community-datasets/yahoo_answers_topics · Datasets at Hugging Face

id int32 0 1.4M	topic class label 10 classes	question_title stringlengths 10 132	question_content stringlengths 0 4k	best_answer stringlengths 0 4k
5,500	4Computers & Internet	When Apple-Intel computers come out, will it be possible to have a dual boot with Windows and MAC OS?		There is a good chance that you can. There are already ways to do so in current intel based mac dev kits and while the final version may be different, it will more than likely be cracked by hackers. See source for details and howto.
5,501	4Computers & Internet	how do i close my yahoo account?		Simply go to the Account Deletion (https://edit.yahoo.com/config/delete_user ) website, log-in and you can delete your account.
5,502	3Education & Reference	where does the word okay come from?		the word okay was used by the american airforce staff when the airplanes were ready for the pilotfighters to go to action ,the pilots used hand signal equivalent to the word okay.this word was used since 1940.it became part of the north american culture where it is widely used today.ok
5,503	6Business & Finance	Where can I purchase Spoto spot remover?		Cincinnati Packaging & Distribution, Inc.\n12000 Mosteller Road\nSharonville, OH 45241\nTel: 513-702-8795\nFax: 513-326-6094
5,504	0Society & Culture	What is meant by the term "negative waves" are surrounding you?	In astrology and psychic circles I hear this term and would like to know what others think about it and how it applies to everyday life.	Negative waves...negative engergy...The best thing to do is buy a sage smudging stick, light it, and let the smoke waft all over your house and body. It works to remove any negative energy that is existing in your home and yourself. You can buy them in metophysical stores and places who carry religious supplies. This really works. It smells, but its worth it.
5,505	6Business & Finance	Is the word "hertz" plural?	Is the word "hertz" plural? Or would the plural of "hertz" be "hertzes" or something like that?	hertz is like fish it is both singular and plural.
5,506	6Business & Finance	where can i find a illinois fighting illini windbreaker jacket???	preferably blue or tan in color	The Fighting Illini have a store. It can be found here\nhttp://fightingillini.collegesports.com/store/ I did a search and went through the categories and found a jacket/windbreaker here http://store.fansonly.com/marketplace/store_contents.cfm?cart_id=&store_id=180&dept_id=2123&product_id=72155 but you can look around for yourself if you don't like that one.
5,507	2Health	is smoking marjuana physically harmful?		Smoking anything is depermental to your health; try eating it.
5,508	8Family & Relationships	when is the right moment to say "i want you to kiss me"?	when would be the good time to say it... just blurt out and say it... or like i donno... i'm just REALLY confused!!!	There isn't a right moment to say this. A kiss will happen, or it won't. Talking about the kiss usually ruins the excitement of the kiss. If you want a kiss to happen, and it's not happening, either lead into the kiss yourself, or wait paitently. If you wait for it, it may never happen, but at least you won't have the embarrassment of having ASKED for a kiss, only to be shrugged off.
5,509	6Business & Finance	where can i find a hard to find washer motor ge model #wbse2090b also has 5kh61kw2516hs on motor its self?		Try Grainger Supply Company.\nThey have branches in all Major Cities and are recognized for electric motors.\nMany brands with cross references for motors if your particular Manufacturer is not available.\nAlso have a Website, but I don't use the Site.
5,510	7Entertainment & Music	how old is Gwen Stefani?		Gwen Stefani is 36 years old. She was born on October 3rd, 1969.
5,511	4Computers & Internet	what are the classification of computers according to its purpose?		There are many different names for categories of comptuers, common ones are PC for 'personal computer', and mainframe, which refers to a computer historically large and to which multiple different people use at the same time with multiple sets of keyboard/monitor pairs ('terminals'). See the article below for much more info than would be prudent for me to type.
5,512	3Education & Reference	what is a secular law?	secula law under the law study.	Secularism is commonly defined as the idea that religion should not interfere with or be integrated into the public affairs of a society. It is often associated with the Age of Enlightenment in Europe, and plays a major role in Western society. The principles of separation of church and state in the United States and Laïcité in France draw heavily on secularism.\n\n\nDefinition\nAs secularism is often used in different contexts, its precise definition can vary from place to place. In philosophy, secularism is the belief that life can be best lived by applying ethics, and the universe best understood, by processes of reasoning, without reference to a god or gods or other supernatural concepts. Secularism in this sense was coined by George Jacob Holyoake and is one of the precursors of modern secular humanism.\n\nWhen applied to society, secularism is considered to be any of a range of situations where a society less automatically assumes religious beliefs to be either widely shared or a basis for conflict in various forms, than in recent generations of the same society. In this sense secularism is linked to the sociological concept of secularization and may be upheld as an academic thesis, rather than advocated as a desirable state of affairs.\n\nIn government, secularism means a policy of avoiding entanglement between government and religion (ranging from reducing ties to a state religion to promoting secularism in society), of non-discrimination among religions (providing they don't deny primacy of civil laws), and of guaranteeing human rights of all citizens, regardless of the creed (and, if conflicting with certain religious rules, by imposing priority of the universal human rights).\n\nSecularism can also mean the practice of working to promote any of those three forms of secularism. It should not be assumed that an advocate of secularism in one sense will also be a secularist in any other sense. It is also important to remember that secularism does not necessarily equate to atheism; indeed, many secularists have counted themselves among the religious.\n\nThe antonym of secularism is usually theocracy, which is a form of government where religion often plays a major or dominant role.
5,513	6Business & Finance	What is the smallest part of an Atom?		an elektron
5,514	6Business & Finance	WHAT IS THIS AT TOP OF MY YAHOO PAGE?	',728,90,-83591,128804,'1','321',-1,-1,'');}else{setTimeout('if(document.pradi1){document.pradi1.onload()}',200);}">	It's probably an error related to the page only partly loading in the browser or a portion of the page that is currently broken. Hit reload/refresh and it will likely disappear.
5,515	6Business & Finance	Which high rated people are sick and tired of asking /answering questions, already?		I answer the same ones over and over and I haven't gotten too tired of it yet. The key is to make sure you don't over do it. Play here for a while and go find something else to do.
5,516	9Politics & Government	What was the full name of chankiya --an Indian Scholar(?)/Philosopher,?	Did he write any book/stuff.	Chanakya was also known as Kautilya, but his given name was Vishnugupth.\n\nHe wrote three books about statecraft:\nChanakyasutras.\nRajaniti shastra.\nArthashastra.
5,517	2Health	What is the known side effect of taking commercial creatine product?		It destroys the liver. I dont suggest you take it if you have a bad liver. I wouldnt even take it even if I had good liver. Because a good liver can become a bad liver. It has resulted in many deaths, so you should steer clear of creatine.
5,518	0Society & Culture	I Like to have email id of our Hon'ble President Dr Abdulkalam since I like to send an article to him .Can I?	I like to send an article to him titled " Harness the healthy youth for the betterment of the Nation and the Humanity "	Great thought, friend! \n\nHere ya go - presidentofindia@rb.nic.in
5,519	7Entertainment & Music	how to set up a crate px-800dp sound system?	we are a small school and lost the papers on our pa system	Hi, my name is Robin, I work at S. M. Hanson Music Inc. in Salina, Ks. 785-825-6273. I can walk you through how to set up the PA system better over the phone. When I know what other gear you are using. I am at home right now, but you can call the store and ask for Aaron, Dale or Ryan right now and they will also be able to help you out. If you want to wait till I get there, Call me after 2:00 pm CST, at 1-800-875-6273. Info we will need: speakers, mics, monitors,cd player, instruments, etc... all that will be run by your powered mixer.
5,520	7Entertainment & Music	what are the general traits of sagittarius people?	How good are they ? in love ? life ? sex ? friends ? people relations ?	As a proud and true Sagittarian, I'm proud to give you the following information\n\nTraits of a Sagittarius:\n\nFun \nOptimist \nGood-natured \nSociable \nSpiritual \nImpatient \nFears responsibility \nSelf-indulgence \nFanaticism \nPeter Pan syndrome \nTendency to gamble \n\nLikes...\n\nFreedom \nUnusual ideas \nBeing on the move \nParties \nLuxury items \nGambling \nNew friends \nFlirting \n\n\n Dislikes...\n\nPublic disapproval \nPlaying safe \nConfinement \nMonotony \nTight clothes/areas \nBeing doubted \nBeing refused \n \nSagittarians have a positive outlook on life, are full of enterprise, energy, versatility, adventurousness and eagerness to extend experience beyond the physically familiar. They enjoy travelling and exploration, the more so because their minds are constantly open to new dimensions of thought. They are basically ambitious and optimistic, and continue to be so even when their hopes are dashed. \n\nTheir strongly idealistic natures can also suffer many disappointments without being affected. They are honorable, honest, trustworthy, truthful, generous and sincere, with a passion for justice. They are usually on the side of the underdog in society they will fight for any cause they believe to be just, and are prepared to be rebellious.
5,521	2Health	what are personality disorders?		A personality disorder is identified \n\nby a pervasive pattern of experience and behavior that is abnormal with respect to any two of the following:\n\nthinking, mood, personal relations, \n\nand the control of impulses.\n\n \n\nThe character of a person is shown through his or her personality -- by the way an individual thinks, feels, and behaves. When the behavior is inflexible, maladaptive, and antisocial, then that individual is diagnosed with a personality disorder. \n\n \n\nMost personality disorders begin as problems in personal development and character which peak during adolescence and then are defined as personality disorders. \n\n \n\nPersonality disorders are not illnesses in a strict sense as they do not disrupt emotional, intellectual, or perceptual functioning. However, those with personality disorders suffer a life that is not positive, proactive, or fulfilling. Not surprisingly, personality disorders are also associated with failures to reach potential.\n\n \n\nThe DSM-IV-TR: Diagnostic and Statistical Manual of Mental Disorders, published by the American Psychiatric Association, defines a personality disorder as an enduring pattern of inner experience and behavior that deviates markedly from the expectation of the individual's culture, is pervasive and inflexible, has an onset in adolescence or early adulthood, is stable over time, and leads to distress or impairment.\n\n \n\nCurrently, there are 10 distinct personality disorders identified in the DSM-IV:\n\nAntisocial Personality Disorder: Lack of regard for the moral or legal standards in the local culture, marked inability to get along with others or abide by societal rules. Sometimes called psychopaths or sociopaths. \n\nAvoidant Personality Disorder: Marked social inhibition, feelings of inadequacy, and extremely sensitive to criticism. \n\nBorderline Personality Disorder: Lack of one's own identity, with rapid changes in mood, intense unstable interpersonal relationships, marked impulsively, instability in affect and in self image. \n\nDependent Personality Disorder: Extreme need of other people, to a point where the person is unable to make any decisions or take an independent stand on his or her own. Fear of separation and submissive behavior. Marked lack of decisiveness and self-confidence. \n\nHistrionic Personality Disorder: Exaggerated and often inappropriate displays of emotional reactions, approaching theatricality, in everyday behavior. Sudden and rapidly shifting emotion expressions. \n\nNarcissistic Personality Disorder: Behavior or a fantasy of grandiosity, a lack of empathy, a need to be admired by others, an inability to see the viewpoints of others, and hypersensitive to the opinions of others. \n\nObsessive-Compulsive Personality Disorder: Characterized by perfectionism and inflexibility; preoccupation with uncontrollable patterns of thought and action. \n\nParanoid Personality Disorder: Marked distrust of others, including the belief, without reason, that others are exploiting, harming, or trying to deceive him or her; lack of trust; belief of others' betrayal; belief in hidden meanings; unforgiving and grudge holding. \n\nSchizoid Personality Disorder: Primarily characterized by a very limited range of emotion, both in expression of and experiencing; indifferent to social relationships. \n\nSchizotypal Personality Disorder: Peculiarities of thinking, odd beliefs, and eccentricities of appearance, behavior, interpersonal style, and thought (e.g., belief in psychic phenomena and having magical powers). \n\nAccording to Dr. Sam Vaknin, author of Malignant Self-Love: Narcissism Revisited, individuals with personality disorders have many things in common (see The Interrelationship Between Personality Disorders):\n\nSelf-centeredness that manifests itself through a me-first, self-preoccupied attitude \n\nLack of individual accountability that results in a victim mentality and blaming others, society and the univ
5,522	6Business & Finance	i like my best guy friend but i am not sure f he likes me? see more info inside.?	every one says that he likes me and he sends mixed signals to me. i know better than to believe every thing i hear but still. they also say that we would make a really cute couple and he agrees. help me i am so confused.	i'm 13 and i like myt best friend that's a girl and she likes me and evryone tells her i like her and that she likes me and we both think we would make a cute couple so i asked her out last month and right now i'm happy
5,523	5Sports	Who will win the matchup between the SF 49ers and the Houston Texans?	Plus, who might take a dive on that game to get that first round draft pick?	The 49ers will amazing win this one, even though they are also doing horrible.
5,524	6Business & Finance	IF YOU WERE TRAPPED INSIDE AN EGG...HOW WOULD YOU FEEL?		I'd be busy thinking of a way to crack the problem. Once I've hatched the plot, I would come out of my shell and take action. This would lay the foundation of a good story.
5,525	6Business & Finance	what should i buy my 9 year old cousin a plasma or surround system?		wtf. Neither. he/she is NINE years old, dont encorage them to be a snob.
5,526	6Business & Finance	what is the number one petroleum producer in the world?	petroleum used to make gas.	In terms of world oil production only for 2004 (the latest figures published):\nSaudi Arabia: 13.1% of world oil production\nRussia: 11.9%\nUSA: 8.5%\nIran: 5.2%\nMexico: 4.9%\nVenezuela: 4.0%\nNorway: 3.9%\nCanada: 3.8%\nU.A.E. 3.3%\nNigeria 3.2%\nKuwait 3.1%\n\nThere is no easy way to evaluate which country produced the most oil that was made into gasoline, just as there is no way to be certain that gasoline you are buying was made from oil from any particular country.\n\n\nThis data comes from the BP Statistical Review of World Energy. You can download the book from:
5,527	4Computers & Internet	How can I answer more questions than Yahoo will allow, without new account?	I answered my limit today? whats this, a limit? dumb. I helped a bunch of english as a second language natives today. I didn't want to stop.	And just remember, there is a reason for this. They dont want just any spammer off the street to just come in and answer 100 questions with like one word or something. The longer you stay the more likely you are to ascend a level and you are less likely to spam.
5,528	6Business & Finance	Wich is Barbie full name?		Barbara Millicent Roberts
5,529	6Business & Finance	Credit history?	How is one's credit history built, and how do you build up a good history? Some people have said to me it's paying utility bills on time, others have said it's spending a lot of money on your credit card every month and paying THAT off on time, and yet others have said you need take out a loan and pay it back on time. So what exactly is it, and how does one get one? At whate age can you start creating a credit history?	You can start building a credit history as soon as you can have accounts in your own name. All the answers you've received thus far are correct. Something to remember is that credit history takes a long time to build, but not long to destroy. Good credit history means paying your bills on time and ahead of time. It's always good to pay more than your minimum payment on loans and credit cards. Another good tidbit of information is this: When most creditors run your credit, they weigh recent activity most heavily. They will see what your recent trends are. How have you been doing the last 6 months or 1 year? If you did well for 5 years, but you've been missing payments for 6 months, forget about that loan. The best thing to do is keep paying bills on time or ahead of time and don't spend more than you make.
5,530	4Computers & Internet	what are the details in formating a computer?		Formatting a hard disk is the process by which all data (information) is lost from the drive. You will loose all of the data unless you back it up. The link below will provide step-by-step instructions to formatting a conventional 386-type system. The article is quite old, but will work for all disks. If you are just trying to format for an install for XP then you just boot off the cd and format using the setup instructions.
5,531	0Society & Culture	why dont jehovah witnesses celebrate holidays birthdays etc..?		One thing you need to do is ignore the people who call them a "cult". \n\n(That means ignore the entire comment made by Dak below. His comments don't make the slightest bit of sense and are obviously motivated by ignorant prejudice. You will NOT get an accurate answer from his comment. For example, anyone with common sense and the ability to do a little research will know that Christ was NOT born on December 25th. Even non-Jehovah's Witnesses know that.) \n\nThey are not a cult. Cults have human leaders, Jehovah's Witnesses' leader is Christ Jesus. \n\nA careful examination of the various holidays celebrated today will show that they can be traced back to pagan false-religious worship. The pagans did not worship God and did not engage in practices that God approved of. The Bible only commands Christians to observe ONE celebration: the death of Christ. Not his birth, not his resurrection....only his death. If his birth was meant to be celebrated, don't you think it would be a Biblical command? And since we're not commanded to celebrate the birth of Jesus Christ, why would we take it upon ourselves to celebrate the birth of anyone else? \n\nThe only 2 mentions of birthday celebrations in the scriptures were by those who did not worship God, and in both instances there was a murder at each. In the second one, it was one of God's own servants who was put to death, John the Baptizer.\n\nGod, through the Bible, tells us just how we are to live and what form of worship is acceptable to him. He also tells us what should be celebrated, which, as said already, is simply the death of his Son. \n\nJehovah's Witnesses firmly adhere to the Holy Scriptures for all of their beliefs. If you want further information, check out their official website below.
5,532	6Business & Finance	What was the most thoughful gift you have been given?		I'd have to go with the most sentimental for me which was the Hobbit's Journal. A gift that was given me at a young age by a good friend. It became lost for several years until my beautiful girlfriend gave it back to me over 10 years later.
5,533	5Sports	Is football the original name, or soccer?	Which name came first?\nThe European call it football, American & Australians Soccer. Which came first?	It is football.\nAmericans and Australians call their own "football" (the one played with the Stewie Griffin head looking ball) football, so they had to find another name for football. \nI call American/Australian insistence on soccer cultural imperialism.
5,534	2Health	what is radon?		Indoor Radon is the second leading cause of lung cancer in the United States and the leading cause among non-smokers. Protect your family. Test your home. During the month of January, EPA works to raise the public's awareness about radon and the importance of testing for radon -- especially in homes and schools. The EPA, working in concert with Federal, State, and local governments as well as volunteer organizations, conducts many different programs to educate Americans about the indoor radon health threat. About 1 in 15 homes has high radon levels. If you haven't tested your home, do it now during National Radon Action Month. If you have further questions about Radon, please call your state radon contact (just click on your state), or call the National Radon Information Line at: 1-800-SOS-RADON [1-800-767-7236]
5,535	5Sports	Do you think professional sports players are overpaid?	I do, even though it takes years of hard work to get there. Nobody is worth 2, 5, 10+ million a year - NOBODY.	Players are paid what the market offers. Team owners generally overpay players in fear that the player may sign elsewhere. I don't have a problem with a football player getting $2 million. The average career of a football player is 4.5 seasons. If that player is injured, and cannot work, then I can justify their salary. As long as we the Suckers, keep buying tickets, jerseys, memorabilia and the like, then pro players will be overpaid.
5,536	1Science & Mathematics	What is the balance on $1,800 deposited at 5% compounded annually for 4 years?		$2,187.91\n\nI would look for a better rate of return if I were you:-)
5,537	6Business & Finance	What is the difference between a Family Business and a Private Business?		You have the option when incorporating a business to have publicly traded shares or keep the shares private. A "privately held company" signifies that it is incorporated but not publicly traded. A family business may or may not be incorporated. Generally a family business signifies the company has been handed down from generation to generation of the same family, but has no significant meaning as to status of incorporation or public/private shares.
5,538	0Society & Culture	Which are the main representative dishes (food) from your country?		Yogurt is the main representative food from my country Turkey. Yogurt is a Turkish word. \n\nSome of other traditional dishes are:\n\nA ravioli-like dish served with yogurt we call it "manti" \n\nHot dish made of grape or cabbage leaves stuffed with meat, and rice we call it "sarma" or olive oiled cold dish stuffed with currant and pine nut instead of meat. \n\nTurkish delight we call it "lokum" \n\nShish kebab we call it "sis kebap"\n\nOlive we call it "zeytin" since we're mediterrian country, we eat olive at breakfast, not just in salads or pizza.
5,539	6Business & Finance	where would you share a story of compassion which you have witnessed locally?		Write it up & send it in to your local news channel; they are always looking for that sort of thing...
5,540	9Politics & Government	Is jhon hanson really the first person?	We looked it up and it said so	I assume you are asking if he was the first President of the United States. This is a common misconception. He was the President of the United States in Congress, a title given to the head of the legislature under the Articles of Confederation, a brief experiment between the Revolution and the Constitution, which had no executive branch, and thus no president, at least as we conceive him. He was instead something like a prime minister, though even that is a stretch. He had very little real power in his position. Besides, if you're really going to say that his position is equivalent, then the first president would have to be Peyton Randolph, who served as the President of the First Continental Congress.
5,541	9Politics & Government	Is family law or divorce cases the only place you find the subject of annullment and where is it can i find it	I new at this I'm studying to be a paralegal. thanks for all your help.lol	Annulment is a procedure of the Catholic church whereby a marriage is considered to have been "null" from the beginning because of some problem ... so from God's point of view, the marriage was not a true marriage when the vows were exchanged. It looks from an examination of my search page as though the pages explaining the causes for annulment aren't available anymore(!) This is too bad, as there are many causes, including fraud (somebody tells you they're rich before you marry them, then afterwards it turns out they aren't), mental incompetence (their vow is invalid 'cause they can't think straight), I think even not having been married in the Catholic church was a reason (I had copied it all out a few years back). Apparently there are also civil annulments in some states. Here's one webpage ...\nhttp://marriage.about.com/od/annulments/
5,542	2Health	last year a mass was found thru mammography in my left breast.it bothered me a lot.?	after a year another mammo was done also untrasound, & it showed benign features.2 months ago as i examined my breast and pinched it, a tiny crystal clear fluid came out.it alarmed me.just about 2weeks ago again mammo & ultrasound was done, the mass remained unchanged. i was advise to a yearly mamo & ultrasound. 3days, as i examined my breast, again tiny crystal clear fluids comes out if i pinch them. im worried about this. can u help me be clarified? i know only if a milk like fluid comes out, sound no good. but what about this crystal clear tiny fluids coming out of my breast if i pinch it..please enlighten me. awaiting your reply	The chances are the lesion is benign- intraduct papilloma or some other benign lesion. Depending on your age. My suggestion is to go see a doctor; usually a fine needle aspiration which is almost painless will clarify the issue.\n\nKuris, MD
5,543	6Business & Finance	in the chronicles on narnia what is the name of the instrument that Mr Tumnus played?		flute
5,544	0Society & Culture	besides christmas, what holiday is your favorite? why?		I would say Valentine day, it is just a happy day filled with love and romance. Even if your single and until I got married I was single every v-day it is still a day when you can reflect on the beauty of love and celebrate the love you have for yourself.
5,545	5Sports	Michael Phelps?	will he graduate\nwill he beat mark spitz's record\nwill he beat ian crocker\nwill he retire after 2008	Yes.\nYes.\nNo.\nNo.
5,546	6Business & Finance	Where do you get games for cxbx (xbox emulator)?	PLz i must have looked for 24 hours and i still ask my self "WHERE DO I FIND THE CXBX GAMES??????" PLz if you know tell me a greyt_greyt@yahoo.com	wal-mart
5,547	2Health	acne products: compare actimine to acuzine?		For quality, success rate, safety, and consumer satisfation, the experts at e-consumer.org rated Actimine as "excellent" in all four categories. \nAcuzine scored excellent in all categories except safety, in which it scored "very good". Acuzine is $40 and Actimine is $30. Looks like they are both good, but Actimine is less expensive and a little safer\nhttp://www.e-consumer.org/catalog/CategoryReview.asp?Category=9
5,548	3Education & Reference	About IIT ENTRANCE EXAM. OF M.SC. PHYSICS 2006.?		u need the luck
5,549	2Health	how can i get pregnet fast? or what can i do to get pregnet?		don't ... if you can't wait for nature you shouldn't be a parent
5,550	6Business & Finance	how old are u??		how about u?
5,551	6Business & Finance	How much wood would a woodchuck chuck if a woodchuck could chuck wood?		Simply put, "A wood chuck would chuck all the wood it could chuck if a woodchuck could chuck wood." Determined bastards those woodchucks are.
5,552	5Sports	San Diego Chargers Win vs Denver Broncos then Pittsburgh Steelers are wild card team! What is the tie breaker?		If the Steelers, Chargers and Chiefs all end up 10-6, the tiebreaker would be very confusing, but I believe that this link may help.
5,553	3Education & Reference	What are the top 10 names for high schools and middle schools in the U.S.?	My guess it that Lincoln is first followed by Kennedy. How do we find out? Thanks!	Washington Lincoln jefferson
5,554	6Business & Finance	What's the meaning of "life"?	What's the meaning of "life"?	To serve our Lord our God, with all of our heart and soul..do good unto others..do not repay evil for evil..give unto the needy..visit those in prison..visit the homeless..if someone asks of you for anything and you have it to give, give without asking in return..Love those that hate you, pray for those that persecute you..Let your light so shine before men..that they may see Christ in you..Amen!!
5,555	1Science & Mathematics	( 3x - 2 ) ( 4x + 3 ) wats the answer plz?????		First Outer Inner Last\n\n3x * 4x = 12x^2\n3x * 3 = 9x\n-2 * 4x = -8x\n-2 * 3 = -6\n\nCombine your stuff\n9x - 8x = x\n\nPut it together\n\n12x^2 + x - 6\n\nAlways double check the answers you get from here.
5,556	6Business & Finance	what do I do is i was threatened and they know where i live but I dont know where they live?		This may be a little late, but you should notify your local police department about the threat and the person who is threatening you. If possible, stay out of your environment in case they strike you or harm you and your children in some way. If you know this persno, find a way to recieve a restraining order from court. And, if possible as well, settle your dispute with the person and see a solution for your disagreements. I hope that all will be well in your life and I will be praying for you, whether or not you believe in the same God that I do. I wish you peace.
5,557	2Health	herpes in women do there nipples leak?		i don't think so, this migth be caused for any other condition. \nAnyway, you don't play with healt, go to se a doctor.
5,558	8Family & Relationships	Is it ok to date a woman 20 yrs younger than you?		If you are both happy, why shouldn't it be? Just be sure that you both are on the same page when it comes to things like marriage, kids, etc, and you should be fine.
5,559	7Entertainment & Music	Do you happy today?	I'm happy!!	i sure am! to be lucky in the coming year, you have to be happy at the start of it.
5,560	6Business & Finance	Why is google charging for google-answers and why not yahoo?	I have found that Google is providing best services with competition to Yahoo! But why is google charging while yahoo not doing for this service?	Because Google pay people to research your question and get really good answers.\n\nOn Yahoo anyone can answer your question so you might get a good answer or you might just get a totally rubbish answer.\n\nIn short you get what you pay for.
5,561	4Computers & Internet	Why can't I access secure sites that require a log-in?	I have XP Pro and have tried the patches on MS site, checked my security settings, made sure my IE6 has 128 bit cipher strength. Please help!	Are you sure about your username and password? Sometimes it's easy to forget, esp. if you normally check 'save password'...
5,562	8Family & Relationships	I'm a 40 year old man and bi curious; should I pursue this?	I'm married for 9 years. I'm not gay, I really love women, but I'm a little curious about being on the receiving end. I'm not in it for the love, I'm in it for the "at that moment pleasure". \nMy wife does not know, I don't want her to know. I'm scared to death of AIDS and other STD's, so practicing safe sex is the only way to go. Also I believe in God and what the bible says about Homosexuality.\nI know a man that is interested in me and he's not pushing me, he knows I'm hesitant.\nShould I forget this? Should I try it once and get it out of my system? But waht if I like it and want it to continue? Help.	Make a list of Pros and Cons. Here's what I have from what you have related, taking everything you've said at face value:\n\nPros: \nYou could satisfy your curiosity.\nIt may sate your desire.\nIt could be pleasurable.\n\nCons:\nLying to your wife.\nWillfully sinning against your faith.\nRisking STD infection for you AND your wife.\nRisking having the affair exposed, with all the effects that will have on your marriage/reputation.\nYou might find out you really like it and want it more than ever.\n\nYou've likely thought of every one of these things, so let me restate it more succinctly: "Can you deny yourself a possible pleasure to hold on to the things that matter most in your life?" Or how about "Is satisfying your curiousity worth risking your health, your wife's health, your self-esteem, and your marriage?"
5,563	7Entertainment & Music	Riddle for you all?	What is greater than God, more evil than the Devil, the poor have it, the rich need it and if you eat it you will die?	nothing
5,564	3Education & Reference	Physics question?	While you are traveling in a car on a straight, level interstate highway at 90 kh/h,another car passes in the same direction;its speedometer reads 120/km/h. (a.) What is your velocity relative to the other driver. (b.) What is the other car's velocity reliative to you?	As I am travelling with a velocity 90 kph & the other car with 120 kph, I will appear as going back to the other driver but with a slower speed ie\na) 120-90 =30 kph\n\nThe other car wil appear to move ahead of me but with a slower speed as I am also chasing it\nb)120-90 =30 kph\n\nBut as we are talking about velocity we have to consider direction also. Hence my velocity will be -ve i.e. (-30 kph) & other car will be +30 kph
5,565	9Politics & Government	What are the laws regarding sexual harrassment in the work place? After reported what are your employeers todo	My manager has been spoke to on 2 prior occasions on this and then last week a third time. The company owners and executives have spoke to him about his behavior. He is no longer my manager but I am left to work with him in a small office one on one daily. I am very uncomfortable but need my job. His actions and comments have been witnessed by past and present co workers as well as the owner and executives and spouses at our company Christmas party. I need advice!	You should look into filing a lawsuit at least against him, but possibly against the company for letting it go on. They have clearly not made an effective effort to make a livable work environment for you. Contact a local lawyer.
5,566	5Sports	is it ok to use nitrous system in a 100cc modified to 175cc motorcycle engine? its a honda xrm...possible?		You are already stressing the components of the motor by almost doubling the cubic centimeters and in my opinion adding the extra horsepower of nitrous to a motor that wasn't ment for it would cause blown head gaskets, overheating and piston melt down. Those motors are touchy enough without the nitrous!
5,567	4Computers & Internet	what is the best home page?		http://my.yahoo.com/\n\nWith my Yahoo.. you can customize which modules you want to see on your homepage. You can set up local modules to show movies listings, weather, news etc.. specifically for your location.
5,568	6Business & Finance	Whose answering these questions?		People that answer questions to help, people that answer questions because they are bored, and people that answer questions because they just want the points.
5,569	6Business & Finance	how can u make a very quiet girl become a naughty girl??		It all comes from being comfortable with the other person. Even quiet girl have a naughty streak in them. But it won't come out until she know that the person she is with will not judge her if she is naughty. It is a comfort zone. If she is comfortable, then she can be naughty. It takes a lot to get to the comfortable zone. We are told that naughty is bad and more stressed on girls to be quiet and good.
5,570	1Science & Mathematics	how to solve vector problems?		Vector problems involve understanding the concept of having a magnitude and direction.\nVectors are just combinations of certain magnitudes in certain directions\n\nEx: F= 2i + 4j + 3k ( this is a force vector which have 3 components in x,y,z plane)\n\nthe most three important operations on vectors are :\nDOT product :\nF . G = (fx,fy).(gx,gy)= fxgx+fygy \nnote that (F.G) is JUST a number \nwe can also define the dot product as :\nF.G= \|f\|\|g\|cos(theta) .. where (theta) is the angle between the two vectors\n\nthe other product is the Cross Product\nwhich says that F(X)G= \|f\|\|g\|sin(theta) n. note that the cross product gives a vector perpendicular to the place of the two vectors which contain F and G\n\nthe thirs important rule is that \n\|f\|=SquareRootOF(fx^2+fy^2+fz^2)\n\nthese are fundementals!
5,571	6Business & Finance	Why are the questions at the top of this page always the same?		I'm guessing that as users move their questions from opened to resolved or undecided that the page numbers shift dynamically rather than staying static.\n\nThis particular functionality is annoying to me.
5,572	6Business & Finance	How do you deal with a friend that you always end up paying for and who uses your personal stuff w/o asking?	As in personal stuff, I mean she will show up at my house and need feminine products. Or she will go into my pantry and help herself to any food she sees. I have also caught her in my bathroom using my makeup and lotions.\nAs far as paying when we first became friends we kind of took turns paying for stuff, but now I end up paying.\nIf she comes around and I am eating or if I have a drink she just digs right in like its communal food. What should I do? I am a pretty nice person, but some of this stuff is just not hygenic!	I'd say talk to your friend at a time when your emotions aren't stirred up, and let her know that some of her behavior is bothering you. She might not realize that you are so upset about it.
5,573	6Business & Finance	DO you think fairy tales will ever come true to anybody?		May be, who knows? I think anyone who ever experience it will never tell it to anyone, maybe afraid being accused crazy by everyone or just want to keep it secret?\n\nAnyway, it won't happen often, that's way it called fairy tales. Besides, there are hardly anymore person that believe in fairy (I believe it though, because there are many things that can't be explained by science...). It's said that when one person say that he/she doesn't believe the existence of fairy, one fairy will be vanished.\n\nJust keep believing, who knows that miracle will come upon you...
5,574	7Entertainment & Music	how do i get disk space to activate road runner?		You delete/unistall stuff that's on your harddrive that you don't even use.
5,575	3Education & Reference	What is the Blauner Hypothesis?		Blauner's hypothesis is a theory about the creation of a minority group that asserts that minority groups created by colonization will experience more intense prejudice, racism, and discrimination than those created by immigration. According to Blauner, there are two major processes by which new groups are incorporated into a society, immigration or colonization. Immigration is voluntary and the prescriptions and exclusions are minimal. Colonization, on the other hand, is involuntary and prescriptions and exclusions are maximized. Blauner then, using his processes by which plural societies are formed, contrasts the experiences of Cubans, Puerto Ricans, and Mexican-Americans in terms of their rate of assimilation.
5,576	4Computers & Internet	what do the numbers designate on hp computers?	such as dv1000 or ze2000	You will probably find they mean very little other than a marketing term. It will certainly not be anything related to the processor speed or anything like that.
5,577	8Family & Relationships	how can i find a girlfriend in iran ?	good looking\nhappy	how can i find a girlfrind in iran
5,578	6Business & Finance	if a company sends you a check and you are a sub to that company . can they stop payment on it after you quite		I am not a lawyer, but here is what makes logical sense - \nOnce they handed you a signed check, that was a commitment on their part to transfer funds to you. \nNow, unless they can find some way in which you fraudulently obtained the check (e.g., you claimed to have done work but didn't), or there were conditions on the check (i.e., if we give you this signing bonus, you will stay for one year), I don't think they should have stopped payment.
5,579	3Education & Reference	DNA convert in amino acids show RNA sequence GGTCCCATGGATCGTAATTCG?		I don't understand the question.
5,580	4Computers & Internet	cd rom says used by disk utility?	drive doesn't read cd inside	I would try reinstalling the driver, but first check just to make sure that the CD works in another computer.
5,581	2Health	how to make stretch marks disappear?		Use Palmers cocoa butter formula. After taking a shawer make sure the parts of the stretch marks are dry and clean then apply the butter (make sure to use it daily).
5,582	6Business & Finance	does tying bedsheets together really work to escape out a window?		Sure if the material is strong, there's a good thread count, and the knot is good. Make sure you anchor it properly to a heavy and solidly placed object.\n\nOh, rolling it up. Good suggestion, Dave.
5,583	6Business & Finance	what dows the torino 2006 olypic cauldron look lke?		See story and photo in link below.
5,584	1Science & Mathematics	Is the earth flat?	Not wrt to Tom Friedman's perspective, but with Colombus' view.	No. We have known for 2500 years that the earth is round. Follow the link below and search at Google.
5,585	8Family & Relationships	How do I know if Drew likes me?		I'm Drew. Who are you? Really!
5,586	2Health	a whitish fluid came out from my girls vagina is it normal can it prevent her from getting pregnant?		I must assume that YOU did not put it in their with your male member. \nShe may have a vaginal yeas infection which can be cured with a Clotrimazole Vaginal Cream. It is avalable over the counter. \nShe may severe itching. The white stuff may have looked like cottage cheeze if it is really bad.\n\nOr she could have just been really excited at the time. \n\nNO. Nothing you have described should keep her from getting pregnant.\n\nThe thing to do to keep her from getting pregnant is to keep you male member away from her.
5,587	6Business & Finance	I own rental house with 200k in equity. What if I use some of that equity to invest in a higher rate of return		The have a few options... if the numbers work out then go for it. I believe, that if your property was aquired from using a 1031 exchange, then you will have to hold the property for 60 months and live in this property for 24 months out of those 60 months to qualify for the tax exemption of gains up to 250k/ 500k if you are married and file joint returns. Depending on your need for the capital, liquidity, and when; would be the questions I would ask \nyourself. If it was me, I would look in to more real estate, maybe a 1031 exchange. What other investment can you not only cash flow from, but is a leveraged asset. Hope this helps.
5,588	6Business & Finance	If you take zantac 75 everyday for 4 years are there any possible health problems?		Let's resolve this overdue question by bringing it to a vote.
5,589	6Business & Finance	what came first the chicken or the egg???		Well, the chicken has evolved from a previous species. That species wasn't really a chicken, but it laid a mutated egg, which was a chicken. So, the egg came first.
5,590	4Computers & Internet	Ipods don't have an off button, why not?	So annoying!	Some of the new Ipods have some very funny flaws I am told. I heard they rushed some of them too fast to get them out to the stores. Maybe it's just a rumor, yet it would be funny if it's true.
5,591	6Business & Finance	what's the capital of illinois?		» Capital: Springfield\n» Location: 40 N, 89 W\n» Area: 57,918 square miles, 26th largest\n» Population: 12,128,370 people\n» Statehood: 21st state, 1818\n» State Bird: Cardinal\n» State Tree: White Oak\n» State Flower: Native Violet\n» State Slogan: Land of Lincoln\n» State Fish: Bluegill\n» State Dance: Square Dance\n» State Insect: Monarch butterfly \n» Popular Tourist Destinations: Chicago Museums, Navy Pier, Lincoln sites\n» Products: Agriculture: corn, soybeans, hogs, cattle, milk, hay, wheat; Manufacturing: machinery and food products; Mining: coal, petroleum, stone sand
5,592	4Computers & Internet	Looking for a well-priced and well-featured all-in-one printer?	I'm looking for a new all-in-one printer with print/copy/scan/fax features. The fax feature isn't very important to me, but is handy for the remote time I need to use it. However, if I find a GOOD 3-in-1, I'm willing to let go of the fax. Some of my desired features:\n1. Supports duplex printing (I'm a tree-hugger)\n2. Is network enabled/ready\n3. Cartridges are provided with the printer, and ink/cartridge replacement doesn't burn a hole in my pocket.\n4. Not looking to pay too much for it (What can i say, I want it all...)\n\nAny recommendations are welcome.	Tom's Hardware has a nice review of inkjet multi-function printers. I've found the reviews on that site to be based on facts and pretty reliable.\n\nI hope it helps!
5,593	1Science & Mathematics	What is the irradiance (intensity, in W/m^2) of light transmitted through a thin piece of glass?	Sunlight is incident on an air-glass interface at angle of incidence theta, which is known. The irradiance (energy flux rate, W/m^2) of the incident light is known. The light must pass the interface from air to glass and then from glass to air. The indices of refraction are known. The angle of refraction is found easily from Snell's Law. In terms of these variables (or any I've forgotten), what is the irradiance of transmitted light?	you either need more information, or this is a trivial problem. \n\ni am assuming the two surfaces of the glass are parallel to each other, so it's not a prism or lens, but a thin flat plate.\n\ntreating it very simply, you could argue that energy is conserved, so the irradiance (which is energy per second per square meter) must be conserved. the speed of light is fixed in air, so the "per second" part is fixed too. if the glass surfaces are not angled with respect to each other, then the light leaves the glass taking up the same area that it went in with. this means the irradiances are the same.\n\nthis is a simplistic physical model, though. realistically, you will get some reflection at the air-glass interface, reflection at the glass-air interface, and some absorption (both in the air and in the glass). you need a lot more details about the problem to say anything meaningful though.
5,594	7Entertainment & Music	what website should i open that i can watch a full length harry potter movies for free?		There are no websites that will allow you to view new movies for free, they will always get you somehow (either directly charging, ransomeware, or by installing spyware/adware). The only thing you could look at doing is attempting to download it in a torrent or through a peer-2-peer network, although you may be breaking copy right laws depending on what country you live in.
5,595	6Business & Finance	how do i become a project manager?		One important requirement to be a project manager is your Knowledge. You have to be able to know if a project possible to be done, understand the project Completely, able to make estimation, choose correct staff(s) (programmer, designer, or other) in doing tasks, manage staff(s).\nYou will also need to create project report(daily, weekly, monthly), conduct meeting with managment or your supervisor. etc.\n\nProject Manager requires wide knowledge in many fields, responsibitilty to customers, your team, and the company.
5,596	2Health	why am i beautiful?		you are beautiful as you have created your beauty on your own,God Gives you gift,you make it pretty or ugly.No matter do you have pysically or inside beauty.it is like doing a dimond as a priceless ring or scattering it,turning it into debris.
5,597	3Education & Reference	What is the Landlord's game?	How is it better known as today? Who invented/improved on it?	The Landlord's Game is a board game patented by Quaker Elizabeth Magie from Virginia. It is a realty and taxation game, the first of its kind to have an attested patent. It was patented by Magie in 1904.\n\nMany similar home-made games were played by people at the beginning of the 20th Century, even before The Landlord's Game was patented.\n\nOne of those home-made games about owning property and taxing, which also got patented, was Monopoly, a game by Pennsylvanian former salesman Charles Darrow, who later sold the rights to manufacture the Monopoly game to the company Parker Brothers of Massachusetts.
5,598	9Politics & Government	Are George W. Bush and John Kerry related?	I had read that they shared a familial line back to the Mayflower.	They are related about 10 generations back. Edmund Reade and Elizabeth Cooke are ancestors of both of them.
5,599	4Computers & Internet	What can I do with the file in the GMail Drive?	For what reason can the GM serve me? Para qué puede servirme el tener mis files en GMail Drive , además de almacenarlos?	You can save small files on the google mail server using up some of that 2 plus gig of space you have. If something happens to your harddrive, you can have your file safe on theirs.

5,500

4Computers & Internet

When Apple-Intel computers come out, will it be possible to have a dual boot with Windows and MAC OS?

There is a good chance that you can. There are already ways to do so in current intel based mac dev kits and while the final version may be different, it will more than likely be cracked by hackers. See source for details and howto.

5,501

4Computers & Internet

how do i close my yahoo account?

Simply go to the Account Deletion (https://edit.yahoo.com/config/delete_user ) website, log-in and you can delete your account.

5,502

3Education & Reference

where does the word okay come from?

the word okay was used by the american airforce staff when the airplanes were ready for the pilotfighters to go to action ,the pilots used hand signal equivalent to the word okay.this word was used since 1940.it became part of the north american culture where it is widely used today.ok

5,503

6Business & Finance

Where can I purchase Spoto spot remover?

Cincinnati Packaging & Distribution, Inc.\n12000 Mosteller Road\nSharonville, OH 45241\nTel: 513-702-8795\nFax: 513-326-6094

5,504

0Society & Culture

What is meant by the term "negative waves" are surrounding you?

In astrology and psychic circles I hear this term and would like to know what others think about it and how it applies to everyday life.

Negative waves...negative engergy...The best thing to do is buy a sage smudging stick, light it, and let the smoke waft all over your house and body. It works to remove any negative energy that is existing in your home and yourself. You can buy them in metophysical stores and places who carry religious supplies. This really works. It smells, but its worth it.

5,505

6Business & Finance

Is the word "hertz" plural?

Is the word "hertz" plural? Or would the plural of "hertz" be "hertzes" or something like that?

hertz is like fish it is both singular and plural.

5,506

6Business & Finance

where can i find a illinois fighting illini windbreaker jacket???

preferably blue or tan in color

The Fighting Illini have a store. It can be found here\nhttp://fightingillini.collegesports.com/store/ I did a search and went through the categories and found a jacket/windbreaker here http://store.fansonly.com/marketplace/store_contents.cfm?cart_id=&store_id=180&dept_id=2123&product_id=72155 but you can look around for yourself if you don't like that one.

5,507

2Health

is smoking marjuana physically harmful?

Smoking anything is depermental to your health; try eating it.

5,508

8Family & Relationships

when is the right moment to say "i want you to kiss me"?

when would be the good time to say it... just blurt out and say it... or like i donno... i'm just REALLY confused!!!

There isn't a right moment to say this. A kiss will happen, or it won't. Talking about the kiss usually ruins the excitement of the kiss. If you want a kiss to happen, and it's not happening, either lead into the kiss yourself, or wait paitently. If you wait for it, it may never happen, but at least you won't have the embarrassment of having ASKED for a kiss, only to be shrugged off.

5,509

6Business & Finance

where can i find a hard to find washer motor ge model #wbse2090b also has 5kh61kw2516hs on motor its self?

Try Grainger Supply Company.\nThey have branches in all Major Cities and are recognized for electric motors.\nMany brands with cross references for motors if your particular Manufacturer is not available.\nAlso have a Website, but I don't use the Site.

5,510

7Entertainment & Music

how old is Gwen Stefani?

Gwen Stefani is 36 years old. She was born on October 3rd, 1969.

5,511

4Computers & Internet

what are the classification of computers according to its purpose?

There are many different names for categories of comptuers, common ones are PC for 'personal computer', and mainframe, which refers to a computer historically large and to which multiple different people use at the same time with multiple sets of keyboard/monitor pairs ('terminals'). See the article below for much more info than would be prudent for me to type.

5,512

3Education & Reference

what is a secular law?

secula law under the law study.

Secularism is commonly defined as the idea that religion should not interfere with or be integrated into the public affairs of a society. It is often associated with the Age of Enlightenment in Europe, and plays a major role in Western society. The principles of separation of church and state in the United States and Laïcité in France draw heavily on secularism.\n\n\nDefinition\nAs secularism is often used in different contexts, its precise definition can vary from place to place. In philosophy, secularism is the belief that life can be best lived by applying ethics, and the universe best understood, by processes of reasoning, without reference to a god or gods or other supernatural concepts. Secularism in this sense was coined by George Jacob Holyoake and is one of the precursors of modern secular humanism.\n\nWhen applied to society, secularism is considered to be any of a range of situations where a society less automatically assumes religious beliefs to be either widely shared or a basis for conflict in various forms, than in recent generations of the same society. In this sense secularism is linked to the sociological concept of secularization and may be upheld as an academic thesis, rather than advocated as a desirable state of affairs.\n\nIn government, secularism means a policy of avoiding entanglement between government and religion (ranging from reducing ties to a state religion to promoting secularism in society), of non-discrimination among religions (providing they don't deny primacy of civil laws), and of guaranteeing human rights of all citizens, regardless of the creed (and, if conflicting with certain religious rules, by imposing priority of the universal human rights).\n\nSecularism can also mean the practice of working to promote any of those three forms of secularism. It should not be assumed that an advocate of secularism in one sense will also be a secularist in any other sense. It is also important to remember that secularism does not necessarily equate to atheism; indeed, many secularists have counted themselves among the religious.\n\nThe antonym of secularism is usually theocracy, which is a form of government where religion often plays a major or dominant role.

5,513

6Business & Finance

What is the smallest part of an Atom?

an elektron

5,514

6Business & Finance

WHAT IS THIS AT TOP OF MY YAHOO PAGE?

',728,90,-83591,128804,'1','321',-1,-1,'');}else{setTimeout('if(document.pradi1){document.pradi1.onload()}',200);}">

It's probably an error related to the page only partly loading in the browser or a portion of the page that is currently broken. Hit reload/refresh and it will likely disappear.

5,515

6Business & Finance

Which high rated people are sick and tired of asking /answering questions, already?

I answer the same ones over and over and I haven't gotten too tired of it yet. The key is to make sure you don't over do it. Play here for a while and go find something else to do.

5,516

9Politics & Government

What was the full name of chankiya --an Indian Scholar(?)/Philosopher,?

Did he write any book/stuff.

Chanakya was also known as Kautilya, but his given name was Vishnugupth.\n\nHe wrote three books about statecraft:\nChanakyasutras.\nRajaniti shastra.\nArthashastra.

5,517

2Health

What is the known side effect of taking commercial creatine product?

It destroys the liver. I dont suggest you take it if you have a bad liver. I wouldnt even take it even if I had good liver. Because a good liver can become a bad liver. It has resulted in many deaths, so you should steer clear of creatine.

5,518

0Society & Culture

I Like to have email id of our Hon'ble President Dr Abdulkalam since I like to send an article to him .Can I?

I like to send an article to him titled " Harness the healthy youth for the betterment of the Nation and the Humanity "

Great thought, friend! \n\nHere ya go - presidentofindia@rb.nic.in

5,519

7Entertainment & Music

how to set up a crate px-800dp sound system?

we are a small school and lost the papers on our pa system

Hi, my name is Robin, I work at S. M. Hanson Music Inc. in Salina, Ks. 785-825-6273. I can walk you through how to set up the PA system better over the phone. When I know what other gear you are using. I am at home right now, but you can call the store and ask for Aaron, Dale or Ryan right now and they will also be able to help you out. If you want to wait till I get there, Call me after 2:00 pm CST, at 1-800-875-6273. Info we will need: speakers, mics, monitors,cd player, instruments, etc... all that will be run by your powered mixer.

5,520

7Entertainment & Music

what are the general traits of sagittarius people?

How good are they ? in love ? life ? sex ? friends ? people relations ?

As a proud and true Sagittarian, I'm proud to give you the following information\n\nTraits of a Sagittarius:\n\nFun \nOptimist \nGood-natured \nSociable \nSpiritual \nImpatient \nFears responsibility \nSelf-indulgence \nFanaticism \nPeter Pan syndrome \nTendency to gamble \n\nLikes...\n\nFreedom \nUnusual ideas \nBeing on the move \nParties \nLuxury items \nGambling \nNew friends \nFlirting \n\n\n Dislikes...\n\nPublic disapproval \nPlaying safe \nConfinement \nMonotony \nTight clothes/areas \nBeing doubted \nBeing refused \n \nSagittarians have a positive outlook on life, are full of enterprise, energy, versatility, adventurousness and eagerness to extend experience beyond the physically familiar. They enjoy travelling and exploration, the more so because their minds are constantly open to new dimensions of thought. They are basically ambitious and optimistic, and continue to be so even when their hopes are dashed. \n\nTheir strongly idealistic natures can also suffer many disappointments without being affected. They are honorable, honest, trustworthy, truthful, generous and sincere, with a passion for justice. They are usually on the side of the underdog in society they will fight for any cause they believe to be just, and are prepared to be rebellious.

5,521

2Health

what are personality disorders?

A personality disorder is identified \n\nby a pervasive pattern of experience and behavior that is abnormal with respect to any two of the following:\n\nthinking, mood, personal relations, \n\nand the control of impulses.\n\n \n\nThe character of a person is shown through his or her personality -- by the way an individual thinks, feels, and behaves. When the behavior is inflexible, maladaptive, and antisocial, then that individual is diagnosed with a personality disorder. \n\n \n\nMost personality disorders begin as problems in personal development and character which peak during adolescence and then are defined as personality disorders. \n\n \n\nPersonality disorders are not illnesses in a strict sense as they do not disrupt emotional, intellectual, or perceptual functioning. However, those with personality disorders suffer a life that is not positive, proactive, or fulfilling. Not surprisingly, personality disorders are also associated with failures to reach potential.\n\n \n\nThe DSM-IV-TR: Diagnostic and Statistical Manual of Mental Disorders, published by the American Psychiatric Association, defines a personality disorder as an enduring pattern of inner experience and behavior that deviates markedly from the expectation of the individual's culture, is pervasive and inflexible, has an onset in adolescence or early adulthood, is stable over time, and leads to distress or impairment.\n\n \n\nCurrently, there are 10 distinct personality disorders identified in the DSM-IV:\n\nAntisocial Personality Disorder: Lack of regard for the moral or legal standards in the local culture, marked inability to get along with others or abide by societal rules. Sometimes called psychopaths or sociopaths. \n\nAvoidant Personality Disorder: Marked social inhibition, feelings of inadequacy, and extremely sensitive to criticism. \n\nBorderline Personality Disorder: Lack of one's own identity, with rapid changes in mood, intense unstable interpersonal relationships, marked impulsively, instability in affect and in self image. \n\nDependent Personality Disorder: Extreme need of other people, to a point where the person is unable to make any decisions or take an independent stand on his or her own. Fear of separation and submissive behavior. Marked lack of decisiveness and self-confidence. \n\nHistrionic Personality Disorder: Exaggerated and often inappropriate displays of emotional reactions, approaching theatricality, in everyday behavior. Sudden and rapidly shifting emotion expressions. \n\nNarcissistic Personality Disorder: Behavior or a fantasy of grandiosity, a lack of empathy, a need to be admired by others, an inability to see the viewpoints of others, and hypersensitive to the opinions of others. \n\nObsessive-Compulsive Personality Disorder: Characterized by perfectionism and inflexibility; preoccupation with uncontrollable patterns of thought and action. \n\nParanoid Personality Disorder: Marked distrust of others, including the belief, without reason, that others are exploiting, harming, or trying to deceive him or her; lack of trust; belief of others' betrayal; belief in hidden meanings; unforgiving and grudge holding. \n\nSchizoid Personality Disorder: Primarily characterized by a very limited range of emotion, both in expression of and experiencing; indifferent to social relationships. \n\nSchizotypal Personality Disorder: Peculiarities of thinking, odd beliefs, and eccentricities of appearance, behavior, interpersonal style, and thought (e.g., belief in psychic phenomena and having magical powers). \n\nAccording to Dr. Sam Vaknin, author of Malignant Self-Love: Narcissism Revisited, individuals with personality disorders have many things in common (see The Interrelationship Between Personality Disorders):\n\nSelf-centeredness that manifests itself through a me-first, self-preoccupied attitude \n\nLack of individual accountability that results in a victim mentality and blaming others, society and the univ

5,522

6Business & Finance

i like my best guy friend but i am not sure f he likes me? see more info inside.?

every one says that he likes me and he sends mixed signals to me. i know better than to believe every thing i hear but still. they also say that we would make a really cute couple and he agrees. help me i am so confused.

i'm 13 and i like myt best friend that's a girl and she likes me and evryone tells her i like her and that she likes me and we both think we would make a cute couple so i asked her out last month and right now i'm happy

5,523

5Sports

Who will win the matchup between the SF 49ers and the Houston Texans?

Plus, who might take a dive on that game to get that first round draft pick?

The 49ers will amazing win this one, even though they are also doing horrible.

5,524

6Business & Finance

IF YOU WERE TRAPPED INSIDE AN EGG...HOW WOULD YOU FEEL?

I'd be busy thinking of a way to crack the problem. Once I've hatched the plot, I would come out of my shell and take action. This would lay the foundation of a good story.

5,525

6Business & Finance

what should i buy my 9 year old cousin a plasma or surround system?

wtf. Neither. he/she is NINE years old, dont encorage them to be a snob.

5,526

6Business & Finance

what is the number one petroleum producer in the world?

petroleum used to make gas.

In terms of world oil production only for 2004 (the latest figures published):\nSaudi Arabia: 13.1% of world oil production\nRussia: 11.9%\nUSA: 8.5%\nIran: 5.2%\nMexico: 4.9%\nVenezuela: 4.0%\nNorway: 3.9%\nCanada: 3.8%\nU.A.E. 3.3%\nNigeria 3.2%\nKuwait 3.1%\n\nThere is no easy way to evaluate which country produced the most oil that was made into gasoline, just as there is no way to be certain that gasoline you are buying was made from oil from any particular country.\n\n\nThis data comes from the BP Statistical Review of World Energy. You can download the book from:

5,527

4Computers & Internet

How can I answer more questions than Yahoo will allow, without new account?

I answered my limit today? whats this, a limit? dumb. I helped a bunch of english as a second language natives today. I didn't want to stop.

And just remember, there is a reason for this. They dont want just any spammer off the street to just come in and answer 100 questions with like one word or something. The longer you stay the more likely you are to ascend a level and you are less likely to spam.

5,528

6Business & Finance

Wich is Barbie full name?

Barbara Millicent Roberts

5,529

6Business & Finance

Credit history?

How is one's credit history built, and how do you build up a good history? Some people have said to me it's paying utility bills on time, others have said it's spending a lot of money on your credit card every month and paying THAT off on time, and yet others have said you need take out a loan and pay it back on time. So what exactly is it, and how does one get one? At whate age can you start creating a credit history?

You can start building a credit history as soon as you can have accounts in your own name. All the answers you've received thus far are correct. Something to remember is that credit history takes a long time to build, but not long to destroy. Good credit history means paying your bills on time and ahead of time. It's always good to pay more than your minimum payment on loans and credit cards. Another good tidbit of information is this: When most creditors run your credit, they weigh recent activity most heavily. They will see what your recent trends are. How have you been doing the last 6 months or 1 year? If you did well for 5 years, but you've been missing payments for 6 months, forget about that loan. The best thing to do is keep paying bills on time or ahead of time and don't spend more than you make.

5,530

4Computers & Internet

what are the details in formating a computer?

Formatting a hard disk is the process by which all data (information) is lost from the drive. You will loose all of the data unless you back it up. The link below will provide step-by-step instructions to formatting a conventional 386-type system. The article is quite old, but will work for all disks. If you are just trying to format for an install for XP then you just boot off the cd and format using the setup instructions.

5,531

0Society & Culture

why dont jehovah witnesses celebrate holidays birthdays etc..?

One thing you need to do is ignore the people who call them a "cult". \n\n(That means ignore the entire comment made by Dak below. His comments don't make the slightest bit of sense and are obviously motivated by ignorant prejudice. You will NOT get an accurate answer from his comment. For example, anyone with common sense and the ability to do a little research will know that Christ was NOT born on December 25th. Even non-Jehovah's Witnesses know that.) \n\nThey are not a cult. Cults have human leaders, Jehovah's Witnesses' leader is Christ Jesus. \n\nA careful examination of the various holidays celebrated today will show that they can be traced back to pagan false-religious worship. The pagans did not worship God and did not engage in practices that God approved of. The Bible only commands Christians to observe ONE celebration: the death of Christ. Not his birth, not his resurrection....only his death. If his birth was meant to be celebrated, don't you think it would be a Biblical command? And since we're not commanded to celebrate the birth of Jesus Christ, why would we take it upon ourselves to celebrate the birth of anyone else? \n\nThe only 2 mentions of birthday celebrations in the scriptures were by those who did not worship God, and in both instances there was a murder at each. In the second one, it was one of God's own servants who was put to death, John the Baptizer.\n\nGod, through the Bible, tells us just how we are to live and what form of worship is acceptable to him. He also tells us what should be celebrated, which, as said already, is simply the death of his Son. \n\nJehovah's Witnesses firmly adhere to the Holy Scriptures for all of their beliefs. If you want further information, check out their official website below.

5,532

6Business & Finance

What was the most thoughful gift you have been given?

I'd have to go with the most sentimental for me which was the Hobbit's Journal. A gift that was given me at a young age by a good friend. It became lost for several years until my beautiful girlfriend gave it back to me over 10 years later.

5,533

5Sports

Is football the original name, or soccer?

Which name came first?\nThe European call it football, American & Australians Soccer. Which came first?

It is football.\nAmericans and Australians call their own "football" (the one played with the Stewie Griffin head looking ball) football, so they had to find another name for football. \nI call American/Australian insistence on soccer cultural imperialism.

5,534

2Health

what is radon?

Indoor Radon is the second leading cause of lung cancer in the United States and the leading cause among non-smokers. Protect your family. Test your home. During the month of January, EPA works to raise the public's awareness about radon and the importance of testing for radon -- especially in homes and schools. The EPA, working in concert with Federal, State, and local governments as well as volunteer organizations, conducts many different programs to educate Americans about the indoor radon health threat. About 1 in 15 homes has high radon levels. If you haven't tested your home, do it now during National Radon Action Month. If you have further questions about Radon, please call your state radon contact (just click on your state), or call the National Radon Information Line at: 1-800-SOS-RADON [1-800-767-7236]

5,535

5Sports

Do you think professional sports players are overpaid?

I do, even though it takes years of hard work to get there. Nobody is worth 2, 5, 10+ million a year - NOBODY.

Players are paid what the market offers. Team owners generally overpay players in fear that the player may sign elsewhere. I don't have a problem with a football player getting $2 million. The average career of a football player is 4.5 seasons. If that player is injured, and cannot work, then I can justify their salary. As long as we the Suckers, keep buying tickets, jerseys, memorabilia and the like, then pro players will be overpaid.

5,536

1Science & Mathematics

What is the balance on $1,800 deposited at 5% compounded annually for 4 years?

$2,187.91\n\nI would look for a better rate of return if I were you:-)

5,537

6Business & Finance

What is the difference between a Family Business and a Private Business?

You have the option when incorporating a business to have publicly traded shares or keep the shares private. A "privately held company" signifies that it is incorporated but not publicly traded. A family business may or may not be incorporated. Generally a family business signifies the company has been handed down from generation to generation of the same family, but has no significant meaning as to status of incorporation or public/private shares.

5,538

0Society & Culture

Which are the main representative dishes (food) from your country?

Yogurt is the main representative food from my country Turkey. Yogurt is a Turkish word. \n\nSome of other traditional dishes are:\n\nA ravioli-like dish served with yogurt we call it "manti" \n\nHot dish made of grape or cabbage leaves stuffed with meat, and rice we call it "sarma" or olive oiled cold dish stuffed with currant and pine nut instead of meat. \n\nTurkish delight we call it "lokum" \n\nShish kebab we call it "sis kebap"\n\nOlive we call it "zeytin" since we're mediterrian country, we eat olive at breakfast, not just in salads or pizza.

5,539

6Business & Finance

where would you share a story of compassion which you have witnessed locally?

Write it up & send it in to your local news channel; they are always looking for that sort of thing...

5,540

9Politics & Government

Is jhon hanson really the first person?

We looked it up and it said so

I assume you are asking if he was the first President of the United States. This is a common misconception. He was the President of the United States in Congress, a title given to the head of the legislature under the Articles of Confederation, a brief experiment between the Revolution and the Constitution, which had no executive branch, and thus no president, at least as we conceive him. He was instead something like a prime minister, though even that is a stretch. He had very little real power in his position. Besides, if you're really going to say that his position is equivalent, then the first president would have to be Peyton Randolph, who served as the President of the First Continental Congress.

5,541

9Politics & Government

Is family law or divorce cases the only place you find the subject of annullment and where is it can i find it

I new at this I'm studying to be a paralegal. thanks for all your help.lol

Annulment is a procedure of the Catholic church whereby a marriage is considered to have been "null" from the beginning because of some problem ... so from God's point of view, the marriage was not a true marriage when the vows were exchanged. It looks from an examination of my search page as though the pages explaining the causes for annulment aren't available anymore(!) This is too bad, as there are many causes, including fraud (somebody tells you they're rich before you marry them, then afterwards it turns out they aren't), mental incompetence (their vow is invalid 'cause they can't think straight), I think even not having been married in the Catholic church was a reason (I had copied it all out a few years back). Apparently there are also civil annulments in some states. Here's one webpage ...\nhttp://marriage.about.com/od/annulments/

5,542

2Health

last year a mass was found thru mammography in my left breast.it bothered me a lot.?

after a year another mammo was done also untrasound, & it showed benign features.2 months ago as i examined my breast and pinched it, a tiny crystal clear fluid came out.it alarmed me.just about 2weeks ago again mammo & ultrasound was done, the mass remained unchanged. i was advise to a yearly mamo & ultrasound. 3days, as i examined my breast, again tiny crystal clear fluids comes out if i pinch them. im worried about this. can u help me be clarified? i know only if a milk like fluid comes out, sound no good. but what about this crystal clear tiny fluids coming out of my breast if i pinch it..please enlighten me. awaiting your reply

The chances are the lesion is benign- intraduct papilloma or some other benign lesion. Depending on your age. My suggestion is to go see a doctor; usually a fine needle aspiration which is almost painless will clarify the issue.\n\nKuris, MD

5,543

6Business & Finance

in the chronicles on narnia what is the name of the instrument that Mr Tumnus played?

flute

5,544

0Society & Culture

besides christmas, what holiday is your favorite? why?

I would say Valentine day, it is just a happy day filled with love and romance. Even if your single and until I got married I was single every v-day it is still a day when you can reflect on the beauty of love and celebrate the love you have for yourself.

5,545

5Sports

Michael Phelps?

will he graduate\nwill he beat mark spitz's record\nwill he beat ian crocker\nwill he retire after 2008

Yes.\nYes.\nNo.\nNo.

5,546

6Business & Finance

Where do you get games for cxbx (xbox emulator)?

PLz i must have looked for 24 hours and i still ask my self "WHERE DO I FIND THE CXBX GAMES??????" PLz if you know tell me a greyt_greyt@yahoo.com

wal-mart

5,547

2Health

acne products: compare actimine to acuzine?

For quality, success rate, safety, and consumer satisfation, the experts at e-consumer.org rated Actimine as "excellent" in all four categories. \nAcuzine scored excellent in all categories except safety, in which it scored "very good". Acuzine is $40 and Actimine is $30. Looks like they are both good, but Actimine is less expensive and a little safer\nhttp://www.e-consumer.org/catalog/CategoryReview.asp?Category=9

5,548

3Education & Reference

About IIT ENTRANCE EXAM. OF M.SC. PHYSICS 2006.?

u need the luck

5,549

2Health

how can i get pregnet fast? or what can i do to get pregnet?

don't ... if you can't wait for nature you shouldn't be a parent

5,550

6Business & Finance

how old are u??

how about u?

5,551

6Business & Finance

How much wood would a woodchuck chuck if a woodchuck could chuck wood?

Simply put, "A wood chuck would chuck all the wood it could chuck if a woodchuck could chuck wood." Determined bastards those woodchucks are.

5,552

5Sports

San Diego Chargers Win vs Denver Broncos then Pittsburgh Steelers are wild card team! What is the tie breaker?

If the Steelers, Chargers and Chiefs all end up 10-6, the tiebreaker would be very confusing, but I believe that this link may help.

5,553

3Education & Reference

What are the top 10 names for high schools and middle schools in the U.S.?

My guess it that Lincoln is first followed by Kennedy. How do we find out? Thanks!

Washington Lincoln jefferson

5,554

6Business & Finance

What's the meaning of "life"?

To serve our Lord our God, with all of our heart and soul..do good unto others..do not repay evil for evil..give unto the needy..visit those in prison..visit the homeless..if someone asks of you for anything and you have it to give, give without asking in return..Love those that hate you, pray for those that persecute you..Let your light so shine before men..that they may see Christ in you..Amen!!

5,555

1Science & Mathematics

( 3x - 2 ) ( 4x + 3 ) wats the answer plz?????

First Outer Inner Last\n\n3x * 4x = 12x^2\n3x * 3 = 9x\n-2 * 4x = -8x\n-2 * 3 = -6\n\nCombine your stuff\n9x - 8x = x\n\nPut it together\n\n12x^2 + x - 6\n\nAlways double check the answers you get from here.

5,556

6Business & Finance

what do I do is i was threatened and they know where i live but I dont know where they live?

This may be a little late, but you should notify your local police department about the threat and the person who is threatening you. If possible, stay out of your environment in case they strike you or harm you and your children in some way. If you know this persno, find a way to recieve a restraining order from court. And, if possible as well, settle your dispute with the person and see a solution for your disagreements. I hope that all will be well in your life and I will be praying for you, whether or not you believe in the same God that I do. I wish you peace.

5,557

2Health

herpes in women do there nipples leak?

i don't think so, this migth be caused for any other condition. \nAnyway, you don't play with healt, go to se a doctor.

5,558

8Family & Relationships

Is it ok to date a woman 20 yrs younger than you?

If you are both happy, why shouldn't it be? Just be sure that you both are on the same page when it comes to things like marriage, kids, etc, and you should be fine.

5,559

7Entertainment & Music

Do you happy today?

I'm happy!!

i sure am! to be lucky in the coming year, you have to be happy at the start of it.

5,560

6Business & Finance

Why is google charging for google-answers and why not yahoo?

I have found that Google is providing best services with competition to Yahoo! But why is google charging while yahoo not doing for this service?

Because Google pay people to research your question and get really good answers.\n\nOn Yahoo anyone can answer your question so you might get a good answer or you might just get a totally rubbish answer.\n\nIn short you get what you pay for.

5,561

4Computers & Internet

Why can't I access secure sites that require a log-in?

I have XP Pro and have tried the patches on MS site, checked my security settings, made sure my IE6 has 128 bit cipher strength. Please help!

Are you sure about your username and password? Sometimes it's easy to forget, esp. if you normally check 'save password'...

5,562

8Family & Relationships

I'm a 40 year old man and bi curious; should I pursue this?

I'm married for 9 years. I'm not gay, I really love women, but I'm a little curious about being on the receiving end. I'm not in it for the love, I'm in it for the "at that moment pleasure". \nMy wife does not know, I don't want her to know. I'm scared to death of AIDS and other STD's, so practicing safe sex is the only way to go. Also I believe in God and what the bible says about Homosexuality.\nI know a man that is interested in me and he's not pushing me, he knows I'm hesitant.\nShould I forget this? Should I try it once and get it out of my system? But waht if I like it and want it to continue? Help.

Make a list of Pros and Cons. Here's what I have from what you have related, taking everything you've said at face value:\n\nPros: \nYou could satisfy your curiosity.\nIt may sate your desire.\nIt could be pleasurable.\n\nCons:\nLying to your wife.\nWillfully sinning against your faith.\nRisking STD infection for you AND your wife.\nRisking having the affair exposed, with all the effects that will have on your marriage/reputation.\nYou might find out you really like it and want it more than ever.\n\nYou've likely thought of every one of these things, so let me restate it more succinctly: "Can you deny yourself a possible pleasure to hold on to the things that matter most in your life?" Or how about "Is satisfying your curiousity worth risking your health, your wife's health, your self-esteem, and your marriage?"

5,563

7Entertainment & Music

Riddle for you all?

What is greater than God, more evil than the Devil, the poor have it, the rich need it and if you eat it you will die?

nothing

5,564

3Education & Reference

Physics question?

While you are traveling in a car on a straight, level interstate highway at 90 kh/h,another car passes in the same direction;its speedometer reads 120/km/h. (a.) What is your velocity relative to the other driver. (b.) What is the other car's velocity reliative to you?

As I am travelling with a velocity 90 kph & the other car with 120 kph, I will appear as going back to the other driver but with a slower speed ie\na) 120-90 =30 kph\n\nThe other car wil appear to move ahead of me but with a slower speed as I am also chasing it\nb)120-90 =30 kph\n\nBut as we are talking about velocity we have to consider direction also. Hence my velocity will be -ve i.e. (-30 kph) & other car will be +30 kph

5,565

9Politics & Government

What are the laws regarding sexual harrassment in the work place? After reported what are your employeers todo

My manager has been spoke to on 2 prior occasions on this and then last week a third time. The company owners and executives have spoke to him about his behavior. He is no longer my manager but I am left to work with him in a small office one on one daily. I am very uncomfortable but need my job. His actions and comments have been witnessed by past and present co workers as well as the owner and executives and spouses at our company Christmas party. I need advice!

You should look into filing a lawsuit at least against him, but possibly against the company for letting it go on. They have clearly not made an effective effort to make a livable work environment for you. Contact a local lawyer.

5,566

5Sports

is it ok to use nitrous system in a 100cc modified to 175cc motorcycle engine? its a honda xrm...possible?

You are already stressing the components of the motor by almost doubling the cubic centimeters and in my opinion adding the extra horsepower of nitrous to a motor that wasn't ment for it would cause blown head gaskets, overheating and piston melt down. Those motors are touchy enough without the nitrous!

5,567

4Computers & Internet

what is the best home page?

http://my.yahoo.com/\n\nWith my Yahoo.. you can customize which modules you want to see on your homepage. You can set up local modules to show movies listings, weather, news etc.. specifically for your location.

5,568

6Business & Finance

Whose answering these questions?

People that answer questions to help, people that answer questions because they are bored, and people that answer questions because they just want the points.

5,569

6Business & Finance

how can u make a very quiet girl become a naughty girl??

It all comes from being comfortable with the other person. Even quiet girl have a naughty streak in them. But it won't come out until she know that the person she is with will not judge her if she is naughty. It is a comfort zone. If she is comfortable, then she can be naughty. It takes a lot to get to the comfortable zone. We are told that naughty is bad and more stressed on girls to be quiet and good.

5,570

1Science & Mathematics

how to solve vector problems?

Vector problems involve understanding the concept of having a magnitude and direction.\nVectors are just combinations of certain magnitudes in certain directions\n\nEx: F= 2i + 4j + 3k ( this is a force vector which have 3 components in x,y,z plane)\n\nthe most three important operations on vectors are :\nDOT product :\nF . G = (fx,fy).(gx,gy)= fxgx+fygy \nnote that (F.G) is JUST a number \nwe can also define the dot product as :\nF.G= |f||g|cos(theta) .. where (theta) is the angle between the two vectors\n\nthe other product is the Cross Product\nwhich says that F(X)G= |f||g|sin(theta) n. note that the cross product gives a vector perpendicular to the place of the two vectors which contain F and G\n\nthe thirs important rule is that \n|f|=SquareRootOF(fx^2+fy^2+fz^2)\n\nthese are fundementals!

5,571

6Business & Finance

Why are the questions at the top of this page always the same?

I'm guessing that as users move their questions from opened to resolved or undecided that the page numbers shift dynamically rather than staying static.\n\nThis particular functionality is annoying to me.

5,572

6Business & Finance

How do you deal with a friend that you always end up paying for and who uses your personal stuff w/o asking?

As in personal stuff, I mean she will show up at my house and need feminine products. Or she will go into my pantry and help herself to any food she sees. I have also caught her in my bathroom using my makeup and lotions.\nAs far as paying when we first became friends we kind of took turns paying for stuff, but now I end up paying.\nIf she comes around and I am eating or if I have a drink she just digs right in like its communal food. What should I do? I am a pretty nice person, but some of this stuff is just not hygenic!

I'd say talk to your friend at a time when your emotions aren't stirred up, and let her know that some of her behavior is bothering you. She might not realize that you are so upset about it.

5,573

6Business & Finance

DO you think fairy tales will ever come true to anybody?

May be, who knows? I think anyone who ever experience it will never tell it to anyone, maybe afraid being accused crazy by everyone or just want to keep it secret?\n\nAnyway, it won't happen often, that's way it called fairy tales. Besides, there are hardly anymore person that believe in fairy (I believe it though, because there are many things that can't be explained by science...). It's said that when one person say that he/she doesn't believe the existence of fairy, one fairy will be vanished.\n\nJust keep believing, who knows that miracle will come upon you...

5,574

7Entertainment & Music

how do i get disk space to activate road runner?

You delete/unistall stuff that's on your harddrive that you don't even use.

5,575

3Education & Reference

What is the Blauner Hypothesis?

Blauner's hypothesis is a theory about the creation of a minority group that asserts that minority groups created by colonization will experience more intense prejudice, racism, and discrimination than those created by immigration. According to Blauner, there are two major processes by which new groups are incorporated into a society, immigration or colonization. Immigration is voluntary and the prescriptions and exclusions are minimal. Colonization, on the other hand, is involuntary and prescriptions and exclusions are maximized. Blauner then, using his processes by which plural societies are formed, contrasts the experiences of Cubans, Puerto Ricans, and Mexican-Americans in terms of their rate of assimilation.

5,576

4Computers & Internet

what do the numbers designate on hp computers?

such as dv1000 or ze2000

You will probably find they mean very little other than a marketing term. It will certainly not be anything related to the processor speed or anything like that.

5,577

8Family & Relationships

how can i find a girlfriend in iran ?

good looking\nhappy

how can i find a girlfrind in iran

5,578

6Business & Finance

if a company sends you a check and you are a sub to that company . can they stop payment on it after you quite

I am not a lawyer, but here is what makes logical sense - \nOnce they handed you a signed check, that was a commitment on their part to transfer funds to you. \nNow, unless they can find some way in which you fraudulently obtained the check (e.g., you claimed to have done work but didn't), or there were conditions on the check (i.e., if we give you this signing bonus, you will stay for one year), I don't think they should have stopped payment.

5,579

3Education & Reference

DNA convert in amino acids show RNA sequence GGTCCCATGGATCGTAATTCG?

I don't understand the question.

5,580

4Computers & Internet

cd rom says used by disk utility?

drive doesn't read cd inside

I would try reinstalling the driver, but first check just to make sure that the CD works in another computer.

5,581

2Health

how to make stretch marks disappear?

Use Palmers cocoa butter formula. After taking a shawer make sure the parts of the stretch marks are dry and clean then apply the butter (make sure to use it daily).

5,582

6Business & Finance

does tying bedsheets together really work to escape out a window?

Sure if the material is strong, there's a good thread count, and the knot is good. Make sure you anchor it properly to a heavy and solidly placed object.\n\nOh, rolling it up. Good suggestion, Dave.

5,583

6Business & Finance

what dows the torino 2006 olypic cauldron look lke?

See story and photo in link below.

5,584

1Science & Mathematics

Is the earth flat?

Not wrt to Tom Friedman's perspective, but with Colombus' view.

No. We have known for 2500 years that the earth is round. Follow the link below and search at Google.

5,585

8Family & Relationships

How do I know if Drew likes me?

I'm Drew. Who are you? Really!

5,586

2Health

a whitish fluid came out from my girls vagina is it normal can it prevent her from getting pregnant?

I must assume that YOU did not put it in their with your male member. \nShe may have a vaginal yeas infection which can be cured with a Clotrimazole Vaginal Cream. It is avalable over the counter. \nShe may severe itching. The white stuff may have looked like cottage cheeze if it is really bad.\n\nOr she could have just been really excited at the time. \n\nNO. Nothing you have described should keep her from getting pregnant.\n\nThe thing to do to keep her from getting pregnant is to keep you male member away from her.

5,587

6Business & Finance

I own rental house with 200k in equity. What if I use some of that equity to invest in a higher rate of return

The have a few options... if the numbers work out then go for it. I believe, that if your property was aquired from using a 1031 exchange, then you will have to hold the property for 60 months and live in this property for 24 months out of those 60 months to qualify for the tax exemption of gains up to 250k/ 500k if you are married and file joint returns. Depending on your need for the capital, liquidity, and when; would be the questions I would ask \nyourself. If it was me, I would look in to more real estate, maybe a 1031 exchange. What other investment can you not only cash flow from, but is a leveraged asset. Hope this helps.

5,588

6Business & Finance

If you take zantac 75 everyday for 4 years are there any possible health problems?

Let's resolve this overdue question by bringing it to a vote.

5,589

6Business & Finance

what came first the chicken or the egg???

Well, the chicken has evolved from a previous species. That species wasn't really a chicken, but it laid a mutated egg, which was a chicken. So, the egg came first.

5,590

4Computers & Internet

Ipods don't have an off button, why not?

So annoying!

Some of the new Ipods have some very funny flaws I am told. I heard they rushed some of them too fast to get them out to the stores. Maybe it's just a rumor, yet it would be funny if it's true.

5,591

6Business & Finance

what's the capital of illinois?

» Capital: Springfield\n» Location: 40 N, 89 W\n» Area: 57,918 square miles, 26th largest\n» Population: 12,128,370 people\n» Statehood: 21st state, 1818\n» State Bird: Cardinal\n» State Tree: White Oak\n» State Flower: Native Violet\n» State Slogan: Land of Lincoln\n» State Fish: Bluegill\n» State Dance: Square Dance\n» State Insect: Monarch butterfly \n» Popular Tourist Destinations: Chicago Museums, Navy Pier, Lincoln sites\n» Products: Agriculture: corn, soybeans, hogs, cattle, milk, hay, wheat; Manufacturing: machinery and food products; Mining: coal, petroleum, stone sand

5,592

4Computers & Internet

Looking for a well-priced and well-featured all-in-one printer?

I'm looking for a new all-in-one printer with print/copy/scan/fax features. The fax feature isn't very important to me, but is handy for the remote time I need to use it. However, if I find a GOOD 3-in-1, I'm willing to let go of the fax. Some of my desired features:\n1. Supports duplex printing (I'm a tree-hugger)\n2. Is network enabled/ready\n3. Cartridges are provided with the printer, and ink/cartridge replacement doesn't burn a hole in my pocket.\n4. Not looking to pay too much for it (What can i say, I want it all...)\n\nAny recommendations are welcome.

Tom's Hardware has a nice review of inkjet multi-function printers. I've found the reviews on that site to be based on facts and pretty reliable.\n\nI hope it helps!

5,593

1Science & Mathematics

What is the irradiance (intensity, in W/m^2) of light transmitted through a thin piece of glass?

Sunlight is incident on an air-glass interface at angle of incidence theta, which is known. The irradiance (energy flux rate, W/m^2) of the incident light is known. The light must pass the interface from air to glass and then from glass to air. The indices of refraction are known. The angle of refraction is found easily from Snell's Law. In terms of these variables (or any I've forgotten), what is the irradiance of transmitted light?

you either need more information, or this is a trivial problem. \n\ni am assuming the two surfaces of the glass are parallel to each other, so it's not a prism or lens, but a thin flat plate.\n\ntreating it very simply, you could argue that energy is conserved, so the irradiance (which is energy per second per square meter) must be conserved. the speed of light is fixed in air, so the "per second" part is fixed too. if the glass surfaces are not angled with respect to each other, then the light leaves the glass taking up the same area that it went in with. this means the irradiances are the same.\n\nthis is a simplistic physical model, though. realistically, you will get some reflection at the air-glass interface, reflection at the glass-air interface, and some absorption (both in the air and in the glass). you need a lot more details about the problem to say anything meaningful though.

5,594

7Entertainment & Music

what website should i open that i can watch a full length harry potter movies for free?

There are no websites that will allow you to view new movies for free, they will always get you somehow (either directly charging, ransomeware, or by installing spyware/adware). The only thing you could look at doing is attempting to download it in a torrent or through a peer-2-peer network, although you may be breaking copy right laws depending on what country you live in.

5,595

6Business & Finance

how do i become a project manager?

One important requirement to be a project manager is your Knowledge. You have to be able to know if a project possible to be done, understand the project Completely, able to make estimation, choose correct staff(s) (programmer, designer, or other) in doing tasks, manage staff(s).\nYou will also need to create project report(daily, weekly, monthly), conduct meeting with managment or your supervisor. etc.\n\nProject Manager requires wide knowledge in many fields, responsibitilty to customers, your team, and the company.

5,596

2Health

why am i beautiful?

you are beautiful as you have created your beauty on your own,God Gives you gift,you make it pretty or ugly.No matter do you have pysically or inside beauty.it is like doing a dimond as a priceless ring or scattering it,turning it into debris.

5,597

3Education & Reference

What is the Landlord's game?

How is it better known as today? Who invented/improved on it?

The Landlord's Game is a board game patented by Quaker Elizabeth Magie from Virginia. It is a realty and taxation game, the first of its kind to have an attested patent. It was patented by Magie in 1904.\n\nMany similar home-made games were played by people at the beginning of the 20th Century, even before The Landlord's Game was patented.\n\nOne of those home-made games about owning property and taxing, which also got patented, was Monopoly, a game by Pennsylvanian former salesman Charles Darrow, who later sold the rights to manufacture the Monopoly game to the company Parker Brothers of Massachusetts.

5,598

9Politics & Government

Are George W. Bush and John Kerry related?

I had read that they shared a familial line back to the Mayflower.

They are related about 10 generations back. Edmund Reade and Elizabeth Cooke are ancestors of both of them.

5,599

4Computers & Internet

What can I do with the file in the GMail Drive?

For what reason can the GM serve me? Para qué puede servirme el tener mis files en GMail Drive , además de almacenarlos?

You can save small files on the google mail server using up some of that 2 plus gig of space you have. If something happens to your harddrive, you can have your file safe on theirs.