or an allergic reaction to the drug.1117 our patient had been taking propranolol for 15 years and had no history of sbp or capd .
thus , we suspect that propranolol may have played a role in the development of secondary sep in our patient .
preoperative diagnosis of sep is challenging , and a considerable number of patients are diagnosed with sep at laparotomy .
accordingly , clinicians should evaluate the possibility of sep in cases with compatible history and symptoms of this condition to ensure the appropriate management of patients .
radiologically , barium follow - through studies usually show the ileal loops clumped together within a sac having a cauliflower - like appearance.3 abdominal ct can reveal small bowel loops congregated to the center of the abdomen and encased by a soft tissue density mantle , making it look like a cocoon.18 consistent with these observations , typical features of conglomerated and encapsulated bowel loops on both barium study and ct , were seen in the present case .
surgical intervention usually includes the careful and complete removal of the covering membrane and adhesiolysis of the dense interbowel adhesions.6 according to one report , sep can be successfully treated by total enterolysis and the oral administration of prednisolone 5 mg / day.19 others reported a lower mortality rate after treatment with tamoxifen in patients with pd - related sep.20 conservative therapy , including long - term intravenous hyperalimentation and levin tube drainage , may be an alternative to surgery in patients with sub - acute intestinal obstruction.6 our patient was initially managed conservatively , with nil per os and parenteral nutrition , because of the risk associated with surgery related to poor hepatic function .
surgical intervention was later required , however , because his symptoms did not improve with conservative management .
prednisolone was not given to our patient due to a history of chronic hepatitis b. in conclusion , sep is a rare cause of intestinal obstruction with an uncertain pathophysiology .
sep should be considered in the differential diagnosis of patients with small bowel obstruction who receive long - term treatment with -adrenergic blockers .
|
sclerosing encapsulating peritonitis ( sep ) is a rare cause of bowel obstruction that is characterized by the encasement of the small bowel by a thick , whitish , and fibrous membrane .
the pathophysiology of sep is poorly understood and preoperative diagnosis is difficult .
previous reports suggest that sep may be linked to the chronic use of -adrenergic blockers . a 46-year - old man with liver cirrhosis and end - stage renal disease on hemodialysis presented with recurrent abdominal pain and borborygmi .
he had been taking propranolol to prevent bleeding from gastroesophageal varices for the past 15 years .
abdominal computed tomography showed ileal loops encapsulated by soft tissue with dilatation of the proximal small bowel on the right side of the abdomen .
barium follow - through showed conglomerated distal ileal loops with a cauliflower - like appearance .
explorative laparotomy revealed a thick , fibrous , whitish capsule encapsulating the ileal loops .
the covering membrane was dissected and excised , resulting in an improvement in symptoms after surgery .
accordingly , a final diagnosis of sep was made .
due to the lack of other apparent causes for sep , we conclude that in this case , the long - term use of propranolol may be associated with the development of sep .
|
the factitious disorders , more commonly known in daily practice as pathomimia , are expressed in dermatology units by skin lesions induced voluntarily by the patient , in order to draw attention of the medical staff and/or the family members .
the disorder is often challenging to diagnose and even more difficult to document in front of the patient or relatives .
it represents a challenge for the physician , and any attempt at treatment may be followed by recurrence of the self - mutilation .
this paper describes two cases of pathomimia diagnosed by dermatologists and treated in a psychiatry unit , highlighting the importance of collaboration in these situations .
two case reports , describing old female patients with pathomimia , hospitalized in a department of dermatology for bizarre skin lesions .
the first case was a 77-year - old female with unknown psychiatric problems and atrophic skin lesions on the face , self - induced for many months , with multiple hospitalizations in dermatology units , with no response to different therapeutic patterns , and full recovery after psychiatric treatment for a major depressive syndrome .
the second case was a 61-year - old female patient with disseminated atrophic scars on the face , trunk , and limbs .
she raised our interest because of possible psychiatric issues , as she had attempted to commit suicide .
these cases indicate that a real psychiatric disease may be recorded in patients suffering from pathomimia .
therefore , complete psychiatric evaluation in order to choose the proper therapy is mandatory for all these cases .
dermatologists and all physicians who take care of old patients must recognize the disorder in order to provide optimum care for this chronic condition .
we emphasize therefore the importance of psychiatric evaluation and treatment to avoid the major risk of suicide .
skin lesions must be regarded as an alarm signal in critical cases , especially in senior people .
a 77-year - old woman was hospitalized in a dermatology department for atrophic skin lesions , with discrete erythema at the edges on the preauricular area and hyperpigmented macules on the frontal and malar area ( figure 1 ) .
she described the lesions as being present for several months , accompanied by slight pruritus on the face and scalp .
the patient was diagnosed 10 years before with arterial hypertension well controlled by indapamide ; a cardiological examination revealed no anomaly or no neurological symptoms .
dermatological examination failed to unfold other skin lesions , except the one on the face strictly related to the patient s age .
she was referred to the hospital under suspicion of discoid lupus ; a punch biopsy was taken from the preauricular area .
the histopathological report excluded lupus and concluded orthokeratosis , spongiosis , and sparse lymphocytic perivascular infiltrate in the dermis ( figure 2 ) .
based on clinical grounds , histological report , and lab investigations , the suspicion of discoid lupus was excluded .
a psychiatric consult was demanded , and a transfer to the psychiatric department was accepted .
new dermatological advice was asked for 1 month later , the patient being in very good condition , with no new lesions and minor hyperpigmentation on the face .
the patient admitted the self - mutilation by causing the skin lesions herself , but without being able to explain the automutilation , most of the time being unaware of doing it ; furthermore , she did not claim any delusions of parasitosis .
she was transferred to the psychiatric unit and not followed up in the dermatology unit .
a 61-year - old woman was hospitalized in a dermatology department for evaluation of atrophic scars disseminated on the face , trunk , and upper limbs ( figure 3 ) .
she could not recall when she had first noticed the lesions , but her medical documents were filled with hospitalizations , investigations , and therapies for the last 2 years , varying from chronic eczema , anetoderma , morphea , prurigo , discoid lupus erythematosus , mycosis fungoides , and others not remembered by the patient .
the patient was in good medical condition , with no comorbidities , treatments , or complaints .
a complete battery of blood tests was performed , but did not reveal the cause of the disorder . on the fifth day of hospitalization , during the night , she attempted suicide by taking an aspirin overdose .
she was transferred to a psychiatric hospital , where she was diagnosed with severe depressive syndrome .
thereafter , she underwent stabilization and treatment , with no information on the therapeutic plan being available .
the patient finally admitted the self - mutilation that had been going on for years .
based on the elusive history of the lesions , chronic evolution , and weird cutaneous impairments displayed upon attainable areas of the body , which did not mirror any of the known dermatoses , and associated to inconclusive biopsy ( figure 4 ) , with remission after specific psychiatric therapy , we finally reached a diagnosis of factitial dermatitis .
a 77-year - old woman was hospitalized in a dermatology department for atrophic skin lesions , with discrete erythema at the edges on the preauricular area and hyperpigmented macules on the frontal and malar area ( figure 1 ) .
she described the lesions as being present for several months , accompanied by slight pruritus on the face and scalp .
the patient was diagnosed 10 years before with arterial hypertension well controlled by indapamide ; a cardiological examination revealed no anomaly or no neurological symptoms .
dermatological examination failed to unfold other skin lesions , except the one on the face strictly related to the patient s age .
she was referred to the hospital under suspicion of discoid lupus ; a punch biopsy was taken from the preauricular area .
the histopathological report excluded lupus and concluded orthokeratosis , spongiosis , and sparse lymphocytic perivascular infiltrate in the dermis ( figure 2 ) .
based on clinical grounds , histological report , and lab investigations , the suspicion of discoid lupus was excluded .
a psychiatric consult was demanded , and a transfer to the psychiatric department was accepted .
new dermatological advice was asked for 1 month later , the patient being in very good condition , with no new lesions and minor hyperpigmentation on the face .
the patient admitted the self - mutilation by causing the skin lesions herself , but without being able to explain the automutilation , most of the time being unaware of doing it ; furthermore , she did not claim any delusions of parasitosis .
she was transferred to the psychiatric unit and not followed up in the dermatology unit .
a 61-year - old woman was hospitalized in a dermatology department for evaluation of atrophic scars disseminated on the face , trunk , and upper limbs ( figure 3 ) .
she could not recall when she had first noticed the lesions , but her medical documents were filled with hospitalizations , investigations , and therapies for the last 2 years , varying from chronic eczema , anetoderma , morphea , prurigo , discoid lupus erythematosus , mycosis fungoides , and others not remembered by the patient .
the patient was in good medical condition , with no comorbidities , treatments , or complaints .
a complete battery of blood tests was performed , but did not reveal the cause of the disorder . on the fifth day of hospitalization , during the night , she attempted suicide by taking an aspirin overdose .
she was transferred to a psychiatric hospital , where she was diagnosed with severe depressive syndrome .
thereafter , she underwent stabilization and treatment , with no information on the therapeutic plan being available .
the patient finally admitted the self - mutilation that had been going on for years .
based on the elusive history of the lesions , chronic evolution , and weird cutaneous impairments displayed upon attainable areas of the body , which did not mirror any of the known dermatoses , and associated to inconclusive biopsy ( figure 4 ) , with remission after specific psychiatric therapy , we finally reached a diagnosis of factitial dermatitis .
psychocutaneous disorders are conditions that are characterized by psychiatric and skin manifestations , and are classified into primary dermatologic disorders with psychiatric comorbidity ( atopic dermatitis , psoriasis , vitiligo , alopecia areata ) and psychiatric disorders with dermatologic manifestations ( obsessive compulsive disorders , factitious disorder by self - mutilation , delusions of parasitosis , psychogenic purpura , cutaneous sensory disorders , and others).1 factitious disorder is a mental disease , and the number of patients requiring medical care for it is probably quite consistent but however is rather unknown , partly caused by misrecognition of the clinical and psychopathological features.2,3 cutaneous factitia is not very well known , can mimic many skin lesions , and may lead to unnecessary investigations and treatments , therefore delaying the diagnosis and correct therapeutic measures in psychiatric hospitals .
other related terms mostly used in dermatology and reflecting the skin condition in these pathological cases are : dermatitis artefacta syndrome , characterized by unconscious self - injury of normal skin , while dermatitis para - artefacta is the result of autoaggravating a preexisting dermatosis.4 it is more often described in women ; the ratio varies from 4:1 to 8:1 , with age of onset ranging from 9 to 73 years.5 the patient in general does not accept the idea of having a psychiatric disorder , and it is sometimes quite difficult to convince the family as well .
skin lesions are produced in different ways , depending on the education and imaginative levels of each person scarifications , cuts , burns and are usually not admitted to by the patient .
factitious disorders must be differentiated from malingering ; an important clue for this is that malingering is based on a real individual motivation ( avoiding work , military or social duty , prison ; obtaining material recompense , cost reparation , drugs ) , while patients suffering from factitia need medical care and support , claiming attention from medical staff and members of their own families.6 morgellons disease is a controversial condition in which patients complain of stinging , burning , and biting sensations under the skin and presence of subcutaneous dermal fibers.7 it has been associated with positive serology to borrelia burgdorferi , and recently these filaments proved to be composed of keratin and products of keratinocytes.8 lichen simplex chronicus is characterized by lichenified plaque due to prolonged scratching , on the neck ( cervical and occipital area ) , elbow , ankles , and vulva , in patients with psychological disorders.9,10 prurigo nodularis is characterized clinically by chronic , intensely pruritic nodules , with hyperpigmentation , with unknown etiology , most commonly seen between the ages of 20 and 60 years , with equal distribution between the sexes , associated with emotional stress , anemia , hepatic dysfunction , uremia , myxedema , venous stasis , folliculitis , nummular eczema , lymphoma , human immunodeficiency virus infection , perforating collagenosis , gluten - sensitive enteropathy , contact dermatitis , and atopic eczema.11 differential diagnosis also included the delusion of parasitosis , a quite frequent clinical entity , but where patients have the fixed , false belief that they are infested with parasites or have foreign objects walking through their skin , despite the almost normal aspect of the skin ( sometimes scratch marks and slight erythema ) .
the history of the disorder is often quite ambiguous and misleading , but despite the fact that our knowledge of this peculiar pathology is limited , the mainstay of the diagnosis must always be kept in mind .
moreover , based on our knowledge and clinical experience , patients with cutaneous factitia are in general , individuals with a high level of education , and are seeking attention .
treatment is challenging , due to a characteristic lack of response to even prolonged therapy ; the curative goal and success depends mostly upon psychiatric evaluation and treatment , which are rather difficult to achieve , and frustrating to both physicians and patients .
clinical suspicion of factitia is based on the following clues : ambiguous history of the lesions , chronic evolution , bizarre forms of skin lesions that are found on accessible parts of the body and that do not resemble any of the known dermatoses , the continuous denial of the self - induced injury , healing of the skin under occlusive dressing , and finally the psychiatric evaluation .
skin lesions must be considered an alarm signal in critical cases with emotional and behavior modifications , and particular attention should be paid especially in aged patients , while dermatologist
|
backgroundthe factitious disorders , more commonly known in daily practice as pathomimia , are expressed in dermatology units by skin lesions induced voluntarily by the patient , in order to draw attention of the medical staff and/or the family members .
the disorder is often challenging to diagnose and even more difficult to document in front of the patient or relatives .
it represents a challenge for the physician , and any attempt at treatment may be followed by recurrence of the self - mutilation .
this paper describes two cases of pathomimia diagnosed by dermatologists and treated in a psychiatry unit , highlighting the importance of collaboration in these situations.patients and methodstwo case reports , describing old female patients with pathomimia , hospitalized in a department of dermatology for bizarre skin lesions.resultsthe first case was a 77-year - old female with unknown psychiatric problems and atrophic skin lesions on the face , self - induced for many months , with multiple hospitalizations in dermatology units , with no response to different therapeutic patterns , and full recovery after psychiatric treatment for a major depressive syndrome .
the second case was a 61-year - old female patient with disseminated atrophic scars on the face , trunk , and limbs .
she raised our interest because of possible psychiatric issues , as she had attempted to commit suicide .
the prescription of antidepressants led to a significant clinical improvement.conclusionthese cases indicate that a real psychiatric disease may be recorded in patients suffering from pathomimia .
therefore , complete psychiatric evaluation in order to choose the proper therapy is mandatory for all these cases .
dermatologists and all physicians who take care of old patients must recognize the disorder in order to provide optimum care for this chronic condition .
we emphasize therefore the importance of psychiatric evaluation and treatment to avoid the major risk of suicide .
skin lesions must be regarded as an alarm signal in critical cases , especially in senior people .
|
less than a decade ago , the introduction of video technology and endoscopic staplers revolutionized thoracoscopy , which was initially introduced as a diagnostic tool early in the century .
the less invasive nature of thoracoscopy and associated video - assisted thoracic surgery ( vats ) has resulted in an altered practice pattern among referring physicians .
patients who would previously have been observed with serial radiographs or subjected to fine needle biopsy are now referred for vats .
the rapid acceptance of vats by the surgical community was both due to the compelling advantages of the new technology , and the pressure imposed on surgeons by equipment manufacturers and patients alike .
indications for vats were shortness of breath ( 45% ) ; pulmonary nodules ( 25% ) ; pleural effusion ( 21% ) ; spontaneous pneumothorax ( 14% ) ; and hemoptysis , chronic cough , and consolidation , collectively ( 5% ) .
vats was used for inspection , lysis of adhesions , biopsy , stapling of blebs , wedge resection , segmental resection , decortication , drainage of empyema , and chemical and mechanical pleurodesis .
the patient is placed in a posterolateral thoracotomy position with the side to be explored positioned up . the first port is placed in the mid - axillary line at the 5th-6th intercostal space followed by a second port in the mid - axillary line at the 2nd-3rd intercostal space .
two more ports are occasionally placed in line with the lower port in the anterior and posterior axillary line .
co2 insufflation is used if the lung can not be collapsed in a timely manner .
sixty - six operations ( 83% ) were completed thoracoscopically , eight patients ( 10% ) required a utility incision ( vats ) to expedite the procedure and six patients ( 7% ) were converted to formal thoracotomy .
thirty - three patients had wedge resection with or without lysis of adhesions , drainage of pleural effusion , pleural biopsy , and pleurodesis .
thirty - eight patients underwent pulmonary , pleural , or mediastinal biopsies with or without lysis of adhesions , drainage of pleural fluid and pleurodesis .
ten patients had lysis of adhesions with or without drainage of pleural effusion and pleurodesis .
thoracoscopic lobectomy was completed in one patient for bronchiectasis , converted in one patient with cancer and in another patient with gunshot wound due to equipment failure .
median operative time was 60 minutes with a range of 15 - 240 minutes , compared to 145 minutes and a range of 50 - 205 minutes for those converted to formal thoracotomy .
median blood loss was 25 cc . with a range of 25 - 500 cc .
compared to 300 cc . and a range of 25 - 500 cc . for the conversions .
median postoperative stay was three days with a range of 1 - 28 days compared to 4.5 days and a range of ( 1 - 22 ) days for the conversions .
one patient died secondary to pneumocystis carnii pneumonia , two patients died of respiratory failure secondary to interstitial pneumonia , and advanced bullous disease .
biopsies obtained through vats showed nonspecific inflammatory changes . in retrospect , these patients had congestive heart failure that responded to medical therapy .
two patients had pulmonary nodules and one patient had a pleural nodule that were wedged out .
pathologic diagnoses included : interstitial pneumonitis ( 22% ) , cancer ( 19% ) , bullous disease ( 15% ) , cocci nodules ( 9% ) and pneumonia , empyema , carcinoid tumor , mesothelioma , obliterative bronchiolitis , asbestosis and thymoma , collectively ( 18% ) .
within a relatively short period of time , vats has become widely used in the diagnosis and treatment of many thoracic conditions .
although diagnosis was achieved in only 83% of our cases , the ability to exercise therapeutic measures raised the number of patients who benefited from the procedure to 95% .
in large series , vats has a mortality of 0.07- 0.5% , a non - fatal complication rate of 4.2 - 10.9% , and a conversion rate of 12.4% .
our complication rate ( 29% ) is clearly higher , probably secondary to our early work at the beginning of our learning curve .
shortness of breath with nonspecific x - ray changes was the main indication for vats followed by solitary pulmonary nodules and pleural effusion , respectively .
the superiority of vats stems from the fact that it offers a magnified panoramic view of the hemithorax and provides the opportunity to lyse adhesions , drain fluid , take adequate biopsies , and to address concomitant pulmonary , pericardial , and mediastinal diseases .
some specific thoracic surgical problems for which vats is , or promises to become , the surgical approach of choice include : pleurodesis , decortication of early empyema , excision of peripheral solitary pulmonary nodules , management of recurrent primary or secondary spontaneous pneumothorax , and stapling of bullae .
other less common indications for vats include : access to anterior thoracic spine , diagnosis of diaphragmatic injuries , treatment of mediastinal lesions , congenital cardiac lesions in pediatric population , and sympathectomy . for open lung biopsy ,
twenty percent of patients with pleural effusion remain without specific diagnosis after thoracentesis and closed pleural biopsy . in malignant effusions ,
vats allows adequate mobilization of the lung with effective pleurodesis using either chemical , mechanical with or without limited pleurectomy , or using only parietal pleurectomy .
the pleural space can be debrided under direct vision , the lung evaluated for re - expansion , associated pathology evaluated , and decortication performed .
nevertheless , vats can still be attempted in these cases as it can direct the proper site for open thoracotomy , should it fail .
although vats has been successful in excising central pulmonary nodules , it has become the diagnostic procedure of choice for peripheral nodules ( nodules with close attachment to segmental and subsegmental bronchopulmonary units and/or with distance to visceral pleura less than 10 mm ) .
staining with methylene blue has been found to be safe , effective and obviates wire - related complications . however
a major concern is that both above - mentioned methods are associated with 33% pneumothorax , and 20% lung hemorrhage .
it can sense the presence of a nodule within 15 mm of the lesion by a sudden upward jump in the resonance frequency curve .
the application of vats for excision of solitary nodules is justified by the fact that many nodules are benign . of interest
is the fact that 9% of the solitary pulmonary nodules in our series were caused by pulmonary coccidiomycosis .
should the nodule be malignant , visualizing the presence of extensive disease may obviate unnecessary thoracotomy .
vats is superior to open thoracotomy in managing recurrent spontaneous pneumothorax or persistent air leak ( more than 5 days ) .
it is more so in primary spontaneous pneumothorax where the subpleural bullae can be adequately excised , and pleurodesis performed .
an important benefit is the reduction in postoperative respiratory dysfunction . in secondary spontaneous pneumothorax ,
vats is less effective due to the patchy pleural adhesions , and multiple bullae , some of which may be missed leading to persistent air leak .
vats is not superior to transaxillary mini - thoracotomy for apical bullae , but it has the advantage of providing an access to other lobes that may not be accessible with open procedure . an important area of debate is the application of vats for anatomical lung resection . it is associated with a potentially fatal complication of bleeding . anatomical lung excision may require the development of a fissure , and in the case of cancer surgery , lymph node dissection may be tedious and time - consuming .
tumor recurrence in the pleural cavity and at port sites is a known complication after vats in spite of the use of sealed bags to remove the specimen .
nevertheless , vats can still be used in anatomical lung resection for non - malignant conditions , such as bronchiectasis .
unilateral lung reduction surgery by vats has shown comparable , and in some cases lower , morbidity and mortality with similar improvement in pulmonary function , except for patients with combination of hypercapnia and reduced single breath diffusing capacity for carbon monoxide , who constitute a considerable perioperative morbidity . in conclusion
, the advantage of reduced chest wall and muscle trauma utilizing vats as opposed to traditional thoracotomy translates to less patient discomfort .
the excellent magnified visualization afforded by vats offers the opportunity to successfully conduct diagnostic and therapeutic interventions in the chest with equal or better visibility compared to open thoracotomy .
our findings suggest that the applicability and success of vats is expanding and its complication rate is less or , at least , comparable to traditional thoracotomy .
|
thoracoscopy has been revived and expanded by recent improvements in endoscopic technology .
the enhanced application and outcome of vats ( video assisted thoracic surgery ) was retrospectively studied . between 1992 and 1995 , 82 patients underwent diagnostic thoracoscopy or interventional vats .
indications included : shortness of breath with nonspecific x - ray abnormality ( 45% ) , pulmonary nodule ( 25% ) , pleural effusion / empyema ( 21% ) , pneumothorax ( 14% ) , and hemoptysis , chronic cough or lung consolidation ( 5% ) .
sixty - six ( 83% ) of the procedures were completed thoracoscopically .
eight procedures ( 10% ) required addition of a utility mini - thoracotomy and 6 procedures ( 7% ) were converted to formal thoracotomy .
specific diagnostic and/or therapeutic applications of vats included : inspection ; lysis of adhesions ; stapling of blebs ; biopsy of lung , pleura , or mediastinal structures ; drainage and decortication of empyema ; mechanical and chemical pleurodesis ; wedge resection ; and segmental resection.diagnosis was established and/or treatment completed in 95% of cases .
pathologic diagnoses included : interstitial pneumonitis ( 22% ) , cancer ( 19% ) , bullous disease ( 15% ) , cocci nodule ( 9% ) , and other ( 18% ) .
there were twentytwo complications ( 28.9% ) and four deaths ( 4.8% ) .
all four deaths were from causes unrelated to the surgery .
the most common complications were : residual pneumothorax or hydrothorax ( 7 ) , failed pleurodesis ( 3 ) , and prolonged incisional pain ( 2).the advantage of reduced chest wall and muscle trauma utilizing vats as opposed to traditional thoracotomy translates to less patient discomfort .
the excellent magnified visualization afforded by vats offers the opportunity to successfully conduct diagnostic and therapeutic interventions in the chest with equal or better visibility .
our findings suggest that the applicability and success of vats is greatly expanding and its complication rate is less or , at worst , comparable to traditional thoracotomy .
|
menssana in corporesanois , a famous latin quotation means a sound mind in a sound body .
studies have reported an increased susceptibility to systemic diseases and delayed wound healing in both animals and human beings who are subjected to prolonged stress , physical or emotional .
one of the major health concerns is the higher prevalence of gingival diseases in young and adults .
also , destructive periodontal diseases should not be perceived as a usual consequence of gingivitis which eventually leads to tooth loss .
the manifestations and progression of periodontitis is also predisposed by a wide variety of determinants and factors .
recently , more emphasis has been directed toward the combined influence of lifestyle , education , psychosocial factors , and socioeconomic factors instead of regular risk factors in dealing with chronic illnesses .
age , gender , smoking habits , anxiety , stress , depression in everyday life , self - liking , self - competence , body image , care and protection were positively related with oral health behaviors .
prevention of dental diseases has always been a long - standing interest of the dental profession .
the maintenance of good oral hygiene is considered a salient issue in dental health promotion .
also , reductions in plaque and gingival bleeding were achieved in the short term in the majority of studies reviewed .
personality is the combination of characteristics or qualities that form an individual 's distinctive character .
also , people with particular personality behavior demonstrate their oral health state differently from others .
a variety of psychological tests have been designed to examine patients in terms of their personality attributes .
this has led to the increase of classifications based on people 's personality types and traits .
the individual differences in emotional and behavioral style can be examined through a personality instrument .
brief cognitive interventions can alter the attitudes and values tapped into by personality tests , which might be useful in preventive dentistry .
there is evidence that psychological approaches to behavior management such as the use of reinforcement , goal setting , and the provision of feedback can improve oral hygiene and oral hygiene - related behaviors .
there has been meager research on the impact of overall personality of an individual on his / her oral hygiene condition .
hence , the aim of this study was to examine the influence of personality characteristics using questionnaire on oral hygiene performance and gingival health .
a total of 155 outpatients attending the department of periodontics , yenepoya dental college , mangalore , india , were selected for the present study .
the inclusion criteria were ( 1 ) minimum age of 18 years of both gender , ( 2 ) minimum of 20 permanent teeth ( with at least index teeth for all the indices which are used ) , ( 3 ) patients who are not under professionally monitored plaque control program .
the exclusion criteria were ( 1 ) patient having any systemic illness , ( 2 ) patient under medication , ( 3 ) pregnancy , and ( 4 ) use of antibiotics during the previous four weeks .
informed consent for the participation from all the subjects was obtained prior to the commencement of the study .
ethical clearance was obtained from the institutional ethical committee of yenepoya university prior to the commencement of the study .
all subjects were examined by a single clinical examiner . for each subject , the following data were collected : name , age , sex , a detailed medical and dental history , personal habits , and oral hygiene practice .
the personality characters were assessed using the eysenck personality questionnaire . the eysenck personality questionnaire ( epq )
is designed to give ready measure of three important personality dimensions : psychoticism ( p ) , extroversion ( e ) , and neuroticism ( n ) .
psychoticism describes the personality as solitary , troublesome , cruel , lacking in feeling and empathy , hostile to others , sensations lacking , and liking odd and unusual things .
neuroticism refers to the general emotional liability of the person , his emotional over - responsiveness , and his liability to neurotic breakdown under stress .
extroversion as opposed to introversion refers to the outgoing , uninhibited , social proclivities of a person .
p and n were scored using 24 questions each and e was scored using 21 questions . a fourth factor , i.e.
, the lie score is used to identify the subject 's truthful compliance to questions , and is derived from a total of 21 questions . if the score of lie scale exceeded 8 for females and 7 for males , they were excluded from the study .
as an individual can have more than one personality trait , based on the norms , the subjects who scored above average expressed greater strength of that particular factor and were divided into three groups : p , e , and n , respectively .
subjects who scored below average in all three personality traits were considered as control group . clinical examinations included assessment of the oral hygiene performance ( by assessing the plaque levels ) and assessment of gingival status .
plaque was recorded using an index developed by podshadley and haley 1968 called the patient hygiene performance index ( phpi ) .
the full mouth gingival index ( gi ) of loe and silness 1963 was used to record gingival inflammation around the entire dentition ( excluding 3 molars ) .
statistics : data were entered onto microsoft excel and statistically analyzed using chi - square test ( spss vers .
of the 155 subjects initially selected for the study , 13 were excluded because of high lie responses , as measured by the epq .
as one can have more than one personality trait , a total of 203 personality traits were assessed .
relation between 203 personality traits , oral hygiene performance , and the gingival status was statistically analyzed .
based on the personality questionnaire , 96 subjects were in p group , 34 subjects in e group , and 49 subjects in n group .
the total mean age was 28.11 years and 70 of them were male while 72 were female ( n=142 ) .
p group consisted of 44 males and 52 females ( n=96 ) and the mean age was 27.53 years .
n group consisted of 25 males and 24 females ( n=49 ) and the mean age was 29.18 years .
e group consisted of 15 males and 19 females ( n=34 ) and the mean age was 29.26 years [ table 1 ] .
the mean age and gender in all groups table 2 demonstrates the relation between the various scores of php index and different personality traits ( p , e , n ) .
majority of the subjects in all the three groups ( p : 57.3% , e : 64.7% , n : 57.1% ) showed poor oral hygiene .
table 3 demonstrates the relation between the various scores of gi and different personality traits ( p , n , e ) .
majority of the subjects in p , n groups ( p : 53.1% , n : 53.1% ) showed moderate gingival inflammation , whereas majority of subjects in e group ( 50.0% ) exhibited severe gingival inflammation .
table 4 shows the relation between the gi scores and phpi scores within each group .
very high statistical significant relation was observed in group p and n , whereas high statistical significant relation was seen in group e. table 5 demonstrates the relation of different personality traits with toothbrushing frequency , past dental visits , and use of tobacco .
no statistically significant relation was seen ( p=0.972 , p=0.728 , p=0.909 , respectively ) .
it was also observed that group p , e subjects had lower brushing frequency . when comparing the number of dental visits among the different groups , majority of the subjects in all three groups
the subjects in the control group had no history of use of tobacco . comparatively , group e subjects had higher tendency of using tobacco .
relation between personality traits and php scores relation between personality traits and gi scores relation between phpi scores and gi scores relation of personality traits with toothbrushing frequency , past dental visits , and use of tobacco
gingivitis is a nondestructive form of periodontal disease which is primarily caused by accumulation of plaque .
all preventive measures are undertaken to minimize the level of plaque and thus improve the oral health .
evaluation of the oral hygiene measures employed by the patient is usually done by assessing the plaque levels and gingival status .
high correlation is found between increased levels of plaque and poor gingival health . in this study ,
oral hygiene performance index and gi were employed to assess the influence of personality traits on gingival health .
also , these clinical parameters will be of greater benefit to both patient and clinician for further follow - up phases if required .
a personality trait is a characteristic way in which an individual perceives , feels , believes , or acts .
studies have shown the effect of personality traits on oral health and health - related behaviors .
example : habit of bruxism ( which may in turn lead to temporomandibular joint dysfunction ) among individuals who score more highly on the trait of aggressiveness .
second , certain personality traits are associated with health - damaging behaviors which may affect the oral health .
example : individuals who are low on constraint are more likely to smoke which also affects the periodontium leading to periodontitis .
third , personality characteristics may alter the way in which individuals respond to ( interpret ) symptoms and thus construct their illness state .
example : individuals who score high on the trait of stress interpret oral symptoms as being more catastrophic than would their low - scoring counterparts . since there are no previous studies in india on the relationship between personality traits and oral health , we found it relevant to focus on the association between overall personality ( on the basis of questionnaire ) , oral hygiene performance , and gingival status .
the study was designed in such a manner that with a sample size of 155 subjects , 95% confidence level and 90% power with the reference value r=0.48 could be observed .
based on the epq , the personalities of the individuals were grouped into three , psychoticism , neuroticism , and extroversion .
no statistically significant correlation was found between p , e , n and plaque and gingival status as measured by the phpi and gi .
a statistical significant relation was observed between the phpi values and gi values in all the groups .
as phpi measures the presence of plaque in an individual , statistical significant correlation between the two indices would ascertain that high levels of plaque relates to gingival inflammation .
also , the presence of plaque gives an outline of one 's oral hygiene practice .
hence , all the subjects demonstrating gingival inflammation were associated with presence of plaque due to poor oral hygiene performance .
therefore , the authors conclude that the personality traits might not have a direct relation with poor gingival health . a trend was observed to exist , i.e. , group p , e , n subjects clinically correlated with poor oral hygiene status and subjects in group p and n clinically correlated with moderate gingivitis , while group e subjects clinically correlated with severe gingivitis .
this can be attributed to the presence of various confounding factors that have been shown in the past to have an influence on the oral health such as the difference in the level of education and socioeconomic status within the groups which was not assessed in the present study .
stress associated with financial strain and distress usually manifested as depression was also identified as a significant risk indicator for more severe periodontal disease in adults .
it was found that the intensity of cynical hostility related positively to the level of oral hygiene when all confounding factors were adjusted and cynical hostility to be a risk marker for poor oral health .
it should be noted that stress and depression and cynical hostility are some of the characters that define the high scores of neuroticism and psychoticism , respectively , among individuals .
however , some investigators did not find any difference in neurosis or introversion levels between periodontal patients in their offices and norms acquired from large population studies . also , when assessing the gingival status and hygiene of the subjects in control group , majority ( 58.3% ) exhibited moderate gingivitis and ( 58.3% ) fair oral hygiene .
when assessing the data on personal habits that were recorded prior to the commencement of the study , it was observed that there was preponderance of using tobacco either smoking or smokeless form among group p , e , n subjects . and , it was found that group e subjects ( 14.6% ) have a greater tendency for the same , whereas subjects in the control group did not report any such habit .
further studies can be carried out with different objectives to assess this association as it will aid during habit counseling and patient education .
various personality characteristics have shown in the earlier studies to affect the toothbrushing frequency and quality of brushing .
it can also be suggested that people who brush poorly or less frequently may have a strong motivation and eagerness to improve but lack confidence in their success .
however , majority of the subjects enrolled for the study had visited the dentist before many of them demonstrated a poor gingival health .
this further supports the fact that in addition to oral hygiene instructions , psychological intervention and motivation might play an important role as well in maintaining the gingival health .
a considerable clinical correlation was observed between the different personality traits and gingival health status of the subjects which was not statistically significant . also , a trend of using tobacco and decreased brushing frequency was observed among subjects with certain personality traits .
this study shows that the personality traits might not have a direct relation with poor gingival health .
further longitudinal studies need to be carried out to identify whether overall personality has a direct association with gingival health by controlling the various confounding factors that have an influence on oral hygiene and gingival health .
|
background : the maintenance of good oral hygiene is considered a salient issue in dental health promotion .
personality is the combination of characteristics or qualities that form an individual 's distinctive character .
various personality traits have been proposed to influence the oral health .
the purpose of the present study was to assess the influence of personality characteristics using questionnaire on oral hygiene performance and gingival health.materials and methods : in total , 155 patients were subjected to personality questionnaire using eysenck personality questionnaire .
clinical parameters such as patient oral hygiene performance index and gingival index were recorded . based on eysenck personality questionnaire ,
the subjects were divided into three groups : psychoticism , extroversion , and neuroticism.results:data analysis showed that subjects in psychoticism and neuroticism groups displayed moderate gingivitis , whereas subjects in extroversion group had severe gingivitis .
subjects in all the three groups demonstrated poor oral hygiene status .
no statistically significant relation was found.conclusions:a considerable clinical correlation was observed between the different personality traits and gingival health status of the subjects .
it was not statistically significant .
further trials need to be conducted so as to ascertain this association so that psychological interventions may be undertaken to improve the oral hygiene condition of the population .
|
a 62-year - old woman with dyspnea , and recent aggravation of the condition 10 days prior , was referred to our institution for further evaluation of the tracheal mass .
the woman had no outstanding medical history ; however , upon a physical examination , a stridor and wheezing sound was examined by auscultation .
a digital chest radiograph showed a well demarcated mass with round opacity located in the mid level of the trachea ( fig .
a non - contrast enhanced chest ct scan was performed at a local clinic and revealed a well defined , intraluminal mass with homogeneous soft tissue attenuation in the trachea ( fig .
next , a contrast - enhanced chest ct ( somatom sensation 64 , siemens medical solutions , erlangen , germany ) scan revealed a heterogeneous enhancement pattern representing a strong nodular enhancement in the peripheral portion of the mass , accompanied with a central area of low attenuation on the axial images ( fig .
further , a photomicrograph helped determine that the round submucosal mass was primarily composed of hypercellular areas with some collagen - rich areas .
in addition , various sized blood vessels were noted along the periphery of the mass , along with dilated and branched vessels in the central portion of the mass ( fig .
the oblique sagittal reconstruction images clearly demonstrated the orientation of the mass and length of the tumor ( fig .
the volume - rendered and virtual bronchoscopic images clearly depict a round intraluminal mass arising from the anterior tracheal wall ( figs .
furthermore , a conventional bronchoscopy revealed the round mass with prominent of small blood vessels on its smooth surface .
although the bronchial mucosa was intact , a bronchoscopic biopsy was not performed with the possibility of massive bleeding .
consequently , the surgical excision of the mass was performed via a segmental resection of the trachea and an end - to - end anastomosis . a histological examination ( hematoxylin & eosin staining ) revealed a benign sft with a haphazard growth pattern of short spindle cells with scant cytoplasm and strands of rope - like collagen ( fig .
an immunohistochemical study revealed a positive response for cd34 and negativity for smooth muscle actin , desmin and s100 protein .
benign tracheal tumors are quite rare , consisting about only 1.9% of all lung tumors . more common benign tumors of the tracheobronchial tree include papillomas , hamartomas , hemagiomas and neurogenic tumors . on the other hand , chondromas , leiomyomas , lipomas and sfts are a rare occurrence in the tracheobronchial tree ( 1 - 3 ) .
furthermore , sfts are rare spindle cell neoplasms that occur extremely rarely in the trachea . in a study of 185 benign tumors of the tracheobronchial tree ,
only 2.2% ( 4 cases ) of lesions were identified as sfts ( 2 , 5 ) .
a series of names including tracheal fibromas , benign mesothelioma , localized fibrous mesothelioma and submesothelial fibroma have been used to designate these neoplasms .
england and colleagues suggested that sfts originate from a primitive multipotential cell of mesenchymal differentiation ( 6 ) .
furthermore , sfts are histologically characterized by a haphazard growth pattern with short spindle cells , scant cytoplasm , a bland cytological appearance and separated by strands of rope - like collagen .
typically , these tumors exhibit a mixture of hypercellular ( tumor - rich ) and hypocellular ( collagen - rich ) areas .
most tumors show prominent vascularity , with numerous small and medium - sized blood vessels which focally resemble a hemangiopericytic growth pattern ( 7 ) .
these tumors have a tendency to be positive for cd34 in immunohistochemical studies ; however , typically lack the expression for cytokeratin and s-100 protein .
in addition , the bcl-2 assay can confirm the diagnosis of sfts in the case of cd34 negativity ( 4 , 8) .
the radiological findings of sfts occurring in the pleura , head and neck are usually depicted as well - circumscribed soft tissue masses , with lobular or smooth external surfaces ( 8 - 10 ) .
a non - contrast ct scan of sfts indicate intermediate to high attenuation ( 8) . alternatively , contrast - enhanced ct scans demonstrate significant , heterogeneous enhancement .
the enhancement pattern perhaps correlates with the vascular nature of these lesions , in addition to secondary degenerations such as myxoid change , hemorrhage , necrosis or cystic degeneration ( 8 , 10 ) .
similar to the ct findings of sfts occurring in the pleura , head and neck , the sfts in this case study have a well - defined round mass with a smooth surface in the trachea .
this morphologic feature was compatible with that of the benign tracheal tumor in that it was made up of homogeneous soft tissue attenuation as revealed by a non - contrast ct scan .
this finding correlates with the tumor size and histopathology of the mass , which primarily consists of hypercellular ( tumor - rich ) areas without secondary degeneration .
as well , the tumor had multiple small vessels on its surface and peripheral portion of the mass .
this characteristic resulted in strong nodular enhancement along the periphery of the mass , as seen on the contrast - enhanced ct scan , and is consistent with the ct findings in pleural and extrathoracic sfts .
a contrast - enhanced ct scan also revealed a focal area with a low attenuation in the central portion of the mass , although the present tumor was small in size without secondary degeneration .
a previous study reported that the enhancement pattern of sfts may depend on the amount of collagen within the tumor ( 10 ) .
in addition , another study showed low attenuation in the central area of the pleural sfts .
correspondingly , a contrast - enhanced ct scan of the tumor contained hypocellular areas of dense fibrosis or loose myxoid stroma , with rich vascularity contributing to the strong enhancement of the mass ( 11 ) .
the heterogeneous enhancement of the present case may have been less conspicuous with delayed ct images , as the mass was primarily composed of hypercellular areas rather than collagen - rich areas .
it is difficult to diagnose a tracheal sft , since its morphology and enhancement pattern is similar to several benign tracheal tumors including hemagiomas , neurogenic tumors , leiomyomas and glomus tumors ( 3 , 12 ) . in conclusion ,
we report , for the first time , the ct and pathologic findings of a sft of the trachea .
although sfts of the trachea are extremely rare , sfts should be included in the suite of the diagnosed benign tracheal masses with a strong enhancement of the ct scan .
|
we present the multidetector ct findings with a pathologic correlation for the case of a solitary fibrous tumor located in the trachea .
the mdct revealed a well - circumscribed intraluminal mass arising from the trachea , with strong nodular enhancement in the periphery of the mass .
the enhancement pattern of the mass corresponded histopathologically to a focal hypocellular area in the center and prominent blood vessels along the periphery of the mass .
we also present volume - rendered and virtual bronchoscopic images of this rare submucosal tracheal tumor .
|
it occurs most commonly in the stomach when it hits the gastrointestinal system 1 . whether lowgrade or highgrade disease is present
, the treatment of this tumor varies according to the type , location , and patient 's presentation . in some instances , it might present as spontaneous perforation of the stomach or perforation related to chemotherapy 2 , 3 . at this point
we present below a case of spontaneous primary gastric lymphoma perforation that was managed in our institution followed by a brief review of the literature and discussion .
this is the case of an 80yearold male patient who is presenting for abdominal pain .
history goes back to the same day of presentation , diffuse , postprandial , and crampy in nature , associated with vomiting of food content as well as fever of 39c and chills .
furthermore , there is no documented history of helicobacter pylori infection , dyspepsia , or previous ppi treatment .
his past surgical history is positive for perforated gastric ulcer , postsurgical repair , and coronary artery bypass grafting , both done 10 years prior to presentation .
he has a past medical history of coronary artery disease , hypertension , dyslipidemia , benign prostatic hyperplasia , and paroxysmal atrial fibrillation .
the patient has no reported allergies , and his family history is noncontributory . on admission ,
he was lethargic , febrile ( 38.5c , rectal ) , and tachycardic ( hr 110 bpm ) . physical examination of the abdomen showed rigidity , diffuse tenderness to palpation , and rebound tenderness .
laboratory showed the following : white blood cell count 10.2/mm , neutrophils 73% , creactive protein 7.37 u , hco3
17.5 , prothrombin time international normalized ratio 1.97 iu .
abdominalpelvic computed tomography scan was performed showing evidence of perforated gastric ulcer on the anterior antral wall of the stomach ( figs 1 and 2 ) .
axial view of abdomen ct scan with contrast showing perforation of the anterior antral wall of the stomach ( curved arrow ) as well as fluid in the perisplenic space ( straight arrow ) .
patient was started on antibiotics and antifungals ( ampicillin , ciprofloxacin , metronidazole , fluconazole ) .
he was also given two fresh frozen plasma units and vitamin k , and urgent laparotomy was decided ( figs 3 and 4 )
. 2 1 cm perforation at the anterior antral wall being repaired while awaiting the frozen result .
an extensively distended colon was encountered with the sigmoid adherent to the stomach at the level of the perforation . abdominal fluid culture taken and irrigation was carried out .
liberation of the sigmoid colon and identification of 2 1 cm gastric perforation at the level of the antrum anteriorly were made .
the relatively big perforation encountered , the fact that the patient was 80 years old and the relative thickness in the gastric mucosa was intriguing to us .
meanwhile closure of the ulcer was made using polyglactin 910 , absorbable , synthetic , braided 20 suture , and graham patch placed .
frozen result came back as lymphoma , and the oncology and anesthesia teams were consulted on the spot .
the best choice regarding the patient 's condition , versus his clinical stability , was the main issue of debate .
the patient was then transferred to the intensive care unit where his condition was stabilized .
5 postop , an upper gi series was performed , showing no anastomotic leak , no stenosis , and feeding was initiated .
diagnosis : gastric bcell lymphoma of malt , low grade with :
free surgical marginmeasuring 5 9 1.5 cmtumor invades submucosa reaching muscular layerfree serosaabsence of helicobacter pylorimoderate chronic active gastritis in nonneoplastic gastric mucosafree omentumno evidence of invasion in 10 lymph nodes ( epigastric)absence of helicobacter pylorilike organisms
measuring 5 9 1.5 cm tumor invades submucosa reaching muscular layer absence of helicobacter pylori moderate chronic active gastritis in nonneoplastic gastric mucosa no evidence of invasion in 10 lymph nodes ( epigastric ) absence of helicobacter pylorilike organisms patient was then referred to the oncology team for followup .
in a time 40% of all nonhodgkin lymphomas ( nhl ) occur in extranodal location in the body , and the predominant site is the gastrointestinal tract 4 , it constitutes merely 15% of this system 's malignancies 5 , 6 .
the stomach in particular is the most common affected organ 1 . in 40% of the cases
, it presents as lowgrade mucosaassociated lymphoid tissue ( malt ) , and in 60% as highgrade diffuse large bcell lymphoma ( dlbcl ) 7 , 8 , 9 .
it usually presents as nonspecific abdominal pain , dyspepsia , heartburn , and b symptoms being uncommon in this case , and the diagnosis is delayed 10 .
nowadays , the treatment of primary gastric lymphoma has shifted away from surgery , toward chemotherapy regimens . in a time surgery
is now limited to cases of perforation , hemorrhage , or obstruction due to the tumor , it is no longer the cornerstone of treatment with its mortality rate reaching up to 8% 11 , 12 . as shown in table 1 , chemotherapy has surpassed surgery in terms of benefits and complications 13 , 14 , 15 , 16 , 17 , 18 .
they concluded that the mean tumor size was 9.13 cm , and the mean diameter of perforation was 1.45 cm .
our patient had a tumor of 9 cm and a diameter of 2 1 cm .
gastric lymphoma perforation , associated with chemotherapy , occurs mainly due to rapid tumor response , necrosis , lysis , and exuberant granulation 2 .
spontaneous perforation in the context of lymphoma without chemotherapy occurs due to tumor necrosis reaching the subserosa , with or without a concomitant ulcer 3 .
surgery versus chemotherapy complications in the treatment of primary gastric lymphoma the most important step in the management of gastric perforation is the intraoperative decision making .
stated some cues that would ensue a high clinical suspicion for malignancy , such as an ulcer > 6 cm , advanced patient 's age , perforation > 0.5 cm , and a high white cell count 20 .
our patient 's condition clearly met several of the abovementioned criteria that would raise one 's clinical suspicion to malignant processes : perforation > 0.5 cm , advanced age ( 80 years ) , high wbc ( 10.2 10 ) .
thus , the intraoperative decision was to send a frozen section of the margins and consult the oncology team on the spot . in the context of hemodynamic instability but high clinical suspicion for the presence of malignancy , the surgeon would be facing a double jeopardy , whether to undergo a primary repair with graham patch or plug , versus a subtotal or total gastrectomy .
however , a review of the literature and our center 's experience demonstrate that an oncological approach is more appropriate
. the risk of recurrent tumor perforation , whether spontaneous or in response to chemotherapy , along with the associated high mortality , makes it crucial to undergo a radical treatment , with an oncologic approach . at this point , it is important for the operating surgeon to be experienced in the field of oncological and upper gi surgery , so that the ideal operative management can be achieved in a timeefficient manner .
|
key clinical messageprimary gastric lymphoma is a rare malignant tumor that can sometimes present as spontaneous perforation .
we present below a case of spontaneous primary gastric lymphoma perforation that was managed in our institution followed by a brief review of the literature and discussion .
|
new
diagnostics for pulmonary tuberculosis ( ptb ) that are more sensitive than
sputum smear microscopy and suitable for primary health care ( phc ) services in
low- and middle - income countries ( lmics ) are urgently needed .
although several
promising new diagnostics are under development , they are unlikely to become
widely available at the lower levels of lmic health services in the near future
. in the meantime , tb case detection must be
improved through the optimal use of existing diagnostic tools .
the optimisation of sputum microscopy
services , often the only tb diagnostic services possible at phc level in lmics ,
is urgently needed [ 26 ] .
smear microscopy has several limitations ,
including poor sensitivity , being labour intensive , and requiring skilled
microscopists .
furthermore , the need to collect serial sputum specimens over
multiple patient visits results in a protracted diagnostic process with high
rates of patient drop - out [ 7 , 8 ] .
recent
studies examining the yield of serial sputum specimens , usually collected as spot - morning - spot , have reported that
the majority of patients with smear - positive ptb are identified by the first
two sputum specimens ,
and the world health organization ( who ) has recently changed its policy in this
respect , reducing the minimum number of
sputum specimens examined for each patient from three to two .
this will result in reduced laboratory workloads in many settings , with the
potential of improving the quality of sputum microscopy .
case detection may thus be expected to increase in locations where the number
of new cases detected through improved microscopy quality exceeds the 2% to 5%
of cases missed by not examining the third specimen .
the
policy changes do not , however , specify the timing for the collection of the
two specimens . if specimens were
collected at the time of consultation ( 1ston - the - spot ) and the
morning of the following day ( morning sample )
, the spot - morning specimens would still require a minimum of two visits , which is the minimum
required by the spot - morning - spot scheme currently used in most
diagnostic centres of lmics .
in addition ,
the spot - morning and spot - morning - spot schemes still examine a
substantial proportion of samples the second day of the diagnostic
process .
if the process could be
front - loaded , that is , if all or the majority of sputum collections were
conducted the first day of the diagnostic process , this may reduce the number
of visits required and reduce patient drop - out , particularly if results could
be made available the same day .
this
study describes the yield of a front - loaded diagnostic scheme , in which an additional on - the - spot specimen ( referred here as the xspot ) is collected
one hour after the first spot specimen .
we hypothesised that the yield of this specimen is similar to the yield
of other specimens collected on the spot , and that the overall yields of the spot - xspot - morning and the standard spot - morning - spot schemes are similar .
in addition , the study explores whether the first
two specimens collected identify the majority of smear - positive patients .
four separate studies were
conducted in ethiopia , nepal , nigeria , and yemen using similar study designs .
all individuals 15 years of age or older with cough for 3 weeks
were invited to participate and were
enrolled consecutively at the time of presentation to the health
services and after obtaining informed consent .
the services in all four
settings were busy outpatient clinics of district hospitals that were
integrated with the national tb control programme of the country .
individuals either self - presented to these
clinics or had been referred from peripheral health centres for assessment .
patients
were requested to submit 3 sputum specimens as spot - morning - spot ( the
standard approach ) , and an additional specimen was collected one hour after the
first ( the xspot ) on the first day of consultation ( figure 1 ) .
all smears were stained using the hot
ziehl - neelsen method , were read blindly by trained laboratory technicians , and
graded using the who / iuatld system . in accordance with the recent who policy
changes , all smears with 1 acid fast bacillus /100 high power fields were considered positive . the main difference in study design between
the four sites was that all morning specimens collected in nepal and
yemen were cultured on solid egg - based media to allow for the calculation of
sensitivity and specificity when considering culture as the reference standard .
external quality assessment ( eqa ) of smear
microscopy was conducted by the liverpool school of tropical medicine ( lstm ) ,
uk . for all 4 sites
, there was > 98% agreement
between the results of the study microscopists and those of the controllers at
lstm .
data were analysed to describe the
yield of single smears and the cumulative yields of the standard ( spot - morning - spot )
versus the front - loaded ( spot - xspot - morning ) schemes and of the two
smear spot - morning versus the front - loaded spot - xspot schemes .
a number of patients ( 62 , 7% ) did not have
complete sets of sputum specimens for analysis .
these patients were included in the analysis for the additional yield ,
and missing smears were considered as negative .
as the schemes were not independent , comparisons of marginal
proportions were made using matched mcnemar tests .
these
included comparisons of the extra yield of the third sputum for each scheme ;
the yield of the two sample schemes and the comparison of the dropouts if
patients were examined by the standard and frontloaded schemes .
the extra yield
of the third sputum for each scheme was summarised in 3 3 tables using the categories positive on at least one of the
first two samples , positive on the third sample only , and
negative on all
samples and stratified by study setting .
as this analysis required complete sets of data , the 62 ( 7% ) patients
with missing sputum samples
the yield for the
two sample schemes was
also compared with 2 2 tables with the indicators for each scheme being positive
on at least one of the two specimens and negative on both specimens .
patients
with one of the two specimens missing ( 36 , 4% ) were classified as negative if the
specimen available was negative .
mcnemar
and stuart maxwell tests for marginal heterogeneity were used for comparison of the
two and three specimen schemes , respectively , stratified by study site .
partial
results of the studies in ethiopia and nigeria , which described the yield of
two smears collected as spot and xspot in a single day , have been
reported previously [ 3 , 4 ] .
however , this report includes the yields of
the spot - morning - spot and spot - xspot - morning schemes from these
sites as well as the data from two additional sites conducting studies with
similar design approaches .
ethical approval for the study protocols was obtained from the
research ethics committees of the liverpool school of tropical medicine and the
institutional review boards of the participating institutions in ethiopia ,
nepal , nigeria , and yemen .
, 243 were
enrolled in ethiopia , 206 in nepal , 224 in nigeria , and 250 in yemen .
two hundred and sixteen ( 23% ) of the 923
patients had one or more positive smears .
the first - spot , xspot , morning , and second - spot specimens were graded positive in 181 ( 20% ) , 186 ( 20% ) ,
185 ( 20% ) , and 176 ( 19% ) patients , respectively , as shown in table 1 .
in addition to the 181 patients identified by
the first - spot , 22 ( 10% ) and 7 ( 3% ) additional patients were detected by
the morning and second - spot specimens , respectively , resulting in
a cumulative yield for the spot - morning - spot scheme of 210 ( 23% )
patients . in comparison ,
the xspot and morning specimens of the
front - loaded approach detected 18 ( 8% ) and 11 ( 5% ) additional patients , also
resulting in a cumulative yield for the spot - xspot - morning scheme of 210
( 23% ) patients .
the yield of the third smear was the same in both approaches ,
independently on whether this was thesecond spot or the morning specimen ( p > .5 ) .
a
comparison of the yield of the third smear for samples collected using the
standard ( spot - morning - spot ) and the
front - loading ( spot - xspot - morning )
approaches by country is shown in table 2 .
although there were a few discrepant results in the yield of the third
specimen across the schemes , the direction of these discrepancies varied across
study sites , and the discrepancies in each study site or combined were not
statistically significant .
the first two ( spot - morning )
smears of the spot - morning - spot approach identified 203 ( 97% ) smear - positive patients .
these two smears , therefore , would have
missed 7 ( 3% , 95%ci 1%6% ) of the cases identified by the three smears , as
shown in table 1 .
the first two ( spot - xspot ) smears of the spot - spot - morning approach identified
199 ( 95% , 91%97% ) smear - positive patients .
these two spot smears , therefore , would have missed 11 cases ( 5% , 95%ci
3%9% ) identified by the three smears . a
matched comparison of the yield of two smears collected using the standard ( spot - morning ) and the front - loading ( spot - xspot ) approaches stratified by
country is shown in table 3 . again , the proportion of cases missed by the spot - morning and the spot - spot smears is not statistically different .
fifty - one ( 25% ) of the 206 patients in nepal and 72
( 29% ) of the 250 patients in yemen had a positive tb culture .
thirty - nine and
37 of the 51 culture - positive patients in nepal were identified by the standard
and the front - loaded schemes , resulting in a sensitivity of 76% [ 95%ci 63%87% ] and 73%
[ 59%83% ] , respectively . in yemen ,
51
and 52 of the 72 culture - positive patients were identified by the standard and
front - loaded schemes , respectively , ( sensitivity 71% [ 60%80% ] and 72% [ 61%82% ] ) .
there were no statistical differences between
the sensitivities of the standard and front - loaded approaches .
the sensitivity of two smears collected as spot - morning would be 69% ( 35 of 51
culture positive patients ) in nepal and 71% ( 51 of 72 ) in yemen . in comparison , the sensitivity of the two
smears collected as spot - xspot would
be 67% ( 34 of 51 ) in nepal and 67% ( 48 of 72 ) in yemen .
much progress has been made in recent years in the development of new
diagnostics for tb .
however , few of the newer diagnostic technologies are
suitable for use outside of reference laboratories in the public health
services of lmics . tb
control in resource - poor , high - prevalence settings , therefore , will continue to
rely upon sputum smear microscopy until frontline services gain access to the
new technologies .
tuberculosis affects disproportionately indigent
populations who seek health services in areas with limited resources , and the costs
incurred by patients can be prohibitively high , even when services are provided
free of charge .
individuals need to attend health facilities
on several occasions to see a clinician , submit sputum specimens , receive
results , and be put on treatment , and these visits may incur loss of earnings
and require repeated travel , purchase of food , and accommodation .
a significant proportion of people undergoing
investigations for tb drop - out of the smear diagnostic pathway , and these
patients are more likely to be the poor .
although few studies report the
proportion of patients who drop out during the diagnosis of tb in lmic , 13% of tb
suspects in india ,
15% and 37% of smear - positive patients in rural ,
and urban malawi
dropout of the process , and unusually , the diagnostic dropout rate can be as
high as 95% . failing to complete the
diagnosis , therefore ,
there is increasing interest in equity in health services , as typified by the
interim report of the who commission on social determinants of health .
primary health care , once again , plays a
central role in who 's current agenda , and the development of equitable diagnostic
services is , therefore , paramount to access treatment .
the investigation of suspected ptb in many
low - prevalence countries is based on the examination of serial morning specimens because these specimens have been associated with a significant
additional yield of patients .
the
proportion of patients who drop out in these settings , however , is
insignificant , and the spot - morning - spot scheme was developed in
the 1950s and 60s in response to the need to reduce the number of visits in
high - prevalence areas , where patients often abandoned the diagnostic process .
although it was widely accepted that
overnight specimens were more likely to contain more bacilli , it was also
acknowledged that in less favourable circumstances , it was more practical to
obtain specimens at the time the patient was attending the service .
two of the morning specimens were replaced by
spot specimens , and shorter schemes that required a reduced number of visits
were developed .
although this was a remarkable improvement , the continued need
for multiple visits was still a hindrance for many patients .
it is now recognised that the high
bacillary threshold for defining a smear as positive and the requirement to
obtain at least one confirmatory smear have unnecessarily reduced the sensitivity of the
test in the detection of smear positive cases .
these requirements also resulted in many laboratory services being overwhelmed
and leaving insufficient time for the examination of smears .
the recent who policy changes reduce the
smear microscopy thresholds
and the minimum number of specimens to be examined .
these changes will reduce
workload , particularly important in areas , where skilled human resources are
limited , potentially increasing case detection through allowing more time to
examine the smears .
these policy changes might be associated with larger gains in case detection if
the timing of sputum specimen collection and examination were more convenient
for patients , particularly poor patients , and help to reduce drop - out .
this study shows that the spot - spot - morning and spot - morning - spot schemes have similar yields .
this
indicates that front - loaded tb diagnostic services ( whether based on the
examination of two or three specimens ) are feasible and would not be associated
with significantly less yield than the equivalent standard approach .
both two - smear strategies would miss about 3%5% of the
patients identified by the three - specimen strategy , as suggested by a previous
systematic review [ 5 , 19 ] .
these losses are likely to be compensated by
increased quality of microscopy and lower drop - out rates of patients .
in addition , programmes
where 10% of patients fail to return for the second day of diagnosis would
identify similar numbers using 2 smears the first day of consultation than 2 or
3 smears collected over two or more days .
countries adopting two - smear schemes ,
therefore , may consider collecting and examining the specimens in a single day
to shorten the time required for diagnosis .
the development
of diagnostic approaches that are responsive to the needs of the population may
be feasible , and larger studies are urgently required to validate the findings
of this study under operational conditions .
if the findings of this study are confirmed , smear microscopy services should be
front loaded in the interests of equity and improved tb control .
the diagnosis of tuberculosis in
high - burden settings relies on sputum smear microscopy and requires multiple
patients ' visits to the health facilities .
this approach could be improved if most specimens were collected the
first day of consultation .
this study
reports the smear microscopy findings of 923 adults with chronic cough participating in four cross - sectional surveysin ethiopia ,
nepal , nigeria , and yemen .
sputum
specimens were collected as spot - morning - spot plus one additional specimen one
hour after the first spot ( x - spot ) .
the yield of two
( spot - xspot or spot - morning ) or three ( spot - morning - spot
or spot - x - spot - morning ) specimens was
compared .
, 210 ( 97% ) were identified by the spot - morning - spot ,
and 210
( 97% ) were identified by the spot - xspot - morning specimens .
spot - morning identified 203 and spot - xspot
specimens 200 patients , respectively , ( p > .1 ) .
the time , number of
visits and patients ' costs to complete smear microscopy could be reduced by
frontloading the collection of sputum specimens .
|
setting .
ethiopia , nepal , nigeria , and yemen . objective . to reduce the time to complete
sputum microscopy
.
design .
cross - sectional surveys enrolling 923 patients with chronic cough in the 4 countries and using similar protocols .
spot - morning - spot sputum specimens were collected . an additional sputum specimen ( xspot )
was collected one hour after the first , and the yields of the first two or the three specimens collected as spot - morning - spot or
spot - xspot - morning were compared .
results .
216 patients had
one positive smear .
210 ( 97% ) were identified by the
spot - morning - spot , and 210 ( 97% ) were identified by the spot - xspot - morning specimens , with 203 and 200 identified by the first 2 specimens of each approach , respectively .
neither difference was significant .
conclusions .
the time to complete smear microscopy could be reduced .
|
cloning and expression constructs the complete open reading frames of dsp14 ( np_008957 ) , dsp24 ( np_076930 ) , dsp18 ( np_776106 ) ( invitrogen ) , and dsp21 ( atcc-9898164 ) ( 27 ) were amplified by pcr from plasmids containing full - length cdnas and cloned into pegfp - n1 , n2 , or c1 ( clontech ) .
vectors for the expression of recombinant c - terminal his - tagged constructs were made using the pet21a vector ( stratagene ) .
murine forms of dsp18 and dsp21 were inserted into pet21a at 5-ndei and 3-xhoi in - frame with the c - terminal his6 tag .
vectors for expression of recombinant n - terminal gst - tagged protein were made using the pgex-4t1 vector ( ge healthcare ) .
bacterially expressed recombinant dsp18-his6 and dsp21-his6 were expressed in bl21 ( de3 ) codonplus ril cells ( stratagene ) and purified using ni - agarose affinity resin ( qiagen ) as described previously ( 28 ) .
recombinant dsp18-his6 and dsp21-his6 were purified using ni - agarose affinity resin followed by separation over a superdex 200 column ( amersham biosciences ) .
bacterially expressed recombinant gst - dsp18 was expressed in bl21 ( de3 ) codonplus ril cells ( stratagene ) and purified using glutathione - agarose affinity resin ( sigma ) as described previously ( 29 ) .
recombinant gst - dsp18 was further purified by gel filtration chromatography using a superdex 200 column and stored at -80 c in 10% glycerol , 2 mm edta , and 2 mm dithiothreitol .
cell culture , transfection , immunocytochemistry , and materials cos-7 cells were maintained at 37 c at 5% co2 in dulbecco 's modified eagle 's medium ( invitrogen ) containing 10% fetal bovine serum and 50 units / ml each penicillin and streptomycin .
transient transfections were performed using fugene 6 reagent ( roche applied science ) according to the manufacturer 's protocol . for immunocytochemistry
, cells were incubated with 100 nm mitotracker red ( invitrogen ) for 20 min before fixation with 3.7% formaldehyde and were then permeabilized in phosphate - buffered saline containing 0.1% tween 20 , 0.3% triton x-100 , and 6% bsa .
cells were incubated with anti - dsp18 serum at 1:1000 or anti - dsp21 at 1:100 in phosphate - buffered saline containing 0.1% tween 20 and 6% bsa and alexa fluor 488 goat anti - rabbit - conjugated secondary antibody ( molecular probes ) at 1:500 .
nuclei were stained with 300 nm dapi ( molecular probes ) for 1 min before viewing .
fluorescence imaging was performed using a light microscope ( dmr ; leica ) with a pl apo 63 1.32 na oil objective ( leica ) at room temperature , and images were captured with a ccd camera ( c4742 - 95 ; hamamatsu ) using openlab 4.0.1 software ( improvision ) .
the following antibodies were purchased : voltage - dependent anion channel protein ( vdac ; calbiochem # 529536 ) , second mitochondria - derived activator of caspase ( smac)/diablo ( calbiochem # 567365 ) , calreticulin ( calbiochem # 208910 ) , cytochrome c ( bd biosciences # 556433 ) , ndufb6 ( mitosciences # ms108 ) , stress - activated protein kinase / jun - n - terminal kinase ( sapk / jnk ; cell signaling # 9258 ) , phospho - sapk / jnk ( cell signaling # 9255 ) , heat shock protein 70 ( hsp70 ; abr # ma3028 ) , enhanced green fluorescent protein ( egfp ; bd clontech # 8371 ) .
generation of dsp18 and dsp21 polyclonal antibodies full - length recombinant gst - dsp18 ( murine ) or dsp21-his6 ( murine ) was used to generate polyclonal anti - sera in rabbits ( cocalico ) .
igg was purified from serum using prosep a ( millipore ) chromatography according to manufacturer 's protocol .
sapk activation assay cells were washed once in phosphate - buffered saline buffer then treated with 40 mj / cm of ultraviolet light in a uv stratalinker 2400 ( stratagene ) . after irradiation , growth medium was added , and cells were further incubated for 30 min .
phosphatase assays phosphatase assays were carried out in 50 l of assay buffer containing 50 mm bis - tris , 25 mm tris , and 2 mm dithiothreitol at ph 6 for 10 min at 30 c .
para - nitrophenyl phosphate ( pnpp ) assays were performed as described previously ( 30 ) .
purification of rat kidney and testis mitochondria mitochondria were purified as described ( 31 - 33 ) with minor modifications .
fresh rat kidneys or testes were harvested and placed in ice - cold mshe+bsa buffer ( 210 mm mannitol , 70 mm sucrose , 5 mm hepes , ph 7.4 , with koh , 2 mm egta , 0.5% fatty acid free bsa , and edta - free complete protease inhibitor mixture ( roche applied science ) ) .
the renal capsule was removed , and kidneys were minced then washed 3 times in 150 mm nacl and 3 times in mshe+bsa buffer .
kidneys were disrupted with 10 - 15 strokes and testes 8 - 10 strokes of a tight fitting potter - elvehjem tissue homogenizer .
homogenate was centrifuged for 10 min at 600 g to remove unbroken cells and nuclei .
the pellet was re - homogenized and spun at 600 g. supernatants were combined and spun at 15,000 g for 10 min to pellet mitochondria .
pellets were washed two times in mshe+bsa followed by one wash in bsa - free mshe buffer .
mitochondria were resuspended in 1 - 2 ml of mshe and layered over a gradient of 35% histodenz ( sigma ) , 17.5% histodenz , and 6% percoll ( sigma ) that was centrifuged at 45,500 g for 45 min at 4 c .
mitochondria were collected from the 17.5 - 35% interface , centrifuged at 15,000 g for 15 min , and resuspended in a small volume of mshe buffer .
fluorescent images of cos-7 cells transiently transfected for 24 h with constructs encoding egfp only ( a ) or c - terminally egfp tagged dsp18 ( b ) , dsp14 ( c ) , or dsp24 ( d ) .
additionally , cells were stained with the mitochondrial marker , mitotracker red , and the nuclear marker , dapi ( blue ) .
fluorescent images of cos-7 cells transiently transfected for 24 h with constructs encoding egfp only ( a ) or c - terminally egfp tagged dsp18 ( b ) , dsp14 ( c ) , or dsp24 ( d ) .
additionally , cells were stained with the mitochondrial marker , mitotracker red , and the nuclear marker , dapi ( blue ) .
rat kidney was perfused with 4% paraformaldehyde ( pfa ) in 0.1 m phosphate buffer and further immersion - fixed overnight in 4% pfa in phosphate buffer .
samples were rinsed with 0.15% glycine in 0.1 m phosphate buffer , pelleted in 10% gelatin in phosphate buffer , and cryoprotected by infusion with 2.3 m sucrose , phosphate buffer overnight at 4 c .
tissue blocks ( 1 mm ) were mounted onto specimen holders and snap - frozen in liquid nitrogen .
ultrathin cryosections ( 70 - 90 nm ) were cut at -100 c on a leica ultracut uct with em fcs cryoattachment using a diatome diamond knife , picked up with a 1:1 mixture of 2.3 m sucrose and 2% methyl cellulose ( 15 cp ) as described ( 34 ) , and transferred onto formvar- and carbon - coated copper grids .
immunolabeling was performed by slight modifications of the tokuyasu technique ( 35 ) using anti - dsp18 at 1:2 followed by 10-nm gold - conjugated goat anti - rabbit igg ( ge healthcare ) at 1:25 .
grids were viewed and photographed using a jeol 1200ex ii transmission electron microscope ( jeol , peabody , ma ) .
separation of inner and outer mitochondrial membranes was performed as described previously ( 16 ) with minor modifications .
gradient - purified mitochondria were resuspended in hypotonic solution ( 10 mm kcl , 2 mm hepes , ph 7.2 ) at 5 - 8 mg / ml on ice for 20 min with gentle agitation . one - third volume of hypertonic solution ( 1.8 mm sucrose , 2 mm atp , 2 mm mgso4 , 2 mm hepes , ph 7.2 ) was then added and allowed to incubate for an additional 5 min .
mitochondria were then sonicated with a probe for 15 s at 3 amps and layered on a step gradient containing 0.76 , 1 , and 1.32 m sucrose .
the om fraction was collected from the 0.76 and 1 m sucrose interface , washed with mshe , and pelleted by centrifugation at 120,000 g. mitoplasts ( mp ) were collected from the pellet , washed with mshe , and pelleted by centrifugation at 15,000 g. submitochondrial particles ( smp ) were generated from mp as described previously ( 36 ) .
the solution was spun at 15,000 g to remove intact mp , and the resulting supernatant was spun at 120,000 g for 45 min at 4 c to pellet smp .
briefly , apoptosis was induced in cos-7 cells by the addition of 500 nm staurosporine ( sigma ) 2 h before fixation .
immunofluorescence screen for subcellular localization of ptps many of the 107 ptps are not well studied , especially the large number of atypical dsps ( 3 ) . as part of a larger effort to uncover the subcellular localizations of ptps
, we initially cloned full - length open reading frames of several genes into a vector encoding a c - terminal egfp .
we then transiently transfected cos-7 cells and analyzed subcellular localization via immunofluorescence ( if ) .
interestingly , of the ptps we initially examined , only dsp18-egfp redirected the predominantly cytosolic and nuclear egfp to mitochondria , where it co - localized with the mitochondrial marker mitotracker red ( fig .
mutation of the catalytic cysteine to serine showed no change in the ability of dsp18 to target to mitochondria ( data not shown ) .
in contrast , dsp14-egfp and dsp24-egfp did not show distinct subcellular localizations and did not co - localize with mitotracker red ( fig . 1 , c and d ) .
dsp18 is a class i cysteine - based ptp and falls into the atypical dsp subgroup , which currently contains 19 phosphatases ( 3 , 25 ) .
we performed psi - blast data base searches using the murine form of dsp18 and found that it is a highly conserved protein among vertebrates , with a potential ortholog in drosophila ( supplemental fig .
the dsp18 orthologs contain the active site consensus sequence ( h / v)cx5r(s / t ) found in both classical and atypical dsps but lack the mapk interacting ch2 domain and kinase interaction motifs found in classical dsps ( supplementalfig .
cos-7 cells transiently expressing c - terminal egfp - tagged dsp18 ( b ) , 1 - 94-egfp ( c ) , 47 - 141-egfp ( d ) , 95 - 188-egfp ( e ) , and n - terminal egfp - tagged dsp18 .
fluorescent images were taken 24 h post - transfection after co - labeling with mitotracker red and dapi ( blue ) .
cos-7 cells transiently expressing c - terminal egfp - tagged dsp18 ( b ) , 1 - 94-egfp ( c ) , 47 - 141-egfp ( d ) , 95 - 188-egfp ( e ) , and n - terminal egfp - tagged dsp18 .
fluorescent images were taken 24 h post - transfection after co - labeling with mitotracker red and dapi ( blue ) .
dsp18 has an internal mitochondrial localization signal the discovery that dsp18-egfp localizes to mitochondria led us to explore its targeting sequence .
we generated several truncated constructs of dsp18 fused to the n terminus of egfp ( fig .
although localization to the mitochondria is often encoded by the n terminus , the first 94 residues of dsp18 were unable to redirect egfp from the cytosol and nucleus to mitochondria as compared with wild type dsp18 ( fig .
2 , b and c ) . however , constructs containing amino acids 47 - 141 and 95 - 188 of dsp18 targeted egfp to the mitochondria as indicated by colocalization with mitotracker red ( fig .
2 , d and e ) . furthermore , the placement of egfp at the n terminus of dsp18 blocked localization of dsp18 to the mitochondria ( fig .
2f ) , suggesting that n - terminal epitope tags impede import into the mitochondria .
the expression of dsp18 constructs was confirmed by immunoblotting with an anti - egfp antibody ( supplemental fig .
2 ) . collectively these findings suggest an internal region of dsp18 from amino acid 95 to 141 is necessary for localization to mitochondria and that import requires an unconstrained n terminus .
detection of endogenous dsp18to verify our overexpression studies , we examined the localization of endogenous dsp18 .
the anti - dsp18 antibody did not cross - react with the highly similar protein dsp21 ( fig .
3a ) . if analysis of endogenous dsp18 in cos-7 cells probed with the anti - dsp18 antibody exhibited mitochondrial localization ( fig .
3c ) or cells stained with antibody blocked with recombinant gst - dsp18 showed no mitochondrial localization ( fig .
similar staining patterns were observed in hek 293 cells and hela cells ( data not shown ) .
to biochemically confirm the if results , we isolated highly purified mitochondria from homogenized rat kidneys by differential centrifugation followed by histodenz gradient purification .
immunoblot analysis demonstrated that endogenous dsp18 was highly enriched in the mitochondrial fraction along with the mitochondrial protein marker smac , whereas the endoplasmic reticulum protein marker calreticulin was removed during histodenz gradient purification ( fig .
3e ) . to investigate the location of dsp18 at a higher resolution , we performed immunogold labeling of dsp18 of ultrathin cryosections from rat kidney tissue and cos-7 cells transiently expressing dsp18-egfp ( fig .
3f , panels 2 and 3 , respectively ) and analyzed them by electron microscopy .
gold particles were found predominantly within mitochondria , suggesting dsp18 is localized to either the matrix , i m , or ims , possibly the intra - cristal spaces ( fig .
these results indicate that endogenous dsp18 is enriched in mitochondria and traffics to one of the interior compartments of the organelle .
endogenous dsp18 is an ims protein that peripherally associates with the inner mitochondrial membrane after identification of dsp18 as a mitochondrial protein , we sought to rigorously define its location within mitochondria .
4a ) : om , ims ( soluble material between the i m and om ) , submitochondrial particles partially depleted of om , mitoplasts ( mp - intact i m and matrix ) , and soluble matrix .
the vdac , an om marker , is enriched at contact sites between the outer and inner membranes and is , therefore , typically detected in both om and mp / smp fractions when using the swell / shrink separation method used here ( 16 ) .
dsp18 was enriched in the inner membrane - containing smp and mp fractions ( fig .
4b ) , similar to ptpmt1 , a known integral membrane protein located on the matrix side of the i m ( 16 ) .
a trace amount of dsp18 was also seen in the soluble matrix ( sm ) fraction ( fig .
a , for raising polyclonal antibody , recombinant dsp18-his6 and dsp21-his6 was purified from bacteria , separated by sds - page , and immunoblotted with protein a - purified anti - dsp18 .
fluorescent images were taken of cos-7 cells probed with anti - dsp18 ( b ) and pre - immune serum ( c ) , or anti - dsp18 was blocked with recombinant gst - dsp18 ( d ) .
e , 20 g of rat kidney homogenate ( hom ) , differential centrifugation purified mitochondria ( dc ) , and histodenz gradient - purified whole mito were separated by sds - page and immunoblotted with anti - calreticulin ( endoplasmic reticulum marker ) , anti - smac ( mitochondrial marker ) , and anti - dsp18 antibodies .
f , immunogold em labeling of rat kidney sections ( 1 and 2 ) and cos-7 cells transiently expressing dsp18-egfp ( 3 ) .
sections were probed with pre - immune serum ( 1 ) or -dsp18 antibody ( 1 and3 ) and labeled with 10-nm gold - conjugated anti - rabbit secondary antibodies .
a , for raising polyclonal antibody , recombinant dsp18-his6 and dsp21-his6 was purified from bacteria , separated by sds - page , and immunoblotted with protein a - purified anti - dsp18 .
fluorescent images were taken of cos-7 cells probed with anti - dsp18 ( b ) and pre - immune serum ( c ) , or anti - dsp18 was blocked with recombinant gst - dsp18 ( d ) .
e , 20 g of rat kidney homogenate ( hom ) , differential centrifugation purified mitochondria ( dc ) , and histodenz gradient - purified whole mito were separated by sds - page and immunoblotted with anti - calreticulin ( endoplasmic reticulum marker ) , anti - smac ( mitochondrial marker ) , and anti - dsp18 antibodies .
f , immunogold em labeling of rat kidney sections ( 1 and 2 ) and cos-7 cells transiently expressing dsp18-egfp ( 3 ) .
sections were probed with pre - immune serum ( 1 ) or -dsp18 antibody ( 1 and3 ) and labeled with 10-nm gold - conjugated anti - rabbit secondary antibodies .
compartments within the mitochondria can have vastly different protein environments and , therefore , play differing roles in signaling events .
because of the location of dsp18 on the i m , we sought to determine whether dsp18 was located on the ims or the matrix side of the i m .
mp and smp were treated with the proteolytic enzyme trypsin to cleave exposed proteins ( fig .
treated with trypsin , dsp18 showed a decrease in signal over time in contrast to the matrix protein ptpmt1 .
however , dsp18 showed no loss of signal from smp treated with trypsin , suggesting that dsp18 is attached to the i m facing the ims compartment .
the complex i protein ndufb6 , which is buried within the i m , was used as a loading control . to evaluate the strength of association of dsp18 to the i m , we washed either mp or pre - swollen whole mitochondria with high salt , an alkaline wash , ph 11.5 , or control buffer .
the whole mitochondria were pre - swollen to expose the outer surface of the inner membrane .
dsp18 remained bound to the membrane after treatment with high salt but was subsequently released during the alkaline wash ( fig .
conversely , the tightly associated integral membrane protein ptpmt1 was not released by either treatment .
collectively , these results suggest that dsp18 is a mitochondrial ims protein , which is peripherally associated with the i m predominantly along the cristae .
dsp21 is a highly similar dsp that is also targeted to mitochondria via an internal mitochondrial localization signal using dsp18 as an index protein , we searched for other highly similar phosphatases that localize to mitochondria .
based on high sequence identity or similarity ( 69.3 and 80.4% , respectively ) , we identified a 21.5-kda protein , dsp21 , as a potential candidate for being targeted to mitochondria ( fig .
interestingly , dsp21-egfp also showed mitochondrial localization when co - stained with mitotracker red ( fig .
, we generated a polyclonal antibody against full - length recombinant dsp21 and labeled cells with anti - dsp21 antibody ( fig .
5c ) . if analysis of endogenous dsp21 showed mitochondrial localization and co - labeled with mitotracker red .
however , no mitochondrial localization was observed in cells stained with pre - immune serum or serum blocked with recombinant dsp21-his6 ( data not shown ) .
the high degree of sequence similarity to dsp18 led us to investigate whether dsp21 also contained an internal mitochondrial localization signal .
we generated several constructs containing truncations of dsp21 fused to egfp and transiently transfected these constructs into cos-7 cells ( fig .
5e ) . similar to dsp18 , dsp21 is targeted to the mitochondria via an internal localization signal .
constructs containing amino acids 43 - 128 were both necessary and sufficient to redirect egfp to the mitochondrion ( fig . 5 , d and e ) . figure 4.dsp18 is associated with the inner mitochondrial membrane facing the intermembrane space . a , diagram of mitochondrial subfractionation as described under
4a ) were separated by sds - page and immunoblotted with markers for om ( anti - vdac ) , ims ( anti - smac ) , i m ( anti - ptpmt1 ) , and soluble matrix ( sm ; anti - hsp70 - heat shock protein 70 ) .
c , 200 g of mp and smp were treated with 2.5 g of trypsin in 100 l of buffer for the indicated amounts of time .
samples were pelleted , washed , separated by sds - page , and immunoblotted with anti - dsp18 and anti - ptpmt1 .
the complex 1 subunit ndufb6 was not susceptible to trypsin digestion and was used as a loading control .
d , 100 g of osmotically swollen whole mitochondria and mp were washed with either control buffer , high salt ( 200 mm kcl , 2 mm hepes , ph 7.2 ) , or high ph ( 0.1 m na2co3 , ph 11.5 ) buffer , repelleted , washed , and separated out by sds - page .
dsp18 is associated with the inner mitochondrial membrane facing the intermembrane space . a , diagram of mitochondrial subfractionation as described under
4a ) were separated by sds - page and immunoblotted with markers for om ( anti - vdac ) , ims ( anti - smac ) , i m ( anti - ptpmt1 ) , and soluble matrix ( sm ; anti - hsp70 - heat shock protein 70 ) .
c , 200 g of mp and smp were treated with 2.5 g of trypsin in 100 l of buffer for the indicated amounts of time .
samples were pelleted , washed , separated by sds - page , and immunoblotted with anti - dsp18 and anti - ptpmt1 .
the complex 1 subunit ndufb6 was not susceptible to trypsin digestion and was used as a loading control .
d , 100 g of osmotically swollen whole mitochondria and mp were washed with either control buffer , high salt ( 200 mm kcl , 2 mm hepes , ph 7.2 ) , or high ph ( 0.1 m na2co3 , ph 11.5 ) buffer , repelleted , washed , and separated out by sds - page .
immunoblots were probed with antibodies against dsp18 , cyt c , and ptpmt1 . to expand on our if results
, we analyzed dsp21 expression in different tissues at the mrna level by reverse transcription - pcr as well as at the protein level by western blot .
unlike dsp18 , which is expressed in several different tissues , dsp21 protein appeared highly expressed only in testis tissue ( data not shown ) .
although dsp18 mrna was present in testes , we were unable to detect any protein expression of dsp18 in testis tissue ( data not shown ) .
we isolated highly purified mitochondria from rat testis homogenate by differential centrifugation followed by histodenz gradient purification .
western blot analysis demonstrated that dsp21 was highly enriched in the mitochondrial fraction along with the mitochondrial marker vdac ; however , the endoplasmic reticulum marker , calreticulin , was removed after gradient purification ( fig .
5f ) . in total , these data indicate that dsp21 is targeted to the mitochondria via an internal mitochondrial localization signal similar to dsp18 , suggesting a common mechanism of import ; however , these phosphatases vary in their tissue - selective expression .
dsp21 is localized to the matrix and peripherally associates with the mitochondrial inner membrane to determine whether dsp21 is localized to the same compartment as dsp18 , we sought to thoroughly define its location within rat testis mitochondria using the previously described fractionation method ( fig .
4a ) . the mitochondrial om marker vdac and the i m marker adenine nucleotide transporter ( ant ) are both found at om / im contact sites ; therefore , they can be found in both membrane fractions .
the observation that dsp21 was enriched in both the smp and mp fractions but not the om suggests that dsp21 is localized to the i m ( fig .
we examined its orientation on the i m using mp and smp fractions treated with trypsin over time .
mp treated with trypsin showed no loss of signal for dsp21 as assessed by western blot ( fig .
in contrast , trypsin - treated smp fractions showed a rapid decrease in signal for dsp21 similar to that seen by the i m marker ant .
interestingly , these data suggest dsp21 is associated with the i m , but in contrast to dsp18 , dsp21 is found facing the matrix compartment . as well , we treated smp with either a buffer control , a high salt solution to remove loosely associated proteins , or an alkaline wash to remove peripheral membrane proteins .
analogous to dsp18 , dsp21 remained membrane - associated after the buffer control and high salt washes ; however , smp treated with the alkaline wash released dsp21 from the membrane as assessed by immunoblots using anti - dsp21 antibodies ( fig .
in contrast , the ant , an integral membrane protein of the i m , was not removed during the alkaline wash .
this indicates that dsp21 , like dsp18 , is a peripheral membrane protein , and collectively these data suggest that dsp21 is localized to mitochondria in testis tissue where it peripherally associates with the i m within the matrix compartment .
a , sequence alignment of dsp18 and dsp21 , with identities highlighted in gray , and the amino acids of the catalytic triad ( d , c , r ) highlighted in yellow .
the active site residues ( ptp - loop ; cx5r ) are highlighted in red .
d , cos-7 cells transiently expressing amino acids 43 - 128 of dsp21 with a c - terminal egfp tag .
f , 20 g of rat testis homogenate ( hom ) , differential centrifugation purified mitochondria ( dc ) , and histodenz gradient purified whole mito were separated by sds - page and immunoblotted with anti - calreticulin ( endoplasmic reticulum marker ) , anti - vdac ( mitochondrial marker ) , and anti - dsp21 antibodies .
a , sequence alignment of dsp18 and dsp21 , with identities highlighted in gray , and the amino acids of the catalytic triad ( d , c , r ) highlighted in yellow .
the active site residues ( ptp - loop ; cx5r ) are highlighted in red .
d , cos-7 cells transiently expressing amino acids 43 - 128 of dsp21 with a c - terminal egfp tag .
f , 20 g of rat testis homogenate ( hom ) , differential centrifugation purified mitochondria ( dc ) , and histodenz gradient purified whole mito were separated by sds - page and immunoblotted with anti - calreticulin ( endoplasmic reticulum marker ) , anti - vdac ( mitochondrial marker ) , and anti - dsp21 antibodies .
phosphatase activity of dsp18 and dsp21to demonstrate that dsp18 and dsp21 are catalytically active , the murine forms of dsp18 and dsp21 were expressed in bacteria , purified to homogeneity ( data not shown ) , and assayed for phosphatase activity .
kinetic analysis of dsp18-his6 and dsp21-his6 was carried out using pnpp as a substrate . dsp18 and dsp21 had km values of 0.46 and 0.92 mm and kcat / km values of 848 and 91.5 s m , respectively .
dsp18 and dsp21 hydrolyze pnpp more efficiently than the dsps mkp-3/rvh6 and ptpmt1 but not as efficiently as vaccinia h1-related protein ( vhr ; table 1 ) ( 38 - 41 ) .
mutation of the catalytic active site cysteine to serine abolished phosphatase activity of both dsp18 and dsp21 ( supplemental fig .
these results demonstrate that dsp18 and dsp21 are catalytically active phosphatases having kinetic constants consistent with other members of the dsp family of phosphatases .
table 1comparison of catalytic activity of dsp 18 and dsp 21 to other dual specific phosphatases utilizing pnppkmkcatkcat / kmmmssm dsp18a 0.46 0.39 848 dsp21a 0.92 0.084 91.5 mkp3/rvh6b 9.85 0.16 1.58 ptpmt1c 5.9 0.91 153.2 vhrd 1.59 5.2 3240 adata are from this study.bdata are from wiland et al .
comparison of catalytic activity of dsp 18 and dsp 21 to other dual specific phosphatases utilizing pnpp data are from this study .
currently there are several dsps that have been reported to dephosphorylate mapk ( 22 ) .
a recent report ( 42 ) describes dsp18 as a mapk phosphatase with the ability to dephosphorylate the p54 sapk / jnk using an overexpression system in hek-293 cells .
because we have shown that dsp18 resides in the mitochondria , we thought it was important to investigate whether endogenous sapk / jnk is localized to mitochondria where it could act as a substrate for dsp18 . because mitochondria can have different protein compositions in different tissues , we isolated mitochondria from kidney , liver , and testis .
rat tissue was isolated and separated into the following fractions : homogenate , post - nuclear supernatant , mito ( histodenz gradient - purified mitochondria ) , and post - mitochondrial supernatant .
equal amounts of each fraction were separated by sds / page and analyzed by immunoblotting with antibodies against sapk / jnk , the mitochondrial marker hsp70 , and dsp18 .
sapk / jnk was detected in the homogenate ( homo ) and post - nuclear supernatant ( pns ) and post - mitochondrial supernatant ( pms ) fractions but not in the mito fractions as compared with hsp70 and dsp18 ( fig .
the high sequence similarity between dsp18 and dsp21 led us to examine whether sapk / jnk could possibly be found in mitochondria isolated from rat testes .
similar to the kidney fractions , sapk / jnk was not detected in mitochondria isolated from testes ( fig .
moreover , sapk / jnk was not detected in mitochondria from liver tissue , which does not express dsp18 or dsp21 ( fig .
to determine whether activation of sapk / jnk was required for translocation to mitochondria , we treated hek-293a cells with 40 mj / cm of ultraviolet ( uv ) light , a known activator of the sapk / jnk pathway ( 43 ) .
after uv treatment , hek-293a cells were homogenized , and crude mito were isolated using differential centrifugation .
activation of sapk / jnk was assessed by immunoblotting against the phosphorylated forms of sapk / jnk .
phospho - sapk / jnk was detected in the whole cell lysates of irradiated cells but not in the mitochondria after uv radiation ( fig .
furthermore , we were unable to detect a change in phospho - sapk / jnk levels in uv - irradiated hek-293a cells overexpressing dsp18 when compared with a catalytically inactive mutant ( fig .
4a ) were separated by sds - page and immunoblotted with markers for om ( anti - vdac ) , and i m ( anti - ant ) .
b , 200 g of mp and smp were treated with 2.5 g of trypsin in 100 l of buffer for the indicated amounts of time .
samples were pelleted , washed , separated by sds - page , and immunoblotted with anti - dsp21 and anti - ptpmt1 .
the complex 1 subunit ndufb6 is not susceptible to trypsin digestion and was used as a loading control .
c , 100 g of smp were washed with either control buffer , high salt ( 200 mm kcl , 2 mm hepes , ph 7.2 ) , or high ph ( 0.1 m na2co3 , ph 11.5 ) buffer , repelleted , washed , and separated out by sds - page .
4a ) were separated by sds - page and immunoblotted with markers for om ( anti - vdac ) , and i m ( anti - ant ) .
b , 200 g of mp and smp were treated with 2.5 g of trypsin in 100 l of buffer for the indicated amounts of time .
samples were pelleted , washed , separated by sds - page , and immunoblotted with anti - dsp21 and anti - ptpmt1 .
the complex 1 subunit ndufb6 is not susceptible to trypsin digestion and was used as a loading control .
c , 100 g of smp were washed with either control buffer , high salt ( 200 mm kcl , 2 mm hepes , ph 7.2 ) , or high ph ( 0.1 m na2co3 , ph 11.5 ) buffer , repelleted , washed , and separated out by sds - page .
a , rat kidneys were isolated and homogenized ( hom ) , nuclei and unbroken cells were removed ( post - nuclear supernatant ( pns ) ) , mito were removed , and the post - mitochondrial supernatant ( pms ) was collected .
fractions were separated out by sds - page and immunoblotted with antibodies against both the p54 and p46 sapk / jnk isoforms , mitochondrial marker protein hsp70 , and dsp18 .
b , fractions collected from testis tissue were separated out by sds - page and immunoblotted with antibodies against sapk / jnk , hsp70 , and dsp21 .
c , fractions collected from rat liver tissue were separated out by sds - page and immunoblotted with antibodies against sapk / jnk and hsp70 .
d , hek-293a cells were homogenized ( hom ) , and mito were isolated by differential centrifugation after treatment with 40 mj / cm of uv radiation and compared with untreated controls .
fractions were separated out and immunoblotted with antibodies against phospho ( p)-sapk / jnk ( active ) , sapk / jnk , and ndufb6 .
e , hek-293a cells transfected with dsp18-egfp or a catalytic inactive mutant dsp18(c / s)-egfp .
after 24 h cells were treated with 40 mj / cm of uv radiation , and equal amounts of whole cell lysate were separated out by sds - page and analyzed for changes in sapk / jnk phosphorylation .
a , rat kidneys were isolated and homogenized ( hom ) , nuclei and unbroken cells were removed ( post - nuclear supernatant ( pns ) ) , mito were removed , and the post - mitochondrial supernatant ( pms ) was collected .
fractions were separated out by sds - page and immunoblotted with antibodies against both the p54 and p46 sapk / jnk isoforms , mitochondrial marker protein hsp70 , and dsp18 .
b , fractions collected from testis tissue were separated out by sds - page and immunoblotted with antibodies against sapk / jnk , hsp70 , and dsp21 .
c , fractions collected from rat liver tissue were separated out by sds - page and immunoblotted with antibodies against sapk / jnk and hsp70 .
d , hek-293a cells were homogenized ( hom ) , and mito were isolated by differential centrifugation after treatment with 40 mj / cm of uv radiation and compared with untreated controls .
fractions were separated out and immunoblotted with antibodies against phospho ( p)-sapk / jnk ( active ) , sapk / jnk , and ndufb6 .
e , hek-293a cells transfected with dsp18-egfp or a catalytic inactive mutant dsp18(c / s)-egfp .
after 24 h cells were treated with 40 mj / cm of uv radiation , and equal amounts of whole cell lysate were separated out by sds - page and analyzed for changes in sapk / jnk phosphorylation .
collectively these data demonstrate the mapk sapk / jnk is not localized to the same subcellular compartment as dsp18 and , therefore , is highly unlikely to be its in vivo substrate under physiological conditions .
( 42 ) on the basis of overexpression of dsp18 leads to inappropriate localization and sapk / jnk dephosphorylation .
however , we should also point out that our observations do not rule out the possibility that under specific signaling conditions sapk / jnk or dsp18 could be re - directed to a common subcellular compartment where the phosphatase could catalyze sapk / jnk dephosphorylation .
because dsp18 targets to the i m within the ims compartment , we considered whether dsp18 would be released into the cytosol upon induction of apoptosis , similar to cytochrome c ( cyt c ) .
cells treated with the nonspecific kinase inhibitor staurosporine , which induces apoptosis through a bax- and bak - mediated pathway , results in release of cyt c into the cytosol ( 44 - 46 ) .
similar results were observed using the topoisomerase ii inhibitor etoposide ( data not shown ) .
these results indicate that dsp18 translocates from the ims compartment to the cytosol upon mitochondrial om permeabilization during apoptosis .
cos-7 cells stained with anti - dsp18 ( a ) or transfected with dsp18-egfp ( b ) were chemically induced to undergo apoptosis .
cells were co - stained with anti - cyt c antibody and dapi , then visualized by if for release of cyt c from mitochondria into the cytosol .
cos-7 cells stained with anti - dsp18 ( a ) or transfected with dsp18-egfp ( b ) were chemically induced to undergo apoptosis .
cells were co - stained with anti - cyt c antibody and dapi , then visualized by if for release of cyt c from mitochondria into the cytosol .
figure 9.schematic representation of where the dual specificity phosphatases are localized to in the mitochondria .
bcl-2 , b cell lymphoma 2 ; ptp - mt1 , protein - tyrosine phosphatase localized to mitochondria 1 .
bcl-2 , b cell lymphoma 2 ; ptp - mt1 , protein - tyrosine phosphatase localized to mitochondria 1 .
mitochondria are dynamic organelles that , in addition to their role in bioenergetics , regulate numerous cellular signaling processes ranging from calcium homeostasis to programmed cell death ( 47 - 49 ) .
disruption of these key signaling events can increase the risk of age related disorders , cardiovascular disease , neurodegeneration , diabetes , and cancer ( 48 , 50 - 52 ) .
given its role in multiple cellular processes , reversible phosphorylation will also likely play a significant role in regulating mitochondrial functions .
currently there are more than 60 reports of mitochondrial phosphoproteins as well as 27 kinases and 10 phosphatases that are reportedly localized to the mitochondrion ( 10 ) .
many of the kinase and phosphatase localizations have not been rigorously examined . in the present study we have clearly shown for the first time that a dual specificity phosphatase , dsp18 , is localized to the ims compartment of mitochondria .
we also identified a highly similar phosphatase , dsp21 , as a protein selectively expressed in testes that resides within the mitochondrion .
dsp18 and dsp21 are both associated with the i m and can be released after an alkaline wash , making them classical peripheral membrane proteins . given the similarity between dsp18 and dsp21 , it is intriguing that they are located on opposing sides of the i m .
interestingly , this is not the first case of two highly similar proteins being targeted to opposite sides of the i m .
the yeast aaa proteases , yme1 and yta10 with homologs in humans , are also targeted to the i m but are oriented so they face opposing compartments ( 53 ) .
this places dsp18 and dsp21 in unique locations for regulating signaling processes within mitochondria via reversible phosphorylation ( fig .
9 ) . finally , our data suggest that dsp18 is released from the mitochondrial ims after induction of specific apoptotic signals that result in mitochondrial outer membrane permeabilization .
previously , published reports claimed that dsp18 and dsp21 are localized to the nucleus and cytoplasm ( 24 , 42 ) .
however , these were overexpression experiments utilizing n - terminal tags which have been shown to commonly disrupt the localization of mitochondrial proteins ( 54 ) .
our data demonstrate that n - terminal tags block the ability of dsp18 and dsp21 to localize to mitochondria either by interfering with the mitochondrial localization signal or translocation machinery .
additionally , previous work demonstrated that recombinant dsp18 and dsp21 exhibits in vitro phosphatase activity against mapk - like phosphopeptides , suggesting that dsp18 may have an in vivo preference for phosphorylated tyrosine residues over phospho - serine / threonine residues ( 24 ) . although preliminary data from our laboratory support this suggestion , questions still remain regarding a physiological substrate(s ) .
recent work using an overexpression system has suggested that the mapk sapk / jnk is an in vivo substrate for dsp18 ( 42 ) . however ,
this is in contrast to previously reported data demonstrating no in vivo phosphatase activity against a variety of mapks including sapk / jnk ( 24 ) .
classical mapk phosphatases contain ch2 and kinase interaction motifs , modules that allow them to recognize their mapk substrates ; however , dsp18 and dsp21 lack these binding motifs , suggesting a unique substrate recognition motif for these phosphatases ( 22 , 24 ) .
furthermore , we were unable to detect any sapk / jnk localized to the mitochondria , indicating that it is not likely a substrate for dsp18 within the ims compartment .
roughly one - third of known mitochondrial proteins do not contain classical n - terminal signal sequences ; yet , alternative import signals such as internal mitochondrial localization signal have not been well defined ( 55 , 56 ) . additionally , many proteins containing an internal mitochondrial localization signal are directed to either the om , ims , or i m ( 55 ) . for example , the ims protein cyt c and the i m protein atp / adp translocase ( ant ) both contain an internal mitochondrial localization signal ( 57 ) .
this is consistent with our finding that endogenous dsp18 and dsp21 localize to the i m ( fig .
, dsp18 is the only dsp shown to localize to the ims compartment , whereas dsp21 is the second dsp to be found predominantly within the matrix ; therefore , they are in distinctive locations for regulating the function of mitochondrial processes by dephosphorylation of proteins both within the ims and the matrix .
our data shows that dsp18 is released from the mitochondrial i m of the ims after induction of apoptotic events .
because dsp18 is tightly associated with the i m , its release into the cytosol after om permeabilization is likely not an artifact . unlike cyt c
, there is precedence for ims proteins such as apoptosis - inducing factor to require proteolysis to enable release ( 58 ) .
dsp18 is in a unique position to regulate signaling processes after its liberation into the cytosol , or perhaps its release into the cytosol allows for key phosphorylation events to take place in the ims to potentiate the apoptotic process .
further exploration of the substrate for dsp18 as well as mouse knock - out models should elucidate its role(s ) in mitochondrial biology as well as in apoptotic processes .
thus , dsp18 and dsp21 are in different , but intriguing , mitochondrial compartments to regulate signaling processes .
although few ptps have well defined in vivo substrates , our work , which rigorously determines their location within mitochondria , dramatically narrows the number of potential phosphoprotein substrates .
further exploration of the substrates for dsp18 and dsp21 should elucidate their role(s ) in mitochondrial biology .
|
although large - scale approaches have identified numerous mitochondrial phosphoproteins , little is known about the mitochondrial kinases and phosphatases that regulate these phosphoproteins . here , we identify two members of the atypical dual specificity phosphatases ( dsp ) , dsp18 and dsp21 , that are localized in mitochondria .
although dsp18 is widely expressed in several mammalian tissues , dsp21 is selectively expressed in the testes .
we demonstrate that dsp18 and dsp21 are targeted to mitochondria by cryptic internal localization signals .
subfractionation of mitochondria demonstrated that dsp18 is located in the intermembrane space as a peripheral membrane protein of the inner membrane .
in contrast , subfractionation of rat testis mitochondria revealed dsp21 is localized to the matrix as a peripheral membrane protein of the inner membrane .
moreover , we demonstrate that a previously reported substrate for dsp18 , the stress - activated protein kinase , does not localize to mitochondria in several different tissues , making it an unlikely substrate for dsp18 .
finally , we show that induction of apoptosis by treatment with staurosporine causes translocation of dsp18 from the intermembrane space into the cytosol similar to other apoptogenic factors such as cytochrome c. this work rigorously demonstrates the unique location of two highly similar dsps on opposing sides of the mitochondrial inner membrane .
|
the
mechanism of the wittig reaction of anisaldehyde with a stabilized
ylide was studied by a combination of 13c kinetic isotope
effects , conventional calculations , and molecular dynamics calculations
in a cluster of 53 thf molecules .
the isotope effects support a cycloaddition
mechanism involving two sequential transition states associated with
separate c c and p o bond formations .
however , the betaine
structure in between the two transition states is bypassed as an equilibrated
intermediate in most trajectories . the role of the dynamics of solvent
equilibration in the nature of mechanistic intermediates is discussed .
|
|
asthma is a common chronic disease of children and adults which is characterized by airway inflammation , hyperreactivity , mucus overproduction and airway obstruction .
epithelial cell mucus production is increased in asthma , and plugging of the airways with mucus is prominent and sometimes fatal for severe asthma exacerbations .
setting , t - helper 2 ( th2 ) cells and other cells produce interleukin-13 ( il-13 ) and il-4 , cytokines those act directly on airway epithelial cells to induce mucus production and airway hyperreactivity .
changes in the airway surface liquid ( asl ) that covers the epithelium can cause airway disease .
ciliary beating and coughing propel asl toward the upper airways thereby removing mucus and inhaled pathogens and particles .
asl thickness is regulated by active ion transport across epithelial cells . in cystic fibrosis ( cf ) , mutations in the cystic fibrosis transmembrane conductance regulator ( cftr ) gene result in decreased chloride secretion , which leads to asl dehydration , impaired mucus clearance , and airway inflammation and obstruction .
similar pathology was seen with asl dehydration in mice with transgenic overexpression of the epithelial sodium channel ( enac ) .
il-13 or il-4 stimulation alters chloride conductance and converts human bronchial epithelial cells from an absorptive to a secretory phenotype , which may help to flush particulates and mucus from the airway lumen . both airway hyperreactivity and inflammation
mechanistic relationships among asl hydration , airway inflammation , and airway obstruction and hyperreactivity are complex and incompletely understood despite extensive analysis of various asthma and cf models .
it is clear that airway epithelial cells can affect inflammation by producing cytokines that affect maturation and recruitment of eosinophils and other leukocytes .
the results reported provide a basis for future studies aimed at developing and testing pendrin inhibitors for use in asthma exacerbations .
therefore , extensive researches on the channel that contributed to the genesis or therapy of the disease have been carried out over the last 30 years . the review focus on enac / chlorine ion channel associated with asthma pathogenesis and
clinical manifestations has been evaluated in molecular , genetic , animal model or human studies .
the conducting airways are the primary interface between the extracellular environment and the lung , which play a major role in host defense .
mucus clearance is a central component of the innate defense system of the lung . during normal mucus clearance ,
inhaled pathogens and particles become trapped in the mucus layer and are then expelled before they can colonize in the airways .
the rate of mucociliary clearance ( mcc ) is strongly influenced by the hydration state of the asl and mucus layers .
mucus hydration is set by the volume of liquid present on the airway surfaces , which may be modified by active ion transport processes in both the superficial epithelium and glands .
secretion is mediated by the apical membrane cl channels ( cftr ) while absorption requires enac .
ion channels , including cftr and enac , play a significant role in the maintenance of asl .
molecular cloning has confirmed that the sodium channel ( enac ) has , , and subunits in mammalian respiratory epithelial .
epithelial sodium channel participates in maintaining appropriate salt and water balance by reabsorbing na at the apical membrane , thereby creating an osmotic gradient that facilitates the reabsorption of fluid [ figure 1 ] . in the lung ,
the airway epithelium shows enac / cftr associated with asthma pathophysiology . the cftr is a kind of cl channel in epithelial membrane regulated by phosphorylation , which is located primarily in the airway epithelial cells of apical membrane [ figure 1 ] .
due to its help of the cl and hco3
travel across the plasma membrane and epithelial salt transport , it plays an important role in regulating water flow and ion concentration , and adjusting the ph value of mucus .
patients with cftr functional defects have low efficiency in mucus secretion , mucus clearance , and mucus transport , which may easy to induce airway inflammation and airway mucus plugs .
cystic fibrosis transmembrane conductance regulator as camp dependent cl channel , also controls the other type of ion channels , including epithelial cl and na channels , and atp transporter .
studies have reported oxidant stress affect the secretion of cl and the function of cftr .
enac interact with cftr , cftr could down - regulate enac in physiological conditions and compromise the function of enac .
nevertheless , it could mutate in pathological condition , which enhances enac 's function , raises the expression of cftr .
asthma is associated with airway hyperresponsiveness ( ahr ) , which leads to recurrent episodes of shortness of breath , coughing , and wheezing . at the pathophysiological level , asthma results from complex biological interactions between different cell types , both resident ( i.e. , epithelial and smooth muscle cells ) and circulating ( mainly immune cells ) , and environmental factors such as allergens , infections , and tobacco smoke .
a key element in this pathophysiological process is the th2 cell , which orchestrates chronic inflammation , smooth muscle contraction , and airway remodeling .
another key feature is a defective airway epithelium , facilitating allergen contact with mucosal antigen - presenting dendritic cells , which in turns will promote a th2 cell phenotype .
the channel response of osmotic pressure and mucus cilia clearance is associated with the activity of ion channels .
cftr and enac , as an important channel for epithelial fluid and electrolyte transport , play a key role in the ahr diseases .
it is closely related to the repair process and airway remodeling after epithelial inflammatory damage . in the pathophysiological process of asthma
early studies of asthma mainly concentrated in the role of the contraction of airway smooth muscle ( asm ) .
enac and cftr participate in airway epithelial permeation , repair and barrier function in the airway . cftr dysfunction caused by the change of the cl and na channel activity lead to airway mucus obstruction , infection and inflammation .
abnormal epithelial mucus secretion increases in asthma , at the same time epithelial injury induces ahr , aggravate airway remodeling .
cl is one of the most abundant anions , chloride ion channel is distributed in cell membranes and organelles membrane as a transmembrane protein .
in addition to the cftr , cl channel - gating depends on many factors , including transmembrane voltage , cell swelling , cross - linking with signal molecules , cell phosphorylation residue or atp combination and hydrolysis caused by various ions and protein kinase . on the one hand , it is associated with the electric charge transport , such as current flows in the channel .
for example , cl current in cytoplasmic membrane is very important for adjusting the excitability of nerve and muscle , in addition , in the acute attack of asthma .
one mechanism of atomization inhalation drug therapy is increasing the expression of enac . the current flow in intracellular cl channel not only guarantees h - atpase electrically neutral transport in the lacuna of some cell but also is very important for regulating cell capacity . at the same time , blood ph value increases , serum lactic acid levels decrease , which are beneficial for the body recover . in the airways ,
ion channels have been linked to tight junction formation , epithelial permeability , or repair , considering that these ion channel - dependent cell processes are common denominators in asthma pathophysiology , their study ( either measuring function or expression levels ) in asthmatic airways or in animal models may provide novel insights into the pathogenesis of the disorder .
the airway epithelium shows enac / cftr associated with asthma pathophysiology [ figure 1 ] .
an important feature of asthma is excessive hyperplasia of goblet cells and mucus secretion that are key features contributing to airflow obstruction in the clinical syndrome of asthma .
previous in vitro studies demonstrated that th2 cytokines act as potent modulators of epithelial ion transport and fluid secretion .
autopsy showed that the airway in patients with acute asthma deaths has excessive hyperplasia of goblet cells and secretion of mucus .
the excessive airway mucus secretion is one of the leading causes of death in severe asthma .
studies have also confirmed that the excessive mucus secretion is an independent risk factor for the decline of forced expiratory volume in 1 s in asthmatic patients . na and cl channel in respiratory epithelium control water and salt transport across the membrane to adjust the asl composition , thickness , and mucus - cilium swings .
enac is distributed in cavity roof membrane in epithelial cells in all levels of the respiratory tract ( from the nasopharynx to bronchioles ) .
it has tissue specificity in respiratory enac and is regulated with local , systemic and genetic factors , and it is mainly responsible for maintaining the volume of asl ( thickness ) .
the active transport of na is divided into two stages ; first of all , na on the cell basal surface has been actively transported from cytoplasm to the stroma , resulting in electrochemical gradient which prompted na from lumen on the top surface transferred to the cytoplasm by enac .
the osmotic pressure of na transport drives the water molecules across the membrane as passive transport [ figure 1 ] .
pseudo - hypoaldosteronism patients have decreased sodium reabsorption function and increased watery secretion , 99m - tc scanning suggests mucosa of the abnormal - lung cilia showed greater clearance rate .
in addition to the disorder of secretion in cl , patients with lung cf have enhanced reabsorption function of enac which easily lead to bacterial engraftment and infection .
blocking enac may reduce airway water reabsorption , and increase mucus moist . as amiloride , an ion channel regulator by inhibition of sodium reabsorption of epithelial cells and the secretion of chloride ion , can maintain hydration of epithelial cells on the surface , promote the role of mucous blanket mobile .
epithelial cl channel is distributed in airway epithelial cells and the top of the cavity of submucosal cell , including camp - activated cl channels and ca activated cl channels .
the former is also called cftr , which could reduce the secretion of cl when mutations happened , leading to secondary water reduction within cavity passage , increased proportion of water and salt in mucin , and sticky mucus .
the latter is called calcium - activated chloride channel ( cacc ) channel , the channel has a very close relationship with asthma goblet cell hyperplasia , excessive airway mucus secretion , mucin gene expression and high reactivity in the airway .
a number of studies have shown that blocking cacc gene can reduce the expression of mucin gene and the mucus secretion .
its expression is linked to changes in inflammation rather than changes in blood pressure / volume .
enac can also be controlled by intracellular factors including ph , lipids , and protein kinase a ( pka ) , which may affect the number of enacs inserted into the plasma membrane as well as affect gating .
it can be combined with specific gc receptor ( gr ) in the cell , which makes the gr complex dissociate , then gr is transferred to the nucleus to combine with grbs ( gc response element ) of the dna .
it regulates the expression of enac at the level of transcription , translation after transcription and protein .
the main physiological channels for activating ion channels are increased receptor - mediated camp and secondary activation of pka . in the acute asthma attacking , the mechanism of systemic or local gc is to increase the intracellular camp , phosphorylate cell , to enhance enac expression and to increase its function .
sodium - water transport with enac is a process of energy consumption , in case of lack of oxygen , it can increase the intracellular reactive oxygen content , the shortage of the energy will bring down the role of enac .
ulinastatin can be used to reverse the inhibition of enac-mrna and protein expression due to the lack of oxygen , and has some relevance with the concentration . in these drugs
those regulate the function of enac , agonists can make the enac gene expression increased , promote the protein phosphorylation , and inhibit the degradation of enac . it has been reported the specific chloride channel inhibitors not only inhibit the il-13 induction of goblet cell hyperplasia , but also suppress the ahr and the infiltration of eosinophilic .
demonstrate that allergic inflammation enhanced basal cl secretion in both airway regions and inhibited enac - mediated na absorption and increased ca - dependent cl secretion in bronchi .
studies demonstrate that th2-dependent airway inflammation produced a pro - secretory ion transport phenotype in vivo .
these results suggest that th2-mediated fluid secretion may improve airway surface hydration and clearance of mucus that is hypersecreted in allergic airway diseases such as asthma .
these results indicate that the coordinate increase in fluid and mucin secretion in th2-driven airway inflammation may provide a protective mechanism to promote mucus clearance and prevent airway mucus plugging in the presence of mucus overproduction in allergic airway disease .
it suggests that dysregulation of this epithelial response may provide a clue to severe airway mucus plugging in fatal asthma .
taken together , these studies suggested that selected th2 cytokines may be involved in the regulation of asl volume to improve mucus hydration and promote mcc in allergic airway disease .
the information exchange between airway epithelial cells and immune inflammatory cells may play an important role in the local mucosal regulation of the immune system .
the remodeling of epithelial cells during the repair process after injury could cause a new signal transduction pathway , shielding the body 's normal t - cell immune tolerance mechanism - induced by the allergens thus promote the development of the local mucosal immune inflammation .
the change of highly active genes within the network and its environment may induce it to form new genes in epithelia cells and new molecular link between airway mucosal immunity and inflammation which may be important for the development of refractory asthma .
researches have shown the relation between epithelial cells and smooth muscle cells , it may involve with ion channel transport , which still needs further research .
na and cl channel in respiratory epithelium control water and salt transport across the membrane to adjust the asl composition , thickness , and mucus - cilium swings .
enac is distributed in cavity roof membrane in epithelial cells in all levels of the respiratory tract ( from the nasopharynx to bronchioles ) .
it has tissue specificity in respiratory enac and is regulated with local , systemic and genetic factors , and it is mainly responsible for maintaining the volume of asl ( thickness ) .
the active transport of na is divided into two stages ; first of all , na on the cell basal surface has been actively transported from cytoplasm to the stroma , resulting in electrochemical gradient which prompted na from lumen on the top surface transferred to the cytoplasm by enac .
the osmotic pressure of na transport drives the water molecules across the membrane as passive transport [ figure 1 ] .
pseudo - hypoaldosteronism patients have decreased sodium reabsorption function and increased watery secretion , 99m - tc scanning suggests mucosa of the abnormal - lung cilia showed greater clearance rate .
in addition to the disorder of secretion in cl , patients with lung cf have enhanced reabsorption function of enac which easily lead to bacterial engraftment and infection .
blocking enac may reduce airway water reabsorption , and increase mucus moist . as amiloride , an ion channel regulator by inhibition of sodium reabsorption of epithelial cells and the secretion of chloride ion , can maintain hydration of epithelial cells on the surface , promote the role of mucous blanket mobile .
epithelial cl channel is distributed in airway epithelial cells and the top of the cavity of submucosal cell , including camp - activated cl channels and ca activated cl channels .
the former is also called cftr , which could reduce the secretion of cl when mutations happened , leading to secondary water reduction within cavity passage , increased proportion of water and salt in mucin , and sticky mucus . the latter is called calcium - activated chloride channel ( cacc ) channel , the channel has a very close relationship with asthma goblet cell hyperplasia , excessive airway mucus secretion , mucin gene expression and high reactivity in the airway .
a number of studies have shown that blocking cacc gene can reduce the expression of mucin gene and the mucus secretion .
its expression is linked to changes in inflammation rather than changes in blood pressure / volume .
enac can also be controlled by intracellular factors including ph , lipids , and protein kinase a ( pka ) , which may affect the number of enacs inserted into the plasma membrane as well as affect gating .
it can be combined with specific gc receptor ( gr ) in the cell , which makes the gr complex dissociate , then gr is transferred to the nucleus to combine with grbs ( gc response element ) of the dna .
it regulates the expression of enac at the level of transcription , translation after transcription and protein .
the main physiological channels for activating ion channels are increased receptor - mediated camp and secondary activation of pka . in the acute asthma attacking , the mechanism of systemic or local gc is to increase the intracellular camp , phosphorylate cell , to enhance enac expression and to increase its function .
sodium - water transport with enac is a process of energy consumption , in case of lack of oxygen , it can increase the intracellular reactive oxygen content , the shortage of the energy will bring down the role of enac .
ulinastatin can be used to reverse the inhibition of enac-mrna and protein expression due to the lack of oxygen , and has some relevance with the concentration . in these drugs
those regulate the function of enac , agonists can make the enac gene expression increased , promote the protein phosphorylation , and inhibit the degradation of enac . it has been reported the specific chloride channel inhibitors not only inhibit the il-13 induction of goblet cell hyperplasia , but also suppress the ahr and the infiltration of eosinophilic .
demonstrate that allergic inflammation enhanced basal cl secretion in both airway regions and inhibited enac - mediated na absorption and increased ca - dependent cl secretion in bronchi .
studies demonstrate that th2-dependent airway inflammation produced a pro - secretory ion transport phenotype in vivo .
these results suggest that th2-mediated fluid secretion may improve airway surface hydration and clearance of mucus that is hypersecreted in allergic airway diseases such as asthma .
these results indicate that the coordinate increase in fluid and mucin secretion in th2-driven airway inflammation may provide a protective mechanism to promote mucus clearance and prevent airway mucus plugging in the presence of mucus overproduction in allergic airway disease .
it suggests that dysregulation of this epithelial response may provide a clue to severe airway mucus plugging in fatal asthma .
taken together , these studies suggested that selected th2 cytokines may be involved in the regulation of asl volume to improve mucus hydration and promote mcc in allergic airway disease .
the information exchange between airway epithelial cells and immune inflammatory cells may play an important role in the local mucosal regulation of the immune system .
the remodeling of epithelial cells during the repair process after injury could cause a new signal transduction pathway , shielding the body 's normal t - cell immune tolerance mechanism - induced by the allergens thus promote the development of the local mucosal immune inflammation .
the change of highly active genes within the network and its environment may induce it to form new genes in epithelia cells and new molecular link between airway mucosal immunity and inflammation which may be important for the development of refractory asthma .
researches have shown the relation between epithelial cells and smooth muscle cells , it may involve with ion channel transport , which still needs further research .
studies have shown that dietary salt intake , sodium of blood and urine affect enac expression , is intimately related to the onset of hypertension , likewise , it has relation with the asthma attack and its phenotypic .
the data from studies examining airway function in the context of asthma and dietary salt intake demonstrate a weak association between salt intake and increased airway reactivity and are controversial .
epidemiological studies have reported increase in asthma mortality rate is associated with high salt intake .
in addition , the use of histamine excitation for measuring shows that airway reactivity is related to the rise in 24 h urine sodium secretion .
's studies were not observed the correlation between 24 h urine sodium secretion and airway reactivity .
furthermore , extensive studies of the plasma of individuals with allergic asthma and/or allergic rhinitis revealed the existence of a hematogenous factor that leads to the accumulation of na within platelets , reduces the absorption of the cation , as well as the na / k pump common activity .
interestingly , there has good correlation between plasma suppression level and the degree of observed airway reactivity .
the researchers also found that allergic is associated with the change of intracellular na homeostasis .
tribe et al . reported that levels of na influx into isolated peripheral blood mononuclear cells ( pbmcs ) were associated with the levels of airway responsiveness .
these data were confirmed by two more recent studies that reported an association between na / k pump inhibition and resulting intracellular na accumulation and increased severity of airway dysfunction .
it is apparent that allergy is associated with elevated serum levels of an endogenous inhibitor of the na / k pump , which can lead to an accumulation of intracellular na associated with atopy .
thus , it may contribute to airway dysfunction by elevating cytosolic levels of na , thereby promoting ca influx via reverse - mode na / ca activity and increasing tone .
in addition , contraction of asm , the association also has limitations , this phenomenon does not seem to be limited to airway dysfunction associated with atopy .
the exact nature of the hematogenous factor associated with inhibition of the na / k pump in allergy has yet to be completely elucidated .
high - serum lpc levels have been associated with increased asthma severity and increased accumulation of na in pbmcs and leukocytes . during ventilation , inhaled air
is conditioned ( i.e. , warmed and humidified ) by contact with the inner epithelial layer and its associated mucous coating .
when the intensity of ventilation increases , as during exercise , the conditioning capacity of the airways is taxed , resulting in a reduced capacity to humidify inhaled air and an increase in mucosal osmolarity ( i.e. , mucous dehydration ) .
the net result of airway dehydration is the activation of resident airway inflammatory cells ( e.g. , mast cells ) and increasing the release of inflammatory mediators ( e.g. , histamine , leukotrienes , and prostaglandins ) that trigger contraction of the asm .
although the role of dietary sodium in the modulation of asthma , its associated ahr is unclear .
recent evidence suggests that dietary sodium can potentiate exercise - induced bronchoconstriction ( eib ) .
gotshall et al . reported that low - salt diets improved and high - salt diets worsened postexercise pulmonary function in individuals with diagnosed eib ( or exercise - induced asthma ) as measured by spirometry .
mickleborough and fogarty reported that high - salt diets decreased arterial blood oxygen saturation during intense exercise ( i.e. , 90% of predicted maximum heart rate in individuals with eib ) . in a well - designed follow - up study ( double - blinded placebo - controlled trial ) , it was revealed that a low - salt diet attenuates some of the inflammation associated with eib ( e.g. , attenuation of increases in sputum levels of eosinophil cation protein , il-1 , and il-8 but not cysteinyl leukotrienes c4-e4 , leukotriene b4 , or prostaglandin d2-methoxime ) .
taken together , it appears that increases in dietary salt may worsen the inflammatory status in the airways of individuals with eib , leading to the release of mediators that trigger contraction of the asm , thus resulting in airway dysfunction .
this may act in concert with changes in mucous osmolarity that decrease the ability of the airways to condition inhaled air .
both atopy and high - salt diets are associated with altered cellular na homeostasis that appears to result from an inhibition of the na / k pump .
dietary sodium alters airway function by elevating systemic levels of endogenous ouabain that in turn inhibit the na / k pump .
the resulting accumulation of na within asm cells triggers membrane depolarization and ca influx via the reverse - mode of the na / ca .
future population studies must consider the possibility that the level of airway dysfunction observed in response to salt loading may vary considerably , just as is observed in salt - sensitive hypertension .
in addition , to elucidate the mechanism of this effect , investigations will need to pay more attention to salt sensitive airway obstruction in the future .
the data from studies examining airway function in the context of asthma and dietary salt intake demonstrate a weak association between salt intake and increased airway reactivity and are controversial .
epidemiological studies have reported increase in asthma mortality rate is associated with high salt intake .
in addition , the use of histamine excitation for measuring shows that airway reactivity is related to the rise in 24 h urine sodium secretion .
's studies were not observed the correlation between 24 h urine sodium secretion and airway reactivity .
furthermore , extensive studies of the plasma of individuals with allergic asthma and/or allergic rhinitis revealed the existence of a hematogenous factor that leads to the accumulation of na within platelets , reduces the absorption of the cation , as well as the na / k pump common activity .
interestingly , there has good correlation between plasma suppression level and the degree of observed airway reactivity .
the researchers also found that allergic is associated with the change of intracellular na homeostasis .
tribe et al . reported that levels of na influx into isolated peripheral blood mononuclear cells ( pbmcs ) were associated with the levels of airway responsiveness .
these data were confirmed by two more recent studies that reported an association between na / k pump inhibition and resulting intracellular na accumulation and increased severity of airway dysfunction .
it is apparent that allergy is associated with elevated serum levels of an endogenous inhibitor of the na / k pump , which can lead to an accumulation of intracellular na associated with atopy .
thus , it may contribute to airway dysfunction by elevating cytosolic levels of na , thereby promoting ca influx via reverse - mode na / ca activity and increasing tone .
in addition , contraction of asm , the association also has limitations , this phenomenon does not seem to be limited to airway dysfunction associated with atopy .
the exact nature of the hematogenous factor associated with inhibition of the na / k pump in allergy has yet to be completely elucidated .
high - serum lpc levels have been associated with increased asthma severity and increased accumulation of na in pbmcs and leukocytes .
during ventilation , inhaled air is conditioned ( i.e. , warmed and humidified ) by contact with the inner epithelial layer and its associated mucous coating . when the intensity of ventilation increases , as during exercise , the conditioning capacity of the airways is taxed , resulting in a reduced capacity to humidify inhaled air and an increase in mucosal osmolarity ( i.e. , mucous dehydration ) .
the net result of airway dehydration is the activation of resident airway inflammatory cells ( e.g. , mast cells ) and increasing the release of inflammatory mediators ( e.g. , histamine , leukotrienes , and prostaglandins ) that trigger contraction of the asm .
although the role of dietary sodium in the modulation of asthma , its associated ahr is unclear .
recent evidence suggests that dietary sodium can potentiate exercise - induced bronchoconstriction ( eib ) .
gotshall et al . reported that low - salt diets improved and high - salt diets worsened postexercise pulmonary function in individuals with diagnosed eib ( or exercise - induced asthma ) as measured by spirometry .
mickleborough and fogarty reported that high - salt diets decreased arterial blood oxygen saturation during intense exercise ( i.e. , 90% of predicted maximum heart rate in individuals with eib ) . in a well - designed follow - up study ( double - blinded placebo - controlled trial ) , it was revealed that a low - salt diet attenuates some of the inflammation associated with eib ( e.g. , attenuation of increases in sputum levels of eosinophil cation protein , il-1 , and il-8 but not cysteinyl leukotrienes c4-e4 , leukotriene b4 , or prostaglandin d2-methoxime ) .
taken together , it appears that increases in dietary salt may worsen the inflammatory status in the airways of individuals with eib , leading to the release of mediators that trigger contraction of the asm , thus resulting in airway dysfunction .
this may act in concert with changes in mucous osmolarity that decrease the ability of the airways to condition inhaled air .
both atopy and high - salt diets are associated with altered cellular na homeostasis that appears to result from an inhibition of the na / k pump .
dietary sodium alters airway function by elevating systemic levels of endogenous ouabain that in turn inhibit the na / k pump .
the resulting accumulation of na within asm cells triggers membrane depolarization and ca influx via the reverse - mode of the na / ca .
future population studies must consider the possibility that the level of airway dysfunction observed in response to salt loading may vary considerably , just as is observed in salt - sensitive hypertension . in addition , to elucidate the mechanism of this effect , investigations will need to pay more attention to salt sensitive airway obstruction in the future .
the cftr gene mutations and the cl channel function disorder have been confirmed that affect the phenotype of asthma directly or indirectly , but the results are different for different people .
dahl et al . found a significant association between asthma and f508 heterozygosity and concluded that f508 heterozygosity is over - represented among asthmatics . in the same year , lowenfels et al .
conducted a multinational analysis in 1113 obligate cftr gene mutation heterozygotes and 688 controls and found that prevalence of asthma in cf heterozygotes was 9.6% that was similar with that reported by dahl et al .
revealed the potential relationship between cftr gene mutation in asian patients ( singaporean chinese ) with severe asthma .
significantly higher frequency of cftr mutations among patients with unaffected controls suggests that these mutations may increase the risk for disease .
however , the studies in barcelona found no obvious correlation between both . in the norwegian environment and childhood asthma study ,
no significant association was found in asthma , reduced lung function , bronchial hyperresponsiveness or feno levels and cf heterozygosity or the modulating polymorphism .
control study conducted in korea , no significant differences were found in genotype and allele frequencies of the 9 polymorphisms observed between the nonasthma and asthma groups .
several studies done in context with asthma and cftr gene mutation , have found increased ige level and positive skin prick test among asthma patients .
but these findings do not suggest the association of cftr gene mutations with atopic asthma as most of the studies observed .
it is still needed large sample and detailed phenotypic study in order to clear cftr role in asthma incidence .
cystic fibrosis transmembrane conductance regulator dysfunction alters physiological functions of both surface and submucosal gland of epithelium , which leads to salt and water imbalance across airway epithelium , depleted surface liquid layer , and impaired mcc .
impaired mcc , together with cftr - related changes in the airway surface microenvironment , leads to a progressive cycle of infection , inflammation , and declining lung function .
lung disease results from clogging of the airways , mucus build - up , decreased mcc and inflammation .
poor mcc with excessive mucus production causes obstructive lung disease such as asthma and chronic bacterial infections leading to respiratory failure that is major cause of mortality .
in fact , due to missing or low diagnosis level , cf is considered a rare disease in china , but with the progress of diagnosis technology , there has been increased evidence that the cf exists in china .
the cftr gene mutations and the cl channel function disorder have been confirmed that affect the phenotype of asthma directly or indirectly , but the results are different for different people .
dahl et al . found a significant association between asthma and f508 heterozygosity and concluded that f508 heterozygosity is over - represented among asthmatics . in the same year , lowenfels et al .
conducted a multinational analysis in 1113 obligate cftr gene mutation heterozygotes and 688 controls and found that prevalence of asthma in cf heterozygotes was 9.6% that was similar with that reported by dahl et al .
revealed the potential relationship between cftr gene mutation in asian patients ( singaporean chinese ) with severe asthma .
significantly higher frequency of cftr mutations among patients with unaffected controls suggests that these mutations may increase the risk for disease .
however , the studies in barcelona found no obvious correlation between both . in the norwegian environment and childhood asthma study ,
no significant association was found in asthma , reduced lung function , bronchial hyperresponsiveness or feno levels and cf heterozygosity or the modulating polymorphism .
control study conducted in korea , no significant differences were found in genotype and allele frequencies of the 9 polymorphisms observed between the nonasthma and asthma groups .
several studies done in context with asthma and cftr gene mutation , have found increased ige level and positive skin prick test among asthma patients .
but these findings do not suggest the association of cftr gene mutations with atopic asthma as most of the studies observed .
it is still needed large sample and detailed phenotypic study in order to clear cftr role in asthma incidence .
cystic fibrosis transmembrane conductance regulator dysfunction alters physiological functions of both surface and submucosal gland of epithelium , which leads to salt and water imbalance across airway epithelium , depleted surface liquid layer , and impaired mcc .
impaired mcc , together with cftr - related changes in the airway surface microenvironment , leads to a progressive cycle of infection , inflammation , and declining lung function .
lung disease results from clogging of the airways , mucus build - up , decreased mcc and inflammation .
poor mcc with excessive mucus production causes obstructive lung disease such as asthma and chronic bacterial infections leading to respiratory failure that is major cause of mortality .
in fact , due to missing or low diagnosis level , cf is considered a rare disease in china , but with the progress of diagnosis technology , there has been increased evidence that the cf exists in china .
multiple pathogenic factors such as inflammation , allergy , cytokines , and environment , lead to mucosal enac / cftr abnormalities .
therefore , dysfunction in ion channels changes asl and the amount of mucus in airway epithelium .
cftr / enac channels participate in fluid secretion and reabsorption , and could play a role in pathogenesis of asthma exacerbations .
ion channels have been the center of many studies aiming to understand asthma pathophysiological mechanisms or to identify therapeutic targets for better control of the disease .
|
objective : to focus on the asthmatic pathogenesis and clinical manifestations related to epithelial sodium channel ( enac)/chlorine ion channel.data sources : the data analyzed in this review were the english articles from 1980 to 2015 from journal databases , primarily pubmed and google scholar .
the terms used in the literature search were : ( 1 ) enacs ; cystic fibrosis ( cf ) transmembrane conductance regulator ( cftr ) ; asthma / asthmatic , ( 2 ) enac / sodium salt ; cf ; asthma / asthmatic , ( 3 ) cftr / chlorine ion channels ; asthma / asthmatic , ( 4 ) enac / sodium channel / scnn1a / scnn1b / scnn1g / scnn1d / amiloride - sensitive / amiloride - inhibtable sodium channels / sodium salt ; asthma / asthmatic , lung / pulmonary / respiratory / tracheal / alveolar , and ( 5 ) cftr ; cf ; asthma / asthmatic ( ti).study selection : these studies included randomized controlled trials or studies covering asthma pathogenesis and clinical manifestations related to enac / chlorine ion channels within the last 25 years ( from 1990 to 2015 ) . the data involving chronic obstructive pulmonary disease and cf obtained from individual studies were also reviewed by the authors.results:airway surface liquid dehydration can cause airway inflammation and obstruction .
enac and cftr are closely related to the airway mucociliary clearance .
ion transporters may play a critical role in pathogenesis of asthmatic exacerbations.conclusions:ion channels have been the center of many studies aiming to understand asthmatic pathophysiological mechanisms or to identify therapeutic targets for better control of the disease .
|
the sequence of the human amyloid beta peptide , a(1 - 42 ) , in single - letter code , is : d1agfrh6dsgy10evh13h14qklvffaed - vgsnkgaiiglm35vggvvia42
cupric ion ( cu ) forms a 1 : 1 complex with a(1 - 40 ) or a(1 - 42 ) with approximately picomolar or nanomolar affinity ( k
d
= 1 10 m for a(1 - 42 ) ; k
d
= 57 5 10 m for a(1 - 40 ) ) .
the presence of added or in vivo buffers may lower the effective affinity to a considerable extent [ 1 , 3 ] .
the cu(ii ) is bound as type 2 , that is , distorted square planar arrangements of ligands with possibly one or two additional axial ligands .
epr measurements indicate a 3n1o equatorial coordination pattern . at room temperature , two [ 3 , 57 ] or three forms
the lower ph component is referred to as component i ( or ia and ib ) while the higher ph component is component ii , all with 3n1o coordination .
it is likely that the three n ligands are due to a combination of the imidazole groups of his6 , his13 , his14 , a deprotonated amide n , and the n - terminus since these are the most common ligands for copper bound in proteins .
indeed , there is direct evidence , obtained by esr experiments on a(1 - 16 ) in which the histidines were isotopically enriched with n , that all three his residues bind to cu(ii ) at physiological ph = 7.4 [ 1012 ] .
the origin of the o ligand is a subject of some debate , although tyr10 , glu3 , asp7 , and glu11 have been ruled out , as has water . on the basis of hyperfine sublevel correlation ( hyscore )
spectroscopy applied to site - specific c and n labeled a(1 - 16 ) , the carbonyl of ala2 is implicated as the o ligand in the coordination mode at higher ph = 8.0 ( component ii ) , along with all three his residues .
ph ( ph = 8.79 ) , studies by both epr and nmr on labeled compounds seem to indicate that deprotonation and coordination of the amide n of ala2 occurs , together with the n - terminal nh2 and one or two his side chains .
hureau and faller and coworkers [ 6 , 7 ] assigned this high ph structure as component ii , but it is at odds with the structure deduced by others at physiological ph that does not involve the n - terminus and was designated component ii .
there is general but not universal agreement that the n - terminus is also part of the native a/cu binding site , although the nature of its involvement is still unclear . in an earlier study ,
karr and coworkers found that copper binding to a was sensitive to changes in the n - terminus , including deletion , but , in a subsequent study , they note that removal or mutation of asp1 does not disrupt the equatorial coordination sphere .
they propose that the n - terminus participates via hydrogen bonding to an axial ligand .
kowalik - jankowska et al . carried out potentiometric and spectroscopic measurements on both human and mouse a(1 - 16 ) and a(1 - 28 ) over a wide ph range , 2.510.5 , and noted a significant shift in the coordination pattern upon acetylation of the n - terminus in all cases . barnham and coworkers used multifrequency cw - epr spectroscopy applied to site - specific n - labeling at asp1 , his6 , his13 , and his14 of a(1 - 16 ) to deduce the presence at ph = 6 - 7 of two independent 3n1o cu coordination modes both of which incorporated the n - terminal nh2 group , an o atom , his6 , but only one of his13 ( component ia ) or his14 ( component ib ) . on the other hand , hong et al .
, propose that the 3n1o coordination arises from an equilibrium between three structures at ph = 6.57.4 that all incorporate , beside an o atom , the n - terminal nh2 group , his6 , and either a deprotonated backbone amide residue or one of his13 or his14 , but not simultaneously his13 and his14 .
both low ph results are in qualitative agreement with the structure assigned to component i at ph = 6 by hureau and faller and coworkers who proved coordination of the nh2 and carbonyl groups of asp1 together with his6 and one of his13 and his14 . besides being highly ph dependent , indications are that copper coordination is probably size dependent as well .
uniformly n - labelled a(1 - 40 ) at ph = 7.3 found that the asp1 signals were not shifted upon addition of cu and seem to indicate that the n - terminus is not involved in copper binding at all . on the basis of ab initio computations on model systems
, we have previously proposed that the primary binding site of cu(ii ) to a is his13his14 which provide two of the three observed n ligands through n of the imidazole groups . by our procedures , we could not verify the presence or absence of the carbonyl o atom of ala2 as has been proposed experimentally . however , in the computations , the o of the intervening amide group ( o of his13 ) inevitably became coordinated to the cu(ii ) .
o of the 3n1o coordination pattern and that the third n was probably that of his6 or asp1 .
possibly because of the excessively high affinity constant calculated in that study , log10k
aff = 19 , this suggestion has not been taken seriously by any of the experimental groups that have examined cu coordination to a. we have since reevaluated the binding by the procedures employed in the present work and found a substantially lower value , log10k
aff = 6.3 , that is more in accordance with the accepted data for cu(ii ) binding to a .
we note that isothermal calorimetry experiments by hong et al . found that cu binding to his13his14 is most favored by the enthalpic contribution to the free energy change but that the enthalpic preference was overwhelmed by an unfavorable entropic term .
less is known experimentally about the coordination of cu(i ) to a. we have previously [ 19 , 20 ] modeled the attachment of cu(i ) to the his13his14 region of a by computational methodology similar to that employed in the present work .
the computations suggest that cu(i ) is dicoordinated and bound to the two his sidechains via the proximal n atoms ( n ) in a linear fashion .
have demonstrated such binding experimentally by exafs and xanes data and results carried out on copper(i ) complexes of small hishis peptides , and fragments of a . such a structure
apparently , cu(i ) binds to a(1 - 16 ) with femtomolar affinity , much higher than does cu(ii ) .
the linear two - coordinate complexes were also able to add a third imidazole ligand in a t - shaped configuration in a dynamic process that interchanges all three his residues .
interestingly , the two - coordinate complexes were resistant to oxidation , but the three - coordinate complexes were redox active
. however , the cu(i ) complexes with hishis containing fragments were able to produce h2o2 in the presence of o2 but without added reducing agents .
the amount of h2o2 produced was independent of the presence of tyr10 ( a potential source of electrons ) or other residues such as asp1 or his6 which are potential binding sites for the copper .
aqueous cu has a one - electron reduction potential e = 0.17 v versus the standard hydrogen electrode ( she ) .
an early report that monomeric cu(ii)/a(1 - 42 ) had an exceptionally high reduction potential e 0.7 v versus she has been discounted as due to oligomer formation .
0.30 v0.34 v [ 28 , 29 ] which represents a modest elevation of the oxidizing power of the cu(ii ) upon complexation to a. brzyska et al . , find a concentration- and buffer - dependent reduction of the reduction potential upon addition of cu(ii ) to monomeric a(1 - 40 ) , although , in the absence of buffer , their value is similar to the others . as noted above , there is uncertainty as to the actual nature of the oxidized and reduced species involved .
report a wide difference between the reduction potential and oxidation potential of copper bound to a(1 - 28 ) , 0.33 v and 0.63 v , respectively .
this is taken as an indication of different geometries at the cu(ii ) and cu(i ) binding sites .
we have undertaken the present study in order to examine the role of asp1 in the coordination of cu(ii ) as well as cu(i ) in a. we employ a higher level of theoretical treatment than was previously applied in order to estimate the binding affinities of complexes containing all combinations of asp1 , modeled by the n - methyl amide derivative , 1 ( figure 2 ) , his6 , modeled by imidazole ( i m ) , an amide carbonyl , modeled by n - methylacetamide ( nma ) , and his13his14 , modeled as previously [ 17 , 20 ] by n--dihydrourocanylhistamine , 5 ( figure 3 ) . simultaneous involvement of both asp1 and ala2 were modeled by the n - methyl amide derivative of asp1ala2 , 3 ( figure 1 ) .
reduction potentials for various cu(ii)/cu(i ) couples were also derived and compared with experimental values in order to elucidate the nature of the species involved .
all calculations were carried out with gaussian 03 and 09 [ 31 , 32 ] using the hybrid density functional method , b3lyp , and second - order moller - plesset perturbation theory .
gaseous - phase geometry optimization , harmonic frequency calculation , and thermochemical parameters were determined at the b3lyp/6 - 31 + g(d ) basis set , which is henceforth referred to as the small basis set ( sb ) .
the frequency calculation confirmed that the optimized structures were at local minima on the potential energy hypersurface .
the zero point energies were scaled by 0.9806 . however , this was not done for the thermal correction of enthalpy or entropies . in the case of the zwitterionic asp1 , 1 ( figure 1 ) and asp1ala2 , 3 ( figure 2 ) , it was necessary to optimize the structure and carry out frequency analysis in the presence of the solvent reaction field ( scrf = iefpcm ) , where iefpcm is the integral equation following polarizable continuum model [ 35 , 36 ] with the default parameters for water .
chemical intuition was used to seek the most stable structures , and no attempt was made to do a comprehensive search of conformational space . instead
, account was taken of conformational flexibility by the addition of an approximate entropy of mixing term , rln(n ) , where n is an estimate of the number of conformers derived by simple rotamer counting .
values of n are listed in table s2 in supplementary materials available online at doi : 10.4061/2011/539762 .
entropies were also converted to a state of 1 m by addition of the term for volume change , r ln(1/24.46 ) , where 24.46 litres is the volume of 1 mol of ideal gas at 298 k. for more accurate enthalpies and to compensate for the lack of long - range dispersion energy in b3lyp , single - point energies were calculated at an approximation for the mp2/lb level ,
( 1)e(mp2/lb)e(mp2/sb)+e(b3lyp / lb)e(b3lyp / sb ) ,
where lb is the large basis set , 6 - 311+(2df,2p ) .
details of all computed quantities and structural information , are provided in tables s1 and s2 , respectively .
molden 4.0 was used as a visualization tool . in order to calculate the free energy change in water , g
( aq ) , the change in the free energy of solvation , g
solv ,
was added to the free energy change in the gaseous phase , g
( g ) , corrected for a standard state of 1 m. g
solv was determined using iefpcm [ 35 , 36 ] as implemented in g03 , and the b3lyp / sb density . in our experience ,
charged species are undersolvated by the iefpcm with standard scaling of the united atom hartree - fock ( uahf ) radii , so selective scaling was applied as follows : the radii of the metal ion and all atoms directly attached to it were scaled by a factor of 1.1 ; all other atoms were scaled by the default value , 1.2 .
experimental rather than calculated relative free energies of solvation were applied where available in order to reduce errors further . for the proton , g
the experimental value of g
solv was adopted for h2o , 16.2 kj mol , where the value reflects the fact that water is 55.6 m. for all other species , free energies of solvation were taken as calculated by the procedure described above .
cu(ii)/cu(i ) couple , relative to the standard hydrogen electrode ( she ) , e(cu(ii)/cu(i ) ) , is defined by
( 2)e(cu(ii)/cu(i))=(g(aq)cug(aq)she)/f ,
where f is the faraday constant , f = 96.485 kj mol v , g
( aq )
is the free energy change for the standard hydrogen cell half reaction , ( 1/2)h2(g ) + e h
( aq ) , ( g
( aq )
= 418 kj mol , ignoring the electron ) , and g
( aq )
is the calculated free energy change for reaction ( 3 ) , again ignoring the electron
( 3)cu(ii)(aq)+ ecu(i)(aq)+al .
in ( 3 ) ,
cu(ii ) and cu(i ) represent species containing oxidized and reduced copper , respectively .
the symbol al recognizes the fact that a number of ligands may be shed in the reduction process and that the associated entropy change may be an important component of the free energy change .
the actual potential , e , of the half reaction under ambient conditions is related to the standard potential , e , through the nernst equation ,
( 4)e = e(rtf)lnq ,
where q is the reaction quotient specifying concentrations of oxidized and reduced components and other species associated with the chemical change . in the special case that n protons are consumed in solution buffered at ph = 7 under otherwise standard conditions
, the reaction quotient reduces to q = 10 , and the symbol , e , denotes the potential at ph 7 ( e = e ( rt / f)lnq = e 0.41nv ) . for most of the energy differences calculated in the following sections , errors inherent in the calculation of absolute values
could be expected to cancel yielding reliable relative energies . however , this is less likely to be the case for the calculation of aqueous free energy changes for reactions such as ( 3 ) .
since a transition element is involved and the number of electrons changes , the enthalpy change will be less accurately described at this theoretical level than expected for lighter elements .
an extreme case is illustrated by the difference between the calculated ( at the b3lyp / lb level ) and experimental second ionization potential of atomic copper ( ie2 ( calc ) = 2008 kj mol ; ie2 ( exp ) = 1958 kj mol ) .
the discrepancy is most likely due to the unequal treatment of electron correlation ( an enthalpic term ) . as in a previous publication
, we assume that the error in the ionization potential of cu will be present in the reduction potentials , e(cu(ii)(aq)/cu(i)(aq ) ) , irrespective of the metal environment since they all involve the change in copper oxidation state from + 2 to + 1 . without correcting for the error in the enthalpy change ,
the calculated value for the reduction of aqueous cupric ion is e(cu(h2o)5
/cu(h2o)3
) = 0.42 v versus she , compared to the experimental value , e(cu(aq)/cu(aq ) ) = 0.17 v .
an empirical correction of + 57 kj mol brings the calculated and experimental numbers into agreement .
thus for addition of an electron to any cu species , the correction to the calculated h is taken as + 57 kj mol . with the procedures described above
, we expect that aqueous free energy changes , g
( aq ) , will be accurate to 15 kj mol for all of the reactions considered .
the b3lyp / sb - optimized structures and all calculated energies and thermochemical properties are provided in tables s1 and s2 and shown in figures 13 .
chemical transformations and aqueous free energy changes are given in the following in the form of numbered equations which are repeated in table 1 along with a complete breakdown of the components at the mp2/lb level .
the n - terminal asp1 of a is modeled by 1 ( figure 1 ) , where the c - terminus is derivatized by nhch3 .
the most stable form of the aqueous cupric ion is the pentaaqua structure , cu(h2o)5
.
reaction with 1 yielded numerous aquated structures 2 with different patterns of chelation :
( 5a)1+cu(h2o)52+2a(h2o)2 + 3h2o+h+;g(5a)=18.0 kj mol1 ,
( 5b)1+cu(h2o)52+ 2b(h2o)2 + 3h2o+h+;g(5b)=+14.3 kj mol1 ,
( 5c)1+cu(h2o)52+2c(h2o)2 + 3h2o+h+ ; g(5c)=+29.1 kj mol1 ,
where g
( 5a ) , g
( 5b ) , and g
( 5c ) , have been adjusted to ph = 7 .
structures of 2a(h2o)2 , 2b(h2o)2 , and 2c(h2o)2 are shown in figure 1 . it should be noted from table 1 that the release of multiple water molecules in processes such as ( 5a)(5c ) endows a large entropic component favoring complex formation . in addition , release of a proton into a solution buffered to ph = 7 provides an additional 40 kj mol ( = rt ln(10 ) ) as a driving force for the forward direction .
of the three 1 : 1 complexes , only the most stable , 2a(h2o)2 , is formed exergonically at physiological ph . this structure has a square pyramidal configuration with three - point coordination of the asp residue to the cupric ion .
the amino and carboxylate groups form adjacent corners of the square , and the carbonyl of the amide occupies the axial position .
structure 2b(h2o)2 , which is lacking the axial carbonyl oxygen coordination , is less stable than 2a(h2o)2 by 32 kj mol .
o bond strength of the coordinated carbonyl oxygen of asp1 is about 50 kj mol ( table 1 ) .
the most stable structure with a deprotonated amide n coordinated to the cu(ii ) is 2c(h2o)2 , which is 47 kj mol less stable than 2a(h2o)2 .
the amide n and the n - terminal nh2 groups occupy adjacent corners of the square pyramidal base with two waters in the other two corners .
the neutral carboxylic acid group of 2c is attached to the axial position with a long bond ( 2.43 , compared to the average cu - oh2 distance , 2.08 ) . the amide - deprotonated structure , 2c(h2o)2 , is not predicted to be stable in water .
however , such a structure permits additional chelation by the carbonyl of the same residue , ala2 in the present model system .
thus , 3 ( i.e. , asp1ala2 ) ( figure 2 ) may provide three ligands for cu(aq ) if the amide group is deprotonated .
the bicyclic structure , 4(h2o ) ( figure 2 ) , is the most stable structure that has coordination by the n - terminal nh2 of asp1 and the deprotonated amide n and carbonyl o of ala2 to the cu .
all three groups occupy sites in the equatorial coordination plane , the last site being occupied by a water molecule .
a second water h bonds to the first and the carboxylic acid group rather than to the copper .
the carboxylate group of asp1 is protonated and interacting with the copper only through h - bonding to the bound water .
equation ( 6 ) examines the stability of 4(h2o ) relative to the dissociated species :
( 6)3+cu(h2o)54(h2o)+4h2o+h+;g(6)=10.2 kj mol1 ,
where g
( 6 ) has been adjusted to ph = 7 .
thus , compared to ( 5c ) , coordination by the o of ala2 provides an additional 19 kj mol of stabilization but is not enough to render the complex stable in water at physiological ph .
the predicted pk
a of the carboxylate proton of 4(h2o ) is 10 , indicating that the deprotonated form of 4(h2o ) would be stable at ph = 9 .
interaction of cu(aq ) with one and two his is represented by :
( 7a)im+cu(h2o)52+cu(im)(h2o)42++h2o;g(7a)=0.5 kj mol1 ,
( 7b)2im+cu(h2o)52+cu(im)2(h2o)32++2h2o;g(7b)=10.9 kj mol1 .
the structures of the two im / cu(ii ) complexes are shown in figure 1 .
displacement of a water ligand by i m is predicted to be isoergonic , g
( 7b ) = 0.5 kj mol .
this result derives from the near cancellation of a highly exergonic change in the gaseous phase by a correspondingly large loss of free energy of solvation ( the g
( g ) and g
solv terms in table 1 ) .
it is in disagreement with results derived from early ph measurements which found log10
1 = 3.76 or g
1 = 21 kj mol .
addition of the second i m was found experimentally to have log10
2 = 3.39 or g
1 = 19 kj mol .
the displacement of a second water is calculated to be more favored , by 10 kj mol .
the computed results suggest that a monoadduct will disproportionate to form the bisadduct and aqueous cu(ii ) .
the preferred orientation of the imidazole rings in cu(im)2(h2o)3 is perpendicular to the basal square plane . in the bis(im ) complex , both cis- and trans - diastereomers are stable and are nearly isoergonic . in the cis - structure ,
the single i m in cu(im ) ( h2o)4
is intended to represent his6 or one of his13 or his14 . the second i m of cu(im)2(h2o)3
may be one of his13 or his14 , or a his6 from a second a. thus , the 1 : 1 interaction of cu(aq ) with i m is less favorable than with asp1 by 18 kj mol and the 1 : 2 interaction is comparable . the most stable structures , 2a(im)(h2o ) and 2a(im)2 , for the 1 : 1 : 1 and 1 : 1 : 2 complexes , respectively , between cu(aq ) , asp1 , and i m are shown in figure 1 . structure 2a(im)(h2o ) is related to 2a(h2o)2 by the substitution of the water that is anti to the carboxylate group by i m .
substitution in 2a(h2o)2 of the water anti to the amino group yielding 2b(im)(h2o ) results in loss of the axial ligand and distortion of the basal plane .
structure 2a(im)(h2o ) is more stable than 2b(im)(h2o ) by 38 kj mol ( from data in table s2 ) .
substitution of both waters of 2a(h2o)2 by i m yields 2a(im)2 . a second structure , 2b(im)2 , in which the i m residues are opposite the nh2 and amide carbonyl groups , and the carboxylate group occupies the axial position , is also stable . in 2b(im)2
, the carboxylate group is coordinated through one of the oxygen atoms but perpendicular to the co2 plane .
structure 2a(im)2 is more stable than 2b(im)2 ( figure 1 ) by 11 kj mol .
equations ( 8a ) and ( 8b ) explore the possible reactions that may yield the 1 : 1 : 1 cu(aq ) , asp1 , and i m adduct , 2a(im)(h2o):(8a)2a(h2o)2+im2a(im)(h2o)+h2o;g(8a)=24.1 kj mol1 ,
( 8b)1+cu(im)(h2o)42+2a(im)(h2o)+3h2o+h+;g(8b)=41.6 kj mol1,where g
( 8b ) has been adjusted to ph = 7 .
thus , 2a(im)(h2o ) is stable with respect to dissociation either by releasing an imidazole ligand or the n - terminal asp . in the context to a ,
these results imply that asp1 1 and any of the his residues may form a stable complex with cu(ii ) in water at physiological ph .
the possible formation of the 1 : 1 : 2 complex , 2a(im)2 , is explored in reactions ( 9a ) and ( 9b ) :
( 9a)2a(im)(h2o)+im2a(im)2+h2o;g(9a)=11.0 kj mol1 ,
( 9b)1+cu(im)2(h2o)32+2a(im)2 + 3h2o+ h+;g(9b)=42.2 kj mol1 ,
where g
( 9b ) has been adjusted to ph = 7 .
thus , as with 2a(im)(h2o ) , the 1 : 1 : 2 complex , 2a(im)2 , is also stable toward dissociation , and , in the context to a , these results imply that asp1 , his6 , and either of his13 or his14 may form stable complexes in water at physiological ph . by ( 6 ) , it was apparent that deprotonation of the amide n ( of ala2 ) required coordination of the o of ala2 in order to afford a complex , 4(h2o ) , that could be formed at ph = 9 but was not stable at ph = 7 . equations ( 10a ) and ( 10b )
examine the possibility that the water of 4(h2o ) may be displaced by i m :
( 10a)4(h2o)+im4(im)+h2o;g(10a)=20.5 kj mol1 ,
( 10b)3+cu(h2o)52++im4(im)+5h2o+h+;g(10b)=10.3 kj mol1 ,
where g
( 10b ) has been adjusted to ph = 7 .
thus , the additional stabilization afforded by replacing water by i m ( 10a ) , is sufficient to render the product , 4(im ) ( figure 2 ) , stable in water at physiological ph ( 10b ) , but would have only marginal stability at lower ph , g
( 10b ) = 4 kj mol at ph = 6 .
the carboxylate group of asp1 is h - bonded to the nh2 group and not interacting with the copper .
deprotonation of 4(im ) affords 4(im)(co2
) ( figure 2 ) with pk
a = 11 .
4(im)(co2
) is pentacoordinated with the carboxylate group occupying the fifth site . in the context of a , ( 10a ) and
( 10b ) imply that a 3n1o complex incorporating the n - terminal nh2 group , the carbonyl o , and the deprotonated amide n of ala2 , and one of his6 , his13 or h14 , should be observed at physiological ph :
( 11)4(im)+im4(im)2;g(11)=6.9 kj mol1 .
by ( 11 )
, coordination of a second i m to the vacant axial coordination site of 4(im ) to yield 4(im)2 ( figure 2 ) is unfavorable by 7 kj mol .
such a structure may be an intermediate for the interchange of the his residues of a. but is a deprotonated amide structure like 4(im ) stable compared to a form like 2a(im)2 in which the amide is protonated and ala2 is not involved ?
equation ( 12 ) compares the stability of the most stable copper - coordinated structure that uses both asp1 and ala2 , 4(im ) , with one that does not involve ala2 , namely , 2a(im)2 :
( 12)4(im)+im+12a(im)2 + 3;g(12)=42.8 kj mol1 .
the relatively large exergonicity of ( 12 ) , g
( 12 ) = 43 kj mol , strongly suggests that ala2 is not involved in the bonding in the n - terminal copper - bound species .
the principal reason , from table 1 , is enthalpic ( h
( 12 ) = 84 kj mol and is a consequence of the greater acidity of the carboxylate group than of the amide group .
thus , 2a(im)2 is the closest model for component i of a , but raising the ph , at least in the physiological range , does not lead to component ii as proposed by faller and hureau and coworkers [ 6 , 7 ] . in the following section
, we propose another structure for component ii and discuss the nature of the ph dependence .
we explore below the special case of his13his14 where the i m groups of the two his residues are tethered by an intervening amide link .
the tethering has an important consequence . as with 3 , this configuration permits three - point chelation to the copper , a favorable contribution to the free energy of binding , but without the penalty of amide deprotonation .
the his13his14 sequence of a is modeled by 5 ( figure 3 ) , in which only the two side chains and the intervening amide link are preserved .
the interaction between 5 and cu(aq ) yielding 6(h2o)2 was recently studied experimentally and reexamined theoretically by the procedures employed in the present paper .
the calculated association constant , log10k
( 12 ) for ( 13 ) , was in good agreement with the experimental value , log10
k
as = 5.6 :
( 13)5+cu(h2o)52+ 6(h2o)2 + 3h2o;g(13)=36.0 kj mol1 ; log10k(13)=6.3 .
structure 6(h2o)2 , which models the mode of attachment of cu(ii ) to his13his14 , has the two i m groups in the trans - positions of a distorted square plane .
the backbone amide carbonyl oxygen and a water molecule occupy the other two opposing sites .
the trans - orientation of the two i m groups is the favored mode of attachment as seen in trans - cu(im)2(h2o)3 ( figure 1 ) .
it has been argued that the copper does not attach to a hishis sequence through the n atoms in a trans - arrangement as in 6(h2o)2 , but rather through the n atoms in a cis - arrangement .
the latter is the configuration seen in the crystal structure of bis(cyclo - l - histidyl - l - histidyl)copper(ii ) , the cyclic anhydride of histidine . in this compound
, cu chelates to the n atom of the imidazole rings in a cis - arrangement . in the present system , the most stable structure
in which cu(ii ) is attached to 5 with the cis coordination pattern , is 6(h2o)3 ( tables s1 and s2 ) ) .
structure 6(h2o)3 is predicted to be less stable relative to 6(h2o)2 + h2o by 36 kj mol .
the constraint imposed by the framework of the cyclic anhydride of histidine does not permit bridging of the copper ion through one or both n atoms of the i m groups . in 5 , or in monomeric a , there are no such constraints .
we also found structures , 6(h2o)2 and 6(h2o)2 ( tables s1 and s2 ) ) , in which coordination is through one n and one n nitrogen of 5 .
these also have the cis orientation and are even less stable , 46 and 51 kj mol ( data in table s2 ) .
we do not consider these structures to be relevant to the chemistry of cu / a in alzheimer 's disease and do not discuss them further .
species 6(h2o)2 may add an additional i m residue yielding , 6(im)(h2o ) . the results are presented in :
( 14)6(h2o)2+im6(im)(h2o)+h2o ; g(14)=12.5 kj mol1 .
the remaining water is in an axial orientation with a long cu - o separation , 2.40 .
exchange of the water by an o of an amide carbonyl group ( of nma = n - methylacetamide ) yields 7 ( figure 3 ) . in 7 ,
the two carbonyl groups occupy equivalent positions in the equatorial plane of a trigonal bipyramidal configuration about the cu(ii ) ion .
attempts to optimize square planar structures with the o of his13 or nma in an axial position converged to similar trigonal bipyramidal structures .
the reaction is described in :
( 15)6(im)(h2o)+nma7+h2o;g(15)=20.5 kj mol1 ; log10k(15)=3.6 .
reaction ( 15 ) is moderately exergonic in water , indicating that the cu(ii ) environment could consist of the three his residues and an additional carbonyl group . in the context of cu / a , the experimental results of barnham and coworkers , and the theoretical modeling of sodupe and coworkers , on cu(ii)/a(1 - 16 ) , the obvious candidate for the additional carbonyl o is ala2 .
we note however that displacement of water by nma is strongly endothermic in the gaseous phase , h
( g ) = 68 kj mol ( table 1 ) .
this is a consequence of the steric crowding about the cu(ii ) site that forces the unusual trigonal bipyramidal geometry .
the exergonicity of reaction ( 15 ) in water ensues from an even larger favorable change in the free energy of solvation , g
( aq ) = 84 kj mol ( table 1 ) .
solvation was also found to favor the coordination of the o of ala2 in the work of sodupe and coworkers .
the most stable structures corresponding to the 1 : 1 : 1 complex between cu(aq ) , asp1 , and his13his14 ( 5 ) , namely , 8a and 8b , are shown in figure 2 . the more stable of the two , 8a , has a square pyramidal coordination sphere about the copper , with bidentate coordination of the nh2 and co2
groups of the asp in the basal square .
one of the i m groups ( formally of his13 ) and the backbone amide carbonyl group of 5 form the other two corners .
the other i m group ( formally of his14 ) has moved into the apical site . the second structure , 8b , which is less stable by 18 kj mol , has the same square pyramidal 3n1o basal configuration as 8a , but the apical i m group has released .
possible routes for the formation of the more stable isomer 8a are examined in :
( 16a)1 + 6(h2o)28a+2h2o+h+;g(16a)=+2.8 kj mol1 ,
( 16b)2a(h2o)2 + 5 8a+2h2o;g(16b)=15.2 kj mol1 ,
where g
( 16a ) has been adjusted to ph = 7 . the negative free energy change of ( 16b ) ,
g
( 16b ) = 15 kj mol , indicates that if the cupric ion was already attached to 2a(h2o)2 , that is , the n - terminus , it can also associate with 5 , that is , his13his14 .
however , the small positive value , g
( 16a ) = + 3 kj mol , indicates that 8a would be partially dissociated , releasing the n - terminal asp .
equation ( 17a ) addresses the question of whether the n - terminus can be coordinated if there are already three his residues coordinated to the copper ion .
such a structure , 9 , is shown in figure 3 :
( 17a)1 + 6(im)(h2o)9+h2o+h+;g(17a)=+22.0 kj mol1 ,
( 17b)98a+im;g(17b)=6.7 kj mol1 ,
( 17c)9+h2o+h+5 + 2a(im)(h2o);g(17c)=24.4 kj mol1 ,
where g
( 17a ) and g
( 17c ) have been adjusted to ph = 7 .
the moderately high value , g
( 17a ) = 22 kj mol , indicates that simultaneous attachment of all four potential ligands to cu(ii ) , the n - terminal asp and the three histidines , is not likely at physiological ph .
equations ( 17b ) and ( 17c ) indicate that such an arrangement would be unstable with respect to loss of one histidine but not two . in the context of a ,
the overall picture that emerges from the above considerations is that the n - terminus and all three his residues may not be simultaneously associated with the cupric ion .
however , such a structure could be a transitional form connecting more stable structures in which the cu(aq ) is attached to his6 , his13 , and his14 ( 6(im)(h2o ) or 7 ) ( figure 3 ) or to the n - terminus and two of the three his residues , his6 and his13 , or his6 and his14 ( both modeled by 2a(im)2 ) ( figure 1 ) but not his13 and his14 ( 8a is unstable by ( 16a ) ) ( figure 3 ) .
thus , structure 2a(im)2 , with 3n1o equatorial coordination to cu(ii ) , serves as a model for components ia and ib . in each case
structure 7 is preferred because it is more stable , but it formally has a 3n2o coordination pattern in a trigonal bipyramid . the computed results for cu(ii ) species agree in most respects with experimental expectations , except possibly for the nature of the o ligand , which would be the carbonyl o atom of his13 if 6(im)(h2o ) proves to be the better model for component ii .
however , favoring 7 in this respect also is the experimental and other computational evidence that the o should be the o atom of ala2 provided the approximately equivalent equatorial o atoms of the trigonal bipyramidal geometry would manifest as 3n1o coordination in epr experiments .
attempts on our part to completely displace the o of his13 in cu(ii ) complexes by any other ligand always failed .
if component i is modeled by 2a(im)2 and component ii is modeled by 7 , what then is the nature of the ph dependence that shifts the equilibrium from one to the other in the narrow physiological ph range ?
we suggest that , since the pk
a of his residues is in this range , one or more of the his residues would be protonated .
the presence of the cu ion sets up a delicate balance : in component i , either his13 or his14 is protonated , permitting the other to bind to the copper together with his6 and asp1 ( but not ala2 ) ; at a slightly higher ph , the remaining his is deprotonated and all three can bind to the copper , displacing asp1 but leaving the nearby o of ala2 attached .
the most stable form of the aqueous cuprous ion at the present theoretical level is the t - shaped triaqua structure , cu(h2o)3
( figure 4 ) , reaction with asp1 1 yielded several aquated structures with different patterns of chelation .
the most stable of these is the 1 : 1 cu(i ) : asp1 complex , 2(h2o ) ( figure 4 , see the following equation ) :
( 18)1+cu(h2o)3+ 2i(h2o)+2h2o+h+;g(18)=+5.3 kj mol1 ,
where g
( 18 ) has been adjusted to ph = 7 .
we denote structures containing the cuprous ion by the superscript i on the structure number of the cu(ii ) equivalent . as with cu(h2o)5
and cu(h2o)3
,
the cuprous form of a complex will generally have fewer ligands than the equivalent cupric form .
some or all of the attached h2o will be lost upon reduction of the copper . if there is no attached water , then one or more of the coordinated ligands will be released upon reduction .
the structures of all complexes containing cu(i ) are shown in figure 4 . the small endergonic free energy change for reaction ( 18 ) in water , g
( 18 ) = 5 kj mol at ph = 7 , suggests that there is a small amount of 1 : 1 complex formed between cu(aq ) and asp1 under physiological conditions .
we examine whether complexation of asp1 is feasible if the cuprous ion is already attached to one or more imidazoles .
the reactions for the 1 : 1 complex between cu(aq ) and i m , cu(im)(h2o ) , is given in :
( 19)im+cu(h2o)3+cu(im)(h2o)++2h2o;g(19)=16.3 kj mol1 .
thus , cu(im)(h2o ) is stable in water and the free energy of complexation is higher than for the equivalent cu(ii ) complex ( 7a ) .
the following reactions explore the addition of a second imidazole group to cu(im)(h2o ) , either as free i m or as his13 or his14 of 5 , yielding products cu(i
m)2
( 20a ) , cu(im)(h13h14 ) ( 20b ) , and cu(im)(h14h13 ) ( 20c ) , respectively:(20a)im+cu(im)(h2o)+cu(im)2++h2o;g(20a)=27.4 kj mol1 ,
( 20b)5+cu(im)(h2o)+cu(im)(h13h14)++h2o;g(20b)=43.4 kj mol1 ,
( 20c)5+cu(im)(h2o)+cu(im)(h14h13)++h2o;g(20c)=31.1 kj mol1.thus , addition of his14 of 5 is approximately equivalent energetically to the addition of a free i m group and both are more exergonic than addition of a single i m ( 19 )
. addition of his13 ( 20b ) is more exergonic still due to a higher free energy of solvation ( table 1 ) which ensues as a consequence of the higher dipole moment of cu(im)(h13h14 ) , = 15.4 d compared to = 13.2 d for cu(im)(h14h13 ) .
both 1 : 1 : 1 and 1 : 1 : 2 complexes between cu(i ) , asp1 1 , and i m , namely , 2(i
m ) and 2(im)2 ( figure 4 ) , are stable in the gaseous phase .
formation of the 1 : 1 : 1 complex , 2(im ) ( figure 4 ) , is essentially isoergonic at ph = 7 if one i m is already attached to cu(i ) :
( 21)1+cu(im)(h2o)+2i(im)+h2o+h+;g(21)=3.0 kj mol1 ,
where g
( 21 ) has been adjusted to ph = 7 .
addition of a second i m to form the 1 : 1 : 2 complex , 2(im)2 ( figure 4 ) , is endergonic , g
( 22 ) = 23 kj mol :
( 22)2i(im)+im2i(im)2;g(22)=22.7 kj mol1 .
because of the high affinity of cu(i ) for two imidazoles , addition of asp1 1 to the bis(imidazole)cu(i ) complex will not occur :
( 23)1+cu(im)2+2i(im)2+h+;g(23)=47.2 kj mol1 ,
where g
( 23 ) has been adjusted to ph = 7 . on the basis of this result , we have not attempted to add asp1 to cu(im)(h13h14 ) or cu(im)(h14h12 ) .
cu(i ) binds to the hishis region 5 yielding the 1 : 1 complex , 6 ( figure 4 ) , with high affinity ,
( 24)5+cu(h2o)3+6i+3h2o;g(24)=72.8 kj mol1 ; log10k(24)=12.7 .
coordination of additional waters to 6 is endergonic , for example , g 15 kj mol for the addition of one water ( data not shown ) .
the calculated affinity constant , log10
k
( 23 ) = 12.7 , is in very good agreement with that found for the cu(i)/a(1 - 16 ) complex , log10
k
aff 14 .
the value is substantially higher than for the addition of two free imidazoles to cu(aq ) ( 20a ) , or a free i m and one of the two imidazoles of 5 ( ( 20b ) and ( 20c ) ) , thus highlighting the importance of chelation .
it is also higher than for the addition of cu(aq ) to hishis ( 13 ) .
the calculations clearly confirm that cu(i ) will bind more strongly than cu(ii ) to a and that the preferred site of binding of cu(i ) is his13his14 .
the linear geometry and a cu - n distance of 1.877 in cu(i)/a(1 - 40 ) was deduced from fitted exafs data by shearer and szalai .
our calculated value for 6 , 1.894 , is in good agreement .
addition of asp1 1 to the linear cu(i)/hishis complex , 6 , in the gaseous phase yields two stable structures , 8a
and 8b
( figure 4 ) , of equal energy in water .
however , the formation of either by addition of asp1 1 to 6 in water is highly endergonic ( ( 25a ) and ( 25b ) ) due to the high stability of 6 :
( 25a)1 + 6i8ai + h+ ; g(25a)=64.6 kj mol1 ,
( 25b)1 + 6i8bi + h+ ; g(25b)=63.4 kj mol1 ,
where g
( 25a ) and g
( 25b ) have been adjusted to ph = 7 .
equations ( 16a ) , ( 16b ) , and ( 17a ) indicate that the n - terminus will be weakly associated with cu(ii ) complexes of two of the his residues .
however , upon reduction of the copper to cu(i ) , the n - terminus will be released leaving only the linear cu(i)/hishis structure .
equation ( 15 ) indicates that an amide carbonyl will be weakly associated with cu(ii ) complexes of all three his residues .
equation ( 26 ) examines whether the carbonyl would remain attached to the reduced copper species , 6 :
( 26)nma+6i7i;g(26)=25.0 kj mol1 .
the complex with nma ( n - methylacetamide ) , 7 ( figure 3 ) , is strongly bound in the gaseous phase , h
( ( 26),g ) = 59 kj mol , but is formed endergonically in water due to a combination of loss of solvation free energy and an unfavorable entropic term ( table 1 ) .
addition of i m to 6 to yield 6(im ) ( figure 4 ) is slightly endergonic ,
( 27)im+6i6i(im);g(27)=10.1 kj mol1 ; log10k(27)=1.8 .
as with nma , the addition reaction is endergonic principally by virtue of loss of free energy of solvation , but also in part due to the unfavorable change in entropy ( table 1 ) . in the context of
a reduced copper / a complex , there is ample experimental evidence that cu(i ) is bound to his13his14 precisely as depicted in 6 , in a linear fashion through the n of both i m groups ( figure 4 ) [ 21 , 22 , 46 ] .
the i m ( his6 ) is tethered to the cu(i ) binding region at his13his14 , and the loss of entropy may be less , reducing the endergonicity of ( 27 ) .
computed reduction potentials for various combinations of cu(ii)/a and cu(i)/a coordination patterns , when compared with the experimental value for cu / a , e 0.30 v0.34 v , [ 28 , 29 , 47 ] may serve to distinguish among the different possibilities that have been suggested in the literature and discussed in the introduction . since all experimental indications suggest that a and cu / a are highly fluxional species , the most stable structures should be most populated .
we assume that electrochemical reduction is an equilibrium process . logically then , reduction of the ( predicted ) most stable cu(ii ) species , yielding the most stable cu(i ) species , should yield the most representative value of e or e. as a second point of reference , the experimental value for the reduction of aqueous cupric ion is e(cu(aq)/cu(aq ) ) = 0.17 v .
equation ( 28 ) describes the reduction process if the copper was attached only to the n - terminal asp1 :
( 28)2a(h2o)2+e2ai(h2o)+h2o;e(2a(h2o)2/2ai(h2o))=0.07 v.
the calculated standard reduction potential e(2a(h2o)2/2a
( h2o ) ) = 0.07 v , is lower than the value for aqueous copper .
therefore , cu(ii ) can not be attached only to the n - terminus since the lower e is incompatible with the experimental observation that the reduction potential is elevated .
a lower value is expected since a negatively charged group is attached to the cu(ii ) , thereby lowering the net charge of the oxidized species .
equation ( 29 ) describes reduction of copper attached in a 1 : 1 ratio to asp1 and i m the cu(ii ) species , 2a(im)(h2o ) , was found to be stable in water ( ( 8a ) and ( 8b ) ) , but the cu(i ) species , 2(i
m ) , had only transient stability ( 21 ) :
( 29)2a(im)(h2o)+e2i(im)+h2o;e(2a(im)(h2o)/2i(im))=0.07 v.
the result , e(2a(im)(h2o)/2(i
m ) ) ) = 0.07 v , indicates that the presence of the i m moiety has little effect on the predicted reduction potential . with respect to the possibility that cu(ii ) may be coordinated to asp1 and two of the i m moieties , the cu(ii ) species , 2a(im)2 ,
was found to be stable at ph = 7 ( ( 9a ) and ( 9b ) ) .
structure 2a(im)2 corresponds to component i , the low ph species , in which cu(ii ) is attached to his6 and either his13 or his14 as well as the n - terminus .
the corresponding reduced species , 2(im)2 was found to release the asp ( 23 ) .
equations ( 30a ) and ( 30b ) describe the appropriate reduction process if the cu(i ) of component i remains attached to the same two his residues :
( 30a)2a(im)2 + 5 + e+h+1+cu(im)(h13h14)+;e(2a(im)2,h+/cu(im)(h13h14)+,1)=0.24 v ,
( 30b)2a(im)2 + 5 + e+h+1+cu(im)(h14h13)+;e(2a(im)2,h+/cu(im)(h14h13)+,1)=0.11 v.
if , during the reduction process , the most stable cu(i ) product , 6 , is formed , the process may be modeled by ( 31 ) in which his6 is retained or by ( 32 ) in which his6 is released :
( 31)2a(im)2 + 5+e+h+1 + 6i(im)+im;e(2a(im)2,5,h+/6i(im),1,im)=0.27 v ,
( 32)2a(im)2 + 5 + e+h+1 + 6i+2im;e(2a(im)2,5,h+/6i,1,im)=0.37 v.
in summary , the reduction potentials of cu(ii ) attached to the n - terminus and one or two independent his residues ( ( 30a ) and ( 30b ) ) in which the cu(i ) remains attached to the same two his residues are predicted to be slightly lower than the experimental value for cu(ii)/a complexes , 0.30 v0.34 v. however , if the cu(i ) rearranges to include both his13 and his14 , with or without loss of his6 ( ( 31 ) and ( 32 ) , resp . ) , e values are predicted to be close to the experimental value .
therefore , it is possible that component i is the species that is observed to undergo reduction .
component ii , modeled by 6(im)(h2o ) or 7 , does not involve the n - terminal asp1 .
reduction of either species in which cu(ii ) is coordinated to his13his4 will yield the cu(i)/hishis species , 6 , with the release of all other coordinating ligands . in the instance that cu(ii )
is only attached to hishis except for waters ( 33 ) , an elevated value of e is obtained :
( 33)6(h2o)2+e6i+2h2o;e(6(h2o)2/6i)=0.55 v.
the high result confirms that 6(h2o)2 is also an incomplete description of the bonding in cu(ii)/a. a more representative species is 6(im)(h2o ) , which models all three his residues coordinated to a with a coordinated water :
( 34)6(im)(h2o)+e6i+im+h2o;e(6(im)(h2o)/6i , im)=0.42 v.
the e value ( 34 ) is close to but higher than the experimental range .
the species , 6(im)(h2o ) , has a coordinated water molecule which may be exchanged for another ligand . on the basis of the experimental finding that the o atom of ala2 is in the cu(ii ) coordination sphere of component ii
, we consider here structure 7 , in which the water is replaced by an amide carbonyl , using n - methylacetamide ( nma ) as a model .
the reduction of 7 is described in :
( 35)7+e6i+im+nma;e(7/6i , im , nma)=0.63 v.
the e value ( 35 ) is substantially higher than the experimental range .
thus , it appears that none of mechanisms that involve reduction and spontaneous loss of ligands provides a satisfactory description of the reduction process .
balland et al . , have recently carried out a detailed study of the kinetics of the reduction / oxidation of cu / a(1 - 16 ) complexes by cyclic voltametry and homogeneous transfer from osmium complexes .
the electron transfer rate was found to be extremely slow and required a preorganization by 22 and 16 kj mol to geometries of the cu(ii ) and cu(i ) species , respectively , between which the actual electron transfer takes place . in the present model systems ,
the preorganization of the oxidized species is to release the bound carbonyl oxygen , that is , the reverse of ( 15 ) for which g
( 15 ) = 20 kj mol .
the preorganization of the reduced species prior to oxidation is to gain the i m residue , that is , ( 27 ) for which g
( 27 ) = 10 kj mol .
scheme , the actual reduction is described by :
( 36)6(im)(h2o)+e6i(im)+h2o;e(6(im)(h2o)/6i(im),h2o)=0.31 v.
the calculated reduction potential , e(6(im)(h2o)/6(im),h2o ) = 0.31 v , is in excellent agreement with that measured by balland et al .
, e = 0.30 v , and the calculated free energy changes for the preorganization steps are also in good agreement .
high - level ab initio electronic structure calculations were applied to models of the n - terminus of a , as well as ala2 , his6 , and his13his14 , to predict structures of the complexes of cu(ii ) and cu(i ) in water at physiological ph .
the calculated binding affinities of both cu(ii ) and cu(i ) to the his13his14 model , log10
k
aff = 6.3 ( 13 ) and log10
k
aff = 12.7 ( 24 ) , respectively , are in good agreement with experimental values , 5.6 and 14 , respectively which lends confidence to other calculated free energy changes . at the present level of theory , cu(ii ) species
the one exception we found is in the case of 7 ( figure 3 ) , the proposed model for component ii of a. in 7 , two carbonyl oxygen atoms , of ala2 and his13 , occupy nearly equivalent sites in the equatorial plane of a trigonal bipyramid . on the other hand ,
the predominant configuration at cu(i ) in water is linear dicoordination , with the exception of cu(h2o)3
and the possible exception of cu(i ) with all three his residues attached ( modeled by 6(im ) ( figure 4 ) ) which are t - shaped structures .
it was found that asp1 forms stable complexes with cu(ii ) and two his residues , either the pair his6 , his13 , or the pair his6 , his14 , but not his13his14 , both modeled by 2a(im)2 ( figure 1 ) .
the complex , 2a(im)2 , represents the bonding configuration of cu(ii ) in component ia and component ib of a. each has 3n1o square planar coordination with tridentate attachment of asp1 .
the nh2 and co2
groups contribute one of the n ligands and the o ligand in the equatorial plane , while the carbonyl o of asp1 occupies the axial position .
the n - terminus does not attach to cu(ii ) if his6 and his13his14 are already attached .
the assignment of 7 as a model for component ii is in agreement with the findings of barnham and coworkers .
hureau and faller and coworkers suggested that the amide nh of ala2 is deprotonated at higher ph and proposed a structure for component ii that is modeled by 4(im ) ( figure 2 ) in our study [ 6 , 7 ] .
our results suggest that the presence of the carboxylate group of asp1 makes deprotonation of the amide group very improbable near physiological ph .
rather , we propose that deprotonation of a protonated his residue of either his13 or his14 facilitates the formation of component ii at the expense of component i. the binding configuration of cu(i ) to a is modeled by 6 ( figure 4 ) .
the cu(i ) is linearly dicoordinated to his13his14 through the n nitrogen atoms of the imidazole groups . weak coordination of his6 , as in 6(im ) , is possible in water as an endergonic process .
our calculations support in full the redox scheme for cu / a(1 - 16 ) proposed by balland et al . , which requires preorganization steps for both oxidized and reduced species .
the sequence of steps for reduction is described by the reverse of ( 15 ) and ( 27 ) , and ( 36 ) , which we repeat here for clarity :
( 15)7+h2o6(im)(h2o)+nma;g(15)=20 kj mol1 ; [ 22 kj mol1 ] ,
( 36)6(im)(h2o)+ e6i(im)+h2o;e(6(im)(h2o)/6i(im),h2o)=0.31 v ; [ 0.30 v ] ,
( 27)6i(im)6i+im;g(27)=10 kj mol1 ; [ 16 kj mol1 ] .
the experimental values derived from the data of balland et al . are given in square parentheses .
|
density functional and second order moller - plesset perturbation theoretical methods , coupled with a polarizable continuum model of water , were applied to determine the structures , binding affinities , and reduction potentials of cu(ii ) and cu(i ) bound to models of the asp1 , ala2 , his6 , and his13his14 regions of the amyloid beta peptide of alzheimer 's disease .
the results indicate that the n - terminal asp binds to cu(ii ) together with his6 and either his13 or his14 to form the lower ph component i of a. component ii of a is the complex between cu(ii ) and his6 , his13 , and his14 , to which an amide o ( of ala2 ) is also coordinated .
asp1 does not bind to cu(ii ) if three his residues are attached nor to any cu(i ) species to which one or more his residues are bound .
the most stable cu(i ) species is one in which cu(i ) bridges the n of his13 and his14 in a linear fashion .
cu(i ) binds more strongly to a than does cu(ii ) .
the computed reduction potential that closely matches the experimental value for cu(ii)/a corresponds to reduction of component ii ( without ala2 ) to the cu(i ) complex after endergonic attachment of his6 .
|
fludarabine is a drug widely used in the treatment of hematological malignancies , representing one of the main components in the reduced intensity conditioning regimens for hematopoietic stem cell transplantation .
anemia , neutropenia , and thrombocytopenia due to myelosuppression are the major adverse effects associated with fludarabine administration 1 .
neurotoxicity is an uncommon but well - known possible adverse event during treatment with fludarabine .
most of the published series on fludarabine neurotoxicity derive from experiences around the middle of the eighties , where escalating doses were administered in dose - finding studies ; moreover , computed tomography ( ct ) scans rather than magnetic resonance imaging ( mri ) were available as imaging counterparts .
subsequently , standard dose fludarabine and purine analogues neurotoxicity has been seldom the matter of specific reports 2 . only recently ,
clinical and mri aspects of a possible specific neurotoxicity after standard dose fludarabine both in the treatment of hematologic malignancies and in reduced intensity allogeneic hematopoietic stem cell transplantation have been reported 3,4 .
we present an additional case of possible severe fludarabine neurotoxicity fitting with the clinical and imaging features described in the above - cited articles .
a 55-year - old male patient was admitted on november 15 , 2010 in our bone marrow transplant centre to undertake hematopoietic stem cell transplantation ( hsct ) from a matched unrelated donor .
he was affected by rapidly progressive myelofibrosis with severe pancytopenia , high transfusion requirement , and iron overload despite iron - chelating therapy .
conditioning regimen included thiotepa 5 mg / kg every 12 h for two doses and fludarabine 30 mg / m per day for 6 days .
anti - thymocyte globulin 2.5 mg / kg per day , was delivered on days -3 and -2 .
graft versus host disease ( gvhd ) prophylaxis included standard dose cyclosporine and short course methotrexate .
subsequent course was uneventful during the neutropenic phase , the patient experienced a single febrile episode rapidly resolving after starting empirical antibiotic therapy . at day + 28 after transplantation , the patient was transfusion independent and chimerism analysis showed full donor engraftment . on december 25 , 2010 ,
the patient complained of bilateral symmetric proprioceptive deficit at the lower extremities . on the ensuing days
, brain and spine ct scans were performed which did not show any abnormality ( fig.1 ) ; mri was somewhat delayed because of the mild clinical pattern and of severe claustrophobia requiring deep sedation with anesthesiologic support .
somato - sensitive evocated potentials , electroencephalogram ( eeg ) and electromyogram ( emg ) were normal .
relying on the possibility of cyclosporine toxicity as the most probable cause , methylprednisolone and mycophenolate were provisionally substituted for cyclosporine on december 26 , 2010 .
the clinical picture , however , continued to worsen on the following days : a proprioceptive deficit appeared also at the upper extremities while the level of leg proprioceptive deficit extended up to the knee level .
moreover , some tactile deficit was observed and the patient started to suffer from occasional confusion episodes .
ct scan taken at the onset of symptoms failing to show any abnormalities . on january 3 , 2011 mri of brain ( fig.2 ) and spine was eventually performed with deep sedation .
the most outstanding feature were bilateral symmetric t2 flair hyperintense lesions involving the posterior periventricular and supraventricular white matter ; the lesions demonstrated restricted diffusion suggesting cytotoxic edema without enhancement .
although primarily attributable to toxicity , the imaging pattern did not fulfill the commonly observed criteria for cyclosporine toxicity .
apart from corticosteroids , the patient received high dose immunoglobulins and hydrosoluble vitamin complex , without any benefit . to confirm the toxicity hypothesis , a positron emission tomography ( pet ) scan
was also performed , failing to show hypermetabolic areas in the brain . on the following days
, the lesions became apparent also at the ct scan as hypodense ones ( fig.3 ) ; two subsequent ct investigations showed only mild signs of worsening .
blood virus monitoring was negative , with the only exception of a low number of jc and bk viruses dna copies detected , without any tendency towards an increase .
axial t2 ( upper left ) , dwi ( lower left ) , and flair ( lower right ) , showing posterior periventricular high signal areas .
subsequent ct scan showing symmetric , hypodense periventricular lesions . due to the lack of any benefit from its interruption ,
cyclosporine was resumed after 1 week , not hindering however the development of cutaneous , hepatic and intestinal acute gvhd .
methylprednisolone dosage was then escalated to 2 mg / kg , though allowing only cutaneous gvhd to be controlled .
a significant improvement in intestinal gvhd was achieved through the addition of the anti - tnf agent infliximab , whereas hepatic gvhd showed a slowly progressive , relentless course . at the same time , the neurological picture worsened jointly at sensitive , motor and cognitive level .
the patient became soon paraplegic , with sensitive deficit ostensibly sparing only pain perception ; eventually , he progressively developed central blindness . at cognitive level , after a protracted phase where the patient appeared delirious and confused , he became barely contactable .
the patient died on march 12 , 2011 from hepatic failure due to progressive acute gvhd .
on january 3 , 2011 mri of brain ( fig.2 ) and spine was eventually performed with deep sedation . the most outstanding feature were
bilateral symmetric t2 flair hyperintense lesions involving the posterior periventricular and supraventricular white matter ; the lesions demonstrated restricted diffusion suggesting cytotoxic edema without enhancement .
although primarily attributable to toxicity , the imaging pattern did not fulfill the commonly observed criteria for cyclosporine toxicity .
apart from corticosteroids , the patient received high dose immunoglobulins and hydrosoluble vitamin complex , without any benefit . to confirm the toxicity hypothesis , a positron emission tomography ( pet ) scan
was also performed , failing to show hypermetabolic areas in the brain . on the following days
, the lesions became apparent also at the ct scan as hypodense ones ( fig.3 ) ; two subsequent ct investigations showed only mild signs of worsening .
blood virus monitoring was negative , with the only exception of a low number of jc and bk viruses dna copies detected , without any tendency towards an increase .
axial t2 ( upper left ) , dwi ( lower left ) , and flair ( lower right ) , showing posterior periventricular high signal areas .
subsequent ct scan showing symmetric , hypodense periventricular lesions . due to the lack of any benefit from its interruption , cyclosporine was resumed after 1 week , not hindering however the development of cutaneous , hepatic and intestinal acute gvhd .
methylprednisolone dosage was then escalated to 2 mg / kg , though allowing only cutaneous gvhd to be controlled .
a significant improvement in intestinal gvhd was achieved through the addition of the anti - tnf agent infliximab , whereas hepatic gvhd showed a slowly progressive , relentless course . at the same time , the neurological picture worsened jointly at sensitive , motor and cognitive level .
the patient became soon paraplegic , with sensitive deficit ostensibly sparing only pain perception ; eventually , he progressively developed central blindness . at cognitive level , after a protracted phase where the patient appeared delirious and confused , he became barely contactable .
the patient died on march 12 , 2011 from hepatic failure due to progressive acute gvhd .
fludarabine is a purine analogue , originally synthesized by montgomery and hewson in 1969 5 , and used primarily in the treatment of malignancies arising from the clonal expansion of lymphocytes , particularly in b - chronic lymphocytic leukemia ( b - cll ) 6 ; because of its potent immunosuppressive activity , it is also used in the conditioning regimens for allogeneic transplantation 7 , particularly in those of reduced - intensity . from a pharmacokinetic point of view
, it acts as a pro - drug , requiring metabolic dephosphorylation to the hydrophilic antimetabolite f - ara - a ( 9-beta - d - arabinosyl-2-fluoroadenine ) , which can enter cells only in the presence of concentrative nucleoside transporters ( cnts ) ; within the cells , the enzyme deoxycytidine ( cdr ) kinase progressively re - phosphorylates f - ara - a up to fludarabine triphosphate ( f - ara - atp ) , the only metabolite displaying cytotoxic activity 8 .
polymorphisms in the genes codifying for cnts or cdr kinase may cause , respectively , different uptake and conversion rate , resulting in altered fludarabine therapeutic index and risk of toxicity .
cytotoxic activity of f - ara - atp relays on the inactivation of dna synthesis through the inhibition of several specific enzymes ( dna polymerase , dna primase , dna ligase , ribonucleotide reductase ) 9 .
the inactivation of dna synthesis is followed by an initiation of an apoptotic process leading to cell death 10 . of note , f - ara - atp
can induce death also in quiescent cells , via the activation of the mitochondrial pathway of apoptosis 11 .
anemia , neutropenia and thrombocytopenia due to myelosuppression are the main adverse effects associated with fludarabine administration 1 .
severe neurotoxicity likely related to the high activity of cdr kinase in the brain is included among nonhematological fludarabine side effects 12,13 .
central and peripheral nervous system toxicity 1416 are possible side effects of several drugs , especially anticancer agents , often directing to dose reduction or drug withdrawal .
central nervous system ( cns ) toxicity presenting as encephalopathy of different severity has been observed not only after fludarabine administration but also with other chemotherapeutic agents , such as vincristine , cisplatin , methotrexate , cytarabine , ifosfamide , 5-fluorouracil ; on the other hand , peripheral neuropathy results most frequently associated with taxanes , carboplatin , vincristine , thalidomide , and bortezomib .
several compounds have been proposed as neuroprotective agents against chemotherapy - induced neurotoxicity , but few of them have been shown to be effective 17 . in an animal model , the incidence of fludarabine neurotoxicity was reduced by the coadministration of nbmpr - p , 5-phosphate of nitrobenzyl - thioinosine , a potent inhibitor of the nucleoside transport ( nt ) system .
nbtgr - p , the 5-phosphate of nitrobenzyl - thioguanosine ( also a potent nt inhibitor ) similarly prevented f - ara - amp neurotoxicity in this experimental system 18 .
moreover , it is commonly used for the treatment of acute myeloid and lymphoblastic leukemia ( aml / all ) together with cytarabine and filgrastim in the setting of the flag schemes 19,20 .
more recently , it has become the reference drug for allogeneic hematopoietic stem cell transplantation following reduced intensity conditioning regimens 21,22 .
fludarabine - related neurotoxicity was reported in up to 3040% of patients in phase i / ii studies , where the drug was frequently administered at daily doses in excess of 100 mg / m for 57 days 13,2325 .
high dose fludarabine neurotoxicity was frequently reported as irreversible and life - threatening , although milder cases were not infrequent 26 .
rather surprisingly , despite the extensive use of the drug , the interest on this field rapidly waned over the subsequent decades , so that rather little is known about the frequency as well as about the clinical and mri features of standard dose fludarabine neurotoxicity .
kornblau and coworkers 27 reported 8 of 219 cases of neurotoxicity , two being severe ; a neutoxicity rate of 14% , benign and reversible in most of the cases , was reported in a review by cheson et al . dealing with standard dose purine analogues 2 .
subsequently , viral infections , including progressive multifocal leukoencephalopathy ( pml ) 2830 , and better established toxic events , as posterior reversible encephalopathy syndrome ( pres ) 31,32 , have been the matter of reports in the field of either fludarabine therapy or reduced intensity allogeneic hematopoietic stem cell transplantation 33 .
concerning the latter , the specific role of fludarabine is hard to be distinguished from that of the well - known neurotoxic immunosuppressive agent cyclosporine - a 34 , and from that of the total body irradiation ( tbi ) , often included in the conditioning regimens .
four years ago , beitinjaneh and collaborators 3 reported acute toxic leukoencephalopathy ( atl ) as a possible clinical and imaging counterpart of fludarabine neurotoxicity .
not unlike to previous reports 13,2325 , the most common clinical features of atl included cognitive impairment associated with visual and sensitive defects ; the clinical outcome was frequently , but not always , irreversible and progressive ; the mri pattern was characterized by the presence of bilateral signal alterations in the deep white matter , rather distinct from pres .
the classic pattern of involvement in pres is the presence of bilateral and symmetric lesions in the cortex and subcortical white matter of the occipital and parietal lobes 31,32 . in the same year
, lee and colleagues 4 described in more detail the clinical and mri features of three patients undergoing reduced intensity hematopoetic stem cell transplantation and receiving fludarabine as part of the conditioning regimen , who developed irreversible , lethal neurotoxicity .
the clinical and imaging findings resembled those of atl and were distinct from the neurological complications , of both toxic and infectious etiology .
the authors concluded that these cases were tentatively attributable to fludarabine - specific neurotoxicity . on the clinical and imaging field , the case we are here reporting bears strict resemblance to the three cases described by lee 4 .
moreover , it shares the clinical picture with the cases reported in phase i / ii studies 13,2325 :
clinical onset occurred 1 month after the end of fludarabine administration ;
sensitive and cognitive impairment were the outstanding clinical features ;
some imbalance was evident between the polymorphic severe clinical pattern and the relatively limited extension of the white matter signal alterations ;
the clinical course was progressive and irreversible ;
the mri pattern was indistinguishable from that reported by lee and collaborators , 4 and strictly reminiscent of atl ;
a toxic rather than inflammatory etiology was strongly suggested by the mri findings ;
although the patients had refused cerebrospinal fluid examination , pet scan and virological negativity did not support an alternative etiology ;
the deep location of the white matter lesions was not coherent with a diagnosis of pres as a possible alternative diagnosis .
clinical onset occurred 1 month after the end of fludarabine administration ;
sensitive and cognitive impairment were the outstanding clinical features ;
some imbalance was evident between the polymorphic severe clinical pattern and the relatively limited extension of the white matter signal alterations ;
the clinical course was progressive and irreversible ;
the mri pattern was indistinguishable from that reported by lee and collaborators , 4 and strictly reminiscent of atl ;
a toxic rather than inflammatory etiology was strongly suggested by the mri findings ;
although the patients had refused cerebrospinal fluid examination , pet scan and virological negativity did not support an alternative etiology ;
the deep location of the white matter lesions was not coherent with a diagnosis of pres as a possible alternative diagnosis .
thiotepa is known to pass through the blood brain barrier and to have the potential of causing neurotoxicity .
nevertheless , the available data concern either the intrathecal 35 or the high - dose administration within myeloablative conditioning regimens followed by autologous stem cell transplantation commonly used in patients with cns malignancies , notably lymphomas 36 . in both settings , reports involved heavily pretreated patients where cns irradiation and disease progression exerted a primary role in determining the appearance of neurological impairment 37 . unlike fludarabine , no suggestive imaging counterpart of thiotepa neurotoxicity has been proposed thus far 36,37 . on the clinical field , a motor impairment seems more likely attributable to direct thiotepa toxicity 38 .
this reinforces the opinion that our patient did suffer of fludarabine neurotoxicity . according to lee and colleagues 4 , after ruling out more obvious etiology of brain impairment
, a fludarabine - related toxic etiology is strongly suspected for severe cns complications and the mri pattern defined as atl may represent the characteristic imaging counterpart . on the other hand , beitinjaneh and
coworkers 3 suggested that fludarabine may also be involved in the pathogenesis of a proportion of more benign neurologic complications presenting as pres at mri ; besides , atl may also be potentially reversible in a proportion of cases . last but
not least , a 10% crude rate of neurotoxicity , mostly benign and reversible , was also reported in old series with standard dose fludarabine 2,27 , before the matter began to be somewhat overlooked .
the case of our patient reinforces the opinion that atl may be the mri counterpart of severe fludarabine neurotoxicity , rarely observed after standard dose treatment . because irreversible atl could only represent the tip of an iceberg , we suggest that fludarabine neurotoxicity should be taken into account also in cases of benign , reversible neurologic impairment .
|
key clinical messagewe present a case of severe , irreversible neurotoxicity in a 55-year - old - patient with myelofibrosis undergoing hematopoietic stem cell transplantation following a reduced intensity conditioning including fludarabine .
the patient developed progressive sensory - motor , visual and consciousness disturbances , eventually leading to death .
mri imaging pattern was unique and attributable to fludarabine neurotoxicity .
|
the anterior cruciate ligament ( acl ) tear and acl reconstruction lead to premature knee osteoarthritis ( oa ) among adolescents , which possibly increases anteroposterior laxity of knee joint , accelerates degeneration of articular cartilage , and disturbs biochemical homeostasis with increasing time from injury .
however , few clinicians are able to be fully conscious of the issue of acl injury in patients with oa , especially in plateau region .
oa is the most common disease of the knee joint in older adults around the world .
the prevalence of oa increases to 10% of males and 20% of females aged 4565 years .
the proportions of oa with complete acl tears were between 8.1% and 35% . in our clinical practice
, we found that 41.3% female patients with knee oa aged 4165 years in plateau region had acl injuries , far higher than the rate in previous reports .
however , the risk factors of predisposing an individual with oa in plateau region to acl injury remain obscure .
the further identification of risk factors contributing to knee oa in patients with acl tear is necessary and urgent on account of some risk factors may be modifiable as to prevent exacerbation of knee oa .
although the cause of disparity in acl injury remains elusive , the extant research shows that both extrinsic and intrinsic factors of knee joint have been explored , which are considered to be relevant .
intercondylar notch size is one of the anatomic variables suspected to predispose an individual to acl injury .
numerous studies measured notch width index ( nwi ) , notch shape index ( nsi ) , notch depth index ( ndi ) , and the cross - sectional area ( csa ) , and considered a smaller or stenotic nwi , nsi , ndi , or csa was a risk factor of acl injury .
one of the main features of patients with oa is the growth of osteophytes , and acl may be missing in patients of severe oa with significantly smaller intercondylar notch relative to the normal knee . given the potentially important relation between the femoral condylar notch morphology and acl injury in patients with knee oa in plateau region , we have carried out a research to evaluate the important of intercondylar notch size for acl injury in the female nonathletes with knee oa aged 4165 years . the influence of intercondylar notch size indexes ( nwi , nsi , ndi , and csa ) for knee oa with acl injury in these patients was also identified .
, we retrospectively reviewed the medical records of patients treated at our hospital for acl injuries or oa .
all cases , including 330 acl injury , 141 oa , and 89 healthy controls , who were all from the loess plateau at gansu province in china , were included in this analysis .
we identified 330 patients with acl injury ( including complete tear and partial tear ) by magnetic resonance imaging ( mri ) .
one hundred and forty - one patients with knee oa aged 3165 years were imaged with mri and plain films .
diagnostic evaluation of radiographs for oa was performed based on the kellgren and lawrence grade ( klg ) .
the cases with oa and without acl injury aged 4165 years of klg = 2 were defined as oa - m - only , and klg = 3 were defined as oa - s - only .
the control group ( control ) population were healthy females aged 4165 years who came to our clinic for health examination other than a knee problem .
all exclusion criteria were as follows : patients with fractures involving articular surfaces , congenital abnormalities of knee , inheritable musculoskeletal disorders , bone and joint of tuberculosis , inflammatory arthritis , tumor around the knee joint , bilateral end - stage
oa , knee arthroplasty , knee oa after acl reconstruction , or klg = 0 , 1 , or 4 were excluded from the study samples .
in addition , patients with oa with clear prior trauma of knee were also excluded .
age and gender distribution of patients with oa or acl and controls oa - m - only : samples with oa of klg = 2 , and without acl injury ; oa - s - only : samples with oa of klg = 3 , and without acl injury ; oa - m + acl : oa - m with acl injury ; oa - s + acl : oa - s with acl injury ; control : health samples ; klg : kellgren and lawrence grade ; acl : anterior cruciate ligament ; oa : osteoarthritis .
all study cases underwent mri of knee performed on a 3.0-t mr system ( ingenia 3.0 t , phillips medical systems , best , the netherlands ) with an 8-channel sense knee coil .
coronal oblique fast spin echo images were obtained of both knees with a repetition time ( tr ) of 520 ms , an echo time ( te ) of 20 ms , and a 3 mm slice thickness .
axial proton density fast spin echo images were obtained with a tr of 2886 ms , a te of 25 ms , and a 3 mm slice thickness . for the purpose of the notch measurements ,
the femoral condylar width ( w ) was measured on a line through the popliteal groove parallel to the reference line .
the intercondylar notch width ( n ) was the distance between the most interior margins of the femoral condyles at the borders of the two - thirds intercondylar notch height .
the intercondylar notch depth ( d ) was identified as the maximum height of notch .
the maximum height of the lateral femoral condyle was measured as the femoral condylar depth ( cd ) .
the intercondylar nwi is the ratio of the intercondylar notch width to the femoral condylar width .
the nsi is calculated by dividing the intercondylar notch width by the intercondylar notch depth .
the ratio of the intercondylar notch depth to the lateral femur cd forms the ndi .
the intercondylar notch width multiplied by the intercondylar notch depth was defined as the csa of the femoral intercondylar notch .
schematic diagram of the measured parameters of the intercondylar notch in axial magnetic resonance imaging .
n : the intercondylar notch width ; w : the femur condylar width ; d : the intercondylar notch depth ; cd : the lateral femoral condylar depth ; the white dotted line : reference line .
nwi = n / w ; nsi = n / d ; ndi = d / cd ; csa = n*d .
nwi : notch width index ; nsi : notch shape index ; ndi : notch depth index ; csa : cross - sectional area .
all of condylar notch dimensions were independently measured twice by a researcher specializing in mri and by an orthopedic surgeon to determine reproducibility .
analysis of variance test with post hoc least significant difference analysis was performed to test the differences of various measured intercondylar notch indexes among different groups .
receiver operating characteristic ( roc ) curves were prepared from the measured data of mri to determine the cutoff value .
the pearson chi - square test was calculated to determine the correlation between acl injury with oa - s and the nwi and nsi .
all statistical analyses were performed using spss version 17.0 ( spss , chicago , il , usa ) , and p < 0.05 was considered statistically significant .
roc curve was analyzed using medcalc statistical software 15.2.2 ( medcalc , ostend , belgium ) .
, we retrospectively reviewed the medical records of patients treated at our hospital for acl injuries or oa .
all cases , including 330 acl injury , 141 oa , and 89 healthy controls , who were all from the loess plateau at gansu province in china , were included in this analysis .
we identified 330 patients with acl injury ( including complete tear and partial tear ) by magnetic resonance imaging ( mri ) .
one hundred and forty - one patients with knee oa aged 3165 years were imaged with mri and plain films .
diagnostic evaluation of radiographs for oa was performed based on the kellgren and lawrence grade ( klg ) .
the cases with oa and without acl injury aged 4165 years of klg = 2 were defined as oa - m - only , and klg = 3 were defined as oa - s - only .
the control group ( control ) population were healthy females aged 4165 years who came to our clinic for health examination other than a knee problem .
all exclusion criteria were as follows : patients with fractures involving articular surfaces , congenital abnormalities of knee , inheritable musculoskeletal disorders , bone and joint of tuberculosis , inflammatory arthritis , tumor around the knee joint , bilateral end - stage
oa , knee arthroplasty , knee oa after acl reconstruction , or klg = 0 , 1 , or 4 were excluded from the study samples .
in addition , patients with oa with clear prior trauma of knee were also excluded .
age and gender distribution of patients with oa or acl and controls oa - m - only : samples with oa of klg = 2 , and without acl injury ; oa - s - only : samples with oa of klg = 3 , and without acl injury ; oa - m + acl : oa - m with acl injury ; oa - s + acl : oa - s with acl injury ; control : health samples ; klg : kellgren and lawrence grade ; acl : anterior cruciate ligament ; oa : osteoarthritis .
all study cases underwent mri of knee performed on a 3.0-t mr system ( ingenia 3.0 t , phillips medical systems , best , the netherlands ) with an 8-channel sense knee coil .
coronal oblique fast spin echo images were obtained of both knees with a repetition time ( tr ) of 520 ms , an echo time ( te ) of 20 ms , and a 3 mm slice thickness .
axial proton density fast spin echo images were obtained with a tr of 2886 ms , a te of 25 ms , and a 3 mm slice thickness .
for the purpose of the notch measurements , the axial mri was used [ figure 1 ] . the femoral condylar width ( w )
the intercondylar notch width ( n ) was the distance between the most interior margins of the femoral condyles at the borders of the two - thirds intercondylar notch height .
the intercondylar notch depth ( d ) was identified as the maximum height of notch .
the maximum height of the lateral femoral condyle was measured as the femoral condylar depth ( cd ) .
the intercondylar nwi is the ratio of the intercondylar notch width to the femoral condylar width .
the nsi is calculated by dividing the intercondylar notch width by the intercondylar notch depth .
the ratio of the intercondylar notch depth to the lateral femur cd forms the ndi .
the intercondylar notch width multiplied by the intercondylar notch depth was defined as the csa of the femoral intercondylar notch .
schematic diagram of the measured parameters of the intercondylar notch in axial magnetic resonance imaging .
n : the intercondylar notch width ; w : the femur condylar width ; d : the intercondylar notch depth ; cd : the lateral femoral condylar depth ; the white dotted line : reference line .
nwi = n / w ; nsi = n / d ; ndi = d / cd ; csa = n*d .
nwi : notch width index ; nsi : notch shape index ; ndi : notch depth index ; csa : cross - sectional area .
all of condylar notch dimensions were independently measured twice by a researcher specializing in mri and by an orthopedic surgeon to determine reproducibility .
analysis of variance test with post hoc least significant difference analysis was performed to test the differences of various measured intercondylar notch indexes among different groups .
receiver operating characteristic ( roc ) curves were prepared from the measured data of mri to determine the cutoff value .
the pearson chi - square test was calculated to determine the correlation between acl injury with oa - s and the nwi and nsi .
all statistical analyses were performed using spss version 17.0 ( spss , chicago , il , usa ) , and p < 0.05 was considered statistically significant .
roc curve was analyzed using medcalc statistical software 15.2.2 ( medcalc , ostend , belgium ) .
the distribution of patients ( from plateau region ) with acl injury or knee oa by age is shown in figure 2 .
the proportion of patients with acl injury in male patients decreases rapidly after age of 50 years , but an opposite trend in oa patients aged 4165 years [ figure 2b ] . unlike in males , a high prevalence of oa and acl injury is found in females [ figure 2a ] .
further research for samples of oa with acl injury is presented in figure 2c and 2d .
the results indicate a significant rising trend in oa - s + acl after age of 41 years , especially in females .
although a similar trend was observed in males and females , of 27 cases of oa - s + acl aged 4565 years , 74% ( 20 ) samples were females [ table 1 ] .
thus , the females aged 4165 years in oa - s + acl were the emphasis in this study .
in addition , we found 41.3% female patients with knee oa aged 4165 years had acl injuries , far higher than the rate in previous reports .
this shows that a plateau environment might be a risk factor of predisposing female nonathletes patients with knee oa to acl injury .
distribution of anterior cruciate ligament injury ( anterior cruciate ligament ) , knee osteoarthritis , or osteoarthritis with anterior cruciate ligament injury ( osteoarthritis + anterior cruciate ligament ) by age .
( a and b ) the proportion of anterior cruciate ligament or osteoarthritis in females or males .
( c and d ) the proportion of osteoarthritis + anterior cruciate ligament in females or males .
acl : cases with anterior cruciate ligament injury ; oa - m : osteoarthritis patients with klg = 2 ; oa - s : osteoarthritis patients with klg = 3 ; klg : kellgren and lawrence grade . to further investigate the relationship between a high prevalence of oa - s + acl in females and intercondylar notch dimensions , data from females aged 4165 years
were analyzed for the four indexes ( nwi , nsi , ndi , and csa ) appeared in table 2 .
we found that the notches of patients with oa - s + acl had a smaller nwi compared to control or oa - s - only .
interestingly , these data of means ( nwi , nsi , ndi , and csa ) all showed a decline trend among these groups .
descriptive statistics of nwi , nsi , ndi , and csa in females aged 4165 years compared to control , * p<0.05 ; compared to oa - s - only , p<0.05 .
nwi : notch width index ; nsi : notch shape index ; ndi : notch depth index ; csa : cross - sectional area ; oa : osteoarthritis ; oa - s - only : samples with oa of klg = 3 , and without acl injury ; oa - s + acl : oa - s with acl injury . to obtain nwi and nsi cutoff value for acl injury with oa - s ,
the cutoff of nwi and nsi value was 0.26 , and 0.65 , and area under the roc curve was 0.82 , and 0.79 , respectively .
the further research displayed a significant correlation between a reduced nwi and nsi and oa - s + acl [ table 3 , p = 0.000 , = 14.012 ; p = 0.000 , = 14.286 ] .
hence , these results have also shown that a smaller nwi and nsi of intercondylar notch positively correlated with predisposing an individual with oa - s aged 4165 years to acl injury .
the receiver operating characteristic curve were performed using measured data of notch width index ( a ) and notch shape index ( b ) in knee osteoarthritis patients with anterior cruciate ligament injury .
correlation between a reduced nwi and nsi and oa - s + acl reduced represents nwi or nsi are smaller than the cutoff value ( 0.26 or 0.65 ) .
nwi : notch width index ; nsi : notch shape index ; oa : osteoarthritis ; oa - s - only : samples with oa of klg = 3 , and without acl injury ; oa - s + acl : oa - s with acl injury .
the distribution of patients ( from plateau region ) with acl injury or knee oa by age is shown in figure 2 .
the proportion of patients with acl injury in male patients decreases rapidly after age of 50 years , but an opposite trend in oa patients aged 4165 years [ figure 2b ] . unlike in males , a high prevalence of oa and acl injury is found in females [ figure 2a ] .
further research for samples of oa with acl injury is presented in figure 2c and 2d .
the results indicate a significant rising trend in oa - s + acl after age of 41 years , especially in females .
although a similar trend was observed in males and females , of 27 cases of oa - s + acl aged 4565 years , 74% ( 20 ) samples were females [ table 1 ] .
thus , the females aged 4165 years in oa - s + acl were the emphasis in this study .
in addition , we found 41.3% female patients with knee oa aged 4165 years had acl injuries , far higher than the rate in previous reports .
this shows that a plateau environment might be a risk factor of predisposing female nonathletes patients with knee oa to acl injury .
distribution of anterior cruciate ligament injury ( anterior cruciate ligament ) , knee osteoarthritis , or osteoarthritis with anterior cruciate ligament injury ( osteoarthritis + anterior cruciate ligament ) by age .
( a and b ) the proportion of anterior cruciate ligament or osteoarthritis in females or males .
( c and d ) the proportion of osteoarthritis + anterior cruciate ligament in females or males .
acl : cases with anterior cruciate ligament injury ; oa - m : osteoarthritis patients with klg = 2 ; oa - s : osteoarthritis patients with klg = 3 ; klg : kellgren and lawrence grade .
to further investigate the relationship between a high prevalence of oa - s + acl in females and intercondylar notch dimensions , data from females aged 4165 years were analyzed for the four indexes ( nwi , nsi , ndi , and csa ) appeared in table 2 .
we found that the notches of patients with oa - s + acl had a smaller nwi compared to control or oa - s - only .
interestingly , these data of means ( nwi , nsi , ndi , and csa ) all showed a decline trend among these groups .
descriptive statistics of nwi , nsi , ndi , and csa in females aged 4165 years compared to control , * p<0.05 ; compared to oa - s - only , p<0.05 .
nwi : notch width index ; nsi : notch shape index ; ndi : notch depth index ; csa : cross - sectional area ; oa : osteoarthritis ; oa - s - only : samples with oa of klg = 3 , and without acl injury ; oa - s + acl : oa - s with acl injury .
to obtain nwi and nsi cutoff value for acl injury with oa - s , roc curves were performed [ figure 3a and 3b ] .
the cutoff of nwi and nsi value was 0.26 , and 0.65 , and area under the roc curve was 0.82 , and 0.79 , respectively .
the further research displayed a significant correlation between a reduced nwi and nsi and oa - s + acl [ table 3 , p = 0.000 , = 14.012 ; p = 0.000 , = 14.286 ] .
hence , these results have also shown that a smaller nwi and nsi of intercondylar notch positively correlated with predisposing an individual with oa - s aged 4165 years to acl injury .
the receiver operating characteristic curve were performed using measured data of notch width index ( a ) and notch shape index ( b ) in knee osteoarthritis patients with anterior cruciate ligament injury .
correlation between a reduced nwi and nsi and oa - s + acl reduced represents nwi or nsi are smaller than the cutoff value ( 0.26 or 0.65 ) .
nwi : notch width index ; nsi : notch shape index ; oa : osteoarthritis ; oa - s - only : samples with oa of klg = 3 , and without acl injury ; oa - s + acl : oa - s with acl injury .
the main finding of the present study was a narrower intercondylar notch was associated with the progress of acl injury in a population with knee oa ( klg = 3 ) in plateau region . compared to oa samples with an intact acl , oa patients with acl tears had a smaller nwi and nsi and showed a decline trend of ndi and csa .
therefore , the intercondylar notch stenosis acts as a pathogenic factor for acl injury in patients with severe oa , and a plateau environment was a risk factor of predisposing female nonathletes patients with knee oa to acl injury .
identified whether patients with knee oa and acl ruptures had smaller nwi independent of previous knee trauma and osteophyte volume through 160 cases from the progression subcohort of oa initiative ( oai ) study .
this study indicated that nwi was significantly different in cases with acl ruptures having a notch stenosis compared to those without acl ruptures .
although patients in our study are all from plateau region , our results are consistent with those findings regarding the correlation of acl ruptures and nwi in that report . however , 41.3% female patients with knee oa had acl injuries in our study , far higher than 14.4% in that report .
this also indicates that plateau environment predisposes female patients with oa to acl injury . in general ,
some extrinsic and intrinsic factors of knee joint are considered to be relevant to predisposing an oa individual to acl injury .
our study showed that the plateau environment is a greater extrinsic risk factor of acl injury in female nonathletes with knee oa aged 4165 years .
some probable reasons are as follows : first , the plateau environment may accelerate progressive damage of articular cartilage in health or oa population .
second , intercondylar notch stenosis of knee oa is aggravated among female nonathletes patients living in plateau region . through above comprehensive analyses , we considered that female patients with oa from plateau region have a stenotic intercondylar notch and might have a correspondingly smaller acl which would be fragile and easily damaged .
furthermore , we considered that a smaller notch would amplify the impact force between acl and the medial wall of femoral condylar , and then acl would be excessively abraded .
therefore , a hypothetical theory is presented a probable vicious circle between oa and acl injury [ figure 4 ] .
patients with acl injury in plateau region will increase knee anteroposterior laxity resulting in augmenting articular surface loading and typically progressing to knee oa after long - term actions .
accordingly , a narrower notch in patients with severe knee oa might predispose acl to damage , and then acl injury appears .
acl injury could aggravate the severity of oa , and oa , in turn , might exacerbate the extent of acl injury .
the above - mentioned hypothesis might have a positive , practical significance in promoting diagnosis and treatment of acl injury and/or knee oa . according to the hypothesis ,
any part of this circle is broke will be helpful for delaying the development of oa or acl injury .
therefore , the early - stage knee oa after an acl reconstruction should be disposed as early as possible avoiding developing a final - stage oa needs a total knee arthroplasty , or a dissatisfied acl reconstruction should be revised early .
similarly , severe oa with a narrower notch should be treated by arthroscopy for decreasing the impact on acl .
acl injury might be one of the sources of anterior knee pain , thus removing the narrow intercondylar notch might alleviate the symptom of knee oa . in brief , this theory is helpful for the clinical diagnosis and treatment of acl injury and/or knee oa in plateau region . a probable vicious circle between osteoarthritis and anterior cruciate ligament injury in plateau regions is hypothesized .
second , our study samples are all nonathletes . because majority of athletes are younger people , those cases are not assessed .
third , many extrinsic and intrinsic factors of knee joint , such as proprioception , height , weight , and quadriceps and hamstring muscle strength , have not been eliminated in this study . in brief , we considered that the influence of the above factors is limited for our research . despite these limitations , we hope that the findings of this study will be helpful for guiding clinical decisions about diagnosis and treatment of acl injury and/or knee oa in plateau region . in conclusion ,
the findings from this comprehensive analysis lead us to understand that a narrower intercondylar notch was associated with the progress of acl injury in a population with knee oa aged 4165 years in plateau region .
we considered that an interaction between oa and acl injury result in forming a vicious circle that immensely deteriorated the structures and functions of knee joint .
therefore , in plateau regions , the present study suggested that a smaller nwi and nsi of intercondylar notch may be two potential diagnostic indexes for female nonathletes oa patients complicated with acl injury based on mri manifestations ; female oa patients with a narrower intercondylar notch living in plateau environment treated under arthroscopy must take into account the possibility of acl injury existed .
|
background : few data are available concerning intercondylar notch dimensions in female nonathletes with knee osteoarthritis ( oa ) in plateau region .
the aim of this study was to assess the relation of intercondylar notch morphology to anterior cruciate ligament ( acl ) injuries in female nonathletes with knee oa aged 4165 years from the chinese loess plateau.methods:the study was conducted on 330 patients with acl injury ( aged 3165 years ; 159 males , 171 females ) , 141 patients with oa ( aged 3165 years ; 59 males , 82 females ) , and 89 female healthy controls ( aged 4165 years ) , and this evaluation included identifying the distribution of patients with oa or acl injury and measuring the intercondylar notch width indexes ( nwis).results : there was a significant rising trend in patients with oa ( the kellgren and lawrence grade = 3 ) with acl injury ( oa - s + acl ) aged 4165 years , especially in females .
we found that the notches of oa - s + acl had a smaller nwi compared with control and oa without acl injury ( oa - s - only , p = 0.000 , 95% confidence interval [ ci ] = 0.0590.030 ; p = 0.000 , 95% ci = 0.0490.016 ) .
a similar trend was found in notch shape index ( nsi ) , but not in notch depth index and the cross - sectional area .
the cutoff of nwi and nsi value was 0.26 , and 0.65 , and area under the receiver operating characteristic curve was 0.82 , and 0.79 , respectively .
further study displayed a significant correlation between a reduced nwi and nsi and oa - s + acl ( p = 0.000 , 2 = 14.012 ; p = 0.000 , 2 = 14.286).conclusion : a narrower intercondylar notch and a plateau environment are risk factors of predisposing female nonathletes with knee oa to acl injury aged 4165 years .
|
in recent years , significant interest has been shown in the development of controlled drug delivery to , or via mucous membranes by the use of bioadhesive polymers .
these dosage forms can be administered by different routes , including ocular , nasal , rectal , and vaginal , for local or systemic delivery.[14 ] mucoadhesion is a state in which 2 materials , one of which is mucus or a mucous membrane , is held together for an extended period of time .
various mucoadhesive polymers have been investigated and identified are generally hydrophilic macromolecules that contain numerous hydrogen bond forming groups , and will hydrate and swell when placed in contact with an aqueous solution .
these materials need to be in the hydrated form to become adhesive . among the various routes of delivering mucoadhesive dosage forms
, the buccal route appears to offer advantages of good accessibility , robust epithelium , quick and easy removal of the dosage form in case of need , good drug absorption , reduction of the first - pass metabolism , and patient compliance .
attempts have been made to formulate various mucoadhesive devices , including films,[711 ] tablets , patches,[1418 ] strips , devices , ointments , gels , and disks .
mucoadhesive buccal film may be preferred over adhesive tablet in terms of flexibility and comfort .
in addition , they can circumvent the relatively short residence time of oral gels on the mucosa , which are easily washed away and removed by saliva .
glibenclamide is a second generation and one of the most potent sulfonylurea used in the treatment of maturity - onset diabetes as an oral hypoglycemic agent .
the plasma half - life is about 56 h. in the present work , a trial has been made to develop mucoadhesive buccal films dosage form of glibenclamide for improving and enhancing bioavailability in a controlled release manner .
it may also be possible to circumvent the hepatic first - pass effect by administering the drug through buccal mucosa , which is richly perfuse with blood vessels and offers greater permeability than the skin .
the required therapeutic plasma concentration of glibenclamide can possibly be achieved more rapidly by using such buccal dosage forms .
different grades of hydroxypropyl methyl cellulose ( hpmc ) , which are biodegradable , were used in the present study .
glibenclamide was a gift sample from hetero drugs pvt ltd ( hyderabad , india ) .
hpmck15 m , hpmck100 m and hpmc3000 cps were procured from matrix ( hyderabad , india ) as gift samples .
buccal films of glibenclamide were prepared by solvent casting technique , employing aluminium foil cups ( placed on glass surface ) as a substrate .
composition of a single circular cast film of various formulations of buccal films were prepared by using drug and hpmck15 m with the ratio of [ gf1 ( 1:15 ) , gf2 ( 1:20 ) , gf3 ( 1:25 ) , gf4 ( 1:50 ) ] , hpmck100 m [ gf5 ( 1:15 ) , gf6 ( 1:20 ) , gf7 ( 1:25 ) , gf8 ( 1:50 ) ] , and hpmc3000 [ gf9(1:15 ) , gf10 ( 1:20 ) , gf11 ( 1:25 ) , gf12 ( 1:50 ) ] with 50 mg of glibenclamide .
propylene glycol , which acts as a plasticizer and permeation enhancer , is used in the concentration of 30% v / v .
dichloromethane and ethanol ( 50:50 v / v ) was used as a solvent system .
fifty milligrams of glibenclamide was incorporated in the polymeric solutions after levigation with 30% w / w propylene glycol , which served the purpose of plasticizer as well as penetration enhancer .
the medicated gels were left overnight at room temperature to obtain clear , bubble - free gels . to prevent evaporation of the solvent
the gels were caste into aluminium foil cups ( 10 8 cm diameter ) , placed on a glass surface was covered with inverted funnel , the end of which was plugged with cotton wool to allow controlled evaporation of the solvent .
these were allowed to dry at room temperature ( 30c ) to form a flexible film .
the dried films were cut into the size of 20 mm diameters , packed in aluminium foil and stored in desiccators until further use .
each formulation was prepared in triplicate ( n = 3 ) and 10 films equivalent to 2 2 cm area were cut from each plate .
the thickness of the films was measured by digital screw gauge ( digimatic outside micrometer , mitutoyo , japan ) .
the mean sd ( n = 3 ) values were shown in table 1 .
physical properties of glibenclamide buccal films the surface ph of films was determined to know the possibility of side effects , in vivo as an acidic or alkaline ph may cause irritation to the buccal mucosa .
it was our aim to keep the surface ph as close to neutral as possible .
the surface ph was determined by taking 3 films of each formulation and the films were allowed to swell for 2 h on the surface of 2% agar plate .
the surface ph was measured by using a ph paper placed on the surface of the swollen film .
a mean of 3 readings was recorded ( n = 3 ) [ table 1 ] .
after determination of the original film weight ( w1 ) , the samples were placed on the surface of 2% agar plate kept in an incubator at 37c 0.2c and examined for any physical change . at regular 1-hr intervals until 3 h , the films were removed from the gel plates and excess surface water was removed carefully using filter paper .
the swollen films were then reweighed ( w2 ) and the swelling index ( si ) was calculated using the following formula .
the experiments were performed in triplicate , and average values were reported [ table 1 ] . from each formulation 3 films of size ( 2 2 cm ) were cut by a sharp blade .
folding endurance was determined by repeatedly folding a small strip of film at the same place till it broke . the number of times the film could be folded at the same place without breaking gave the value of folding endurance .
the mean value of 3 readings ( n = 3 ) and standard deviation are shown in the table 1
. drug content uniformity was determined by dissolving the films in solvent and filter with whatman filter paper .
the resultant filtrate was evaporated and the drug residue was dissolved in 100 ml of ph 6.8 phosphate buffer .
absorbance of the sample was measured using uv vis spectrophotometer ( systronics ) 011 , hyderabad , at a wavelength of 274 nm against ph 6.8 phosphate buffer used as blank .
the experiments were carried out in triplicate and average values are reported in table 1 .
drug release from buccal films was studied by using dissolution rate test apparatus electrolabtdt 087 usp , mumbai .
the assembly for release study was prepared with the film being adhered onto a glass slide with one side of the film facing upward using a solution of cyanoacrylate adhesive , then placed in dissolution apparatus maintaining temperature at 37c 0.2c and rpm 50 using dissolution medium 900 ml phosphate buffer ph 6.8 .
samples ( 5 ml ) were collected at different time intervals : 10 , 15 min , 0.5 , 1 , 1.5 , 2 , 3 , 4 , 5 , 6 , and 7 h and replaced with fresh medium .
the release data were analyzed to study release kinetics using zero - order , first - order , korsmeyer
the release studies were performed in 6 replicates and mean sd values were calculated .
ex vivo buccal permeation of glibenclamide studied with fresh sheep buccal mucosa as a barrier membrane .
the buccal pouch of freshly sacrificed animal was procured from local slaughter house and was used within 2 h of slaughter .
the membrane was washed with distilled water and then with phosphate buffer ( ph 6.8 ) .
the ex vivo permeation studies were carried out using the modified franz diffusion cell at 37c 0.2c .
a film of ( 2 2 cm diameter ) each formulation under study was placed in intimate contact with the excised sheep buccal mucosa and the top side was covered with aluminum foil as a backing membrane .
teflon bead was placed in the receptor compartment filled with 15 ml of ph 7.4 phosphate buffer .
the cell contents were stirred with a magnetic stirrer and temperature of 37c 0.2c was maintained throughout the experiment .
the samples were withdrawn at predetermined time intervals , filtered , diluted suitably , and then analyzed using uv - spectrophotometer at 274 nm ( n = 3 ) .
buccal films of glibenclamide were prepared by solvent casting technique , employing aluminium foil cups ( placed on glass surface ) as a substrate .
composition of a single circular cast film of various formulations of buccal films were prepared by using drug and hpmck15 m with the ratio of [ gf1 ( 1:15 ) , gf2 ( 1:20 ) , gf3 ( 1:25 ) , gf4 ( 1:50 ) ] , hpmck100 m [ gf5 ( 1:15 ) , gf6 ( 1:20 ) , gf7 ( 1:25 ) , gf8 ( 1:50 ) ] , and hpmc3000 [ gf9(1:15 ) , gf10 ( 1:20 ) , gf11 ( 1:25 ) , gf12 ( 1:50 ) ] with 50 mg of glibenclamide .
propylene glycol , which acts as a plasticizer and permeation enhancer , is used in the concentration of 30% v / v .
dichloromethane and ethanol ( 50:50 v / v ) was used as a solvent system .
fifty milligrams of glibenclamide was incorporated in the polymeric solutions after levigation with 30% w / w propylene glycol , which served the purpose of plasticizer as well as penetration enhancer .
the medicated gels were left overnight at room temperature to obtain clear , bubble - free gels . to prevent evaporation of the solvent , medicated gels were filled into the vials and closed tightly by rubber closures .
the gels were caste into aluminium foil cups ( 10 8 cm diameter ) , placed on a glass surface was covered with inverted funnel , the end of which was plugged with cotton wool to allow controlled evaporation of the solvent .
these were allowed to dry at room temperature ( 30c ) to form a flexible film .
the dried films were cut into the size of 20 mm diameters , packed in aluminium foil and stored in desiccators until further use .
each formulation was prepared in triplicate ( n = 3 ) and 10 films equivalent to 2 2 cm area were cut from each plate . their weight was measured using keroy digital balance .
the thickness of the films was measured by digital screw gauge ( digimatic outside micrometer , mitutoyo , japan ) .
the mean sd ( n = 3 ) values were shown in table 1 .
physical properties of glibenclamide buccal films the surface ph of films was determined to know the possibility of side effects , in vivo as an acidic or alkaline ph may cause irritation to the buccal mucosa .
it was our aim to keep the surface ph as close to neutral as possible .
the surface ph was determined by taking 3 films of each formulation and the films were allowed to swell for 2 h on the surface of 2% agar plate .
the surface ph was measured by using a ph paper placed on the surface of the swollen film .
a mean of 3 readings was recorded ( n = 3 ) [ table 1 ] .
after determination of the original film weight ( w1 ) , the samples were placed on the surface of 2% agar plate kept in an incubator at 37c 0.2c and examined for any physical change . at regular 1-hr intervals until 3 h , the films were removed from the gel plates and excess surface water was removed carefully using filter paper .
the swollen films were then reweighed ( w2 ) and the swelling index ( si ) was calculated using the following formula .
the experiments were performed in triplicate , and average values were reported [ table 1 ] . from each formulation
3 films of size ( 2 2 cm ) were cut by a sharp blade .
folding endurance was determined by repeatedly folding a small strip of film at the same place till it broke .
the number of times the film could be folded at the same place without breaking gave the value of folding endurance .
the mean value of 3 readings ( n = 3 ) and standard deviation are shown in the table 1
. drug content uniformity was determined by dissolving the films in solvent and filter with whatman filter paper .
the resultant filtrate was evaporated and the drug residue was dissolved in 100 ml of ph 6.8 phosphate buffer .
absorbance of the sample was measured using uv vis spectrophotometer ( systronics ) 011 , hyderabad , at a wavelength of 274 nm against ph 6.8 phosphate buffer used as blank .
the experiments were carried out in triplicate and average values are reported in table 1 .
drug release from buccal films was studied by using dissolution rate test apparatus electrolabtdt 087 usp , mumbai .
the assembly for release study was prepared with the film being adhered onto a glass slide with one side of the film facing upward using a solution of cyanoacrylate adhesive , then placed in dissolution apparatus maintaining temperature at 37c 0.2c and rpm 50 using dissolution medium 900 ml phosphate buffer ph 6.8 .
samples ( 5 ml ) were collected at different time intervals : 10 , 15 min , 0.5 , 1 , 1.5 , 2 , 3 , 4 , 5 , 6 , and 7 h and replaced with fresh medium .
the release data were analyzed to study release kinetics using zero - order , first - order , korsmeyer
the release studies were performed in 6 replicates and mean sd values were calculated .
each formulation was prepared in triplicate ( n = 3 ) and 10 films equivalent to 2 2 cm area were cut from each plate . their weight was measured using keroy digital balance .
the thickness of the films was measured by digital screw gauge ( digimatic outside micrometer , mitutoyo , japan ) .
the mean sd ( n = 3 ) values were shown in table 1 .
the surface ph of films was determined to know the possibility of side effects , in vivo as an acidic or alkaline ph may cause irritation to the buccal mucosa .
it was our aim to keep the surface ph as close to neutral as possible .
the surface ph was determined by taking 3 films of each formulation and the films were allowed to swell for 2 h on the surface of 2% agar plate .
the surface ph was measured by using a ph paper placed on the surface of the swollen film .
a mean of 3 readings was recorded ( n = 3 ) [ table 1 ] .
after determination of the original film weight ( w1 ) , the samples were placed on the surface of 2% agar plate kept in an incubator at 37c 0.2c and examined for any physical change . at regular 1-hr intervals until 3 h , the films were removed from the gel plates and excess surface water was removed carefully using filter paper .
the swollen films were then reweighed ( w2 ) and the swelling index ( si ) was calculated using the following formula .
si = ( w2 w1)/w1 100 . the experiments were performed in triplicate , and average values were reported [ table 1 ] .
from each formulation 3 films of size ( 2 2 cm ) were cut by a sharp blade .
folding endurance was determined by repeatedly folding a small strip of film at the same place till it broke . the number of times the film could be folded at the same place without breaking gave the value of folding endurance .
the mean value of 3 readings ( n = 3 ) and standard deviation are shown in the table 1 .
drug content uniformity was determined by dissolving the films in solvent and filter with whatman filter paper .
the resultant filtrate was evaporated and the drug residue was dissolved in 100 ml of ph 6.8 phosphate buffer .
absorbance of the sample was measured using uv vis spectrophotometer ( systronics ) 011 , hyderabad , at a wavelength of 274 nm against ph 6.8 phosphate buffer used as blank .
the experiments were carried out in triplicate and average values are reported in table 1 .
drug release from buccal films was studied by using dissolution rate test apparatus electrolabtdt 087 usp , mumbai .
the assembly for release study was prepared with the film being adhered onto a glass slide with one side of the film facing upward using a solution of cyanoacrylate adhesive , then placed in dissolution apparatus maintaining temperature at 37c 0.2c and rpm 50 using dissolution medium 900 ml phosphate buffer ph 6.8 .
samples ( 5 ml ) were collected at different time intervals : 10 , 15 min , 0.5 , 1 , 1.5 , 2 , 3 , 4 , 5 , 6 , and 7 h and replaced with fresh medium .
the release data were analyzed to study release kinetics using zero - order , first - order , korsmeyer
the release studies were performed in 6 replicates and mean sd values were calculated .
ex vivo buccal permeation of glibenclamide studied with fresh sheep buccal mucosa as a barrier membrane .
the buccal pouch of freshly sacrificed animal was procured from local slaughter house and was used within 2 h of slaughter .
the membrane was washed with distilled water and then with phosphate buffer ( ph 6.8 ) .
the ex vivo permeation studies were carried out using the modified franz diffusion cell at 37c 0.2c . a film of ( 2 2 cm diameter ) each formulation under study was placed in intimate contact with the excised sheep buccal mucosa and the top side was covered with aluminum foil as a backing membrane .
teflon bead was placed in the receptor compartment filled with 15 ml of ph 7.4 phosphate buffer .
the cell contents were stirred with a magnetic stirrer and temperature of 37c 0.2c was maintained throughout the experiment .
the samples were withdrawn at predetermined time intervals , filtered , diluted suitably , and then analyzed using uv - spectrophotometer at 274 nm ( n = 3 ) .
in the present study , mucoadhesive buccal films of glibenclamide were prepared for controlled drug delivery , using hpmc - k15 m , hpmc - k100 m , and hpmc3000 cps .
the films were characterized for their physical characteristics , release characteristics , such as surface ph , thickness , folding endurance , drug content uniformity , and percentage swelling [ table 1 ] .
the film thicknesses were observed to be in the range of 0.213 0.005 mm to 0.4892 0.0012 mm and weight was found to be in the range of 22.25 1.25 mg to 39.83 1.35 mg .
considering the fact that acidic or alkaline ph may cause irritation to the buccal mucosa and influence the degree of hydration of polymers , the surface ph of the buccal films was determined to optimize both drug permeation and mucoadhesion .
attempts were made to keep the surface ph as close to buccal / salivary ph as possible , by the proper selection of the polymers for developing the buccal films .
the surface ph of all the films was within the range of salivary ph ( 6.4 - 6.8 ) .
hydration is required for a mucoadhesive polymer to expand and create a proper macromolecular mesh of sufficient size , and also to induce mobility in the polymer chains in order to enhance the interpenetration process between polymer and mucin .
polymer swelling permits a mechanical entanglement by exposing the bioadhesive sites for hydrogen bonding and/or electrostatic interaction between the polymer and the mucous network .
however , a critical degree of hydration of the mucoadhesive polymer exists where optimum swelling and bioadhesion occur .
the effect of glibenclamide on the swelling behavior of various mucoadhesive polymers was also observed [ table 1 ] .
this is possibly due to micronized drug particles , which exist between the polymer chains allowing each chain to hydrate freely , resulting in weak hydrogen - bonding areas around the glibenclamide molecules .
these areas may increase the strength of the swollen layer followed by an obvious increase in the amount of penetrated water .
the influence of drug on the swelling properties of polymer matrices is primarily dependent on the substituted groups of the polymer .
the hydroxyl group in the molecules plays an important role in the matrix integrity of the swollen hydrophilic cellulose matrices .
the comparative percentage swelling for various formulations was in the following order : ( gf1 < gf2 < gf3 < gf4 ) , ( gf5 < gf6 < gf7 < gf8 ) , and ( gf9 < gf10 < gf11
< gf12 ) [ table 1 ] . the films containing hpmck15 showed a higher percent swelling due to the presence of more hydroxyl groups in the hpmc molecules .
the water - soluble hydrophilic additive dissolves rapidly , resulting in high porosity . the void volume is thus expected to be occupied by the external solvent diffusing into the film , and thereby accelerating the dissolution of the gel .
the incorporation of the drug induced significant reduction in the residence time of various formulations .
as the particle swells , the matrix experiences intramatrix swelling force , which promotes disintegration and leaching of the drug leaving behind a highly porous matrix .
water influx weakens the network integrity of the polymer , thus influencing structural resistance of the swollen matrices , which in turn results in pronounced erosion of the loose gel layer . in vitro residence time of
the folding endurance was measured manually by folding the films repeatedly at a point till they broke . the breaking time was considered as the end point . folding endurance was found to be highest for gf12 ( 275.3 12.17 ) and lowest for gf1 ( 173.5 5.65 ) [ table 1 ] .
it was found that the folding endurance of hpmc films were increased with increasing concentration of polymer .
the comparative folding endurance of formulations was in the following order : ( gf1 < gf2 < gf3 < gf4 ) , ( gf5 < gf6 < gf7 < gf8 ) and gf9
< gf10 < gf11 < gf12 ) drug content in formulations being 2.46 0.02 to 2.48 0.08 mg/20 mm indicated that the drug was dispersed uniformly throughout the film . in vitro release studies of various formulations
were performed using ph 6.8 phosphate buffer as dissolution medium and drug concentration was measured spectrophotometrically at 226 nm .
hpmck100 m shows good release characteristics , as has been already discussed that the release of the drug from the film takes more time when the weight of the polymer increased .
g releases the drug faster than the following weights 1.0 , 1.25 , and 1.5 g. during dissolution , the loosely bound polymer molecules with hpmc in these films were readily eroded , allowing the easy release of glibenclamide .
it was found that the drug release from the films varied with respect to the proportion of polymers .
preliminary studies done with the groups of formulations , from which these 4 formulations were selected , showed that increase in the polymer concentration reduced the diffusion of drug from the matrix [ figure 1 ] . if the viscosity increases , the entrapment of drug is tightly bound in between the cross - links of the polymer ; thereby the drug will take time to release from the film . the different ratios of polymer used were hpmck15 m ( gf1 , gf2 , gf3 , gf4 ) , hpmck100 m ( gf5 , gf6 , gf7 , gf8 ) , and hpmc3000 ( gf9 , gf10 , gf11 , gf12 ) . from the above - mentioned polymers , the drug release after 4 h was found to be gf1 ( 90.95% ) , gf2 ( 85.22% ) , gf3 ( 82.83% ) , gf4 ( 79.86% ) , gf5 ( 78.41% ) , gf6 ( 75.81% ) , gf7 ( 71.92% ) , gf8 ( 69.98% ) , gf9 ( 65.36% ) , gf10 ( 51.12% ) , gf11 ( 45.51% ) , and gf12 ( 45.19% )
. the percentage of drug release from the film is selected , and showed that the increase in the polymer concentration reduced the diffusion of drug from the matrix . due to its high viscosity
, the thick gel layer formed on the swollen film surface is capable of preventing matrix disintegration and controlling additional water penetration .
hence the drug release from hpmc3000 films delayed with increasing concentration , that is , gf10 ( 51.12% ) , gf11 ( 45.51% ) , and gf12 ( 45.19% ) after 4th h [ figure 1 ] .
zero - order drug release profile for selected formulations of glibenclamide buccal films and marketed immediate release tablet the mechanism of drug release whether diffusion , swelling , or erosion was confirmed by higuchi 's plots showing the graphical representation of cumulative percentage drug release vs. square root of time [ figure 2 ] .
the higuchi plots were found to be linear with correlation coefficient values 0.8933 , 0.9138 , and 0.9947 for gf4 , gf8 , and gf9 , respectively .
it was concluded that the release of the drug from the films followed the diffusion controlled mechanism in all the formulations .
higuchi plots for selected formulations of glibenclamide buccal films it was found that formulations gf4 ,
gf8 , and gf9 showed good swelling , a convenient residence time , as well as promising drug release pattern . on the basis of release pattern , swelling , and residence time , gf4 , gf8 , and gf9 formulations were selected for ex vivo study . in ex
vivo study , drug permeation through the sheep buccal mucosa was determined for formulations gf4 , gf8 , and gf9 [ figure 3 ] . the drug permeation was found to be 89.44% , 82.93% , and 65.72% in gf4 , gf8 , and gf9 , respectively , after 4 h as they are correlated with in vitro drug release profile .
these films also subjected to ftir studies showed no interaction between the polymer and the drug , glibenclamide [ figures 4 and 5 ] .
zero - order drug release profiles for ex vivo permeation studies with selected glibenclamide films of hydroxypropyl methyl cellulose using sheep buccal mucosa ftir spectra of pure drug glibenclamide ftir spectra of pure drug glibenclamide and polymer
the present study indicates a good potential of erodible mucoadhesive buccal hpmc films containing glibenclamide for systemic delivery with an added advantage of circumventing the hepatic first - pass metabolism . from the results
it can be concluded that hpmc3000 at low concentrations can be useful for buccal delivery of glibenclamide in a controlled manner .
buccal drug delivery is a promising area for continued research with the aim of systemic delivery of orally inefficient drugs as well as a feasible attractive alternative for noninvasive delivery of potent peptide and protein drug molecules .
however , the need for safe and effective buccal permeation / absorption enhancers is a crucial component for a prospective future in the area of buccal drug delivery .
|
background : glibenclamide is an oral hypoglycemic drug completely metabolized in the liver , the principal metabolite being very weakly active , buccal delivery may be useful for the treatment of diabetes more effectively .
the aim of the present study was to design formulations and systematically evaluate in vitro and ex vivo performances of buccal films of glibenclamide so that the required therapeutic plasma concentrations can possibly be achieved more rapidly using the different grades of hydroxypropyl methyl cellulose ( hpmc ) as the base matrix.materials and methods : mucoadhesive buccal films of glibenclamide were prepared by solvent casting technique using different grades of hpmc with different ratios .
prepared films were evaluated for weight , thickness , surface ph , swelling index ( si ) , folding endurance , drug content uniformity , in vitro release , and ex vivo permeation studies.results:the film thickness and weight were in the range of 0.2130.4892 mm and 22.2539.83 mg , respectively .
the films exhibited controlled release over more than 6 h. hpmc , hpmck100 , and hpmc3000 films exhibited satisfactory swelling .
surface ph of buccal films was found to be 6.46.8 .
si observed to be highest for gf12 ( 275.3 12.17 ) and lowest for gf1 ( 173.5 5.65 ) .
the films exhibited controlled release over more than 6 h. hpmc exhibited satisfactory swelling , an optimum residence time , and promising drug release .
the higuchi plots were found to be linear with correlation coefficient values of 0.8933 , 0.9138 , and 0.9947 for gf4 , gf8 , and gf9 , respectively.conclusions:among all the formulations , gf9 shows good controlled release results correlated with ex vivo permeation studies .
|
the investigation of the mycobactericidal activity of disinfectants and antiseptics has been standardized for several years . the first european standard en 14204 for testing the mycobactericidal activity of products used in the veterinary field was implemented by the cen ( european committee for standardization ) in 2004 .
the standard en 14563 , dedicated to mycobactericidal products used in the medical area , was established in 2008 .
the laboratory research performed used mycobacterial strains derived from the american type culture collection ( atcc ) , except for mycobacterium tuberculosis , due to the risk of infection in the laboratory and the slow growth of microorganisms .
in addition , the mycobacteria that cause tuberculosis are classified by the us centers for disease control and prevention ( cdc ) in atlanta as category c , and this pathogen can be used as a biological weapon . according to world health organization ( who ) , tuberculosis , hiv , and malaria are the most common infectious diseases in the world ( one - third of the world population is infected with mycobacterium tuberculosis ) . in this context , effective disinfection , in addition to regular immunization , is a significant method for the limitation of mycobacterial infections .
mycobactericidal activity testing was performed in accordance with european standards ( en ) based on the culture of mycobacteria , which means that the test results are known after 21 days .
however , the use of the mycobacterium terrae strain , which contains the gfpm gene , causes fluorescence of living mycobacteria cells and can reduce the detection time to 15 days .
there is growing interest among manufacturers of disinfectants and antiseptics in conducting tests of mycobactericidal activity in accordance with ens , which will make the presence of high - quality products on the market possible .
the aim of this study was to evaluate the mycobactericidal activity against 2 mycobacterial species , mycobacterium avium and mycobacterium terrae , or the activity only against mycobacterium tuberculosis , of selected chemical disinfectants and antiseptics used in the medical and veterinary areas in accordance with relevant european standards [ 57 ] .
the department of antibiotics and microbiology at the national medicines institute , warsaw , poland , has investigated the antimicrobial effectiveness of antiseptic and disinfectant products for many years .
our department is certified by the european directorate for the quality of medicines ( edqm ) for microbiological tests carried out in accordance with iso / en 17025 and possesses the accreditation of the polish centre for accreditation ( no .
ab 774 ) for microbiological testing of disinfectants and antiseptics , according to several ens .
these studies included 19 products submitted to the national medicines institute in poland for the evaluation of mycobactericidal activity .
these products contain active substances that belong to different chemical groups , including aldehydes , alcohols , amines , quaternary ammonium compounds , guanidine , phenols , and oxidizing compounds ( table 1 ) .
investigations , according to the manufacturers description of the products , were carried out in accordance with european standards , which also met the polish standards : pn - en 14204 : 2013 ( en 14204 : 2012 ) : chemical disinfectants and antiseptics quantitative suspension test for the evaluation of mycobactericidal activity of chemical disinfectants used in the veterinary area
test method and requirements ( phase 2 , step 1 ) ; pn - en 14348 : 2006 ( en 14348 : 2005 ) : chemical disinfectants and antiseptics quantitative suspension test for the evaluation of mycobactericidal activity of chemical disinfectants in the medical area including instrument disinfectants test method and requirements ( phase 2 , step 1 ) ; and pn - en 14563 : 2012 ( en 14563 : 2008 ) : chemical disinfectants and antiseptics quantitative carrier test for the evaluation of mycobactericidal or tuberculocidal activity of chemical disinfectants used for instruments in the medical area test method and requirements ( phase 2 , step 2 ) .
products recognized as mycobactericidal should be active against both mycobacterium avium and mycobacterium terrae mycobacterial species .
product activity against mycobacterium tuberculosis is determined in accordance with the recommendations of the european committee for standardization ( cen ) , only to strain m. terrae .
the product meets the requirements of the pn - en 14563 : 2012 when after 60 min of contact time of the product and mycobacteria suspension in the appropriate temperature ( 10c or 20c ) , it demonstrates at least a decimal log reduction in counts of 4 ( reduction 4 log cfu / ml ) of both organisms ( mycobactericidal activity ) or only against m. terrae ( tuberculocidal activity ) .
depending on the application of the products , interfering substance were used : clean conditions were simulated by 0.3 g / l bovine serum albumin /bsa/ ( according to en 14348 and en 14563 ) , or by a solution of bsa 3.0 g / l ( according to en 14204 ) and dirty conditions , 3.0 g / l bsa , 3.0 ml / l sheep erythrocytes ( according to en 14348 and en 14563 ) or yeast extract 10 g / l , bsa 10 g / l ( according to en 14204 ) . in the studies performed according to the pn - en 14348 and pn - en 14563 , 2 reference strains of mycobacteria mycobacterium avium atcc 15769 and mycobacterium terrae atcc 15755 were used . in tests
performed according to pn - en 14204 , only the strain m. avium atcc 15769 was used .
these studies included 19 products submitted to the national medicines institute in poland for the evaluation of mycobactericidal activity .
these products contain active substances that belong to different chemical groups , including aldehydes , alcohols , amines , quaternary ammonium compounds , guanidine , phenols , and oxidizing compounds ( table 1 ) .
investigations , according to the manufacturers description of the products , were carried out in accordance with european standards , which also met the polish standards : pn - en 14204 : 2013 ( en 14204 : 2012 ) : chemical disinfectants and antiseptics quantitative suspension test for the evaluation of mycobactericidal activity of chemical disinfectants used in the veterinary area test method and requirements ( phase 2 , step 1 ) ; pn - en 14348 : 2006 ( en 14348 : 2005 ) : chemical disinfectants and antiseptics quantitative suspension test for the evaluation of mycobactericidal activity of chemical disinfectants in the medical area including instrument disinfectants test method and requirements ( phase 2 , step 1 ) ; and pn - en 14563 : 2012 ( en 14563 : 2008 ) : chemical disinfectants and antiseptics quantitative carrier test for the evaluation of mycobactericidal or tuberculocidal activity of chemical disinfectants used for instruments in the medical area test method and requirements ( phase 2 , step 2 ) . products recognized as mycobactericidal
product activity against mycobacterium tuberculosis is determined in accordance with the recommendations of the european committee for standardization ( cen ) , only to strain m. terrae .
the product meets the requirements of the pn - en 14563 : 2012 when after 60 min of contact time of the product and mycobacteria suspension in the appropriate temperature ( 10c or 20c ) , it demonstrates at least a decimal log reduction in counts of 4 ( reduction 4 log cfu / ml ) of both organisms ( mycobactericidal activity ) or only against m. terrae ( tuberculocidal activity ) .
depending on the application of the products , interfering substance were used : clean conditions were simulated by 0.3
( according to en 14348 and en 14563 ) , or by a solution of bsa 3.0 g / l ( according to en 14204 ) and dirty conditions ,
3.0 g / l bsa , 3.0 ml / l sheep erythrocytes ( according to en 14348 and en 14563 ) or yeast extract 10
g / l , bsa 10 g / l ( according to en 14204 ) .
in the studies performed according to the pn - en 14348 and pn - en 14563 , 2 reference strains of mycobacteria mycobacterium avium atcc 15769 and mycobacterium terrae atcc 15755 were used . in tests performed according to pn - en 14204 , only the strain m.
the majority of products ( 17/18 ) for use in the medical field were tested in accordance with en 14348 .
one product designed for use in the veterinary field was evaluated according to en 14204 .
both of these standards are to be tests of phase 2 step 1 ( suspension method ) in which the products are tested under simulated conditions by the introduction of inorganic loads ( hard water to dilute the product ) and organic loads ( albumin , albumin + erythrocytes , or albumin + yeast extract ) .
only 4 studies were conducted in accordance with en 14563 the phase 2 step 2 , in which a test suspension of mycobacteria in a solution of interfering substances was spread on a glass carrier ( glass slides ) . the majority of tested products ( 16 out of 19 ) showed mycobactericidal activity in accordance with the applicable standard under the selected conditions of the study ( tables 2 and 3 ) . only 1 product , desisoft ytdesinfektion , did not present what was required by the appropriate standard of mycobactericidal activity in undiluted form , even when the longest contact time ( 60 min ) was applied .
the study was conducted at the request of the manufacturer ; however , the mycobactericidal activity was not declared on the product s label . the other 2 products
. proper selection of the test conditions ( concentration , contact time , interfering substance ) allows for determination of the mycobactericidal activity in specific conditions of use .
table 3 presents the results of the activity of the product virusolve + eds , after 4 contact exposures of 5 , 15 , 30 , and 60 min , examined in carrier test under simulated clean and dirty conditions .
there was a significant increase in the activity of the product against m. avium , from about 2.3 log after 5 min to more than 4.9 log after 60 min .
the prolongation of contact time of this product with m. terrae from 5 to 60 min did not cause appropriate activity ( reduction minimum 4 log ) , although with increasing contact time , the product caused reduction of tested mycobacteria from a value of below 1.4 log to about 3.0 log .
the manufacturer of the product ( virusolve + eds ) declared mycobactericidal activity at a 2.5% concentration after 5 min of contact time .
the results in table 3 show that this product , at a concentration of 2.5% , is active against m. avium only after 30 min of contact time , but in the case of m. terrae , the 4-log reduction was not achieved , even after 60 min of exposure to the agent .
mycobactericidal activity of disinfectants and antiseptics depends on chemical compositions , concentrations of use , durations of contact time , and organic loads .
aldehydes , phenols , quaternary ammonium compounds , and polyalkylamines are commonly used as detergents / disinfectants in the disinfection procedure . because of the toxicity of aldehydes and phenols , new disinfectant formulations are being developed .
amine - based disinfectants have become quite popular for the disinfection of surgical instruments and other medical devices .
korsolex af ( 15.6% dodecyl - bis - propylene triamine and 5.1% lauryl propylene diamine ) was studied by hernandez et al . .
the mycobactericidal and tuberculocidal activities of korsolex af against m. tuberculosis h37 rv atcc 25618 , mycobacterium kansasii atcc 12478 , m. chelonae atcc 35752 , and a mai ( m. avium
m. intracellulare ) clinical strain were determined using quantitative bacteria suspension and carrier tests .
korsolex af had acceptable efficacy against several species of mycobacteria in quantitative suspension and carrier tests at a concentration of 2% with an exposure time of 30 min .
one of the 4 strains the mai clinical strain was the least sensitive : the reduction in number of mycobacteria was about 4.6 log , while for the other strains the reduction rate was more than 5 log .
glutaraldehyde is widely used as the active ingredient in high - level disinfectants for heat - sensitive , semi - critical medical instruments , including soft endoscopes or bronchoscopes , which may be contaminated with different strains of bacteria , including mycobacteria , after usage .
flexible fiber - optic bronchoscopy has become accepted as a safe tuberculosis diagnostic and therapeutic procedure and it is typically well tolerated by the patient .
however , the transmission of mycobacterium tuberculosis , atypical mycobacteria , and other pathogens between patients undergoing bronchoscopy has been reported due to improper cleaning and disinfection procedures .
miner et al . demonstrated that products containing concentrations of 20% w / w isopropanol and 8% potassium acetate in combination with 3.5% w / w glutaraldehyde at alkaline ph values killed 6 log of mycobacteria mycobacterium bovis var bcg , m. terrae atcc 15755 , and glutaraldehyde - resistant m. chelonae var abscessus atcc 14472 within 10 min at 20c . in our study , products containing glutaraldehyde ( aldesan e , aldizol , and synsept ag ) have also been found to be effective against mycobacteria ( i.e. , they meet the requirements of en 14348 ) .
much work has been devoted to the study of the mycobactericidal activity of products containing ortho - phthalaldehyde ( opa ) , glutaraldehyde ( gta ) , and other dialdehydes .
. showed high mycobactericidal activity of aldehydes ( opa ) at 0.5% ( v / v ) unadjusted ph 6.5 and ph 8 , under both clean and dirty conditions .
test organisms consisted of glutaraldehyde ( gta)-sensitive strains of mycobacterium chelonae nctc 946 , m. abscessus nctc 10882 , two gta - resistant m. chelonae strains , and m. terrae nctc 10856 ( a proposed m. tuberculosis surrogate ) . all mycobacterial reference strains used in the suspension test under clean conditions were very sensitive to 0.5% alkaline opa , resulting in a log reduction factor of 5 after 1 min exposure or after 10 min with m. abscessus ntcc 10882 . in the carrier test , in which discs of polypropylene ( the material of which endoscopes are constructed )
were covered with biofilm formed from a mixture of mycobacteria with sodium alginate , a high degree of bacterial reduction was achieved ( 5 log ) for a 0.5% w / v solution of opa , but after a longer contact time ( 3060 min ) and only under clean conditions .
mycobactericidal activity of cidex ( 2% glutaraldehyde ) and cidex opa ( 0.55% ortho - phthalaldehyde ) was evaluated with m. smegmatis atcc 19420 and with clinical isolates of m. fortuitum , m. abscessus , and m. tuberculosis h37rv ( apart from the clinical strain of m. chelonae ) . cidex and cidex opa were effective against tested organisms , showing greater than a 5-log reduction in colony - forming units ( cfu ) after 5 min of exposure under both clean and dirty conditions .
in the past decade , high - level disinfectants based on glutaraldehyde have become widely used in disinfection because of their mycobactericidal activity . however , disinfection with glutaraldehyde has recently been of some concern because of its toxicity , skin and respiratory sensitizing of hospital staff , and the emergence of resistant mycobacteria .
this agent also selects for strains of several microorganisms with a decreased susceptibility to 2% alkaline glutaraldehyde , such as mycobacterium chelonae .
the in vitro and in vivo studies conducted by hernandez et al . showed the equivalency of products for disinfection of bronchoscopes , containing 2% glutaraldehyde ( cidex ) and 0.26% peracetic acid ( perasafe ) .
both preparations caused a reduction in the number of mycobacteria of more than 5 log after 20 to 30 min , under both clean and dirty conditions . in our studies , products containing peracetic acid also caused high reduction ratios ( over 6 log ) of both mycobacterial strains of m. terrae and m. avium after 10 to 15 min of contact time in a study conducted in dirty conditions .
chlorine dioxide may be an alternative to aldehydes in disinfection of soft endoscopes and other medical equipment . in the carrier test according to the modified method of pren 14563 : 2005 , hernandez et al .
tristel sporicidal wipes. this system is composed of 2 components : a wipe that is saturated with a mixture of organic acids , preservatives , buffers , and corrosion inhibitors , and a bottle containing a sodium chlorite - based foam . prior to testing ,
the wipes were prepared by squirting foam onto the wipe and then scrunching it by hand to mix the 2 components of the product to activate the disinfectant .
the results showed that the chlorine dioxide wipes were mycobactericidally active against m. avium atcc 15769 with 30 s contact time with mechanical action and in 60 s without mechanical action , under both clean and dirty conditions . in our suspension studies ( en 14348 ) , chlorine - based disinfectant ( chlor - clean ) showed activity against both strains of mycobacteria m. avium and m. terrae , compatible with the standard . increasing the chlorine concentration of use from 1000 ppm to 10 000 ppm , despite the changing conditions from clean to dirty at the same contact time ; 15 min resulted in a significant increase in the degree of reduction of bacteria , from approximately 4 log to over 6 log .
an example of a different , new biocidal substance from the oxidizing agents group is 2-butanone peroxide , which is proposed for use in antiseptic and disinfectant products dedicated for skin disinfection and for the disinfection of instruments and surfaces in a hospital environment .
garcia - de - lomas et al . tested the biocidal activity of different concentrations of 2-butanone peroxide against different microorganisms : bacteria , spores , fungi , viruses , and also mycobacteria , including m. terrae atcc 15755 .
it showed a degree of reduction of approximately 7 log at a 0.5% solution , after 60 min of contact time at 20c .
toxicity assessment showed negative results in the acute dermal irritation test , acute eye irritation test , and acute oral toxicity test .
the results allow for the recognition of 2-butanone peroxide as an active ingredient suitable for use in the new formulation of antiseptics and disinfectants .
taking into account the biocidal efficacy of disinfectants , as well as security to users and the environment and compatibility with disinfected materials , a new formulation based on hydrogen peroxide ( accelerated hydrogen peroxide , ahd ) was developed .
it contains very low levels of certain food - grade anionic and non - ionic surfactants , which act in synergy with hydrogen peroxide to produce the desired microbicidal activity .
omidbakhsh and sattar investigated the activity of such a product containing 0.5% hydrogen peroxide against mycobacteria : m. bovis , bcg strain and m. terrae atcc 15755 .
the resulting degree of reduction after a contact time only 5 min at 20c for these strains was over 6 log in the presence of 5% serum .
our results confirmed the efficacy of products containing hydrogen peroxide ( synrol paa10 and synsept paa ) against mycobacteria m. avium and m. terrae .
the complex composition of the products should also be considered , as they also include other active substances .
disinfecting products that contain substances from the group of quaternary ammonium compounds do not exhibit effective biocidal activity against mycobacteria .
conducted studies with 2 disinfectants gerdex and k - ller which both contain the quaternary ammonium compound dimethyl benzyl lauryl ammonium bromide in concentrations of 10% and 0.16% , respectively .
gerdex and k - ller caused only a 2-log cell reduction of m. tuberculosis h37rv , m. abscessus , and m. chelonae , even after 60 min of contact time under both clean and dirty conditions .
the products tested in our study ( lysoformin plus - schaum , onemed easydes and synsept ag ) , in addition to quaternary ammonium compounds , also contain other active ingredients .
only the product lysoformin plus schaum showed no reduction in accordance with en 14348 of m. terrae cells , even under clean conditions after 15 min of contact time ( < 3.1 log ) , but in the case of a m. avium the degree of reduction was on the border of the requirements according to standard ( approximately 4.1 log ) .
the tested products for disinfection and antisepsis contain active substances from different chemical groups : aldehydes , alcohols , quaternary ammonium compounds , phenolic compounds , and oxidizing agents . in most cases they showed mycobactericidal activity that complied with european standards . in the case of products that contain guanidines and amine compounds , the concentration of active ingredients used and the test conditions specified by the client that ordered the test did not show the mycobactericidal activity required by the standards . prior to the introduction of the product to the market , it is important to establish the appropriate conditions for the use of the product , such as the concentration to use , contact time , and clean or dirty conditions .
|
backgroundthe history of the investigation of standardized mycobactericidal activity of disinfectants and antiseptics is not very long .
there is growing interest among the manufacturers of disinfectants in carrying out research on the antimicrobial activities in accordance with european standards ( en ) .
this research could facilitate the introduction of high - quality disinfectants to the market .
the aim of this study was to evaluate the mycobactericidal activity of selected chemical disinfectants and antiseptics used in the medical and veterinary fields.material/methodsthis study included 19 products submitted to the national medicines institute in poland for evaluation of mycobactericidal activity .
these products contain in their composition active substances belonging to different chemical groups , including aldehydes , alcohols , amines , quaternary ammonium compounds , phenols , guanidine , and oxidizing compounds .
this study , conducted according to the manufacturers description of the preparations , was carried out in accordance with european standards , which also met the polish standards : pn - en 14204 : 2013 , pn - en 14348 : 2006 , and pn - en 14563 : 2012.resultstested products for disinfection and antiseptics containing active substances from different chemical groups showed high mycobactericidal activity and met the requirements of the appropriate european standards in most cases . in the case of products containing guanidine and amine compounds , the concentration of active ingredients used in the test and the test conditions specified by the manufacturer did not provide the mycobactericidal activity required by the standards.conclusionsprior to the launch of a new product on the market , it is important to establish the appropriate usage and testing conditions of the preparation , such as its practical concentration , contact time , and environment condition ( clean or dirty ) .
|
stem cells represent the building blocks of our bodies , functioning as the natural units of embryonic generation during development , and adult regeneration following tissue damage .
they are defined by two distinct characteristics : the ability to maintain themselves through cell division , sometimes after long periods of inactivity ( self - renewal ) , and the ability to give rise to more specialized cell types ( differentiation ) .
based on the stage in development they are derived from , stem cells are broadly classified as embryonic , umbilical cord , and adult stem cells .
potency of stem cells decreases during development from totipotent stem cells at the morula stage , capable of differentiating into all embryonic and extraembryonic tissues , to pluripotent stem cells at the blastocyst stage , forming all embryonic tissues , and to multi- or uni - potent adult stem cells , forming tissues within their germ layer ( figure 1 ) .
modern understanding of stem cell biology dates back to 1960s , when multipotent hematopoietic and stromal stem cells residing in the bone marrow were identified . from then on , a number of works have reported the isolation of stem cells from adult tissues .
adult stem cells , also called somatic stem cells , prompt tissue homeostasis throughout life and ensure tissue regeneration following damage .
they reside in specific anatomic locations ( stem cell niches ) and are regulated by a combination of cellular , molecular , and physical signals .
numerous types of adult stem cells have been identified , including hematopoietic , mesenchymal , endothelial , intestinal , and neuronal stem cells , each displaying different properties and potency .
mesenchymal stem cells , which have been isolated from a range of adult tissues including bone marrow , periosteum , fat , skeletal muscle , and synovial fluid , as well as from the cord blood , umbilical cord , and placenta , have been extensively explored as a source of cells for biomedical applications , owing to their broad regenerative potential , paracrine regulatory effects , and strong immunomodulatory activity .
notably , cell populations isolated from different tissues exhibit phenotypic similarities , as well as specific differences in gene expression profiles and biosynthetic properties [ 14 , 15 ] .
importantly , adult stem can be harvested and reimplanted in the same patient , therefore circumventing the immunological problems associated with allogeneic cell transplantation . however , adult stem cells exhibit limited proliferation potential and progressive loss of functionality upon in vitro expansion [ 1618 ] , and an age - associated decline in cellular fitness [ 19 , 20 ] , which limit their use for generating large amounts of functional cells for experimental and clinical applications . on the other hand , human embryonic stem cells ( hescs ) , which have been first derived from early embryos in 1998 , are characterized by virtually unlimited proliferation potential and ability to give rise to all tissues constituting the human body , thus holding a high potential for biomedical research and clinical applications as an allogeneic cell source
. however , the broader differentiation potential also presents a challenge in directing / controlling the cell fate , and a higher risk of tumor formation after transplantation of hesc - derived tissue progenitors compared to adult stem cells .
the ethical controversies involving isolation of hesc and the need for an autologous pluripotent stem cell source have fueled intense investigations into cellular reprogramming , leading to the generation of induced pluripotent stem cells ( ips ) in 2006 ( figure 1 ) .
more recently , the new techniques of cellular reprogramming have also been adapted for transdifferentiation the ability of cells to switch from one specialized cell type to another directly , without reversal into a less specialized cell ( figure 1 ) .
we are now at a point when our growing understanding of the stem cell regenerative potential , and the development of new technologies offer unprecedented possibilities to conduct biomedical research and to translate the findings into new treatments . in the current paper
, we will present the state of the art in human pluripotent stem cells and transdifferentiation research , and discuss some of the biomedical applications that this emerging technology is expected to empower .
thomson and colleagues were the first to derive hesc lines from the inner cell mass of human blastocysts generated during in vitro fertilization procedures .
derivation from morula stage embryos , from developmentally arrested ( poor quality ) embryos , and from single blastomeres has also been reported , although with lower efficiencies [ 2326 ] . between 650% of normal embryos
give rise to new hesc lines , whereas only up to 3% success has been reported with poor quality embryos .
chen and colleagues systematically explored the timing of inner cell mass isolation and found that isolation on day 6 postfertilization results in the highest hesc derivation efficiency ( ~50% ) , about 10-fold increased compared to isolation on day 5 , and about 5-fold increased compared to hesc derivation from intact blastocysts .
hesc typically grow in compact colonies on feeder layers of murine embryonic fibroblasts or human cells , which produce the extracellular matrix for cell attachment and condition the culture medium with paracrine factors [ 21 , 28 ] .
protein substrates ( e.g. matrigel , laminin , vitronectin ) and synthetic matrices can also be used for cell derivation and/or culture , providing a more reproducible culture system [ 29 , 30 ] .
hesc culture media were initially supplemented with fetal bovine serum of selected lots , or serum replacement , and with growth factors ( i.e. , basic fibroblast growth factor ) which activate the intracellular signaling networks maintaining pluripotency [ 21 , 31 ] . in 2006 ,
ludwig and colleagues developed a defined medium for feeder - free derivation and culture of hesc , accomplishing one of the critical steps to standardize cell production and banking .
however , hesc cultivation and passaging are conducted manually , using enzymes ( collagenase iv , dispase , trypsin ) or mechanical dissociation of colonies .
survival of hesc as single cells or small aggregates at passaging and after freezing - thawing cycles has been extremely low , until the discovery that application of a selective rho - associated kinase ( rock ) inhibitor , y-27632 markedly diminishes dissociation - induced apoptosis .
further investigations are aimed at automating and scaling up hesc production , such as expansion and differentiation in three - dimensional carriers in suspension culture bioreactors .
hescs are commonly characterized by probing the expression of pluripotency markers , including transcription factors ( oct4 , sox2 , nanog ) , surface antigens ( stage specific antigens ssea-4 , ssea-3 , proteoglycans tra-1 - 60 , tra-1 - 81 ) , and enzymes ( alkaline phosphatase and telomerase ) .
pluripotency is confirmed by testing the formation of teratomas containing tissues of all three germ layers after injection into immunocompromised mice [ 21 , 35 ] .
in addition , genetic status and microbiological status are screened to assess quality of the cultures .
the described hesc culture environment has allowed extensive ( potentially unlimited ) expansion of undifferentiated cells , while maintaining a normal euploid karyotype .
however , several studies showed that hesc cultivation can lead to accumulation of genomic abnormalities , including amplifications and deletions of whole chromosomes or large genomic regions , amplification of certain gene regions ( i.e. , myc oncogene ) , changes in single nucleotide polymorphism , mutations in mitochondrial genome , and aberrant methylation profiles [ 3638 ] .
many of these alterations were observed in late passages , and are likely to provide a growth advantage to the cells . in the future , it will be important to evaluate how specific genomic changes might affect the differentiated progeny of hesc , and to regularly monitor the genomic status of hesc applying high - resolution techniques .
first indications that nuclei of somatic cells can be reprogrammed to generate all germ layers of an adult animal date back to 1958 , when gurdon and colleagues cloned mature fertile xenopus laevis from cultured intestinal cells of tadpoles .
it took until 1997 to clone the first mammalian , dolly the sheep , by transferring the nucleus of an epithelial cell into enucleated oocyte .
reports of successful cloning of mice , cats , dogs , and other animals by somatic cell nuclear transfer followed [ 4143 ] .
recently , it was shown that human somatic cell nuclei can be reprogrammed when intact oocytes are used as the recipient cells , resulting in the first triploid pluripotent cell lines .
meanwhile , a groundbreaking discovery that has transformed the field came from an alternative approach in 2006/2007 , when takahashi and colleagues reprogrammed first mouse and then human skin fibroblasts to an
induced pluripotent state by forced expression of four transcription factors : oct4 , sox2 , klf4 , c - myc , delivered by retroviruses [ 22 , 45 ] .
understanding of esc biology was essential for the generation of induced pluripotent stem cells ( ips ) , guiding the selection of transcription factors and culture conditions .
improvements of the reprogramming methods followed rapidly , including the use of alternative nonintegrating vectors [ 46 , 47 ] , reprogramming by recombinant proteins , using only two factors for reprogramming , and replacement of transcription factors with small molecules . in 2010 , warren and colleagues reported on cellular reprogramming using modified rna , avoiding genetic manipulation , and increasing the efficiency of the process . whereas optimization of techniques is still ongoing , generation of hips lines in a safe way opens the possibility for their use in replacement therapies .
many of the culture protocols developed for hesc have been successfully adapted to hips , which resemble hesc in their morphology , feeder dependence , surface marker expression , and in vivo teratoma formation capacity .
however , it remains an open question how similar are various hesc and hips lines .
a study by the international stem cell initiative characterizing 59 hesc lines from 17 laboratories showed similarities in the expression patterns of most hesc markers , as well as differences in expression patterns of some lineage markers and imprinted genes .
variable efficiencies to form specific lineages , such as cardiac , neuronal , and pancreatic in vitro , were also observed [ 52 , 53 ] . in hips , the problem of variability resulting from different genetic backgrounds and culture conditions is compounded by the differences in reprogramming protocols , which involve major transcriptional and epigenetic shifts . perhaps not surprisingly , studies showed larger heterogeneity of hips compared to hesc on a single - cell level , distinct gene expression and methylation signatures , epigenetic memory of somatic cell origin , and differences in the yield and properties of differentiated progeny , such as early senescence of ips - derived cells .
there have also been reports of similarities between cohorts of hesc and hips , such at the study of boulting and colleagues , who have found a similar range of efficiencies for motor neuron differentiation between hesc and hips lines .
bock and colleagues have approached the problem by establishing genome - wide reference maps for dna methylation and gene expression of 20 hesc and 12 hips lines , and combined these with assaying in vitro differentiation propensity and evaluating 500 lineage - specific transcripts .
the assays were combined in a scorecard for a quick and comprehensive characterization of pluripotent cell lines .
their results suggest that hesc and hips should be regarded as two partially overlapping groups , with inherent variability among both hesc and hips lines .
some studies have indicated that hips retain certain epigenetic memory from the parent cells , and it is largely unclear to what extent the origin of the reprogrammed cells could affect their safety and function .
ideally , the source cells would be easily accessible with minimal risk procedures for the patients ( i.e. , blood sample ) , available in large quantities , and allow relatively high reprogramming efficiency and fast hips derivation process .
the elucidation of the molecular and cellular events occurring during embryogenesis is of paramount importance to understand the key pathways regulating cell differentiation and tissue formation under normal and pathological conditions .
historically , early development was studied in experimental animals , with mouse being the most popular due to its defined genetics and reproductive ability .
strong conservation of genes and signaling pathways regulating development between the species has justified the use of animal models as research platform .
mouse studies led to identification of several genes and signaling pathways , including wnt , nodal and bmp pathways , which display specific spatiotemporal expression profiles during embryogenesis and play an important role in germ layer specification and tissue formation ( reviewed by tam and loebel ) .
subsequent studies in mesc cultures revealed that the same pathways are involved in the regulation of germ layer development in vitro . despite the similarities observed , there are also differences between mouse and human development , including the timing and profile of expression of control genes , as well as the onset and patterning of tissue formation [ 62 , 63 ] .
in addition , discrepancies exist between mesc and hesc , which differ in morphology , cell surface markers , responsiveness to specific factors ( including the leukemia inhibitory factor signaling pathway ) , and pluripotent state .
noteworthy , recent studies demonstrated that hesc display a closer similarity with mouse epiblast stem cells ( episc ) , which are derived from postimplantation embryos , suggesting that mouse episc might be a closer equivalent for comparative developmental studies between the two species .
today , the ability to culture human pluripotent stem cells and to apply developmentally relevant inductive signals offers an unprecedented possibility to establish human models of embryonic development in vitro .
early lineage specification is recapitulated when esc are induced to form three - dimensional cell aggregates embryoid bodies ( ebs ) . in order to direct differentiation toward specific cell lineages , ebs
are stimulated with specific growth factors and signaling molecules in tightly controlled concentrations and temporal sequences .
typical factors currently used to promote human ebs differentiation include egf , fgf , ra , bmp-4 for ectodermal - mesodermal induction , tgf- and activin - a for mesodermal induction , and a set of small molecules for endoderm specification [ 61 , 67 ] .
examples of specific lineages derived from hesc using directed differentiation approach include functional motor neurons [ 68 , 69 ] , human cardiovascular progenitors , pancreatic endoderm , insulin - secreting -cells , hepatocytes , and others .
importantly , cells exhibited functionality following in vivo implantation , such as improvement in cardiac function in rodent models of myocardial infarction and development of glucose - responsive endocrine cells from implanted pancreatic endoderm .
similarly , stepwise induction protocols have been successfully used for differentiation of ips lines toward different specialized cell types , although the authors often report differences in differentiation efficiency and properties of differentiated progeny [ 48 , 74 , 75 ] .
factors such as size of ebs and variability of initial hesc colonies have also been shown to affect differentiation outcomes [ 76 , 77 ] .
for some lineages , differentiation has been achieved in monolayer culture , thereby simplifying the protocols and avoiding the variability associated with eb cultures .
frequently , a combination of ebs and monolayer culture is used , utilizing the effects of three - dimensional environment on cell differentiation , and accessibility of monolayer culture for subsequent cell characterization .
hesc and hips technologies allow the generation of novel in vitro models to study the underlying mechanisms of disease development , and establish platforms for the screening of new drugs to prevent or reverse disease progression . in one of the first examples , digiorgio and colleagues
have shown that motor neurons derived from hesc are sensitive to toxic effects of glial cells that carry a mutation in sod1 gene , causing amyotrophic lateral sclerosis ( als ) , a fatal neurodegenerative disease . to study the familial forms of the disease , the group has established hips lines from patients with als and shown
development of models to study inherited and degenerative disorders , including alzheimer 's disease , parkinson 's disease , schizophrenia , diabetes , gaucher 's disease , and muscular dystrophy is ongoing and expected to significantly affect our understanding of a variety of medical conditions .
creation of disease - specific hips is especially valuable when the underlying mechanisms of the disease are not well understood , and the affected cells are not available from the patients , for example in neurodegenerative diseases or cardiac conditions .
generation of hesc / hips libraries from specific patient populations and healthy individuals also allows the development of screening platforms to evaluate toxicity and safety of existing and new drugs . during recent years
, a considerable number of drugs were withdrawn from the market due to unforeseen cardiotoxic side effects , and cardiotoxicity is one of the major reasons for late - stage attrition of drug candidates .
another serious complication is drug - induced liver injury , which is among the most frequent reasons for withdrawal of approved drugs from the market .
the early detection of fatal side effects of new drugs could prevent the continuation of a useless and cost - intensive developing process .
also , exclusion of compounds proving false negative in suboptimal test systems could be prevented by improving detection of potential toxicity .
currently , negative effects are not detected during in vitro and preclinical studies , due to the limited functional capacity and genetic diversity of cellular models used , and due to the interspecies differences between experimental animals and humans in pharmacotoxicological effects .
the potential usefulness of hesc - derived cardiac cells for safe pharmacology was shown recently [ 86 , 87 ] , where cells were reactive to several drugs in a manner that resembles mature cardiomyocytes .
in addition , there has been progress in the establishment of protocols for the generation of hepatocyte - like cells from hesc and hips . with respect to evaluating hepatotoxicity using these cells
, it will be important to establish the degree of their similarity to primary cells , as well as to identify specific assays to evaluate the functionality of the cells and to detect the drug - induced liver injury in vitro .
a large number of medical conditions are associated with loss or malfunction of tissues and organs , and result in patient distress , disability , and death .
treatments for these patients currently rely on the transplantation from living and deceased donors , or implantation of medical devices that are limited in their functionality and availability .
the ability of stem cells to self - renew and differentiate into specialized cells offers great possibilities in the field of regenerative medicine , both for the ex vivo construction of tissue substitutes ( tissue engineering ) and for transplantation of healthy , potentially genetically - corrected cells ( cell therapy ) . in tissue engineering , stem cells
are combined with biomaterial scaffolds , which act as a functional template for regeneration and tissue maturation under appropriate culture conditions . to date , adult stem cells have largely been used for experimental and clinical tissue engineering applications . however , adult stem cells display limited proliferation and differentiation potential , progressive loss of functionality upon in vitro expansion , and age - associated decline in cellular fitness [ 16 , 1820 , 90 ] .
in contrast , pluripotent stem cells allow the generation of an unlimited supply of reparative cells ( which are patient - matched in the case of hips ) . to avoid the risk of teratoma formation following in vivo implantation , hesc and hips are induced into lineage - specific progenitors , which display differentiation potential restricted within the germ layer [ 91 , 92 ]
. in one example , our group and others have derived mesodermal progenitors with similarity to adult mesenchymal stem cells in the expression of surface markers , global gene expression profile , and potential to differentiate into osteogenic , chondrogenic , and adipogenic lineage [ 91 , 9395 ] .
hesc - mesenchymal progenitors have displayed excellent potential for formation of bone - like tissue when seeded in three - dimensional scaffolds and cultured in dynamic culture systems , suggesting they could be a promising cell source for regeneration of the skeletal system . in some studies , in vivo transplantation of hesc - mesenchymal progenitors showed restricted developmental potential of the cells , as teratoma formation was not observed [ 94 , 95 ] .
in addition , hesc - mesenchymal progenitors injection improved the outcome of ischemic hindlimb injuries . in light of the variability detected between hesc and hips lines , the current challenges lay in the development of robust protocols that will allow effective and reproducible differentiation of various hips lines .
in addition , therapeutic applications of hesc and hips derivatives will critically depend on the development of stringent protocols for selection and/or purification of well - defined , stable tissue progenitors , that will demonstrate limited developmental potential within the selected lineage .
advances in the hesc field have already resulted in first clinical trials using hesc - derived cells . in 2010 , geron corporation started a phase i clinical trial to evaluate the safety of hesc - derived neural progenitor cells administration in patients with neurologically complete subacute spinal cord injuries ( http://clinicaltrials.gov/ , number nct01217008 ) . unfortunately the trial has been stopped in 2011 due to financial difficulties of the company .
currently , advanced cell technology has two ongoing prospective clinical trials ( phases i / ii ) to evaluate the effects of subretinal injection of hesc - derived retinal pigment epithelium cells in patients with dry age - related macular degeneration and patients with stargardt 's macular dystrophy ( http://clinicaltrials.gov/ , no .
preliminary studies indicated measurable improvements in the vision of two nearly blind patients that lasted four months following the treatment . a similar clinical trial for treatment of age - related macular degeneration with hesc - derived retinal pigment epithelium cells
is expected to start in the uk in 2012 by the london project to cure blindness ( http://www.thelondonproject.org/ ) .
in addition to tissue replacement , stem cells represent a valuable tool in cell therapy for the correction of genetic diseases . in one of the recent studies , deyle et al . reported the disruption of the allele carrying the dominant mutation in the type i collagen genes causing osteogenesis imperfecta , using a combination of gene - targeting and ips technology .
mesenchymal stem cells derived from the bone of patients affected by the disease were gene targeted to disrupt the mutant alleles causing the disease , converted to hips , expanded in vitro , and then induced to differentiate toward the osteogenic lineage . following in vivo implantation on ceramic scaffolds , gene - targeted osteogenic cells were able to form bone tissue in experimental animals .
correction of genetic mutations was reported for other diseases , including 1-antitrypsin deficiency and x - linked chronic granulomatous disease , using the zinc finger nuclease technology , which holds great potential for efficient and precise gene manipulation at the desired genomic locations [ 99 , 100 ] . in summary ,
stem cell technology , along with the accurate genetic manipulation of hips , opens new possibilities for the generation of clinically relevant cells for autologous cell - based therapies .
our growing understanding of the stem cell biology and the development of specific cell lineages has allowed the generation of multiple specialized cell types from stem cells , and the identification of distinct developmental stages that are governed by genetic and epigenetic regulatory networks . in parallel ,
an alternative approach is being investigated , in which one somatic cell type could be directly converted transdifferentiated into another somatic cell type . this way , abundant adult cells , such as dermal fibroblasts or adipocytes , could be used to produce other therapeutically important cells , such as neurons , cardiomyocytes or pancreatic beta cells .
natural transdifferentiation involves a stepwise dedifferentiation of the primary cell to an intermediate cell type , that can then differentiate into the new lineage .
in contrast , experimentally induced transdifferentiation involves a direct conversion through a simultaneous downregulation of one genetic programme and a concomitant upregulation of the new genetic programme . in one of the first experiments ,
muscle - specific genes were induced in pigmented epithelium , nerve , fat , liver , and fibroblast cells by forced expression of myod , a master regulator of muscle differentiation .
however , it was not clear until 2008 how the procedure could be applied more generally to other cell types . following the ips reprogramming experiments , zhou and colleagues found that reexpressing a combination of 3 transcription factors , tested from a list of 20 key developmental regulators , can turn pancreatic exocrine cells into pancreatic beta - like cells in adult mice . using a similar approach , vierbuchen and colleagues showed that a combination of 3 factors with important roles in neural development converts mouse embryonic and postnatal fibroblasts into functional neurons in vitro . in a later study
, it was shown that the same factors work in converting terminally differentiated hepatocytes into neurons , thereby demonstrating the possibility to reprogram cells between different germ layers .
interestingly , the resulting neurons silenced the donor cell transcriptional program , suggesting a binary lineage switch rather than an induction of hybrid cell phenotypes .
however , a small but detectable epigenetic memory of the donor cells remained in the induced neurons .
current examples of experimentally induced transdifferentiation rely on the ectopic expression of master regulator genes , which are essential for lineage specification during development and can direct the establishment of a new epigenetic state when expressed in the host cell . to achieve a complete phenotypic switch between the two mature cells and
generate functional cells for potential clinical applications , the activation of a new epigenetic state in the host cells must be associated with full deactivation of the original epigenetic state
. this might be more cumbersome to achieve between more distantly related cells owing to their larger epigenetic differences , resulting in relatively inaccessible chromosomal regions .
possible strategies to convert more distant cell types could involve the use of chemicals that loosen the chromatin structure and favor epigenetic rearrangements .
in addition , reduction of factors that support the original epigenetic state of the mature host cells , and the use of factors that promote the reentry into cell cycle could facilitate the transdifferentiation .
taken together , transdifferentiation studies underline the importance of specific factors in lineage specification , and overturn the long - believed notion of stable and irreversible lineage commitment events . with further development and optimization , transdifferentiation protocols could offer a shortcut to production of differentiated cells for biomedical research and clinical applications , potentially avoiding the extensive cell proliferation required for hips derivation and differentiation .
in addition , transdifferentiation opens the possibility to convert different cell types directly in vivo to drive tissue repair and regeneration in situ , an approach that would be impossible using ips technology due to the teratoma - forming ability of pluripotent stem cells . on the other hand , direct conversion between terminally differentiated cells , which are characterized by limited proliferative potential ,
may not be suitable for experimental and clinical applications where large amounts of cells are needed , and in situations where disease conditions result from genetic mutations .
hitherto , only a few instructive factor combinations have been reported to directly convert mature cell types , and it is likely that these will depend on the selected target and final cell types . as with the ips ,
a number of questions regarding the transdifferentiated cell stability , functionality , and safety need to be addressed , and a deeper understanding of the reprogramming process is needed before transdifferentiation can be translated into a therapeutic setting .
advances in pluripotent stem cell biology and transdifferentiation have generated great enthusiasm in the scientific community over the last years , and are expected to affect numerous biomedical applications .
hesc and hips allow the study and modeling of human development and tissue formation under diverse experimental conditions , and therefore represent an excellent platform for understanding human diseases and developing innovative therapeutic solutions . in parallel ,
development of transdifferentiation technology offers new insights into adult cell plasticity and could lead to expedited protocols for differentiated cell production . in the context of regenerative medicine , hesc and hips
offer the possibility to generate an unlimited number of functional cells for reconstructive and reparative therapies .
creation of hips libraries is underway , and will expedite both safety pharmacology studies , as well as development of novel therapies .
approval of the first hesc - based clinical trials in the usa is encouraging for the field , and signifies the potential of pluripotent stem cells to cure the most devastating diseases of our time .
however , there is a lot of work to be done to fully determine the clinical potential , efficacy , and safety of hesc and hips - based treatments . as with other medical breakthroughs
, it is only via scrupulous scientific investigation that the true potential of human pluripotent stem cells may be realized .
|
stem cells divide by asymmetric division and display different degrees of potency , or ability to differentiate into various specialized cell types . owing to their unique regenerative capacity ,
stem cells have generated great enthusiasm worldwide and represent an invaluable tool with unprecedented potential for biomedical research and therapeutic applications .
stem cells play a central role in the understanding of molecular mechanisms regulating tissue development and regeneration in normal and pathological conditions and open large possibilities for the discovery of innovative pharmaceuticals to treat the most devastating diseases of our time .
not least , their intrinsic characteristics allow the engineering of functional tissues for replacement therapies that promise to revolutionize the medical practice in the near future . in this paper , the authors present the characteristics of pluripotent stem cells and new developments of transdifferentiation technologies and explore some of the biomedical applications that this emerging technology is expected to empower .
|
influenza is a major public health problem that causes significant morbidity and mortality worldwide ( lambert and fauci , 2010 ; igarashi et al . , 2011 ) .
yearly vaccination prevents influenza - related complications and reduces influenza prevalence ( nichol et al . , 2007 ) .
elderly patients with chronic pulmonary diseases such as bronchial asthma , chronic obstructive pulmonary disease ( copd ) , and interstitial pulmonary diseases are strongly recommended to receive an annual influenza vaccine to prevent disease symptom exacerbation or loss of pulmonary function due to respiratory tract infection ( nichol et al .
however , many patients with chronic pulmonary diseases regularly receive systemic or inhaled corticosteroid , and it is well known that systemic corticosteroid administration restrains immune responses , such as antibody production ( baxter and harris , 1975 ) . despite this , few studies have investigated the influence of steroid therapy on influenza vaccine efficacy and safety , and the effects of regular oral or inhaled corticosteroids on these parameters were unclear . in this study , we evaluated the efficacy and safety of the influenza vaccine in elderly patients with chronic pulmonary diseases who were receiving oral or inhaled corticosteroids .
a total of 48 patients with chronic respiratory diseases , with or without oral or inhaled corticosteroid treatment , were recruited from yamaguta university hospital and enrolled in the study ( those who received both oral and inhaled corticosteroid were excluded ) .
the patients were classified into three groups based on their maintenance therapy : ( a ) without corticosteroid therapy ( 17 males , three females ; mean age , 72.3 7.9 ) , ( b ) oral corticosteroid therapy ( four males , seven females , mean age , 66.1 10.6 ; median corticosteroid dose : 10.0 mg/ day ( 2.5 - 25 mg / day ) , equivalent to prednisolone ) , or ( c ) inhaled corticosteroid therapy ( eight males , nine females ; mean age , 62.4 16.0 ; median inhaled corticosteroid dose : 800 g / day ( 400 - 1600 g / day ) , equivalent to budesonide ) .
all patients received a single subcutaneous inoculation of the trivalent influenza vaccine from the same lot containing hemagglutinin of influenza ha1 ( a / beijing ) , ha2 ( a / taiwan ) , and hb ( b / panama ) , from mitsubishi tanabe pharma co. osaka , japan .
blood samples were collected to measure antibody titers against influenza a and b antigens before vaccination and 4 - 6 weeks after vaccination .
the serum samples were serially diluted and co - incubated with influenza antigen and 0.5 % chicken red blood cells .
the hi titter was determined as the reciprocal of the highest serum dilution resulting in nonagglutination of red blood cells .
vaccination efficacy was evaluated by seroconversion , defined as a pre - vaccination hi titer < 1:10 and a post - vaccination hi titer 1:40 or a pre - vaccination hi titer 1:10 and a minimum four - fold rise in post - vaccination hi antibody titer and seroprotection , defined as a post - vaccination hi titer of 1:40 ( chotirosniramit et al . , 2012 ) .
possible influences of oral or inhaled steroid therapy were evaluated with chi - squared tests .
a total of 48 patients with chronic respiratory diseases , with or without oral or inhaled corticosteroid treatment , were recruited from yamaguta university hospital and enrolled in the study ( those who received both oral and inhaled corticosteroid were excluded ) .
the patients were classified into three groups based on their maintenance therapy : ( a ) without corticosteroid therapy ( 17 males , three females ; mean age , 72.3 7.9 ) , ( b ) oral corticosteroid therapy ( four males , seven females , mean age , 66.1 10.6 ; median corticosteroid dose : 10.0 mg/ day ( 2.5 - 25 mg / day ) , equivalent to prednisolone ) , or ( c ) inhaled corticosteroid therapy ( eight males , nine females ; mean age , 62.4 16.0 ; median inhaled corticosteroid dose : 800 g / day ( 400 - 1600 g / day ) , equivalent to budesonide ) .
all patients received a single subcutaneous inoculation of the trivalent influenza vaccine from the same lot containing hemagglutinin of influenza ha1 ( a / beijing ) , ha2 ( a / taiwan ) , and hb ( b / panama ) , from mitsubishi tanabe pharma co. osaka , japan .
blood samples were collected to measure antibody titers against influenza a and b antigens before vaccination and 4 - 6 weeks after vaccination .
the serum samples were serially diluted and co - incubated with influenza antigen and 0.5 % chicken red blood cells .
the hi titter was determined as the reciprocal of the highest serum dilution resulting in nonagglutination of red blood cells .
vaccination efficacy was evaluated by seroconversion , defined as a pre - vaccination hi titer < 1:10 and a post - vaccination hi titer 1:40 or a pre - vaccination hi titer 1:10 and a minimum four - fold rise in post - vaccination hi antibody titer and seroprotection , defined as a post - vaccination hi titer of 1:40 ( chotirosniramit et al . , 2012 ) .
possible influences of oral or inhaled steroid therapy were evaluated with chi - squared tests .
serum antibody responses against influenza vaccine antigens were increased from baseline values in all three groups ( figure 1(fig .
1 ) ) . in group a , we observed significant increases in ha1 and ha2 titers .
although there was no significant difference in hb antibody hi titer between pre- and post - vaccination , hb antibody hi titers were sufficient for seroprotection .
although there was no significant difference in ha1 antibody hi titer between the two time points , the hi titers were high enough for seroprotection . in group c , significant increases in hi titers against ha1 and hb were noted .
although we did not observe a significant difference in ha2 antibody hi titer levels between pre- and post - vaccination , the levels were high enough to confer seroprotection .
2 ) . in patients who received inhaled corticosteroid therapy , the ratio of seroconversion or seroprotection for hb was significantly higher than in patients without corticosteroid therapy .
a local reaction was observed at the injection site within several days after vaccination in one patient , but no systemic reactions were observed .
we investigated the efficacy and safety of the influenza vaccine in elderly patients with chronic pulmonary diseases receiving oral or inhaled corticosteroid therapy .
maintenance treatment with oral or inhaled corticosteroid therapy in this population did not reduce the serological response to influenza vaccination .
2 ) shows that the serological response to hb was significantly reduced in patients without corticosteroid therapy .
overall , nine of 20 control patients ( without corticosteroid therapy ) did not show a serological response after vaccination .
our findings suggest that inhaled corticosteroid did not exert a significant immunosuppressive effect . in patients with chronic pulmonary disease ,
respiratory tract infection is the most prevalent cause of acute symptom exacerbation ( inoue et al . , 2003 , 2009 ) .
this is especially true in copd patients ; respiratory tract infections due to influenza virus or rhinovirus induce secondary bacterial infection and severe respiratory failure ( igarashi et al .
patients with chronic pulmonary diseases are strongly urged to receive an annual influenza vaccination , and many of them also receive oral and/or inhaled corticosteroid treatment .
we did not find any significant differences in antibody production against influenza strains between patients with or without corticosteroid therapy .
a few studies have investigated the influence of corticosteroids on influenza vaccine - induced antibody production ( kubiet et al . , 1996 ; hanania et al . , 2004
) , but ours is the first report that shows effective antibody production against influenza in elderly patients with chronic pulmonary diseases who were receiving oral or inhaled corticosteroid .
it is well known that long - term systemic corticosteroid therapy is immunosuppressive ( lipworth , 1999 ) .
indeed , we found that pre - vaccination antibody titers were lower in patients treated with oral or inhaled corticosteroid compared to patients without steroid therapy . despite this observation
these results suggest that vaccinating patients with chronic pulmonary diseases who receive corticosteroid treatment against influenza is effective .
first , it was performed at a single center , so the number of subjects enrolled was not large .
second , the dose of systemic steroid was relatively low in this study population , so the effects of high - dose corticosteroid treatment on antibody production against influenza is still unknown .
third , only one patient treated with inhaled corticosteroid was infected with influenza a , and one patient without corticosteroid therapy was infected with influenza b during the study period . as such , we could not investigate any potential preventative effect of the corticosteroid treatment on influenza infection .
fourth , most patients had received the flu vaccine for multiple consecutive years , and many exhibited high antibody titers before vaccination ; therefore , we can not ignore the influence of previous vaccinations on antibody titer levels . in conclusion ,
influenza vaccination is safe and effectively stimulates antibody production even in patients treated with oral or inhaled corticosteroid .
|
annual influenza vaccination is strongly recommended for patients with chronic pulmonary diseases , such as bronchial asthma , chronic obstructive pulmonary disease ( copd ) , and interstitial pulmonary diseases .
however , many of these patients regularly receive systemic and/or inhaled corticosteroid therapy , and the impact of corticosteroid therapy on influenza vaccine efficacy and safety is unclear .
patients with chronic pulmonary diseases were enrolled in the study and divided into three groups based on their maintenance therapy : ( a ) without corticosteroid therapy ( 17 males , three females ; mean age , 72.3 7.9 ) , ( b ) oral corticosteroid therapy ( four males , seven females ; mean age , 66.1 10.6 ) , and ( c ) inhaled corticosteroid therapy ( eight males , nine females ; mean age , 62.4 16.0 ) .
all patients received influenza vaccine , and serum hemagglutination inhibition ( hi ) antibodies against influenza strains a / h1n1 , a / h3n2 , and b were measured at baseline ( before vaccination ) and 4 - 6 weeks after vaccination .
sufficient antibody titers or significant increases were observed after vaccination compared with titers before vaccination in all three groups .
no systemic reactions were reported .
long - term oral / inhaled corticosteroid therapy was not associated with vaccination side effects and did not affect the immune response to the influenza vaccine .
|
in the islamic republic of iran , primary health care is provided by community health workers ( behvarzes ) in a health house .
the rural health house is the most basic unit of health service delivered to villagers of about 1500 people .
each health house usually has two behvarzes , one male and one female , and it covers one main village and one or more surrounding village(s ) .
the behvarzes have a pivotal role in the success of the country s public health center ( phc ) networks ( 1 ) .
the most rapid developments have been devoted to the iranian version of the primary health care system with the central role of the behvarzes ( 2 ) .
the role of community health workers ( chws ) in improving access to basic healthcare services is widely recognized ( 3 ) .
some of the more important tasks of health workers well established in the health system are as follows : training the community on health matters , family health , maternal and child health care , care of school - aged children , family planning services , vaccination , visiting homes for follow - up of drop - out cases , and follow - up for infectious diseases ( tb and malaria ) , mental health problems , and more recently other chronic illnesses such as diabetes and hypertension , environmental health activities , counseling and recording information , limited symptomatic treatment , and occupational health ( 4 ) .
multiplicity of tasks and the difference in their nature cause interference in their tasks and sometimes create conflicts in playing their roles and confusion in providing services , and they can create many problems for them ( 5 ) .
the term burnout syndrome , which was entered into scientific texts for the first time in 1974 , is a condition that has three aspects , namely , emotional exhaustion , depersonalization , and reduction of personal accomplishment ( 6 ) .
professional burnout results from prolonged exposure to chronic , job - related stressors ( 7 ) .
vocational burnout is a syndrome that appears with symptoms including exhaustion , frustration , anger , cynicism , and feeling of inefficiency and failure .
an important element of this syndrome is its negative effect on job performance ( 8) . burnout can create stress - related health problems , low temperament and physical exhaustion , insomnia , adverse effect on interpersonal and family relationship , increased use of alcohol and drugs , and increased family problems ( 4 , 9 , 10 ) .
only a few studies have been conducted on vocational burnout in health workers in iran ; these studies reported moderate to high vocational burnout among community health workers ( 4 , 11 - 13 ) .
therefore , identifying the factors influencing vocational burnout can be useful in improving the provision of health services . in the past 30 years
, the increasing duties of health workers seem to have imposed too much mental and physical pressure on them that they can become incapable of performing their assigned duties ( 4 ) .
this study aims to investigate vocational burnout , mental health , and the associated factors among rural health workers in south khorasan .
all rural health workers of phcs under the coverage of the birjand university of medical sciences participated in this cross - sectional study . the census sampling method was used .
a list of health workers of phcs under the coverage of the birjand university of medical sciences was requested from the department of health .
a total of 425 rural health workers had at least one year of work experience .
two health workers were excluded because of defects in information . finally , 423 questionnaires were analyzed .
this study was conducted in the birjand , quen , sarayan , ferdous , boshrooyeh , darmian , sarbisheh , and nehbandan counties in south khorasan province in east iran between october 2012 and march 2013 .
this study adopted the demographic check list , maslach burnout inventory ( mbi ) , and ghq-12 questionnaire .
the demographic check list includes items indicating the participants background information such as age , gender , and educational status , among others .
the mbi was developed by maslach and jackson in 1980 , and it includes 22 separate items that measure the frequency and the intensity of vocational burnout among the personnel of human services in three aspects , namely , emotional exhaustion [ ee ] ( 9 items ) , depersonalization [ dp ] ( 5 items ) , and personal accomplishment [ pa ] ( 8 items ) .
all 22 items are scored on a seven - point scale ranging from never ( 0 ) to everyday ( 6 ) .
the scores can range from 0 to 54 on the ee subscale , from 0 to 30 on the dp subscale , and from 0 to 48 on the pa subscale ( 14 ) .
the total scores of each dimension are summed up and categorized into low , moderate , or high . according to the primary definition by maslach
, vocational burnout is classified into high emotional exhaustion ( 27 and the higher ) , high depersonalization ( 10 and the higher ) , and low personal accomplishment ( 33 and the lower ) .
high levels of ee and dp and low levels of pa indicate an increased risk of vocational burnout .
any response to the items is scored 0 for the first and second options and 1 for the third and fourth level options . the final score of the questionnaire ranges from 0 to 12 .
subjects with a score of equal or less than 4 ( s 4 ) are considered normal , and those with a score higher than 4 ( s > 4 ) are considered as suspected of having a mental disorder .
the reliability , validity , and simplicity of the instrument used for measuring the vocational burnout among iranian health workers have been confirmed with a reliability coefficient of 86% ( 15 ) .
factorial validity of the mbi was examined in akbari s study , the findings of which confirm the appropriateness of the original three - factor model proposed by maslach and jackson for the persian version of the mbi ( 16 ) . in study of french teachers ,
the cronbach s alpha coefficient was 0.87 for the emotional exhaustion subscale , 0.61 for depersonalization , and 0.82 for personal accomplishment ( 17 ) . the questionnaire has been frequently assessed and confirmed to have a reliability of over 90% by iranian researchers ( 14 ) . according to montazeri ,
the iranian version of the ghq-12 is a reliable and valid instrument that can be used for measuring psychological well - being in iran ( = 0.87 ) ( 18 ) .
the study was approved by the institutional review board of the deputy of research technology of the birjand university of medical sciences ( code 602 dated 1/8/2011 ) .
the association between overall burnout status and some nominal variables , such as sex , age group , marital status ( single/ married ) , level of education , and number of children ( 0 - 3 and 3 ) , was assessed by the chi - square test . a high score on the subscales of ee and dp and a low score on the pa scale reflect severe burnout .
behvarzes with a high score on either the ee or dp subscale were considered to have a moderate degree of burnout .
all rural health workers of phcs under the coverage of the birjand university of medical sciences participated in this cross - sectional study . the census sampling method was used .
a list of health workers of phcs under the coverage of the birjand university of medical sciences was requested from the department of health .
a total of 425 rural health workers had at least one year of work experience .
two health workers were excluded because of defects in information . finally , 423 questionnaires were analyzed .
this study was conducted in the birjand , quen , sarayan , ferdous , boshrooyeh , darmian , sarbisheh , and nehbandan counties in south khorasan province in east iran between october 2012 and march 2013 .
this study adopted the demographic check list , maslach burnout inventory ( mbi ) , and ghq-12 questionnaire .
the demographic check list includes items indicating the participants background information such as age , gender , and educational status , among others .
the mbi was developed by maslach and jackson in 1980 , and it includes 22 separate items that measure the frequency and the intensity of vocational burnout among the personnel of human services in three aspects , namely , emotional exhaustion [ ee ] ( 9 items ) , depersonalization [ dp ] ( 5 items ) , and personal accomplishment [ pa ] ( 8 items ) .
all 22 items are scored on a seven - point scale ranging from never ( 0 ) to everyday ( 6 ) .
the scores can range from 0 to 54 on the ee subscale , from 0 to 30 on the dp subscale , and from 0 to 48 on the pa subscale ( 14 ) .
the total scores of each dimension are summed up and categorized into low , moderate , or high . according to the primary definition by maslach
, vocational burnout is classified into high emotional exhaustion ( 27 and the higher ) , high depersonalization ( 10 and the higher ) , and low personal accomplishment ( 33 and the lower ) .
high levels of ee and dp and low levels of pa indicate an increased risk of vocational burnout .
psychological symptoms were measured by ghq-12 . in this questionnaire , any response to the items is scored 0 for the first and second options and 1 for the third and fourth level options . the final score of the questionnaire ranges from 0 to 12 .
subjects with a score of equal or less than 4 ( s 4 ) are considered normal , and those with a score higher than 4 ( s > 4 ) are considered as suspected of having a mental disorder .
the reliability , validity , and simplicity of the instrument used for measuring the vocational burnout among iranian health workers have been confirmed with a reliability coefficient of 86% ( 15 ) .
factorial validity of the mbi was examined in akbari s study , the findings of which confirm the appropriateness of the original three - factor model proposed by maslach and jackson for the persian version of the mbi ( 16 ) . in study of french teachers ,
the cronbach s alpha coefficient was 0.87 for the emotional exhaustion subscale , 0.61 for depersonalization , and 0.82 for personal accomplishment ( 17 ) . the questionnaire has been frequently assessed and confirmed to have a reliability of over 90% by iranian researchers ( 14 ) . according to montazeri ,
the iranian version of the ghq-12 is a reliable and valid instrument that can be used for measuring psychological well - being in iran ( = 0.87 ) ( 18 ) .
the study was approved by the institutional review board of the deputy of research technology of the birjand university of medical sciences ( code 602 dated 1/8/2011 ) .
the association between overall burnout status and some nominal variables , such as sex , age group , marital status ( single/ married ) , level of education , and number of children ( 0 - 3 and 3 ) , was assessed by the chi - square test . a high score on the subscales of ee and dp and a low score on the pa scale reflect severe burnout .
behvarzes with a high score on either the ee or dp subscale were considered to have a moderate degree of burnout .
a total of 423 behvarzes working in health houses in the villages of south khorasan province participated in this study .
the participants mean age was 39 8.4 years , with a minimum age of 20 years and a maximum of 58 years .
most of the participants were in the age group of 30 - 40 years , and most of them were women ( 245 individuals = % 57.9 ) .
the mean years of employment were 16.6 8.7 ( minimum of 1year and maximum of 30 years ) . among the subjects ,
268 ( 63.2% ) had normal mental health and 155 ( 36.8% ) had a mental disorder based on the cut - off point of 4 in the ghq-12 .
no significant difference was found in the prevalence of mental disorders between men and women ( p = 0.09 ) .
the mean score of general health was 3.7 3.4 ( median = 3 ) ranging from 0 to 12 .
mean score of ee was 15.4 12.1 ( median = 12 ) , that of dp was 2.5 4 ( median = 1 ) , and that of pa was 30.8 12.3 ( median = 33 ) .
about 34.5% of the subjects had a moderate - to - severe level of burnout .
about 31.4% of the subjects had abnormal scores in the ee , 16.8% in the dp , and 47% in the pa subscales .
the prevalence of moderate - to - severe burnout in subjects with normal mental health was 21.4% and that in subject with mental disorders was 56.1% .
in subjects with normal mental health , the prevalence of moderate and severe burnout was 18.8% and 2.6% , respectively ( table 2 ) . among the subjects ,
68 ( 24.5% ) with low burnout or without burnout and 57 ( 60.4% ) with moderate or severe burnout had a ghq score > 4 and were suspected to have mental disorders .
a significant association was found between mental disorder and vocational burnout among health workers ( p = 0.001 ) ( table 3 ) .
age , educational status , number of children , and years of employment had a significant association with vocational burnout among the subjects .
burnout was significantly higher in the 40 - 50 age group , those with a diploma education , those having more than three children , and those with more than 15 years of employment ( table 3 ) .
one of the main vocational problems commonly observed in the form of an organizational response to job stress among employees is vocational burnout , which indicates the reduction of an individual s adaptation to environmental stressors . as jobs that provide public health
are almost unique in iran , only a few studies have been conducted on this susceptible stratum .
34.5% of the subjects had vocational burnout , and 5.7% had severe vocational burnout . in the study by malakouti et al .
on public health workers under the rules of iran university , 16.6% of the subjects had moderate - to - severe vocational burnout , and 1% of them had severe vocational burnout ( 4 ) , which is less than that in our study .
the frequency of job burnout among health workers in golestan province was 30.3% at the low level , 53.5% at the moderate level , and 16.2% at the high level ( 13 ) . in the present study ,
31.4% , 16.8% , and 47% of the subjects had abnormal scores on the ee , dp , and pa subscales , respectively . compared with those in a study on health workers in tehran ( 4 ) , the results were higher in ee and dep and lower in pa . in comparison with the results of quri s study , those in our study were higher in all three subscales ( 11 ) .
as the rate of mental disorder among the subjects was high , the prevalence of burnout in subjects with normal mental health was calculated separately . after matching with the mental health status ,
the prevalence of burnout was 21.4% , which is considerable and similar to that in a study on health workers in tehran ( 4 ) .
the difference in the rate of vocational burnout and its subscales can be attributed to the differences in the geographical area and the number of subjects . as south khorasan province
is one of the deprived provinces of the country , and its climate and geographical conditions in comparison with the western provinces are less than desirable , this study can be effective in determining the prevalence of vocational burnout among health workers .
moreover , all health workers in south khorasan province were analyzed , and the sample size was higher than those in other studies conducted in the country .
the rate of mental disorder among health workers in this study was 36.8% , which is higher than that of the general population of iran ( 19 ) and tehran university health workers ( 28.4% ) . in our study , a significant association was found between mental disorder and burnout in health workers , consistent with the study of iran university ( 4 ) .
the rates of health workers occupational satisfaction were measured in studies conducted in qazvin ( 20 ) , sabzevar ( 21 ) , and zahedan ( 22 ) , and the obtained results indicate the moderate occupational satisfaction of health workers in zahedan and the relatively high occupational satisfaction of health workers in sabzevar . in another study that measured the levels of job stress among health workers in mashhad ,
the overall results were reported a normal range ( 23 ) . as stress and dissatisfaction in the workplace can lead to vocational burnout , the vocational burnout prevalence is predicted to also be low in areas with low stress and high job satisfaction .
studies have been conducted on the prevalence of vocational burnout among health personnel in other countries .
for example , the mean of the obtained scores is similar to that in our study in a research conducted on personnel of health services in brazil ( 24 ) .
the prevalence of burnout in clinical nurses in a hospital in latin america was 10.1% , and 4% of the subjects had severe vocational burnout ( 25 ) .
the prevalence of vocational burnout in barcelona s primary health care teams was 17.2% , and 46.2% of the participants had high scores in at least one of the three aspects ( subscales ) of burnout ( 26 ) . in a study conducted in southeast nigeria ,
the prevalence of anxiety symptoms among community healthcare workers in china was 38.0% ( 28 ) . in the present study ,
the rate of burnout increased among health workers with the increase in age and work experience .
this result may be related to the fact that older health workers with more work experience face much mental and physical pressures due to fatigue caused by overwork and repetitive duties that make them incapable of performing their assigned duties . in a study conducted in tehran ,
gender and marital status had no significant association with vocational burnout ( 4 ) . however , vocational burnout had a significant relationship with gender and marital status in a study conducted in east azerbaijan ( 12 ) . in a study on vocational burnout among health workers in koohrang city , a significant association
was not found between vocational burnout and gender , age , marital status , work experience , type of employment , and level of education ( 11 ) . in a study conducted in golestan province , the intensity and frequency of burnout had a significant relationship with age , years of experience , level of education , and the place of residence ( 13 ) .
the differences in the prevalence of vocational burnout and its associated factors may be due to the differences in managerial procedures in different areas , the differences in expectations of health workers , the differences in facilities and opportunities required for the promotion of individuals , the assignment of various responsibilities and overloading of health workers with duties , the lack of integrity between payments and rewards with the amount of work , the lack of positive and rewarding feedback , and the differences in the working environment .
the strengths of the current study are its high sample size ( we included all behvarzes in south khorasan without using sampling methods ) , the use of standard and valid questionnaires , the low rate of missing data because of direct supervision , and follow - up research . nevertheless , this study has some limitations .
second , in the method of gathering data , some questions were not clear for the behvarzes even if we attempted to explain them .
third , the results may not be representative of the entire health workers in iran because of the geographical and cultural differences .
therefore , the prevention and reduction of vocational burnout among primary health care providers is an important task of managers of the health system .
teaching of strategies for coping with stress and training life skills , providing consultations and psychology services , and creating supportive environments are some of the ways that can limit the prevalence of vocational burnout .
these actions will result in increased efficiency and effectiveness of health workers , decrease their vocational burnout , and improve the overall health of society .
|
backgroundessential primary health care is delivered through the public health center phc network by public health workers ( behvarzs ) .
health workers are exposed to different types of stresses while working.objectivesthe aim of this study is to determine the prevalence of burnout and associated factors among rural health workers in the health centers of birjand university of medical sciences.patients and methodsall rural health workers of health centers under the coverage of the birjand university of medical sciences selected through census sampling participated in this cross - sectional study . the maslach burnout inventory , ghq-12 questionnaire , and demographic questionnaire were completed by the participants .
data were analyzed by spss 15 using descriptive statistics , chi - square ( 2 ) , t - test , and anova test.resultsa total of 423 health workers participated in this study , and their mean age was 39 8.4 years . among the participants , 34.5% had moderate to severe levels of burnout .
about 31.4% of the subjects had abnormal scores in emotional exhaustion , 16.8% in depersonalization , and 47% in the personal accomplishment subscales .
the rate of abnormal mental health among the participants was 36.68% .
the prevalence of mental disorders was 24.5% in subjects with low burnout or without burnout against 60.4% of subjects with moderate or severe burnout ( p = 0.001 ) .
age , education level , number of children , and years of employment were found to have a significant association with the burnout level of the participants ( p < 0.05).conclusionsburnout was prevalent among health workers . based on the high level of burnout among health workers , reducing job ambiguity / conflict , participating in planning new programs , and improving interaction with health authorities may help them to overcome their job - related pressure and to give a more desirable performance .
|
we discuss four cases illustrating the nonhomogeneous clinical presentation and evolution of this subset of patients .
surprisingly , these long survivors do not always have deep responses and some require frequent treatments , which include autologous stem cell transplantation and novel drugs .
the authors discuss several aspects of these clinical histories , including treatment options , raising hypothesis on their relation with long survivorship which may be important to have in consideration when studying this subject .
multiple myeloma ( mm ) is , generally , an incurable progressive neoplasm accounting for 10% of all hematological malignancies .
it was estimated in 2012 that 21,700 new cases and 10,710 deaths from the disease occurred in the united states 1 . in the european union
, there were 38,900 new cases and 24,300 deaths due to mm in 2012 , with only 10% of patients currently surviving longer than 10 years 2,3 .
the prevalence of this neoplasm , the better knowledge of mm biology , and the availability of new treatment options set the importance of analyzing long survivors among this group of patients .
novel drugs used in mm include proteasome inhibitors , and immunomodulators and newer molecules are still under clinical development .
compared to the conventional chemotherapeutic agents , proteasome inhibitors and immunomodulators have distinct , more specific mechanisms of action .
they are potent effectors , interfering directly with the neoplastic plasma cells and the surrounding microenvironment , leading to high response rates and prolonged overall and progression - free survival 4 . their combination with dexamethasone or conventional chemotherapeutic agents results in response rates comparable to those produced by autologous stem cell transplantation ( asct ) 5,6 .
recently , the continued improvement in overall survival of mm patients treated with novel agents was confirmed regardless of age 7 .
however , other clinical and biological characteristics of the disease as well as patient- and drug - dependent factors , such as treatment toxicities , dramatically influence survival .
well - defined molecular abnormalities are associated with poor outcomes in mm , and gene expression profiles and cytogenetic abnormalities can determine the patients ' prognosis 812 .
almost all mm patients harbor genomic abnormalities including structural and numeric chromosomal variations , with variable complexity .
this is an indication of genomic instability and intrinsic oncogenic properties and/or failure of protective cellular mechanisms .
myeloma - initiating events such as hyperdiploidy and chromosomal translocations leading to activation of oncogenes , as ccnd1 , ccnd2 , c - maf ( v - maf musculoaponeurotic fibrosarcoma oncogene homolog ) , and mmset ( multiple myeloma set domain ) are important , but not sufficient , determinants of disease aggressiveness .
secondary events , including activation of oncogenes , such as ras ( rat sarcoma ) and myc ( myelocytomatosis viral oncogene ) , of nf-b and inactivation of tumor suppressor genes such as tp53 and rb ( retinoblastoma ) , are the markers of high - risk disease that characterize patients with a very poor prognosis 13,14 .
concurrent to biological disease characteristics , clinical variables related to mm ( including the ones validated in the international score system ) advanced age and comorbidities also have an important negative impact .
an appropriate assessment of organ dysfunction at the beginning of therapy may allow to better define treatment strategies , improving tolerability and optimizing efficacy , especially in the elderly 1517 .
neurological , hematopoietic , and cardiac side effects are the most common toxicities in patients under prolonged treatment .
they are associated to the broad use of alkylating agents , corticosteroids and , more recently , proteasome inhibitors and immunomodulators . also , survivors of mm are confronted with nonspecific , cancer treatment - related long - term symptoms , most commonly fatigue , sexual dysfunction , arthralgia , and a high risk of second primary malignancies ( spm ) 18 .
high - dose chemotherapy with autologous stem cell support became widely used since 1990s in fit patients under 65 years of age . despite employing high doses of melphalan
, the risk of myelodysplastic syndromes / acute myeloid leukemia after transplant is estimated to be less than 5% , mostly attributable to pretransplant therapy 19 .
also , no significant risk change was noted after the introduction of autologous stem cell transplant among younger patients ( < 65 years ) and other novel agents 20,21 .
recent studies have reported an increased risk of second primary cancers following treatments with immunomodulators , possibly reflecting longer survival times .
patients with mm who are considered long survivors are usually young patients , without high - risk cytogenetic features and international staging score ( iss ) 1 , low tumor burden ( absence of severe anemia , hypercalcaemia , renal failure , or multiple bone lesions ) , absence of bence - jones proteinuria , low - plasma cell percentage in bone marrow , mature and intermediate myeloma .
also , a positive response to first - line treatment and to subsequent treatments were related to long - term survival 1921 .
interestingly , it seems that long - term survival in mm is associated with a distinct immunological profile , which includes proliferative cytotoxic t - cell clones and a favorable treg / th17 balance 22 . with the aim of examining some factors that influence long - term survivorship , we present and discuss four different clinical cases of long - term survivors with mm , including both transplanted and nontransplanted patients with a variety of comorbidities and different treatments flows .
these four patients diagnosed with mm for more than 10 years ( 13 , 18 , 19 , and 20 years ) were selected from the authors ' outpatient practice because they were alive and are representative of the true story and heterogeneity of mm worldwide .
a caucasian 56-year - old man with no relevant past medical history was diagnosed with mm igg kappa , durie salmon stage iiia , iss ii in july 1996 . at diagnosis
, he had a performance status ( ps ) of 1 and presented with a bone marrow plasmocytosis of 65.5% , serum
igg 10,600 mg / dl , anemia ( hb = 10.5 g / dl ) , and lumbar lytic lesions . at that time
no cytogenetic abnormalities were screened by fluorescent in situ hybridization ( fish ) and later ( in 2011 ) no fish abnormalities were detected .
first - line treatment with melphalan and prednisolone ( mp ) and radiotherapy ( d12-l2 30 gy ) were started , but suspended after three cycles due to deep venous thrombosis .
partial response was achieved and the patient remained stable until 1997 . in march and may 1997 ,
the patient underwent tandem asct without further treatment , achieving a complete response by the international myeloma working group criteria 23 .
biochemical disease progression was documented in may 2002 with positive serum immunofixation , but due to the absence of clinical symptoms , treatment was postponed until december 2002 , when thalidomide and prednisolone were started due to bone pain and increased serum ig levels .
after 12 cycles , thalidomide dose was reduced to 50 mg / day due to grade 2 peripheral neuropathy .
the neurologic toxicity motivated the interruption of the treatment in march 2005 , despite the achievement of very good partial response ( vgpr ) .
retreatment was not necessary until october 2008 , when bone pain reappeared and an increased serum ig level was detected .
the patient was started on with lenalidomide ( monthly cycles of 25 mg / day for 21 days ) and dexamethasone ( 40 mg / week ) .
a caucasian 58-year - old woman with a medical history of hepatitis c , epilepsy , intestinal angiodysplasia with previous bleeding episodes , major depression , and a ps of 0 was diagnosed with igg kappa mm , durie salmon stage iiia ( iss not available ) , in june 1994 . at diagnosis
, she had 13% bone marrow infiltration by plasma cells , serum igg of 8731 mg / dl , and multiple painful osteolytic lesions . at that time
no cytogenetic abnormalities were screened by fish and in 2009 no fish abnormalities were detected .
first - line treatment with mp was changed to cyclophosphamide and prednisolone due to no response .
this second line of treatment was maintained for four cycles and the patient achieved stable disease . in march 1997 , she presented with bone pain , rising serum levels of monoclonal protein and hepatomegaly , which led to the introduction of the third line of treatment with vincristine , melphalan , cyclophosphamide , and prednisone ( vmcp ) alternating with vincristine , carmustine ( bcnu ) , doxorubicin , and prednisone ( vbap ) ( vmcp / vbap ) .
after local radiotherapy ( 30 gy ) , she continued treatment with six cycles of infused vincristine , adriamycin , and high - dose methylprednisolone ( vamp ) , which was complicated by hematologic and infectious toxicity , grades 2 and 3 respectively .
still , symptoms improved and the hepatomegaly receded but by the end of the treatment igg had stabilized at 7200 mg / dl and 3.5% plasma cells persisted in the bone marrow . due to clinical stability and chemotherapy - related toxicities ,
the patient was kept without therapy for 3 years . in 2001 , she restarted vbap ( fifth line ) due to biochemical progression and recurrence of pain .
clinical and biochemical progression lead to treatment with thalidomide plus dexamethasone ( sixth line ) for 14 months , with grade 2 neuropathy .
however , a long - lasting partial response was achieved and remained stable for almost 5 years . during that period , new york heart association class ii
iii heart failure was diagnosed and attributed to previous treatment with anthracyclins . by the end of 2008 ,
back pain increased and serum monoclonal protein rose , and thalidomide and dexamethasone were restarted and kept until march 2010 .
again , a partial response was obtained that lasted for 24 months . in january 2012 , a new clinical relapse was treated with cyclophosphamide and prednisolone without success .
a caucasian 32-year - old man with no relevant past medical history and a ps of 3 due to bone pain was diagnosed with igg lambda mm , durie salmon stage iia , iss i in july 1995 . at diagnosis , he presented marrow plasmocytosis of 2.3% , serum igg of 3238 mg / dl , 14.6 g / dl of hemoglobin , and one osseous plasmocytoma on the left femur that led to a pathological fracture . at that time
no cytogenetic abnormalities were screened by fish and in 2005 and 2012 no fish abnormalities were detected .
right after diagnosis , first - line treatment with cyclophosphamide and prednisone for two cycles and local radiotherapy ( rt ) ( 40 gy ) were started , followed by vincristine , doxorubicin , and dexamethasone ( vad ) for six cycles , without major toxicities .
partial response was achieved and the patient underwent tandem asct in 1996 ( melphalan 200 mg / m in conditioning for both ) with 2 years maintenance therapy with alpha - interferon .
he reached a vgpr and remained without further treatment for 7 years . in february 2005 ,
a third line of chemotherapy with cyclophosphamide plus dexamethasone and additional rt to control painful bone lesions was started .
after four cycles without response , a fourth line of treatment was initiated with bortezomib and dexamethasone ( vd ) .
. he was proposed for a third asct that took place in may 2006 ( melphalan 140 mg / m ) , keeping a vgpr .
the patient remained clinically stable , with slow biochemical progression after transplantation . in july 2007 ,
a partial response was achieved , with grade 2 neurotoxicity , which lead to treatment interruption after eight cycles .
four months later , progression was documented with bone pain and an increase in bone marrow plasmacytosis
. a sixth line of treatment with lenalidomide and dexamethasone was introduced and a partial response was achieved .
this treatment continued until november 2010 , when the patient was admitted in the emergency room with paraplegia due to dorsal vertebra collapse and spinal cord compression .
he then initiated seventh treatment line with bortezomib , cyclophosphamide , and dexamethasone , which was maintained for 23 cycles and suspended in july 2012 due to grade 3 neuropathy and frequent respiratory infections .
six months later , the patient started his eighth therapeutic line ( idarrubicine and dexamethasone , interrupted due to toxicities without response ) .
repeated infectious and hematological adverse events occurred , and the disease progressed after four cycles .
a 56 year - old woman patient with no relevant past clinical history , was diagnosed with mm igg kappa , durie salmon stage iib , iss stage iii in december 2001 . at diagnosis ,
the patient presented bone marrow plasmocytosis of 68.4% , serum igg of 1500 mg / dl , anemia and renal insufficiency ( hb 9.2 g / dl , serum creatinine 1.6 mg / dl ) . at that time
no cytogenetic abnormalities were detected by fish , but a del 13q14 was identified in 2002 . right after diagnosis , treatment with vamp for four cycles was initiated .
the treatment was altered to cyclophosphamide and prednisolone , and kept for 12 cycles with the achievement of pr without renal function recovery . in july 2003
disease progression with bone pain and increased serum igg lead to a third line of treatment with thalidomide and dexamethasone .
the patient achieved vgpr by the 18th cycle , with grade 2 neuropathy . in november 2006 ,
the patient was kept on the same regimen until october 2008 , when disease progression ( painful bone lesions ) was observed .
radiotherapy , vertebroplasty , and treatment with high - dose dexamethasone ( fourth line ) were started .
she was kept on observation until january 2013 , when de novo lower back and right hip pain started .
new bone lesions and a soft tissue mass in the right femur were documented without changes on bone marrow plasmocytosis or biochemical progression .
the term long - term survivor in oncology refers to patients alive for 10 or more years after the diagnosis of cancer . in the case of mm ,
long - term survival is still unusual and less than 10% of patients fulfill this criteria 4,7 . nowadays , with expanded overall survival and a population well aware of health information
, myeloma patients frequently discuss survival issues with their physicians and it is important to note that both the overall and disease - free survival of those patients have been significantly prolonged due to newer and more target - specific treatments and adequate supportive care 4,7,24 .
the cases presented here are good examples of long - term mm control with different sequential treatment strategies . while patient 3 clearly benefited from conventional chemotherapy ( mainly melphalan ) , patients 1 and 2 were particularly responsive to immunomodulation .
although we did not identify specific biological or genetic characteristics in these cases , they differ from the more commonly observed pattern of progressively shorter remissions after multiple relapses .
besides treatment options , prolongation of survival is , in some cases ( as illustrated in case 1 ) , not simply related to the use of novel drugs but possibly associated to clinical prognostic factors and biological characteristics of the disease .
cytogenetic and molecular characteristics of clonal plasma cells are well - defined as prognostic factors based on the results of several myeloma biology studies and clinical trials 6,11,2528 . although each patient had a different profile of response all were long survivors . as such
, there seems to be , not one , but several profiles of long survivors in mm .
case 1 exemplifies a highly chemo- and immunomodulation - sensitive disease , as shown by good responses to all treatment lines for the last 17 years . in this case , the prolongation of survival was evident even before the introduction of new drugs .
notably the patient received only three treatment lines and was never exposed to proteasome inhibitors .
this type of tumor allows treatment strategies that may even exclude high - dose melphalan and autologous transplantation , as suggested by the mayo clinic treatment approach 29 .
this case is also an example of potential advantages for maintenance treatment approaches that may prolong responses and , subsequently , overall survival .
she received mostly conventional chemotherapy regimens and achieved mainly partial responses . with the introduction of thalidomide , more prolonged disease control was possible at the cost of neurotoxicity that finally led to treatment discontinuation .
currently this patient is under lenalidomide and dexamethasone and achieved a new partial response with significantly less toxicity . in this case ,
the neurotoxicity associated to the extensive use of thalidomide is now known to preclude or delay treatment with bortezomib , which must be taken in consideration when planning the therapeutic approach to this chronic disease .
case 3 exemplifies the advantage of high - dose melphalan and asct as a pathway to achieve better responses and prolonged survival , even before the introduction of novel drugs .
this patient was diagnosed at an early age and underwent three asct and several treatment lines with a wide range of anti - mm drugs , including experimental agents ( pomalidomide ) . in this case
however , the long clinical course may have allowed an evolution through sequential sensitive clones .
more sensitive molecular methodologies such as gene expression studies or dna sequencing might enlighten relevant genetic features explaining chemo - sensitivity in similar clinical settings .
this case is also an example of the need for a multidisciplinary team to optimize mm patient care , as well as of the importance of maximizing the use of current drugs in order to allow future access to drugs still under development .
patient 4 illustrates the case of an early acute renal failure complicating a diagnosis of mm in a young woman , who became dependent of dialysis regardless of what was considered standard chemotherapy at that time .
however , even in this poor setting , deep and prolonged disease control was possible .
the patient received thalidomide , corticosteroids , and local radiotherapy to control pain related to isolated bone lesions .
an improvement on renal function was never achieved and neurological , thromboembolic , and metabolic toxicities occurred over time , which precluded the use of proteasome inhibitors .
however , a reasonable quality of life is maintained and the disease was controlled with few treatment lines and limited use of novel agents .
in addition to treatment options , long survival of myeloma patients might be related to biological characteristics of tumor cells and/or microenvironment .
disease biology is indeed one of the most important determinants of outcome . among patients with similar age , comorbidities , and disease stage ,
although scores based on cytogenetic abnormalities are used for prognostic stratification , they not always directly dictate treatments 9 . as such
, detailed cytogenetic and molecular studies were not performed in the long - term survivors presented here and can not be used as an explanation for the observed outcomes .
these observations underline the importance of other variables interfering with overall survival , including comorbidities and fitness .
these are typically approached in the clinics by modifying treatment intensity and tailoring therapeutic approaches . in this sense
, hematologists tend to avoid asct in patients with advanced age , and often reduce the dose and intensity of chemotherapy to minimize toxic side effects and maximize control of the disease .
however , a recent study showed that asct is feasible and well - tolerated in selected mm patients aged > 65 .
with the limitations of a retrospective case - match analysis and differences in the treatments , novel agents incorporated into asct seem to offer better outcomes in comparison with novel agent - based treatments alone and should be considered a valid option for fit elderly patients 31 . on the other hand , the role of asct to treat fit and young patients with mm
was recently questioned as several studies questioning the need for such an aggressive approach are ongoing ( studies from the european myeloma network and italian group ) .
better , patient - centered health care , aiming at specific problems occurring in long survivors may minimize some of the adverse events and increase quality of life .
multidisciplinary teams of health professionals including physicians , psychologists , nutritionists , and physical therapists may contribute to better evaluate the needs of long survivors and design comprehensive survivor programs . besides therapeutic antimyeloma strategies aiming to control residual disease , these survivor programs may include special attention to patient comorbidities , toxicity management , and physical , psychological , and social rehabilitation .
current approaches to cancer survivorship care should include the integration of health care perspectives with the needs of cancer survivors and the optimization of practices in cancer survivorship care , overcoming barriers for personalized approaches and exploring areas for future research aimed at improving the quality of life 32,33 .
the observed prolongation on mm patients ' survival may allow statisticians to apply cure models as an alternative to the standard cox proportional hazards models to data showing prolonged survival trends 34,35 .
these models may allow researchers to investigate what covariates are associated with either short- or long - term effects .
the cases presented here are , however , good examples of prolonged survival with reasonable controlled but persistent disease .
it is important to incorporate the concept of quality of life in the management of these patients and appreciate that long survivorship , even not leading to cure , is very dependent on treatment strategies .
currently , and given the prolongation of survival , we may point three major controversies in mm management : early versus late transplant , treatment or observation in high - risk smoldering myeloma , and use of maintenance / prolonged therapy .
these controversies and the answers hematologists may prefer are associated with the perception of risks and benefits associated to each of the choices .
although it is common thinking that patients should receive upfront treatment with a triple or quadruple combination of drugs , there is no absolute evidence pointing to the need for combined therapies in the beginning of symptomatic disease ; sequencing novel agents , saving options for a later relapse , may be an alternative and effective strategy in some cases .
new phase iii clinical trials are needed to specifically address and clarify these questions . recently
the concept of clonal evolution through tides among the population of myeloma cells showed the presence of several clones of tumor cells at diagnosis , each with a different genetic makeup .
the results of that work also show that the dominant clone changes over the course of the disease and is influenced by treatments , with a given clone rising and falling over time ( known as clonal tides ) 13 .
these concepts provide a rational basis for the definition of optimal sequential treatment strategies for specific groups of mm patients , maximizing the survival benefit through the appropriate choice of drugs at different time - points . while the clinical availability of such tools is limited to some centers , survival of mm patients depends not only on the availability of multiple drug options but also on the personalized decisions and multidisciplinary teams providing adequate care during different stages of the disease , including ( and leading to ) long survivorship .
|
key clinical messagethe survival of multiple myeloma patients has improved very significantly over the last decade .
still median overall survival is inferior to 5 years .
a small proportion of patients survive longer than 10 years . in this paper
we discuss four cases illustrating the nonhomogeneous clinical presentation and evolution of this subset of patients .
surprisingly , these long survivors do not always have deep responses and some require frequent treatments , which include autologous stem cell transplantation and novel drugs .
the authors discuss several aspects of these clinical histories , including treatment options , raising hypothesis on their relation with long survivorship which may be important to have in consideration when studying this subject .
|
in a recent issue of critical care , januzzi and coworkers report the results of a prospective cohort study , evaluating natriuretic peptides in various shock patients in the intensive care unit ( icu ) .
the authors found no correlation between elevated levels of amino - terminal pro - bnp ( nt - probnp ) and high filling pressures among patients with shock within the icu , but higher values were reported to be strongly associated with death . a low level of nt - probnp , however , identified low risk patients , who were less likely to benefit from pulmonary artery catheterization ( pac ) .
the authors posed the question , therefore , whether nt - probnp measurements can replace the need for pac in icu patients .
brain natriuretic peptide ( bnp ) has been shown to be a useful cardiac biomarker for the identification of patients with suspected heart failure .
elevated serum levels have been described in both left ventricular ( lv ) systolic and diastolic dysfunction as well as in right ventricular pressure overload states , such as pulmonary embolism , cor pulmonale and primary pulmonary hypertension .
bnp and its amino - terminal fragment nt - probnp are markers of lv dysfunction , and elevated levels aid in discriminating cardiac from non - cardiac dyspnea .
peptide levels also correlate with lv filling pressures ( lvfp ) in patients with depressed systolic function . however , it is unclear whether bnp or nt - probnp correlate with pulmonary capillary wedge pressure in a population of critically ill patients with a broad range of life - threatening diagnoses .
however , given its cost , complications , and evidence from recent studies that it has either a neutral or negative effect on icu patient outcome , a reliable non - invasive method or parameter for the estimation of lvfp is needed .
one method of evaluating patients with shock is invasive hemodynamic monitoring with pac . in the modern era , however , non - invasive methods for estimating cardiac filling pressures and hemodynamics in icu patients with shock , such as biomarkers capable of predicting prognosis , are coming to light .
several studies have shown that levels of the neurohormones bnp and nt - probnp are increased in patients with cardiac dysfunction and severe sepsis or septic shock [ 8 - 12 ] . moreover , these studies have shown that nt - probnp can serve as an early marker of prognosis in this patient population .
similar to previous examinations , januzzi and coworkers demonstrated that elevated levels of nt - probnp were strongly associated with the risk of death in the icu , and were even stronger predictors of death than apache ii scores .
it is doubtful , however , whether bnp or nt - probnp correlate with invasively measured hemodynamic parameters , such as pulmonary capillary wedge pressure or low cardiac output in patients with various types of shock in the icu . in agreement with the findings reported by jannuzzi and coworkers in the present issue of critical care ,
previous investigators reported that lower levels of nt - bnp identified patients with lower risk and better prognosis and that they may differentiate survivors from non - survivors in the icu .
thus , januzzi and coworkers suggested that low nt - probnp concentrations may be useful indicators to avoid pac in low risk patients in the icu .
several mechanisms account for increased natriuretic peptide levels in shock patients and for the observed lack of association between natriuretic peptides and cardiac filling pressures and hemodynamics .
first , lipopolysaccharide and proinflammatory cytokines such as interleukin-1 and cardiotrophin-1 up - regulate transcription of the gene encoding bnp .
second , wall stretch can activate the janus kinase / signal transducer and activator of transcription ( jak / stat ) pathway in cardiomyocytes ; this activation augments il-6 mrna expression and consecutively il-6 release .
according to witthaut and collegues , who found a correlation between levels of natriuretic peptides and interleukin-6 plasma levels , the upregulation of il-6 may effect cardiac release of natriuretic peptides .
thus , plasma levels of natriuretic peptides are not only affected by lv function , but also by secretion of inflammatory cytokines such as il-6 in icu shock patients .
however , future studies evaluating the precise mechanisms responsible for enhanced natriuretic peptide secretion in critically ill patients are still needed . in critically ill patients ,
the use of pac neither increases overall mortality or days in hospital nor confers benefit . despite almost 20 years of randomized clinical trials ,
a clear benefit leading to improved survival from the use of pac has not been proven .
the neutrality of pac for clinical outcomes may result from the absence of effective evidence - based treatment regimens according to pac information across the spectrum of critically ill patients .
further clinical trials should lead to the establishment of treatment protocols for the use of pac in this patient population .
the additional measurement of nt - probnp in critically ill patients may provide promising decision support for the application of pac and may help to identify candidates who might benefit from pac measurements or be harmed by pac .
bnp = brain natriuretic peptide ; icu = intensive care unit ; il = interleukin ; lv = left ventricular ; lvfp = left ventricular filling pressures ; nt - probnp = amino - terminal probnp ; pac = pulmonary artery catheterization .
this work was supported by a grant of the faculty of clinical medicine mannheim , university of heidelberg , germany .
|
b - type natriuretic peptide ( bnp ) and amino - terminal pro - bnp ( nt - probnp ) are promising cardiac biomarkers that have recently been shown to be of diagnostic value in decompensated heart failure , acute coronary syndromes and other conditions resulting in myocardial stretch and volume overload . in view of the high prevalence of cardiac disorders in the intensive care unit , the experience of elevated natriuretic peptide levels in the critically ill might be of enormous diagnostic and therapeutic value .
bnp and nt - probnp levels rise to different degrees in critical illness and may also serve as markers of severity and prognosis in diseases beyond acute or chronic heart failure . the diagnostic and prognostic use of natriuretic peptides in the intensive care setting for patients with various forms of shock could be an attractive alternative as noninvasive markers of cardiac dysfunction that could obviate the need for pulmonary artery catheterization in some patients .
|
we studied 20 patients ( 50% male ) with pcd based on who criteria.1 bone marrow ( bm ) aspirates were collected after informed consent and were selected based on availability of sufficient sample material .
gtg - analysis was performed on unstimulated bm cells after long - term ( 72h and 120 h ) culture .
karyotypes were described according to iscn 2013.9 pcs were selected to a purity of > 90% ( as previously tested on a subcohort ( results not shown ) ) by immunomagnetic enrichment of cd138 positive cells using the human cd138 positive selection kit ( stemcell technologies melbourne , australia ) .
i - fish was performed on all samples using a mixture of locus - specific probes for 1q21(s100a10)/8p21(pnoc ) , 11q23(zbtb16)/13q14(dleu1 ) and 17p13(tp53)/19q13.3(cd37 ) ( kreatech , the netherlands ) and a break - apart probe for 14q32(igh ) .
an additional panel of dual fusion probes was applied to the samples that were positive for an igh rearrangement ( 4p16(fgfr3)/14q32(igh ) , 11q13(meyov)/14q32(igh ) and 14q32(igh)/16q23(maf ) ) ( cytocell , uk ) . according to the uk haemato - oncology best practice guidelines ,
cut - off values were set at the levels recommended by the european myeloma network.10 whole genome microarray was performed using an oligonucleotide array ( 860 k oligonucleotide array , ccmc design ) ( bluegnome , uk ) .
labelling and hybridisation of patient dna was performed as per the agilent oligonucleotide array - based cgh for genomic dna analysis - enzymatic protocol user manual .
sex - matched reference dna supplied by agilent technologies was used ( agilent technologies , usa ) .
we studied 20 patients ( 50% male ) with pcd based on who criteria.1 bone marrow ( bm ) aspirates were collected after informed consent and were selected based on availability of sufficient sample material .
gtg - analysis was performed on unstimulated bm cells after long - term ( 72h and 120 h ) culture .
pcs were selected to a purity of > 90% ( as previously tested on a subcohort ( results not shown ) ) by immunomagnetic enrichment of cd138 positive cells using the human cd138 positive selection kit ( stemcell technologies melbourne , australia ) .
i - fish was performed on all samples using a mixture of locus - specific probes for 1q21(s100a10)/8p21(pnoc ) , 11q23(zbtb16)/13q14(dleu1 ) and 17p13(tp53)/19q13.3(cd37 ) ( kreatech , the netherlands ) and a break - apart probe for 14q32(igh ) .
an additional panel of dual fusion probes was applied to the samples that were positive for an igh rearrangement ( 4p16(fgfr3)/14q32(igh ) , 11q13(meyov)/14q32(igh ) and 14q32(igh)/16q23(maf ) ) ( cytocell , uk ) . according to the uk haemato - oncology best practice guidelines ,
whole genome microarray was performed using an oligonucleotide array ( 860 k oligonucleotide array , ccmc design ) ( bluegnome , uk ) .
labelling and hybridisation of patient dna was performed as per the agilent oligonucleotide array - based cgh for genomic dna analysis - enzymatic protocol user manual .
sex - matched reference dna supplied by agilent technologies was used ( agilent technologies , usa ) .
genomic imbalances and rearrangements were detected in 1 ( 15% ) patient using gtg - analysis , 19 ( 95% ) patients using i - fish and 20 ( 100% ) patients using array - cgh and the combination of array - cgh and igh rearrangement i - fish .
the total number of abnormalities detected using array - cgh was 248 ( figure 1 ) .
on integration of array - cgh and igh rearrangement i - fish techniques , the detection of genomic imbalances and rearrangements reached a total of 257 aberrations .
total number of abnormalities detected across 20 patient samples by each individual screening method and the combination of array - cgh and igh rearrangement i - fish .
i - fish , interphase fluorescent in situ hybridisation ; array - cgh , comparative genomic hybridisation ; igh i - fish , igh rearrangement i - fish .
gtg - analysis provided metaphases for all cases , of which 95% ( 19/20 ) produced apparently
one case was found to be abnormal in which two clonal populations were identified in a low number of cells ( 4/51 ) .
this rearrangement was not completely defined using gtg - banding , but was identified as two derivative 8 chromosomes with the loss of the 8p and a gain of unidentified genetic material ( + der(8)t(8;?)(p11.2;?)2 ) . in this instance , the i - fish probe located at 8p21(pnoc ) identified the loss of this loci in 98% of cells scored , but did not detect a rearrangement .
array - cgh clarified the findings of gtg - analysis and identified the additional material on chromosome 8 as being that of 19p , which included the 19 centromere to produce + der(19)t(8;19)(q11.1;q12)2 .
array - cgh did not detect the rearrangement ( see online supplementary table s1 ) .
i - fish detected only 62 copy number aberrations ( 20% cut - off value ) and a total of eight igh rearrangements ( 10% cut - off value ) in seven cases .
array - cgh identified 241 genomic aberrations at a 1 mb resolution and a further seven aberrations at the fish probe loci that were < 1 mb to give a total of 248 , of which 69 were whole chromosome changes .
the seven copy number changes detected at < 1 mb all involved the igh variable region at 14q32.3 ( see online supplementary table s1 ) .
three copy number change aberrations detected by i - fish in greater than 20% of cells were not detected using array - cgh .
these aberrations were present in 21% , 23% and 28% of cells in cases 2 , 6 and 11 , respectively , and constituted 1.33% ( 3/226 ) of the total loci tested by i - fish .
interestingly , case 10 was identified as having a near - tetraploid clone by i - fish ( see online supplementary table s1 ) .
the array software normalised the data at a copy number of four ( log2=0 ) , hence all copy numbers greater or less than four were seen as either a gain or a loss .
near - tetraploid clones generally represent a doubling of the original abnormal clone , hence , all aberrations of the original clone were detected .
however , i - fish detected rearrangements in 7/20 cases . of the 7 cases with an igh rearrangement ,
3 involved myeov(11q13 ) , 1 fgfr3(4p16 ) , 1 maf(16q23 ) and 2 with an unidentified partner chromosome ( see online supplementary table s1 ) .
gtg - analysis provided metaphases for all cases , of which 95% ( 19/20 ) produced apparently normal results ( see online supplementary table s1 ) .
one case was found to be abnormal in which two clonal populations were identified in a low number of cells ( 4/51 ) .
this rearrangement was not completely defined using gtg - banding , but was identified as two derivative 8 chromosomes with the loss of the 8p and a gain of unidentified genetic material ( + der(8)t(8;?)(p11.2;?)2 ) . in this instance , the i - fish probe located at 8p21(pnoc ) identified the loss of this loci in 98% of cells scored , but did not detect a rearrangement .
array - cgh clarified the findings of gtg - analysis and identified the additional material on chromosome 8 as being that of 19p , which included the 19 centromere to produce + der(19)t(8;19)(q11.1;q12)2 .
array - cgh did not detect the rearrangement ( see online supplementary table s1 ) .
i - fish detected only 62 copy number aberrations ( 20% cut - off value ) and a total of eight igh rearrangements ( 10% cut - off value ) in seven cases .
array - cgh identified 241 genomic aberrations at a 1 mb resolution and a further seven aberrations at the fish probe loci that were < 1 mb to give a total of 248 , of which 69 were whole chromosome changes .
the seven copy number changes detected at < 1 mb all involved the igh variable region at 14q32.3 ( see online supplementary table s1 ) .
three copy number change aberrations detected by i - fish in greater than 20% of cells were not detected using array - cgh .
these aberrations were present in 21% , 23% and 28% of cells in cases 2 , 6 and 11 , respectively , and constituted 1.33% ( 3/226 ) of the total loci tested by i - fish .
interestingly , case 10 was identified as having a near - tetraploid clone by i - fish ( see online supplementary table s1 ) .
the array software normalised the data at a copy number of four ( log2=0 ) , hence all copy numbers greater or less than four were seen as either a gain or a loss .
near - tetraploid clones generally represent a doubling of the original abnormal clone , hence , all aberrations of the original clone were detected .
however , i - fish detected rearrangements in 7/20 cases . of the 7 cases with an igh rearrangement ,
3 involved myeov(11q13 ) , 1 fgfr3(4p16 ) , 1 maf(16q23 ) and 2 with an unidentified partner chromosome ( see online supplementary table s1 ) .
gtg - analysis provided metaphases for all cases , of which 95% ( 19/20 ) produced apparently normal results ( see online supplementary table s1 ) .
one case was found to be abnormal in which two clonal populations were identified in a low number of cells ( 4/51 ) .
this rearrangement was not completely defined using gtg - banding , but was identified as two derivative 8 chromosomes with the loss of the 8p and a gain of unidentified genetic material ( + der(8)t(8;?)(p11.2;?)2 ) . in this instance , the i - fish probe located at 8p21(pnoc ) identified the loss of this loci in 98% of cells scored , but did not detect a rearrangement .
array - cgh clarified the findings of gtg - analysis and identified the additional material on chromosome 8 as being that of 19p , which included the 19 centromere to produce + der(19)t(8;19)(q11.1;q12)2 .
array - cgh did not detect the rearrangement ( see online supplementary table s1 ) .
i - fish detected only 62 copy number aberrations ( 20% cut - off value ) and a total of eight igh rearrangements ( 10% cut - off value ) in seven cases .
array - cgh identified 241 genomic aberrations at a 1 mb resolution and a further seven aberrations at the fish probe loci that were < 1 mb to give a total of 248 , of which 69 were whole chromosome changes .
the seven copy number changes detected at < 1 mb all involved the igh variable region at 14q32.3 ( see online supplementary table s1 ) .
three copy number change aberrations detected by i - fish in greater than 20% of cells were not detected using array - cgh .
these aberrations were present in 21% , 23% and 28% of cells in cases 2 , 6 and 11 , respectively , and constituted 1.33% ( 3/226 ) of the total loci tested by i - fish .
interestingly , case 10 was identified as having a near - tetraploid clone by i - fish ( see online supplementary table s1 ) .
the array software normalised the data at a copy number of four ( log2=0 ) , hence all copy numbers greater or less than four were seen as either a gain or a loss .
near - tetraploid clones generally represent a doubling of the original abnormal clone , hence , all aberrations of the original clone were detected .
predictably , array - cgh analysis did not detect igh rearrangements . however , i - fish detected rearrangements in 7/20 cases . of the 7 cases with an igh rearrangement ,
3 involved myeov(11q13 ) , 1 fgfr3(4p16 ) , 1 maf(16q23 ) and 2 with an unidentified partner chromosome ( see online supplementary table s1 ) .
gtg - analysis for monoclonal pc disorders is inadequate as only one patient showed an abnormal karyotype ( case 8) ( see online supplementary table s1 ) .
this has also been demonstrated in several other studies and is most likely related to the low proliferation rate of pcs.1113 the production of abnormal karyotypes has also been associated with disease progression .
studies have indicated that the earlier stages of disease will be less likely to produce abnormal karyotypes as the abnormal pcs are still stromal dependant and are not able to replicate in situ.1416 this may impact on the availability of dividing pcs for gtg - analysis .
some studies show that stimulation of cultures using various agents such as interleukins , 12 - 0-tetradecanoylphorbol-13-acetate ( tpa ) , phytohaemagglutinin and granulocyte - macrophage colony - stimulating factor ( gm - csf ) may increase the yield of genetically abnormal karyotypes in some cases.1719 the use of stimulants to increase the production of metaphases by pcs is one methodology that may have increased the mitotic yield of abnormal pcs .
interestingly , a cryptic translocation involving chromosome 8q and unidentified genetic material in case 20 was detected using gtg - analysis , and was further classified with array - cgh to show involvement with chromosome 19p and centromeric regions .
this was redefined from + der(8)t(8;?)(p11.2;?)2 to + der(19)t(8;19)(q11.1;q12)2 . to the best of our knowledge , this t(8;19 )
appears to be a novel translocation in myeloma and there are no known prognostic associations with a gain of 19p in myeloma ( see online supplementary table s1 ) .
myeloma typically falls into one of two main categories hyperdiploidy or non - hyperdiploidy depending upon the genetic signature of the disease .
the hyperdiploid group of myeloma patients ( approximately 45% of cases ) is associated with standard risk and improved outcome according to the international myeloma working group ( imwg ) and mayo clinic stratification for myeloma and risk - adapted therapy ( msmart ) categorisation.3
20
21 the non - hyperdiploid patients ( approximately 40% ) generally exhibit a translocation involving igh and losses of either whole chromosomes or chromosome arms .
risk involved in these patients ranges from standard to intermediate to high , depending largely on the translocation partner of the igh gene .
the remaining 15% of cases exhibit traits of both hyper and non - hyperdiploid categories and their associate risk varies depending on which genetic abnormalities are detected.8
20
21 the ploidy status of a patient is achievable using array - cgh ; however , the complete risk categorisation can only be determined when array - cgh is combined with igh rearrangement i - fish.3
8 in our cohort , we determined 7 cases to be hyperdiploid , 12 cases non - hyperdiploid and 1 case to be a combination of both based on copy number changes and the igh rearrangement status in accordance with the imwg guidelines .
the ability to determine ploidy when using a myeloma - specific fish panel is somewhat limited , as it is unable to determine if the gain or loss is part of a whole chromosome or a segmental change .
used alone , it is an inaccurate tool in assessment of risk based on current imwg guidelines .
in addition to the msmart classification , the imwg reports that some genetic features are considered to be
secondary genetic events being indicators of disease progression , including deletion of tp53 at 17p13 and abnormalities of chromosome 1 , typically involving losses on 1p and gains on 1q.16
21 it has been demonstrated that tp53 deletions are associated with high risk ; however , reports vary as to percentage of cells involved before considered high risk .
for instance , some papers describe tp53 deletions as prognostically significant if found in > 60% of cells8
22 while others do not refer to a tumour burden at all.3
6
16
20
23 in this study , we detected a tp53 deletion in three cases using both i - fish and array - cgh screening methods .
emerging genomic risk markers , such as chromosome 1 aberrations , del(16q ) , del(12p ) , del(22q ) and chromosome 5 aberrations are currently being investigated by various microarrays and gene - expression profiling.16
2427 although our cohort is relatively small , these aberrations were identified by array - cgh in many of the cases .
chromothripsis is another emerging genomic risk marker associated with pcds and other cancers.28
29 this shattering of chromosomes is not reliably detectable by either gtg - analysis or ifish , and in some cases may be missed at a 1 mb resolution .
it is expected that this array platform will detect chromothripsis , however , there was no evidence of this in the current cohort of patients to discuss .
the current prognostication guidelines set out by the imwg and the mayo clinic do not refer to chromothripsis as this is a very recent finding in genomics .
the mechanisms by which it occurs are not yet understood and there has only been one prospective study of a large cohort associating it with patient outcomes in myeloma.28
3033 as this massive genomic instability generally occurs as a secondary genetic event , it can be assumed to be associated with disease progression , however , it is evident that more studies are required to understand the impact of this phenomenon . in this study ,
the use of array - cgh increased the aberration detection rate ( 248 ) significantly in contrast with i - fish ( 70 ) and gtg - analysis ( 14 ) alone . upon combining the igh rearrangement i - fish results with the array - cgh results
the detection rate improved ( 257 ) and added significant prognostic information . however , while array - cgh is a superior screening method for the identification of copy number changes in pcds , igh rearrangement i - fish is still needed to provide prognostic information .
when comparing the sensitivity of i - fish to array - cgh , only three aberrations were not detected by array - cgh .
this may be explained by the scoring of single cells while excluding clumps of cells by i - fish ; on the other hand , the dna from clumps of cells and singular cells were tested on the microarray .
this slight difference in cell population may have changed the ratio of normal to abnormal clonal populations enough to mask the aberrations present on the microarray . the introduction of single - nucleotide polymorphism ( snp)-microarrays may overcome some of the sensitivity problems uncovered here , as low mosaic array - cgh calls may be confirmed by snp calls
. they will also provide information on copy - neutral genomic loss of heterozygositiy , which may be of prognostic importance.16
25 we show that array - cgh significantly improves the detection of clinically relevant and possibly novel genomic abnormalities in pcd , and thus could be considered as a diagnostic technique in combination with igh rearrangement i - fish .
however , further prospective studies analysing the prognostic significance of these array - cgh findings are needed .
take home messagescomparative genomic hybridisation ( cgh ) arrays are a useful and superior screening method for the identification of copy number changes in plasma cell dyscrasia in a clinical setting.however , due to the prognostic significance of igh(14q32 ) rearrangements , it is highly recommended that array - cgh be complemented with igh translocation fish.array-cgh has significantly increased the ability to decipher the complex myeloma genome .
comparative genomic hybridisation ( cgh ) arrays are a useful and superior screening method for the identification of copy number changes in plasma cell dyscrasia in a clinical setting . however , due to the prognostic significance of igh(14q32 ) rearrangements , it is highly recommended that array - cgh be complemented with igh translocation fish .
gtg - analysis for monoclonal pc disorders is inadequate as only one patient showed an abnormal karyotype ( case 8) ( see online supplementary table s1 ) .
this has also been demonstrated in several other studies and is most likely related to the low proliferation rate of pcs.1113 the production of abnormal karyotypes has also been associated with disease progression .
studies have indicated that the earlier stages of disease will be less likely to produce abnormal karyotypes as the abnormal pcs are still stromal dependant and are not able to replicate in situ.1416 this may impact on the availability of dividing pcs for gtg - analysis .
some studies show that stimulation of cultures using various agents such as interleukins , 12 - 0-tetradecanoylphorbol-13-acetate ( tpa ) , phytohaemagglutinin and granulocyte - macrophage colony - stimulating factor ( gm - csf ) may increase the yield of genetically abnormal karyotypes in some cases.1719 the use of stimulants to increase the production of metaphases by pcs is one methodology that may have increased the mitotic yield of abnormal pcs .
interestingly , a cryptic translocation involving chromosome 8q and unidentified genetic material in case 20 was detected using gtg - analysis , and was further classified with array - cgh to show involvement with chromosome 19p and centromeric regions .
this was redefined from + der(8)t(8;?)(p11.2;?)2 to + der(19)t(8;19)(q11.1;q12)2 . to the best of our knowledge , this t(8;19 )
appears to be a novel translocation in myeloma and there are no known prognostic associations with a gain of 19p in myeloma ( see online supplementary table s1 ) .
myeloma typically falls into one of two main categories hyperdiploidy or non - hyperdiploidy depending upon the genetic signature of the disease .
the hyperdiploid group of myeloma patients ( approximately 45% of cases ) is associated with standard risk and improved outcome according to the international myeloma working group ( imwg ) and mayo clinic stratification for myeloma and risk - adapted therapy ( msmart ) categorisation.3
20
21 the non - hyperdiploid patients ( approximately 40% ) generally exhibit a translocation involving igh and losses of either whole chromosomes or chromosome arms .
risk involved in these patients ranges from standard to intermediate to high , depending largely on the translocation partner of the igh gene .
the remaining 15% of cases exhibit traits of both hyper and non - hyperdiploid categories and their associate risk varies depending on which genetic abnormalities are detected.8
20
21 the ploidy status of a patient is achievable using array - cgh ; however , the complete risk categorisation can only be determined when array - cgh is combined with igh rearrangement i - fish.3
8 in our cohort , we determined 7 cases to be hyperdiploid , 12 cases non - hyperdiploid and 1 case to be a combination of both based on copy number changes and the igh rearrangement status in accordance with the imwg guidelines .
the ability to determine ploidy when using a myeloma - specific fish panel is somewhat limited , as it is unable to determine if the gain or loss is part of a whole chromosome or a segmental change .
used alone , it is an inaccurate tool in assessment of risk based on current imwg guidelines .
in addition to the msmart classification , the imwg reports that some genetic features are considered to be
secondary genetic events being indicators of disease progression , including deletion of tp53 at 17p13 and abnormalities of chromosome 1 , typically involving losses on 1p and gains on 1q.16
21 it has been demonstrated that tp53 deletions are associated with high risk ; however , reports vary as to percentage of cells involved before considered high risk .
for instance , some papers describe tp53 deletions as prognostically significant if found in > 60% of cells8
22 while others do not refer to a tumour burden at all.3
6
16
20
23 in this study , we detected a tp53 deletion in three cases using both i - fish and array - cgh screening methods .
emerging genomic risk markers , such as chromosome 1 aberrations , del(16q ) , del(12p ) , del(22q ) and chromosome 5 aberrations are currently being investigated by various microarrays and gene - expression profiling.16
2427 although our cohort is relatively small , these aberrations were identified by array - cgh in many of the cases .
chromothripsis is another emerging genomic risk marker associated with pcds and other cancers.28
29 this shattering of chromosomes is not reliably detectable by either gtg - analysis or ifish , and in some cases may be missed at a 1 mb resolution .
it is expected that this array platform will detect chromothripsis , however , there was no evidence of this in the current cohort of patients to discuss .
the current prognostication guidelines set out by the imwg and the mayo clinic do not refer to chromothripsis as this is a very recent finding in genomics .
the mechanisms by which it occurs are not yet understood and there has only been one prospective study of a large cohort associating it with patient outcomes in myeloma.28
3033 as this massive genomic instability generally occurs as a secondary genetic event , it can be assumed to be associated with disease progression , however , it is evident that more studies are required to understand the impact of this phenomenon .
in this study , the use of array - cgh increased the aberration detection rate ( 248 ) significantly in contrast with i - fish ( 70 ) and gtg - analysis ( 14 ) alone . upon combining the igh rearrangement i - fish results with the array - cgh results
the detection rate improved ( 257 ) and added significant prognostic information . however , while array - cgh is a superior screening method for the identification of copy number changes in pcds , igh rearrangement i - fish is still needed to provide prognostic information .
when comparing the sensitivity of i - fish to array - cgh , only three aberrations were not detected by array - cgh .
this may be explained by the scoring of single cells while excluding clumps of cells by i - fish ; on the other hand , the dna from clumps of cells and singular cells were tested on the microarray .
this slight difference in cell population may have changed the ratio of normal to abnormal clonal populations enough to mask the aberrations present on the microarray . the introduction of single - nucleotide polymorphism ( snp)-microarrays may overcome some of the sensitivity problems uncovered here , as low mosaic array - cgh calls may be confirmed by snp calls
. they will also provide information on copy - neutral genomic loss of heterozygositiy , which may be of prognostic importance.16
25 we show that array - cgh significantly improves the detection of clinically relevant and possibly novel genomic abnormalities in pcd , and thus could be considered as a diagnostic technique in combination with igh rearrangement i - fish .
however , further prospective studies analysing the prognostic significance of these array - cgh findings are needed .
take home messagescomparative genomic hybridisation ( cgh ) arrays are a useful and superior screening method for the identification of copy number changes in plasma cell dyscrasia in a clinical setting.however , due to the prognostic significance of igh(14q32 ) rearrangements , it is highly recommended that array - cgh be complemented with igh translocation fish.array-cgh has significantly increased the ability to decipher the complex myeloma genome .
comparative genomic hybridisation ( cgh ) arrays are a useful and superior screening method for the identification of copy number changes in plasma cell dyscrasia in a clinical setting . however
, due to the prognostic significance of igh(14q32 ) rearrangements , it is highly recommended that array - cgh be complemented with igh translocation fish .
|
aimto evaluate the role of whole genome comparative genomic hybridisation microarray ( array - cgh ) in detecting genomic imbalances as compared to conventional karyotype ( gtg - analysis ) or myeloma specific fluorescence in situ hybridisation ( fish ) panel in a diagnostic setting for plasma cell dyscrasia ( pcd).methodsa myeloma - specific interphase fish ( i - fish ) panel was carried out on cd138 pc - enriched bone marrow ( bm ) from 20 patients having bm biopsies for evaluation of pcd .
whole genome array - cgh was performed on reference ( control ) and neoplastic ( test patient ) genomic dna extracted from cd138 pc - enriched bm and analysed.resultscomparison of techniques demonstrated a much higher detection rate of genomic imbalances using array - cgh .
genomic imbalances were detected in 1 , 19 and 20 patients using gtg - analysis , i - fish and array - cgh , respectively .
genomic rearrangements were detected in one patient using gtg - analysis and seven patients using i - fish , while none were detected using array - cgh .
i - fish was the most sensitive method for detecting gene rearrangements and gtg - analysis was the least sensitive method overall .
all copy number aberrations observed in gtg - analysis were detected using array - cgh and i-fish.conclusionswe show that array - cgh performed on cd138-enriched pcs significantly improves the detection of clinically relevant and possibly novel genomic abnormalities in pcd , and thus could be considered as a standard diagnostic technique in combination with igh rearrangement i - fish .
|
preeclampsia is a medical condition in which hypertension arises in pregnancy ( pregnancy - induced hypertension ) in association with significant amounts of protein in the urine .
preeclampsia is diagnosed when a pregnant woman develops high blood pressure ( two separate readings taken at least 6 hours apart of 140/90 mmhg or more ) and 300 mg of protein in a 24-hour urine sample ( proteinuria ) that occurs after 20 weeks of gestation ( 1 , 2 ) .
preeclampsia is one of the most serious complications during pregnancy with important effects on the health of mother and fetus that causes maternal and fetal morbidity and mortality ( 3 , 4 ) . after infection and bleeding ,
preeclampsia is the third cause of death in pregnant women ( 5 , 6 ) .
furthermore , it has significant undesirable effects on fetus , including decreased amniotic fluid levels , decreased fetal growth , placental abruption , and intrauterine fetal demise ( 7 ) .
although 3% to 10% of pregnancies are affected with preeclampsia , it is estimated to be 20% in developing countries ( 8 , 9 ) .
a study in tehran showed a prevalence rate of 6.4% for preeclampsia in 2010 ( 6 ) .
first pregnancy , mother s age ( younger than 18 and older than 35 ) , previous and family history , chronic hypertension , diabetes , renal disease , multiple gestations , and obesity are some of the reported risk factors for preeclampsia ( 2 , 10 ) .
the etiology of preeclampsia is unknown but may be associated with immune system dysfunction , genetic factors , placental abnormalities , and low antitoxic protective mechanisms because of low protein ( albumin ) levels in the blood ( 11 - 13 ) .
therefore , early detection of this problem , which involves careful monitoring of both mother and fetus is an important issue ( 14 ) . to detect preeclampsia ,
hemoglobin commonly measured during the pregnancy is one of these quantities ( 15 - 19 ) . according to recent reports
levels that are abnormally high may be an important alarm for preeclampsia ( 19 - 24 ) .
in addition , other researchers showed that high levels of hemoglobin may be associated with the increased risk of diabetes , hypertension in pregnancy , preterm delivery , and low birth weight .
thus , checking the hemoglobin is important during the pregnancy for early diagnosis of these problems ( 19 , 20 , 25 , 26 ) . in diagnostic medical research ,
discriminant analysis is usually applied for evaluating the ability of biomarkers to classify patients into different groups .
commonly , biomarkers are measured at a single time for each patient and traditional discriminant analysis may be a feasible approach in this case for classifying the subjects and predicting the diseases under study ( 27 ) .
fisher linear discriminant function is the usual method in the classic discriminant analysis , which can be used in cross sectional studies .
however in longitudinal studies , there are situations that researchers wish to analyze longitudinal biomarkers for predicting the outcome in discriminant analysis . in these areas ,
the covariance pattern and linear mixed - effects models are common methods in discriminant analysis of the longitudinal data ( 28 - 30 ) .
the present study aimed to predict preeclampsia by the hemoglobin profiles through longitudinal discriminant analysis and calculating the aic ( akaike s information criterion ) , sensitivity , specificity , and misclassification error rate of this approach .
we also aimed to compare the predicting ability of covariance pattern and linear mixed - effects models in our data set .
comparing the error rate of discrimination in longitudinal and cross sectional data was another purpose in this study .
in a prospective cohort study from october 2010 to july 2011 , 650 pregnant women who were referred to the prenatal clinic of milad hospital in tehran , iran were evaluated in 3 stages .
all women referred to the laboratory and the hemoglobin level of each woman was measured in the first , second , and third trimester of pregnancy by an expert technician .
the subjects were followed up to delivery and the presence of preeclampsia was the main outcome under study .
the inclusion criteria were singleton pregnancy , gestational age of 13 weeks or less , maternal age of 18 - 35 years , parity of 3 or less , lack of systemic diseases , including diabetes , chronic hypertension and cardiovascular disease , chronic renal disease , gastroenterology disease , thyroid , epilepsy , hemoglobinopathies and mental disorders , lack of any history of smoking , alcohol use , non - routine drugs use during the present pregnancy , and lack of any history of preeclampsia in pervious pregnancy .
the exclusion criteria were known fetal anomalies , polyhydramnios , oligohydramnios , placenta previa , abruption placenta , abortion , and stillbirth . based on the mentioned criteria ,
the study protocol was approved by the ethics committee of shahid beheshti university of medical sciences issued on 31st august 2010 and written informed consent was obtained from the participants after comprehensive explanation of the procedure involved . as mentioned before , the present study aimed to predict the presence of preeclampsia in pregnant women based on their hemoglobin levels in 3 trimesters .
there are a variety of statistical methods for assessing the power of different tests for predicting a binary outcome .
for instance , classic discriminant analysis for cross - sectional data , covariance pattern model , and mixed - effects models for longitudinal data are well - known statistical methods in this context ( 28 ) .
discriminant analysis includes multivariate techniques for classifying observations into pre - defined groups . in classical discriminant analysis ,
observations only measure one time and an unstructured pattern is assumed as the covariance matrix , and then the fisher linear discriminant function can be used for classification and discrimination ( 28 ) .
covariance pattern model assumes a functional form such as compound symmetry ( cs ) or first - order autoregressive ( ar ( 1 ) ) for variance - covariance and correlation matrix .
these structures for the covariance matrix in the covariance pattern model enable discriminant analysis to consider correlation between observations , which should be assumed in the longitudinal data ( 30 , 31 ) .
the mixed - effects model supposes correlation structures such as cs or ar ( 1 ) for estimating the correlation between repeated measures data and also time is incorporated as a covariate in this model .
furthermore , a random subject effect is assumed in the model for considering the within - subject variance .
this variance for one particular subject can be different by each subject and let the model to capture the variability and cause more precise for estimation the parameters .
also mixed - effects model will allow discriminant analysis to cope with missing data ( 29 - 32 ) .
the accuracy of the classification is usually described by the misclassification error rate ( mer ) ; mer is the error rate that estimates the proportion of study participants assigned to groups incorrectly ( 28 ) . also evaluating the aic , sensitivity , and specificity rates are practical criterions for comparing different models and assessing the precision of various methods in longitudinal discriminant analysis .
hence , the best model for classifying the patients into groups is a model with the least mer and aic as well as the most sensitivity and specificity .
student t , mann - whitney u , and chi - square tests were used for comparing the demographic and clinical characteristics between two groups .
as mentioned before , the present study aimed to predict the presence of preeclampsia in pregnant women based on their hemoglobin levels in 3 trimesters .
there are a variety of statistical methods for assessing the power of different tests for predicting a binary outcome .
for instance , classic discriminant analysis for cross - sectional data , covariance pattern model , and mixed - effects models for longitudinal data are well - known statistical methods in this context ( 28 ) .
discriminant analysis includes multivariate techniques for classifying observations into pre - defined groups . in classical discriminant analysis ,
observations only measure one time and an unstructured pattern is assumed as the covariance matrix , and then the fisher linear discriminant function can be used for classification and discrimination ( 28 ) .
covariance pattern model assumes a functional form such as compound symmetry ( cs ) or first - order autoregressive ( ar ( 1 ) ) for variance - covariance and correlation matrix .
these structures for the covariance matrix in the covariance pattern model enable discriminant analysis to consider correlation between observations , which should be assumed in the longitudinal data ( 30 , 31 ) .
the mixed - effects model supposes correlation structures such as cs or ar ( 1 ) for estimating the correlation between repeated measures data and also time is incorporated as a covariate in this model .
furthermore , a random subject effect is assumed in the model for considering the within - subject variance .
this variance for one particular subject can be different by each subject and let the model to capture the variability and cause more precise for estimation the parameters . also mixed - effects model will allow discriminant analysis to cope with missing data ( 29 - 32 ) .
the accuracy of the classification is usually described by the misclassification error rate ( mer ) ; mer is the error rate that estimates the proportion of study participants assigned to groups incorrectly ( 28 ) . also evaluating the aic , sensitivity , and specificity rates are practical criterions for comparing different models and assessing the precision of various methods in longitudinal discriminant analysis .
hence , the best model for classifying the patients into groups is a model with the least mer and aic as well as the most sensitivity and specificity .
student t , mann - whitney u , and chi - square tests were used for comparing the demographic and clinical characteristics between two groups .
the mean sd age of these women was 27.37 3.91 , ranged from 18 to 35 years . among them , 309 women ( 47.5% ) were experiencing the first pregnancy and 341 ( 52.5% ) women were experiencing the second or third pregnancy .
body mass index for 332 women ( 51.1% ) was at the normal range ( 19 - 25 ) .
the percentage of women that used food supplement ( including folic acid , iron , calcium and vitamin ) during pregnancy , were 93.2% , 95.2% , 64.3% and 76.3% respectively .
there was no significant difference in the demographic and clinical characteristics between two groups ( presence or absence of preeclampsia ) ( p > 0.05 ) .
it appears that there is a time trend for the levels of hemoglobin and the mean of hemoglobin is decreasing in the second trimester and then increasing in the third trimester .
the mean hemoglobin level is lower for the women without preeclampsia than that of the other group at 3 times , so it seems to be a good separation between two groups suggesting discriminant analysis a useful approach for our data .
the mean ( sd ) hemoglobin level for two groups of with preeclampsia or without preeclampsia were , 12.88 ( 1.20 ) g / dl and 12.63 ( 1.03 ) g / dl in the first period , 12.56 ( 0.98 ) g / dl and 11.93 ( 1.04 ) g / dl in the second period and 12.84 ( 1.39 ) g / dl and 12.52 ( 1.07 ) g / dl in the third period , respectively . in model fitting , the women s hemoglobin was assumed as the response variable and preeclampsia and time as the covariates .
, the women with preeclampsia had a higher mean of hemoglobin values and the difference was 0.46 . also it appears that there is the time trend ; mean of hemoglobin level in trimester 1 was higher and in trimester 2 was lower than that of trimester 3 .
as mentioned in the previous section , we fitted the covariance pattern and linear mixed - effects models with unstructured , ar ( 1 ) and cs structures in longitudinal discriminant analysis .
akaike s information criterion ( aic ) , misclassification error rates ( mer ) , sensitivity and specificity for all the models described .
also negative predictive value ( npv ) , positive predictive value ( ppv ) , positive and negative likelihood ratios ( lr ) were explained in table 5 . in the next step ,
the receiver operating characteristics ( roc ) curves for longitudinal data , trimesters 1 , 2 , and 3 are illustrated in figure 2 the areas under the roc curve were 93% , 59% , 68% , and 54% , respectively . from our results , the sensitivity values for longitudinal model and
three trimesters were 90% , 67% , 72% , and 54% . also the specificity values were 88% , 55% , 63% , and 50% , respectively .
preeclampsia is the third reason of death in pregnant women and early detection of this disease is important in diagnostic medical research ; so this study was performed to predict preeclampsia by the longitudinal hemoglobin data and evaluating the ability of this marker for premature diagnosis of preeclampsia .
kashanian et al . showed that preexisting preeclampsia ( p = 0.004 ) was a risk factor , whereas parity more than 3 ( p = 0.007 ) and anemia ( p = 0.01 ) were protective for preeclampsia ( 10 ) .
studied the role of some risk factors as predictors associated with preeclampsia among iranian women using logistic regression .
they concluded the history of preeclampsia , hypertension , and infertility could predict preeclampsia with an increased odds ratio ( or was 5.46 , 2.34 and 3.07 , respectively ) ( 9 ) .
. showed that factors such as fulfillment of university education , marriage more than once , high blood pressure during the 24 to 28 weeks of gestation , being a housekeeper and increase in bmi raised the risk of preeclampsia ( p < 0.05 ) ( 6 ) . in our study , however , there was no significant difference in age , bmi , systolic and diastolic blood pressure , parity , education , and using food supplement between two groups , ( presence or absence of preeclampsia ) ( p > 0.05 ) .
various quantities are commonly measured during the pregnancy and hemoglobin level is one of them .
a variety of cross sectional studies have performed to investigate the relationship between the levels of hemoglobin and preeclampsia .
chang et al . showed that high hemoglobin in the first and third trimester is associated with preeclampsia ( p < 0.01 ) ( 20 , 33 ) .
our results were similar to their findings and showed that the women with preeclampsia had a higher mean of hemoglobin values and the difference was 0.46 g / dl .
also , khoigani et al . conducted a study in the first and second half of the pregnancy separately .
they concluded hemoglobin levels in the first half of pregnancy can predict preeclampsia ( p = 0.024 ) , but they found no significant association in the second half of the pregnancy ( p > 0.05 ) ( 34 ) . in our study , however , the second trimester was more informative than other trimesters . in a study by alavi ,
the ability of hemoglobin for predicting the preeclampsia was assessed by calculating the sensitivity and specificity in the first trimester . according to the study of alavi
the cut off point for hemoglobin was 12.45 and the sensitivity and specificity were reported at 0.85 and 0.43 in the first trimester .
shojaeian has also reported the sensitivity and specificity in the second trimester ( 5 , 14 ) ; the sensitivity and specificity value in their study were 0.72 and 0.57 , respectively . in our study , according to cross sectional data , the sensitivity was 0.67 and 0.72 in the first and second trimester , respectively and the specificity was 0.55 and 0.63 at the corresponding times , respectively .
thus , the specificity was greater in our study than their study in two trimesters , however , in the first trimester , the sensitivity was lower than that of the researches mentioned and in the second trimester , the sensitivity value was similar to them . at this point , there is a controversial issue ; in which trimesters the hemoglobin can better predict preeclampsia .
for example in this study , we have a better discrimination in the second trimester compared to first and third ones ; because the changes of hemoglobin is higher at this time and the differences in hemoglobin level between two groups is greater in the second trimester .
however for some pregnant women , the level of hemoglobin in the first or the third trimester may be significant and this quantity is higher for them compared to the normal group in these trimesters .
furthermore there is a significant time trend for the hemoglobin in three trimesters ( p < 0.05 ) .
thus , combining the trimesters and applying the longitudinal hemoglobin data can increase the accuracy of discrimination .
longitudinal discriminant analysis is a useful method to combine three trimesters and expected to acquire a more correct classification and lower error rate .
our findings showed that sensitivity and specificity values for longitudinal model were 0.9 and 0.88 and the area under the roc curve was 93% .
thus , this study confirmed that in longitudinal data , the error rate of classification is lower and the sensitivity and specificity are greater than that of cross sectional data . thus the strong point of our study is assuming the time trend in the model and supposing the hemoglobin in three trimesters simultaneously for discriminant analysis and predicting preeclampsia that eventually results in more accuracy .
however , in longitudinal discriminant analysis , it is not possible to detect the best cut off point for the hemoglobin level like cross sectional data , because we had the longitudinal hemoglobin data in three trimesters , which makes it a weak point in our research . in the model
fitting , the mixed effects models had a much better predicting ability in comparison to covariance pattern models for all the correlation structures and the mixed - effects model with cs correlation structure on the repeated measures was the best model .
this model had the lowest misclassification error rate and aic , and the largest sensitivity and specificity .
in longitudinal discriminant analysis , time trend was assumed by the correlation structures and cs correlation structure was the best structure in all models . in general , longitudinal discriminant analysis is an efficient method for predicting the outcome in longitudinal data and taking into consideration the time trend in the model provides more precise classification than a cross sectional study .
thus , this method may be practical for time varying markers such as hemoglobin for early detection of diseases . because of the high sensitivity and specificity , the hemoglobin may be a good marker for early diagnosis of preeclampsia .
therefore , monitoring the pregnant women and measuring regularly their hemoglobin level in 3 trimesters , help us identify the women at risk for preeclampsia .
|
background : preeclampsia is one of the most serious complications during pregnancy with important effects on health of mother and fetus that causes maternal and fetal morbidity and mortality .
this study was performed to evaluate whether high levels of hemoglobin may increase the risk of preeclampsia.objectives:the present study aimed to predict preeclampsia by the hemoglobin profiles through longitudinal discriminant analysis and comparing the error rate of discrimination in longitudinal and cross sectional data.patients and methods : in a prospective cohort study from october 2010 to july 2011 , 650 pregnant women referred to the prenatal clinic of milad hospital in tehran were evaluated in 3 stages .
the hemoglobin level of each woman was measured in the first , second , and third trimester of pregnancy by an expert technician .
the subjects were followed up to delivery and preeclampsia was the main outcome under study .
the covariance pattern and linear - mixed effects models are common methods that were applied for discriminant analysis of longitudinal data .
also student t , mann - whitney u , and chi - square tests were used for comparing the demographic and clinical characteristics between two groups .
statistical analyses were performed using the sas software version 9.1.results:the prevalence rate of preeclampsia was 7.2% ( 47 women ) .
the women with preeclampsia had a higher mean of hemoglobin values and the difference was 0.46 g / dl ( p = 0.003 ) . also the mean of hemoglobin in the first trimester was higher than that of the second trimester , and was lower than that of the third trimester and the differences were significant ( p = 0.015 and p < 0.001 , respectively ) .
the sensitivity for longitudinal data and cross - sectional data in three trimesters was 90% , 67% , 72% , and 54% and the specificity was 88% , 55% , 63% , and 50% , respectively.conclusions:the levels of hemoglobin can be used to predict preeclampsia and monitoring the pregnant women and its regular measure in 3 trimesters help us to identify women at risk for preeclampsia .
|
this results in less trauma and pain , faster recovery , and a better cosmetic outcome for the patients .
natural orifice transluminal endoscopic surgery ( notes ) involves the introduction of instruments through a natural orifice into the peritoneal cavity to perform diagnostic and therapeutic surgical interventions .
although many reports have demonstrated the technical feasibility of per os , transgastric and transcolonic approaches to certain procedures , current endoscopes and instruments are too flexible and insufficient to allow wide usage of this technology for procedures .
the combination of conventional rigid laparoscope and instruments with the natural orifice technique , such as transvaginal , may allow less - invasive procedures and favorable outcomes .
the technique of vaginal hysterectomy has become more commonly used , and in many countries it is the operation of choice for benign uterine disease requiring surgery .
the establishment and closure of transvaginal access to the abdominal cavity have become conventional techniques in this procedure , which also provide a theoretical basis and technical support for transvaginal notes procedures .
the vagina is the most widely used approach to notes because it is easy to clean and disinfect and , more importantly , because it provides safe access to the peritoneal cavity and the incision can easily be closed manually . in dedicated collaboration with gynecologists and surgeons , we successfully performed transvaginal appendectomy using conventional rigid laparoscope and instruments , using the vaginal opening , at the time of vaginal hysterectomy .
ten patients underwent transvaginal laparoscopic appendectomy at the time of vaginal hysterectomy at shengjing hospital of china medical university between november 2010 and november 2012 .
the mean patient age was 46.7 years ( range , 27 to 63 years ) .
the indications for hysterectomy were abnormal uterine bleeding ( 1 case ) , symptomatic leiomyomata ( 7 cases ) , and endometrial hyperplasia ( 2 cases , 1 of them combined with symptomatic leiomyomata ) .
the diagnoses of chronic appendicitis were made when the patient had 1 or more attacks of acute appendicitis and a fecalith was present on computed tomography scan or no filling of the appendix on barium enema .
the exclusion criteria included a history of multiple prior open abdominal operations , body mass index ( bmi ) > 35 kg / m ( because morbid obesity may affect the exposure of the appendix by the transvaginal route , unlike transvaginal hysterectomy alone ) , and extremes of age ( < 18 yr . or > 65 yr . ) . all patients gave written informed consent for surgery , institutional review board approval was obtained for the study , and patient confidentiality was maintained at all times .
all patients underwent routine preoperative mechanical and chemical bowel preparation and received a single dose of prophylactic intravenous antibiotics immediately prior to the start of the procedure . under general endotracheal anesthesia ( 7 patients ) or epidural anesthesia ( 3 patients ) , all subjects were placed in the lithotomy position .
vaginal hysterectomy was performed in the usual fashion ; once the uterus was removed , attention was turned to the appendix .
three trocars were placed through the opening of the vagina in the fashion of a reverse triangle ( figure 1 ) . before the above procedure , sparse sutures on the opening end of vagina were taken to maintain the trocars place and pneumoperitoneum .
a 30 rigid laparoscope ( stryker endoscopy , u.s.a . ) was used throughout the procedures .
using 5-mm conventional ultrasonic ace ( ethicon , u.s.a . ) , the mesoappendix was coagulated and cut , mobilizing the appendix to its base ( figure 2 ) .
closure of the appendicular base was performed with hem - o - lock clips ( weck closure systems , u.s.a . ) .
the appendix was then removed via the colpotomy without the use of an endoscopic bag ( figure 4 ) .
after hemostasis was confirmed , the vaginal cuff was sutured manually in the routine fashion for vaginal hysterectomy .
t-shaped tube as vault drainage was placed through the opening of vagina ( removed at 48 hours after surgery ) . during the laparoscopic procedures with pneumoperitoneum , it is not easy to keep the vaginal incision tightly sealed , and a gas leak or the use of suction can significantly affect operative field visibility and instrument maneuverability .
we used 2 towel forceps to form a parallel double - line suspension at the right lower quadrant , around mcburney s point , as we described previously , which is able to provide better exposure in the pelvis to facilitate gasless surgery
the first suspension device makes room for surgery , while the second expands the space so that instruments can be manipulated with greater ease .
using 5-mm conventional ultrasonic ace ( ethicon , u.s.a . ) , the mesoappendix was coagulated and cut , mobilizing the appendix to its base ( figure 2 ) .
closure of the appendicular base was performed with hem - o - lock clips ( weck closure systems , u.s.a . ) .
the appendix was then removed via the colpotomy without the use of an endoscopic bag ( figure 4 ) .
after hemostasis was confirmed , the vaginal cuff was sutured manually in the routine fashion for vaginal hysterectomy .
a t-shaped tube as vault drainage was placed through the opening of vagina ( removed at 48 hours after surgery ) .
during the laparoscopic procedures with pneumoperitoneum , it is not easy to keep the vaginal incision tightly sealed , and a gas leak or the use of suction can significantly affect operative field visibility and instrument maneuverability .
we used 2 towel forceps to form a parallel double - line suspension at the right lower quadrant , around mcburney s point , as we described previously , which is able to provide better exposure in the pelvis to facilitate gasless surgery
the first suspension device makes room for surgery , while the second expands the space so that instruments can be manipulated with greater ease .
all intended surgical procedures were carried out successfully and additional transabdominal ports were not required . the appendectomy procedure time was measured from the establishment of the operating space to the complete closure of the vaginal cuff .
the average operating time was 27.2 min ( range , 21 to 34 min ) , and the estimated blood loss was minimal .
postoperative analgesia was considered routine for the vaginal hysterectomy procedure ; additional medication requirements were not noted .
all patients were started on a clear liquid diet on postoperative day 1 and advanced to a low - residue diet without difficulty within 48 hours .
the mean postoperative hospital stay was 2.7 days , with 4 patients discharged home on the second postoperative day , 5 on the third day , and 1 on the fourth day .
pathological examination of all appendectomy specimens revealed fibrosis in the appendiceal wall , partial to complete obstruction of the lumen , evidence of old mucosal ulceration and scarring , or infiltration of the wall of the appendix with chronic inflammatory cells .
minor outpatient postoperative complications were as follows : 1 urinary tract infection successfully treated with oral antibiotics , and 1 vaginal cuff granulation tissue repair 3 months after surgery .
the patients were advised to abstain from sexual activity for 2 weeks postoperatively , and all sexually active patients reported a return to normal sexual activity 2 weeks later .
notes represents a new field that is drawing the attention of surgeons and endoscopists alike , which comprises several new endoscopic and surgical entryways into the abdominal cavity .
transvaginal surgery , traditionally limited to gynecologists for the purpose of performing hysterectomies , is now being used for abdominal operations such as appendectomy , cholecystectomy , nephrectomy , hernia repair , adrenalectomy , and sleeve gastrectomy .
one of the advantages of notes is the ability to provide female patients with a superior cosmetic alternative to the traditional laparoscopic techniques .
nonetheless , this new frontier of surgical approaches has been received critically from the surgical community .
the vaginal hysterectomy route appears to have little effect on postoperative sexual function , but overall pain scores are improved with the vaginal approach , over abdominal hysterectomy .
the establishment and closure of transvaginal access to the abdominal cavity have become conventional techniques in gynecology , which provide a theoretical basis and technical support for transvaginal notes .
effective closure of natural tract - wall incisions and prevention of intra - abdominal infections are 2 key factors affecting the development of the notes technique .
manual closure of a vaginal incision is much easier and safer than closing wounds of the stomach and colorectal walls .
the transvaginal approach does not have the serious potential risk of causing intestinal fistula , unlike the transgastric and trans - colorectal approaches .
in addition , with adequate preoperative vaginal preparation , the risk of abdominal infection can be effectively reduced so as to establish a safe and reliable notes pathway . based on our previous animal notes experiments and a large number of umbilical laparoscopic surgeries
, we decided to perform transvaginal laparoscopic appendectomy . because the target organ ( the appendix ) is close to the operation pathway ( the vagina ) , and
appendectomy is a relatively simple procedure , we tried this procedure in our initial series . from our results ,
transvaginal laparoscopic appendectomy using rigid instruments proved to be feasible , safe , and cost - effective .
the major drawback to this technique is the frequent collision of laparoscopic instruments , both extra- and intracorporeally , ascribed to the lack of triangulation necessitated by the narrow instrument - insertion space and the limited operating area .
in addition , when surgical instruments are almost coaxial with the light source , a strong sense of space misappropriation is generated and it becomes even more difficult when multiple instruments are simultaneously needed for a collaborative operation .
vaginal opening gas leak is another important problem that seriously affects transvaginal laparoscopic procedure performed under conventional pneumoperitoneum .
it is difficult to ensure that the vaginal incision is as absolutely airtight as an abdominal incision , and a surgical gas leak or the use of extensive suction will influence the operative view and instrument maneuverability ; waiting for resufflation will prolong surgery .
we used an abdominal lifting device so that the procedure could be performed under gasless conditions , and thus avoided this problem .
it also has other advantages , such as avoiding the complications of carbon dioxide pneumoperitoneum ( e.g. , subcutaneous or mediastinal emphysema ) , hypercapnia , air embolism , cardiopulmonary dysfunction , and hemodynamic changes . under gasless surgery ,
our technique employs 2 towel forceps to form a parallel double - line suspension to provide better exposure in the pelvis , which is more simple , convenient , time - saving , and cost - effective .
transvaginal laparoscopic appendectomy is in the exploratory stage of clinical application , and is far from achieving the same popularity as conventional laparoscopic surgery .
for their procedure , rigid instruments were used and the procedure was performed with 2 transvaginal and 1 transumbilical access points , with the specimen retrieved transvaginally .
roberts et al . reported that pure transvaginal appendectomy was a safe and well - tolerated procedure , with significantly less pain and faster recovery compared to traditional laparoscopic appendectomy .
recently , some authors also reported the utilization of the vaginal opening at the time of laparoscopic - assisted vaginal hysterectomy or total laparoscopic hysterectomy as a natural orifice for appendectomy and achieved acceptable outcomes . although the transvaginal approach is the preferred surgical route , controversy still exists as to the ethical aspects .
the results of some questionnaire surveys have shown that the acceptance of transvaginal notes is still low in the public .
the presence of severe adhesions , obesity , or the need for a complex operation are still technical bottlenecks for pure notes , as is the lack of appropriate surgical instruments .
development of special access devices and instruments will remove some of the present limitations of notes surgery so that it may be applied to a wider variety of surgical fields .
we have applied laparoscopy to transvaginal appendectomy for the first time , and gained the desired results . based on this initial series ,
transvaginal laparoscopic appendectomy , following vaginal hysterectomy , seems to be a safe and effective modification of established techniques , with acceptable outcomes .
|
backgroundnatural orifice transluminal endoscopic surgery ( notes ) involves the introduction of instruments through a natural orifice into the peritoneal cavity to perform surgical interventions .
the vagina is the most widely used approach to notes .
we report the utilization of the vaginal opening at the time of vaginal hysterectomy as a natural orifice for laparoscopic appendectomy.material/methodswe reviewed cases of 10 patients with chronic appendicitis who underwent transvaginal laparoscopic appendectomy simultaneously with vaginal hysterectomy .
a laparoscopic approach was established after removal of the uterus , and the appendix was removed transvaginally . among the 10 cases ,
5 were conducted under gasless laparoscopy by using a simple abdominal wall - lifting instrument.resultsall procedures were performed successfully without intraoperative or major postoperative complications .
the appendectomy portion of the procedure took approximately 21 minutes to 34 minutes .
all patients were discharged less than 4 days after surgery , without external scars.conclusionstransvaginal appendectomy with rigid laparoscopic instruments following vaginal hysterectomy appears to be a feasible and safe modification of established techniques , with acceptable outcomes .
|
oral focal mucinosis ( ofm ) is an uncommon tumor - like growth arises due to unknown etiology .
jhonson and hoelwing reported skin lesions with similar features on face , trunk and extremities .
he proposed that ofm develops as a result of local hyaluronic acid overproduction by fibroblasts .
the objective of this article is to report the occurrence of relatively rare lesion and its management .
a 53-year - old female patient reported to the mgv 's kbh dental college and hospital , nashik with the chief complaint of a lump on the gums .
after primary evaluation , the patient was referred to the department of periodontology . on oral examination , a painless
, firm and fibrous gingival overgrowth approximately ( 10 cm 2 cm ) was located on the buccal aspect of 3335 region .
the lesion appeared pale pink with flecks of melanin pigmentation which was similar to adjacent gingival tissues .
lesion had well defined borders extending from mesial aspect of 33 to distal aspect of 35 .
it was limited laterally by the lower lip mucosa and coronally by the gingival sulcus of the involved teeth [ figure 1 ] .
( c ) lingual view the patient was otherwise systemically healthy having no adverse habits .
initially , it was very small in size and the patient attempted to rupture it twice with a safety pin . since her
last attempt about a month and half ago , the lesion initially shrunk in its size however after which it expanded quite rapidly to existing one .
based on history and clinical examination , a provisional diagnosis of irritation fibroma was made .
routine laboratory investigations like hb% , bleeding time and clotting time were in normal limits .
the intraoral periapical radiographic revealed mild horizontal interproximal crestal bone loss between 33 and 34 .
an occlusal radiograph was also taken to rule out any evidence of calcification within the lesion [ figure 3 ] .
arrow indicates shadow of the lesion on x - ray without any calcifications a thorough scaling and root planning was done to remove local irritants . with patient 's consent a surgical excision of the lesion was planned . under local anesthesia
, a 3 - 0 silk suture was passed through the lesion for ease of retraction during excision . using no .
the excised lesion was stored in 10% formalin and sent for histopathological examination . after a week , dressing was removed and uneventful healing by secondary intention was observed [ figure 6 ] .
( a ) excision of the lesion under local anaesthesia using no . 15 blade .
( b ) periodontal dressing given the hematoxylin and eosin , staining revealed stratified squamous hyper - parakeratinized epithelium .
deeper stroma composed of stellate shaped fibroblasts interspersed between thin collagen fiber bundles and numerous small capillaries [ figure 7 ] .
alcian blue at ph 2.5 showed strong blue staining due presence of abundant hyaluronic acid [ figure 8 ] .
based on these histological features , a definitive diagnosis of ofm was made .
( a ) photomicrograph showing the surface epithelium with the underlying myxoid stroma ( h and e , 10 ) ( b ) loose myxoid stroma having numerous plump fibroblasts ( black arrows ) positive alcian blue staining ( ph 2.5 ) of myxoid stroma suggesting presence of hyaluronic acid patient is being reviewed periodically . at 3 month
routine laboratory investigations like hb% , bleeding time and clotting time were in normal limits .
the intraoral periapical radiographic revealed mild horizontal interproximal crestal bone loss between 33 and 34 .
an occlusal radiograph was also taken to rule out any evidence of calcification within the lesion [ figure 3 ] .
a thorough scaling and root planning was done to remove local irritants . with patient 's consent a surgical excision of the lesion was planned . under local anesthesia , a 3 - 0 silk suture was passed through the lesion for ease of retraction during excision . using no .
the excised lesion was stored in 10% formalin and sent for histopathological examination . after a week , dressing was removed and uneventful healing by secondary intention was observed [ figure 6 ] .
( a ) excision of the lesion under local anaesthesia using no . 15 blade .
deeper stroma composed of stellate shaped fibroblasts interspersed between thin collagen fiber bundles and numerous small capillaries [ figure 7 ] .
alcian blue at ph 2.5 showed strong blue staining due presence of abundant hyaluronic acid [ figure 8 ] .
based on these histological features , a definitive diagnosis of ofm was made .
( a ) photomicrograph showing the surface epithelium with the underlying myxoid stroma ( h and e , 10 ) ( b ) loose myxoid stroma having numerous plump fibroblasts ( black arrows ) positive alcian blue staining ( ph 2.5 ) of myxoid stroma suggesting presence of hyaluronic acid
since the original report by tomich , 60 cases of ofm were reported in english literature and only five cases have been reported in indian literature . based on the literature review , ofm shows predilection for adult women ( 62% ) , keratinized mucosa , gingiva in particular ( 80% of reported cases ) and mandibular arch over maxillary arch .
clinically ofm presents as a solitary , painless , non - ulcerated , round , elevated overgrowth .
tomich suggested a probable mechanism for formation of ofm as overproduction of hyaluronic acid by the fibroblasts at the expense of collagen production .
however , the reason behind this overproduction is not well understood . in the current case ,
intense blue staining of hyaluronic acid by alcian blue stain during histopathological analysis is in accordance with given theory .
there is controversy as to whether local trauma plays a role in the etiology of ofm .
documented trauma as a contributing factor . in the current case , the history of trauma seems to have aggravated size of the lesion .
the possibility of it can not be ruled out in the existing case . from histological aspect
the nerve sheath myxoma is more circumscribed , has fibrous septa between multiple myxoid nodules , and has more plump stromal cells .
peripheral odontogenic myxoma shows presence of mast cells , increased reticular fibers and islands of odontogenic epithelium .
central odontogenic myxoma is a symptomless bony swelling expanding cortices from within whereas ofm is a peripheral soft tissue lesion .
clinically , the differential diagnoses of ofm will include :
inflammatory lesions :
fibrous hyperplasiaperipheral giant cell granulomaepulis fissuratumpyogenic granuloma .
tumors :
peripheral fibromaperipheral ossifying fibromaperipheral ameloblatomaperipheral odontogenic myxomamalignant and metastatic tumors in gingiva .
non - plaque induced lesions :
irritation fibroma .
inflammatory lesions :
fibrous hyperplasiaperipheral giant cell granulomaepulis fissuratumpyogenic granuloma .
peripheral giant cell granuloma
peripheral fibromaperipheral ossifying fibromaperipheral ameloblatomaperipheral odontogenic myxomamalignant and metastatic tumors in gingiva .
non - plaque induced lesions :
irritation fibroma .
however , none of the articles reported a clinical diagnosis of ofm at its first presentation .
nevertheless surgical excision of lesion seems to be a safe approach without any reports of recurrence .
|
oral focal mucinosis ( ofm ) is a rare soft tissue lesion of unknown aetiology .
clinically , it is most commonly found on the gingiva and presents as a painless , sessile or pedunculated mass .
histologically , it is characterized by focal myxoid degeneration of underlying connective tissue .
fifty - three - year - old patient reported with a painless , firm and fibrous gingival overgrowth present from 7 to 8 months . clinical examination and
patient 's history pointed towards
irritation fibroma .
an excisional biopsy was performed .
the histopathologic diagnosis was established as ofm , an uncommon and poorly characterized type of lesion .
this case report stresses on the fact that prediagnosis of ofm is almost impossible .
thus though rare , ofm must be considered in the differential diagnosis of soft tissue overgrowths in oral cavity .
|
a small number of cases of congenital prepubic sinus ( cps ) have been reported.1
2 cps is a rare congenital anomaly of the urinary tract .
it is associated with discharge from an opening overlying the symphysis pubis , and affects both males and females.3 cps may either be a complete or incomplete channel that runs parallel to the normal urethra from the prepubic glans or clitoral area and extends to the bladder , which may either join the urethra or end blindly.4 dorsal urethral duplication and cloacal anomalies are assumed to be the causes of this condition.5 in most cases of cps , a tiny hole is seen in the prepubic area .
we herein report a case of cps in which the tissue extending from the overlying skin mimicked the corpus spongiosum of the penis .
a 3-year - old boy with weight of 12 kg was admitted for yellowish discharge from a tiny opening along the midline of the pubic
physical examination revealed a tiny sinus in the prepubic area and 3 cm of tissue , similar to the corpus spongiosum , attached to the sinus .
fistulography showed a noncommunicating fistulous tract coursing from the prepubic skin toward the bladder ( fig .
the overlying tissue located 3 cm from the base of the penis was excised and found to be continuous with the sinus tract .
the sinus opening was probed and simple excision of the sinus tract was performed , revealing a tract approximately 4 cm long that extended to the retropubic space and ended in a fibrous tract . the postoperative course was uncomplicated , and the boy remains asymptomatic 1 year after the intervention .
histomorphological findings showed that the tissue was lined with squamous epithelium , and the accompanying urothelial residue was compatible with urothelial cysts and surrounded by focal smooth muscle layers .
the sinus usually passes from the base of the penis near the abdominal wall toward the anterior bladder without communicating with the urinary tract.6 the diagnosis is generally established by confirming the presence of the sinus tract using fistulography or the us .
the diagnosis in our case was confirmed with us , and fistulography revealed the precise anatomy of the sinus .
variants of cps have been reported , and because the anatomic features often differ , a consensus concerning the embryology and classification has not yet been established .
rozanski et al7 reported a case of cps that represented a mild form of a midline closure defect .
a second theory is that the defect does not allow for complete replacement of the ventral cloacal membrane by the lateral mesodermic folds , creating a fistulous tract.8 van der putte9 considered the basis for this condition to be congenital malformations of cloaca - derived orifices , such as hypospadias , epispadias , vesical and cloacal exstrophy , double urethra , and prepubic sinuses .
most reported cases of cps have been characterized by a tiny opening in the prepubic area that was primarily surrounded by squamous epithelium .
campbell et al10 reported three cases of cps in which the sinus tract was surrounded by stratified squamous epithelium or transitional epithelium with concentric bundles of collagen and smooth muscle fibers .
the authors concluded that these sinuses may represent a variant of epispadiac duplication of the urethra .
huang et al1 performed an immunohistochemical study , and found that the epithelium lining was transitional proximally and squamous distally in five patients .
they reinforced the theory that cps is a variant form of dorsal urethral duplication . in our case ,
the squamous epithelium was surrounded by muscle and glands within the tissue , and urothelial epithelium was found within the sinus tract .
the difference between the locations of the squamous epithelium and transitional epithelium may have been because of the fact that cps reacts with ductal and glandular epithelia , including the urothelium .
this finding might support the theory that dorsal urethral duplication is the etiology of this condition .
stephens11 stated that cps might be caused by an inturned epithelial tube or remnant along the line of fusion of the infraumbilical abdominal walls , and classified this into three parts based on where the sinus begins .
we believe that this case involved type 2 dorsal urethral duplication according to stephens ' classification , which describes a sinus that simulates an accessory urethra and tract from the dorsum of the penis behind the symphysis pubis to the bladder wall . however , we found no previous studies indicating that the sinus continues with the urinary tract tissue mimicking the corpus spongiosum .
it is possible that the sinus tract was hypertrophic because of the accumulation of discharge from the cps . in conclusion ,
we postulate that all the previously reported cases may be manifestations of a wide spectrum of the same condition . however , according to most investigators , cps may represent a variant of dorsal duplication of the urethra . to the best of our knowledge ,
this is the first case in which the cps continued outward from the skin within the urinary tract .
|
a congenital prepubic sinus is a tract that originates in the skin and overlays the base of the penis ; however , its embryologic basis is still debated .
we herein present a case involving a 3-year - old boy who was admitted for examination of overlying tissue located a few centimeters distal to the dorsal base of the penis .
examination revealed a tiny sinus in the prepubic area , and 3 cm of tissue was attached to the sinus .
pathologic examination showed that the tissue was lined with squamous epithelium and continued along the sinus tract , which was lined with urothelial epithelium . according to stephens ' classification
, the sinus appeared to be a variant of type 2 dorsal urethral duplication , and the remnant tissue mimicked the corpus spongiosum of the penis .
|
today 's fast pace of life is extremely demanding and people stretch beyond their limits to meet the challenges .
nonsteroidal anti - inflammatory drugs ( nsaids ) are the most widely prescribed medication as well as sold over the counter .
nsaids are said to function as inhibitors of isoforms of 1 and 2 of cyclo - oxygenase enzyme ( cox-1 and cox-2 ) .
nsaids thus produce gastric and renal side effects through their indirect inhibition of pge-2 and pgi2 synthesis .
coxibs are a class of nsaids designed to inhibit cox-2 selectively . their development was based on the hypothesis that cox-2 was the source of pge-2 and pgi2 , which mediate inflammation and that cox-1 was the source of the same pg in gastric epithelium where they afford cytoprotection .
this prompted the development of selective cox-2 inhibitors ( coxibs ) such as rofecoxib and celecoxib , second - generation coxibs valdecoxib , parecoxib and etoricoxib .
a 37-year - old woman was referred from the emergency department for complaint of redness on her legs since 2 days .
she had experienced pain in her right shoulder for which she had been taking etoricoxib 60 mg orally once daily for 5 days .
on cutaneous examination , diffuse erythema [ figures 1 and 2 ] was observed below the knees to just above the ankles on both lower limbs .
redness was more evident on the anterior aspect of the leg , similar to that observed in pretibial myxedema except that it was pitting in nature .
her temperature , blood pressure , and routine investigations and thyroid function tests were all within normal limits .
naranjo 's score in this patient was 5 denoting thereby that this was probably a drug - induced reaction .
high usage of etoricoxib by prescription as well as self - administered routes has led to increase in reports of side effects and adverse reactions including dermatologic reactions in 0.1%0.3% of cases .
various studies have been done wherein cases with a history of adverse cutaneous reactions to nsaids were challenged with etoricoxib .
sporadic cases of etoricoxib - induced acute generalized exanthematous pustulosis and erythema multiforme - like eruption have also been documented as are case reports of erythema and fixed drug eruption induced by etoricoxib .
drug - induced erythema is a type iv hypersensitivity reaction of the gell and coombs classification .
no specific treatment is required ; however , topical corticosteroids and/or oral antihistaminics may give symptomatic relief from itching .
however in doubtful circumstances , the possibility of any kind of adverse reaction to a drug must be kept in mind . in our case ,
to the best of our knowledge , pretibial erythema associated with edema has not been reported so far in any patient receiving etoricoxib .
|
cyclooxygenase inhibitors were developed in the quest of enhanced analgesic efficacy devoid of gastric side effects .
etoricoxib is a second - generation cox-2 inhibitor and as its use increases so do the reports of side effects .
we report a case of extoricoxib - induced pretibial erythema and edema ; and review the literature .
|
duodenal varices represent an ectopic portosystemic shunt , usually originating from pancreaticoduodenal vein.1 although duodenal varices are a rare cause of gastrointestinal bleeding , a greater than 40% mortality rate has been reported after the initial bleeding episode.2 for bleeding control there are several treatment modalities including endoscopic treatments , radiologic interventions and surgical procedures .
however , it is still unclear which option would be the best for treatment of bleeding duodenal varices .
here we report a case of massive bleeding from the ruptured duodenal varices , directly arising from main portal vein , which was successfully treated with endoscopic injection sclerotherapy ( eis ) .
a 62-year old man who had a history of excessive alcohol consumption presented with massive hematemesis and melena .
he had no medical history of other systemic disease . on arrival at emergency room ,
melena was seen on digital rectal examination and fresh blood was drained through l - tube during gastric irrigation .
complete blood counts showed hemoglobin of 3.6 g / dl and platelet count of 68,000/mm .
other laboratory tests were followings ; total bilirubin 0.9 mg / dl , albumin 1.5 g / dl , prothrombin time 18.8 seconds .
child - pugh 's classification was b. hepatitis b surface antigen , anti - hepatitis c virus antibody and anti - human immunodeficiency virus antibody were all seronegative .
1a ) and blood - stained gastric mucosae with no evidence of the cardiac or fundal varices ( fig .
duodenal ulcer scar with marked luminal narrowing was noted on the bulb , however , the endoscope can pass through the narrow lumen .
dumbbell - shaped ruptured varices with an adhering whitish fibrin clot were seen on the postbulbar portion of the duodenum ( fig .
the duodenal varices were collapsed during air inflation and engorged with suction of the air .
abdominal computed tomography ( ct ) demonstrated liver cirrhosis with splenomegaly and moderate amount of ascites .
venous collaterals around the duodenum with extravasated contrast in the second and third portion were seen and the collaterals originated from main portal vein and drained throughout the inferior vena cava via the right renal vein ( fig .
2a - d ) . for hemostasis , we intravariceally injected 1.0 ml of cyanoacrylate into the duodenal varices .
the patient was getting hemodynamically stable and hemoglobin level was recovered up to 8.9 g / dl with transfusion of the packed red blood cells .
an endoscopy after 5 days showed a tubular - shaped venous bulging , by previous injection of cyanoacrylate , with a hard consistency and hyperemic covering mucosa .
endoscopic biopsy was done at the ulcer scar on the bulb , showing a chronic inflammation with granulation tissue microscopically .
after 2 weeks , an endoscopy revealed post - eis ulceration with yellow plaque and venous bulging .
six months later , a follow - up endoscopy revealed much collapsed duodenal varices with small yellow plaque on the surface ( fig .
abdominal ct disclosed the collapsed and much decreased portosystemic venous collaterals in the retroperitoneum of the paraduodenal space ( fig .
no bleeding has been detected by this time as of 9 months after the initial bleeding episode .
portosystemic communications in splanchnic hypertension occur through the several venous routes , and the duodenal varices are one of ectopic varices resulting from retroperitoneal portosystemic shunts .
these are caused by increased hepatofugal blood flow through cystic branches of superior mesenteric vein , superior and inferior pancreaticoduodenal veins , gastroduodenal veins , and pyloric veins.1 in ectopic duodenal varices of this present patient , the afferent vessel originated from the main portal vein and the efferent vein drained into the inferior vena cava via the right renal vein . to our knowledge
this is the first case of duodenal varices directly arising from the main portal vein , confirmed by radiologic imaging .
the most common cause of duodenal varices is portal hypertension in cirrhotic liver and the others are obstruction of splenic vein , portal vein , superior mesenteric vein or inferior vena cava.3 biliary cirrhosis can also rarely cause duodenal varices by the same mechanism in cirrhotic patients from other causes.4 lebrec and behamou have reported that an extrahepatic etiology of portal hypertension accounted for 20 - 30% of the patients with duodenal varices.5 in the present case , the patient had laboratory ( thrombocytopenia , hypoalbuminemia and prolongation of prothrombin time ) , and radiologic findings ( ascites and splenomegaly ) corresponding to liver cirrhosis with obvious portal hypertension . in review by amin et al ,
most of the duodenal varices are located in the duodenal bulb and they may also occur in the second and third portions of the duodenum.6 liu et al reported , however , they could see almost all of duodenal verices in the descending part of the duodenum.7 the discrepancy of occurrence site was thought to be attributable to the ethnicity of the patients and/or the experience of the endoscopists.7 nineteen of the 21 cases with duodenal varices in korea were located in the second portion of the duodenum,8 and the varices in this present case was also located in the postbulbar portion of the duodenum .
approximately 50 - 60% of the patients with duodenal varices have concomitant gastroesophageal varices.9 various treatment modalities have been reported to be available for bleeding from duodenal varices , including endoscopic variceal ligation ( evl ) , eis , transjugular intrahepatic portosystemic shunt ( tips ) , balloon - occluded retrograde transvenous obliteration ( brto ) , beta - blocker therapy , and resection of a segment of bleeding site.10 - 14 although tips or brto can be performed in the hemodynamically unstable patients whose endoscopic procedure can not secure a clear view because of massive hemorrhage , these radiologic interventions have some shortcomings to perform ; a significant mortality rate , shunt occlusion , hepatic encephalopathy , renal failure or worsening of esophageal varices .
therefore , over the last few years , it seems that endoscopic interventions have been more frequently performed , because it is less invasive , easier and faster to perform , and more effort - effective than other treatment options .
several reports suggest that evl is effective for treatment of bleeding from duodenal varices.15 - 17 however , it can be difficult to perform in some location , and rebleeding can occur by post - evl ulcer.16 and also it is difficult to achieve complete long - term eradication of varices with evl alone , because of the insufficient effect of evl on the feeding collateral vessels.18 eis has been performed for treatment of bleeding duodenal varices and suggested as a practical and effective measure.7,13 however , it carries a risk of perforation , tissue injury , and embolism . among several sclerosants such as cyanoacrylate , ethanolamine oleate , polidocanol , sodium tetradecyl sulfate , and fibrin,13 adopted for eis , cyanoacrylate and ethanolamine oleate
ethanolamine oleate disturbs the endothelial cells , induces a coagulation necrosis , and directly promotes thrombus formation .
however , this compound can lead to penetration or perforation of the thin duodenal wall.19 accordingly , some investigators prefer cyanoacrylate which causes less tissue injury .
lee et al reported that a combination therapy of the evl and eis was applied to all of 4 cases resulting in the successful hemostasis and eradication of duodenal varices.8 currently , no best treatment option for controlling duodenal varices has been proposed and verified . in the maelstrom of treatment debate , we chose a cyanoacrylate as a sclerosant for eis , performed bleeding control successfully without any complication , and eradicated the duodenal varices radiologically and endoscopically .
we report a case of endoscopic treatment in a patient with a massive bleeding from duodenal varices directly arising from the main portal vein .
we recommend eis with cyanoacrylate as a first line of treatment for bleeding duodenal varices .
|
duodenal varices result from retroperitoneal portosystemic shunts that usually come from the pancreaticoduodenal vein and drain into the inferior vena cava . because they are a rare but fatal cause of gastrointestinal bleeding , a prompt hemostatic intervention is mandatory
. a 62-year - old man who had a history of excessive alcohol consumption presented with massive hematemesis and melena .
emergent endoscopy revealed ruptured varices with an adhering whitish fibrin clot on the postbulbar portion of the duodenum .
abdominal computed tomography demonstrated a cirrhotic liver with venous collaterals around the duodenum and extravasated contrast in the second and third portions .
the collaterals originated from the main portal vein and drained via the right renal vein into the inferior vena cava .
endoscopic injection sclerotherapy with cyanoacrylate was successful in achieving hemostasis , and resulted in the near eradication of duodenal varices at a 6-month follow - up .
|
rhinoplasty is a plastic surgery procedure that is employed to reshape the nose , often through the use of implants .
alloplastic materials are composed of silicone and other synthetic materials . since alloplastic materials are cheaper and easier to acquire and process , they are used more frequently .
however , alloplastic materials , especially silicone , lead to a higher risk of extrusion and infection . in addition , calcification on the surface of silicone implants after rhinoplasty with transformation into a semiliquid form has been reported to be quite rare .
herein , we report a case of gruel - like calcification about 50 years after silicone implant rhinoplasty .
a 72-year - old female presented at our hospital with complaints of progressive swelling of the nose .
she had noticed mild pruritic sensations of the nose 1 year earlier , and the dorsal area of the nose had then swollen gradually without any other symptoms .
she had a history of rhinoplasty with silicone implant approximately 50 years earlier . upon physical examination
, we found a subcutaneous mass , 15 5 mm in size , at the dorsal nasal area ( fig .
a superficial ultrasound test showed a well - circumscribed subcutaneous mass with post - acoustic shadow , which indicated calcification therein ( fig .
x - ray and ultrasound tests showed a high - intensity plate over the dorsal nasal area ( fig .
1c ) , indicating the silicone plate placed in her nose . based on the clinical manifestation ,
the differential diagnosis included calcinosis cutis , calcifying epithelioma , foreign body granuloma and subcutaneous tumors . to confirm a diagnosis
a white , gruel - like , semiliquid material seeped out and solidified shortly thereafter .
histological analysis of this white gruel - like semiliquid material confirmed calcified deposits and fibrosis ( fig .
there were no foreign body giant cells or malignant cells . from the above findings , we considered the calcified deposits to be a possible result of rhinoplasty using silicone .
in this case , we observed gruel - like , semiliquid calcified deposits , probably related to the long - term use of a silicone implant .
silicone is a widely used rhinoplasty material that is chemically stable and has low biological reactivity , but in this case , calcification at the surface of the implant appears to have occurred after approximately 50 years .
it has been reported that the severity of calcification is correlated with the duration of use , and that a denatured type of large calcification can be observed in silicone implants older than 15 years .
calcification on the surface of the implant after rhinoplasty often occurs , but to the best of our knowledge , this is the first report of it transforming into a semiliquid state .
although the precise mechanism of calcification on the surface of implants is unclear , silicone - rich surfaces are more likely to be calcified compared to non - silicone implants .
in addition , long - term mechanical stress and inflammatory reactions might be responsible for calcification , namely the deposition of calcium phosphate .
it is difficult for calcium phosphate to dissolve under normal conditions , but it dissolves easily in a low - ph environment . in inflammatory lesions , tissue ph decreases locally due to the increased production of lactic acid , which is related to tissue damage and bacterial metabolism . in our case , calcification at the surface of the silicone implant was observed after approximately 50 years of use .
the patient had pruritus before the formation of a subcutaneous mass at the dorsal nasal area , which is indicative of inflammation occurring at the site .
although the underlying mechanism remains unclear , a ph change in the tissue might have occurred during the process of inflammation that resulted in the dissolution of calcified deposits .
|
rhinoplasty is a plastic surgery procedure to reconstruct the nose .
silicone alloplastic materials are most widely used as implants for rhinoplasty , but calcification on the surface occurs with long - term usage . herein , we report a case of gruel - like calcification approximately 50 years after silicone implant rhinoplasty . in this case ,
calcification on the silicone surface might have transformed into gruel - like deposits , which presented as a subcutaneous mass at the dorsal area of the nose .
the precise mechanism is unclear ; a ph change in the tissue might have occurred during the process of inflammation , leading to the dissolution of calcified deposits .
|
anorexia nervosa is an eating disorder characterized by excessively restricted caloric intake that induces profound weight loss , osteoporosis , and amenorrhea .
the onset of anorexia nervosa is commonly observed during puberty and adolescence , with 9095% of the cases occurring among females . due to its complexity , the neurobiology of anorexia nervosa is unknown , but studies using magnetic resonance imaging showed hippocampal volume reduction [ 36 ] .
alterations in these cognitive functions have been reported in patients and in experimental models of anorexia .
murine models of anorexia such as dehydration - induced anorexia ( dia ) or activity - based anorexia ( aba ) mimic the characteristic weight loss and reduced food intake observed in anorexic patients [ 1 , 2 , 813 ] .
the smaller hippocampal volume in anorexic patients may reflect structural changes at the cellular level . in the aba model , changes in the hippocampus included reduced cell proliferation in the dentate gyrus and decreased branching of dendrites in the stratum radiatum of ca1 [ 1 , 11 , 12 ] .
excessive physical activity alters food ingestion , which can result in nutrient and electrolyte imbalance .
thus , alterations in hippocampal function and structure could be the result of reduced caloric intake that compromises the supply of energy to the brain .
astrocytes , one of the major populations of cells in the central nervous system , play a crucial role in supplying energy to neurons ; therefore , we tested if hippocampal astrocyte density and intermediate filament expression are affected by anorexia .
the institutional animal care and use of laboratory animals committee of the unam instituto de neurobiologa approved all the experimental protocols .
animals were handled in accordance with the national institute of health guide for the care and use of laboratory animals .
wistar female rats ( 160190 g ) were housed individually under 12-h/12-h light / dark cycle and controlled temperature , with food and water ad libitum .
briefly , two independent experimental series of twelve animals were placed in individual cages ; for each series , animals were randomly selected to form three groups of four .
the dia group received a 2.5% nacl solution as their sole drinking liquid and had unrestricted access to food .
the forced food - restricted ( ffr ) group , a positive control to distinguish between starvation and dehydration effects , received tap water ad libitum and the same amount of food consumed by dia animals .
the experimental protocol was conducted for five days and body weight and solid food intake were recorded daily at noon for each experimental group .
the ffr group received the same amount of food as that ingested by dia animals ( see supplemental figure 1 in supplementary material available online at http://dx.doi.org/10.1155/2016/2426413 ) .
rats were deeply anaesthetized with an overdose of sodium pentobarbital ( 100 mg / kg ) and transcardially perfused with 100 ml of saline followed by 250 ml of chilled 4% paraformaldehyde in phosphate - buffered saline ( pbs ) ( ph 7.4 ) .
brains were removed , postfixed overnight , and then transferred to a series of sucrose solutions ( from 10 to 30% ) .
coronal sections ( 30 m ) including the dorsal hippocampus were obtained on a freezing microtome , collected , and stored in cryoprotectant solution ( 30% ethylene glycol/20% glycerol in pbs ) at 20c .
briefly , coronal sections were rinsed three times in pbs buffer and treated with 3% hydrogen peroxide for 10 min , followed by three rinses in pbs and incubation in 1.0% sodium borohydride for 68 min to reduce free aldehydes .
the sections were incubated for 1 h in blocking solution ( 5% horse serum albumin/1% triton x-100 in pbs ) .
sections were incubated for 48 h with polyclonal rabbit anti - gfap antibody ( dilution 1 : 1000 , dakocytomation , fort collins , co , usa ; 4c ) .
after washing , primary antibody was detected with alexa 594 ( 1 : 500 , invitrogen ) coupled goat anti - rabbit secondary antibody .
the sections were counterstained with 4,6-diamidino-2-phenylindole ( dapi ) and mounted with vectashield h-1000 ( vector laboratories , burlingame , ca , usa ) .
mounted coronal sections containing the hippocampus were photographed with a digital camera ( photometrics cool snap fx , usa ) attached to a nikon microscope ( nikon eclipse e600 , tokyo , japan ) and analyzed using image j version 1.41 ( nih , bethesda md , usa ) .
a zeiss lsm 780 meta confocal microscope ( zeiss , gttingen , germany ) was used for confocal images with alexa 594 ( excitation / emission wavelength 590/617 nm ) and dapi ( excitation / emission wavelength 350/460 nm ) ( figure 1 ) .
gfap - immunolabeled cells were counted and contrasted with the number of dapi - labeled nuclei for each subfield of the hippocampus : ca1 , ca2 , ca3 , and dentate gyrus ( dg ) .
a total of 2 - 3 aleatory fields in each of the three tissue sections selected from each of 68 animals per group were used for cell counting and n refers to the total aleatory fields used from all the tissue sections from all the animals of each experimental group . a test square grid of 100 100 m ( 0.01 mm ) was used to estimate the number of dapi - stained nuclei ( equivalent to the total number of cells ) and gfap - labeled cells corresponding to astrocytes , manually and with cell profiler [ 13 , 15 ] .
only process - bearing cells showing their soma in the plane of the analyzed area were counted , and their density was estimated ( number per mm ) .
six to eight randomly chosen fields located within each of the analyzed hippocampal subfields were counted by progressive displacement of a test square grid .
the astrocytes / nuclei ratio was calculated by dividing the number of gfap+ cells by the total number of nuclei labeled with dapi .
gfap+ cells were identified as resting ( with small somata bearing long , thin , and ramified processes ) or reactive ( with retraction of processes to a length shorter than the diameter of the somata ) .
the number of reactive astrocytes was estimated for all the experimental groups and normalized with the control .
all the data corresponding to each treatment and region were pooled and are presented as the mean standard error of the mean ( sem ) .
statistical analysis of data was performed using a one - way anova followed by a bonferroni posttest with origin 7.0 software .
the hippocampi from three different rats for each experimental group ( control , dia , and ffr ) were homogenized in ice cold lysis buffer ( 200 mm glycine , 150 mm nacl , 50 mm egta , 50 mm edta , and 300 mm sucrose ) with a protease inhibitor ( sigma - aldrich , usa ) .
the homogenate was centrifuged at 10,000 g for 15 minutes at 4c , and the supernatants were aliquoted and stored at 80c .
an equal concentration of protein ( 30 g ) was resolved by 10% polyacrylamide gel electrophoresis ( page ) . the proteins were transferred electrophoretically to pvdf membrane ; then the membranes were blocked with 5% nonfat dry milk in tbs - t for 3 h at room temperature ( rt ) .
membranes were incubated at 4c overnight with one of the following primary antibodies : ( a ) polyclonal rabbit anti - gfap antibody ( dilution 1 : 2000 , dakocytomation , fort collins , co , usa ) ; ( b ) polyclonal rabbit anti - vimentin ( dilution 1 : 2500 , cell signaling , danvers , ma , usa ) ; ( c ) monoclonal mouse anti - nestin ( dilution 1 : 5000 , bd biosciences , san jos , ca , usa ) ; and ( d ) polyclonal goat anti - actin ( dilution 1 : 2500 , santacruz , dallas , tx , usa ) .
the membranes were washed , and bound antibodies were detected by incubating for 3 h with either the goat anti - rabbit alkaline phosphatase conjugated antibody ( dilution 1 : 2500 ; santacruz , dallas , tx ) ; goat anti - mouse alkaline phosphatase conjugated antibody ( dilution 1 : 2500 ; santacruz , dallas , tx ) ; or rabbit anti - goat alkaline phosphatase conjugated antibody ( dilution 1 : 2500 ; santacruz , dallas , tx ) . then the membrane was washed with tbs - t and the alkaline phosphatase activity was detected with bcip / nbt ap - conjugate substrate reaction kit ( bio - rad , usa ) .
the effects of dia and ffr on the density of nuclei and astrocytes were estimated for the following hippocampal regions : ca1 , ca2 , ca3 , and dentate gyrus ( dg ) ( figure 1 ) .
all observations included the stratum radiatum and stratum oriens , where astrocytes are preferentially located , while for the dg the observations were performed in the hilus ( figure 1 ) .
the hippocampal region ca1 showed no significant change in nuclear density between the control ( 1099 52 nuclei / mm ; n = 62 ) , dia ( 924 67 nuclei / mm ; n = 56 ) , and ffr groups ( 932 68 nuclei / mm ; n = 52 ) ( p = 0.075 ) ( figure 1 and table 1 ) .
additionally , no significant changes were observed for astrocyte density between the control ( 257 14 nuclei / mm ; n = 82 ) , dia ( 253 14 nuclei / mm ; n = 72 ) , and ffr groups ( 221 15 nuclei / mm ; n = 66 ) ( p = 0.172 ) ( figure 2 and table 1 ) .
we also determined the astrocyte / nuclei ratio by estimating the gfap+ cells from the total nuclei .
the astrocyte / nuclei ratio for the control group was 0.277 0.025 ( n = 62 ) , and it was not significantly different for the dia and ffr groups ( 0.324 0.025 ; n = 56 and 0.286 0.029 ; n = 52 ; p = 0.417 ) ( figure 2 and table 1 ) .
nuclear density in ca2 was similar for the control ( 1125 101 nuclei / mm ; n = 40 ) , dia ( 1007 51
nuclei / mm ; n = 40 ) , and ffr groups ( 1022 56
nuclei / mm ; n = 36 ) ( p = 0.467 ) ( figure 3 ; table 1 ) .
in contrast , the astrocyte density estimated for the control group ( 405 19 astrocytes / mm ; n = 40 ) was significantly reduced for the dia ( 323 18 astrocytes / mm ; n = 40 ) and ffr groups ( 267 19 astrocyte / mm ; n = 36 ) ( p < 0.001 ) ( figure 3 ; table 1 ) .
accordingly , the astrocyte / nuclei ratio estimated for the control group ( 0.447 0.053 ; n = 40 ) was also significantly reduced for the dia ( 0.345 0.021 ; n = 40 ) and ffr groups ( 0.282 0.024 ; n = 36 ) ( p = 0.008 ) ( figure 3 ; table 1 )
. the nuclear density of ca3 did not show significant changes between the control ( 1288 43
nuclei / mm ; n = 56 ) , and ffr groups ( 1117 46
nuclei / mm ; n = 52 ) ( p = 0.001 ) ( figure 4 ; table 1 ) .
however , the astrocyte density of the control group ( 332 19 astrocytes / mm ; n = 82 ) was significantly reduced for the dia ( 269 15 astrocytes / mm ; n = 72 ) and ffr groups ( 258 15 astrocyte / mm ; n = 66 ) ( p < 0.001 ) ( figure 4 ; table 1 ) .
however , the astrocyte / nuclei ratio estimated for the control group ( 0.292 0.016 ; n = 62 ) was not significantly reduced in the dia ( 0.262 0.016 ; n = 56 ) and ffr groups ( 0.264 0.016 ; n = 52 ) ( p = 0.347 ) ( figure 4 ; table 1 ) . the nuclear density of the dentate gyrus did not differ significantly for the control ( 1433 110
nuclei / mm ; n = 20 ) , and ffr groups ( 1268 161
nuclei / mm ; n = 19 ) ( p = 0.398 ) ( figure 5 ; table 1 ) .
the astrocyte density of the control group ( 476 28 astrocytes / mm ; n = 41 ) was significantly reduced for the dia ( 294 124 astrocytes / mm ; n = 36 ) and ffr groups ( 321 26 astrocyte / mm ; n = 32 ) ( p < 0.001 ) ( figure 5 ; table 1 ) .
accordingly , the astrocyte / nuclei ratio estimated for the control group ( 0.334 0.031 ; n = 21 ) was significantly reduced for the dia ( 0.173 0.022 ; n = 20 ) and ffr groups ( 0.139 0.032 ; n = 19 ) ( p < 0.001 ) ( figure 5 ; table 1 ) .
the expression of intermediate filaments of astrocytes was tested by western blot in the control , dia , and ffr experimental groups ( figure 6 ) .
the expression of gfap was significantly reduced by dia ( 0.48 0.02 ; n = 3 ; p = 0.003 ) and ffr ( 0.67 0.04 ; n = 3 ; p = 0.006 ) when compared to the normalized control ; no significant differences were observed between dia and ffr groups ( p = 0.668 ) ( figures 6(a ) and 6(b ) ) .
the expression of vimentin was significantly increased by dia ( 1.51 0.08 ; n = 3 ; p = 0.009 ) and ffr ( 1.46 0.11 ; n = 3 ; p = 0.008 ) , when compared to the normalized control ; no significant differences were observed between dia and ffr groups ( p = 0.896 ) ( figures 6(a ) and 6(b ) ) .
finally , the expression of nestin was significantly increased by dia ( 1.74 0.1 ; n = 3 ; p = 0.004 ) and ffr ( 1.61 0.12 ; n = 3 ; p = 0.001 ) when compared to the normalized control ; no significant differences were observed between dia and ffr groups ( p = 0.468 ) ( figures 6(a ) and 6(b ) ) .
our results showed a reduced gfap+ cell density in the hippocampus that correlated with a lower expression of the protein .
thus , the expression of gfap was tested by western blot after one and three days for control , dia , or ffr experimental groups ( figures 7(a ) and 7(b ) ) .
the results showed that the expression of gfap was unaffected after the first day for dia ( 0.92 0.04 ) and ffr ( 0.94 0.03 ) , when compared to the normalized control ( p > 0.1 ) .
however , gfap expression was significantly reduced after the third day for dia ( 0.72 0.01 ) and ffr ( 0.75 0.04 ) , when compared to the normalized control ( p < 0.001 ) ( figures 7(a ) and 7(b ) ) .
the reactive astrocytes were estimated in ca2 and dg , because astrocyte - nuclei ratio was significantly reduced in these regions .
reactive astrocytes were defined as gfap+ cells with processes shorter than the diameter of the somata .
the number of reactive astrocytes was estimated for all the experimental groups and normalized with their respective controls ( see section 2.5 ) . in ca2 ,
reactive astrocytes increased 2.76 0.7 ( n = 4 ; p = 0.047 ) for dia and 2.92 0.75 ( n = 4 ; p = 0.032 ) for ffr , while for dentate gyrus , reactive astrocytes increased 2.25 0.15 ( n = 4 ; p < 0.0001 ) for dia and 1.61 0.29 ( n = 4 ; p = 0.034 ) for ffr ( figure 8) .
anorexia nervosa is common among female adolescents and has one of the highest mortality rates within psychiatric disorders ( 1020% ) , even surpassing depression [ 1921 ] . during puberty ,
mood swings , and anxiety are common due to a sudden rise of hormones which affects the hippocampus [ 11 , 12 , 22 ] . moreover , in the activity - based anorexia model ( aba ) , structural and functional alterations have been observed in the hippocampus , accompanied by anxiety - like behavior [ 1 , 11 , 12 , 23 ] .
however , the effect of anorexia on astrocyte density has been barely explored . indeed , previous studies in the rat corpus callosum reported that cell proliferation was reduced with the aba model , while astrocyte density was regionally reduced in the dia model [ 1 , 13 ] .
results from the present study show that anorexia reduced astrocyte density in ca2 , ca3 , and dg , while no significant changes were observed in ca1 . accordingly , anorexia mutant mice ( anx / anx ) showed lower expression of c - fos in the dentate gyrus and ca3 region of the hippocampus , while no significant differences were found in ca1 . on the other hand ,
astrocytes express three types of intermediate filament proteins : gfap , vimentin , and nestin .
nestin and vimentin are the main intermediate filaments in immature astrocytes , whereas maturing and adult astrocytes contain vimentin and gfap .
interestingly , anorexia increased vimentin and nestin expression resembling reactive astrocytes observed after injury [ 26 , 27 ] . accordingly
, gfap+ cells deficit may be replaced by vimentin+/nestin+ cells in anorexia . in support of this hypothesis ,
nestin reexpression has been observed following experimental hippocampal lesions [ 25 , 28 , 29 ] and also in human pathology such as multiple sclerosis .
moreover , reactive astrocytes were increased by anorexia and forced food restriction , indicating that gfap+ cells react to severe caloric restriction . another factor to consider
is that female animals subjected to anorexia or chronic stress stop their ovarian cycles , ending their exposure to hormones that may affect morphology and astrocyte density [ 32 , 33 ] .
moreover , hippocampal gliogenesis , but not neurogenesis , is reduced in the aba model .
thus , astrocytes possess different levels of differentiation and maturation and they can switch between these states even in the adult brain .
likewise , astrocytes secrete gliotransmitters and growth factors like bdnf , required for synaptic plasticity , synaptogenesis , and neurogenesis [ 34 , 35 ] .
thus , a reduced density of gfap+ cells may affect hippocampal gliotransmission of d - serine , a gliotransmitter necessary for neuronal nmda - mediated transmission and long term potentiation .
growth factors such as bdnf are also required for long term synaptic plasticity of dendrites in the adult hippocampus ; however , decreased branching of dendrites was reported in an aba model , particularly in the stratum radiatum [ 11 , 12 ] .
accordingly , our results showed that gfap+ cell density and gfap expression are decreased by anorexia .
similar results were reported in a rat model of depression , where gfap expression was reduced .
thus , we conclude that gfap+ cells and intermediate filament expression are affected by anorexia . our results
add new information about the structural changes observed in the hippocampus of murine models of anorexia .
|
anorexia nervosa is an eating disorder observed primarily in young women .
the neurobiology of the disorder is unknown but recently magnetic resonance imaging showed a volume reduction of the hippocampus in anorexic patients .
dehydration - induced anorexia ( dia ) is a murine model that mimics core features of this disorder , including severe weight loss due to voluntary reduction in food intake .
the energy supply to the brain is mediated by astrocytes , but whether their density is compromised by anorexia is unknown .
thus , the aim of this study was to estimate gfap+ cell density in the main regions of the hippocampus ( ca1 , ca2 , ca3 , and dentate gyrus ) in the dia model .
our results showed that gfap+ cell density was significantly reduced ( ~20% ) in all regions of the hippocampus , except in ca1 .
interestingly , dia significantly reduced the gfap+ cells / nuclei ratio in ca2 ( 23% ) and dentate gyrus ( 48% ) .
the reduction of gfap+ cell density was in agreement with a lower expression of gfap protein .
additionally , anorexia increased the expression of the intermediate filaments vimentin and nestin .
accordingly ,
anorexia increased the number of reactive astrocytes in ca2 and dentate gyrus more than twofold .
we conclude that anorexia reduces the hippocampal gfap+ cell density and increases vimentin and nestin expression .
|
trichomoniasis , caused by trichomonas vaginalis , is the most common sexually transmitted disease worldwide . according to the world health organization ( who ) , an estimated 170 million new infections occur annually throughout the world .
data on the prevalence and incidence rates of this parasite remains limited in many developing countries including palestine . according to syndromic diagnosis ,
the number of patients with trichomoniasis in palestine in 2003 was 103 females and 36 males per 100,000 .
t. vaginalis is associated with diverse pregnancy outcomes and may serve as a cofactor in human immunodeficiency virus ( hiv ) transmission .
t. vaginalis increases the risk of hiv transmission as seen among african - americans in the united states [ 4 , 5 ] .
t. vaginalis causes a common genitourinary infection , which is frequently asymptomatic ; about 1050% of infections in women are asymptomatic . in women ,
trichomoniasis is characterized by a yellow - green frothy vaginal discharge , vaginal odor , pain with sexual intercourse , pain during urination , and vulvovaginal soreness and itching .
complications in pregnant women include postabortion infection , postcesarean infection , preterm birth , low birth weight infants , and preterm labor causing premature rupture of the membranes .
other complications caused by t. vaginalis include pelvic inflammatory disease and tubal infertility , vaginitis , and urethritis . in males
, it is usually found in the urethra , prostate or epididymis causing urethritis and prostatitis .
although rapid and inexpensive , this technique has a low sensitivity of 50 to 80% [ 1113 ] . for accurate diagnosis by wet mount , adequate numbers of the parasite must be present and the characteristic tumbling motility must be observed by an experienced technician within a short time . the culture method was used in this study because it is the gold standard against which the performance of other diagnostic methods is compared [ 11 , 12 ] .
the aim of this study was to determine the prevalence of t. vaginalis among palestinian women in the west bank , palestine .
this is the first study conducted in this country that utilized the culture method and did not rely on direct microscopic examination .
this prospective study was conducted on women attending reproductive health clinics in the west bank , palestine .
unduplicated vaginal swabs were randomly collected by the attending physician from women residing in districts throughout the west bank , palestine .
samples were collected from 1207 women of childbearing age from october 2004 to december 2005 .
vaginal discharge was taken from the posterior cervix or from the vaginal wall using a sterile swab containing stuart 's transport media ( via magent 77/6 , rho ( mi ) italy ) .
the swabs were immediately transported to the central public health laboratory in ramallah , palestine and cultured within 4 hours after collection .
litmus paper was used to determine the ph of the discharge ; the color change was compared with a ph standard color chart . in most cases , a high vaginal ph ( > 4.5 ) is indicative of trichomoniasis .
the swabs were removed from the transport media and used to inoculate trichomonas medium no . 2 ( oxoid ) .
the cultures were then incubated at 37c and checked daily for motility under the microscope for a total of 5 days .
chi - square was used to analyze the data obtained in this study at 0.05 level of significance using spss 13 statistical package ( spss inc . ,
this study was conducted on a total of 1207 women of childbearing age attending reproductive health clinics in the west bank , palestine .
the rate of positive cultures for t. vaginalis was 22.7% ( 5/22 ) in women of 18 years and younger and 6.8% ( 4/59 ) in women of 46 years and older .
these variables included age , marital status , pregnancy and lactation , use of contraceptives , socioeconomic conditions , education , and symptoms .
the symptoms experienced by all women participating in this study are documented and summarized in table 2 .
the percentage of positive cultures for t. vaginalis ranged from 13.1% ( 130/990 ) for vaginal discharge to 15.9% ( 48/302 ) for pelvic pain as shown in table 2 .
t. vaginalis is the third most common cause of vaginitis . according to the who , t. vaginalis accounts for approximately half of all curable sexually transmitted diseases worldwide .
the objective of this study was to determine the prevalence of trichomoniasis among palestinian women by using the culture method .
sexually active women are at an increased risk of vaginitis due to this parasite . in this study ,
as shown in table 1 , the percentage of positive cultures of t. vaginalis tends to decrease with advanced age as compared to young sexually active women . although the number of women above 46 years of age was low ( 4/59 ) , the low percentage of positive cultures of 6.8% may correlate with reduced sexual activity .
interestingly , a study was conducted in gaza ( palestine ) using the papanicolaou smears ( pap ) to determine the prevalence of t. vaginalis among pregnant women .
the pap smears are not reliable and inaccurate for the diagnosis of t. vaginalis and have a low sensitivity of 61% as compared to culture , the golden standard with a sensitivity of 8095% and specificity exceeding 95% . considering women status
, trichomoniasis is unusual in lactating women , since the glycogen - poor atrophic vagina of the breastfeeding woman is relatively hostile to this parasite . comparing the percentage of positive cultures found for married women ( 13.6% ) , pregnant women ( 28.1% ) , and lactating women ( 11.4% ) , results were significant ( p < 0.05 ) .
the use of contraceptives is effective in reducing the percentage of positive cultures . in this study
, the results obtained did not reveal a statistical significance ( p > 0.05 ) in the percentage of positive cultures by using different means of contraceptives .
the percentage was low ( 8.6% ) in women whose spouses used condoms as compared to the others .
this indicates that using barrier contraceptives ( condoms ) is the most effective mechanical barrier to various microorganisms .
women using either barrier or oral contraceptives six months before becoming pregnant had decreased rates to be colonized by t. vaginalis as previously described .
diagnosis of trichomoniasis is usually based on the presence of symptoms such as vaginal discharge , irritation , genital soreness , pelvic pain , burning sensation , and vaginal ph .
although 93% of the women had a vaginal ph > 4.5 ( 1125/1207 ) and 82% have vaginal discharge ( 990/1207 ) , the percentage of positive cultures was 13.7% ( 154/1125 ) and 13.1% ( 130/990 ) , respectively , as shown in table 2 .
t. vaginalis grows best at acidic environment and attaches itself by its axostyle thus creating the irritation , inflammation , and other symptoms associated with the infection by this parasite .
there were no significant differences in the percentage of positive cultures of t. vaginalis according to occupation , education , or economic status . in conclusion , this study showed that the prevalence of t. vaginalis in the west bank is 13.6% .
this study warrants having better understanding and more accurate evaluation of urogenital trichomoniasis in palestine . to curb the high rates of trichomoniasis and
help in its prevention and control among palestinian people , it is recommended that the ministry of health must take drastic measures to implement effective screening programs , provide treatment for infected partners , and spread awareness in the population about this disease and its transmission .
in addition , it is extremely important to screen and treat asymptomatic women who may have persistent trichomoniasis for years .
|
background .
trichomoniasis is a common sexually transmitted disease caused by trichomonas vaginalis .
it is a major health problem worldwide .
the world health organization ( who ) has estimated that 180 million infections are acquired annually worldwide . methodology . vaginal swabs ( 1207 ) were cultured for t. vaginalis on trichomonas medium no .
2 ( oxoid ) soon after specimen collection .
the cultures were examined daily using a light microscope to detect the presence of t. vaginalis . results .
the prevalence of t. vaginalis was 13.6% ( 164/1207 ) .
the infection rate was the highest during pregnancy , 28.1% , and the lowest among women whose spouses use condoms , 8.6% .
conclusions . the culture method was used in this study to accurately determine the prevalence of this parasite in the west bank , palestine .
the results of the study will eliminate ambiguities concerning trichomoniasis in this country and will contribute to better management and proper treatment .
|
the
peptidoglycan precursor , lipid ii , produced in the model gram - positive
bacterium bacillus subtilis differs from lipid ii
found in gram - negative bacteria such as escherichia coli by a single amidation on the peptide side chain .
how this difference
affects the cross - linking activity of penicillin - binding proteins
( pbps ) that assemble peptidoglycan in cells has not been investigated
because b. subtilis lipid ii was not previously available .
here
we report the synthesis of b. subtilis lipid
ii and its use by purified b. subtilis pbp1 and e. coli pbp1a .
while enzymes from both organisms assembled b. subtilis lipid ii into glycan strands , only the b. subtilis enzyme cross - linked the strands .
furthermore , b. subtilis pbp1 catalyzed the exchange of both d - amino acids and d - amino carboxamides into nascent peptidoglycan ,
but the e. coli enzyme only exchanged d - amino
acids .
we exploited these observations to design a fluorescent d - amino carboxamide probe to label b. subtilis pg in vivo and found that this probe labels the cell wall dramatically
better than existing reagents .
|
|
heterogeneous nuclear ribonucleoproteins ( hnrnps ) are nucleoplasmic molecules interacting with premessenger ribonucleic acid ( pre - mrna ) and partake in the processing thereof . in general , hnrnps contain at least one rna recognition motif representing the rna - binding domain .
furthermore , they can play a role in various other important cellular mechanisms like dna repair , telomere elongation , chromatin remodelling , and translocation , as well as nuclear - cytoplasmic shuttling , translation , and regulation of proteins .
loss of immunological tolerance to hnrnp has been reported in several systemic autoimmune rheumatic diseases ( sard ) .
hitherto , 30 major hnrnps with the terminology a1 through u have been described . of them
particularly hnrnp a1 , a2 , b , c , h , i , and r could be demonstrated as autoantigenic targets in sard .
autoreactivity to the ra33 complex mainly consisting of autoantibodies to hnrnp a2 and its alternatively spliced variants b1 and b2 has been demonstrated in patients with rheumatoid arthritis ( ra ) as early as 1989 .
thus , the respective autoantibody was referred to as anti - ra33 because of its reaction with a 33 kda antigen by immunoblotting employing nuclear extracts from hela cells .
apart from immunoblotting , enzyme - linked immunosorbent assay ( elisa ) has been employed mainly to test for anti - ra33 , but experimental testing has led to inconsistent results amongst studies .
nevertheless , several reports revealed a prevalence of about 30% for anti - b1/a2 hnrnp autoantibodies in patients with ra .
however , those autoantibodies have been also found in patients with systemic lupus erythematosus ( sle ) and other sard [ 6 , 7 ] .
such data challenged the original notion that anti - ra33 autoantibodies are highly specific for ra . along with other ra - specific autoantibodies , such as rheumatoid factor ( rf ) and
anticitrullinated peptide / protein antibodies ( acpa ) , these antibodies are of interest to rheumatologists as they appear to be present in early disease states , especially in rf - negative patients [ 8 , 9 ] .
furthermore , they are associated with relatively mild and nonerosive disease in the absence of high - titer rf and acpa such as anticitrullinated cyclic peptide ( ccp ) antibodies . recently , several anti - hnrnp autoantibodies have been investigated in patients with sard .
such a meticulous assessment concluded that the most prevalent anti - ra33 antibody by elisa is directed against hnrnp b1 .
the aim of the present study was to develop a novel elisa detecting anti - hnrnp b1 autoantibodies and to investigate their prevalence in a russian cohort of patients with ra and other sard , as well as controls .
as these autoantibodies are directed against a complex with pleiotropic functions , we speculated that autoreactivity against hnrnp b1 could bear pathogenic significance and it is of clinical relevance , stratifying patients according to distinct clinical phenotypes .
thus , we also attempted to correlate the occurrence of anti - hnrnp b1 autoantibodies with disease - related clinical manifestations .
in total , 397 patients with sard and 174 controls were enrolled in the study .
patients with sard consisted of 165 patients with ra , 58 patients with spondyloarthropathy ( spa ) , 42 patients with juvenile chronic arthritis ( jca ) , 50 patients with sle , 65 patients with systemic sclerosis ( ssc ) , and 17 patients with sjgren 's syndrome ( ss ) .
diagnosis of sard had been established based on typical clinical , biochemical , histological , and serological features according to the criteria of the respective classification criteria of each sard .
controls consisted of 52 hyperlipidemic donors in whom there was no current evidence or past medical history of sard .
furthermore , 122 blood donors were included in the control group ( table 1 ) .
aliquots of the sera stored at 20c were used for the study of antibody reactivity .
measurement of vascular stiffness by pulse wave velocity ( pwv ) and augmentation index ( ai ) was performed using applanation tonometry with the sphygmocor system ( atcor medical pty ltd . ,
briefly , pwv and ai adjusted to a heart rate of 75 beats per minute were registered in subgroups of patients with late ra , sss , spa , and hyi as cardiology controls .
pulse wave velocity was assessed in patients after 15 minutes of rest in a sitting position .
measurements were done consequentially above carotid and femoral arteries during 10 seconds with simultaneous registration of electrocardiography , which was used to determine the moment of heart contraction .
distance of pulse wave propagation from carotid arteries to femoral arteries was measured directly and divided by the time of wave propagation to calculate pulse wave velocity .
augmentation index was calculated from the difference between first and second wave of pulse pressure expressed as a percentage of pulse pressure .
anti - hnrnp b1 igg was assessed in serum samples of patients and controls by an elisa .
this assay employs recombinant human hnrnp b1 expressed in e. coli ( in.vent diagnostica gmbh , hennigsdorf , germany ) .
briefly , hnrnp b1 at a concentration of 5 mg / l was coated onto the solid phase of maxisorb microtiter plates ( thermo scientific inc./nunc , germany ) in bicarbonate buffer , ph 9.5 , at 4c for 26 h. after blocking with 0.05 mol / l tris - hcl and 1% bovine serum albumin ( trisbsa , ph 7.4 ) at room temperature ( rt ) for 1 h , serum samples diluted 1 : 100 in trisbsa were incubated at rt for 1 h and washed .
horseradish peroxidase - conjugated anti - human igg was added and developed with ready - to - use h2o2/tmb substrate .
the reaction was stopped with 0.25 mol / l sulphuric acid after 15 min . the optical density ( od ) of the samples
, winooski , usa ) at a wavelength of 450 nm against 620 nm and results were expressed as arbitrary units ( u / ml ) .
the cut - off for positivity at 10 u / ml determined by receiver operating characteristics curve analysis was used . the functional assay sensitivity representing the lowest antibody concentration with a coefficient of variation smaller than 20% was determined at 6.4 u / ml .
the intra- and interassay variances were determined at 4% and 6% , respectively , employing a serum with a concentration of 12.0 u / ml anti - hnrnp b1 antibody .
testing 299 sera of patients suffering from ra , anti - hnrnp b1 antibody analysis by the novel elisa was correlated with anti - hnrnp a2 ( ra33 ) antibody detection by a commercially available elisa ( human , wiesbaden , germany ) ( see supplementary figure 1 in supplementary material available online at http://dx.doi.org/10.1155/2014/516593 ) .
there was a weak , yet significant , correlation between both anti - hnrnp antibody assays ( spearman 's rho = 0.209 , 95% confidential interval [ ci ] : 0.0980.315 ; p < 0.001 ) .
in contrast to the commercially available assay , the novel elisa demonstrated no significant difference in anti - hnrnp antibody levels testing fresh and unthawed aliquots of long - term stored sera . to confirm the specificity of anti - hnrnp b1 antibody detection by the novel elisa
, 5 sera of patients suffering from rheumatoid arthritis and systemic sclerosis each demonstrating anti - hnrnp b1 igg positivity were tested by immunoblot employing the recombinant hnrnp b1 polypeptide .
all 10 sera demonstrated a clear positive reaction to hnrnp b1 blotted onto a nitrocellulose membrane ( supplementary figure 2 ) .
rheumatoid factor was determined with tina - quant immunoturbidimetry assay ( roche diagnostics / roche deutschland holding gmbh , penzberg , germany ) and results were expressed in iu / ml . concentrations over 15 iu / ml were scored positive .
anti - ccp igg was determined by elisa according to the instructions of the manufacturer ( euroimmun ag , lbeck , germany ) .
the od was read in a microplate reader at 450 nm and results were expressed as relative units ( ru / ml ) .
the cut - off for positivity at 5 ru / ml in accordance with the recommendations of the manufacturer was used for these assays .
the two - tailed , nonparametric mann - whitney and kruskal - wallis tests were used to test for statistically significant differences of independent samples in 2 or more groups , respectively .
comparison of prevalence rates between groups was performed by two - tailed fisher 's exact test .
elevated anti - hnrnp b1 autoantibodies have been found to be significantly more prevalent in patients with sard ( 47/397 , 11.8% ) in comparison with controls ( 2/174 , 1.1% ) ( p < 0.001 , table 2 ) .
amongst sard patients , those with ra ( 24/165 , 14.5% ) , spa ( 6/58 , 10.3% ) , ssc ( 11/65 , 16.9% ) , and sle ( 4/50 , 8.0% ) demonstrated significantly higher prevalences of anti - hnrnp 1 autoantibodies compared to controls ( p < 0.001 , p = 0.004 , p < 0.001 , and p = 0.023 , resp . ) .
anti - hnrnp b1 autoantibody levels differed significantly amongst the 397 patients with sard and the 174 controls ( anova , kruskal wallis test , p < 0.001 ) ( figure 1 ) . amongst patients with sard
, the highest anti - hnrnp b1 autoantibody concentrations were found in patients with ra ( median : 5.8 , interquartile range [ iqr ] : 3.68.1 ) and ssc ( median : 6.5 , iqr : 3.29.0 ) which differed significantly from the other patient groups ( spa , jca , sle , and ss , p < 0.001 , resp . ) and controls ( hli and bd , p < 0.001 , resp . ) .
however , patients with ra and ssc did not reveal significantly different anti - hnrnp b1 autoantibody levels ( p > 0.05 ) .
rheumatoid arthritis - specific rf showed a prevalence of 118/165 ( 71.5% ) in serum samples of 165 patients with ra , whereas antibodies against ccp were elevated in 126/165 ( 76.4% ) sera thereof ( table 3 ) .
there was no correlation between anti - hnrnp autoantibody levels and those of rf and anti - ccp antibody according to rank correlation analysis ( table 4 ) .
furthermore , neither in rf - positive compared with rf - negative patients nor in anti - ccp antibody positives against anti - ccp antibody negatives were anti - hnrnp b1 autoantibodies significantly different ( p > 0.05 , resp . ) .
there was also no significant difference in rf and/or anti - ccp antibody positives compared with the respective negatives ( p > 0.05 ) .
interestingly , a significant negative correlation of anti - hnrnp b1 autoantibody with disease duration could be established hinting at an early occurrence thereof in ra patients .
however , there was no significant difference of anti - hnrnp autoantibody levels as well as prevalence in early ( disease duration of less than 12 months , n = 102 ) and established ra ( p > 0.05 ) .
although anti - hnrnp b1 autoantibodies correlated significantly with c - reactive protein ( crp ) levels , erythrocyte sedimentation rate ( esr ) , and joint space narrowing of hands , there was no significant association with the disease activity score of 28 joints ( das28 ) in the patients with ra . to investigate the association with clinical phenotype of patients with ssc , clinical characteristics
in contrast to patients with ra , there was no significant correlation between anti - hnrnp b1 autoantibody and esr , crp levels , and duration of disease ( p > 0.05 ) .
furthermore , no significant correlation of autoreactivity to hnrnp b1 with fibrotic clinical manifestations in ssc such as lung and skin involvement could be established .
given the relative small number of the sera tested from patients with ssc , a safe conclusion can not be reached and larger studies are warranted . however , like in patients with ra , there was a significantly positive correlation with the age of patients in this group .
interestingly , a significantly positive correlation with the presence of clinical manifestations including digital ulcers and esophagitis could be established ( p = 0.007 , p = 0.016 ) .
notably , anti - hnrnp b1 autoantibodies demonstrated an association with hypertension and associated features such as arterial wall elasticity and pulse wave velocity ( pwv ) ( p = 0.009 , p = 0.009 , and p = 0.004 , resp . ) .
preliminary assessment revealed a noteworthy positive correlation of anti - hnrnp b1 autoantibodies with pwv in patients with ra ( n = 39 , spearman 's rho = 0.41 ; p = 0.009 ) but not in patients with spa and hyi ( p > 0.05 , resp . ) .
loss of immune tolerance to components of large rnp moieties being part of spliceosomes or ribosomes seems to be characteristic for distinct sard . in particular , autoantibodies against the hnrnp complex composed of pre - mrna and approximately 30 different proteins
have been the interest of rheumatologists as putative serological markers in sard [ 10 , 12 ] .
autoantibodies to hnrnp a2 have been described in patients with ra and are thought to be associated with milder disease [ 9 , 13 ] .
these autoantibodies have been proposed for autoantibody profiling in ra serological testing , as they do not seem to correlate with rf or apca [ 8 , 14 ] .
autoantibody profiling appears to be a sensible approach in the serology of sard supported by novel developments in the modern autoimmunity laboratory addressing the need of analyzing several autoantibodies simultaneously [ 8 , 1519 ] .
a comprehensive clinical study has shown that anti - hnrnp b1 autoantibodies interacting with an alternatively spliced variant of hnrnp a2 are most prevalent in patients with sard amongst 10 different anti - hnrnp autoantibodies detected by elisa .
nevertheless , autoreactivity to hnrnp a2 does not appear to be different to that against its alternatively spliced variant b1 .
thus , the present clinical study investigated anti - hnrnp b1 autoantibody levels in 397 russian patients with sard and 174 controls .
significantly higher anti - hnrnp b1 autoantibody prevalences and levels were found in patients with ra and ssc .
interestingly , an overlap syndrome of ra and limited ssc has been described , which was characterized by an incomplete crest syndrome and cross - reactivity of anticentromere with anti - hnrnp b1 autoantibodies [ 20 , 21 ] . recently , an association of anti - hnrnp autoantibodies with erosive arthritis has been described in patients with ssc .
thus , anti - hnrnp autoantibody might become a nonspecific but useful marker for joint involvement in ssc patients and identify ssc patients prone to develop joint damage .
in general , the radiological articular manifestations in ssc are less severe compared to those noted in patients with ra .
we did not find a significant correlation of articular manifestations with anti - hnrnp b1 autoantibody levels in patients with ssc .
, russian patients with sard demonstrated a lower prevalence of anti - hnrnp autoantibodies in patients with sard in general .
in particular , russian patients with ss and sle showed a comparatively low prevalence ( 5.9% versus 44.1% and 8.0% versus 37.1% in , resp . ) .
these differences could be due to the different patient characteristics of the respective cohorts or different assay performance of the elisa employed for autoantibody testing .
indeed , detection of autoantibodies to hnrnp seems to require the preservation of conformational epitopes which can be influenced by the recombinant expression system and coating procedure for elisa - solid phases utilized as demonstrated for other autoantigenic targets as well [ 24 , 25 ] .
furthermore , russian patients with ra can demonstrate different prevalences of ra - specific autoantibodies than reported in studies with caucasian patients . as a matter of fact ,
hnrnps have important cellular functions and their respective autoantibodies could alter their functional properties [ 1 , 3 , 27 ] . this has led us to speculate that , in addition to their diagnostic relevance , anti - hnrnp autoantibodies may bear pathogenic potential .
thus , we attempted to correlate the loss of tolerance to hnrnp b1 with clinical characteristics in russian patients with ra and ssc . in this study ,
anti - hnrnp b1 autoantibodies were not associated with disease activity or erosions in patients with ra .
these findings support the assumption that anti - hnrnp antibodies are more frequent in ra patients with mild disease compared to those with more active disease [ 8 , 9 ] .
interestingly , there was a positive correlation with clinical manifestations of ssc such as the occurrence of esophagitis and digital ulcers .
furthermore , an association with hypertension and arterial wall elasticity , as well as pwv , that is , features of arterial stiffness , could be established .
arterial wall stiffness is recommended as a risk factor for cardiovascular events in patients with arterial hypertension by the european network for non - invasive investigation of large arteries .
it needs to be noted that there is accumulating evidence of increased arterial stiffness in patients with ssc [ 29 , 30 ] .
our preliminary results revealed a positive correlation of anti - hnrnp b1 autoantibody with pwv in ra patients , but this finding requires external validation in larger cohorts .
nevertheless , such a correlation was not seen in hyperlipidemic patients with an increased risk for atherosclerosis and arterial stiffness . to the best of our knowledge ,
this is the first report of a significant association of anti - hnrnp b1 autoantibodies with hypertension in sard and could support the existence of an overlap between ra and ssc . in summary
, anti - hnrnp b1 autoantibodies occur in russian patients with sard and particularly in patients with ra and ssc . in the latter patient groups , they seem to be correlated with clinical characteristics such as hypertension .
larger prospective studies are urgently warranted to address the clinical relevance and the pathogenic significance of these autoantibodies .
|
heterogeneous nuclear ribonucleoproteins ( hnrnps ) are potent autoantigenic targets in systemic autoimmune rheumatic diseases ( sard ) .
loss of tolerance to the ra33 complex consisting of hnrnp a2 and its alternatively spliced variants b1 and b2 has been the interest of rheumatologists .
a novel elisa for the detection of anti - hnrnp b1 autoantibodies has been developed to investigate the prevalence thereof in 397 patients with sard , including patients with rheumatoid arthritis ( ra ) , spondyloarthropathy ( spa ) , juvenile chronic arthritis , systemic lupus erythematosus ( sle ) , systemic sclerosis ( ssc ) , and sjgren 's syndrome ( ss ) , in comparison to 174 controls .
anti - hnrnp b1 autoantibodies were significantly more prevalent in patients with sard than controls ( 47/397 , 11.8% versus 2/174 , 1.1% ; p < 0.001 ) .
in particular , anti - hnrnp b1 were found more frequently in the disease cohorts than in the controls and were present in 24/165 ( 14.5% ) patients with ra , 6/58 ( 10.3% ) spa , 11/65 ( 16.9% ) ssc , and 4/50 ( 8.0% ) sle . in ra patients ,
anti - hnrnp b1 autoantibodies correlated significantly with c - reactive protein levels and erythrocyte sedimentation rate , while in patients with ssc it was associated with features of arterial wall stiffness and presence of hypertension .
anti - hnrnp b1 autoantibodies occur in sard and seem to be correlated with distinct clinical characteristics in patients with ra and ssc .
|
articular cartilage is a specialized connective tissue that covers the ends of the bones in synovial joints .
articular cartilage extracellular matrix and cell function change with age and are considered to be the most important factors in the development and progression of osteoarthritis . aging and development of cartilage degeneration involve many factors , which either alone or in combination may precipitate the onset of osteoarthritis .
much evidence indicates that a single factor may induce a number of sequential responses and structural changes , which either affects the extracellular matrix or cell function , or makes the tissue more vulnerable to compressive loads or injury .
these changes eventually lead to a disruption of tissue homeostasis and reduced capacity for regeneration , which manifest as osteoarthritis and eventual tissue destruction .
the aging process is inevitable , yet our understanding of the consequences of this phenomenon is incomplete .
articular cartilage appears to be highly susceptible to the accumulation of aging - related changes , in part due to the relatively low turnover of extracellular matrix and cells .
it has been estimated that the half - life of type ii collagen is approximately 117 years and various measurements in mature cartilage revealed only a very small fraction of proliferating cells .
thus , cartilage matrix and cells are prone to accumulate changes related to trauma , mechanical , or oxidant stress over time .
the studies on age changes in the articular cartilage have been traditionally based on individual observations but this approach is limited by its subjectivity and bias , yielding considerable variability . in this study , we used image pro express image analysis software for quantitative analysis of articular cartilage .
computerized morphometric analysis provides a simple , reliable , and reproducible method for improved and consistent results in various research works .
so the present study was conducted to observe the various age related changes in the morphology of the femoral articular cartilage using computerized morphometric analysis .
group 1 ( n = 16)below 40 years ( 1640 years ) of age as the articular cartilage below 40 years showed a normal adult histology and
below 40 years ( 1640 years ) of age as the articular cartilage below 40 years showed a normal adult histology and
group 2 ( n = 12)above 40 years ( 4186 years ) of age .
above 40 years ( 4186 years ) of age .
patients suffering from any disease of knee joint like tumor , any deformity , bony enlargement , or irregularities such as osteophytes or having a history of trauma or joint pain were excluded from the study .
articular cartilage specimens were obtained from the most prominent area of the medial femoral condyle from cadavers in the department of anatomy within 18 hrs after death and from patients undergoing lower limb amputation due to accident in the trauma center of postgraduate institute of medical education and research , chandigarh .
5 thick serial paraffin sections were stained with haematoxylin and eosin to confirm the histological structure of the articular cartilage and to study the various features for morphometry .
the equipment for morphometric analysis consisted of an olympus microscope fitted with a digital camera and computer loaded with image pro express software . in all specimens ,
at least five sections of each specimen and five fields from each section were observed and photomicrographed .
the image acquired on the computer was analyzed using the image pro express software for the following .
number of chondrocytes per 10,000 m area in each zone . for total thickness of the articular cartilage
, sections were photomicrographed at 4x magnification , the software was calibrated for 4x magnification , and thickness was measured in millimeters using measure the distance
the software was calibrated for 40x magnification and the area was measured in square microns by drawing the area to be measured using the area of interest ( aoi ) option of the software .
for measuring the number of chondrocytes per 10,000 m , photomicrographs at 40x magnification were used .
the software was calibrated for 40x magnification and the area was measured in square microns by selecting the area .
number of cells in that given area was counted using the tag points option of the software .
independent sample t - test ( student 's t - test ) was used to determine the statistical significance between the means .
analysis of variance ( anova ) was done followed by student - newman - keul 's post - hoc tests .
partial correlation of various parameters with age was computed using pearson 's correlation test . for all statistical tests , probability levels of less than or equal to 5% ( two - tailed p value < 0.05 )
group 1 in group 1 , the articular cartilage was obtained from knee joints of individuals below 40 yrs of age as the articular cartilage below 40 years showed a normal adult histology and no significant difference was observed in the various parameters in all age groups below 40 years of age .
there was marked difference in the size , shape , and arrangement of the cells from superficial to deep part of the cartilage .
the cells varied in shape from quite flat near the surface to oval or rounded in the deeper layers .
total thickness of the articular cartilage ranged from 2.01 to 2.89 mm with an average of 2.34 0.30 mm ( table 1).the area of the lacunae and density of cells that is , number of cells per 10,000 m area in the four zones of the articular cartilage were measured ( tables 2 and 3 ) .
the lacunae were classified as small sized ( < 100 m ) , medium - sized ( 100200 m ) , and large sized ( > 200 m ) according to area .
in group 1
, the articular cartilage was obtained from knee joints of individuals below 40 yrs of age as the articular cartilage below 40 years showed a normal adult histology and no significant difference was observed in the various parameters in all age groups below 40 years of age .
there was marked difference in the size , shape , and arrangement of the cells from superficial to deep part of the cartilage .
the cells varied in shape from quite flat near the surface to oval or rounded in the deeper layers .
total thickness of the articular cartilage ranged from 2.01 to 2.89 mm with an average of 2.34 0.30 mm ( table 1 ) .
the area of the lacunae and density of cells that is , number of cells per 10,000 m area in the four zones of the articular cartilage were measured ( tables 2 and 3 ) .
the lacunae were classified as small sized ( < 100 m ) , medium - sized ( 100200 m ) , and large sized ( > 200 m ) according to area
the area of the lacunae ranged from 29.62 to 107.38 m with an average of 54.93 22.54 m .
86.36% of the lacunae were small sized ( < 100 m ) in area and 13.64% were medium sized ( 100200 m ) .
the density of cells , that is , number of cells per 10,000 m area ranged from 1.49 to 14.99 with an average of 5.76 3.85 . intermediate / transitional zone ( zone 2 ) . in the intermediate zone ,
the area of the lacunae ranged from 109.78255.66 m with an average of 154.62 36.39 m .
21.96% of the lacunae were small sized , 64.59% were medium sized , and 13.55% of the lacunae were large sized .
the density of cells varied from 0.57 to 6.42 with an average of 3.12 1.71 .
the area of the lacunae ranged from 128.09 to 194.09 m with an average of 161.63 17.42 m .
16.46% of the lacunae were small - sized , 62.42% were medium sized , and 20.12% of the lacunae were large sized .
the density of cells ranged from 1.39 to 5.31 with an average of 2.69 1.12 .
the area of the lacunae ranged from 102.24 192.05 mwith an average of 145.00 32.17 m .
21.54% of the lacunae were small - sized , 64.62% were medium - sized and 13.84% of the lacunae were large - sized .
the density of cells ranged from 0.91 5.82 with an average of 3.36 1.37 .
numerous small cavities were seen in the subchondral bone . the area of the subchondral cavities varied from 1,395.17 to 21,366.52 m with an average of 5933.46 5821.12 m ( table 4 ) .
comparison of the mean of the area of lacunae and the cell density in the four zones and the mean of the area of subchondral cavities at various age groups using anova showed no statistically significant difference and no correlation of these parameters with age was observed in group 1 .
numerous small cavities were seen in the subchondral bone . the area of the subchondral cavities varied from 1,395.17 to 21,366.52 m with an average of 5933.46 5821.12 m ( table 4 ) .
comparison of the mean of the area of lacunae and the cell density in the four zones and the mean of the area of subchondral cavities at various age groups using anova showed no statistically significant difference and no correlation of these parameters with age was observed in group 1 . in group 2 ,
normal histology was seen , that is , four zones could be identified in all specimens though changes were observed in the superficial zone either in the form of horizontal or oblique splitting of collagen bundles or complete loss of the most superficial zone .
( 60% ) specimens small oblique or vertical splits were present at the surface while in 1 ( 8.33% ) specimens , the superficial zone was swollen due to separation of the collagen bundles and in 2 ( 16.67% ) specimens , the articular surface had depressed areas giving a saucer - like appearance .
total thickness of the articular cartilage ranged from 1.57 to 2.79 mm with an average of 2.23 0.36 mm ( table 1 ) . on comparing the mean of the total thickness at various age groups using anova , no statistically significant difference in the mean of the total thickness above 40 years of age was observed .
the total thickness of the cartilage in group 2 was significantly correlated to age ( p < 0.05 ) .
the area of the lacunae ( table 2 ) and density of cells ( table 3 ) was measured and the lacunae were classified according to area .
the area of the lacunae ranged from 35.69 to 83.70 m with an average of 58.92 18.03 m .
85.79% of the lacunae were small sized ( < 100 m ) in area and 14.21% were medium sized ( 100200 m ) .
the density of cells , that is , number of cells per 10,000 m area ranged from 2.35 to 11.44 with an average of 6.08 2.97 .
the area of the lacunae ranged from 131.91 to228.79 m with an average of 167.79 27.18 m .
9.63% of the lacunae were small sized , 63.76% were medium sized , and 26.61% of the lacunae were large sized .
the density of cells ranged from 1.31 to 5.93 with an average of 3.01 1.35 .
the area of the lacunae ranged from 150.33300.97 m with an average of 204.59 43.28 m .
3.35% of the lacunae were small sized , 60.59% were medium sized , and 36.06% of the lacunae were large - sized .
the density of cells ranged from 1.51 to 4.94 with an average of 3.24 1.11 .
the area of the lacunae ranged from 102.24 to 192.05 m with an average of 145.00 32.17 m .
21.54% of the lacunae were small sized , 64.62% were medium sized , and 13.84% of the lacunae were large sized .
the density of cells ranged from 0.91 to 5.82 with an average of 3.36 1.37 .
numerous small cavities were seen in the subchondral bone . the area of the subchondral cavities varied from 2,191.57 to 10,309.88 m with an average of 4322.89 2299.21 m ( table 4 ) .
comparison of the mean of the area of lacunae and the cell density in the four zones and the mean of the area of subchondral cavities at various age groups using anova showed no statistically significant difference in the various age groups above 40 years of age and no correlation of these parameters with age was observed in group 2 .
the area of the subchondral cavities varied from 2,191.57 to 10,309.88 m with an average of 4322.89 2299.21 m ( table 4 ) .
comparison of the mean of the area of lacunae and the cell density in the four zones and the mean of the area of subchondral cavities at various age groups using anova showed no statistically significant difference in the various age groups above 40 years of age and no correlation of these parameters with age was observed in group 2 .
on comparing the means using independent sample t - test ( student 's t - test ) , the mean of the lacunar size in zone 3 was found to differ significantly in the below 40 ( group 1 ) and above 40 ( group 2 ) age groups ( p < 0.01 ) .
lacunar size was found to be significantly larger in the latter ( table 5 ) . the total thickness and the lacunar size in zone 3
the total thickness was found to decrease with age while the lacunar size was found to increase with age .
the articular cartilage below 40 years of age showed a smooth surface and a distinct zonation into four zones while in group 2 ( above 40 years ) , although zonation could be identified in all the specimens , changes were seen in the form of small splits or swelling due to separation of collagen bundles only in the superficial zone of the cartilage .
the superficial zone of the articular cartilage plays a vital role in the healthy joint by virtue of its unique location , structure , and material properties .
it provides a smooth surface with low friction that withstands high tensile stresses and distributes the load over the surface of the joint , thereby protecting the underlying cartilage .
disruption of the superficial zone may cause release of metalloproteinases from chondrocytes or from synovial fluid and may lead to the enhanced removal of proteoglycans from the tissue hence leading to further degeneration . in previous studies on osteoarthritic articular cartilage , we observed a disrupted surface in the osteoarthritic articular cartilage .
inspite of the changes in the superficial zone , the deeper zones appeared normal with a regular tidemark .
the changes in the superficial layer which appear due to splitting of collagen bundles have been linked with a weakened or altered fibrillar network and could deprive the adjacent cartilage of its nutrition leading to further changes . in previous studies
, we observed an irregular articular surface and altered histology throughout the thickness of the cartilage in osteoarthritic articular cartilage [ 6 , 7 ] .
wigley also stated that articular cartilage has no nerves or blood vessels and its nutrition depends on peripheral vascular plexus in synovial membrane ( circulus vasculosus articuli ) , synovial fluid , and blood vessels in adjacent marrow spaces though the relative importance of these is uncertain
. the changes of articular cartilage with advancing age could be because of lack of its nutrition as there is an imbalance between the chondrocytes and the cartilage matrix .
the average thickness of the articular cartilage was found to be 2.34 0.30 mm in the subjects below 40 years of age .
wigley stated that the thickness of the articular cartilage ranges from 1 to 2 mm and may even reach 57 mm .
however , most of these studies are based on radiographic imaging , specifically magnetic resonance imaging ( mri ) . according to eckstein
mri of strongly curved surfaces can overestimate cartilage thickness without appropriate derivations . in the present study
, the total thickness of the cartilage was found to decrease significantly with age in group 2 . based on mri studies , karvonen et al .
reported significant cartilage thinning with age in the weight - bearing aspect of the femoral condyles of subjects without osteoarthritis .
. in their mri studies found significant reduction of cartilage thickness in the femur of elderly men and women and stated that thinning of knee joint cartilage occurs physiologically with ageing , even in the absence of cartilage disease .
earlier , bullough and jagannath stated that the calcification of the cartilage is uninterrupted throughout the adult life and the calcified zone remains at the constant thickness , due to the absorption of the calcified cartilage into the subchondral bone by endochondral ossification while the calcification front ( tidemark ) continues to advance into the noncalcified cartilage at a slow rate which is in equilibrium with the rate of absorption of the calcified cartilage from the subchondral bone .
comparison of the mean of the total thickness , area of lacunae , and the cell density in the four zones and the mean of the area of subchondral cavities at various age groups using anova showed no statistically significant difference and no correlation of these parameters with age was observed while the lacunar size in zone 3 was found to be significantly larger in the ageing articular cartilage suggesting the cells may undergo hypertrophy .
the usefulness of the earlier methods of micrometry was inherently limited by observer subjectivity and bias , yielding considerable variability .
because of the development of digital microscopic image analysis , substantial efforts have been made to correlate the evaluations made by experienced pathologists with quantitative values [ 1618 ] . in the present study we used computerized morphometric analysis to observe the changes in the ageing articular cartilage .
further insights in this field are required to understand the phenomenon of ageing and cartilage degeneration .
|
objective .
articular cartilage shows changes with age that are considered to be the most important factors in the development and progression of osteoarthritis .
the studies on age changes in articular cartilage have been traditionally based on individual observations but this approach is limited by its subjectivity and bias , yielding considerable variability .
so the present study was conducted to observe various age related changes in morphology of femoral articular cartilage using computerized morphometric analysis .
design .
the articular cartilage specimens were divided into two groups according to age : group 1 ( n = 16 ) below 40 years ( 1640 years ) and group 2 ( n = 12 ) above 40 years ( 4186 years ) of age . 5 m thick paraffin sections were stained with h&e and analyzed using image pro express image analysis software for quantitative analysis of articular cartilage .
various parameters , that is , total thickness of the cartilage , area of lacunae in each zone , area of subchondral cavities , and number of chondrocytes per 10,000 m2 area in each zone were measured . results .
significant difference with age was found in the total thickness and area of lacunae in zone 3 .
conclusions .
not much difference is observed in articular cartilage morphology with age .
so ageing is not the only risk factor in development of osteoarthritis .
|
brave new world revisited , by aldous l. huxley ( 18941963 ) in many biological systems , including human societies , individuals adopt deceptive tactics to change the perception and behavior of others .
perpetrators may deceive by purposely attempting to convince others to believe false information ( i.e. , the pinocchio effect in humans ) , or by misleading them through the deliberate omission or concealment of key information that could jeopardize their interests .
the range of traits , behaviors and circumstances involved in the deceit may be very diverse across species , but the ultimate goal is to gain some kind of benefit or to avoid loss , hence leading to an increase in evolutionary fitness . because of the potential benefits of misleading signals , the art of deception is commonly practiced by many species and , paradoxically , essential for the proper workings of interactions among individuals and groups ( e.g. , some lies are altruistic and pro - social , making for smoother communication in humans ) .
interestingly , the deceit only works when embedded within signaling systems with a certain degree of reliability where signals are reliable often enough because , on average , they convey information that are honest , thus making the response beneficial to receivers ( for a review of the topic see searcy and nowicki ) . and indeed , deceptive signaling can be identified only if we first know what constitutes a reliably honest communication within our specific study system . although arguably one of the most intriguing evolutionary questions , our own interest here does not revolve around the actual issue of reliability and deceit of signaling systems .
instead , we ask a question about the reliability of the context we adopt to interpret the issue and what happens when the function of animal signals is inferred from a look - alike true assumption . across the animal and plant kingdoms ,
mimicry has evolved in response to common selective pressures that favor individuals that can conceal their identity and avoid recognition by ( more or less ) closely resembling their model . for many mimicry systems , body shape , size ,
color and patterns are the primary signaling mechanisms used to deceive receivers , and the conspicuous eyespots at the end of animals ' backs , heads , tails and wings are certainly among the most intriguing forms of these deceptive adaptations .
because eyespots are most commonly found in lepidoptera , their role has been primarily discussed and examined in this group and several studies over the last few years have supported the two main long - standing hypotheses invoked to explain their occurrence : ( 1 ) intimidation eyespots frighten predators by mimicking the eyes of the predators own dangerous enemies ; ( 2 ) deflection eyespots deflect the attacks of predators to non - vital regions of the body ( for a comprehensive review see kodandaramaiah ) .
although the eye - mimicry hypothesis has been the most cited explanation for the intimidating nature of eyespots , experimental support for it has become available only recently . aside from butterflies and moths ,
eyespots are a common feature in many other insect groups , birds , reptiles and several fish species ( fig . 1 ) .
because of their widespread occurrence and similarity in shapes and forms across species , it has been tempting to assume that they evolved to perform similar adaptive functions , particularly in the context of protection against predators . and
indeed , both the intimidation and deflection hypotheses have been proposed to explain the occurrence of eyespots in fish for instance , although empirical evidence in support of either idea has been noticeably missing . interestingly , quite a different story has emerged from more recent studies that have gone far enough to test experimentally the function of fish eyespots in nature .
reef fishes , eyespots are particularly common in damselfishes ( a and b ) , blennies ( c ) and butterfly fishes ( d and e ) . photos courtesy of n. thake .
eyespots have been observed to occur on the tails and dorsal fins of juveniles in a number of coral reef fish species .
located posteriorly , they have long been assumed to misdirect a predator s attack away from vital parts of the body such as the head , by mimicking the real eyes but being located in a less vital region of the body , such as the dorsal fin .
eyespots in coral reef fishes have also been expected to deflect a predator s attention away by confusing a predator about its actual distance from a potential prey assuming that a larger eyespot relative to the real eye would induce a predator to initiate an attack from a greater distance than it normally would .
remarkably , the assumption that eyespots in these species have such anti - predator function and larger eyespots relative to the size of real eyes better serve as a decoy , thereby increasing juvenile survivorship in the wild , remained untested until recently . using a mark - recapture experiment , gagliano demonstrated that eyespots of the ambon damselfish ( pomacentrus amboinensis ) may not confer the long - assumed protection from predators and suggested that these markings may serve other purposes . in our recent paper , we investigated this alternative of a non - predatory function of eyespots in this species and showed that these markings have a deceptive function in the context of intrasexual ( male - male ) competition .
specifically , we examined the possible functional role of the dorsal eyespots in p. amboinensis by exploring differences in body shape among age and gender groups , based on the fact that : ( 1 ) all juveniles are females and all have an eyespot , and ( 2 ) most individuals lose their eyespots on maturation , yet a few retain them into adulthood .
we demonstrated that the eyespot retention is gender - specific , where eye - spotted adults are always sexually mature males , and these eye - spotted males more closely resemble the size and body shape of immature females than that of the males they actually are ( i.e. , mimicry ) .
moreover , age data of p. amboinensis with and without eyespots indicated that the functional significance of these markings switches within a lifetime from serving as an honest signal of the sexual immaturity of juveniles to reduce aggression by mature males to a deceptive signal of age and non - breeding status . what our study really highlights , however , is a much more perilous trap .
obviously , evidence shown in one system may not necessarily be a panacea for all systems .
something said often enough does not make it so ; our study reminds us that hypotheses should be tested and evaluated within their specific context if we are to avoid the risk of developing our science on widely accepted , but not always correct premises .
across the animal and plant kingdoms , mimicry has evolved in response to common selective pressures that favor individuals that can conceal their identity and avoid recognition by ( more or less ) closely resembling their model . for many mimicry systems , body shape , size ,
color and patterns are the primary signaling mechanisms used to deceive receivers , and the conspicuous eyespots at the end of animals ' backs , heads , tails and wings are certainly among the most intriguing forms of these deceptive adaptations .
because eyespots are most commonly found in lepidoptera , their role has been primarily discussed and examined in this group and several studies over the last few years have supported the two main long - standing hypotheses invoked to explain their occurrence : ( 1 ) intimidation eyespots frighten predators by mimicking the eyes of the predators own dangerous enemies ; ( 2 ) deflection eyespots deflect the attacks of predators to non - vital regions of the body ( for a comprehensive review see kodandaramaiah ) .
although the eye - mimicry hypothesis has been the most cited explanation for the intimidating nature of eyespots , experimental support for it has become available only recently . aside from butterflies and moths ,
eyespots are a common feature in many other insect groups , birds , reptiles and several fish species ( fig . 1 ) .
because of their widespread occurrence and similarity in shapes and forms across species , it has been tempting to assume that they evolved to perform similar adaptive functions , particularly in the context of protection against predators . and indeed , both the intimidation and deflection hypotheses have been proposed to explain the occurrence of eyespots in fish for instance , although empirical evidence in support of either idea has been noticeably missing .
interestingly , quite a different story has emerged from more recent studies that have gone far enough to test experimentally the function of fish eyespots in nature .
reef fishes , eyespots are particularly common in damselfishes ( a and b ) , blennies ( c ) and butterfly fishes ( d and e ) . photos courtesy of n. thake .
eyespots have been observed to occur on the tails and dorsal fins of juveniles in a number of coral reef fish species .
located posteriorly , they have long been assumed to misdirect a predator s attack away from vital parts of the body such as the head , by mimicking the real eyes but being located in a less vital region of the body , such as the dorsal fin .
eyespots in coral reef fishes have also been expected to deflect a predator s attention away by confusing a predator about its actual distance from a potential prey assuming that a larger eyespot relative to the real eye would induce a predator to initiate an attack from a greater distance than it normally would .
remarkably , the assumption that eyespots in these species have such anti - predator function and larger eyespots relative to the size of real eyes better serve as a decoy , thereby increasing juvenile survivorship in the wild , remained untested until recently . using a mark - recapture experiment , gagliano demonstrated that eyespots of the ambon damselfish ( pomacentrus amboinensis ) may not confer the long - assumed protection from predators and suggested that these markings may serve other purposes . in our recent paper , we investigated this alternative of a non - predatory function of eyespots in this species and showed that these markings have a deceptive function in the context of intrasexual ( male - male ) competition .
specifically , we examined the possible functional role of the dorsal eyespots in p. amboinensis by exploring differences in body shape among age and gender groups , based on the fact that : ( 1 ) all juveniles are females and all have an eyespot , and ( 2 ) most individuals lose their eyespots on maturation , yet a few retain them into adulthood .
we demonstrated that the eyespot retention is gender - specific , where eye - spotted adults are always sexually mature males , and these eye - spotted males more closely resemble the size and body shape of immature females than that of the males they actually are ( i.e. , mimicry ) .
moreover , age data of p. amboinensis with and without eyespots indicated that the functional significance of these markings switches within a lifetime from serving as an honest signal of the sexual immaturity of juveniles to reduce aggression by mature males to a deceptive signal of age and non - breeding status . what our study really highlights , however , is a much more perilous trap . obviously ,
something said often enough does not make it so ; our study reminds us that hypotheses should be tested and evaluated within their specific context if we are to avoid the risk of developing our science on widely accepted , but not always correct premises .
|
deception is ubiquitous in plant and animal kingdoms and is widely thought to provide selective advantages to the individual and evolutionary success to the species .
mimicry , a form of deception whereby an individual imitates their model to advantage by closely resembling their behavior or appearance , is particularly well documented and represented by the peripheral eyespots seen on the wings of many butterfly species .
the significance of butterfly eyespots has been convincingly demonstrated to serve as an anti - predatory function either by imitation of a predator s own dangerous enemies ( intimidation hypothesis ) or by deflecting predator strikes toward less - vital parts of the body ( deflection hypothesis ) .
a convincing and compelling explanation in butterflies , the functional role of eyespots as anti - predatory devices has become a widely held and firmly entrenched belief that has been freely adopted into other systems . here
we comment on a recent paper that demonstrates a vastly different role for eyespots , that of intra - specific male - male competition , and make the point that even long - held beliefs need to be tested and challenged under different contexts if we are not to be deceived ourselves .
|
the association between type 1 diabetes ( t1d ) and vitamin d deficiency ( vdd ) is widely reported .
vitamin d treatment has been shown to improve and even prevent t1d in both human and animal models .
animal studies has shown definite role of vitamin d in pancreatic cell function and insulin sensitivity . however , less is known regarding the association between vitamin d and type 2 diabetes ( t2d ) in humans .
several studies have demonstrated a link between vitamin d receptor ( vdr ) gene polymorphism and t2d .
large number of cross sectional and longitudinal studies have reported inverse association between vitamin d status and t2d .
studies have also shown that replacement with vitamin d in deficient patients rectifies the abnormalities of impaired insulin secretion and glucose intolerance . in patients with t2d or impaired glucose tolerance ( igt ) ,
studies from india have also reported hypovitaminosis d in a significant number of people with t1d and in youth onset both in t1d and t2d . in view of scarce data on vitamin d status in t2d patients from india , the present study was undertaken to assess the vitamin d status in newly detected t2d patients .
the present prospective case control study was conducted at tertiary care hospital in north india over a period of 2 years .
sample size was calculated on the basis of moderate effect size of 0.4 between the two groups with of 5% and power of the study 1- = 80% , the required sample size for each group comes around 100 each .
we have recruited 102 new onset t2d patients and an equal number of age , gender and body mass index ( bmi ) matched healthy control people .
people with age more than 25 years were recruited and were classified as new onset t2d if they had fasting plasma glucose ( fpg ) 126 mg / dl or frank osmotic symptoms with random blood glucose ( rbg ) 200 mg / dl or 2 hour blood glucose 200 mg / dl on oral glucose tolerance test ( ogtt ) without ketoacidosis and had diabetes mellitus ( dm ) of less than 6 months duration .
controls included healthy adult men and women accompanying the patients and were without any illness in which diabetes was ruled out with appropriate testing .
an informed consent was obtained from all the cases and controls after explaining in local language .
the study was approved by institutional review board . a detailed history focusing on presentation of dm ( osmotic symptoms , ketoacidosis or others ) , family history of diabetes , occupation , socioeconomic status , drug intake , history of any systemic illness , and menstrual and obstetric history in women was noted .
direct sunlight exposure was assessed by average daily duration of exposure and percentage of body surface area exposed .
nutritional status of the patients and controls was assessed by a trained dietician based on the average composition of their daily diet in terms of energy , carbohydrate , protein , fat and calcium using a semi - quantitative food frequency questionnaire and published data on the nutrient composition of indian food .
after an overnight fast of at least 8 hours , a non- heparinized venous blood sample was taken for analysis of glucose , lipids , creatinine , calcium , phosphorus , and alkaline phosphatase .
serum was separated within 2 hours of venipuncture and analysis was done within 24 hours .
biochemical parameters were analyzed with commercially available enzymatic reagents ( audit diagnostics , ireland ) adapted to hitachi 912 auto analyser .
hba1c was measured with high performance liquid chromatography ( hplc ) standardized to the dcct assay ( reference range , 4 - 6% ) .
after the patients had been at rest for at least 10 min in the supine position , blood sample was collected in a 5 ml evacuated glass tube .
the blood was allowed to clot at room temperature ( 15 - 25c ) and centrifuged for 15 minutes to obtain hemolysis free serum .
after rapid extraction from serum with acetonitrile ; 25hd was estimated by radioimmunoassay ( ria ) procedure .
the intra- and inter assay coefficients of variation ranged between 11.7 - 12.5% and 9.4 - 11.0% , respectively .
samples were collected throughout the years of the study duration with equal representations in winter and summer .
vitamin d status in our patients and controls was defined as follows : sufficiency ( 25hd levels , 30 - 100 ng / ml ) , insufficiency ( 25hd 20 - 30 ng / ml ) , and deficiency ( 25hd < 20 ng / ml ) .
vitamin d deficient subjects were also graded as mild ( 10 - 20 ng / ml , moderate ( 5 - 10 ng / ml ) , and severe ( < 5 ng / ml ) as recommended by lips .
an independent sample t test was used to compare mean sd values between cases and controls .
pearson correlation coefficient was computed between vitamin d and other parameters and then partial correlation was analyzed between vitamin d and other parameters .
the strength of association between diabetes and vdd was studied by using chi square test .
analysis of covariance was used to study the vitamin d status in people with t2d and those without t2d , after adjusting for confounding factors like age , sex , and bmi .
after an overnight fast of at least 8 hours , a non- heparinized venous blood sample was taken for analysis of glucose , lipids , creatinine , calcium , phosphorus , and alkaline phosphatase .
serum was separated within 2 hours of venipuncture and analysis was done within 24 hours .
biochemical parameters were analyzed with commercially available enzymatic reagents ( audit diagnostics , ireland ) adapted to hitachi 912 auto analyser .
hba1c was measured with high performance liquid chromatography ( hplc ) standardized to the dcct assay ( reference range , 4 - 6% ) .
after the patients had been at rest for at least 10 min in the supine position , blood sample was collected in a 5 ml evacuated glass tube .
the blood was allowed to clot at room temperature ( 15 - 25c ) and centrifuged for 15 minutes to obtain hemolysis free serum .
after rapid extraction from serum with acetonitrile ; 25hd was estimated by radioimmunoassay ( ria ) procedure .
the intra- and inter assay coefficients of variation ranged between 11.7 - 12.5% and 9.4 - 11.0% , respectively .
samples were collected throughout the years of the study duration with equal representations in winter and summer .
vitamin d status in our patients and controls was defined as follows : sufficiency ( 25hd levels , 30 - 100 ng / ml ) , insufficiency ( 25hd 20 - 30 ng / ml ) , and deficiency ( 25hd < 20 ng / ml ) .
vitamin d deficient subjects were also graded as mild ( 10 - 20 ng / ml , moderate ( 5 - 10 ng / ml ) , and severe ( < 5 ng / ml ) as recommended by lips .
an independent sample t test was used to compare mean sd values between cases and controls .
pearson correlation coefficient was computed between vitamin d and other parameters and then partial correlation was analyzed between vitamin d and other parameters .
the strength of association between diabetes and vdd was studied by using chi square test .
analysis of covariance was used to study the vitamin d status in people with t2d and those without t2d , after adjusting for confounding factors like age , sex , and bmi .
a total of 102 new onset t2d patients and equal number of healthy controls were studied .
both cases and controls were comparable in age , gender and bmi [ table 1 ] .
analysis of the data revealed that serum level of 25hd had a significant negative correlation with fpg and hba1c and positive correlation with 24 hour dietary calcium intake , all the subsequent analysis was carried after adjusting for these three factors . taking a 25hd cut - off of 30 ng / ml , 81% of t2d patients
were vdd or insufficient , while around 67% of healthy control subjects also were either deficient of insufficient .
severe vdd ( 25 hd < 5 ng / ml ) was seen in 16.2% of patients and 2.5% of control subjects [ table 1 ] .
the main finding of the study was a significantly lower 25hd in people with diabetes compared with healthy controls .
overall plasma 25hd ( mean sd ) was 18.81 15.18 ng / ml in patients with diabetes compared to 28.46 18.89 ng / ml in healthy controls ( p = 0.00 ) .
the difference in vitamin d status persisted even after adjusting for confounding factors like age , gender , and bmi ( p = < 0.001 ) .
clinical and biochemical parameters of cases and healthy controls in present study , while hba1c and fpg of t2d patients was significantly higher , dietary calcium intake was significantly lower compared with control subjects ( p = 0.00 ) , at the same time there was no statistically significant difference between percentage sunlight exposures between patients and healthy controls [ table 1 ] .
there was no statistically significant difference in age , gender , bmi , hba1c , serum calcium , phosphorus and alkaline phosphatase in diabetes patients across different severity of vdd [ table 2 ] .
there was no correlation between 25hd level and other clinical and biochemical parameters after adjusting for fpg , hba1c , and calcium either in patients with t2d or healthy controls [ table 3 ] .
people witht2d had 2.18 times more chance of vdd as compared with non diabetes population ( ci = 1.14 - 4.16 ; p = 0.017 ) .
comparison of clinical and biochemical parameters as per severity of vitamin d deficiency correlation of vitamin d with clinical and biochemical parameters
aim of present study was to determine vitamin d status among new onset t2d patients compared with healthy controls without diabetes . in the present study , mean sd 25hd level was significantly lower ( 18.81 15.18 ng / ml ) in diabetes patients compared to 28.46 18.89 ng / ml in healthy controls p = < 0.000 , similarly , prevalence of severe vdd was also significantly more in patients with t2d compared with healthy controls ( 16.2% in t2d patients and 2.5% in healthy controls ) .
many similar studies have demonstrated significantly lower 25hd in people with t2d . in one study , increased prevalence of hypovitaminosis d was found in t2d patients after adjusting for age and gender . in another similar study ,
both patients with igt and diabetes had significantly lower 25hd . in a recently published study from kashmir ,
vdd was found in 91% of the patients with diabetes and 58% of the healthy controls in the age group of less than 25 years .
mean sd 25hd was significantly low , 7.88 1.20 ng / ml in people with diabetes against 16.63 7.82 ng / ml in healthy controls . in a korean study ,
mean sd concentration of 25hd in t2d patients was 12.90 0.4 ng / ml while that in controls was15.40 0.5 ng / ml .
in contrast , one study in japanese population having as high as 70% prevalence of vdd , has not shown any difference in 25hd between patients with diabetes compared to normal population .
two reports from united states revealed higher mean value of 25hd in t2d patients as well as in controls .
these differing reports suggest that , 25hd levels in patients with t2d patients vary widely according to ethnicity or some other unknown reasons .
both insulin resistance and pancreatic beta cell dysfunction have been reported in people with vitamin d insufficiency . in a cross
sectional data , positive association has been demonstrated between 25hd and glucose induced insulin secretion in east london asians at risk of t2d .
similarly an inverse association of insulin resistance with 25hd has been demonstrated in third national health and nutrition examination survey .
significant inverse association has also been reported between 25hd and glucose induced insulin secretion in elderly dutch men and hyperglycemic clamp induced insulin response in subjects of various ethnic backgrounds . however , in one study no association was found between 25hd and meal induced insulin secretion in men with t2d .
summary of studies reviewed regarding vitamin d deficiency and type 2 diabetes mellitus in present study , 25hd had a significant negative correlation with fpg and hba1c .
in one korean study , hba1c was significantly higher in t2d patients than that of controls and had a significant correlation with 25hd .
in the present study , dietary calcium intake was significantly higher in healthy control subjects as compared to t2d patients , though one italian study has shown lower dietary calcium intake int2d patients as compared to controls .
because the calcium intake was based on 24 hour recall , it is possible that after detection of diabetes , calcium containing foods would also be unknowingly restricted in them .
the direct clinical evidence of association of hypovitaminosis d and diabetes has come from interventional studies .
though we did not supplement any group with calcium or vitamin d , only few prospective studies have examined the predictive value of 25hd on future risk of type 2 diabetes mellitus .
it would be worthwhile to see the effect of vitamin d supplementation on the onset of new diabetes in well - designed placebo controlled prospective studies .
the aim of the current prospective study was to find the vitamin d status in newly detected t2d patients .
whether vitamin d status in patients with t2d has a role in the pathogenesis of the disease needs to be seen in future studies .
|
background : vitamin d deficiency ( vdd ) has been linked to impaired glucose tolerance and type 2 diabetes ( t2d ) in humans .
the aim of the present study was to find the vitamin d status in newly detected t2d patients compared with healthy controls.materials and methods : one hundred and two , newly detected t2d patients and similar number of age , body mass index ( bmi ) , and gender matched healthy controls without diabetes were studied .
in addition to basic information , metabolic parameters and serum 25 hydroxy vitamin d ( 25hd ) were measured in both the groups.results:overall 25hd , was lower ( mean sd , 18.81 15.18
ng / ml ) in patients with t2d as compared to healthy controls ( 28.46 18.89 ng / ml ) ( p = 0.00 ) .
taking a cut of 30 ng / ml , 81% of t2d patients had either vdd or insufficiency compared to 67% of healthy control subjects .
severe vdd ( 25hd of < 5 ng / ml ) was seen in 16.2% of patients with diabetes and 2.5% of control subjects .
levels of 25hd had a negative correlation with hba1c , fasting plasma glucose.conclusions:vdd is common in people with new onset t2d .
|
one of the main goals of an antimicrobial stewardship ( ams ) intervention is to ensure patients with infections receive the most appropriate antimicrobial agent at the optimal dose at the earliest time . as ams programs can take many forms there is a need to ensure that the intervention(s ) selected can maximize the outcomes of the program . however , there is a lack of clarity around the outcome measures that provide the best indicators of a successful ams program with most studies focusing on changes in antimicrobial utilization rates .
( 2016 ) on current metrics to measure the impact of ams programs in a recent review reported that only a handful of studies included patient outcomes .
the authors reported that only 13 of the 63 studies that met their inclusion criteria reported on mortality , length of stay and unplanned admissions related to post - ams infection as an outcome measure .
okumura et al . ( 2015 ) focused on six studies that examined mortality and the non - significant impact was highlighted with only one study reporting an absolute risk reduction in 30-day mortality .
a recent study by cairns ( 2016 ) found that active review of patients with bloodstream infections ( bsi ) by their ams team improved the timeliness of appropriate therapy .
bsi mortality has been proposed as a useful indicator to evaluate ams programs , based on the premise that better prescribing practices should improve patient outcomes . while this premise may make sense , the evidence to support this link is not clear .
bloodstream infections are serious infections and factors such as the choice of antimicrobial , duration of therapy , dosage , and route of administration can impact patient outcomes . while there are many infectious agents causing serious infections in a hospital environment , a group of organisms referred to as the eskape bacteria ( enterococcus faecium / faecalis , staphylococcus aureus , klebsiella pneumoniae , acinetobacter baumannii , pseudomonas aeruginosa and enterobacter species ) are particularly problematic .
patients with bsi due to eskape organisms who are not receiving appropriate therapy , and patients with infections caused by resistant organisms , have worse outcomes than those caused by susceptible organisms .
it follows that if bsi are managed more effectively , morbidity , mortality and length of stay in this subset of patients can be reduced .
this systematic review aims to synthesize findings from epidemiological studies to determine whether there is an association between inappropriate ( i.e. , inadequate , incorrect or delayed ) prescribing and an increased risk of mortality in adult hospitalized patients with bsi caused by eskape organisms .
in addition , the impact of factors such as organism group ( gram positive , gp , or gram negative , gn ) and resistance status will be assessed .
a systematic literature search was performed in november 2015 in key medical databases ( pubmed , embase and cochrane ) to identify all papers published in english between january 2005 and november 2015 that assessed the association between inappropriate prescribing and bsi mortality .
all retrieved studies were scanned using title and abstract to determine whether the inclusion and exclusion criteria were met for the review . where a decision could not be made based on the title or abstract , the paper was subject to full review .
only primary studies in english that met the following inclusion criteria were analyzed : adult inpatients in hospital settings ; studies performed in member countries of the organization for economic cooperation and development ( oecd ) ; the sample size was greater than 99 ; the risk of mortality related to bsi was expressed as a relative risk ( odds ratio , relative risk or hazard ratio ) ; and , included only organisms belonging to the eskape group .
exclusions included : immunocompromized populations ( transplant and oncology patients ) ; neonatal and pediatric populations ; and non - hospital inpatients .
data on the study design , context , organisms , definition of inappropriate prescribing , main study objective and main outcome measure was extracted from all included studies using specifically designed data extraction forms that were piloted prior to use .
the overall quality of the evidence to support an association between inappropriate prescribing and bsi mortality was assessed using the grade criteria .
subgroup analyses were conducted to look at differences in outcomes by organism group ( gp or gn ) and resistance status ( sensitive or resistant ) of bsis .
of 9046 studies screened for inclusion , forty - six met the inclusion and exclusion criteria .
reasons for exclusion are shown in figure 1 . of the 46 studies two were large multi - center studies : one including data from usa , canada and saudi arabia ; and the second including data from nine european countries .
thirteen studies were from the usa , eight from spain , five from italy , four from korea , three each from turkey and israel , two each from the netherlands and the uk , and single studies from denmark , germany , norway , and australia .
of the 46 studies 34 were retrospective in design and only three of these studies were case controlled .
whilst a few studies focused on specific patient groups , most included all adult patients .
the majority of studies reviewed used a retrospective study design but used different analytical methods and adjusted for different confounders , making results difficult to directly compare .
the definition for inappropriate prescribing varied significantly between countries although most studies defined appropriate prescribing as the correct antimicrobial for the pathogen according to local guidelines .
the definition for inadequate therapy was no different from the one used for inappropriate therapy , in most cases .
the definition of inappropriate , inadequate and delayed therapy used in each of the studies is described in supplementary tables s1 and s2 .
the time to antimicrobial therapy varied with a range from 6 hrs in septic shock and severe sepsis to up to 72 hrs being deemed acceptable .
this variation of sickness severity in some patient cohorts explains the range in time to therapy , as a shorter time would be more appropriate for more severely unwell patients .
the impact of timing of antimicrobial therapy on the risk of mortality in patients with bsi was reported in 12 of the 46 studies ( supplementary table s3 ) .
the definition of delayed therapy varied from 1hr to > 72hrs in the studies making it difficult to compare the impact on mortality in these patients .
the impact of delayed therapy on bsi - associated mortality combined with the analysis of gp and gn organisms were reported in five of the 12 studies and reported a two - fold increase .
only two of the twelve studies were case controlled and reported on the impact of methicillin resistant staphylococcus aureus ( mrsa ) with a delay in therapy of two days , resulting in an odds of mortality of 1.85 ( 95%ci : 0.094 - 3.64 , p=0.074 ) and patients with bsi due to esbl organisms with a delay in therapy of 48 hours resulting in an or of 25.1 ( 95%ci : 10.5 - 60.2 , p0.001 ) .
overall a greater impact was seen in gn resistant infections ranging from 3 to 25-fold increases in the risk of bsi - associated mortality .
the definitions for inadequate and inappropriate therapy used in the studies overlap and as such these studies will be presented collectively .
six of 34 studies that described the impact of inappropriate therapy on bsi - associated mortality combined the analysis of gp and gn organisms , seven only reported gp bsi and 21 reported gn bsi . in the six studies that pooled gp and gn bsi data , the odds of mortality ranged from no significant impact to a nine - fold increase in death ; however , this higher estimate was observed in a subset of patients with severe sepsis .
the risks associated with inappropriate prescribing were higher for studies looking at mrsa than studies reporting on methicillin susceptible staphylococcus aureus ( mssa ) infections .
studies that looked at the impact of mortality in all gn bsi , including enterobacteriaceae , pseudomonas aeruginosa and acinetobacter species , reported an increase in the odds of mortality from two to five - fold due to inappropriate therapy .
the impact increased significantly when inappropriate prescribing involved bsi due to resistant gn gram negative organisms ranging from two to nine - fold increases in the risk of death .
the only case controlled study in this group reported data from multi drug resistant p mirabilis bsi and observed a nine - fold ( 9.85 , 95%ci : 2.67 - 36.25 , p<0.001 ) increase in mortality due to inappropriate prescribing .
the overall quality of the papers included in this study were of medium to low quality only reaching an average score of grade c according to the grade criteria .
inappropriate ( i.e. , inadequate , incorrect or delayed ) therapy is associated with a higher risk of mortality in bsi caused by resistant gp organisms ( e.g. , mrsa ) than mssa organisms .
however , the impact of inappropriate prescribing on mortality is greatest in bsi caused by gn organisms , with the risk of death ranging from 3 to 25-fold depending on the resistance status of the pathogen . while the quality of studies is tempered due to study design , and the variation in the definition of appropriate prescribing ,
there is some evidence to suggest that inappropriate prescribing leads to unfavorable outcomes in patients with bsi , particularly in those bsi caused by resistant organisms .
only two studies investigating outcomes of bsi mortality in gn organisms reported no impact ; all other studies reported a higher risk of death if therapy was inappropriate .
however , the exact magnitude of this association is somewhat unclear . while most studies adjusted for co - morbidities using multivariate logistic regression there was variety in the confounders considered and no studies used methods that accounted for time - dependent bias .
earlier work has demonstrated that adjustment for time - dependent bias can lead to a dramatic reduction in estimates of the attributable mortality and length of stay associated with infection in hospitalized patients .
while short term outcomes such as 30-day mortality in susceptible gp infections , e.g. , those caused by s. aureus , does not seem to be associated with inadequate prescribing these infections can cause significant complications such as osteomyelitis and endocarditis in the longer term if not treated effectively .
the long term effects of poor prescribing are more difficult to capture and there is a need for prospective studies assessing longer term mortality outcomes and an assessment of morbidity impact in this area of research . while it is perhaps intuitive that the dose as well as the timely delivery of antimicrobials to a patient with a bsi would be considered important , it remains not well studied in the current published evidence .
to be considered appropriate therapy , the correct dose according to the local guidelines needs to be delivered .
( 2008 ) advocated the delivery of the highest tolerable dose to achieve the best clearance of infection .
however in this review , most studies focused solely on timely delivery of the correct antibiotic , with no information as to what percentage of patients with bsi received an inadequate dose of the correct antimicrobial . the dose of the antimicrobial is important for a number of reasons .
if therapeutic exposures of antimicrobials are not achieved at the site of infection , then the infection will not be controlled .
additionally , sub - optimal doses have been associated with the emergence of resistance . to achieve improved prescribing practices in hospitals , the most informative data on the causative pathogen
the delivery of rapid and accurate information on the identification and susceptibility of the pathogen causing the infection could lead to better prescribing and improved outcomes for patients .
there has been published evidence to support the claim that rapid technology in conjunction with an ams intervention improved survival in resistant gn bsi .
more data needs to be collected on the long term effects to measure the impact of ams interventions and the use of rapid technology over longer periods of time .
this data may indicate whether the improvements in prescribing achieved by ams programs translate into improved patient outcomes and provide some insight as to the sustainability of the outcomes of these interventions .
our review has a number of limitations due to the quality and the heterogeneity of the studies included therefore a meta - analysis of the data was not able to be performed .
the various study designs , definitions and variation in the way the risk of death was quantified in these studies made it difficult to compare outcomes .
a standardized metric of measuring the risk of mortality would be of benefit when measuring these outcomes so that it would be easier to compare studies in the future . some studies may have been missed as the strict inclusion criteria meant other potentially important groups , such as the immunocompromized , were excluded due to their higher risks of mortality and morbidity .
studies that had a sample size of less than 99 were also excluded to minimize the influence of chance findings on our summary ; this exclusion may have excluded small but potentially important studies . the nature of the subject matter is not suitable for rct methodology as it would be unethical to randomize any patient or patient group to inappropriate therapy .
the cochrane handbook for systematic reviews endorses the use of high quality observational evidence where the quality of studies is of a high to moderate quality . in our case
what is thought of as lower level evidence in the absence of rct studies might be the best available evidence on this topic .
bsi - associated mortality in patients caused by these organisms resulted in an increased risk of mortality ; this finding suggests a link between inappropriate prescribing and an increased risk of death in these bsi . since the largest impact of inappropriate prescribing was seen in resistant gn bsi , these may be a suitable metric to describe the impact of an ams intervention on patient outcomes
however , little is known on the longer term impacts of bsi that are treated with inappropriate antimicrobials and future longitudinal studies would provide better information on morbidity and quality of life impacts on patients receiving inappropriate therapy for bsi .
more effort into better study design and more consistent definitions of appropriate versus inappropriate therapy would be advantageous . the current review of evidence suggests that bsi mortality in gn may be associated with the adequacy of prescribing and thus may be a useful metric for evaluating the impact of ams programs that focus on improving prescribing practices .
|
this review sets out to evaluate the current evidence on the impact of inappropriate therapy on bloodstream infections ( bsi ) and associated mortality .
based on the premise that better prescribing practices should result in better patient outcomes , bsi mortality may be a useful metric to evaluate antimicrobial stewardship ( ams ) interventions .
a systematic search was performed in key medical databases to identify papers published in english between 2005 and 2015 that examined the association between inappropriate prescribing and bsi mortality in adult patients .
only studies that included bsis caused by eskape ( enterococcus faecium / faecalis , staphylococcus aureus , klebsiella pneumoniae , acinetobacter baumannii , pseudomonas aeruginosa and enterobacter species ) organisms were included .
study quality was assessed using the grade criteria and results combined using a narrative synthesis .
we included 46 studies .
inappropriate prescribing was associated with an overall increase in mortality in bsi . in bsi caused by
resistant gram positive organisms , such as methicillin resistant s. aureus , inappropriate therapy resulted in up to a 3-fold increase in mortality . in bsi caused by gram
negative ( gn ) resistant organisms a much greater impact ranging from 3 to 25 fold increase in the risk of mortality was observed .
while the overall quality of the studies is limited by design and the variation in the definition of appropriate prescribing , there appears to be some evidence to suggest that inappropriate prescribing leads to increased mortality in patients due to gn bsi .
the highest impact of inappropriate prescribing was seen in patients with gn bsi , which may be a useful metric to monitor the impact of ams interventions .
|
short tandem repeats ( strs ) are highly polymorphic sequences of nucleotides , which are abundant in eukaryotic genome .
they form approximately 3% of the total human genome and occur on average in every 10 000 nucleotides . due to their small dimension , low mutation , and high level of polymorphism
, these markers are intensely used as important genetic markers for mapping studies , disease diagnosis , and human identity testing .
strs remained the mainstays in most of the forensic laboratories in the world for the last two decades , as these markers provide high statistical capability of discrimination and individualization . with the growing number of laboratories which use str markers ,
more and more population data are reported from all over the world . in this study , we report the allele frequency data from chakma and tripura tribal population of bangladesh . besides the forensic uses , we find this study a very powerful adjunct for further regional and worldwide meta analysis .
liquid blood samples were collected from randomly selected 109 chakma and 58 tripura individuals in bangladesh .
there are four ethnic groups in bangladesh ; the dravidian , proto - australian , mongolian , and bengalis .
the bengalis are by far of all , constituting 98% of the population of the country .
the chakmas and tripuras tribal groups along with marmas , garos , and manipuris belong to the mongoloid stock and are sino - tibetan in origin .
they live in chittagong hill tract , khagrachari , and bandarban districts along the eastern border of bangladesh adjoining myanmar and indian states of mizoram and tripura .
the chittagong hill tracts host 13 main tribes of which chakmas are largest single tribes in bangladesh . according to the 2001 population census
the dravidian element of population is represented mainly by oraons , a tribe of central india in origin .
the australoid group includes khasias and santals , mainly labourers in the tea garden at the sylhet district .
dna was extracted using the chelex-100 method as described by walsh et al . .
extracted dna was quantified by using nanodrop-1000 ( nanodrop technologies , inc . , wilmington , de 19810 , usa ) .
approximately 1 - 2 ng of template dna was used for each pcr amplification process .
ten autosomal str loci namely d3s1358 , vwa , d16s539 , d2s1338 , d8s1179 , d21s11 , d18s51 , d19s433 , th01 , and fga were coamplified using ampflstr sgm plus pcr amplification kit ( applied biosystems , foster city , ca , usa ) .
the pcr reaction was carried out in a genamp pcr system 2720 ( appliled biosystems ) .
pcr - amplified fragments were separated and analyzed on abi prism 3100-avant genetic analyzer ( applied biosystems ) using pop-4 polymer and data collection software ver .
genotype of each locus was determined after comparison with allelic ladder using genotyper software version 3.7 nt .
allele frequencies at each locus and statistical parameters of forensic efficiency were calculated by using powerstat microsoft excel workbook template .
positive control dna and allelic ladder provided in ampflstr sgm plus pcr amplification kit ( applied biosystems ) .
approximately 10% of samples from both the populations were regenotypes to ensure reproducibility and accuracy .
allele frequencies of chakma and tripura tribal groups are shown in tables 1 and 2 , respectively . forensic efficiency parameters for both
the combined probability of match ( pm ) for the 10 str loci are 3.49 10 ( 1 in 2.86 10 ) and 1.03 10 ( 1 in 9.65 10 ) , respectively , for chakma and tripura populations .
the combined power of exclusion of paternity ( pe ) for the chakma and tripura were calculated to be 0.99997 and 0.9998 , respectively .
significant deviation from hardy - weinberg equilibrium was observed for fga locus in chakma and d21s11 in tripura population .
this may be due to inbreeding and lack of admixture , which is a characteristic feature of these populations .
although both the populations achieved combined probability of match ( pm ) in the order of 10 to 10 , it would be reasonable to implement a
correction while using this data in forensic casework , as recommended by the national research council ( 1996 ) and by foreman and lambert .
population differentiation test for each population pair per locus revealed significant difference in the allele frequency distribution for most of the loci ( table 4 ) between chakma and tripura populations .
both chakma and tripura populations also showed significant difference in the allele frequency distribution with the mainstream bengali population when compared with previously published data from this lab . among
the populations tho1 locus showed least differentiation whereas , highest differentiation was observed in d18s51 locus which was followed by d2s1338 locus ( table 4 ) .
the present study was undertaken from the standpoint of compiling own - population genetic database , owing to the fact that population and subpopulation differences at str loci of forensic interest are growing up . in this context
, we embarked on compiling the allele frequency database of two ethnolinguistic populations of bangladesh .
the obtained high combined pm and pe values demonstrated that str loci employed in sgm plus pcr amplification kit would be highly efficient for personal identification and paternity cases in spite of some population substructuring . besides forensic benefits , we find this study very useful for regional and worldwide human population meta - analysis .
|
allele frequencies of ten autosomal str loci , d3s1358 , vwa , d16s539 , d2s1338 , d8s1179 , d21s11 , d18s51 , d19s433 , th01 , and fga were investigated in chakma and tripura tribal populations of bangladesh . in both the populations ,
all loci were in hardy - weinberg equilibrium except for fga locus in chakma and d21s11 in tripura .
all the loci were highly polymorphic in chakma population with an observed heterozygosity ( ho ) of > 0.7 and moderately polymorphic in tripura population ( ho > 0.6 ) .
however , both the population showed least polymorphism at th01 locus ( ho < 0.6 ) . a comparison between chakma and tripura population data revealed statistically significant differences in allele frequency distribution for most of the loci . a similar comparison with the mainstream bengali population using previously published data from this lab also showed significant difference in allele frequency with these two tribal populations .
|
between 36% and 44% of the adult population show signs of pyrosis once a month and 18% take antacids to control the symptoms .
although open surgery is effective in controlling reflux , it was not until the advent of esophageal manometry studies and minimally invasive surgery techniques that the surgical treatment of gerd became popular .
these therapeutics have focused mainly on augmenting the lower esophageal sphincter ( les ) and by paying less attention to the role of other physio - pathological factors that intervene in this pathology .
the objective of this project was to evaluate the physiological alterations produced after laparoscopic surgery for gerd and its possible clinical implications .
from may 1996 until january 2000 , 13 patients diagnosed with gerd were treated surgically .
six were men and 7 were women with an average age of 37.76 years ( range 16 to 64 ) .
all of the patients in this series experienced thoracic pain , 11 had pyrosis as a dominant symptom ( 84.6% ) , and one had signs of nocturnal coughing as a cardinal symptom ( 7.69% ) .
the diagnosis was confirmed with upper endoscopy and esophageal biopsy , high quality radiological series with contrast and 24-hour ph monitoring for all of the patients .
a synectics 4-channel polygraph , connected to 4 pressure transducers connected to an n 12 fr 4-channel catheter , which used polygram software for windows for the esophageal manometry analysis , was also used .
the ph studies were performed with a synectics digitrapper mk iii apparatus , which was connected to a synectics multi - purpose anti - ammonium catheter with 1 electrode , along with a module for analyzing the esopha - gram of the reflux that was included in the polygram program for windows. all of the above required a monitor with a resolution of 800 * 600 and an mmx 32 mb ram pentium processor with a windows 95 program .
second - degree esophagitis was diagnosed in 5 patients , and third - degree esophagitis was diagnosed in 5 patients .
of the 13 patients , a sliding hiatal hernia was diagnosed in 10 cases ( 76.9% ) . in 2 patients ,
the demeester test was normal , and in the 11 remaining ones , the test score was above 14 points with an average of 113.3 points ( 17 to 200 points ) . from the manometric point of view , 8 patients had damage to the esophageal pump that was expressed as abnormal values in motility , characterized by alterations in the primary peristaltic waves .
the percentage of primary peristaltic waves in these 8 patients was 39.2% , with a range from 10% to 78% ( normal value > 60% ) with an average pressure per wave of 40 mm hg , with a range from 24.6 mm hg to 55 mm hg ( normal value : 60 to 140 mm hg ) , and a normal wave morphology of 7.4% with a range from 0% to 10% .
the average pressure for the les was 6.9 mm hg ( normal value : 14 mm hg ) .
a complete fundoplication of the nissen - rossetti type was performed by laparoscopic means in the 5 patients with a normal esophageal pump , and in the 8 remaining patients who had damage to the esophageal pump , a partial fundoplication of the toupet type was performed by means of a laparoscopy . with the patient in a gynecological position ,
the surgeon placed himself between the patient 's legs with his first assistant to his left and the second assistant to his right .
the abdominal cavity was initially entered in all cases by the hasson technique , inserting the trocar and cannula in the midline , 1/3 of the distance between the umbilicus and xyphoid process .
pneumoperitoneum was created with co2 insufflation and a 30 laparoscope was introduced by the first assistant . immediately afterwards
and under direct vision , two 10-mm trocars were introduced at the clavicular midlines , parallel to the first portal , which were handled by the surgeon .
a fourth 10-mm trocar was introduced into the left anterior axillary line , parallel to the previous ones .
the fourth port , which was managed by the second assistant , permitted the gastric fundus to be retracted during dissection of the hiatus and allowed for esophageal traction after the esophagus was encircled with a latex drain .
a fifth trocar , in the subxiphoid position , was manned by the second assistant who retracted the left lobe of the liver and exposed the phrenoesophageal membrane . in all of the patients ,
the fundoplication was performed over a n 51 fr esophageal bougie , and included a diaphragmatic crurroraphy . under no circumstances
for the patients with toupet fundoplication , 6 stitches with ethibond 2 - 0 were made on the right side including 3 stitches on the esophagus - stomach - right abutment of the diaphragm and 3 stitches on the left side from the stomach to the esophagus .
the posterior esophageal channel was left free , and a 270-posterior fundoplication with gastropexy was performed . in 3 patients ,
after 24 hours , an esophagram was performed with an iodine water soluable contrast to evaluate the esophagus , the gastric - esophageal junction , and the gastric fundus for possible perforation . if the esophagram was interpreted as normal , liquids were given and the nasogastric probe was retrieved . in 7 of these 8 patients ,
six men and 2 women , average age 32.3 years ( range 16 to 64 years ) , were operated on with the toupet technique . in all cases ,
the average postoperative manometric results from the series were as follows : primary peristalsis 76.4% ( 45% to 100% ) ; length of the wave 57 mm hg ( 27.4 to 68.8 mm hg ) ; percentage of normal waves ( morphology ) 45.8% ( 10% to 75% ) ; and les pressure 18.8 mm hg .
these results were evaluated by using a nonparametric test ( wilcoxon test ) , p = 0.05906 for both primary peristalsis and the percentage of normality of the wave . for the length of the wave p = 0.1056 .
pre- and postoperative manometric values all of the patients have satisfactory control of gerd without the need for antireflux medication . in no case was dysphagia or gas bloat syndrome present .
all of the patients indicated that they could burp , and 2 of them had an episode of vomiting which they did without difficulty .
postoperative upper endoscopic studies confirmed that the patients were cured in 100% of the cases .
laparoscopic procedures have proven the efficiency and certainty of gerd surgical management . in the current study , age distribution was similar to that of other series but with a lower average age .
the choice of patients who will benefit from the surgical treatment for gerd as well as the selection for the type of procedure to be performed depends on a careful preoperative evaluation in which esophageal manometry studies are fundamental
. a complete study of esophageal motility must include evaluation of the superior and inferior esophageal sphincters as well as an evaluation of the esophageal body ( esophageal pump ) .
for this , the following parameters must be considered : the length of the contractions , the morphology of the wave ( wave length and velocity ) , and the primary esophageal peristalsis ( morphology and number of contractions ) .
seven of the 13 ( 53.8% ) patients in our study had alterations in the esophageal pump .
this advanced condition can be attributed to the fact that in our area , surgical intervention for patients with gerd is delayed due to the opposition of gastroenterologists to surgical procedures .
for this reason , patients reach the surgeon with more esophageal damage due to reflux that has lasted for a longer period of time . in our series of patients with esophageal pump alterations , we elected to perform a partial toupet fundoplication .
our objective was to improve les pressure as much as possible to prevent reflux without creating an obstruction to esophageal emptying .
we can not define the parameters , which precisely determine when the esophageal pump is considered inadequate .
the normal values of the manometry equipment are considered a reference point and when 2 or more of the parameters to be evaluated are below the normal values , the possibility of esophageal emptying ( clearance ) is considered deficient .
although our series was small , in studies with a higher number of patients , it has been established that posterior partial fundoplications are sufficient to treat gerd .
for this reason , our postoperative findings , in which significant improvement in esophageal physiology was obtained with an improved efficiency in the esophageal pump and with adequate les pressure , correlated clinically and endoscopically with 100% control of the disease without any need for medication .
this leads us to question whether nissen fundoplication which can lead to dysphagia and the gas bloat syndrome , is justified in patients with an adequate esophageal pump .
these results indicate that good esophageal clearance along with sufficient les pressure can be obtained after toupet fundoplication and physiological reflux episodes can be easily controlled .
we suggest that patients with a good esophageal pump are candidates for a 270-posterior - partial fundoplication , which avoids the inconveniences produced by the 360 fundoplication of a nissen type .
|
objective : the purpose of this study was to evaluate the changes in esophageal physiology that are produced after laparoscopic surgery in patients with gastroesophageal reflux disease ( gerd).methods : from may 1996 until january 2000 , 13 patients with gerd underwent antireflux laparoscopic surgery . in 8 patients ,
preoperative manometric studies showed motility disorders characterized by a decrease in the percentage of primary peristaltic waves ( 32% average ) , a reduction in the pressure of the waves ( 40 mm hg average ) , and a decrease in the percentage of the physiological waves ( 7.4% average ) .
laparoscopic toupet fundoplication was the surgical procedure used in all cases , without complications and with a good postoperative course .
esophageal manometry was performed 8 weeks after the operation in 7 patients.results:the results revealed an increase in the percentage of primary peristaltic waves ( 76.4% average ) ( p = 0.05906 wilcoxon test ) ; an increase in the wave pressure ( 57 mm hg average ) ( p = 0.1056 ) ; and an increase in the percentage of the physiological waves ( 45.8% average ) ( p = 0.05906).conclusion : our final conclusion was that antireflux laparoscopic surgery , in this specific case the toupet ( partial ) fundoplication , induced recovery in esophageal motility in those patients with peristaltic alterations due to reflux .
this plays an important role in disease control because the recovery of esophageal peristalsis allows an increase in its emptying and reduces the possibility of esophageal damage by reflux episodes that could persist even though a fundoplication was constructed .
|
translation of ideas from bench to the clinic needs a verification and validation step where molecular diagnostic modalities are substantial tools in developing new tracers , drug design and therapeutic regimens . in the last few years
, there was a tremendous change and focus on the development of new microscale imaging systems of spatial resolution and detection sensitivity that relatively cope with the requirements of imaging small animals such as mice and rats .
the focus was not only on instrumentation but also was accompanied by contrast agents / probes / biomarkers that target specific biological processes .
similarly , as these molecular agents are developed to suit particular biochemical targets , there are corresponding imaging techniques able to detect this particular signal .
the molecular imaging arena has been revolutionized also by hybridization / fusion of these techniques into single imaging devices .
the best example that can be drawn from the literature as well as from the clinical practice is the recent implementation of pet / ct and ( spect / ct ) in clinical oncology and other important areas of disease detection
. apparent pet / mri implementation and direct incorporation in routine practice is still controversial and active research is underway and its spread in the market will be determined in the near future . however , there are emerging promising approaches that are undergoing extensive research work and investigation ( with some successful results ) for possible translation into the clinic .
these include contrast - enhanced molecular ultrasound with molecularly targeted contrast microbubbles , optical imaging with fluorescent molecular probes , raman spectroscopy / microscopy and more recently , photoacoustic imaging ; a hybrid optical and ultrasound technique ( see [ 24 ] for review ) .
nuclear medicine has an established role in this context and tomographic tools such as single photon emission computer tomography ( spect ) and positron emission tomography ( pet ) have their significant contribution to the world of molecular imaging [ 4 , 5 ] .
however , anatomical techniques such as ct and mri through their high spatial resolution capabilities serve to identify morphological changes in small structures .
when these imaging modalities are combined in one imaging session , the amount of information obtained can synergically and significantly improve the diagnostic process and its outcome when compared to a single diagnostic technique .
another important aspect of preclinical imaging is the ability to study the physiology over several time points referred to as longitudinal studies .
a significant reduction of cost , number of animals as well as reduction of intervariability among subjects are among the most important outcomes of this technology .
thus , one can avoid animal dissection , ex vivo tissue counting and other autoradiographic studies .
diagnostic modalities can generally be distinguished based on whether they are structural or functional imaging techniques . computerized tomography ( ct ) and magnetic resonance imaging ( mri )
are well - known diagnostic tools that provide very high structural information of the tissue under investigation when compared to functional techniques such as spect or pet .
mri provides better soft tissue contrast even in absence of contrast media , a feature that is absent in ct scanning .
ultrasound procedures use high - frequency ultrasound waves to differentiate between different anatomical structures and safe ( radiationless ) diagnostic imaging technique . however , it has less functional or physiological significance when compared to nuclear modalities .
optical imaging such as bioluminescence and fluorescence are also functional modalities , but their limited spatial resolution , limited penetration capabilities and other factors contribute to their unease of transition to clinical practice .
the relative weaknesses and strengths that exist among imaging techniques are important to be understood .
one can notice that the spatial resolution of mri and ct is significantly higher than that of spect and pet .
however , the detection sensitivity of spect and pet is significantly higher than those given by structural modalities and moreover can detect tracer concentration in the picomolar or nanomolar range .
both approaches use the tracer principal to detect physiological abnormality or disturbed biochemical process .
the first should have high specific , as well as sensitive characteristics to optimally study a molecular or cellular phenomenon .
the imaging device is a radiation detector with specific performance to localize activity distribution within the human body or the animal .
the most commonly used instrument in spect imaging is the conventional gamma camera that was invented in the middle of the last century by anger .
however , for detection of coincidence events and localization of pet - administered compounds , a pet scanner is normally used .
both imaging devices have witnessed a significant change in the last decade in terms of performance characteristics as well as diagnostic quality .
on the other hand , mri techniques do not relay on ionizing radiation , and thus , it is one of the features that characterize magnetic resonance procedures over other methods . because of these inherent differences , there has been a large interest to combine more than one or two modalities into one imaging system able to morphologically and functionally address pathophysiologic questions .
the present review will generally discuss many aspects of small animal micro - spect ( spect ) imaging including instrumentation , molecular imaging probes used in preclinical and clinical practice , and the last section will cover some important and valuable preclinical applications . before this discussion , the author would like to outline some major differences that exist between spect and pet imaging . in clinical practice , almost all nuclear medicine procedures that use single photon emission tracers rely on the use of the gamma camera .
it is a gamma ray position sensitive detector that typically consists of large slab of scintillator crystal with position circuitry and energy determination . to localize the emission site of the released photons ,
a multihole collimator is mounted on the front face of the system to provide a spatial correlation of the detected events .
hal anger introduced the gamma camera as a novel detection technique able to localize an activity distribution of an administered radionuclide .
however , his original prototype in 1953 was a camera in which a photographic x - ray film was in contact with nai(tl ) intensifying screen .
he used a pinhole collimation and small detector size to project the distribution of gamma rays onto the scintillation screen .
initially , the camera was used to scan patients administered by therapeutic doses of 131-i .
disadvantages of this prototype were ( 1 ) small field of view of the imaging system ( 4 inch in diameter ) and ( 2 ) poor image quality unless a high injected dose or long exposure time are applied . in 1958 , anger succeeded in developing the first efficient scintillation camera , and marked progress in the detection efficiency was realized by using an nai(tl ) crystal , photomultiplier ( pmt ) tubes , and a larger field of view . spatial resolution and detection sensitivity are two important performance characteristics that play an important role in molecular imaging research using spect and pet tracers .
although the clinical gamma camera can provide a tomographic resolution of about 10 mm , some preclinical spect scanners can provide a submillimeter spatial resolution pushing down to subhalf millimeters using a specialized dedicated multipinhole geometry .
this situation is different in clinical and preclinical pet imaging where the spatial resolution of preclinical pet scanners is about 1 - 2 mm while that of clinical pet scanners lies in the range of 46 mm .
dedicated brain pet scanners , however , can achieve a slightly better spatial resolution ( 2.5 mm ) in the centre field of view .
these resolution differences are mainly due to the fact that spect systems are not affected by some physical and fundamental limits that hinder the pet camera to reach sub - millimeter ranges although some research groups were able to achieve a resolution of less than 1 mm using fine segmented lutetium orthosilicate ( lso ) crystal .
many factors serve to impact the final reconstructed images of data acquired from a pet scanner .
these are crystal size , positron range , photon acollinearity , intercrystal interaction and scatter , depth of interaction and the reconstruction algorithm . in preclinical pet machines
, positron range appears to be the most important challenge that needs to be tackled to improve the spatial resolution of the pet images .
however , the current generation of clinical pet scanners is slightly affected by the positron range , but correction of the phenomenon was shown to be effective in positron emitters of high maximum kinetic energy [ 1012 ] .
the gamma camera relies on hardware collimators to determine the photons trajectory and hence able to localize the emission site by analyzing the electronic signal detected by the imaging detector .
this hardware collimation plays a significant role in reducing the overall system sensitivity as well as the spatial resolution .
the intrinsic resolution of gamma camera is about 3 - 4 mm and tomographic spect acquisition reveals a spatial resolution , as mentioned above , not better than 10 mm .
however , a new trend of designing semiconductor systems is emerging in the field , providing a significant improvement in spatial resolution , and other performance measures [ 13 , 14 ] .
spect degrading factors have been extensively studied in the literature and , namely , include attenuation , scatter and resolution effects , in addition to motion artifacts .
apart from the later , most of these physical issues can be resolved in great part by the use of spect / ct systems .
these imaging degrading factors have a relatively smaller impact on the overall image quality in small animal imaging due to the smaller size of the rodents ( mouse 2040 g , rat 250550 g ) in comparison to standard human ( 75 kg ) .
nevertheless , correction for photon attenuation , scatter and partial volume would collectively improve the detection and estimation task .
this is particularly important for small structures and in small energy radionuclides such as i-125 .
unlike pet , single photon emitting radiopharmaceuticals have several features in the context of molecular imaging such as cost and wide availability of the radioligands as well as relative ease of labeling .
small animal imaging using preclinical scanners and pet radiopharmaceuticals showed better capability in tracer kinetic studies when compared to its spect counterparts .
furthermore , small animal pet scanners showed a large axial field of view such that distant tissues / organs can be covered when image derived input function such as left ventricle is sought for calculations .
hal anger used a pinhole collimation which is an important element when we come across spect imaging . the early work done on small animal imaging using spect
tracer was to use a gamma camera equipped with pinhole collimator(s ) of very small aperture size .
although parallel hole is the most commonly used collimator in many nuclear medicine procedures , pinhole imaging has a well - recognized role particularly for small organs such as thyroid and parathyroid imaging . in bone joints as well as in some pediatric studies
, pinhole can also improve the spatial resolution by magnifying small structures of different tracer uptakes .
in recent years , pinhole geometry was found an increasing interest in designing spect scanners with superb spatial resolution and this has been attained by minimizing the aperture size to sub - millimeter range and specialized collimator geometry . however , the cost paid for this improved spatial resolution is a reduction of the detection efficiency .
the later was partially tackled by increasing the number of holes for improvement of count collection and statistical quality .
pinhole geometry is not similar to parallel hole geometry where one - to - one magnification is achieved .
the geometric magnification provided by pinhole geometry is a function of the object distance from the aperture as well as distance of the aperture from the detector surface in addition to the effective aperture diameter .
nothing is free , this takes place with a reduction of the imaging field of view .
another problem encountered when pinhole collimator is used in tomographic acquisition is data insufficiency and the resulting images could suffer from reconstruction errors .
image reconstruction using iterative techniques have solved many problems that were not possible to achieve with analytic approaches . in clinical and preclinical arena involving both spect and pet imaging ,
iterative reconstructions were found superior to analytic approaches in many aspects of diagnostic quality and quantitative accuracy .
spect imaging has received large benefit from the use of iterative reconstruction by incorporating as many degrading factors in the system matrix . besides its treatment to image noise , iterative reconstruction for
edge penetration and parallax errors can also be modeled in the reconstruction scheme reducing the blurring effect allowing for enhanced spatial resolution .
a conventional gamma camera can be used by manufacturing pinhole collimators of very small aperture size .
the other alternative is to use pixilated detectors that have better intrinsic properties or semiconductor detectors that fit with the resolution requirements of small animal imaging and , meanwhile , better than that provided by the conventional gamma camera .
regardless of their cost , semiconductor detectors are more compact and allow for system portability and can be manufactured in pixilated structure providing better spatial resolution . using a large field of
view gamma camera serves to improve the magnification by providing large projection area onto the detector surface for the subject under investigation .
however , some recent scanners are implementing pixilated detectors that have an intrinsic resolution equivalent to the segmentation size .
this , to some extent , obviates the need to use detector width of size equivalent to the standard clinical gamma camera .
thallium - activated sodium iodide nai(tl ) crystal is the conventional scintillator used in most clinical designs .
however , there are also some scintillators that have been used such as cesium iodide - thallium doped and cesium iodide - sodium doped and yttrium aluminum perovskite ( csi(tl ) , csi(na ) , and yap , resp . )
. new designs of photodetectors such as position sensitive pmt , avalanche photodiode and position sensitive avalanche photodiode can be of value in spect systems .
for example , funk et al . have designed a multipinhole small animal imaging based on position sensitive avalanche photodiode ( psapd ) detectors coupled to csi(tl ) scintillator .
the system showed submillimeter spatial resolution and high detection efficiency when compared to dual head gamma camera , permitting shortened acquisition time and a reduced injected dose .
several designs were proposed for pinhole geometry , including rotating gamma camera , stationary detector but rotating collimators , or completely stationary camera . in u - spect ii
( milabs , the netherlands ) , the three - headed gamma cameras is equipped with interchangeable multihole collimators that can achieve high spatial resolution .
the collimator is cylindrical in shape with relatively large number of pinholes ( i.e. , 75 ) , providing a good count collection for the high spatial resolution .
a resolution of 0.35 mm can be achieved with an aperture size of 0.35 mm while a spatial resolution of 0.45 mm can be obtained with a 0.6 mm gold pinhole aperture size .
the values are less in case of rat imaging ( 0.8 mm ) using the standard whole body rat collimator .
a recent release of the milab company is the simultaneous acquisition of spect and pet tracers with resolution that can reach below 1 mm for the former .
the scanner is a trimodality imaging system that has three imaging modules namely pet , spect and ct .
the spect portion can be two or four 150 mm 150 mm nai(tl ) pixilated detectors ( 2.2 mm pitch ) and 10 mm crystal thickness .
the heads can be equipped with various parallel - hole , single- or multipinhole collimators , including mouse general body as well as mouse brain imaging with possible submillimeter spatial resolution .
the triumph trimodality scanner ( gamma medica , inc ) is an integrated spect / pet / ct hardware and software platform designed for small animals in preclinical and biomedical research applications .
the system combines pet ( labpet ) , spect ( x - spect ) and ct ( x - o ) modalities .
the spect module utilizes solid - state cadmium zinc telluride ( czt ) detector technology .
the spect system accommodates single and multiple pinhole collimators as well as parallel hole collimators to address a broad range of study needs .
it can be configured to have 1,2,3 or 4 czt cameras providing a variety of spatial resolution , detection sensitivity , and scanning field of view .
the bioscan system has a four - detector head that consist of nai(tl ) crystal .
the scanner uses the spiral path to scan the object ( 24 to 270 mm ) and also has stationary and circular detector motion .
it has a variety of collimator options that can reach < 1 mm spatial resolution in addition to high detection sensitivity .
it uses a patented multiplexed - multipinhole collimator design that can reach 36 pinholes or eve more . commercially available spects are shown in figure 2 .
spect scanners can produce functional images with high spatial resolution ; however , anatomical correlation using structural imaging modalities is still needed .
in addition to spect / ct and spect / mri other hybrid systems such as spect - optical devices have also been investigated [ 23 , 24 ] .
the common underlying idea is to get and extract more information about the biological question in one imaging session and preferably with the same spatial and/or temporal framework .
they produce high resolution anatomical images in addition to generating a subject - specific attenuation map able to correct for photon attenuation .
mri machines can have a better soft tissue contrast , not relying on ionizing radiation , and provide high spatial resolution as mentioned earlier .
microct ( ct ) has been advanced in the last few years providing a spatial resolution in the order of few microns .
a resolution of 10 m or even better can be achieved giving more insights into structural abnormalities for in vivo as well as ex vivo samples .
nowadays , ct is not only for attenuation and anatomical localizations but the benefits were extended to blood vessels imaging which is known as ct angiography .
a number of reports were recently released discussing the utility of ct in many preclinical applications [ 25 , 26 ] .
spect / mri systems were also designed , and it is worthy mentioning that image of the year 2008 ( in the annual meeting of the society of nuclear medicine ) was selected where diabetic feet using spect were coregistered with the patient mri providing anatomolecular diagnosis of the extent and location of the disease . in preclinical context , the interest was given to pet / mri rather than spect / mri .
however , new photodiodes that are less prone to magnetic fields can be very helpful in such designs .
molecular imaging is an emerging field of study that deals with imaging of disease on a cellular or genetic level rather than on a gross level . with the emergence of the new field of molecular imaging
, there is an increasing demand for developing sensitive and specific novel imaging agents that can rapidly be translated from small animal models into patients .
spect and pet imaging techniques have the ability to detect and serially monitor a variety of biological and pathophysiological processes , usually with tracer quantities of radiolabeled peptides , drugs , and other molecules at doses free of pharmacologic side effects .
rimps are highly specific radiolabeled imaging agents used to visualize , characterize , and measure biological processes in living systems .
the ultimate goal of molecular medicine is to treat the disease in its early stages with an appropriate patient - specific targeted molecular therapy . in order to achieve this goal , it is essential to develop highly specific rmips . in the design and development of an ideal rmip , it is important to identify first a molecular imaging probe ( mip ) , which may be a biochemical or a synthetic molecule , specific for a biological process ( such as metabolism , angiogenesis , and apoptosis ) or a molecular target ( such as hexokinase , thymidine kinase , and neuroreceptor ) in an organ , or tissue of interest .
general rules for the design of rmipsan ideal rmip should be designed to fulfill the following characteristics .rapid plasma clearance to reduce blood pool background in the target tissue.rapid washout or clearance from non specific areas.low nonspecific binding and preferably no peripheral metabolism.high membrane permeability and intracellular trapping.target specificity and high affinity for molecular targets.specific activity must be high to prevent saturation of specific binding sites.tissue distribution , localization , and target binding should be favorable for developing simple kinetic modeling to estimate quantitative data.radiation dosimetry of rmip must be favorable for multiple diagnostic imaging studies ( if necessary).synthesis of rmip must be rapid and suitable for automation using automated synthesis modules .
an ideal rmip should be designed to fulfill the following characteristics .rapid plasma clearance to reduce blood pool background in the target tissue.rapid washout or clearance from non specific areas.low nonspecific binding and preferably no peripheral metabolism.high membrane permeability and intracellular trapping.target specificity and high affinity for molecular targets.specific activity must be high to prevent saturation of specific binding sites.tissue distribution , localization , and target binding should be favorable for developing simple kinetic modeling to estimate quantitative data.radiation dosimetry of rmip must be favorable for multiple diagnostic imaging studies ( if necessary).synthesis of rmip must be rapid and suitable for automation using automated synthesis modules .
tissue distribution , localization , and target binding should be favorable for developing simple kinetic modeling to estimate quantitative data .
radiation dosimetry of rmip must be favorable for multiple diagnostic imaging studies ( if necessary ) .
synthesis of rmip must be rapid and suitable for automation using automated synthesis modules .
radiolabeling of rmipsgenerally , the radiolabeling process of molecular imaging agents can be categorized as follows.isotope exchangewhere the preparation is obtained by direct exchange of stable atom(s ) of an element in a molecule with one or more nuclide of a radioisotope of the same element.introduction of foreign elementthis is the most common method of radiolabeling of rmips , however , the rmip will have a chemical structure and in vivo behavior different from that of the parent mip.metal chelationin this method , a chelating agent ( radiometal such as tc and in ) is being introduced into an organic compound producing a ligand with different biological and chemical features than both the conjugated two partners . certain peptides and monoclonal antibodies
can successfully be labeled by the metal chelation procedure but only in the presence of a bifunctional chelate ( bfc ) by conjugation with the peptide or protein first and then bind the radiometal to the bfc conjugated molecule .
generally , the radiolabeling process of molecular imaging agents can be categorized as follows.isotope exchangewhere the preparation is obtained by direct exchange of stable atom(s ) of an element in a molecule with one or more nuclide of a radioisotope of the same element.introduction of foreign elementthis is the most common method of radiolabeling of rmips , however , the rmip will have a chemical structure and in vivo behavior different from that of the parent mip.metal chelationin this method , a chelating agent ( radiometal such as tc and in ) is being introduced into an organic compound producing a ligand with different biological and chemical features than both the conjugated two partners . certain peptides and monoclonal antibodies
can successfully be labeled by the metal chelation procedure but only in the presence of a bifunctional chelate ( bfc ) by conjugation with the peptide or protein first and then bind the radiometal to the bfc conjugated molecule . where the preparation is obtained by direct exchange of stable atom(s ) of an element in a molecule with one or more nuclide of a radioisotope of the same element .
this is the most common method of radiolabeling of rmips , however , the rmip will have a chemical structure and in vivo behavior different from that of the parent mip . in this method , a chelating agent ( radiometal such as tc and in )
is being introduced into an organic compound producing a ligand with different biological and chemical features than both the conjugated two partners .
certain peptides and monoclonal antibodies can successfully be labeled by the metal chelation procedure but only in the presence of a bifunctional chelate ( bfc ) by conjugation with the peptide or protein first and then bind the radiometal to the bfc conjugated molecule .
classification of rmipsbased on their clinical utility and the nature of application for which they are designed as tools in the drug development program , four classes of rmips have been identified .radiolabeled drug substance in which the cold stable atom is replaced by a radioisotope of the same element , which can be used for assessing the pharmacokinetics and biodistribution of the parent drug.radioligand with good binding affinity for a biological target , which can be used to evaluate the effect of other unlabeled compounds at that target.pathway marker interacting with one component of a set of related biological molecules , which may be used to probe the overall status of that system.biomarker , or surrogate marker , which provides a more general readout at the level of cell or organ for a specific biological process .
based on their clinical utility and the nature of application for which they are designed as tools in the drug development program ,
four classes of rmips have been identified .radiolabeled drug substance in which the cold stable atom is replaced by a radioisotope of the same element , which can be used for assessing the pharmacokinetics and biodistribution of the parent drug.radioligand with good binding affinity for a biological target , which can be used to evaluate the effect of other unlabeled compounds at that target.pathway marker interacting with one component of a set of related biological molecules , which may be used to probe the overall status of that system.biomarker , or surrogate marker , which provides a more general readout at the level of cell or organ for a specific biological process . radiolabeled drug substance in which the cold stable atom is replaced by a radioisotope of the same element , which can be used for assessing the pharmacokinetics and biodistribution of the parent drug .
radioligand with good binding affinity for a biological target , which can be used to evaluate the effect of other unlabeled compounds at that target .
pathway marker interacting with one component of a set of related biological molecules , which may be used to probe the overall status of that system .
biomarker , or surrogate marker , which provides a more general readout at the level of cell or organ for a specific biological process .
( 1 ) radiolabeled monoclonal antibodies ( mabs)antibodies are immunoglobulins ( ig ) produced in vivo in response to the administration of an antigen to a human or animal tissue and bind specifically to this antigen forming an antigen - antibody complex .
since the advent of hybridoma technology for production of moabs in 1975 which was designed originally as an in vivo tumor localizing agents , only few have reached a point of proven clinical utility .labeling of mabs can be accomplished with several radionuclides , among which in-111 , tc-99 m , i-131 , i-123 , and i-125 , where most of them are commonly used in nuclear medicine and listed in table 1 . a number of monoclonal labeled antibodies using in-111 or y-90 radionuclides are described in table 2 .
antibodies are immunoglobulins ( ig ) produced in vivo in response to the administration of an antigen to a human or animal tissue and bind specifically to this antigen forming an antigen - antibody complex . since the advent of hybridoma technology for production of moabs in 1975 which was designed originally as an in vivo tumor localizing agents ,
only few have reached a point of proven clinical utility .labeling of mabs can be accomplished with several radionuclides , among which in-111 , tc-99 m , i-131 , i-123 , and i-125 , where most of them are commonly used in nuclear medicine and listed in table 1 . a number of monoclonal labeled antibodies using in-111 or y-90 radionuclides are described in table 2 .
( 2 ) tc - labeled monoclonal antibodies
arcitumomab ( cea scan)carcinoembryonic antigen ( cea ) or cea - scan kit ( introduced by mallinckrodt medical ) as a single dosage kit contains the active ingredient fab fragment of arcitumomab , a murine monoclonal antibody immu-4 .
cea is expressed in a variety of carcinomas , particularly of the gastrointestinal tract ( git ) and can be detected in the serum .
immu-4 is specific for the classical 200 kda cea that is found predominantly on the cell membrane .
tc - cea - scan complexes the circulating cea and binds to ces on the cell surface .
fab fragment of arcitumomab is cleared rapidly by urinary tract and plasma clearance due to its small particular size .
the immu-4 antibody is targeted against the carcinoembryonic antigens of the colorectal tumors , and , therefore , tc - cea - scan is used for the detection of recurrence and/or metastatic carcinomas of the colon or rectum particularly when high levels of cea are detected .
sulesomab ( leukoscan)the kit vial contains the active ingredient fab fragment , called sulesomab , obtained from the murine monoclonal antigranulocyte antibody , immu - mn3 . it is a single - dose kit introduced by immunomedics europe in 1997 .
tc - sulesomab targets the granulocytes , and therefore is primarily used to detect infection and inflammation , particularly in patients with osteomyelitis , joint infection involving implants , inflammatory bowel disease , and diabetic patients with foot ulcers .
annexin v ( apomate)annexin v is a human protein with a molecular weight of 36 kda has a high affinity for cell membranes with bound phosphatidyl serine ( ps ) . in vitro assays
have been developed that use annexin v to detect apoptosis in hematopoietic cells , neurons , fibroblasts , endothelial cells , smooth muscle cells , carcinomas , and lymphomas .
tc - annexin v has also been suggested as an imaging agent to detect thrombi in vivo , because activated platelets express large amounts of ps on their surfaces .
arcitumomab ( cea scan)carcinoembryonic antigen ( cea ) or cea - scan kit ( introduced by mallinckrodt medical ) as a single dosage kit contains the active ingredient fab fragment of arcitumomab , a murine monoclonal antibody immu-4 .
cea is expressed in a variety of carcinomas , particularly of the gastrointestinal tract ( git ) and can be detected in the serum .
immu-4 is specific for the classical 200 kda cea that is found predominantly on the cell membrane .
tc - cea - scan complexes the circulating cea and binds to ces on the cell surface .
fab fragment of arcitumomab is cleared rapidly by urinary tract and plasma clearance due to its small particular size .
the immu-4 antibody is targeted against the carcinoembryonic antigens of the colorectal tumors , and , therefore , tc - cea - scan is used for the detection of recurrence and/or metastatic carcinomas of the colon or rectum particularly when high levels of cea are detected .
sulesomab ( leukoscan)the kit vial contains the active ingredient fab fragment , called sulesomab , obtained from the murine monoclonal antigranulocyte antibody , immu - mn3 . it is a single - dose kit introduced by immunomedics europe in 1997 . the labeling yield should be more than 90% .
tc - sulesomab targets the granulocytes , and therefore is primarily used to detect infection and inflammation , particularly in patients with osteomyelitis , joint infection involving implants , inflammatory bowel disease , and diabetic patients with foot ulcers .
annexin v ( apomate)annexin v is a human protein with a molecular weight of 36 kda has a high affinity for cell membranes with bound phosphatidyl serine ( ps ) . in vitro assays have been developed that use annexin v to detect apoptosis in hematopoietic cells , neurons , fibroblasts , endothelial cells , smooth muscle cells , carcinomas , and lymphomas .
tc - annexin v has also been suggested as an imaging agent to detect thrombi in vivo , because activated platelets express large amounts of ps on their surfaces .
carcinoembryonic antigen ( cea ) or cea - scan kit ( introduced by mallinckrodt medical ) as a single dosage kit contains the active ingredient fab fragment of arcitumomab , a murine monoclonal antibody immu-4 .
cea is expressed in a variety of carcinomas , particularly of the gastrointestinal tract ( git ) and can be detected in the serum .
immu-4 is specific for the classical 200 kda cea that is found predominantly on the cell membrane .
tc - cea - scan complexes the circulating cea and binds to ces on the cell surface .
fab fragment of arcitumomab is cleared rapidly by urinary tract and plasma clearance due to its small particular size .
the immu-4 antibody is targeted against the carcinoembryonic antigens of the colorectal tumors , and , therefore , tc - cea - scan is used for the detection of recurrence and/or metastatic carcinomas of the colon or rectum particularly when high levels of cea are detected .
the kit vial contains the active ingredient fab fragment , called sulesomab , obtained from the murine monoclonal antigranulocyte antibody , immu - mn3 .
tc - sulesomab targets the granulocytes , and therefore is primarily used to detect infection and inflammation , particularly in patients with osteomyelitis , joint infection involving implants , inflammatory bowel disease , and diabetic patients with foot ulcers .
annexin v is a human protein with a molecular weight of 36 kda has a high affinity for cell membranes with bound phosphatidyl serine ( ps ) . in vitro assays
have been developed that use annexin v to detect apoptosis in hematopoietic cells , neurons , fibroblasts , endothelial cells , smooth muscle cells , carcinomas , and lymphomas .
tc - annexin v has also been suggested as an imaging agent to detect thrombi in vivo , because activated platelets express large amounts of ps on their surfaces .
( 3 ) radiolabeled peptideshigh background activity difficulties which usually appear when imaging with radiolabeled mabs which is attributed to the slow tumor uptake and plasma clearance due to their relatively large molecular sizes .
this can be mitigated by peptides whose molecular size is smaller than that of proteins and where the peptidases can act for rapid excretion by degradation of the peptides .
peptides have been labeled with in and tc in the same manner of the monoclonal antibodies .
high background activity difficulties which usually appear when imaging with radiolabeled mabs which is attributed to the slow tumor uptake and plasma clearance due to their relatively large molecular sizes .
this can be mitigated by peptides whose molecular size is smaller than that of proteins and where the peptidases can act for rapid excretion by degradation of the peptides .
peptides have been labeled with in and tc in the same manner of the monoclonal antibodies .
metabolic imaging can be achieved using natural or exogenous radiolabeled substrates which participate in the particular metabolic process .
the design of such tracers is based on the physiological concepts such as turnover of oxygen , glucose , amino acids , fatty acids , or dna precursors .
commonly , i and tc derivatives are used as spect tracers for this function , however , the obvious chemical changes occur with this conjugation which can alter the physiological properties of the tracer module limits their application in molecular imaging .
( 1 ) glucose metabolismalthough there are intensive research trials to find a sugar derivative labeled with i and tc , none of these were able to provide an spect substitute for f - fdg to act as glucose metabolism imaging agent [ 5153 ] .
although there are intensive research trials to find a sugar derivative labeled with i and tc , none of these were able to provide an spect substitute for f - fdg to act as glucose metabolism imaging agent [ 5153 ] .
( 2 ) amino acid metabolismdiagnosis of various neurological diseases as well as tumor evaluation ( detection , grading and therapy monitoring ) can be obtained by quantitative assessment of protein synthesis rate that is provided when using radiolabeled amino acids as a radiolabeled molecular imaging probe ( rmip ) . radiolabeled
amino acids pass the blood - brain barrier and are accumulated in tissues via a specific amino acid transport system .
l-3-i - iodo--methyltyrosine ( i - imt ) is a good example of radiolabeled amino acids , it is evidenced that it accumulates in the brain via a specific facilitating l - amino acid transport system . in analogy with pet , imt is not incorporated into proteins and its uptake reflects amino acid transport .
imt can be prepared by electrophilic substitution via in situ oxidation of i - iodide by chloramines - t , hydrogen peroxide , iodogen , or iodate with radiochemical yields of 70%80% .
diagnosis of various neurological diseases as well as tumor evaluation ( detection , grading and therapy monitoring ) can be obtained by quantitative assessment of protein synthesis rate that is provided when using radiolabeled amino acids as a radiolabeled molecular imaging probe ( rmip ) . radiolabeled
amino acids pass the blood - brain barrier and are accumulated in tissues via a specific amino acid transport system .
l-3-i - iodo--methyltyrosine ( i - imt ) is a good example of radiolabeled amino acids , it is evidenced that it accumulates in the brain via a specific facilitating l - amino acid transport system . in analogy with pet , imt is not incorporated into proteins and its uptake reflects amino acid transport .
imt can be prepared by electrophilic substitution via in situ oxidation of i - iodide by chloramines - t , hydrogen peroxide , iodogen , or iodate with radiochemical yields of 70%80% .
( 3 ) nucleosides metabolism ( gene reporter imaging)nucleosides or nucleoside analogs can be transported across the cell membrane by selective transporters and can then be phosphorylated intracellularly by specific kinases to the corresponding phosphate derivatives , and , ultimately , they can be incorporated into dna . as thymidine kinase 1 ( tk1 ) shows an s - phase dependant expression ,
the intracellular accumulation of labeled nucleosides that are substrates for tk1 reflects dna synthesis and thus tumor proliferation .
i-131- and i-124- labeled 2-arabino - fluro-5-iodo-2-deoxyuridine ( fiau ) has been used successfully as nucleoside analog for tumor proliferation detection .
nucleoside derivatives that are selective substrates for herpes simplex virus thymidine kinase ( hsvtk ) have been developed for the in vivo visualization of transgene expression using the hsvtk gene as a reporter gene .
radioiodine labeled uracil compounds ( e.g. , fiau ) are widely applicable derivatives .
nucleosides or nucleoside analogs can be transported across the cell membrane by selective transporters and can then be phosphorylated intracellularly by specific kinases to the corresponding phosphate derivatives , and , ultimately , they can be incorporated into dna . as thymidine kinase 1 ( tk1 ) shows an s - phase dependant expression ,
the intracellular accumulation of labeled nucleosides that are substrates for tk1 reflects dna synthesis and thus tumor proliferation .
i-131- and i-124- labeled 2-arabino - fluro-5-iodo-2-deoxyuridine ( fiau ) has been used successfully as nucleoside analog for tumor proliferation detection .
nucleoside derivatives that are selective substrates for herpes simplex virus thymidine kinase ( hsvtk ) have been developed for the in vivo visualization of transgene expression using the hsvtk gene as a reporter gene .
( 4 ) hypoxia imaginghypoxia , a condition of insufficient o2 to support metabolism , occurs when the vascular supply is interrupted , as in stroke or myocardial infarction , or when a tumor outgrows its vascular supply .
when otherwise healthy tissues lose their o2 supply acutely , the cells usually die , whereas when cells gradually become hypoxic , they adapt by upregulating the production of numerous proteins that promote their survival .
these proteins slow the rate of growth , switch the mitochondria to glycolysis , stimulate growth of new vasculature , inhibit apoptosis , and promote metastatic spread .most
nitroimidazoles can be used as probes to detect hypoxia as they are reduced intracellularly in all cells , but in absence of adequate supply of o2 , they undergo further reduction to more reactive products which bind to cell components and are finally trapped in the hypoxic tissue .
tc - o - propylene - amine - oxime ( tc - pano or bms-181321 ) was validated as a proper hypoxia imaging agent in hypoxic myocardium , acutely ischemic brain and solid tumors .
bms-194796 and tc - hl91 have also been designed as rmip for imaging hypoxia , however , none of these three probes has been commercially available . iodine-123
labeled iodoazomycin arabinoside ( iaza ) has been validated in animal model in the preclinical phase , but no clinical studies with this agent have been reported so far .
hypoxia , a condition of insufficient o2 to support metabolism , occurs when the vascular supply is interrupted , as in stroke or myocardial infarction , or when a tumor outgrows its vascular supply .
when otherwise healthy tissues lose their o2 supply acutely , the cells usually die , whereas when cells gradually become hypoxic , they adapt by upregulating the production of numerous proteins that promote their survival .
these proteins slow the rate of growth , switch the mitochondria to glycolysis , stimulate growth of new vasculature , inhibit apoptosis , and promote metastatic spread .
nitroimidazoles can be used as probes to detect hypoxia as they are reduced intracellularly in all cells , but in absence of adequate supply of o2 , they undergo further reduction to more reactive products which bind to cell components and are finally trapped in the hypoxic tissue .
tc - o - propylene - amine - oxime ( tc - pano or bms-181321 ) was validated as a proper hypoxia imaging agent in hypoxic myocardium , acutely ischemic brain and solid tumors .
bms-194796 and tc - hl91 have also been designed as rmip for imaging hypoxia , however , none of these three probes has been commercially available . iodine-123
labeled iodoazomycin arabinoside ( iaza ) has been validated in animal model in the preclinical phase , but no clinical studies with this agent have been reported so far .
( 5 ) cell labelingthe most common applications of in-111 are in labeling blood cells ( white blood cells ( wbc ) and platelets ) for imaging inflammatory processes and thrombi . in blood cell labeling ,
the plasma transferrin competes for the in-111 and reduces the labeling efficiency because in-111 binds with higher efficiency to transferrin than blood cells , and , therefore , isolation of the desired blood component from plasma permits easy labeling of either platelets or wbcs .
tc - hmpao is primarily used in brain perfusion imaging , although it is used for leukocyte labeling substituting in - oxine .
stabilization of the tc - hmpao primary complex is required due to the high degradation rate of its radiochemical purity .
this could be achieved by adding stabilizers like methylene blue in phosphate buffer or cobalt ( ii)-chloride to the reaction vials , however , these reagents should not be used when the complex formulation is designed for labeling of leukocytes .
the most common applications of in-111 are in labeling blood cells ( white blood cells ( wbc ) and platelets ) for imaging inflammatory processes and thrombi . in blood cell labeling ,
the plasma transferrin competes for the in-111 and reduces the labeling efficiency because in-111 binds with higher efficiency to transferrin than blood cells , and , therefore , isolation of the desired blood component from plasma permits easy labeling of either platelets or wbcs .
tc - hmpao is primarily used in brain perfusion imaging , although it is used for leukocyte labeling substituting in - oxine .
stabilization of the tc - hmpao primary complex is required due to the high degradation rate of its radiochemical purity .
this could be achieved by adding stabilizers like methylene blue in phosphate buffer or cobalt ( ii)-chloride to the reaction vials , however , these reagents should not be used when the complex formulation is designed for labeling of leukocytes .
( 6 ) iodine-123 as an rmipi-123 is the preferred thyroid imaging agent imparting 1% of thyroid dose per microcurie when compared with i-131 .
i - labeled compounds are commonly used as i - mibg for adrenal scan , i - oih for tubular renal scan , and i - iodoamphetamine ( i- imp ) for cerebral perfusion scan .
i - ioflupane ( datscan ) is a widely used i derivative for detection of the loss of nerve cells in an area of the brain called the striatum which release dopamine , a chemical messenger , and therefore , it will be useful in distinguishing between parkinson 's disease and essential tremor ( tremors of unknown cause ) with a sensitivity of 96.5% .
it is also used to help distinguish between dementia with lewy bodies and alzheimer 's disease with 75.0% to 80.25% sensitivity .dopamine transporter ( dat ) imaging with tropane derivatives such as fp - cit ( i - ioflupane ) and -cit has been developed to directly measure degeneration of dopamine presynaptic terminal and may be used to quantify changes in dat density .
ioflupane binds specifically to structures of the nerve cells ending in the striatum area of the brain that are responsible for the transportation of dopamine .
i-123 is the preferred thyroid imaging agent imparting 1% of thyroid dose per microcurie when compared with i-131 .
i - labeled compounds are commonly used as i - mibg for adrenal scan , i - oih for tubular renal scan , and i - iodoamphetamine ( i- imp ) for cerebral perfusion scan .
i - ioflupane ( datscan ) is a widely used i derivative for detection of the loss of nerve cells in an area of the brain called the striatum which release dopamine , a chemical messenger , and therefore , it will be useful in distinguishing between parkinson 's disease and essential tremor ( tremors of unknown cause ) with a sensitivity of 96.5% .
it is also used to help distinguish between dementia with lewy bodies and alzheimer 's disease with 75.0% to 80.25% sensitivity .
dopamine transporter ( dat ) imaging with tropane derivatives such as fp - cit ( i - ioflupane ) and -cit has been developed to directly measure degeneration of dopamine presynaptic terminal and may be used to quantify changes in dat density .
ioflupane binds specifically to structures of the nerve cells ending in the striatum area of the brain that are responsible for the transportation of dopamine .
the application for imaging modalities in preclinical models is highly valuable as it has a great scope for noninvasively studying dynamic biological processes at the molecular and cellular level .
the noninvasive nature of imaging provides advantages in investigating the onset and the progression of disease , assessing the biological effects of drug candidates and assisting in the development of disease biomarkers and monitoring the therapeutic effectiveness of new treatment and/or pharmaceuticals .
this technology plays a key role in bridging bench studies of disease modelled in vitro to their implementation in clinically relevant animal models of diagnostic or therapeutics for their translation into the clinics .
in fact , the implementation of imaging in rodents has a great relevance because of the widespread use of genetically modified mice in biomedical research and the need to characterise the in vivo anatomical and functional phenotypes of animal disease models .
another advantage of imaging modalities developed for small animals is that the technology can relatively be translated directly for application to clinical practice .
preclinical spect systems have a great scope of applications in cardiovascular research , including the study of myocardial functions ( e.g. , ejection fraction , regional wall motion abnormalities , perfusion , tissue viability , oxygen consumption , and glucose metabolism ) and the investigation of several vascular disorders , including coronary artery disease and related disorders , such as ischemia , infarction and atherosclerosis . moreover , spect has great applications for developing and testing diagnostic tracers which could assist in understanding the prognosis of disorders and assess new therapeutic approaches for cardiovascular lesions .
99mtc - labelled radiopharmaceuticals for spect imaging have been applied to demonstrate tissue viability and perfusion status in animal models of ischemia and/or impaired myocardial perfusion [ 70 , 71 ] .
cardiac and respiratory motion is one of the major challenges when imaging rodent ( mouse heart rate : 400800 beats / min ) .
indeed , ecg - gated micro spect can yield accurate measurements of left ventricle volumes and ejection fraction in rats and mice [ 72 , 73 ] .
another key area is the visualization of necrotic tissues and related tracers during myocardial infarction ( mi ) . some studies have assessed myocardial ischemia in rat heart models after left coronary artery occlusion by using tc - glucarate . in vivo visualization of necrosis may help to detect mi at early stages and may provide a good approach for evaluating the antinecrotic effect of developing drugs for ischemic heart disease . on the same vein , the visualization of apoptotic cell death is another important target for non - invasive imaging .
hence , the development of tracers ( e.g.,tc - annexin ) that bind to apoptotic cells is a very useful tool for in vivo analysis , especially to investigate apoptotic cell death in cardiomyocytes and the efficacy of cell - based therapies .
imaging such a mechanism is important for the understanding of infarct healing and post - mi remodelling .
vascular growth factors such as v3 integrins have been used as targeted tracers to investigate angiogenesis in postinfarct animal models , with in-111-labelled v3 targeted radiotracers in hypoperfused myocardial regions .
another relevant area of cardiovascular imaging is the development of methods to characterise the formation and prognosis of atherosclerotic plaques .
plaque rupture results in severe cardiac events including mi and sudden death , hence , there is an important need for developing tools that can assist in predicting the plaques vulnerability to rupture .
not all the plaques carry the same risk , and the criteria for imaging their vulnerability relies on the detection of inflammatory cell infiltration , platelet aggregation , tissue matrix degradation , large lipid contents and apoptosis . radiolabeled annexin and z2d3 targeted to apoptotic macrophages and smooth muscle cells , respectively ,
have been used as spect tracers to study the pathophysiology of atherosclerosis in animal models [ 77 , 78 ] .
one of the main challenges for imaging plaques is their anatomical localization , as high spatial resolution is needed to image such a small anatomical structure in a motile vessel , hence the importance of co - registering spect acquisition with other imaging modalities such as micro - ct . with advances in research of stem cell - based therapies , the application of imaging technologies may be useful to validate their efficacy and safety in preclinical models , in particular , for studying tracking and engraftment of transplanted cells , assessing their viability , function and differentiation status in addition to monitoring their ability to promote regeneration .
for example , stem cells labelled with the spect radiolabels in - oxyquinoline have been successfully imaged after transplantation in rat and porcine models of myocardial infarction [ 80 , 81 ] , but , because of the short half - life of the radionuclide ( e.g. , tc : 6.02 h ; in : 2.8 days ) and because the activity may still be present after transplantation even if the cell have died , this method may only be applicable for a short - term cell tracking and assessing stem cell homing after transplantation . to investigate not only long - term engraftment of stem cells but also their viability
gene expression is assessed by reporter genes constructs which are translated into a protein and interact with an exogenously given probe ( radiolabeled for spect detection ) , resulting in a signal that can be monitored non - invasively .
reporter genes are incorporated into the cells before transplantation , and if the cell remains alive after engraftment , the protein , which is the main target for the nuclides , will be encoded ( e.g. , enzyme , cell surface receptor ) .
as mentioned earlier , one of the reporter genes mostly used for spect imaging is based on the production of an intracellular enzyme ( e.g. , herpes simplex virus type 1 thymidine kinase [ hsv1tk ] ) that phosphorylates an exogenously administered substrate that is retained in the cell because of its negative charge .
although normal mammalian cells ( without the hsv1-tk ) do carry the enzyme , it only minimally phosphorylates the radionuclide probes used in this system .
conversely , in cells carrying the hsv1-tk , the exogenously administered probe undergoes significant phosphorylation and intracellular retention , leading to a robust signal - to - background ratio and enabling accurate monitoring of these cells .
this imaging approach has been recently used to monitor the distribution of transplanted human embryonic stem cell derivatives in a live mouse model over a long period of time , up to 3 months .
another approach consists of the encoding of the sodium - iodide symporter ( nis ) , a thyroid transmembrane protein that , under physiologic conditions , transports iodine into the cells in exchange for sodium .
it has the advantage that it can be used for pet ( with i as the tracer ) and spect imaging ( using i or tc - pertechnetate as tracer ) .
this approach has been used to monitor activity of cardiac - derived stem cells after transplantation to a rat infarct model , confirming the visualization of cells up to 6 days after transplantation . with rapid advances in stem cell research , and with high demands for testing their regenerative potential in preclinical model , noninvasive stem cell imaging will play a critical role , and we can foresee more studies requiring long - term monitoring of stem cells in preclinical models of disease .
imaging techniques play a potential role in preclinical cancer research , enabling sequential analysis of deep - seated tumors and metastases including studies of basic biological processes , tissue pharmacokinetics and pharmacodynamics responses to treatments .
imaging of cancer cells targets have different biological procedures including overexpression of receptor , activated enzymes or relocated molecules , apoptotic levels , sustained angiogenesis , unlimited replicative potential and invasion of tissue , and metastasis .
imaging gene expression in vivo is very relevant in cancer preclinical models as it allows the characterization of dynamic changes in several deregulated pathways in cancer cells .
as previously mentioned , hsvtk genes are typically used for spect , enabling noninvasive imaging of tumor cell growth as demonstrated in an experimental mouse model for lung metastases expressing after injection of hsv1-tk cells .
this model may be proven very useful for assessment of anticancer and antimetastases therapies in preclinical efficacy models .
another used approach is the imaging receptors that are overexpressed in cancer cells and can be used for prognosis and for following therapeutic targeting .
this has been successfully applied preclinically as well as clinically by targeting prostate - specific membrane antigen ( psma ) .
this receptor is overexpressed on the cell surface of prostate cancer cells and provides a useful target for prostate tumor imaging and therapy . as mentioned previously , radiolabeled monoclonal antibodies , such as in - capromab pendetide ( prostascint ) , are currently available to detect prostate cancer but suffer from problems associated with poor delivery because of their large size .
the feasibility of imaging psma receptor expression with low - molecular - weight , high - affinity psma ligands labeled with [ i ] nai / iodogen for spect was demonstrated in a study using a prostate tumor mouse model .
spect technology is extensively used as a diagnostic tool for bone metastases in the clinic .
bone scintigraphy with tc - labelled diphosphonate is a widely used method for the detection of bone metastases , and other bone disorders .
this technique provides a high sensitivity and is able to survey the whole skeleton but unfortunately does not provide enough anatomical resolution to allow precise localization of the radiotracer high uptake lesion .
the implementation of a spect / ct multimodality system can partly overcome this disadvantage , allowing a coregistration of the functional and the anatomical imaging component , resulting in precise anatomical localisation of the radiotracer .
studies have reported the use of tc-99m - labeled diphosphonates compounds ( e.g. , methylene - diphosphonate ( mdp ) ) to detect metastatic bone lesions in immunocompromised mouse models injected with cancer cells .
overall , the application of spect imaging in cancer research while remaining challenging have already had a remarkable impact providing new insights into the dynamics of cancer growth , invasion , and metastases , being possible to visualize gene expression , molecular pathways and functional parameters in preclinical models of cancer .
the use of spect in preclinical functional neuroimaging provides an excellent application for understanding the pathophysiology of central nervous system ( cns ) disorders , including the mechanisms of neurodegeneration , neuropharmacology related to drug abuse , and testing therapeutic strategies . as mentioned earlier ,
one of the strength of spect over other functional modalities such as the pet is the ability to get a spatial resolution below 1 mm , allowing detailed structural and functional information of different region of the brain in animal models . also , spect radioligands have relative longer half - lives , which permits prolonged dynamic function studies and provides a simultaneous dual tracer imaging .
indeed , specific radioligands have been used to study the dopaminergic , serotonergic , and cholinergic neurotransmission system in vivo .
spect has been applied to study basic mechanisms of degeneration in parkinson 's ( pd ) and alzheimer 's disease ( ad ) .
animal models of neurodegeneration have been used to evaluate novel radioligands and to study their binding in the dopaminergic synapsis . in vivo quantification of the presynaptic dopamine transporter ( dat ) activity which regulates
the synaptic dopamine is feasible in the rat striatum using the i - n--fluoropropyl-2-carbomethoxy-3-(4-iodophenyl)-nortropane ( i - fp - cit ) as a dat radioligand , as outlined earlier .
this technology is of particular interest for investigating the interrelation of synaptic dopamine and dat in animal models of pd .
spect imaging has improved the early diagnosis of ad in patients by detecting the onset of progressive neurodegenerative disorders and vascular brain pathology causing dementia .
the thioflavin derivative , 6-iodo-2-(4-dimethylamino- ) phenyl - imidazo [ 1,2-a ] pyridine , impy , which is readily radiolabeled with i / i [ i ] impy was assessed ex vivo in a transgenic mouse model of ad by labeling the deposition of amyloid plaque that is linked to the pathogenesis of ad , showing a good binding with brain tissue homogenates of confirmed alzheimer 's disease patients .
overall , these preclinical studies support the use of spect for functional imaging in preclinical models of cns disorders , facilitating the efficacy of translational studies into this field with a direct relevance for developing clinical diagnostic tools and efficacious therapies .
preclinical imaging has a key role in the drug development , in particular for validating drug targeting , safety , and efficacy .
one of the main applications is the validation in drug binding assays to specific targeted areas , by directly labeling a drug to determine its distribution and pharmacokinetics .
this approach is very useful for validating delivery roots and the specificity of novel therapeutic drugs or imaging agents .
spect imaging has been applied to measure the binding potential of targeted nuclide [ i ] iodobenzamide to the dopamine transporters in the rat brain after specific treatments .
similarly , tc - labeled liposomes migration has been studied after intratumoral administration to tumor xenograft models in nude rats .
specific skeletal targeted probes ( 125i labeled ) were investigated with particular emphasis on the pharmacokinetics and biodistribution following intravenous administration .
this has proved to be of great potential for validating the efficacy of animal models of osteoporosis and other skeletal diseases .
imaging technologies are also very useful for safety validation , as they can measure the functional response of organs to a tested drug candidate , providing information on any toxic or secondary effects related to the treatment .
radiopharmaceuticals that bind to apoptotic cells ( e.g. , tc - annexin ) have been used preclinically to validate the possible toxicity effects in developing therapies .
other examples on secondary response to the administration of a candidate drug in preclinical models include measurements in blood flow changes and infiltration of inflammatory cells .
another important application is the development and validation of imaging biomarkers , a surrogate imaging product that simulates a biological compound and/or has some biologic link to the disease process .
these biomarkers are becoming very useful to assess therapeutic actions of pharmaceuticals , providing a non - invasive imaging tool for validating the efficacy of treatment .
advances in proteomics and genomics are leading to the discovery of new biomarkers , promoting the use of functional imaging for their validation and translation into the clinics .
recent advances in dedicated preclinical systems are able to provide high spatial and temporal resolution as well as high detection efficiency with more potentiall for further improvement .
reliable animal models that , mimic human diseases is another innovative field that when combined with spect technology will reveal more insights into early disease detection , development of new tracers / therapeutics and treatment strategy .
spect imaging has a large potential in molecular medicine , and many novel approaches are expected in the near future .
|
molecular imaging has witnessed a tremendous change over the last decade .
growing interest and emphasis are placed on this specialized technology represented by developing new scanners , pharmaceutical drugs , diagnostic agents , new therapeutic regimens , and ultimately , significant improvement of patient health care .
single photon emission computed tomography ( spect ) and positron emission tomography ( pet ) have their signature on paving the way to molecular diagnostics and personalized medicine .
the former will be the topic of the current paper where the authors address the current position of the molecular spect imaging among other imaging techniques , describing strengths and weaknesses , differences between spect and pet , and focusing on different spect designs and detection systems .
radiopharmaceutical compounds of clinical as well - preclinical interest have also been reviewed .
moreover , the last section covers several application , of spect imaging in many areas of disease detection and diagnosis .
|
the autonomic innervation of the heart is rich and asymmetric.1 ) the postganglionic parasympathetic neurons are primarily located in the fat pads , whereas the postganglionic sympathetic nerves originate from the extracardiac sites , the stellate ganglia , and the sympathetic trunks , and course along the great arteries .
canine hearts have three well - known epicardial fat pads that contain cardiac ganglionated plexi ( gp ) of the autonomic nervous system .
the major gps are the right pulmonary vein ( rpv ) fat pad ( the so - called sinus nodal fat pad ) , the inferior vena cava - left atrium ( ivc - la ) fat pad [ the so - called atrioventricular ( av ) nodal fat pad ] , and the superior vena cava ( svc)-aorta fat pad ( the so - called third fat pad ) , which are referred to as the " head station."2 ) in the human heart , the existence and location of epicardial fat pads also seem to be similar with those of the canine heart.3)4 ) both vagal and sympathetic stimulation can shorten the atrial effective refractory period ( erp ) , action potential duration , and re - entrant wavelength .
vagal activation also affects the duration of the refractory period and the heterogeneity of refractoriness .
the initiation and maintenance of atrial fibrillation ( af ) are highly dependent on these electrophysiologic characteristics ; therefore , they could be important in the pathophysiology of af .
the effects of denervation on ventricular arrhythmia has been evaluated in animal models by several investigators.5 ) the effects on af has also been introduced using animal models .
af was not inducible after major epicardial fat pad ablation.2 ) fat pad ablation was also achievable by a transvenous approach to suppress af.6 ) in humans , gp ablation combined with pv isolation has a reasonable success rate.7 - 9 ) botulinum toxin ( bt ) is a neurotoxin produced by clostridium botulinum , which functions as zinc - binding metalloendopeptidases .
the mechanism of action is blocking of exocytotic release of acetylcholine stored in synaptic vesicles.10 ) therefore , bt blocks cholinergic neurotransmission , which is important in postganglionic neurons .
injection of bt into the sinus nodal fat pad blocks bradycardia mediated by parasympathetic activation in the dog heart.11 ) this study was designed to elucidate the acute effects of blocking the right atrium - pulmonary vein ( ra - pv ) and left atrium - inferior vena cava ( la - ivc ) fat pads on the electrophysiologic characteristics of the atrium and af inducibility with bt .
this study protocol was approved by the seoul national university hospital institutional animal care and use committee .
eight adult male mongrel dogs weighing 15 - 20 kg were studied . following standard and approved protocols ,
all dogs were anesthetized with thiopental ( 20 mg / kg iv ) , intubated , and oxygenated followed by gaseous anesthesia ( 1 - 2% isofluorane / o2 ) .
all measures were taken to ensure that discomfort , distress , pain , and injury were limited to that which was unavoidable .
intermittent arterial blood gas measurements were obtained and ventilator adjustments were made to correct any metabolic abnormalities .
an electrical heating pad was used to maintain body the temperature at 36 - 37. bilateral cervical vagal stimulation ( vs ) was applied using stainless steel electrodes ( model 6491 , unipolar pediatric temporary pacing lead ; medtronic , minneapolis , mn , usa ) at intensities sufficient to double the sinus cycle length .
typical parameters for the cervical vs trains were a frequency of 20 hz , a pulse width of 0.2 ms , and a current amplitude of 4 - 10 v with a grass stimulator ( s-88 ; astro - med , warwick , ma , usa ) . a median thoracotomy was performed .
after exposure of the posterior side of the heart , bt ( 50 u/1 ml in each fat pad of six dogs allergan , inc . ,
irvine , ca , usa ) or normal saline ( ns , 1 ml in each fat pad of two dogs ) was injected epicardially to the entire visible areas of the two major epicardial fat pads ( rpv and ivc - la fat pads ) .
the dose of bt used in this study was within the range of the usual clinical dose , therefore the systemic effects were insignificant .
the locations of both fat pads are illustrated in a previous report.12 ) the needle tip was positioned manually at several points on the epicardial surface of the fat pads under direct visual control to ensure optimal injection .
the study protocol was applied before bt or ns injection and repeated 1 , 2 , 3 , 4 , and 5 hours later .
electrocardiographic and atrial electrograms were amplified and filtered from 0.05 - 500 hz , and were displayed and recorded on a prucka cardiolab ep system ( ge medical systems , fairfield , ct , usa ) .
two epicardial pacing electrodes ( capsure epi , medtronic , minneapolis , mn , usa ) were placed at the right atrial free wall .
av nodal function was evaluated by measuring the ventricular response rate during rapid atrial pacing ( rap ) with 50-ms cycle length , mimicking the ventricular response during af .
the sinus and ventricular rate was calculated using the average rr interval of 20 beats .
af inducibility was evaluated with burst pacing using 200 impulses at a 50-ms cycle length , which was performed 4 times in each animal during vs. spontaneous af that lasted > 30 seconds after the end of the burst stimulation was defined as sustained .
the incidence of sustained af expressed as a percent of the total attempts was defined as af inducibility .
this study protocol was approved by the seoul national university hospital institutional animal care and use committee .
eight adult male mongrel dogs weighing 15 - 20 kg were studied . following standard and approved protocols ,
all dogs were anesthetized with thiopental ( 20 mg / kg iv ) , intubated , and oxygenated followed by gaseous anesthesia ( 1 - 2% isofluorane / o2 ) .
all measures were taken to ensure that discomfort , distress , pain , and injury were limited to that which was unavoidable .
intermittent arterial blood gas measurements were obtained and ventilator adjustments were made to correct any metabolic abnormalities .
bilateral cervical vagal stimulation ( vs ) was applied using stainless steel electrodes ( model 6491 , unipolar pediatric temporary pacing lead ; medtronic , minneapolis , mn , usa ) at intensities sufficient to double the sinus cycle length .
typical parameters for the cervical vs trains were a frequency of 20 hz , a pulse width of 0.2 ms , and a current amplitude of 4 - 10 v with a grass stimulator ( s-88 ; astro - med , warwick , ma , usa ) .
a median thoracotomy was performed . after exposure of the posterior side of the heart , bt
, irvine , ca , usa ) or normal saline ( ns , 1 ml in each fat pad of two dogs ) was injected epicardially to the entire visible areas of the two major epicardial fat pads ( rpv and ivc - la fat pads ) .
the dose of bt used in this study was within the range of the usual clinical dose , therefore the systemic effects were insignificant .
the locations of both fat pads are illustrated in a previous report.12 ) the needle tip was positioned manually at several points on the epicardial surface of the fat pads under direct visual control to ensure optimal injection .
the study protocol was applied before bt or ns injection and repeated 1 , 2 , 3 , 4 , and 5 hours later .
electrocardiographic and atrial electrograms were amplified and filtered from 0.05 - 500 hz , and were displayed and recorded on a prucka cardiolab ep system ( ge medical systems , fairfield , ct , usa ) .
two epicardial pacing electrodes ( capsure epi , medtronic , minneapolis , mn , usa ) were placed at the right atrial free wall .
av nodal function was evaluated by measuring the ventricular response rate during rapid atrial pacing ( rap ) with 50-ms cycle length , mimicking the ventricular response during af .
the sinus and ventricular rate was calculated using the average rr interval of 20 beats .
af inducibility was evaluated with burst pacing using 200 impulses at a 50-ms cycle length , which was performed 4 times in each animal during vs. spontaneous af that lasted > 30 seconds after the end of the burst stimulation was defined as sustained .
the incidence of sustained af expressed as a percent of the total attempts was defined as af inducibility .
the sinus nodal function was suppressed during vs. vs reduced the sinus rate ( 5714% vs. non - vs ) before fat pad injection . the effect on sinus rate reduction
the denervation effect of bt on the sinus node was significant 3 hours after bt injection .
the av nodal function was also suppressed during vs. the ventricular response rate during vs was reduced to 3922% in comparison to non - vs .
af was significantly reduced 3 hours after injection , and af was not induced at 4 and 5 hours in the bt group ( fig .
2 ) ; however , suppression of af inducibility was not observed in ns group .
the sinus nodal function was suppressed during vs. vs reduced the sinus rate ( 5714% vs. non - vs ) before fat pad injection . the effect on sinus rate reduction
the denervation effect of bt on the sinus node was significant 3 hours after bt injection .
the av nodal function was also suppressed during vs. the ventricular response rate during vs was reduced to 3922% in comparison to non - vs .
af was significantly reduced 3 hours after injection , and af was not induced at 4 and 5 hours in the bt group ( fig .
2 ) ; however , suppression of af inducibility was not observed in ns group .
this is the first study to evaluate the effects of gp blocking using bt on af inducibility in the dog .
the vs effects on the sinus node and af inducibility were significantly eliminated a few hours after bt injection .
these findings suggest that short - term denervation of the atria may be achievable by bt in this canine model .
long - term effects of gp block utilizing radiofrequency ablation on cardiac innervation might be difficult to achieve .
it has been demonstrated in an animal model.12 ) in addition , human gp ablation for the management of patients with af has been evaluated by several investigators .
the effectiveness and outcome of gp ablation as a stand - alone therapy do not seem to be as good as conventional pv isolation procedures.13)14 ) however , short - term gp block would be applicable in some clinical field , such as prevention of post - cardiac surgery af , although its mechanism has not been well - established . for this purpose , a temporary gp block without permanent destruction of gp using bt would be a novel management . to consider human application , the safety of the procedure should be evaluated and how long the denervation effects persist should be determined .
one has to keep in mind that we injected bt into only two major epicardial fat pads .
the majority of the right vagal fibers innervate the sinus node and they run predominantly through the rpv fat pad ( anterior right gp ) . in contrast , fewer right vagal fibers reach the av node via ivc - la fat pad ( inferior right gp ) .
there are more gps ( e.g. , superior left gp and inferior left gp ) innervating the left atria and the av node although the ivc - la fat pad would be the major control station of the av node .
therefore effective denervation of the av node might be difficult to achieve by blocking only two fat pads .
such an explanation needs experimental testing by all gps plus the third fat pad block .
we did not block the third fat pad as well as the left - side gps in the present study , as described previously . however , total denervation would not be achievable even with ablation of all these gps , although the completeness of denervation would be higher .
this is because efferent fibers bypassing the gps in dogs have been identified.2 ) therefore a 100% denervation might be impossible in any case .
we did not decentralize the cervical vagal trunks , so we can not rule out the effect of afferent nerve activation .
we did not use sympathetic system blockade , such as beta - blocker or sympathetic ganglia destruction .
thus , sympathetic activation during the procedures might have affected the results of the present study .
however , we successfully kept all vital signs stable in the animals during the experimental procedures
thus , we do not know whether a bt injection affected that erp could be associated with af vulnerability .
short - term autonomic denervation was achieved by blocking the major epicardial gp with bt .
this is the first study to evaluate the effects of gp blocking using bt on af inducibility in the dog .
the vs effects on the sinus node and af inducibility were significantly eliminated a few hours after bt injection .
these findings suggest that short - term denervation of the atria may be achievable by bt in this canine model .
long - term effects of gp block utilizing radiofrequency ablation on cardiac innervation might be difficult to achieve .
it has been demonstrated in an animal model.12 ) in addition , human gp ablation for the management of patients with af has been evaluated by several investigators .
the effectiveness and outcome of gp ablation as a stand - alone therapy do not seem to be as good as conventional pv isolation procedures.13)14 ) however , short - term gp block would be applicable in some clinical field , such as prevention of post - cardiac surgery af , although its mechanism has not been well - established . for this purpose , a temporary gp block without permanent destruction of gp using bt would be a novel management . to consider human application , the safety of the procedure should be evaluated and how long the denervation effects persist should be determined .
one has to keep in mind that we injected bt into only two major epicardial fat pads .
the majority of the right vagal fibers innervate the sinus node and they run predominantly through the rpv fat pad ( anterior right gp ) . in contrast , fewer right vagal fibers reach the av node via ivc - la fat pad ( inferior right gp ) .
there are more gps ( e.g. , superior left gp and inferior left gp ) innervating the left atria and the av node although the ivc - la fat pad would be the major control station of the av node .
therefore effective denervation of the av node might be difficult to achieve by blocking only two fat pads .
such an explanation needs experimental testing by all gps plus the third fat pad block .
we did not block the third fat pad as well as the left - side gps in the present study , as described previously . however , total denervation would not be achievable even with ablation of all these gps , although the completeness of denervation would be higher .
this is because efferent fibers bypassing the gps in dogs have been identified.2 ) therefore a 100% denervation might be impossible in any case .
we did not decentralize the cervical vagal trunks , so we can not rule out the effect of afferent nerve activation .
we did not use sympathetic system blockade , such as beta - blocker or sympathetic ganglia destruction .
thus , sympathetic activation during the procedures might have affected the results of the present study . however , we successfully kept all vital signs stable in the animals during the experimental procedures
thus , we do not know whether a bt injection affected that erp could be associated with af vulnerability .
short - term autonomic denervation was achieved by blocking the major epicardial gp with bt .
|
background and objectivesmajor epicardial fat pads contain cardiac ganglionated plexi ( gp ) of the autonomic nervous system .
autonomic denervation may improve the success rate of atrial fibrillation ( af ) ablation .
this study was designed to elucidate the acute effects of blocking the right atrium - pulmonary vein ( ra - pv ) and left atrium - inferior vena cava ( la - ivc ) fat pads on the electrophysiologic characteristics of the atrium and af inducibility with a botulinum toxin injection.materials and methodseight mongrel dogs were studied .
the ra - pv and la - ivc fat pads were exposed through a median thoracotomy .
botulinum toxin ( bt , 50 u to each fat pad , n=6 ) or normal saline ( ns , n=2 ) was injected in the entire area of two fat pads .
the study protocol was applied before injection and repeated at 1 , 2 , 3 , 4 , and 5 hours thereafter .
the sinus rate , ventricular rate during rapid atrial pacing with a cycle length of 50 ms , and af inducibility were measured with and without vagal stimulation ( vs ) .
bilateral cervical vs was applied ( 20 hz , 0.2 ms , 5.62.0 v ) .
af inducibility was evaluated with burst pacing with 200 impulses at a 50-ms cycle length.resultsvs effects on the sinus node and af inducibility were eliminated a few hours after injection of bt ; these changes were not observed after injection of ns.conclusionshort-term autonomic denervation of the atria was achieved by blocking the major epicardial gp with bt .
|
the rare extraskeletal soft tissue chondromas ( stc ) , also referred to as chondroma of the soft parts , is a benign soft tissue tumor composed mainly of a hyaline cartilage with no connection to the bone or periosteum .
patients with a soft tissue chondroma may present to a dermatologist , surgeon or an orthopedician with a complaint of a hard nodule growing below the skin .
soft tissue chondroma should be considered in the differential diagnosis of any slowly growing mass of the wrist joint .
a 52-year - old male patient presented to the surgery outpatient department , with a well - defined , firm - to - hard , immobile , nontender , subcutaneous swelling over the lateral aspect of the wrist joint of the right hand , since two years .
there was development of mild pain recently , only when he lifted weight with his right hand .
magnetic resonance imaging ( mri ) of the right wrist and hand showed a well - defined , lobulated lesion measuring 5 4 3 cm in the radial aspect of the wrist , appearing t2 hyperintense , with a peripheral t2 hypointense rim , slightly hyperintense on t1 w1 , with a central hypointense area , with no significant post - contrast enhancement [ figure 1a ] .
the mri findings were suggestive of chronic infective arthritis with a differential diagnosis of myositis ossificans and chronic calcified hematoma .
mri right wrist and hand : ( a ) well - defined lobulated lesion measuring 5 4 3 cm in the radial aspect of the wrist , appearing t2 hyperintense , with a peripheral t2 hypointense rim , slightly hyperintense on t1 w1 with a central hypointense area , with no significant post contrast enhancement ; ( b ) the lesion was closely abutting the scaphoid and trapezoid .
fna : ( c ) predominantly chondromyxoid substance showing chondrocytes ( c ) inset showing chondrocytes with mild atypia .
( h and e , 400 ) , ( d ) showing clusters ofchondrocytes with vesicular nucleus and moderate amount of basophilic nucleus ( h and e , 400 ) fine needle aspiration ( fna ) performed on the lesion showed predominantly cartilaginous tissue fragments with abundant chondromyxoid substance [ figure 1c ] .
taking into consideration the clinical , radiological , and cytological findings , a diagnosis of soft tissue chondroma was considered .
intraoperatively it was noted that the swelling was well - demarcated from the surrounding tissues .
postoperatively the patient was disease - free with no evidence of recurrence for six months . on gross examination ,
the swelling was 5 4 3.5 cm , well - defined , lobulated , hard , and glistening white [ figure 2a ] .
macroscopic features of the tumor : ( a ) external surface , the swelling is 5 4 3.5 cm , well - defined , lobulated , and glistening white .
the chondrocytes show mild cytological atypia and areas of myxoid change ( h and e , 100 ) , and ( d ) calcification noted ( h and e , 100 ) on microscopic examination , a well - defined lesion composed of lobules of mature , and at places , immature hyaline cartilage was seen .
focal myxoid areas [ figure 2c ] were seen , with spotty calcification and small areas of enchondral ossification [ figure 2d ] .
few have suggested the origin from the synovial sheath of the long tendons , the paratendinous soft tissues or the para - articular tissues .
intra - articular chondromas , juxtacortical chondromas , and chondromas of soft parts are the three types of extraosseous chondromas .
most stcs have been found to occur around the ages of 30 and 60 years .
the most affected site was the fingers ( 49% ) , followed by the hands ( 15% ) , toes ( 11% ) , feet ( 10% ) , forearms ( 4% ) , and others . in our case
the swelling was seen in a 52-year - old male and was situated on the radial aspect of the wrist joint .
most of the stcs described in literature are less than 3 cm in size . in our case ,
it is worth mentioning that in our case the tumor was at a relatively uncommon site and had a large size , which could hinder arriving at an appropriate diagnosis .
clinically the differential diagnosis should include a ganglion , giant cell tumor of the tendon sheath , fibroma , myositis ossificans , osteochondroma , calcinosis cutis , and chondrosarcoma .
it defines the extent , the contour , the shape , and the intensity of the tumor in relation to the surrounding structures and calcifications , if any .
extraskeletal chondromas usually show intermediate signal intensity on t1-weighted images and high signal intensity on t2-weighted images , in most mri studies .
however , the water content and degree of calcification can differ causing diagnostic difficulties . in our case
the differential diagnosis of chronic calcified hematoma and myositis ossificans was suggested by the radiologist .
it is important to note that only two cases have been reported in the literature , to have undergone fnac for soft tissue chondroma , to determine the diagnosis preoperatively .
the cytological features of soft tissue chondroma mimic those of its malignant counterpart to a considerable extent .
awareness of the cytological features , that is , cellular fragments , chondrocytes showing no or little atypia , and absence of mitosis and binucleation , combined with the clinical and radiological findings , should guide the cytopathologist to make a correct diagnosis of this neoplasm .
histopathologically , the differential diagnosis of soft tissue chondroma includes other cartilaginous lesions such as true cutaneous chondromas , hamartomas , calcifying aponeurotic fibroma , skeletal tumors with cartilaginous differentiation ( osteochondroma , synovial chondromatosis ) , chondroid syringomas , extraskeletal well - differentiated chondrosarcoma , and cutaneous metastases of chondrosarcoma or chondroblastic osteosarcoma .
the histopathological appearance of this neoplasm ranges from an immature pattern dominated by chondroblasts ( resembling osseous chondroblastoma ) to a mature profile with chondrocytes ( resembling osseous enchondroma ) .
the matrix can be hyaline , fibrous or fibrohyaline with granuloma - like areas in the stroma .
the variable cellularity along with cellular immaturity and atypia could mislead one to a malignant pathological interpretation .
however , a soft - tissue chondroma is unlikely to display cords of tumor cells within a myxoid matrix , as found in the extraskeletal myxoid chondrosarcoma or the primitive round - cell pattern .
furthermore , hemangiopericytoid vascularity is characteristic of the extraskeletal mesenchymal chondrosarcoma . in our case , an extraskeletal ,
well - differentiated chondrosarcoma had been excluded by the presence of slow growth clinically , absence of secondary bone involvement and irregular calcification radiologically , and absence of binucleation and mitotic figures cytohistopathologically .
diagnostic errors can be avoided if any soft tissue lesion that can not be diagnosed is regarded as potentially malignant , until proven otherwise . besides a histopathological examination , immunohistochemistry is useful in the diagnosis of stc , as the tumor cells are positive for the s-100 protein and vimentin and negative for epithelial and myoepithelial cell markers .
malignant transformation has not been reported yet . however , recurrence is a potential problem . to prevent local recurrence
it is advisable to remove the tumor completely , including the capsular structure and adhesion sites .
our experience with the present case highlights the significance of detailed clinical , radiological , and cytohistological analysis in soft tissue lesions of the wrist , with an unusually large size .
stc should be considered in patients with a slowly growing , mildly painful , cutaneous nodule in the wrist .
one should also understand the importance of recognizing benign soft tissue chondroma in spite of it exhibiting atypical features , such as pleomorphism and binucleation , cytopathologically .
|
giant soft tissue chondromas ( stcs ) of the wrist are seldom encountered in clinical practice .
precise diagnosis of benign stc may pose diagnostic difficulties on clinical and radiological findings alone .
we encountered a slowly growing soft tissue neoplasm in the radial aspect of the wrist joint of the right hand in a 52-year - old male , masquerading as a calcified hematoma , as suggested by magnetic resonance imaging .
on cytohistopathological examination , it turned out to be a rare giant stc .
the variable cellularity , in conjunction with cellular immaturity and atypia , could mislead one to a malignant pathological interpretation .
diagnosis is based on both radiological and cytohistological evaluation , which is indispensable for determining the tumor type . the detailed clinical , radiological , cytomorphological , and immune - histopathological study
was carried out , which has prompted us to report this case along with a review of the literature .
|
radon and its daughters are amonst the most important sources of natural exposure in the world . based on the epidemiological studies , inhalation of radon
can cause lung cancer particularly in its high - level concentrations , also known as the second leading cause of the cancer [ 1 , 2 ] .
this noble radioactive gas is the daughter of natural radium which is released into the environments through surface waters , soil and rocks and naturally found in groundwater . among the sources , soil has its particular importance due to both radium and thorium which is the thoron parent . in spite of short half - life of the thoron ( less than 1 minute ) in comparison with that of radon ( 3.8 days ) ,
although the radon may be found in any regions , some areas such as kerala in india , cities like yangjiang in china , ramsar in iran , as well as the flinders ranges in australia and the town of guarapari in brazil are known as hnlra due to high level of radon concentrations .
thus the accurate measurements of radon concentration in the soil of the areas are the subject of investigations .
recently , a diffusion chamber has been designed and optimized for passive discriminative measurements of radon / thoron concentrations in the soil .
the method is based upon the measurement by a diffusion chamber , including two lexan polycarbonate ssntds , which can discriminate the emanated radon / thorn from the soil by delay method .
in this research , some comparative measurements ( with active methods ) have been performed in hlnra of ramsar in iran in order to evaluate the capability of the passive method .
as well , the linear regression and correlation between the results of two methods have been studied .
the configuration of passive chamber is shown in figure 1.a . in the chamber ,
the volume is divided by two parts which consist of two fiber glass filters as well as two polycarbonates lexan nuclear track detectors ( film ) .
the distribution of
220
rn within the cylindrical diffusion chamber decreases exponentially with the distance from the entry filter .
as well , only the radon can diffuse through the holes / second fiber glass filter inside of the lower volume and be detected by lower film .
thus the upper film detects both radon and thoron and the lower film can only detect the radon .
the sensitivity of the detectors have been measured by 16.85 and 17.25 track.cm
-2
( kbq.m
-3
day )
-1
values for radon in the lower and upper lexan films respectively , and by 1.76 [ track.cm
-2
( kbq.m
-3
day )
-1
] value for thoron in the upper film .
( a ) configuration of diffusion chamber used for discriminative measurements of radon / thoron .
( b ) method of measurement by means of the chamber inside of deep small well .
electrochemical etching ( ece ) process was applied to magnify the latent tracks on the films .
the etchant solution , pew , consists of 15%koh , 40% c2h5oh and 45% h2o by weight was applied at 25c followed by a 32 kv / cm electrical field strength , 2 khz frequency and duration of 3 h .
the radon and thoron concentrations are calculated by :
ctn=1ktn - utu - tlkrn - ukrn - l2
where crn is the concentration of radon in soil ( kbq / m
3
) , tl is the track density of the lower film ( track / cm
2
) , d is exposure time ( days ) and krn is the related sensitivity ( l for lower film and u for upper film ) .
for the measurements , the chamber has been placed in small wells with depth of 1 m , as shown in figure 1.b in reversed direction for a duration time of two days .
as well , an alpha - guard active measurement system was applied for comparison with the results of the passive measurements . for this aim
, the probe was placed inside of the small wells at 80 cm depth ( figure 2 ) .
alpha guard system ( active method )
the measurements have been performed at 10 different selected points in hlnra of ramsar using both active and passive methods simultaneously .
the points have been selected based upon high concentration measurements of radon in the air at 1 m altitude , and are shown in figure 3 .
the results of both measurements along with the corresponding geographical coordinates of the points have been presented in table 1 .
the concentrations of radon in the soil have been measured within the range of 12.1 to 165 kbq / m
3
values by passive method which is comparable with that of 8.2 to 189.0 kbq / m
3
values for active method .
concentration of radon / thoron which are measured using active and passive method in the soil of ramsar
in figure 4 , the linear regression curve has been shown as solid line for passive versus active method .
considering the x = y line ( dashed line ) , the results show that the measured values obtained by passive method are inconsistent with that of active method in low concentrations , whereas they are under - estimated in that of higher concentrations .
the reason for the under - estimation is that the registered tracks on the film may be overlapped in exposures with higher radon concentrations .
however the correlation value between the results of active and passive methods was measured by 0.99 .
the linear regression curve for two passive and active methods ( solid line ) and comparison with y = x dashed line .
also the thoron concentrations have been measured to be between 1.9 to 29.5 kbq / m
3
values at the points .
a home - made passive diffusion chamber which is based on lexan ssntd has been developed for separated measurements of radon/ thoron in soil .
the sensitivity as well as the strong correlation with active measurements shows that it is appropriate for accurate seasonal measurements of radon and thoron concentration in soil .
the advantages of the method are inclusive of its low - cost , small size chamber , light weight , simple etching process and its capability of being used in an extended range of radon / thoron concentrations , which make it useful for large scale measurements .
|
background : radon and its daughters are amongst the most important sources of natural exposure in the world .
soil is one of the significant sources of radon / thoron due to both radium and thorium so that the emanated thoron from it may cause increased uncertainties in radon measurements .
recently , a diffusion chamber has been designed and optimized for passive discriminative measurements of radon / thoron concentrations in soil .
objective : in order to evaluate the capability of the passive method , some comparative measurements ( with active methods ) have been performed .
method : the method is based upon measurements by a diffusion chamber , including two lexan polycarbonate ssntds , which can discriminate the emanated radon / thorn from the soil by delay method .
the comparative measurements have been done in ten selected points of hlnra of ramsar in iran . the linear regression and correlation between the results of two methods have been studied .
results : the results show that the radon concentrations are within the range of 12.1 to 165 kbq / m3 values .
the correlation between the results of active and passive methods was measured by 0.99 value . as well
, the thoron concentrations have been measured between 1.9 to 29.5 kbq / m3 values at the points .
conclusion : the sensitivity as well as the strong correlation with active measurements shows that the new low - cost passive method is appropriate for accurate seasonal measurements of radon and thoron concentration in soil .
|
cutaneous leiomyomas are benign tumors with smooth muscle differentiation that arise from the arrector pili muscle , the muscular layer of the blood vessels , the tunica dartos , labia majora , or nipples .
three types are recognized , namely piloleiomyoma , dartoic leiomyoma , and angioleiomyoma ; piloleiomyomas being the most common type .
multiple lesions may be arranged in diffuse ( disseminated ) , blaschkoid , or segmental ( zosteriform ) patterns .
patients with piloleiomyoma often complain of pain that may be spontaneous or secondary to cold , pressure , or emotion .
we present here a case of bilateral multisegmental leiomyoma cutis because of the unusual presentation .
a 32-year - old man presented with multiple brownish solid elevations of the skin over the back present for the preceding 6 years .
first appearing on the left side of the lower back , new lesions sequentially developed over the upper back on the same side and lower back on the opposite side .
there was no family history of similar lesions and the patient was otherwise in good health .
clinical examination revealed skin colored to brownish papules and nodules of varying sizes , ranging from 2 mm to 2 cm , distributed over multiple dermatomes strictly respecting the midline . on the left side c6 to t8 dermatomes and on the right side t11 to l1 dermatomes
most papules were discrete whereas some had coalesced to form plaques [ figure 2 ] .
histopathological examination with hematoxylin and eosin staining revealed poorly demarcated interlacing bundles of smooth muscle fibers intermingled with varying amount of collagen under low power magnification [ figure 3 ] .
the muscle fibers contain centrally located , thin , blunt edged nuclei [ figure 4 ] .
special stains and genetic studies could not be performed owing to local unavailability and financial constraints .
based on the distinct clinical and histopathologic findings , a diagnosis of sporadic multisegmental zosteriform leiomyoma cutis was given .
he refused to undergo any active intervention for his nearly asymptomatic condition and was kept under regular follow - up .
clusters of papules and nodules in multisegmental distribution over the back close - up of left mid - back showing discrete and coalescing papules and nodules in a segmental distribution histopathology showing intertwined fascicles of smooth muscles occupying the upper and mid - dermis .
the most common type of presentation of leiomyoma cutis is that of multiple piloleiomyomas . both solitary and multiple piloleiomyomas arise from the arrectores pilorum muscles and occur as grouped , linear , or segmentally distributed firm , red to brown intradermal papules and nodules , which are fixed to the skin , but free from the deeper tissues .
the sites involved are the extensor aspect of the extremities , trunk , face and neck in decreasing order of frequency .
multiple piloleiomyomas may be inherited in an autosomal - dominant fashion and may be associated with uterine leiomyomas and aggressive renal carcinoma , also known as multiple cutaneous and uterine leiomyomatosis ( mcul ) or reed 's syndrome and hereditary leiomyomatosis and renal cell carcinoma ( hlrcc ) , respectively .
the type 1 occurs due to heterozygosity for the underlying mutation with a clinical picture similar to that in a non - mosaic phenotype . in type 2 , loss of heterozygosity causes homo- or hemizygosity , with a pronounced segmental manifestation of lesions .
though the precise molecular mechanisms that lead to the development of multiple cutaneous leiomyomas are unknown , recent studies have demonstrated the mutation of a gene encoding fumarate hydratase , on chromosome 1q42.3 - 43 that predispose individuals to mcul and hlrcc .
there was no family history of uterine or cutaneous leiomyoma in our patient , neither was there any finding suggestive of renal neoplasm affecting the patient himself .
the clinical profile of our patient was suggestive of non - familial type 2 segmental leiomyoma .
patients with piloleiomyoma often have pain that may be spontaneous or secondary to cold , pressure , or emotion .
the precise pathomechanism of pain in leiomyoma cutis is unknown but pressure on nerve fibers and abnormal muscle contraction have been suggested as possible explanations .
histology of piloleiomyoma is characterized by poorly demarcated interlacing bundles of smooth muscle fibers with intermingling collagen fibers of varying amount under low power magnification .
the muscle fibers are mostly straight , with little or no waviness and contain centrally located , thin , very long , blunt edged eel - like nuclei .
treatment of cutaneous leiomyoma depends on the number of lesions and the presence or absence of symptoms .
camouflage with cosmetics and avoidance of exposure to cold may be the only measures required .
when lesions are painful , various pharmacologic agents such as nifedipine , phenoxybenzamine and other alpha-1 blockers and nitroglycerin may be tried alone or in combination . a recent report described carbon dioxide laser ablation therapy of multiple cutaneous leiomyomas with continued pain relief 9 months after operation . in conclusion
, we presented here a case of multi - segmental zosteriform leiomyomas involving dermatomes of both sides .
though segmental distribution of leiomyoma is common , bilateral multi - segmental involvement is extremely rare , and after extensive pubmed search we could locate only one case report of piloleiomyomas showing bilateral multi - segmental distribution . in view of the potential association with aggressive renal carcinoma , patients with multiple leiomyoma cutis should be kept under long - term follow up .
however , bilateral multi - segmental distribution is extremely rare and to the best of our knowledge , this is the second case report of sporadic cutaneous leiomyoma showing bilateral multi - segmental distribution .
|
cutaneous leiomyomas are benign tumors derived from the smooth muscles of the skin .
they are firm , skin - colored to brownish , frequently painful papules and nodules presenting either as a solitary tumor or multiple clustered lesions . uncommon patterns of multiple leiomyoma cutis include linear , zosteriform , or dermatomal - like arrangement of lesions .
we saw a 32-year - old man who presented with clusters of skin colored to reddish brown , occasionally painful papules and nodules distributed segmentally over c6 to t8 dermatomes on left side and t11 to l1 dermatomes on right side .
histopathology confirmed the diagnosis of cutaneous leiomyoma .
the case is reported here for the occurrence of this benign cutaneous neoplasm in an extremely rare bilateral multisegmental distribution .
|
amyloid
disorders are characterized by the aberrant aggregation
of proteins or peptides into amyloid fibrils . in each case ,
normally soluble proteins or peptides that may be
folded , partially folded , or intrinsically disordered embark on alternative
aggregation energy landscapes leading
to the formation of -sheet - rich fibrillar assemblies that can
be characterized by the binding of dyes such as congo red or thioflavin
t ( tht ) .
the identity of the toxic species associated
with amyloid diseases is widely debated as a result of the difficulty
of separating , identifying , and individually characterizing these
heterogeneous and transient intermediates of the assembly process .
human islet amyloid polypeptide ( hiapp ) , also known as amylin ,
is a highly amyloidogenic 37-residue peptide hormone produced by the
-cells of the pancreas .
it is produced , stored , and co - secreted
with insulin and plays a role in the control of gastric emptying ,
glucose homeostasis , and suppression of glucagon release . in its monomeric state
, hiapp is a soluble , intrinsically disordered
polypeptide but forms islet amyloid in cases of type-2 diabetes mellitus
( t2 dm ) .
islet amyloid formation leads to -cell
dysfunction , death , and reduction in -cell mass and contributes to the failure of islet cell transplantation .
hiapp forms amyloid readily at neutral ph , while
rat iapp ( riapp ) does not , despite differing in sequence at only six
out of 37 amino acid positions ( figure 1a ) .
significantly , five of these amino acid substitutions are located
within residues 2029 , three of which are pro residues in riapp ,
leading to supposed disruption of secondary structure formation . despite numerous studies on the conformational
properties , membrane binding , and aggregation of iapp , important challenges remain in
revealing the mechanism of amyloid formation of hiapp , particularly
in the characterization of oligomeric intermediates , which would enable
detailed studies of the mechanisms of assembly and the effects of
known inhibitors on the aggregation process .
both peptides have a
disulfide bridge between cys-2 and cys-7 and have an amidated c - terminus .
residues that differ from those of the human peptide are colored pink
in the rat sequence .
( b ) esi - ims - ms driftscope plot of the hiapp oligomers
present 2 min after diluting the monomer to a final peptide concentration
of 50 m in 20 mm ammonium acetate , ph 6.8 , 37 c , 600
rpm .
esi - ims - ms driftscope plots show ims drift time versus m / z versus intensity ( z = square root scale ) , and the corresponding mass spectrum is shown
on the left - hand side .
numbers adjacent to peaks denote oligomer order ,
with the positive charge state of each oligomer ions in superscript .
the esi mass spectrum shows the 2 + and 3 + charge state ions of hiapp
monomer ( labeled 1 ) and minor amounts of dimer and trimer ( labeled
2 and 3 , respectively ) .
most conventional biophysical techniques used in the study
of amyloid
systems , including cd , ftir spectroscopy , and fluorescence - based assays ,
are limited to providing data relating to a global average of species
within heterogeneous mixtures .
previous analytical ultracentrifugation
studies , conducted at ph 4.9 where aggregation
is very slow , and f nmr studies have failed to detect low order oligomeric species for hiapp , possibly
due to the low population , or heterogeneous and/or transient nature
of such species . by contrast , photoinduced cross - linking has identified
oligomeric states , including monomer through hexamer .
ion mobility spectrometry - mass spectrometry ( ims - ms ) has
the unique advantage of being capable of resolving complex mixtures
of species present in solution , including transiently populated states
and even isobaric species without requiring their prior separation .
ims - ms has been utilized previously to provide insights into the
oligomerization pathways of other intrinsically unstructured amyloid - related
peptides and proteins including amyloid- ( a ) peptide and -synuclein , which are associated
with alzheimer s disease and parkinson s disease , respectively .
in the case of a40 and a42 , oligomeric
species up to and including 16-mer and 12-mer , respectively , have
been identified , and their rotationally averaged collision cross - sectional
areas ( ccs ) were measured using either positive or negative ion ims - ms . for -synuclein ,
the conformeric states of monomers were determined
and the ph dependence of dimer formation was demonstrated .
ims - ms has also provided structural insights
into the hiapp monomer and dimer , as well as the self - assembly of a series of
short synthetic peptides derived from an amyloidogenic sequence ( 2029 )
of hiapp .
using ims - ms and replica - exchange
molecular dynamics ( remd ) simulations , dupuis et al . proposed that
full - length monomeric hiapp occupies both a helix coil conformation
and an extended -hairpin conformation that has a significantly
( 18% ) larger collision cross - section ( ccs ) .
these extended hairpin structures were not observed for riapp , leading
to the conclusion that this conformer is an amyloidogenic precursor .
dupuis et al . also investigated dimeric structures of hiapp , using
ims - ms , reporting that the dimers observed are significantly more
extended than those formed by riapp , suggestive of a higher percentage
of -sheet content that is formed from extended -hairpin - containing
monomers .
an early conformational transition
to -sheet - rich conformers was proposed , therefore , as a first
step in hiapp self - assembly , by contrast with other reports that have
suggested a transition to amyloid via helix - rich oligomers .
none of these studies , however , reported the detection or identification
of higher order species .
a wealth of studies has assessed the
ability of small molecules
to interfere with the progress of fibril formation from many amyloid - prone
peptides and proteins in vitro . despite these analyses ,
currently , there are no clinically
approved inhibitors of hiapp assembly . in addition , the mode of action
of small molecule inhibitors of hiapp aggregation is not well understood .
electrospray ionization ( esi)-ims - ms has been utilized previously
to identify inhibitors of -2-microglobulin ( 2 m ) amyloid formation . using a similar
approach ,
we aimed here to detect , identify , and characterize oligomeric
intermediates of hiapp aassembly and , thereby , to determine the mode
of action of two known small molecule inhibitors of hiapp amyloid
formation , epigallocatechin gallate ( egcg ) and silibinin .
in addition , we used
esi - ims - ms to investigate the moderately effective inhibition caused
by mixing hiapp and riapp .
egcg is one
of the most effective amyloid inhibitors known and has generated considerable attention given its ability
to inhibit or modulate amyloid formation from a diverse range of polypeptides .
despite the plethora of these studies and
the interest they have generated , the mode of action of egcg
is not well understood .
it is thought to direct some , but not all ,
amyloidogenic proteins into off - pathway aggregates . here
, using esi - ims - ms , we demonstrate the presence of high
order
oligomers formed by both hiapp and riapp and use this technique to
determine the populations , shapes , and gas - phase stabilities of these
co - populated , transient species .
the results reveal significant differences
in the stability of otherwise similarly organized oligomers of these
peptides .
in addition , the binding of the small molecule inhibitors ,
egcg and silibinin , to specific conformers within the dynamic ensemble
of hiapp species has also been ascertained , and the progress of oligomer
formation and fibril assembly and disassembly was monitored . the results
indicate that ligand binding either arrests oligomerization ( silibinin )
or diverts hiapp onto new assembly routes resulting in the formation
of amorphous aggregates without a buildup of oligomeric species ( egcg ) .
the results presented provide evidence for the mode of action of these
two effective small molecule inhibitors of hiapp amyloid formation
and reveal why riapp is such a poor inhibitor of hiapp assembly .
lyophilized peptide samples were dissolved in dimethyl sulfoxide
( dmso ) at a final concentration of peptide of 5 mm .
after 24 h of
incubation at 25 c , stock solutions were diluted 100-fold into
20 mm ammonium acetate , ph 6.8 , to a final peptide concentration of
50 m for ms analysis .
all samples were incubated at 37 c in 96-well plates
with or without agitation ( 600 rpm ) .
experiments were repeated at
a range of iapp concentrations , from 10 m to 100 m .
as expected , there is a concentration - dependence of the rate of fibril
formation and oligomer consumption as measured using esi - ims - ms .
however ,
the oligomers formed are of the same mass and ccs under each condition . a synapt hdms quadrupole time - of - flight
mass spectrometer ( micromass uk ltd . , waters corpn . , manchester , u.k . ) ,
equipped with a triversa ( advion biosciences , ithaca , ny , u.s . ) automated
nano - esi interface , was used for these analyses .
positive ion mode
was chosen because iapp has a pi of > 9 and therefore should be
predominantly
positively charged at near - neutral ph .
the instrument has a traveling - wave
ims device situated in - between the quadrupole and the time - of - flight
analyzers and has been described in detail elsewhere .
samples were analyzed by positive ionization nanoesi ( nesi )
with a capillary voltage of 1.7 kv and a nitrogen nebulizing gas pressure
of 0.8 psi .
the following instrumental parameters were used : cone
voltage 30100 v ; source temperature 60 c ; backing pressure
4.0 mbar ; ramped traveling wave height 720 v ; traveling wave
speed 400 m / s ; ims nitrogen gas flow 20 ml / min ; ims cell pressure
0.55 mbar .
the cone voltage was optimized to transmit the higher order
peptide oligomers ; the ccs of the oligomers did not alter over the
range 30100 v. data were processed by use of masslynx v4.1
and driftscope software supplied with the mass spectrometer .
calibration of the drift time cross - section
function was achieved by analysis of the denatured proteins equine
cytochrome c and horse heart myoglobin ( 10 m
in 50:40:10 , v / v / v , acetonitrile / water / acetic acid ) , whose ccs values had been predetermined elsewhere by
use of conventional ion mobility measurements .
the collision cross - sectional areas ( ) of
the analytes were then obtained after calibration from their corrected
drift times according to eq 1:1this step also includes an
adjustment for the mass and charge of the protein ions , where
is the calibrated collision cross - section , a is the
calibration determined constant , td
is the absolute drift time ( corrected ) , z is the
charge state of the ion , mion is the mass
of the ion , and mgas is the mass of the
target gas used in the ims cell .
collision induced
dissociation ( cid ) ms / ms experiments were performed
using the quadrupole analyzer to select isobaric m / z ions representing the dimer and tetramer , separating
these ions in the ims device and performing cid in the transfer collision
cell prior to the time - of - flight analyzer ( the pressure in the collision
cell was kept constant ) . increasing collision energy was applied to
the transfer collision cell in 10 v increments from 10 to 100 v until
the oligomers ions were completely dissociated into monomer ions .
cid energies are displayed as center of mass energy ( ev ) by use of
the eq 2:2where z is the charge state
of the ion , ems is the collision energy
used ( ev ) , margon is the mass of argon
the collision gas , and mion is the mass
of the analyte of interest . note that the equation is missing a multiplication
factor of e , elementary charge ( 1.602 10 c ) .
this has been omitted as conversion of the zevms from joules to electron volts is facilitated
by division of e. a mixed sample containing a
1:1 molar ratio of hiapp : riapp was prepared by diluting 5 mm stock
solutions of each peptide in dmso 100-fold into 20 mm ammonium acetate ,
ph 6.8 , to a final concentration of each peptide of 50 m in
1% ( v / v ) dmso for ms analysis . after 5 days of incubation at 37 c
and 600 rpm , mixed samples were centrifuged in a beckman ultracentrifuge
at 300,000 g for 45 min .
fibrillar samples in the
pellet were depolymerized by incubation in 100% ( v / v ) hfip for 24
h. samples were air - dried and then redissolved in 50:40:10 ( v / v / v )
acetonitrile / water / acetic acid , and fibril constituent peptides were
identified by esi - ms .
hiapp
( 50 m ) was dissolved in 20 mm ammonium acetate ( ph 6.8 ) containing
5 , 50 , or 500 m egcg or silibinin in 1% ( v / v ) dmso . for analysis
of these samples by nesi - ms ,
data were acquired over the range m / z 4008,000 . for ims - ms experiments ,
the wave height was ramped from 7 to 20 v at a speed of 300 m / s .
samples were prepared
in a 96-well plate ( corning costar 3915 , corning life sciences , amsterdam ,
the netherlands ) sealed with clear sealing film and were incubated
in a fluostar optima plate reader ( bmg labtech , aylesbury , bucks ,
u.k . ) for 5 days at 37 c with or without agitation ( 600 rpm ) .
samples had a volume of 100 l containing 100 m tht and
50 m peptide in 20 mm ammonium acetate , ph 6.8 and a 1% ( v / v )
final concentration of dmso .
fluorescence was excited at 440 nm , and
emission intensity was measured at 485 nm .
turbidity measurements
were performed by monitoring the apparent absorbance at 635 nm using
a nephalostar galaxy reader ( bmg labtech , aylesbury , bucks , uk ) and
96-well clear plates sealed with clear sealing film . for these experiments ,
the samples were prepared as described above , except that tht was
not included . in each experiment readings
were taken every 5 min ,
from 2 min to 50 h. in parallel , samples were analyzed at different
time points ( but in the absence of tht ) using esi - ims - ms .
each experiment
under each condition was repeated a minimum of three times with at
least triplicate measurements for each condition , and representative
traces are shown . the tem images
of each 50 m peptide solution were acquired after 5 days of
incubation at 37 c on a cm10 microscope ( phillips , electron
optics , amsterdam , the netherlands ) .
carbon grids were prepared by
irradiating under uv light for 30 min and stained with 4% ( w / v ) uranyl
acetate solution as described previously .
to understand the aggregation process of
amyloid - prone peptides
and proteins , oligomeric intermediates need to be identified and characterized
in detail . here , by exploiting the separative and investigative powers
of ms coupled with ims and cid - ms / ms , we describe higher order oligomeric
states populated by hiapp and riapp and elucidate their ccs , growth
mechanism , and relative gas - phase stability .
the rat and human peptides
were each dissolved in 100% dmso to remove any preformed aggregates and diluted 100-fold into 20 mm ammonium acetate ,
ph 6.8 , and the distribution of oligomeric species was analyzed immediately
and at various time points after dilution , using esi - ims - ms .
the data
obtained ( figure 1b ) showed that oligomers
up to and including hexamers are formed within 2 min of dilution of
hiapp into buffer .
esi - ims - ms allows co - populated oligomeric ions
with the same m / z to be separated
and identified individually ( e.g. , dimer and tetramer ) ( figure 1b ) .
multiple charge states ,
predominantly doubly and triply charged , and different conformers ,
both compact and expanded for species of the same mass , are observed
for the hiapp monomer at this ph .
for example , the monomer 2 + ions
occupy two distinct peaks in the ims - ms spectrum ( figure 1b ) with drift times of 7.6 and 10.6 ms .
these represent
two conformations of this charge state , which have ccss that differ
by a significant 15% . although less well - resolved , the monomer
3 + ions also exhibit two distinct conformations , having drift times
of 6.0 and 8.0 ms , a 14% difference in their ccs ( figure 1b ) .
oligomers of hiapp also populate a range of
charge states and conformations , for each of which the ccs was determined
( supporting information , table 1 ) .
previous studies have shown that increased ionic strength increases
the rate of aggregation of many proteins and peptides , including hiapp . to investigate whether the presence of oligomers
of hiapp correlates with the ability of the peptide to assemble into
amyloid fibrils , the ionic - strength dependency of the oligomers of
hiapp observed using esi - ims - ms
was investigated and compared with
the rate of fibril formation , measured using tht fluorescence . under
the conditions employed ,
an enhanced rate of amyloid formation is
observed as the ionic strength is increased from 20 to 500 mm , consistent
with previous studies ( figure 2a ) .
gross fibril morphology was unchanged with the
buffer conditions employed ( a representative tem image is shown ( figure 2b ) ) .
a more rapid decrease in oligomer signal intensity
over time was also detected with increasing ionic strength ( using
esi - ims - ms , figure 2c ) , consistent with the
oligomers observed being involved in assembly into amyloid .
( a ) tht fluorescence intensity of hiapp ( 50 m peptide , 37 c ,
600 rpm ) in 20 mm ( squares / purple ) , 100 mm ( triangles / orange ) , or
500 mm ( circles / green ) ammonium acetate buffer , ph 6.8 .
( b ) representative
negative stain tem image of hiapp fibrils after 5 days in 100 mm buffer
( 37 c , 600 rpm ) ( scale bar = 100 nm ) .
( c ) esi - ims - ms driftscope
plots of hiapp oligomers present at t = 2 min ( left - hand
side ) and t = 5 h ( right - hand side ) at different
ionic strengths ( 20 , 100 , and 500 mm ) .
( d ) ccss of hiapp oligomers
measured using esi - ims - ms plotted versus oligomer order showing that
oligomers have the same ccs regardless of ionic strength : 20 mm ( squares ) ,
100 mm ( triangles ) , and 500 mm ( circles ) .
the orange dashed line represents
a globular fit based on the average density of a protein ( 0.44 da / ) , the purple dashed line represents
a linear growth model , and the green
dashed line represents an isotropic growth model . to probe the properties of the
oligomers formed from hiapp in more
detail
, their ccss were estimated from the esi - ims - ms arrival time
distributions and compared with ccss estimated for theoretical models
including a fit assuming isotropic growth , a globular fit based on the average density of a protein under similar
conditions ( 0.44 da / ) , and a model that assumes growth in a single dimension ( note that more detailed molecular models can not
be generated for the underlying structures of the oligomers detected ,
given the lack of information about the type , location , or extent
of secondary structure in these species ) .
ccs determination ( experimental section ) suggests that hiapp oligomers
4-mer in size adopt an extended conformation and that the
ccs of the different oligomers observed are independent of ionic strength
( figure 2d ) .
however , the relative population
of compact vs expanded monomeric and dimeric conformers is altered
with increasing ionic strength ( discussed below ) .
for riapp , which does not
form ordered amyloid fibrils when incubated at near neutral ph , a surprisingly similar array of oligomers was
observed using esi - ims - ms compared with that detected for hiapp ( figure 3a , supporting information figures s1a and s2 ) .
akin to the results observed for hiapp , multiple
conformers are observed for riapp monomer and oligomers , albeit at
different relative intensities compared with those observed for hiapp .
accordingly , hiapp consistently occupies a greater proportion of more
expanded conformers than riapp ( supporting information figure s1b ) . to investigate the relative stabilities of the different
monomeric conformers of hiapp and riapp , the dependence of the ion
arrival time distribution versus increasing the trap energy ( used
to effect cid ) was examined ( supporting information , figure s1c ) .
the results of these experiments showed that hiapp
monomer 3 + ions unfold at lower trap collision energies than those
required for the riapp monomer , with hiapp more readily converting
to expanded conformers at lower trap voltages ( supporting information figure s1c ) .
( a ) esi - ims - ms
driftscope plot of riapp oligomers present at 2 min after dilution
into 20 mm ammonium acetate buffer , ph 6.8 to a final peptide concentration
of 50 m .
the number adjacent to each peak denotes oligomer
order with charge state of the oligomer in superscript .
( b ) aggregation
of riapp ( diamonds ) and hiapp ( circles ) monitored using turbidity
at 635 nm . in both cases ,
50 m peptide was incubated in 20
mm ammonium acetate buffer , ph 6.8 ( 37 c , 600 rpm ) . ( c )
negative
stain tem image of riapp aggregates after 5 days of incubation ( 37
c , 600 rpm ) ; scale bar = 100 nm .
( d ) tht fluorescence intensity
of riapp ( 50 m peptide , 37 c , ph 6.8 , 600 rpm ) .
the data
are normalized to the signal intensity of a hiapp fibril formation
end point at the same peptide concentration .
although riapp has been reported previously not to form amyloid
fibrils , turbidity measurements ( figure 3b ) and tem images ( figure 3c ) showed that under the conditions employed here ( 20 mm ammonium
acetate , ph 6.8 , 1% dmso ( v / v ) ) , riapp forms small globular aggregates
that scatter light but do not bind tht ( figure 3d ) .
the riapp oligomers observed are similar in ccs , as well as order
and mass , to those of hiapp ( supporting information table s1 and figures s1a and s3 ) .
these results indicate , therefore ,
that the presence of oligomers of similar numbers of subunits and
ccs can not account for the very different amyloidogenic properties
of the two sequences .
next , the gas - phase stabilities of oligomers
of hiapp and riapp
were probed to investigate whether their gas - phase dissociation can
be related to the differences in the ability of these sequences to
form amyloid .
these oligomers are not amenable to solution - phase stability
assays , since they are so lowly populated and co - populated with each
other and the monomeric species .
accordingly , cid - ms / ms was utilized
to provide a side - by - side comparison of the gas - phase stabilities
of the two peptides in different oligomeric forms . in this experiment ,
ions of specific m / z were selected
by the quadrupole analyzer , followed by ims separation of the different
oligomers contributing to this m / z and then sequential fragmentation of the oligomer ions in the transfer
collision cell immediately prior to the time - of - flight analyzer .
the
data revealed that hiapp dimers are significantly less stable than
riapp dimers in the gas phase .
hiapp dimers were found to dissociate
into monomer at an energy ( 0.4 ev ) that is lower than that required
for the equivalent riapp dimers , which only began to dissociate at
0.7 ev ( figure 4a ) .
oligomeric species , including
tetramer ions with six charges , also showed subtle differences in
stability for the two sequences .
the hiapp tetramer ions
begin to dissociate at 0.3 ev , whereas rat tetramer ions
remain fully associated until an energy of 0.5 ev is applied ( supporting information figure s4a , b ) . the significant
difference in the gas - phase stability of the dimer ions of hiapp and
riapp could be related to the capability of hiapp to access amyloidogenic
conformations more easily than its riapp counterpart .
consistent with
this view , the expanded conformers of the hiapp monomer and dimer
ions became increased in population , and the dimer 3 + ions become
less stable in the gas phase as the ionic strength of the buffer used
is increased ( figure 4b ) .
this supports the
hypothesis that peptide gas - phase stability is inversely correlated
with the amyloid competence of iapp , given that both the hiapp monomer
and its oligomers are less stable than their counterparts for the
rat sequence and that high ionic strength destabilizes oligomers and
increases the rate of amyloid fibril formation for hiapp
. differences
between riapp and hiapp dimer and monomer stabilities
in the gas phase measured using collision induced dissociation ( cid ) .
(
a ) cid ms / ms of riapp ( blue ) and hiapp ( red ) dimers ( 50 m
peptide , 20 mm ammonium acetate buffer , ph 6.8 ) .
relative intensity
of the 3 + dimer ions ( squares ) of each peptide is plotted versus increasing
ion - accelerating voltage into the transfer t - wave collision cell ( cid ) .
bar chart ( inset ) showing the appearance of hiapp ( red ) and riapp
( blue ) monomer from dissociation of dimer ions with increasing cid
voltage .
( b ) arrival time distributions ( atds ) of 3 + hiapp monomer
ions 2 min after dissolving into 50 mm ( purple ) , 100 mm ( orange ) ,
or 500 mm ( green ) ammonium acetate , ph 6.8 .
bar chart ( inset ) showing
relative intensity of monomer ions with increasing ion - accelerating
voltage at different ionic strengths : 50 mm ( green ) , 100 mm ( orange ) ,
and 500 mm ( purple ) ( 25 m peptide , 50/100/500 mm ammonium acetate
buffer , ph 6.8 ) .
having identified the prefibrillar species
populated by hiapp , the mode of action of two known small molecule
inhibitors of hiapp fibril formation was investigated using esi - ims - ms .
in these experiments ,
hiapp ( 50 m ) was incubated at 37 c
in 20 mm ammonium acetate buffer , ph 6.8 , in the presence of egcg or silibinin at molar ratios of small
molecule : hiapp of 0.1:1 , 1:1 , or 10:1 .
the oligomer populations were
characterized subsequently using esi - ims - ms . to complement the gas - phase
analyses ,
fibril formation was monitored by tht fluorescence , and
peptide aggregates were characterized using negative stain em .
the
primary objectives here were to determine how the presence ( or binding )
of each small molecule affects the distribution of monomeric conformers
and populations of oligomers and whether such changes can be correlated
with the inhibition of hiapp amyloid formation .
egcg , a polyphenol flavanol found in
green tea , has shown promise as a generic anti - amyloid agent as this
small molecule has been found to redirect aggregating proteins onto
alternative pathways or to maintain them
in a native - like state .
it has also been
shown to promote remodeling of mature amyloid fibrils , with recent work of kelly et al .
demonstrating
that hydrophobic binding to the amyloid fibril by egcg is a significant
step in this process . despite being proposed
as a potent inhibitor of amyloid formation for several proteins and
peptides including hiapp , -synuclein ,
and a42 ,
to identify the effects of egcg on
hiapp aggregation , the binding capabilities of individual monomeric
conformers of hiapp for egcg were investigated .
the results revealed
that egcg binds to monomeric hiapp ( 10% monomer remains bound
in the gas phase ) ( figure 5a ) ( note that estimating kd values of binding events by ms was not feasible
in this instance , given the difficulty of maintaining quantitative
amounts of bound ligand in the gas phase ) .
the presence of the small
molecule also alters the equilibrium of monomer charge states present .
the monomer 3 + ions are more highly populated in samples incubated
with egcg ( compare figures 1b and 5a ) , with a change in ratio of 3+:2 + monomer charge
states in the spectra changing from 1:2 to 1:1.2 in
the presence of the ligand .
it is possible that the changes in monomer
charge state distribution observed may arise from direct binding of
egcg to the monomer that causes conformational changes and hence alters
the profile of the charge state distribution , despite the ligand dissociating
in the gas phase .
alternatively , changes in the charge state distribution
may arise from gas - phase dissociation of ligand - bound higher order
oligomeric species .
in addition to its effects on the monomeric conformers
of hiapp , egcg binding inhibits assembly of the peptide into higher
order oligomers and fibrils ( figure 5b d ) .
both of the observed charge states ( 2 + and 3 + ) of the hiapp monomer
( figure 5a ) and indeed each monomeric conformer
( both the expanded and the compact form of each charge state ) ( supporting information figure s5 ) are bound by
egcg , with one or two molecules binding to one doubly charged monomer
and up to three egcg molecules binding to the triply charged monomer
when egcg is added in an 10-fold molar excess over hiapp ( figure 5a ) .
binding of egcg to both the 2 + and 3 + monomer
ions was also observed at a stoichiometry of 1:1 hiapp : egcg , albeit
at a lower intensity ( data not shown ) .
the low levels of binding observed ,
despite complete inhibition of fibrillation , are consistent with hydrophobic
interactions playing a role in the binding interface and may help toward explaining the ability of egcg to inhibit
a wide range of natively unfolded polypeptides , including iapp mutants .
( a ) positive ion
esi mass spectrum showing binding of egcg ( added at 500 m to
50 m peptide ) to both the 2 + ( orange ) and 3 + ( purple ) charge
state ions of hiapp monomer .
stoichiometry of binding is shown by
color : 1:1 inhibitor molecule bound to an iapp monomer is highlighted
in green , 2:1 in pink , and 3:1 in blue .
( b ) tht fluorescence intensity of hiapp ( black ) ( 50 m peptide ,
20 mm ammonium acetate buffer , ph 6.8 , 37 c , 600 rpm ) with increasing
egcg : hiapp molar ratios : 0.1:1 ( pink ) , 1:1 ( orange ) , and 10:1 ( blue ) .
( c )
esi - ims - ms driftscope plots of hiapp oligomers formed in the presence
of ( i ) 0.1:1 , ( ii ) 1:1 , and ( iii ) 10:1 molar ratios of egcg : peptide
monomer at t = 5 h. the number of egcg molecules
bound to each species is shown as a colored dot .
( d ) negative stain
tem images of hiapp incubated with ( i ) 0.1:1 , ( ii ) 1:1 , and ( iii )
10:1 molar ratios of egcg for 5 days ( 37 c , 600 rpm ) .
( iv ) hiapp
fibrils alone and aggregates formed when a 10-fold molar excess of
egcg : hiapp is added to preformed hiapp fibrils after 5 h ( v ) and 24
h ( vi ) .
esi - ims - ms data ( figure 5c ) reveal
that
incubation with increasing molar ratios of egcg : hiapp prevents the
appearance of higher order oligomers in a dose - dependent manner . at
0.1:1 and 1:1 molar ratios of egcg : hiapp , monomer through tetramer
species of hiapp are observed ( figure 5c ) ,
but no pentamer or hexamer ( which were observed in the absence of
the small molecule ( figure 1b ) ) . at a 10:1
molar ratio of egcg : hiapp , no oligomers are observed ( figure 5c ) . under the latter conditions
, there is no increase
in tht fluorescence ( figure 5b ) , and tem images
( figure 5d , panel iii ) do not show any aggregated
material , indicating complete inhibition of amorphous aggregate and
amyloid formation .
these results suggest that egcg may trap amyloidogenic
oligomers as low order species and differentially stabilize distinct
monomeric charge states of hiapp with the result that amyloid fibrils
can not form .
alternatively , egcg may divert low order oligomers of
hiapp onto other aggregation pathways that result in the formation
of aggregates that are incapable of forming amyloid . in the latter
scenario , the oligomers
that form must be of low abundance , low ionization
propensity , or too heterogeneous to be detected by esi - ims - ms .
in addition
to its ability to remodel oligomers , egcg
has been shown previously to remodel amyloid fibrils formed by a range
of polypeptides , including hiapp . having determined
the effect of egcg on the aggregation reaction of hiapp , the effect
of this small molecule on fibril depolymerization was studied also ,
using tem to monitor fibril loss and esi - ims - ms to investigate how
fibril remodeling by egcg influences oligomer populations .
fibril
samples formed by incubation of hiapp at ph 6.8 for 5 days were mixed
with a 10-fold molar excess of egcg , and the subsequent loss of fibrils
was monitored by tem and esi - ims - ms at various time points after addition
of the small molecule .
the results of these experiments are shown
in figure 5d ( panels iv vi ) and in supplementary figure s6a . under the conditions
employed ,
clumping of hiapp fibrils followed by remodeling into amorphous
aggregates over a 24 h period was observed ( figure 5d , panels iv vi ) .
this is accompanied by a subtle increase
in intensity of the signal arising from monomer ions , measured using
esi - ims - ms , compared with the same sample prior to addition of egcg
( supporting information figure s6a ) .
there
is , however , an absence of higher order oligomers indicating that
fibril remodeling by egcg does not result in the reformation of higher
order oligomeric species .
silibinin , a flavonol extracted from
seeds of the herb milk thistle , has been proposed as a potential therapeutic
for amyloidosis associated with t2 dm . the interaction of this inhibitor with hiapp was also probed using
esi - ims - ms .
the resulting data ( figure 6a )
revealed that silibinin binds to the 3 + charge state ions of monomeric
hiapp ( 20% remaining bound in the gas phase ) , with no detectable
binding to the 2 + charge state ions of the monomer .
this may be due
to selectivity of the small molecule or the low abundance of the 2 +
charge state in the presence of the small molecule .
in the latter
case , the intensity of ligand - bound ions may fall below the levels
of detection . like egcg , but more obviously , the presence of excess
silibinin alters the equilibrium of the two different charge states
of monomeric hiapp , favoring the population of the triply charged
monomer ions , changing the ratio of 3+:2 + monomer charge state ions
in the spectra from 1:2 without silibinin to 3:1 in
the presence of the small molecule .
in addition , analysis using esi - ims - ms
indicates that the presence of substoichiometric ratios of silibinin : hiapp
prevents hiapp oligomer formation ( figure 6b ) .
more specifically , binding of silibinin is observed only to the
expanded conformer of the 3 + monomer ions ( figure 6c ) .
this conformer ( ccs = 790 ) ,
adopted by the hiapp monomer , but not the riapp monomer ( supporting information figure s1b , ii ) , has been
proposed previously as the on - pathway , amyloid - competent conformation ,
the formation of which precedes the generation of extended dimers
and -sheet - rich oligomers .
there is no
detectable binding of silbinin to the riapp monomer when incubated
under identical conditions ( supporting information figure s7 ) .
specific binding to the expanded monomer conformation
of hiapp is thus consistent with the ability of silibinin to inhibit
amyloid formation .
tht data ( figure 6d ) showed
that aggregation of hiapp decreases significantly as the concentration
of silibinin is increased , although in a 10-fold molar excess of silibinin
a weak positive tht signal is still observed ( figure 6d ) , likely due to the presence of aggregates not visible by
esi - ims - ms .
tem images indicated that incubation of monomeric hiapp
with silibinin for 5 days leads to few aggregates , with none visible
by tem when a 10-fold molar excess of silibinin : hiapp is used ( figure 6e , panels
( a ) positive
ion esi mass spectra showing binding of silibinin molecules ( added
at 500 m to 50 m peptide ) to the 3 + monomer ions ( purple )
and absence of binding to the 2 + monomer ions ( orange ) at a molar
ratio of silibinin : hiapp of 10:1 .
( b ) esi - ims - ms driftscope plots showing the lack of hiapp oligomers
in the presence of 0.1:1 , 1:1 , and 10:1 molar ratios of silibinin : hiapp
at t = 5 h. ( c ) arrival time distribution of 3 + monomer
ions shows two conformers are present ( td = 6 and 8 ms ) .
silibinin binds to the extended conformer of the
3 + monomer ions ( pink ) but does not bind to the compact conformer
( blue ) .
( d ) tht fluorescence intensity of hiapp ( black ) ( 50 m
peptide , 20 mm ammonium acetate buffer , ph 6.8 , 37 c , 600 rpm )
with increasing silibinin : hiapp molar ratios : 0.1:1 ( pink ) , 1:1 ( orange ) ,
and 10:1 ( blue ) .
( e ) negative stain tem images of hiapp incubated
with ( i ) 0.1:1 , ( ii ) 1:1 , and ( iii ) 10:1 molar ratios of silibinin : hiapp
for 5 days ( 37 c , 600 rpm ) .
lower panels show hiapp fibrils
alone ( iv ) and aggregates formed when a 10-fold molar excess of silibinin : hiapp
is added to preformed hiapp fibrils after 5 h ( v ) and 24 h ( vi ) .
although
silibinin has been shown previously to inhibit fibril formation by
hiapp , the interaction of this small
molecule with preformed fibrils had not been reported .
preformed hiapp
fibrils were incubated , therefore , with a 10-fold molar excess of
silibinin , and the effect of addition of the small molecule was measured
using tem and esi - ims - ms .
the results showed that addition of silbinin
causes depolymerization of preformed fibrils over a 24 h time period
during which time fibrils decrease in length ( figure 6e , panels iv vi ) . during fibril
depolymerization , esi - ims - ms
revealed a simultaneous increase in low - order oligomeric species ( supporting information figure s6b ) , suggesting
that depolymerization may occur via oligomer release .
alternatively ,
monomer release may occur and initiate rapid reformation of oligomers
in solution .
oligomers reformed upon fibril depolymerization are comparable
in ccs to those formed during amyloid formation ( data not shown ) . a range of peptide inhibitors has been developed against
hiapp . however
, the lack of structural information available on the intermediates
of aggregation has made it difficult to rationalize why some are more
effective than others . despite riapp
having been used previously as
the basis for design of an fda approved therapy to treat t2 dm , this peptide is only moderately effective in
inhibiting hiapp aggregation when added at equimolar concentrations .
a two - dimensional infrared spectroscopy study
revealed that riapp can become amyloid - competent in the presence of
hiapp , converting from a natively disordered riapp monomer into an
ordered -sheet - rich complex with hiapp . to determine why the riapp peptide is an ineffective inhibitor
of hiapp assembly and to identify how the hiapp - riapp complex forms ,
esi - ims - ms was used to study the oligomeric structures present in
a mixture ( 1:1 molar ratio ) of the two peptides .
by contrast
with the decrease in oligomer populations of hiapp observed in the
presence of the two small molecule inhibitors studied here , oligomers
up to and including hexamer were formed upon incubation of the hiapp
and riapp ( figure 7a ) , consistent with results
observed when each peptide was incubated in isolation .
the presence
of riapp did not prevent fibril formation of hiapp under the conditions
of these experiments ( figure 7b ) , consistent
with previous reports suggesting that the rat peptide must be present
in an 10-fold molar excess to inhibit hiapp amyloid formation
noticeably .
the fibrils formed from the mixed
sample were of similar morphology to those of hiapp incubated alone
( figure 7c ) .
mixed oligomers were observed
using esi - ims - ms with m / z values
corresponding to all - hiapp , all - riapp , and oligomers containing a
mixture of hiapp and riapp monomer subunits .
the triply charged dimer
ions ( figure 7a , inset ) , for example , have
an m / z of 2608 , corresponding to
one hiapp monomer ( 3904 da ) and one riapp monomer ( 3921 da ) , carrying
three positive charges .
mixed trimers and higher order oligomers were
observed also , as well as homo - oligomers of both peptides .
the ability
to form mixed oligomers rationalizes why riapp is inefficient at inhibiting
hiapp amyloid formation .
after 5 days , the fibrils formed were ultracentrifuged
and depolymerized by incubation in 100% hfip for 24 h with agitation .
samples were then air - dried and resuspended in denaturing solvent
( 50:40:10 acetonitrile / water / acetic acid ( v / v / v ) ) .
the resulting mass
spectra ( figure 7d , panel i ) showed the presence
of both hiapp and riapp monomer subunits in the aggregate pellet ,
confirming the presence of both peptides in the fibrillar state , with
approximately twice as many hiapp monomer units being incorporated
into the fibrils compared with riapp monomers under the conditions
employed .
both monomers were also found in the supernatant of the
original mixed sample , with riapp monomers being in excess here ( figure 7d , panel ii ) .
the cid - ms / ms method of interrogation
of oligomer stability was used to probe the stability of the mixed
oligomers formed from hiapp and riapp by subjecting the heterodimer
and heterotetramer ions to increasing transfer collision cell voltages
to promote gas - phase dissociation .
interestingly , the hetero - oligomers
exhibited gas - phase stabilities between those of homo - oligomers of
hiapp and riapp of the same mass , being less stable than riapp oligomers
but more stable than hiapp oligomers ( supporting
information figure s8 ) .
( a )
esi - ims - ms driftscope plot
of oligomers present at t = 2 min in a mixed sample
of hiapp and riapp at a 1:1 molar ratio ( 50 m final peptide
concentration , 20 mm ammonium acetate buffer , ph 6.8 , 25 c ) .
extracted driftscope peak shows masses corresponding to a mixed dimer
of one hiapp monomer plus one riapp monomer ( inset ) .
( b ) tht fluorescence
intensity during agitation of hiapp : riapp 1:1 ( 50 m final peptide
concentration , 20 mm ammonium acetate buffer , ph 6.8 , 37 c ,
600 rpm ) .
( c ) negative stain
tem image of 1:1 hiapp : riapp fibrils after 5 days .
( d ) esi mass spectra of depolymerized fibrils showing the presence
of both hiapp and riapp monomer constituents in the pellet ( i ) and
supernatant ( ii ) following ultracentrifugation . taken together , therefore
, the esi - ims - ms and cid - ms / ms data
suggest
that differences in gas - phase stability of monomer and low order oligomers
between hiapp and riapp sequences could be related to their differences
in amyloid propensity . in addition
, small molecule binding to hiapp
prevents fibril formation by disfavoring oligomer formation via binding
to monomers . as a result
, the aggregation pathway is diverted to alternative
routes that result in the formation of monomers and/or amorphous aggregates .
identifying and characterizing the structures
and dynamics of prefibrillar
oligomers is vital for understanding the mechanisms of protein aggregation
in amyloid disease , identifying the specific culprits of toxicity ,
and designing therapeutics to prevent aggregation . here , using esi - ims - ms ,
the high order oligomers of hiapp and riapp have been characterized
for the first time , and their structural organization and relative
gas - phase stabilities were compared .
additionally , the binding and
mode of action of two small molecule inhibitors of hiapp have been
determined , and the relative ineffective inhibition of hiapp by riapp
has been investigated .
previous ims - ms studies into the structure
of hiapp monomer and dimer have suggested that a conformational transition
to an extended structure is likely as an early step in amyloid formation . in the study presented here , the population of monomer through hexamer
has been revealed for both peptides .
these oligomers likely assemble
via monomer addition ( since every species from monomer to hexamer
is observed ) . in the case of hiapp ,
further monomer association into
higher order oligomers is not observed , suggesting that fibril formation
occurs without measurable population of larger oligomeric intermediates
or that higher order species are too lowly populated , too transient ,
or too heterogeneous to be detected by esi - ims - ms .
the oligomeric
states observed may be on - pathway to fibril formation
or alternatively may be off - pathway . in the latter case , conformational
changes occurring due to the oligomers relative lack of structural
stability may facilitate amyloid assembly compared with their counterparts
in riapp .
ccs estimations on hiapp species indicate that the
early oligomers
formed are elongated rather than globulamers , akin to the oligomers
observed during 2 m assembly into amyloid . of interest , early oligomers of riapp , which
are similar in size and ccs to those of hiapp ,
are formed when the
peptide is incubated under conditions identical to those used to analyze
hiapp but are significantly more stable in the gas phase as judged
by cid experiments .
although solution - phase stability can not be directly
inferred from gas - phase stability , the difference
in stability observed may rationalize the difference in aggregation
propensity of the two peptides , assuming that a conformational change
is necessary for fibril formation that is impeded for the more stable
rat peptide .
the ability of the two peptides to form mixed oligomeric
species on pathway to heterofibrils in vitro has been revealed using
esi - ims - ms and has provided an explanation as to the inefficient inhibition
of hiapp amyloid formation by riapp .
the study highlights the pitfalls
associated with designing peptide inhibitors based on amino acid sequence ,
given that riapp in principle would be expected to be a good inhibitor
of hiapp since it combines a recognition motif with a -sheet
breaker unit .
having characterized
the oligomeric species of hiapp , the binding
of two potent hiapp amyloid inhibitors , egcg and silibinin , were studied
using esi - ims - ms .
negative controls were performed using molecules
that do not have an inhibitory effect on hiapp amyloid formation ( e.g. ,
rifampicin and benzimidazole ) ; these
do not to bind hiapp or inhibit oligomerization ( data not shown ) .
we show that both egcg and silibinin are able to block oligomer and
fibril formation from hiapp when added prior to amyloid assembly ,
despite showing different binding characteristics and having different
effects on the equilibrium of species present .
by contrast with the
observations made at high ionic strength , in which oligomers are formed
and then lost from the ensemble rapidly as they elongate into fibrils ,
the presence of these small molecules inhibits formation of oligomeric
species from monomer subunits . in both scenarios ,
the observation
is the same ( lack of persistence of signal arising from oligomeric
ions ) .
however , the interpretation of the molecular events that lead
to the observed absence of oligomeric species is fundamentally different .
egcg was found to bind to both observed charge states of the hiapp
monomer , inhibiting early oligomer formation in a dose - dependent manner
and preventing fibril formation .
by contrast , silibinin was detected
to bind only to the most expanded conformer of the monomer 3 + ions
within the dynamic ensemble of intrinsically disordered monomeric
conformations , blocking oligomerization and fibrillation .
the latter
result supports the notion of the role of the extended state of the
monomer 3 + species in the fibril assembly mechanism of hiapp because
the hiapp conformer bound by silibinin is absent in riapp .
binding
to monomer may inhibit assembly directly or may create a structure
that associates with other monomers to generate non - amyloidogenic
aggregates . the fact that both egcg and silibinin were found to be
effective as amyloid inhibitors at substoichiometric concentrations
suggests that the small molecules may bind to oligomers , as well as
the monomer .
due to the low intensity of oligomers in the presence
of small molecules , however , binding of small molecules to these species
could not be observed by esi - ims . both egcg and silibinin
alter
the equilibrium of the monomeric
charge states of hiapp present , with the addition of each small molecule
leading to increased population of the triply charged monomer ions .
we propose that binding to these extended species prevents their self - assembly
into amyloid .
previous studies have shown that altering the equilibration
between different monomeric conformers can divert 2 m to alternative assembly pathways , leading
to formation of spherical aggregates rather than highly ordered -sheet
rich fibrillar assemblies .
for hiapp , these alternative aggregation
pathways are presumably kinetically or thermodynamically unfavorable
in the absence of egcg and silibinin but made feasible upon ligand
binding to unfolded hiapp monomers .
the fact that both of these small
molecules are capable of disaggregating hiapp amyloid fibrils in distinguishable
manners is also of interest .
egcg remodels fibrils into amorphous
aggregates without reformation of low order oligomers , while silibinin
depolymerizes fibrils and re - establishes the prefibrillar array of
monomer plus early oligomeric species observed by esi - ims - ms .
it is widely accepted that early oligomeric states are key to protein
self - assembly and subsequent amyloid disease , and determination of
which species are on - pathway to amyloid assembly is vital .
here we
have used esi - ims - ms to show that specific , lowly populated hiapp
monomeric conformers are capable of binding small molecule ligands .
in addition we have used this technique to identify a range of extended
oligomeric assemblies .
we have assessed the effect of ligand binding
on each individual species within a heterogeneous mixture of peptide
monomers and their conformers populated prior to fibril formation .
our experimental results provide support for a route to hiapp amyloid
fibrils via formation of elongated oligomers .
we propose that reduced
stability ( relative to nonamyloidogenic riapp ) is related to the ability
of hiapp to form extended monomer and oligomeric conformations that
have increased amyloid propensity compared with their more stable
counterparts . binding to and stabilizing monomers , thereby preventing
their polymerization ,
could be key to the mechanism of inhibition
of amyloid by egcg and silibinin .
the
data presented herein , and previously by bowers and co - workers , demonstrate that formation of extended structures is likely key
in early amylin amyloid formation .
small molecule binding to these
extended structures , which results in alteration of the distribution
of conformers present , leads to inhibition of oligomerization and
fibrillation by hiapp .
we hypothesize that stability plays a role
in the sequence specificity of iapp amyloid formation , given that
oligomers of riapp ( that differs at only six amino acid positions
compared with hiapp ) are similar in size and shape to those of hiapp
but are significantly more stable in the gas phase . in order for amyloid
systems to be fully understood , all species on the energy landscape ,
both on - pathway and off - pathway , must
be identified .
we can not determine unequivocally whether the oligomers
detected here using ms are on- or off - pathway .
whichever scenario
is correct , our data are consistent with a lower stability corresponding
to an enhanced rate and/or ability to form amyloid fibrils .
oligomers
either may be on - pathway to fibril formation and require conformational
changes to progress assembly or alternatively may undergo conformational
changes allowing off - pathway species to enter the aggregation pathway
to amyloid . additionally , we demonstrate that the mixing of the hiapp
and riapp sequences leads to copolymerization into amyloid , hence
explaining the lack of inhibition of hiapp fibril formation by riapp .
|
the molecular mechanisms by which
different proteins assemble into
highly ordered fibrillar deposits and cause disease remain topics
of debate . human amylin ( also known as islet amyloid polypeptide / hiapp )
is found in vivo as amyloid deposits in the pancreatic islets of sufferers
of type ii diabetes mellitus , and its self - aggregation is thought
to be a pathogenic factor in disease and to contribute to the failure
of islet transplants . here
, electrospray ionization - ion mobility spectrometry - mass
spectrometry ( esi - ims - ms ) has been used to monitor oligomer formation
from iapp . the detection , identification and characterization of oligomers
from both human and rat amylin ( riapp )
are described .
oligomers up
to and including hexamers have been detected for both peptides . from
esi - ims - ms derived collision cross sections ( ccs ) , these species are
shown to be elongated in conformation .
collision - induced dissociation
( cid - ms / ms ) revealed differences in the gas - phase stability of the
oligomers formed from hiapp and riapp , which may contribute to their
differences in amyloid propensity . using esi - ims - ms , the mode of inhibition
of amyloid formation from hiapp using small molecules or co - incubation
with riapp
was also investigated .
we show that the polyphenolic compounds
epigallocatechin gallate ( egcg ) and silibinin bind to specific conformers
within a dynamic ensemble of hiapp monomers , altering the progress
of oligomerization and fibril assembly .
hetero - oligomer formation
also occurs with riapp but leads only to inefficient inhibition .
the
results indicate that although different small molecules can be effective
inhibitors of hiapp self - assembly , their modes of action are distinct
and can be distinguished using esi - ims - ms .
|
little is known about lead exposure in the general population of young adults . in this study ,
whole blood lead concentration ( pbb ) was determined in a sample of the dunedin multidisciplinary health and development study , a well - documented birth cohort of new zealanders aged 21 years in 1993 - 1994 .
pbb in those who consented to venipuncture at 21 years of age ( n = 779 ; 411 males , 368 females ) was compared to pbb for the same cohort at age 11 years .
the pbb at age 21 ranged from 0.4 to 56 micrograms / dl with a geometric mean of 4.5 micrograms / dl ( 95% ci , 4.3 - 4.7 micrograms / dl ) .
only three individuals had a pbb above 30 micrograms / dl .
males had significantly higher pbb than females ( geometric mean 6.0 vs. 3.2 micrograms / dl ; p < 0.0001 ) .
the pbb at age 21 was 53% lower than in the same individuals at age 11 ( geometric mean 4.8 vs. 10.2 micrograms / dl ; p < 0.001 ; n = 480 ) and the correlation between corresponding values was weak ( r = 0.19 ; p < 0.001 ) .
pbb at age 21 showed significant associations with high risk occupational activities , recreational exposure , domicile close to a main road , smoking , and male sex .
blood lead concentrations continue to fall in new zealand , but occupational and recreational activities remain a significant source of lead exposure.imagesfigure 1 .
|
|
during 20062007 , blood samples were obtained from 776 volunteers living in 18 villages bordering ta national park .
all participants signed informed consent forms and completed questionnaires aimed at determining their exposure to nonhuman primate bushmeat through activities such as hunting of nonhuman primates or consumption of nonhuman primate bushmeat .
to determine effective exposure to htlv-1/stlv-1 , we used an htlv-1/2 elisa to test serum samples for reactivity to htlv-1/2 antigens ( 10 ) .
of the 776 serum samples , 16 were positive according to the elisa manufacturer s criteria ; an additional 15 samples had values just below the cutoff .
we extracted dna from all elisa - reactive samples and performed a search for htlv-1/stlv-1 sequences by using a tax - specific quantitative pcr ( 8) . of the 31 samples , 10 were positive and were analyzed by using a multiplex nested / seminested pcr targeting env and long terminal repeat ( ltr ) sequences ( table 1 ; technical appendix ) . to identify multiple infections with htlv-1/stlv-1 ,
this assay was applied on near endpoint dilutions of the 10 dna extracts ( 26 starting template molecules per reaction ; technical appendix ) . for each person , 620 env and 220 ltr sequences ( 1540 sequences per person ) were determined by sanger sequencing .
* gray shading indicates infections with stlv-1like htlv-1 ( as determined through phylogenetic analyses ) .
minimum distances were calculated by using the same datasets as for phylogenetic analyses ( see technical appendix ) .
htlv-1 , human t - lymphotropic virus type1 ; stlv-1 , simian t - lymphotropic virus type1 ; ltr , long terminal repeat ; chimp , chimpanzee(s ) .
phylogenetic analyses were performed by using bayesian and maximum likelihood methods on env and ltr datasets ( technical appendix ) .
both methods agreed on all essential features of the ltr tree topology ( figure 2 ) and env tree topology ( technical appendix figure ) .
six of the newly determined htlv-1 sequences were unambiguously related to htlv-1a ( bootstrap , 94 ; posterior probabilities , 1 ) ( figure 2 ) , confirming the predominance of this molecular subtype in cte divoire and in western africa ( 6 ) .
another 3 htlv-1 sequences were closely related to stlv-1 sequences found in sooty mangabeys ( cercocebus atys ) from ta national park ( bootstrap , 83 ; posterior probabilities , 1 ) ( figure 2 ; technical appendix table 2 ) , whereas the last 1 was related to stlv-1 sequences from red colobus monkeys ( piliocolobus badius badius ) and chimpanzees ( pan troglodytes verus ) from ta national park ( bootstrap , 98 ; posterior probabilities , 1 ) ( figure 2 ; technical appendix table 2 ) ( 7,8 ) .
however , reliable divergence dates could not been determined because most shallow nodes of the trees , including those of interest here , were not supported ( technical appendix ) . observed divergences , however , seemed compatible with cross - species transmission events , particularly in the case of study participant pau009 ( divergence to closest stlv-1 , 0% in ltr and 0.2% in env ) ( table 1 ) .
maximum - likelihood tree based on the analysis of a long terminal repeat ( 853 bp ) alignment in a study of the origin of human t - lymphotropic virus type 1 ( htlv-1 ) in rural western africa , 20062007 .
branches leading to outgroup sequences ( htvmel5 and z46900 ) were removed from the figure to increase its legibility .
the htlv-1 sequences determined from specimens from west and north africa are shown in light blue ; htlv-1 sequences determined from persons living in the region of ta national park are shown in green ; stlv-1 sequences determined from specimens from west and north africa are shown in black ; and stlv-1 sequences determined from persons living in the ta national park are shown in red .
sequence names are built as follows : [ host species]_[country of origin]_[genbank accession number ] .
reference sequence names also include their molecular subtype assignation : [ host species]_[country of origin]_[molecular subtype]_[accession number ] .
* sequences determined from captive or semicaptive hosts ; # sequences determined from bushmeat samples .
molecular subtypes were assigned on the basis of an analysis performed on an enlarged dataset including assigned reference sequences ( data not shown ) . bootstrap ( bp ) and posterior probability ( pp ) values are indicated where bp>50.0 and pp>0.95 .
we investigated the frequency of direct zoonotic transmission of stlv-1 in a rural region of cte divoire neighboring ta national park and found that only 2 of the stlv-1related sequences would be compatible with a local human - to - human transmission ( gah050 and kei005 ; figure 2 ) .
therefore , our data support the notion that direct zoonotic transmissions of stlv-1 represent a measurable proportion of htlv-1 infections , at least in rural regions bordering nonhuman primate habitat .
in addition , these results mirror observations made among adult chimpanzees from ta national park , which are often infected with retroviruses ( i.e. , simian foamy viruses and stlv-1 ) of their prey ( figure 2 ) ( 7,11 ) . despite the high prevalence of stlv-1 , simian foamy virus , and simian immunodeficiency virus infections among red colobus populations ( 8) and the fact that this nonhuman primate species is the one most frequently hunted by humans ( 4 ) , most zoonotic transmissions of retroviruses in western africa seem to originate from sooty mangabeys , as shown here for stlv-1 and previously described for simian immunodeficiency virus of sooty mangabeys , the precursor of hiv-2 ( 12 ) .
it remains to be determined whether these zoonotic transmissions from sooty mangabeys are favored as a result of molecular determinants ( e.g. , convergent evolution of retroviral receptors ) or behavioral determinants ( e.g. , increased aggressiveness ) .
considering the human exposure to nonhuman primate bushmeat in this region ( as illustrated by 150,000 kg sold per year in markets ) ( 13 ) and given the high prevalence of stlv-1 among local nonhuman primates ( 7,8 ) , the observation that zoonotic transmission events are , in absolute terms , exceedingly rare is striking . yet , the accumulation of genetically distinct htlv-1/stlv-1 over restricted geographic areas remains possible , as illustrated by the finding of 1 person infected with htlv-1a and 2 persons infected with putative stlv-1 in a single village , kibly ( table 1 ; figure 1 ) .
such local accumulations add to the threat represented by direct transmissions of stlv-1 because they can provide an opportunity for recombinant viruses to emerge , even though htlv-1/stlv-1 biology may be unfavorable to recombination ( 14 ) .
the analysis of behavioral data reveals generalized exposure of local populations to cooked nonhuman primate bushmeat ( table 2 ) .
exposure to fresh tissues , which can be expected to be more risky in terms of retroviral transmission , is less common ( table 2 ) . along a gradient of bushmeat freshness , going from hunting to preparation and cooking , a clear reversal of sex - related skew can be observed : only men are hunters , men and women are equally involved in dismembering , and women predominantly prepare and cook nonhuman primate bushmeat ( table 2 ) .
hence , men likely constitute a population at risk . in our study , 75% of persons who were identified as infected with viruses closely related to stlv-1 were men , whereas all htlv-1a infected persons were women
. increased surveillance for zoonotic transmission of stlv-1 to humans in areas where such transmission is more likely and increased surveillance of nonhuman primate species with high transmission potential ( like sooty mangabeys ) will contribute to a better understanding of risk factors .
* sex assignation was lost for 3 persons ; thus , the total sampling size was 773 rather than 776 , the total number included in the study .
detailed material and methods for a study on the origin of human t - lymphotropic virus type 1 in rural western africa , 20062007 , and a table showing simian t - lymphotropic virus type 1 infection in nonhuman primates from ta national park , cte d'ivoire .
|
simian t - lymphotropic virus type 1 ( stlv-1 ) strains occasionally infect humans .
however , the frequency of such infections is unknown . we show that direct transmission of stlv-1 from nonhuman primates to humans may be responsible for a substantial proportion of human t - lymphotropic virus type 1 infections in rural cte divoire , where primate hunting is common
.
|
during the development of multicellular organisms , each cell acquires its specific fate through a precisely controlled pattern of gene expression . to examine the transcriptional profile and/or chromatin state of specific cells and tissues , many techniques require some form of cell isolation , such as fluorescent activated cell sorting ( facs ) ( bryant et al . , 1999 ) or
these methods can be technically challenging , can yield a mixed population of cells , and may also disturb the transcriptional state of the cells or tissues being isolated .
other methods for assaying transcription are based on rna pull - down , relying on targeted expression of a tagged rna - binding ( roy et al . , 2002 ) or a ribosomal protein ( thomas et al . , 2012 ) , or an rna modifying enzyme ( miller et al . , 2009
these kinds of approaches can not assess genome - wide binding of transcription factors or chromatin - binding proteins .
techniques that can assay both chromatin binding and transcriptional profiling ( including intact [ deal and henikoff , 2010 ; henry et al . , 2012 ; steiner et al . , 2012 ] and bits - chip [ bonn et al .
, 2012a , 2012b ] ) involve affinity purification of tagged nuclei , requiring fixation and facs or magnetic - activated cell sorting ( macs ) , as well as large amounts of starting material ( e.g. , 46 million nuclei ) ( bonn et al . , 2012b ) .
we have developed tada to assess genome - wide protein binding in vivo in a cell type - specific way without cell purification .
it is simple and requires no cell isolation , fixation , cell sorting , or immunoprecipitation .
tada is based on dna adenine methyltransferase identification ( damid ) ( van steensel and henikoff , 2000 ; van steensel et al . , 2001 ) , an in vivo chromatin profiling technique ( choksi et al . , 2006 ;
, 2008 ; schuster et al . , 2010 ; woolcock et al . ,
2011 ) in which an escherichia coli dna adenine methyltransferase is fused to a dna- or chromatin - binding protein of interest .
when the fusion protein is expressed in vivo , its binding site is tagged by adenine methylation .
expression of dam methylase at high levels is toxic , however , and can lead to nonspecific methylation ( van steensel and henikoff , 2000 ) . as a result , damid requires the dam methylase - fusion protein to be expressed at extremely low levels .
this has been achieved by expression from basal promoters ( bianchi - frias et al . , 2004 ;
choksi et al . , 2006 ; vogel et al . , 2007 ) with the drawback that the dam - fusion protein
previous attempts to control the spatial specificity of dam fusions using targeted expression systems , such as gal4 ( brand and perrimon , 1993 ) , have resulted in excessively high levels of the methylase and toxicity .
we have devised a means of reducing the level of translation of the dam - fusion protein , thereby enabling us to express the fusion protein at very low levels in a cell- or tissue - specific fashion with both spatial and temporal control ( tada , targeted damid ) .
tada is robust , reproducible and sensitive , requires no crosslinking , immunoprecipitation or cell sorting , and avoids the difficulties associated with isolating small quantities of rna and protein .
tada can be completed in 3 days from start to finish and requires fewer than 10,000 cells , possibly far fewer , in contrast to the 46 million required by other methods .
it can be adapted for use in any model system , as all of the elements of the method are transferable and endogenous adenine methylation is rarely found in eukaryotes ( van steensel and henikoff , 2000 ) .
conditional expression of the dam - fusion protein can be achieved using the gal4 system ( brand and perrimon , 1993 ) , which has been adapted successfully for use in other model systems , or with recombination systems such as cre / lox or flp / frt .
tada can be used to map genome - wide binding of any dna- or chromatin - binding protein and also to assay gene expression by profiling rna polymerase ii occupancy .
we use tada to assess differential transcription in neighboring , clonally related stem cells in the optic lobes of intact drosophila brains .
we identified genes in all of the signaling pathways known to be active in optic lobe neuroepithelial cells as well as noncanonical metabolic pathways and genes in the retinal determination network , which had not previously shown to be active . by assaying transcription in neuroepithelial cells over time
, we reveal a switch in the activity of signaling pathways that control the fate of these symmetrically dividing neural stem cells .
in order to benefit from targeted expression with the gal4 system , we aimed to reduce the level of translation of the dam fusion protein , thereby avoiding the toxicity associated with high levels of the methylase .
we took advantage of the fact that , at a low frequency , eukaryotic ribosomes are able to reinitiate translation on bicistronic messages lacking an obvious ires ( luukkonen et al .
, 1995 ; child et al . , 1999 ; van blokland et al . ,
the degree of reinitiation is dependent upon the size of the primary orf ( kozak , 2001 ) , therefore we designed gal4-inducible constructs containing primary orfs of different lengths followed by a secondary orf encoding the dam methylase .
translation of the secondary orf must be essentially null in uninduced cells and sufficiently low upon induction to avoid toxicity ( figure 1a ) . at levels where the dam methylase is functional and nontoxic
, the protein is undetectable by western blotting or immunofluorescence ( vogel et al . , 2007 ) .
we generated a series of transgenes in which a primary orf ( orf1 ) is followed by two stop codons and a secondary orf ( orf2 ) encoding the dam methylase ( figure 1a ) .
in uas - lt1-dam ( low level translation version 1 ) orf1 encodes six amino acids ( mggsag ) , in uas - lt2-dam orf1 encodes the first 80 amino acids of mgfp6 ( schuldt et al . ,
1998 ) and in uas - lt3-dam orf1 encodes full - length mcherry ( 246 amino acids ) ( shaner et al . , 2004 ) .
as a first step , we crossed each line to ase - gal4 ( for neural stem cell expression ) and assayed toxicity .
2006 ) , in which the dam methylase is encoded by orf1 , leads to 100% embryonic lethality .
this is also the case for uas - lt1-dam , suggesting that orf2 expression is too high .
expression of uas - lt3-dam is not toxic at any stage of development and has the added advantage of marking the expressing cells with mcherry .
uas - lt3-dam was crossed to insc - gal4 ( gal4 , expressed in neural stem cells from the embryo onward ) and to w ( control ) .
dna was digested with dpni , which only recognizes methylated gatc sites , followed by amplification of the methylated dna by pcr ( see experimental procedures ) .
we were able to amplify dna from insc - gal4 x uas - lt3-dam brains ( figure 1b ) , suggesting that the dam methylase has been expressed and is active .
in contrast , dna from w x uas - lt3-dam brains was equivalent to that from control brains ( w ) and barely detectable ( figure 1b ) .
therefore , by controlling the level of translation of the dam methylase , dam - fusion proteins can be targeted temporally and spatially using the gal4 system : gal4-driven expression of lt3-dam is sufficient to methylate genomic dna and there is no detectable dna methylation in the absence of gal4 .
one of the goals of modern stem cell biology is to manipulate cells down particular developmental pathways , for example by inducing pluripotency and driving cells to differentiate into a specific cell type or by trans - differentiating cells from one cell type to another . in order to do this ,
we need to understand as much as possible about the transcriptional states of different cells and cell populations and how they change over time . to assay genome - wide transcription in a cell - specific fashion , we used tada to profile rna polymerase ii occupancy in vivo .
a gfp - tagged version of the core subunit of pol ii ( rpii215 ) has been shown to be functional in vertebrate cells ( sugaya et al . , 2000 ) .
we fused dam - methylase to the core subunit of pol ii to create dam - pol ii ( puast - lt3-ndam - pol ii ; figure 1c ) . to confirm
that dam - pol ii is being expressed at very low levels in our system , we drove expression of uas - lt3-dam - pol ii in all cells throughout larval development using tubulin - gal4 ( lee and luo , 1999 ) .
western blot analysis reveals that dam - pol ii levels are undetectable relative to endogenous pol ii ( figure s1 available online ) . to assess whether dam - pol ii recapitulates endogenous pol ii binding , we performed pol ii tada on third instar larval salivary glands and compared our results with the previously published pol ii chip - seq data ( conrad et al . , 2012 ) .
we used hs - gal4 ( brand et al . , 1994 ) to express uas - lt3-dam - pol ii in salivary glands ( costantino et al . , 2008 ) .
genomic dna was extracted , digested with dpn i , and pcr - amplified . amplified dna from dam - only ( reference ) and dam - pol ii (
the binding profiles are extremely similar ( figure 2a ) , with a highly significant correlation between the two data sets ( r = 0.586 , p < 1 10 , signal across genes ) . a meta - analysis of dam - pol ii occupancy reveals similar binding profiles for tada and chip - seq ( figures 2b and 2c )
the developing drosophila optic lobe contains two clonally related populations of stem cells : symmetrically dividing neuroepithelial cells that transform over time into asymmetrically dividing neural stem cells ( neuroblasts ) ( egger et al .
this cell fate transition is remarkably similar to that seen in the developing mammalian cerebral cortex , where neuroepithelial cells divide symmetrically to expand the stem cell pool before transforming into asymmetrically dividing radial glial cells ( farkas and huttner , 2008 ) . understanding the common molecular mechanisms that promote neurogenesis is crucial in efforts to regenerate or repair the nervous system after injury or disease . comparing the transcriptomes of neuroepithelial cells and neuroblasts
is a first step in revealing the transcriptional changes leading from stem cell self - renewal to differentiation .
we drove expression of dam - pol ii in the neuroepithelium or in neuroblasts , with gal4 and gal4 , respectively ( egger et al .
expression was temporally regulated with gal80 , a temperature - sensitive negative regulator of gal4 ( matsumoto et al . , 1978 ; mcguire et al . ,
dam - pol ii was expressed for 24 hr , from mid third instar to wandering third instar larval stages .
genomic dna was extracted from 100 brains , digested with dpn i and amplified ( figure 3b ) .
we performed a meta - analysis of dam - pol ii occupancy in neuroepithelial cells ( figure 4a ) .
the profile of dam - pol ii binding across all annotated genes is consistent with previous chip studies ( gilchrist et al . , 2010 ; nechaev et al . , 2010 ; lam et al .
we find a peak immediately downstream of the transcriptional start site ( tss ) and a dip at the transcriptional stop ( lam et al . , 2012 ) ,
demonstrating that dam - pol ii binding accurately reflects pol ii occupancy in vivo .
the mean ratios for binding across annotated transcripts were determined ( dam - pol ii / dam - only ) and a false discovery rate ( fdr ) assigned ( see experimental procedures ) .
we found a high degree of reproducibility between biological replicates , with an average correlation coefficient of 0.88 when comparing three neuroepithelial cell replicates . in total ,
2,711 genes with significant pol ii occupancy were identified in the neuroepithelium and 4,142 in neuroblasts .
we found pol ii binding to 88% of these genes in the neuroepithelium ( table s1 ) .
a total of 157 genes were previously identified as expressed in microdissected neuroepithelial cells ( egger et al . , 2010 )
( figure 4b ) . of these , at least two ( trol and dsx ) are false positives ( voigt et al . , 2002 ; rideout et al . ,
we observed dam - pol ii binding at 80% of genes identified in microdissected neuroepithelial cells and trol and dsx were correctly assigned ( not expressed in the neuroepithelium ) .
patj , mer , apkc , dome , and stat92e are reported to be expressed in the neuroepithelium but exhibited a dam - pol ii / dam log2 ratio that was below that deemed to be significant ( table s1 ) .
it is possible that these genes produce stable mrnas and/or proteins and only require a low level of active transcription .
we were concerned whether perdurance of gal4 and its target gene , in this case the dam - fusion , might generate false positive signals .
however , we saw no signal for the neuroblast genes eyeless and insc in neuroepithelial cells ( figures 6e and 6e and egger et al . , 2007 , respectively ) .
dam - pol ii was bound to ase , wor , brat , and mira , in the neuroepithelium as well as in neuroblasts ( table s2 ) .
these genes may be regulated posttranscriptionally in the neuroepithelium ( e.g. , by one of the micrornas that we found to be differentially expressed between neuroblasts and neuroepithelium ) .
if we discover a signal that is indeed due to perdurance , then it can be eliminated by expression of gal80 in neuroblasts . to identify genes that are specifically expressed or highly enriched in either the neuroepithelium or in neuroblasts ,
we compared pol ii occupancy between these two stem cell subtypes . of the 2,711 genes bound by pol
ii in the neuroepithelium , 352 genes show a significantly enriched signal relative to neuroblasts ( table s2 ) .
this is nearly twice as many genes as identified by transcriptome analysis of microdissected neuroepithelial cells . of the 4,142 neuroblast genes ,
1,802 are preferentially bound by pol ii in neuroblasts as compared to neuroepithelial cells . among these
are the known neuroblast genes ase , wor , mira , brat , insc , and pros ( table s2 ) .
none of these genes were identified in microdissected optic lobe neuroblasts , in which only 36 genes were found to be expressed ( egger et al . ,
2010 ) . to obtain an integrated view of the 352 genes enriched in the neuroepithelium
, we used string ( szklarczyk et al . , 2011 ) to generate a network of interactions based on experimental data as well as predicted interactions from coexpression and literature searches .
the string analysis highlighted signaling pathways known to be active in the neuroepithelium ( figure 5 ) , such as notch ( egger et al .
, 2010 ; ngo et al . , 2010 ; reddy et al . , 2010 ; yasugi et al . , 2010 ) , egfr ( yasugi et al . , 2010 ) , hippo ( reddy et al . , 2010 ) , jak - stat ( yasugi et al . , 2008 ; ngo et al . , 2010 ;
wang et al . , 2011 ) , wnt ( kaphingst and kunes , 1994 ) , and dpp ( kaphingst and kunes , 1994 ) .
notch maintains neuroepithelial cell fate and prevents premature differentiation into neuroblasts and neurons ( egger et al .
, 2010 ; ngo et al . , 2010 ; reddy et al . , 2010 ;
tom and brd are bearded family proteins that block delta endocytosis in cells where notch is active ( bardin and schweisguth , 2006 ; de renzis et al . , 2006 ) .
we confirmed transcription of tom in the neuroepithelium by rna in situ hybridization ( egger et al . , 2010 )
( figure 6a ) . as predicted by dam - pol ii occupancy , neither of these genes
intriguingly , however , we observe dam - pol ii paused at the 5 ends of both tom and brd in neuroblasts ( figure 6a ) , suggesting that transcription of these genes may resume at a later stage .
the jak / stat ligand unpaired ( upd ) inhibits the transition of neuroepithelial cells into neuroblasts ( yasugi et al . , 2008 ) .
dam - pol ii bound upd in neuroepithelial cells but not neuroblasts ( figure 7b ) . in support of this result , we found that upd - gal4 is expressed in a subset of neuroepithelial cells but not in neuroblasts ( figure 7b ) .
similar results were found for egfr ( figures 7c and 7c ) and dpp ( figures 6c and 6c ) , whereas hairy was expressed in neuroepithelial cells in the inner proliferation center ( figures s3b and s3b ) .
we found that even low level binding of pol ii is predictive of gene expression , as seen at the nija locus ( figures 6b and 6b ) .
we also found genes that are expressed in neuroblasts but not neuroepithelial cells , e.g. , eyeless ( figures 6e and 6e ) and tsh ( figures 6f and 6f ) .
of the ten genes identified by tada and shown in figure 6 only two , tom and nija , were identified by mrna expression profiling ( egger et al . , 2010 ) .
importantly , tada revealed the expression of numerous genes not previously shown to be active in the optic lobe .
these include genes in the retinal determination network ( figure s2 ) , such as twin of eyeless , optix , eyes absent ( figures 6d and 6d ) , and dachshund in both the neuroepithelium and in neuroblasts , wg , dpp , and sine oculis in neuroepithelium alone , and eyeless in neuroblasts alone ( figures 6e and 6e ) .
we also found a set of glutathione s - transferase genes ( gsts ) and genes involved in carbohydrate metabolism expressed in the neuroepithelium ( figure 5 ) .
the neuroepithelium does not begin to generate neuroblasts until the second instar larval stage ( hofbauer and campos - ortega , 1990 ; nassif et al .
, 2003 ) . to investigate the transcriptional changes in neuroepithelial cells before and after neuroblast production , we compared pol ii occupancy in the neuroepithelium at first and third instar larval stages .
several of the newly identified neuroepithelial genes are transcribed both in early and late neuroepithelial cells , including glutathione s - transferase gstd1 and the retinal determination genes eya , optix , dac , and toy , as are the notch target genes hlhmgamma ( figures 7a and 7a ) , hlhmbeta , and e(spl ) .
strikingly , however , the majority of genes involved in the signaling pathways that are active in the third instar neuroepithelium are not transcribed in the first instar ( figures 7 and s2 ; table s2 ) ; these include genes in the notch , egfr , fat / hippo , jak / stat , dpp , and wnt pathways .
for example , the notch targets hlhm5 , hlhmdelta , and hlhmalpha are expressed at third , but not first , instar
. transcription of the gene encoding the jak / stat ligand upd , which controls the timing of the neuroepithelial to neuroblast transition , is also absent from the early neuroepithelium ( figures 7b and 7b ) , as is egfr ( figures 7c and 7c ) , dpp ( figures s3c s3c ) , members of the hippo pathway ( ds , hpo , and ft ) , and the wnt pathway ( wg , fz3 , and wnt2 ) .
this suggests that there is switch during neuroepithelial development when these signaling pathways are activated .
it is likely that this is coordinated with the beginning of optic lobe neuroblast production at the second instar larval stage and may be induced by an ecdysone pulse toward the end of the first instar .
we also found that the cell cycle genes cyce ( figure 7 ) and e2f are not expressed in the early neuroepithelium , which is consistent with little or no cell division at this stage .
tada is designed to express dam - fusion proteins at very low levels in a spatially and temporally restricted manner , allowing the identification of protein - dna interactions in a cell - specific fashion in vivo without the need for cell purification .
we show here that tada enables transcriptome analysis and chromatin profiling in any cell type or lineage that can be genetically labeled . with tada ,
we identified actively transcribed genes in neuroepithelial cells and neuroblasts and genes at which rna pol ii was paused .
tada can be applied to the study of chromatin - associated factors ( van steensel et al . , 2001 ; tolhuis et al . , 2006 ;
2010 ) , including nuclear envelope proteins ( guelen et al . , 2008 ) and components of the rnai pathway ( woolcock et al . , 2011 ) .
we have also used tada to assess genome - wide binding of transcription factors ( e. contreras sepulveda , a.r.c .
, unpublished data ) and are currently assessing the binding of chromatin modifiers ( t.d.s .
tada is highly sensitive ; we could detect pol ii binding in 250 neuroblasts ( miller et al . , 2009 ) of 15,000 cells in the larval brain with only small amounts of starting material ( 50 larval brains ) .
we recently succeeded in profiling 100 neurons of the 150,000 cells in intact adult heads ( t.d.s . and a.h.b .
tada can be adapted for use in any model organism amenable to transformation , as well as at any stage of development from embryo to adult .
damid works effectively in drosophila ( bianchi - frias et al . , 2004 ;
, 2006 ; pym et al . , 2006 ; southall and brand , 2009 ) , yeast ( woolcock et al . , 2011 ) , plants ( germann et al . , 2006 ) , caenorhabditis elegans ( schuster et al . , 2010 ) , and human tissue culture cells ( vogel et al . , 2006 ; guelen et al . ,
ribosome reinitiation , which makes tada possible , has been observed in mammalian cell lines ( luukkonen et al . , 1995 ; van blokland et al . ,
our data confirm the expression of signaling pathways known to be active and required for the development of the proliferating neuroepithelium , such as notch , jak / stat , egfr , wnt , and dpp .
we also identified many more genes , such as the transcription factors of the retinal determination network , which may pattern the neuroepithelium and cell adhesion molecules , such as ninjurina , which may regulate tissue integrity and polarity in this rapidly dividing tissue .
the discovery of the spatially restricted expression of retinal determination genes in the optic lobe is intriguing .
the retinal determination network is a highly dynamic and cross - regulatory gene network , with multiple feedback loops acting to regulate gene expression in the developing eye disc ( kumar , 2009 ) .
it is unclear whether these same regulatory relationships are recapitulated in the optic lobe , particularly because many of the transcription factors are expressed in distinct populations of neural precursors
. it will be interesting to determine whether retinal determination gene function contributes to the patterning of distinct regions and cell types within the optic lobe .
our string analysis also identified two unexpected clusters of genes as being expressed in the neuroepithelium , those encoding glutathione s - transferases ( gsts ) and genes involved in carbohydrate metabolism .
gsts have roles in protecting cells against chemical toxicity and oxidative stress , in modulating jnk signaling and in cancer progression ( for review , see hayes et al . , 2005 ; laborde , 2010 ) . of the carbohydrate metabolism genes , pepck and cg10924
are involved in gluconeogenesis and glyceroneogenesis , the generation of glucose and glycerol from noncarbohydrate carbon substrates .
this pathway is usually associated with nutritional deprivation ( for review , see jitrapakdee , 2012 ) .
another gene in the cluster is pgd , which is part of the pentose phosphate pathway ( ppp ) , an alternative to glycolysis for metabolizing glucose .
isocitrate dehydrogenase ( idh ) is part of the citric acid cycle and is also important for generating cytosolic nadph and protecting cells against oxidative damage ( kim et al . , 2012 ) .
these results suggest that noncanonical metabolic pathways are active in the neuroepithelium and that there may be mechanisms in place to protect against oxidative stress ( gsts and the carbohydrate metabolism genes idh and pgd ) .
tada has revealed dramatic differences in the activity of signaling pathways in the neuroepithelium during brain development .
the notch , egfr , fat - hippo , and jak / stat signaling pathways work in coordination to control the transition of neuroepithelial cells to neuroblasts ( for review , see egger et al . , 2011 ) .
the dpp and wnt pathways play a role in patterning the developing optic lobe ( kaphingst and kunes , 1994 ) .
strikingly , the majority of the genes in these pathways are not expressed in the first instar neuroepithelium .
this suggests that there is a switch during neuroepithelial development , when these pathways are activated , likely in response to a developmentally regulated pulse of ecdysone ( truman et al . , 1994 ) .
many of the retinal determination genes ( e.g. , eya , optix , dac , and toy ) are expressed in the early neuroepithelium suggesting that they are responsible for patterning the neuroepithelium at this stage , or that they act to maintain neuroepithelial cell fate .
tada has permitted us to assay , simply and quickly , the transcriptomes of closely related neural stem cell pools in the developing brain , revealing the expression of both known and unknown pathways in these cells .
these data provide the basis for future studies to uncover the function of retinal determination factors and noncanonical metabolism in neural stem cell regulation .
furthermore , we anticipate that the ease and adaptability of tada will open new horizons for researchers exploring the chromatin landscapes and transcriptomes of specific cell types during development and in the adult organism .
details and sequences of all primers used for generating constructs are shown in supplemental experimental procedures .
puast - lt1-ndam was generated by pcr amplifying ndammyc from puast - ndam ( choksi et al . , 2006 ) , using a 5 primer that incorporates the coding sequence for mggsag , followed by two stop codons before the ndammyc orf .
the resulting pcr product was cloned into puast ( brand and perrimon , 1993 ) with ecori and bglii sites .
puast - lt2-ndam was generated by amplifying the first 240 bp of mgfp6 ( schuldt et al . , 1998 ) and pcr fusing it to a ndammyc pcr fragment using a second pcr reaction .
mgfp6 is followed by two stop codons and a single nucleotide before the ndammyc start codon .
puastattb - lt3-ndam ( see figure 1c ) was generated in a similar manner to puast - lt2-ndam , however , the full mcherry cds was used as the primary orf and the puastattb vector ( bischof et al . , 2007 ) was used to allow site specific integration of the construct into the drosophila genome . to generate puast - mgfp6-rpii215 , puast - nmgfp6
was first made by pcr amplifying mgfp6 and cloning it into puast with ecori and bglii .
rpii215 was pcr amplified from an embryonic cdna library and cloned into puast - nmgfp6 using noti and xbai sites .
rpii215 was cut out from puast - mgfp6-rpii215 with noti and xbai to generate puastattb - lt3-ndam - rpii215 .
salivary glands : uas - lt3-ndam and uas - lt3-ndam - rpii215 were crossed to hs - gal4 ( brand et al . , 1994 ; costantino et al . ,
third instar larval brains : uas - lt3-ndam and uas - lt3-ndam - rpii215 were crossed to the appropriate gal4 line containing gal80 .
embryos were collected over a 4 hr period at 25c and then shifted to 18c ( restrictive temperature ) for 2 days .
hatched larvae were then transferred to a food plate containing standard fly food and left at 18c for a further 5 days .
the food plate was then shifted to 29c ( permissive temperature ) for 24 hr before dissection ( third instar larvae ) .
first instar larval brains : same as for third instar except that hatched larvae were immediately shifted to 29c for 24 hr , and 300 brains were dissected .
genomic dna was extracted and methylated dna processed and amplified as previously described ( sun et al . , 2003 ;
2006 ) apart from the following modifications : after precipitation of the gdna , the dpni digest was set up in 50 l ( rather than 10 l ) .
it is especially important not to shear the gdna , therefore when the 50 l of dpni mix was added , the pellet was not disturbed by vortexing or mixing . following overnight digestion , an extra 0.5 l of dpni enzyme
after denaturation of dpni , the dna was purified ( qiagen pcr purification ) into 30 l of h2o , of which 15 l was used for the ligation step . amplified dna from experimental and dam - only controls were labeled with either cy3 or cy5 and cohybridized to nimblegen hd2 drosophila whole genome tiling arrays ( performed at flychip , cambridge , uk ) .
arrays were scanned using a genepix 4000b dual laser scanner ( axon ) and data probe intensities extracted using nimblescan software ( nimblegen ) .
three biological replicates were performed for profiling of the neuroepithelium ( one dye swap ) and two replicates for neuroblasts and salivary glands ( with dye - swap ) .
log2 ratio files were generated ( dam - pol ii over dam - only ) and median normalized ( nimblescan software ) .
each replicate data set was analyzed separately : using drosophila genome annotation release 5.47 , the mean ratio change across each annotated transcript was calculated . to assign a fdr value , the frequency of transcripts with a mean ratio over specific values ( from 0.1 to 0.75 log2 increase ) were calculated within a randomized data set ( for each chromosome arm ) using 10 iterations and 1,000 sampling events .
this was repeated for a range of gene sizes ( 250 to 2,500 bp ) .
these data were used to model fdr values relative to the dam - pol ii enrichment across a transcript and gene sizes , therefore enabling extrapolation of fdr values for larger ratio changes and larger transcripts . after being performed for each replicate , each transcript was assigned a mean ratio between the biological replicates and the highest associated fdr .
these data were then analyzed as described above to identify genes with significantly different pol ii occupancy . due to the presence of negative log2 ratios in damid experiments ,
these genes were filtered to check that any significantly enriched genes were also bound by pol ii in the experiment of interest ( numerator data set ) .
a gene list was generated from the transcript data using the values from the associated transcript with the most significant fdr .
metagene profiles were created from nonoverlapping genes with a size between 1,500 bp and 20 kb . where multiple splice variants existed ,
metagene profiles of transcribed genes were created using only the transcript with the lowest fdr from each gene .
the correlation between dam - pol ii and pol ii - chip log2 ratios across gene structures was analyzed by first determining the average ratio across each gene structure ( using the perl script described above ) and then calculating the correlation coefficient using excel .
asense - gal4 ( zhu et al . , 2006 ) was used for testing toxicity of uas - dam lines . for polii
profiling , we used the gal4 driver lines hs - gal4 ( brand et al . , 1994 ; costantino et al . ,
, 1997 ; egger et al . , 2007 ) , and insc - gal4 ( gal4 ) ( luo et al . ,
tubulin - gal4 ( lee and luo , 1999 ) was used for analysis of dam - pol ii protein levels .
w- ; insc - gal4 ; tubulin - gal80 and w- ; tubulin - gal80 ; gal4 were used for temporally restricted expression of uas - lt3-ndam and uas - lt3-ndam - rpii215 in neuroblasts and the neuroepithelium , respectively .
gal4 reporter lines used upd - gal4 ( halder et al . , 1995 ) , h - gal4 ( brand and perrimon , 1993 ) , yw ; ra87-gal4/cyo ( gcm - gal4 ) ( chotard et al . , 2005 ) , egfr - gal4 ( bloomington stock 45123 ; jenett et al . ,
2012 ) , and dpp - gal4 ( takaesu et al . , 2002 ) .
hlhmgamma - gfp ( almeida and bray , 2005 ) was used to assess the expression pattern of hlhmgamma .
uas - lt1-ndam , uas - lt2-ndam , and uas - mgfp6-rpii215 were generated by injection of w embryos with the respective constructs and 2 - 3 helper plasmid as a transposase source .
uas - lt3-ndam and uas - lt3-ndam - rpii215 were generated by injection of w- ; + ; attp2 ( markstein et al . , 2008 )
embryos with the respective constructs and phic31 integrase helper plasmid pbs130 as an integrase source .
immunohistochemistry of drosophila larval brains was carried out as previously described ( van vactor et al . , 1991 ) , using the following antisera : mouse anti - dlg ( 1/100 ) , ( developmental studies hybridoma bank ) , chicken anti - gfp ( 1/2,000 ) ( ab13970 , abcam ) , guinea pig anti - dpn ( 1/500 ) ( gift from j.b .
skeath ) , guinea pig anti - nija ( 1/500 ) ( zhang et al . , 2006 ) , rabbit anti - tsh ( 1/300 ) ( wu and cohen , 2000 ) , rabbit anti - eyeless ( 1/300 ) ( gift from uwe walldorf ) , mouse anti - eyes absent ( 1/75 ) ( dshb ) , rat anti - de - cadherin ( dcad2 ) ( 1/20 ) ( dshb ) , anti - cyce ( 1/30 ) ( richardson et al . , 1995 ) , and rabbit anti - scribble ( 1/2,000 ) .
secondary antibodies coupled to alexa-488 , alexa-546 , or alexa-633 ( invitrogen ) were used at a dilution of 1/200 .
fluorescent in situ hybridization was performed as previously described ( egger et al . , 2007 ) .
|
summarycell - type - specific transcriptional profiling often requires the isolation of specific cell types from complex tissues .
we have developed tada , a technique that enables cell - specific profiling without cell isolation .
tada permits genome - wide profiling of dna- or chromatin - binding proteins without cell sorting , fixation , or affinity purification .
the method is simple , sensitive , highly reproducible , and transferable to any model system .
we show that tada can be used to identify transcribed genes in a cell - type - specific manner with considerable temporal precision , enabling the identification of differential gene expression between neuroblasts and the neuroepithelial cells from which they derive .
we profile the genome - wide binding of rna polymerase ii in these adjacent , clonally related stem cells within intact drosophila brains .
our data reveal expression of specific metabolic genes in neuroepithelial cells , but not in neuroblasts , and highlight gene regulatory networks that may pattern neural stem cell fates .
|
microorganisms - strain 18 of p. brasiliensis was
isolated from a clinical case of paracoccidioidomycosis and maintained in the faculty of
pharmaceutical sciences of araraquara , so paulo state university , brazil , in fava netto
medium ( fava netto 1961 ) at 37c .
epithelial cells - the cell line a549 , a type ii pneumocyte , was
obtained from the american type culture collection ( usa ) .
the cells were seeded for 24 h
in ham f-12 nutrient ( cultilab , brazil ) , supplemented with 10% heat - inactivated foetal
calf serum ( cultilab ) and maintained at 36.5c and 5% co2 .
preparation of the 14 - 3 - 3 and gp43 proteins - the 14 - 3 - 3 protein was
prepared by heterologous expression in escherichia coli , as described
by da silva et al .
( 2013 ) , and the gp43 protein
was purified from crude exoantigen of p. brasiliensis , as previously
described ( mendes - giannini et al . 1989 ) .
briefly ,
the exoantigen was fractionated by gel filtration chromatography on sephacryl s-100
columns ( pharmacia - biotech , usa ) using akta - fplc ( ge healthcare , usa ) .
two - dimensional
electrophoresis analysis was performed using ipgphor iii ( ge healthcare ) , sodium dodecyl
sulfate - polyacrylamide gel electrophoresis ( sds - page ) and coomassie blue phast gel r350
staining to show specific spots corresponding to molecular masses of 30 kda and 43 kda ,
respectively .
treatment of a549 cells with 14 - 3 - 3 protein and gp43 - a549 cells were
cultured at 36.5c in 24-well plates and cell concentrations were adjusted to 1.0
10 cells per well .
the cells were incubated for varying amounts of time
( 5 h , 24 h , 48 h and 72 h ) with 25 g / ml of the appropriate protein ( 14 - 3 - 3 protein
alone , gp43 alone or combined treatment with 14 - 3 - 3 protein with gp43 ) dissolved in ham
f-12 nutrient medium . after incubation ,
the cells were washed three times with
phosphate - buffered saline ( pbs ) . in the negative control experiments ,
the a549 cells
were not pre - incubated with any protein and the positive controls were performed using 1
mm methotrexate ( zodiac , brazil ) .
epithelial cells were
grown on glass coverslips and incubated for 5 h and 24 h with 14 - 3 - 3 and gp43 proteins ,
as previously described , washed and fixed with paraformaldehyde 4% in pbs .
the
coverslips were blocked with bovine serum albumin , permeabilised for 15 min with 0.2%
triton x-100 and incubated with terminal d - transferase and fluorescent dutp ( boehringer
mannheim , germany ) .
apoptotic bodies were visualised and counted by fluorescence
microscopy ( leica , germany ) using filter sets for fluorescein isothiocyanate ( fitc ) and
flow cytometry ( bd facscanto ; bd biosciences , usa ) .
statistical analysis was calculated by anova ( with
tukey post - test ) using graphpad prism 5.0 software .
expression of pro and anti - apoptotic markers by flow cytometry analysis
- flow cytometry was performed using a facscanto ( becton dickinson immunocytometry
system , usa ) to study the expression of bcl-2 , bak , p53 , caspase-3 , caspase-8 and
caspase-9 .
epithelial cells were grown in six - well plates , adjusted to 1.0
10 cells per well and incubated with 14 - 3 - 3 protein and gp43 proteins , as
previously described , for 5 h , 24 h , 48 h and 72 h. after incubation , the cells were
separated by trypsinisation and then washed with a pbs and placed in 70% ethanol in pbs
overnight at 4c .
the cells were then washed three times in pbs and permeabilised with
1% saponin .
the reaction was developed using anti - bak , anti - bcl-2 , anti - p53 ,
anti - caspase-3 , anti - caspase-8 and anti - caspase-9 antibodies diluted 1:200 in pbs .
after
three washes with pbs , the cells were incubated with fitc - labelled anti - mouse antibody
for 30 min , washed twice and resuspended in pbs .
cells ( 10,000/sample ) were analysed by flow
cytometry . for quantitation and comparison , positive cell percentages and median
fluorescence intensity values
statistical
analysis was completed using anova ( with tukey post - test ) in graphpad prism 5.0
software .
expression analysis of apoptotic / anti - apoptotic markers by real - time polymerase
chain reaction ( pcr ) - the expression of apoptotic ( bax , bak , caspase-3 and
caspase-8 ) and anti - apoptotic ( bcl-2 ) markers was evaluated in a549 cells .
specific
primers for each gene were synthesised ( table )
and gadph expression was used as the endogenous control .
tablespecific primers for apoptotic / anti - apoptotic a549 markersgeneprimer sequence
( 5-3)bak rctgccagggaacagagaaggbak fgttctgttgggccagttgtbax rccacaaagatggtcacggtctgbax fgaaccatcatgggctggacabcl-2 rccttggcatgagatgcaggabcl-2 fgattgatgggatcgttgccttagadph rtggtgaagacgccagtggagadph fgcaccgtcaaggctgagaac
for these experiments , epithelial cells were grown in 75 mm cell culture
flasks , adjusted to 10 cells / ml and incubated with 14 - 3 - 3 protein and gp43
proteins ( as previously described ) for 5 h , 24 h , 48 h and 72 h. after each incubation
period , the cells were washed three times with pbs and were removed from the bottle
using trizol reagent ( invitrogen life technologies , usa ) .
first - strand cdna synthesis
was performed using reverse transcriptase ( revertaidtm h minus reverse transcriptase ;
fermentas life sciences , canada ) and 1 g of total rna .
the 25-l reaction mixture contained 1 l of cdna , 12.5 l of maxima sybr
green / rox qpcr master mix ( 2x ) ( thermo scientific , usa ) and 0.5 m of each primer .
the
reaction program was 50c for 2 min , 95c for 10 min and 40 cycles of 95c for 15 s and
the annealing and synthesis occurred at 60c for 1 min . following the pcr ,
melt - curve
analysis was performed , which confirmed that the signal corresponded to a single pcr
product .
the cycle threshold values for the triplicate
pcrs of each rna sample were averaged and then the 2 values were
calculated .
a sample that contained all reagents except untreated a549 cdna was used as
negative control . after 40 rounds of amplification ,
statistics
were performed using one - way anova with tukey s coefficient post - test using graphpad
prism 5.0 software .
the results of the statistical analysis were considered to be
significant when p < 0.05 .
preparation of 14 - 3 - 3 and gp43 proteins - specific spots corresponding
to the respective molecular masses of gp43 and the 14 - 3 - 3 protein are shown in fig . 1 to confirm the purity of these molecules used
in the following experiments .
these analyses were performed by two dimensional
electrophoresis , sds - page and coomassie blue phast gel r350 staining .
fig . 1 : two - dimensional electrophoresis showing the 14 - 3 - 3 ( 30 kda ) and
glycoprotein of 43 kda ( gp43 ) after purification .
sodium dodecyl
sulfate - polyacrylamide gel electrophoresis 12.5% stained with coomassie blue
phast gel r350 .
tunel assay - to determine whether epithelial cells undergo apoptosis
after treatment with p. brasiliensis molecules , dna fragmentation was
assessed by the tunel assay .
after treatment with gp43 and the 14 - 3 - 3 protein for 5 h , there was no significant
increase in apoptotic cells when compared with the control .
however , 24-h showed a
significant increase of apoptotic cells of 4% when treated with 14 - 3 - 3 protein , 6% with
gp43 and 10% with both adhesins
the
results from 48-h and 72-h treatments were also evaluated , but there were no significant
differences between these results and those obtained after 24-h treatment .
asterisk means p < 0.05 . a : control ; b :
treatment with 14 - 3 - 3 protein ; c : treatment with 43 kda ; d : treatment with
14 - 3 - 3 and 43 kda ; gp43 : glycoprotein of 43 kda .
3 shows the results of epithelial cell treatment
with the 14 - 3 - 3 protein and gp43 for varying periods of time in relation to bak
expression by flow cytometry analysis . within 5 h of treatment , a significant difference
in bak expression
after 24 h of
treatment with gp43 or both proteins ( gp43 + 14 - 3 - 3 ) , an increase of bak expression was
observed .
after 48 h , all treatments led to significant increases in bak expression when
compared with 24-h treatment and the control .
3 : bak expression in a549 cells with different treatments analysed by
fluorescence - activated cell sorting . asterisk means significant difference
compared to the control ( p < 0.05 ) .
when the cells were treated with gp43 , increase expression of bax was observed by
real - time pcr .
expression levels increased 271-fold by 24 h and 53-fold by 48 h.
furthermore , bax expression increased by 112-fold after 24 h of treatment with gp43 and
3-fold after 48 h of treatment .
the same pro apoptotic expression profile was observed
by fluorescence - activated cell sorting , confirming the activation of these factors by
gp43 .
evaluation of anti - apoptotic markers ( bcl-2 expression ) - bcl-2
expression was evaluated in cells after treatment with the 14 - 3 - 3 protein and gp43 by
flow cytometry analysis .
after 5 h , decreased bcl-2 expression was
observed when cells were treated with 14 - 3 - 3 and 14 - 3 - 3 + gp43 . within 24 h of
treatment
however , after
48 h of treatment with both molecules , a significant increase in bcl-2 expression was
observed followed by a significant reduction after 72 h of treatment ( fig .
4 ) .
fig . 4 : bcl-2 expression in a549 cells with different treatments analysed by
fluorescence - activated cell sorting .
following 24 h of
treatment with 14 - 3 - 3 , gp43 or both proteins , bcl-2 expression was decreased by
two - fold .
after 48 h and 72 h , no significant differences in bcl-2 expression were
observed , indicating a possible loss of this pathway due to treatment .
5 shows
the expression of caspases 8 , 9 and 3 determined by flow cytometry analysis after
treatment with 14 - 3 - 3 , gp43 or 14 - 3 - 3 + gp43 .
when treated with the 14 - 3 - 3 protein ,
caspase-8 expression was significantly decreased after 5 h , followed by a significant
increase at 48 h , thus reducing expression levels to those of the control after 72 h of
treatment .
gp43 treatment increased caspase expression after 5 h and 72 h and maintained
control levels of expression after 24 h and 48 h. combined 14 - 3 - 3 and gp43 treatment
increased caspase expression only after 72 h.
fig .
caspase-8
( a ) , caspase-9 ( b ) and caspase-3 ( c ) analysed by fluorescence - activated cell
sorting .
gp43 : glycoprotein of 43 kda .
for caspase-9 , after 5 h of treatment ,
no differences in expression were observed ;
however , after 24 h and 48 h , all treatments led to significantly increased caspase-9
expression with the highest levels of expression observed for the treatment with 14 - 3 - 3
protein and the combination of 14 - 3 - 3 and gp43 .
after 72 h , decreased caspase-9
expression was observed following gp43 treatment , whereas the combined treatment
resulted in increased caspase-9 expression compared with that of the control .
treatment with the 14 - 3 - 3 protein induced a significant increase in the expression of
caspase-9 after 24 h and a significant decrease after 48 h , equating the level of
expression with the control in 72 h. treatment with gp43 increased caspase-9 expression
after 5 h and 24 h followed by a decrease after 48 h , maintaining the same expression
level as that of the control after 72 h. the combined treatment increased expression
after 24 h and 72 h with a decrease observed after 48 h.
p53 expression - fig .
6 shows the
expression of the p53 protein after the treatment with p. brasiliensis
molecules .
following 5 h of treatment , p53 expression was absent when the cells were
treated with gp43 or left untreated .
however , when the cells were treated with the
14 - 3 - 3 protein or both molecules , significantly increased p53 expression was observed .
after 24 h , the increase was more evident in cells treated with the 14 - 3 - 3 protein or
both molecules and p53 expression remained absent when cells were treated with gp43
alone . following 48 h of treatment , all conditions led to increased p53 expression
observed .
after 72 h , a reduction in p53 expression was observed relative to expression
levels at shorter treatment intervals ; however , p53 expression was still increased when
compared with that of the untreated control .
fig .
6 : the p53 expression in a549 cells with different treatments analysed by
fluorescence - activated cell sorting .
induction of apoptosis in host cells has been implicated in microbial pathogenesis . in
previous studies ,
the induction of apoptosis by p. brasiliensis was
evaluated in epithelial cells and the number of apoptotic cells increased together with
fungal exposure ( mendes - giannini et al .
this result suggests
a requirement for internalisation of the fungus to trigger apoptosis in epithelial
cells .
however , the fungus molecules involved in apoptosis induction were unknown . in the present study ,
the contribution of two p. brasi- liensis
molecules , gp43 and the 14 - 3 - 3 protein , to apoptosis induction in a549 cells were
evaluated to elucidate the mechanisms used by the fungus to surpass host barriers and
establish infection and subsequent dissemination . to this end
, a549 cells were treated
with both molecules for different periods of time and the extent of apoptosis was
assessed by several techniques .
our results showed that the treatment with these
molecules for 24 h led an increase in the number of apoptotic cells , indicating that
these molecules are capable of inducing apoptosis .
the expression levels of the apoptosis regulating proteins bak , bcl-2 and caspases 3 , 8
and 9 were also evaluated .
treatment with the 14 - 3 - 3 protein and/or gp43 did not
increase bak or bcl-2 expression in relation to that of untreated cells at early time
points ( 5 h ) .
after 24 h , gp43 treatment led to increased expression of bak , but not
bcl-2 , demonstrating the apoptosis induction of the tested molecules .
after 48 h of
treatment while bak expression increased , expression of the anti - apoptotic protein bcl-2
also increased , although to a lesser extent than bak .
the first one indicates that
the apoptosis induction through bak expression leads to a cellular response by
increasing bcl-2 expression in order to avoid cell death
. the second hypothesis could be
that the fungus induces the expression of both bak and bcl-2 in order to damage the cell
without killing it thus protecting itself from the host immune system .
the behaviour
found in these experiments was very similar to that reported by mendes - giannini et al .
the caspase pathway was also investigated and we determined that gp43 , during early
treatment intervals , promotes the activation of the extrinsic pathway through the
activation of caspase-8 , leading to the activation of caspase-3 and the induction of
apoptosis . on the other hand , 14 - 3 - 3
initially induces the activation of caspase-9 ( 24
h ) while only after 48 h is caspase-8 activated .
after 48 h , the induction of the
intrinsic pathway is more prominent and the 14 - 3 - 3 protein appears to be predominantly
responsible for this response . in this study , when the cells were treated with gp43 and 14 - 3 - 3 proteins , a significant
increase in p53 expression was observed mainly after the treatment with the 14 - 3 - 3
protein when compared with untreated cells at all evaluated time points .
the highest
levels of p53 expression were observed after 48 h of treatment with both gp43 and
14 - 3 - 3 .
p53 is involved in maintaining genome integrity maintenance through cell cycle
progression inhibition or apoptosis induction ( fujita et
al .
( 1996 )
demonstrated that pneumocyte apoptosis is associated with p53 overexpression , proposing
an apoptosis mechanism dependent of this molecule .
p. brasiliensis survival in the intracellular environment may act as a
protective mechanism against immune responses and antimicrobial actions because
nonprofessional phagocytes , such as pneumocytes , do not possess efficient microbicidal
machinery similar to that of macrophages .
however , it is speculated that apoptosis
modulation is an advantage to the fungi because the cell death with internalised
p. brasiliensis could provide a method for fungal dissemination .
apoptotic cells with internalised fungus would serve as a vehicle for the entrance in
macrophages without the stimulation of the microbicidal activities .
the events that occur in infected epithelial cells with p. brasiliensis
in vitro include adhesion , fungal translocation to the cytoplasm , multiplication and
apoptosis induction .
correlation with pathogenicity mechanisms in vivo might elucidate
the initial steps of the infection ( mendes - giannini et
al .
, the microorganisms
could evade the killing activity of the phagocyte antimicrobial machinery in tissues ,
thus preventing its proper death and stimulating the inflammatory response to invade the
tissue as consequence of these injures ( bayles et al .
many pathogens have surface proteins or secreted metabolites able to function as
important inducers of apoptosis in the host cells .
for example , it was demonstrated in
staphylococcus aureus that the invasion of endothelial cells causes
induction of apoptosis and only occurs when the bacteria express a component called
aflatoxin , which is the main participant in the induction of apoptosis in these cells .
previous studies have also demonstrated that this process is dependent upon virulence
factors ( haslinger - lffler et al . 2005 ) .
another
example of this process occurs in yersinia sp . , which express cell
surface inv that is responsible for the adhesion and internalisation of
this bacterium to intestinal epithelial cells and induce apoptosis ( superti et al . 2005 ) . in pathogenic fungi such as the obligate intracellular pathogen histoplasma
capsulatum
, apoptosis is a critical element in the immune response and
increased levels of interleukin ( il)-4 and il-10 are observed when apoptosis is
inhibited .
therefore , the increased release of these cytokines is directly proportional
to the severity of infection ( allen & deepe
2005 )
. furthermore , upon h. capsulatum infection , caspases-3
and 1 are activated and both contribute to cell death ; however , only the former is
involved in apoptosis ( deepe & buesing
2012 ) .
( 2002 ) studied a strain of
candida albicans that induced the appearance of phosphatidylserine
in macrophage membranes , suggesting the induction of apoptosis as a virulence factor .
recently , it was demonstrated that in c. albicans , both the complement
receptor 3 ) and dectin-1 play a crucial role in coordinating -glucan - induced il-1
processing as well as a cell death responses .
in addition , this study also described an
essential role for caspase-1 and caspase-8 in promoting -glucan - induced cell death
( ganesan et al . 2014 ) .
these in vitro
observations suggest that c. albicans induces apoptosis as a mechanism
to evade host defenses .
our results suggest that the p. brasiliensis 14 - 3 - 3 and gp43 proteins
can induce apoptosis by modulating the caspase and p53 pathways .
gp43 appears to be an
important inducer of the extrinsic pathway and may be a very important molecule in the
initial step of the infection , whereas 14 - 3 - 3 acts mainly in the intrinsic and p53
pathways and may be of great importance in the maintenance of the fungi in the host
cells and consequently the fungal dissemination .
fig . 7 : schematic representation of the results obtained for the expression of
components involved in apoptosis during the interaction of
paracoccidioides brasiliensis ( pb )
proteins [ 14 - 3 - 3 and glycoprotein of 43 kda ( gp43 ) ] .
csp : caspase ; : no
difference in the expression compared to control ; : 10 - 20% increase of
expression compared to control ; : 20 - 30% increase of expression compared to
control ; : 30% or higher expression compared to control ; : 10 - 20% decrease
of expression compared to control ; - : no expression .
the mechanisms of invasion of host cells , persistence within them and the subsequent
induction of apoptosis , may explain the efficient behaviour of p.
brasiliensis in promoting tissue infection and/or blood dissemination ( da
silva et al .
we conclude with these
findings that the p. brasiliensis 14 - 3 - 3 and gp43 molecules that act as
adhesins and virulence factors also participate in many other important mechanisms that
contribute to its pathogenesis , including apoptosis .
|
the fungal strain paracoccidioides brasiliensis remains viable
inside of epithelial cells and can induce apoptosis in this population .
however ,
until now , the molecules that participate in this process remained unknown .
thus ,
this study evaluated the contribution of two p. brasiliensis
molecules , the 14 - 3 - 3 and glycoprotein of 43 kda proteins , which had been previously
described as extracellular matrix adhesins and apoptosis inductors in human
pneumocytes . accordingly , epithelial cells were treated with these molecules for
different periods of time and the expression of the apoptosis regulating - proteins
bak , bax , bcl-2 , p53 and caspases were evaluated by terminal deoxynucleotidyl
transferase dutp nick end labelling , flow cytometry and real - time polymerase chain
reaction analysis .
our results demonstrated that treatment with these molecules
induces apoptosis signalling in pulmonary epithelial cells , showing the same pattern
of programmed cell - death as that observed during infection with p.
brasiliensis .
thus , we could conclude that p.
brasiliensis uses these molecules as virulence factors that participate
not only in the fungal adhesion process to host cells , but also in other important
cellular mechanisms such as apoptosis .
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.