repo_name
stringlengths
5
92
path
stringlengths
4
232
copies
stringclasses
19 values
size
stringlengths
4
7
content
stringlengths
721
1.04M
license
stringclasses
15 values
hash
int64
-9,223,277,421,539,062,000
9,223,102,107B
line_mean
float64
6.51
99.9
line_max
int64
15
997
alpha_frac
float64
0.25
0.97
autogenerated
bool
1 class
JulyKikuAkita/PythonPrac
cs15211/LongestWordInDictionaryThroughDeleting.py
1
4177
__source__ = 'https://leetcode.com/problems/longest-word-in-dictionary-through-deleting/' # Time: O(nlogn + n*x), Sorting takes O(nlogn) and isSubsequence takes O(x) # Space: O(logn) Sorting takes O(logn) space in average case. # # Description: 524. Longest Word in Dictionary through Deleting # # Given a string and a string dictionary, find the longest string in the dictionary # that can be formed by deleting some characters of the given string. # If there are more than one possible results, return the longest word with the smallest lexicographical order. # If there is no possible result, return the empty string. # # Example 1: # Input: # s = "abpcplea", d = ["ale","apple","monkey","plea"] # # Output: # "apple" # Example 2: # Input: # s = "abpcplea", d = ["a","b","c"] # # Output: # "a" # # Note: # All the strings in the input will only contain lower-case letters. # The size of the dictionary won't exceed 1,000. # The length of all the strings in the input won't exceed 1,000. # Hide Company Tags Google # Hide Tags Two Pointers Sort # import unittest # Let's check whether each word is a subsequence of S individually by "best" order # (largest size, then lexicographically smallest.) Then if we find a match, # we know the word being considered must be the best possible answer, # since better answers were already considered beforehand. # # Let's figure out how to check if a needle (word) is a subsequence of a haystack (S). # This is a classic problem with the following solution: walk through S, # keeping track of the position (i) of the needle that indicates that word[i:] # still remains to be matched to S at this point in time. Whenever word[i] matches the current character in S, # we only have to match word[i+1:], so we increment i. At the end of this process, i == len(word) # if and only if we've matched every character in word to some character in S in order of our walk. # # 584ms 19.60% class Solution(object): def findLongestWord(self, s, d): """ :type s: str :type d: List[str] :rtype: str """ d.sort(key = lambda x: (-len(x), x)) for word in d: i = 0 for c in s: if i < len(word) and word[i] == c: i += 1 if i == len(word): return word return "" class TestMethods(unittest.TestCase): def test_Local(self): self.assertEqual(1, 1) if __name__ == '__main__': unittest.main() Java = ''' # Thought: https://leetcode.com/problems/longest-word-in-dictionary-through-deleting/solution/ 1. An alternate, more efficient solution which avoids sorting the dictionary: # 33ms 65.40% class Solution { public String findLongestWord(String s, List<String> d) { String res = ""; for (String key : d) { int i = 0; for ( char c : s.toCharArray()) { if ( i < key.length() && c == key.charAt(i)) i++; } if (i == key.length() && key.length() >= res.length()) { if (key.length() > res.length() || key.compareTo(res) < 0) { //asec res = key; } } } return res; } } 2. Idea is sort the dictionary d first by length DESC then lexicographical ASC and test if p is SubSequence of s. The first match is the answer. # 106ms 4.57% class Solution { public String findLongestWord(String s, List<String> d) { if (s.length() == 0 || d.size() == 0) return ""; //sort dict: Collections.sort(d, (a, b) -> { return s2.length() != s1.length() ? s2.length() - s1.length() : //desc s1.compareTo(s2); //asec }); for (String key : d) { if (s.length() < key.length()) continue; if (isSubSeq(key, s)) return key; } return ""; } public boolean isSubSeq(String needle, String Hay) { int i = 0; for (char c : Hay.toCharArray()) { if (i < needle.length() && c == needle.charAt(i)) { i++; } } return i == needle.length(); } } '''
apache-2.0
-5,894,769,081,862,545,000
31.889764
111
0.594925
false
uclouvain/osis_louvain
assessments/forms/score_file.py
1
1880
############################################################################## # # OSIS stands for Open Student Information System. It's an application # designed to manage the core business of higher education institutions, # such as universities, faculties, institutes and professional schools. # The core business involves the administration of students, teachers, # courses, programs and so on. # # Copyright (C) 2015-2018 Université catholique de Louvain (http://www.uclouvain.be) # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # A copy of this license - GNU General Public License - is available # at the root of the source code of this program. If not, # see http://www.gnu.org/licenses/. # ############################################################################## from django import forms from django.utils.translation import ugettext_lazy as _ class ScoreFileForm(forms.Form): file = forms.FileField(error_messages={'required': _('no_file_submitted')}) def clean_file(self): file = self.cleaned_data['file'] content_type = file.content_type.split('/')[1] valid_content_type = 'vnd.openxmlformats-officedocument.spreadsheetml.sheet' in content_type if ".xlsx" not in file.name or not valid_content_type: self.add_error('file', forms.ValidationError(_('file_must_be_xlsx'), code='invalid')) return file
agpl-3.0
-502,586,721,529,759,000
47.179487
100
0.654604
false
hsharsha/perfrunner
perfrunner/tests/functional.py
1
1852
import unittest from perfrunner.__main__ import get_options from perfrunner.helpers.memcached import MemcachedHelper from perfrunner.helpers.remote import RemoteHelper from perfrunner.helpers.rest import RestHelper from perfrunner.settings import ClusterSpec, TestConfig from perfrunner.tests import TargetIterator class FunctionalTest(unittest.TestCase): def __init__(self, *args, **kwargs): options, _args = get_options() override = \ _args and (arg.split('.') for arg in ' '.join(_args).split(',')) self.cluster_spec = ClusterSpec() self.cluster_spec.parse(options.cluster_spec_fname) self.test_config = TestConfig() self.test_config.parse(options.test_config_fname, override) self.target_iterator = TargetIterator(self.cluster_spec, self.test_config) self.memcached = MemcachedHelper(self.test_config) self.remote = RemoteHelper(self.cluster_spec, self.test_config) self.rest = RestHelper(self.cluster_spec) super(FunctionalTest, self).__init__(*args, **kwargs) class MemcachedTests(FunctionalTest): def test_num_threads(self): expected_threads = self.test_config.cluster.num_cpus if expected_threads is None: cores = self.remote.detect_number_cores() expected_threads = int(0.75 * cores) for target in self.target_iterator: host = target.node.split(':')[0] port = self.rest.get_memcached_port(target.node) stats = self.memcached.get_stats(host, port, target.bucket, stats='') num_threads = int(stats['threads']) self.assertEqual(num_threads, expected_threads) if __name__ == '__main__': unittest.main(argv=['functional.py'])
apache-2.0
919,988,435,475,458,000
37.583333
76
0.636609
false
mfasq1Monash/FIT3140
interpreter.py
1
6491
''' Author: Michael Asquith, Aaron Gruneklee Created: 2014.12.08 Last Modified: 2014.12.23 Interpreter for a simple functional programming language. Access with interpret(command) Based on Peter Norvig's Lispy interpreter, http://norvig.com/lispy.html ''' import math, operator as op from robotio import RobotIO Symbol = str class VariableAlreadyPresentException(Exception): pass class FunctionAlreadyDefinedException(Exception): pass class VariableAlreadySetException(Exception): pass class VariableNotFoundException(Exception): pass class InterpretedList(list): pass class Procedure(object): """A user-defined method for the interpreter""" def __init__(self, parms, stats, env, inter): self.parameters = parms self.statements = stats self.environment = env self.interpreter = inter def __call__(self, *args): localVariables = Environment(self.parameters, args, self.environment) return self.interpreter.evaluate(self.statements, localVariables) class Environment(dict): """A set of variables for the interpreter or a method within it.""" def __init__(self, parms=(), expressions=(), outer=None): """When evaluating, procedures will pass in their parameters""" self.update(zip(parms, expressions)) self.outer = outer def find(self, variable): """Returns the lowest level Environment which has variable""" if variable in self: return self try: return self.outer.find(variable) except AttributeError: raise VariableNotFoundException def add_new(self, variable, value): """Adds a new definition to the environment. If the variable is already present, raises a KeyAlreadyPresentError""" if variable in self: raise(VariableAlreadyPresentException) self[variable] = value class Interpreter: """After initialising an interpreter, run expressions by calling interpret. """ def __init__(self, newRobotIO): """Creates an interpreter with standard math operations and variables. Can send input/output to newRobotIO """ self.global_environment = self.standard_environment() self.robotio = newRobotIO def interpret(self, code): """Parses and executes code a string in the form of: (method_name argument1 argument2) Arguments which are expressions must be placed in brackets. Arguments which are not expressions must not be placed in brackets. """ return self.evaluate(self.parse(code)) def parse(self, code): "Read an expression from a string." return self.read_from_tokens(self.tokenize(code)) def tokenize(self, s): "Convert a string into a list of tokens." return s.replace('(',' ( ').replace(')',' ) ').split() def read_from_tokens(self, tokens): "Read an expression from a sequence of tokens." if len(tokens) == 0: raise SyntaxError('unexpected EOF while reading') token = tokens.pop(0) if '(' == token: L = [] while tokens[0] != ')': L.append(self.read_from_tokens(tokens)) tokens.pop(0) # pop off ')' return L elif ')' == token: raise SyntaxError('unexpected )') else: return self.atom(token) def atom(self, token): "Numbers become numbers, booleans become booleans, everything else become symbols." try: return int(token) except ValueError: if token.lower() == 'true': return True elif token.lower() == 'false': return False else: return Symbol(token) def standard_environment(self): "Creates the base variable environment" env = Environment() env.update(vars(math)) env.update({ '+':op.add, '-':op.sub, '*':op.mul, '/':op.div, '>':op.gt, '<':op.lt, '>=':op.ge, '<=':op.le, '=':op.eq, 'define':None, 'if':None, 'set':None, 'comment':None, '%': lambda x,y: abs(x % y), 'and': lambda x,y: x and y, 'or': lambda x,y: x or y, 'not': lambda x: not x, 'move': lambda x: self.robotio.move(x), 'turn': lambda x: self.robotio.turn(x), 'detect-wall': lambda x: self.robotio.detect_wall(x), 'detect-goal': lambda x: self.robotio.detect_goal(x), '[]': InterpretedList(), 'build': lambda x,y: InterpretedList([x] + y), 'head': lambda x: x[0], 'tail': lambda x: InterpretedList(x[1:]) }) return env def evaluate(self, x, env=None): if env == None: env = self.global_environment # If x is a list, must be evaluating a method if isinstance(x, list): if isinstance(x, InterpretedList): return x method = x.pop(0) # Defines a function if method == 'define': try: self.global_environment.add_new(x[0], Procedure(x[1], x[2], env, self)) except VariableAlreadyPresentException: raise FunctionAlreadyDefinedException # If statement. [Test, consequences, alternative] elif method == 'if': if self.evaluate(x[0]): return self.evaluate(x[1]) return self.evaluate(x[2]) # Sets a variable elif method == 'set': try: env.add_new(x[0], self.evaluate(x[1],env)) except VariableAlreadyPresentException: raise VariableAlreadySetException return elif method == 'comment': return # Executes all other functions else: method = self.evaluate(method, self.global_environment) args = [self.evaluate(variable, env) for variable in x] return method(*args) elif isinstance(x, Symbol): return self.evaluate(env.find(x)[x]) else: return x
mit
5,197,515,918,788,058,000
33.343915
123
0.558312
false
scottrice/Ice
ice/tasks/engine.py
1
1118
# encoding: utf-8 import os from pysteam import paths as steam_paths from pysteam import shortcuts from pysteam import steam as steam_module from ice import backups from ice import configuration from ice import consoles from ice import emulators from ice import paths from ice import settings from ice.logs import logger from ice.persistence.config_file_backing_store import ConfigFileBackingStore class TaskEngine(object): def __init__(self, steam): self.steam = steam logger.debug("Initializing Ice") # We want to ignore the anonymous context, cause theres no reason to sync # ROMs for it since you cant log in as said user. is_user_context = lambda context: context.user_id != 'anonymous' self.users = filter(is_user_context, steam_module.local_user_contexts(self.steam)) def run(self, tasks, app_settings, dry_run=False): if self.steam is None: logger.error("Cannot run Ice because Steam doesn't appear to be installed") return logger.info("=========== Starting Ice ===========") for task in tasks: task(app_settings, self.users, dry_run=dry_run)
mit
4,875,944,689,318,500,000
29.216216
86
0.723614
false
glidernet/python-ogn-client
tests/client/test_AprsClient.py
1
6185
import unittest import unittest.mock as mock from ogn.parser import parse from ogn.client.client import create_aprs_login, AprsClient from ogn.client.settings import APRS_APP_NAME, APRS_APP_VER, APRS_KEEPALIVE_TIME class AprsClientTest(unittest.TestCase): def test_create_aprs_login(self): basic_login = create_aprs_login('klaus', -1, 'myApp', '0.1') self.assertEqual('user klaus pass -1 vers myApp 0.1\n', basic_login) login_with_filter = create_aprs_login('klaus', -1, 'myApp', '0.1', 'r/48.0/11.0/100') self.assertEqual('user klaus pass -1 vers myApp 0.1 filter r/48.0/11.0/100\n', login_with_filter) def test_initialisation(self): client = AprsClient(aprs_user='testuser', aprs_filter='') self.assertEqual(client.aprs_user, 'testuser') self.assertEqual(client.aprs_filter, '') @mock.patch('ogn.client.client.socket') def test_connect_full_feed(self, mock_socket): client = AprsClient(aprs_user='testuser', aprs_filter='') client.connect() client.sock.send.assert_called_once_with('user testuser pass -1 vers {} {}\n'.format( APRS_APP_NAME, APRS_APP_VER).encode('ascii')) client.sock.makefile.assert_called_once_with('rb') @mock.patch('ogn.client.client.socket') def test_connect_client_defined_filter(self, mock_socket): client = AprsClient(aprs_user='testuser', aprs_filter='r/50.4976/9.9495/100') client.connect() client.sock.send.assert_called_once_with('user testuser pass -1 vers {} {} filter r/50.4976/9.9495/100\n'.format( APRS_APP_NAME, APRS_APP_VER).encode('ascii')) client.sock.makefile.assert_called_once_with('rb') @mock.patch('ogn.client.client.socket') def test_disconnect(self, mock_socket): client = AprsClient(aprs_user='testuser', aprs_filter='') client.connect() client.disconnect() client.sock.shutdown.assert_called_once_with(0) client.sock.close.assert_called_once_with() self.assertTrue(client._kill) @mock.patch('ogn.client.client.socket') def test_run(self, mock_socket): import socket mock_socket.error = socket.error client = AprsClient(aprs_user='testuser', aprs_filter='') client.connect() client.sock_file.readline = mock.MagicMock() client.sock_file.readline.side_effect = [b'Normal text blabla', b'my weird character \xc2\xa5', UnicodeDecodeError('funnycodec', b'\x00\x00', 1, 2, 'This is just a fake reason!'), b'... show must go on', BrokenPipeError(), b'... and on', ConnectionResetError(), b'... and on', socket.error(), b'... and on', b'', b'... and on', KeyboardInterrupt()] try: client.run(callback=lambda msg: print("got: {}".format(msg)), autoreconnect=True) except KeyboardInterrupt: pass finally: client.disconnect() @mock.patch('ogn.client.client.time') @mock.patch('ogn.client.client.socket') def test_run_keepalive(self, mock_socket, mock_time): import socket mock_socket.error = socket.error client = AprsClient(aprs_user='testuser', aprs_filter='') client.connect() client.sock_file.readline = mock.MagicMock() client.sock_file.readline.side_effect = [b'Normal text blabla', KeyboardInterrupt()] mock_time.side_effect = [0, 0, APRS_KEEPALIVE_TIME + 1, APRS_KEEPALIVE_TIME + 1] timed_callback = mock.MagicMock() try: client.run(callback=lambda msg: print("got: {}".format(msg)), timed_callback=timed_callback) except KeyboardInterrupt: pass finally: client.disconnect() timed_callback.assert_called_with(client) def test_reset_kill_reconnect(self): client = AprsClient(aprs_user='testuser', aprs_filter='') client.connect() # .run() should be allowed to execute after .connect() mock_callback = mock.MagicMock( side_effect=lambda raw_msg: client.disconnect()) self.assertFalse(client._kill) client.run(callback=mock_callback, autoreconnect=True) # After .disconnect(), client._kill should be True self.assertTrue(client._kill) self.assertEqual(mock_callback.call_count, 1) # After we reconnect, .run() should be able to run again mock_callback.reset_mock() client.connect() client.run(callback=mock_callback, autoreconnect=True) self.assertEqual(mock_callback.call_count, 1) def test_50_live_messages(self): print("Enter") self.remaining_messages = 50 def process_message(raw_message): if raw_message[0] == '#': return try: message = parse(raw_message) print("{}: {}".format(message['aprs_type'], raw_message)) except NotImplementedError as e: print("{}: {}".format(e, raw_message)) return if self.remaining_messages > 0: self.remaining_messages -= 1 else: raise KeyboardInterrupt client = AprsClient(aprs_user='testuser', aprs_filter='') client.connect() try: client.run(callback=process_message, autoreconnect=True) except KeyboardInterrupt: pass finally: client.disconnect() self.assertTrue(True)
agpl-3.0
-3,735,583,712,359,570,000
40.233333
132
0.551657
false
TheWitchers/Team
TestingArea/TESTZONE_methods.py
1
1111
__author__ = 'dvir' import tkFileDialog import sqlite3 conn = sqlite3.connect(tkFileDialog.askopenfilename()) c = conn.cursor() # using example db def ex_show_purch(price): l = [] for row in c.execute("SELECT symbol FROM stocks WHERE price > " + str(price) + ""): print row l.append(row) print l return l ex_show_purch(raw_input("Enter Price: ")) # for project db def show_purch(name): l = [] for row in c.execute("SELECT * FROM Purchaseses WHERE nickname = '" + name + "'"): print row l.append(row) print l return l def correct_user(id, pas): if len(c.execute("SELECT * FROM Users WHERE username = '" + id + "' AND password = '" + pas + "'")) > 0: print "user exists" else: print "user does not exist" def has_inf(col, tbl, info): if len(c.execute( "SELECT '" + col + "' FROM Users WHERE username = '" + id + "' AND '" + col + "' = '" + info + "'")) > 0: print col + "already exists" else: print col + " is OK"
gpl-2.0
6,712,637,197,793,229,000
24.25
181
0.531953
false
MagicStack/asyncpg
asyncpg/transaction.py
1
8297
# Copyright (C) 2016-present the asyncpg authors and contributors # <see AUTHORS file> # # This module is part of asyncpg and is released under # the Apache 2.0 License: http://www.apache.org/licenses/LICENSE-2.0 import enum from . import connresource from . import exceptions as apg_errors class TransactionState(enum.Enum): NEW = 0 STARTED = 1 COMMITTED = 2 ROLLEDBACK = 3 FAILED = 4 ISOLATION_LEVELS = {'read_committed', 'serializable', 'repeatable_read'} ISOLATION_LEVELS_BY_VALUE = { 'read committed': 'read_committed', 'serializable': 'serializable', 'repeatable read': 'repeatable_read', } class Transaction(connresource.ConnectionResource): """Represents a transaction or savepoint block. Transactions are created by calling the :meth:`Connection.transaction() <connection.Connection.transaction>` function. """ __slots__ = ('_connection', '_isolation', '_readonly', '_deferrable', '_state', '_nested', '_id', '_managed') def __init__(self, connection, isolation, readonly, deferrable): super().__init__(connection) if isolation and isolation not in ISOLATION_LEVELS: raise ValueError( 'isolation is expected to be either of {}, ' 'got {!r}'.format(ISOLATION_LEVELS, isolation)) self._isolation = isolation self._readonly = readonly self._deferrable = deferrable self._state = TransactionState.NEW self._nested = False self._id = None self._managed = False async def __aenter__(self): if self._managed: raise apg_errors.InterfaceError( 'cannot enter context: already in an `async with` block') self._managed = True await self.start() async def __aexit__(self, extype, ex, tb): try: self._check_conn_validity('__aexit__') except apg_errors.InterfaceError: if extype is GeneratorExit: # When a PoolAcquireContext is being exited, and there # is an open transaction in an async generator that has # not been iterated fully, there is a possibility that # Pool.release() would race with this __aexit__(), since # both would be in concurrent tasks. In such case we # yield to Pool.release() to do the ROLLBACK for us. # See https://github.com/MagicStack/asyncpg/issues/232 # for an example. return else: raise try: if extype is not None: await self.__rollback() else: await self.__commit() finally: self._managed = False @connresource.guarded async def start(self): """Enter the transaction or savepoint block.""" self.__check_state_base('start') if self._state is TransactionState.STARTED: raise apg_errors.InterfaceError( 'cannot start; the transaction is already started') con = self._connection if con._top_xact is None: if con._protocol.is_in_transaction(): raise apg_errors.InterfaceError( 'cannot use Connection.transaction() in ' 'a manually started transaction') con._top_xact = self else: # Nested transaction block if self._isolation: top_xact_isolation = con._top_xact._isolation if top_xact_isolation is None: top_xact_isolation = ISOLATION_LEVELS_BY_VALUE[ await self._connection.fetchval( 'SHOW transaction_isolation;')] if self._isolation != top_xact_isolation: raise apg_errors.InterfaceError( 'nested transaction has a different isolation level: ' 'current {!r} != outer {!r}'.format( self._isolation, top_xact_isolation)) self._nested = True if self._nested: self._id = con._get_unique_id('savepoint') query = 'SAVEPOINT {};'.format(self._id) else: query = 'BEGIN' if self._isolation == 'read_committed': query += ' ISOLATION LEVEL READ COMMITTED' elif self._isolation == 'repeatable_read': query += ' ISOLATION LEVEL REPEATABLE READ' elif self._isolation == 'serializable': query += ' ISOLATION LEVEL SERIALIZABLE' if self._readonly: query += ' READ ONLY' if self._deferrable: query += ' DEFERRABLE' query += ';' try: await self._connection.execute(query) except BaseException: self._state = TransactionState.FAILED raise else: self._state = TransactionState.STARTED def __check_state_base(self, opname): if self._state is TransactionState.COMMITTED: raise apg_errors.InterfaceError( 'cannot {}; the transaction is already committed'.format( opname)) if self._state is TransactionState.ROLLEDBACK: raise apg_errors.InterfaceError( 'cannot {}; the transaction is already rolled back'.format( opname)) if self._state is TransactionState.FAILED: raise apg_errors.InterfaceError( 'cannot {}; the transaction is in error state'.format( opname)) def __check_state(self, opname): if self._state is not TransactionState.STARTED: if self._state is TransactionState.NEW: raise apg_errors.InterfaceError( 'cannot {}; the transaction is not yet started'.format( opname)) self.__check_state_base(opname) async def __commit(self): self.__check_state('commit') if self._connection._top_xact is self: self._connection._top_xact = None if self._nested: query = 'RELEASE SAVEPOINT {};'.format(self._id) else: query = 'COMMIT;' try: await self._connection.execute(query) except BaseException: self._state = TransactionState.FAILED raise else: self._state = TransactionState.COMMITTED async def __rollback(self): self.__check_state('rollback') if self._connection._top_xact is self: self._connection._top_xact = None if self._nested: query = 'ROLLBACK TO {};'.format(self._id) else: query = 'ROLLBACK;' try: await self._connection.execute(query) except BaseException: self._state = TransactionState.FAILED raise else: self._state = TransactionState.ROLLEDBACK @connresource.guarded async def commit(self): """Exit the transaction or savepoint block and commit changes.""" if self._managed: raise apg_errors.InterfaceError( 'cannot manually commit from within an `async with` block') await self.__commit() @connresource.guarded async def rollback(self): """Exit the transaction or savepoint block and rollback changes.""" if self._managed: raise apg_errors.InterfaceError( 'cannot manually rollback from within an `async with` block') await self.__rollback() def __repr__(self): attrs = [] attrs.append('state:{}'.format(self._state.name.lower())) if self._isolation is not None: attrs.append(self._isolation) if self._readonly: attrs.append('readonly') if self._deferrable: attrs.append('deferrable') if self.__class__.__module__.startswith('asyncpg.'): mod = 'asyncpg' else: mod = self.__class__.__module__ return '<{}.{} {} {:#x}>'.format( mod, self.__class__.__name__, ' '.join(attrs), id(self))
apache-2.0
-3,851,821,235,338,135,000
33.861345
78
0.556105
false
turtledb/0install
zeroinstall/injector/qdom.py
1
3485
"""A quick DOM implementation. Python's xml.dom is very slow. The xml.sax module is also slow (as it imports urllib2). This is our light-weight version. """ # Copyright (C) 2009, Thomas Leonard # See the README file for details, or visit http://0install.net. from xml.parsers import expat import zeroinstall from zeroinstall.injector import versions _parsed_version = versions.parse_version(zeroinstall.version) class Element(object): """An XML element. @ivar uri: the element's namespace @type uri: str @ivar name: the element's localName @type name: str @ivar attrs: the element's attributes (key is in the form [namespace " "] localName) @type attrs: {str: str} @ivar childNodes: children @type childNodes: [L{Element}] @ivar content: the text content @type content: str""" __slots__ = ['uri', 'name', 'attrs', 'childNodes', 'content'] def __init__(self, uri, name, attrs): """@type uri: str @type name: str @type attrs: {str: str}""" self.uri = uri self.name = name self.attrs = attrs.copy() self.content = None self.childNodes = [] def __str__(self): """@rtype: str""" attrs = [n + '=' + self.attrs[n] for n in self.attrs] start = '<{%s}%s %s' % (self.uri, self.name, ' '.join(attrs)) if self.childNodes: return start + '>' + '\n'.join(map(str, self.childNodes)) + ('</%s>' % (self.name)) elif self.content: return start + '>' + self.content + ('</%s>' % (self.name)) else: return start + '/>' def getAttribute(self, name): """@type name: str @rtype: str""" return self.attrs.get(name, None) class QSAXhandler(object): """SAXHandler that builds a tree of L{Element}s""" def __init__(self, filter_for_version = False): """@param filter_for_version: skip elements if their if-0install-version attribute doesn't match L{zeroinstall.version} (since 1.13). @type filter_for_version: bool @rtype: bool""" self.stack = [] if filter_for_version: self.filter_range = lambda expr: versions.parse_version_expression(expr)(_parsed_version) else: self.filter_range = lambda x: True def startElementNS(self, fullname, attrs): """@type fullname: str @type attrs: {str: str}""" split = fullname.split(' ', 1) if len(split) == 2: self.stack.append(Element(split[0], split[1], attrs)) else: self.stack.append(Element(None, fullname, attrs)) self.contents = '' def characters(self, data): """@type data: str""" self.contents += data def endElementNS(self, name): """@type name: str""" contents = self.contents.strip() self.stack[-1].content = contents self.contents = '' new = self.stack.pop() if self.stack: target_versions = new.attrs.get('if-0install-version') if target_versions and not self.filter_range(target_versions): return self.stack[-1].childNodes.append(new) else: self.doc = new def parse(source, filter_for_version = False): """Parse an XML stream into a tree of L{Element}s. @param source: data to parse @type source: file @param filter_for_version: skip elements if their if-0install-version attribute doesn't match L{zeroinstall.version} (since 1.13). @type filter_for_version: bool @return: the root @rtype: L{Element}""" handler = QSAXhandler(filter_for_version) parser = expat.ParserCreate(namespace_separator = ' ') parser.StartElementHandler = handler.startElementNS parser.EndElementHandler = handler.endElementNS parser.CharacterDataHandler = handler.characters parser.ParseFile(source) return handler.doc
lgpl-2.1
-237,805,872,924,645,440
29.840708
135
0.682927
false
bandit145/ans-between
src/dictops.py
1
1886
#TODO: allow missing params and args lists to pass tests from src import logging class dict_mgm: #creates ansible command to run def make_play(data,db_data,location): if dict_mgm.data_check(data, db_data) == 'OK': command = 'ansible-playbook {location}'.format(location=location) #did and incredi bad if else thing logging.debug(data.keys()) command+=data['name']+' ' if 'params' in data.keys(): command+= dict_mgm.sort_params(data['params']) if 'args' in data.keys(): command+= dict_mgm.sort_args(data['args']) if 'password' in data.keys(): password = data['password'] else: password = None logging.debug(command) logging.debug(password) return command, password else: return 'Error', None #check integrity of submitted data compared to its schema model def data_check(data,db_data): logging.debug(data) logging.debug(db_data) if len(data) != len(db_data): logging.debug('triggered 1') return 'Error' if data.keys() != db_data.keys(): logging.debug('triggered 2') return 'Error' if len(data.values()) != len(db_data.values()): logging.debug('triggered 3') return 'Error' #for playbooks that have no params/args try: if len(data['params']) != len(db_data['params']): logging.debug('triggered 4') return 'Error' except KeyError: pass try: if len(data['args']) != len(db_data['args']): logging.debug('triggered 5') return 'Error' except KeyError: pass logging.debug('OK') return 'OK' def sort_params(params):#deals with param dics command = '' for item in params: keys= list(item.keys()) values= list(item.values()) logging.debug(keys) logging.debug(values) command+=keys[0]+' '+values[0]+' ' return command def sort_args(args): #deals with args list command = '' for arg in args: command+= arg+' ' return command
mit
-4,789,335,474,906,966,000
25.208333
68
0.656416
false
phense/check_duplicate_files
check_duplicate_files.py
1
21660
#!/usr/bin/env python # -*- coding: utf-8 -*- """check_duplicate_files.py Finds all duplicate files in given directories using a hash-algorithm. After scanning the filesystem for possible duplicate files (all files with a unique filesize are dismissed, except for Images when selecting the perceptual hash algorithm). All possible candidate duplicate files are hashed. With pre-filtering, this module is extremely fast on large file-sets since only a handful of files need to actually hbe ashed. Standard use: python3 check_duplicate_files -i /some/folder ./out.txt """ # FEATURE(zyrkon): ignore/include win/linux/mac hidden file # FEATURE(zyrkon): implement multiprocessor for hashing # FEATURE(zyrkon): find broken symbolic links # FEATURE(zyrkon): find empty files and directories # FEATURE(zyrkon): --size 20M-1G to find files between 20mb and 1gb (example) # FEATURE(zyrkon): maybe a GUI __author__ = 'Peter Hense (peter.hense@gmail.com)' __copyright__ = 'Copyright (c) 2015, Peter Hense' __license__ = 'Apache License Version 2.0' __credits__ = '' # ['List', 'of', 'programmers'] __status__ = 'Development' # Prototype / Development / Production __version__ = '0.8' import os import sys if sys.version_info < (3, 0): sys.stdout.write("Sorry, requires Python 3.x, not Python 2.x\n") sys.exit(1) import codecs import datetime import hashlib import json import operator import signal from argparse import ArgumentParser from argparse import ArgumentTypeError from collections import defaultdict from tqdm import * from stat import * try: from PIL import Image # Pillow (modern PIL fork) except ImportError: IMG_LIB_ERROR = True else: IMG_LIB_ERROR = False FILEREADERROR = 255 def generate_hashes(filelist, image_list, hashtype, pHash): """ Main-Module for handling all File-Hashing and saving the hash-results Args: filelist: List of file-paths to REGULAR FILES to run a normal hash-algorithm on image_list: List of file-paths of images to run a perceptual hash-algorithm on hashtype: hash-algorithm to use for normal files (default=md5) pHash: boolean switch to activate perceptual image-hashing Returns: d_list_hash: dictionary with lists of files sorted by hash-value (key) errorlist: list of files that could not be accessed / read """ d_list_hash = defaultdict(list) errorlist = [] for file_path in tqdm(filelist, 'hashing', None, True): hash = _hash(file_path, hashtype) if hash != FILEREADERROR: d_list_hash[hash].append(file_path) else: errorlist.append(file_path) if pHash: # perceptual image hashing d_list_hash_img = defaultdict(list) for file_path in tqdm(image_list, 'hashing images:', None, True): hash = _perceptive_hash(file_path) if hash != FILEREADERROR: d_list_hash_img[hash].append(file_path) else: errorlist.append(file_path) # calculate hamming-distance between all image-hashes to find # outliners (hamming distance of two perceptual hashes < 4 means the images # are basically the same) index_list = [key for key in d_list_hash_img] deleted_index_keys = [] for hash1 in tqdm(index_list, 'calculating', None, True): if hash1 in deleted_index_keys: continue for hash2 in index_list: if hash1 == hash2: continue # same entry in list if hash2 in deleted_index_keys: continue if _hamming_distance(hash1, hash2) < 4: d_list_hash_img[hash1] += d_list_hash_img[hash2] del d_list_hash_img[hash2] deleted_index_keys.append(hash2) # Filter out all unique entries from our resultset _delete_unique_entries(d_list_hash) if pHash: _delete_unique_entries(d_list_hash_img) d_list_hash.update(d_list_hash_img) return d_list_hash, errorlist def _perceptive_hash(file_path, hash_size = 8): """Calculates a hash-value from an image Conversion uses a resized, grayscaled pixel-array of the image, converting the pixel-array to a number-array (differences between neighboring pixels) and finally converting these values to a hex-string of length hash_size Args: file_path: Path to an Image File hash_size: Size of the generated hash string Returns: hash_string: generated hash string """ # if memory consumption is to high for many images, it is posisble to use # with open (file_path, 'rb') as f: # image = Image.open(f) # ... # del image try: image = Image.open(file_path) except: return FILEREADERROR # Grayscale and shrink the image in one step image = image.convert('L').resize((hash_size + 1, hash_size), Image.ANTIALIAS) pixels = list(image.getdata()) # Compage adjacent pixels difference = [] for row in range(hash_size): for col in range(hash_size): pixel_left = image.getpixel((col, row)) pixel_right = image.getpixel((col +1, row)) difference.append(pixel_left > pixel_right) # Convert binary array to hexadecimal string decimal_value = 0 hex_string = [] for index, value in enumerate(difference): if value: decimal_value += 2**(index % 8) if (index % 8) == 7: hex_string.append(hex(decimal_value)[2:].rjust(2, '0')) decimal_value = 0 return ''.join(hex_string) def _hash(file_path, hashtype): """Uses a specified standard hash-algorithm to hash a regular file Args: file_path: file_path to a regular file that can be hashed hashtype: version of hash-algorithm, default = md5 Returns: hash: hash-string of the hashed file Raises: Returns global const FILEREADERROR on IOError """ try: with open(file_path, 'rb') as f: contents = f.read() except: return FILEREADERROR hasher = getattr(hashlib, hashtype.lower(), hashlib.md5) return hasher(contents).hexdigest() def _hamming_distance(string1, string2): """ Calculates the Hamming Distance of two strings, fast version Args: string1, string2: two strings of the same length Returns: Integer describing the Hamming Distance of the input strings """ assert len(string1) == len(string2) ne = operator.ne # faster than '!=' and 'str.__ne__' return sum(map(ne, string1, string2)) def scan_directories(directories, pHash): """ creates file-lists from given directories Recursively walks the given directories and their subdirectories, checking all including files and their file-sizes. These are saved inside a dictionary and pre-filtered by filesize. Optional separate handling of image-files. Args: directories: List of directories to crawl pHash: boolean switch to active separate handling of image-files Returns: prefiltered_files: List of files with their file-paths images: List of image-files if pHash is set, else an empty list errorlist: List of files that could not be accessed """ extensions = ('.jpg', '.jpeg', '.png', '.bmp') d_list_filesize = defaultdict(list) images = [] errorlist = [] count = 0 print('Scanning directories...') # code could be a lot smaller with `if pHash` inside the innermost loop # it would also lead to a LOT of unnessary checking if not pHash: # use normal hash on all files for root_dir in directories: for path, subdirList, fileList in os.walk(root_dir): for fname in fileList: qualified_filename = os.path.join(path, fname) try: # denied permission for os.stat st = os.stat(qualified_filename) if S_ISREG(st.st_mode): d_list_filesize[st.st_size].append(qualified_filename) count += 1 except: errorlist.append(qualified_filename) count += 1 else: # split list of normal- and image-files for root_dir in directories: for path, subdirList, fileList in os.walk(root_dir): for fname in fileList: qualified_filename = os.path.join(path, fname) if fname.endswith(extensions): images.append(qualified_filename) count += 1 else: try: st = os.stat(qualified_filename) if S_ISREG(st.st_mode): d_list_filesize[st.st_size].append(qualified_filename) count += 1 except: errorlist.append(qualified_filename) count += 1 # Statistic print('\nFiles found: %s' % count) # pre-filter all files with unique filesize # this is where we need the dictionary _delete_unique_entries(d_list_filesize) # put all filtered files in a list for easier handling prefiltered_files = [path for paths in d_list_filesize.values() for path in paths] # Statistic print('Possible candidates: %s\n' % (prefiltered_files.__len__() + images.__len__())) return prefiltered_files, images, errorlist def _delete_unique_entries(dictionary): """ removes all Lists from a dictionary that contain a single element Args: dictionary a dictionary of type defaultdict(set) or defaultdict(list) """ mark_for_delete = [] for key in dictionary: if dictionary[key].__len__() == 1: mark_for_delete.append(key) for i in mark_for_delete: del dictionary[i] return def write_output_text(d_list_hash, errorlist, outfile): """ Writes result of this module in textform to a file Args: d_list_hash: found duplicates in form of a dictionary (key = hash-value) outfile: the path and filename to write the output into (needs write-permission) errorlist: list of files that could not be accessed """ write_errorlist = [] try: with codecs.open(outfile, 'w', encoding='utf-8') as f: f.write('\nThe Following File-Duplicates where found:') f.write('\n==========================================\n') for key in d_list_hash: f.write('Hash: %s\n' %key) for file_path in d_list_hash[key]: try: f.write('%s \n' % os.path.normcase(file_path)) except: write_errorlist.append(file_path) f.write('-------------------\n') if errorlist.__len__() > 0: f.write('\nThe Following Files could not be accessed:') f.write('\n==========================================\n') for error in errorlist: try: f.write('%s\n' % os.path.normcase(error)) except: write_errorlist.append(error) f.flush() except: #IOError, UnicodeEncodeError print('\n- Error - Could not open Output File.\n') if write_errorlist.__len__() > 0: print('- Error - These files could not be written to output file:\n') for write_error in write_errorlist: print('%s\n' % os.path.normcase(write_error)) print('(Please check your filesystem encoding)\n') return def write_output_bash(d_list_hash, outfile, create_link): """ Writes result of this module as a bash script to a file Args: d_list_hash: found duplicates in form of a dictionary (key = hash-value) outfile: the path and filename to write the output into (needs write-permission) create_link: boolean switch to select, if a deleted file should be replaced by a hardlink """ write_errorlist = [] try: with codecs.open(outfile, 'w', encoding='utf-8') as f: f.write('#!/bin/bash\n\n') f.write('# This script is machine generated and might do harm to your\n') f.write('# running system.\n') f.write('# Please check this script carefully before running\n') if create_link: f.write('printf "replacing duplicates with hardlinks..."\n') else: f.write('printf "deleting duplicates..."\n') for key in d_list_hash: try: original = os.path.normcase(d_list_hash[key][0]) f.write('# ------------------\n') f.write('# Original: %s\n' % original) for copy in d_list_hash[key][1:]: f.write('rm %s\n' % copy) if create_link: f.write('ln %s %s\n' % (original, os.path.normcase(copy))) except: write_errorlist.append(file_path) f.flush() except: #IOError, UnicodeEncodeError print('\n- Error - Could not open Output File.\n') if write_errorlist.__len__() > 0: print('- Error - These files could not be written to output file:\n') for write_error in write_errorlist: print('%s\n' % write_error) print('(Please check your filesystem encoding)\n') return def write_output_win(d_list_hash, outfile, create_link): """ Writes result of this module as a batch script to a file Args: d_list_hash: found duplicates in form of a dictionary (key = hash-value) outfile: the path and filename to write the output into (needs write-permission) create_link: boolean switch to select, if a deleted file should be replaced by a hardlink """ write_errorlist = [] try: with codecs.open(outfile, 'w', encoding='utf-8') as f: f.write('@ECHO OFF\n\n') f.write('REM This script is machine generated and might do harm to your\n') f.write('REM running system.\n') f.write('REM Please check this script carefully before running\n') if create_link: f.write('ECHO "replacing duplicates with hardlinks..."\n') else: f.write('ECHO "deleting duplicates..."\n') for key in d_list_hash: try: original = os.path.normcase(d_list_hash[key][0]) f.write('REM ------------------\n') f.write('REM Original: %s\n' % original) for copy in d_list_hash[key][1:]: f.write('DEL %s\n' % copy) if create_link: f.write('mklink /H %s %s\n' % (os.path.normcase(copy), original)) except: write_errorlist.append(file_path) f.flush() except: #IOError, UnicodeEncodeError print('\n- Error - Could not open Output File.\n') if write_errorlist.__len__() > 0: print('- Error - These files could not be written to output file:\n') for write_error in write_errorlist: print('%s\n' % write_error) print('(Please check your filesystem encoding)\n') return def write_output_json(d_list_hash, outfile): """ Writes result of this module as JSON to a file Args: d_list_hash: found duplicates in form of a dictionary (key = hash-value) outfile: the path and filename to write the output into (needs write-permission) """ try: with codecs.open(outfile, 'w', encoding='utf-8') as f: json.dump(d_list_hash, f, ensure_ascii=False, indent=4) except: print('\n- Error - Could not write JSON Data to file') return def _query_yes_no(question, default="yes"): """User Console Interaction for Y/N Questions. Args: question: String containing a Question that needs User input default: select the default answer of the question """ valid = {"yes": True, "y": True, "ye": True, "no": False, "n": False} if default is None: prompt = " [y/n] " elif default == "yes": prompt = " [Y/n] " elif default == "no": prompt = " [y/N] " else: raise ValueError("invalid default answer: '%s'" % default) while True: sys.stdout.write(question + prompt) choice = input().lower() if default is not None and choice == '': return valid[default] elif choice in valid: return valid[choice] else: sys.stdout.write("Please respond with 'yes' or 'no' " "(or 'y' or 'n').\n") def _signal_handler(signal, frame): sys.exit('Aborting...') def _readable_dir(prospective_dir): """ Checks if a given string is a valid path on the file-system Args: prospective_dir: file-path as String Returns: prospective_dir if checks are passed Raises: ArgumentTypeError if checks fail """ if not os.path.isdir(prospective_dir): raise ArgumentTypeError('readable_dir:{0} is not a valid path'.format(prospective_dir)) if os.access(prospective_dir, os.R_OK): return prospective_dir else: raise ArgumentTypeError('readable_dir:{0} is not a readable dir'.format(prospective_dir)) def main(): signal.signal(signal.SIGINT, _signal_handler) signal.signal(signal.SIGTERM, _signal_handler) start_time = datetime.datetime.now() parser = ArgumentParser(description = 'Check Duplicate Files') parser.add_argument('-i', action = 'append', dest = 'dir', type = _readable_dir, help = 'add directory to list for duplicate search' ) parser.add_argument('--hash', action = 'store', dest = 'hashtype', default = 'md5', help = 'select hash-type (md5 (default), sha1, sha224, sha256, sha384, sha512)' ) parser.add_argument('-p', '--perceptual-hashing', action = 'store_true', dest = 'pHash', default = False, help = 'enables perceptual hashing of images' ) parser.add_argument('-o', '--output-format', action = 'store', dest = 'outformat', default = 'text', help = 'select output format (text, json, bash_rm, bash_link, win_del, win_link)' ) parser.add_argument('outfile', #nargs='?', help = 'output file for found duplicates' ) parser.add_argument('--version', action='version', version='%(prog)s {version}'.format(version=__version__)) args = parser.parse_args() # disable perceptual hashing (normal hashes on all files) when PIL LIB could # not be loaded and it is not enabled pHash = ((not IMG_LIB_ERROR) and args.pHash) if not pHash: print('(Perceptual Image Scan disabled)') # Scan all directories and find duplicates by filesize prefiltered_filelist, images, read_errors = scan_directories(args.dir, pHash) # Ask the user if he wants to continue, now that he knows how # many files need to be hashed. Exclude the query-time from # execution time time_query = datetime.datetime.now() if not _query_yes_no('Do you want to continue?', 'yes'): sys.exit(0) timedelta_query = datetime.datetime.now() - time_query # timedelta # generate the hashed and calculate the execution time # append possible new read-errors to the general error-list d_list_hash = defaultdict(list) d_list_hash, read_errors2 = generate_hashes(prefiltered_filelist, images, args.hashtype, pHash) read_errors += read_errors2 execution_time = datetime.datetime.now() - start_time # timedelta execution_time -= timedelta_query # timedelta # write output output = ['text', 'json', 'bash_rm', 'bash_link', 'win_del', 'win_link'] if args.outformat in output: if args.outformat == 'text': write_output_text(d_list_hash, read_errors, args.outfile) elif args.outformat == 'json': write_output_json(d_list_hash, args.outfile) elif args.outformat == 'bash_rm': write_output_bash(d_list_hash, args.outfile, False) elif args.outformat == 'bash_link': write_output_bash(d_list_hash, args.outfile, True) elif args.outformat == 'win_del': write_output_win(d_list_hash, args.outfile, False) elif args.outformat == 'win_link': write_output_win(d_list_hash, args.outfile, True) else: write_output_text(d_list_hash, read_errors, args.outfile) print('\nExecution Time: %s.%s seconds' % (execution_time.seconds, execution_time.microseconds)) # done sys.exit(0) if __name__ == '__main__': main()
apache-2.0
-369,360,307,060,061,250
34.862583
105
0.580979
false
petrpulc/git-cmp
checkers/references.py
1
1113
""" Reference level checker (existence of given references or all refs/heads ans refs/tags). """ from common import Common from utils import check_diff def __filter(reference_list): return set(reference for reference in reference_list if reference.split('/')[1] in ('heads', 'tags')) def check(): """ Run the checker on references. """ print("=== References") if Common.args.references is None: o_refs = __filter(Common.original.listall_references()) n_refs = __filter(Common.new.listall_references()) check_diff(o_refs, n_refs, "References", 2) else: o_refs = set() for reference in Common.args.references: if reference not in Common.original.listall_references(): print(" {} does not exist, please report".format(reference)) exit(1) if reference not in Common.new.listall_references(): print(" {} expected, but not found".format(reference)) exit(1) o_refs.add(reference) print(" OK") Common.references = o_refs
mit
2,314,850,003,653,533,000
30.8
88
0.602875
false
kubeflow/kfp-tekton
backend/api/python_http_client/kfp_server_api/__init__.py
1
3915
# coding: utf-8 # flake8: noqa """ Kubeflow Pipelines API This file contains REST API specification for Kubeflow Pipelines. The file is autogenerated from the swagger definition. Contact: kubeflow-pipelines@google.com Generated by: https://openapi-generator.tech """ from __future__ import absolute_import __version__ = "1.5.0" # import apis into sdk package from kfp_server_api.api.experiment_service_api import ExperimentServiceApi from kfp_server_api.api.healthz_service_api import HealthzServiceApi from kfp_server_api.api.job_service_api import JobServiceApi from kfp_server_api.api.pipeline_service_api import PipelineServiceApi from kfp_server_api.api.pipeline_upload_service_api import PipelineUploadServiceApi from kfp_server_api.api.run_service_api import RunServiceApi # import ApiClient from kfp_server_api.api_client import ApiClient from kfp_server_api.configuration import Configuration from kfp_server_api.exceptions import OpenApiException from kfp_server_api.exceptions import ApiTypeError from kfp_server_api.exceptions import ApiValueError from kfp_server_api.exceptions import ApiKeyError from kfp_server_api.exceptions import ApiException # import models into sdk package from kfp_server_api.models.api_cron_schedule import ApiCronSchedule from kfp_server_api.models.api_experiment import ApiExperiment from kfp_server_api.models.api_experiment_storage_state import ApiExperimentStorageState from kfp_server_api.models.api_get_healthz_response import ApiGetHealthzResponse from kfp_server_api.models.api_get_template_response import ApiGetTemplateResponse from kfp_server_api.models.api_job import ApiJob from kfp_server_api.models.api_list_experiments_response import ApiListExperimentsResponse from kfp_server_api.models.api_list_jobs_response import ApiListJobsResponse from kfp_server_api.models.api_list_pipeline_versions_response import ApiListPipelineVersionsResponse from kfp_server_api.models.api_list_pipelines_response import ApiListPipelinesResponse from kfp_server_api.models.api_list_runs_response import ApiListRunsResponse from kfp_server_api.models.api_parameter import ApiParameter from kfp_server_api.models.api_periodic_schedule import ApiPeriodicSchedule from kfp_server_api.models.api_pipeline import ApiPipeline from kfp_server_api.models.api_pipeline_runtime import ApiPipelineRuntime from kfp_server_api.models.api_pipeline_spec import ApiPipelineSpec from kfp_server_api.models.api_pipeline_version import ApiPipelineVersion from kfp_server_api.models.api_read_artifact_response import ApiReadArtifactResponse from kfp_server_api.models.api_relationship import ApiRelationship from kfp_server_api.models.api_report_run_metrics_request import ApiReportRunMetricsRequest from kfp_server_api.models.api_report_run_metrics_response import ApiReportRunMetricsResponse from kfp_server_api.models.api_resource_key import ApiResourceKey from kfp_server_api.models.api_resource_reference import ApiResourceReference from kfp_server_api.models.api_resource_type import ApiResourceType from kfp_server_api.models.api_run import ApiRun from kfp_server_api.models.api_run_detail import ApiRunDetail from kfp_server_api.models.api_run_metric import ApiRunMetric from kfp_server_api.models.api_run_storage_state import ApiRunStorageState from kfp_server_api.models.api_status import ApiStatus from kfp_server_api.models.api_trigger import ApiTrigger from kfp_server_api.models.api_url import ApiUrl from kfp_server_api.models.job_mode import JobMode from kfp_server_api.models.protobuf_any import ProtobufAny from kfp_server_api.models.report_run_metrics_response_report_run_metric_result import ReportRunMetricsResponseReportRunMetricResult from kfp_server_api.models.report_run_metrics_response_report_run_metric_result_status import ReportRunMetricsResponseReportRunMetricResultStatus from kfp_server_api.models.run_metric_format import RunMetricFormat
apache-2.0
8,307,729,000,647,385,000
53.375
145
0.844955
false
mikegagnon/sidenote
prefix-links.py
1
1725
#!/usr/bin/env python # # This is free and unencumbered software released into the public domain. # # Sometimes you want to include one sidenote document into another. # One way you could do that is copy the .md files from one project into another. # However, this creates a risk of link-tag collisions. I.e. one project # defines ~foo and the other project also defines ~foo. # # prefix-links.py solves this problem. It takes a .md file as input, then # prefixes each link tag with a random string. Therefore ~foo becomes # ~4C5FGAL2foo # # Then you can safely include .md files from multiple projects into another # project # from sidenote import * import argparse import random import re import string # https://stackoverflow.com/questions/2257441/random-string-generation-with-upper-case-letters-and-digits-in-python key = ''.join(random.choice(string.ascii_uppercase + string.digits) for _ in range(8)) def obscure(filename): with open(filename) as f: lines = f.readlines() for line in lines: newline = "" # tokenize the line into links and non-links for part in LINK_PARSER.split(line): if LINK_PARSER.match(part): newpart = part.replace("(##", "(##" + key) newline += newpart else: newline += part if TILDE_ANCHOR_PARSER.match(newline): newline = newline.replace("~", "~" + key) print newline, if __name__=="__main__": parser = argparse.ArgumentParser(description='"Obscure" links in a Sidenote document') parser.add_argument('file', type=str, help='the markdown file to obscure') args = parser.parse_args() obscure(args.file)
unlicense
1,335,531,607,694,736,400
30.363636
115
0.662029
false
slipstream/SlipStreamClient
client/src/main/python/slipstream/Logger.py
1
1610
import os import errno import logging from logging.handlers import RotatingFileHandler class Logger(object): LOGGER_NAME = 'SSClient' LOGFILE_MAXBYTES = 2*1024*1024 LOGFILE_BACKUPCOUNT = 5 LOGFILE_FORMAT = "%(asctime)s:%(levelname)s:%(name)s:%(message)s" log_file = '/var/log/slipstream/client/slipstream-node.log' def __init__(self, config_holder): self.log_to_file = True self.log_level = 'info' self.logger_name = '' config_holder.assign(self) self.logger = None self._configure_logger() def _configure_logger(self): self.logger = logging.getLogger(self.logger_name or Logger.LOGGER_NAME) numeric_level = getattr(logging, self.log_level.upper(), None) if not isinstance(numeric_level, int): raise ValueError('Invalid log level: %s' % self.log_level) self.logger.setLevel(numeric_level) formatter = logging.Formatter(self.LOGFILE_FORMAT) if self.log_to_file: self._create_log_dir() handler = RotatingFileHandler(self.log_file, maxBytes=self.LOGFILE_MAXBYTES, backupCount=self.LOGFILE_BACKUPCOUNT) else: handler = logging.StreamHandler() handler.setFormatter(formatter) self.logger.addHandler(handler) def _create_log_dir(self): log_dir = os.path.dirname(self.log_file) try: os.makedirs(log_dir) except OSError, ex: if ex.errno != errno.EEXIST: raise def get_logger(self): return self.logger
apache-2.0
-4,789,312,884,300,418,000
30.568627
79
0.618012
false
kpreid/shinysdr
shinysdr/plugins/wspr/test_blocks.py
1
3942
# Copyright 2017 Kevin Reid and the ShinySDR contributors # # This file is part of ShinySDR. # # ShinySDR is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # ShinySDR is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with ShinySDR. If not, see <http://www.gnu.org/licenses/>. from __future__ import absolute_import, division, print_function, unicode_literals from zope.interface import implementer from zope.interface.verify import verifyObject from twisted.internet import defer from twisted.trial import unittest from twisted.internet import task from shinysdr.plugins.wspr.blocks import WSPRFilter, WAVIntervalSink from shinysdr.plugins.wspr.interfaces import IWAVIntervalListener class TestWSPRFilter(unittest.TestCase): def test_for_smoke(self): WSPRFilter(48000) class TestWAVIntervalSink(unittest.TestCase): def setUp(self): self.clock = task.Clock() self.listener = FakeListener() self.sink = WAVIntervalSink( interval=120, duration=115, listener=self.listener, sample_rate=48000, _callLater=self.clock.callLater, _time=self.clock.seconds, _deferToThread=self.deferToThread) def deferToThread(self, f, *args, **kwargs): """What thread?""" return defer.succeed(f(*args, **kwargs)) def test_listener_interface(self): verifyObject(IWAVIntervalListener, self.listener) def advance_to_next_interval(self): self.clock.advance(120 - (self.clock.seconds() % 120)) def test_time(self): self.sink.start_running() # initially nothing has happened. self.assertFalse(self.listener._filesClosed) self.assertFalse(self.listener._filesOpened) # start of first interval. self.advance_to_next_interval() self.assertEqual(self.listener._filesOpened, ['120']) # just before end of first interval. self.clock.advance(114) self.assertEqual(self.listener._filesClosed, []) # end of first interval. self.clock.advance(1) self.assertEqual(self.listener._filesClosed, ['120']) # next interval begins. self.advance_to_next_interval() self.assertEqual(self.listener._filesOpened, ['120', '240']) self.assertEqual(self.listener._filesClosed, ['120']) def test_start(self): # nothing is scheduled self.assertFalse(self.clock.getDelayedCalls()) # until we start it self.sink.start_running() self.assertEqual(len(self.clock.getDelayedCalls()), 1) # and starting it again doesn't start it twice. self.sink.start_running() self.assertEqual(len(self.clock.getDelayedCalls()), 1) # More things to test, but so little time. # # What if interval == duration? (Currently undefined behavior) # # What if there's an error in opening or closing the wav file? # # Are the interactions with the wavfile_sink block being done in a thread? # They block on aquiring locks and file IO. # # Are the internal connections sane? @implementer(IWAVIntervalListener) class FakeListener(object): def __init__(self): self._filesOpened = [] self._filesClosed = [] def fileClosed(self, filename): self._filesClosed.append(filename) def fileOpened(self, filename): self._filesOpened.append(filename) def filename(self, time): return str(int(time))
gpl-3.0
4,385,461,148,180,318,700
31.04878
82
0.678082
false
psychopy/psychopy
psychopy/sound/microphone.py
1
35191
#!/usr/bin/env python # -*- coding: utf-8 -*- """Audio recording using a microphone. """ # Part of the PsychoPy library # Copyright (C) 2002-2018 Jonathan Peirce (C) 2019-2021 Open Science Tools Ltd. # Distributed under the terms of the GNU General Public License (GPL). __all__ = ['Microphone'] import sys import psychopy.logging as logging from psychopy.constants import NOT_STARTED, STARTED from psychopy.preferences import prefs from .audioclip import * from .audiodevice import * from .exceptions import * import numpy as np _hasPTB = True try: import psychtoolbox.audio as audio except (ImportError, ModuleNotFoundError): logging.warning( "The 'psychtoolbox' library cannot be loaded but is required for audio " "capture (use `pip install psychtoolbox` to get it). Microphone " "recording will be unavailable this session. Note that opening a " "microphone stream will raise an error.") _hasPTB = False class RecordingBuffer(object): """Class for a storing a recording from a stream. Think of instances of this class behaving like an audio tape whereas the `Microphone` class is the tape recorder. Samples taken from the stream are written to the tape which stores the data. Used internally by the `Microphone` class, users usually do not create instances of this class themselves. Parameters ---------- sampleRateHz : int Sampling rate for audio recording in Hertz (Hz). By default, 48kHz (``sampleRateHz=480000``) is used which is adequate for most consumer grade microphones (headsets and built-in). channels : int Number of channels to record samples to `1=Mono` and `2=Stereo`. maxRecordingSize : int Maximum recording size in kilobytes (Kb). Since audio recordings tend to consume a large amount of system memory, one might want to limit the size of the recording buffer to ensure that the application does not run out of memory. By default, the recording buffer is set to 24000 KB (or 24 MB). At a sample rate of 48kHz, this will result in 62.5 seconds of continuous audio being recorded before the buffer is full. policyWhenFull : str What to do when the recording buffer is full and cannot accept any more samples. If 'ignore', samples will be silently dropped and the `isFull` property will be set to `True`. If 'warn', a warning will be logged and the `isFull` flag will be set. Finally, if 'error' the application will raise an exception. """ def __init__(self, sampleRateHz=SAMPLE_RATE_48kHz, channels=2, maxRecordingSize=24000, policyWhenFull='ignore'): self._channels = channels self._sampleRateHz = sampleRateHz self._maxRecordingSize = maxRecordingSize self._samples = None # `ndarray` created in _allocRecBuffer` self._offset = 0 # recording offset self._lastSample = 0 # offset of the last sample from stream self._spaceRemaining = None # set in `_allocRecBuffer` self._totalSamples = None # set in `_allocRecBuffer` # check if the value is valid if policyWhenFull not in ['ignore', 'warn', 'error']: raise ValueError("Invalid value for `policyWhenFull`.") self._policyWhenFull = policyWhenFull self._warnedRecBufferFull = False self._loops = 0 self._allocRecBuffer() def _allocRecBuffer(self): """Allocate the recording buffer. Called internally if properties are changed.""" # allocate another array nBytes = self._maxRecordingSize * 1000 recArraySize = int((nBytes / self._channels) / (np.float32()).itemsize) self._samples = np.zeros( (recArraySize, self._channels), dtype=np.float32, order='C') # sanity check assert self._samples.nbytes == nBytes self._totalSamples = len(self._samples) self._spaceRemaining = self._totalSamples @property def samples(self): """Reference to the actual sample buffer (`ndarray`).""" return self._samples @property def bufferSecs(self): """Capacity of the recording buffer in seconds (`float`).""" return self._totalSamples / self._sampleRateHz @property def nbytes(self): """Number of bytes the recording buffer occupies in memory (`int`).""" return self._samples.nbytes @property def sampleBytes(self): """Number of bytes per sample (`int`).""" return np.float32().itemsize @property def spaceRemaining(self): """The space remaining in the recording buffer (`int`). Indicates the number of samples that the buffer can still add before overflowing. """ return self._spaceRemaining @property def isFull(self): """Is the recording buffer full (`bool`).""" return self._spaceRemaining <= 0 @property def totalSamples(self): """Total number samples the recording buffer can hold (`int`).""" return self._totalSamples @property def writeOffset(self): """Index in the sample buffer where new samples will be written when `write()` is called (`int`). """ return self._offset @property def lastSample(self): """Index of the last sample recorded (`int`). This can be used to slice the recording buffer, only getting data from the beginning to place where the last sample was written to. """ return self._lastSample @property def loopCount(self): """Number of times the recording buffer restarted (`int`). Only valid if `loopback` is ``True``.""" return self._loops @property def maxRecordingSize(self): """Maximum recording size in kilobytes (`int`). Since audio recordings tend to consume a large amount of system memory, one might want to limit the size of the recording buffer to ensure that the application does not run out of memory. By default, the recording buffer is set to 24000 KB (or 24 MB). At a sample rate of 48kHz, this will result in 62.5 seconds of continuous audio being recorded before the buffer is full. Setting this value will allocate another recording buffer of appropriate size. Avoid doing this in any time sensitive parts of your application. """ return self._maxRecordingSize @maxRecordingSize.setter def maxRecordingSize(self, value): value = int(value) # don't do this unless the value changed if value == self._maxRecordingSize: return # if different than last value, update the recording buffer self._maxRecordingSize = value self._allocRecBuffer() def seek(self, offset, absolute=False): """Set the write offset. Use this to specify where to begin writing samples the next time `write` is called. You should call `seek(0)` when starting a new recording. Parameters ---------- offset : int Position in the sample buffer to set. absolute : bool Use absolute positioning. Use relative positioning if `False` where the value of `offset` will be added to the current offset. Default is `False`. """ if not absolute: self._offset += offset else: self._offset = absolute assert 0 <= self._offset < self._totalSamples self._spaceRemaining = self._totalSamples - self._offset def write(self, samples): """Write samples to the recording buffer. Parameters ---------- samples : ArrayLike Samples to write to the recording buffer, usually of a stream. Must have the same number of dimensions as the internal array. Returns ------- int Number of samples overflowed. If this is zero then all samples have been recorded, if not, the number of samples rejected is given. """ nSamples = len(samples) if self.isFull: if self._policyWhenFull == 'ignore': return nSamples # samples lost elif self._policyWhenFull == 'warn': if not self._warnedRecBufferFull: logging.warning( f"Audio recording buffer filled! This means that no " f"samples are saved beyond {round(self.bufferSecs, 6)} " f"seconds. Specify a larger recording buffer next time " f"to avoid data loss.") logging.flush() self._warnedRecBufferFull = True return nSamples elif self._policyWhenFull == 'error': raise AudioRecordingBufferFullError( "Cannot write samples, recording buffer is full.") else: return nSamples # whatever if not nSamples: # no samples came out of the stream, just return return if self._spaceRemaining >= nSamples: self._lastSample = self._offset + nSamples audioData = samples[:, :] else: self._lastSample = self._offset + self._spaceRemaining audioData = samples[:self._spaceRemaining, :] self._samples[self._offset:self._lastSample, :] = audioData self._offset += nSamples self._spaceRemaining -= nSamples # Check if the recording buffer is now full. Next call to `poll` will # not record anything. if self._spaceRemaining <= 0: self._spaceRemaining = 0 d = nSamples - self._spaceRemaining return 0 if d < 0 else d def clear(self): # reset all live attributes self._samples = None self._offset = 0 self._lastSample = 0 self._spaceRemaining = None self._totalSamples = None # reallocate buffer self._allocRecBuffer() def getSegment(self, start=0, end=None): """Get a segment of recording data as an `AudioClip`. Parameters ---------- start : float or int Absolute time in seconds for the start of the clip. end : float or int Absolute time in seconds for the end of the clip. If `None` the time at the last sample is used. Returns ------- AudioClip Audio clip object with samples between `start` and `end`. """ idxStart = int(start * self._sampleRateHz) idxEnd = self._lastSample if end is None else int( end * self._sampleRateHz) return AudioClip( np.array(self._samples[idxStart:idxEnd, :], dtype=np.float32, order='C'), sampleRateHz=self._sampleRateHz) class Microphone(object): """Class for recording audio from a microphone or input stream. Creating an instance of this class will open a stream using the specified device. Streams should remain open for the duration of your session. When a stream is opened, a buffer is allocated to store samples coming off it. Samples from the input stream will written to the buffer once :meth:`~Microphone.start()` is called. Parameters ---------- device : int or `~psychopy.sound.AudioDevice` Audio capture device to use. You may specify the device either by index (`int`) or descriptor (`AudioDevice`). sampleRateHz : int Sampling rate for audio recording in Hertz (Hz). By default, 48kHz (``sampleRateHz=480000``) is used which is adequate for most consumer grade microphones (headsets and built-in). channels : int Number of channels to record samples to `1=Mono` and `2=Stereo`. streamBufferSecs : float Stream buffer size to pre-allocate for the specified number of seconds. The default is 2.0 seconds which is usually sufficient. maxRecordingSize : int Maximum recording size in kilobytes (Kb). Since audio recordings tend to consume a large amount of system memory, one might want to limit the size of the recording buffer to ensure that the application does not run out of memory. By default, the recording buffer is set to 24000 KB (or 24 MB). At a sample rate of 48kHz, this will result in 62.5 seconds of continuous audio being recorded before the buffer is full. audioLatencyMode : int or None Audio latency mode to use, values range between 0-4. If `None`, the setting from preferences will be used. Using `3` (exclusive mode) is adequate for most applications and required if using WASAPI on Windows for other settings (such audio quality) to take effect. Symbolic constants `psychopy.sound.audiodevice.AUDIO_PTB_LATENCY_CLASS_` can also be used. audioRunMode : int Run mode for the recording device. Default is standby-mode (`0`) which allows the system to put the device to sleep. However when the device is needed, waking the device results in some latency. Using a run mode of `1` will keep the microphone running (or 'hot') with reduces latency when th recording is started. Cannot be set when after initialization at this time. Examples -------- Capture 10 seconds of audio from the primary microphone:: import psychopy.core as core import psychopy.sound.Microphone as Microphone mic = Microphone(bufferSecs=10.0) # open the microphone mic.start() # start recording core.wait(10.0) # wait 10 seconds mic.stop() # stop recording audioClip = mic.getRecording() print(audioClip.duration) # should be ~10 seconds audioClip.save('test.wav') # save the recorded audio as a 'wav' file The prescribed method for making long recordings is to poll the stream once per frame (or every n-th frame):: mic = Microphone(bufferSecs=2.0) mic.start() # start recording # main trial drawing loop mic.poll() win.flip() # calling the window flip function mic.stop() # stop recording audioClip = mic.getRecording() """ # Force the use of WASAPI for audio capture on Windows. If `True`, only # WASAPI devices will be returned when calling static method # `Microphone.getDevices()` enforceWASAPI = True def __init__(self, device=None, sampleRateHz=None, channels=2, streamBufferSecs=2.0, maxRecordingSize=24000, policyWhenFull='warn', audioLatencyMode=None, audioRunMode=0): if not _hasPTB: # fail if PTB is not installed raise ModuleNotFoundError( "Microphone audio capture requires package `psychtoolbox` to " "be installed.") # get information about the selected device devices = Microphone.getDevices() if isinstance(device, AudioDeviceInfo): self._device = device elif isinstance(device, (int, float)): devicesByIndex = {d.deviceIndex: d for d in devices} if device in devicesByIndex: self._device = devicesByIndex[device] else: raise AudioInvalidCaptureDeviceError( 'No suitable audio recording devices found matching index ' '{}.'.format(device)) else: # get default device, first enumerated usually if not devices: raise AudioInvalidCaptureDeviceError( 'No suitable audio recording devices found on this system. ' 'Check connections and try again.') self._device = devices[0] # use first logging.info('Using audio device #{} ({}) for audio capture'.format( self._device.deviceIndex, self._device.deviceName)) # error if specified device is not suitable for capture if not self._device.isCapture: raise AudioInvalidCaptureDeviceError( 'Specified audio device not suitable for audio recording. ' 'Has no input channels.') # get the sample rate self._sampleRateHz = \ self._device.defaultSampleRate if sampleRateHz is None else int( sampleRateHz) logging.debug('Set stream sample rate to {} Hz'.format( self._sampleRateHz)) # set the audio latency mode if audioLatencyMode is None: self._audioLatencyMode = int(prefs.hardware["audioLatencyMode"]) else: self._audioLatencyMode = audioLatencyMode logging.debug('Set audio latency mode to {}'.format( self._audioLatencyMode)) assert 0 <= self._audioLatencyMode <= 4 # sanity check for pref # set the number of recording channels self._channels = \ self._device.inputChannels if channels is None else int(channels) logging.debug('Set recording channels to {} ({})'.format( self._channels, 'stereo' if self._channels > 1 else 'mono')) if self._channels > self._device.inputChannels: raise AudioInvalidDeviceError( 'Invalid number of channels for audio input specified.') # internal recording buffer size in seconds assert isinstance(streamBufferSecs, (float, int)) self._streamBufferSecs = float(streamBufferSecs) # PTB specific stuff self._mode = 2 # open a stream in capture mode # Handle for the recording stream, should only be opened once per # session logging.debug('Opening audio stream for device #{}'.format( self._device.deviceIndex)) self._stream = audio.Stream( device_id=self._device.deviceIndex, latency_class=self._audioLatencyMode, mode=self._mode, freq=self._sampleRateHz, channels=self._channels) logging.debug('Stream opened') assert isinstance(audioRunMode, (float, int)) and \ (audioRunMode == 0 or audioRunMode == 1) self._audioRunMode = int(audioRunMode) self._stream.run_mode = self._audioRunMode logging.debug('Set run mode to `{}`'.format( self._audioRunMode)) # set latency bias self._stream.latency_bias = 0.0 logging.debug('Set stream latency bias to {} ms'.format( self._stream.latency_bias)) # pre-allocate recording buffer, called once self._stream.get_audio_data(self._streamBufferSecs) logging.debug( 'Allocated stream buffer to hold {} seconds of data'.format( self._streamBufferSecs)) # status flag self._statusFlag = NOT_STARTED # setup recording buffer self._recording = RecordingBuffer( sampleRateHz=self._sampleRateHz, channels=self._channels, maxRecordingSize=maxRecordingSize, policyWhenFull=policyWhenFull ) # setup clips and transcripts dicts self.clips = {} self.lastClip = None self.scripts = {} self.lastScript = None logging.debug('Audio capture device #{} ready'.format( self._device.deviceIndex)) @staticmethod def getDevices(): """Get a `list` of audio capture device (i.e. microphones) descriptors. On Windows, only WASAPI devices are used. Returns ------- list List of `AudioDevice` descriptors for suitable capture devices. If empty, no capture devices have been found. """ try: Microphone.enforceWASAPI = bool(prefs.hardware["audioForceWASAPI"]) except KeyError: pass # use default if option not present in settings # query PTB for devices if Microphone.enforceWASAPI and sys.platform == 'win32': allDevs = audio.get_devices(device_type=13) else: allDevs = audio.get_devices() # make sure we have an array of descriptors allDevs = [allDevs] if isinstance(allDevs, dict) else allDevs # create list of descriptors only for capture devices inputDevices = [desc for desc in [ AudioDeviceInfo.createFromPTBDesc(dev) for dev in allDevs] if desc.isCapture] return inputDevices # def warmUp(self): # """Warm-/wake-up the audio stream. # # On some systems the first time `start` is called incurs additional # latency, whereas successive calls do not. To deal with this, it is # recommended that you run this warm-up routine prior to capturing audio # samples. By default, this routine is called when instancing a new # microphone object. # # """ # # We should put an actual test here to see if timing stabilizes after # # multiple invocations of this function. # self._stream.start() # self._stream.stop() @property def recording(self): """Reference to the current recording buffer (`RecordingBuffer`).""" return self._recording @property def recBufferSecs(self): """Capacity of the recording buffer in seconds (`float`).""" return self.recording.bufferSecs @property def maxRecordingSize(self): """Maximum recording size in kilobytes (`int`). Since audio recordings tend to consume a large amount of system memory, one might want to limit the size of the recording buffer to ensure that the application does not run out. By default, the recording buffer is set to 64000 KB (or 64 MB). At a sample rate of 48kHz, this will result in about. Using stereo audio (``nChannels == 2``) requires twice the buffer over mono (``nChannels == 2``) for the same length clip. Setting this value will allocate another recording buffer of appropriate size. Avoid doing this in any time sensitive parts of your application. """ return self._recording.maxRecordingSize @maxRecordingSize.setter def maxRecordingSize(self, value): self._recording.maxRecordingSize = value @property def latencyBias(self): """Latency bias to add when starting the microphone (`float`). """ return self._stream.latency_bias @latencyBias.setter def latencyBias(self, value): self._stream.latency_bias = float(value) @property def audioLatencyMode(self): """Audio latency mode in use (`int`). Cannot be set after initialization. """ return self._audioLatencyMode @property def streamBufferSecs(self): """Size of the internal audio storage buffer in seconds (`float`). To ensure all data is captured, there must be less time elapsed between subsequent `getAudioClip` calls than `bufferSecs`. """ return self._streamBufferSecs @property def status(self): """Status flag for the microphone. Value can be one of ``psychopy.constants.STARTED`` or ``psychopy.constants.NOT_STARTED``. For detailed stream status information, use the :attr:`~psychopy.sound.microphone.Microphone.streamStatus` property. """ if hasattr(self, "_statusFlag"): return self._statusFlag @status.setter def status(self, value): self._statusFlag = value @property def streamStatus(self): """Status of the audio stream (`AudioDeviceStatus` or `None`). See :class:`~psychopy.sound.AudioDeviceStatus` for a complete overview of available status fields. This property has a value of `None` if the stream is presently closed. Examples -------- Get the capture start time of the stream:: # assumes mic.start() was called captureStartTime = mic.status.captureStartTime Check if microphone recording is active:: isActive = mic.status.active Get the number of seconds recorded up to this point:: recordedSecs = mic.status.recordedSecs """ currentStatus = self._stream.status if currentStatus != -1: return AudioDeviceStatus.createFromPTBDesc(currentStatus) @property def isRecBufferFull(self): """`True` if there is an overflow condition with the recording buffer. If this is `True`, then `poll()` is still collecting stream samples but is no longer writing them to anything, causing stream samples to be lost. """ return self._recording.isFull @property def isStarted(self): """``True`` if stream recording has been started (`bool`).""" return self.status == STARTED def start(self, when=None, waitForStart=0, stopTime=None): """Start an audio recording. Calling this method will begin capturing samples from the microphone and writing them to the buffer. Parameters ---------- when : float, int or None When to start the stream. If the time specified is a floating point (absolute) system time, the device will attempt to begin recording at that time. If `None` or zero, the system will try to start recording as soon as possible. waitForStart : bool Wait for sound onset if `True`. stopTime : float, int or None Number of seconds to record. If `None` or `-1`, recording will continue forever until `stop` is called. Returns ------- float Absolute time the stream was started. """ # check if the stream has been if self.isStarted: raise AudioStreamError( "Cannot start a stream, already started.") if self._stream is None: raise AudioStreamError("Stream not ready.") # reset the writing 'head' self._recording.seek(0, absolute=True) # reset warnings # self._warnedRecBufferFull = False startTime = self._stream.start( repetitions=0, when=when, wait_for_start=int(waitForStart), stop_time=stopTime) # recording has begun or is scheduled to do so self._statusFlag = STARTED logging.debug( 'Scheduled start of audio capture for device #{} at t={}.'.format( self._device.deviceIndex, startTime)) return startTime def record(self, when=None, waitForStart=0, stopTime=None): """Start an audio recording (alias of `.start()`). Calling this method will begin capturing samples from the microphone and writing them to the buffer. Parameters ---------- when : float, int or None When to start the stream. If the time specified is a floating point (absolute) system time, the device will attempt to begin recording at that time. If `None` or zero, the system will try to start recording as soon as possible. waitForStart : bool Wait for sound onset if `True`. stopTime : float, int or None Number of seconds to record. If `None` or `-1`, recording will continue forever until `stop` is called. Returns ------- float Absolute time the stream was started. """ return self.start( when=when, waitForStart=waitForStart, stopTime=stopTime) def stop(self, blockUntilStopped=True, stopTime=None): """Stop recording audio. Call this method to end an audio recording if in progress. This will simply halt recording and not close the stream. Any remaining samples will be polled automatically and added to the recording buffer. Parameters ---------- blockUntilStopped : bool Halt script execution until the stream has fully stopped. stopTime : float or None Scheduled stop time for the stream in system time. If `None`, the stream will stop as soon as possible. Returns ------- tuple Tuple containing `startTime`, `endPositionSecs`, `xruns` and `estStopTime`. """ if not self.isStarted: raise AudioStreamError( "Cannot stop a stream that has not been started.") # poll remaining samples, if any if not self.isRecBufferFull: self.poll() startTime, endPositionSecs, xruns, estStopTime = self._stream.stop( block_until_stopped=int(blockUntilStopped), stopTime=stopTime) self._statusFlag = NOT_STARTED logging.debug( ('Device #{} stopped capturing audio samples at estimated time ' 't={}. Total overruns: {} Total recording time: {}').format( self._device.deviceIndex, estStopTime, xruns, endPositionSecs)) return startTime, endPositionSecs, xruns, estStopTime def pause(self, blockUntilStopped=True, stopTime=None): """Pause a recording (alias of `.stop`). Call this method to end an audio recording if in progress. This will simply halt recording and not close the stream. Any remaining samples will be polled automatically and added to the recording buffer. Parameters ---------- blockUntilStopped : bool Halt script execution until the stream has fully stopped. stopTime : float or None Scheduled stop time for the stream in system time. If `None`, the stream will stop as soon as possible. Returns ------- tuple Tuple containing `startTime`, `endPositionSecs`, `xruns` and `estStopTime`. """ return self.stop(blockUntilStopped=blockUntilStopped, stopTime=stopTime) def close(self): """Close the stream. Should not be called until you are certain you're done with it. Ideally, you should never close and reopen the same stream within a single session. """ self._stream.close() logging.debug('Stream closed') def poll(self): """Poll audio samples. Calling this method adds audio samples collected from the stream buffer to the recording buffer that have been captured since the last `poll` call. Time between calls of this function should be less than `bufferSecs`. You do not need to call this if you call `stop` before the time specified by `bufferSecs` elapses since the `start` call. Can only be called between called of `start` (or `record`) and `stop` (or `pause`). Returns ------- int Number of overruns in sampling. """ if not self.isStarted: raise AudioStreamError( "Cannot poll samples from audio device, not started.") # figure out what to do with this other information audioData, absRecPosition, overflow, cStartTime = \ self._stream.get_audio_data() if overflow: logging.warning( "Audio stream buffer overflow, some audio samples have been " "lost! To prevent this, ensure `Microphone.poll()` is being " "called often enough, or increase the size of the audio buffer " "with `bufferSecs`.") overruns = self._recording.write(audioData) return overruns def bank(self, tag=None, transcribe=False, **kwargs): """Store current buffer as a clip within the microphone object. This method is used internally by the Microphone component in Builder, don't use it for other applications. Either `stop()` or `pause()` must be called before calling this method. Parameters ---------- tag : str or None Label for the clip. transcribe : bool or str Set to the name of a transcription engine (e.g. "GOOGLE") to transcribe using that engine, or set as `False` to not transcribe. kwargs : dict Additional keyword arguments to pass to :class:`~psychopy.sound.AudioClip.transcribe()`. """ # make sure the tag exists in both clips and transcripts dicts if tag not in self.clips: self.clips[tag] = [] if tag not in self.scripts: self.scripts[tag] = [] # append current recording to clip list according to tag self.lastClip = self.getRecording() self.clips[tag].append(self.lastClip) # append current clip's transcription according to tag if transcribe: if transcribe in ('Built-in', True, 'BUILT_IN', 'BUILT-IN', 'Built-In', 'built-in'): engine = "sphinx" elif type(transcribe) == str: engine = transcribe self.lastScript = self.lastClip.transcribe( engine=engine, **kwargs) else: self.lastScript = "Transcription disabled." self.scripts[tag].append(self.lastScript) # clear recording buffer self._recording.clear() # return banked items if transcribe: return self.lastClip, self.lastScript else: return self.lastClip def clear(self): """Wipe all clips. Deletes previously banked audio clips. """ # clear clips self.clips = {} # clear recording self._recording.clear() def flush(self): """Get a copy of all banked clips, then clear the clips from storage.""" # get copy of clips dict clips = self.clips.copy() # clear self.clear() return clips def getRecording(self): """Get audio data from the last microphone recording. Call this after `stop` to get the recording as an `AudioClip` object. Raises an error if a recording is in progress. Returns ------- AudioClip Recorded data between the last calls to `start` (or `record`) and `stop`. """ if self.isStarted: raise AudioStreamError( "Cannot get audio clip, recording was in progress. Be sure to " "call `Microphone.stop` first.") return self._recording.getSegment() # full recording if __name__ == "__main__": pass
gpl-3.0
1,498,106,364,352,994,300
34.909184
80
0.613424
false
fyookball/electrum
ios/ElectronCash/app.py
1
2878
# # This file is: # Copyright (C) 2018 Calin Culianu <calin.culianu@gmail.com> # # MIT License # import os from electroncash_gui.ios_native.monkeypatches import MonkeyPatches from electroncash.util import set_verbosity from electroncash_gui.ios_native import ElectrumGui from electroncash_gui.ios_native.utils import call_later, get_user_dir, cleanup_tmp_dir, is_debug_build, NSLogSuppress, NSLog from electroncash.simple_config import SimpleConfig from electroncash.networks import set_mainnet, set_testnet # NB: This is called from appdelegate.py "application_didFinishLaunchingWithOptions_" def main(): cleanup_tmp_dir() config_options = { 'verbose': is_debug_build(), 'cmd': 'gui', 'gui': 'ios_native', 'cwd': os.getcwd(), 'whitelist_servers_only' : True, # on iOS we force only the whitelist ('preferred') servers only for now as a security measure 'testnet': 'EC_TESTNET' in os.environ, # You can set the env when testing using Xcode "Scheme" editor } if config_options.get('testnet'): set_testnet() else: set_mainnet() set_verbosity(config_options.get('verbose'), timestamps=False, thread_id=False) NSLogSuppress(not config_options.get('verbose')) MonkeyPatches.patch() config = SimpleConfig(config_options, read_user_dir_function = get_user_dir) gui = ElectrumGui(config) call_later(0.010, gui.main) # this is required for the activity indicator to actually animate. Switch to a direct call if not using activity indicator on Splash2 _printStats(config_options) # Prints some startup/debug stats such as Python version and SSL version (this is done in another thread to hopefully not impact startup overhead too much, as importing ssl may be a bit heavy) return "Bitcoin Cash FTW!" def _printStats(config_options): import threading def thrdfunc(config_options): # lazy init of SSL import ssl, sys from electroncash import version, ecc_fast, schnorr NSLog("Electron Cash lib version: %s (using server protocol: %s)", version.PACKAGE_VERSION, version.PROTOCOL_VERSION) NSLog("Python version: %s", ' '.join(sys.version.split('\n'))) NSLog("OpenSSL version: %s", ssl.OPENSSL_VERSION) NSLog("Fast ECC: %s Fast Schnorr: %s", str(ecc_fast.is_using_fast_ecc()), str(schnorr.has_fast_sign())) #NSLog("Environment Vars:") #for k,v in os.environ.copy().items(): # NSLog("%s=%s", str(k), str(v)) #NSLog("Config Vars:") #for k,v in config_options.copy().items(): # NSLog("config[%s] = %s", str(k), str(v)) # / # We do this from a thread so as to not delay app startup by importing more stuff we don't strictly need. threading.Thread(target=thrdfunc, args=(config_options,), daemon=True).start()
mit
-7,125,776,896,081,296,000
43.276923
225
0.677206
false
sipwise/repoapi
build/test/test_utils.py
1
11161
# Copyright (C) 2017-2020 The Sipwise Team - http://sipwise.com # # This program is free software: you can redistribute it and/or modify it # under the terms of the GNU General Public License as published by the Free # Software Foundation, either version 3 of the License, or (at your option) # any later version. # # This program is distributed in the hope that it will be useful, but WITHOUT # ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or # FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for # more details. # # You should have received a copy of the GNU General Public License along # with this program. If not, see <http://www.gnu.org/licenses/>. import re from unittest.mock import patch from django.test import override_settings from django.test import SimpleTestCase from build import exceptions as err from build.conf import settings from build.utils import get_common_release from build.utils import get_simple_release from build.utils import is_release_trunk from build.utils import ReleaseConfig from build.utils import trigger_build from build.utils import trigger_copy_deps class SimpleIsReleaseTrunkTest(SimpleTestCase): def test_trunk(self): ok, val = is_release_trunk("trunk") self.assertFalse(ok) self.assertIsNone(val) def test_mrXX(self): ok, val = is_release_trunk("release-mr8.5") self.assertFalse(ok) self.assertIsNone(val) def test_release_trunk(self): ok, val = is_release_trunk("release-trunk-buster") self.assertTrue(ok) self.assertEqual(val, "buster") ok, val = is_release_trunk("release-trunk-bullseye") self.assertTrue(ok) self.assertEqual(val, "bullseye") class SimpleReleaseTest(SimpleTestCase): def test_trunk(self): val = get_simple_release("release-trunk-buster") self.assertEqual(val, "trunk") def test_branch_release(self): val = get_simple_release("release-mr8.0") self.assertEqual(val, "mr8.0") def test_release_ok(self): val = get_simple_release("release-mr8.1.1") self.assertEqual(val, "mr8.1.1") def test_release_update_ok(self): val = get_simple_release("release-mr8.1-update") self.assertEqual(val, "mr8.1") def test_release_ko(self): val = get_simple_release("mr8.1.1") self.assertIsNone(val) class CommonReleaseTest(SimpleTestCase): def test_trunk(self): val = get_common_release("release-trunk-buster") self.assertEqual(val, "master") def test_branch_release(self): val = get_common_release("release-mr8.0") self.assertEqual(val, "mr8.0") def test_release_ok(self): val = get_common_release("mr8.1.1") self.assertEqual(val, "mr8.1") def test_release_ko(self): val = get_common_release("whatever-mr8.1.1") self.assertIsNone(val) class ReleaseConfigTestCase(SimpleTestCase): build_deps = [ "data-hal", "ngcp-schema", "libinewrate", "libswrate", "libtcap", "sipwise-base", "check-tools", ] @override_settings(BUILD_RELEASES_SKIP=["mr0.1"]) def test_supported_releases(self): supported = [ "release-trunk-buster", "release-trunk-bullseye", "mr8.1.2", "mr8.1", "mr7.5.3", "mr7.5.2", "mr7.5.1", "mr7.5", ] res = ReleaseConfig.supported_releases() self.assertListEqual(res, supported) @patch.object(ReleaseConfig, "supported_releases") def test_supported_releases_dict(self, sr): res_ok = [ {"release": "release-trunk-buster", "base": "master"}, {"release": "mr8.0", "base": "mr8.0"}, {"release": "mr8.0.1", "base": "mr8.0"}, {"release": "mr7.5.1", "base": "mr7.5"}, ] sr.return_value = [ "release-trunk-buster", "mr8.0", "mr8.0.1", "mr7.5.1", ] res = ReleaseConfig.supported_releases_dict() self.assertListEqual(res, res_ok) def test_no_release_config(self): with self.assertRaises(err.NoConfigReleaseFile): ReleaseConfig("fake_release") def test_no_jenkins_jobs(self): with self.assertRaises(err.NoJenkinsJobsInfo): ReleaseConfig("mr0.1") def test_ok(self): rc = ReleaseConfig("trunk") self.assertIsNotNone(rc.config) self.assertListEqual(list(rc.build_deps.keys()), self.build_deps) self.assertEqual(rc.debian_release, "buster") self.assertEqual(len(rc.projects), 73) def test_debian_release_value(self): rc = ReleaseConfig("trunk") self.assertEqual(rc.debian_release, "buster") rc = ReleaseConfig("release-trunk-bullseye") self.assertEqual(rc.debian_release, "bullseye") rc = ReleaseConfig("trunk", "bullseye") self.assertEqual(rc.debian_release, "bullseye") # distribution parameter is only used with trunk rc = ReleaseConfig("release-mr8.1-update", "bullseye") self.assertEqual(rc.debian_release, "buster") def test_release_value(self): rc = ReleaseConfig("trunk") self.assertEqual(rc.release, "trunk") def test_branch_tag_value_trunk(self): rc = ReleaseConfig("trunk") self.assertEqual(rc.branch, "master") self.assertIsNone(rc.tag) def test_branch_tag_value_mrXX(self): rc = ReleaseConfig("mr8.1") self.assertEqual(rc.branch, "mr8.1") self.assertIsNone(rc.tag) def test_branch_tag_value_mrXXX(self): rc = ReleaseConfig("mr7.5.2") self.assertEqual(rc.branch, "mr7.5.2") self.assertEqual(rc.tag, "mr7.5.2.1") def test_build_deps(self): rc = ReleaseConfig("trunk") build_deps = [ "data-hal", "ngcp-schema", "libinewrate", "libswrate", "libtcap", "sipwise-base", "check-tools", ] self.assertListEqual(list(rc.build_deps.keys()), build_deps) def test_build_deps_iter_step_1(self): rc = ReleaseConfig("trunk") build_deps = [ "data-hal", "libinewrate", "libswrate", "libtcap", "sipwise-base", "check-tools", ] values = [] for prj in rc.wanna_build_deps(0): values.append(prj) self.assertListEqual(build_deps, values) def test_build_deps_iter_step_2(self): rc = ReleaseConfig("trunk") values = [] for prj in rc.wanna_build_deps(1): values.append(prj) self.assertListEqual(["ngcp-schema"], values) @patch("build.utils.open_jenkins_url") class TriggerBuild(SimpleTestCase): def test_project_build(self, openurl): params = { "project": "kamailio-get-code", "release_uuid": "UUID_mr8.2", "trigger_release": "release-mr8.2", "trigger_branch_or_tag": "branch/mr8.2", "trigger_distribution": "buster", "uuid": "UUID_A", } url = ( "{base}/job/{project}/buildWithParameters?" "token={token}&cause={trigger_release}&uuid={uuid}&" "release_uuid={release_uuid}&" "branch=mr8.2&tag=none&" "release={trigger_release}&distribution={trigger_distribution}" ) res = trigger_build(**params) params["base"] = settings.JENKINS_URL params["token"] = settings.JENKINS_TOKEN self.assertEqual(res, "{base}/job/{project}/".format(**params)) openurl.assert_called_once_with(url.format(**params)) def test_project_build_uuid(self, openurl): params = { "project": "kamailio-get-code", "release_uuid": "UUID_mr8.2", "trigger_release": "release-mr8.2", "trigger_branch_or_tag": "branch/mr8.2", "trigger_distribution": "buster", } res = [trigger_build(**params), trigger_build(**params)] params["base"] = settings.JENKINS_URL params["token"] = settings.JENKINS_TOKEN self.assertEqual(res[0], "{base}/job/{project}/".format(**params)) self.assertEqual(res[0], res[1]) uuids = list() self.assertEqual(len(openurl.call_args_list), 2) for call in openurl.call_args_list: m = re.match(r".+&uuid=([^&]+)&.+", str(call)) self.assertIsNotNone(m) uuids.append(m.groups(0)) self.assertNotEqual(uuids[0], uuids[1]) def test_copy_debs_build(self, openurl): params = { "release": "release-mr8.2", "internal": True, "release_uuid": "UUID_mr8.2", "uuid": "UUID_A", } url = ( "{base}/job/{project}/buildWithParameters?" "token={token}&cause={release}&uuid={uuid}&" "release_uuid={release_uuid}&" "release=mr8.2&internal=true" ) res = trigger_copy_deps(**params) params["project"] = "release-copy-debs-yml" params["base"] = settings.JENKINS_URL params["token"] = settings.JENKINS_TOKEN self.assertEqual(res, "{base}/job/{project}/".format(**params)) openurl.assert_called_once_with(url.format(**params)) def test_project_build_trunk(self, openurl): params = { "project": "kamailio-get-code", "release_uuid": "UUID_mr8.2", "trigger_release": "trunk", "trigger_branch_or_tag": "branch/master", "trigger_distribution": "buster", "uuid": "UUID_A", } url = ( "{base}/job/{project}/buildWithParameters?" "token={token}&cause={trigger_release}&uuid={uuid}&" "release_uuid={release_uuid}&" "branch=master&tag=none&" "release=trunk&distribution={trigger_distribution}" ) res = trigger_build(**params) params["base"] = settings.JENKINS_URL params["token"] = settings.JENKINS_TOKEN self.assertEqual(res, "{base}/job/{project}/".format(**params)) openurl.assert_called_once_with(url.format(**params)) def test_copy_debs_build_trunk(self, openurl): params = { "release": "release-trunk-buster", "internal": True, "release_uuid": "UUID_master", "uuid": "UUID_B", } url = ( "{base}/job/{project}/buildWithParameters?" "token={token}&cause={release}&uuid={uuid}&" "release_uuid={release_uuid}&" "release=release-trunk-buster&internal=true" ) res = trigger_copy_deps(**params) params["project"] = "release-copy-debs-yml" params["base"] = settings.JENKINS_URL params["token"] = settings.JENKINS_TOKEN self.assertEqual(res, "{base}/job/{project}/".format(**params)) openurl.assert_called_once_with(url.format(**params))
gpl-3.0
-7,227,835,457,043,220,000
33.55418
77
0.585431
false
RNAcentral/rnacentral-import-pipeline
tests/databases/gtrnadb/parser_test.py
1
5743
# -*- coding: utf-8 -*- """ Copyright [2009-2017] EMBL-European Bioinformatics Institute Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. """ from pathlib import Path import attr import pytest from rnacentral_pipeline.databases import data from rnacentral_pipeline.databases.gtrnadb import parser @pytest.fixture(scope="module") def simple(): tax_file = Path("taxonomy.db") with open("data/gtrnadb/simple.json", "r") as raw: yield list(parser.parse(raw, tax_file)) @pytest.fixture(scope="module") def version2(): with open("data/gtrnadb/version2.json", "r") as raw: tax_file = Path("taxonomy.db") yield list(parser.parse(raw, tax_file)) def test_it_can_generate_all_entries(simple): assert len(simple) == 984 # 16 pseudogenes def test_it_generates_correct_entries(simple): assert attr.asdict(simple[0]) == attr.asdict( data.Entry( primary_id="tRNA-Ala-CGC-1-1:CP000828.1:603738-603810", accession="CP000828.1:tRNA-Ala-CGC-1-1", ncbi_tax_id=329726, database="GTRNADB", sequence="GGGGAATTAGCTCAGCTGGTAGAGTGCTGCGATCGCACCGCAGAGGTCAGGGGTTCGAATCCCCTATTCTCCA", regions=[], rna_type="tRNA", url="http://gtrnadb.ucsc.edu/genomes/bacteria/Acar_mari_MBIC11017/genes/tRNA-Ala-CGC-1-1.html", seq_version="1", note_data={ "anticodon": "CGC", "anticodon_positions": [ { "relative_start": 34, "relative_stop": 36, } ], "isotype": "Ala", "score": 72.7, "url": "http://gtrnadb.ucsc.edu/genomes/bacteria/Acar_mari_MBIC11017/genes/tRNA-Ala-CGC-1-1.html", }, secondary_structure=data.SecondaryStructure.empty(), references=[ data.Reference( authors="Chan P.P., Lowe T.M.", location="Nucl. Acids Res. 37(Database issue)", title=( "GtRNAdb: A database of transfer RNA genes detected in " "genomic sequence" ), pmid=18984615, doi="10.1093/nar/gkn787.", ) ], chromosome="chr", species="Acaryochloris marina MBIC11017", common_name=None, anticodon="CGC", lineage="Bacteria; Cyanobacteria; Synechococcales; Acaryochloridaceae; Acaryochloris; Acaryochloris marina MBIC11017", gene="tRNA-Ala-CGC-1-1", optional_id="tRNA-Ala-CGC-1-1", product="tRNA-Ala (CGC)", parent_accession="CP000828.1", description="Acaryochloris marina MBIC11017 tRNA-Ala (CGC)", mol_type="genomic DNA", location_start=1, location_end=73, gene_synonyms=["chr.trna27-AlaCGC"], ) ) def test_it_generates_all_entries(version2): assert len(version2) == 1000 def test_it_creates_correct_entries(version2): assert attr.asdict(version2[3]) == attr.asdict( data.Entry( primary_id="tRNA-Arg-CCG-1-1:CP003168.1:421631-421753", accession="CP003168.1:tRNA-Arg-CCG-1-1", ncbi_tax_id=673860, database="GTRNADB", sequence="GGGCCCGTGGGGTAGCTTGGATATCCTAGGGGCCTCCGGAGCCCCGGACCCGGGTTCGAATCCCGGCGGGCCCG", regions=[], rna_type="tRNA", url="http://gtrnadb.ucsc.edu/genomes/archaea/Acid_MAR08_339/genes/tRNA-Arg-CCG-1-1.html", seq_version="1", note_data={ "anticodon": "CCG", "anticodon_positions": [{"relative_start": 36, "relative_stop": 38}], "isotype": "Arg", "score": 73.6, "url": "http://gtrnadb.ucsc.edu/genomes/archaea/Acid_MAR08_339/genes/tRNA-Arg-CCG-1-1.html", }, secondary_structure=data.SecondaryStructure.empty(), references=[ data.Reference( authors="Chan P.P., Lowe T.M.", location="Nucl. Acids Res. 37(Database issue)", title=( "GtRNAdb: A database of transfer RNA genes detected in " "genomic sequence" ), pmid=18984615, doi="10.1093/nar/gkn787.", ) ], chromosome="chr", species="Aciduliprofundum sp. MAR08-339", common_name=None, anticodon="CCG", lineage="Archaea; Euryarchaeota; Diaforarchaea group; DHVE2 group; Aciduliprofundum; unclassified Aciduliprofundum; Aciduliprofundum sp. MAR08-339", gene="tRNA-Arg-CCG-1-1", optional_id="tRNA-Arg-CCG-1-1", product="tRNA-Arg (CCG)", parent_accession="CP003168.1", description="Aciduliprofundum sp. MAR08-339 tRNA Arginine with anticodon CCG", mol_type="genomic DNA", location_start=1, location_end=123, gene_synonyms=["chr.trna10-ArgCCG"], ) )
apache-2.0
-7,829,339,666,094,141,000
37.543624
160
0.563991
false
grovesdixon/metaTranscriptomes
scripts/parse_codeml_pairwise_outputBACKUP.py
1
6189
#!/usr/bin/env python ##parse_codeml_pairwise_output.py ##written 6/26/14 by Groves Dixon ProgramName = 'parse_codeml_pairwise_output.py' LastUpdated = '6/26/14' By = 'Groves Dixon' VersionNumber = '1.0' print "\nRunning Program {}...".format(ProgramName) VersionString = '{} version {} Last Updated {} by {}'.format(ProgramName, VersionNumber, LastUpdated, By) Description = ''' Description: Parses a list of codeml output files that were generated using pair-wise dN/dS estimation (runmode -2). Pairs are set up against one base species (set as spp1) and all other species (a list file) ''' AdditionalProgramInfo = ''' Additional Program Information: ''' ##Import Modules import time import argparse from sys import argv from sys import exit import numpy as np Start_time = time.time() ##keeps track of how long the script takes to run ##Set Up Argument Parsing parser = argparse.ArgumentParser(description=Description, epilog=AdditionalProgramInfo) ##create argument parser that will automatically return help texts from global variables above parser.add_argument('-f', required = True, dest = 'files', nargs="+", help = 'A glob to the codeml output files (probably *.codeml)') parser.add_argument('-spp1', required = True, dest = 'spp1', help = 'The search tag for species 1') parser.add_argument('-sppList', required = True, dest = 'sppList', help = 'The List of species to pair with species 1') parser.add_argument('-o', required = True, dest = 'out', help = 'The desired output file name') args = parser.parse_args() #Assign Arguments FileList = args.files Spp1 = args.spp1 SppListName = args.sppList OutfileName = args.out SppList = [] with open(SppListName, 'r') as infile: for line in infile: SppList.append(line.strip("\n")) def read_files(FileList, Spp1, SppList): '''Function to reads through each file and parses out dN and dS estimates for the specified species pair. ''' print "\nLooking for data in {} codeml output files...".format(len(FileList)) geneList = [] dNList = [] dSList = [] speciesList = [] highDScount = 0 for species in SppList: if species == Spp1: continue for file in FileList: with open(file, 'r') as infile: hit = 0 hitCount = 0 #this should never exceed 1 for line in infile: if hitCount > 1: exit("Found more than one instance of pairing in a file. Something is wrong.") if hit == 0: ##look for your species pair if "("+Spp1+")" in line: if "("+species+")" in line: if "..." in line: hit = 1 continue elif hit == 1: if "dN/dS=" in line: line = line.split() try: dn = line[10] ds = line[13] except IndexError: #occurs sometimes when dS is very large #the dn value is also sometimes so high it must be split differently #this probably means its a bad alignment/ortholog call, but pasrse it anyway try: dn = line[10] ds = line[12] #it's rare, but possible that N is double digits and S is not, so only "strip" the = from the front of ds if its there if "=" in ds: ds = ds.split('=')[1] #split the large ds value assuming that dS is >= 10.0 but dN is not except IndexError: dn = line[9].split('=')[1] #this means that the dN value was also >= 10.0, so grab it differently ds = line[11].split('=')[1] #dS is also in a different place because of the big dN, so grab it geneName = file.strip(".codeml") geneList.append(geneName) dNList.append(dn) dSList.append(ds) speciesList.append(species) hit = 0 hitCount += 1 # print geneName # print species # print dn return geneList, dNList, dSList, speciesList def output(OutfileName, geneList, dNList, dSList, speciesList): """Outputs the data into a table""" badValues = [] lineNums = [] with open(OutfileName, 'w') as out: out.write("EST\tspecies\tdN\tdS") for i in range(len(geneList)): ######### ##there is a bug that occurs when the synonymous substitution rate is >99.99 #these are obviously wrong anyway and they stop the output from uploading into R so skip them fourData = 'TRUE' outList = [geneList[i], speciesList[i], dNList[i], dSList[i]] try: float(dNList[i]) float(dSList[i]) except ValueError: badValues.append([dNList[i], dSList[i]]) lineNums.append(i) continue for x in outList: if x == "": fourData = 'FALSE' if fourData == 'FALSE': continue ########### outString = "\n{}\t{}\t{}\t{}".format(geneList[i], speciesList[i], dNList[i], dSList[i]) out.write("\n{}\t{}\t{}\t{}".format(geneList[i], speciesList[i], dNList[i], dSList[i])) geneList, dNList, dSList, speciesList = read_files(FileList, Spp1, SppList) output(OutfileName, geneList, dNList, dSList, speciesList) #return time to run Time = time.time() - Start_time print('\nTime took to run: {}'.format(Time))
mit
5,886,263,383,535,908,000
40.536913
182
0.527549
false
Wintermute0110/plugin.program.advanced.emulator.launcher
tests/fakes.py
1
8256
from abc import ABCMeta, abstractmethod from resources.objects import * from resources.utils import * from resources.scrap import * class FakeRomSetRepository(ROMSetRepository): def __init__(self, roms): self.roms = roms def find_by_launcher(self, launcher): return self.roms def save_rom_set(self, launcher, roms): self.roms = roms def delete_all_by_launcher(self, launcher): self.roms = {} class FakeExecutor(ExecutorABC): def __init__(self): self.actualApplication = None self.actualArgs = None super(FakeExecutor, self).__init__(None) def getActualApplication(self): return self.actualApplication def getActualArguments(self): return self.actualArgs def execute(self, application, arguments, non_blocking): self.actualApplication = application self.actualArgs = arguments pass class FakeClass(): def FakeMethod(self, value, key, launcher): self.value = value class FakeFile(FileName): def __init__(self, pathString): self.fakeContent = '' self.path_str = pathString self.path_tr = pathString self.exists = self.exists_fake self.write = self.write_fake def setFakeContent(self, content): self.fakeContent = content def getFakeContent(self): return self.fakeContent def loadFileToStr(self, encoding = 'utf-8'): return self.fakeContent def readAllUnicode(self, encoding='utf-8'): contents = unicode(self.fakeContent) return contents def saveStrToFile(self, data_str, encoding = 'utf-8'): self.fakeContent = data_str def write_fake(self, bytes): self.fakeContent = self.fakeContent + bytes def open(self, mode): pass def close(self): pass def writeAll(self, bytes, flags='w'): self.fakeContent = self.fakeContent + bytes def pjoin(self, *args): child = FakeFile(self.path_str) child.setFakeContent(self.fakeContent) for arg in args: child.path_str = os.path.join(child.path_str, arg) child.path_tr = os.path.join(child.path_tr, arg) return child def switchExtension(self, targetExt): switched_fake = super(FakeFile, self).switchExtension(targetExt) #switched_fake = FakeFile(switched_type.getPath()) switched_fake.setFakeContent(self.fakeContent) return switched_fake def exists_fake(self): return True def scanFilesInPathAsFileNameObjects(self, mask = '*.*'): return [] #backwards compatiblity def __create__(self, path): return FakeFile(path) class Fake_Paths: def __init__(self, fake_base, fake_addon_id = 'ael-tests'): # --- Base paths --- self.ADDONS_DATA_DIR = FileName(fake_base, isdir = True) self.ADDON_DATA_DIR = self.ADDONS_DATA_DIR.pjoin(fake_addon_id, isdir = True) self.PROFILE_DIR = self.ADDONS_DATA_DIR.pjoin('profile', isdir = True) self.HOME_DIR = self.ADDONS_DATA_DIR.pjoin('home', isdir = True) self.ADDONS_DIR = self.HOME_DIR.pjoin('addons', isdir = True) self.ADDON_CODE_DIR = self.ADDONS_DIR.pjoin(fake_addon_id, isdir = True) self.ICON_FILE_PATH = self.ADDON_CODE_DIR.pjoin('media/icon.png') self.FANART_FILE_PATH = self.ADDON_CODE_DIR.pjoin('media/fanart.jpg') # --- Databases and reports --- self.CATEGORIES_FILE_PATH = self.ADDON_DATA_DIR.pjoin('categories.xml') self.FAV_JSON_FILE_PATH = self.ADDON_DATA_DIR.pjoin('favourites.json') self.COLLECTIONS_FILE_PATH = self.ADDON_DATA_DIR.pjoin('collections.xml') self.VCAT_TITLE_FILE_PATH = self.ADDON_DATA_DIR.pjoin('vcat_title.xml') self.VCAT_YEARS_FILE_PATH = self.ADDON_DATA_DIR.pjoin('vcat_years.xml') self.VCAT_GENRE_FILE_PATH = self.ADDON_DATA_DIR.pjoin('vcat_genre.xml') self.VCAT_DEVELOPER_FILE_PATH = self.ADDON_DATA_DIR.pjoin('vcat_developers.xml') self.VCAT_NPLAYERS_FILE_PATH = self.ADDON_DATA_DIR.pjoin('vcat_nplayers.xml') self.VCAT_ESRB_FILE_PATH = self.ADDON_DATA_DIR.pjoin('vcat_esrb.xml') self.VCAT_RATING_FILE_PATH = self.ADDON_DATA_DIR.pjoin('vcat_rating.xml') self.VCAT_CATEGORY_FILE_PATH = self.ADDON_DATA_DIR.pjoin('vcat_category.xml') # Launcher app stdout/stderr file self.LAUNCH_LOG_FILE_PATH = self.ADDON_DATA_DIR.pjoin('launcher.log') self.RECENT_PLAYED_FILE_PATH = self.ADDON_DATA_DIR.pjoin('history.json') self.MOST_PLAYED_FILE_PATH = self.ADDON_DATA_DIR.pjoin('most_played.json') self.BIOS_REPORT_FILE_PATH = self.ADDON_DATA_DIR.pjoin('report_BIOS.txt') self.LAUNCHER_REPORT_FILE_PATH = self.ADDON_DATA_DIR.pjoin('report_Launchers.txt') # --- Offline scraper databases --- self.GAMEDB_INFO_DIR = self.ADDON_CODE_DIR.pjoin('GameDBInfo', isdir = True) self.GAMEDB_JSON_BASE_NOEXT = 'GameDB_info' self.LAUNCHBOX_INFO_DIR = self.ADDON_CODE_DIR.pjoin('LaunchBox', isdir = True) self.LAUNCHBOX_JSON_BASE_NOEXT = 'LaunchBox_info' # --- Artwork and NFO for Categories and Launchers --- self.CATEGORIES_ASSET_DIR = self.ADDON_DATA_DIR.pjoin('asset-categories', isdir = True) self.COLLECTIONS_ASSET_DIR = self.ADDON_DATA_DIR.pjoin('asset-collections', isdir = True) self.LAUNCHERS_ASSET_DIR = self.ADDON_DATA_DIR.pjoin('asset-launchers', isdir = True) self.FAVOURITES_ASSET_DIR = self.ADDON_DATA_DIR.pjoin('asset-favourites', isdir = True) self.VIRTUAL_CAT_TITLE_DIR = self.ADDON_DATA_DIR.pjoin('db_title', isdir = True) self.VIRTUAL_CAT_YEARS_DIR = self.ADDON_DATA_DIR.pjoin('db_year', isdir = True) self.VIRTUAL_CAT_GENRE_DIR = self.ADDON_DATA_DIR.pjoin('db_genre', isdir = True) self.VIRTUAL_CAT_DEVELOPER_DIR = self.ADDON_DATA_DIR.pjoin('db_developer', isdir = True) self.VIRTUAL_CAT_NPLAYERS_DIR = self.ADDON_DATA_DIR.pjoin('db_nplayer', isdir = True) self.VIRTUAL_CAT_ESRB_DIR = self.ADDON_DATA_DIR.pjoin('db_esrb', isdir = True) self.VIRTUAL_CAT_RATING_DIR = self.ADDON_DATA_DIR.pjoin('db_rating', isdir = True) self.VIRTUAL_CAT_CATEGORY_DIR = self.ADDON_DATA_DIR.pjoin('db_category', isdir = True) self.ROMS_DIR = self.ADDON_DATA_DIR.pjoin('db_ROMs', isdir = True) self.COLLECTIONS_DIR = self.ADDON_DATA_DIR.pjoin('db_Collections', isdir = True) self.REPORTS_DIR = self.ADDON_DATA_DIR.pjoin('reports', isdir = True) class FakeScraper(Scraper): def __init__(self, settings, launcher, rom_data_to_apply = None): self.rom_data_to_apply = rom_data_to_apply scraper_settings = ScraperSettings(1,1,False,True) super(FakeScraper, self).__init__(scraper_settings, launcher, True, []) def getName(self): return 'FakeScraper' def supports_asset_type(self, asset_info): return True def _get_candidates(self, searchTerm, romPath, rom): return ['fake'] def _load_metadata(self, candidate, romPath, rom): gamedata = self._new_gamedata_dic() if self.rom_data_to_apply : gamedata['title'] = self.rom_data_to_apply['m_name'] if 'm_name' in self.rom_data_to_apply else '' gamedata['year'] = self.rom_data_to_apply['m_year'] if 'm_year' in self.rom_data_to_apply else '' gamedata['genre'] = self.rom_data_to_apply['m_genre'] if 'm_genre' in self.rom_data_to_apply else '' gamedata['developer'] = self.rom_data_to_apply['m_developer']if 'm_developer' in self.rom_data_to_apply else '' gamedata['plot'] = self.rom_data_to_apply['m_plot'] if 'm_plot' in self.rom_data_to_apply else '' else: gamedata['title'] = romPath.getBase_noext() def _load_assets(self, candidate, romPath, rom): pass
gpl-2.0
-8,512,910,359,609,642,000
42.005208
123
0.622941
false
coolbombom/CouchPotatoServer
couchpotato/core/downloaders/transmission/main.py
1
10725
from base64 import b64encode from couchpotato.core.downloaders.base import Downloader, StatusList from couchpotato.core.helpers.encoding import isInt from couchpotato.core.logger import CPLog from couchpotato.environment import Env from datetime import timedelta import httplib import json import os.path import re import traceback import urllib2 log = CPLog(__name__) class Transmission(Downloader): type = ['torrent', 'torrent_magnet'] log = CPLog(__name__) def download(self, data, movie, filedata = None): log.info('Sending "%s" (%s) to Transmission.', (data.get('name'), data.get('type'))) # Load host from config and split out port. host = self.conf('host').split(':') if not isInt(host[1]): log.error('Config properties are not filled in correctly, port is missing.') return False # Set parameters for Transmission params = { 'paused': self.conf('paused', default = 0), } if len(self.conf('directory', default = '')) > 0: folder_name = self.createFileName(data, filedata, movie)[:-len(data.get('type')) - 1] params['download-dir'] = os.path.join(self.conf('directory', default = ''), folder_name).rstrip(os.path.sep) torrent_params = {} if self.conf('ratio'): torrent_params = { 'seedRatioLimit': self.conf('ratio'), 'seedRatioMode': self.conf('ratiomode') } if not filedata and data.get('type') == 'torrent': log.error('Failed sending torrent, no data') return False # Send request to Transmission try: trpc = TransmissionRPC(host[0], port = host[1], username = self.conf('username'), password = self.conf('password')) if data.get('type') == 'torrent_magnet': remote_torrent = trpc.add_torrent_uri(data.get('url'), arguments = params) torrent_params['trackerAdd'] = self.torrent_trackers else: remote_torrent = trpc.add_torrent_file(b64encode(filedata), arguments = params) if not remote_torrent: return False # Change settings of added torrents elif torrent_params: trpc.set_torrent(remote_torrent['torrent-added']['hashString'], torrent_params) log.info('Torrent sent to Transmission successfully.') return self.downloadReturnId(remote_torrent['torrent-added']['hashString']) except: log.error('Failed to change settings for transfer: %s', traceback.format_exc()) return False def getAllDownloadStatus(self): log.debug('Checking Transmission download status.') # Load host from config and split out port. host = self.conf('host').split(':') if not isInt(host[1]): log.error('Config properties are not filled in correctly, port is missing.') return False # Go through Queue try: trpc = TransmissionRPC(host[0], port = host[1], username = self.conf('username'), password = self.conf('password')) return_params = { 'fields': ['id', 'name', 'hashString', 'percentDone', 'status', 'eta', 'isFinished', 'downloadDir', 'uploadRatio'] } queue = trpc.get_alltorrents(return_params) except Exception, err: log.error('Failed getting queue: %s', err) return False if not queue: return [] statuses = StatusList(self) # Get torrents status # CouchPotato Status #status = 'busy' #status = 'failed' #status = 'completed' # Transmission Status #status = 0 => "Torrent is stopped" #status = 1 => "Queued to check files" #status = 2 => "Checking files" #status = 3 => "Queued to download" #status = 4 => "Downloading" #status = 4 => "Queued to seed" #status = 6 => "Seeding" #To do : # add checking file # manage no peer in a range time => fail for item in queue['torrents']: log.debug('name=%s / id=%s / downloadDir=%s / hashString=%s / percentDone=%s / status=%s / eta=%s / uploadRatio=%s / confRatio=%s / isFinished=%s', (item['name'], item['id'], item['downloadDir'], item['hashString'], item['percentDone'], item['status'], item['eta'], item['uploadRatio'], self.conf('ratio'), item['isFinished'])) if not os.path.isdir(Env.setting('from', 'renamer')): log.error('Renamer "from" folder doesn\'t to exist.') return if (item['percentDone'] * 100) >= 100 and (item['status'] == 6 or item['status'] == 0) and item['uploadRatio'] > self.conf('ratio'): try: trpc.stop_torrent(item['hashString'], {}) statuses.append({ 'id': item['hashString'], 'name': item['name'], 'status': 'completed', 'original_status': item['status'], 'timeleft': str(timedelta(seconds = 0)), 'folder': os.path.join(item['downloadDir'], item['name']), }) if ((not os.path.isdir(item['downloadDir']))) and (self.conf('from') in item['downloadDir'])): trpc.remove_torrent(item['id'], "true", {}) except Exception, err: log.error('Failed to stop and remove torrent "%s" with error: %s', (item['name'], err)) statuses.append({ 'id': item['hashString'], 'name': item['name'], 'status': 'failed', 'original_status': item['status'], 'timeleft': str(timedelta(seconds = 0)), }) else: statuses.append({ 'id': item['hashString'], 'name': item['name'], 'status': 'busy', 'original_status': item['status'], 'timeleft': str(timedelta(seconds = item['eta'])), # Is ETA in seconds?? }) return statuses class TransmissionRPC(object): """TransmissionRPC lite library""" def __init__(self, host = 'localhost', port = 9091, username = None, password = None): super(TransmissionRPC, self).__init__() self.url = 'http://' + host + ':' + str(port) + '/transmission/rpc' self.tag = 0 self.session_id = 0 self.session = {} if username and password: password_manager = urllib2.HTTPPasswordMgrWithDefaultRealm() password_manager.add_password(realm = None, uri = self.url, user = username, passwd = password) opener = urllib2.build_opener(urllib2.HTTPBasicAuthHandler(password_manager), urllib2.HTTPDigestAuthHandler(password_manager)) opener.addheaders = [('User-agent', 'couchpotato-transmission-client/1.0')] urllib2.install_opener(opener) elif username or password: log.debug('User or password missing, not using authentication.') self.session = self.get_session() def _request(self, ojson): self.tag += 1 headers = {'x-transmission-session-id': str(self.session_id)} request = urllib2.Request(self.url, json.dumps(ojson).encode('utf-8'), headers) try: open_request = urllib2.urlopen(request) response = json.loads(open_request.read()) log.debug('request: %s', json.dumps(ojson)) log.debug('response: %s', json.dumps(response)) if response['result'] == 'success': log.debug('Transmission action successfull') return response['arguments'] else: log.debug('Unknown failure sending command to Transmission. Return text is: %s', response['result']) return False except httplib.InvalidURL, err: log.error('Invalid Transmission host, check your config %s', err) return False except urllib2.HTTPError, err: if err.code == 401: log.error('Invalid Transmission Username or Password, check your config') return False elif err.code == 409: msg = str(err.read()) try: self.session_id = \ re.search('X-Transmission-Session-Id:\s*(\w+)', msg).group(1) log.debug('X-Transmission-Session-Id: %s', self.session_id) # #resend request with the updated header return self._request(ojson) except: log.error('Unable to get Transmission Session-Id %s', err) else: log.error('TransmissionRPC HTTPError: %s', err) except urllib2.URLError, err: log.error('Unable to connect to Transmission %s', err) def get_session(self): post_data = {'method': 'session-get', 'tag': self.tag} return self._request(post_data) def add_torrent_uri(self, torrent, arguments): arguments['filename'] = torrent post_data = {'arguments': arguments, 'method': 'torrent-add', 'tag': self.tag} return self._request(post_data) def add_torrent_file(self, torrent, arguments): arguments['metainfo'] = torrent post_data = {'arguments': arguments, 'method': 'torrent-add', 'tag': self.tag} return self._request(post_data) def set_torrent(self, torrent_id, arguments): arguments['ids'] = torrent_id post_data = {'arguments': arguments, 'method': 'torrent-set', 'tag': self.tag} return self._request(post_data) def get_alltorrents(self, arguments): post_data = {'arguments': arguments, 'method': 'torrent-get', 'tag': self.tag} return self._request(post_data) def stop_torrent(self, torrent_id, arguments): arguments['ids'] = torrent_id post_data = {'arguments': arguments, 'method': 'torrent-stop', 'tag': self.tag} return self._request(post_data) def remove_torrent(self, torrent_id, remove_local_data, arguments): arguments['ids'] = torrent_id arguments['delete-local-data'] = remove_local_data post_data = {'arguments': arguments, 'method': 'torrent-remove', 'tag': self.tag} return self._request(post_data)
gpl-3.0
1,714,337,725,172,411,100
41.9
339
0.554499
false
astroswego/magellanic-structure
src/magstruct/transformations.py
1
1722
import numpy from numpy import array, sin, cos __all__ = [ 'Equatorial2Cartesian', 'Rotation3D', 'rotation_matrix_3d' ] class Equatorial2Cartesian(): def __init__(self, RA_0, Dec_0, D_0): self.RA_0 = RA_0 self.Dec_0 = Dec_0 self.D_0 = D_0 def fit(self, X, y=None): return self def transform(self, X, y=None, **params): X_new = numpy.empty_like(X) x, y, z = X_new[:,0], X_new[:,1], X_new[:,2] RA, Dec, D = X[:,0], X[:,1], X[:,2] delta_RA = RA - self.RA_0 x[:] = -D * sin(delta_RA) * cos(Dec) y[:] = D * (sin(Dec) * cos(self.Dec_0) + sin(self.Dec_0) * cos(delta_RA) * cos(Dec)) z[:] = self.D_0 \ - D * (sin(Dec)*sin(self.Dec_0) + cos(RA)*cos(self.Dec_0)) \ - self.RA_0*cos(Dec) return X_new def rotation_matrix_3d(angle, axis): assert axis in range(3), 'Axis must be 0, 1, or 2' T = numpy.empty((3, 3), dtype=float) # find the index of the -sin(angle) term # this formula is the polynomial which passes through all of the pairs # (axis, index) i = axis**2 - 4*axis + 5 T.flat[::3+1] = cos(angle) T.flat[i::3-1] = sin(angle) # negate the -sin(angle) term, as it is currently just sin(angle) T.flat[i] *= -1 T[axis,:] = 0 T[:,axis] = 0 T[axis,axis] = 1 return T class Rotation3D(): def __init__(self, angle, axis): self.axis = axis self.angle = angle self.rotation_matrix = rotation_matrix_3d(angle, axis) def fit(self, X, y=None): return self def transform(self, X, y=None, **params): return self.rotation_matrix.dot(X)
mit
-4,956,154,805,142,992,000
24.701493
74
0.522648
false
lindemann09/pyForceDAQ
forceDAQ/data_handling/read_force_data.py
1
2147
""" Functions to read your force and event data """ __author__ = 'Oliver Lindemann' import os import sys import gzip from collections import OrderedDict import numpy as np TAG_COMMENTS = "#" TAG_UDPDATA = TAG_COMMENTS + "UDP" TAG_DAQEVENTS = TAG_COMMENTS + "T" def _csv(line): return list(map(lambda x: x.strip(), line.split(","))) def DataFrameDict(data, varnames): """data frame: Dict of numpy arrays does not require Pandas, but can be easily converted to pandas dataframe via pandas.DataFrame(data_frame_dict) """ rtn = OrderedDict() for v in varnames: rtn[v] = [] for row in data: for v, d in zip(varnames, row): rtn[v].append(d) return rtn def data_frame_to_text(data_frame): rtn = ",".join(data_frame.keys()) rtn += "\n" for x in np.array(list(data_frame.values())).T: rtn += ",".join(x) + "\n" return rtn def read_raw_data(path): """reading trigger and udp data Returns: data, udp_event, daq_events and comments data, udp_event, daq_events: DataFrameDict comments: text string """ daq_events = [] udp_events = [] comments = "" data = [] varnames = None app_dir = os.path.split(sys.argv[0])[0] path = os.path.abspath(os.path.join(app_dir, path)) if path.endswith("gz"): fl = gzip.open(path, "rt") else: fl = open(path, "rt") for ln in fl: if ln.startswith(TAG_COMMENTS): comments += ln if ln.startswith(TAG_UDPDATA + ","): udp_events.append(_csv(ln[len(TAG_UDPDATA) + 1:])) elif ln.startswith(TAG_DAQEVENTS): daq_events.append(_csv(ln[len(TAG_DAQEVENTS) + 1:])) else: # data if varnames is None: # first row contains varnames varnames = _csv(ln) else: data.append(_csv(ln)) fl.close() return (DataFrameDict(data, varnames), DataFrameDict(udp_events, ["time", "value"]), DataFrameDict(daq_events, ["time", "value"]), comments)
mit
-4,905,626,410,306,586,000
23.123596
76
0.56218
false
cemarchi/biosphere
Src/BioAnalyzer/Analysis/GenePrioritization/Steps/DataIntegration/IntermediateRepresentation/Transformers/MicroRnaToGeneTransformer.py
1
4546
import math import statistics from itertools import groupby from random import randint from typing import Dict, Tuple, Counter import pandas as pd from Src.BioAnalyzer.Analysis.GenePrioritization.Steps.DataIntegration.IntermediateRepresentation.Generators import \ IntermediateRepresentationGeneratorBase from Src.BioAnalyzer.Analysis.GenePrioritization.Steps.DataIntegration.IntermediateRepresentation.Transformers.SampleTransformerBase import \ SampleTransformerBase from Src.BioDataManagement.CrossCutting.DTOs.ExpressionLevelStatusDto import ExpressionLevelStatusDto class MicroRnaToGeneTransformer(SampleTransformerBase): """ """ def __init__(self, intermediateRepresentationGenerator: IntermediateRepresentationGeneratorBase, get_global_diff_values_action, get_mirna_gene_target_action): super().__init__(intermediateRepresentationGenerator) self.__get_mirna_gene_target_action = get_mirna_gene_target_action self.__get_global_diff_values_action = get_global_diff_values_action def transform(self, from_sample_matrix: pd.DataFrame, is_highly_significant: bool) -> Tuple[pd.DataFrame, Dict[int, ExpressionLevelStatusDto]]: mirna_gene_targets = {mirna.lower(): g for mirna, g in self.__get_mirna_gene_targets(from_sample_matrix.columns.tolist()).items()} mirna_samples = self.__get_mirna_samples(from_sample_matrix, mirna_gene_targets) id_entrez_list = list(set([id_entrez for mirna_symbol, id_entrez_list in mirna_gene_targets.items() for id_entrez in id_entrez_list])) measure_matrix = dict([(g, []) for g in id_entrez_list]) key_func = lambda gene: gene[0] for patient_id, exp_values in mirna_samples.items(): gene_values = [(id_entrez, exp_value) for mirna_symbol, exp_value in exp_values.items() for id_entrez in mirna_gene_targets[mirna_symbol]] gene_values = sorted(gene_values, key=key_func) for id_entrez, measures in groupby(gene_values, key_func): measures = [measure for id_entrez, measure in list(measures) if not math.isnan(measure)] measure_matrix[id_entrez].append(float('NaN') if not measures else statistics.mean(measures)) gene_matrix = pd.DataFrame.from_dict(measure_matrix).dropna(axis=1,how='all') gene_matrix = self.intermediateRepresentationGenerator.generate(gene_matrix).dropna(axis=1,how='all') return gene_matrix, \ self.__get_gene_status(mirna_gene_targets, gene_matrix.columns.tolist(), is_highly_significant) def __get_mirna_gene_targets(self, mirnas): gene_targets = {} fe_target = self.__get_mirna_gene_target_action(mirnas) gene_targets.update(dict([(t.microrna_symbol, list(set(gene_targets[t.microrna_symbol] + t.id_entrez_genes))) if t.microrna_symbol in gene_targets else (t.microrna_symbol, t.id_entrez_genes) for t in fe_target.result_list])) return gene_targets def __get_mirna_samples(self, from_sample_matrix, mirna_gene_targets): from_sample_matrix = from_sample_matrix[list(mirna_gene_targets.keys()) + ['patient_id']] from_sample_matrix.set_index("patient_id", drop=True, inplace=True) return from_sample_matrix.to_dict(orient="index") def __get_gene_status(self, mirna_gene_targets, genes, is_highly_significant): diff_mirna = [diff for diff in self.__get_global_diff_values_action(is_highly_significant).result.values if diff.element_id in mirna_gene_targets] genes_status = [(g, diff.status) for diff in diff_mirna for g in mirna_gene_targets[diff.element_id] if g in genes] key_func = lambda gene: gene[0] genes_status = sorted(genes_status, key=key_func) genes_status_dict = {} for id_entrez, status in groupby(genes_status, key_func): status = list(status) status_counter = Counter(status) status = [k for k, v in status_counter.most_common()] len_status = len(status) - 1 genes_status_dict[id_entrez] = status[0] if len_status == 1 else status[randint(0, len_status)] return dict([(entrez_id, status[1]) for entrez_id, status in genes_status_dict.items()])
bsd-3-clause
261,306,271,858,045,380
49.522222
147
0.653322
false
aplanas/kmanga
kmanga/core/models.py
1
21424
import os.path from django.conf import settings from django.db import connection from django.db import models from django.db.models import Count from django.db.models import F from django.db.models import Q from django.urls import reverse from django.utils import timezone class TimeStampedModel(models.Model): created = models.DateTimeField(auto_now_add=True) modified = models.DateTimeField(auto_now=True) class Meta: abstract = True class Source(TimeStampedModel): name = models.CharField(max_length=200) spider = models.CharField(max_length=80) url = models.URLField(unique=True) has_footer = models.BooleanField(default=False) enabled = models.BooleanField(default=True) def __str__(self): return self.name class SourceLanguage(TimeStampedModel): GERMAN = 'DE' ENGLISH = 'EN' SPANISH = 'ES' FRENCH = 'FR' ITALIAN = 'IT' RUSSIAN = 'RU' PORTUGUESE = 'PT' LANGUAGE_CHOICES = ( (ENGLISH, 'English'), (SPANISH, 'Spanish'), (GERMAN, 'German'), (FRENCH, 'French'), (ITALIAN, 'Italian'), (RUSSIAN, 'Russian'), (PORTUGUESE, 'Portuguese'), ) language = models.CharField(max_length=2, choices=LANGUAGE_CHOICES) source = models.ForeignKey(Source, on_delete=models.CASCADE) def __str__(self): return '%s (%s)' % (self.get_language_display(), self.language) class ConsolidateGenre(TimeStampedModel): name = models.CharField(max_length=200) def __str__(self): return self.name class Genre(TimeStampedModel): name = models.CharField(max_length=200) source = models.ForeignKey(Source, on_delete=models.CASCADE) # consolidategenre = models.ForeignKey(ConsolidateGenre, # on_delete=models.CASCADE) def __str__(self): return self.name class AdvRawQuerySet(models.query.RawQuerySet): """RawQuerySet subclass with advanced options.""" def __init__(self, raw_query, paged_query, count_query, model=None, query=None, params=None, translations=None, using=None, hints=None): super(AdvRawQuerySet, self).__init__(raw_query, model=model, query=query, params=params, translations=translations, using=using, hints=hints) self.raw_query = raw_query self.paged_query = paged_query self.count_query = count_query def __getitem__(self, key): if isinstance(key, slice): start, stop = key.start, key.stop else: start, stop = key, key + 1 if self.params: params = self.params + [stop-start, start] else: params = (stop-start, start) return models.query.RawQuerySet(self.paged_query, model=self.model, params=params, translations=self.translations, using=self._db, hints=self._hints) def __len__(self): cursor = connection.cursor() cursor.execute(self.count_query, self.params) return cursor.fetchone()[0] class MangaQuerySet(models.QuerySet): def latests(self): """Return the lastest mangas with new/updated issues.""" # The correct annotation expression is the next one, but due # to an error in Django ORM, this empression uses a full GROUP # BY with the data fields. This produce a slow query. # # return self.annotate( # models.Max('issue__modified') # ).order_by('-issue__modified__max') # # Alternative (without deferreds) # # extra_query = ''' # SELECT MAX(core_issue.modified) # FROM core_issue # WHERE core_issue.manga_id = core_manga.id # ''' # Manga.objects.extra({ # 'issue__modified__max': extra_query # }).order_by('-issue__modified__max') raw_query = ''' SELECT core_manga.id, MAX(core_issue.modified) AS issue__modified__max FROM core_manga LEFT OUTER JOIN core_issue ON (core_manga.id = core_issue.manga_id) GROUP BY core_manga.id ORDER BY issue__modified__max DESC NULLS LAST, core_manga.name ASC, core_manga.url ASC; ''' paged_query = ''' SELECT core_manga.id, MAX(core_issue.modified) AS issue__modified__max FROM core_manga LEFT OUTER JOIN core_issue ON (core_manga.id = core_issue.manga_id) GROUP BY core_manga.id ORDER BY issue__modified__max DESC NULLS LAST, core_manga.name ASC, core_manga.url ASC LIMIT %s OFFSET %s; ''' count_query = ''' SELECT COUNT(*) FROM core_manga; ''' return AdvRawQuerySet(raw_query=raw_query, paged_query=paged_query, count_query=count_query, model=self.model, using=self.db) def _to_tsquery(self, q): """Convert a query to a PostgreSQL tsquery.""" # Remove special chars (except parens) q = ''.join(c if c.isalnum() or c in '()' else ' ' for c in q) # Separate parentesis from words for token in ('(', ')'): q = q.replace(token, ' %s ' % token) # Parse the query op = { 'and': '&', 'or': '|', 'not': '-', '(': '(', ')': ')', } # Join operators j = '&|' # Operators that expect and join before ops_j = '-(' tsquery = [] for token in q.split(): if token in op: if tsquery and op[token] in ops_j and tsquery[-1] not in j: tsquery.append(op['and']) tsquery.append(op[token]) else: if tsquery and tsquery[-1] not in (j + ops_j): tsquery.append(op['and']) tsquery.append('%s:*' % token) # Add spaces between join operators tsquery = [(t if t not in j else ' %s ' % t) for t in tsquery] return ''.join(tsquery) def is_valid(self, q): """Check is the query is a valid query.""" q = self._to_tsquery(q) # Separate parentesis from words for token in ('(', ')'): q = q.replace(token, ' %s ' % token) s = [] for token in q.split(): if token == '(': s.append(token) elif token == ')': try: t = s.pop() except IndexError: return False if t != '(': return False return not len(s) def search(self, q): q = self._to_tsquery(q) raw_query = ''' SELECT core_manga.* FROM ( SELECT id FROM core_manga_fts_view, to_tsquery(%s) AS q WHERE document @@ q ORDER BY ts_rank(document, q) DESC, name ASC, url ASC ) AS ids INNER JOIN core_manga ON core_manga.id = ids.id; ''' paged_query = ''' SELECT core_manga.* FROM ( SELECT id FROM core_manga_fts_view, to_tsquery(%s) AS q WHERE document @@ q ORDER BY ts_rank(document, q) DESC, name ASC, url ASC LIMIT %s OFFSET %s ) AS ids INNER JOIN core_manga ON core_manga.id = ids.id; ''' count_query = ''' SELECT COUNT(*) FROM core_manga_fts_view WHERE document @@ to_tsquery(%s); ''' return AdvRawQuerySet(raw_query=raw_query, paged_query=paged_query, count_query=count_query, model=self.model, params=[q], using=self.db) def refresh(self): cursor = connection.cursor() cursor.execute('REFRESH MATERIALIZED VIEW core_manga_fts_view;') def _cover_path(instance, filename): return os.path.join(instance.source.spider, filename) class Manga(TimeStampedModel): LEFT_TO_RIGHT = 'LR' RIGHT_TO_LEFT = 'RL' READING_DIRECTION = ( (LEFT_TO_RIGHT, 'Left-to-right'), (RIGHT_TO_LEFT, 'Right-to-left'), ) ONGOING = 'O' COMPLETED = 'C' STATUS = ( (ONGOING, 'Ongoing'), (COMPLETED, 'Completed'), ) ASC = 'ASC' DESC = 'DESC' RANK_ORDER = ( (ASC, 'Ascending'), (DESC, 'Descending'), ) name = models.CharField(max_length=200, db_index=True) # slug = models.SlugField(max_length=200) # release = models.DateField() author = models.CharField(max_length=200) artist = models.CharField(max_length=200) reading_direction = models.CharField(max_length=2, choices=READING_DIRECTION, default=RIGHT_TO_LEFT) status = models.CharField(max_length=1, choices=STATUS, default=ONGOING) genres = models.ManyToManyField(Genre) rank = models.FloatField(null=True, blank=True) rank_order = models.CharField(max_length=4, choices=RANK_ORDER, default=ASC) description = models.TextField() cover = models.ImageField(upload_to=_cover_path) url = models.URLField(unique=True, db_index=True) source = models.ForeignKey(Source, on_delete=models.CASCADE) objects = MangaQuerySet.as_manager() def __str__(self): return self.name def subscribe(self, user, language=None, issues_per_day=4, paused=False): """Subscribe an User to the current manga.""" language = language if language else user.userprofile.language obj, created = Subscription.all_objects.update_or_create( manga=self, user=user, defaults={ 'language': language, 'issues_per_day': issues_per_day, 'paused': paused, 'deleted': False, }) return obj def is_subscribed(self, user): """Check if an user is subscribed to this manga.""" return self.subscription(user).exists() def subscription(self, user): """Return the users' subscription of this manga.""" return self.subscription_set.filter(user=user) def languages(self): """Return the number of issues per language.""" return self.issue_set\ .values('language')\ .order_by('language')\ .annotate(Count('language')) class AltName(TimeStampedModel): name = models.CharField(max_length=200) manga = models.ForeignKey(Manga, on_delete=models.CASCADE) def __str__(self): return self.name class Issue(TimeStampedModel): name = models.CharField(max_length=200) number = models.CharField(max_length=10) order = models.IntegerField() language = models.CharField(max_length=2, choices=SourceLanguage.LANGUAGE_CHOICES) release = models.DateField() url = models.URLField(unique=True, max_length=255) manga = models.ForeignKey(Manga, on_delete=models.CASCADE) class Meta: ordering = ('order', 'name') def __str__(self): return self.name def is_sent(self, user): """Check if an user has received this issue.""" return self.result(user, status=Result.SENT).exists() def create_result_if_needed(self, user, status, set_send_date=True): """Create `Result` if is new with a status.""" defaults = {'status': status} if set_send_date: defaults['send_date'] = timezone.now() subscription = Subscription.objects.get( manga=self.manga, user=user) result, _ = Result.objects.update_or_create( issue=self, subscription=subscription, defaults=defaults) return result def result(self, user, status=None): """Return the Result for an user for this issue.""" # XXX TODO - Avoid filtering by subscription__deleted using # the Subscription manager. query = self.result_set.filter( subscription__user=user, subscription__deleted=False) if status: query = query.filter(status=status) return query def retry_if_failed(self, user): """Increment the retry field of `Result` if status is FAIL.""" self.result(user, status=Result.FAILED).update(retry=F('retry') + 1) class SubscriptionQuerySet(models.QuerySet): def latests(self, user): """Return the latests subscriptions with changes in Result.""" # See the notes from `MangaQuerySet.latests()` raw_query = ''' SELECT core_subscription.id, MAX(core_result.modified) AS result__modified__max FROM core_subscription LEFT OUTER JOIN core_result ON (core_subscription.id = core_result.subscription_id) WHERE core_subscription.deleted = false AND core_subscription.user_id = %s GROUP BY core_subscription.id ORDER BY result__modified__max DESC NULLS LAST, core_subscription.id ASC; ''' paged_query = ''' SELECT core_subscription.id, MAX(core_result.modified) AS result__modified__max FROM core_subscription LEFT OUTER JOIN core_result ON (core_subscription.id = core_result.subscription_id) WHERE core_subscription.deleted = false AND core_subscription.user_id = %s GROUP BY core_subscription.id ORDER BY result__modified__max DESC NULLS LAST, core_subscription.id ASC LIMIT %s OFFSET %s; ''' count_query = ''' SELECT COUNT(*) FROM core_subscription WHERE core_subscription.deleted = false AND core_subscription.user_id = %s; ''' return AdvRawQuerySet(raw_query=raw_query, paged_query=paged_query, count_query=count_query, model=self.model, params=[user.id], using=self.db) class SubscriptionManager(models.Manager): def get_queryset(self): """Exclude deleted subscriptions.""" return super(SubscriptionManager, self).get_queryset().exclude(deleted=True) class SubscriptionActiveManager(models.Manager): def get_queryset(self): """Exclude paused and deleted subscriptions.""" return super(SubscriptionActiveManager, self).get_queryset().exclude( Q(paused=True) | Q(deleted=True)) class Subscription(TimeStampedModel): # Number of retries before giving up in a FAILED result RETRY = 3 manga = models.ForeignKey(Manga, on_delete=models.CASCADE) user = models.ForeignKey(settings.AUTH_USER_MODEL, on_delete=models.CASCADE) language = models.CharField(max_length=2, choices=SourceLanguage.LANGUAGE_CHOICES) issues_per_day = models.IntegerField(default=4) paused = models.BooleanField(default=False) deleted = models.BooleanField(default=False) objects = SubscriptionManager.from_queryset(SubscriptionQuerySet)() actives = SubscriptionActiveManager.from_queryset(SubscriptionQuerySet)() all_objects = models.Manager() class Meta: unique_together = ('manga', 'user') def __str__(self): return '%s (%d per day)' % (self.manga, self.issues_per_day) def issues(self): """Return the list of issues in the language of the Subscription.""" return self.manga.issue_set.filter(language=self.language) def issues_to_send(self, retry=None): """Return the list of issues to send, ordered by number.""" if not retry: retry = Subscription.RETRY already_sent = Result.objects.processed_last_24hs(self.user, subscription=self) remains = max(0, self.issues_per_day-already_sent) return self.manga.issue_set.filter( language=self.language ).exclude( pk__in=self.result_set.filter( Q(status__in=(Result.PROCESSING, Result.SENT)) | (Q(status=Result.FAILED) & Q(retry__gt=retry)) ).values('issue__id') ).order_by('order')[:remains] def issues_to_retry(self, retry=None): """Return the list of issues to retry, ordered by number.""" # This method doesn't take care about the limits of the user if not retry: retry = Subscription.RETRY return self.manga.issue_set.filter( language=self.language, result__subscription=self, result__status=Result.FAILED, result__retry__lte=retry ).order_by('order') def add_sent(self, issue): """Add or update a Result to a Subscription.""" # XXX TODO - add_sent is deprecated, use # Issue.create_result_if_needed, or extend the features inside # Subscription. return Result.objects.update_or_create( issue=issue, subscription=self, defaults={ 'status': Result.SENT, 'send_date': timezone.now(), }) def latest_issues(self): """Return the list of issues ordered by modified result.""" return self.issues().filter( result__subscription=self ).annotate( models.Max('result__modified') ).order_by('-result__modified') class ResultQuerySet(models.QuerySet): TIME_DELTA = 2 def latests(self, status=None): query = self if status: query = query.filter(status=status) return query.order_by('-modified') def _processed_last_24hs(self, user, subscription=None): """Return the list of `Result` processed during the last 24 hours.""" today = timezone.now() yesterday = today - timezone.timedelta(days=1) # XXX TODO - Objects are created / modified always after time # T. If the send process is slow, the error margin can be # bigger than the one used here. yesterday += timezone.timedelta(hours=ResultQuerySet.TIME_DELTA) query = self.filter( subscription__user=user, send_date__range=[yesterday, today], ) if subscription: query = query.filter(subscription=subscription) return query def processed_last_24hs(self, user, subscription=None): """Return the number of `Result` processed during the last 24 hours.""" return self._processed_last_24hs(user, subscription).count() def pending(self): return self.latests(status=Result.PENDING) def processing(self): return self.latests(status=Result.PROCESSING) def sent(self): return self.latests(status=Result.SENT) def failed(self): return self.latests(status=Result.FAILED) class Result(TimeStampedModel): PENDING = 'PE' PROCESSING = 'PR' SENT = 'SE' FAILED = 'FA' STATUS_CHOICES = ( (PENDING, 'Pending'), (PROCESSING, 'Processing'), (SENT, 'Sent'), (FAILED, 'Failed'), ) issue = models.ForeignKey(Issue, on_delete=models.CASCADE) subscription = models.ForeignKey(Subscription, on_delete=models.CASCADE) status = models.CharField(max_length=2, choices=STATUS_CHOICES, default=PENDING) missing_pages = models.IntegerField(default=0) send_date = models.DateTimeField(null=True, blank=True) retry = models.IntegerField(default=0) objects = ResultQuerySet.as_manager() class Meta: unique_together = ('issue', 'subscription') def __str__(self): return '%s (%s)' % (self.issue, self.get_status_display()) def get_absolute_url(self): return reverse('result-detail', kwargs={'pk': self.pk}) def set_status(self, status): self.status = status # If the result is marked as FAILED, unset the `send_date`. # In this way, if the result is moved to PENDING is not # counted as SENT. Also if is not moved, the user can have # one more issue for this day. if status == Result.FAILED: self.send_date = None self.save() def is_pending(self): return self.status == Result.PENDING def is_processing(self): return self.status == Result.PROCESSING def is_sent(self): return self.status == Result.SENT def is_failed(self): return self.status == Result.FAILED
gpl-3.0
-7,570,314,442,123,775,000
32.632653
80
0.56334
false
blueboxgroup/neutron
neutron/plugins/sriovnicagent/sriov_nic_agent.py
1
14818
# Copyright 2014 Mellanox Technologies, Ltd # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or # implied. # See the License for the specific language governing permissions and # limitations under the License. import socket import sys import time import eventlet eventlet.monkey_patch() from oslo.config import cfg from oslo import messaging from neutron.agent import rpc as agent_rpc from neutron.agent import securitygroups_rpc as sg_rpc from neutron.common import config as common_config from neutron.common import constants as q_constants from neutron.common import topics from neutron.common import utils as q_utils from neutron import context from neutron.i18n import _LE, _LI from neutron.openstack.common import log as logging from neutron.openstack.common import loopingcall from neutron.plugins.sriovnicagent.common import config # noqa from neutron.plugins.sriovnicagent.common import exceptions as exc from neutron.plugins.sriovnicagent import eswitch_manager as esm LOG = logging.getLogger(__name__) class SriovNicSwitchRpcCallbacks(sg_rpc.SecurityGroupAgentRpcCallbackMixin): # Set RPC API version to 1.0 by default. # history # 1.1 Support Security Group RPC target = messaging.Target(version='1.1') def __init__(self, context, agent, sg_agent): super(SriovNicSwitchRpcCallbacks, self).__init__() self.context = context self.agent = agent self.sg_agent = sg_agent def port_update(self, context, **kwargs): LOG.debug("port_update received") port = kwargs.get('port') # Put the port mac address in the updated_devices set. # Do not store port details, as if they're used for processing # notifications there is no guarantee the notifications are # processed in the same order as the relevant API requests. self.agent.updated_devices.add(port['mac_address']) LOG.debug("port_update RPC received for port: %s", port['id']) class SriovNicSwitchAgent(object): def __init__(self, physical_devices_mappings, exclude_devices, polling_interval, root_helper): self.polling_interval = polling_interval self.root_helper = root_helper self.setup_eswitch_mgr(physical_devices_mappings, exclude_devices) configurations = {'device_mappings': physical_devices_mappings} self.agent_state = { 'binary': 'neutron-sriov-nic-agent', 'host': cfg.CONF.host, 'topic': q_constants.L2_AGENT_TOPIC, 'configurations': configurations, 'agent_type': q_constants.AGENT_TYPE_NIC_SWITCH, 'start_flag': True} # Stores port update notifications for processing in the main loop self.updated_devices = set() self.context = context.get_admin_context_without_session() self.plugin_rpc = agent_rpc.PluginApi(topics.PLUGIN) self.sg_plugin_rpc = sg_rpc.SecurityGroupServerRpcApi(topics.PLUGIN) self.sg_agent = sg_rpc.SecurityGroupAgentRpc(self.context, self.sg_plugin_rpc, self.root_helper) self._setup_rpc() # Initialize iteration counter self.iter_num = 0 def _setup_rpc(self): self.agent_id = 'nic-switch-agent.%s' % socket.gethostname() LOG.info(_LI("RPC agent_id: %s"), self.agent_id) self.topic = topics.AGENT self.state_rpc = agent_rpc.PluginReportStateAPI(topics.PLUGIN) # RPC network init # Handle updates from service self.endpoints = [SriovNicSwitchRpcCallbacks(self.context, self, self.sg_agent)] # Define the listening consumers for the agent consumers = [[topics.PORT, topics.UPDATE], [topics.NETWORK, topics.DELETE], [topics.SECURITY_GROUP, topics.UPDATE]] self.connection = agent_rpc.create_consumers(self.endpoints, self.topic, consumers) report_interval = cfg.CONF.AGENT.report_interval if report_interval: heartbeat = loopingcall.FixedIntervalLoopingCall( self._report_state) heartbeat.start(interval=report_interval) def _report_state(self): try: devices = len(self.eswitch_mgr.get_assigned_devices()) self.agent_state.get('configurations')['devices'] = devices self.state_rpc.report_state(self.context, self.agent_state) self.agent_state.pop('start_flag', None) except Exception: LOG.exception(_LE("Failed reporting state!")) def setup_eswitch_mgr(self, device_mappings, exclude_devices={}): self.eswitch_mgr = esm.ESwitchManager(device_mappings, exclude_devices, self.root_helper) def scan_devices(self, registered_devices, updated_devices): curr_devices = self.eswitch_mgr.get_assigned_devices() device_info = {} device_info['current'] = curr_devices device_info['added'] = curr_devices - registered_devices # we don't want to process updates for devices that don't exist device_info['updated'] = updated_devices & curr_devices # we need to clean up after devices are removed device_info['removed'] = registered_devices - curr_devices return device_info def _device_info_has_changes(self, device_info): return (device_info.get('added') or device_info.get('updated') or device_info.get('removed')) def process_network_devices(self, device_info): resync_a = False resync_b = False self.sg_agent.prepare_devices_filter(device_info.get('added')) if device_info.get('updated'): self.sg_agent.refresh_firewall() # Updated devices are processed the same as new ones, as their # admin_state_up may have changed. The set union prevents duplicating # work when a device is new and updated in the same polling iteration. devices_added_updated = (set(device_info.get('added')) | set(device_info.get('updated'))) if devices_added_updated: resync_a = self.treat_devices_added_updated(devices_added_updated) if device_info.get('removed'): resync_b = self.treat_devices_removed(device_info['removed']) # If one of the above operations fails => resync with plugin return (resync_a | resync_b) def treat_device(self, device, pci_slot, admin_state_up): if self.eswitch_mgr.device_exists(device, pci_slot): try: self.eswitch_mgr.set_device_state(device, pci_slot, admin_state_up) except exc.SriovNicError: LOG.exception(_LE("Failed to set device %s state"), device) return if admin_state_up: # update plugin about port status self.plugin_rpc.update_device_up(self.context, device, self.agent_id, cfg.CONF.host) else: self.plugin_rpc.update_device_down(self.context, device, self.agent_id, cfg.CONF.host) else: LOG.info(_LI("No device with MAC %s defined on agent."), device) def treat_devices_added_updated(self, devices): try: devices_details_list = self.plugin_rpc.get_devices_details_list( self.context, devices, self.agent_id) except Exception as e: LOG.debug("Unable to get port details for devices " "with MAC address %(devices)s: %(e)s", {'devices': devices, 'e': e}) # resync is needed return True for device_details in devices_details_list: device = device_details['device'] LOG.debug("Port with MAC address %s is added", device) if 'port_id' in device_details: LOG.info(_LI("Port %(device)s updated. Details: %(details)s"), {'device': device, 'details': device_details}) profile = device_details['profile'] self.treat_device(device_details['device'], profile.get('pci_slot'), device_details['admin_state_up']) else: LOG.info(_LI("Device with MAC %s not defined on plugin"), device) return False def treat_devices_removed(self, devices): resync = False for device in devices: LOG.info(_LI("Removing device with mac_address %s"), device) try: dev_details = self.plugin_rpc.update_device_down(self.context, device, self.agent_id, cfg.CONF.host) except Exception as e: LOG.debug("Removing port failed for device %(device)s " "due to %(exc)s", {'device': device, 'exc': e}) resync = True continue if dev_details['exists']: LOG.info(_LI("Port %s updated."), device) else: LOG.debug("Device %s not defined on plugin", device) return resync def daemon_loop(self): sync = True devices = set() LOG.info(_LI("SRIOV NIC Agent RPC Daemon Started!")) while True: start = time.time() LOG.debug("Agent rpc_loop - iteration:%d started", self.iter_num) if sync: LOG.info(_LI("Agent out of sync with plugin!")) devices.clear() sync = False device_info = {} # Save updated devices dict to perform rollback in case # resync would be needed, and then clear self.updated_devices. # As the greenthread should not yield between these # two statements, this will should be thread-safe. updated_devices_copy = self.updated_devices self.updated_devices = set() try: device_info = self.scan_devices(devices, updated_devices_copy) if self._device_info_has_changes(device_info): LOG.debug("Agent loop found changes! %s", device_info) # If treat devices fails - indicates must resync with # plugin sync = self.process_network_devices(device_info) devices = device_info['current'] except Exception: LOG.exception(_LE("Error in agent loop. Devices info: %s"), device_info) sync = True # Restore devices that were removed from this set earlier # without overwriting ones that may have arrived since. self.updated_devices |= updated_devices_copy # sleep till end of polling interval elapsed = (time.time() - start) if (elapsed < self.polling_interval): time.sleep(self.polling_interval - elapsed) else: LOG.debug("Loop iteration exceeded interval " "(%(polling_interval)s vs. %(elapsed)s)!", {'polling_interval': self.polling_interval, 'elapsed': elapsed}) self.iter_num = self.iter_num + 1 class SriovNicAgentConfigParser(object): def __init__(self): self.device_mappings = {} self.exclude_devices = {} def parse(self): """Parses device_mappings and exclude_devices. Parse and validate the consistency in both mappings """ self.device_mappings = q_utils.parse_mappings( cfg.CONF.SRIOV_NIC.physical_device_mappings) self.exclude_devices = config.parse_exclude_devices( cfg.CONF.SRIOV_NIC.exclude_devices) self._validate() def _validate(self): """Validate configuration. Validate that network_device in excluded_device exists in device mappings """ dev_net_set = set(self.device_mappings.itervalues()) for dev_name in self.exclude_devices.iterkeys(): if dev_name not in dev_net_set: raise ValueError(_("Device name %(dev_name)s is missing from " "physical_device_mappings") % {'dev_name': dev_name}) def main(): common_config.init(sys.argv[1:]) common_config.setup_logging() try: config_parser = SriovNicAgentConfigParser() config_parser.parse() device_mappings = config_parser.device_mappings exclude_devices = config_parser.exclude_devices except ValueError: LOG.exception(_LE("Failed on Agent configuration parse. " "Agent terminated!")) raise SystemExit(1) LOG.info(_LI("Physical Devices mappings: %s"), device_mappings) LOG.info(_LI("Exclude Devices: %s"), exclude_devices) polling_interval = cfg.CONF.AGENT.polling_interval root_helper = cfg.CONF.AGENT.root_helper try: agent = SriovNicSwitchAgent(device_mappings, exclude_devices, polling_interval, root_helper) except exc.SriovNicError: LOG.exception(_LE("Agent Initialization Failed")) raise SystemExit(1) # Start everything. LOG.info(_LI("Agent initialized successfully, now running... ")) agent.daemon_loop() if __name__ == '__main__': main()
apache-2.0
2,106,327,654,775,121,000
40.740845
79
0.5687
false
Azure/azure-sdk-for-python
sdk/appservice/azure-mgmt-web/azure/mgmt/web/v2020_12_01/aio/operations/_certificates_operations.py
1
21769
# coding=utf-8 # -------------------------------------------------------------------------- # Copyright (c) Microsoft Corporation. All rights reserved. # Licensed under the MIT License. See License.txt in the project root for license information. # Code generated by Microsoft (R) AutoRest Code Generator. # Changes may cause incorrect behavior and will be lost if the code is regenerated. # -------------------------------------------------------------------------- from typing import Any, AsyncIterable, Callable, Dict, Generic, Optional, TypeVar import warnings from azure.core.async_paging import AsyncItemPaged, AsyncList from azure.core.exceptions import ClientAuthenticationError, HttpResponseError, ResourceExistsError, ResourceNotFoundError, map_error from azure.core.pipeline import PipelineResponse from azure.core.pipeline.transport import AsyncHttpResponse, HttpRequest from azure.mgmt.core.exceptions import ARMErrorFormat from ... import models as _models T = TypeVar('T') ClsType = Optional[Callable[[PipelineResponse[HttpRequest, AsyncHttpResponse], T, Dict[str, Any]], Any]] class CertificatesOperations: """CertificatesOperations async operations. You should not instantiate this class directly. Instead, you should create a Client instance that instantiates it for you and attaches it as an attribute. :ivar models: Alias to model classes used in this operation group. :type models: ~azure.mgmt.web.v2020_12_01.models :param client: Client for service requests. :param config: Configuration of service client. :param serializer: An object model serializer. :param deserializer: An object model deserializer. """ models = _models def __init__(self, client, config, serializer, deserializer) -> None: self._client = client self._serialize = serializer self._deserialize = deserializer self._config = config def list( self, filter: Optional[str] = None, **kwargs: Any ) -> AsyncIterable["_models.CertificateCollection"]: """Get all certificates for a subscription. Description for Get all certificates for a subscription. :param filter: Return only information specified in the filter (using OData syntax). For example: $filter=KeyVaultId eq 'KeyVaultId'. :type filter: str :keyword callable cls: A custom type or function that will be passed the direct response :return: An iterator like instance of either CertificateCollection or the result of cls(response) :rtype: ~azure.core.async_paging.AsyncItemPaged[~azure.mgmt.web.v2020_12_01.models.CertificateCollection] :raises: ~azure.core.exceptions.HttpResponseError """ cls = kwargs.pop('cls', None) # type: ClsType["_models.CertificateCollection"] error_map = { 401: ClientAuthenticationError, 404: ResourceNotFoundError, 409: ResourceExistsError } error_map.update(kwargs.pop('error_map', {})) api_version = "2020-12-01" accept = "application/json" def prepare_request(next_link=None): # Construct headers header_parameters = {} # type: Dict[str, Any] header_parameters['Accept'] = self._serialize.header("accept", accept, 'str') if not next_link: # Construct URL url = self.list.metadata['url'] # type: ignore path_format_arguments = { 'subscriptionId': self._serialize.url("self._config.subscription_id", self._config.subscription_id, 'str'), } url = self._client.format_url(url, **path_format_arguments) # Construct parameters query_parameters = {} # type: Dict[str, Any] query_parameters['api-version'] = self._serialize.query("api_version", api_version, 'str') if filter is not None: query_parameters['$filter'] = self._serialize.query("filter", filter, 'str', skip_quote=True) request = self._client.get(url, query_parameters, header_parameters) else: url = next_link query_parameters = {} # type: Dict[str, Any] request = self._client.get(url, query_parameters, header_parameters) return request async def extract_data(pipeline_response): deserialized = self._deserialize('CertificateCollection', pipeline_response) list_of_elem = deserialized.value if cls: list_of_elem = cls(list_of_elem) return deserialized.next_link or None, AsyncList(list_of_elem) async def get_next(next_link=None): request = prepare_request(next_link) pipeline_response = await self._client._pipeline.run(request, stream=False, **kwargs) response = pipeline_response.http_response if response.status_code not in [200]: error = self._deserialize.failsafe_deserialize(_models.DefaultErrorResponse, response) map_error(status_code=response.status_code, response=response, error_map=error_map) raise HttpResponseError(response=response, model=error, error_format=ARMErrorFormat) return pipeline_response return AsyncItemPaged( get_next, extract_data ) list.metadata = {'url': '/subscriptions/{subscriptionId}/providers/Microsoft.Web/certificates'} # type: ignore def list_by_resource_group( self, resource_group_name: str, **kwargs: Any ) -> AsyncIterable["_models.CertificateCollection"]: """Get all certificates in a resource group. Description for Get all certificates in a resource group. :param resource_group_name: Name of the resource group to which the resource belongs. :type resource_group_name: str :keyword callable cls: A custom type or function that will be passed the direct response :return: An iterator like instance of either CertificateCollection or the result of cls(response) :rtype: ~azure.core.async_paging.AsyncItemPaged[~azure.mgmt.web.v2020_12_01.models.CertificateCollection] :raises: ~azure.core.exceptions.HttpResponseError """ cls = kwargs.pop('cls', None) # type: ClsType["_models.CertificateCollection"] error_map = { 401: ClientAuthenticationError, 404: ResourceNotFoundError, 409: ResourceExistsError } error_map.update(kwargs.pop('error_map', {})) api_version = "2020-12-01" accept = "application/json" def prepare_request(next_link=None): # Construct headers header_parameters = {} # type: Dict[str, Any] header_parameters['Accept'] = self._serialize.header("accept", accept, 'str') if not next_link: # Construct URL url = self.list_by_resource_group.metadata['url'] # type: ignore path_format_arguments = { 'resourceGroupName': self._serialize.url("resource_group_name", resource_group_name, 'str', max_length=90, min_length=1, pattern=r'^[-\w\._\(\)]+[^\.]$'), 'subscriptionId': self._serialize.url("self._config.subscription_id", self._config.subscription_id, 'str'), } url = self._client.format_url(url, **path_format_arguments) # Construct parameters query_parameters = {} # type: Dict[str, Any] query_parameters['api-version'] = self._serialize.query("api_version", api_version, 'str') request = self._client.get(url, query_parameters, header_parameters) else: url = next_link query_parameters = {} # type: Dict[str, Any] request = self._client.get(url, query_parameters, header_parameters) return request async def extract_data(pipeline_response): deserialized = self._deserialize('CertificateCollection', pipeline_response) list_of_elem = deserialized.value if cls: list_of_elem = cls(list_of_elem) return deserialized.next_link or None, AsyncList(list_of_elem) async def get_next(next_link=None): request = prepare_request(next_link) pipeline_response = await self._client._pipeline.run(request, stream=False, **kwargs) response = pipeline_response.http_response if response.status_code not in [200]: error = self._deserialize.failsafe_deserialize(_models.DefaultErrorResponse, response) map_error(status_code=response.status_code, response=response, error_map=error_map) raise HttpResponseError(response=response, model=error, error_format=ARMErrorFormat) return pipeline_response return AsyncItemPaged( get_next, extract_data ) list_by_resource_group.metadata = {'url': '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Web/certificates'} # type: ignore async def get( self, resource_group_name: str, name: str, **kwargs: Any ) -> "_models.Certificate": """Get a certificate. Description for Get a certificate. :param resource_group_name: Name of the resource group to which the resource belongs. :type resource_group_name: str :param name: Name of the certificate. :type name: str :keyword callable cls: A custom type or function that will be passed the direct response :return: Certificate, or the result of cls(response) :rtype: ~azure.mgmt.web.v2020_12_01.models.Certificate :raises: ~azure.core.exceptions.HttpResponseError """ cls = kwargs.pop('cls', None) # type: ClsType["_models.Certificate"] error_map = { 401: ClientAuthenticationError, 404: ResourceNotFoundError, 409: ResourceExistsError } error_map.update(kwargs.pop('error_map', {})) api_version = "2020-12-01" accept = "application/json" # Construct URL url = self.get.metadata['url'] # type: ignore path_format_arguments = { 'resourceGroupName': self._serialize.url("resource_group_name", resource_group_name, 'str', max_length=90, min_length=1, pattern=r'^[-\w\._\(\)]+[^\.]$'), 'name': self._serialize.url("name", name, 'str'), 'subscriptionId': self._serialize.url("self._config.subscription_id", self._config.subscription_id, 'str'), } url = self._client.format_url(url, **path_format_arguments) # Construct parameters query_parameters = {} # type: Dict[str, Any] query_parameters['api-version'] = self._serialize.query("api_version", api_version, 'str') # Construct headers header_parameters = {} # type: Dict[str, Any] header_parameters['Accept'] = self._serialize.header("accept", accept, 'str') request = self._client.get(url, query_parameters, header_parameters) pipeline_response = await self._client._pipeline.run(request, stream=False, **kwargs) response = pipeline_response.http_response if response.status_code not in [200]: map_error(status_code=response.status_code, response=response, error_map=error_map) error = self._deserialize.failsafe_deserialize(_models.DefaultErrorResponse, response) raise HttpResponseError(response=response, model=error, error_format=ARMErrorFormat) deserialized = self._deserialize('Certificate', pipeline_response) if cls: return cls(pipeline_response, deserialized, {}) return deserialized get.metadata = {'url': '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Web/certificates/{name}'} # type: ignore async def create_or_update( self, resource_group_name: str, name: str, certificate_envelope: "_models.Certificate", **kwargs: Any ) -> "_models.Certificate": """Create or update a certificate. Description for Create or update a certificate. :param resource_group_name: Name of the resource group to which the resource belongs. :type resource_group_name: str :param name: Name of the certificate. :type name: str :param certificate_envelope: Details of certificate, if it exists already. :type certificate_envelope: ~azure.mgmt.web.v2020_12_01.models.Certificate :keyword callable cls: A custom type or function that will be passed the direct response :return: Certificate, or the result of cls(response) :rtype: ~azure.mgmt.web.v2020_12_01.models.Certificate :raises: ~azure.core.exceptions.HttpResponseError """ cls = kwargs.pop('cls', None) # type: ClsType["_models.Certificate"] error_map = { 401: ClientAuthenticationError, 404: ResourceNotFoundError, 409: ResourceExistsError } error_map.update(kwargs.pop('error_map', {})) api_version = "2020-12-01" content_type = kwargs.pop("content_type", "application/json") accept = "application/json" # Construct URL url = self.create_or_update.metadata['url'] # type: ignore path_format_arguments = { 'resourceGroupName': self._serialize.url("resource_group_name", resource_group_name, 'str', max_length=90, min_length=1, pattern=r'^[-\w\._\(\)]+[^\.]$'), 'name': self._serialize.url("name", name, 'str'), 'subscriptionId': self._serialize.url("self._config.subscription_id", self._config.subscription_id, 'str'), } url = self._client.format_url(url, **path_format_arguments) # Construct parameters query_parameters = {} # type: Dict[str, Any] query_parameters['api-version'] = self._serialize.query("api_version", api_version, 'str') # Construct headers header_parameters = {} # type: Dict[str, Any] header_parameters['Content-Type'] = self._serialize.header("content_type", content_type, 'str') header_parameters['Accept'] = self._serialize.header("accept", accept, 'str') body_content_kwargs = {} # type: Dict[str, Any] body_content = self._serialize.body(certificate_envelope, 'Certificate') body_content_kwargs['content'] = body_content request = self._client.put(url, query_parameters, header_parameters, **body_content_kwargs) pipeline_response = await self._client._pipeline.run(request, stream=False, **kwargs) response = pipeline_response.http_response if response.status_code not in [200]: map_error(status_code=response.status_code, response=response, error_map=error_map) error = self._deserialize.failsafe_deserialize(_models.DefaultErrorResponse, response) raise HttpResponseError(response=response, model=error, error_format=ARMErrorFormat) deserialized = self._deserialize('Certificate', pipeline_response) if cls: return cls(pipeline_response, deserialized, {}) return deserialized create_or_update.metadata = {'url': '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Web/certificates/{name}'} # type: ignore async def delete( self, resource_group_name: str, name: str, **kwargs: Any ) -> None: """Delete a certificate. Description for Delete a certificate. :param resource_group_name: Name of the resource group to which the resource belongs. :type resource_group_name: str :param name: Name of the certificate. :type name: str :keyword callable cls: A custom type or function that will be passed the direct response :return: None, or the result of cls(response) :rtype: None :raises: ~azure.core.exceptions.HttpResponseError """ cls = kwargs.pop('cls', None) # type: ClsType[None] error_map = { 401: ClientAuthenticationError, 404: ResourceNotFoundError, 409: ResourceExistsError } error_map.update(kwargs.pop('error_map', {})) api_version = "2020-12-01" accept = "application/json" # Construct URL url = self.delete.metadata['url'] # type: ignore path_format_arguments = { 'resourceGroupName': self._serialize.url("resource_group_name", resource_group_name, 'str', max_length=90, min_length=1, pattern=r'^[-\w\._\(\)]+[^\.]$'), 'name': self._serialize.url("name", name, 'str'), 'subscriptionId': self._serialize.url("self._config.subscription_id", self._config.subscription_id, 'str'), } url = self._client.format_url(url, **path_format_arguments) # Construct parameters query_parameters = {} # type: Dict[str, Any] query_parameters['api-version'] = self._serialize.query("api_version", api_version, 'str') # Construct headers header_parameters = {} # type: Dict[str, Any] header_parameters['Accept'] = self._serialize.header("accept", accept, 'str') request = self._client.delete(url, query_parameters, header_parameters) pipeline_response = await self._client._pipeline.run(request, stream=False, **kwargs) response = pipeline_response.http_response if response.status_code not in [200, 204]: map_error(status_code=response.status_code, response=response, error_map=error_map) error = self._deserialize.failsafe_deserialize(_models.DefaultErrorResponse, response) raise HttpResponseError(response=response, model=error, error_format=ARMErrorFormat) if cls: return cls(pipeline_response, None, {}) delete.metadata = {'url': '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Web/certificates/{name}'} # type: ignore async def update( self, resource_group_name: str, name: str, certificate_envelope: "_models.CertificatePatchResource", **kwargs: Any ) -> "_models.Certificate": """Create or update a certificate. Description for Create or update a certificate. :param resource_group_name: Name of the resource group to which the resource belongs. :type resource_group_name: str :param name: Name of the certificate. :type name: str :param certificate_envelope: Details of certificate, if it exists already. :type certificate_envelope: ~azure.mgmt.web.v2020_12_01.models.CertificatePatchResource :keyword callable cls: A custom type or function that will be passed the direct response :return: Certificate, or the result of cls(response) :rtype: ~azure.mgmt.web.v2020_12_01.models.Certificate :raises: ~azure.core.exceptions.HttpResponseError """ cls = kwargs.pop('cls', None) # type: ClsType["_models.Certificate"] error_map = { 401: ClientAuthenticationError, 404: ResourceNotFoundError, 409: ResourceExistsError } error_map.update(kwargs.pop('error_map', {})) api_version = "2020-12-01" content_type = kwargs.pop("content_type", "application/json") accept = "application/json" # Construct URL url = self.update.metadata['url'] # type: ignore path_format_arguments = { 'resourceGroupName': self._serialize.url("resource_group_name", resource_group_name, 'str', max_length=90, min_length=1, pattern=r'^[-\w\._\(\)]+[^\.]$'), 'name': self._serialize.url("name", name, 'str'), 'subscriptionId': self._serialize.url("self._config.subscription_id", self._config.subscription_id, 'str'), } url = self._client.format_url(url, **path_format_arguments) # Construct parameters query_parameters = {} # type: Dict[str, Any] query_parameters['api-version'] = self._serialize.query("api_version", api_version, 'str') # Construct headers header_parameters = {} # type: Dict[str, Any] header_parameters['Content-Type'] = self._serialize.header("content_type", content_type, 'str') header_parameters['Accept'] = self._serialize.header("accept", accept, 'str') body_content_kwargs = {} # type: Dict[str, Any] body_content = self._serialize.body(certificate_envelope, 'CertificatePatchResource') body_content_kwargs['content'] = body_content request = self._client.patch(url, query_parameters, header_parameters, **body_content_kwargs) pipeline_response = await self._client._pipeline.run(request, stream=False, **kwargs) response = pipeline_response.http_response if response.status_code not in [200]: map_error(status_code=response.status_code, response=response, error_map=error_map) error = self._deserialize.failsafe_deserialize(_models.DefaultErrorResponse, response) raise HttpResponseError(response=response, model=error, error_format=ARMErrorFormat) deserialized = self._deserialize('Certificate', pipeline_response) if cls: return cls(pipeline_response, deserialized, {}) return deserialized update.metadata = {'url': '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Web/certificates/{name}'} # type: ignore
mit
-2,230,951,434,480,266,200
47.700224
174
0.638798
false
HingeChat/HingeChat
src/hingechat/qt/qChatWidget.py
1
8829
import re from PyQt5.QtCore import Qt from PyQt5.QtCore import QTimer from PyQt5.QtGui import QFontMetrics from PyQt5.QtWidgets import QHBoxLayout from PyQt5.QtWidgets import QMessageBox from PyQt5.QtWidgets import QLabel from PyQt5.QtWidgets import QPushButton from PyQt5.QtWidgets import QSplitter from PyQt5.QtWidgets import QTextBrowser from PyQt5.QtWidgets import QTextEdit from PyQt5.QtWidgets import QLineEdit from PyQt5.QtWidgets import QWidget from src.hingechat.qt import qtUtils from src.hinge.utils import * class QChatWidget(QWidget): def __init__(self, chat_window, nick, parent=None): QWidget.__init__(self, parent) self.chat_window = chat_window self.nick = nick self.disabled = False self.cleared = False self.url_regex = re.compile(URL_REGEX) self.chat_log = QTextBrowser() self.chat_log.setOpenExternalLinks(True) self.chat_input = QTextEdit() self.chat_input.textChanged.connect(self.chatInputTextChanged) self.send_button = QPushButton("Send") self.send_button.clicked.connect(self.sendMessage) # Set the min height for the chatlog and a matching fixed height for the send button chat_input_font_metrics = QFontMetrics(self.chat_input.font()) self.chat_input.setMinimumHeight(chat_input_font_metrics.lineSpacing() * 3) self.send_button.setFixedHeight(chat_input_font_metrics.lineSpacing() * 3) hbox = QHBoxLayout() hbox.addWidget(self.chat_input) hbox.addWidget(self.send_button) # Put the chatinput and send button in a wrapper widget so they may be added to the splitter chat_input_wrapper = QWidget() chat_input_wrapper.setLayout(hbox) chat_input_wrapper.setMinimumHeight(chat_input_font_metrics.lineSpacing() * 3.7) # Put the chat log and chat input into a splitter so the user can resize them at will splitter = QSplitter(Qt.Vertical) splitter.addWidget(self.chat_log) splitter.addWidget(chat_input_wrapper) splitter.setSizes([int(parent.height()), 1]) hbox = QHBoxLayout() hbox.addWidget(splitter) self.setLayout(hbox) self.typing_timer = QTimer() self.typing_timer.setSingleShot(True) self.typing_timer.timeout.connect(self.stoppedTyping) def setRemoteNick(self, nick): self.nick = nick def chatInputTextChanged(self): # Check if the text changed was the text box being cleared to avoid sending an invalid typing status if self.cleared: self.cleared = False return if str(self.chat_input.toPlainText())[-1:] == '\n': self.sendMessage() else: # Start a timer to check for the user stopping typing self.typing_timer.start(TYPING_TIMEOUT) self.sendTypingStatus(TYPING_START) def stoppedTyping(self): self.typing_timer.stop() if str(self.chat_input.toPlainText()) == '': self.sendTypingStatus(TYPING_STOP_WITHOUT_TEXT) else: self.sendTypingStatus(TYPING_STOP_WITH_TEXT) def sendMessage(self): if self.disabled: return else: pass self.typing_timer.stop() text = str(self.chat_input.toPlainText())[:-1] # Don't send empty messages if text == '': return # Convert URLs into clickable links text = self.__linkify(text) # Add the message to the message queue to be sent self.chat_window.client.getSession(self.remote_id).sendChatMessage(text) # Clear the chat input self.wasCleared = True self.chat_input.clear() self.appendMessage(text, MSG_SENDER) def sendTypingStatus(self, status): self.chat_window.client.getSession(self.remote_id).sendTypingMessage(status) def showNowChattingMessage(self, nick): self.nick = nick self.remote_id = self.chat_window.client.getClientId(self.nick) self.appendMessage("You are now securely chatting with " + self.nick + " :)", MSG_SERVICE, show_timestamp_and_nick=False) self.appendMessage("It's a good idea to verify the communcation is secure by selecting " "\"authenticate buddy\" in the options menu.", MSG_SERVICE, show_timestamp_and_nick=False) self.addNickButton = QPushButton('Add', self) self.addNickButton.setGeometry(584, 8, 31, 23) self.addNickButton.clicked.connect(self.addNickScreen) self.addNickButton.show() def addUser(self, user): nick = str(user.text()).lower() # Validate the given nick nickStatus = utils.isValidNick(nick) if nickStatus == errors.VALID_NICK: # TODO: Group chats pass elif nickStatus == errors.INVALID_NICK_CONTENT: QMessageBox.warning(self, errors.TITLE_INVALID_NICK, errors.INVALID_NICK_CONTENT) elif nickStatus == errors.INVALID_NICK_LENGTH: QMessageBox.warning(self, errors.TITLE_INVALID_NICK, errors.INVALID_NICK_LENGTH) elif nickStatus == errors.INVALID_EMPTY_NICK: QMessageBox.warning(self, errors.TITLE_EMPTY_NICK, errors.EMPTY_NICK) def addNickScreen(self): self.chat_log.setEnabled(False) self.chat_input.setEnabled(False) self.send_button.setEnabled(False) self.addNickButton.hide() self.addUserText = QLabel("Enter a username to add a user to the group chat.", self) self.addUserText.setGeometry(200, 20, 300, 100) self.addUserText.show() self.user = QLineEdit(self) self.user.setGeometry(200, 120, 240, 20) self.user.returnPressed.connect(self.addUser) self.user.show() self.addUserButton = QPushButton('Add User', self) self.addUserButton.setGeometry(250, 150, 150, 25) self.addUserButton.clicked.connect(lambda: self.addUser(self.user)) self.addUserButton.show() self.cancel = QPushButton('Cancel', self) self.cancel.setGeometry(298, 210, 51, 23) self.cancel.clicked.connect(lambda: self.chat_log.setEnabled(True)) self.cancel.clicked.connect(lambda: self.chat_input.setEnabled(True)) self.cancel.clicked.connect(lambda: self.send_button.setEnabled(True)) self.cancel.clicked.connect(self.addUserText.hide) self.cancel.clicked.connect(self.user.hide) self.cancel.clicked.connect(self.addUserButton.hide) self.cancel.clicked.connect(self.addNickButton.show) self.cancel.clicked.connect(self.cancel.hide) self.cancel.show() def appendMessage(self, message, source, show_timestamp_and_nick=True): color = self.__getColor(source) if show_timestamp_and_nick: timestamp = '<font color="' + color + '">(' + getTimestamp() + ') <strong>' + \ (self.chat_window.client.nick if source == MSG_SENDER else self.nick) + \ ':</strong></font> ' else: timestamp = '' # If the user has scrolled up (current value != maximum), do not move the scrollbar # to the bottom after appending the message shouldScroll = True scrollbar = self.chat_log.verticalScrollBar() if scrollbar.value() != scrollbar.maximum() and source != constants.SENDER: shouldScroll = False self.chat_log.append(timestamp + message) # Move the vertical scrollbar to the bottom of the chat log if shouldScroll: scrollbar.setValue(scrollbar.maximum()) def __linkify(self, text): matches = self.url_regex.findall(text) for match in matches: text = text.replace(match[0], '<a href="%s">%s</a>' % (match[0], match[0])) return text def __getColor(self, source): if source == MSG_SENDER: if qtUtils.is_light_theme: return '#0000CC' else: return '#6666FF' elif source == MSG_RECEIVER: if qtUtils.is_light_theme: return '#CC0000' else: return '#CC3333' else: if qtUtils.is_light_theme: return '#000000' else: return '#FFFFFF' def disable(self): self.disabled = True self.chat_input.setReadOnly(True) def enable(self): self.disabled = False self.chat_input.setReadOnly(False)
lgpl-3.0
7,082,114,969,052,042,000
36.220779
117
0.619209
false
JiahuiZHONG/Internship_Thread
tests/scripts/thread-cert/Cert_5_6_08_ContextManagement.py
1
4303
#!/usr/bin/python # # Copyright (c) 2016, Nest Labs, Inc. # All rights reserved. # # Redistribution and use in source and binary forms, with or without # modification, are permitted provided that the following conditions are met: # 1. Redistributions of source code must retain the above copyright # notice, this list of conditions and the following disclaimer. # 2. Redistributions in binary form must reproduce the above copyright # notice, this list of conditions and the following disclaimer in the # documentation and/or other materials provided with the distribution. # 3. Neither the name of the copyright holder nor the # names of its contributors may be used to endorse or promote products # derived from this software without specific prior written permission. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" # AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE # IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE # ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT HOLDER OR CONTRIBUTORS BE # LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR # CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF # SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS # INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN # CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) # ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE # POSSIBILITY OF SUCH DAMAGE. # import pexpect import time import unittest import node LEADER = 1 ROUTER = 2 ED = 3 class Cert_5_6_8_ContextManagement(unittest.TestCase): def setUp(self): self.nodes = {} for i in range(1,4): self.nodes[i] = node.Node(i) self.nodes[LEADER].set_panid(0xface) self.nodes[LEADER].set_mode('rsdn') self.nodes[LEADER].add_whitelist(self.nodes[ROUTER].get_addr64()) self.nodes[LEADER].add_whitelist(self.nodes[ED].get_addr64()) self.nodes[LEADER].enable_whitelist() self.nodes[LEADER].set_context_reuse_delay(10) self.nodes[ROUTER].set_panid(0xface) self.nodes[ROUTER].set_mode('rsdn') self.nodes[ROUTER].add_whitelist(self.nodes[LEADER].get_addr64()) self.nodes[ROUTER].enable_whitelist() self.nodes[ED].set_panid(0xface) self.nodes[ED].set_mode('rsn') self.nodes[ED].add_whitelist(self.nodes[LEADER].get_addr64()) self.nodes[ED].enable_whitelist() def tearDown(self): for node in self.nodes.itervalues(): node.stop() del self.nodes def test(self): self.nodes[LEADER].start() self.nodes[LEADER].set_state('leader') self.assertEqual(self.nodes[LEADER].get_state(), 'leader') self.nodes[ROUTER].start() time.sleep(3) self.assertEqual(self.nodes[ROUTER].get_state(), 'router') self.nodes[ED].start() time.sleep(3) self.assertEqual(self.nodes[ED].get_state(), 'child') self.nodes[ROUTER].add_prefix('2001::/64', 'pvcrs') self.nodes[ROUTER].register_netdata() time.sleep(2) addrs = self.nodes[LEADER].get_addrs() for addr in addrs: if addr[0:3] == '200': self.nodes[ED].ping(addr) self.nodes[ROUTER].remove_prefix('2001::/64') self.nodes[ROUTER].register_netdata() time.sleep(5) addrs = self.nodes[LEADER].get_addrs() for addr in addrs: if addr[0:3] == '200': self.nodes[ED].ping(addr) self.nodes[ROUTER].add_prefix('2002::/64', 'pvcrs') self.nodes[ROUTER].register_netdata() time.sleep(5) addrs = self.nodes[LEADER].get_addrs() for addr in addrs: if addr[0:3] == '200': self.nodes[ED].ping(addr) time.sleep(5) self.nodes[ROUTER].add_prefix('2003::/64', 'pvcrs') self.nodes[ROUTER].register_netdata() time.sleep(5) addrs = self.nodes[LEADER].get_addrs() for addr in addrs: if addr[0:3] == '200': self.nodes[ED].ping(addr) if __name__ == '__main__': unittest.main()
bsd-3-clause
-5,238,427,176,629,124,000
35.159664
78
0.647223
false
scherroman/mugen
mugen/location_utility.py
1
2143
from typing import List, Tuple """ Module for Location & Interval manipulation """ def intervals_from_locations(locations: List[float]) -> List[float]: intervals = [] previous_location = None for index, location in enumerate(locations): if index == 0: intervals.append(location) else: intervals.append(location - previous_location) previous_location = location return intervals def locations_from_intervals(intervals: List[float]) -> List[float]: locations = [] running_duration = 0 for index, interval in enumerate(intervals): if index < len(intervals): running_duration += interval locations.append(running_duration) return locations def start_end_locations_from_locations(locations: List[float]) -> Tuple[List[float], List[float]]: """ Calculates the start and end times of each location Ex) 5, 10, 15 start_times == 5, 10, 15 end_times == 10, 15, 15 Returns ------- A tuple of start and end times """ start_locations = [] end_locations = [] for index, location in enumerate(locations): start_time = location if index == len(locations) - 1: end_time = location else: end_time = locations[index + 1] start_locations.append(start_time) end_locations.append(end_time) return start_locations, end_locations def start_end_locations_from_intervals(intervals: List[float]) -> Tuple[List[float], List[float]]: """ Calculates the start and end times of each interval Ex) 5, 10, 15 start_times == 0, 5, 10 end_times == 5, 10, 15 Returns ------- A tuple of start and end times """ start_locations = [] end_locations = [] running_duration = 0 for index, duration in enumerate(intervals): start_time = running_duration end_time = start_time + duration start_locations.append(start_time) end_locations.append(end_time) running_duration += duration return start_locations, end_locations
mit
7,078,705,883,654,456,000
23.918605
98
0.615492
false
adbrebs/spynet
models/max_pool_3d.py
1
3198
from theano import tensor from theano.tensor.signal.downsample import DownsampleFactorMax def max_pool_3d(input, ds, ignore_border=False): """ Takes as input a N-D tensor, where N >= 3. It downscales the input by the specified factor, by keeping only the maximum value of non-overlapping patches of size (ds[0],ds[1],ds[2]) (depth, height, width) Arguments: input (N-D theano tensor of input images): input images. Max pooling will be done over the 3 last dimensions. ds (tuple of length 3): factor by which to downscale. (2,2,2) will halve the video in each dimension. ignore_border (boolean): When True, (5,5,5) input with ds=(2,2,2) will generate a (2,2,2) output. (3,3,3) otherwise. """ if input.ndim < 3: raise NotImplementedError('max_pool_3d requires a dimension >= 3') # extract nr dimensions vid_dim = input.ndim # max pool in two different steps, so we can use the 2d implementation of # downsamplefactormax. First maxpool frames as usual. # Then maxpool the depth dimension. Shift the depth dimension to the third # position, so rows and cols are in the back # extract dimensions frame_shape = input.shape[-2:] # count the number of "leading" dimensions, store as dmatrix batch_size = tensor.prod(input.shape[:-2]) batch_size = tensor.shape_padright(batch_size,1) # store as 4D tensor with shape: (batch_size,1,height,width) new_shape = tensor.cast(tensor.join(0, batch_size, tensor.as_tensor([1,]), frame_shape), 'int32') input_4D = tensor.reshape(input, new_shape, ndim=4) # downsample mini-batch of videos in rows and cols op = DownsampleFactorMax((ds[1],ds[2]), ignore_border) output = op(input_4D) # restore to original shape outshape = tensor.join(0, input.shape[:-2], output.shape[-2:]) out = tensor.reshape(output, outshape, ndim=input.ndim) # now maxpool depth # output (depth, rows, cols), reshape so that depth is in the back shufl = (list(range(vid_dim-3)) + [vid_dim-2]+[vid_dim-1]+[vid_dim-3]) input_depth = out.dimshuffle(shufl) # reset dimensions vid_shape = input_depth.shape[-2:] # count the number of "leading" dimensions, store as dmatrix batch_size = tensor.prod(input_depth.shape[:-2]) batch_size = tensor.shape_padright(batch_size,1) # store as 4D tensor with shape: (batch_size,1,width,depth) new_shape = tensor.cast(tensor.join(0, batch_size, tensor.as_tensor([1,]), vid_shape), 'int32') input_4D_depth = tensor.reshape(input_depth, new_shape, ndim=4) # downsample mini-batch of videos in depth op = DownsampleFactorMax((1,ds[0]), ignore_border) outdepth = op(input_4D_depth) # output # restore to original shape (xxx, rows, cols, depth) outshape = tensor.join(0, input_depth.shape[:-2], outdepth.shape[-2:]) shufl = (list(range(vid_dim-3)) + [vid_dim-1]+[vid_dim-3]+[vid_dim-2]) return tensor.reshape(outdepth, outshape, ndim=input.ndim).dimshuffle(shufl)
bsd-2-clause
608,790,142,119,456,300
42.821918
117
0.641026
false
chrismedrela/scriptcraft
scriptcraft/client.py
1
76856
#!/usr/bin/env python #-*- coding:utf-8 -*- import ConfigParser try: import cPickle as pickle except: import pickle import itertools import math import os.path from Queue import Queue import random import time import threading from Tkinter import * import tkColorChooser import tkFileDialog import tkFont import tkMessageBox import tkSimpleDialog # Imports from PIL import Image, ImageTk # it overrides Tkinter.Image so it must be after Tkinter # import statement # We have to explicitly statically import PIL plugins so py2exe know that they # are necessary. import PngImagePlugin import GifImagePlugin from scriptcraft import direction from scriptcraft.gamemap import GameMap from scriptcraft.gamestate import (actions, Game, DEFAULT_GAME_CONFIGURATION, Language, Program, STAR_PROGRAM, Unit, NoFreeStartPosition, Tree, MineralDeposit, load_game_map, InvalidGameMapData, cmds) from scriptcraft.gamesession import (GameSession, SystemConfiguration, AlreadyExecuteGame) from scriptcraft.utils import * class GameViewer(Canvas): """GameViewer is canvas widget to display a scriptcraft Game instance. It provides scrolling and zooming the map and selecting fields. About selecting: When a mouse motion is detected and the selection (the selection is the field under the cursor) changed then <<selection-changed>> event is emitted. You can find out which field is selected by checking GameViewer.selection_position which is (x, y) tuple or None. When a left mouse button is being pressed then <<field-selected>> event is emitted (it doesn't matter if the mouse is inside or outside map). You can check position of clicked field by getting GameViewer.selection_position. If there is a double click, then <<field-double-clicked>> event is also emitted. You can set pointer at any valid position by calling set_pointer_position. Pointer is a special selection. There is also second pointer. Its color can be changed. Use set_pointer_2_position and set_pointer_2_color methods. Layers: layer-1 -- ground layer-1.5 -- grid of ground layer-2 -- arrows layer-3 -- units, trees, objects on map, texts over units layer-4 -- pointer interface """ SCROLLING_SENSITIVITY = 2**(1/2.0) # in (1, +inf); greater means faster scrolling TILE_WIDTH = 64 TILE_HEIGHT = 32 GROUND_TILE_WIDTH = 32 GROUND_TILE_HEIGHT = 32 GROUND_TILES_IN_ROW = 4 GROUND_TILES_IN_COLUMN = 4 GROUND_TYPE_TO_NAME = { 0:'ground-black', 1:'ground-dirt', 2:'ground-grass', 3:'ground-rock', 4:'ground-stones', 5:'ground-flowers', 6:'ground-hardearth', 7:'ground-tiles', 8:'ground-sand', } MAX_ZOOM = 1.0 MIN_ZOOM = 1.0/4 CORNER_TEXT_POSITION = (15, 20) # position at screen CORNER_TEXT_FONT_OPTIONS = {'size':12, 'weight':'bold'} CORNER_TEXT_COLOR = 'red' CORNER_TEXT_INITIAL_TEXT = '' FREQUENCY_OF_UPDATING_ANIMATIONS = 50 # ms LOADING_INDICATOR_POSITION = (-45, 15) LOADING_INDICATOR_SPEED = int(-360*1.5) # degrees per second FREQUENCY_OF_CHECKING_QUERY = 100 # ms COLOR_OF_GROUND_IMITATION = '#336633' GRID_COLOR = '#555555' POINTER_ROTATION_SPEED = int(-360*2.5) # degrees per second POINTER_SIZE = (80, 40) POINTER_COLORS = [ ('white', '#ffffff'), ('red', '#ff0000'), ('green', '#00ff00'), ('darkblue', '#0000aa'), ] POINTER_2_ROTATION_SPEED = int(-360*1.2) POINTER_2_SIZE = (64, 32) def __init__(self, master): Canvas.__init__(self, master, width=800, height=600, bg='black') self.pack(expand=YES, fill=BOTH) # To enable receiving wheel rolling events under windows, we # need this action before bindings: self.focus_set() # bindings self.bind('<B1-Motion>', self._mouse_motion_with_button_pressed_callback) self.bind('<Motion>', self._mouse_motion_callback) self.bind('<ButtonRelease-1>', self._release_callback) self.bind('<MouseWheel>', self._roll_wheel_callback) self.bind('<Button-4>', self._roll_wheel_callback) self.bind('<Button-5>', self._roll_wheel_callback) self.bind('<Button-1>', self._click_callback) self.bind('<Double-Button-1>', self._double_click_callback) self.bind("<Configure>", self._resized_callback) # own attributes self._zoom = 1.0 self._delta = (-5.0, 0.0) self._game = None self._scaled_images_cache = {} self._ground_image_cache = None self._ground_tiles_cache = {} self._last_mouse_position = None # None unless button pressed self._click_position = None self.selection_position = None # None or (x, y) self._trees_ids_by_position = {} self._queue = Queue() self._compute_ground_image_flag = False # corner text self._corner_text_id = self.create_text( GameViewer.CORNER_TEXT_POSITION[0], GameViewer.CORNER_TEXT_POSITION[1], anchor=NW, text=GameViewer.CORNER_TEXT_INITIAL_TEXT, font=tkFont.Font(**GameViewer.CORNER_TEXT_FONT_OPTIONS), fill=GameViewer.CORNER_TEXT_COLOR, tag=['interface']) # loading indicator image = self._get_image('loading') self._loading_image = ImageTk.PhotoImage(image) self._loading_indicator_id = self.create_image( self._loading_indicator_position[0], self._loading_indicator_position[1], image=self._loading_image, state=HIDDEN, anchor=NW, tags=['interface']) self._loading_indicator_turned_on = False self._update_loading_indicator() # load pointer images self._pointer_images_by_color = {} image = self._get_image('loading') alpha = image.split()[-1] for color_name, color in GameViewer.POINTER_COLORS: colored = Image.new('RGBA', image.size, color) colored.putalpha(alpha) self._pointer_images_by_color[color_name] = colored # pointer image = self._pointer_images_by_color['white'] self._pointer_image = ImageTk.PhotoImage(image) self._pointer_position = None self._pointer_id = self.create_image( 0, 0, image=self._pointer_image, state=HIDDEN, anchor=NW, tags=['layer-2', 'game']) self._update_pointer() # second pointer self._pointer_2_image = None self._pointer_2_color = 'white' self._pointer_2_position = None self._pointer_2_id = self.create_image( 0, 0, image=self._pointer_2_image, state=HIDDEN, anchor=NW, tags=['layer-2', 'game']) self._update_pointer_2() # run checking queue self._check_queue() @log_on_enter('set game in game viewer', mode='only time') def set_game(self, game): """ Attribute game should be scriptcraft game instance or None. In this method game instance passed during previous call is used. The previous game instance cannot be modified since the previous call! Use set_game(None) and set_game(new_game) to force redrawing ground and delete current selection. """ previous_game = self._game self._game = game if previous_game: self.delete('non-cached') if not game: # reset queue self._queue = Queue() self._compute_ground_image_flag = False # selection position self._set_selection_position(None, force_emitting=True) # force redrawing ground during next set_game call self._ground_image_cache = None if 'ground' in self._scaled_images_cache: del self._scaled_images_cache['ground'] # reset zoom and delta self._zoom = 1.0 self._delta = (-5.0, 0.0) # hide loading indicator self.show_loading_indicator(False) # other stuff self._trees_ids_by_position.clear() self.delete('tree') else: # selection position self._set_selection_position(self.selection_position, force_emitting=True) # draw game self._draw_game(game, old_game=previous_game) def set_corner_text(self, text): self.itemconfigure(self._corner_text_id, text=text) def show_loading_indicator(self, state): assert isinstance(state, bool) self._loading_indicator_turned_on = state state = NORMAL if state else HIDDEN self.itemconfig(self._loading_indicator_id, state=state) def set_pointer_position(self, position_or_None): self._pointer_position = position_or_None def set_pointer_2_position(self, position_or_None): self._pointer_2_position = position_or_None def set_pointer_2_color(self, color): assert color in self._pointer_images_by_color, 'unknown color' self._pointer_2_color = color @property def _loading_indicator_position(self): x, y = GameViewer.LOADING_INDICATOR_POSITION width, height = self.winfo_width(), self.winfo_height() result = (x if x >= 0 else width+x, y if y >= 0 else height+y) return result def _update_loading_indicator(self): if self._loading_indicator_turned_on: angle = time.time()*GameViewer.LOADING_INDICATOR_SPEED % 360 image = self._get_image('loading') image = image.rotate(angle, resample=Image.BICUBIC) self._loading_image = ImageTk.PhotoImage(image) self.itemconfig(self._loading_indicator_id, image=self._loading_image) self.master.after(GameViewer.FREQUENCY_OF_UPDATING_ANIMATIONS, self._update_loading_indicator) def _update_pointer(self): if self._pointer_position is not None: angle = time.time()*GameViewer.POINTER_ROTATION_SPEED % 360 image = self._get_image('pointer') image = image.rotate(angle, resample=Image.BICUBIC) size = GameViewer.POINTER_SIZE size = (size[0]*self._zoom, size[1]*self._zoom) size = tuple(map(int, size)) image = image.resize(size) self._pointer_image = ImageTk.PhotoImage(image) self.itemconfig(self._pointer_id, state=NORMAL, image=self._pointer_image) pos = self._to_screen_coordinate(self._pointer_position) x, y = self._to_image_position('pointer', pos) self.coords(self._pointer_id, x, y) else: self.itemconfig(self._pointer_id, state=HIDDEN) self.master.after(GameViewer.FREQUENCY_OF_UPDATING_ANIMATIONS, self._update_pointer) def _update_pointer_2(self): if self._pointer_2_position is not None: angle = time.time()*GameViewer.POINTER_2_ROTATION_SPEED % 360 image = self._pointer_images_by_color[self._pointer_2_color] image = image.rotate(angle, resample=Image.BICUBIC) size = GameViewer.POINTER_2_SIZE size = (size[0]*self._zoom, size[1]*self._zoom) size = tuple(map(int, size)) image = image.resize(size) self._pointer_2_image = ImageTk.PhotoImage(image) self.itemconfig(self._pointer_2_id, state=NORMAL, image=self._pointer_2_image) pos = self._to_screen_coordinate(self._pointer_2_position) x, y = self._to_image_position('pointer2', pos) self.coords(self._pointer_2_id, x, y) else: self.itemconfig(self._pointer_2_id, state=HIDDEN) self.master.after(GameViewer.FREQUENCY_OF_UPDATING_ANIMATIONS, self._update_pointer_2) def _draw_game(self, game, old_game): # draw imitation of ground size = self._game.game_map.size points = [(0, 0), (0, size[1]), (size[0], size[1]), (size[0], 0)] points = [self._to_screen_coordinate(pos) for pos in points] points = [coord for pos in points for coord in pos] self.create_polygon(points, fill=GameViewer.COLOR_OF_GROUND_IMITATION, tags=['game', 'non-cached', 'layer-1']) # draw ground self._draw_ground() # remove deleted trees tree_positions = [position for (position, obj) in self._game.game_map._objs.items() if isinstance(obj, Tree)] tree_positions = set(tree_positions) if old_game is not None: old_tree_positions = [ position for (position, obj) in old_game.game_map._objs.items() if isinstance(obj, Tree)] old_tree_positions = set(old_tree_positions) else: old_tree_positions = set() deleted_trees = old_tree_positions - tree_positions for position in deleted_trees: self.delete(self._trees_ids_by_position[position]) del self._trees_ids_by_position[position] # draw objects def draw_arrow(source, destination, type='red'): assert type in ('red', 'blue') delta = map(lambda (a, b): a-b, zip(destination, source)) d = direction.FROM_RAY[tuple(delta)] direction_name = direction.TO_FULL_NAME[d] self._draw('arrow-%s-%s' % (type, direction_name), source, layer=2) objs = sorted(self._game.game_map._objs.items(), key=lambda (pos, obj): pos[0]+pos[1]) for position, obj in objs: if isinstance(obj, Tree): # draw tree if position not in old_tree_positions: name = 'tree%s' % obj.type id_ = self._draw(name, position, layer=3, cached=True, extra_tags=['tree']) self._trees_ids_by_position[position] = id_ else: pass self.tag_raise(self._trees_ids_by_position[position]) elif isinstance(obj, MineralDeposit): # draw minerals if obj.minerals: self._draw('minerals', position, layer=3) else: self._draw('minerals-ex', position, layer=3) elif isinstance(obj, Unit): # draw unit unit = obj # build sprite name if unit.type.main_name == '4': # base sprite_name = 'base' elif unit.type.main_name == '5': # miner storage_state = 'loaded' if unit.minerals else 'empty' direction_name = direction.TO_FULL_NAME[unit.direction] sprite_name = 'miner-%s-%s' % \ (storage_state, direction_name) elif unit.type.main_name == '6': direction_name = direction.TO_FULL_NAME[unit.direction] sprite_name = 'tank-%s' % direction_name else: assert False, 'oops, unknown unit type %r' % unit.type # draw the unit self._draw(sprite_name, position, layer=3) # draw label for the unit x, y = self._to_screen_coordinate(position) color = '#' + "%02x%02x%02x" % unit.player.color font = self._get_font_for_current_zoom() # this operation costs a lot [optimization] self.create_text(x, y, fill=color, text=unit.player.name, font=font, tags=['layer-3', 'game', 'text', 'non-cached'], state=NORMAL if font else HIDDEN) # draw arrows indicating executing action (or fire explosion) if isinstance(unit.action, actions.MoveAction): draw_arrow(unit.action.source, unit.action.destination, type='blue') if isinstance(unit.action, actions.GatherAction): draw_arrow(unit.position, unit.action.source) elif isinstance(unit.action, actions.StoreAction): destination_unit = self._game.units_by_IDs[ unit.action.storage_ID] destination = destination_unit.position draw_arrow(unit.position, destination) elif isinstance(unit.action, actions.FireAction): self._draw('explosion', unit.action.destination, layer=3) # draw lines (debug) def draw_grid(): line_color = GameViewer.GRID_COLOR for x in xrange(0, game.game_map.size[1] + 1): start_position = (0, x) end_position = (game.game_map.size[0], x) start_position = self._to_screen_coordinate(start_position) end_position = self._to_screen_coordinate(end_position) self.create_line(*(start_position + end_position), fill=line_color, tag=['layer-1.5', 'game', 'non-cached']) for y in xrange(0, game.game_map.size[0] + 1): start_position = (y, 0) end_position = (y, game.game_map.size[1]) start_position = self._to_screen_coordinate(start_position) end_position = self._to_screen_coordinate(end_position) self.create_line(*(start_position + end_position), fill=line_color, tag=['layer-1.5', 'game', 'non-cached']) # draw grid draw_grid() # sort layers self._sort_layers() def _sort_layers(self): self.tag_raise('layer-1') self.tag_raise('layer-1.5') self.tag_raise('layer-2') self.tag_raise('layer-3') self.tag_raise('layer-4') self.tag_raise('interface') def _draw_ground(self): if self._ground_image_cache: self._draw('ground', (0, 0), layer=1) self.tag_lower('layer-1') elif not self._compute_ground_image_flag: target = lambda: self._compute_ground_image_asynch(self._queue) thread = threading.Thread(target=target) thread.start() def _compute_ground_image_asynch(self, queue): self._get_ground_image() queue.put('ready') self._compute_ground_image_flag = False def _check_queue(self): if not self._queue.empty(): command = self._queue.get_nowait() assert command == 'ready' self._draw_ground() self.master.after(GameViewer.FREQUENCY_OF_CHECKING_QUERY, self._check_queue) @memoized def _gradient(self, align): assert align in ('ns', 'we') gradient = Image.new('L', (255, 1)) for x in range(255): gradient.putpixel((254-x, 0), x) gradient = gradient.resize((255, 255)) if align == 'ns': gradient = gradient.rotate(45-180, expand=True) elif align == 'we': gradient = gradient.rotate(-45, expand=True) gradient = gradient.resize((GameViewer.TILE_WIDTH+2, GameViewer.TILE_HEIGHT+2)) return gradient def _draw(self, name, position, layer, state=NORMAL, extra_tags=None, cached=False): """ Draw sprite with name 'name' at position 'position' in game coordinates.""" extra_tags = extra_tags or [] tags = [name, 'layer-%s' % layer, 'game'] if not cached: tags.append('non-cached') position = self._to_screen_coordinate(position) x, y = self._to_image_position(name, position) image = self._get_scaled_sprite(name) id_ = self.create_image(x, y, image=image, anchor=NW, state=state, tags=tags+extra_tags) return id_ def _get_font_for_current_zoom(self): size = int(12.2*self._zoom) if size < 9: if size >= 6: return tkFont.Font(size=9) else: return None else: return tkFont.Font(size=size) @memoized def _get_image(self, name): """ Return (PIL.)Image instance. """ path = 'graphic/%s.png' % name image = Image.open(datafile_path(path)) return image def _get_ground_tile(self, name, (x, y)): x %= GameViewer.GROUND_TILES_IN_ROW y %= GameViewer.GROUND_TILES_IN_COLUMN key = (name, (x, y)) if key not in self._ground_tiles_cache: start_point_x = x*GameViewer.GROUND_TILE_WIDTH start_point_y = y*GameViewer.GROUND_TILE_HEIGHT image = self._get_image(name) # '.'+name for testing image = image.convert('RGBA') box = (start_point_x, start_point_y, GameViewer.GROUND_TILE_WIDTH+start_point_x, GameViewer.GROUND_TILE_HEIGHT+start_point_y) croped = image.crop(box) rotated = croped.rotate(-45, expand=True, resample=Image.BICUBIC) scaled = rotated.resize((GameViewer.TILE_WIDTH+2, GameViewer.TILE_HEIGHT+2)) self._ground_tiles_cache[key] = scaled return self._ground_tiles_cache[key] @log_on_enter('GameViewer._get_ground_image', mode='only time') def _get_ground_image(self): """ Return (PIL.)Image instance. """ if self._ground_image_cache is None: # then compute it and cache log('computing ground image') def blend(image_nw, image_ne, image_se, image_sw, gradient_ns, gradient_we): if image_nw == image_ne == image_se == image_sw: return image_nw image_w = (Image.composite(image_nw, image_sw, gradient_ns) if image_nw != image_sw else image_nw) image_e = (Image.composite(image_ne, image_se, gradient_ns) if image_ne != image_se else image_ne) return Image.composite(image_w, image_e, gradient_we) gradient_ns = self._gradient('ns') gradient_we = self._gradient('we') size = self._game.game_map.size image_size = (GameViewer.TILE_WIDTH/2.0*(size[0]+size[1]+2), GameViewer.TILE_HEIGHT/2.0*(size[0]+size[1]+2)) result = Image.new('RGB', map(int, image_size)) game_map = self._game.game_map for (x, y) in itertools.product(xrange(-1, size[0]), xrange(-1, size[1])): ground_type_nw = game_map[x, y].ground_type or 0 ground_type_ne = game_map[x+1, y].ground_type or 0 ground_type_se = game_map[x+1, y+1].ground_type or 0 ground_type_sw = game_map[x, y+1].ground_type or 0 tile_name_nw = GameViewer.GROUND_TYPE_TO_NAME[ground_type_nw] tile_name_ne = GameViewer.GROUND_TYPE_TO_NAME[ground_type_ne] tile_name_se = GameViewer.GROUND_TYPE_TO_NAME[ground_type_se] tile_name_sw = GameViewer.GROUND_TYPE_TO_NAME[ground_type_sw] tile_nw = self._get_ground_tile(tile_name_nw, (x, y)) tile_ne = self._get_ground_tile(tile_name_ne, (x, y)) tile_se = self._get_ground_tile(tile_name_se, (x, y)) tile_sw = self._get_ground_tile(tile_name_sw, (x, y)) tile = blend(tile_nw, tile_ne, tile_se, tile_sw, gradient_ns, gradient_we) box = [GameViewer.TILE_WIDTH/2.0*(x-y+size[1]), GameViewer.TILE_HEIGHT/2.0*(x+y+2)] result.paste(tile, tuple(map(int, box)), tile) self._ground_image_cache = result return self._ground_image_cache def _get_scaled_sprite(self, name): """ Return (PIL.)ImageTk scaled by self._zoom factor. """ # if cached, return cached value key = name image = self._scaled_images_cache.get(key, None) if image: return image # otherwise compute, cache and return if name == 'ground': image = self._get_ground_image() elif name.startswith('pointer-'): _, color = name.split('-') image = self._pointer_images_by_color[color] else: image = self._get_image(name) width, height = image.size delta = 0 if name == 'ground' else 2 new_width, new_height = (int(width*self._zoom)+delta, int(height*self._zoom)+delta) if width != new_width: # resize if it's necessary image = image.resize((new_width, new_height), Image.NEAREST) image = ImageTk.PhotoImage(image) # no problem with bug connected with reference count -- # caching keeps image reference self._scaled_images_cache[key] = image return image def _to_screen_coordinate(self, (x, y), delta=None, zoom=None): """ From game coordinates. """ zoom = zoom or self._zoom delta = delta or self._delta return (32*zoom*(x-y-2*delta[0]), 16*zoom*(x+y-2*delta[1])) def _to_game_coordinate(self, (x, y), delta=None, zoom=None): """ From screen coordinates. """ zoom = zoom or self._zoom delta = delta or self._delta return (x/64.0/zoom + y/32.0/zoom \ + delta[0] + delta[1], -x/64.0/zoom + y/32.0/zoom \ - delta[0] + delta[1]) def _to_image_position(self, image_name, (x, y)): """ From screen coordinaties. """ if image_name == 'ground': dx = GameViewer.TILE_WIDTH/2.0 * (self._game.game_map.size[1]+1) dy = GameViewer.TILE_HEIGHT/2.0 else: switch = { 'tank' : (22, 0), 'miner' : (18, 3), 'base' : (31, 13), 'minerals' : (20, 10), 'tree1' : (10, 45), 'tree2' : (20, 25), 'tree3' : (20, 33), 'tree4' : (15, 25), 'tree5' : (18, 15), 'tree6' : (22, 18), 'arrow' : (32, 0), 'pointer' : (GameViewer.POINTER_SIZE[0]/2, 4), 'pointer2' : (GameViewer.POINTER_2_SIZE[0]/2, 0), 'explosion' : (10, -5),} first_part = image_name.split('-', 1)[0] dx, dy = switch[first_part] return x-dx*self._zoom, y-dy*self._zoom def _set_zoom(self, zoom, (XS, YS)): """ Set zoom. The point (XS, YS) in screen coordinate doesn't move.""" # bound zoom zoom = max(zoom, GameViewer.MIN_ZOOM) zoom = min(zoom, GameViewer.MAX_ZOOM) if zoom == self._zoom: # zoom hasn't been changed return # It clears cache of scaled images. Due to reference count bug # all images will be removed from memory! # compute new self._delta and self._zoom xS, yS = self._to_game_coordinate((XS, YS)) delta = [-XS/64.0/zoom + xS/2.0 - yS/2.0, -YS/32.0/zoom + xS/2.0 + yS/2.0] self._zoom, old_zoom = zoom, self._zoom cleared_delta = self._clear_delta(delta) self._delta = cleared_delta delta_delta = (cleared_delta[0]-delta[0], cleared_delta[1]-delta[1]) # scale all images with log_on_enter('GameViewer._set_zoom: rescaling images', mode='only time'): names = self._scaled_images_cache.keys() self._scaled_images_cache = {} # clear cache for name in names: image = self._get_scaled_sprite(name) self.itemconfigure(name, image=image) # scale all texts font = self._get_font_for_current_zoom() self.itemconfigure('text', font=font, state = NORMAL if font else HIDDEN) # move all images factor = zoom/old_zoom self.scale('game', XS, YS, factor, factor) self.move('game', -delta_delta[0]*64.0*self._zoom, -delta_delta[1]*32.0*self._zoom) def _clear_delta(self, delta): if not self._game: return delta size = self.winfo_width(), self.winfo_height() center_of_screen = (size[0]/2, size[1]/2) map_width = self._game.game_map.size[0] map_height = self._game.game_map.size[1] pos = self._to_game_coordinate(center_of_screen, delta=delta) if (0 <= pos[0] < map_width and 0 <= pos[1] < map_height): return delta # If we are here it means that the delta is invalid. # 1. Find valid position pos = (min(map_width, max(0, pos[0])), min(map_height, max(0, pos[1]))) # 2. Find delta which fullfils the condition: # _to_screen_coordinate(pos) == center_of_screen delta = (-(center_of_screen[0]/32.0/self._zoom - pos[0] + pos[1])/2.0, -(center_of_screen[1]/16.0/self._zoom - pos[0] - pos[1])/2.0) return delta def _set_selection_position(self, value, force_emitting=False): old_selection = self.selection_position self.selection_position = value if old_selection != value or force_emitting: self.event_generate('<<selection-changed>>') def _roll_wheel_callback(self, event): if self._game: delta = 0 if event.num == 5: # respond Linux wheel event delta -= 1 elif event.num == 4: # -//- delta += 1 else: # respond Windows wheel event delta += event.delta // 120 factor = GameViewer.SCROLLING_SENSITIVITY**delta self._set_zoom(self._zoom*factor, (event.x, event.y)) def _mouse_motion_with_button_pressed_callback(self, event): # scrolling map if self._game and self._last_mouse_position: with log_on_enter('moving everything', mode='only time'): dx, dy = (event.x - self._last_mouse_position[0], event.y - self._last_mouse_position[1]) delta = (self._delta[0] - dx/64.0/self._zoom, self._delta[1] - dy/32.0/self._zoom) delta = self._clear_delta(delta) dx, dy = ((self._delta[0]-delta[0])*64.0*self._zoom, (self._delta[1]-delta[1])*32.0*self._zoom) self._delta = delta self.move('game', dx, dy) self._last_mouse_position = (event.x, event.y) def _mouse_motion_callback(self, event): if not self._game: return # info about field/unit under mouse -- update corner text pos = self._to_game_coordinate((event.x, event.y)) pos = tuple(map(lambda x: int(math.floor(x)), pos)) if self._game.game_map[pos].valid_position: self._set_selection_position(pos) else: self._set_selection_position(None) def _click_callback(self, event): if self._game: self._click_position = (event.x, event.y) def _double_click_callback(self, event): if self._game: self.event_generate('<<field-double-clicked>>') def _release_callback(self, event): self._last_mouse_position = None if self._click_position: release_position = (event.x, event.y) if self._click_position == release_position: self._single_click_callback(event) def _single_click_callback(self, event): if self._game: click_position = self._to_game_coordinate((event.x, event.y)) integer_click_position = map(lambda i: int(math.floor(i)), click_position) integer_click_position = tuple(integer_click_position) # generate event even click position is outside map self.event_generate('<<field-selected>>') def _resized_callback(self, event): # update delta delta = self._clear_delta(self._delta) dx, dy = ((self._delta[0]-delta[0])*64.0*self._zoom, (self._delta[1]-delta[1])*32.0*self._zoom) self._delta = delta self.move('game', dx, dy) # update loading indicator's position self.coords( self._loading_indicator_id, self._loading_indicator_position[0], self._loading_indicator_position[1]) class Scrolled(Frame): """Example: >>> scroll = Scrolled(master) >>> label = Label(scroll, text='Label') >>> scroll.set_widget(label) # ==> label packed >>> scroll.pack() """ def __init__(self, *args, **kwargs): Frame.__init__(self, *args, **kwargs) def set_widget(self, widget): scroll = Scrollbar(self) scroll.pack(side=RIGHT, fill=Y) scroll.config(command=widget.yview) widget.configure(yscrollcommand=scroll.set) widget.pack(side=LEFT, fill=BOTH, expand=1) class UnitInfoWindow(tkSimpleDialog.Dialog): LANGUAGES = [None, STAR_PROGRAM] LANGUAGES += (lang for lang in Language.ALL) LANGUAGE_NAMES = tuple(('brak programu' if lang is None else 'star program' if lang is STAR_PROGRAM else Language.TO_NAME[lang]) for lang in LANGUAGES) FONT_ATTRS = { 'family':'Courier New', 'size':8, } CODE_FONT_ATTRS = dict(FONT_ATTRS) CODE_FONT_ATTRS['size'] = 10 def __init__(self, master, program, maybe_compilation_status, maybe_run_status, ok_callback): self._program = program self._maybe_compilation_status = maybe_compilation_status self._maybe_run_status = maybe_run_status self._ok_callback = ok_callback tkSimpleDialog.Dialog.__init__(self, master) def buttonbox(self): tkSimpleDialog.Dialog.buttonbox(self) self.unbind('<Return>') # so we can use enter in code textarea def body(self, master): left_box = Frame(master) separator = Frame(master, width=2, bd=1, relief=SUNKEN) right_box = Frame(master) self._create_program_editor_part(left_box) self._create_compilation_part(right_box) self._add_horizontal_separator(right_box) self._create_execution_part(right_box) left_box.pack(side=LEFT, fill=BOTH, expand=1) separator.pack(side=LEFT, fill=Y, padx=15, pady=15) right_box.pack(side=RIGHT, fill=BOTH, expand=1) master.pack(fill=BOTH, expand=1) self.geometry('800x600') self.attributes('-fullscreen', '1') def _add_horizontal_separator(self, master): separator = Frame(master, height=2, bd=1, relief=SUNKEN) separator.pack(fill=X, padx=15, pady=15) def _create_program_editor_part(self, master): box = Frame(master) self._create_language_label(box) self._create_language_listbox(box) box.pack(fill=BOTH) self._create_code_label(master) self._create_code_textarea(master) def _create_language_label(self, master): self._language_label = Label(master, text='Język: ') self._language_label.pack(side=LEFT) def _create_language_listbox(self, master): scroll = Scrolled(master) language_list = StringVar(value=UnitInfoWindow.LANGUAGE_NAMES) self._language_listbox = Listbox(scroll, selectmode=SINGLE, height=5, width=20, exportselection=0, # to keep selection highlighted listvariable=language_list) language_index = UnitInfoWindow.LANGUAGES.index( self._program.language if isinstance(self._program, Program) else self._program) self._language_listbox.select_set(language_index) scroll.set_widget(self._language_listbox) scroll.pack(side=LEFT, fill=BOTH, expand=1) def _create_code_label(self, master): self._code_label = Label(master, text='Kod: ', anchor=W) self._code_label.pack(fill=BOTH) def _create_code_textarea(self, master): scroll = Scrolled(master) self._code_textarea = Text( scroll, height=1, width=1, font=tkFont.Font(**UnitInfoWindow.CODE_FONT_ATTRS)) text = ("" if self._program in (None, STAR_PROGRAM) else self._program.code) self._code_textarea.insert('1.0', text) scroll.set_widget(self._code_textarea) scroll.pack(fill=BOTH, expand=1) def _create_compilation_part(self, master): self._create_compilation_label(master) box = Frame(master) self._create_compilation_output_label(box) self._create_compilation_error_output_label(box) box.pack(fill=BOTH) box = Frame(master) self._create_compilation_output_textarea(box) self._create_compilation_error_output_textarea(box) box.pack(fill=BOTH, expand=1) def _create_compilation_label(self, master): text = u"Kompilacja: " if self._maybe_compilation_status is None: text += u"brak informacji" else: text += u"czas %.2f s" % self._maybe_compilation_status.execution_time if self._maybe_compilation_status.killed: text += u" (zabity)" text += u"." self._compilation_label = Label(master, text=text, anchor=W) self._compilation_label.pack(fill=BOTH) def _create_compilation_output_label(self, master): label = Label(master, text="Standardowe wyjście: ") label.pack(side=LEFT, fill=BOTH, expand=1) def _create_compilation_error_output_label(self, master): label = Label(master, text="Standardowe wyjście błędów: ") label.pack(side=LEFT, fill=BOTH, expand=1) def _create_compilation_output_textarea(self, master): scroll = Scrolled(master) self._compilation_output_area = Text( scroll, height=1, width=1, font=tkFont.Font(**UnitInfoWindow.FONT_ATTRS)) text = (self._maybe_compilation_status.output if self._maybe_compilation_status else "") self._compilation_output_area.insert('1.0', text) self._compilation_output_area.configure(state=DISABLED) scroll.set_widget(self._compilation_output_area) scroll.pack(side=LEFT, fill=BOTH, expand=1) def _create_compilation_error_output_textarea(self, master): scroll = Scrolled(master) self._compilation_error_output_area = Text( scroll, height=1, width=1, font=tkFont.Font(**UnitInfoWindow.FONT_ATTRS)) text = (self._maybe_compilation_status.error_output if self._maybe_compilation_status else "") self._compilation_error_output_area.insert('1.0', text) self._compilation_error_output_area.configure(state=DISABLED) scroll.set_widget(self._compilation_error_output_area) scroll.pack(side=LEFT, fill=BOTH, expand=1) def _create_execution_part(self, master): self._create_execution_label(master) self._create_execution_input_label(master) self._create_execution_input_area(master) box = Frame(master) self._create_execution_output_label(box) self._create_execution_error_output_label(box) box.pack(fill=BOTH) box = Frame(master) self._create_execution_output_textarea(box) self._create_execution_error_output_textarea(box) box.pack(fill=BOTH, expand=1) def _create_execution_label(self, master): text = u"Wykonanie: " if self._maybe_run_status is None: text += u"program nie został wykonany" else: text += u"czas %.2f s" % self._maybe_run_status.execution_time if self._maybe_run_status.killed: text += u" (zabity)" text += u"." self._execution_label = Label(master, text=text, anchor=W) self._execution_label.pack(fill=BOTH) def _create_execution_input_label(self, master): label = Label(master, text='Standardowe wejście: ') label.pack(fill=BOTH) def _create_execution_input_area(self, master): scroll = Scrolled(master) self._execution_input_area = Text( scroll, height=1, width=1, font=tkFont.Font(**UnitInfoWindow.FONT_ATTRS)) text = (self._maybe_run_status.input if self._maybe_run_status else "") self._execution_input_area.insert('1.0', text) self._execution_input_area.configure(state=DISABLED) scroll.set_widget(self._execution_input_area) scroll.pack(fill=BOTH, expand=1) def _create_execution_output_label(self, master): label = Label(master, text="Standardowe wyjście: ") label.pack(side=LEFT, fill=BOTH, expand=1) def _create_execution_error_output_label(self, master): label = Label(master, text="Standardowe wyjście błędów: ") label.pack(side=LEFT, fill=BOTH, expand=1) def _create_execution_output_textarea(self, master): scroll = Scrolled(master) self._execution_output_area = Text( scroll, height=1, width=1, font=tkFont.Font(**UnitInfoWindow.FONT_ATTRS)) text = (self._maybe_run_status.output if self._maybe_run_status else "") self._execution_output_area.insert('1.0', text) self._execution_output_area.configure(state=DISABLED) scroll.set_widget(self._execution_output_area) scroll.pack(side=LEFT, fill=BOTH, expand=1) def _create_execution_error_output_textarea(self, master): scroll = Scrolled(master) self._execution_error_output_area = Text( scroll, height=1, width=1, font=tkFont.Font(**UnitInfoWindow.FONT_ATTRS)) text = (self._maybe_run_status.error_output if self._maybe_run_status else "") self._execution_error_output_area.insert('1.0', text) self._execution_error_output_area.configure(state=DISABLED) scroll.set_widget(self._execution_error_output_area) scroll.pack(side=LEFT, fill=BOTH, expand=1) def apply(self): language_index = int(self._language_listbox.curselection()[0]) language = UnitInfoWindow.LANGUAGES[language_index] program = (language if language in (None, STAR_PROGRAM) else Program(language, self._code_textarea.get('1.0', END))) self._ok_callback(program) class ClientApplication(Frame): CONFIGURATION_FILE = 'configuration.ini' FREQUENCY_OF_CHECKING_QUERY = 50 # ms TIME_BETWEEN_TICS = 100 # ms MAPS_DIRECTORY = 'maps' GAMES_DIRECTORY = 'games' MENU_GAME_LABEL = "Gra" NEW_GAME_LABEL = "Stwórz nową grę..." SAVE_GAME_LABEL = "Zapisz grę" LOAD_GAME_LABEL = "Wczytaj grę..." ADD_PLAYER_LABEL = "Dodaj nowego gracza..." SET_PROGRAM_LABEL = "Ustaw program zaznaczonej jednostce..." SET_STAR_PROGRAM_LABEL = "Ustaw star program zaznaczonej jednostce" DELETE_PROGRAM_LABEL = "Usuń program zaznaczonej jednostce" TIC_LABEL = "Symuluj jedną turę gry" TIC_IN_LOOP_LABEL = "Symulacja gry w pętli" QUIT_LABEL = "Wyjdź" MENU_ABOUT_LABEL = "O grze" CHOOSE_MAP_FILE = 'Wybierz mapę' CHOOSE_DIRECTORY_FOR_NEW_GAME = "Wybierz folder dla nowej gry" TITLE_CREATE_NEW_GAME = 'Stwórz nową grę' CANNOT_CREATE_NEW_GAME = 'Nie można stworzyć nowej gry.' CANNOT_OPEN_FILE = ('Nie można otworzyć pliku ' '(być może nie masz wystarczających uprawnień).') MAP_FILE_IS_CORRUPTED = 'Plik mapy jest uszkodzony.' CANNOT_CREATE_FOLDER = 'Nie można utworzyć folderu gry.' FILE_WITH_THE_SAME_NAME_EXISTS = ('Nie można utworzyć folderu gry ponieważ ' 'istnieje już plik o takiej samej nazwie.') IO_ERROR_DURING_READING = 'Wystąpił błąd podczas czytania pliku.' TITLE_SAVE_GAME = 'Zapisz grę' CANNOT_SAVE_GAME = 'Nie można zapisać gry.' IO_ERROR_DURING_SAVING = 'Wystąpił błąd podczas zapisywania pliku.' TITLE_LOAD_GAME = 'Wczytaj grę' CANNOT_LOAD_GAME = 'Nie można wczytać gry.' TITLE_CREATE_PLAYER = 'Dodaj nowego gracza' ENTER_NEW_PLAYER_NAME = 'Wpisz nazwę nowego gracza.' TITLE_CREATE_PLAYER_CHOOSE_COLOR = 'Wybierz kolor dla nowego gracza.' CANNOT_CREATE_PLAYER = 'Nie można dodać nowego gracza.' NO_FREE_START_POSITION = \ 'Wszystkie pozycje startowe na mapie są już zajęte.' TITLE_CHOOSE_SOURCE_FILE = 'Wybierz plik źródłowy' TITLE_SET_PROGRAM = 'Ustaw program' CANNOT_SET_PROGRAM = 'Nie można ustawić programu.' UNKNOWN_SOURCE_FILE_EXTENSION = 'Nieznane rozszerzenie pliku źródłowego.' TITLE_ARE_YOU_SURE = 'Czy jesteś pewien?' WARNING_CURRENT_GAME_WILL_BE_LOST = \ 'Czy jesteś pewien? Aktualna gra zostanie bezpowrotnie utracona.' TITLE_QUIT_PROGRAM = 'Wyjdź z programu' QUIT_PROGRAM_QUESTION = 'Czy na pewno chcesz wyjść z programu?' ABOUT_TITLE = 'O grze' ABOUT_CONTENT = ('Scriptcraft - gra programistyczna.\n\n' 'Właścicielem grafiki i map jest Marek Szykuła. ' 'Nie mogą być one kopiowane ani rozpowszechniane. \n\n' 'Kod źródłowy jest na licencji GPLv3 ' 'i może być rozpowszechniany i kopiowany.') TITLE_INVALID_CONFIGURATION_FILE = 'Niepoprawny plik konfiguracji' INVALID_CONFIGURATION_FILE = ('Nie można wczytać ustawień z pliku ' 'konfiguracji. Aplikacja zostanie ' 'zamknięta. Sprawdź zawartość pliku "' + \ CONFIGURATION_FILE + \ '".') DIRECTION_TO_NAME = { direction.N : u'północ', direction.W : u'zachód', direction.S : u'południe', direction.E : u'wschód', } MAP_FILE_TYPES = ( ('Plik mapy', '*.map'), ('Wszystkie pliki', '*') ) DEFAULT_PLAYER_COLORS = ( (178, 146, 0), (128, 0, 0), (0, 255, 220), (255, 0, 255), (0, 0, 255), (0, 200, 0), (255, 255, 0), (255, 0, 0), # the last one is get as the first one ) # initializing -------------------------------------------------------- def __init__(self, master): Frame.__init__(self, master) self._tic_in_loop = BooleanVar(False) self._init_gui() self._game = None self._game_session = None self._queue = Queue() self._master = master self._pointed_unit_id = None self._check_queue() self._load_configuration_file() if len(sys.argv) == 2 and sys.argv[1].lower() == '--test': self._load_testing_game() @log_on_enter('load game for testing') def _load_testing_game(self): filename = datafile_path('maps/small.map') # create game_map #game_map = load_game_map(open(filename, 'r').read()) def generate_simple_map(): import random size = 96 game_map = GameMap((size, size), [(10, 10), (53, 10), (10, 53), (53, 53)]) number_of_trees = 0 for x in xrange(size): for y in xrange(size): p = 0.0 if (6 <= x <= 14 or 49 <= x <= 57 or 6 <= y <= 14 or 49 <= y <= 57): p = 0.0 if (random.random() < p): number_of_trees += 1 game_map[x, y].place_object(Tree()) game_map[x, y].change_ground(random.randint(1, 8)) log('map size: %d, number of fields: %d' % (size, size**2)) log('number of trees: %d' % number_of_trees) return game_map game = None #game = Game(generate_simple_map(), DEFAULT_GAME_CONFIGURATION) # create game and game session session = GameSession( directory='scriptcraft/.tmp', system_configuration=self.system_configuration, game=game) self.set_game_session(session) game = session.game # modify game (set programs) def set_program(unit_id, filename): program = Program(Language.PYTHON, open('scriptcraft/.tmp/'+filename).read()) game.set_program(game.units_by_IDs[unit_id], program) try: set_program(8, 'build_tank.py') for i in xrange(3,7): set_program(i, 'move_randomly.py') for i in xrange(9,13): set_program(i, 'move_randomly.py') except Exception: log_exception('cannot set program for testing game') self._set_game(game) def _check_queue(self): if not self._queue.empty(): command = self._queue.get_nowait() assert command == 'ready' self._set_game(self._game_session.game) if self._tic_in_loop.get(): self.master.after(ClientApplication.TIME_BETWEEN_TICS, self._tic) else: self._game_viewer.show_loading_indicator(False) self.master.after(ClientApplication.FREQUENCY_OF_CHECKING_QUERY, self._check_queue) def _load_configuration_file(self): try: filename = datafile_path(ClientApplication.CONFIGURATION_FILE) self.system_configuration = SystemConfiguration(filename) except (IOError, ValueError, ConfigParser.Error) as ex: log_exception('invalid configuration file') self._warning( ClientApplication.TITLE_INVALID_CONFIGURATION_FILE, ClientApplication.INVALID_CONFIGURATION_FILE ) global root root.destroy() def _init_gui(self): self.pack(expand=YES, fill=BOTH) global root root.protocol("WM_DELETE_WINDOW", self._quit_callback) self._game_viewer = GameViewer(self) self._game_viewer.bind('<<selection-changed>>', self._selection_changed_callback) self._game_viewer.bind('<<field-selected>>', self._field_selected_callback) self._game_viewer.bind('<Button-3>', self._command_ordered_callback) self._game_viewer.bind('<<field-double-clicked>>', self._field_double_clicked_callback) self._create_menubar() self._create_keyboard_shortcuts() def _create_menubar(self): menubar = Menu(self) self._game_menu = Menu(menubar, tearoff=0) menubar.add_cascade(label=ClientApplication.MENU_GAME_LABEL, menu=self._game_menu) self._game_menu.add_command( label=ClientApplication.NEW_GAME_LABEL, command=self._new_game_callback) self._game_menu.add_command( label=ClientApplication.SAVE_GAME_LABEL, command=self._save_game_callback, state=DISABLED) self._game_menu.add_command( label=ClientApplication.LOAD_GAME_LABEL, command=self._load_game_callback) self._game_menu.add_separator() self._game_menu.add_command( label=ClientApplication.ADD_PLAYER_LABEL, command=self._add_player_callback, state=DISABLED) self._game_menu.add_command( label=ClientApplication.DELETE_PROGRAM_LABEL, command=self._delete_program_callback, state=DISABLED) self._game_menu.add_command( label=ClientApplication.SET_PROGRAM_LABEL, command=self._set_program_callback, state=DISABLED) self._game_menu.add_command( label=ClientApplication.SET_STAR_PROGRAM_LABEL, command=self._set_star_program_callback, state=DISABLED) self._game_menu.add_command( label=ClientApplication.TIC_LABEL, command=self._tic_callback, state=DISABLED) self._game_menu.add_checkbutton( label=ClientApplication.TIC_IN_LOOP_LABEL, command=lambda: self._tic_in_loop_callback(switch=False), state=DISABLED, variable=self._tic_in_loop) self._game_menu.add_separator() self._game_menu.add_command( label=ClientApplication.QUIT_LABEL, command=self._quit_callback) menubar.add_command(label=ClientApplication.MENU_ABOUT_LABEL, command=self._about_callback) global root root.config(menu=menubar) def _create_keyboard_shortcuts(self): # new game self._game_menu.entryconfigure( ClientApplication.NEW_GAME_LABEL, accelerator="Ctrl+N") args = ("<Control-n>", lambda w: self._new_game_callback()) self.bind(*args) self._game_viewer.bind(*args) self._game_menu.bind(*args) # save game self._game_menu.entryconfigure( ClientApplication.SAVE_GAME_LABEL, accelerator="Ctrl+S") args = ("<Control-s>", lambda w: self._save_game_callback()) self.bind(*args) self._game_viewer.bind(*args) self._game_menu.bind(*args) # load game self._game_menu.entryconfigure( ClientApplication.LOAD_GAME_LABEL, accelerator="Ctrl+O") args = ("<Control-o>", lambda w: self._load_game_callback()) self.bind(*args) self._game_viewer.bind(*args) self._game_menu.bind(*args) # add player self._game_menu.entryconfigure( ClientApplication.ADD_PLAYER_LABEL, accelerator="Ctrl+A") args = ("<Control-a>", lambda w: self._add_player_callback()) self.bind(*args) self._game_viewer.bind(*args) self._game_menu.bind(*args) # tic item self._game_menu.entryconfigure( ClientApplication.TIC_LABEL, accelerator="T") args = ("<t>", lambda w: self._tic_callback()) self.bind(*args) self._game_viewer.bind(*args) self._game_menu.bind(*args) # tic in loop item self._game_menu.entryconfigure( ClientApplication.TIC_IN_LOOP_LABEL, accelerator='spacja') args = ("<space>", lambda w: self._tic_in_loop_callback(switch=True)) self.bind(*args) self._game_viewer.bind(*args) self._game_menu.bind(*args) # quit program self._game_menu.entryconfigure( ClientApplication.QUIT_LABEL, accelerator="Ctrl+Q") args = ("<Control-q>", lambda w: self._quit_callback()) self.bind(*args) self._game_viewer.bind(*args) self._game_menu.bind(*args) # callbacks ---------------------------------------------------------- @log_on_enter('use case: new game', lvl='info') def _new_game_callback(self): if not self._ask_if_delete_current_game_if_exists(): return map_filename = tkFileDialog.askopenfilename( title=ClientApplication.CHOOSE_MAP_FILE, filetypes=ClientApplication.MAP_FILE_TYPES, initialdir=datafile_path(ClientApplication.MAPS_DIRECTORY), parent=self, ) if not map_filename: return directory = tkFileDialog.askdirectory( title=ClientApplication.CHOOSE_DIRECTORY_FOR_NEW_GAME, initialdir=datafile_path(ClientApplication.GAMES_DIRECTORY), mustexist=False, parent=self, ) if is_it_py2exe_distribution(): directory = directory.replace('/', '\\') if not directory: return try: stream = open(map_filename, 'r') except IOError as ex: log_exception('io error during opening stream to map file') self._warning(ClientApplication.TITLE_CREATE_NEW_GAME, ClientApplication.CANNOT_CREATE_NEW_GAME + ' ' + \ ClientApplication.CANNOT_OPEN_FILE) return if not os.path.exists(directory): try: os.makedirs(directory) except OSError as ex: log_exception('cannot create directory for a game') self._warning(ClientApplication.TITLE_CREATE_NEW_GAME, ClientApplication.CANNOT_CREATE_NEW_GAME + ' ' + \ ClientApplication.CANNOT_CREATE_FOLDER) return else: if not os.path.isdir(directory): self._warning(ClientApplication.TITLE_CREATE_NEW_GAME, ClientApplication.CANNOT_CREATE_NEW_GAME + ' ' + \ ClientApplication.FILE_WITH_THE_SAME_NAME_EXISTS) return try: game_map = load_game_map(stream.read()) except InvalidGameMapData as ex: log_exception('invalid game map data') self._warning(ClientApplication.TITLE_CREATE_NEW_GAME, ClientApplication.CANNOT_CREATE_NEW_GAME + ' ' + \ ClientApplication.MAP_FILE_IS_CORRUPTED) except IOError as ex: log_exception('io error during loading map file') self._warning(ClientApplication.TITLE_CREATE_NEW_GAME, ClientApplication.CANNOT_CREATE_NEW_GAME + ' ' + \ ClientApplication.IO_ERROR_DURING_READING) else: game = Game(game_map, DEFAULT_GAME_CONFIGURATION) game_session = GameSession(directory, self.system_configuration, game=game) self.set_game_session(game_session) finally: stream.close() @log_on_enter('use case: save game', mode='time', lvl='info') def _save_game_callback(self): try: self._game_session.save() except IOError as ex: log_exception('io error duing saving game') self._warning(ClientApplication.TITLE_SAVE_GAME, ClientApplication.CANNOT_SAVE_GAME + ' ' + \ ClientApplication.IO_ERROR_DURING_SAVING) @log_on_enter('use case: load game', lvl='info') def _load_game_callback(self): if not self._ask_if_delete_current_game_if_exists(): return directory = tkFileDialog.askdirectory( title=ClientApplication.TITLE_LOAD_GAME, initialdir=datafile_path(ClientApplication.GAMES_DIRECTORY), mustexist=True, parent=self, ) if is_it_py2exe_distribution(): directory = directory.replace('/', '\\') if not directory: return try: game_session = GameSession(directory, self.system_configuration) except IOError as ex: log_exception('io error during loading game') self._warning(ClientApplication.TITLE_LOAD_GAME, ClientApplication.CANNOT_LOAD_GAME + ' ' + \ ClientApplication.IO_ERROR_DURING_READING) except pickle.UnpicklingError as ex: log_exception('pickle error during loading game') self._warning(ClientApplication.TITLE_LOAD_GAME, ClientApplication.CANNOT_LOAD_GAME + ' ' + \ ClientApplication.MAP_FILE_IS_CORRUPTED) else: self.set_game_session(game_session) @log_on_enter('use case: add player', lvl='info') def _add_player_callback(self): if self._game is None: return name = tkSimpleDialog.askstring( title=ClientApplication.TITLE_CREATE_PLAYER, prompt=ClientApplication.ENTER_NEW_PLAYER_NAME, parent=self) if name is None: return color = self._reserve_color() try: self._game_session.new_player_with_units(name, color) except NoFreeStartPosition: self._warning(ClientApplication.TITLE_CREATE_PLAYER, ClientApplication.CANNOT_CREATE_PLAYER + ' ' + \ ClientApplication.NO_FREE_START_POSITION) else: self._set_game(self._game) @log_on_enter('use case: set program', lvl='info') def _set_program_callback(self): stream = tkFileDialog.askopenfile( title=ClientApplication.TITLE_CHOOSE_SOURCE_FILE, mode='r', parent=self) if stream is None: return filename = stream.name if filename.endswith('.cpp'): language = Language.CPP elif filename.endswith('.py'): language = Language.PYTHON else: self._warning(ClientApplication.TITLE_SET_PROGRAM, ClientApplication.CANNOT_SET_PROGRAM + ' ' + \ ClientApplication.UNKNOWN_SOURCE_FILE_EXTENSION) return field = self._game.game_map[self._game_viewer._pointer_position] unit = field.maybe_object program = Program(language=language, code=stream.read()) self._game_session.set_program(unit, program) @log_on_enter('use case: set star program', lvl='info') def _set_star_program_callback(self): field = self._game.game_map[self._game_viewer._pointer_position] unit = field.maybe_object self._game_session.set_program(unit, STAR_PROGRAM) @log_on_enter('use case: delete program', lvl='info') def _delete_program_callback(self): field = self._game.game_map[self._game_viewer._pointer_position] unit = field.maybe_object self._game_session.set_program(unit, None) @log_on_enter('use case: tic', mode='time', lvl='info') def _tic_callback(self): self._tic() @log_on_enter('use case: switch tic in loop', lvl='info') def _tic_in_loop_callback(self, switch): if switch: self._tic_in_loop.set(not self._tic_in_loop.get()) if self._tic_in_loop.get(): self._tic() @log_on_enter('use case: quit', lvl='info') def _quit_callback(self): if not self._ask_if_quit_program(): return global root root.destroy() @log_on_enter('use case: about game', lvl='info') def _about_callback(self): tkMessageBox.showinfo( title=ClientApplication.ABOUT_TITLE, message=ClientApplication.ABOUT_CONTENT, parent=self) def _selection_changed_callback(self, event): # first, update the corner text pos = self._game_viewer.selection_position if pos is None: text = u" " else: field = self._game.game_map[pos] obj = field.maybe_object if obj is None: obj_info = u"" elif isinstance(obj, Tree): obj_info = u"Drzewa." elif isinstance(obj, MineralDeposit): obj_info = u"Złoża minerałów (%d jednostek minerałów)." % obj.minerals elif isinstance(obj, Unit): # type of the unit if obj.type.main_name == '4': # base obj_info = u"Baza (%d minerałów)" % obj.minerals elif obj.type.main_name == '5': # miner state = (u'pełny' if obj.minerals else u'pusty') obj_info = u"Zbieracz minerałów (%s)" % state elif obj.type.main_name == '6': # tank obj_info = u"Czołg" else: assert False, 'oops, unknown unit type %r' % unit.type # player obj_info += u' gracza %s.' % obj.player.name # command if isinstance(obj.command, cmds.StopCommand): command_info = u'stop' elif isinstance(obj.command, cmds.MoveCommand): d = ClientApplication.DIRECTION_TO_NAME[obj.command.direction] command_info = u'idź na %s' % d elif isinstance(obj.command, cmds.ComplexMoveCommand): command_info = u'idź do (%d, %d)' \ % obj.command.destination elif isinstance(obj.command, cmds.ComplexGatherCommand): command_info = u'zbieraj minerały z (%d, %d)' \ % obj.command.destination elif isinstance(obj.command, cmds.FireCommand): command_info = u'ogień na (%d, %d)' \ % obj.command.destination elif isinstance(obj.command, cmds.ComplexAttackCommand): command_info = u'atak na (%d, %d)' \ % obj.command.destination elif isinstance(obj.command, cmds.BuildCommand): command_info = u'buduj "%s"' \ % obj.command.unit_type_name obj_info += u' Komenda: %s.' % command_info else: assert False, 'oops, unknown object on map %r' % obj field_info = u"Pole (%d, %d)." % (pos[0], pos[1]) text = u" ".join([field_info, obj_info]) self._game_viewer.set_corner_text(text) self._refresh_game_menu_items_state() # second, update second pointer self._update_pointer_2() def _field_selected_callback(self, event): pos = self._game_viewer.selection_position if pos is None: self._game_viewer.set_pointer_position(None) else: obj = self._game.game_map[pos].maybe_object if obj and isinstance(obj, Unit): self._pointed_unit_id = obj.ID self._game_viewer.set_pointer_position(pos) else: self._pointed_unit_id = None self._game_viewer.set_pointer_position(None) self._update_pointer_2() def _field_double_clicked_callback(self, event): if self._game is None: return pos = self._game_viewer._pointer_position if pos is None: return unit = self._game.game_map[pos].maybe_object assert unit is not None # because self._game_viewer._pointer_position is set to sth other than # None only if there is an object on pointed field def ok_callback(program): if unit.ID in self._game_session.units_by_IDs: self._game_session.set_program(unit, program) window = UnitInfoWindow(self, program=unit.program, maybe_compilation_status=unit.maybe_last_compilation_status, maybe_run_status=unit.maybe_run_status, ok_callback=ok_callback) def _command_ordered_callback(self, event): command = self._command_for_pointed_unit() clicked_pos = self._game_viewer._pointer_position if clicked_pos is None: return clicked_obj = self._game.game_map[clicked_pos].maybe_object pointed_pos = self._game_viewer.selection_position if clicked_obj is None or not isinstance(clicked_obj, Unit): return unit = clicked_obj if command == '': self._game_session.set_program(unit, Program(Language.OUTPUT, '')) return command = { 'move' : 'MOVE %(x)d %(y)d', 'attack' : 'ATTACK %(x)d %(y)d', 'gather' : 'GATHER %(x)d %(y)d', }[command] command = command % {'x':pointed_pos[0], 'y':pointed_pos[1]} self._game_session.set_program(unit, Program(Language.OUTPUT, command)) self._pointed_unit_id = None self._game_viewer.set_pointer_2_position(None) self._game_viewer.set_pointer_position(None) def _update_pointer_2(self): command = self._command_for_pointed_unit() if command == '': self._game_viewer.set_pointer_2_position(None) return pos = self._game_viewer.selection_position self._game_viewer.set_pointer_2_position(pos) color = { 'attack' : 'red', 'gather' : 'darkblue', 'move' : 'green', }[command] self._game_viewer.set_pointer_2_color(color) def _command_for_pointed_unit(self): """ Or '' if there is no pointed unit """ pos = self._game_viewer._pointer_position # selected (clicked) field if pos is None: return '' clicked_unit = self._game.game_map[pos].maybe_object if not clicked_unit or not isinstance(clicked_unit, Unit): return '' pointed_position = self._game_viewer.selection_position # field under cursor if pointed_position is None: return '' selected_obj = self._game.game_map[pointed_position].maybe_object if (clicked_unit.type.can_attack and clicked_unit.type.movable): selected_own_unit = (selected_obj is not None and isinstance(selected_obj, Unit) and selected_obj.player == clicked_unit.player) if selected_own_unit: return 'move' else: return 'attack' elif (clicked_unit.type.has_storage and clicked_unit.type.movable and selected_obj is not None and isinstance(selected_obj, MineralDeposit)): return 'gather' elif (clicked_unit.type.movable and pos != pointed_position): return 'move' return '' # other methods ------------------------------------------------------- def _tic(self): try: self._game_viewer.show_loading_indicator(True) self._game_session.tic(self._queue) except AlreadyExecuteGame as ex: log('already execute game') @log_on_enter('set game session') def set_game_session(self, game_session): self._game_session = game_session self._set_game(None) self._tic_in_loop.set(False) self._queue = Queue() if game_session: self._set_game(game_session.game) def _set_game(self, game): """ Call it if game instance was changed and you want to make the application up to date.""" # set game.free_colors if game is not None and not hasattr(game, 'free_colors'): if self._game is None or not hasattr(self._game, 'free_colors'): game.free_colors = \ list(ClientApplication.DEFAULT_PLAYER_COLORS) else: game.free_colors = self._game.free_colors # track pointed unit self._game_viewer.set_pointer_position(None) if game and self._pointed_unit_id: unit = game.units_by_IDs.get(self._pointed_unit_id, None) if unit: self._game_viewer.set_pointer_position(unit.position) # other stuff self._game = game self._game_viewer.set_game(game) self._refresh_game_menu_items_state() def _reserve_color(self): if self._game.free_colors: return self._game.free_colors.pop() else: rand = lambda: random.randint(0, 255) return (rand(), rand(), rand()) def _print_info_about_field_at(self, position): field = self._game.game_map[position] print "\nSelected position: (%d, %d)" % position print "Field: %s" % str(field) if isinstance(field.maybe_object, Unit): unit = field.maybe_object print "Unit: %s" % (unit,) print "Compilation: %s" % (unit.maybe_last_compilation_status,) print "Executing: %s" % (unit.maybe_run_status,) def _refresh_game_menu_items_state(self): has_game = self._game is not None obj = (self._game.game_map[self._game_viewer._pointer_position].maybe_object if has_game and self._game_viewer._pointer_position is not None else None) has_unit = (self._game is not None and self._game_viewer._pointer_position is not None and isinstance(obj, Unit)) state = NORMAL if has_game else DISABLED entries = [ClientApplication.ADD_PLAYER_LABEL, ClientApplication.SAVE_GAME_LABEL, ClientApplication.TIC_LABEL, ClientApplication.TIC_IN_LOOP_LABEL] for entry in entries: self._game_menu.entryconfigure(entry, state=state) state = NORMAL if has_unit else DISABLED entries = [ClientApplication.SET_PROGRAM_LABEL, ClientApplication.SET_STAR_PROGRAM_LABEL, ClientApplication.DELETE_PROGRAM_LABEL] for entry in entries: self._game_menu.entryconfigure(entry, state=state) def _warning(self, title, text): tkMessageBox.showwarning(title, text, parent=self) def _ask_if_delete_current_game_if_exists(self): if self._game: return tkMessageBox.askyesno(ClientApplication.TITLE_ARE_YOU_SURE, ClientApplication.WARNING_CURRENT_GAME_WILL_BE_LOST, icon=tkMessageBox.WARNING, parent=self ) else: return True def _ask_if_quit_program(self): return tkMessageBox.askyesno( ClientApplication.TITLE_QUIT_PROGRAM, ClientApplication.QUIT_PROGRAM_QUESTION, icon=tkMessageBox.WARNING, parent=self ) def run_with_profiling(): # profile run function filename = '.stats' import cProfile cProfile.run('run()', filename) import pstats p = pstats.Stats(filename) p.strip_dirs() p.sort_stats('cumulative') p.dump_stats(filename) p.print_stats(25) def run(): # prevent "errors occured" message box in py2exe distribution turn_off_standard_streams_if_it_is_py2exe_distribution() # run it! global root, app init_logging('debug') try: root = Tk() root.report_callback_exception = log_error_callback app = ClientApplication(master=root) app.mainloop() except Exception as ex: log_exception('Unhandled exception outside tkinter!') finally: shutdown_logging() if __name__ == "__main__": run() # replace with run_with_profiling to enable profiling
gpl-3.0
-163,926,196,609,843,170
37.956345
92
0.559653
false
mikedh/trimesh
trimesh/path/exchange/load.py
1
2622
import os from .dxf import _dxf_loaders from .svg_io import svg_to_path from ..path import Path from . import misc from ... import util def load_path(file_obj, file_type=None, **kwargs): """ Load a file to a Path file_object. Parameters ----------- file_obj : One of the following: - Path, Path2D, or Path3D file_objects - open file file_object (dxf or svg) - file name (dxf or svg) - shapely.geometry.Polygon - shapely.geometry.MultiLineString - dict with kwargs for Path constructor - (n,2,(2|3)) float, line segments file_type : str Type of file is required if file file_object passed. Returns --------- path : Path, Path2D, Path3D file_object Data as a native trimesh Path file_object """ if isinstance(file_obj, Path): # we have been passed a Path file_object so # do nothing and return the passed file_object return file_obj elif util.is_file(file_obj): # for open file file_objects use loaders kwargs.update(path_loaders[file_type]( file_obj, file_type=file_type)) elif util.is_string(file_obj): # strings passed are evaluated as file file_objects with open(file_obj, 'rb') as file_file_obj: # get the file type from the extension file_type = os.path.splitext(file_obj)[-1][1:].lower() # call the loader kwargs.update(path_loaders[file_type]( file_file_obj, file_type=file_type)) elif util.is_instance_named(file_obj, 'Polygon'): # convert from shapely polygons to Path2D kwargs.update(misc.polygon_to_path(file_obj)) elif util.is_instance_named(file_obj, 'MultiLineString'): # convert from shapely LineStrings to Path2D kwargs.update(misc.linestrings_to_path(file_obj)) elif isinstance(file_obj, dict): # load as kwargs from ...exchange.load import load_kwargs return load_kwargs(file_obj) elif util.is_sequence(file_obj): # load as lines in space kwargs.update(misc.lines_to_path(file_obj)) else: raise ValueError('Not a supported object type!') from ...exchange.load import load_kwargs return load_kwargs(kwargs) def path_formats(): """ Get a list of supported path formats. Returns ------------ loaders : list of str Extensions of loadable formats, ie: ['svg', 'dxf'] """ return list(path_loaders.keys()) path_loaders = {'svg': svg_to_path} path_loaders.update(_dxf_loaders)
mit
7,173,151,525,337,611,000
29.847059
66
0.615179
false
jakdot/pyactr
tutorials/u7_simplecompilation.py
1
1254
""" Testing a simple case of production compilation. The compilation also allows for utility learning, shown in the model below, as well. """ import warnings import pyactr as actr class Compilation1(object): """ Model testing compilation -- basic cases. """ def __init__(self, **kwargs): actr.chunktype("state", "starting ending") self.m = actr.ACTRModel(**kwargs) self.m.goal.add(actr.makechunk(nameofchunk="start", typename="state", starting=1)) self.m.productionstring(name="one", string=""" =g> isa state starting =x ending ~=x ==> =g> isa state ending =x""", utility=2) self.m.productionstring(name="two", string=""" =g> isa state starting =x ending =x ==> =g> isa state starting =x ending 4""") if __name__ == "__main__": warnings.simplefilter("ignore") mm = Compilation1(production_compilation=True, utility_learning=True) model = mm.m sim = model.simulation(realtime=True) sim.run(0.5) print(model.productions["one and two"])
gpl-3.0
8,944,572,004,527,267,000
24.591837
133
0.53429
false
duyet-website/api.duyet.net
lib/docs/conf.py
1
8187
# -*- coding: utf-8 -*- # # Faker documentation build configuration file, created by # sphinx-quickstart on Tue Mar 11 11:25:48 2014. # # This file is execfile()d with the current directory set to its # containing dir. # # Note that not all possible configuration values are present in this # autogenerated file. # # All configuration values have a default; values that are commented out # serve to show the default. import sys import os # If extensions (or modules to document with autodoc) are in another directory, # add these directories to sys.path here. If the directory is relative to the # documentation root, use os.path.abspath to make it absolute, like shown here. #sys.path.insert(0, os.path.abspath('.')) # -- General configuration ------------------------------------------------ # If your documentation needs a minimal Sphinx version, state it here. #needs_sphinx = '1.0' # Add any Sphinx extension module names here, as strings. They can be # extensions coming with Sphinx (named 'sphinx.ext.*') or your custom # ones. extensions = [ 'sphinx.ext.todo', 'faker.build_docs', ] # Add any paths that contain templates here, relative to this directory. templates_path = ['_templates'] # The suffix of source filenames. source_suffix = '.rst' # The encoding of source files. #source_encoding = 'utf-8-sig' # The master toctree document. master_doc = 'index' # General information about the project. project = u'Faker' copyright = u'2014, Daniele Faraglia' # The version info for the project you're documenting, acts as replacement for # |version| and |release|, also used in various other places throughout the # built documents. # # The short X.Y version. version = '0.7.5' # The full version, including alpha/beta/rc tags. release = '0.7.5' # The language for content autogenerated by Sphinx. Refer to documentation # for a list of supported languages. #language = None # There are two options for replacing |today|: either, you set today to some # non-false value, then it is used: #today = '' # Else, today_fmt is used as the format for a strftime call. #today_fmt = '%B %d, %Y' # List of patterns, relative to source directory, that match files and # directories to ignore when looking for source files. exclude_patterns = ['_build'] # The reST default role (used for this markup: `text`) to use for all # documents. #default_role = None # If true, '()' will be appended to :func: etc. cross-reference text. #add_function_parentheses = True # If true, the current module name will be prepended to all description # unit titles (such as .. function::). #add_module_names = True # If true, sectionauthor and moduleauthor directives will be shown in the # output. They are ignored by default. #show_authors = False # The name of the Pygments (syntax highlighting) style to use. pygments_style = 'sphinx' # A list of ignored prefixes for module index sorting. #modindex_common_prefix = [] # If true, keep warnings as "system message" paragraphs in the built documents. #keep_warnings = False # -- Options for HTML output ---------------------------------------------- # The theme to use for HTML and HTML Help pages. See the documentation for # a list of builtin themes. html_theme = 'default' # Theme options are theme-specific and customize the look and feel of a theme # further. For a list of options available for each theme, see the # documentation. #html_theme_options = {} # Add any paths that contain custom themes here, relative to this directory. #html_theme_path = [] # The name for this set of Sphinx documents. If None, it defaults to # "<project> v<release> documentation". #html_title = None # A shorter title for the navigation bar. Default is the same as html_title. #html_short_title = None # The name of an image file (relative to this directory) to place at the top # of the sidebar. #html_logo = None # The name of an image file (within the static path) to use as favicon of the # docs. This file should be a Windows icon file (.ico) being 16x16 or 32x32 # pixels large. #html_favicon = None # Add any paths that contain custom static files (such as style sheets) here, # relative to this directory. They are copied after the builtin static files, # so a file named "default.css" will overwrite the builtin "default.css". html_static_path = ['_static'] # Add any extra paths that contain custom files (such as robots.txt or # .htaccess) here, relative to this directory. These files are copied # directly to the root of the documentation. #html_extra_path = [] # If not '', a 'Last updated on:' timestamp is inserted at every page bottom, # using the given strftime format. #html_last_updated_fmt = '%b %d, %Y' # If true, SmartyPants will be used to convert quotes and dashes to # typographically correct entities. #html_use_smartypants = True # Custom sidebar templates, maps document names to template names. #html_sidebars = {} # Additional templates that should be rendered to pages, maps page names to # template names. #html_additional_pages = {} # If false, no module index is generated. #html_domain_indices = True # If false, no index is generated. #html_use_index = True # If true, the index is split into individual pages for each letter. #html_split_index = False # If true, links to the reST sources are added to the pages. #html_show_sourcelink = True # If true, "Created using Sphinx" is shown in the HTML footer. Default is True. #html_show_sphinx = True # If true, "(C) Copyright ..." is shown in the HTML footer. Default is True. #html_show_copyright = True # If true, an OpenSearch description file will be output, and all pages will # contain a <link> tag referring to it. The value of this option must be the # base URL from which the finished HTML is served. #html_use_opensearch = '' # This is the file name suffix for HTML files (e.g. ".xhtml"). #html_file_suffix = None # Output file base name for HTML help builder. htmlhelp_basename = 'Fakerdoc' # -- Options for LaTeX output --------------------------------------------- latex_elements = { # The paper size ('letterpaper' or 'a4paper'). #'papersize': 'letterpaper', # The font size ('10pt', '11pt' or '12pt'). #'pointsize': '10pt', # Additional stuff for the LaTeX preamble. #'preamble': '', } # Grouping the document tree into LaTeX files. List of tuples # (source start file, target name, title, # author, documentclass [howto, manual, or own class]). latex_documents = [ ('index', 'Faker.tex', u'Faker Documentation', u'Daniele Faraglia', 'manual'), ] # The name of an image file (relative to this directory) to place at the top of # the title page. #latex_logo = None # For "manual" documents, if this is true, then toplevel headings are parts, # not chapters. #latex_use_parts = False # If true, show page references after internal links. #latex_show_pagerefs = False # If true, show URL addresses after external links. #latex_show_urls = False # Documents to append as an appendix to all manuals. #latex_appendices = [] # If false, no module index is generated. #latex_domain_indices = True # -- Options for manual page output --------------------------------------- # One entry per manual page. List of tuples # (source start file, name, description, authors, manual section). man_pages = [ ('index', 'faker', u'Faker Documentation', [u'Daniele Faraglia'], 1) ] # If true, show URL addresses after external links. #man_show_urls = False # -- Options for Texinfo output ------------------------------------------- # Grouping the document tree into Texinfo files. List of tuples # (source start file, target name, title, author, # dir menu entry, description, category) texinfo_documents = [ ('index', 'Faker', u'Faker Documentation', u'Daniele Faraglia', 'Faker', 'One line description of project.', 'Miscellaneous'), ] # Documents to append as an appendix to all manuals. #texinfo_appendices = [] # If false, no module index is generated. #texinfo_domain_indices = True # How to display URL addresses: 'footnote', 'no', or 'inline'. #texinfo_show_urls = 'footnote' # If true, do not generate a @detailmenu in the "Top" node's menu. #texinfo_no_detailmenu = False
mit
5,187,688,238,013,529,000
30.367816
79
0.706119
false
coyotevz/nobix-app
nbs/models/misc.py
1
3865
# -*- coding: utf-8 -*- from datetime import datetime from sqlalchemy.ext.declarative import declared_attr from nbs.models import db class TimestampMixin(object): created = db.Column(db.DateTime, default=datetime.now) modified = db.Column(db.DateTime, default=datetime.now, onupdate=datetime.now) @staticmethod def stamp_modified(mapper, connection, target): if db.object_session(target).is_modified(target): target.modified = datetime.now() @classmethod def __declare_last__(cls): db.event.listen(cls, 'before_update', cls.stamp_modified) class RefEntityMixin(object): @declared_attr def entity_id(cls): return db.Column('entity_id', db.Integer, db.ForeignKey('entity.id'), nullable=False) @declared_attr def entity(cls): name = cls.__name__.lower() return db.relationship('Entity', backref=db.backref(name, lazy='joined'), lazy='joined') class Address(RefEntityMixin, db.Model): """Stores addresses information""" __tablename__ = 'address' id = db.Column(db.Integer, primary_key=True) address_type = db.Column(db.Unicode) street = db.Column(db.Unicode(128), nullable=False) city = db.Column(db.Unicode(64)) province = db.Column(db.Unicode(32), nullable=False) postal_code = db.Column(db.Unicode(32)) def __str__(eslf): retval = self.street if self.city: retval += ", {}".format(self.city) retval += ", {}".format(self.province) if self.postal_code: retval += " ({})".format(self.postal_code) return retval def __repr__(self): return "<Address '{}' of '{}: {}'>".format( str(self), self.entity.entity_type, self.entity.full_name ) class Phone(RefEntityMixin, db.Model): """Model to store phone information""" __tablename__ = 'phone' id = db.Column(db.Integer, primary_key=True) phone_type = db.Column(db.Unicode) prefix = db.Column(db.Unicode(8)) number = db.Column(db.Unicode, nullable=False) extension = db.Column(db.Unicode(5)) def __str__(self): retval = self.phone_type+': ' if self.phone_type else '' if self.prefix: retval += "({})".format(self.prefix) retval += self.number if self.extension: retval += " ext: {}".format(self.extension) return retval def __repr__(self): return "<Phone '{}' of '{}: {}'>".format( str(self), self.entity.entity_type, self.entity.full_name ) class Email(RefEntityMixin, db.Model): """Model to store email information""" __tablename__ = 'email' id = db.Column(db.Integer, primary_key=True) email_type = db.Column(db.Unicode(50)) email = db.Column(db.Unicode(50), nullable=False) def __str__(self): retval = self.email_type + ': ' if self.email_type else '' retval += self.email return retval def __repr__(self): return "<Email '{}' of '{}: {}'>".format( str(self), self.entity.entity_type, self.entity.full_name ) class ExtraField(RefEntityMixin, db.Model): """Model to store information of additional data""" __tablename__ = 'extra_field' id = db.Column(db.Integer, primary_key=True) field_name = db.Column(db.Unicode(50), nullable=False) field_value = db.Column(db.Unicode(50), nullable=False) def __str__(self): return self.field_name + ': ' + self.field_value def __repr__(self): return "<ExtraField '{}' of '{}: {}'>".format( str(self), self.entity.entity_type, self.entity.full_name )
mit
6,016,156,342,892,989,000
28.280303
77
0.574386
false
pablodiguerero/asterisk.api
migrations/versions/4_add_physical_users_.py
1
1968
"""empty message Revision ID: a374e36d0888 Revises: 4a6559da7594 Create Date: 2017-05-21 22:53:53.490856 """ from alembic import op import sqlalchemy as sa from sqlalchemy.orm import Session from models import physical from models import user # revision identifiers, used by Alembic. revision = '4_add_physical_users' down_revision = '3_modify_user_fields' branch_labels = None depends_on = None def upgrade(): # ### commands auto generated by Alembic - please adjust! ### op.create_table('crm_physical', sa.Column('id', sa.Integer(), nullable=False), sa.Column('fam', sa.String(length=255), nullable=True), sa.Column('name', sa.String(length=255), nullable=False), sa.Column('otch', sa.String(length=255), nullable=True), sa.PrimaryKeyConstraint('id') ) op.create_table('crm_users', sa.Column('id', sa.Integer(), nullable=False), sa.Column('login', sa.String(length=255), nullable=False), sa.Column('password', sa.LargeBinary(), nullable=False), sa.Column('access_level', sa.Integer(), server_default='10', nullable=False), sa.Column('is_active', sa.Boolean(), server_default='f', nullable=False), sa.ForeignKeyConstraint(['id'], ['crm_physical.id'], ondelete='CASCADE'), sa.PrimaryKeyConstraint('id'), sa.UniqueConstraint('login') ) op.add_column('crm_users', sa.Column('sip_id', sa.Integer(), nullable=True)) op.create_foreign_key(None, 'crm_users', 'asterisk_sip_users', ['sip_id'], ['id'], ondelete='SET NULL') # ### end Alembic commands ### bind = op.get_bind() session = Session(bind) phys = physical.Physical("Администратор") phys.user = user.User("admin", "admin") phys.user.access_level = user.User.BOSS session.add(phys) session.commit() def downgrade(): # ### commands auto generated by Alembic - please adjust! ### op.drop_table('crm_users') op.drop_table('crm_physical') # ### end Alembic commands ###
mit
1,240,968,507,135,020,300
31.583333
107
0.670588
false
wesm/ibis
dev/merge-pr.py
1
8184
#!/usr/bin/env python # # Licensed to the Apache Software Foundation (ASF) under one or more # contributor license agreements. See the NOTICE file distributed with # this work for additional information regarding copyright ownership. # The ASF licenses this file to You under the Apache License, Version 2.0 # (the "License"); you may not use this file except in compliance with # the License. You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # # Utility for creating well-formed pull request merges and pushing them to # Apache. # usage: ./apache-pr-merge.py (see config env vars below) # # Lightly modified from version of this script in incubator-parquet-format from __future__ import print_function from requests.auth import HTTPBasicAuth import requests import os import subprocess import sys import textwrap from six.moves import input import six IBIS_HOME = os.path.abspath(__file__).rsplit("/", 2)[0] PROJECT_NAME = 'ibis' print("IBIS_HOME = " + IBIS_HOME) # Remote name with the PR PR_REMOTE_NAME = os.environ.get("PR_REMOTE_NAME", "upstream") # Remote name where results pushed PUSH_REMOTE_NAME = os.environ.get("PUSH_REMOTE_NAME", "upstream") GITHUB_BASE = "https://github.com/cloudera/" + PROJECT_NAME + "/pull" GITHUB_API_BASE = "https://api.github.com/repos/cloudera/" + PROJECT_NAME # Prefix added to temporary branches BRANCH_PREFIX = "PR_TOOL" os.chdir(IBIS_HOME) auth_required = False if auth_required: GITHUB_USERNAME = os.environ['GITHUB_USER'] import getpass GITHUB_PASSWORD = getpass.getpass('Enter github.com password for %s:' % GITHUB_USERNAME) def get_json_auth(url): auth = HTTPBasicAuth(GITHUB_USERNAME, GITHUB_PASSWORD) req = requests.get(url, auth=auth) return req.json() get_json = get_json_auth else: def get_json_no_auth(url): req = requests.get(url) return req.json() get_json = get_json_no_auth def fail(msg): print(msg) clean_up() sys.exit(-1) def run_cmd(cmd): if isinstance(cmd, six.string_types): cmd = cmd.split(' ') try: output = subprocess.check_output(cmd) except subprocess.CalledProcessError as e: # this avoids hiding the stdout / stderr of failed processes print('Command failed: %s' % cmd) print('With output:') print('--------------') print(e.output) print('--------------') raise e if isinstance(output, six.binary_type): output = output.decode('utf-8') return output def continue_maybe(prompt): result = input("\n%s (y/n): " % prompt) if result.lower() != "y": fail("Okay, exiting") original_head = run_cmd("git rev-parse HEAD")[:8] def clean_up(): print("Restoring head pointer to %s" % original_head) run_cmd("git checkout %s" % original_head) branches = run_cmd("git branch").replace(" ", "").split("\n") for branch in filter(lambda x: x.startswith(BRANCH_PREFIX), branches): print("Deleting local branch %s" % branch) run_cmd("git branch -D %s" % branch) # merge the requested PR and return the merge hash def merge_pr(pr_num, target_ref): pr_branch_name = "%s_MERGE_PR_%s" % (BRANCH_PREFIX, pr_num) target_branch_name = "%s_MERGE_PR_%s_%s" % (BRANCH_PREFIX, pr_num, target_ref.upper()) run_cmd("git fetch %s pull/%s/head:%s" % (PR_REMOTE_NAME, pr_num, pr_branch_name)) run_cmd("git fetch %s %s:%s" % (PUSH_REMOTE_NAME, target_ref, target_branch_name)) run_cmd("git checkout %s" % target_branch_name) had_conflicts = False try: run_cmd(['git', 'merge', pr_branch_name, '--squash']) except Exception as e: msg = ("Error merging: %s\nWould you like to " "manually fix-up this merge?" % e) continue_maybe(msg) msg = ("Okay, please fix any conflicts and 'git add' " "conflicting files... Finished?") continue_maybe(msg) had_conflicts = True commit_authors = run_cmd(['git', 'log', 'HEAD..%s' % pr_branch_name, '--pretty=format:%an <%ae>']).split("\n") distinct_authors = sorted(set(commit_authors), key=lambda x: commit_authors.count(x), reverse=True) primary_author = distinct_authors[0] commits = run_cmd(['git', 'log', 'HEAD..%s' % pr_branch_name, '--pretty=format:%h [%an] %s']).split("\n\n") merge_message_flags = [] merge_message_flags += ["-m", title] if body is not None: merge_message_flags += ["-m", '\n'.join(textwrap.wrap(body))] authors = "\n".join(["Author: %s" % a for a in distinct_authors]) merge_message_flags += ["-m", authors] if had_conflicts: committer_name = run_cmd("git config --get user.name").strip() committer_email = run_cmd("git config --get user.email").strip() message = ("This patch had conflicts when merged, " "resolved by\nCommitter: %s <%s>" % (committer_name, committer_email)) merge_message_flags += ["-m", message] # The string "Closes #%s" string is required for GitHub to correctly close # the PR merge_message_flags += [ "-m", "Closes #%s from %s and squashes the following commits:" % (pr_num, pr_repo_desc)] for c in commits: merge_message_flags += ["-m", c] run_cmd(['git', 'commit', '--no-verify', # do not run commit hooks '--author="%s"' % primary_author] + merge_message_flags) continue_maybe("Merge complete (local ref %s). Push to %s?" % ( target_branch_name, PUSH_REMOTE_NAME)) try: run_cmd('git push %s %s:%s' % (PUSH_REMOTE_NAME, target_branch_name, target_ref)) except Exception as e: clean_up() fail("Exception while pushing: %s" % e) merge_hash = run_cmd("git rev-parse %s" % target_branch_name)[:8] clean_up() print("Pull request #%s merged!" % pr_num) print("Merge hash: %s" % merge_hash) return merge_hash branches = get_json("%s/branches" % GITHUB_API_BASE) branch_names = filter(lambda x: x.startswith("branch-"), [x['name'] for x in branches]) pr_num = input("Which pull request would you like to merge? (e.g. 34): ") pr = get_json("%s/pulls/%s" % (GITHUB_API_BASE, pr_num)) url = pr["url"] title = pr["title"] body = pr["body"] target_ref = pr["base"]["ref"] user_login = pr["user"]["login"] base_ref = pr["head"]["ref"] pr_repo_desc = "%s/%s" % (user_login, base_ref) if pr["merged"] is True: print("Pull request {0} has already been merged, assuming " "you want to backport".format(pr_num)) merge_commit_desc = run_cmd([ 'git', 'log', '--merges', '--first-parent', '--grep=pull request #%s' % pr_num, '--oneline']).split("\n")[0] if merge_commit_desc == "": fail("Couldn't find any merge commit for #{0}" ", you may need to update HEAD.".format(pr_num)) merge_hash = merge_commit_desc[:7] message = merge_commit_desc[8:] print("Found: %s" % message) sys.exit(0) if not bool(pr["mergeable"]): msg = ("Pull request {0} is not mergeable in its current form.\n" "Continue? (experts only!)".format(pr_num)) continue_maybe(msg) print("\n=== Pull Request #%s ===" % pr_num) print("title\t%s\nsource\t%s\ntarget\t%s\nurl\t%s" % ( title, pr_repo_desc, target_ref, url)) continue_maybe("Proceed with merging pull request #%s?" % pr_num) merged_refs = [target_ref] merge_hash = merge_pr(pr_num, target_ref)
apache-2.0
-6,758,902,495,747,892,000
31.86747
78
0.601417
false
vinoth3v/In
In/core/valuator.py
1
7873
import re from In.core.object_meta import ObjectMetaBase class ValuatorContainer(dict): def __missing__(self, key): vcls = IN.register.get_class(key, 'Valuator') obj = vcls() self[key] = obj return obj class ValuatorEngine: '''Valuator class that valuate values based on validation rules. Instance available as IN.valuator ''' # dict of all Valuator instances valuators = ValuatorContainer() def validate(self, value, rule): # rule is ['type', args] or [[], [], []] ''' #TODO: allow per false error message rule = [ 'And', [ ['Length', '>', 6, 'The value length should be greater than 6.'], ['Not', [['Num']], ['Or', [ ['Email', 'Invalid email address.'], ['Domain'], ['Url', 'Invalid Url.'], ]], ]], ] ''' if not rule: # empty list return [True] try: firstitem = rule[0] item_type = type(firstitem) if item_type is str: # ['type', args] args = rule[1:] result = self.valuators[firstitem].validate(value, *args) if not result[0]: #return [False, args[-1]] # last item is error message return result elif item_type is list: # [[], [], []] for subrule in rule: result = self.validate(value, subrule) # recursive if not result[0]: return result except Exception as e: IN.logger.debug() return [False, str(e)] return [True] def __getattr__(self, key): self.key = self.valuators[key] return self.key class ValuatorMeta(ObjectMetaBase): __class_type_base_name__ = 'ValuatorBase' __class_type_name__ = 'Valuator' class ValuatorBase(dict, metaclass = ValuatorMeta): '''Base class of all IN ValuatorBase. ''' __allowed_children__ = None __default_child__ = None ops = { '=' : lambda l, al, ml: l == al, '==' : lambda l, al, ml: l == al, '!=' : lambda l, al, ml: l != al, '>' : lambda l, al, ml: l > al, '<' : lambda l, al, ml: l < al, '>=' : lambda l, al, ml: l >= al, '<=' : lambda l, al, ml: l <= al, '<>' : lambda l, al, ml: al < l > ml, '><' : lambda l, al, ml: al > l < ml, } def validate(self, value): '''return value should be a list like [False, 'Error message.'] or [True] ''' return [True] @IN.register('Valuator', type = 'Valuator') class Valuator(ValuatorBase): '''Base class of all IN ValuatorBase. ''' pass class And(Valuator): pass class Or(Valuator): pass class Not(Valuator): def validate(self, value, rule, message = ''): '''not validator''' result = IN.valuator.validate(value, rule[0]) not_result = not result[0] return [not_result, message] class Empty(Valuator): def validate(self, value, message = ''): # returning value itself makes it evaluates again return [False, message] if value else [True] class NotEmpty(Valuator): def validate(self, value, message = ''): # returning value itself makes it evaluates again return [False, message] if not value else [True] class Length(Valuator): def validate(self, value, length = 0, op = '=', mlength = 0, message = ''): try: # does multiple ifs are good? result = self.ops[op](len(value), length, mlength) result = [result or False, message] return result except KeyError: IN.logger.debug() return [False, message] # always false class Equal(Valuator): def validate(self, value, tvalue, op = '=', mvalue = 0, message = ''): try: # does multiple ifs are good? result = self.ops[op](value, tvalue, mvalue) result = [result or False, message] return result except KeyError: IN.logger.debug() return [False, message] # always false class Regx(Valuator): '''Valuator rule class that using regex''' re_compiled = {} # we dont want to compile again def get_regx(self, regx): try: return self.re_compiled[regx] except KeyError: self.re_compiled[regx] = re.compile(regx) return self.re_compiled[regx] def validate(self, value, regx, message = ''): result = self.get_regx(regx).match(value) return [result, message] class Domain(Regx): regex_host = r'(?:(?:[a-zA-Z0-9][a-zA-Z0-9\-]*)?[a-zA-Z0-9])' def validate(self, domain, message = ''): false_message = [False, message] dlen = len(domain) if dlen < 4 or dlen > 255 or domain.endswith('.') or '.' not in domain: return false_message try: domain = domain.encode('idna').decode('ascii') except Exception: return false_message try: domain.encode('ascii').decode('idna') except Exception: return false_message reg = self.regex_host + r'(?:\.' + self.regex_host + r')*' m = re.match(reg + "$", domain) if not m: return false_message return [True] class Email(Regx): regex = re.compile(r'^[A-Za-z0-9\.\+_-]') atext = r'a-zA-Z0-9_\.\-' # !#\$%&\'\*\+/=\?\^`\{\|\}~ atext_utf8 = atext + r"\u0080-\U0010FFFF" regex_local = re.compile(''.join(('[', atext, ']+(?:\\.[', atext, ']+)*$'))) regex_local_utf8 = re.compile(''.join(('[', atext_utf8, ']+(?:\\.[', atext_utf8, ']+)*$'))) def validate(self, value, message = ''): parts = value.split('@') if len(parts) != 2: return [False, message] local = self.validate_local(parts[0]) if not local: return [False, message] # check domain part domain_result = IN.valuator.validate(parts[1], ['Domain', message]) if not domain_result[0]: return domain_result return [True] # valid def validate_local(self, local): # check nabar name part if not local or len(local) > 64 or '..' in local: return False m = re.match(self.regex_local, local) # ASCII if m: # True return True else: # unicode m = re.match(self.regex_local_utf8, local) if m: return True else: return False class Url(Regx): def validate(self, value, message = ''): return True class Alpha(Valuator): def validate(self, value, message = ''): return [str.isalpha(value), message] class AlphaNum(Valuator): def validate(self, value, message = ''): return [str.isalnum(value), message] class Digit(Valuator): def validate(self, value, message = ''): return [str.isdigit(value), message] class Decimal(Valuator): def validate(self, value, message = ''): return [str.isdecimal(value), message] class Lower(Valuator): def validate(self, value, message = ''): return [str.islower(value), message] class Upper(Valuator): def validate(self, value, message = ''): return [str.isupper(value), message] class Numeric(Valuator): def validate(self, value, message = ''): return [str.isnumeric(value), message] class Space(Valuator): '''Is value has only non printable chars''' def validate(self, value, message = ''): return [str.isspace(value), message] class Startswith(Valuator): def validate(self, value, start, message = ''): return [str(value).startswith(start), message] class Endswith(Valuator): def validate(self, value, start, message = ''): return [str(value).endswith(start), message] class In(Valuator): def validate(self, value, itr, message = ''): return [value in itr, message] class INPath(Valuator): '''Check whether this string is a valid IN route.''' def validate(self, value, message = ''): return True class NabarRole(Valuator): '''Check whether nabar has this role.''' def validate(self, value, message = ''): return True class NabarAccess(Valuator): '''Check whether nabar has this access permissions.''' def validate(self, value): return True class Callback(Valuator): '''call the Callback to valuate.''' def validate(self, value, message = ''): return True #@IN.hook #def __In_app_init__(app): ### set the valuator #IN.valuator = ValuatorEngine()
apache-2.0
3,151,906,794,283,461,600
23.396774
92
0.61133
false
plotly/plotly.py
packages/python/plotly/plotly/graph_objs/heatmapgl/legendgrouptitle/_font.py
1
8487
from plotly.basedatatypes import BaseTraceHierarchyType as _BaseTraceHierarchyType import copy as _copy class Font(_BaseTraceHierarchyType): # class properties # -------------------- _parent_path_str = "heatmapgl.legendgrouptitle" _path_str = "heatmapgl.legendgrouptitle.font" _valid_props = {"color", "family", "size"} # color # ----- @property def color(self): """ The 'color' property is a color and may be specified as: - A hex string (e.g. '#ff0000') - An rgb/rgba string (e.g. 'rgb(255,0,0)') - An hsl/hsla string (e.g. 'hsl(0,100%,50%)') - An hsv/hsva string (e.g. 'hsv(0,100%,100%)') - A named CSS color: aliceblue, antiquewhite, aqua, aquamarine, azure, beige, bisque, black, blanchedalmond, blue, blueviolet, brown, burlywood, cadetblue, chartreuse, chocolate, coral, cornflowerblue, cornsilk, crimson, cyan, darkblue, darkcyan, darkgoldenrod, darkgray, darkgrey, darkgreen, darkkhaki, darkmagenta, darkolivegreen, darkorange, darkorchid, darkred, darksalmon, darkseagreen, darkslateblue, darkslategray, darkslategrey, darkturquoise, darkviolet, deeppink, deepskyblue, dimgray, dimgrey, dodgerblue, firebrick, floralwhite, forestgreen, fuchsia, gainsboro, ghostwhite, gold, goldenrod, gray, grey, green, greenyellow, honeydew, hotpink, indianred, indigo, ivory, khaki, lavender, lavenderblush, lawngreen, lemonchiffon, lightblue, lightcoral, lightcyan, lightgoldenrodyellow, lightgray, lightgrey, lightgreen, lightpink, lightsalmon, lightseagreen, lightskyblue, lightslategray, lightslategrey, lightsteelblue, lightyellow, lime, limegreen, linen, magenta, maroon, mediumaquamarine, mediumblue, mediumorchid, mediumpurple, mediumseagreen, mediumslateblue, mediumspringgreen, mediumturquoise, mediumvioletred, midnightblue, mintcream, mistyrose, moccasin, navajowhite, navy, oldlace, olive, olivedrab, orange, orangered, orchid, palegoldenrod, palegreen, paleturquoise, palevioletred, papayawhip, peachpuff, peru, pink, plum, powderblue, purple, red, rosybrown, royalblue, rebeccapurple, saddlebrown, salmon, sandybrown, seagreen, seashell, sienna, silver, skyblue, slateblue, slategray, slategrey, snow, springgreen, steelblue, tan, teal, thistle, tomato, turquoise, violet, wheat, white, whitesmoke, yellow, yellowgreen Returns ------- str """ return self["color"] @color.setter def color(self, val): self["color"] = val # family # ------ @property def family(self): """ HTML font family - the typeface that will be applied by the web browser. The web browser will only be able to apply a font if it is available on the system which it operates. Provide multiple font families, separated by commas, to indicate the preference in which to apply fonts if they aren't available on the system. The Chart Studio Cloud (at https://chart- studio.plotly.com or on-premise) generates images on a server, where only a select number of fonts are installed and supported. These include "Arial", "Balto", "Courier New", "Droid Sans",, "Droid Serif", "Droid Sans Mono", "Gravitas One", "Old Standard TT", "Open Sans", "Overpass", "PT Sans Narrow", "Raleway", "Times New Roman". The 'family' property is a string and must be specified as: - A non-empty string Returns ------- str """ return self["family"] @family.setter def family(self, val): self["family"] = val # size # ---- @property def size(self): """ The 'size' property is a number and may be specified as: - An int or float in the interval [1, inf] Returns ------- int|float """ return self["size"] @size.setter def size(self, val): self["size"] = val # Self properties description # --------------------------- @property def _prop_descriptions(self): return """\ color family HTML font family - the typeface that will be applied by the web browser. The web browser will only be able to apply a font if it is available on the system which it operates. Provide multiple font families, separated by commas, to indicate the preference in which to apply fonts if they aren't available on the system. The Chart Studio Cloud (at https://chart-studio.plotly.com or on- premise) generates images on a server, where only a select number of fonts are installed and supported. These include "Arial", "Balto", "Courier New", "Droid Sans",, "Droid Serif", "Droid Sans Mono", "Gravitas One", "Old Standard TT", "Open Sans", "Overpass", "PT Sans Narrow", "Raleway", "Times New Roman". size """ def __init__(self, arg=None, color=None, family=None, size=None, **kwargs): """ Construct a new Font object Sets this legend group's title font. Parameters ---------- arg dict of properties compatible with this constructor or an instance of :class:`plotly.graph_objs.heatmapgl.lege ndgrouptitle.Font` color family HTML font family - the typeface that will be applied by the web browser. The web browser will only be able to apply a font if it is available on the system which it operates. Provide multiple font families, separated by commas, to indicate the preference in which to apply fonts if they aren't available on the system. The Chart Studio Cloud (at https://chart-studio.plotly.com or on- premise) generates images on a server, where only a select number of fonts are installed and supported. These include "Arial", "Balto", "Courier New", "Droid Sans",, "Droid Serif", "Droid Sans Mono", "Gravitas One", "Old Standard TT", "Open Sans", "Overpass", "PT Sans Narrow", "Raleway", "Times New Roman". size Returns ------- Font """ super(Font, self).__init__("font") if "_parent" in kwargs: self._parent = kwargs["_parent"] return # Validate arg # ------------ if arg is None: arg = {} elif isinstance(arg, self.__class__): arg = arg.to_plotly_json() elif isinstance(arg, dict): arg = _copy.copy(arg) else: raise ValueError( """\ The first argument to the plotly.graph_objs.heatmapgl.legendgrouptitle.Font constructor must be a dict or an instance of :class:`plotly.graph_objs.heatmapgl.legendgrouptitle.Font`""" ) # Handle skip_invalid # ------------------- self._skip_invalid = kwargs.pop("skip_invalid", False) self._validate = kwargs.pop("_validate", True) # Populate data dict with properties # ---------------------------------- _v = arg.pop("color", None) _v = color if color is not None else _v if _v is not None: self["color"] = _v _v = arg.pop("family", None) _v = family if family is not None else _v if _v is not None: self["family"] = _v _v = arg.pop("size", None) _v = size if size is not None else _v if _v is not None: self["size"] = _v # Process unknown kwargs # ---------------------- self._process_kwargs(**dict(arg, **kwargs)) # Reset skip_invalid # ------------------ self._skip_invalid = False
mit
5,632,017,995,005,265,000
36.387665
82
0.559797
false
danhooper/sandbox
pinball/attract.py
1
2386
from procgame import * class Mode(game.Mode): def __init__(self, game): super(Mode, self).__init__(game, 1) highscore_categories = [] cat = highscore.HighScoreCategory() cat.game_data_key = "HighScores" cat.titles = [ "Grand Champion", "High Score 1", "High Score 2", "High Score 3", "High Score 4" ] highscore_categories.append(cat) for category in highscore_categories: category.load_from_game(game) frame_proc = dmd.Animation().load('dmd/P-ROC.dmd').frames[0] layer_proc = dmd.FrameLayer(opaque=True, frame=frame_proc) layer_th = dmd.TextLayer(128/2, 7, game.font_jazz, "center", opaque=True).set_text("Town Hall") layer_presents = dmd.TextLayer(128/2, 7, game.font_jazz, "center", opaque=True).set_text("Presents") layer_name = dmd.TextLayer(128/2, 7, game.font_jazz, "center", opaque=True).set_text("TBD") layer_high_scores = [] for frame in highscore.generate_highscore_frames(highscore_categories): layer_high_scores.append(dmd.FrameLayer(opaque=True, frame=frame)) self.layer = dmd.ScriptedLayer(128, 32, [ { "layer": None, "seconds": 10.0 }, { "layer": layer_proc, "seconds": 3.0 }, { "layer": layer_th, "seconds": 3.0 }, { "layer": layer_presents, "seconds": 3.0 }, { "layer": layer_name, "seconds": 3.0 }, { "layer": layer_high_scores[0], "seconds": 3.0 }, { "layer": layer_high_scores[1], "seconds": 3.0 }, { "layer": layer_high_scores[2], "seconds": 3.0 }, { "layer": layer_high_scores[3], "seconds": 3.0 }, { "layer": layer_high_scores[4], "seconds": 3.0 }, ]) def mode_stopped(self): self.layer.script_index = 0 self.frame_start_time = None self.is_new_script_item = True def sw_enter_active(self, sw): self.game.modes.add(self.game.service_mode) return True def sw_exit_active(self, sw): return True def sw_startButton_active(self, sw): self.game.modes.remove(self) self.game.modes.add(self.game.mode.base) return True
mit
-5,484,256,992,289,313,000
38.766667
79
0.536463
false
userzimmermann/robotframework-python3
src/robot/utils/text.py
1
3235
# Copyright 2008-2014 Nokia Solutions and Networks # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. from .charwidth import get_char_width from .misc import seq2str2 from .unic import unic _MAX_ASSIGN_LENGTH = 200 _MAX_ERROR_LINES = 40 _MAX_ERROR_LINE_LENGTH = 78 _ERROR_CUT_EXPLN = ' [ Message content over the limit has been removed. ]' def cut_long_message(msg): lines = msg.splitlines() lengths = _count_line_lengths(lines) if sum(lengths) <= _MAX_ERROR_LINES: return msg start = _prune_excess_lines(lines, lengths) end = _prune_excess_lines(lines, lengths, from_end=True) return '\n'.join(start + [_ERROR_CUT_EXPLN] + end) def _prune_excess_lines(lines, lengths, from_end=False): if from_end: lines.reverse() lengths.reverse() ret = [] total = 0 # Use // (explicit int div) for Python 3 compatibility: limit = _MAX_ERROR_LINES//2 for line, length in zip(lines[:limit], lengths[:limit]): if total + length >= limit: ret.append(_cut_long_line(line, total, from_end)) break total += length ret.append(line) if from_end: ret.reverse() return ret def _cut_long_line(line, used, from_end): # Use // (explicit int div) for Python 3 compatibility: available_lines = _MAX_ERROR_LINES//2 - used available_chars = available_lines * _MAX_ERROR_LINE_LENGTH - 3 if len(line) > available_chars: if not from_end: line = line[:available_chars] + '...' else: line = '...' + line[-available_chars:] return line def _count_line_lengths(lines): return [ _count_virtual_line_length(line) for line in lines ] def _count_virtual_line_length(line): if not line: return 1 lines, remainder = divmod(len(line), _MAX_ERROR_LINE_LENGTH) return lines if not remainder else lines + 1 def format_assign_message(variable, value, cut_long=True): value = unic(value) if variable.startswith('$') else seq2str2(value) if cut_long and len(value) > _MAX_ASSIGN_LENGTH: value = value[:_MAX_ASSIGN_LENGTH] + '...' return '%s = %s' % (variable, value) def get_console_length(text): return sum(get_char_width(char) for char in text) def pad_console_length(text, width): if width < 5: width = 5 diff = get_console_length(text) - width if diff > 0: text = _lose_width(text, diff+3) + '...' return _pad_width(text, width) def _pad_width(text, width): more = width - get_console_length(text) return text + ' ' * more def _lose_width(text, diff): lost = 0 while lost < diff: lost += get_console_length(text[-1]) text = text[:-1] return text
apache-2.0
7,472,979,966,690,661,000
30.715686
77
0.643586
false
chromium/chromium
build/util/lib/common/chrome_test_server_spawner.py
6
16817
# Copyright 2017 The Chromium Authors. All rights reserved. # Use of this source code is governed by a BSD-style license that can be # found in the LICENSE file. """A "Test Server Spawner" that handles killing/stopping per-test test servers. It's used to accept requests from the device to spawn and kill instances of the chrome test server on the host. """ # pylint: disable=W0702 import json import logging import os import select import struct import subprocess import sys import threading import time from six.moves import BaseHTTPServer, urllib SERVER_TYPES = { 'http': '', 'ftp': '-f', 'ws': '--websocket', } _DIR_SOURCE_ROOT = os.path.abspath( os.path.join(os.path.dirname(__file__), os.pardir, os.pardir, os.pardir, os.pardir)) _logger = logging.getLogger(__name__) # Path that are needed to import necessary modules when launching a testserver. os.environ['PYTHONPATH'] = os.environ.get('PYTHONPATH', '') + (':%s:%s:%s' % (os.path.join(_DIR_SOURCE_ROOT, 'third_party'), os.path.join(_DIR_SOURCE_ROOT, 'third_party', 'tlslite'), os.path.join(_DIR_SOURCE_ROOT, 'net', 'tools', 'testserver'))) # The timeout (in seconds) of starting up the Python test server. _TEST_SERVER_STARTUP_TIMEOUT = 10 def _GetServerTypeCommandLine(server_type): """Returns the command-line by the given server type. Args: server_type: the server type to be used (e.g. 'http'). Returns: A string containing the command-line argument. """ if server_type not in SERVER_TYPES: raise NotImplementedError('Unknown server type: %s' % server_type) return SERVER_TYPES[server_type] class PortForwarder: def Map(self, port_pairs): pass def GetDevicePortForHostPort(self, host_port): """Returns the device port that corresponds to a given host port.""" return host_port def WaitHostPortAvailable(self, port): """Returns True if |port| is available.""" return True def WaitPortNotAvailable(self, port): """Returns True if |port| is not available.""" return True def WaitDevicePortReady(self, port): """Returns whether the provided port is used.""" return True def Unmap(self, device_port): """Unmaps specified port""" pass class TestServerThread(threading.Thread): """A thread to run the test server in a separate process.""" def __init__(self, ready_event, arguments, port_forwarder): """Initialize TestServerThread with the following argument. Args: ready_event: event which will be set when the test server is ready. arguments: dictionary of arguments to run the test server. device: An instance of DeviceUtils. tool: instance of runtime error detection tool. """ threading.Thread.__init__(self) self.wait_event = threading.Event() self.stop_event = threading.Event() self.ready_event = ready_event self.ready_event.clear() self.arguments = arguments self.port_forwarder = port_forwarder self.test_server_process = None self.is_ready = False self.host_port = self.arguments['port'] self.host_ocsp_port = 0 assert isinstance(self.host_port, int) # The forwarder device port now is dynamically allocated. self.forwarder_device_port = 0 self.forwarder_ocsp_device_port = 0 # Anonymous pipe in order to get port info from test server. self.pipe_in = None self.pipe_out = None self.process = None self.command_line = [] def _WaitToStartAndGetPortFromTestServer(self): """Waits for the Python test server to start and gets the port it is using. The port information is passed by the Python test server with a pipe given by self.pipe_out. It is written as a result to |self.host_port|. Returns: Whether the port used by the test server was successfully fetched. """ assert self.host_port == 0 and self.pipe_out and self.pipe_in (in_fds, _, _) = select.select([self.pipe_in, ], [], [], _TEST_SERVER_STARTUP_TIMEOUT) if len(in_fds) == 0: _logger.error('Failed to wait to the Python test server to be started.') return False # First read the data length as an unsigned 4-byte value. This # is _not_ using network byte ordering since the Python test server packs # size as native byte order and all Chromium platforms so far are # configured to use little-endian. # TODO(jnd): Change the Python test server and local_test_server_*.cc to # use a unified byte order (either big-endian or little-endian). data_length = os.read(self.pipe_in, struct.calcsize('=L')) if data_length: (data_length,) = struct.unpack('=L', data_length) assert data_length if not data_length: _logger.error('Failed to get length of server data.') return False server_data_json = os.read(self.pipe_in, data_length) if not server_data_json: _logger.error('Failed to get server data.') return False _logger.info('Got port json data: %s', server_data_json) parsed_server_data = None try: parsed_server_data = json.loads(server_data_json) except ValueError: pass if not isinstance(parsed_server_data, dict): _logger.error('Failed to parse server_data: %s' % server_data_json) return False if not isinstance(parsed_server_data.get('port'), int): _logger.error('Failed to get port information from the server data.') return False self.host_port = parsed_server_data['port'] self.host_ocsp_port = parsed_server_data.get('ocsp_port', 0) return self.port_forwarder.WaitPortNotAvailable(self.host_port) def _GenerateCommandLineArguments(self): """Generates the command line to run the test server. Note that all options are processed by following the definitions in testserver.py. """ if self.command_line: return args_copy = dict(self.arguments) # Translate the server type. type_cmd = _GetServerTypeCommandLine(args_copy.pop('server-type')) if type_cmd: self.command_line.append(type_cmd) # Use a pipe to get the port given by the instance of Python test server # if the test does not specify the port. assert self.host_port == args_copy['port'] if self.host_port == 0: (self.pipe_in, self.pipe_out) = os.pipe() self.command_line.append('--startup-pipe=%d' % self.pipe_out) # Pass the remaining arguments as-is. for key, values in args_copy.iteritems(): if not isinstance(values, list): values = [values] for value in values: if value is None: self.command_line.append('--%s' % key) else: self.command_line.append('--%s=%s' % (key, value)) def _CloseUnnecessaryFDsForTestServerProcess(self): # This is required to avoid subtle deadlocks that could be caused by the # test server child process inheriting undesirable file descriptors such as # file lock file descriptors. for fd in xrange(0, 1024): if fd != self.pipe_out: try: os.close(fd) except: pass def run(self): _logger.info('Start running the thread!') self.wait_event.clear() self._GenerateCommandLineArguments() command = [sys.executable, os.path.join(_DIR_SOURCE_ROOT, 'net', 'tools', 'testserver', 'testserver.py')] + self.command_line _logger.info('Running: %s', command) # Disable PYTHONUNBUFFERED because it has a bad interaction with the # testserver. Remove once this interaction is fixed. unbuf = os.environ.pop('PYTHONUNBUFFERED', None) # Pass _DIR_SOURCE_ROOT as the child's working directory so that relative # paths in the arguments are resolved correctly. self.process = subprocess.Popen( command, preexec_fn=self._CloseUnnecessaryFDsForTestServerProcess, cwd=_DIR_SOURCE_ROOT) if unbuf: os.environ['PYTHONUNBUFFERED'] = unbuf if self.process: if self.pipe_out: self.is_ready = self._WaitToStartAndGetPortFromTestServer() else: self.is_ready = self.port_forwarder.WaitPortNotAvailable(self.host_port) if self.is_ready: port_map = [(0, self.host_port)] if self.host_ocsp_port: port_map.extend([(0, self.host_ocsp_port)]) self.port_forwarder.Map(port_map) self.forwarder_device_port = \ self.port_forwarder.GetDevicePortForHostPort(self.host_port) if self.host_ocsp_port: self.forwarder_ocsp_device_port = \ self.port_forwarder.GetDevicePortForHostPort(self.host_ocsp_port) # Check whether the forwarder is ready on the device. self.is_ready = self.forwarder_device_port and \ self.port_forwarder.WaitDevicePortReady(self.forwarder_device_port) # Wake up the request handler thread. self.ready_event.set() # Keep thread running until Stop() gets called. self.stop_event.wait() if self.process.poll() is None: self.process.kill() # Wait for process to actually terminate. # (crbug.com/946475) self.process.wait() self.port_forwarder.Unmap(self.forwarder_device_port) self.process = None self.is_ready = False if self.pipe_out: os.close(self.pipe_in) os.close(self.pipe_out) self.pipe_in = None self.pipe_out = None _logger.info('Test-server has died.') self.wait_event.set() def Stop(self): """Blocks until the loop has finished. Note that this must be called in another thread. """ if not self.process: return self.stop_event.set() self.wait_event.wait() class SpawningServerRequestHandler(BaseHTTPServer.BaseHTTPRequestHandler): """A handler used to process http GET/POST request.""" def _SendResponse(self, response_code, response_reason, additional_headers, contents): """Generates a response sent to the client from the provided parameters. Args: response_code: number of the response status. response_reason: string of reason description of the response. additional_headers: dict of additional headers. Each key is the name of the header, each value is the content of the header. contents: string of the contents we want to send to client. """ self.send_response(response_code, response_reason) self.send_header('Content-Type', 'text/html') # Specify the content-length as without it the http(s) response will not # be completed properly (and the browser keeps expecting data). self.send_header('Content-Length', len(contents)) for header_name in additional_headers: self.send_header(header_name, additional_headers[header_name]) self.end_headers() self.wfile.write(contents) self.wfile.flush() def _StartTestServer(self): """Starts the test server thread.""" _logger.info('Handling request to spawn a test server.') content_type = self.headers.getheader('content-type') if content_type != 'application/json': raise Exception('Bad content-type for start request.') content_length = self.headers.getheader('content-length') if not content_length: content_length = 0 try: content_length = int(content_length) except: raise Exception('Bad content-length for start request.') _logger.info(content_length) test_server_argument_json = self.rfile.read(content_length) _logger.info(test_server_argument_json) if len(self.server.test_servers) >= self.server.max_instances: self._SendResponse(400, 'Invalid request', {}, 'Too many test servers running') return ready_event = threading.Event() new_server = TestServerThread(ready_event, json.loads(test_server_argument_json), self.server.port_forwarder) new_server.setDaemon(True) new_server.start() ready_event.wait() if new_server.is_ready: response = {'port': new_server.forwarder_device_port, 'message': 'started'}; if new_server.forwarder_ocsp_device_port: response['ocsp_port'] = new_server.forwarder_ocsp_device_port self._SendResponse(200, 'OK', {}, json.dumps(response)) _logger.info('Test server is running on port %d forwarded to %d.' % (new_server.forwarder_device_port, new_server.host_port)) port = new_server.forwarder_device_port assert port not in self.server.test_servers self.server.test_servers[port] = new_server else: new_server.Stop() self._SendResponse(500, 'Test Server Error.', {}, '') _logger.info('Encounter problem during starting a test server.') def _KillTestServer(self, params): """Stops the test server instance.""" try: port = int(params['port'][0]) except ValueError: port = None if port == None or port <= 0: self._SendResponse(400, 'Invalid request.', {}, 'port must be specified') return if port not in self.server.test_servers: self._SendResponse(400, 'Invalid request.', {}, "testserver isn't running on port %d" % port) return server = self.server.test_servers.pop(port) _logger.info('Handling request to kill a test server on port: %d.', port) server.Stop() # Make sure the status of test server is correct before sending response. if self.server.port_forwarder.WaitHostPortAvailable(port): self._SendResponse(200, 'OK', {}, 'killed') _logger.info('Test server on port %d is killed', port) else: # We expect the port to be free, but nothing stops the system from # binding something else to that port, so don't throw error. # (crbug.com/946475) self._SendResponse(200, 'OK', {}, '') _logger.warn('Port %s is not free after killing test server.' % port) def log_message(self, format, *args): # Suppress the default HTTP logging behavior if the logging level is higher # than INFO. if _logger.getEffectiveLevel() <= logging.INFO: pass def do_POST(self): parsed_path = urllib.parse.urlparse(self.path) action = parsed_path.path _logger.info('Action for POST method is: %s.', action) if action == '/start': self._StartTestServer() else: self._SendResponse(400, 'Unknown request.', {}, '') _logger.info('Encounter unknown request: %s.', action) def do_GET(self): parsed_path = urllib.parse.urlparse(self.path) action = parsed_path.path params = urllib.parse.parse_qs(parsed_path.query, keep_blank_values=1) _logger.info('Action for GET method is: %s.', action) for param in params: _logger.info('%s=%s', param, params[param][0]) if action == '/kill': self._KillTestServer(params) elif action == '/ping': # The ping handler is used to check whether the spawner server is ready # to serve the requests. We don't need to test the status of the test # server when handling ping request. self._SendResponse(200, 'OK', {}, 'ready') _logger.info('Handled ping request and sent response.') else: self._SendResponse(400, 'Unknown request', {}, '') _logger.info('Encounter unknown request: %s.', action) class SpawningServer(object): """The class used to start/stop a http server.""" def __init__(self, test_server_spawner_port, port_forwarder, max_instances): self.server = BaseHTTPServer.HTTPServer(('', test_server_spawner_port), SpawningServerRequestHandler) self.server_port = self.server.server_port _logger.info('Started test server spawner on port: %d.', self.server_port) self.server.port_forwarder = port_forwarder self.server.test_servers = {} self.server.max_instances = max_instances def _Listen(self): _logger.info('Starting test server spawner.') self.server.serve_forever() def Start(self): """Starts the test server spawner.""" listener_thread = threading.Thread(target=self._Listen) listener_thread.setDaemon(True) listener_thread.start() def Stop(self): """Stops the test server spawner. Also cleans the server state. """ self.CleanupState() self.server.shutdown() def CleanupState(self): """Cleans up the spawning server state. This should be called if the test server spawner is reused, to avoid sharing the test server instance. """ if self.server.test_servers: _logger.warning('Not all test servers were stopped.') for port in self.server.test_servers: _logger.warning('Stopping test server on port %d' % port) self.server.test_servers[port].Stop() self.server.test_servers = {}
bsd-3-clause
3,188,136,761,027,053,600
34.553911
80
0.662068
false
onyxfish/votersdaily_web
api/couchdb/log_views.py
1
2166
import couchdb from couchdb.design import ViewDefinition """ This module defines a collection of functions which accept a CouchDB database as an argument, are named with a 'make_views_*' convention, and return a list of generated CouchDB ViewDefinitions. The 'syncviews' management command dynamically executes each method to compile a list of all Couchdb views. """ def make_views_all_documents(event_db): """ Generate a view that includes all documents. """ all_view_map_function = \ ''' function(doc) { emit(doc.access_datetime, doc) } ''' return [ViewDefinition('api', 'all', all_view_map_function)] def make_views_error_documents(event_db): """ Generate a view that includes all documents. """ error_view_map_function = \ ''' function(doc) { if (doc.result != "success") { emit(doc.access_datetime, doc) } } ''' return [ViewDefinition('api', 'errors', error_view_map_function)] def get_parser_list(event_db): """ Return a list of unique parser names in the database. """ parser_list_map_function = \ ''' function(doc) { emit(doc.parser_name, null); } ''' parser_list_reduce_function = \ ''' function(keys, values) { return null; } ''' return [ e.key for e in event_db.query( parser_list_map_function, parser_list_reduce_function, group=True)] def make_views_parser_lists(event_db): """ Return a list of views, one for each parser, using templated view functions. """ parser_names = get_parser_list(event_db) parser_view_map_function = \ ''' function(doc) { if (doc.parser_name == "%(parser_name)s") { emit(doc.parser_name, doc) } } ''' return [ ViewDefinition('api', name, parser_view_map_function % { 'parser_name': name }) for name in parser_names]
gpl-3.0
4,641,316,289,698,557,000
23.908046
78
0.548476
false
pr-omethe-us/PyKED
pyked/chemked.py
1
44185
""" Main ChemKED module """ # Standard libraries from os.path import exists from collections import namedtuple from warnings import warn from copy import deepcopy import xml.etree.ElementTree as etree import xml.dom.minidom as minidom from itertools import chain import numpy as np # Local imports from .validation import schema, OurValidator, yaml, Q_ from .converters import datagroup_properties, ReSpecTh_to_ChemKED VolumeHistory = namedtuple('VolumeHistory', ['time', 'volume']) VolumeHistory.__doc__ = 'Time history of the volume in an RCM experiment. Deprecated, to be removed after PyKED 0.4' # noqa: E501 VolumeHistory.time.__doc__ = '(`~numpy.ndarray`): the time during the experiment' VolumeHistory.volume.__doc__ = '(`~numpy.ndarray`): the volume during the experiment' TimeHistory = namedtuple('TimeHistory', ['time', 'quantity', 'type']) TimeHistory.__doc__ = 'Time history of the quantity in an RCM experiment' TimeHistory.time.__doc__ = '(`~numpy.ndarray`): the time during the experiment' TimeHistory.quantity.__doc__ = '(`~numpy.ndarray`): the quantity of interest during the experiment' TimeHistory.type.__doc__ = """\ (`str`): the type of time history represented. Possible options are: * volume * temperature * pressure * piston position * light emission * OH emission * absorption """ RCMData = namedtuple( 'RCMData', ['compressed_pressure', 'compressed_temperature', 'compression_time', 'stroke', 'clearance', 'compression_ratio'] ) RCMData.__doc__ = 'Data fields specific to rapid compression machine experiments' RCMData.compressed_pressure.__doc__ = '(`~pint.Quantity`) The pressure at the end of compression' RCMData.compressed_temperature.__doc__ = """\ (`~pint.Quantity`) The temperature at the end of compression""" RCMData.compression_time.__doc__ = '(`~pint.Quantity`) The duration of the compression stroke' RCMData.stroke.__doc__ = '(`~pint.Quantity`) The length of the stroke' RCMData.clearance.__doc__ = """\ (`~pint.Quantity`) The clearance between piston face and end wall at the end of compression""" RCMData.compression_ratio.__doc__ = '(`~pint.Quantity`) The volumetric compression ratio' Reference = namedtuple('Reference', ['volume', 'journal', 'doi', 'authors', 'detail', 'year', 'pages']) Reference.__doc__ = 'Information about the article or report where the data can be found' Reference.volume.__doc__ = '(`str`) The journal volume' Reference.journal.__doc__ = '(`str`) The name of the journal' Reference.doi.__doc__ = '(`str`) The Digital Object Identifier of the article' Reference.authors.__doc__ = '(`list`) The list of authors of the article' Reference.detail.__doc__ = '(`str`) Detail about where the data can be found in the article' Reference.year.__doc__ = '(`str`) The year the article was published' Reference.pages.__doc__ = '(`str`) The pages in the journal where the article was published' Apparatus = namedtuple('Apparatus', ['kind', 'institution', 'facility']) Apparatus.__doc__ = 'Information about the experimental apparatus used to generate the data' Apparatus.kind.__doc__ = '(`str`) The kind of experimental apparatus' Apparatus.institution.__doc__ = '(`str`) The institution where the experiment is located' Apparatus.facility.__doc__ = '(`str`) The particular experimental facility at the location' Composition = namedtuple('Composition', 'species_name InChI SMILES atomic_composition amount') Composition.__doc__ = 'Detail of the initial composition of the mixture for the experiment' Composition.species_name.__doc__ = '(`str`) The name of the species' Composition.InChI.__doc__ = '(`str`) The InChI identifier for the species' Composition.SMILES.__doc__ = '(`str`) The SMILES identifier for the species' Composition.atomic_composition.__doc__ = '(`dict`) The atomic composition of the species' Composition.amount.__doc__ = '(`~pint.Quantity`) The amount of this species' class ChemKED(object): """Main ChemKED class. The ChemKED class stores information about the contents of a ChemKED database file. It stores each datapoint associated with the database and provides access the the reference information, versions, and file author. Arguments: yaml_file (`str`, optional): The filename of the YAML database in ChemKED format. dict_input (`dict`, optional): A dictionary with the parsed ouput of YAML file in ChemKED format. skip_validation (`bool`, optional): Whether validation of the ChemKED should be done. Must be supplied as a keyword-argument. Attributes: datapoints (`list`): List of `DataPoint` objects storing each datapoint in the database. reference (`~collections.namedtuple`): Attributes include ``volume``, ``journal``, ``doi``, ``authors``, ``detail``, ``year``, and ``pages`` describing the reference from which the datapoints are derived. apparatus (`~collections.namedtuple`): Attributes include ``kind`` of experimental apparatus, and the ``institution`` and ``facility`` where the experimental apparatus is located. chemked_version (`str`): Version of the ChemKED database schema used in this file. experiment_type (`str`): Type of exeperimental data contained in this database. file_author (`dict`): Information about the author of the ChemKED database file. file_version (`str`): Version of the ChemKED database file. _properties (`dict`): Original dictionary read from ChemKED database file, meant for internal use. """ def __init__(self, yaml_file=None, dict_input=None, *, skip_validation=False): if yaml_file is not None: with open(yaml_file, 'r') as f: self._properties = yaml.safe_load(f) elif dict_input is not None: self._properties = dict_input else: raise NameError("ChemKED needs either a YAML filename or dictionary as input.") if not skip_validation: self.validate_yaml(self._properties) self.datapoints = [] for point in self._properties['datapoints']: self.datapoints.append(DataPoint(point)) self.reference = Reference( volume=self._properties['reference'].get('volume'), journal=self._properties['reference'].get('journal'), doi=self._properties['reference'].get('doi'), authors=self._properties['reference'].get('authors'), detail=self._properties['reference'].get('detail'), year=self._properties['reference'].get('year'), pages=self._properties['reference'].get('pages'), ) self.apparatus = Apparatus( kind=self._properties['apparatus'].get('kind'), institution=self._properties['apparatus'].get('institution'), facility=self._properties['apparatus'].get('facility'), ) for prop in ['chemked-version', 'experiment-type', 'file-authors', 'file-version']: setattr(self, prop.replace('-', '_'), self._properties[prop]) @classmethod def from_respecth(cls, filename_xml, file_author='', file_author_orcid=''): """Construct a ChemKED instance directly from a ReSpecTh file. Arguments: filename_xml (`str`): Filename of the ReSpecTh-formatted XML file to be imported file_author (`str`, optional): File author to be added to the list generated from the XML file file_author_orcid (`str`, optional): ORCID for the file author being added to the list of file authors Returns: `ChemKED`: Instance of the `ChemKED` class containing the data in ``filename_xml``. Examples: >>> ck = ChemKED.from_respecth('respecth_file.xml') >>> ck = ChemKED.from_respecth('respecth_file.xml', file_author='Bryan W. Weber') >>> ck = ChemKED.from_respecth('respecth_file.xml', file_author='Bryan W. Weber', file_author_orcid='0000-0000-0000-0000') """ properties = ReSpecTh_to_ChemKED(filename_xml, file_author, file_author_orcid, validate=False) return cls(dict_input=properties) def validate_yaml(self, properties): """Validate the parsed YAML file for adherance to the ChemKED format. Arguments: properties (`dict`): Dictionary created from the parsed YAML file Raises: `ValueError`: If the YAML file cannot be validated, a `ValueError` is raised whose string contains the errors that are present. """ validator = OurValidator(schema) if not validator.validate(properties): for key, value in validator.errors.items(): if any(['unallowed value' in v for v in value]): print(('{key} has an illegal value. Allowed values are {values} and are case ' 'sensitive.').format(key=key, values=schema[key]['allowed'])) raise ValueError(validator.errors) def get_dataframe(self, output_columns=None): """Get a Pandas DataFrame of the datapoints in this instance. Arguments: output_columns (`list`, optional): List of strings specifying the columns to include in the output DataFrame. The default is `None`, which outputs all of the columns. Options include (not case sensitive): * ``Temperature`` * ``Pressure`` * ``Ignition Delay`` * ``Composition`` * ``Equivalence Ratio`` * ``Reference`` * ``Apparatus`` * ``Experiment Type`` * ``File Author`` * ``File Version`` * ``ChemKED Version`` In addition, specific fields from the ``Reference`` and ``Apparatus`` attributes can be included by specifying the name after a colon. These options are: * ``Reference:Volume`` * ``Reference:Journal`` * ``Reference:DOI`` * ``Reference:Authors`` * ``Reference:Detail`` * ``Reference:Year`` * ``Reference:Pages`` * ``Apparatus:Kind`` * ``Apparatus:Facility`` * ``Apparatus:Institution`` Only the first author is printed when ``Reference`` or ``Reference:Authors`` is selected because the whole author list may be quite long. Note: If the Composition is selected as an output type, the composition specified in the `DataPoint` is used. No attempt is made to convert to a consistent basis; mole fractions will remain mole fractions, mass fractions will remain mass fractions, and mole percent will remain mole percent. Therefore, it is possible to end up with more than one type of composition specification in a given column. However, if the composition is included in the resulting dataframe, the type of each composition will be specified by the "Kind" field in each row. Examples: >>> df = ChemKED(yaml_file).get_dataframe() >>> df = ChemKED(yaml_file).get_dataframe(['Temperature', 'Ignition Delay']) Returns: `~pandas.DataFrame`: Contains the information regarding each point in the ``datapoints`` attribute """ import pandas as pd valid_labels = [a.replace('_', ' ') for a in self.__dict__ if not (a.startswith('__') or a.startswith('_')) ] valid_labels.remove('datapoints') valid_labels.extend( ['composition', 'ignition delay', 'temperature', 'pressure', 'equivalence ratio'] ) ref_index = valid_labels.index('reference') valid_labels[ref_index:ref_index + 1] = ['reference:' + a for a in Reference._fields] app_index = valid_labels.index('apparatus') valid_labels[app_index:app_index + 1] = ['apparatus:' + a for a in Apparatus._fields] species_list = list(set(chain(*[list(d.composition.keys()) for d in self.datapoints]))) if output_columns is None or len(output_columns) == 0: col_labels = valid_labels comp_index = col_labels.index('composition') col_labels[comp_index:comp_index + 1] = species_list + ['Composition:Kind'] else: output_columns = [a.lower() for a in output_columns] col_labels = [] for col in output_columns: if col in valid_labels or col in ['reference', 'apparatus']: col_labels.append(col) else: raise ValueError('{} is not a valid output column choice'.format(col)) if 'composition' in col_labels: comp_index = col_labels.index('composition') col_labels[comp_index:comp_index + 1] = species_list + ['Composition:Kind'] if 'reference' in col_labels: ref_index = col_labels.index('reference') col_labels[ref_index:ref_index + 1] = ['reference:' + a for a in Reference._fields] if 'apparatus' in col_labels: app_index = col_labels.index('apparatus') col_labels[app_index:app_index + 1] = ['apparatus:' + a for a in Apparatus._fields] data = [] for d in self.datapoints: row = [] d_species = list(d.composition.keys()) for col in col_labels: if col in species_list: if col in d_species: row.append(d.composition[col].amount) else: row.append(Q_(0.0, 'dimensionless')) elif 'reference' in col or 'apparatus' in col: split_col = col.split(':') if split_col[1] == 'authors': row.append(getattr(getattr(self, split_col[0]), split_col[1])[0]['name']) else: row.append(getattr(getattr(self, split_col[0]), split_col[1])) elif col in ['temperature', 'pressure', 'ignition delay', 'equivalence ratio']: row.append(getattr(d, col.replace(' ', '_'))) elif col == 'file authors': row.append(getattr(self, col.replace(' ', '_'))[0]['name']) elif col == 'Composition:Kind': row.append(d.composition_type) else: row.append(getattr(self, col.replace(' ', '_'))) data.append(row) col_labels = [a.title() for a in col_labels] columns = pd.Index(col_labels) return pd.DataFrame(data=data, columns=columns) def write_file(self, filename, *, overwrite=False): """Write new ChemKED YAML file based on object. Arguments: filename (`str`): Filename for target YAML file overwrite (`bool`, optional): Whether to overwrite file with given name if present. Must be supplied as a keyword-argument. Raises: `NameError`: If ``filename`` is already present, and ``overwrite`` is not ``True``. Example: >>> dataset = ChemKED(yaml_file) >>> dataset.write_file(new_yaml_file) """ # Ensure file isn't already present if exists(filename) and not overwrite: raise OSError(filename + ' already present. Specify "overwrite=True" ' 'to overwrite, or rename.' ) with open(filename, 'w') as yaml_file: yaml.dump(self._properties, yaml_file) def convert_to_ReSpecTh(self, filename): """Convert ChemKED record to ReSpecTh XML file. This converter uses common information in a ChemKED file to generate a ReSpecTh XML file. Note that some information may be lost, as ChemKED stores some additional attributes. Arguments: filename (`str`): Filename for output ReSpecTh XML file. Example: >>> dataset = ChemKED(yaml_file) >>> dataset.convert_to_ReSpecTh(xml_file) """ root = etree.Element('experiment') file_author = etree.SubElement(root, 'fileAuthor') file_author.text = self.file_authors[0]['name'] # right now ChemKED just uses an integer file version file_version = etree.SubElement(root, 'fileVersion') major_version = etree.SubElement(file_version, 'major') major_version.text = str(self.file_version) minor_version = etree.SubElement(file_version, 'minor') minor_version.text = '0' respecth_version = etree.SubElement(root, 'ReSpecThVersion') major_version = etree.SubElement(respecth_version, 'major') major_version.text = '1' minor_version = etree.SubElement(respecth_version, 'minor') minor_version.text = '0' # Only ignition delay currently supported exp = etree.SubElement(root, 'experimentType') if self.experiment_type == 'ignition delay': exp.text = 'Ignition delay measurement' else: raise NotImplementedError('Only ignition delay type supported for conversion.') reference = etree.SubElement(root, 'bibliographyLink') citation = '' for author in self.reference.authors: citation += author['name'] + ', ' citation += (self.reference.journal + ' (' + str(self.reference.year) + ') ' + str(self.reference.volume) + ':' + self.reference.pages + '. ' + self.reference.detail ) reference.set('preferredKey', citation) reference.set('doi', self.reference.doi) apparatus = etree.SubElement(root, 'apparatus') kind = etree.SubElement(apparatus, 'kind') kind.text = self.apparatus.kind common_properties = etree.SubElement(root, 'commonProperties') # ChemKED objects have no common properties once loaded. Check for properties # among datapoints that tend to be common common = [] composition = self.datapoints[0].composition # Composition type *has* to be the same composition_type = self.datapoints[0].composition_type if not all(dp.composition_type == composition_type for dp in self.datapoints): raise NotImplementedError('Error: ReSpecTh does not support varying composition ' 'type among datapoints.' ) if all([composition == dp.composition for dp in self.datapoints]): # initial composition is common common.append('composition') prop = etree.SubElement(common_properties, 'property') prop.set('name', 'initial composition') for species_name, species in composition.items(): component = etree.SubElement(prop, 'component') species_link = etree.SubElement(component, 'speciesLink') species_link.set('preferredKey', species_name) if species.InChI is not None: species_link.set('InChI', species.InChI) amount = etree.SubElement(component, 'amount') amount.set('units', composition_type) amount.text = str(species.amount.magnitude) # If multiple datapoints present, then find any common properties. If only # one datapoint, then composition should be the only "common" property. if len(self.datapoints) > 1: for prop_name in datagroup_properties: attribute = prop_name.replace(' ', '_') quantities = [getattr(dp, attribute, False) for dp in self.datapoints] # All quantities must have the property in question and all the # values must be equal if all(quantities) and quantities.count(quantities[0]) == len(quantities): common.append(prop_name) prop = etree.SubElement(common_properties, 'property') prop.set('description', '') prop.set('name', prop_name) prop.set('units', str(quantities[0].units)) value = etree.SubElement(prop, 'value') value.text = str(quantities[0].magnitude) # Ignition delay can't be common, unless only a single datapoint. datagroup = etree.SubElement(root, 'dataGroup') datagroup.set('id', 'dg1') datagroup_link = etree.SubElement(datagroup, 'dataGroupLink') datagroup_link.set('dataGroupID', '') datagroup_link.set('dataPointID', '') property_idx = {} labels = {'temperature': 'T', 'pressure': 'P', 'ignition delay': 'tau', 'pressure rise': 'dP/dt', } for prop_name in datagroup_properties: attribute = prop_name.replace(' ', '_') # This can't be hasattr because properties are set to the value None # if no value is specified in the file, so the attribute always exists prop_indices = [i for i, dp in enumerate(self.datapoints) if getattr(dp, attribute) is not None ] if prop_name in common or not prop_indices: continue prop = etree.SubElement(datagroup, 'property') prop.set('description', '') prop.set('name', prop_name) units = str(getattr(self.datapoints[prop_indices[0]], attribute).units) prop.set('units', units) idx = 'x{}'.format(len(property_idx) + 1) property_idx[idx] = {'name': prop_name, 'units': units} prop.set('id', idx) prop.set('label', labels[prop_name]) # Need to handle datapoints with possibly different species in the initial composition if 'composition' not in common: for dp in self.datapoints: for species in dp.composition.values(): # Only add new property for species not already considered has_spec = any([species.species_name in d.values() for d in property_idx.values() ]) if not has_spec: prop = etree.SubElement(datagroup, 'property') prop.set('description', '') idx = 'x{}'.format(len(property_idx) + 1) property_idx[idx] = {'name': species.species_name} prop.set('id', idx) prop.set('label', '[' + species.species_name + ']') prop.set('name', 'composition') prop.set('units', self.datapoints[0].composition_type) species_link = etree.SubElement(prop, 'speciesLink') species_link.set('preferredKey', species.species_name) if species.InChI is not None: species_link.set('InChI', species.InChI) for dp in self.datapoints: datapoint = etree.SubElement(datagroup, 'dataPoint') for idx, val in property_idx.items(): # handle regular properties a bit differently than composition if val['name'] in datagroup_properties: value = etree.SubElement(datapoint, idx) quantity = getattr(dp, val['name'].replace(' ', '_')).to(val['units']) value.text = str(quantity.magnitude) else: # composition for item in dp.composition.values(): if item.species_name == val['name']: value = etree.SubElement(datapoint, idx) value.text = str(item.amount.magnitude) # See https://stackoverflow.com/a/16097112 for the None.__ne__ history_types = ['volume_history', 'temperature_history', 'pressure_history', 'piston_position_history', 'light_emission_history', 'OH_emission_history', 'absorption_history'] time_histories = [getattr(dp, p) for dp in self.datapoints for p in history_types] time_histories = list(filter(None.__ne__, time_histories)) if len(self.datapoints) > 1 and len(time_histories) > 1: raise NotImplementedError('Error: ReSpecTh files do not support multiple datapoints ' 'with a time history.') elif len(time_histories) > 0: for dg_idx, hist in enumerate(time_histories): if hist.type not in ['volume', 'temperature', 'pressure']: warn('The time-history type {} is not supported by ReSpecTh for ' 'ignition delay experiments'.format(hist.type)) continue datagroup = etree.SubElement(root, 'dataGroup') datagroup.set('id', 'dg{}'.format(dg_idx)) datagroup_link = etree.SubElement(datagroup, 'dataGroupLink') datagroup_link.set('dataGroupID', '') datagroup_link.set('dataPointID', '') # Time history has two properties: time and quantity. prop = etree.SubElement(datagroup, 'property') prop.set('description', '') prop.set('name', 'time') prop.set('units', str(hist.time.units)) time_idx = 'x{}'.format(len(property_idx) + 1) property_idx[time_idx] = {'name': 'time'} prop.set('id', time_idx) prop.set('label', 't') prop = etree.SubElement(datagroup, 'property') prop.set('description', '') prop.set('name', hist.type) prop.set('units', str(hist.quantity.units)) quant_idx = 'x{}'.format(len(property_idx) + 1) property_idx[quant_idx] = {'name': hist.type} prop.set('id', quant_idx) prop.set('label', 'V') for time, quantity in zip(hist.time, hist.quantity): datapoint = etree.SubElement(datagroup, 'dataPoint') value = etree.SubElement(datapoint, time_idx) value.text = str(time.magnitude) value = etree.SubElement(datapoint, quant_idx) value.text = str(quantity.magnitude) ign_types = [getattr(dp, 'ignition_type', False) for dp in self.datapoints] # All datapoints must have the same ignition target and type if all(ign_types) and ign_types.count(ign_types[0]) == len(ign_types): # In ReSpecTh files all datapoints must share ignition type ignition = etree.SubElement(root, 'ignitionType') if ign_types[0]['target'] in ['pressure', 'temperature']: ignition.set('target', ign_types[0]['target'][0].upper()) else: # options left are species ignition.set('target', self.datapoints[0].ignition_type['target']) if ign_types[0]['type'] == 'd/dt max extrapolated': ignition.set('type', 'baseline max intercept from d/dt') else: ignition.set('type', self.datapoints[0].ignition_type['type']) else: raise NotImplementedError('Different ignition targets or types for multiple datapoints ' 'are not supported in ReSpecTh.') et = etree.ElementTree(root) et.write(filename, encoding='utf-8', xml_declaration=True) # now do a "pretty" rewrite xml = minidom.parse(filename) xml_string = xml.toprettyxml(indent=' ') with open(filename, 'w') as f: f.write(xml_string) print('Converted to ' + filename) class DataPoint(object): """Class for a single datapoint. The `DataPoint` class stores the information associated with a single data point in the dataset parsed from the `ChemKED` YAML input. Arguments: properties (`dict`): Dictionary adhering to the ChemKED format for ``datapoints`` Attributes: composition (`list`): List of dictionaries representing the species and their quantities ignition_delay (pint.Quantity): The ignition delay of the experiment temperature (pint.Quantity): The temperature of the experiment pressure (pint.Quantity): The pressure of the experiment pressure_rise (pint.Quantity, optional): The amount of pressure rise during the induction period of a shock tube experiment. compression_time (pint.Quantity, optional): The compression time for an RCM experiment. compressed_pressure (pint.Quantity, optional): The pressure at the end of compression for an RCM experiment. compressed_temperature (pint.Quantity, optional): The temperature at the end of compression for an RCM experiment. first_stage_ignition_delay (pint.Quantity, optional): The first stage ignition delay of the experiment. compression_time (pint.Quantity, optional): The compression time for an RCM experiment. ignition_type (`dict`): Dictionary with the ignition target and type. volume_history (`~collections.namedtuple`, optional): The volume history of the reactor during an RCM experiment. pressure_history (`~collections.namedtuple`, optional): The pressure history of the reactor during an experiment. temperature_history (`~collections.namedtuple`, optional): The temperature history of the reactor during an experiment. piston_position_history (`~collections.namedtuple`, optional): The piston position history of the reactor during an RCM experiment. light_emission_history (`~collections.namedtuple`, optional): The light emission history of the reactor during an experiment. OH_emission_history (`~collections.namedtuple`, optional): The OH emission history of the reactor during an experiment. absorption_history (`~collections.namedtuple`, optional): The absorption history of the reactor during an experiment. """ value_unit_props = [ 'ignition-delay', 'first-stage-ignition-delay', 'temperature', 'pressure', 'pressure-rise', ] rcm_data_props = [ 'compressed-pressure', 'compressed-temperature', 'compression-time', 'stroke', 'clearance', 'compression-ratio' ] def __init__(self, properties): for prop in self.value_unit_props: if prop in properties: quant = self.process_quantity(properties[prop]) setattr(self, prop.replace('-', '_'), quant) else: setattr(self, prop.replace('-', '_'), None) if 'rcm-data' in properties: orig_rcm_data = properties['rcm-data'] rcm_props = {} for prop in self.rcm_data_props: if prop in orig_rcm_data: quant = self.process_quantity(orig_rcm_data[prop]) rcm_props[prop.replace('-', '_')] = quant else: rcm_props[prop.replace('-', '_')] = None self.rcm_data = RCMData(**rcm_props) else: self.rcm_data = None self.composition_type = properties['composition']['kind'] composition = {} for species in properties['composition']['species']: species_name = species['species-name'] amount = self.process_quantity(species['amount']) InChI = species.get('InChI') SMILES = species.get('SMILES') atomic_composition = species.get('atomic-composition') composition[species_name] = Composition( species_name=species_name, InChI=InChI, SMILES=SMILES, atomic_composition=atomic_composition, amount=amount) setattr(self, 'composition', composition) self.equivalence_ratio = properties.get('equivalence-ratio') self.ignition_type = deepcopy(properties.get('ignition-type')) if 'time-histories' in properties and 'volume-history' in properties: raise TypeError('time-histories and volume-history are mutually exclusive') if 'time-histories' in properties: for hist in properties['time-histories']: if hasattr(self, '{}_history'.format(hist['type'].replace(' ', '_'))): raise ValueError('Each history type may only be specified once. {} was ' 'specified multiple times'.format(hist['type'])) time_col = hist['time']['column'] time_units = hist['time']['units'] quant_col = hist['quantity']['column'] quant_units = hist['quantity']['units'] if isinstance(hist['values'], list): values = np.array(hist['values']) else: # Load the values from a file values = np.genfromtxt(hist['values']['filename'], delimiter=',') time_history = TimeHistory( time=Q_(values[:, time_col], time_units), quantity=Q_(values[:, quant_col], quant_units), type=hist['type'], ) setattr(self, '{}_history'.format(hist['type'].replace(' ', '_')), time_history) if 'volume-history' in properties: warn('The volume-history field should be replaced by time-histories. ' 'volume-history will be removed after PyKED 0.4', DeprecationWarning) time_col = properties['volume-history']['time']['column'] time_units = properties['volume-history']['time']['units'] volume_col = properties['volume-history']['volume']['column'] volume_units = properties['volume-history']['volume']['units'] values = np.array(properties['volume-history']['values']) self.volume_history = VolumeHistory( time=Q_(values[:, time_col], time_units), volume=Q_(values[:, volume_col], volume_units), ) history_types = ['volume', 'temperature', 'pressure', 'piston_position', 'light_emission', 'OH_emission', 'absorption'] for h in history_types: if not hasattr(self, '{}_history'.format(h)): setattr(self, '{}_history'.format(h), None) def process_quantity(self, properties): """Process the uncertainty information from a given quantity and return it """ quant = Q_(properties[0]) if len(properties) > 1: unc = properties[1] uncertainty = unc.get('uncertainty', False) upper_uncertainty = unc.get('upper-uncertainty', False) lower_uncertainty = unc.get('lower-uncertainty', False) uncertainty_type = unc.get('uncertainty-type') if uncertainty_type == 'relative': if uncertainty: quant = quant.plus_minus(float(uncertainty), relative=True) elif upper_uncertainty and lower_uncertainty: warn('Asymmetric uncertainties are not supported. The ' 'maximum of lower-uncertainty and upper-uncertainty ' 'has been used as the symmetric uncertainty.') uncertainty = max(float(upper_uncertainty), float(lower_uncertainty)) quant = quant.plus_minus(uncertainty, relative=True) else: raise ValueError('Either "uncertainty" or "upper-uncertainty" and ' '"lower-uncertainty" need to be specified.') elif uncertainty_type == 'absolute': if uncertainty: uncertainty = Q_(uncertainty) quant = quant.plus_minus(uncertainty.to(quant.units).magnitude) elif upper_uncertainty and lower_uncertainty: warn('Asymmetric uncertainties are not supported. The ' 'maximum of lower-uncertainty and upper-uncertainty ' 'has been used as the symmetric uncertainty.') uncertainty = max(Q_(upper_uncertainty), Q_(lower_uncertainty)) quant = quant.plus_minus(uncertainty.to(quant.units).magnitude) else: raise ValueError('Either "uncertainty" or "upper-uncertainty" and ' '"lower-uncertainty" need to be specified.') else: raise ValueError('uncertainty-type must be one of "absolute" or "relative"') return quant def get_cantera_composition_string(self, species_conversion=None): """Get the composition in a string format suitable for input to Cantera. Returns a formatted string no matter the type of composition. As such, this method is not recommended for end users; instead, prefer the `get_cantera_mole_fraction` or `get_cantera_mass_fraction` methods. Arguments: species_conversion (`dict`, optional): Mapping of species identifier to a species name. This argument should be supplied when the name of the species in the ChemKED YAML file does not match the name of the same species in a chemical kinetic mechanism. The species identifier (the key of the mapping) can be the name, InChI, or SMILES provided in the ChemKED file, while the value associated with a key should be the desired name in the Cantera format output string. Returns: `str`: String in the ``SPEC:AMT, SPEC:AMT`` format Raises: `ValueError`: If the composition type of the `DataPoint` is not one of ``'mass fraction'``, ``'mole fraction'``, or ``'mole percent'`` """ if self.composition_type in ['mole fraction', 'mass fraction']: factor = 1.0 elif self.composition_type == 'mole percent': factor = 100.0 else: raise ValueError('Unknown composition type: {}'.format(self.composition_type)) if species_conversion is None: comps = ['{!s}:{:.4e}'.format(c.species_name, c.amount.magnitude/factor) for c in self.composition.values()] else: comps = [] for c in self.composition.values(): amount = c.amount.magnitude/factor idents = [getattr(c, s, False) for s in ['species_name', 'InChI', 'SMILES']] present = [i in species_conversion for i in idents] if not any(present): comps.append('{!s}:{:.4e}'.format(c.species_name, amount)) else: if len([i for i in present if i]) > 1: raise ValueError('More than one conversion present for species {}'.format( c.species_name)) ident = idents[present.index(True)] species_replacement_name = species_conversion.pop(ident) comps.append('{!s}:{:.4e}'.format(species_replacement_name, amount)) if len(species_conversion) > 0: raise ValueError('Unknown species in conversion: {}'.format(species_conversion)) return ', '.join(comps) def get_cantera_mole_fraction(self, species_conversion=None): """Get the mole fractions in a string format suitable for input to Cantera. Arguments: species_conversion (`dict`, optional): Mapping of species identifier to a species name. This argument should be supplied when the name of the species in the ChemKED YAML file does not match the name of the same species in a chemical kinetic mechanism. The species identifier (the key of the mapping) can be the name, InChI, or SMILES provided in the ChemKED file, while the value associated with a key should be the desired name in the Cantera format output string. Returns: `str`: String of mole fractions in the ``SPEC:AMT, SPEC:AMT`` format Raises: `ValueError`: If the composition type is ``'mass fraction'``, the conversion cannot be done because no molecular weight information is known Examples: >>> dp = DataPoint(properties) >>> dp.get_cantera_mole_fraction() 'H2:4.4400e-03, O2:5.5600e-03, Ar:9.9000e-01' >>> species_conversion = {'H2': 'h2', 'O2': 'o2'} >>> dp.get_cantera_mole_fraction(species_conversion) 'h2:4.4400e-03, o2:5.5600e-03, Ar:9.9000e-01' >>> species_conversion = {'1S/H2/h1H': 'h2', '1S/O2/c1-2': 'o2'} >>> dp.get_cantera_mole_fraction(species_conversion) 'h2:4.4400e-03, o2:5.5600e-03, Ar:9.9000e-01' """ if self.composition_type == 'mass fraction': raise ValueError('Cannot get mole fractions from the given composition.\n' '{}'.format(self.composition)) else: return self.get_cantera_composition_string(species_conversion) def get_cantera_mass_fraction(self, species_conversion=None): """Get the mass fractions in a string format suitable for input to Cantera. Arguments: species_conversion (`dict`, optional): Mapping of species identifier to a species name. This argument should be supplied when the name of the species in the ChemKED YAML file does not match the name of the same species in a chemical kinetic mechanism. The species identifier (the key of the mapping) can be the name, InChI, or SMILES provided in the ChemKED file, while the value associated with a key should be the desired name in the Cantera format output string. Returns: `str`: String of mass fractions in the ``SPEC:AMT, SPEC:AMT`` format Raises: `ValueError`: If the composition type is ``'mole fraction'`` or ``'mole percent'``, the conversion cannot be done because no molecular weight information is known Examples: >>> dp = DataPoint(properties) >>> dp.get_cantera_mass_fraction() 'H2:2.2525e-04, O2:4.4775e-03, Ar:9.9530e-01' >>> species_conversion = {'H2': 'h2', 'O2': 'o2'} >>> dp.get_cantera_mass_fraction(species_conversion) 'h2:2.2525e-04, o2:4.4775e-03, Ar:9.9530e-01' >>> species_conversion = {'1S/H2/h1H': 'h2', '1S/O2/c1-2': 'o2'} >>> dp.get_cantera_mass_fraction(species_conversion) 'h2:2.2525e-04, o2:4.4775e-03, Ar:9.9530e-01' """ if self.composition_type in ['mole fraction', 'mole percent']: raise ValueError('Cannot get mass fractions from the given composition.\n' '{}'.format(self.composition) ) else: return self.get_cantera_composition_string(species_conversion)
bsd-3-clause
-6,256,631,093,448,223,000
48.701912
130
0.583388
false
bjornaa/ladim
ladim/state.py
1
6096
""" Class for the state of the model """ import sys import os import importlib import logging from typing import Any, Dict, Sized # mypy import numpy as np from netCDF4 import Dataset, num2date from .tracker import Tracker from .gridforce import Grid, Forcing # ------------------------ Config = Dict[str, Any] class State(Sized): """The model variables at a given time""" def __init__(self, config: Config, grid: Grid) -> None: logging.info("Initializing the model state") self.timestep = 0 self.timestamp = config["start_time"].astype("datetime64[s]") self.dt = np.timedelta64(config["dt"], "s") self.position_variables = ["X", "Y", "Z"] if "ibm" in config and "variables" in config["ibm"]: self.ibm_variables = config["ibm"]["variables"] else: self.ibm_variables = config.get("ibm_variables", []) self.ibm_forcing = config.get("ibm_forcing", []) self.particle_variables = config["particle_variables"] self.instance_variables = self.position_variables + [ var for var in self.ibm_variables if var not in self.particle_variables ] self.pid = np.array([], dtype=int) for name in self.instance_variables: setattr(self, name, np.array([], dtype=float)) for name in self.particle_variables: setattr(self, name, np.array([], dtype=config["release_dtype"][name])) self.track = Tracker(config) self.dt = config["dt"] if config["ibm_module"]: # Import the module logging.info("Initializing the IBM") sys.path.insert(0, os.getcwd()) ibm_module = importlib.import_module(config["ibm_module"]) # Initiate the IBM object self.ibm = ibm_module.IBM(config) else: self.ibm = None # self.num_particles = len(self.X) self.nnew = 0 # Modify with warm start? if config["warm_start_file"]: self.warm_start(config, grid) def __getitem__(self, name: str) -> None: return getattr(self, name) def __setitem__(self, name: str, value: Any) -> None: return setattr(self, name, value) def __len__(self) -> int: return len(getattr(self, "X")) def append(self, new: Dict[str, Any], forcing: Forcing) -> None: """Append new particles to the model state""" nnew = len(new["pid"]) self.pid = np.concatenate((self.pid, new["pid"])) for name in self.instance_variables: if name in new: self[name] = np.concatenate((self[name], new[name])) elif name in self.ibm_forcing: # Take values as Z must be a numpy array self[name] = np.concatenate( (self[name], forcing.field(new["X"], new["Y"], new["Z"].values, name)) ) else: # Initialize to zero self[name] = np.concatenate((self[name], np.zeros(nnew))) self.nnew = nnew def update(self, grid: Grid, forcing: Forcing) -> None: """Update the model state to the next timestep""" # From physics all particles are alive # self.alive = np.ones(len(self), dtype="bool") self.alive = grid.ingrid(self.X, self.Y) self.timestep += 1 self.timestamp += np.timedelta64(self.dt, "s") self.track.move_particles(grid, forcing, self) # logging.info( # "Model time = {}".format(self.timestamp.astype('M8[h]'))) if self.timestamp.astype("int") % 3600 == 0: # New hour logging.info("Model time = {}".format(self.timestamp.astype("M8[h]"))) # Update the IBM if self.ibm: self.ibm.update_ibm(grid, self, forcing) # Extension, allow inactive particles (not moved next time) if "active" in self.ibm_variables: pass # self.active = self.ibm_variables['active'] else: # Default = active self.active = np.ones_like(self.pid) # Surface/bottom boundary conditions # Reflective at surface I = self.Z < 0 self.Z[I] = -self.Z[I] # Keep just above bottom H = grid.sample_depth(self.X, self.Y) I = self.Z > H self.Z[I] = 0.99 * H[I] # Compactify by removing dead particles # Could have a switch to avoid this if no deaths self.pid = self.pid[self.alive] for key in self.instance_variables: self[key] = self[key][self.alive] def warm_start(self, config: Config, grid: Grid) -> None: """Perform a warm (re)start""" warm_start_file = config["warm_start_file"] try: f = Dataset(warm_start_file) except FileNotFoundError: logging.critical(f"Can not open warm start file: {warm_start_file}") raise SystemExit(1) logging.info("Reading warm start file") # Using last record in file tvar = f.variables["time"] warm_start_time = np.datetime64(num2date(tvar[-1], tvar.units)) # Not needed anymore, explicitly set in configuration # if warm_start_time != config['start_time']: # print("warm start time = ", warm_start_time) # print("start time = ", config['start_time']) # logging.error("Warm start time and start time differ") # raise SystemExit(1) pstart = f.variables["particle_count"][:-1].sum() pcount = f.variables["particle_count"][-1] self.pid = f.variables["pid"][pstart : pstart + pcount] # Give error if variable not in restart file for var in config["warm_start_variables"]: logging.debug(f"Reading {var} from warm start file") self[var] = f.variables[var][pstart : pstart + pcount] # Remove particles near edge of grid I = grid.ingrid(self["X"], self["Y"]) self.pid = self.pid[I] for var in config["warm_start_variables"]: self[var] = self[var][I]
mit
6,137,527,517,948,302,000
35.285714
90
0.57103
false
Anvil/maestro-ng
maestro/loader.py
1
2758
# Copyright (C) 2015 SignalFx, Inc. All rights reserved. # # Docker container orchestration utility. import jinja2 import os import sys import yaml from . import exceptions class MaestroYamlConstructor(yaml.constructor.Constructor): """A PyYAML object constructor that errors on duplicate keys in YAML mappings. Because for some reason PyYAML doesn't do that since 3.x.""" def construct_mapping(self, node, deep=False): if not isinstance(node, yaml.nodes.MappingNode): raise yaml.constructor.ConstructorError( None, None, "expected a mapping node, but found %s" % node.id, node.start_mark) keys = set() for key_node, value_node in node.value: key = self.construct_object(key_node, deep=deep) if key in keys: raise yaml.constructor.ConstructorError( "while constructing a mapping", node.start_mark, "found duplicate key (%s)" % key, key_node.start_mark) keys.add(key) return yaml.constructor.Constructor.construct_mapping(self, node, deep) class MaestroYamlLoader(yaml.reader.Reader, yaml.scanner.Scanner, yaml.parser.Parser, yaml.composer.Composer, MaestroYamlConstructor, yaml.resolver.Resolver): """A custom YAML Loader that uses the custom MaestroYamlConstructor.""" def __init__(self, stream): yaml.reader.Reader.__init__(self, stream) yaml.scanner.Scanner.__init__(self) yaml.parser.Parser.__init__(self) yaml.composer.Composer.__init__(self) MaestroYamlConstructor.__init__(self) yaml.resolver.Resolver.__init__(self) def load(filename): """Load a config from the given file. Args: filename (string): Path to the YAML environment description configuration file to load. Use '-' for stdin. Returns: A python data structure corresponding to the YAML configuration. """ env = jinja2.Environment( loader=jinja2.FileSystemLoader(os.path.dirname(filename)), extensions=['jinja2.ext.with_']) try: if filename == '-': template = env.from_string(sys.stdin.read()) else: template = env.get_template(os.path.basename(filename)) except jinja2.exceptions.TemplateNotFound: raise exceptions.MaestroException( 'Environment description file {} not found!'.format(filename)) except Exception as e: raise exceptions.MaestroException( 'Error reading environment description file {}: {}!' .format(filename, e)) return yaml.load(template.render(env=os.environ), Loader=MaestroYamlLoader)
apache-2.0
4,613,575,730,410,633,000
36.27027
79
0.638869
false
bootstraponline/testdroid_device_finder
device_finder.py
1
4900
# -*- coding: utf-8 -*- # from: https://github.com/bitbar/testdroid-samples/blob/03fc043ba98235b9ea46a0ab8646f3b20dd1960e/appium/sample-scripts/python/device_finder.py import os, sys, requests, json, time, httplib from optparse import OptionParser from urlparse import urljoin from datetime import datetime class DeviceFinder: # Cloud URL (not including API path) url = None # Oauth access token access_token = None # Oauth refresh token refresh_token = None # Unix timestamp (seconds) when token expires token_expiration_time = None """ Full constructor with username and password """ def __init__(self, username=None, password=None, url="https://cloud.testdroid.com", download_buffer_size=65536): self.username = username self.password = password self.cloud_url = url self.download_buffer_size = download_buffer_size """ Get Oauth2 token """ def get_token(self): if not self.access_token: # TODO: refresh url = "%s/oauth/token" % self.cloud_url payload = { "client_id": "testdroid-cloud-api", "grant_type": "password", "username": self.username, "password": self.password } res = requests.post( url, data = payload, headers = { "Accept": "application/json" } ) if res.status_code != 200: print "FAILED: Authentication or connection failure. Check Testdroid Cloud URL and your credentials." sys.exit(-1) reply = res.json() self.access_token = reply['access_token'] self.refresh_token = reply['refresh_token'] self.token_expiration_time = time.time() + reply['expires_in'] elif self.token_expiration_time < time.time(): url = "%s/oauth/token" % self.cloud_url payload = { "client_id": "testdroid-cloud-api", "grant_type": "refresh_token", "refresh_token": self.refresh_token } res = requests.post( url, data = payload, headers = { "Accept": "application/json" } ) if res.status_code != 200: print "FAILED: Unable to get a new access token using refresh token" self.access_token = None return self.get_token() reply = res.json() self.access_token = reply['access_token'] self.refresh_token = reply['refresh_token'] self.token_expiration_time = time.time() + reply['expires_in'] return self.access_token """ Helper method for getting necessary headers to use for API calls, including authentication """ def _build_headers(self): return { "Authorization": "Bearer %s" % self.get_token(), "Accept": "application/json" } """ GET from API resource """ def get(self, path=None, payload={}, headers={}): if path.find('v2/') >= 0: cut_path = path.split('v2/') path = cut_path[1] url = "%s/api/v2/%s" % (self.cloud_url, path) headers = dict(self._build_headers().items() + headers.items()) res = requests.get(url, params=payload, headers=headers) if headers['Accept'] == 'application/json': return res.json() else: return res.text """ Returns list of devices """ def get_devices(self, limit=0): return self.get("devices?limit=%s" % (limit)) """ Find available free Android device """ def available_free_android_device(self, limit=0): print "Searching Available Free Android Device..." for device in self.get_devices(limit)['data']: if device['creditsPrice'] == 0 and device['locked'] == False and device['osType'] == "ANDROID" and device['softwareVersion']['apiLevel'] > 16: print "Found device '%s'" % device['displayName'] print "" return device['displayName'] print "No available device found" print "" return "" """ Find available free iOS device """ def available_free_ios_device(self, limit=0): print "Searching Available Free iOS Device..." for device in self.get_devices(limit)['data']: if device['creditsPrice'] == 0 and device['locked'] == False and device['osType'] == "IOS": print "Found device '%s'" % device['displayName'] print "" return device['displayName'] print "No available device found" print "" return ""
apache-2.0
-8,658,598,604,070,463,000
35.842105
154
0.546327
false
icgc/icgc-get
tests/test_ega.py
1
1474
# # Copyright (c) 2016 The Ontario Institute for Cancer Research. All rights reserved. # # This program and the accompanying materials are made available under the terms of the GNU Public License v3.0. # You should have received a copy of the GNU General Public License along with # this program. If not, see <http://www.gnu.org/licenses/>. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" AND ANY # EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES # OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT # SHALL THE COPYRIGHT HOLDER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, # INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED # TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; # OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER # IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN # ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. # from conftest import download_test def test_ega_file(data_dir): download_test(['FI98765'], 'status', 'ega', ['_methylationCEL_CLL-174.CEL'], [5556766], data_dir) def test_ega_manifest(data_dir): download_test(["4294ed2b-4d41-4967-8c5d-231027fa40c7"], 'download', 'ega', ['_methylationCEL_CLL-174.CEL'], [5556766], data_dir)
gpl-3.0
-8,480,794,609,064,911,000
51.642857
112
0.751696
false
bolkedebruin/airflow
tests/providers/datadog/hooks/test_datadog.py
1
4769
# -*- coding: utf-8 -*- # # Licensed to the Apache Software Foundation (ASF) under one # or more contributor license agreements. See the NOTICE file # distributed with this work for additional information # regarding copyright ownership. The ASF licenses this file # to you under the Apache License, Version 2.0 (the # "License"); you may not use this file except in compliance # with the License. You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, # software distributed under the License is distributed on an # "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY # KIND, either express or implied. See the License for the # specific language governing permissions and limitations # under the License. # import json import unittest from unittest import mock from airflow.exceptions import AirflowException from airflow.models import Connection from airflow.providers.datadog.hooks.datadog import DatadogHook APP_KEY = 'app_key' API_KEY = 'api_key' METRIC_NAME = 'metric' DATAPOINT = 7 TAGS = ['tag'] TYPE = 'rate' INTERVAL = 30 TITLE = 'title' TEXT = 'text' AGGREGATION_KEY = 'aggregation-key' ALERT_TYPE = 'warning' DATE_HAPPENED = 12345 HANDLE = 'handle' PRIORITY = 'normal' RELATED_EVENT_ID = 7 DEVICE_NAME = 'device-name' class TestDatadogHook(unittest.TestCase): @mock.patch('airflow.providers.datadog.hooks.datadog.initialize') @mock.patch('airflow.providers.datadog.hooks.datadog.DatadogHook.get_connection') def setUp(self, mock_get_connection, mock_initialize): mock_get_connection.return_value = Connection(extra=json.dumps({ 'app_key': APP_KEY, 'api_key': API_KEY, })) self.hook = DatadogHook() @mock.patch('airflow.providers.datadog.hooks.datadog.initialize') @mock.patch('airflow.providers.datadog.hooks.datadog.DatadogHook.get_connection') def test_api_key_required(self, mock_get_connection, mock_initialize): mock_get_connection.return_value = Connection() with self.assertRaises(AirflowException) as ctx: DatadogHook() self.assertEqual(str(ctx.exception), 'api_key must be specified in the Datadog connection details') def test_validate_response_valid(self): try: self.hook.validate_response({'status': 'ok'}) except AirflowException: self.fail('Unexpected AirflowException raised') def test_validate_response_invalid(self): with self.assertRaises(AirflowException): self.hook.validate_response({'status': 'error'}) @mock.patch('airflow.providers.datadog.hooks.datadog.api.Metric.send') def test_send_metric(self, mock_send): mock_send.return_value = {'status': 'ok'} self.hook.send_metric( METRIC_NAME, DATAPOINT, tags=TAGS, type_=TYPE, interval=INTERVAL, ) mock_send.assert_called_once_with( metric=METRIC_NAME, points=DATAPOINT, host=self.hook.host, tags=TAGS, type=TYPE, interval=INTERVAL, ) @mock.patch('airflow.providers.datadog.hooks.datadog.api.Metric.query') @mock.patch('airflow.providers.datadog.hooks.datadog.time.time') def test_query_metric(self, mock_time, mock_query): now = 12345 mock_time.return_value = now mock_query.return_value = {'status': 'ok'} self.hook.query_metric('query', 60, 30) mock_query.assert_called_once_with( start=now - 60, end=now - 30, query='query', ) @mock.patch('airflow.providers.datadog.hooks.datadog.api.Event.create') def test_post_event(self, mock_create): mock_create.return_value = {'status': 'ok'} self.hook.post_event( TITLE, TEXT, aggregation_key=AGGREGATION_KEY, alert_type=ALERT_TYPE, date_happened=DATE_HAPPENED, handle=HANDLE, priority=PRIORITY, related_event_id=RELATED_EVENT_ID, tags=TAGS, device_name=DEVICE_NAME, ) mock_create.assert_called_once_with( title=TITLE, text=TEXT, aggregation_key=AGGREGATION_KEY, alert_type=ALERT_TYPE, date_happened=DATE_HAPPENED, handle=HANDLE, priority=PRIORITY, related_event_id=RELATED_EVENT_ID, tags=TAGS, host=self.hook.host, device_name=DEVICE_NAME, source_type_name=self.hook.source_type_name, ) if __name__ == '__main__': unittest.main()
apache-2.0
-8,385,485,857,153,462,000
33.064286
87
0.63787
false
chrisfilda/edx_platform
lms/envs/common.py
1
51252
# -*- coding: utf-8 -*- """ This is the common settings file, intended to set sane defaults. If you have a piece of configuration that's dependent on a set of feature flags being set, then create a function that returns the calculated value based on the value of FEATURES[...]. Modules that extend this one can change the feature configuration in an environment specific config file and re-calculate those values. We should make a method that calls all these config methods so that you just make one call at the end of your site-specific dev file to reset all the dependent variables (like INSTALLED_APPS) for you. Longer TODO: 1. Right now our treatment of static content in general and in particular course-specific static content is haphazard. 2. We should have a more disciplined approach to feature flagging, even if it just means that we stick them in a dict called FEATURES. 3. We need to handle configuration for multiple courses. This could be as multiple sites, but we do need a way to map their data assets. """ # We intentionally define lots of variables that aren't used, and # want to import all variables from base settings files # pylint: disable=W0401, W0611, W0614, C0103 import sys import os import imp import json from path import path from .discussionsettings import * from lms.lib.xblock.mixin import LmsBlockMixin ################################### FEATURES ################################### # The display name of the platform to be used in templates/emails/etc. PLATFORM_NAME = "edX" CC_MERCHANT_NAME = PLATFORM_NAME COURSEWARE_ENABLED = True ENABLE_JASMINE = False DISCUSSION_SETTINGS = { 'MAX_COMMENT_DEPTH': 2, } # Features FEATURES = { 'SAMPLE': False, 'USE_DJANGO_PIPELINE': True, 'DISPLAY_DEBUG_INFO_TO_STAFF': True, 'DISPLAY_HISTOGRAMS_TO_STAFF': False, # For large courses this slows down courseware access for staff. 'REROUTE_ACTIVATION_EMAIL': False, # nonempty string = address for all activation emails 'DEBUG_LEVEL': 0, # 0 = lowest level, least verbose, 255 = max level, most verbose ## DO NOT SET TO True IN THIS FILE ## Doing so will cause all courses to be released on production 'DISABLE_START_DATES': False, # When True, all courses will be active, regardless of start date # When True, will only publicly list courses by the subdomain. Expects you # to define COURSE_LISTINGS, a dictionary mapping subdomains to lists of # course_ids (see dev_int.py for an example) 'SUBDOMAIN_COURSE_LISTINGS': False, # When True, will override certain branding with university specific values # Expects a SUBDOMAIN_BRANDING dictionary that maps the subdomain to the # university to use for branding purposes 'SUBDOMAIN_BRANDING': False, 'FORCE_UNIVERSITY_DOMAIN': False, # set this to the university domain to use, as an override to HTTP_HOST # set to None to do no university selection # for consistency in user-experience, keep the value of the following 3 settings # in sync with the corresponding ones in cms/envs/common.py 'ENABLE_DISCUSSION_SERVICE': True, 'ENABLE_TEXTBOOK': True, 'ENABLE_STUDENT_NOTES': True, # enables the student notes API and UI. # discussion home panel, which includes a subscription on/off setting for discussion digest emails. # this should remain off in production until digest notifications are online. 'ENABLE_DISCUSSION_HOME_PANEL': False, 'ENABLE_PSYCHOMETRICS': False, # real-time psychometrics (eg item response theory analysis in instructor dashboard) 'ENABLE_DJANGO_ADMIN_SITE': True, # set true to enable django's admin site, even on prod (e.g. for course ops) 'ENABLE_SQL_TRACKING_LOGS': False, 'ENABLE_LMS_MIGRATION': False, 'ENABLE_MANUAL_GIT_RELOAD': False, 'ENABLE_MASQUERADE': True, # allow course staff to change to student view of courseware 'ENABLE_SYSADMIN_DASHBOARD': False, # sysadmin dashboard, to see what courses are loaded, to delete & load courses 'DISABLE_LOGIN_BUTTON': False, # used in systems where login is automatic, eg MIT SSL # extrernal access methods 'ACCESS_REQUIRE_STAFF_FOR_COURSE': False, 'AUTH_USE_OPENID': False, 'AUTH_USE_CERTIFICATES': False, 'AUTH_USE_OPENID_PROVIDER': False, # Even though external_auth is in common, shib assumes the LMS views / urls, so it should only be enabled # in LMS 'AUTH_USE_SHIB': False, 'AUTH_USE_CAS': False, # This flag disables the requirement of having to agree to the TOS for users registering # with Shib. Feature was requested by Stanford's office of general counsel 'SHIB_DISABLE_TOS': False, # Can be turned off if course lists need to be hidden. Effects views and templates. 'COURSES_ARE_BROWSABLE': True, # Enables ability to restrict enrollment in specific courses by the user account login method 'RESTRICT_ENROLL_BY_REG_METHOD': False, # analytics experiments 'ENABLE_INSTRUCTOR_ANALYTICS': False, # Enables the LMS bulk email feature for course staff 'ENABLE_INSTRUCTOR_EMAIL': True, # If True and ENABLE_INSTRUCTOR_EMAIL: Forces email to be explicitly turned on # for each course via django-admin interface. # If False and ENABLE_INSTRUCTOR_EMAIL: Email will be turned on by default # for all Mongo-backed courses. 'REQUIRE_COURSE_EMAIL_AUTH': True, # enable analytics server. # WARNING: THIS SHOULD ALWAYS BE SET TO FALSE UNDER NORMAL # LMS OPERATION. See analytics.py for details about what # this does. 'RUN_AS_ANALYTICS_SERVER_ENABLED': False, # Flip to True when the YouTube iframe API breaks (again) 'USE_YOUTUBE_OBJECT_API': False, # Give a UI to show a student's submission history in a problem by the # Staff Debug tool. 'ENABLE_STUDENT_HISTORY_VIEW': True, # segment.io for LMS--need to explicitly turn it on for production. 'SEGMENT_IO_LMS': False, # Provide a UI to allow users to submit feedback from the LMS (left-hand help modal) 'ENABLE_FEEDBACK_SUBMISSION': False, # Turn on a page that lets staff enter Python code to be run in the # sandbox, for testing whether it's enabled properly. 'ENABLE_DEBUG_RUN_PYTHON': False, # Enable URL that shows information about the status of variuous services 'ENABLE_SERVICE_STATUS': False, # Toggle to indicate use of a custom theme 'USE_CUSTOM_THEME': False, # Don't autoplay videos for students 'AUTOPLAY_VIDEOS': False, # Enable instructor dash to submit background tasks 'ENABLE_INSTRUCTOR_BACKGROUND_TASKS': True, # Enable instructor to assign individual due dates 'INDIVIDUAL_DUE_DATES': False, # Enable instructor dash beta version link 'ENABLE_INSTRUCTOR_BETA_DASHBOARD': True, # Toggle to enable certificates of courses on dashboard 'ENABLE_VERIFIED_CERTIFICATES': False, # Allow use of the hint managment instructor view. 'ENABLE_HINTER_INSTRUCTOR_VIEW': False, # for load testing 'AUTOMATIC_AUTH_FOR_TESTING': False, # Toggle to enable chat availability (configured on a per-course # basis in Studio) 'ENABLE_CHAT': False, # Allow users to enroll with methods other than just honor code certificates 'MULTIPLE_ENROLLMENT_ROLES': False, # Toggle the availability of the shopping cart page 'ENABLE_SHOPPING_CART': False, # Toggle storing detailed billing information 'STORE_BILLING_INFO': False, # Enable flow for payments for course registration (DIFFERENT from verified student flow) 'ENABLE_PAID_COURSE_REGISTRATION': False, # Automatically approve student identity verification attempts 'AUTOMATIC_VERIFY_STUDENT_IDENTITY_FOR_TESTING': False, # Disable instructor dash buttons for downloading course data # when enrollment exceeds this number 'MAX_ENROLLMENT_INSTR_BUTTONS': 200, # Grade calculation started from the new instructor dashboard will write # grades CSV files to S3 and give links for downloads. 'ENABLE_S3_GRADE_DOWNLOADS': False, # whether to use password policy enforcement or not 'ENFORCE_PASSWORD_POLICY': False, # Give course staff unrestricted access to grade downloads (if set to False, # only edX superusers can perform the downloads) 'ALLOW_COURSE_STAFF_GRADE_DOWNLOADS': False, 'ENABLED_PAYMENT_REPORTS': ["refund_report", "itemized_purchase_report", "university_revenue_share", "certificate_status"], # Turn off account locking if failed login attempts exceeds a limit 'ENABLE_MAX_FAILED_LOGIN_ATTEMPTS': False, # Hide any Personally Identifiable Information from application logs 'SQUELCH_PII_IN_LOGS': False, # Toggle embargo functionality 'EMBARGO': False, # Whether the Wiki subsystem should be accessible via the direct /wiki/ paths. Setting this to True means # that people can submit content and modify the Wiki in any arbitrary manner. We're leaving this as True in the # defaults, so that we maintain current behavior 'ALLOW_WIKI_ROOT_ACCESS': True, # Turn on/off Microsites feature 'USE_MICROSITES': False, # Turn on third-party auth. Disabled for now because full implementations are not yet available. Remember to syncdb # if you enable this; we don't create tables by default. 'ENABLE_THIRD_PARTY_AUTH': False, # Toggle to enable alternate urls for marketing links 'ENABLE_MKTG_SITE': False, # Prevent concurrent logins per user 'PREVENT_CONCURRENT_LOGINS': False, # Turn off Advanced Security by default 'ADVANCED_SECURITY': False, # Show a "Download your certificate" on the Progress page if the lowest # nonzero grade cutoff is met 'SHOW_PROGRESS_SUCCESS_BUTTON': False, } # Used for A/B testing DEFAULT_GROUPS = [] # If this is true, random scores will be generated for the purpose of debugging the profile graphs GENERATE_PROFILE_SCORES = False # Used with XQueue XQUEUE_WAITTIME_BETWEEN_REQUESTS = 5 # seconds ############################# SET PATH INFORMATION ############################# PROJECT_ROOT = path(__file__).abspath().dirname().dirname() # /edx-platform/lms REPO_ROOT = PROJECT_ROOT.dirname() COMMON_ROOT = REPO_ROOT / "common" ENV_ROOT = REPO_ROOT.dirname() # virtualenv dir /edx-platform is in COURSES_ROOT = ENV_ROOT / "data" DATA_DIR = COURSES_ROOT # TODO: Remove the rest of the sys.path modification here and in cms/envs/common.py sys.path.append(REPO_ROOT) sys.path.append(PROJECT_ROOT / 'djangoapps') sys.path.append(COMMON_ROOT / 'djangoapps') sys.path.append(COMMON_ROOT / 'lib') # For Node.js system_node_path = os.environ.get("NODE_PATH", REPO_ROOT / 'node_modules') node_paths = [ COMMON_ROOT / "static/js/vendor", COMMON_ROOT / "static/coffee/src", system_node_path, ] NODE_PATH = ':'.join(node_paths) # For geolocation ip database GEOIP_PATH = REPO_ROOT / "common/static/data/geoip/GeoIP.dat" # Where to look for a status message STATUS_MESSAGE_PATH = ENV_ROOT / "status_message.json" ############################ OpenID Provider ################################## OPENID_PROVIDER_TRUSTED_ROOTS = ['cs50.net', '*.cs50.net'] ################################## EDX WEB ##################################### # This is where we stick our compiled template files. Most of the app uses Mako # templates from tempdir import mkdtemp_clean MAKO_MODULE_DIR = mkdtemp_clean('mako') MAKO_TEMPLATES = {} MAKO_TEMPLATES['main'] = [PROJECT_ROOT / 'templates', COMMON_ROOT / 'templates', COMMON_ROOT / 'lib' / 'capa' / 'capa' / 'templates', COMMON_ROOT / 'djangoapps' / 'pipeline_mako' / 'templates'] # This is where Django Template lookup is defined. There are a few of these # still left lying around. TEMPLATE_DIRS = [ PROJECT_ROOT / "templates", COMMON_ROOT / 'templates', COMMON_ROOT / 'lib' / 'capa' / 'capa' / 'templates', COMMON_ROOT / 'djangoapps' / 'pipeline_mako' / 'templates', ] TEMPLATE_CONTEXT_PROCESSORS = ( 'django.core.context_processors.request', 'django.core.context_processors.static', 'django.contrib.messages.context_processors.messages', 'django.core.context_processors.i18n', 'django.contrib.auth.context_processors.auth', # this is required for admin 'django.core.context_processors.csrf', # Added for django-wiki 'django.core.context_processors.media', 'django.core.context_processors.tz', 'django.contrib.messages.context_processors.messages', 'sekizai.context_processors.sekizai', # Hack to get required link URLs to password reset templates 'edxmako.shortcuts.marketing_link_context_processor', # Shoppingcart processor (detects if request.user has a cart) 'shoppingcart.context_processor.user_has_cart_context_processor', ) # use the ratelimit backend to prevent brute force attacks AUTHENTICATION_BACKENDS = ( 'ratelimitbackend.backends.RateLimitModelBackend', ) STUDENT_FILEUPLOAD_MAX_SIZE = 4 * 1000 * 1000 # 4 MB MAX_FILEUPLOADS_PER_INPUT = 20 # FIXME: # We should have separate S3 staged URLs in case we need to make changes to # these assets and test them. LIB_URL = '/static/js/' # Dev machines shouldn't need the book # BOOK_URL = '/static/book/' BOOK_URL = 'https://mitxstatic.s3.amazonaws.com/book_images/' # For AWS deploys RSS_TIMEOUT = 600 # Configuration option for when we want to grab server error pages STATIC_GRAB = False DEV_CONTENT = True EDX_ROOT_URL = '' LOGIN_REDIRECT_URL = EDX_ROOT_URL + '/accounts/login' LOGIN_URL = EDX_ROOT_URL + '/accounts/login' COURSE_NAME = "6.002_Spring_2012" COURSE_NUMBER = "6.002x" COURSE_TITLE = "Circuits and Electronics" ### Dark code. Should be enabled in local settings for devel. ENABLE_MULTICOURSE = False # set to False to disable multicourse display (see lib.util.views.edXhome) WIKI_ENABLED = False ### COURSE_DEFAULT = '6.002x_Fall_2012' COURSE_SETTINGS = { '6.002x_Fall_2012': { 'number': '6.002x', 'title': 'Circuits and Electronics', 'xmlpath': '6002x/', 'location': 'i4x://edx/6002xs12/course/6.002x_Fall_2012', } } # IP addresses that are allowed to reload the course, etc. # TODO (vshnayder): Will probably need to change as we get real access control in. LMS_MIGRATION_ALLOWED_IPS = [] ############################## EVENT TRACKING ################################# # FIXME: Should we be doing this truncation? TRACK_MAX_EVENT = 50000 DEBUG_TRACK_LOG = False TRACKING_BACKENDS = { 'logger': { 'ENGINE': 'track.backends.logger.LoggerBackend', 'OPTIONS': { 'name': 'tracking' } } } # We're already logging events, and we don't want to capture user # names/passwords. Heartbeat events are likely not interesting. TRACKING_IGNORE_URL_PATTERNS = [r'^/event', r'^/login', r'^/heartbeat'] EVENT_TRACKING_ENABLED = True EVENT_TRACKING_BACKENDS = { 'logger': { 'ENGINE': 'eventtracking.backends.logger.LoggerBackend', 'OPTIONS': { 'name': 'tracking', 'max_event_size': TRACK_MAX_EVENT, } } } EVENT_TRACKING_PROCESSORS = [ { 'ENGINE': 'track.shim.LegacyFieldMappingProcessor' } ] # Backwards compatibility with ENABLE_SQL_TRACKING_LOGS feature flag. # In the future, adding the backend to TRACKING_BACKENDS should be enough. if FEATURES.get('ENABLE_SQL_TRACKING_LOGS'): TRACKING_BACKENDS.update({ 'sql': { 'ENGINE': 'track.backends.django.DjangoBackend' } }) EVENT_TRACKING_BACKENDS.update({ 'sql': { 'ENGINE': 'track.backends.django.DjangoBackend' } }) ######################## GOOGLE ANALYTICS ########################### GOOGLE_ANALYTICS_ACCOUNT = 'GOOGLE_ANALYTICS_ACCOUNT_DUMMY' GOOGLE_ANALYTICS_LINKEDIN = 'GOOGLE_ANALYTICS_LINKEDIN_DUMMY' ######################## subdomain specific settings ########################### COURSE_LISTINGS = {} SUBDOMAIN_BRANDING = {} VIRTUAL_UNIVERSITIES = [] ############################### XModule Store ################################## MODULESTORE = { 'default': { 'ENGINE': 'xmodule.modulestore.xml.XMLModuleStore', 'OPTIONS': { 'data_dir': DATA_DIR, 'default_class': 'xmodule.hidden_module.HiddenDescriptor', } } } CONTENTSTORE = None DOC_STORE_CONFIG = { 'host': 'localhost', 'db': 'xmodule', 'collection': 'modulestore', } ############# XBlock Configuration ########## # Import after sys.path fixup from xmodule.modulestore.inheritance import InheritanceMixin from xmodule.modulestore import prefer_xmodules from xmodule.x_module import XModuleMixin # This should be moved into an XBlock Runtime/Application object # once the responsibility of XBlock creation is moved out of modulestore - cpennington XBLOCK_MIXINS = (LmsBlockMixin, InheritanceMixin, XModuleMixin) # Allow any XBlock in the LMS XBLOCK_SELECT_FUNCTION = prefer_xmodules #################### Python sandbox ############################################ CODE_JAIL = { # Path to a sandboxed Python executable. None means don't bother. 'python_bin': None, # User to run as in the sandbox. 'user': 'sandbox', # Configurable limits. 'limits': { # How many CPU seconds can jailed code use? 'CPU': 1, }, } # Some courses are allowed to run unsafe code. This is a list of regexes, one # of them must match the course id for that course to run unsafe code. # # For example: # # COURSES_WITH_UNSAFE_CODE = [ # r"Harvard/XY123.1/.*" # ] COURSES_WITH_UNSAFE_CODE = [] ############################### DJANGO BUILT-INS ############################### # Change DEBUG/TEMPLATE_DEBUG in your environment settings files, not here DEBUG = False TEMPLATE_DEBUG = False USE_TZ = True # CMS base CMS_BASE = 'localhost:8001' # Site info SITE_ID = 1 SITE_NAME = "edx.org" HTTPS = 'on' ROOT_URLCONF = 'lms.urls' # NOTE: Please set ALLOWED_HOSTS to some sane value, as we do not allow the default '*' # Platform Email EMAIL_BACKEND = 'django.core.mail.backends.console.EmailBackend' DEFAULT_FROM_EMAIL = 'registration@example.com' DEFAULT_FEEDBACK_EMAIL = 'feedback@example.com' SERVER_EMAIL = 'devops@example.com' TECH_SUPPORT_EMAIL = 'technical@example.com' CONTACT_EMAIL = 'info@example.com' BUGS_EMAIL = 'bugs@example.com' ADMINS = () MANAGERS = ADMINS # Static content STATIC_URL = '/static/' ADMIN_MEDIA_PREFIX = '/static/admin/' STATIC_ROOT = ENV_ROOT / "staticfiles" STATICFILES_DIRS = [ COMMON_ROOT / "static", PROJECT_ROOT / "static", ] FAVICON_PATH = 'images/favicon.ico' # Locale/Internationalization TIME_ZONE = 'America/New_York' # http://en.wikipedia.org/wiki/List_of_tz_zones_by_name LANGUAGE_CODE = 'en' # http://www.i18nguy.com/unicode/language-identifiers.html # Sourced from http://www.localeplanet.com/icu/ and wikipedia LANGUAGES = ( ('en', u'English'), ('eo', u'Dummy Language (Esperanto)'), # Dummy languaged used for testing ('fake2', u'Fake translations'), # Another dummy language for testing (not pushed to prod) ('ar', u'العربية'), # Arabic ('az', u'azərbaycanca'), # Azerbaijani ('bg-bg', u'български (България)'), # Bulgarian (Bulgaria) ('bn-bd', u'বাংলা (বাংলাদেশ)'), # Bengali (Bangladesh) ('bn-in', u'বাংলা (ভারত)'), # Bengali (India) ('bs', u'bosanski'), # Bosnian ('ca', u'Català'), # Catalan ('ca@valencia', u'Català (València)'), # Catalan (Valencia) ('cs', u'Čeština'), # Czech ('cy', u'Cymraeg'), # Welsh ('da', u'dansk'), # Danish ('de-de', u'Deutsch (Deutschland)'), # German (Germany) ('el', u'Ελληνικά'), # Greek ('en@lolcat', u'LOLCAT English'), # LOLCAT English ('en@pirate', u'Pirate English'), # Pirate English ('es-419', u'Español (Latinoamérica)'), # Spanish (Latin America) ('es-ar', u'Español (Argentina)'), # Spanish (Argentina) ('es-ec', u'Español (Ecuador)'), # Spanish (Ecuador) ('es-es', u'Español (España)'), # Spanish (Spain) ('es-mx', u'Español (México)'), # Spanish (Mexico) ('es-pe', u'Español (Perú)'), # Spanish (Peru) ('et-ee', u'Eesti (Eesti)'), # Estonian (Estonia) ('eu-es', u'euskara (Espainia)'), # Basque (Spain) ('fa', u'فارسی'), # Persian ('fa-ir', u'فارسی (ایران)'), # Persian (Iran) ('fi-fi', u'Suomi (Suomi)'), # Finnish (Finland) ('fr', u'Français'), # French ('gl', u'Galego'), # Galician ('he', u'עברית'), # Hebrew ('hi', u'हिन्दी'), # Hindi ('hu', u'magyar'), # Hungarian ('hy-am', u'Հայերեն (Հայաստան)'), # Armenian (Armenia) ('id', u'Bahasa Indonesia'), # Indonesian ('it-it', u'Italiano (Italia)'), # Italian (Italy) ('ja-jp', u'日本語(日本)'), # Japanese (Japan) ('kk-kz', u'қазақ тілі (Қазақстан)'), # Kazakh (Kazakhstan) ('km-kh', u'ភាសាខ្មែរ (កម្ពុជា)'), # Khmer (Cambodia) ('kn', u'ಕನ್ನಡ'), # Kannada ('ko-kr', u'한국어(대한민국)'), # Korean (Korea) ('lt-lt', u'Lietuvių (Lietuva)'), # Lithuanian (Lithuania) ('ml', u'മലയാളം'), # Malayalam ('mn', u'Монгол хэл'), # Mongolian ('ms', u'Bahasa Melayu'), # Malay ('nb', u'Norsk bokmål'), # Norwegian Bokmål ('ne', u'नेपाली'), # Nepali ('nl-nl', u'Nederlands (Nederland)'), # Dutch (Netherlands) ('pl', u'Polski'), # Polish ('pt-br', u'Português (Brasil)'), # Portuguese (Brazil) ('pt-pt', u'Português (Portugal)'), # Portuguese (Portugal) ('ro', u'română'), # Romanian ('ru', u'Русский'), # Russian ('si', u'සිංහල'), # Sinhala ('sk', u'Slovenčina'), # Slovak ('sl', u'Slovenščina'), # Slovenian ('th', u'ไทย'), # Thai ('tr-tr', u'Türkçe (Türkiye)'), # Turkish (Turkey) ('uk', u'Українська'), # Ukranian ('ur', u'اردو'), # Urdu ('vi', u'Tiếng Việt'), # Vietnamese ('zh-cn', u'中文(简体)'), # Chinese (China) ('zh-tw', u'中文(台灣)'), # Chinese (Taiwan) ) LANGUAGE_DICT = dict(LANGUAGES) USE_I18N = True USE_L10N = True # Localization strings (e.g. django.po) are under this directory LOCALE_PATHS = (REPO_ROOT + '/conf/locale',) # edx-platform/conf/locale/ # Messages MESSAGE_STORAGE = 'django.contrib.messages.storage.session.SessionStorage' #################################### GITHUB ####################################### # gitreload is used in LMS-workflow to pull content from github # gitreload requests are only allowed from these IP addresses, which are # the advertised public IPs of the github WebHook servers. # These are listed, eg at https://github.com/edx/edx-platform/admin/hooks ALLOWED_GITRELOAD_IPS = ['207.97.227.253', '50.57.128.197', '108.171.174.178'] #################################### AWS ####################################### # S3BotoStorage insists on a timeout for uploaded assets. We should make it # permanent instead, but rather than trying to figure out exactly where that # setting is, I'm just bumping the expiration time to something absurd (100 # years). This is only used if DEFAULT_FILE_STORAGE is overriden to use S3 # in the global settings.py AWS_QUERYSTRING_EXPIRE = 10 * 365 * 24 * 60 * 60 # 10 years ################################# SIMPLEWIKI ################################### SIMPLE_WIKI_REQUIRE_LOGIN_EDIT = True SIMPLE_WIKI_REQUIRE_LOGIN_VIEW = False ################################# WIKI ################################### from course_wiki import settings as course_wiki_settings WIKI_ACCOUNT_HANDLING = False WIKI_EDITOR = 'course_wiki.editors.CodeMirror' WIKI_SHOW_MAX_CHILDREN = 0 # We don't use the little menu that shows children of an article in the breadcrumb WIKI_ANONYMOUS = False # Don't allow anonymous access until the styling is figured out WIKI_CAN_DELETE = course_wiki_settings.CAN_DELETE WIKI_CAN_MODERATE = course_wiki_settings.CAN_MODERATE WIKI_CAN_CHANGE_PERMISSIONS = course_wiki_settings.CAN_CHANGE_PERMISSIONS WIKI_CAN_ASSIGN = course_wiki_settings.CAN_ASSIGN WIKI_USE_BOOTSTRAP_SELECT_WIDGET = False WIKI_LINK_LIVE_LOOKUPS = False WIKI_LINK_DEFAULT_LEVEL = 2 ##### Feedback submission mechanism ##### FEEDBACK_SUBMISSION_EMAIL = None ##### Zendesk ##### ZENDESK_URL = None ZENDESK_USER = None ZENDESK_API_KEY = None ##### shoppingcart Payment ##### PAYMENT_SUPPORT_EMAIL = 'payment@example.com' ##### Using cybersource by default ##### CC_PROCESSOR = { 'CyberSource': { 'SHARED_SECRET': '', 'MERCHANT_ID': '', 'SERIAL_NUMBER': '', 'ORDERPAGE_VERSION': '7', 'PURCHASE_ENDPOINT': '', } } # Setting for PAID_COURSE_REGISTRATION, DOES NOT AFFECT VERIFIED STUDENTS PAID_COURSE_REGISTRATION_CURRENCY = ['usd', '$'] # Members of this group are allowed to generate payment reports PAYMENT_REPORT_GENERATOR_GROUP = 'shoppingcart_report_access' ################################# open ended grading config ##################### #By setting up the default settings with an incorrect user name and password, # will get an error when attempting to connect OPEN_ENDED_GRADING_INTERFACE = { 'url': 'http://example.com/peer_grading', 'username': 'incorrect_user', 'password': 'incorrect_pass', 'staff_grading': 'staff_grading', 'peer_grading': 'peer_grading', 'grading_controller': 'grading_controller' } # Used for testing, debugging peer grading MOCK_PEER_GRADING = False # Used for testing, debugging staff grading MOCK_STAFF_GRADING = False ################################# Jasmine ################################### JASMINE_TEST_DIRECTORY = PROJECT_ROOT + '/static/coffee' ################################# Waffle ################################### # Name prepended to cookies set by Waffle WAFFLE_COOKIE = "waffle_flag_%s" # Two weeks (in sec) WAFFLE_MAX_AGE = 1209600 ################################# Middleware ################################### # List of finder classes that know how to find static files in # various locations. STATICFILES_FINDERS = ( 'staticfiles.finders.FileSystemFinder', 'staticfiles.finders.AppDirectoriesFinder', 'pipeline.finders.PipelineFinder', ) # List of callables that know how to import templates from various sources. TEMPLATE_LOADERS = ( 'edxmako.makoloader.MakoFilesystemLoader', 'edxmako.makoloader.MakoAppDirectoriesLoader', # 'django.template.loaders.filesystem.Loader', # 'django.template.loaders.app_directories.Loader', ) MIDDLEWARE_CLASSES = ( 'request_cache.middleware.RequestCache', 'microsite_configuration.middleware.MicrositeMiddleware', 'django_comment_client.middleware.AjaxExceptionMiddleware', 'django.middleware.common.CommonMiddleware', 'django.contrib.sessions.middleware.SessionMiddleware', # Instead of AuthenticationMiddleware, we use a cached backed version #'django.contrib.auth.middleware.AuthenticationMiddleware', 'cache_toolbox.middleware.CacheBackedAuthenticationMiddleware', 'student.middleware.UserStandingMiddleware', 'contentserver.middleware.StaticContentServer', 'crum.CurrentRequestUserMiddleware', # Adds user tags to tracking events # Must go before TrackMiddleware, to get the context set up 'user_api.middleware.UserTagsEventContextMiddleware', 'django.contrib.messages.middleware.MessageMiddleware', 'track.middleware.TrackMiddleware', 'django.middleware.csrf.CsrfViewMiddleware', 'splash.middleware.SplashMiddleware', # Allows us to dark-launch particular languages 'dark_lang.middleware.DarkLangMiddleware', 'embargo.middleware.EmbargoMiddleware', # Allows us to set user preferences # should be after DarkLangMiddleware 'lang_pref.middleware.LanguagePreferenceMiddleware', # Detects user-requested locale from 'accept-language' header in http request 'django.middleware.locale.LocaleMiddleware', 'django.middleware.transaction.TransactionMiddleware', # 'debug_toolbar.middleware.DebugToolbarMiddleware', 'django_comment_client.utils.ViewNameMiddleware', 'codejail.django_integration.ConfigureCodeJailMiddleware', # catches any uncaught RateLimitExceptions and returns a 403 instead of a 500 'ratelimitbackend.middleware.RateLimitMiddleware', # needs to run after locale middleware (or anything that modifies the request context) 'edxmako.middleware.MakoMiddleware', # For A/B testing 'waffle.middleware.WaffleMiddleware', # for expiring inactive sessions 'session_inactivity_timeout.middleware.SessionInactivityTimeout', # use Django built in clickjacking protection 'django.middleware.clickjacking.XFrameOptionsMiddleware', 'course_wiki.middleware.WikiAccessMiddleware', ) # Clickjacking protection can be enabled by setting this to 'DENY' X_FRAME_OPTIONS = 'ALLOW' ############################### Pipeline ####################################### STATICFILES_STORAGE = 'pipeline.storage.PipelineCachedStorage' from rooted_paths import rooted_glob courseware_js = ( [ 'coffee/src/' + pth + '.js' for pth in ['courseware', 'histogram', 'navigation', 'time'] ] + sorted(rooted_glob(PROJECT_ROOT / 'static', 'coffee/src/modules/**/*.js')) ) main_vendor_js = [ 'js/vendor/require.js', 'js/RequireJS-namespace-undefine.js', 'js/vendor/json2.js', 'js/vendor/jquery.min.js', 'js/vendor/jquery-ui.min.js', 'js/vendor/jquery.cookie.js', 'js/vendor/jquery.qtip.min.js', 'js/vendor/swfobject/swfobject.js', 'js/vendor/jquery.ba-bbq.min.js', 'js/vendor/ova/annotator-full.js', 'js/vendor/ova/annotator-full-firebase-auth.js', 'js/vendor/ova/video.dev.js', 'js/vendor/ova/vjs.youtube.js', 'js/vendor/ova/rangeslider.js', 'js/vendor/ova/share-annotator.js', 'js/vendor/ova/tinymce.min.js', 'js/vendor/ova/richText-annotator.js', 'js/vendor/ova/reply-annotator.js', 'js/vendor/ova/tags-annotator.js', 'js/vendor/ova/flagging-annotator.js', 'js/vendor/ova/jquery-Watch.js', 'js/vendor/ova/ova.js', 'js/vendor/ova/catch/js/catch.js', 'js/vendor/ova/catch/js/handlebars-1.1.2.js', 'js/vendor/URI.min.js', ] discussion_js = sorted(rooted_glob(COMMON_ROOT / 'static', 'coffee/src/discussion/**/*.js')) staff_grading_js = sorted(rooted_glob(PROJECT_ROOT / 'static', 'coffee/src/staff_grading/**/*.js')) open_ended_js = sorted(rooted_glob(PROJECT_ROOT / 'static', 'coffee/src/open_ended/**/*.js')) notes_js = sorted(rooted_glob(PROJECT_ROOT / 'static', 'coffee/src/notes/**/*.js')) instructor_dash_js = sorted(rooted_glob(PROJECT_ROOT / 'static', 'coffee/src/instructor_dashboard/**/*.js')) PIPELINE_CSS = { 'style-vendor': { 'source_filenames': [ 'css/vendor/font-awesome.css', 'css/vendor/jquery.qtip.min.css', 'css/vendor/responsive-carousel/responsive-carousel.css', 'css/vendor/responsive-carousel/responsive-carousel.slide.css', 'css/vendor/ova/edx-annotator.css', 'css/vendor/ova/annotator.css', 'css/vendor/ova/video-js.min.css', 'css/vendor/ova/rangeslider.css', 'css/vendor/ova/share-annotator.css', 'css/vendor/ova/richText-annotator.css', 'css/vendor/ova/tags-annotator.css', 'css/vendor/ova/flagging-annotator.css', 'css/vendor/ova/ova.css', 'js/vendor/ova/catch/css/main.css' ], 'output_filename': 'css/lms-style-vendor.css', }, 'style-vendor-tinymce-content': { 'source_filenames': [ 'js/vendor/tinymce/js/tinymce/skins/studio-tmce4/content.min.css' ], 'output_filename': 'css/lms-style-vendor-tinymce-content.css', }, 'style-vendor-tinymce-skin': { 'source_filenames': [ 'js/vendor/tinymce/js/tinymce/skins/studio-tmce4/skin.min.css' ], 'output_filename': 'css/lms-style-vendor-tinymce-skin.css', }, 'style-app': { 'source_filenames': [ 'sass/application.css', 'sass/ie.css' ], 'output_filename': 'css/lms-style-app.css', }, 'style-app-extend1': { 'source_filenames': [ 'sass/application-extend1.css', ], 'output_filename': 'css/lms-style-app-extend1.css', }, 'style-app-extend2': { 'source_filenames': [ 'sass/application-extend2.css', ], 'output_filename': 'css/lms-style-app-extend2.css', }, 'style-course-vendor': { 'source_filenames': [ 'js/vendor/CodeMirror/codemirror.css', 'css/vendor/jquery.treeview.css', 'css/vendor/ui-lightness/jquery-ui-1.8.22.custom.css', ], 'output_filename': 'css/lms-style-course-vendor.css', }, 'style-course': { 'source_filenames': [ 'sass/course.css', 'xmodule/modules.css', ], 'output_filename': 'css/lms-style-course.css', }, } common_js = set(rooted_glob(COMMON_ROOT / 'static', 'coffee/src/**/*.js')) - set(courseware_js + discussion_js + staff_grading_js + open_ended_js + notes_js + instructor_dash_js) project_js = set(rooted_glob(PROJECT_ROOT / 'static', 'coffee/src/**/*.js')) - set(courseware_js + discussion_js + staff_grading_js + open_ended_js + notes_js + instructor_dash_js) # test_order: Determines the position of this chunk of javascript on # the jasmine test page PIPELINE_JS = { 'application': { # Application will contain all paths not in courseware_only_js 'source_filenames': sorted(common_js) + sorted(project_js) + [ 'js/form.ext.js', 'js/my_courses_dropdown.js', 'js/toggle_login_modal.js', 'js/sticky_filter.js', 'js/query-params.js', 'js/src/utility.js', 'js/src/accessibility_tools.js', ], 'output_filename': 'js/lms-application.js', 'test_order': 1, }, 'courseware': { 'source_filenames': courseware_js, 'output_filename': 'js/lms-courseware.js', 'test_order': 2, }, 'main_vendor': { 'source_filenames': main_vendor_js, 'output_filename': 'js/lms-main_vendor.js', 'test_order': 0, }, 'module-descriptor-js': { 'source_filenames': rooted_glob(COMMON_ROOT / 'static/', 'xmodule/descriptors/js/*.js'), 'output_filename': 'js/lms-module-descriptors.js', 'test_order': 8, }, 'module-js': { 'source_filenames': rooted_glob(COMMON_ROOT / 'static', 'xmodule/modules/js/*.js'), 'output_filename': 'js/lms-modules.js', 'test_order': 3, }, 'discussion': { 'source_filenames': discussion_js, 'output_filename': 'js/discussion.js', 'test_order': 4, }, 'staff_grading': { 'source_filenames': staff_grading_js, 'output_filename': 'js/staff_grading.js', 'test_order': 5, }, 'open_ended': { 'source_filenames': open_ended_js, 'output_filename': 'js/open_ended.js', 'test_order': 6, }, 'notes': { 'source_filenames': notes_js, 'output_filename': 'js/notes.js', 'test_order': 7 }, 'instructor_dash': { 'source_filenames': instructor_dash_js, 'output_filename': 'js/instructor_dash.js', 'test_order': 9, }, } PIPELINE_DISABLE_WRAPPER = True # Compile all coffee files in course data directories if they are out of date. # TODO: Remove this once we move data into Mongo. This is only temporary while # course data directories are still in use. if os.path.isdir(DATA_DIR): for course_dir in os.listdir(DATA_DIR): js_dir = DATA_DIR / course_dir / "js" if not os.path.isdir(js_dir): continue for filename in os.listdir(js_dir): if filename.endswith('coffee'): new_filename = os.path.splitext(filename)[0] + ".js" if os.path.exists(js_dir / new_filename): coffee_timestamp = os.stat(js_dir / filename).st_mtime js_timestamp = os.stat(js_dir / new_filename).st_mtime if coffee_timestamp <= js_timestamp: continue os.system("rm %s" % (js_dir / new_filename)) os.system("coffee -c %s" % (js_dir / filename)) PIPELINE_CSS_COMPRESSOR = None PIPELINE_JS_COMPRESSOR = None STATICFILES_IGNORE_PATTERNS = ( "sass/*", "coffee/*", # Symlinks used by js-test-tool "xmodule_js", "common_static", ) PIPELINE_YUI_BINARY = 'yui-compressor' # Setting that will only affect the edX version of django-pipeline until our changes are merged upstream PIPELINE_COMPILE_INPLACE = True ################################# CELERY ###################################### # Message configuration CELERY_TASK_SERIALIZER = 'json' CELERY_RESULT_SERIALIZER = 'json' CELERY_MESSAGE_COMPRESSION = 'gzip' # Results configuration CELERY_IGNORE_RESULT = False CELERY_STORE_ERRORS_EVEN_IF_IGNORED = True # Events configuration CELERY_TRACK_STARTED = True CELERY_SEND_EVENTS = True CELERY_SEND_TASK_SENT_EVENT = True # Exchange configuration CELERY_DEFAULT_EXCHANGE = 'edx.core' CELERY_DEFAULT_EXCHANGE_TYPE = 'direct' # Queues configuration HIGH_PRIORITY_QUEUE = 'edx.core.high' DEFAULT_PRIORITY_QUEUE = 'edx.core.default' LOW_PRIORITY_QUEUE = 'edx.core.low' HIGH_MEM_QUEUE = 'edx.core.high_mem' CELERY_QUEUE_HA_POLICY = 'all' CELERY_CREATE_MISSING_QUEUES = True CELERY_DEFAULT_QUEUE = DEFAULT_PRIORITY_QUEUE CELERY_DEFAULT_ROUTING_KEY = DEFAULT_PRIORITY_QUEUE CELERY_QUEUES = { HIGH_PRIORITY_QUEUE: {}, LOW_PRIORITY_QUEUE: {}, DEFAULT_PRIORITY_QUEUE: {}, HIGH_MEM_QUEUE: {}, } # let logging work as configured: CELERYD_HIJACK_ROOT_LOGGER = False ################################ Bulk Email ################################### # Suffix used to construct 'from' email address for bulk emails. # A course-specific identifier is prepended. BULK_EMAIL_DEFAULT_FROM_EMAIL = 'no-reply@example.com' # Parameters for breaking down course enrollment into subtasks. BULK_EMAIL_EMAILS_PER_TASK = 100 BULK_EMAIL_EMAILS_PER_QUERY = 1000 # Initial delay used for retrying tasks. Additional retries use # longer delays. Value is in seconds. BULK_EMAIL_DEFAULT_RETRY_DELAY = 30 # Maximum number of retries per task for errors that are not related # to throttling. BULK_EMAIL_MAX_RETRIES = 5 # Maximum number of retries per task for errors that are related to # throttling. If this is not set, then there is no cap on such retries. BULK_EMAIL_INFINITE_RETRY_CAP = 1000 # We want Bulk Email running on the high-priority queue, so we define the # routing key that points to it. At the moment, the name is the same. BULK_EMAIL_ROUTING_KEY = HIGH_PRIORITY_QUEUE # Flag to indicate if individual email addresses should be logged as they are sent # a bulk email message. BULK_EMAIL_LOG_SENT_EMAILS = False # Delay in seconds to sleep between individual mail messages being sent, # when a bulk email task is retried for rate-related reasons. Choose this # value depending on the number of workers that might be sending email in # parallel, and what the SES rate is. BULK_EMAIL_RETRY_DELAY_BETWEEN_SENDS = 0.02 ############################## Video ########################################## YOUTUBE = { # YouTube JavaScript API 'API': 'www.youtube.com/iframe_api', # URL to test YouTube availability 'TEST_URL': 'gdata.youtube.com/feeds/api/videos/', # Current youtube api for requesting transcripts. # For example: http://video.google.com/timedtext?lang=en&v=j_jEn79vS3g. 'TEXT_API': { 'url': 'video.google.com/timedtext', 'params': { 'lang': 'en', 'v': 'set_youtube_id_of_11_symbols_here', }, }, } ################################### APPS ###################################### INSTALLED_APPS = ( # Standard ones that are always installed... 'django.contrib.auth', 'django.contrib.contenttypes', 'django.contrib.humanize', 'django.contrib.messages', 'django.contrib.sessions', 'django.contrib.sites', 'djcelery', 'south', # Database-backed configuration 'config_models', # Monitor the status of services 'service_status', # For asset pipelining 'edxmako', 'pipeline', 'staticfiles', 'static_replace', # Our courseware 'circuit', 'courseware', 'student', 'static_template_view', 'staticbook', 'track', 'eventtracking.django', 'util', 'certificates', 'dashboard', 'instructor', 'instructor_task', 'open_ended_grading', 'psychometrics', 'licenses', 'course_groups', 'bulk_email', # External auth (OpenID, shib) 'external_auth', 'django_openid_auth', # For the wiki 'wiki', # The new django-wiki from benjaoming 'django_notify', 'course_wiki', # Our customizations 'mptt', 'sekizai', #'wiki.plugins.attachments', 'wiki.plugins.links', 'wiki.plugins.notifications', 'course_wiki.plugins.markdownedx', # Foldit integration 'foldit', # For A/B testing 'waffle', # For testing 'django.contrib.admin', # only used in DEBUG mode 'django_nose', 'debug', # Discussion forums 'django_comment_client', 'django_comment_common', 'notes', # Splash screen 'splash', # Monitoring 'datadog', # User API 'rest_framework', 'user_api', # Shopping cart 'shoppingcart', # Notification preferences setting 'notification_prefs', # Different Course Modes 'course_modes', # Student Identity Verification 'verify_student', # Dark-launching languages 'dark_lang', # Microsite configuration 'microsite_configuration', # Student Identity Reverification 'reverification', 'embargo', # Monitoring functionality 'monitoring', ) ######################### MARKETING SITE ############################### EDXMKTG_COOKIE_NAME = 'edxloggedin' MKTG_URLS = {} MKTG_URL_LINK_MAP = { 'ABOUT': 'about_edx', 'CONTACT': 'contact', 'FAQ': 'help_edx', 'COURSES': 'courses', 'ROOT': 'root', 'TOS': 'tos', 'HONOR': 'honor', 'PRIVACY': 'privacy_edx', 'JOBS': 'jobs', 'PRESS': 'press', # Verified Certificates 'WHAT_IS_VERIFIED_CERT': 'verified-certificate', } ################# Student Verification ################# VERIFY_STUDENT = { "DAYS_GOOD_FOR": 365, # How many days is a verficiation good for? } ### This enables the Metrics tab for the Instructor dashboard ########### FEATURES['CLASS_DASHBOARD'] = False if FEATURES.get('CLASS_DASHBOARD'): INSTALLED_APPS += ('class_dashboard',) ######################## CAS authentication ########################### if FEATURES.get('AUTH_USE_CAS'): CAS_SERVER_URL = 'https://provide_your_cas_url_here' AUTHENTICATION_BACKENDS = ( 'django.contrib.auth.backends.ModelBackend', 'django_cas.backends.CASBackend', ) INSTALLED_APPS += ('django_cas',) MIDDLEWARE_CLASSES += ('django_cas.middleware.CASMiddleware',) ###################### Registration ################################## # For each of the fields, give one of the following values: # - 'required': to display the field, and make it mandatory # - 'optional': to display the field, and make it non-mandatory # - 'hidden': to not display the field REGISTRATION_EXTRA_FIELDS = { 'level_of_education': 'optional', 'gender': 'optional', 'year_of_birth': 'optional', 'mailing_address': 'optional', 'goals': 'optional', 'honor_code': 'required', 'city': 'hidden', 'country': 'hidden', } ########################## CERTIFICATE NAME ######################## CERT_NAME_SHORT = "Certificate" CERT_NAME_LONG = "Certificate of Achievement" ###################### Grade Downloads ###################### GRADES_DOWNLOAD_ROUTING_KEY = HIGH_MEM_QUEUE GRADES_DOWNLOAD = { 'STORAGE_TYPE': 'localfs', 'BUCKET': 'edx-grades', 'ROOT_PATH': '/tmp/edx-s3/grades', } ######################## PROGRESS SUCCESS BUTTON ############################## # The following fields are available in the URL: {course_id} {student_id} PROGRESS_SUCCESS_BUTTON_URL = 'http://<domain>/<path>/{course_id}' PROGRESS_SUCCESS_BUTTON_TEXT_OVERRIDE = None #### PASSWORD POLICY SETTINGS ##### PASSWORD_MIN_LENGTH = None PASSWORD_MAX_LENGTH = None PASSWORD_COMPLEXITY = {} PASSWORD_DICTIONARY_EDIT_DISTANCE_THRESHOLD = None PASSWORD_DICTIONARY = [] ##################### LinkedIn ##################### INSTALLED_APPS += ('django_openid_auth',) ############################ LinkedIn Integration ############################# INSTALLED_APPS += ('linkedin',) LINKEDIN_API = { 'EMAIL_WHITELIST': [], 'COMPANY_ID': '2746406', } ##### ACCOUNT LOCKOUT DEFAULT PARAMETERS ##### MAX_FAILED_LOGIN_ATTEMPTS_ALLOWED = 5 MAX_FAILED_LOGIN_ATTEMPTS_LOCKOUT_PERIOD_SECS = 15 * 60 ##### LMS DEADLINE DISPLAY TIME_ZONE ####### TIME_ZONE_DISPLAYED_FOR_DEADLINES = 'UTC' # Source: # http://loc.gov/standards/iso639-2/ISO-639-2_utf-8.txt according to http://en.wikipedia.org/wiki/ISO_639-1 ALL_LANGUAGES = ( [u"aa", u"Afar"], [u"ab", u"Abkhazian"], [u"af", u"Afrikaans"], [u"ak", u"Akan"], [u"sq", u"Albanian"], [u"am", u"Amharic"], [u"ar", u"Arabic"], [u"an", u"Aragonese"], [u"hy", u"Armenian"], [u"as", u"Assamese"], [u"av", u"Avaric"], [u"ae", u"Avestan"], [u"ay", u"Aymara"], [u"az", u"Azerbaijani"], [u"ba", u"Bashkir"], [u"bm", u"Bambara"], [u"eu", u"Basque"], [u"be", u"Belarusian"], [u"bn", u"Bengali"], [u"bh", u"Bihari languages"], [u"bi", u"Bislama"], [u"bs", u"Bosnian"], [u"br", u"Breton"], [u"bg", u"Bulgarian"], [u"my", u"Burmese"], [u"ca", u"Catalan"], [u"ch", u"Chamorro"], [u"ce", u"Chechen"], [u"zh", u"Chinese"], [u"cu", u"Church Slavic"], [u"cv", u"Chuvash"], [u"kw", u"Cornish"], [u"co", u"Corsican"], [u"cr", u"Cree"], [u"cs", u"Czech"], [u"da", u"Danish"], [u"dv", u"Divehi"], [u"nl", u"Dutch"], [u"dz", u"Dzongkha"], [u"en", u"English"], [u"eo", u"Esperanto"], [u"et", u"Estonian"], [u"ee", u"Ewe"], [u"fo", u"Faroese"], [u"fj", u"Fijian"], [u"fi", u"Finnish"], [u"fr", u"French"], [u"fy", u"Western Frisian"], [u"ff", u"Fulah"], [u"ka", u"Georgian"], [u"de", u"German"], [u"gd", u"Gaelic"], [u"ga", u"Irish"], [u"gl", u"Galician"], [u"gv", u"Manx"], [u"el", u"Greek"], [u"gn", u"Guarani"], [u"gu", u"Gujarati"], [u"ht", u"Haitian"], [u"ha", u"Hausa"], [u"he", u"Hebrew"], [u"hz", u"Herero"], [u"hi", u"Hindi"], [u"ho", u"Hiri Motu"], [u"hr", u"Croatian"], [u"hu", u"Hungarian"], [u"ig", u"Igbo"], [u"is", u"Icelandic"], [u"io", u"Ido"], [u"ii", u"Sichuan Yi"], [u"iu", u"Inuktitut"], [u"ie", u"Interlingue"], [u"ia", u"Interlingua"], [u"id", u"Indonesian"], [u"ik", u"Inupiaq"], [u"it", u"Italian"], [u"jv", u"Javanese"], [u"ja", u"Japanese"], [u"kl", u"Kalaallisut"], [u"kn", u"Kannada"], [u"ks", u"Kashmiri"], [u"kr", u"Kanuri"], [u"kk", u"Kazakh"], [u"km", u"Central Khmer"], [u"ki", u"Kikuyu"], [u"rw", u"Kinyarwanda"], [u"ky", u"Kirghiz"], [u"kv", u"Komi"], [u"kg", u"Kongo"], [u"ko", u"Korean"], [u"kj", u"Kuanyama"], [u"ku", u"Kurdish"], [u"lo", u"Lao"], [u"la", u"Latin"], [u"lv", u"Latvian"], [u"li", u"Limburgan"], [u"ln", u"Lingala"], [u"lt", u"Lithuanian"], [u"lb", u"Luxembourgish"], [u"lu", u"Luba-Katanga"], [u"lg", u"Ganda"], [u"mk", u"Macedonian"], [u"mh", u"Marshallese"], [u"ml", u"Malayalam"], [u"mi", u"Maori"], [u"mr", u"Marathi"], [u"ms", u"Malay"], [u"mg", u"Malagasy"], [u"mt", u"Maltese"], [u"mn", u"Mongolian"], [u"na", u"Nauru"], [u"nv", u"Navajo"], [u"nr", u"Ndebele, South"], [u"nd", u"Ndebele, North"], [u"ng", u"Ndonga"], [u"ne", u"Nepali"], [u"nn", u"Norwegian Nynorsk"], [u"nb", u"Bokmål, Norwegian"], [u"no", u"Norwegian"], [u"ny", u"Chichewa"], [u"oc", u"Occitan"], [u"oj", u"Ojibwa"], [u"or", u"Oriya"], [u"om", u"Oromo"], [u"os", u"Ossetian"], [u"pa", u"Panjabi"], [u"fa", u"Persian"], [u"pi", u"Pali"], [u"pl", u"Polish"], [u"pt", u"Portuguese"], [u"ps", u"Pushto"], [u"qu", u"Quechua"], [u"rm", u"Romansh"], [u"ro", u"Romanian"], [u"rn", u"Rundi"], [u"ru", u"Russian"], [u"sg", u"Sango"], [u"sa", u"Sanskrit"], [u"si", u"Sinhala"], [u"sk", u"Slovak"], [u"sl", u"Slovenian"], [u"se", u"Northern Sami"], [u"sm", u"Samoan"], [u"sn", u"Shona"], [u"sd", u"Sindhi"], [u"so", u"Somali"], [u"st", u"Sotho, Southern"], [u"es", u"Spanish"], [u"sc", u"Sardinian"], [u"sr", u"Serbian"], [u"ss", u"Swati"], [u"su", u"Sundanese"], [u"sw", u"Swahili"], [u"sv", u"Swedish"], [u"ty", u"Tahitian"], [u"ta", u"Tamil"], [u"tt", u"Tatar"], [u"te", u"Telugu"], [u"tg", u"Tajik"], [u"tl", u"Tagalog"], [u"th", u"Thai"], [u"bo", u"Tibetan"], [u"ti", u"Tigrinya"], [u"to", u"Tonga (Tonga Islands)"], [u"tn", u"Tswana"], [u"ts", u"Tsonga"], [u"tk", u"Turkmen"], [u"tr", u"Turkish"], [u"tw", u"Twi"], [u"ug", u"Uighur"], [u"uk", u"Ukrainian"], [u"ur", u"Urdu"], [u"uz", u"Uzbek"], [u"ve", u"Venda"], [u"vi", u"Vietnamese"], [u"vo", u"Volapük"], [u"cy", u"Welsh"], [u"wa", u"Walloon"], [u"wo", u"Wolof"], [u"xh", u"Xhosa"], [u"yi", u"Yiddish"], [u"yo", u"Yoruba"], [u"za", u"Zhuang"], [u"zu", u"Zulu"] ) ### Apps only installed in some instances OPTIONAL_APPS = ( 'edx_jsdraw', 'mentoring', # edx-ora2 'submissions', 'openassessment', 'openassessment.assessment', 'openassessment.workflow', 'openassessment.xblock' ) for app_name in OPTIONAL_APPS: # First attempt to only find the module rather than actually importing it, # to avoid circular references - only try to import if it can't be found # by find_module, which doesn't work with import hooks try: imp.find_module(app_name) except ImportError: try: __import__(app_name) except ImportError: continue INSTALLED_APPS += (app_name,) # Stub for third_party_auth options. # See common/djangoapps/third_party_auth/settings.py for configuration details. THIRD_PARTY_AUTH = {} ### ADVANCED_SECURITY_CONFIG # Empty by default ADVANCED_SECURITY_CONFIG = {}
agpl-3.0
7,149,862,700,838,229,000
31.291059
180
0.625886
false
redhat-cip/python-tripleo-wrapper
rdomhelper/ssh.py
1
11391
# -*- coding: utf-8 -*- # # Copyright (C) 2016 Red Hat, Inc # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. import paramiko from paramiko import ssh_exception import io import logging import select import time LOG = logging.getLogger('__chainsaw__') class SshClient(object): """SSH client based on Paramiko. This class implements the following features: - run commands on a remote host - send file to a remote host - redirect connection to another ssh server so that every commands will be executed on the redirected host - send files - create remote files """ def __init__(self, hostname, user, key_filename=None, via_ip=None): """:param hostname: the host on which to connect :type hostname: str :param user: the user to use for the connection :type user: str :param key_filename: the private key path to use, by default it will use the system host keys :type key_filename: str :param redirect_to_host: the host on which to redirect, by default it will use the port 22 :type redirect_to_host: str """ assert hostname, 'hostname is defined.' assert user, 'user is defined.' self._hostname = hostname self._user = user self._key_filename = key_filename self.load_private_key(key_filename) self._client = paramiko.SSHClient() self._client.set_missing_host_key_policy(paramiko.AutoAddPolicy()) self._via_ip = via_ip self._transport = None self._started = False self.description = 'not started yet' self._environment_filenames = [] def load_private_key(self, priv_key): """Register the SSH private key.""" with open(priv_key) as fd: self._private_key = paramiko.RSAKey.from_private_key(fd) def _get_transport_via_ip(self): exception = None for i in range(60): try: channel = self._client.get_transport().open_channel( 'direct-tcpip', (self._hostname, 22), (self._via_ip, 0)) except ssh_exception.ChannelException as exception: LOG.debug('%s creating the direct-tcip connections' % self.description) time.sleep(1) else: transport = paramiko.Transport(channel) transport.start_client() transport.auth_publickey(self._user, self._private_key) return transport raise exception def _get_transport(self): if self._via_ip: transport = self._get_transport_via_ip() else: transport = self._client.get_transport() transport.set_keepalive(10) return transport def start(self): """Start the ssh client and connect to the host. It will wait until the ssh service is available during 90 seconds. If it doesn't succed to connect then the function will raise an SSHException. """ if self._via_ip: connect_to = self._via_ip self.description = '[%s@%s via %s]' % (self._user, self._hostname, self._via_ip) else: connect_to = self._hostname self.description = '[%s@%s]' % (self._user, self._hostname) for i in range(60): try: self._client.connect( connect_to, username=self._user, allow_agent=True, key_filename=self._key_filename) # NOTE(Gonéri): TypeError is in the list because of # https://github.com/paramiko/paramiko/issues/615 self._transport = self._get_transport() except (OSError, TypeError, ssh_exception.SSHException, ssh_exception.NoValidConnectionsError) as e: LOG.info('%s waiting for %s' % (self.description, connect_to)) LOG.debug("exception: '%s'" % str(e)) time.sleep(1) else: LOG.debug('%s connected' % self.description) self._started = True return _error = ("unable to connect to ssh service on '%s'" % self._hostname) LOG.error(_error) raise ssh_exception.SSHException(_error) def _check_started(self): if not self._started: _error = "ssh client not started, please start the client" LOG.error(_error) raise ssh_exception.SSHException(_error) def stop(self): """Close the ssh connection.""" self._started = False self._client.close() def run(self, cmd, sudo=False, ignore_error=False, success_status=(0,), error_callback=None, custom_log=None): """Run a command on the remote host. The command is run on the remote host, if there is a redirected host then the command will be run on that redirected host. See __init__. :param cmd: the command to run :type cmd: str :param sudo: True if the command should be run with sudo, this parameter disable the use of environment files. :type sudo: str :param success_status: the list of the possible success status :type success_status: list :param error_callback: if provided, the callback to call in case of a failure. it will be called with two args, the output of the command and the returned error code. :return: the tuple (output of the command, returned code) :rtype: tuple :param custom_log: a optional string to record in the log instead of the command. This is useful for example if you want to hide a password. :type custom_log: str """ self._check_started() cmd_output = io.StringIO() channel = self._get_channel() if sudo: cmd = "sudo %s" % cmd else: for filename in self._environment_filenames: cmd = '. %s; %s' % (filename, cmd) if not custom_log: custom_log = cmd LOG.info("%s run '%s'" % (self.description, custom_log)) channel.exec_command(cmd) while True: if channel.exit_status_ready(): break rl, _, _ = select.select([channel], [], [], 30) if rl: received = channel.recv(1024).decode('UTF-8', 'ignore').strip() if received: LOG.debug(received) cmd_output.write(received) cmd_output = cmd_output.getvalue() exit_status = channel.exit_status if ignore_error or channel.exit_status in success_status: return cmd_output, channel.exit_status elif error_callback: return error_callback(cmd_output, exit_status) else: _error = ("%s command %s has failed with, rc='%s'" % (self.description, custom_log, exit_status)) LOG.error(_error) raise ssh_exception.SSHException(_error) def _get_channel(self): """Returns a channel according to if there is a redirection to do or not. """ channel = self._transport.open_session() channel.set_combine_stderr(True) channel.get_pty() return channel def send_file(self, local_path, remote_path): """Send a file to the remote host. :param local_path: the local path of the file :type local_path: str :param remote_path: the remote path of the file :type remote_path: str :return: the file attributes :rtype: paramiko.sftp_attr.SFTPAttributes """ self._check_started() sftp = paramiko.SFTPClient.from_transport(self._transport) return sftp.put(local_path, remote_path) def create_file(self, path, content, mode='w'): """Create a file with a content. :param path: the path of the file. :type path: str :param content: the content of the file :type content: str :param mode: the mode of the file while opening it :type mode: str """ self._check_started() sftp = paramiko.SFTPClient.from_transport(self._transport) with sftp.open(path, mode) as remote_file: remote_file.write(content) remote_file.flush() def info(self): return {'hostname': self._hostname, 'user': self._user, 'key_filename': self._key_filename} def add_environment_file(self, filename): self._environment_filenames.append(filename) class PoolSshClient(object): def __init__(self): self._ssh_clients = {} def build_ssh_client(self, hostname, user, key_filename=None, via_ip=None): _ssh_client = SshClient(hostname, user, key_filename, via_ip) _ssh_client.start() self._ssh_clients[user] = _ssh_client def add_ssh_client(self, user, ssh_client): self._ssh_clients[user] = ssh_client def del_ssh_client(self, user): self._check_ssh_client(user) del self._ssh_clients[user] def get_client(self, user): self._check_ssh_client(user) return self._ssh_clients[user] def _check_ssh_client(self, user): if user not in self._ssh_clients.keys(): _error = "ssh client for user %s not existing" % user LOG.error(_error) raise ssh_exception.SSHException(_error) def run(self, user, cmd, sudo=False, ignore_error=False, success_status=(0,), error_callback=None, custom_log=None): self._check_ssh_client(user) return self._ssh_clients[user].run( cmd, sudo=sudo, ignore_error=ignore_error, success_status=success_status, error_callback=error_callback, custom_log=custom_log) def send_file(self, user, local_path, remote_path): self._check_ssh_client(user) return self._ssh_clients[user].send_file(local_path, remote_path) def create_file(self, user, path, content, mode='w'): self._check_ssh_client(user) return self._ssh_clients[user].create_file(path, content, mode) def stop_all(self): for ssh_client in self._ssh_clients.values(): ssh_client.stop() def add_environment_file(self, user, filename): self._check_ssh_client(user) self._ssh_clients[user].add_environment_file(filename)
apache-2.0
-2,446,650,625,284,174,300
35.623794
89
0.576207
false
hermestrimegiste/patchtgtel
patchConnectionTogotelecom.py
1
2031
#-*- coding:utf-8 -*- __author__ = 'hermes' import socket from os import system from time import sleep from datetime import datetime global connectionName connectionName = 'TOGOTELECOM' # Definir le nom de votre reseau def is_connected(): # http://stackoverflow.com/questions/20913411/test-if-an-internet-connection-is-present-in-python try: #host = socket.gethostbyname("www.google.com") #socket.create_connection(('173.194.67.94', 80), 25) #methode 2 sans test de connection socket.gethostbyname("www.google.com") return True except: try: socket.create_connection(('173.194.67.94', 80), 15) return True except: pass pass return False def hardRestartNetwork(): system('nmcli nm enable false') system('nmcli nm enable true') sleep(5) system("nmcli con up id '%s'"% connectionName) def patchTogotelecom(): activeReseau = system('nmcli nm enable true') deconnectionSoft = system('nmcli dev disconnect iface ttyUSB0') sleep(5) if (deconnectionSoft == 0 or deconnectionSoft == 1536): activeTGTEL = system("nmcli con up id '%s'"% connectionName) if activeTGTEL == 768: # si Erreur : le délai d'attente de 90 sec a expiré. #system('modprobe --force-vermagic usb_wwan usbserial') hardRestartNetwork() else: # redemarrer le reseau si la methode soft ne marche pas hardRestartNetwork() if is_connected(): print(u'Connecté le %s '%str(datetime.now().strftime('%d-%m-%Y -> %H:%M:%S'))) else: print(u'Tentative echoué le %s '%str(datetime.now().strftime('%d-%m-%Y -> %H:%M:%S'))) # sleep(5) # debut de l execution du script #system('modprobe --force-vermagic usb_wwan usbserial') hardRestartNetwork() print(u'debut du script > %s '%str(datetime.now().strftime('%d-%m-%Y -> %H:%M:%S'))) sleep(5) while True: if is_connected(): sleep(60) else: print(u'Tentative de reconnexion le %s '%str(datetime.now().strftime('%d-%m-%Y -> %H:%M:%S'))) patchTogotelecom()
gpl-2.0
-6,435,792,570,533,313,000
26.378378
100
0.659427
false
nigelb/SerialGrabber
serial_grabber/cli.py
1
2827
#!/usr/bin/env python # SerialGrabber reads data from a serial port and processes it with the # configured processor. # Copyright (C) 2012 NigelB # # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation; either version 2 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License along # with this program; if not, write to the Free Software Foundation, Inc., # 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA. import signal import time from SerialGrabber_Storage import storage_cache from serial_grabber.commander import MultiProcessParameterFactory from serial_grabber.util import config_helper from serial_grabber.watchdog import running, counter, Watchdog from serial_grabber.processor import ProcessorManager class status: def __init__(self, logger): self.logger = logger def set_tooltip(self, tooltip): self.logger.info(tooltip) def register_handler(running, watchdog, reader, processor, command): def signal_handler(signal, frame): print 'You pressed Ctrl+C!' running.running = False if command: command.stop() watchdog.join() if reader: reader.close() exit(0) signal.signal(signal.SIGINT, signal_handler) def start(logger, reader, processor, command): try: si = status(logger) isRunning = running(True) c = counter(si) params = config_helper({ "counter": c, "running": isRunning }) if issubclass(command.__class__, MultiProcessParameterFactory): command.populate_parameters(params) if issubclass(reader.__class__, MultiProcessParameterFactory): reader.populate_parameters(params) if issubclass(processor.__class__, MultiProcessParameterFactory): processor.populate_parameters(params) watchdog = Watchdog(isRunning) register_handler(isRunning, watchdog, reader, processor, command) if reader: watchdog.start_thread(reader, (isRunning, c, params), "Runner") if processor: watchdog.start_thread(ProcessorManager(processor), (isRunning, c, params), "Processor") if command and reader: watchdog.start_thread(command, (isRunning, c, params), "Commander") while isRunning.running: time.sleep(1) finally: storage_cache.close_cache()
gpl-2.0
-6,709,110,638,634,718,000
34.3375
99
0.686594
false
Hybrid-Cloud/badam
patches_tool/aws_patch/aws_deps/libcloud/compute/drivers/vultr.py
1
6023
# Licensed to the Apache Software Foundation (ASF) under one or more # contributor license agreements. See the NOTICE file distributed with # this work for additional information regarding copyright ownership. # The ASF licenses this file to You under the Apache License, Version 2.0 # (the "License"); you may not use this file except in compliance with # the License. You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """ Vultr Driver """ import time from libcloud.utils.py3 import httplib from libcloud.utils.py3 import urlencode from libcloud.common.base import ConnectionKey, JsonResponse from libcloud.compute.types import Provider, NodeState from libcloud.common.types import LibcloudError, InvalidCredsError from libcloud.compute.base import NodeDriver from libcloud.compute.base import Node, NodeImage, NodeSize, NodeLocation class VultrResponse(JsonResponse): def parse_error(self): if self.status == httplib.OK: body = self.parse_body() return body elif self.status == httplib.FORBIDDEN: raise InvalidCredsError(self.body) else: raise LibcloudError(self.body) class VultrConnection(ConnectionKey): """ Connection class for the Vultr driver. """ host = 'api.vultr.com' responseCls = VultrResponse def add_default_params(self, params): """ Add parameters that are necessary for every request This method add ``api_key`` to the request. """ params['api_key'] = self.key return params def encode_data(self, data): return urlencode(data) def get(self, url): return self.request(url) def post(self, url, data): headers = {'Content-Type': 'application/x-www-form-urlencoded'} return self.request(url, data=data, headers=headers, method='POST') class VultrNodeDriver(NodeDriver): """ VultrNode node driver. """ connectionCls = VultrConnection type = Provider.VULTR name = 'Vultr' website = 'https://www.vultr.com' NODE_STATE_MAP = {'pending': NodeState.PENDING, 'active': NodeState.RUNNING} def list_nodes(self): return self._list_resources('/v1/server/list', self._to_node) def list_locations(self): return self._list_resources('/v1/regions/list', self._to_location) def list_sizes(self): return self._list_resources('/v1/plans/list', self._to_size) def list_images(self): return self._list_resources('/v1/os/list', self._to_image) def create_node(self, name, size, image, location): params = {'DCID': location.id, 'VPSPLANID': size.id, 'OSID': image.id, 'label': name} result = self.connection.post('/v1/server/create', params) if result.status != httplib.OK: return False subid = result.object['SUBID'] retry_count = 3 created_node = None for i in range(retry_count): try: nodes = self.list_nodes() created_node = [n for n in nodes if n.id == subid][0] except IndexError: time.sleep(1) pass else: break return created_node def reboot_node(self, node): params = {'SUBID': node.id} res = self.connection.post('/v1/server/reboot', params) return res.status == httplib.OK def destroy_node(self, node): params = {'SUBID': node.id} res = self.connection.post('/v1/server/destroy', params) return res.status == httplib.OK def _list_resources(self, url, tranform_func): data = self.connection.get(url).object sorted_key = sorted(data) return [tranform_func(data[key]) for key in sorted_key] def _to_node(self, data): if 'status' in data: state = self.NODE_STATE_MAP.get(data['status'], NodeState.UNKNOWN) if state == NodeState.RUNNING and \ data['power_status'] != 'running': state = NodeState.STOPPED else: state = NodeState.UNKNOWN if 'main_ip' in data and data['main_ip'] is not None: public_ips = [data['main_ip']] else: public_ips = [] extra_keys = [] extra = {} for key in extra_keys: if key in data: extra[key] = data[key] node = Node(id=data['SUBID'], name=data['label'], state=state, public_ips=public_ips, private_ips=None, extra=extra, driver=self) return node def _to_location(self, data): return NodeLocation(id=data['DCID'], name=data['name'], country=data['country'], driver=self) def _to_size(self, data): extra = {'vcpu_count': int(data['vcpu_count'])} ram = int(data['ram']) disk = int(data['disk']) bandwidth = float(data['bandwidth']) price = float(data['price_per_month']) return NodeSize(id=data['VPSPLANID'], name=data['name'], ram=ram, disk=disk, bandwidth=bandwidth, price=price, extra=extra, driver=self) def _to_image(self, data): extra = {'arch': data['arch'], 'family': data['family']} return NodeImage(id=data['OSID'], name=data['name'], extra=extra, driver=self)
apache-2.0
-2,399,194,911,052,198,000
30.733696
78
0.584592
false
YourCyborg/Sun-RPI
src/objects/admin.py
1
5428
# # This sets up how models are displayed # in the web admin interface. # from django import forms from django.conf import settings from django.contrib import admin from src.objects.models import ObjAttribute, ObjectDB, ObjectNick, Alias from src.utils.utils import mod_import class ObjAttributeInline(admin.TabularInline): model = ObjAttribute fields = ('db_key', 'db_value') extra = 0 class NickInline(admin.TabularInline): model = ObjectNick fields = ('db_nick', 'db_real', 'db_type') extra = 0 class AliasInline(admin.TabularInline): model = Alias fields = ("db_key",) extra = 0 class ObjectCreateForm(forms.ModelForm): "This form details the look of the fields" class Meta: model = ObjectDB db_key = forms.CharField(label="Name/Key", widget=forms.TextInput(attrs={'size':'78'}), help_text="Main identifier, like 'apple', 'strong guy', 'Elizabeth' etc. If creating a Character, check so the name is unique among characters!",) db_typeclass_path = forms.CharField(label="Typeclass",initial="Change to (for example) %s or %s." % (settings.BASE_OBJECT_TYPECLASS, settings.BASE_CHARACTER_TYPECLASS), widget=forms.TextInput(attrs={'size':'78'}), help_text="This defines what 'type' of entity this is. This variable holds a Python path to a module with a valid Evennia Typeclass. If you are creating a Character you should use the typeclass defined by settings.BASE_CHARACTER_TYPECLASS or one derived from that.") db_permissions = forms.CharField(label="Permissions", initial=settings.PERMISSION_PLAYER_DEFAULT, required=False, widget=forms.TextInput(attrs={'size':'78'}), help_text="a comma-separated list of text strings checked by certain locks. They are mainly of use for Character objects. Character permissions overload permissions defined on a controlling Player. Most objects normally don't have any permissions defined.") db_cmdset_storage = forms.CharField(label="CmdSet", initial=settings.CMDSET_DEFAULT, required=False, widget=forms.TextInput(attrs={'size':'78'}), help_text="Most non-character objects don't need a cmdset and can leave this field blank.") class ObjectEditForm(ObjectCreateForm): "Form used for editing. Extends the create one with more fields" db_lock_storage = forms.CharField(label="Locks", required=False, widget=forms.Textarea(attrs={'cols':'100', 'rows':'2'}), help_text="In-game lock definition string. If not given, defaults will be used. This string should be on the form <i>type:lockfunction(args);type2:lockfunction2(args);...") class ObjectDBAdmin(admin.ModelAdmin): list_display = ('id', 'db_key', 'db_location', 'db_player', 'db_typeclass_path') list_display_links = ('id', 'db_key') ordering = ['db_player', 'db_typeclass_path', 'id'] search_fields = ['^db_key', 'db_typeclass_path'] save_as = True save_on_top = True list_select_related = True list_filter = ('db_permissions', 'db_location', 'db_typeclass_path') # editing fields setup form = ObjectEditForm fieldsets = ( (None, { 'fields': (('db_key','db_typeclass_path'), ('db_permissions', 'db_lock_storage'), ('db_location', 'db_home'), 'db_destination','db_cmdset_storage' )}), ) #deactivated temporarily, they cause empty objects to be created in admin inlines = [AliasInline]#, ObjAttributeInline] # Custom modification to give two different forms wether adding or not. add_form = ObjectCreateForm add_fieldsets = ( (None, { 'fields': (('db_key','db_typeclass_path'), 'db_permissions', ('db_location', 'db_home'), 'db_destination','db_cmdset_storage' )}), ) def get_fieldsets(self, request, obj=None): if not obj: return self.add_fieldsets return super(ObjectDBAdmin, self).get_fieldsets(request, obj) def get_form(self, request, obj=None, **kwargs): """ Use special form during creation """ defaults = {} if obj is None: defaults.update({ 'form': self.add_form, 'fields': admin.util.flatten_fieldsets(self.add_fieldsets), }) defaults.update(kwargs) return super(ObjectDBAdmin, self).get_form(request, obj, **defaults) def save_model(self, request, obj, form, change): if not change: # adding a new object obj = obj.typeclass obj.basetype_setup() obj.basetype_posthook_setup() obj.at_object_creation() obj.at_init() admin.site.register(ObjectDB, ObjectDBAdmin)
bsd-3-clause
8,773,561,773,923,069,000
42.130081
306
0.573876
false
dgutman/ADRCPathViewer
api/routes/v1/Tile.py
1
1783
from flask_restful import Resource from flask import Response from bson.objectid import ObjectId from bson.json_util import dumps from utils.deepzoom import get_slide, PILBytesIO class Tile(Resource): def __init__(self, db, config): """initialize DeepZoom resource Args: db: mongo db connection config: application configurations opt: deep zoom configurations Returns: None """ self.db = db self.config = config self.slides = self.db[self.config["db_collection"]] def get(self, id, level, x, y): """ Get slide tile --- tags: - Tile parameters: - in: path name: id description: MonogDB ObjectId appended to it the level -- Example 57bf3c092f9b2e1595b29730 type: string - in: path name: level description: The zoom level type: integer - in: path name: x description: The column type: integer - in: path name: y description: The row type: integer responses: 200: description: Returns the slide information 404: description: Invalid slide Id or slide not found """ if not ObjectId.is_valid(id): resp = {"status": 404, "message": "Invalid slide Id " + id} return Response(dumps(resp), status=404, mimetype='application/json') image = self.slides.find_one({'_id': ObjectId(id)}) path = image["path"] slide = get_slide(path) try: tile = slide.get_tile(level, (x, y)) buf = PILBytesIO() tile.save(buf, 'jpeg', quality=90) return Response(buf.getvalue(), status=200, mimetype='image/jpeg') except ValueError: Response(None, status=404)
mit
4,115,524,365,538,051,600
25.626866
102
0.596186
false
HEPData/hepdata3
hepdata/modules/records/migrator/api.py
1
18355
# -*- coding: utf-8 -*- # # This file is part of HEPData. # Copyright (C) 2016 CERN. # # HEPData is free software; you can redistribute it # and/or modify it under the terms of the GNU General Public License as # published by the Free Software Foundation; either version 2 of the # License, or (at your option) any later version. # # HEPData is distributed in the hope that it will be # useful, but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU # General Public License for more details. # # You should have received a copy of the GNU General Public License # along with HEPData; if not, write to the # Free Software Foundation, Inc., 59 Temple Place, Suite 330, Boston, # MA 02111-1307, USA. # # In applying this license, CERN does not # waive the privileges and immunities granted to it by virtue of its status # as an Intergovernmental Organization or submit itself to any jurisdiction. from __future__ import absolute_import, print_function import socket from datetime import datetime, timedelta from urllib2 import HTTPError import requests from celery import shared_task from flask import current_app import os from invenio_db import db from hepdata.ext.elasticsearch.api import get_records_matching_field, index_record_ids from hepdata.modules.inspire_api.views import get_inspire_record_information from hepdata.modules.dashboard.views import do_finalise from hepdata.modules.records.utils.common import record_exists from hepdata.modules.records.utils.submission import \ process_submission_directory, get_or_create_hepsubmission, \ remove_submission from hepdata.modules.records.utils.workflow import create_record, update_record import logging from hepdata.modules.records.utils.yaml_utils import split_files from hepdata.modules.submission.api import get_latest_hepsubmission, is_resource_added_to_submission from hepdata.modules.submission.models import DataResource, HEPSubmission from hepdata.utils.file_extractor import get_file_in_directory from hepdata.modules.records.utils.doi_minter import generate_dois_for_submission from hepdata.modules.email.api import notify_publication_update logging.basicConfig() log = logging.getLogger(__name__) class FailedSubmission(Exception): def __init__(self, message, errors, record_id): # Call the base class constructor with the parameters it needs super(FailedSubmission, self).__init__(message) # Now for your custom code... self.errors = errors self.record_id = record_id def print_errors(self): for file in self.errors: print(file) for error_message in self.errors[file]: print("\t{0} for {1}".format(error_message, self.record_id)) @shared_task def update_analyses(): endpoints = current_app.config["ANALYSES_ENDPOINTS"] for analysis_endpoint in endpoints: if "endpoint_url" in endpoints[analysis_endpoint]: log.info("Updating analyses from {0}...".format(analysis_endpoint)) response = requests.get(endpoints[analysis_endpoint]["endpoint_url"]) if response: analyses = response.json() for record in analyses: submission = get_latest_hepsubmission(inspire_id=record, overall_status='finished') if submission: num_new_resources = 0 for analysis in analyses[record]: _resource_url = endpoints[analysis_endpoint]["url_template"].format(analysis) if not is_resource_added_to_submission(submission.publication_recid, submission.version, _resource_url): print('Adding {} analysis to ins{} with URL {}' .format(analysis_endpoint, record, _resource_url)) new_resource = DataResource( file_location=_resource_url, file_type=analysis_endpoint) submission.resources.append(new_resource) num_new_resources += 1 if num_new_resources: try: db.session.add(submission) db.session.commit() index_record_ids([submission.publication_recid]) except Exception as e: db.session.rollback() log.error(e) else: log.debug("An analysis is available in {0} but with no equivalent in HEPData (ins{1}).".format( analysis_endpoint, record)) else: log.debug("No endpoint url configured for {0}".format(analysis_endpoint)) @shared_task def update_submissions(inspire_ids_to_update, force=False, only_record_information=False, send_email=False): migrator = Migrator() for index, inspire_id in enumerate(inspire_ids_to_update): _cleaned_id = inspire_id.replace("ins", "") _matching_records = get_records_matching_field("inspire_id", _cleaned_id) if len(_matching_records["hits"]["hits"]) >= 1: recid = _matching_records["hits"]["hits"][0]["_source"]["recid"] if "related_publication" in _matching_records["hits"]["hits"][0]["_source"]: recid = _matching_records["hits"]["hits"][0]["_source"]["related_publication"] print("The record with inspire_id {} and recid {} will be updated now".format(inspire_id, recid)) migrator.update_file.delay(inspire_id, recid, force, only_record_information, send_email) else: log.error("No record exists with id {0}. You should load this file first.".format(inspire_id)) @shared_task def add_or_update_records_since_date(date=None, send_tweet=False, convert=False): """ Given a date, gets all the records updated or added since that date and updates or adds the corresponding records. :param date: in the format YYYYddMM (e.g. 20160705 for the 5th July 2016) :param send_tweet: :param convert: :return: """ if not date: # then use yesterdays date yesterday = datetime.now() - timedelta(days=1) date = yesterday.strftime("%Y%m%d") inspire_ids = get_all_ids_in_current_system(date) print("{0} records to be added or updated since {1}.".format(len(inspire_ids), date)) load_files(inspire_ids, send_tweet=send_tweet, convert=convert) def get_all_ids_in_current_system(date=None, prepend_id_with="ins"): """ Finds all the IDs that have been added or updated since some date. :param date: :param prepend_id_with: :return: """ import requests, re brackets_re = re.compile(r"\[+|\]+") inspire_ids = [] base_url = "http://hepdata.cedar.ac.uk/allids/{0}" if date: base_url = base_url.format(date) else: base_url = base_url.format("") response = requests.get(base_url) if response.ok: _all_ids = response.text for match in re.finditer("\[[0-9]+,[0-9]+,[0-9]+\]", _all_ids): start = match.start() end = match.end() # process the block which is of the form [inspire_id,xxx,xxx] id_block = brackets_re.sub("", _all_ids[start:end]) id = id_block.split(",")[0].strip() if id != "0": inspire_ids.append("{0}{1}".format(prepend_id_with, id)) return inspire_ids def load_files(inspire_ids, send_tweet=False, synchronous=False, convert=False, base_url='http://hepdata.cedar.ac.uk/view/{0}/yaml'): """ :param base_url: override default base URL :param convert: :param synchronous: if should be run immediately :param send_tweet: whether or not to tweet this entry. :param inspire_ids: array of inspire ids to load (in the format insXXX). :return: None """ migrator = Migrator() for index, inspire_id in enumerate(inspire_ids): _cleaned_id = inspire_id.replace("ins", "") if not record_exists(inspire_id=_cleaned_id): print("The record with id {0} does not exist in the database, so we're loading it.".format(inspire_id)) try: log.info("Loading {0}".format(inspire_id)) if synchronous: migrator.load_file(inspire_id, send_tweet, convert=convert, base_url=base_url) else: migrator.load_file.delay(inspire_id, send_tweet, convert=convert, base_url=base_url) except socket.error as se: print("socket error...") log.error(se.message) except Exception as e: print("Failed to load {0}. {1} ".format(inspire_id, e)) log.error("Failed to load {0}. {1} ".format(inspire_id, e)) else: print("The record with inspire id {0} already exists. Updating instead.".format(inspire_id)) log.info("Updating {}".format(inspire_id)) if synchronous: update_submissions([inspire_id]) else: update_submissions.delay([inspire_id]) class Migrator(object): """ Performs the interface for all migration-related tasks including downloading, splitting files, YAML cleaning, and loading. """ def __init__(self, base_url="http://hepdata.cedar.ac.uk/view/{0}/yaml"): self.base_url = base_url def prepare_files_for_submission(self, inspire_id, force_retrieval=False): """ Either returns a file if it already exists, or downloads it and splits it. :param inspire_id: :return: output location if successful, None if not """ output_location = os.path.join(current_app.config["CFG_DATADIR"], inspire_id) last_updated = datetime.now() download = not os.path.exists(output_location) or (get_file_in_directory(output_location, 'yaml') is None) if download or force_retrieval: print("Downloading file for {0}".format(inspire_id)) file_location = self.download_file(inspire_id) if file_location: output_location = os.path.join(current_app.config["CFG_DATADIR"], inspire_id) error, last_updated = split_files(file_location, output_location, "{0}.zip".format(output_location)) # remove temporary download file after processing try: os.remove(file_location) except: log.info('Unable to remove {0}'.format(file_location)) else: output_location = None else: print("File for {0} already in system...no download required.".format(inspire_id)) return output_location, last_updated @shared_task def update_file(inspire_id, recid, force=False, only_record_information=False, send_email=False, send_tweet=False, convert=False): self = Migrator() output_location, oldsite_last_updated = self.prepare_files_for_submission(inspire_id, force_retrieval=True) if output_location: updated_record_information, status = self.retrieve_publication_information(inspire_id) if status == 'success': record_information = update_record(recid, updated_record_information) else: log.error("Failed to retrieve publication information for {0}".format(inspire_id)) return hep_submission = HEPSubmission.query.filter_by(publication_recid=recid).first() version_count = HEPSubmission.query.filter_by(publication_recid=recid).count() print('Old site last updated {}'.format(str(oldsite_last_updated))) print('New site last updated {}'.format(str(hep_submission.last_updated))) print('Coordinator ID is {}, version count is {}'.format(hep_submission.coordinator, version_count)) allow_update = (hep_submission.last_updated < oldsite_last_updated or force) and \ hep_submission.coordinator == 1 and version_count == 1 if not only_record_information and allow_update: try: recid = self.load_submission( record_information, output_location, os.path.join(output_location, "submission.yaml"), update=True) print('Loaded record {}'.format(recid)) if recid is not None: do_finalise(recid, publication_record=record_information, force_finalise=True, send_tweet=send_tweet, update=True, convert=convert) except FailedSubmission as fe: log.error(fe.message) fe.print_errors() remove_submission(fe.record_id) elif not only_record_information: print('Not updating record {}'.format(recid)) else: index_record_ids([record_information["recid"]]) _cleaned_id = inspire_id.replace("ins", "") generate_dois_for_submission.delay(inspire_id=_cleaned_id) # update metadata stored in DataCite if send_email: notify_publication_update(hep_submission, record_information) # send email to all participants else: log.error("Failed to load {0}".format(inspire_id)) @shared_task def load_file(inspire_id, send_tweet=False, convert=False, base_url='http://hepdata.cedar.ac.uk/view/{0}/yaml'): self = Migrator(base_url) output_location, oldsite_last_updated = self.prepare_files_for_submission(inspire_id) if output_location: publication_information, status = self.retrieve_publication_information(inspire_id) if status == "success": record_information = create_record(publication_information) else: log.error("Failed to retrieve publication information for " + inspire_id) return False try: recid = self.load_submission( record_information, output_location, os.path.join(output_location, "submission.yaml")) if recid is not None: do_finalise(recid, publication_record=record_information, force_finalise=True, send_tweet=send_tweet, convert=convert) return True except FailedSubmission as fe: log.error(fe.message) fe.print_errors() remove_submission(fe.record_id) return False else: log.error("Failed to load " + inspire_id) return False def download_file(self, inspire_id): """ :param inspire_id: :return: """ import requests import tempfile from shutil import copyfile # Check if single YAML file exists in static directory. base_dir = os.path.dirname(os.path.realpath(__file__)) yaml_file = os.path.join(base_dir, 'static', inspire_id + '.yaml') if os.path.isfile(yaml_file): print("Found {}".format(yaml_file)) tmp_file = tempfile.NamedTemporaryFile(dir=current_app.config["CFG_TMPDIR"], delete=False) tmp_file.close() copyfile(yaml_file, tmp_file.name) return tmp_file.name try: url = self.base_url.format(inspire_id) log.info("Trying URL " + url) response = requests.get(url) if response.ok: yaml = response.text # save to tmp file tmp_file = tempfile.NamedTemporaryFile(dir=current_app.config["CFG_TMPDIR"], delete=False) tmp_file.write(yaml) tmp_file.close() return tmp_file.name else: log.error('Non OK response from endpoint at {0}'.format(url)) return None except HTTPError as e: log.error("Failed to download {0}".format(inspire_id)) log.error(e.message) return None def retrieve_publication_information(self, inspire_id): """ :param inspire_id: id for record to get. If this contains "ins", the "ins" is removed. :return: dict containing keys for: title doi authors abstract arxiv_id collaboration """ if "ins" in inspire_id: inspire_id = int(inspire_id.replace("ins", "")) content, status = get_inspire_record_information(inspire_id) content["inspire_id"] = inspire_id return content, status def load_submission(self, record_information, file_base_path, submission_yaml_file_location, update=False): """ :param record_information: :param file_base_path: :param files: :return: """ # create publication record. # load data tables # create data table records (call finalise(recid)) admin_user_id = 1 # consume data payload and store in db. get_or_create_hepsubmission(record_information["recid"], admin_user_id) errors = process_submission_directory(file_base_path, submission_yaml_file_location, record_information["recid"], update=update) if len(errors) > 0: print("ERRORS ARE: ") print(errors) if errors: raise FailedSubmission("Submission failed for {0}.".format( record_information["recid"]), errors, record_information["recid"]) else: return record_information["recid"]
gpl-2.0
-4,209,488,083,953,529,000
40.154709
119
0.592373
false
hiatobr/midiacapoeira
modules/queries.py
1
1403
# -*- coding: utf-8 -*- from gluon import current def tagQuery(tags, ctbl, ttbl, query = 0, op = 'or', field = 'texto_id'): ''' Busca no banco de dados por conteúdo marcado pelas tags em <tags>. A operação é recursiva, tag por tag, juntando o resultado de uma busca ao resultado referente à tag anterior. Essa junção pode ser por intersecção (op = 'and') ou por união (op = 'or'). Esta implementação preza por generalidade, de modo que a função pode ser utilizada para buscar qualquer tipo de conteúdo, desde que a variável <field> seja corretamente preenchida na chamada da função. <ctbl> = tabela de conteúdo <ttbl> = tabela de tags ''' db = current.db try: # Escolhe uma tag e procura por índices de textos que a contêm tag_ref = db(ttbl.tag==tags.pop()).select(ttbl[field]).as_list() tag_ref = map(list.pop, map(dict.values, tag_ref)) if query and op == 'or': return tagQuery(tags, ctbl, ttbl, ctbl.id.belongs(tag_ref) | query) elif query and op == 'and': return tagQuery (tags, ctbl, ttbl, ctbl.id.belongs(tag_ref) & query) else: return tagQuery(tags, ctbl, ttbl, ctbl.id.belongs(tag_ref)) except IndexError: return db(query).select(ctbl.ALL).as_list()
gpl-3.0
3,060,283,172,362,273,000
34.435897
73
0.606368
false
jsaponara/opentaxforms
opentaxforms/serve.py
1
3082
#!/usr/bin/env python from __future__ import print_function, absolute_import import flask_restless from argparse import ArgumentParser from flask import Flask from flask_sqlalchemy import SQLAlchemy from sqlalchemy.ext.declarative import declarative_base from sqlalchemy.orm import scoped_session, sessionmaker from .db import connect from .version import appname, apiVersion from .ut import Bag def createApi(app,**kw): db = SQLAlchemy(app) conn, engine, metadata, md = connect(appname, **kw) Base = declarative_base() Session = sessionmaker(autocommit=False, autoflush=False, bind=engine) mysession = scoped_session(Session) apimanager = flask_restless.APIManager(app, session=mysession) counts = {} for tabl in md: tablobj = md[tabl] counts[tabl] = tablobj.count().execute().fetchone()[0] attrs = dict( __table__=tablobj, # todo should flask_restless need __tablename__? __tablename__=str(tabl), ) attrs.update(dict( orgn=dict( form=db.relationship('Form'), ), form=dict( orgn=db.relationship('Orgn', back_populates='form'), slot=db.relationship('Slot', back_populates='form'), ), slot=dict( form=db.relationship('Form'), ), )[tabl]) tablcls = type(str(tabl).capitalize(), (Base, ), attrs) colsToAdd = dict( orgn=(), form=( 'orgn', 'orgn.code', ), slot=( 'form', 'form.code', ), )[tabl] colsToShow = [c.name for c in tablobj.columns] colsToShow.extend(colsToAdd) # print tabl,colsToShow apimanager.create_api( tablcls, url_prefix='/api/v%s' % (apiVersion, ), include_columns=colsToShow, ) return counts def parseCmdline(): '''Load command line arguments''' parser = ArgumentParser( description='Automates tax forms' ' and provides an API for new tax form interfaces' ) parser.add_argument( '-P', '--postgres', help='use postgres database [default=sqlite]', action="store_true") return parser.parse_args() def createApp(**kw): cmdline = kw.get('cmdline') verbose = kw.get('verbose') if 'cmdline' in kw: del kw['cmdline'] if 'verbose' in kw: del kw['verbose'] args = parseCmdline() if cmdline else Bag(dict(postgres=False)) app = Flask(appname) app.config['SQLALCHEMY_TRACK_MODIFICATIONS'] = False # to suppress warning counts = createApi(app,postgres=args.postgres, **kw) if verbose: print('serving {slot} slots in {form} forms from {orgn} orgns'.format( **counts)) return app def main(**kw): app = createApp(dbpath='sqlite:///opentaxforms.sqlite3', **kw) app.run() if __name__ == "__main__": main(cmdline=True, verbose=True)
agpl-3.0
2,853,290,267,090,020,000
30.131313
79
0.576249
false
bbglab/wok
wok/core/flow/reader.py
1
6997
############################################################################### # # Copyright 2009-2011, Universitat Pompeu Fabra # # This file is part of Wok. # # Wok is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # Wok is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program. If not, see <http://www.gnu.org/licenses # ############################################################################### import os.path try: from lxml import etree except ImportError: try: # Python 2.5 import xml.etree.cElementTree as etree except ImportError: try: # Python 2.5+ import xml.etree.ElementTree as etree except ImportError: try: # normal cElementTree install import cElementTree as etree except ImportError: try: # normal ElementTree install import elementtree.ElementTree as etree except ImportError: import sys sys.stderr.write("Failed to import ElementTree from any known place\n") raise from wok.config.data import DataElement, Data from wok.core.flow.model import * def str_to_bool(s): s2b = { "0" : False, "1" : True, "no" : False, "yes" : True, "false" : False, "true" : True} if s in s2b: return s2b[s] else: return False class FlowReader(object): def __init__(self, source): if isinstance(source, basestring): self.path = os.path.abspath(source) self.fp = open(source, "r") else: self.path = None self.fp = source self.__doc = None def __read_doc(self): if self.__doc is None: self.__doc = etree.parse(self.fp) return self.__doc def read_meta(self): doc = self.__read_doc() root = doc.getroot() if root.tag != "flow": raise Exception("<flow> expected but <{}> found".format(xmle.tag)) name = root.attrib.get("name") library = root.attrib.get("library") version = root.attrib.get("version") return (name, library, version) def read(self): doc = self.__read_doc() root = doc.getroot() flow = self._parse_flow(root) if self.path: flow.path = self.path return flow def _parse_base_desc(self, xmle, obj): if "name" not in xmle.attrib: raise Exception("'name' attribute not found in tag <{}>".format(xmle.tag)) obj.name = xmle.attrib["name"] obj.title = xmle.findtext("title") obj.desc = xmle.findtext("desc") if "enabled" in xmle: obj.enabled = str_to_bool(xmle.attr["enabled"]) def _parse_base_port(self, xmle, obj): self._parse_base_desc(xmle, obj) if "serializer" in xmle.attrib: obj.serializer = xmle.attrib["serializer"] if "wsize" in xmle.attrib: try: obj.wsize = int(xmle.attrib["wsize"]) except: raise Exception("At {} {}: 'wsize' should be a number greater than 0".format(xmle.tag, obj.name)) if obj.wsize < 1: raise Exception("At {} {}: 'wsize' should be a number greater than 0".format(xmle.tag, obj.name)) def _parse_base_module(self, xmle, obj): self._parse_base_port(xmle, obj) if "maxpar" in xmle.attrib: try: obj.maxpar = int(xmle.attrib["maxpar"]) except: raise Exception("At {} {}: 'maxpar' should be a number greater than 0".format(xmle.tag, obj.name)) if obj.maxpar < 1: raise Exception("At {} {}: 'maxpar' should be a number greater than 0".format(xmle.tag, obj.name)) conf_xml = xmle.find("conf") if conf_xml is not None: obj.conf = self._parse_conf(conf_xml) res_xml = xmle.find("resources") if res_xml is not None: obj.resources = self._parse_conf(res_xml) for x in xmle.findall("param"): obj.params += [self._parse_param(x)] for x in xmle.findall("in"): obj.add_in_port(self._parse_port(x)) for x in xmle.findall("out"): obj.add_out_port(self._parse_port(x)) def _parse_flow(self, xmle): if xmle.tag != "flow": raise Exception("<flow> expected but <{}> found".format(xmle.tag)) flow = Flow(name = None) self._parse_base_module(xmle, flow) if "library" in xmle.attrib: flow.library = xmle.attrib["library"] if "version" in xmle.attrib: flow.version = xmle.attrib["version"] for xmle in xmle.findall("module"): module = self._parse_module(flow, xmle) # TODO check that there is no other module with the same name flow.add_module(module) return flow def _parse_module(self, flow, xmle): mod = Module(name = None) self._parse_base_module(xmle, mod) if "depends" in xmle.attrib: depends = [d.strip() for d in xmle.attrib["depends"].split(",")] mod.depends = [d for d in depends if len(d) > 0] exec_xml = xmle.find("exec") if exec_xml is None: run_xml = xmle.find("run") if run_xml is None: flow_ref_xml = xmle.find("flow") if flow_ref_xml is None: raise Exception("Missing either <exec>, <run> or <flow> in module {}".format(mod.name)) else: mod.flow_ref = self._parse_flow_ref(flow, mod, flow_ref_xml) else: mod.execution = self._parse_run(mod, run_xml) else: mod.execution = self._parse_exec(exec_xml) return mod def _parse_param(self, xmle): raise Exception("Unimplemented") def _parse_port(self, xmle): if xmle.tag == "in": mode = PORT_MODE_IN elif xmle.tag == "out": mode = PORT_MODE_OUT port = Port(name = None, mode = mode) self._parse_base_port(xmle, port) if "link" in xmle.attrib: link = [x.strip() for x in xmle.attrib["link"].split(",")] port.link = [l for l in link if len(l) > 0] return port def _parse_conf(self, xmle): return Data.from_xmle(xmle) def _parse_exec(self, xmle): execution = Exec() if "launcher" in xmle.attrib: execution.mode = xmle.attrib["launcher"].lower() if execution.mode == "python": execution.mode = "native" execution.conf = Data.from_xmle(xmle) return execution def _parse_run(self, mod, xmle): if xmle.text is None or len(xmle.text) == 0: raise Exception("Missing script name for <run> in module {}".format(mod.name)) execution = Exec() execution.mode = "native" execution.conf = DataElement() execution.conf["script_path"] = xmle.text return execution def _parse_flow_ref(self, flow, mod, xmle): if xmle.text is None or len(xmle.text) == 0: raise Exception("Missing flow name for <flow> in module {}".format(mod.name)) flow_ref = FlowRef() pos = xmle.text.rfind(".") if pos == -1 and flow.library is not None: flow_ref.canonical_name = "{}.{}".format(flow.library, xmle.text) else: flow_ref.canonical_name = xmle.text if "version" in xmle.attrib: flow_ref.version = xmle.attrib["version"] return flow_ref def close(self): self.fp.close()
gpl-3.0
6,454,725,803,999,862,000
26.225681
102
0.641561
false
nacc/autotest
client/tests/kvm/tests/pci_hotplug.py
1
8582
import re from autotest.client.shared import error from autotest.client.virt import virt_utils, virt_vm, aexpect def run_pci_hotplug(test, params, env): """ Test hotplug of PCI devices. (Elements between [] are configurable test parameters) 1) PCI add a deivce (NIC / block) 2) Compare output of monitor command 'info pci'. 3) Compare output of guest command [reference_cmd]. 4) Verify whether pci_model is shown in [pci_find_cmd]. 5) Check whether the newly added PCI device works fine. 6) PCI delete the device, verify whether could remove the PCI device. @param test: KVM test object. @param params: Dictionary with the test parameters. @param env: Dictionary with test environment. """ vm = env.get_vm(params["main_vm"]) vm.verify_alive() timeout = int(params.get("login_timeout", 360)) session = vm.wait_for_login(timeout=timeout) # Modprobe the module if specified in config file module = params.get("modprobe_module") if module: session.cmd("modprobe %s" % module) # Get output of command 'info pci' as reference info_pci_ref = vm.monitor.info("pci") # Get output of command as reference reference = session.cmd_output(params.get("reference_cmd")) tested_model = params.get("pci_model") test_type = params.get("pci_type") image_format = params.get("image_format_stg") # Probe qemu to verify what is the supported syntax for PCI hotplug cmd_output = vm.monitor.cmd("?") if len(re.findall("\ndevice_add", cmd_output)) > 0: cmd_type = "device_add" elif len(re.findall("\npci_add", cmd_output)) > 0: cmd_type = "pci_add" else: raise error.TestError("Unknow version of qemu") # Determine syntax of drive hotplug # __com.redhat_drive_add == qemu-kvm-0.12 on RHEL 6 if len(re.findall("\n__com.redhat_drive_add", cmd_output)) > 0: drive_cmd_type = "__com.redhat_drive_add" # drive_add == qemu-kvm-0.13 onwards elif len(re.findall("\ndrive_add", cmd_output)) > 0: drive_cmd_type = "drive_add" else: raise error.TestError("Unknow version of qemu") # Probe qemu for a list of supported devices devices_support = vm.monitor.cmd("%s ?" % cmd_type) if cmd_type == "pci_add": if test_type == "nic": pci_add_cmd = "pci_add pci_addr=auto nic model=%s" % tested_model elif test_type == "block": image_params = params.object_params("stg") image_filename = virt_utils.get_image_filename(image_params, test.bindir) pci_add_cmd = ("pci_add pci_addr=auto storage file=%s,if=%s" % (image_filename, tested_model)) # Execute pci_add (should be replaced by a proper monitor method call) add_output = vm.monitor.cmd(pci_add_cmd) if not "OK domain" in add_output: raise error.TestFail("Add PCI device failed. " "Monitor command is: %s, Output: %r" % (pci_add_cmd, add_output)) after_add = vm.monitor.info("pci") elif cmd_type == "device_add": driver_id = test_type + "-" + virt_utils.generate_random_id() device_id = test_type + "-" + virt_utils.generate_random_id() if test_type == "nic": if tested_model == "virtio": tested_model = "virtio-net-pci" pci_add_cmd = "device_add id=%s,driver=%s" % (device_id, tested_model) elif test_type == "block": image_params = params.object_params("stg") image_filename = virt_utils.get_image_filename(image_params, test.bindir) controller_model = None if tested_model == "virtio": tested_model = "virtio-blk-pci" if tested_model == "scsi": tested_model = "scsi-disk" controller_model = "lsi53c895a" if len(re.findall(controller_model, devices_support)) == 0: raise error.TestError("scsi controller device (%s) not " "supported by qemu" % controller_model) if controller_model is not None: controller_id = "controller-" + device_id controller_add_cmd = ("device_add %s,id=%s" % (controller_model, controller_id)) vm.monitor.cmd(controller_add_cmd) if drive_cmd_type == "drive_add": driver_add_cmd = ("drive_add auto " "file=%s,if=none,id=%s,format=%s" % (image_filename, driver_id, image_format)) elif drive_cmd_type == "__com.redhat_drive_add": driver_add_cmd = ("__com.redhat_drive_add " "file=%s,format=%s,id=%s" % (image_filename, image_format, driver_id)) pci_add_cmd = ("device_add id=%s,driver=%s,drive=%s" % (device_id, tested_model, driver_id)) vm.monitor.cmd(driver_add_cmd) # Check if the device is support in qemu if len(re.findall(tested_model, devices_support)) > 0: add_output = vm.monitor.cmd(pci_add_cmd) else: raise error.TestError("%s doesn't support device: %s" % (cmd_type, tested_model)) after_add = vm.monitor.info("pci") if not device_id in after_add: raise error.TestFail("Add device failed. Monitor command is: %s" ". Output: %r" % (pci_add_cmd, add_output)) # Define a helper function to delete the device def pci_del(ignore_failure=False): if cmd_type == "pci_add": result_domain, bus, slot, function = add_output.split(',') domain = int(result_domain.split()[2]) bus = int(bus.split()[1]) slot = int(slot.split()[1]) pci_addr = "%x:%x:%x" % (domain, bus, slot) cmd = "pci_del pci_addr=%s" % pci_addr elif cmd_type == "device_add": cmd = "device_del %s" % device_id # This should be replaced by a proper monitor method call vm.monitor.cmd(cmd) def device_removed(): after_del = vm.monitor.info("pci") return after_del != after_add if (not virt_utils.wait_for(device_removed, 10, 0, 1) and not ignore_failure): raise error.TestFail("Failed to hot remove PCI device: %s. " "Monitor command: %s" % (tested_model, cmd)) try: # Compare the output of 'info pci' if after_add == info_pci_ref: raise error.TestFail("No new PCI device shown after executing " "monitor command: 'info pci'") # Define a helper function to compare the output def new_shown(): o = session.cmd_output(params.get("reference_cmd")) return o != reference secs = int(params.get("wait_secs_for_hook_up")) if not virt_utils.wait_for(new_shown, 30, secs, 3): raise error.TestFail("No new device shown in output of command " "executed inside the guest: %s" % params.get("reference_cmd")) # Define a helper function to catch PCI device string def find_pci(): o = session.cmd_output(params.get("find_pci_cmd")) return params.get("match_string") in o if not virt_utils.wait_for(find_pci, 30, 3, 3): raise error.TestFail("PCI %s %s device not found in guest. " "Command was: %s" % (tested_model, test_type, params.get("find_pci_cmd"))) # Test the newly added device try: session.cmd(params.get("pci_test_cmd")) except aexpect.ShellError, e: raise error.TestFail("Check for %s device failed after PCI " "hotplug. Output: %r" % (test_type, e.output)) session.close() except Exception: pci_del(ignore_failure=True) raise else: pci_del()
gpl-2.0
-7,138,173,694,472,886,000
41.275862
79
0.53554
false
cshtarkov/autobump
tests/test_java_handler.py
1
10110
import os import tempfile import unittest from autobump.handlers import java_ast from autobump.handlers import java_native class TestJavaHandlerBase(unittest.TestCase): """Used to set up a simple Java codebase in a temporary location. Does not contain any actual tests. Test cases are meant to inherit from this class so that they all have a non-trivial fixture.""" @classmethod def setUpClass(cls): sources = [ ("packageX/ClassA.java", """ package packageX; public class ClassA { public void returnsVoid() {} public ClassB returnsB(ClassB b) { return b; } private void privateReturnsVoid() {} } """), ("packageX/ClassB.java", """ package packageX; public class ClassB { private static final int ONE = 1; public static final int FIVE = 5; public ClassA returnsB(ClassA b) { return b; } } """), ("packageY/ClassC.java", """ package packageY; import packageX.ClassA; import packageX.ClassB; public class ClassC extends ClassA { public void overloaded(int a) {} public void overloaded(int a, ClassA b) {} public void overloaded(int a, ClassB b) {} public class Inner { } } """), ("packageY/InterfaceD.java", """ package packageY; public interface InterfaceD { public static final boolean INTERFACE_D = true; } """), ("packageY/InterfaceE.java", """ package packageY; public interface InterfaceE { } """), ("packageY/InterfaceX.java", """ package packageY; public interface InterfaceX extends InterfaceD, InterfaceE { } """), ("packageY/ClassD.java", """ package packageY; import packageX.ClassA; public class ClassD extends ClassC implements InterfaceD { public static void acceptsClassD(ClassD p) {} public static void acceptsIfaceD(InterfaceD p) {} public static void acceptsIfaceE(InterfaceE p) {} public static void acceptsIfaceX(InterfaceX p) {} public static void acceptsClassA(ClassA p) {} public static void acceptsClassC(ClassC p) {} public static void acceptsArrayClassC(ClassC[] p) {} public static void acceptsArrayClassA(ClassA[] p) {} } """) ] cls.dir_handle = tempfile.TemporaryDirectory() cls.dir = cls.dir_handle.name # Write the above class definitions to source files. files = [] for filename, source in sources: fullpath = os.path.join(cls.dir, filename) files.append(fullpath) os.makedirs(os.path.dirname(fullpath), exist_ok=True) with open(fullpath, "w") as f: f.write(source) # Get two codebases for the two different handlers. cls.codebase_ast = java_ast.codebase_to_units(cls.dir) cls.codebase_native = java_native.codebase_to_units(cls.dir, 'javac `find -name "*.java" | xargs`', '.') # By default, run the java_ast handler tests. # The java_native handler will need to override setUp() # and reassign cls.codebase. cls.codebase = cls.codebase_ast @classmethod def tearDownClass(cls): cls.dir_handle.cleanup() def setUp(self): self.codebase = self.__class__.codebase self.codebase_ast = self.__class__.codebase_ast class TestClassesAST(TestJavaHandlerBase): def test_class_names(self): self.assertTrue("packageX.ClassA" in self.codebase) self.assertTrue("packageX.ClassB" in self.codebase) self.assertTrue("packageY.ClassC" in self.codebase) self.assertTrue("packageY.InterfaceD" in self.codebase) self.assertTrue("packageY.ClassD" in self.codebase) def test_class_functions(self): self.assertTrue("returnsVoid" in self.codebase["packageX.ClassA"].functions) self.assertFalse("privateReturnsVoid" in self.codebase["packageX.ClassA"].functions) def test_class_fields(self): self.assertTrue("FIVE" in self.codebase["packageX.ClassB"].fields) self.assertFalse("ONE" in self.codebase["packageX.ClassB"].fields) def test_inner_class(self): self.assertTrue("Inner" in self.codebase["packageY.ClassC"].units) class TestClassesNative(TestClassesAST): def setUp(self): super(TestClassesNative, self).setUp() self.codebase = self.codebase_native # java_ast and java_native disagree on what inner classes should be called, # so we need to override this test. def test_inner_class(self): self.assertTrue("packageY.ClassC$Inner" in self.codebase["packageY.ClassC"].units) class TestMethodOverloadingAST(TestJavaHandlerBase): def test_overloading_possible(self): self.assertEqual(len(self.codebase["packageY.ClassC"].functions["overloaded"].signatures), 3) def test_additional_parameter(self): function = self.codebase["packageY.ClassC"].functions["overloaded"] self.assertTrue(any(len(sig.parameters) == 3 and sig.parameters[2].type.name == "packageX.ClassA" for sig in function.signatures)) def test_parameter_different_type(self): function = self.codebase["packageY.ClassC"].functions["overloaded"] self.assertTrue(any(len(sig.parameters) == 3 and sig.parameters[2].type.name == "packageX.ClassB" for sig in function.signatures)) class TestMethodOverloadingNative(TestMethodOverloadingAST): def setUp(self): super(TestMethodOverloadingNative, self).setUp() self.codebase = self.codebase_native class TestTypesAST(TestJavaHandlerBase): def test_type_and_array_of_type_are_different(self): t = self.codebase["packageY.ClassD"].functions["acceptsClassA"].signatures[0].parameters[1].type arrayT = self.codebase["packageY.ClassD"].functions["acceptsArrayClassA"].signatures[0].parameters[1].type self.assertFalse(t.is_compatible(arrayT)) self.assertFalse(arrayT.is_compatible(t)) def test_superclass_compatible_with_subclass(self): superclass = self.codebase["packageY.ClassD"].functions["acceptsClassA"].signatures[0].parameters[1].type subclass = self.codebase["packageY.ClassD"].functions["acceptsClassC"].signatures[0].parameters[1].type self.assertTrue(superclass.is_compatible(subclass)) def test_superclass_array_compatible_with_subclass(self): superclass = self.codebase["packageY.ClassD"].functions["acceptsArrayClassA"].signatures[0].parameters[1].type subclass = self.codebase["packageY.ClassD"].functions["acceptsArrayClassC"].signatures[0].parameters[1].type self.assertTrue(superclass.is_compatible(subclass)) def test_subclass_not_compatible_with_superclass(self): superclass = self.codebase["packageY.ClassD"].functions["acceptsClassA"].signatures[0].parameters[1].type subclass = self.codebase["packageY.ClassD"].functions["acceptsClassC"].signatures[0].parameters[1].type self.assertFalse(subclass.is_compatible(superclass)) def test_subclass_array_not_compatible_with_superclass(self): superclass = self.codebase["packageY.ClassD"].functions["acceptsArrayClassA"].signatures[0].parameters[1].type subclass = self.codebase["packageY.ClassD"].functions["acceptsArrayClassC"].signatures[0].parameters[1].type self.assertFalse(subclass.is_compatible(superclass)) def test_superclass_compatible_with_subclass_skip_one(self): superclass = self.codebase["packageY.ClassD"].functions["acceptsClassA"].signatures[0].parameters[1].type subclass = self.codebase["packageY.ClassD"].functions["acceptsClassD"].signatures[0].parameters[1].type self.assertTrue(superclass.is_compatible(subclass)) def test_interface_compatible_with_class(self): interface = self.codebase["packageY.ClassD"].functions["acceptsIfaceD"].signatures[0].parameters[1].type subclass = self.codebase["packageY.ClassD"].functions["acceptsClassD"].signatures[0].parameters[1].type self.assertTrue(interface.is_compatible(subclass)) def test_class_not_compatible_with_interface(self): interface = self.codebase["packageY.ClassD"].functions["acceptsIfaceD"].signatures[0].parameters[1].type subclass = self.codebase["packageY.ClassD"].functions["acceptsClassD"].signatures[0].parameters[1].type self.assertFalse(subclass.is_compatible(interface)) def test_interface_extension(self): interface1 = self.codebase["packageY.ClassD"].functions["acceptsIfaceD"].signatures[0].parameters[1].type interface2 = self.codebase["packageY.ClassD"].functions["acceptsIfaceE"].signatures[0].parameters[1].type subclass = self.codebase["packageY.ClassD"].functions["acceptsIfaceX"].signatures[0].parameters[1].type self.assertTrue(interface1.is_compatible(subclass)) self.assertTrue(interface2.is_compatible(subclass)) class TestTypesNative(TestTypesAST): def setUp(self): super(TestTypesNative, self).setUp() self.codebase = self.codebase_native # Need to patch the 'location' of every type - i.e. # where TypeCompatibilityChecker will try to find the # class files. for function in self.codebase["packageY.ClassD"].functions.values(): for signature in function.signatures: for parameter in signature.parameters: parameter.type.location = self.dir if __name__ == "__main__": unittest.main()
gpl-3.0
-4,486,002,600,987,291,600
39.44
138
0.646785
false
arruda/rmr
rmr/apps/accounts/migrations/0001_initial.py
1
4385
# -*- coding: utf-8 -*- import datetime from south.db import db from south.v2 import SchemaMigration from django.db import models class Migration(SchemaMigration): def forwards(self, orm): # Adding model 'UserProfile' db.create_table('accounts_userprofile', ( ('id', self.gf('django.db.models.fields.AutoField')(primary_key=True)), ('user', self.gf('django.db.models.fields.related.ForeignKey')(to=orm['auth.User'])), ('quota', self.gf('django.db.models.fields.DecimalField')(default='0', null=True, max_digits=10, decimal_places=2, blank=True)), )) db.send_create_signal('accounts', ['UserProfile']) def backwards(self, orm): # Deleting model 'UserProfile' db.delete_table('accounts_userprofile') models = { 'accounts.userprofile': { 'Meta': {'object_name': 'UserProfile'}, 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'quota': ('django.db.models.fields.DecimalField', [], {'default': "'0'", 'null': 'True', 'max_digits': '10', 'decimal_places': '2', 'blank': 'True'}), 'user': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['auth.User']"}) }, 'auth.group': { 'Meta': {'object_name': 'Group'}, 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'unique': 'True', 'max_length': '80'}), 'permissions': ('django.db.models.fields.related.ManyToManyField', [], {'to': "orm['auth.Permission']", 'symmetrical': 'False', 'blank': 'True'}) }, 'auth.permission': { 'Meta': {'ordering': "('content_type__app_label', 'content_type__model', 'codename')", 'unique_together': "(('content_type', 'codename'),)", 'object_name': 'Permission'}, 'codename': ('django.db.models.fields.CharField', [], {'max_length': '100'}), 'content_type': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['contenttypes.ContentType']"}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '50'}) }, 'auth.user': { 'Meta': {'object_name': 'User'}, 'date_joined': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'email': ('django.db.models.fields.EmailField', [], {'max_length': '75', 'blank': 'True'}), 'first_name': ('django.db.models.fields.CharField', [], {'max_length': '30', 'blank': 'True'}), 'groups': ('django.db.models.fields.related.ManyToManyField', [], {'to': "orm['auth.Group']", 'symmetrical': 'False', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'is_active': ('django.db.models.fields.BooleanField', [], {'default': 'True'}), 'is_staff': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'is_superuser': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'last_login': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'last_name': ('django.db.models.fields.CharField', [], {'max_length': '30', 'blank': 'True'}), 'password': ('django.db.models.fields.CharField', [], {'max_length': '128'}), 'user_permissions': ('django.db.models.fields.related.ManyToManyField', [], {'to': "orm['auth.Permission']", 'symmetrical': 'False', 'blank': 'True'}), 'username': ('django.db.models.fields.CharField', [], {'unique': 'True', 'max_length': '30'}) }, 'contenttypes.contenttype': { 'Meta': {'ordering': "('name',)", 'unique_together': "(('app_label', 'model'),)", 'object_name': 'ContentType', 'db_table': "'django_content_type'"}, 'app_label': ('django.db.models.fields.CharField', [], {'max_length': '100'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'model': ('django.db.models.fields.CharField', [], {'max_length': '100'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '100'}) } } complete_apps = ['accounts']
mit
4,301,774,263,361,745,000
61.657143
182
0.560547
false
Dev-Cloud-Platform/Dev-Cloud
dev_cloud/cc1/src/wi/tests/registration_test.py
1
3217
# -*- coding: utf-8 -*- # @COPYRIGHT_begin # # Copyright [2010-2014] Institute of Nuclear Physics PAN, Krakow, Poland # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # # @COPYRIGHT_end # -*- coding: utf-8 -*- """@package src.wi.tests.registration_test @author Piotr Wójcik @author Krzysztof Danielowski @date 11.10.2012 """ from wi.tests import WiTestCase import unittest import random class RegistrationTests(WiTestCase, unittest.TestCase): def _fill_common_data(self, field_key=None, field_value=None): driver = self.driver self.base_url = self.TEST_SERVER driver.get(self.base_url + "/registration/register/") self.change_language() self.wait_for_text("//div[@id='content']/div[2]/div/div[5]/h2", ["Registration"]) driver.find_element_by_id("id_login").clear() driver.find_element_by_id("id_login").send_keys("witest" + str(random.randint(1, 100000))) driver.find_element_by_id("id_first").clear() driver.find_element_by_id("id_first").send_keys("test") driver.find_element_by_id("id_last").clear() driver.find_element_by_id("id_last").send_keys("test") driver.find_element_by_id("id_organization").clear() driver.find_element_by_id("id_organization").send_keys("test") driver.find_element_by_id("id_email").clear() driver.find_element_by_id("id_email").send_keys("witest" + str(random.randint(1, 100000)) + "@witest.pl") driver.find_element_by_id("id_new_password").clear() driver.find_element_by_id("id_new_password").send_keys("test1") driver.find_element_by_id("id_password2").clear() driver.find_element_by_id("id_password2").send_keys("test1") if field_key is not None: driver.find_element_by_id(field_key).clear() driver.find_element_by_id(field_key).send_keys(field_value) driver.find_element_by_css_selector("input.big_button").click() @unittest.skip('a') def test_1_registration_success(self): driver = self.driver self._fill_common_data() self.assertEqual("Registration success - Registration - CC1", driver.title) def test_2_registration_login_duplicate(self): self._fill_common_data("id_login", self.TEST_USER['login']) self.wait_for_text("//form[@id='registration-form']/fieldset/div/ul/li", ["A user with that login already exists."]) def test_3_registration_wrong_email(self): self._fill_common_data("id_email", "witest" + str(random.randint(1, 100000)) + "@witestpl") self.wait_for_text("//form[@id='registration-form']/fieldset/div/ul/li", ["Enter a valid email address."])
apache-2.0
5,230,412,575,024,754,000
40.230769
114
0.662313
false
gustavovaliati/ci724-ppginfufpr-2016
knn-02-06/knn-cuda_notworking_yet.py
1
7979
#!/usr/bin/python import datetime, argparse, sys, os import numpy as np from multiprocessing import Pool import pycuda.driver as drv import pycuda.tools import pycuda.autoinit import numpy.linalg as la from pycuda.compiler import SourceModule import pycuda.gpuarray as gpuarray ap = argparse.ArgumentParser() ap.add_argument("-tr", "--train", required = True, help = "Is the training dataset path.") ap.add_argument("-te", "--test", required = True, help = "Is the testing dataset path.") ap.add_argument("-k", required = True, help = "Is K for the KNN algorithm.") ap.add_argument("-lte", "--limit-test", required = False, help = "Sets a limit for how many testing sets must be used instead of the whole file.") ap.add_argument("-ltr", "--limit-train", required = False, help = "Sets a limit for how many training sets must be used instead of the whole file.") args = vars(ap.parse_args()) train_file_path = args["train"] test_file_path = args["test"] k_number = int(args["k"]) test_calculation_limit = False test_calculation_limit_arg = args["limit_test"] if (test_calculation_limit_arg): test_calculation_limit = int(test_calculation_limit_arg) else: print "Be aware you didn't set a limit for the testing set. We are going to test all." train_calculation_limit = False train_calculation_limit_arg = args["limit_train"] if (train_calculation_limit_arg): train_calculation_limit = int(train_calculation_limit_arg) else: print "Be aware you didn't set a limit for the training set. We are going to use it all." ############ # STATIC PARAMETERS ############ classes = 10 #todo remove harded coded. confusion_matrix = np.zeros((classes,classes), dtype=np.int) result_error = 0 result_rejection = 0 total_testing = 0 total_training = 0 process_number = 4 ############ #LOAD TRAINING FILE ############ train_file = open(train_file_path, "r") print "Reading file: ", train_file_path header = train_file.readline().split(" ") train_number_lines = int(header[0]) number_features = int(header[1]) print "Lines {} | Features {}".format(train_number_lines, number_features) if train_calculation_limit: print "We are limiting to {} training sets.".format(train_calculation_limit) if train_number_lines > train_calculation_limit: total_training = train_calculation_limit else: print "\nERROR: the training limit is bigger than the actual number of testing sets." sys.exit() else: total_training = train_number_lines train_features = [] train_real_class = [] train_guessed_class = [] for train_index, features in enumerate(train_file): if train_calculation_limit and train_index >= train_calculation_limit: break features = features.split(" ") features_class = features.pop(number_features) # features = np.array(map(float, features)) features = np.array(features, dtype=np.float32) features_class = int(features_class.replace("\n","")) train_features.append(features) train_real_class.append(features_class) ############ #LOAD TEST FILE ############ test_file = open(test_file_path, "r") print "Reading file: ", test_file_path header = test_file.readline().split(" ") test_number_lines = int(header[0]) number_features = int(header[1]) print "Lines {} | Features {}".format(test_number_lines, number_features) if test_calculation_limit: print "We are limiting to {} testing sets.".format(test_calculation_limit) if test_number_lines > test_calculation_limit: total_testing = test_calculation_limit else: print "\nERROR: the testing limit is bigger than the actual number of testing sets." sys.exit() else: total_testing = test_number_lines test_features = [] test_real_class = [] test_guessed_class = [] test_processed_lines = 0 for test_index, features in enumerate(test_file): if test_calculation_limit and test_index >= test_calculation_limit: break features = features.split(" ") features_class = features.pop(number_features) # features = np.array(map(float, features)) features = np.array(features, dtype=np.float32) features_class = int(features_class.replace("\n","")) test_features.append(features) test_real_class.append(features_class) ############ # CALCULATION ############ def print_summary(tested): valid_total = tested - result_rejection time_end = datetime.datetime.now() print "Calculation time: {}".format(time_end - time_start) if valid_total > 0: correct = (valid_total - result_error) * 100.0 / valid_total else: correct = 0.0 print "Tested {} | Error: {} | Rejection {} | Correct {} %".format(tested, result_error, result_rejection, correct) print confusion_matrix def calc_distance(test_feat_index, train_feat_index): # a = test_features[test_feat_index][:3] # b = train_features[train_feat_index][:3] # a = np.array(test_features[test_feat_index], dtype=np.float32) # b = np.array(train_features[train_feat_index], dtype=np.float32) # print a, a.shape # print b, b.shape a_gpu = gpuarray.to_gpu(np.array([0.4, 0.5, 0.6])) b_gpu = gpuarray.to_gpu(np.array([0.1, 0.2, 0.3])) # a_gpu = gpuarray.to_gpu(test_features[test_feat_index]) # b_gpu = gpuarray.to_gpu(train_features[train_feat_index]) # a_gpu = gpuarray.to_gpu(np.random.randn(132).astype(np.float32)) # b_gpu = gpuarray.to_gpu(np.random.randn(132).astype(np.float32)) a_doubled = ((a_gpu - b_gpu)**2).get() return pycuda.gpuarray.sum(a_doubled) # return 1 def calc_train(start, end, test_feat_index): # print "pid", os.getpid(), start, end # current_ranking = np.zeros(0) current_ranking = np.zeros(0, dtype=np.float32) dictionary = {} for index in range(start, end): distance = calc_distance(test_feat_index, index) if current_ranking.size >= k_number: # dictionary.pop(current_ranking[k_number-1]) current_ranking = np.delete(current_ranking, k_number-1, 0) current_ranking = np.append(current_ranking, distance) # print distance dictionary[distance] = train_real_class[index] current_ranking = np.sort(current_ranking, kind="mergesort") # print current_ranking, dictionary new_dic = {} for r in current_ranking: new_dic[r] = dictionary[r] return new_dic, current_ranking time_start = datetime.datetime.now() offset = int(total_training / process_number) pool = Pool(processes=process_number) for test_index, test_feat in enumerate(test_features): start = 0 workers = [] for i in range(process_number): end = start+offset worker = pool.apply_async(calc_train, (start, end, test_index)) workers.append(worker) start = end # print "workers",workers k_ranking_dict = {} ranking = [] for worker in workers: d, r = worker.get() ranking = np.concatenate((ranking, r)) k_ranking_dict.update(d) ranking = np.sort(ranking, kind="mergesort") ranking = ranking[0:k_number] # print "here",ranking, k_ranking_dict to_count_array = [] for r in ranking: # print "k_ranking_dict[key]",k_ranking_dict[key] to_count_array.append(k_ranking_dict[r]) counting = np.bincount(to_count_array) guessed_class = np.argmax(counting) guessed_counter = counting[guessed_class] counting = np.delete(counting, guessed_class) if guessed_counter in counting: result_rejection = result_rejection + 1 continue real_class = test_real_class[test_index] confusion_matrix[real_class,guessed_class] = confusion_matrix[real_class,guessed_class] + 1 # print real_class, guessed_class if real_class != guessed_class: result_error = result_error + 1 print_summary(test_index+1) ############ # END - PRESENT RESULTS ############ print "\n FINISHED. Final summary: \n" tested = len(test_features) print_summary(tested)
gpl-3.0
4,105,071,858,557,358,000
30.788845
148
0.6665
false
clembou/PCWG
tests/interpolators_test.py
1
4393
import pcwg.core.interpolators as interpolators import unittest from pcwg.core.binning import Bins class TestMarmanderPowerCurveInterpolator(unittest.TestCase): def test_spreadsheet_benchmark(self): x = [1.00, 2.00, 3.00, 4.10, 5.06, 6.04, 7.00, 8.00, 9.01, 9.98, 10.97, 12.00, 12.99, 13.95, 14.99, 16.01, 16.98, 17.84, 19.00, 20.00, 21.00, 22.00, 23.00, 24.00, 25.00, 26.00, 27.00, 28.00, 29.00, 30.00] y = [0.0, 0.0, 0.0, 70.5, 198.6, 373.7, 578.4, 886.4, 1177.2, 1523.2, 1792.2, 1918.3, 1955.4, 1976.0, 1976.0, 1981.7, 1982.9, 1982.2, 1987.4, 1987.4, 1987.4, 1987.4, 1987.4, 1987.4, 1987.4, 0.0, 0.0, 0.0, 0.0, 0.0] cutOutWindSpeed = 25.0 limits = Bins(0.0,1.0, 30.0).limits expectedX = [1.00, 2.00, 3.00, 3.55, 4.10, 5.06, 6.04, 7.00, 8.00, 9.01, 9.98, 10.97, 12.00, 12.99, 13.95, 14.99, 16.01, 16.98, 17.84, 18.42, 19.00, 20.00, 21.00, 22.00, 23.00, 24.00, 25.00, 25.01, 26.00, 27.00] expectedY = [0.0, 0.0, 0.0, 0.0, 91.8, 204.2, 383.9, 571.1, 893.5, 1173.5, 1522.4, 1794.9, 1922.8, 1954.5, 1977.4, 1975.1, 1982.2, 1983.4, 1979.4, 1987.4, 1987.4, 1987.4, 1987.4, 1987.4, 1987.4, 1987.4, 1987.4, 0.0, 0.0, 0.0 ] interpolator = interpolators.MarmanderPowerCurveInterpolator(x, y, cutOutWindSpeed, xLimits = limits, debug = False) if interpolator.debug: print interpolator.debugText print "Cen\tExpect\tAct\tError\tTolerance\tMatch" #NNOTE: a relative large tolerance required to make test pass. #This is understood to be associated with differences #between the cubic interpolation scheme implemented #in the excel benchmark and scipy. #TODO: Further work to bottom out on this difference. for i in range(len(expectedX)): if expectedX[i] < 6.0: tolerancePercent = 0.02 else: tolerancePercent = 0.005 actual = interpolator(expectedX[i]) error = actual - expectedY[i] if expectedY[i] != 0.0: errorPercent = (actual - expectedY[i]) / expectedY[i] else: errorPercent = 0.0 match = (abs(errorPercent) <= tolerancePercent) print "{0:.2f}\t{1:.2f}\t{2:.2f}\t{3:.2f}%\t{4:.2f}%\t{5}".format(expectedX[i], expectedY[i], actual, (errorPercent * 100.0), (tolerancePercent * 100.0), match) self.assertTrue(match) if __name__ == '__main__': unittest.main()
mit
3,842,213,902,350,668,000
24.247126
172
0.332575
false
Azure/azure-sdk-for-python
sdk/keyvault/azure-keyvault-keys/samples/backup_restore_operations_async.py
1
3785
# ------------------------------------ # Copyright (c) Microsoft Corporation. # Licensed under the MIT License. # ------------------------------------ import asyncio import os from azure.keyvault.keys.aio import KeyClient from azure.identity.aio import DefaultAzureCredential from azure.core.exceptions import HttpResponseError # ---------------------------------------------------------------------------------------------------------- # Prerequisites: # 1. An Azure Key Vault (https://docs.microsoft.com/en-us/azure/key-vault/quick-create-cli) # # 2. azure-keyvault-keys and azure-identity libraries (pip install these) # # 3. Set Environment variables AZURE_CLIENT_ID, AZURE_TENANT_ID, AZURE_CLIENT_SECRET, VAULT_URL # (See https://github.com/Azure/azure-sdk-for-python/tree/main/sdk/keyvault/azure-keyvault-keys#authenticate-the-client) # # ---------------------------------------------------------------------------------------------------------- # Sample - demonstrates the basic backup and restore operations on a vault(key) resource for Azure Key Vault # # 1. Create a key (create_key) # # 2. Backup a key (backup_key) # # 3. Delete a key (delete_key) # # 4. Purge a key (purge_deleted_key) # # 5. Restore a key (restore_key_backup) # ---------------------------------------------------------------------------------------------------------- async def run_sample(): # Instantiate a key client that will be used to call the service. # Notice that the client is using default Azure credentials. # To make default credentials work, ensure that environment variables 'AZURE_CLIENT_ID', # 'AZURE_CLIENT_SECRET' and 'AZURE_TENANT_ID' are set with the service principal credentials. VAULT_URL = os.environ["VAULT_URL"] credential = DefaultAzureCredential() client = KeyClient(vault_url=VAULT_URL, credential=credential) try: # Let's create a Key of type RSA. # if the key already exists in the Key Vault, then a new version of the key is created. print("\n.. Create Key") key = await client.create_key("keyName", "RSA") print("Key with name '{0}' created with key type '{1}'".format(key.name, key.key_type)) # Backups are good to have, if in case keys gets deleted accidentally. # For long term storage, it is ideal to write the backup to a file. print("\n.. Create a backup for an existing Key") key_backup = await client.backup_key(key.name) print("Backup created for key with name '{0}'.".format(key.name)) # The rsa key is no longer in use, so you delete it. deleted_key = await client.delete_key(key.name) print("Deleted key with name '{0}'".format(deleted_key.name)) # Purge the deleted key. # The purge will take some time, so wait before restoring the backup to avoid a conflict. print("\n.. Purge the key") await client.purge_deleted_key(key.name) await asyncio.sleep(60) print("Purged key with name '{0}'".format(deleted_key.name)) # In the future, if the key is required again, we can use the backup value to restore it in the Key Vault. print("\n.. Restore the key using the backed up key bytes") key = await client.restore_key_backup(key_backup) print("Restored key with name '{0}'".format(key.name)) except HttpResponseError as e: print("\nrun_sample has caught an error. {0}".format(e.message)) finally: print("\nrun_sample done") await credential.close() await client.close() if __name__ == "__main__": try: loop = asyncio.get_event_loop() loop.run_until_complete(run_sample()) loop.close() except Exception as e: print("Top level Error: {0}".format(str(e)))
mit
-6,305,333,877,761,251,000
43.011628
123
0.60317
false
Habitissimo/vespapp-web
vespapp/settings.py
1
4155
""" Django settings for vespapp project. Generated by 'django-admin startproject' using Django 1.9.4. For more information on this file, see https://docs.djangoproject.com/en/1.9/topics/settings/ For the full list of settings and their values, see https://docs.djangoproject.com/en/1.9/ref/settings/ """ from decouple import config import os # Build paths inside the project like this: os.path.join(BASE_DIR, ...) BASE_DIR = os.path.dirname(os.path.dirname(os.path.abspath(__file__))) PROJECT_DIR = os.path.dirname(os.path.realpath(__file__)) # Quick-start development settings - unsuitable for production # See https://docs.djangoproject.com/en/1.9/howto/deployment/checklist/ # SECURITY WARNING: keep the secret key used in production secret! SECRET_KEY = '@7xvv!(2p469*!j7d)g^tc-e*$spkkj+g#rly6m+b7%p3hift&' # SECURITY WARNING: don't run with debug turned on in production! DEBUG = True ALLOWED_HOSTS = [] # Application definition BASE_APPS = ( 'django.contrib.admin', 'django.contrib.auth', 'django.contrib.contenttypes', 'django.contrib.sessions', 'django.contrib.messages', 'django.contrib.staticfiles', ) VENDOR_APPS = ( 'rest_framework', ) MY_APPS = ( 'web', 'api', ) INSTALLED_APPS = BASE_APPS + VENDOR_APPS + MY_APPS MIDDLEWARE_CLASSES = [ 'django.middleware.security.SecurityMiddleware', 'django.contrib.sessions.middleware.SessionMiddleware', 'django.middleware.common.CommonMiddleware', 'django.middleware.csrf.CsrfViewMiddleware', 'django.contrib.auth.middleware.AuthenticationMiddleware', 'django.contrib.auth.middleware.SessionAuthenticationMiddleware', 'django.contrib.messages.middleware.MessageMiddleware', 'django.middleware.clickjacking.XFrameOptionsMiddleware', ] ROOT_URLCONF = 'vespapp.urls' TEMPLATES = [ { 'BACKEND': 'django.template.backends.django.DjangoTemplates', 'DIRS': [], 'APP_DIRS': True, 'OPTIONS': { 'context_processors': [ 'django.template.context_processors.debug', 'django.template.context_processors.request', 'django.contrib.auth.context_processors.auth', 'django.contrib.messages.context_processors.messages', ], }, }, ] WSGI_APPLICATION = 'vespapp.wsgi.application' # Database # https://docs.djangoproject.com/en/1.9/ref/settings/#databases if not DEBUG: DATABASES = { 'default': { 'ENGINE': 'django.db.backends.postgresql_psycopg2', 'NAME': config("DB_NAME"), 'USER': config("DB_USER"), 'PASSWORD': config("DB_PASSWORD", default='supersecret'), 'HOST': config("DB_HOST"), 'PORT': config("DB_PORT", default="5432"), } } else: DATABASES = { 'default': { 'ENGINE': 'django.db.backends.sqlite3', 'NAME': os.path.join(BASE_DIR, 'db.sqlite3'), } } # Password validation # https://docs.djangoproject.com/en/1.9/ref/settings/#auth-password-validators AUTH_PASSWORD_VALIDATORS = [ { 'NAME': 'django.contrib.auth.password_validation.UserAttributeSimilarityValidator', }, { 'NAME': 'django.contrib.auth.password_validation.MinimumLengthValidator', }, { 'NAME': 'django.contrib.auth.password_validation.CommonPasswordValidator', }, { 'NAME': 'django.contrib.auth.password_validation.NumericPasswordValidator', }, ] # Internationalization # https://docs.djangoproject.com/en/1.9/topics/i18n/ LANGUAGE_CODE = 'es-ES' TIME_ZONE = 'Europe/Madrid' USE_I18N = True USE_L10N = True USE_TZ = True # Static files (CSS, JavaScript, Images) # https://docs.djangoproject.com/en/1.9/howto/static-files/ STATIC_ROOT = os.path.join(PROJECT_DIR, 'static') STATIC_URL = '/static/' STATICFILES_DIRS = ( os.path.join(PROJECT_DIR, 'staticfiles'), ) MEDIA_ROOT = os.path.join(PROJECT_DIR, 'media') MEDIA_URL = '/media/' REST_FRAMEWORK = { 'DEFAULT_RENDERER_CLASSES': ( 'rest_framework.renderers.JSONRenderer', 'rest_framework.renderers.BrowsableAPIRenderer', ) }
gpl-3.0
6,548,691,946,700,982,000
24.648148
91
0.662335
false
masschallenge/django-accelerator
accelerator/tests/contexts/judge_feedback_context.py
1
13749
from accelerator_abstract.models import ( FORM_ELEM_FEEDBACK_TO_MC, FORM_ELEM_FEEDBACK_TO_STARTUP, FORM_ELEM_OVERALL_RECOMMENDATION, ) from accelerator.models import ( ACTIVE_PROGRAM_STATUS, ASSIGNED_PANEL_ASSIGNMENT_STATUS, COMPLETE_PANEL_ASSIGNMENT_STATUS, FEEDBACK_DISPLAY_DISABLED as DISABLED, FEEDBACK_DISPLAY_ENABLED as ENABLED, IN_PERSON_JUDGING_ROUND_TYPE, ONLINE_JUDGING_ROUND_TYPE, JUDGING_FEEDBACK_STATUS_INCOMPLETE as INCOMPLETE, PREVIEW_PANEL_STATUS, SUBMITTED_APP_STATUS, UserRole, ) from accelerator.tests.factories import ( ApplicationAnswerFactory, ApplicationFactory, ApplicationPanelAssignmentFactory, ExpertFactory, JudgeApplicationFeedbackFactory, JudgeFeedbackComponentFactory, JudgePanelAssignmentFactory, JudgeRoundCommitmentFactory, JudgingFormElementFactory, PanelFactory, ProgramCycleFactory, ProgramRoleFactory, ProgramRoleGrantFactory, ScenarioFactory, StartupCycleInterestFactory, StartupProgramInterestFactory, ) from accelerator.tests.contexts.context_utils import get_user_role_by_name from .judging_round_context import JudgingRoundContext ELEMENT_NAMES = [ FORM_ELEM_OVERALL_RECOMMENDATION, FORM_ELEM_FEEDBACK_TO_STARTUP, FORM_ELEM_FEEDBACK_TO_MC, ] _round_type = {True: ONLINE_JUDGING_ROUND_TYPE, False: IN_PERSON_JUDGING_ROUND_TYPE} class JudgeFeedbackContext: def __init__(self, application=None, num_components=1, complete=True, panel_status=PREVIEW_PANEL_STATUS, display_feedback=False, merge_feedback_with=None, cycle_based_round=False, online_round=True, is_active=True, judge_capacity=10, program_status=ACTIVE_PROGRAM_STATUS): self.judging_capacity = 0 if application: self.application = application self.cycle = application.cycle else: self.cycle = ProgramCycleFactory() self.application = ApplicationFactory( application_status=SUBMITTED_APP_STATUS, application_type=self.cycle.default_application_type, cycle=self.cycle) self.application_type = self.application.application_type self.applications = [self.application] self.startup = self.application.startup self.industry = self.startup.primary_industry feedback_display = ENABLED if display_feedback else DISABLED jr_kwargs = { 'program__cycle': self.cycle, 'round_type': _round_type[online_round], 'feedback_display': feedback_display, 'cycle_based_round': cycle_based_round, 'application_type': self.application_type, 'is_active': False, 'program__program_status': program_status, } if merge_feedback_with: jr_kwargs['feedback_merge_with'] = merge_feedback_with self.judging_round = JudgingRoundContext(**jr_kwargs).judging_round self.program = self.judging_round.program self.panel = PanelFactory(status=panel_status, panel_time__judging_round=self.judging_round) self.scenario = ScenarioFactory(judging_round=self.judging_round) user_role = get_user_role_by_name(UserRole.JUDGE) self.judge_role = ProgramRoleFactory(program=self.program, user_role=user_role) self.judges = [] self.judge = self.add_judge(complete=complete, capacity=judge_capacity) self.feedback = JudgeApplicationFeedbackFactory( judge=self.judge, application=self.application, panel=self.panel, form_type=self.judging_round.judging_form) self.judging_form = self.feedback.form_type self.application_assignment = ApplicationPanelAssignmentFactory( application=self.application, panel=self.panel, scenario=self.scenario) cycle_interest = StartupCycleInterestFactory(cycle=self.program.cycle, startup=self.startup) StartupProgramInterestFactory(program=self.program, startup=self.startup, startup_cycle_interest=cycle_interest, applying=True, order=1) self.components = [] self.elements = [] self.application_questions = [] self.application_answers = [] for element_name in ELEMENT_NAMES: self.add_component(element_name=element_name) if complete: self.feedback.save() for _ in range(num_components): self.add_component() else: for _ in range(num_components): self.add_element() self.judging_round.is_active = is_active self.judging_round.save() def add_application_answer(self, question=None, answer_text=None): question = question or self.application_questions[0] kwargs = {"application_question": question, "application": self.application} if answer_text: kwargs["answer_text"] = answer_text app_answer = ApplicationAnswerFactory(**kwargs) self.application_answers.append(app_answer) return app_answer def add_component(self, element_name=None, feedback_element=None, add_answer=True, answer_text=None): factory_params = { "judge_feedback": self.feedback, } if feedback_element is None: app_type_key = "__".join(["feedback_element", "application_question", "application_type"]) factory_params.update( { "feedback_element__form_type": self.judging_form, "feedback_element__element_type": "feedback", "feedback_element__mandatory": True, "feedback_element__sharing": "share-with-startup", app_type_key: self.application_type} ) if element_name: factory_params['feedback_element__element_name'] = element_name else: factory_params.update({"feedback_element": feedback_element}) if answer_text: factory_params["answer_text"] = answer_text component = JudgeFeedbackComponentFactory( **factory_params) self.components.append(component) question = component.feedback_element.application_question self.application_questions.append(question) if add_answer: app_answer = ApplicationAnswerFactory( application_question=question, application=self.application) self.application_answers.append(app_answer) if feedback_element is None: self.elements.append(component.feedback_element) self.feedback.save() return component def add_element(self, feedback_type="", element_type="feedback", choice_layout="", mandatory=True, text_minimum=0, text_minimum_units="", answer_text=None, text_limit=0, text_limit_units=""): element = JudgingFormElementFactory( form_type=self.judging_form, mandatory=mandatory, element_type=element_type, feedback_type=feedback_type, choice_layout=choice_layout, sharing="share-with-startup", application_question__application_type=self.application_type, text_minimum=text_minimum, text_minimum_units=text_minimum_units, text_limit=text_limit, text_limit_units=text_limit_units, ) application_question = element.application_question self.application_questions.append(application_question) answer_kwargs = {"application_question": application_question, "application": self.application} if answer_text: answer_kwargs["answer_text"] = answer_text application_answer = ApplicationAnswerFactory(**answer_kwargs) self.application_answers.append(application_answer) self.elements.append(element) self.feedback.save() return element def add_extra_scenario(self): return ScenarioFactory(judging_round=self.judging_round) def add_panel(self): return PanelFactory( panel_time__judging_round=self.judging_round, panel_type__judging_round=self.judging_round, location__judging_round=self.judging_round) def add_assignment(self, judge=None, panel=None, scenario=None): scenario = scenario or self.scenario judge = judge or self.judge panel = panel or self.panel return JudgePanelAssignmentFactory( judge=judge, panel=panel, scenario=scenario) def add_feedback(self, application=None, judge=None, panel=None, feedback_status=INCOMPLETE): judge = judge or self.judge application = application or self.application panel = panel or self.panel if not panel.applicationpanelassignment_set.filter( application=application).exists(): ApplicationPanelAssignmentFactory( application=application, panel=panel, scenario=self.scenario) return JudgeApplicationFeedbackFactory( feedback_status=feedback_status, judge=judge, application=application, panel=panel, form_type=self.judging_round.judging_form) def add_application(self, application=None, field=None, option=None, program=None): program = program or self.program if application is None: fields = { "application_status": SUBMITTED_APP_STATUS, "application_type": self.application_type, } if field: fields[field] = option application = ApplicationFactory(**fields) self.applications.append(application) startup = application.startup cycle_interest = StartupCycleInterestFactory(cycle=program.cycle, startup=startup) StartupProgramInterestFactory(program=program, startup=startup, startup_cycle_interest=cycle_interest, applying=True, order=1) return application def add_applications(self, count, field=None, options=[], programs=[]): result = [] option_count = len(options) option = None program_count = len(programs) program = None for i in range(count): if option_count > 0: option = options[i % option_count] if program_count > 0: program = programs[i % program_count] result.append(self.add_application(field=field, option=option, program=program)) return result def add_judge(self, assigned=True, complete=True, judge=None, panel=None, capacity=10): if judge is None: judge = ExpertFactory( profile__primary_industry=self.industry, profile__home_program_family=self.program.program_family) ProgramRoleGrantFactory(person=judge, program_role=self.judge_role) self.judging_round.confirmed_judge_label.users.add(judge) JudgeRoundCommitmentFactory(judging_round=self.judging_round, judge=judge, capacity=10, commitment_state=True) self.judging_capacity += capacity if assigned: if complete: status = COMPLETE_PANEL_ASSIGNMENT_STATUS else: status = ASSIGNED_PANEL_ASSIGNMENT_STATUS JudgePanelAssignmentFactory( judge=judge, assignment_status=status, panel=panel or self.panel, scenario=self.scenario) self.judges.append(judge) return judge @classmethod def create_batch(cls, qty, *args, **kwargs): if 'merge_feedback' in kwargs: merge_feedback = kwargs.pop('merge_feedback') else: merge_feedback = False contexts = [cls(*args, **kwargs)] if merge_feedback: kwargs['merge_feedback_with'] = contexts[0].judging_round for _ in range(1, qty): contexts.append(cls(*args, **kwargs)) return contexts
mit
4,584,632,868,787,122,000
38.852174
79
0.56695
false
superbatlc/dtailweb
phonegroups/migrations/0001_initial.py
1
1870
# -*- coding: utf-8 -*- from __future__ import unicode_literals from django.db import models, migrations class Migration(migrations.Migration): dependencies = [ ('systems', '0001_initial'), ('calls', '0001_initial'), ] operations = [ migrations.CreateModel( name='Phonegroup', fields=[ ('id', models.AutoField(verbose_name='ID', serialize=False, auto_created=True, primary_key=True)), ('name', models.CharField(max_length=255, verbose_name=b'Nome')), ('code', models.CharField(max_length=10, verbose_name=b'Codice')), ('parent', models.ForeignKey(related_name='child_phonegroup_set', blank=True, to='phonegroups.Phonegroup', help_text=b'The father of this group', null=True)), ], options={ }, bases=(models.Model,), ), migrations.CreateModel( name='PhonegroupCall', fields=[ ('id', models.AutoField(verbose_name='ID', serialize=False, auto_created=True, primary_key=True)), ('call', models.ForeignKey(to='calls.Call')), ('phonegroup', models.ForeignKey(to='phonegroups.Phonegroup')), ], options={ }, bases=(models.Model,), ), migrations.CreateModel( name='PhonegroupExtension', fields=[ ('id', models.AutoField(verbose_name='ID', serialize=False, auto_created=True, primary_key=True)), ('extension', models.CharField(max_length=4)), ('phonegroup', models.ForeignKey(to='phonegroups.Phonegroup')), ('system', models.ForeignKey(to='systems.System')), ], options={ }, bases=(models.Model,), ), ]
gpl-2.0
-5,535,782,326,201,843,000
36.4
174
0.536364
false
hiraditya/fool
tensorflow/scaling-up-ml-using-cmle.py
1
6449
''' In this lab, you will learn how to: Package up TensorFlow model Run training locally Run training on cloud Deploy model to cloud Invoke model to carry out predictions ''' ''' Scaling up ML using Cloud ML Engine In this notebook, we take a previously developed TensorFlow model to predict taxifare rides and package it up so that it can be run in Cloud MLE. For now, we'll run this on a small dataset. The model that was developed is rather simplistic, and therefore, the accuracy of the model is not great either. However, this notebook illustrates how to package up a TensorFlow model to run it within Cloud ML. Later in the course, we will look at ways to make a more effective machine learning model. Environment variables for project and bucket Note that: Your project id is the unique string that identifies your project (not the project name). You can find this from the GCP Console dashboard's Home page. My dashboard reads: Project ID: cloud-training-demos Cloud training often involves saving and restoring model files. If you don't have a bucket already, I suggest that you create one from the GCP console (because it will dynamically check whether the bucket name you want is available). A common pattern is to prefix the bucket name by the project id, so that it is unique. Also, for cost reasons, you might want to use a single region bucket. Change the cell below to reflect your Project ID and bucket name. ''' import os PROJECT = 'cloud-training-demos' # REPLACE WITH YOUR PROJECT ID BUCKET = 'cloud-training-demos-ml' # REPLACE WITH YOUR BUCKET NAME REGION = 'us-central1' # REPLACE WITH YOUR BUCKET REGION e.g. us-central1 # for bash os.environ['PROJECT'] = PROJECT os.environ['BUCKET'] = BUCKET os.environ['REGION'] = REGION os.environ['TFVERSION'] = '1.7' # Tensorflow version %bash gcloud config set project $PROJECT gcloud config set compute/region $REGION %bash PROJECT_ID=$PROJECT AUTH_TOKEN=$(gcloud auth print-access-token) SVC_ACCOUNT=$(curl -X GET -H "Content-Type: application/json" \ -H "Authorization: Bearer $AUTH_TOKEN" \ https://ml.googleapis.com/v1/projects/${PROJECT_ID}:getConfig \ | python -c "import json; import sys; response = json.load(sys.stdin); \ print response['serviceAccount']") echo "Authorizing the Cloud ML Service account $SVC_ACCOUNT to access files in $BUCKET" gsutil -m defacl ch -u $SVC_ACCOUNT:R gs://$BUCKET gsutil -m acl ch -u $SVC_ACCOUNT:R -r gs://$BUCKET # error message (if bucket is empty) can be ignored gsutil -m acl ch -u $SVC_ACCOUNT:W gs://$BUCKET ''' Packaging up the code Take your code and put into a standard Python package structure. model.py and task.py contain the Tensorflow code from earlier (explore the directory structure). ''' !find taxifare !cat taxifare/trainer/model.py ''' Find absolute paths to your data Note the absolute paths below. /content is mapped in Datalab to where the home icon takes you ''' %bash echo $PWD rm -rf $PWD/taxi_trained head -1 $PWD/taxi-train.csv head -1 $PWD/taxi-valid.csv ''' Running the Python module from the command-line ''' %bash rm -rf taxifare.tar.gz taxi_trained export PYTHONPATH=${PYTHONPATH}:${PWD}/taxifare python -m trainer.task \ --train_data_paths="${PWD}/taxi-train*" \ --eval_data_paths=${PWD}/taxi-valid.csv \ --output_dir=${PWD}/taxi_trained \ --train_steps=1000 --job-dir=./tmp %bash ls $PWD/taxi_trained/export/exporter/ %writefile ./test.json {"pickuplon": -73.885262,"pickuplat": 40.773008,"dropofflon": -73.987232,"dropofflat": 40.732403,"passengers": 2} %bash model_dir=$(ls ${PWD}/taxi_trained/export/exporter) gcloud ml-engine local predict \ --model-dir=${PWD}/taxi_trained/export/exporter/${model_dir} \ --json-instances=./test.json ''' Running locally using gcloud ''' %bash rm -rf taxifare.tar.gz taxi_trained gcloud ml-engine local train \ --module-name=trainer.task \ --package-path=${PWD}/taxifare/trainer \ -- \ --train_data_paths=${PWD}/taxi-train.csv \ --eval_data_paths=${PWD}/taxi-valid.csv \ --train_steps=1000 \ --output_dir=${PWD}/taxi_trained ''' When I ran it (due to random seeds, your results will be different), the average_loss (Mean Squared Error) on the evaluation dataset was 187, meaning that the RMSE was around 13. ''' from google.datalab.ml import TensorBoard TensorBoard().start('./taxi_trained') for pid in TensorBoard.list()['pid']: TensorBoard().stop(pid) print 'Stopped TensorBoard with pid {}'.format(pid) ''' If the above step (to stop TensorBoard) appears stalled, just move on to the next step. You don't need to wait for it to return. ''' !ls $PWD/taxi_trained ''' Submit training job using gcloud First copy the training data to the cloud. Then, launch a training job. After you submit the job, go to the cloud console (http://console.cloud.google.com) and select Machine Learning | Jobs to monitor progress. Note: Don't be concerned if the notebook stalls (with a blue progress bar) or returns with an error about being unable to refresh auth tokens. This is a long-lived Cloud job and work is going on in the cloud. Use the Cloud Console link (above) to monitor the job. https://cloud.google.com/ml-engine/docs/tensorflow/getting-started-training-prediction ''' %bash echo $BUCKET gsutil -m rm -rf gs://${BUCKET}/taxifare/smallinput/ gsutil -m cp ${PWD}/*.csv gs://${BUCKET}/taxifare/smallinput/ %%bash OUTDIR=gs://${BUCKET}/taxifare/smallinput/taxi_trained JOBNAME=lab3a_$(date -u +%y%m%d_%H%M%S) echo $OUTDIR $REGION $JOBNAME gsutil -m rm -rf $OUTDIR gcloud ml-engine jobs submit training $JOBNAME \ --region=$REGION \ --module-name=trainer.task \ --package-path=${PWD}/taxifare/trainer \ --job-dir=$OUTDIR \ --staging-bucket=gs://$BUCKET \ --scale-tier=BASIC \ --runtime-version=$TFVERSION \ -- \ --train_data_paths="gs://${BUCKET}/taxifare/smallinput/taxi-train*" \ --eval_data_paths="gs://${BUCKET}/taxifare/smallinput/taxi-valid*" \ --output_dir=$OUTDIR \ --train_steps=10000 Job [lab3a_180607_192245] submitted successfully. Your job is still active. You may view the status of your job with the command (on google cloud consile) $ gcloud ml-engine jobs describe lab3a_180607_192245 or continue streaming the logs with the command $ gcloud ml-engine jobs stream-logs lab3a_180607_192245 Use the Cloud Console link to monitor the job and do NOT proceed until the job is done.
mit
2,726,381,697,759,011,000
36.71345
401
0.728485
false
wangyixiaohuihui/spark2-annotation
python/pyspark/mllib/stat/_statistics.py
1
13703
# # Licensed to the Apache Software Foundation (ASF) under one or more # contributor license agreements. See the NOTICE file distributed with # this work for additional information regarding copyright ownership. # The ASF licenses this file to You under the Apache License, Version 2.0 # (the "License"); you may not use this file except in compliance with # the License. You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # import sys if sys.version >= '3': basestring = str from pyspark.rdd import RDD, ignore_unicode_prefix from pyspark.mllib.common import callMLlibFunc, JavaModelWrapper from pyspark.mllib.linalg import Matrix, _convert_to_vector from pyspark.mllib.regression import LabeledPoint from pyspark.mllib.stat.test import ChiSqTestResult, KolmogorovSmirnovTestResult __all__ = ['MultivariateStatisticalSummary', 'Statistics'] class MultivariateStatisticalSummary(JavaModelWrapper): """ Trait for multivariate statistical summary of a data matrix. """ def mean(self): return self.call("mean").toArray() def variance(self): return self.call("variance").toArray() def count(self): return int(self.call("count")) def numNonzeros(self): return self.call("numNonzeros").toArray() def max(self): return self.call("max").toArray() def min(self): return self.call("min").toArray() def normL1(self): return self.call("normL1").toArray() def normL2(self): return self.call("normL2").toArray() class Statistics(object): @staticmethod def colStats(rdd): """ Computes column-wise summary statistics for the input RDD[Vector]. :param rdd: an RDD[Vector] for which column-wise summary statistics are to be computed. :return: :class:`MultivariateStatisticalSummary` object containing column-wise summary statistics. >>> from pyspark.mllib.linalg import Vectors >>> rdd = sc.parallelize([Vectors.dense([2, 0, 0, -2]), ... Vectors.dense([4, 5, 0, 3]), ... Vectors.dense([6, 7, 0, 8])]) >>> cStats = Statistics.colStats(rdd) >>> cStats.mean() array([ 4., 4., 0., 3.]) >>> cStats.variance() array([ 4., 13., 0., 25.]) >>> cStats.count() 3 >>> cStats.numNonzeros() array([ 3., 2., 0., 3.]) >>> cStats.max() array([ 6., 7., 0., 8.]) >>> cStats.min() array([ 2., 0., 0., -2.]) """ cStats = callMLlibFunc("colStats", rdd.map(_convert_to_vector)) return MultivariateStatisticalSummary(cStats) @staticmethod def corr(x, y=None, method=None): """ Compute the correlation (matrix) for the input RDD(s) using the specified method. Methods currently supported: I{pearson (default), spearman}. If a single RDD of Vectors is passed in, a correlation matrix comparing the columns in the input RDD is returned. Use C{method=} to specify the method to be used for single RDD inout. If two RDDs of floats are passed in, a single float is returned. :param x: an RDD of vector for which the correlation matrix is to be computed, or an RDD of float of the same cardinality as y when y is specified. :param y: an RDD of float of the same cardinality as x. :param method: String specifying the method to use for computing correlation. Supported: `pearson` (default), `spearman` :return: Correlation matrix comparing columns in x. >>> x = sc.parallelize([1.0, 0.0, -2.0], 2) >>> y = sc.parallelize([4.0, 5.0, 3.0], 2) >>> zeros = sc.parallelize([0.0, 0.0, 0.0], 2) >>> abs(Statistics.corr(x, y) - 0.6546537) < 1e-7 True >>> Statistics.corr(x, y) == Statistics.corr(x, y, "pearson") True >>> Statistics.corr(x, y, "spearman") 0.5 >>> from math import isnan >>> isnan(Statistics.corr(x, zeros)) True >>> from pyspark.mllib.linalg import Vectors >>> rdd = sc.parallelize([Vectors.dense([1, 0, 0, -2]), Vectors.dense([4, 5, 0, 3]), ... Vectors.dense([6, 7, 0, 8]), Vectors.dense([9, 0, 0, 1])]) >>> pearsonCorr = Statistics.corr(rdd) >>> print(str(pearsonCorr).replace('nan', 'NaN')) [[ 1. 0.05564149 NaN 0.40047142] [ 0.05564149 1. NaN 0.91359586] [ NaN NaN 1. NaN] [ 0.40047142 0.91359586 NaN 1. ]] >>> spearmanCorr = Statistics.corr(rdd, method="spearman") >>> print(str(spearmanCorr).replace('nan', 'NaN')) [[ 1. 0.10540926 NaN 0.4 ] [ 0.10540926 1. NaN 0.9486833 ] [ NaN NaN 1. NaN] [ 0.4 0.9486833 NaN 1. ]] >>> try: ... Statistics.corr(rdd, "spearman") ... print("Method name as second argument without 'method=' shouldn't be allowed.") ... except TypeError: ... pass """ # Check inputs to determine whether a single value or a matrix is needed for output. # Since it's legal for users to use the method name as the second argument, we need to # check if y is used to specify the method name instead. if type(y) == str: raise TypeError("Use 'method=' to specify method name.") if not y: return callMLlibFunc("corr", x.map(_convert_to_vector), method).toArray() else: return callMLlibFunc("corr", x.map(float), y.map(float), method) @staticmethod @ignore_unicode_prefix def chiSqTest(observed, expected=None): """ If `observed` is Vector, conduct Pearson's chi-squared goodness of fit test of the observed data against the expected distribution, or againt the uniform distribution (by default), with each category having an expected frequency of `1 / len(observed)`. If `observed` is matrix, conduct Pearson's independence test on the input contingency matrix, which cannot contain negative entries or columns or rows that sum up to 0. If `observed` is an RDD of LabeledPoint, conduct Pearson's independence test for every feature against the label across the input RDD. For each feature, the (feature, label) pairs are converted into a contingency matrix for which the chi-squared statistic is computed. All label and feature values must be categorical. .. note:: `observed` cannot contain negative values :param observed: it could be a vector containing the observed categorical counts/relative frequencies, or the contingency matrix (containing either counts or relative frequencies), or an RDD of LabeledPoint containing the labeled dataset with categorical features. Real-valued features will be treated as categorical for each distinct value. :param expected: Vector containing the expected categorical counts/relative frequencies. `expected` is rescaled if the `expected` sum differs from the `observed` sum. :return: ChiSquaredTest object containing the test statistic, degrees of freedom, p-value, the method used, and the null hypothesis. >>> from pyspark.mllib.linalg import Vectors, Matrices >>> observed = Vectors.dense([4, 6, 5]) >>> pearson = Statistics.chiSqTest(observed) >>> print(pearson.statistic) 0.4 >>> pearson.degreesOfFreedom 2 >>> print(round(pearson.pValue, 4)) 0.8187 >>> pearson.method u'pearson' >>> pearson.nullHypothesis u'observed follows the same distribution as expected.' >>> observed = Vectors.dense([21, 38, 43, 80]) >>> expected = Vectors.dense([3, 5, 7, 20]) >>> pearson = Statistics.chiSqTest(observed, expected) >>> print(round(pearson.pValue, 4)) 0.0027 >>> data = [40.0, 24.0, 29.0, 56.0, 32.0, 42.0, 31.0, 10.0, 0.0, 30.0, 15.0, 12.0] >>> chi = Statistics.chiSqTest(Matrices.dense(3, 4, data)) >>> print(round(chi.statistic, 4)) 21.9958 >>> data = [LabeledPoint(0.0, Vectors.dense([0.5, 10.0])), ... LabeledPoint(0.0, Vectors.dense([1.5, 20.0])), ... LabeledPoint(1.0, Vectors.dense([1.5, 30.0])), ... LabeledPoint(0.0, Vectors.dense([3.5, 30.0])), ... LabeledPoint(0.0, Vectors.dense([3.5, 40.0])), ... LabeledPoint(1.0, Vectors.dense([3.5, 40.0])),] >>> rdd = sc.parallelize(data, 4) >>> chi = Statistics.chiSqTest(rdd) >>> print(chi[0].statistic) 0.75 >>> print(chi[1].statistic) 1.5 """ if isinstance(observed, RDD): if not isinstance(observed.first(), LabeledPoint): raise ValueError("observed should be an RDD of LabeledPoint") jmodels = callMLlibFunc("chiSqTest", observed) return [ChiSqTestResult(m) for m in jmodels] if isinstance(observed, Matrix): jmodel = callMLlibFunc("chiSqTest", observed) else: if expected and len(expected) != len(observed): raise ValueError("`expected` should have same length with `observed`") jmodel = callMLlibFunc("chiSqTest", _convert_to_vector(observed), expected) return ChiSqTestResult(jmodel) @staticmethod @ignore_unicode_prefix def kolmogorovSmirnovTest(data, distName="norm", *params): """ Performs the Kolmogorov-Smirnov (KS) test for data sampled from a continuous distribution. It tests the null hypothesis that the data is generated from a particular distribution. The given data is sorted and the Empirical Cumulative Distribution Function (ECDF) is calculated which for a given point is the number of points having a CDF value lesser than it divided by the total number of points. Since the data is sorted, this is a step function that rises by (1 / length of data) for every ordered point. The KS statistic gives us the maximum distance between the ECDF and the CDF. Intuitively if this statistic is large, the probabilty that the null hypothesis is true becomes small. For specific details of the implementation, please have a look at the Scala documentation. :param data: RDD, samples from the data :param distName: string, currently only "norm" is supported. (Normal distribution) to calculate the theoretical distribution of the data. :param params: additional values which need to be provided for a certain distribution. If not provided, the default values are used. :return: KolmogorovSmirnovTestResult object containing the test statistic, degrees of freedom, p-value, the method used, and the null hypothesis. >>> kstest = Statistics.kolmogorovSmirnovTest >>> data = sc.parallelize([-1.0, 0.0, 1.0]) >>> ksmodel = kstest(data, "norm") >>> print(round(ksmodel.pValue, 3)) 1.0 >>> print(round(ksmodel.statistic, 3)) 0.175 >>> ksmodel.nullHypothesis u'Sample follows theoretical distribution' >>> data = sc.parallelize([2.0, 3.0, 4.0]) >>> ksmodel = kstest(data, "norm", 3.0, 1.0) >>> print(round(ksmodel.pValue, 3)) 1.0 >>> print(round(ksmodel.statistic, 3)) 0.175 """ if not isinstance(data, RDD): raise TypeError("data should be an RDD, got %s." % type(data)) if not isinstance(distName, basestring): raise TypeError("distName should be a string, got %s." % type(distName)) params = [float(param) for param in params] return KolmogorovSmirnovTestResult( callMLlibFunc("kolmogorovSmirnovTest", data, distName, params)) def _test(): import doctest from pyspark.sql import SparkSession globs = globals().copy() spark = SparkSession.builder\ .master("local[4]")\ .appName("mllib.stat.statistics tests")\ .getOrCreate() globs['sc'] = spark.sparkContext (failure_count, test_count) = doctest.testmod(globs=globs, optionflags=doctest.ELLIPSIS) spark.stop() if failure_count: exit(-1) if __name__ == "__main__": _test()
apache-2.0
1,669,562,013,303,584,300
40.821875
95
0.583157
false
googleapis/googleapis-gen
google/ads/googleads/v6/googleads-py/google/ads/googleads/v6/enums/types/lead_form_desired_intent.py
1
1209
# -*- coding: utf-8 -*- # Copyright 2020 Google LLC # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # import proto # type: ignore __protobuf__ = proto.module( package='google.ads.googleads.v6.enums', marshal='google.ads.googleads.v6', manifest={ 'LeadFormDesiredIntentEnum', }, ) class LeadFormDesiredIntentEnum(proto.Message): r"""Describes the desired level of intent of generated leads. """ class LeadFormDesiredIntent(proto.Enum): r"""Enum describing the desired level of intent of generated leads. """ UNSPECIFIED = 0 UNKNOWN = 1 LOW_INTENT = 2 HIGH_INTENT = 3 __all__ = tuple(sorted(__protobuf__.manifest))
apache-2.0
-8,953,890,120,698,834,000
29.225
74
0.687345
false
praekelt/jmbo-twitter
jmbo_twitter/models.py
1
5204
import datetime, twitter from urllib2 import URLError import logging from django.db import models from django.core.cache import cache from django.utils.translation import ugettext_lazy as _ from django.conf import settings from jmbo.models import ModelBase logger = logging.getLogger('django') class Status(ModelBase): """Purely a wrapper that allows us to use jmbo-foundry's listings for tweets.""" def __init__(self, status): # Copy attributes over attrs = ('contributors', 'coordinates', 'created_at', \ 'created_at_in_seconds', 'favorited', 'geo', 'hashtags', 'id', \ 'in_reply_to_screen_name', 'in_reply_to_status_id', \ 'in_reply_to_user_id', 'location', 'now', 'place', \ 'relative_created_at', 'retweet_count', 'retweeted', \ 'retweeted_status', 'source', 'text', 'truncated', 'urls', 'user', \ 'user_mentions', 'created_at_datetime') for attr in attrs: setattr(self, attr, getattr(status, attr)) @property def as_leaf_class(self): return self def save(self): raise NotImplemented class StatusMixin(object): def get_statuses(self, api): raise NotImplemented def fetch(self, force=False): klass_name = self.__class__.__name__ cache_key = 'jmbo_twitter_%s_%s' % (klass_name, self.id) cached = cache.get(cache_key, None) if (cached is not None) and not force: return cached # Get and check settings di = getattr(settings, 'JMBO_TWITTER', {}) ck = di.get('consumer_key') cs = di.get('consumer_secret') atk = di.get('access_token_key') ats = di.get('access_token_secret') if not all([ck, cs, atk, ats]): logger.error( 'jmbo_twitter.models.%s.fetch - incomplete settings' \ % klass_name ) return [] # Query twitter taking care to handle network errors api = twitter.Api( consumer_key=ck, consumer_secret=cs, access_token_key=atk, access_token_secret=ats, requests_timeout=10 ) try: statuses = self.get_statuses(api) except (URLError, ValueError, twitter.TwitterError): statuses = [] except Exception, e: # All manner of things can go wrong with integration logger.error( 'jmbo_twitter.models.%s.fetch - %s' % (klass_name, e.message) ) statuses = [] for status in statuses: status.created_at_datetime = datetime.datetime.fromtimestamp( status.created_at_in_seconds ) if statuses: # Only set if there are statuses. Twitter may randomly throttle us # and destroy our cache without this check. Cache for a long time # incase Twitter goes down. cache.set(cache_key, statuses, 86400) # Legacy return return statuses @property def fetched(self): klass_name = self.__class__.__name__ cache_key = 'jmbo_twitter_%s_%s' % (klass_name, self.id) return cache.get(cache_key, []) @property def tweets(self): class MyList(list): """Slightly emulate QuerySet API so jmbo-foundry listings work""" @property def exists(self): return len(self) > 0 result = [] for status in self.fetched: result.append(Status(status)) return MyList(result) class Feed(ModelBase, StatusMixin): """A feed represents a twitter user account""" name = models.CharField( max_length=255, unique=True, help_text="A twitter account name, eg. johnsmith" ) profile_image_url = models.CharField( null=True, editable=False, max_length=255 ) twitter_id = models.CharField(max_length=255, default='', editable=False) def get_statuses(self, api): # Fall back to slug for historical reasons statuses = api.GetUserTimeline( screen_name=self.name or self.slug, include_rts=True ) return statuses def fetch(self, force=False): statuses = super(Feed, self).fetch(force=force) if statuses: # This is a convenient place to set the feed image url status = statuses[0] changed = False if status.user.profile_image_url != self.profile_image_url: self.profile_image_url = status.user.profile_image_url changed = True if status.user.name != self.title: self.title = status.user.name changed = True if changed: self.save() return statuses class Search(ModelBase, StatusMixin): """A search represents a twitter keyword search""" criteria = models.CharField( max_length=255, unique=True, help_text="Search string or a hashtag" ) class Meta: verbose_name_plural = _("Searches") def get_statuses(self, api): return api.GetSearch(self.criteria)
bsd-3-clause
148,431,581,819,713,100
30.349398
80
0.580515
false
ronas/PythonGNF
Fabulao/PedidosCapa.py
1
3001
# -*- coding: latin -*- import sys #from PyQt5 import QtGui, QtCore, QtWidgets #, QTableWidget, QTableWidgetItem from PyQt5.QtWidgets import QApplication, QWidget, QTableWidget, QTableWidgetItem, QLineEdit, QLabel from PyQt5.QtCore import QSize, Qt import pymysql config = { 'host': 'localhost', 'port': 3306, 'database': 'LojaDB', 'user': 'root', 'password' : 'fbl1978' } class ClasseAPP(QWidget): def __init__(self): super(ClasseAPP, self).__init__() self.initUI() def initUI(self): self.setWindowTitle('Pedidos') self.resize(850, 400) self.move(300, 200) self.tabela = QTableWidget(3,5,self) self.tabela.setGeometry(20,20,760,300) self.tabela.setHorizontalHeaderLabels(('Numero Pedido','Data','Codigo Cliente','Telefone','Cond Pagamento')) self.dbBuscarPedidos() self.lblNumeroPedido = QLabel('Numero Pedido',self) self.lblNumeroPedido.setGeometry(20,330,130,25) self.lblData = QLabel('Data',self) self.lblData.setGeometry(100.360,50,25) #self.lblCodigoCliente = QLabel('Codigo Cliente',self) #self.lblCodigoCliente.setGeometry() #self.lblTelefone = QLabel('Telefone',self) #self.lblTelefone.setGeometry() #self.lblCondPagamento = QLabel('Cond Pagamento',self) #self.lblCondPagamento.setGeometry() self.txtNumeroPedido = QLineEdit(self) self.txtNumeroPedido.setGeometry(130,330,130,25) self.txtData = QLineEdit(self) self.txtData.setGeometry(130,360,50,25) #self.txtCodigoCliente = QLineEdit(self) #self.txtCOdigoCliente.setGeometry() #self.txtTelefone = QLineEdit(self) #self.txtTelefone.setGeometry() #self.txtCondPagamento = QLineEdit(self) #self.txtCondPagamento.setGeometry() self.tabela.resizeColumnsToContents() self.show() def dbBuscarPedidos(self): db = pymysql.connect(**config) cursor = db.cursor() comando = ('select * from LojaDB.Pedidos ') cursor.execute(comando ) self.tabela.setRowCount(0) registros = cursor.fetchall() for registro in registros: numerolinhas = self.tabela.rowCount() self.tabela.insertRow(numerolinhas) self.tabela.setItem(numerolinhas, 0, QTableWidgetItem( str(registro[0]) )) self.tabela.setItem(numerolinhas, 1, QTableWidgetItem( str(registro[1]) )) self.tabela.setItem(numerolinhas, 2, QTableWidgetItem( registro[2] )) self.tabela.setItem(numerolinhas, 3, QTableWidgetItem( str(registro[3]) )) self.tabela.setItem(numerolinhas, 4, QTableWidgetItem( registro[4] )) cursor.close() db.close() def main(): app = QApplication(sys.argv) MeuApp = ClasseAPP() sys.exit(app.exec_()) if __name__ == '__main__': main()
gpl-3.0
-1,464,602,394,802,016,300
29.632653
116
0.625125
false
caronc/newsreap
newsreap/Logging.py
1
6395
# -*- coding: utf-8 -*- # # Common Logging Parameters and Defaults # # Copyright (C) 2015-2017 Chris Caron <lead2gold@gmail.com> # # This program is free software; you can redistribute it and/or modify it # under the terms of the GNU Lesser General Public License as published by # the Free Software Foundation; either version 3 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Lesser General Public License for more details. # The first part of the file defines all of the namespacing # used by this application import sys import logging # We intentionally import this module so it preconfigures it's logging # From there we can choose to manipulate it later without worrying about # it's configuration over-riding ours; This creates a lint warning # that we're importing a module we're not using; but this is intended. # do not comment out or remove this entry import sqlalchemy # The default logger identifier used for general logging NEWSREAP_LOGGER = 'newsreap' # The default logger which displays backend engine and # NNTP Server Interaction NEWSREAP_ENGINE = '%s.engine' % NEWSREAP_LOGGER # Codec Manipulation such as yEnc, uuencoded, etc NEWSREAP_CODEC = '%s.codec' % NEWSREAP_LOGGER # Users should utilize this for their hook logging NEWSREAP_HOOKS = '%s.hooks' % NEWSREAP_LOGGER # Command Line Interface Logger NEWSREAP_CLI = '%s.cli' % NEWSREAP_LOGGER # For a common reference point, we include the static logging # Resource at the time for this information was: # - http://docs.sqlalchemy.org/en/rel_1_0/core/engines.html#dbengine-logging # # namespaces used by SQLAlchemy SQLALCHEMY_LOGGER = 'sqlalchemy' # Defines the logger for the SQLAlchemy Engine SQLALCHEMY_ENGINE = '%s.engine' % SQLALCHEMY_LOGGER # Controls SQLAlchemy's connection pool logging. SQLALCHEMY_POOL = '%s.pool' % SQLALCHEMY_LOGGER # Controls SQLAlchemy's various Object Relational Mapping (ORM) logging. SQLALCHEMY_ORM = '%s.orm' % SQLALCHEMY_LOGGER # The number of bytes reached before automatically rotating the log file # if this option was specified # 5000000 bytes == 5 Megabytes LOG_ROTATE_FILESIZE_BYTES = 5000000 def add_handler(logger, sendto=True, backupCount=5): """ Add handler to idenfied logger sendto == None then logging is disabled sendto == True then logging is put to stdout sendto == False then logging is put to stderr sendto == <string> then logging is routed to the filename specified if sendto is a <string>, then backupCount defines the number of logs to keep around. Set this to 0 or None if you don't wish the python logger to backupCount the files ever. By default logs are rotated once they reach 5MB """ if sendto is True: # redirect to stdout handler = logging.StreamHandler(sys.stdout) elif sendto is False: # redirect to stderr handler = logging.StreamHandler(sys.stderr) elif sendto is None: # redirect to null try: handler = logging.NullHandler() except AttributeError: # Python <= v2.6 class NullHandler(logging.Handler): def emit(self, record): pass handler = NullHandler() # Set data to NOTSET just to eliminate the # extra checks done internally if logger.level != logging.NOTSET: logger.setLevel(logging.NOTSET) elif isinstance(sendto, basestring): if backupCount is None: handler = logging.FileHandler(filename=sendto) elif isinstance(backupCount, int): handler = logging.RotatingFileHandler( filename=sendto, maxBytes=LOG_ROTATE_FILESIZE_BYTES, backupCount=backupCount, ) else: # We failed to add a handler return False # Setup Log Format handler.setFormatter(logging.Formatter( '%(asctime)s %(levelname)s %(name)s %(message)s')) # Add Handler logger.addHandler(handler) return True def init(verbose=2, sendto=True, backupCount=5): """ Set's up some simple default handling to make it easier for those wrapping this library. You do not need to call this function if you don't wnat to; ideally one might want to set up things their own way. """ # Add our handlers at the parent level add_handler( logging.getLogger(SQLALCHEMY_LOGGER), sendto=True, backupCount=backupCount, ) add_handler( logging.getLogger(NEWSREAP_LOGGER), sendto=True, backupCount=backupCount, ) if verbose: set_verbosity(verbose=verbose) def set_verbosity(verbose): """ A simple function one can use to set the verbosity of the app. """ # Default logging.getLogger(SQLALCHEMY_LOGGER).setLevel(logging.ERROR) logging.getLogger(SQLALCHEMY_ENGINE).setLevel(logging.ERROR) logging.getLogger(NEWSREAP_LOGGER).setLevel(logging.ERROR) logging.getLogger(NEWSREAP_CLI).setLevel(logging.ERROR) logging.getLogger(NEWSREAP_CODEC).setLevel(logging.ERROR) logging.getLogger(NEWSREAP_HOOKS).setLevel(logging.ERROR) logging.getLogger(NEWSREAP_ENGINE).setLevel(logging.ERROR) # Handle Verbosity if verbose > 0: logging.getLogger(NEWSREAP_CLI).setLevel(logging.INFO) logging.getLogger(NEWSREAP_HOOKS).setLevel(logging.INFO) logging.getLogger(NEWSREAP_ENGINE).setLevel(logging.INFO) if verbose > 1: logging.getLogger(NEWSREAP_CLI).setLevel(logging.DEBUG) logging.getLogger(NEWSREAP_HOOKS).setLevel(logging.DEBUG) logging.getLogger(NEWSREAP_ENGINE).setLevel(logging.DEBUG) if verbose > 2: logging.getLogger(SQLALCHEMY_ENGINE).setLevel(logging.INFO) logging.getLogger(NEWSREAP_CODEC).setLevel(logging.INFO) if verbose > 3: logging.getLogger(NEWSREAP_CODEC).setLevel(logging.DEBUG) if verbose > 4: logging.getLogger(SQLALCHEMY_ENGINE).setLevel(logging.DEBUG) # set initial level to WARN. rootlogger = logging.getLogger(NEWSREAP_LOGGER) if rootlogger.level == logging.NOTSET: set_verbosity(-1)
gpl-3.0
3,607,045,367,080,225,300
31.794872
76
0.696638
false
AutorestCI/azure-sdk-for-python
azure-mgmt-network/azure/mgmt/network/v2017_08_01/operations/load_balancer_load_balancing_rules_operations.py
1
7995
# coding=utf-8 # -------------------------------------------------------------------------- # Copyright (c) Microsoft Corporation. All rights reserved. # Licensed under the MIT License. See License.txt in the project root for # license information. # # Code generated by Microsoft (R) AutoRest Code Generator. # Changes may cause incorrect behavior and will be lost if the code is # regenerated. # -------------------------------------------------------------------------- import uuid from msrest.pipeline import ClientRawResponse from msrestazure.azure_exceptions import CloudError from .. import models class LoadBalancerLoadBalancingRulesOperations(object): """LoadBalancerLoadBalancingRulesOperations operations. :param client: Client for service requests. :param config: Configuration of service client. :param serializer: An object model serializer. :param deserializer: An objec model deserializer. :ivar api_version: Client API version. Constant value: "2017-08-01". """ models = models def __init__(self, client, config, serializer, deserializer): self._client = client self._serialize = serializer self._deserialize = deserializer self.api_version = "2017-08-01" self.config = config def list( self, resource_group_name, load_balancer_name, custom_headers=None, raw=False, **operation_config): """Gets all the load balancing rules in a load balancer. :param resource_group_name: The name of the resource group. :type resource_group_name: str :param load_balancer_name: The name of the load balancer. :type load_balancer_name: str :param dict custom_headers: headers that will be added to the request :param bool raw: returns the direct response alongside the deserialized response :param operation_config: :ref:`Operation configuration overrides<msrest:optionsforoperations>`. :return: An iterator like instance of LoadBalancingRule :rtype: ~azure.mgmt.network.v2017_08_01.models.LoadBalancingRulePaged[~azure.mgmt.network.v2017_08_01.models.LoadBalancingRule] :raises: :class:`CloudError<msrestazure.azure_exceptions.CloudError>` """ def internal_paging(next_link=None, raw=False): if not next_link: # Construct URL url = '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Network/loadBalancers/{loadBalancerName}/loadBalancingRules' path_format_arguments = { 'resourceGroupName': self._serialize.url("resource_group_name", resource_group_name, 'str'), 'loadBalancerName': self._serialize.url("load_balancer_name", load_balancer_name, 'str'), 'subscriptionId': self._serialize.url("self.config.subscription_id", self.config.subscription_id, 'str') } url = self._client.format_url(url, **path_format_arguments) # Construct parameters query_parameters = {} query_parameters['api-version'] = self._serialize.query("self.api_version", self.api_version, 'str') else: url = next_link query_parameters = {} # Construct headers header_parameters = {} header_parameters['Content-Type'] = 'application/json; charset=utf-8' if self.config.generate_client_request_id: header_parameters['x-ms-client-request-id'] = str(uuid.uuid1()) if custom_headers: header_parameters.update(custom_headers) if self.config.accept_language is not None: header_parameters['accept-language'] = self._serialize.header("self.config.accept_language", self.config.accept_language, 'str') # Construct and send request request = self._client.get(url, query_parameters) response = self._client.send( request, header_parameters, stream=False, **operation_config) if response.status_code not in [200]: exp = CloudError(response) exp.request_id = response.headers.get('x-ms-request-id') raise exp return response # Deserialize response deserialized = models.LoadBalancingRulePaged(internal_paging, self._deserialize.dependencies) if raw: header_dict = {} client_raw_response = models.LoadBalancingRulePaged(internal_paging, self._deserialize.dependencies, header_dict) return client_raw_response return deserialized def get( self, resource_group_name, load_balancer_name, load_balancing_rule_name, custom_headers=None, raw=False, **operation_config): """Gets the specified load balancer load balancing rule. :param resource_group_name: The name of the resource group. :type resource_group_name: str :param load_balancer_name: The name of the load balancer. :type load_balancer_name: str :param load_balancing_rule_name: The name of the load balancing rule. :type load_balancing_rule_name: str :param dict custom_headers: headers that will be added to the request :param bool raw: returns the direct response alongside the deserialized response :param operation_config: :ref:`Operation configuration overrides<msrest:optionsforoperations>`. :return: LoadBalancingRule or ClientRawResponse if raw=true :rtype: ~azure.mgmt.network.v2017_08_01.models.LoadBalancingRule or ~msrest.pipeline.ClientRawResponse :raises: :class:`CloudError<msrestazure.azure_exceptions.CloudError>` """ # Construct URL url = '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Network/loadBalancers/{loadBalancerName}/loadBalancingRules/{loadBalancingRuleName}' path_format_arguments = { 'resourceGroupName': self._serialize.url("resource_group_name", resource_group_name, 'str'), 'loadBalancerName': self._serialize.url("load_balancer_name", load_balancer_name, 'str'), 'loadBalancingRuleName': self._serialize.url("load_balancing_rule_name", load_balancing_rule_name, 'str'), 'subscriptionId': self._serialize.url("self.config.subscription_id", self.config.subscription_id, 'str') } url = self._client.format_url(url, **path_format_arguments) # Construct parameters query_parameters = {} query_parameters['api-version'] = self._serialize.query("self.api_version", self.api_version, 'str') # Construct headers header_parameters = {} header_parameters['Content-Type'] = 'application/json; charset=utf-8' if self.config.generate_client_request_id: header_parameters['x-ms-client-request-id'] = str(uuid.uuid1()) if custom_headers: header_parameters.update(custom_headers) if self.config.accept_language is not None: header_parameters['accept-language'] = self._serialize.header("self.config.accept_language", self.config.accept_language, 'str') # Construct and send request request = self._client.get(url, query_parameters) response = self._client.send(request, header_parameters, stream=False, **operation_config) if response.status_code not in [200]: exp = CloudError(response) exp.request_id = response.headers.get('x-ms-request-id') raise exp deserialized = None if response.status_code == 200: deserialized = self._deserialize('LoadBalancingRule', response) if raw: client_raw_response = ClientRawResponse(deserialized, response) return client_raw_response return deserialized
mit
-4,003,765,549,931,447,000
45.482558
186
0.643652
false
RedhawkSDR/integration-gnuhawk
components/fll_band_edge_cc_4o/tests/test_fll_band_edge_cc_4o.py
1
4545
#!/usr/bin/env python # # This file is protected by Copyright. Please refer to the COPYRIGHT file # distributed with this source distribution. # # This file is part of GNUHAWK. # # GNUHAWK is free software: you can redistribute it and/or modify is under the # terms of the GNU General Public License as published by the Free Software # Foundation, either version 3 of the License, or (at your option) any later # version. # # GNUHAWK is distributed in the hope that it will be useful, but WITHOUT ANY # WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR # A PARTICULAR PURPOSE. See the GNU General Public License for more details. # You should have received a copy of the GNU General Public License along with # this program. If not, see http://www.gnu.org/licenses/. # import unittest import ossie.utils.testing import os from omniORB import any class ComponentTests(ossie.utils.testing.ScaComponentTestCase): """Test for all component implementations in fll_band_edge_cc_4o""" def testScaBasicBehavior(self): ####################################################################### # Launch the component with the default execparams execparams = self.getPropertySet(kinds=("execparam",), modes=("readwrite", "writeonly"), includeNil=False) execparams = dict([(x.id, any.from_any(x.value)) for x in execparams]) self.launch(execparams) ####################################################################### # Verify the basic state of the component self.assertNotEqual(self.comp, None) self.assertEqual(self.comp.ref._non_existent(), False) self.assertEqual(self.comp.ref._is_a("IDL:CF/Resource:1.0"), True) self.assertEqual(self.spd.get_id(), self.comp.ref._get_identifier()) ####################################################################### # Simulate regular component startup # Verify that initialize nor configure throw errors self.comp.initialize() configureProps = self.getPropertySet(kinds=("configure",), modes=("readwrite", "writeonly"), includeNil=False) self.comp.configure(configureProps) ####################################################################### # Validate that query returns all expected parameters # Query of '[]' should return the following set of properties expectedProps = [] expectedProps.extend(self.getPropertySet(kinds=("configure", "execparam"), modes=("readwrite", "readonly"), includeNil=True)) expectedProps.extend(self.getPropertySet(kinds=("allocate",), action="external", includeNil=True)) props = self.comp.query([]) props = dict((x.id, any.from_any(x.value)) for x in props) # Query may return more than expected, but not less for expectedProp in expectedProps: self.assertEquals(props.has_key(expectedProp.id), True) ####################################################################### # Verify that all expected ports are available for port in self.scd.get_componentfeatures().get_ports().get_uses(): port_obj = self.comp.getPort(str(port.get_usesname())) self.assertNotEqual(port_obj, None) self.assertEqual(port_obj._non_existent(), False) self.assertEqual(port_obj._is_a("IDL:CF/Port:1.0"), True) for port in self.scd.get_componentfeatures().get_ports().get_provides(): port_obj = self.comp.getPort(str(port.get_providesname())) self.assertNotEqual(port_obj, None) self.assertEqual(port_obj._non_existent(), False) self.assertEqual(port_obj._is_a(port.get_repid()), True) ####################################################################### # Make sure start and stop can be called without throwing exceptions self.comp.start() self.comp.stop() ####################################################################### # Simulate regular component shutdown self.comp.releaseObject() # TODO Add additional tests here # # See: # ossie.utils.bulkio.bulkio_helpers, # ossie.utils.bluefile.bluefile_helpers # for modules that will assist with testing components with BULKIO ports if __name__ == "__main__": ossie.utils.testing.main("../fll_band_edge_cc_4o.spd.xml") # By default tests all implementations
gpl-3.0
149,642,112,192,682,620
47.870968
133
0.588559
false
Mirantis/octane
octane/commands/sync_images.py
1
2791
# Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. import tempfile from cliff import command as cmd from fuelclient.objects import environment as environment_obj from octane.helpers.sync_glance_images import sync_glance_images from octane.util import db from octane.util import env as env_util from octane.util import ssh def prepare(orig_id, seed_id): orig_env = environment_obj.Environment(orig_id) seed_env = environment_obj.Environment(seed_id) controller = env_util.get_one_controller(seed_env) with tempfile.NamedTemporaryFile() as temp: db.mysqldump_from_env(orig_env, ['keystone'], temp.name) db.mysqldump_restore_to_env(seed_env, temp.name) ssh.call(['keystone-manage', 'db_sync'], node=controller, parse_levels=True) for controller in env_util.get_controllers(seed_env): ssh.call(['service', 'memcached', 'restart'], node=controller) class SyncImagesCommand(cmd.Command): """Sync glance images between ORIG and SEED environments""" def get_parser(self, prog_name): parser = super(SyncImagesCommand, self).get_parser(prog_name) parser.add_argument( 'orig_id', type=int, metavar='ORIG_ID', help="ID of original environment") parser.add_argument( 'seed_id', type=int, metavar='SEED_ID', help="ID of seed environment") parser.add_argument( 'swift_ep', type=str, help="Endpoint's name where swift-proxy service is listening on") return parser def take_action(self, parsed_args): sync_glance_images(parsed_args.orig_id, parsed_args.seed_id, parsed_args.swift_ep) class SyncImagesPrepareCommand(cmd.Command): """Sync glance images between ORIG and SEED environments""" def get_parser(self, prog_name): parser = super(SyncImagesPrepareCommand, self).get_parser(prog_name) parser.add_argument( 'orig_id', type=int, metavar='ORIG_ID', help="ID of original environment") parser.add_argument( 'seed_id', type=int, metavar='SEED_ID', help="ID of seed environment") return parser def take_action(self, parsed_args): prepare(parsed_args.orig_id, parsed_args.seed_id)
apache-2.0
-4,300,452,264,042,446,300
36.716216
77
0.677893
false
Wolnosciowiec/file-repository
client/bahub/bahubapp/handler/__init__.py
1
4733
from ..entity.definition import BackupDefinition from ..service.client import FileRepositoryClient from ..service.pipefactory import PipeFactory from ..exceptions import ReadWriteException from ..result import CommandExecutionResult from logging import Logger import string import random import subprocess from shutil import copyfileobj class BackupHandler: """ Manages the process of backup and restore, interacts with different sources of backup data using adapters """ _client = None # type: FileRepositoryClient _pipe_factory = None # type: PipeFactory _logger = None # type: Logger _definition = None def __init__(self, _client: FileRepositoryClient, _pipe_factory: PipeFactory, _logger: Logger, _definition: BackupDefinition): self._client = _client self._pipe_factory = _pipe_factory self._logger = _logger self._definition = _definition def perform_backup(self): self._validate() self._validate_running_command() response = self._read() if response.return_code != 0 and response.return_code is not None: raise ReadWriteException('Backup source read error, use --debug and retry to investigate') upload_response = self._client.send(response.stdout, self._get_definition()) response.process.wait(15) response.stdout.close() return upload_response def perform_restore(self, version: str): response = self._write( self._read_from_storage(version) ) response.process.wait() self._logger.info('Waiting for process to finish') if response.return_code is not None and response.return_code > 0: raise ReadWriteException('Cannot write files to disk while restoring from backup. Errors: ' + str(response.stderr.read().decode('utf-8'))) self._logger.info('No errors found, sending success information') return '{"status": "OK"}' def close(self): self._logger.info('Finishing the process') self._close() def _get_definition(self) -> BackupDefinition: return self._definition def _execute_command(self, command: str, stdin=None) -> CommandExecutionResult: """ Executes a command on local machine, returning stdout as a stream, and streaming in the stdin (optionally) """ self._logger.debug('shell(' + command + ')') process = subprocess.Popen(command, stdout=subprocess.PIPE, stderr=subprocess.PIPE, stdin=subprocess.PIPE if stdin else None, executable='/bin/bash', shell=True) if stdin: self._logger.info('Copying stdin to process') try: copyfileobj(stdin, process.stdin) except BrokenPipeError: raise ReadWriteException( 'Cannot write to process, broken pipe occurred, probably a tar process died. ' + str(process.stdin.read()) + str(process.stderr.read()) ) process.stdin.close() return CommandExecutionResult(process.stdout, process.stderr, process.returncode, process) def _validate_running_command(self): """ Validate if the command really exports the data, does not end up with an error """ response = self._read() response.stdout.read(1024) response.process.kill() response.process.wait(15) if response.process.returncode > 0: raise ReadWriteException( 'The process exited with incorrect code, try to verify the command in with --debug switch' ) def _validate(self): raise Exception('_validate() not implemented for handler') def _read(self) -> CommandExecutionResult: """ TAR output or file stream buffered from ANY source for example """ raise Exception('_read() not implemented for handler') def _write(self, stream) -> CommandExecutionResult: """ A file stream or tar output be written into the storage. May be OpenSSL encoded, depends on definition """ raise Exception('_write() not implemented for handler') def _read_from_storage(self, version: str): return self._client.fetch(version, self._get_definition()) def _close(self): pass @staticmethod def generate_id(size=6, chars=string.ascii_uppercase + string.digits): return ''.join(random.choice(chars) for _ in range(size))
lgpl-3.0
-7,351,242,393,543,664,000
35.129771
118
0.616734
false
Saevon/saevon.github.io
plugins/jinja2/__init__.py
1
1409
#!/usr/bin/python # -*- coding: UTF-8 -*- from __future__ import unicode_literals from itertools import chain from plugins.jinja2.debug_dump import dump, dump_all, dump_file, dump_url from plugins.jinja2.category import find_category, category_preview_articles, mark from plugins.jinja2.article import is_untold from plugins.jinja2.nav import is_cur_page, get_main from plugins.jinja2.summary import summary, summary_raw from plugins.jinja2.tags import update_count, tag_remap, tag_sort, tag_ratios from plugins.jinja2.date import date_to_xmlschema from plugins.jinja2.string import title_case, file_title_case from datetime import datetime JINJA_FILTERS = { 'find_category': find_category, 'category_preview_articles': category_preview_articles, 'mark': mark, 'is_untold': is_untold, 'update_count': update_count, 'tag_remap': tag_remap, 'tag_ratios': tag_ratios, 'tag_sort': tag_sort, 'summary': summary, 'summary_raw': summary_raw, 'merge': lambda *args: list(chain(*args)), 'is_cur_page': is_cur_page, 'date_to_xmlschema': date_to_xmlschema, # DEBUG 'dump': dump, 'dump_all': dump_all, # String 'title_case': title_case, 'file_title_case': file_title_case, } JINJA_FUNCTIONS = { 'today': datetime.today, 'get_main': get_main, 'dump_file': dump_file, 'dump_url': dump_url, } JINJA_EXTENSIONS = []
mit
2,002,489,755,693,733,400
23.719298
82
0.686302
false
aerokappa/SantaClaus
handCodedOptimum_v4.py
1
2216
import numpy as np import pandas as pd from processInput import processInput def handCodedOptimum_v4 ( ): fileName = 'gifts.csv' giftList, giftListSummary = processInput( fileName ) packedBags = [] for i in np.arange(1000): print i currentBag = [] if (i< 333): itemCount = np.array([0 ,3 ,0 ,0 ,0 ,0 ,0 ,3 ,0]) elif ((i>=333) & (i<458)): itemCount = np.array([8, 0, 0, 0, 0, 0, 0, 0, 0]) elif ((i>=458) & (i<583)): itemCount = np.array([0, 0, 0, 0, 0, 0, 8, 0, 0]) elif ((i>=583) & (i<916)): itemCount = np.array([0, 0, 0, 3, 0, 2, 0, 0, 0]) elif ((i>=916) & (i<924)): itemCount = np.array([ 0, 0, 0, 0, 0, 0, 0, 0, 25]) elif ((i>=924) & (i<928)): itemCount = np.array([ 0, 23, 0, 0, 0, 0, 0, 0, 0]) elif ((i>=928) & (i<938)): itemCount = np.array([ 0, 0, 0, 0, 0, 19, 0, 0, 0]) elif ((i>=938) & (i<939)): itemCount = np.array([ 0, 0, 0, 0, 0, 11, 0, 1, 0]) elif ((i>=939) & (i<940)): itemCount = np.array([0, 9, 0, 1, 0, 0, 0, 0, 0]) else: itemCount = np.array([0, 0, 1, 0, 0, 5, 0, 0, 0]) for i in np.arange(len(itemCount)): if (itemCount[i] <= giftListSummary['nGiftsNotPacked'][i]): for j in np.arange(itemCount[i]): giftName = giftListSummary['GiftType'][i] currGiftID = giftListSummary['nGiftsPacked'][i] currentBag.append(giftName+'_'+str(currGiftID)) giftListSummary['nGiftsPacked'][i] += 1 giftListSummary['nGiftsNotPacked'][i] -= 1 packedBags.append(currentBag) # Write to File 'submission.csv' subFile = open('submission_5.csv','w') subFile.write('Gifts\n') for currentBag in packedBags: subFile.write(currentBag[0]) for currentItem in currentBag[1:]: subFile.write(' ') subFile.write(currentItem) subFile.write('\n') subFile.close() return packedBags
mit
-6,132,476,382,293,829,000
35.344262
73
0.476083
false
Jbonnett/Mutagen-flo
mutagen/ogg.py
1
17770
# Copyright 2006 Joe Wreschnig # # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU General Public License version 2 as # published by the Free Software Foundation. # # $Id: ogg.py 3975 2007-01-13 21:51:17Z piman $ """Read and write Ogg bitstreams and pages. This module reads and writes a subset of the Ogg bitstream format version 0. It does *not* read or write Ogg Vorbis files! For that, you should use mutagen.oggvorbis. This implementation is based on the RFC 3533 standard found at http://www.xiph.org/ogg/doc/rfc3533.txt. """ import struct import sys import zlib from cStringIO import StringIO from mutagen import FileType from mutagen._util import cdata, insert_bytes, delete_bytes, WrappedFileobj class error(IOError): """Ogg stream parsing errors.""" pass class OggPage(object): """A single Ogg page (not necessarily a single encoded packet). A page is a header of 26 bytes, followed by the length of the data, followed by the data. The constructor is givin a file-like object pointing to the start of an Ogg page. After the constructor is finished it is pointing to the start of the next page. Attributes: version -- stream structure version (currently always 0) position -- absolute stream position (default -1) serial -- logical stream serial number (default 0) sequence -- page sequence number within logical stream (default 0) offset -- offset this page was read from (default None) complete -- if the last packet on this page is complete (default True) packets -- list of raw packet data (default []) Note that if 'complete' is false, the next page's 'continued' property must be true (so set both when constructing pages). If a file-like object is supplied to the constructor, the above attributes will be filled in based on it. """ version = 0 __type_flags = 0 position = 0L serial = 0 sequence = 0 offset = None complete = True def __init__(self, fileobj=None): self.packets = [] if fileobj is None: return self.offset = fileobj.tell() header = fileobj.read(27) if len(header) == 0: raise EOFError try: (oggs, self.version, self.__type_flags, self.position, self.serial, self.sequence, crc, segments) = struct.unpack( "<4sBBqIIiB", header) except struct.error: raise error("unable to read full header; got %r" % header) if oggs != "OggS": raise error("read %r, expected %r, at 0x%x" % ( oggs, "OggS", fileobj.tell() - 27)) if self.version != 0: raise error("version %r unsupported" % self.version) total = 0 lacings = [] lacing_bytes = fileobj.read(segments) if len(lacing_bytes) != segments: raise error("unable to read %r lacing bytes" % segments) for c in map(ord, lacing_bytes): total += c if c < 255: lacings.append(total) total = 0 if total: lacings.append(total) self.complete = False self.packets = map(fileobj.read, lacings) if map(len, self.packets) != lacings: raise error("unable to read full data") def __eq__(self, other): """Two Ogg pages are the same if they write the same data.""" try: return (self.write() == other.write()) except AttributeError: return False __hash__ = object.__hash__ def __repr__(self): attrs = ['version', 'position', 'serial', 'sequence', 'offset', 'complete', 'continued', 'first', 'last'] values = ["%s=%r" % (attr, getattr(self, attr)) for attr in attrs] return "<%s %s, %d bytes in %d packets>" % ( type(self).__name__, " ".join(values), sum(map(len, self.packets)), len(self.packets)) def write(self): """Return a string encoding of the page header and data. A ValueError is raised if the data is too big to fit in a single page. """ data = [ struct.pack("<4sBBqIIi", "OggS", self.version, self.__type_flags, self.position, self.serial, self.sequence, 0) ] lacing_data = [] for datum in self.packets: quot, rem = divmod(len(datum), 255) lacing_data.append("\xff" * quot + chr(rem)) lacing_data = "".join(lacing_data) if not self.complete and lacing_data.endswith("\x00"): lacing_data = lacing_data[:-1] data.append(chr(len(lacing_data))) data.append(lacing_data) data.extend(self.packets) data = "".join(data) # Python's CRC is swapped relative to Ogg's needs. crc = ~zlib.crc32(data.translate(cdata.bitswap), -1) # Although we're using to_int_be, this actually makes the CRC # a proper le integer, since Python's CRC is byteswapped. crc = cdata.to_int_be(crc).translate(cdata.bitswap) data = data[:22] + crc + data[26:] return data def __size(self): size = 27 # Initial header size for datum in self.packets: quot, rem = divmod(len(datum), 255) size += quot + 1 if not self.complete and rem == 0: # Packet contains a multiple of 255 bytes and is not # terminated, so we don't have a \x00 at the end. size -= 1 size += sum(map(len, self.packets)) return size size = property(__size, doc="Total frame size.") def __set_flag(self, bit, val): mask = 1 << bit if val: self.__type_flags |= mask else: self.__type_flags &= ~mask continued = property( lambda self: cdata.test_bit(self.__type_flags, 0), lambda self, v: self.__set_flag(0, v), doc="The first packet is continued from the previous page.") first = property( lambda self: cdata.test_bit(self.__type_flags, 1), lambda self, v: self.__set_flag(1, v), doc="This is the first page of a logical bitstream.") last = property( lambda self: cdata.test_bit(self.__type_flags, 2), lambda self, v: self.__set_flag(2, v), doc="This is the last page of a logical bitstream.") def renumber(klass, fileobj, serial, start): """Renumber pages belonging to a specified logical stream. fileobj must be opened with mode r+b or w+b. Starting at page number 'start', renumber all pages belonging to logical stream 'serial'. Other pages will be ignored. fileobj must point to the start of a valid Ogg page; any occuring after it and part of the specified logical stream will be numbered. No adjustment will be made to the data in the pages nor the granule position; only the page number, and so also the CRC. If an error occurs (e.g. non-Ogg data is found), fileobj will be left pointing to the place in the stream the error occured, but the invalid data will be left intact (since this function does not change the total file size). """ number = start while True: try: page = OggPage(fileobj) except EOFError: break else: if page.serial != serial: # Wrong stream, skip this page. continue # Changing the number can't change the page size, # so seeking back based on the current size is safe. fileobj.seek(-page.size, 1) page.sequence = number fileobj.write(page.write()) fileobj.seek(page.offset + page.size, 0) number += 1 renumber = classmethod(renumber) def to_packets(klass, pages, strict=False): """Construct a list of packet data from a list of Ogg pages. If strict is true, the first page must start a new packet, and the last page must end the last packet. """ serial = pages[0].serial sequence = pages[0].sequence packets = [] if strict: if pages[0].continued: raise ValueError("first packet is continued") if not pages[-1].complete: raise ValueError("last packet does not complete") elif pages and pages[0].continued: packets.append("") for page in pages: if serial != page.serial: raise ValueError("invalid serial number in %r" % page) elif sequence != page.sequence: raise ValueError("bad sequence number in %r" % page) else: sequence += 1 if page.continued: packets[-1] += page.packets[0] else: packets.append(page.packets[0]) packets.extend(page.packets[1:]) return packets to_packets = classmethod(to_packets) def from_packets(klass, packets, sequence=0, default_size=4096, wiggle_room=2048): """Construct a list of Ogg pages from a list of packet data. The algorithm will generate pages of approximately default_size in size (rounded down to the nearest multiple of 255). However, it will also allow pages to increase to approximately default_size + wiggle_room if allowing the wiggle room would finish a packet (only one packet will be finished in this way per page; if the next packet would fit into the wiggle room, it still starts on a new page). This method reduces packet fragmentation when packet sizes are slightly larger than the default page size, while still ensuring most pages are of the average size. Pages are numbered started at 'sequence'; other information is uninitialized. """ chunk_size = (default_size // 255) * 255 pages = [] page = OggPage() page.sequence = sequence for packet in packets: page.packets.append("") while packet: data, packet = packet[:chunk_size], packet[chunk_size:] if page.size < default_size and len(page.packets) < 255: page.packets[-1] += data else: # If we've put any packet data into this page yet, # we need to mark it incomplete. However, we can # also have just started this packet on an already # full page, in which case, just start the new # page with this packet. if page.packets[-1]: page.complete = False if len(page.packets) == 1: page.position = -1L else: page.packets.pop(-1) pages.append(page) page = OggPage() page.continued = not pages[-1].complete page.sequence = pages[-1].sequence + 1 page.packets.append(data) if len(packet) < wiggle_room: page.packets[-1] += packet packet = "" if page.packets: pages.append(page) return pages from_packets = classmethod(from_packets) def replace(klass, fileobj, old_pages, new_pages): """Replace old_pages with new_pages within fileobj. old_pages must have come from reading fileobj originally. new_pages are assumed to have the 'same' data as old_pages, and so the serial and sequence numbers will be copied, as will the flags for the first and last pages. fileobj will be resized and pages renumbered as necessary. As such, it must be opened r+b or w+b. """ # Number the new pages starting from the first old page. first = old_pages[0].sequence for page, seq in zip(new_pages, range(first, first + len(new_pages))): page.sequence = seq page.serial = old_pages[0].serial new_pages[0].first = old_pages[0].first new_pages[0].last = old_pages[0].last new_pages[0].continued = old_pages[0].continued new_pages[-1].first = old_pages[-1].first new_pages[-1].last = old_pages[-1].last new_pages[-1].complete = old_pages[-1].complete if not new_pages[-1].complete and len(new_pages[-1].packets) == 1: new_pages[-1].position = -1L new_data = "".join(map(klass.write, new_pages)) # Make room in the file for the new data. delta = len(new_data) fileobj.seek(old_pages[0].offset, 0) insert_bytes(fileobj, delta, old_pages[0].offset) fileobj.seek(old_pages[0].offset, 0) fileobj.write(new_data) new_data_end = old_pages[0].offset + delta # Go through the old pages and delete them. Since we shifted # the data down the file, we need to adjust their offsets. We # also need to go backwards, so we don't adjust the deltas of # the other pages. old_pages.reverse() for old_page in old_pages: adj_offset = old_page.offset + delta delete_bytes(fileobj, old_page.size, adj_offset) # Finally, if there's any discrepency in length, we need to # renumber the pages for the logical stream. if len(old_pages) != len(new_pages): fileobj.seek(new_data_end, 0) serial = new_pages[-1].serial sequence = new_pages[-1].sequence + 1 klass.renumber(fileobj, serial, sequence) replace = classmethod(replace) def find_last(klass, fileobj, serial): """Find the last page of the stream 'serial'. If the file is not multiplexed this function is fast. If it is, it must read the whole the stream. This finds the last page in the actual file object, or the last page in the stream (with eos set), whichever comes first. """ # For non-muxed streams, look at the last page. try: fileobj.seek(-256*256, 2) except IOError: # The file is less than 64k in length. fileobj.seek(0) data = fileobj.read() try: index = data.rindex("OggS") except ValueError: raise error("unable to find final Ogg header") stringobj = StringIO(data[index:]) best_page = None try: page = OggPage(stringobj) except error: pass else: if page.serial == serial: if page.last: return page else: best_page = page else: best_page = None # The stream is muxed, so use the slow way. fileobj.seek(0) try: page = OggPage(fileobj) while not page.last: page = OggPage(fileobj) while page.serial != serial: page = OggPage(fileobj) best_page = page return page except error: return best_page except EOFError: return best_page find_last = classmethod(find_last) class OggFileType(FileType): """An generic Ogg file.""" _Info = None _Tags = None _Error = None _mimes = ["application/ogg", "application/x-ogg"] def load(self, filename): """Load file information from a filename.""" self.filename = filename fileobj = WrappedFileobj(filename, "rb") try: try: self.info = self._Info(fileobj) self.tags = self._Tags(fileobj, self.info) if self.info.length: # The streaminfo gave us real length information, # don't waste time scanning the Ogg. return last_page = OggPage.find_last(fileobj, self.info.serial) samples = last_page.position try: denom = self.info.sample_rate except AttributeError: denom = self.info.fps self.info.length = samples / float(denom) except error, e: raise self._Error, e, sys.exc_info()[2] except EOFError: raise self._Error, "no appropriate stream found" finally: fileobj.close() def delete(self, filename=None): """Remove tags from a file. If no filename is given, the one most recently loaded is used. """ if filename is None: filename = self.filename self.tags.clear() fileobj = WrappedFileobj(filename, "rb+") try: try: self.tags._inject(fileobj) except error, e: raise self._Error, e, sys.exc_info()[2] except EOFError: raise self._Error, "no appropriate stream found" finally: fileobj.close() def save(self, filename=None): """Save a tag to a file. If no filename is given, the one most recently loaded is used. """ if filename is None: filename = self.filename fileobj = WrappedFileobj(filename, "rb+") try: try: self.tags._inject(fileobj) except error, e: raise self._Error, e, sys.exc_info()[2] except EOFError: raise self._Error, "no appropriate stream found" finally: fileobj.close()
gpl-2.0
-2,453,146,239,836,660,000
34.54
79
0.570568
false
kervi/kervi
kervi-core/kervi/core/utility/kervi_logging.py
1
2921
#Copyright 2016 Tim Wentlau. #Distributed under the MIT License. See LICENSE in root of project. """ Module that holds log functionality. In general you dont need to include this in your kervi code as the spine class holds a reference to a fully configured log. """ import logging import logging.handlers import os VERBOSE = 15 logging.addLevelName(VERBOSE, "VERBOSE") class BraceMessage(object): def __init__(self, fmt, *args): self.fmt = fmt self.args = args def __str__(self): try: if '{' in self.fmt: return self.fmt.format(*self.args) else: return self.fmt % self.args except: return self.fmt class KerviLog(object): def __init__(self, name): self.logger = logging.getLogger(name) def info(self, message, *args): self.logger.info(BraceMessage(message, *args)) def verbose(self, message, *args, **kwargs): if args: self.logger._log(VERBOSE, str(BraceMessage(message, *args)), None) else: self.logger._log(VERBOSE, message, *args) def warn(self, message, *args): self.logger.warning(BraceMessage(message, *args)) def warning(self, message, *args): self.logger.warning(BraceMessage(message, *args)) def debug(self, message, *args): if args: self.logger.debug(BraceMessage(message, *args)) else: self.logger.debug(message) def error(self, message, *args): self.logger.error(BraceMessage(message, *args)) def exception(self, message, *args): self.logger.exception(BraceMessage(message, *args)) def fatal(self, message, *args): self.logger.fatal(BraceMessage(message, *args)) def init_process_logging(process_name, config, log_queue=None): logger = logging.getLogger() if config.level == "verbose": logger.setLevel(VERBOSE) elif config.level == "info": logger.setLevel(logging.INFO) elif config.level == "warning": logger.setLevel(logging.WARNING) elif config.level == "debug": logger.setLevel(logging.DEBUG) if log_queue: queue_handler = logging.handlers.QueueHandler(log_queue) logger.addHandler(queue_handler) else: if config.resetLog: try: os.remove(config.file) except: pass file_handler = logging.FileHandler(config.file) file_handler.setLevel(logging.DEBUG) stream_handler = logging.StreamHandler() stream_handler.setLevel(logging.ERROR) formatter = logging.Formatter('%(asctime)s - %(name)s - %(levelname)s - %(message)s') file_handler.setFormatter(formatter) stream_handler.setFormatter(formatter) logger.addHandler(file_handler) logger.addHandler(stream_handler)
mit
1,199,704,996,666,553,600
28.806122
96
0.618966
false
arcticfoxnv/slackminion
slackminion/plugin/base.py
1
4847
from six import string_types from builtins import object import logging import threading from slackminion.slack import SlackChannel, SlackIM, SlackUser, SlackRoom class BasePlugin(object): def __init__(self, bot, **kwargs): self.log = logging.getLogger(type(self).__name__) self._bot = bot self._dont_save = False # By default, we want to save a plugin's state during save_state() self._state_handler = False # State storage backends should set this to true self._timer_callbacks = {} self.config = {} if 'config' in kwargs: self.config = kwargs['config'] def on_load(self): """ Executes when a plugin is loaded. Override this if your plugin needs to do initialization when loading. Do not use this to restore runtime changes to variables -- they will be overwritten later on by PluginManager.load_state() """ return True def on_unload(self): """ Executes when a plugin is unloaded. Override this if your plugin needs to do cleanup when unloading. """ return True def on_connect(self): """ Executes immediately after connecting to slack. Will not fire on reconnects. """ return True def send_message(self, channel, text, thread=None, reply_broadcast=False): """ Used to send a message to the specified channel. * channel - can be a channel or user * text - message to send * thread - thread to reply in * reply_broadcast - whether or not to also send the message to the channel """ self.log.debug('Sending message to channel {} of type {}'.format(channel, type(channel))) if isinstance(channel, SlackIM) or isinstance(channel, SlackUser): self._bot.send_im(channel, text) elif isinstance(channel, SlackRoom): self._bot.send_message(channel, text, thread, reply_broadcast) elif isinstance(channel, string_types): if channel[0] == '@': self._bot.send_im(channel[1:], text) elif channel[0] == '#': self._bot.send_message(channel[1:], text, thread, reply_broadcast) else: self._bot.send_message(channel, text, thread, reply_broadcast) else: self._bot.send_message(channel, text, thread, reply_broadcast) def start_timer(self, duration, func, *args): """ Schedules a function to be called after some period of time. * duration - time in seconds to wait before firing * func - function to be called * args - arguments to pass to the function """ self.log.info("Scheduling call to %s in %ds: %s", func.__name__, duration, args) if self._bot.runnable: t = threading.Timer(duration, self._timer_callback, (func, args)) self._timer_callbacks[func] = t self._bot.timers.append(t) t.start() self.log.info("Scheduled call to %s in %ds", func.__name__, duration) else: self.log.warning("Not scheduling call to %s in %ds because we're shutting down.", func.__name__, duration) def stop_timer(self, func): """ Stops a timer if it hasn't fired yet * func - the function passed in start_timer """ self.log.debug('Stopping timer {}'.format(func.__name__)) if func in self._timer_callbacks: t = self._timer_callbacks[func] self._bot.timers.remove(t) t.cancel() del self._timer_callbacks[func] def _timer_callback(self, func, args): self.log.debug('Executing timer function {}'.format(func.__name__)) try: func(*args) except Exception: self.log.exception("Caught exception executing timer function: {}".format(func.__name__)) def get_user(self, username): """ Utility function to query slack for a particular user :param username: The username of the user to lookup :return: SlackUser object or None """ if hasattr(self._bot, 'user_manager'): user = self._bot.user_manager.get_by_username(username) if user: return user user = SlackUser.get_user(self._bot.sc, username) self._bot.user_manager.set(user) return user return SlackUser.get_user(self._bot.sc, username) def get_channel(self, channel): """ Utility function to query slack for a particular channel :param channel: The channel name or id of the channel to lookup :return: SlackChannel object or None """ return SlackChannel.get_channel(self._bot.sc, channel)
mit
-3,488,926,449,185,535,000
36
118
0.595007
false
linxdcn/iS3
IS3Py/is3.py
2
7512
# Copyright (C) 2015 iS3 Software Foundation # Author: Xiaojun Li # Contact: xiaojunli@tongji.edu.cn import sys import clr import System # Load System.Windows.Media in PresentationCore.dll sys.path.append('C:\\Program Files (x86)\\Reference Assemblies\\Microsoft\\Framework\\.NETFramework\\v4.5') prcore = clr.LoadAssemblyFromFile('PresentationCore.dll') clr.AddReference(prcore) # Import classes in System from System import Func,Action from System.Windows.Media import Colors from System.Collections.ObjectModel import ObservableCollection from System.Threading.Tasks import Task # Load IS3 namespaces iS3Core = clr.LoadAssemblyFromFile('IS3.Core.dll') clr.AddReference(iS3Core) # Import classes in IS3 from IS3.Core import (Globals, Runtime, ErrorReport, ErrorReportTarget, DGObject, DGObjects, ProjectDefinition, Project, EngineeringMap, EngineeringMapType, DrawShapeType, IView, LayerDef, Domain, DomainType, ToolTreeItem) from IS3.Core.Geometry import * from IS3.Core.Graphics import * def output(text): print(text) # Redirect ErrorReport to python cosole ErrorReport.target = ErrorReportTarget.DelegateConsole ErrorReport.consoleDelegate = output # In Windows, UI thread vars and functions are restricted to other threads. # So, be caution with python calls to functions in UI thread. # Classes in the main UI thread include: mainframe, view, layer, ... # Therefore, calling to functions in mainframe, view, layer etc. are restricted. mainframe = Globals.mainframe # Global var: mainframe prj = mainframe.prj # Global var: prj dispatcher = mainframe.Dispatcher # Global var: dispatcher -> UI thread manager graphicsEngine = Runtime.graphicEngine # Global var: graphics Engine geometryEngine = Runtime.geometryEngine # Global var: geometry Engine class MainframeWrapper(): "Define thread safe calls to mainframe methods" @staticmethod def addView(emap, canClose = True): "A thread safe call to -> mainframe.addView(emap, canclose)" if (Globals.isThreadUnsafe()): func = Func[EngineeringMap, bool, Task[IView]](mainframe.addView) view = dispatcher.Invoke(func, emap, canClose) else: view = mainframe.addView(emap, canClose) viewWrapper = ViewWrapper(view.Result) return viewWrapper @staticmethod def loadDomainPanels(): "A thread safe call to -> mainframe.loadDomainPanels()" if (Globals.isThreadUnsafe()): dispatcher.Invoke(mainframe.loadDomainPanels) else: mainframe.loadDomainPanels() class ViewWrapper(): "Define thread safe calls to IS3View methods" def __init__(self, view): self.view = view def addLayer(self, layer): "A thread safe call to -> IS3View.addLayer" if (Globals.isThreadUnsafe()): func = Action[IGraphicsLayer](self.view.addLayer) dispatcher.Invoke(func, layer) else: self.view.addLayer(layer) def addLocalTiledLayer(self, file, id): "A thread safe call to -> IS3View.addLocalTiledLayer" if (Globals.isThreadUnsafe()): func = Action[str, str](self.view.addLocalTiledLayer) dispatcher.Invoke(func, file, id) else: self.view.addLocalTiledLayer(file, id) def addGdbLayer(self, layerDef, gdbFile, start = 0, maxFeatures = 0): "A thread safe call to -> IS3View.addGdbLayer" if (Globals.isThreadUnsafe()): func = Func[LayerDef, str, int, int, Task[IGraphicsLayer]](self.view.addGdbLayer) layer = dispatcher.Invoke(func, layerDef, gdbFile, start, maxFeatures) else: layer = self.view.addGdbLayer(layerDef, gdbFile, start, maxFeatures) layerWrapper = GraphicsLayerWrapper(layer.Result) return layerWrapper def addShpLayer(self, layerDef, shpFile, start = 0, maxFeatures = 0): "A thread safe call to -> IS3View.addShpLayer" if (Globals.isThreadUnsafe()): func = Func[LayerDef, str, int, int, Task[IGraphicsLayer]](self.view.addShpLayer) layer = dispatcher.Invoke(func, layerDef, shpFile, start, maxFeatures) else: self.view.addShpLayer(layerDef, shpFile, start, maxFeatures) layerWrapper = GraphicsLayerWrapper(layer.Result) return layerWrapper def selectByRect(self): "A thread safe call to -> IS3View.selectByRect" if (Globals.isThreadUnsafe()): dispatcher.Invoke(self.view.selectByRect) else: self.view.selectByRect() class GraphicsLayerWrapper(): "Define thread safe calls to IS3GraphicsLayer methods" def __init__(self, glayer): self.layer = glayer def setRenderer(self, renderer): "A thread safe call to -> IS3GraphicsLayer.setRenderer" if (Globals.isThreadUnsafe()): func = Action[IRenderer](self.layer.setRenderer) dispatcher.Invoke(func, renderer) else: self.layer.setRenderer(renderer) def addGraphic(self, graphic): "A thread safe call to -> IS3GraphicsLayer.addGraphic" if (Globals.isThreadUnsafe()): func = Action[IGraphic](self.layer.addGraphic) dispatcher.Invoke(func, graphic) else: self.layer.addGraphic(graphic) def newGraphicsLayer(id, displayName): layer = graphicsEngine.newGraphicsLayer(id, displayName) layerWrapper = GraphicsLayerWrapper(layer) return layerWrapper def addView3d(id, file): map3d = EngineeringMap() map3d.MapID = id map3d.MapType = EngineeringMapType.Map3D map3d.LocalMapFileName = file view3d = MainframeWrapper.addView(map3d, True) return view3d def addGdbLayer(viewWrapper, layerDef, gdbFile = None, start = 0, maxFeatures = 0): prj = Globals.project layerWrapper = viewWrapper.addGdbLayer(layerDef, gdbFile, start, maxFeatures) if (layerWrapper.layer == None): print('addGdbFileELayer failed: ' + layerDef.Name) return None else: print('addGdbFileELayer succeeded: ' + layerDef.Name) objs = prj.findObjects(layerDef.Name) if (objs == None): print('Layer ' + layerDef.Name + ' has no corresponding objects in the project.') else: count = layerWrapper.layer.syncObjects(objs) print('Sync with ' + str(count) + ' objects for layer ' + layerDef.Name) return layerWrapper def addGdbLayerLazy(view, name, type, gdbFile = None, start = 0, maxFeatures = 0): layerDef = LayerDef() layerDef.Name = name layerDef.GeometryType = type layerWrapper = addGdbLayer(view, layerDef, gdbFile, start, maxFeatures) return layerWrapper def addShpLayer(viewWrapper, layerDef, shpfile, start = 0, maxFeatures = 0): prj = Globals.project layerWrapper = viewWrapper.addShpLayer(layerDef, shpfile, start, maxFeatures) if (layerWrapper.layer == None): print('addShpFileELayer failed: ' + layerDef.Name) return None else: print('addShpFileELayer succeeded: ' + layerDef.Name) objs = prj.findObjects(layerDef.Name) if (objs == None): print('Layer ' + layerDef.Name + ' has no corresponding objects in the project.') else: count = layerWrapper.layer.syncObjects(objs) print('Sync with ' + str(count) + ' objects for layer ' + layerDef.Name) return layerWrapper
lgpl-3.0
-7,984,074,763,647,838,000
37.523077
107
0.676384
false
abendig/django-mailchimp
mailchimp/models.py
1
9678
from django.db import models import json as simplejson from django.contrib.contenttypes.models import ContentType from django.contrib.contenttypes import generic from django.core.urlresolvers import reverse from django.shortcuts import get_object_or_404 from django.utils.translation import ugettext_lazy as _ from mailchimp.utils import get_connection class QueueManager(models.Manager): def queue(self, campaign_type, contents, list_id, template_id, subject, from_email, from_name, to_email, folder_id=None, tracking_opens=True, tracking_html_clicks=True, tracking_text_clicks=False, title=None, authenticate=False, google_analytics=None, auto_footer=False, auto_tweet=False, segment_options=False, segment_options_all=True, segment_options_conditions=[], type_opts={}, obj=None, extra_info=[]): """ Queue a campaign """ kwargs = locals().copy() kwargs['segment_options_conditions'] = simplejson.dumps(segment_options_conditions) kwargs['type_opts'] = simplejson.dumps(type_opts) kwargs['contents'] = simplejson.dumps(contents) kwargs['extra_info'] = simplejson.dumps(extra_info) for thing in ('template_id', 'list_id'): thingy = kwargs[thing] if hasattr(thingy, 'id'): kwargs[thing] = thingy.id del kwargs['self'] del kwargs['obj'] if obj: kwargs['object_id'] = obj.pk kwargs['content_type'] = ContentType.objects.get_for_model(obj) return self.create(**kwargs) def dequeue(self, limit=None): if limit: qs = self.filter(locked=False)[:limit] else: qs = self.filter(locked=False) for obj in qs: yield obj.send() def get_or_404(self, *args, **kwargs): return get_object_or_404(self.model, *args, **kwargs) class Queue(models.Model): """ A FIFO queue for async sending of campaigns """ campaign_type = models.CharField(max_length=50) contents = models.TextField() list_id = models.CharField(max_length=50) template_id = models.PositiveIntegerField() subject = models.CharField(max_length=255) from_email = models.EmailField() from_name = models.CharField(max_length=255) to_email = models.EmailField() folder_id = models.CharField(max_length=50, null=True, blank=True) tracking_opens = models.BooleanField(default=True) tracking_html_clicks = models.BooleanField(default=True) tracking_text_clicks = models.BooleanField(default=False) title = models.CharField(max_length=255, null=True, blank=True) authenticate = models.BooleanField(default=False) google_analytics = models.CharField(max_length=100, blank=True, null=True) auto_footer = models.BooleanField(default=False) generate_text = models.BooleanField(default=False) auto_tweet = models.BooleanField(default=False) segment_options = models.BooleanField(default=False) segment_options_all = models.BooleanField(default=False) segment_options_conditions = models.TextField() type_opts = models.TextField() content_type = models.ForeignKey(ContentType, null=True, blank=True) object_id = models.PositiveIntegerField(null=True, blank=True) content_object = generic.GenericForeignKey('content_type', 'object_id') extra_info = models.TextField(null=True) locked = models.BooleanField(default=False) objects = QueueManager() def send(self): """ send (schedule) this queued object """ # check lock if self.locked: return False # aquire lock self.locked = True self.save() # get connection and send the mails c = get_connection() tpl = c.get_template_by_id(self.template_id) content_data = dict([(str(k), v) for k,v in simplejson.loads(self.contents).items()]) built_template = tpl.build(**content_data) tracking = {'opens': self.tracking_opens, 'html_clicks': self.tracking_html_clicks, 'text_clicks': self.tracking_text_clicks} if self.google_analytics: analytics = {'google': self.google_analytics} else: analytics = {} segment_opts = {'match': 'all' if self.segment_options_all else 'any', 'conditions': simplejson.loads(self.segment_options_conditions)} type_opts = simplejson.loads(self.type_opts) title = self.title or self.subject camp = c.create_campaign(self.campaign_type, c.get_list_by_id(self.list_id), built_template, self.subject, self.from_email, self.from_name, self.to_email, self.folder_id, tracking, title, self.authenticate, analytics, self.auto_footer, self.generate_text, self.auto_tweet, segment_opts, type_opts) if camp.send_now_async(): self.delete() kwargs = {} if self.content_type and self.object_id: kwargs['content_type'] = self.content_type kwargs['object_id'] = self.object_id if self.extra_info: kwargs['extra_info'] = simplejson.loads(self.extra_info) return Campaign.objects.create(camp.id, segment_opts, **kwargs) # release lock if failed self.locked = False self.save() return False def get_dequeue_url(self): return reverse('mailchimp_dequeue', kwargs={'id': self.id}) def get_cancel_url(self): return reverse('mailchimp_cancel', kwargs={'id': self.id}) def get_list(self): return get_connection().lists[self.list_id] @property def object(self): """ The object might have vanished until now, so triple check that it's there! """ if self.object_id: model = self.content_type.model_class() try: return model.objects.get(id=self.object_id) except model.DoesNotExist: return None return None def get_object_admin_url(self): if not self.object: return '' name = 'admin:%s_%s_change' % (self.object._meta.app_label, self.object._meta.module_name) return reverse(name, args=(self.object.pk,)) def can_dequeue(self, user): if user.is_superuser: return True if not user.is_staff: return False if callable(getattr(self.object, 'mailchimp_can_dequeue', None)): return self.object.mailchimp_can_dequeue(user) return user.has_perm('mailchimp.can_send') and user.has_perm('mailchimp.can_dequeue') class CampaignManager(models.Manager): def create(self, campaign_id, segment_opts, content_type=None, object_id=None, extra_info=[]): con = get_connection() camp = con.get_campaign_by_id(campaign_id) extra_info = simplejson.dumps(extra_info) obj = self.model(content=camp.content, campaign_id=campaign_id, name=camp.title, content_type=content_type, object_id=object_id, extra_info=extra_info) obj.save() segment_opts = dict([(str(k), v) for k,v in segment_opts.items()]) for email in camp.list.filter_members(segment_opts): Reciever.objects.create(campaign=obj, email=email) return obj def get_or_404(self, *args, **kwargs): return get_object_or_404(self.model, *args, **kwargs) class DeletedCampaign(object): subject = u'<deleted from mailchimp>' class Campaign(models.Model): sent_date = models.DateTimeField(auto_now_add=True) campaign_id = models.CharField(max_length=50) content = models.TextField() name = models.CharField(max_length=255) content_type = models.ForeignKey(ContentType, null=True, blank=True) object_id = models.PositiveIntegerField(null=True, blank=True) content_object = generic.GenericForeignKey('content_type', 'object_id') extra_info = models.TextField(null=True) objects = CampaignManager() class Meta: ordering = ['-sent_date'] permissions = [('can_view', 'Can view Mailchimp information'), ('can_send', 'Can send Mailchimp newsletters')] verbose_name = _('Mailchimp Log') verbose_name_plural = _('Mailchimp Logs') def get_absolute_url(self): return reverse('mailchimp_campaign_info', kwargs={'campaign_id': self.campaign_id}) def get_object_admin_url(self): if not self.object: return '' name = 'admin:%s_%s_change' % (self.object._meta.app_label, self.object._meta.module_name) return reverse(name, args=(self.object.pk,)) def get_extra_info(self): if self.extra_info: return simplejson.loads(self.extra_info) return [] @property def object(self): """ The object might have vanished until now, so triple check that it's there! """ if self.object_id: model = self.content_type.model_class() try: return model.objects.get(id=self.object_id) except model.DoesNotExist: return None return None @property def mc(self): try: if not hasattr(self, '_mc'): self._mc = get_connection().get_campaign_by_id(self.campaign_id) return self._mc except: return DeletedCampaign() class Reciever(models.Model): campaign = models.ForeignKey(Campaign, related_name='recievers') email = models.EmailField()
bsd-3-clause
-397,447,282,722,257,540
37.712
93
0.626886
false
bashu/fluentcms-filer
fluentcms_filer/file/south_migrations/0001_initial.py
1
10131
# -*- coding: utf-8 -*- from south.utils import datetime_utils as datetime from south.db import db from south.v2 import SchemaMigration from django.db import models class Migration(SchemaMigration): def forwards(self, orm): # Adding model 'FilerFileItem' db.create_table(u'contentitem_file_filerfileitem', ( (u'contentitem_ptr', self.gf('django.db.models.fields.related.OneToOneField')(to=orm['fluent_contents.ContentItem'], unique=True, primary_key=True)), ('file', self.gf('django.db.models.fields.related.ForeignKey')(to=orm['filer.File'])), ('name', self.gf('django.db.models.fields.CharField')(max_length=255, null=True, blank=True)), ('target', self.gf('django.db.models.fields.CharField')(default='', max_length=100, blank=True)), )) db.send_create_signal(u'file', ['FilerFileItem']) def backwards(self, orm): # Deleting model 'FilerFileItem' db.delete_table(u'contentitem_file_filerfileitem') models = { u'auth.group': { 'Meta': {'object_name': 'Group'}, u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'unique': 'True', 'max_length': '80'}), 'permissions': ('django.db.models.fields.related.ManyToManyField', [], {'to': u"orm['auth.Permission']", 'symmetrical': 'False', 'blank': 'True'}) }, u'auth.permission': { 'Meta': {'ordering': "(u'content_type__app_label', u'content_type__model', u'codename')", 'unique_together': "((u'content_type', u'codename'),)", 'object_name': 'Permission'}, 'codename': ('django.db.models.fields.CharField', [], {'max_length': '100'}), 'content_type': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['contenttypes.ContentType']"}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '50'}) }, u'auth.user': { 'Meta': {'object_name': 'User'}, 'date_joined': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'email': ('django.db.models.fields.EmailField', [], {'max_length': '75', 'blank': 'True'}), 'first_name': ('django.db.models.fields.CharField', [], {'max_length': '30', 'blank': 'True'}), 'groups': ('django.db.models.fields.related.ManyToManyField', [], {'symmetrical': 'False', 'related_name': "u'user_set'", 'blank': 'True', 'to': u"orm['auth.Group']"}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'is_active': ('django.db.models.fields.BooleanField', [], {'default': 'True'}), 'is_staff': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'is_superuser': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'last_login': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'last_name': ('django.db.models.fields.CharField', [], {'max_length': '30', 'blank': 'True'}), 'password': ('django.db.models.fields.CharField', [], {'max_length': '128'}), 'user_permissions': ('django.db.models.fields.related.ManyToManyField', [], {'symmetrical': 'False', 'related_name': "u'user_set'", 'blank': 'True', 'to': u"orm['auth.Permission']"}), 'username': ('django.db.models.fields.CharField', [], {'unique': 'True', 'max_length': '30'}) }, u'contenttypes.contenttype': { 'Meta': {'ordering': "('name',)", 'unique_together': "(('app_label', 'model'),)", 'object_name': 'ContentType', 'db_table': "'django_content_type'"}, 'app_label': ('django.db.models.fields.CharField', [], {'max_length': '100'}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'model': ('django.db.models.fields.CharField', [], {'max_length': '100'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '100'}) }, u'file.filerfileitem': { 'Meta': {'ordering': "('placeholder', 'sort_order')", 'object_name': 'FilerFileItem', 'db_table': "u'contentitem_file_filerfileitem'", '_ormbases': ['fluent_contents.ContentItem']}, u'contentitem_ptr': ('django.db.models.fields.related.OneToOneField', [], {'to': "orm['fluent_contents.ContentItem']", 'unique': 'True', 'primary_key': 'True'}), 'file': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['filer.File']"}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '255', 'null': 'True', 'blank': 'True'}), 'target': ('django.db.models.fields.CharField', [], {'default': "''", 'max_length': '100', 'blank': 'True'}) }, u'filer.file': { 'Meta': {'object_name': 'File'}, '_file_size': ('django.db.models.fields.IntegerField', [], {'null': 'True', 'blank': 'True'}), 'description': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'file': ('django.db.models.fields.files.FileField', [], {'max_length': '255', 'null': 'True', 'blank': 'True'}), 'folder': ('django.db.models.fields.related.ForeignKey', [], {'blank': 'True', 'related_name': "u'all_files'", 'null': 'True', 'to': u"orm['filer.Folder']"}), 'has_all_mandatory_data': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'is_public': ('django.db.models.fields.BooleanField', [], {'default': 'True'}), 'modified_at': ('django.db.models.fields.DateTimeField', [], {'auto_now': 'True', 'blank': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'default': "u''", 'max_length': '255', 'blank': 'True'}), 'original_filename': ('django.db.models.fields.CharField', [], {'max_length': '255', 'null': 'True', 'blank': 'True'}), 'owner': ('django.db.models.fields.related.ForeignKey', [], {'blank': 'True', 'related_name': "u'owned_files'", 'null': 'True', 'to': u"orm['auth.User']"}), 'polymorphic_ctype': ('django.db.models.fields.related.ForeignKey', [], {'related_name': "u'polymorphic_filer.file_set+'", 'null': 'True', 'to': u"orm['contenttypes.ContentType']"}), 'sha1': ('django.db.models.fields.CharField', [], {'default': "u''", 'max_length': '40', 'blank': 'True'}), 'uploaded_at': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}) }, u'filer.folder': { 'Meta': {'ordering': "(u'name',)", 'unique_together': "((u'parent', u'name'),)", 'object_name': 'Folder'}, 'created_at': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), u'level': ('django.db.models.fields.PositiveIntegerField', [], {'db_index': 'True'}), u'lft': ('django.db.models.fields.PositiveIntegerField', [], {'db_index': 'True'}), 'modified_at': ('django.db.models.fields.DateTimeField', [], {'auto_now': 'True', 'blank': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '255'}), 'owner': ('django.db.models.fields.related.ForeignKey', [], {'blank': 'True', 'related_name': "u'filer_owned_folders'", 'null': 'True', 'to': u"orm['auth.User']"}), 'parent': ('django.db.models.fields.related.ForeignKey', [], {'blank': 'True', 'related_name': "u'children'", 'null': 'True', 'to': u"orm['filer.Folder']"}), u'rght': ('django.db.models.fields.PositiveIntegerField', [], {'db_index': 'True'}), u'tree_id': ('django.db.models.fields.PositiveIntegerField', [], {'db_index': 'True'}), 'uploaded_at': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}) }, 'fluent_contents.contentitem': { 'Meta': {'ordering': "('placeholder', 'sort_order')", 'object_name': 'ContentItem'}, u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'language_code': ('django.db.models.fields.CharField', [], {'default': "''", 'max_length': '15', 'db_index': 'True'}), 'parent_id': ('django.db.models.fields.IntegerField', [], {'null': 'True'}), 'parent_type': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['contenttypes.ContentType']"}), 'placeholder': ('django.db.models.fields.related.ForeignKey', [], {'related_name': "'contentitems'", 'null': 'True', 'on_delete': 'models.SET_NULL', 'to': "orm['fluent_contents.Placeholder']"}), 'polymorphic_ctype': ('django.db.models.fields.related.ForeignKey', [], {'related_name': "'polymorphic_fluent_contents.contentitem_set+'", 'null': 'True', 'to': u"orm['contenttypes.ContentType']"}), 'sort_order': ('django.db.models.fields.IntegerField', [], {'default': '1', 'db_index': 'True'}) }, 'fluent_contents.placeholder': { 'Meta': {'unique_together': "(('parent_type', 'parent_id', 'slot'),)", 'object_name': 'Placeholder'}, u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'parent_id': ('django.db.models.fields.IntegerField', [], {'null': 'True'}), 'parent_type': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['contenttypes.ContentType']", 'null': 'True', 'blank': 'True'}), 'role': ('django.db.models.fields.CharField', [], {'default': "'m'", 'max_length': '1'}), 'slot': ('django.db.models.fields.SlugField', [], {'max_length': '50'}), 'title': ('django.db.models.fields.CharField', [], {'max_length': '255', 'blank': 'True'}) } } complete_apps = ['file']
apache-2.0
-6,681,037,321,661,970,000
82.04918
210
0.566183
false
WilliamDiakite/ExperimentationsACA
processing/lsa.py
1
3364
import os import sys import itertools import operator import nltk import numpy as np import matplotlib.pyplot as plt from nltk.util import ngrams from collections import Counter from spell_checker import SpellChecker from sklearn.decomposition import TruncatedSVD from sklearn.pipeline import make_pipeline from sklearn.preprocessing import Normalizer sys.path.insert(0, '/Users/diakite_w/Documents/Dev/ExperimentationsACA/FrenchLefffLemmatizer') from FrenchLefffLemmatizer import FrenchLefffLemmatizer def extract_ngrams(documents, n): ''' Return list of n-grams ''' chained_documents = list(itertools.chain.from_iterable(documents)) return Counter(ngrams(chained_documents, n)) def tokenize(text): fll = FrenchLefffLemmatizer() splck = SpellChecker() contracted_pronouns = ["l'", "m'", "n'", "d'", "c'", "j'", "qu'", "s'"] dictionnary = [] stopwords = [w.rstrip() for w in open('stopwords-fr.txt')] # Put everything to lower case text = text.lower() # Tokenize text tokens = nltk.tokenize.word_tokenize(text) print('Nombre de tokens dans le texte :', len(tokens)) #tokens = [splck.correct(t) if t not in dictionnary else t for t in tokens] # Remove contacted pronous from tokens tokens = [t[2:] if t[:2] in contracted_pronouns else t for t in tokens] tokens = [t for t in tokens if len(t) > 2] tokens = [t for t in tokens if t not in stopwords] tokens = [fll.lemmatize(t) for t in tokens] print('Nombre de tokens apres traitement :', len(tokens), '\n') return tokens def tokens_to_vec(tokens): vec = np.zeros(len(word_index_map)) for token in tokens: idx = word_index_map[token] vec[idx] = 1 return vec def read_txt(textfile): with open(textfile, 'r') as f: text = f.read() text = text.replace('\n', ' ') text = text.replace('- ', '') text = text.replace('.', '') text = text.replace('-', '') text = text.replace("‘l'", 'ï') return text def get_all_doc(directory): ''' Read all txt documents and append them in string ''' documents = [] counter = 1 for filename in os.listdir(directory): if filename.endswith('.txt'): print('\n[...] Reading document', counter) filename = 'data/' + filename documents.append(read_txt(filename)) counter += 1 return documents documents = get_all_doc('data/') all_tokens = [tokenize(doc) for doc in documents] vocabulary = list(set(itertools.chain.from_iterable(all_tokens))) print ('\nVocab size:', len(vocabulary)) # Computing n-grams bigrams = extract_ngrams(all_tokens, 2) trigrams = extract_ngrams(all_tokens, 3) [print(t) for t in trigrams.most_common(5)] print('\n') [print(t) for t in bigrams.most_common(10)] ''' # Key: word - value: index word_index_map = {j: i for i, j in enumerate(vocabulary)} # Key: index - value: word index_word_map = sorted(word_index_map.items(), key=operator.itemgetter(1)) index_word_map = [t[0] for t in index_word_map] N = len(documents) D = len(word_index_map) X = np.zeros((D,N)) i = 0 for tokens in all_tokens: X[:,i] = tokens_to_vec(tokens) i += 1 print(X.shape) svd = TruncatedSVD() Z = svd.fit_transform(X) print('Z shape', Z.shape) plt.scatter(Z[:,0], Z[:,1]) print('D:', D) for i in range(D): plt.annotate(s=index_word_map[i], xy=(Z[i,0], Z[i,1])) plt.show() '''
mit
-8,408,729,182,994,486,000
20.96732
94
0.664683
false
babble/babble
include/jython/Lib/asyncore.py
1
17033
# -*- Mode: Python -*- # Id: asyncore.py,v 2.51 2000/09/07 22:29:26 rushing Exp # Author: Sam Rushing <rushing@nightmare.com> # ====================================================================== # Copyright 1996 by Sam Rushing # # All Rights Reserved # # Permission to use, copy, modify, and distribute this software and # its documentation for any purpose and without fee is hereby # granted, provided that the above copyright notice appear in all # copies and that both that copyright notice and this permission # notice appear in supporting documentation, and that the name of Sam # Rushing not be used in advertising or publicity pertaining to # distribution of the software without specific, written prior # permission. # # SAM RUSHING DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE, # INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS, IN # NO EVENT SHALL SAM RUSHING BE LIABLE FOR ANY SPECIAL, INDIRECT OR # CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS # OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, # NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF OR IN # CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE. # ====================================================================== """Basic infrastructure for asynchronous socket service clients and servers. There are only two ways to have a program on a single processor do "more than one thing at a time". Multi-threaded programming is the simplest and most popular way to do it, but there is another very different technique, that lets you have nearly all the advantages of multi-threading, without actually using multiple threads. it's really only practical if your program is largely I/O bound. If your program is CPU bound, then pre-emptive scheduled threads are probably what you really need. Network servers are rarely CPU-bound, however. If your operating system supports the select() system call in its I/O library (and nearly all do), then you can use it to juggle multiple communication channels at once; doing other work while your I/O is taking place in the "background." Although this strategy can seem strange and complex, especially at first, it is in many ways easier to understand and control than multi-threaded programming. The module documented here solves many of the difficult problems for you, making the task of building sophisticated high-performance network servers and clients a snap. """ import exceptions import select import socket import sys import time import os from errno import EALREADY, EINPROGRESS, EWOULDBLOCK, ECONNRESET, \ ENOTCONN, ESHUTDOWN, EINTR, EISCONN try: socket_map except NameError: socket_map = {} class ExitNow(exceptions.Exception): pass def read(obj): try: obj.handle_read_event() except ExitNow: raise except: obj.handle_error() def write(obj): try: obj.handle_write_event() except ExitNow: raise except: obj.handle_error() def readwrite(obj, flags): try: if flags & select.POLLIN: obj.handle_read_event() if flags & select.POLLOUT: obj.handle_write_event() except ExitNow: raise except: obj.handle_error() def poll(timeout=0.0, map=None): if map is None: map = socket_map if map: r = []; w = []; e = [] for fd, obj in map.items(): if obj.readable(): r.append(fd) if obj.writable(): w.append(fd) if [] == r == w == e: time.sleep(timeout) else: try: r, w, e = select.select(r, w, e, timeout) except select.error, err: if err[0] != EINTR: raise else: return for fd in r: obj = map.get(fd) if obj is None: continue read(obj) for fd in w: obj = map.get(fd) if obj is None: continue write(obj) def poll2(timeout=0.0, map=None): import poll if map is None: map = socket_map if timeout is not None: # timeout is in milliseconds timeout = int(timeout*1000) if map: l = [] for fd, obj in map.items(): flags = 0 if obj.readable(): flags = poll.POLLIN if obj.writable(): flags = flags | poll.POLLOUT if flags: l.append((fd, flags)) r = poll.poll(l, timeout) for fd, flags in r: obj = map.get(fd) if obj is None: continue readwrite(obj, flags) def poll3(timeout=0.0, map=None): # Use the poll() support added to the select module in Python 2.0 if map is None: map = socket_map if timeout is not None: # timeout is in milliseconds timeout = int(timeout*1000) pollster = select.poll() if map: for fd, obj in map.items(): flags = 0 if obj.readable(): flags = select.POLLIN if obj.writable(): flags = flags | select.POLLOUT if flags: pollster.register(fd, flags) try: r = pollster.poll(timeout) except select.error, err: if err[0] != EINTR: raise r = [] for fd, flags in r: obj = map.get(fd) if obj is None: continue readwrite(obj, flags) def loop(timeout=30.0, use_poll=0, map=None): if map is None: map = socket_map if use_poll: if hasattr(select, 'poll'): poll_fun = poll3 else: poll_fun = poll2 else: poll_fun = poll while map: poll_fun(timeout, map) class dispatcher: debug = 0 connected = 0 accepting = 0 closing = 0 addr = None def __init__(self, sock=None, map=None): if sock: self.set_socket(sock, map) # I think it should inherit this anyway self.socket.setblocking(0) self.connected = 1 # XXX Does the constructor require that the socket passed # be connected? try: self.addr = sock.getpeername() except socket.error: # The addr isn't crucial pass else: self.socket = None def __repr__(self): status = [self.__class__.__module__+"."+self.__class__.__name__] if self.accepting and self.addr: status.append('listening') elif self.connected: status.append('connected') if self.addr is not None: try: status.append('%s:%d' % self.addr) except TypeError: status.append(repr(self.addr)) # On some systems (RH10) id() can be a negative number. # work around this. MAX = 2L*sys.maxint+1 return '<%s at %#x>' % (' '.join(status), id(self)&MAX) def add_channel(self, map=None): #self.log_info('adding channel %s' % self) if map is None: if hasattr(self, '_map'): map = self._map del self._map else: map = socket_map if not hasattr(self, '_fileno'): self._fileno = self.socket.fileno() map[self._fileno] = self def del_channel(self, map=None): fd = self._fileno if map is None: map = socket_map if map.has_key(fd): #self.log_info('closing channel %d:%s' % (fd, self)) del map[fd] def create_socket(self, family, type): self.family_and_type = family, type self.socket = socket.socket(family, type) self.socket.setblocking(0) def set_socket(self, sock, map=None): self.socket = sock ## self.__dict__['socket'] = sock if sock.fileno(): self.add_channel(map) else: self._map = map def set_reuse_addr(self): # try to re-use a server port if possible try: self.socket.setsockopt( socket.SOL_SOCKET, socket.SO_REUSEADDR, self.socket.getsockopt(socket.SOL_SOCKET, socket.SO_REUSEADDR) | 1 ) except socket.error: pass # ================================================== # predicates for select() # these are used as filters for the lists of sockets # to pass to select(). # ================================================== def readable(self): return True if os.name == 'mac': # The macintosh will select a listening socket for # write if you let it. What might this mean? def writable(self): return not self.accepting else: def writable(self): return True # ================================================== # socket object methods. # ================================================== def listen(self, num): self.accepting = 1 if os.name == 'nt' and num > 5: num = 1 ret = self.socket.listen(num) self.add_channel() return ret def bind(self, addr): self.addr = addr return self.socket.bind(addr) def connect(self, address): self.connected = 0 err = self.socket.connect_ex(address) # XXX Should interpret Winsock return values if err in (EINPROGRESS, EALREADY, EWOULDBLOCK): return if err in (0, EISCONN): self.add_channel() self.addr = address self.connected = 1 self.handle_connect() else: raise socket.error, err def accept(self): # XXX can return either an address pair or None try: conn, addr = self.socket.accept() self.add_channel() return conn, addr except socket.error, why: if why[0] == EWOULDBLOCK: pass else: raise socket.error, why def send(self, data): try: result = self.socket.send(data) return result except socket.error, why: if why[0] == EWOULDBLOCK: return 0 else: raise socket.error, why return 0 def recv(self, buffer_size): try: data = self.socket.recv(buffer_size) if not data: # a closed connection is indicated by signaling # a read condition, and having recv() return 0. self.handle_close() return '' else: return data except socket.error, why: # winsock sometimes throws ENOTCONN if why[0] in [ECONNRESET, ENOTCONN, ESHUTDOWN]: self.handle_close() return '' else: raise socket.error, why def close(self): self.del_channel() self.socket.close() # cheap inheritance, used to pass all other attribute # references to the underlying socket object. def __getattr__(self, attr): return getattr(self.socket, attr) # log and log_info may be overridden to provide more sophisticated # logging and warning methods. In general, log is for 'hit' logging # and 'log_info' is for informational, warning and error logging. def log(self, message): sys.stderr.write('log: %s\n' % str(message)) def log_info(self, message, type='info'): if __debug__ or type != 'info': print '%s: %s' % (type, message) def handle_read_event(self): if self.accepting: # for an accepting socket, getting a read implies # that we are connected if not self.connected: self.connected = 1 self.handle_accept() elif not self.connected: self.handle_connect() self.connected = 1 self.handle_read() else: self.handle_read() def handle_write_event(self): # getting a write implies that we are connected if not self.connected: self.handle_connect() self.connected = 1 self.handle_write() def handle_expt_event(self): self.handle_expt() def handle_error(self): nil, t, v, tbinfo = compact_traceback() # sometimes a user repr method will crash. try: self_repr = repr(self) except: self_repr = '<__repr__(self) failed for object at %0x>' % id(self) self.log_info( 'uncaptured python exception, closing channel %s (%s:%s %s)' % ( self_repr, t, v, tbinfo ), 'error' ) self.close() def handle_expt(self): self.log_info('unhandled exception', 'warning') def handle_read(self): self.log_info('unhandled read event', 'warning') def handle_write(self): self.log_info('unhandled write event', 'warning') def handle_connect(self): self.log_info('unhandled connect event', 'warning') def handle_accept(self): self.log_info('unhandled accept event', 'warning') def handle_close(self): self.log_info('unhandled close event', 'warning') self.close() # --------------------------------------------------------------------------- # adds simple buffered output capability, useful for simple clients. # [for more sophisticated usage use asynchat.async_chat] # --------------------------------------------------------------------------- class dispatcher_with_send(dispatcher): def __init__(self, sock=None): dispatcher.__init__(self, sock) self.out_buffer = '' def initiate_send(self): num_sent = 0 num_sent = dispatcher.send(self, self.out_buffer[:512]) self.out_buffer = self.out_buffer[num_sent:] def handle_write(self): self.initiate_send() def writable(self): return (not self.connected) or len(self.out_buffer) def send(self, data): if self.debug: self.log_info('sending %s' % repr(data)) self.out_buffer = self.out_buffer + data self.initiate_send() # --------------------------------------------------------------------------- # used for debugging. # --------------------------------------------------------------------------- def compact_traceback(): t, v, tb = sys.exc_info() tbinfo = [] assert tb # Must have a traceback while tb: tbinfo.append(( tb.tb_frame.f_code.co_filename, tb.tb_frame.f_code.co_name, str(tb.tb_lineno) )) tb = tb.tb_next # just to be safe del tb file, function, line = tbinfo[-1] info = ' '.join(['[%s|%s|%s]' % x for x in tbinfo]) return (file, function, line), t, v, info def close_all(map=None): if map is None: map = socket_map for x in map.values(): x.socket.close() map.clear() # Asynchronous File I/O: # # After a little research (reading man pages on various unixen, and # digging through the linux kernel), I've determined that select() # isn't meant for doing asynchronous file i/o. # Heartening, though - reading linux/mm/filemap.c shows that linux # supports asynchronous read-ahead. So _MOST_ of the time, the data # will be sitting in memory for us already when we go to read it. # # What other OS's (besides NT) support async file i/o? [VMS?] # # Regardless, this is useful for pipes, and stdin/stdout... if os.name == 'posix': import fcntl class file_wrapper: # here we override just enough to make a file # look like a socket for the purposes of asyncore. def __init__(self, fd): self.fd = fd def recv(self, *args): return os.read(self.fd, *args) def send(self, *args): return os.write(self.fd, *args) read = recv write = send def close(self): return os.close(self.fd) def fileno(self): return self.fd class file_dispatcher(dispatcher): def __init__(self, fd): dispatcher.__init__(self) self.connected = 1 # set it to non-blocking mode flags = fcntl.fcntl(fd, fcntl.F_GETFL, 0) flags = flags | os.O_NONBLOCK fcntl.fcntl(fd, fcntl.F_SETFL, flags) self.set_file(fd) def set_file(self, fd): self._fileno = fd self.socket = file_wrapper(fd) self.add_channel()
apache-2.0
6,117,678,477,258,131,000
29.361854
78
0.540422
false
pjh/vm-analyze
analyze/ip_to_fn.py
1
21352
# Virtual memory analysis scripts. # Developed 2012-2014 by Peter Hornyack, pjh@cs.washington.edu # Copyright (c) 2012-2014 Peter Hornyack and University of Washington # This file contains methods that implement a wrapper around the # binutils "addr2line" utility, which can be used to look up instruction # pointer values in executable files and shared object files to find # the function (and sometimes the source code file + line number) that # contains the ip. # Note that each instance of "addr2line -e /path/to/binary..." will load # that entire binary into memory while it runs; this is annoying for # enormous binaries like firefox's libxul.so. from util.pjh_utils import * from analyze.vm_mapping_class import UNKNOWN_FN import fcntl import os import shlex import subprocess import sys import time cache_addr2line_lookups = True # With caching disabled, less memory will be consumed, but it will take # 14 minutes to analyze the function lookups of a firefox trace. With # caching enabled, the analysis only takes 2 minutes. addr2line_prog = '/usr/bin/addr2line' file_prog = '/usr/bin/file' linux_code_startaddr = int("0x400000", 16) # On x86_64 Linux anyway, all non-relocatable executables are loaded # into virtual address space at this address, I believe. # Given the filename of an executable file or a shared object file, # determines if the file is relocatable. All shared object files should # be relocatable, and most executable files are non-relocatable, but it # is possible to build "position independent executables" (see the "-fpic" # and "-pie" flags in gcc(1)). # # This method is intended to be used when determining function names # from instruction pointers using addr2line: if the file is relocatable, # then an absolute ip should have the address of the file's memory mapping # subtracted from it before passing it to addr2line. If the file is not # relocatable, then the absolute ip can be passed directly to addr2line. # Note that this method must create a child subprocess to check the file, # so try not to call it too often. # # Returns: True/False if object file is relocatable or not, or None if an # error occurred. def is_objfile_relocatable(name): tag = 'is_objfile_relocatable' global file_prog # Command line that I think makes sense: # file -e apptype -e ascii -e encoding -e tokens -e cdf -e elf -e tar # -bn <filename> # This should return one of the following strings, indicating that the # file is relocatable or not: # ELF 64-bit LSB shared object, x86-64, version 1 (SYSV) # ELF 64-bit LSB executable, x86-64, version 1 (SYSV) # (even position-independent executables will be described as "shared # object"). filecmd = ("{} -e apptype -e ascii -e encoding -e tokens -e cdf " "-e elf -e tar -bn {}").format(file_prog, name) # don't use -p flag, so that output will *always* have two lines fileargs = shlex.split(filecmd) print_debug(tag, ("fileargs: {}").format(fileargs)) p = subprocess.Popen(fileargs, stdout=subprocess.PIPE, stderr=subprocess.STDOUT) if not p: print_error(tag, "Popen failed for command {}".format(filecmd)) return None # communicate() will wait for the process to terminate and will # read its output. A "timeout" arg was added for Python 3.3, but # verbena is only running 3.2.3 right now, so hope that the process # will always terminate. (out, err) = p.communicate() #retcode = p.poll() # unnecessary, I think #retcode = p.wait() # unnecessary, I think retcode = p.returncode if retcode is None: print_error(tag, ("unexpected: got a None retcode - subprocess " "has not terminated yet?!").format()) return None elif retcode != 0: print_error(tag, ("file command returned a non-zero error code: " "{}").format(retcode)) return None if out: # Convert from bytes back to string: out = out.decode('utf-8').strip() else: print_error(tag, "got no output from file subprocess") return None if err: err = err.decode('utf-8').strip() else: err = '' print_debug(tag, ("call to file subprocess succeeded, got stdout " "{} and stderr {}").format(out, err)) # It's probably not necessary to define the expected output strings # so strictly here, but this will cause an error if we ever e.g. # move to a different architecture, at which point we can double- # check this code to make sure it makes sense for non-x86-64. # Ah, I already found one thing that's not consistent: some files # are "version 1 (SYSV)", others are "version 1 (GNU/Linux)". reloc_str = 'ELF 64-bit LSB shared object, x86-64, version 1' nonreloc_str = 'ELF 64-bit LSB executable, x86-64, version 1' if reloc_str in out: print_debug(tag, ("relocatable: {}").format(reloc_str)) return True elif nonreloc_str in out: print_debug(tag, ("nonrelocatable: {}").format(nonreloc_str)) return False print_error(tag, ("unexpected output \"{}\", doesn't match " "expected output from file command").format(out)) print_error(tag, ("output: {}").format(repr(out))) print_error(tag, ("reloc_str: {}").format(repr(reloc_str))) print_error(tag, ("nonreloc_str: {}").format(repr(nonreloc_str))) return None ############################################################################## # Creates an addr2line instance (subprocess) for a particular code module # (executable file or shared object file). # This class probably shouldn't be used directly; use the ip_to_fn_converter # class below instead. class addr2line_module: tag = 'addr2line_module' # Members: objname = None relocatable = None a2l = None # Popen class instance representing an addr2line subprocess cache = None def __init__(self, objname): tag = "{}.__init__".format(self.tag) if not objname: print_error_exit(tag, "must provide an object name") self.objname = objname self.tag = "addr2line_module-{}".format(objname) self.relocatable = is_objfile_relocatable(objname) if self.relocatable is None: #print_error_exit(tag, ("is_objfile_relocatable() returned " # "error, not sure how to handle gracefully inside of " # "this constructor so aborting.").format()) print_error(tag, ("is_objfile_relocatable() returned " "error, not sure how to handle gracefully inside of " "this constructor so aborting...").format()) return None elif self.relocatable is True: print_debug(tag, ("determined that object file {} is " "relocatable, will subtract vma_start_addr from ips " "passed to this addr2line_module").format(objname)) else: print_debug(tag, ("determined that object file {} is " "not relocatable, will use absolute ips that are passed " "to this addr2line_module").format(objname)) ret = self.start_addr2line() if ret != 0: print_error_exit(tag, ("failed to start addr2line " "subprocess").format()) self.cache = dict() return # Returns: the fn corresponding to this ip if it is found in the # cache map, or None if not found. def cache_lookup(self, ip): tag = "{}.cache_lookup".format(self.tag) try: fn = self.cache[ip] except KeyError: return None return fn # Inserts the specified ip, fn pair into the addr2line "cache" for # this module. # "Cache" isn't quite the right term, as nothing is ever evicted; # it's just a dictionary... def cache_insert(self, ip, fn): tag = "{}.cache_insert".format(self.tag) try: fn = self.cache[ip] print_error_exit(tag, ("unexpected: already a cache entry " "for ip {} -> {}").format(hex(ip), fn)) except KeyError: self.cache[ip] = fn print_debug(tag, ("cache insert {} -> {}").format(hex(ip), fn)) return # Passes the specified ip to addr2line and returns the function that # it corresponds to, if found. # ip should be a base-10 integer! # Returns: the function name if addr2line was able to lookup the ip # successfully, or '' if addr2line was unsuccessful. Returns None # on error. def ip_to_fn(self, ip, vma_start_addr): tag = "{}.ip_to_fn".format(self.tag) global linux_code_startaddr global cache_addr2line_lookups if not self.a2l: print_debug(tag, ("self.a2l is None, addr2line subprocess " "is already terminated (or was never started)").format()) return None if type(ip) != int: print_error(tag, ("ip argument {} is not an int").format(ip)) return None if vma_start_addr is None or type(vma_start_addr) != int: print_error(tag, ("invalid vma_start_addr: {}").format( vma_start_addr)) return None # For relocatable object files, we must subtract the vma start # addr (the address where the file was mapped into the process' # address space) from the ip, which is assumed to be an absolute # ip from an execution's userstacktrace. For non-relocatable # executables, we directly use the absolute ip. if self.relocatable: #print_debug(tag, ("file {} is relocatable, so subtracting " # "vma_start_addr {} from absolute ip {} to get ip for " # "addr2line function lookup: {}").format(self.objname, # hex(vma_start_addr), hex(ip), hex(ip - vma_start_addr))) if vma_start_addr > ip: print_error_exit(tag, ("unexpected: vma_start_addr {} " "> ip {}").format(hex(vma_start_addr), hex(ip))) ip -= vma_start_addr else: #print_debug(tag, ("file {} is not relocatable, so directly " # "using absolute ip {} and ignoring vma_start_addr " # "{}").format(self.objname, hex(ip), hex(vma_start_addr))) if vma_start_addr != linux_code_startaddr: print_error_exit(tag, ("file is non-relocatable, but " "its start addr {} doesn't match expected value for " "64-bit Linux, {} - is this expected?").format( hex(vma_start_addr), hex(linux_code_startaddr))) # See if we've already looked up this ip for this module. # Important: this must come after the ip is offset for relocatable # modules; ip must not change between now and when it is inserted # into the cache below. if cache_addr2line_lookups: cache_lookup_ip = ip # for sanity checking fn = self.cache_lookup(ip) if fn: print_debug(tag, ("cache hit: ip {} -> fn '{}'").format( hex(ip), fn)) else: print_debug(tag, ("cache miss: ip {}").format(hex(ip))) # Communicate with addr2line process if cache lookups are disabled # or the cache lookup just missed. if not cache_addr2line_lookups or fn is None: # Stupidly, it appears that Python's subprocess module can't # be used to communicate multiple times with an interactive # subprocess. # http://docs.python.org/3/library/subprocess.html#subprocess.Popen.communicate # http://stackoverflow.com/questions/3065060/communicate-multiple-times-with-a-process-without-breaking-the-pipe # http://stackoverflow.com/questions/375427/non-blocking-read-on-a-subprocess-pipe-in-python # http://stackoverflow.com/questions/11457931/running-an-interactive-command-from-within-python # It appears that the subprocess' stdin and stdout can just be # written and read directly instead. It appears that the input # string written to stdin must be converted to bytes first, and # then any output read from stdout must be converted from a byte # string back to a standard str as well. #print_debug(tag, ("addr2line: lookup ip {} in object file " # "{}").format(hex(ip), self.objname)) ip_input = """{} """.format(hex(ip)) # send Enter keypress: to enter in vim insert mode, hit # Ctrl-v first self.a2l.stdin.write(bytearray(ip_input, 'utf-8')) #print_debug(tag, "a2l.stdin.write returned") # Read the output from addr2line: # http://docs.python.org/3/tutorial/inputoutput.html#methods-of-file-objects # If self.a2l.stdout.readline() is used to read lines of output # here, then after reading all of the lines, the next call to # readline() will block forever. A possible workaround is to # always just call readline() exactly twice, since that's what # we expect addr2line's output to be, but this seems fragile. # Instead, can we just call read(), which will read "the entire # contents of the file"? This will block as well, since there # is no EOF at the end of the output. According to some stack # overflow answer for providing non-blocking reads in Python, # we may be able to use the fcntl module to mark file # descriptors as non-blocking. # http://stackoverflow.com/a/1810703/1230197 # This seems to work a little better, although now the problem # is that after writing to stdin, the python script here will # likely attempt to read stdout before addr2line has had a # chance to write to it. The problem is that we want to block # <a little bit>, but not forever... # Fragile but working solution: keep reading until two newlines # have been encountered, or until the process has terminated. # As far as I can tell addr2line will always return two lines # of output when started with the "-Cif" flags, even if # gibberish input is provided. # $ addr2line -e test-programs/hello-world -Cif # 1234 # ?? # ??:0 # 0x4006d9 # _start # ??:0 fd = self.a2l.stdout.fileno() flags = fcntl.fcntl(fd, fcntl.F_GETFL) fcntl.fcntl(fd, fcntl.F_SETFL, flags | os.O_NONBLOCK) output = "" linecount = 0 loopcount = 0 while linecount < 2: # In practice, it looks like this loop may run one or more # times (e.g. 41 times) without reading anything from # self.a2l.stdout, but then when there is data available # for reading, it is all available at once (both lines that # we expect). bytestr = self.a2l.stdout.read() if bytestr and len(bytestr) > 0: buf = bytestr.decode('utf-8') output += buf linecount = len(output.splitlines()) if False: # When this code is enabled and stderr is set to # subprocess.PIPE when self.a2l if Popen'd, it # didn't seem to help - stderr.read() here never # ever returns. bytestrerr = self.a2l.stderr.read() if bytestrerr and len(bytestrerr) > 0: buf = bytestrerr.decode('utf-8') output += buf linecount = len(output.splitlines()) print_error_exit(tag, ("stderr.read(): output={}, " "linecount={}").format(output, linecount)) print_error_exit(tag, ("BUMMER: this code was broken for " "some reason after upgrading from Ubuntu 12.04 to 13.04 " "(or something else broke it, but I'm not sure what); " "perhaps due to python3 upgrade, or maybe a change to " "addr2line. In the loop below, the stdout.read() never " "actually returns anything, and we will just loop " "here forever.").format()) loopcount += 1 if loopcount % 50000 == 0: # Lookup time appears to depend on the size of the object # file, which makes sense I guess; for a test lookup in # my version of libc, I saw loopcount up to 10,000. #print_debug(tag, ("loopcount is {}, checking if " # "addr2line is still alive").format(loopcount)) self.a2l.poll() if self.a2l.returncode: print_error(tag, ("addr2line subprocess has " "terminated with retcode {}, returning error " "from this fn").format(self.a2l.returncode)) return None else: print_debug(tag, ("addr2line subprocess is still " "alive, will keep looping; output buffer so far " "is {}").format(output)) pass lines = output.splitlines() # Ok, now, if addr2line was able to lookup the function name, it # should be found in the first line of output; if not, then it # should have printed "??". fn = lines[0].strip() if cache_addr2line_lookups: if ip != cache_lookup_ip: print_error_exit(tag, ("cache_insert ip {} doesn't match " "cache_lookup_ip {}").format(hex(ip), hex(cache_lookup_ip))) self.cache_insert(ip, fn) # This needs to happen for both the cache hit case and the # just-looked-it-up case. if '?' in fn: #print_debug(tag, ("got unknown fn '{}' returned from addr2line, " # "will return empty string from this fn").format(fn)) fn = '' else: #print_debug(tag, ("got fn '{}' from addr2line output {}").format( # fn, output.replace('\n', ''))) pass return fn # The user should try to remember to call this function explicitly # when done using the instance of the class, but if the user forgets, # then the destructor (__del__) should eventually perform the same # cleanup operations (i.e. terminating the addr2line process). def close(self): tag = "{}.close".format(self.tag) self.stop_addr2line() self.objname = None self.relocatable = None self.cache = None return # "private" method: # Starts an instance of the addr2line program for converting ips into # function names. Returns: 0 on success, -1 on error. def start_addr2line(self): tag = "{}.start_addr2line".format(self.tag) global addr2line_prog a2lcmd = ("{} -e {} -Cif").format(addr2line_prog, self.objname) # don't use -p flag, so that output will *always* have two lines a2largs = shlex.split(a2lcmd) print_debug(tag, ("a2largs: {}").format(a2largs)) self.a2l = subprocess.Popen(a2largs, stdin=subprocess.PIPE, stdout=subprocess.PIPE, stderr=subprocess.STDOUT) #stdout=subprocess.PIPE, stderr=subprocess.PIPE) if not self.a2l: print_error(tag, "Popen failed for command {}".format(a2lcmd)) return -1 retcode = self.a2l.poll() if retcode: print_error(tag, ("addr2line subprocess already " "terminated, this is unexpected").format()) retcode = self.a2l.wait() self.a2l = None return -1 print_debug(tag, ("started addr2line subprocess with pid " "{}").format(self.a2l.pid)) return 0 # "private" method: def stop_addr2line(self): tag = "{}.stop_addr2line".format(self.tag) if not self.a2l: print_debug(tag, ("self.a2l is None, addr2line subprocess " "is already terminated (or was never started)").format()) return # http://docs.python.org/3/library/subprocess.html#subprocess.Popen.communicate print_debug(tag, ("sending Ctrl-d to addr2line subprocess {} to " "terminate it").format(self.a2l.pid)) stop_input = '' # Ctrl-d: hit Ctrl-v first in vim insert mode to 'type' this # special key #(out, err) = self.a2l.communicate(input=stop_input) (out, err) = self.a2l.communicate( input=bytearray(stop_input, 'utf-8')) # does stop_input need to be converted to bytes?? Docs appear to # say so, but code examples don't... if self.a2l.returncode is None: print_error_exit(tag, ("communicate() returned, but returncode " "is not set yet!").format()) elif self.a2l.returncode != 0: print_warning(tag, ("terminated addr2line subprocess returned " "error code {}").format(self.a2l.returncode)) else: print_debug(tag, ("addr2line subprocess terminated " "successfully").format()) self.a2l = None return def __del__(self): tag = "{}.__del__".format(self.tag) if self.a2l: self.stop_addr2line() return ############################################################################## # Converts instruction pointers to function names. # Uses one addr2line_module object per file that we perform lookups in. class ip_to_fn_converter: tag = 'ip_to_fn_converter' # Members: a2lmap = None def __init__(self): tag = "{}.__init__".format(self.tag) self.a2lmap = dict() return # Attempts to lookup the specified instruction pointer in the specified # file (executable file or shared object file). vma_start_addr should # be the address (as an int) where the file was mapped into the address # space when the ip was captured. If this address is unknown, then # setting it to 0 will likely still work for non-relocatable executable # files, but the lookup will likely fail (or worse, succeed incorrectly) # for relocatable object files or position-independent executables. # Returns: function name on success, empty string '' if the lookup # failed, or None if there was an error. def lookup(self, objname, ip, vma_start_addr): tag = "{}.lookup".format(self.tag) if (not objname or not ip or type(objname) != str or type(ip) != int or len(objname) == 0 or vma_start_addr is None or type(vma_start_addr) != int): print_error(tag, ("invalid argument: objname {} must be a " "non-empty string, ip {} must be an int, vma_start_addr " "must be an int").format(objname, ip, vma_start_addr)) return None # We keep one addr2line_module object per file: try: a2l = self.a2lmap[objname] print_debug(tag, ("got an existing addr2line instance for " "objname {}").format(objname)) except KeyError: print_debug(tag, ("creating a new addr2line instance for " "objname {}").format(objname)) a2l = addr2line_module(objname) if not a2l: print_error(tag, ("addr2line_module constructor " "failed, just returning {}").format(UNKNOWN_FN)) return UNKNOWN_FN self.a2lmap[objname] = a2l return a2l.ip_to_fn(ip, vma_start_addr) def close(self): tag = "{}.close".format(self.tag) for a2l in self.a2lmap.values(): a2l.close() self.a2lmap = None return def __del__(self): tag = "{}.__del__".format(self.tag) if self.a2lmap: self.close() return if __name__ == '__main__': print("Cannot run stand-alone") sys.exit(1)
bsd-3-clause
8,448,444,619,364,010,000
37.747731
117
0.678344
false
boegel/easybuild-easyblocks
easybuild/easyblocks/b/blacs.py
1
8124
## # Copyright 2009-2020 Ghent University # # This file is part of EasyBuild, # originally created by the HPC team of Ghent University (http://ugent.be/hpc/en), # with support of Ghent University (http://ugent.be/hpc), # the Flemish Supercomputer Centre (VSC) (https://www.vscentrum.be), # Flemish Research Foundation (FWO) (http://www.fwo.be/en) # and the Department of Economy, Science and Innovation (EWI) (http://www.ewi-vlaanderen.be/en). # # https://github.com/easybuilders/easybuild # # EasyBuild is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation v2. # # EasyBuild is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with EasyBuild. If not, see <http://www.gnu.org/licenses/>. ## """ EasyBuild support for building and installing BLACS, implemented as an easyblock @author: Stijn De Weirdt (Ghent University) @author: Dries Verdegem (Ghent University) @author: Kenneth Hoste (Ghent University) @author: Pieter De Baets (Ghent University) @author: Jens Timmerman (Ghent University) """ import glob import re import os import shutil from easybuild.easyblocks.generic.configuremake import ConfigureMake from easybuild.tools.build_log import EasyBuildError from easybuild.tools.run import run_cmd # also used by ScaLAPACK def det_interface(log, path): """Determine interface through 'xintface' heuristic tool""" (out, _) = run_cmd(os.path.join(path, "xintface"), log_all=True, simple=False) intregexp = re.compile(r".*INTFACE\s*=\s*-D(\S+)\s*") res = intregexp.search(out) if res: return res.group(1) else: raise EasyBuildError("Failed to determine interface, output for xintface: %s", out) class EB_BLACS(ConfigureMake): """ Support for building/installing BLACS - configure: symlink BMAKES/Bmake.MPI-LINUX to Bmake.inc - make install: copy files """ def configure_step(self): """Configure BLACS build by copying Bmake.inc file.""" src = os.path.join(self.cfg['start_dir'], 'BMAKES', 'Bmake.MPI-LINUX') dest = os.path.join(self.cfg['start_dir'], 'Bmake.inc') if not os.path.isfile(src): raise EasyBuildError("Can't find source file %s", src) if os.path.exists(dest): raise EasyBuildError("Destination file %s exists", dest) try: shutil.copy(src, dest) except OSError as err: raise EasyBuildError("Copying %s to %s failed: %s", src, dest, err) def build_step(self): """Build BLACS using build_step, after figuring out the make options based on the heuristic tools available.""" opts = { 'mpicc': "%s %s" % (os.getenv('MPICC'), os.getenv('CFLAGS')), 'mpif77': "%s %s" % (os.getenv('MPIF77'), os.getenv('FFLAGS')), 'f77': os.getenv('F77'), 'cc': os.getenv('CC'), 'builddir': os.getcwd(), 'mpidir': os.path.dirname(os.getenv('MPI_LIB_DIR')), } # determine interface and transcomm settings comm = '' interface = 'UNKNOWN' try: cwd = os.getcwd() os.chdir('INSTALL') # need to build cmd = "make" cmd += " CC='%(mpicc)s' F77='%(mpif77)s' MPIdir=%(mpidir)s" \ " MPILIB='' BTOPdir=%(builddir)s INTERFACE=NONE" % opts # determine interface using xintface run_cmd("%s xintface" % cmd, log_all=True, simple=True) interface = det_interface(self.log, "./EXE") # try and determine transcomm using xtc_CsameF77 and xtc_UseMpich if not comm: run_cmd("%s xtc_CsameF77" % cmd, log_all=True, simple=True) (out, _) = run_cmd(self.toolchain.mpi_cmd_for("./EXE/xtc_CsameF77", 2), log_all=True, simple=False) # get rid of first two lines, that inform about how to use this tool out = '\n'.join(out.split('\n')[2:]) notregexp = re.compile("_NOT_") if not notregexp.search(out): # if it doesn't say '_NOT_', set it comm = "TRANSCOMM='-DCSameF77'" else: (_, ec) = run_cmd("%s xtc_UseMpich" % cmd, log_all=False, log_ok=False, simple=False) if ec == 0: (out, _) = run_cmd(self.toolchain.mpi_cmd_for("./EXE/xtc_UseMpich", 2), log_all=True, simple=False) if not notregexp.search(out): commregexp = re.compile(r'Set TRANSCOMM\s*=\s*(.*)$') res = commregexp.search(out) if res: # found how to set TRANSCOMM, so set it comm = "TRANSCOMM='%s'" % res.group(1) else: # no match, set empty TRANSCOMM comm = "TRANSCOMM=''" else: # if it fails to compile, set empty TRANSCOMM comm = "TRANSCOMM=''" os.chdir(cwd) except OSError as err: raise EasyBuildError("Failed to determine interface and transcomm settings: %s", err) opts.update({ 'comm': comm, 'int': interface, }) add_makeopts = ' MPICC="%(mpicc)s" MPIF77="%(mpif77)s" %(comm)s ' % opts add_makeopts += ' INTERFACE=%(int)s MPIdir=%(mpidir)s BTOPdir=%(builddir)s mpi ' % opts self.cfg.update('buildopts', add_makeopts) super(EB_BLACS, self).build_step() def install_step(self): """Install by copying files to install dir.""" # include files and libraries for (srcdir, destdir, ext) in [ (os.path.join("SRC", "MPI"), "include", ".h"), # include files ("LIB", "lib", ".a"), # libraries ]: src = os.path.join(self.cfg['start_dir'], srcdir) dest = os.path.join(self.installdir, destdir) try: os.makedirs(dest) os.chdir(src) for lib in glob.glob('*%s' % ext): # copy file shutil.copy2(os.path.join(src, lib), dest) self.log.debug("Copied %s to %s" % (lib, dest)) if destdir == 'lib': # create symlink with more standard name for libraries symlink_name = "lib%s.a" % lib.split('_')[0] os.symlink(os.path.join(dest, lib), os.path.join(dest, symlink_name)) self.log.debug("Symlinked %s/%s to %s" % (dest, lib, symlink_name)) except OSError as err: raise EasyBuildError("Copying %s/*.%s to installation dir %s failed: %s", src, ext, dest, err) # utilities src = os.path.join(self.cfg['start_dir'], 'INSTALL', 'EXE', 'xintface') dest = os.path.join(self.installdir, 'bin') try: os.makedirs(dest) shutil.copy2(src, dest) self.log.debug("Copied %s to %s" % (src, dest)) except OSError as err: raise EasyBuildError("Copying %s to installation dir %s failed: %s", src, dest, err) def sanity_check_step(self): """Custom sanity check for BLACS.""" custom_paths = { 'files': [fil for filptrn in ["blacs", "blacsCinit", "blacsF77init"] for fil in ["lib/lib%s.a" % filptrn, "lib/%s_MPI-LINUX-0.a" % filptrn]] + ["bin/xintface"], 'dirs': [] } super(EB_BLACS, self).sanity_check_step(custom_paths=custom_paths)
gpl-2.0
4,030,611,416,693,584,400
35.430493
119
0.555268
false
lampertb/RPIAFIB
Software/afib_lib.py
1
4157
import sys import numpy as np from scipy import signal # For testing import csv defaultWindowSize=120 defaultMinSNR=2 defaultNoisePercentage=10 defaultSampleRate=250 #The find peaks function takes in an array of data #It returns an array of the peak locations after running the wavelet transform def findPeaks(dataArray, windowSize=defaultWindowSize): peakIndex=signal.find_peaks_cwt(dataArray, np.arange(1, windowSize), min_snr=defaultMinSNR, noise_perc=defaultNoisePercentage) #print peakIndex return peakIndex #Calcuate the time interval between samples def getRR(peakIndex, sampleRate=defaultSampleRate): rr_data = [] for i in range(0, len(peakIndex)-1): diff = peakIndex[i+1]-peakIndex[i] #print "peak1 {0} - peak2 {1} Diff {2}".format(peakIndex[i+1], peakIndex[i], diff) timeDelay = diff/float(sampleRate) #Get the time difference between samples rr_data.append(timeDelay) #sum+=timeDelay #create an average #print "Sum {0}, len {1}".format(sum, len(peakIndex)) return rr_data #AFib Detection Algorithm from scipy.stats import norm def Fib_Detection( x , seglen = 128): N = len(x) tprmean = 0.65625; tprvar = 0.001369222 # TPR mean and variance from rozinn database afstats = {}; afstats['avg'] = []; afstats['rmssd'] = []; afstats['tpr'] = []; afstats['se'] = []; afstats['tprstat'] = []; afstats['count'] = []; for i in range (0,N-seglen+1): perc = i/N*100 j = 0 segment = x[i:i+seglen] #******************** Remove 16 outlier ******************************** #* In the outlier removal, 8 maximum and 8 minimum values are discarded #*********************************************************************** segment_outlier = segment[:] for j in range (0,8): segment_outlier.remove(max(segment_outlier)) segment_outlier.remove(min(segment_outlier)) #print segment #print segment_outlier # Get mean afstats['avg'].append(np.mean(segment)) # RMSSD difference = np.subtract(segment_outlier[2:seglen-16], segment_outlier[1:seglen-17]) afstats['rmssd'].append(np.sqrt(np.sum(np.power(difference, 2))/(seglen-17))/afstats['avg'][i-1]) # TPR j = 0 for k in range (1,seglen-1): if ((segment[k]-segment[k-1])*(segment[k]-segment[k+1])>0): j = j+1 afstats['tpr'].append(j/(seglen-2.0)) # Shannon Entropy seg_max = np.max(segment_outlier) seg_min = np.min(segment_outlier) step = (seg_max-seg_min)/16.0; entropy = 0; if (step!=0): group1 = [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0] for j in range(0,112): z = int(np.around((segment_outlier[j]-seg_min)/step)) group1[z] = group1[z]+1 group1 = np.divide(group1,np.sum(group1)+0.0) for j in range (0,16): if (group1[j]>0): entropy = entropy+group1[j]*np.log(group1[j]) afstats['se'].append(entropy/-2.7726) # Compute the afstats afstats['tprstat'].append(norm.cdf(afstats['tpr'][i-1], tprmean, np.sqrt(tprvar))); if(afstats['rmssd'][i-1]>=0.1 and afstats['tprstat'][i-1]>0.0001 and afstats['tprstat'][i-1] <= 0.9999 and afstats['se'][i-1] >=0.7): afstats['count'].append(1) else: afstats['count'].append(0) return afstats #AFib Detection from ECG file def afib_dect(): inputFile="0403_Normal_tiny.csv" ECG=[] with open(inputFile,'rb') as csvfile: reader = csv.DictReader(csvfile) for row in reader: ECG.append(float(row['ECG'])) data=np.asarray(ECG) peakIndex=findPeaks(data, 200) rr_data = getRR(peakIndex) afstats = Fib_Detection(rr_data) # Print result to result.txt file outputFile = "result.txt" result = "%d"%sum(afstats['count']); fp = open(outputFile, 'r+') fp.write(result); fp.close() return sum(afstats['count']) > 1 afib_dect();
mit
1,566,503,293,678,278,400
32.256
141
0.577099
false
eubr-bigsea/tahiti
migrations/versions/38745782554d_adding_missing_port_interfaces.py
1
5671
# -*- coding: utf-8 -*-} """Adding missing port interfaces Revision ID: 38745782554d Revises: b2b823fe47b1 Create Date: 2017-06-07 15:16:30.224298 """ from alembic import op from sqlalchemy import Integer, String from sqlalchemy.sql import table, column, text # revision identifiers, used by Alembic. revision = '38745782554d' down_revision = 'b2b823fe47b1' branch_labels = None depends_on = None data = [ (34, 5), (55, 1), (56, 1), (57, 11), (37, 2), (37, 18), # (46, 2), # (46, 18), (63, 1), (64, 1), (73, 19), (100, 2), (100, 19), (161, 17) ] def upgrade(): try: op.execute(text('START TRANSACTION')) insert_operation_port_interface() insert_operation_port_interface_translation() insert_operation_port_interface_operation_port() insert_operation_platform() insert_operation_translation() except: op.execute(text('ROLLBACK')) raise def insert_operation_translation(): tb = table( 'operation_translation', column('id', Integer), column('locale', String), column('name', String), column('description', String), ) columns = ('id', 'locale', 'name', 'description') rows_data = [ (73, 'en', 'Regression Model', 'Regression Model'), (73, 'pt', 'Modelo de Regressão', 'Modelo de Regressão'), (74, 'en', 'Isotonic Regression', 'Isotonic Regression'), (74, 'pt', 'Regressão Isotônica', 'Regressão Isotônica'), (75, 'en', 'One Hot Encoder', 'One hot encoding transforms categorical ' 'features to a format that works better with ' 'classification and regression algorithms.'), (75, 'pt', 'One Hot Encoder', 'One Hot encoding é uma transformação que fazemos nos ' 'dados para representarmos uma variável categórica de ' 'forma binária (indica presença ou ausência de um valor).'), (76, 'en', 'AFT Survival Regression', 'Accelerated Failure Time (AFT) Model Survival Regression'), (76, 'pt', 'Regressão AFT Survival', 'Accelerated Failure Time (AFT) Model Survival Regression'), (77, 'en', 'GBT Regressor', 'Gradient-Boosted Trees (GBTs) learning algorithm for ' 'regression. It supports both continuous and categorical featur'), (77, 'pt', 'Regressor GBT', 'Gradient-Boosted Trees (GBTs) learning algorithm for ' 'regression. It supports both continuous and categorical feature'), (78, 'en', 'Random Forest Regressor', 'Random Forest learning algorithm for regression. ' 'It supports both continuous and categorical features.'), (78, 'pt', 'Regressor Random Forest', 'Random Forest learning algorithm for regression. ' 'It supports both continuous and categorical features.'), (79, 'en', 'Generalized Linear Regressor', 'Generalized Linear Regressor'), (79, 'pt', 'Regressor Linear Generalizado', 'Regressor Linear Generalizado'), ] rows = [dict(list(zip(columns, row))) for row in rows_data] op.bulk_insert(tb, rows) def insert_operation_platform(): tb = table( 'operation_platform', column('operation_id', Integer), column('platform_id', Integer), ) columns = ('operation_id', 'platform_id') rows_data = [ (73, 1), (74, 1), (75, 1), (76, 1), (77, 1), (78, 1), (79, 1), ] rows = [dict(list(zip(columns, row))) for row in rows_data] op.bulk_insert(tb, rows) def insert_operation_port_interface(): tb = table( 'operation_port_interface', column('id', Integer), column('color', String), ) columns = ('id', 'color') interface_data = [ (19, '#AACC22') ] rows = [dict(list(zip(columns, row))) for row in interface_data] op.bulk_insert(tb, rows) def insert_operation_port_interface_translation(): tb = table( 'operation_port_interface_translation', column('id', Integer), column('locale', String), column('name', String), ) columns = ('id', 'locale', 'name') interface_data = [ (19, 'pt', 'Visualização'), (19, 'en', 'Visualization'), ] rows = [dict(list(zip(columns, row))) for row in interface_data] op.bulk_insert(tb, rows) def insert_operation_port_interface_operation_port(): tb = table( 'operation_port_interface_operation_port', column('operation_port_id', Integer), column('operation_port_interface_id', Integer), ) columns = ('operation_port_id', 'operation_port_interface_id') rows = [dict(list(zip(columns, row))) for row in data] op.bulk_insert(tb, rows) def downgrade(): try: for d in data: op.execute( text('DELETE FROM ' 'operation_port_interface_operation_port ' 'WHERE operation_port_id = {} ' ' AND operation_port_interface_id = {}'.format(*d))) op.execute(text('DELETE FROM operation_port_interface_translation ' 'WHERE id = 19')) op.execute(text('DELETE FROM operation_port_interface ' 'WHERE id = 19')) op.execute(text('DELETE FROM operation_platform ' 'WHERE operation_id BETWEEN 73 AND 79')) op.execute(text('DELETE FROM operation_translation ' 'WHERE id BETWEEN 73 AND 79')) except: op.execute(text('ROLLBACK')) raise
apache-2.0
7,238,215,253,415,339,000
28.915344
76
0.582773
false
Barrog/C4-Datapack
data/jscript/quests/329_CuriosityOfDwarf/__init__.py
1
2487
# Made by Mr. - Version 0.3 by DrLecter import sys from net.sf.l2j.gameserver.model.quest import State from net.sf.l2j.gameserver.model.quest import QuestState from net.sf.l2j.gameserver.model.quest.jython import QuestJython as JQuest GOLEM_HEARTSTONE = 1346 BROKEN_HEARTSTONE = 1365 ADENA = 57 class Quest (JQuest) : def __init__(self,id,name,descr): JQuest.__init__(self,id,name,descr) def onEvent (self,event,st) : htmltext = event if event == "7437-03.htm" : st.set("cond","1") st.setState(STARTED) st.playSound("ItemSound.quest_accept") elif event == "7437-06.htm" : st.exitQuest(1) st.playSound("ItemSound.quest_finish") return htmltext def onTalk (Self,npc,st) : npcId = npc.getNpcId() htmltext = "<html><head><body>I have nothing to say you</body></html>" id = st.getState() if id == CREATED : st.set("cond","0") if int(st.get("cond"))==0 : if st.getPlayer().getLevel() >= 33 : htmltext = "7437-02.htm" else: htmltext = "7437-01.htm" st.exitQuest(1) else : heart=st.getQuestItemsCount(GOLEM_HEARTSTONE) broken=st.getQuestItemsCount(BROKEN_HEARTSTONE) if broken+heart>0 : st.giveItems(ADENA,50*broken+1000*heart) st.takeItems(BROKEN_HEARTSTONE,-1) st.takeItems(GOLEM_HEARTSTONE,-1) htmltext = "7437-05.htm" else: htmltext = "7437-04.htm" return htmltext def onKill (self,npc,st): npcId = npc.getNpcId() n = st.getRandom(100) if npcId == 85 : if n<5 : st.giveItems(GOLEM_HEARTSTONE,1) st.playSound("ItemSound.quest_itemget") elif n<58 : st.giveItems(BROKEN_HEARTSTONE,1) st.playSound("ItemSound.quest_itemget") elif npcId == 83 : if n<6 : st.giveItems(GOLEM_HEARTSTONE,1) st.playSound("ItemSound.quest_itemget") elif n<56 : st.giveItems(BROKEN_HEARTSTONE,1) st.playSound("ItemSound.quest_itemget") return QUEST = Quest(329,"329_CuriosityOfDwarf","Curiosity Of Dwarf") CREATED = State('Start', QUEST) STARTED = State('Started', QUEST) COMPLETED = State('Completed', QUEST) QUEST.setInitialState(CREATED) QUEST.addStartNpc(7437) CREATED.addTalkId(7437) STARTED.addTalkId(7437) STARTED.addKillId(83) STARTED.addKillId(85) STARTED.addQuestDrop(85,BROKEN_HEARTSTONE,1) STARTED.addQuestDrop(85,GOLEM_HEARTSTONE,1) print "importing quests: 329: Curiosity Of Dwarf"
gpl-2.0
4,741,307,329,138,383,000
27.918605
74
0.650985
false
skuda/client-python
kubernetes/client/models/v1beta1_role_ref.py
1
4581
# coding: utf-8 """ Kubernetes No description provided (generated by Swagger Codegen https://github.com/swagger-api/swagger-codegen) OpenAPI spec version: v1.6.1 Generated by: https://github.com/swagger-api/swagger-codegen.git """ from pprint import pformat from six import iteritems import re class V1beta1RoleRef(object): """ NOTE: This class is auto generated by the swagger code generator program. Do not edit the class manually. """ def __init__(self, api_group=None, kind=None, name=None): """ V1beta1RoleRef - a model defined in Swagger :param dict swaggerTypes: The key is attribute name and the value is attribute type. :param dict attributeMap: The key is attribute name and the value is json key in definition. """ self.swagger_types = { 'api_group': 'str', 'kind': 'str', 'name': 'str' } self.attribute_map = { 'api_group': 'apiGroup', 'kind': 'kind', 'name': 'name' } self._api_group = api_group self._kind = kind self._name = name @property def api_group(self): """ Gets the api_group of this V1beta1RoleRef. APIGroup is the group for the resource being referenced :return: The api_group of this V1beta1RoleRef. :rtype: str """ return self._api_group @api_group.setter def api_group(self, api_group): """ Sets the api_group of this V1beta1RoleRef. APIGroup is the group for the resource being referenced :param api_group: The api_group of this V1beta1RoleRef. :type: str """ if api_group is None: raise ValueError("Invalid value for `api_group`, must not be `None`") self._api_group = api_group @property def kind(self): """ Gets the kind of this V1beta1RoleRef. Kind is the type of resource being referenced :return: The kind of this V1beta1RoleRef. :rtype: str """ return self._kind @kind.setter def kind(self, kind): """ Sets the kind of this V1beta1RoleRef. Kind is the type of resource being referenced :param kind: The kind of this V1beta1RoleRef. :type: str """ if kind is None: raise ValueError("Invalid value for `kind`, must not be `None`") self._kind = kind @property def name(self): """ Gets the name of this V1beta1RoleRef. Name is the name of resource being referenced :return: The name of this V1beta1RoleRef. :rtype: str """ return self._name @name.setter def name(self, name): """ Sets the name of this V1beta1RoleRef. Name is the name of resource being referenced :param name: The name of this V1beta1RoleRef. :type: str """ if name is None: raise ValueError("Invalid value for `name`, must not be `None`") self._name = name def to_dict(self): """ Returns the model properties as a dict """ result = {} for attr, _ in iteritems(self.swagger_types): value = getattr(self, attr) if isinstance(value, list): result[attr] = list(map( lambda x: x.to_dict() if hasattr(x, "to_dict") else x, value )) elif hasattr(value, "to_dict"): result[attr] = value.to_dict() elif isinstance(value, dict): result[attr] = dict(map( lambda item: (item[0], item[1].to_dict()) if hasattr(item[1], "to_dict") else item, value.items() )) else: result[attr] = value return result def to_str(self): """ Returns the string representation of the model """ return pformat(self.to_dict()) def __repr__(self): """ For `print` and `pprint` """ return self.to_str() def __eq__(self, other): """ Returns true if both objects are equal """ return self.__dict__ == other.__dict__ def __ne__(self, other): """ Returns true if both objects are not equal """ return not self == other
apache-2.0
-5,183,765,010,237,596,000
25.633721
105
0.531107
false
DarthMaulware/EquationGroupLeaks
Leak #5 - Lost In Translation/windows/Resources/Python/Core/Lib/multiprocessing/queues.py
1
9842
# uncompyle6 version 2.9.10 # Python bytecode 2.7 (62211) # Decompiled from: Python 3.6.0b2 (default, Oct 11 2016, 05:27:10) # [GCC 6.2.0 20161005] # Embedded file name: queues.py __all__ = [ 'Queue', 'SimpleQueue', 'JoinableQueue'] import sys import os import threading import collections import time import atexit import weakref from Queue import Empty, Full import _multiprocessing from multiprocessing import Pipe from multiprocessing.synchronize import Lock, BoundedSemaphore, Semaphore, Condition from multiprocessing.util import debug, info, Finalize, register_after_fork from multiprocessing.forking import assert_spawning class Queue(object): def __init__(self, maxsize=0): if maxsize <= 0: maxsize = _multiprocessing.SemLock.SEM_VALUE_MAX self._maxsize = maxsize self._reader, self._writer = Pipe(duplex=False) self._rlock = Lock() self._opid = os.getpid() if sys.platform == 'win32': self._wlock = None else: self._wlock = Lock() self._sem = BoundedSemaphore(maxsize) self._after_fork() if sys.platform != 'win32': register_after_fork(self, Queue._after_fork) return def __getstate__(self): assert_spawning(self) return ( self._maxsize, self._reader, self._writer, self._rlock, self._wlock, self._sem, self._opid) def __setstate__(self, state): self._maxsize, self._reader, self._writer, self._rlock, self._wlock, self._sem, self._opid = state self._after_fork() def _after_fork(self): debug('Queue._after_fork()') self._notempty = threading.Condition(threading.Lock()) self._buffer = collections.deque() self._thread = None self._jointhread = None self._joincancelled = False self._closed = False self._close = None self._send = self._writer.send self._recv = self._reader.recv self._poll = self._reader.poll return def put(self, obj, block=True, timeout=None): if not self._sem.acquire(block, timeout): raise Full self._notempty.acquire() try: if self._thread is None: self._start_thread() self._buffer.append(obj) self._notempty.notify() finally: self._notempty.release() return def get(self, block=True, timeout=None): if block and timeout is None: self._rlock.acquire() try: res = self._recv() self._sem.release() return res finally: self._rlock.release() else: if block: deadline = time.time() + timeout if not self._rlock.acquire(block, timeout): raise Empty try: if not self._poll(block and deadline - time.time() or 0.0): raise Empty res = self._recv() self._sem.release() return res finally: self._rlock.release() return def qsize(self): return self._maxsize - self._sem._semlock._get_value() def empty(self): return not self._poll() def full(self): return self._sem._semlock._is_zero() def get_nowait(self): return self.get(False) def put_nowait(self, obj): return self.put(obj, False) def close(self): self._closed = True self._reader.close() if self._close: self._close() def join_thread(self): debug('Queue.join_thread()') if self._jointhread: self._jointhread() def cancel_join_thread(self): debug('Queue.cancel_join_thread()') self._joincancelled = True try: self._jointhread.cancel() except AttributeError: pass def _start_thread(self): debug('Queue._start_thread()') self._buffer.clear() self._thread = threading.Thread(target=Queue._feed, args=( self._buffer, self._notempty, self._send, self._wlock, self._writer.close), name='QueueFeederThread') self._thread.daemon = True debug('doing self._thread.start()') self._thread.start() debug('... done self._thread.start()') created_by_this_process = self._opid == os.getpid() if not self._joincancelled and not created_by_this_process: self._jointhread = Finalize(self._thread, Queue._finalize_join, [ weakref.ref(self._thread)], exitpriority=-5) self._close = Finalize(self, Queue._finalize_close, [ self._buffer, self._notempty], exitpriority=10) @staticmethod def _finalize_join(twr): debug('joining queue thread') thread = twr() if thread is not None: thread.join() debug('... queue thread joined') else: debug('... queue thread already dead') return @staticmethod def _finalize_close(buffer, notempty): debug('telling queue thread to quit') notempty.acquire() try: buffer.append(_sentinel) notempty.notify() finally: notempty.release() @staticmethod def _feed(buffer, notempty, send, writelock, close): debug('starting thread to feed data to pipe') from .util import is_exiting nacquire = notempty.acquire nrelease = notempty.release nwait = notempty.wait bpopleft = buffer.popleft sentinel = _sentinel if sys.platform != 'win32': wacquire = writelock.acquire wrelease = writelock.release else: wacquire = None try: while 1: nacquire() try: if not buffer: nwait() finally: nrelease() try: while 1: obj = bpopleft() if obj is sentinel: debug('feeder thread got sentinel -- exiting') close() return if wacquire is None: send(obj) else: wacquire() try: send(obj) finally: wrelease() except IndexError: pass except Exception as e: try: if is_exiting(): info('error in queue thread: %s', e) else: import traceback traceback.print_exc() except Exception: pass return _sentinel = object() class JoinableQueue(Queue): def __init__(self, maxsize=0): Queue.__init__(self, maxsize) self._unfinished_tasks = Semaphore(0) self._cond = Condition() def __getstate__(self): return Queue.__getstate__(self) + (self._cond, self._unfinished_tasks) def __setstate__(self, state): Queue.__setstate__(self, state[:-2]) self._cond, self._unfinished_tasks = state[-2:] def put(self, obj, block=True, timeout=None): if not self._sem.acquire(block, timeout): raise Full self._notempty.acquire() self._cond.acquire() try: if self._thread is None: self._start_thread() self._buffer.append(obj) self._unfinished_tasks.release() self._notempty.notify() finally: self._cond.release() self._notempty.release() return def task_done(self): self._cond.acquire() try: if not self._unfinished_tasks.acquire(False): raise ValueError('task_done() called too many times') if self._unfinished_tasks._semlock._is_zero(): self._cond.notify_all() finally: self._cond.release() def join(self): self._cond.acquire() try: if not self._unfinished_tasks._semlock._is_zero(): self._cond.wait() finally: self._cond.release() class SimpleQueue(object): def __init__(self): self._reader, self._writer = Pipe(duplex=False) self._rlock = Lock() if sys.platform == 'win32': self._wlock = None else: self._wlock = Lock() self._make_methods() return def empty(self): return not self._reader.poll() def __getstate__(self): assert_spawning(self) return ( self._reader, self._writer, self._rlock, self._wlock) def __setstate__(self, state): self._reader, self._writer, self._rlock, self._wlock = state self._make_methods() def _make_methods(self): recv = self._reader.recv racquire, rrelease = self._rlock.acquire, self._rlock.release def get(): racquire() try: return recv() finally: rrelease() self.get = get if self._wlock is None: self.put = self._writer.send else: send = self._writer.send wacquire, wrelease = self._wlock.acquire, self._wlock.release def put(obj): wacquire() try: return send(obj) finally: wrelease() self.put = put return
unlicense
1,957,727,825,150,317,600
28.47006
106
0.517578
false