image
image | latex
string | filename
string |
|---|---|---|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Exon} & \textbf{Gene position} & \textbf{cDNA position} & \textbf{Codon and amino-acid change} & \textbf{Mutation} & \textbf{Mutation} type \\
\hline
5 & g.12524A > G & c.536A > G & p.H179R His-Arg & Missense & A:T > G:C \\
\hline
6 & g.12706C > T & c.637C > T & p.R213X Arg-Stop & Nonsense & G:C > A:T at CpG \\
\hline
6 & g.12706C > T & c.637C > T & p.R213X Arg-Stop & Nonsense & G:C > A:T at CpG \\
\hline
7 & g.13386C > T & c.749C > T & p.P250L Pro-Leu & Missense & G:C > A:T \\
\hline
7 & g.13400A > T & c.763A > T & p.I255F Ile-Phe & Missense & A:T > T:A \\
\hline
8 & g.13776G > A & c.796G > A & p.G266R Gly-Arg & Missense & G:C > A:T \\
\hline
8 & g.13813C > T & c.833C > T & p.P278L Pro-Leu & Missense & G:C > A:T \\
\hline
8 & g.13816G > A & c.836G > A & p.G279E Gly-Glu & Missense & G:C > A:T \\
\hline
8 & g.13896C > T & c.916C > T & p.R306X Arg-Stop & Nonsense & G:C > A:T at CpG \\
\hline
8 & g.13811_13815del5 & c.831_835del5 & p.? & FS* & - \\
\hline
6 & g.12729_12732del4 & c.660_663del4 & p.? & FS & - \\
\hline
\end{tabular}
\end{table}
|
PMC3216406_table_1
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{number of events}} \\
\hline
\textbf{unit} & \textbf{control} & \textbf{treatment} & \textbf{IRRa} \\
\hline
1 & 14 & 10 & 0.71 \\
\hline
2 & 17 & 7 & 0.41 \\
\hline
3 & 8 & 3 & 0.38 \\
\hline
4 & 6 & 4 & 0.67 \\
\hline
5 & 11 & 5 & 0.45 \\
\hline
6 & 20 & 7 & 0.35 \\
\hline
7 & 12 & 15 & 1.25 \\
\hline
8 & 5 & 5 & 1.00 \\
\hline
9 & 4 & 4 & 1.00 \\
\hline
10 & 9 & 8 & 0.89 \\
\hline
\end{tabular}
\end{table}
|
PMC3338707_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{HAP} & \multicolumn{8}{c|}{\textbf{SNPa}} & \multicolumn{6}{c|}{\textbf{CLR}} \\
\hline
& & & & & & & & & \multicolumn{3}{c|}{\textbf{Scarring trachoma}} & \multicolumn{3}{c|}{\textbf{Trichiasis}} \\
\hline
& \textbf{1A} & \textbf{2A} & \textbf{3A} & \textbf{4A} & \textbf{5A} & \textbf{6A} & \textbf{7A} & \textbf{8A} & \textbf{\textbf{OR}} & \textbf{\textbf{95\%CI}} & \textbf{\textbf{p value}} & \textbf{\textbf{OR}} & \textbf{\textbf{95\%CI}} & \textbf{\textbf{p value}} \\
\hline
H1 & T & C & C & G & T & C & G & C & 1.370 & 1.070,1.763 & 0.010 & 1.390 & 1.040,1.869 & 0.030 \\
\hline
H2 & - & - & - & - & T & C & G & - & 1.032 & 0.830,1.280 & 0.778 & 1.131 & 0.822,1.556 & 0.448 \\
\hline
L1 & T & C & C & G & A & T & A & C & 0.804 & 0.520,1.220 & 0.324 & 0.871 & 0.520,1.378 & 0.609 \\
\hline
L2 & - & - & - & - & A & T & A & - & 0.820 & 0.650,1.043 & 0.084 & 0.610 & 0.423,0.880 & 0.008 \\
\hline
\end{tabular}
\end{table}
|
PMC2810293_table_4
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Litter} & \textbf{TL (mm)} & \textbf{No. embryos} & \textbf{No. sires} & \textbf{Skew} \\
\hline
Mm152 & 1630 & 10 & 2 & 8:2 (1.54E−6) \\
\hline
Mm159 & 1350 & 6 & 2 & 3:3 (5.76E−8) \\
\hline
Mm203 & 1550 & 16 & 2 & 3:12 (1.02E−10) \\
\hline
Mm229 & 1585 & 18 & 2 & 17:1 (4.14E−10) \\
\hline
Mm237 & 1310 & 15 & 2 & 14:1 (3.80E−6) \\
\hline
Mm240 & 1400 & 9 & 2 & 4:5 (3.54E−5) \\
\hline
Mm266 & 1420 & 15 & 2 & 4:10 (3.63E−9) \\
\hline
Mm274 & 1375 & 12 & 2 & 3:4 (3.61E−3) \\
\hline
Mm275 & 1320 & 9 & 3 & 4:3:2 (1.84E−5) \\
\hline
Mp154 & 1255 & 27 & 2 & 13:14 (1.9E−11) \\
\hline
Mp287 & 1250 & 14 & 2 & 5:9 (2.38E−10) \\
\hline
Mp1_6.9 & 1170 & 16 & 2 & 14:2 (4.09E−10) \\
\hline
Mp4_6.9 & 1180 & 15 & 2 & 6:9 (7.85E−10) \\
\hline
Mp6_6.9 & 1320 & 30 & 2 & 28:2 (1.42E−9) \\
\hline
Mp7_6.9 & 1410 & 29 & 2 & 14:15 (7.8E−10) \\
\hline
Mp9_6.9 & 1290 & 26 & 2 & 18:5 (NA) \\
\hline
\end{tabular}
\end{table}
|
PMC4530440_table_4
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{LBD alone (n = 62)} & \textbf{EST plus LBD (n = 69)} & \textbf{P value} \\
\hline
Diameter of inflated balloon (mm) & 15.9 $\pm$ 2.3 (12-20) & 16.2 $\pm$ 2.5 (12-20) & 0.444 \\
\hline
Complete stone removal irrespective of whether ML was used, no. (\%) & 60 (96.8) & 66 (95.7) & 0.738 \\
\hline
Complete stone removal without ML, no. (\%) & 50 (80.6) & 51 (73.9) & 0.360 \\
\hline
\end{tabular}
\end{table}
|
PMC3556067_table_1
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\multirow{2}{*}{\textbf{Cancer}} & \multicolumn{3}{c|}{\textbf{China}} & \multicolumn{3}{c|}{\textbf{USA}} & \multirow{2}{*}{\textbf{\textbf{\textbf{ASRW}} ratio (\textbf{\textbf{\%}})}} \\
\hline
\textbf{\textbf{Number}} & \textbf{\textbf{\%}} & \textbf{\textbf{ASRW}} & \textbf{\textbf{Number}} & \textbf{\textbf{\%}} & \textbf{\textbf{ASRW}} \\
\hline
Lip, oral cavity & 10427 & 0.6 & 1.4 & 15817 & 2.1 & 7.3 & -5.2 \\
\hline
Nasopharynx & 22317 & 1.4 & 2.8 & 1352 & 0.2 & 0.7 & 4.0 \\
\hline
Other pharynx & 4515 & 0.3 & 0.6 & 8144 & 1.1 & 3.9 & -6.5 \\
\hline
Esophagus & 175863 & 10.8 & 22.9 & 12970 & 1.7 & 5.8 & 4.0 \\
\hline
Stomach & 315843 & 19.5 & 41.3 & 13189 & 1.8 & 5.7 & 7.3 \\
\hline
rectum & 125461 & 7.7 & 16.3 & 79271 & 10.6 & 34.1 & -2.1 \\
\hline
Liver & 292966 & 18.1 & 37.4 & 15192 & 2.0 & 7.0 & 5.3 \\
\hline
Gallbladder & 11434 & 0.7 & 1.5 & 4501 & A0.6 & 1.9 & -1.3 \\
\hline
Pancreas & 24841 & 1.5 & 3.2 & 18771 & 2.5 & 8.0 & -2.5 \\
\hline
Larynx & 17077 & 1.1 & 2.3 & 9681 & 1.3 & 4.4 & -1.9 \\
\hline
Lung & 351713 & 21.7 & 45.9 & 114691 & 15.4 & 49.5 & -1.1 \\
\hline
Melanoma of skin & 2281 & 0.1 & 0.3 & 34949 & 4.7 & 16.3 & -54.3 \\
\hline
Prostate & 33802 & 2.1 & 4.3 & 186320 & 25.0 & 83.8 & -19.5 \\
\hline
Testis & 2795 & 0.2 & 0.4 & 8090 & 1.1 & 5.1 & -12.8 \\
\hline
Kidney & 21269 & 1.3 & 2.8 & 34638 & 4.6 & 16.1 & -5.8 \\
\hline
Bladder & 42686 & 2.6 & 5.5 & 51231 & 6.9 & 21.1 & -3.8 \\
\hline
Brain, nervous system & 33244 & 2.0 & 4.3 & 11779 & 1.6 & 6.3 & -1.5 \\
\hline
Thyroid & 6286 & 0.4 & 0.8 & 8931 & 1.2 & 4.6 & -5.8 \\
\hline
Hodgkin lymphoma & 3740 & 0.2 & 0.5 & 4400 & 0.6 & 2.6 & -5.2 \\
\hline
Non-Hodgkin lymphoma & 19205 & 1.2 & 2.5 & 35453 & 4.8 & 16.3 & -6.5 \\
\hline
Multiple myeloma & 3274 & 0.2 & 0.4 & 11188 & 1.5 & 4.8 & -12.0 \\
\hline
Leukemia & 38635 & 2.4 & 5.3 & 25179 & 3.4 & 12.1 & -2.3 \\
\hline
\end{tabular}
\end{table}
|
PMC3643656_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Name/Responsive Element sequence} & \textbf{Description} & \textbf{Enrichment Score} & \textbf{Nominal P-value} & \textbf{FDR* q-value} \\
\hline
Frzb-/- miRNA associations in samples \\
\hline
miR-147 & microRNA-147 & 0.49 & 0.000 & 0.172 \\
\hline
\multicolumn{2}{c|}{Frzb-/- Transcription factor associations in} \\
\hline
FoxD1 & forkhead box D1 & 0.48 & 0.000 & 0.027 \\
\hline
Znf238 & zinc finger protein 238 & 0.45 & 0.000 & 0.018 \\
\hline
Pbx1 & pre B-cell leukemia transcription factor 1 & 0.49 & 0.000 & 0.014 \\
\hline
RYTAAWNNNTGAY & No matching TCF & 0.58 & 0.000 & 0.037 \\
\hline
AAANWWTGC & No matching TCF & 0.43 & 0.000 & 0.018 \\
\hline
\end{tabular}
\end{table}
|
PMC3392806_table_2
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Characteristics} & \textbf{Number of cases or mean} & \textbf{Percentage or range} \\
\hline
Age, years & 71 & (30–96) \\
\hline
Tumor size (mm) & 75 & (4–170) \\
\hline
Gender \\
\hline
Female (\%) & 741 & (52.2) \\
\hline
Male (\%) & 673 & (47.4) \\
\hline
Anatomic site of the tumor \\
\hline
Left-sided (\%) & 912 & (64.2) \\
\hline
Right-sided (\%) & 488 & (34.4) \\
\hline
T stage \\
\hline
T1 (\%) & 62 & (4.4) \\
\hline
T2 (\%) & 203 & (14.3) \\
\hline
T3 (\%) & 899 & (63.3) \\
\hline
T4 (\%) & 223 & (15.7) \\
\hline
N stage \\
\hline
N0 (\%) & 711 & (50.1) \\
\hline
N1 (\%) & 358 & (25.2) \\
\hline
N2 (\%) & 294 & (20.7) \\
\hline
Tumor grade \\
\hline
G1 (\%) & 31 & (2.2) \\
\hline
G2 (\%) & 1177 & (82.9) \\
\hline
G3 (\%) & 177 & (12.5) \\
\hline
UICC \\
\hline
Stage I (pN0 pT1 or 2) (\%) & 185 & (13.6) \\
\hline
pT3)+IIB-C Stage IIA (pN0 (pN0 pT4) (\%) & 445+61 & (37.2) \\
\hline
Stage III (pN.0) (\%) & 581 & (42.7) \\
\hline
Stage IV metastasis (\%) & 88 & (6.5) \\
\hline
Tumor border configuration \\
\hline
Infiltrative (\%) & 871 & (61.3) \\
\hline
Pushing (\%) & 513 & (36.1) \\
\hline
Vascular invasion \\
\hline
No (\%) & 1002 & (70.6) \\
\hline
Yes (\%) & 383 & (27) \\
\hline
Microsatellite Stability \\
\hline
Proficient (\%) & 1031 & (72.6) \\
\hline
Deficient (\%) & 194 & (13.7) \\
\hline
Rectal cancers (\%) & 575 & (40.5) \\
\hline
Overall survival time (months) & 67.7 & (0–152) \\
\hline
5-years survival \% (95\%CI) & 56.4 & (54–59) \\
\hline
\end{tabular}
\end{table}
|
PMC3667167_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \textbf{U11} & \textbf{U22} & \textbf{U33} & \textbf{U12} & \textbf{U13} & \textbf{U23} \\
\hline
C1 & 0.0368 (14) & 0.0208 (12) & 0.0204 (12) & −0.0048 (10) & 0.0062 (10) & −0.0025 (9) \\
\hline
C2 & 0.0390 (14) & 0.0215 (12) & 0.0197 (12) & −0.0036 (10) & 0.0066 (10) & 0.0023 (9) \\
\hline
C3 & 0.0249 (12) & 0.0178 (11) & 0.0234 (12) & −0.0009 (9) & 0.0083 (9) & −0.0001 (9) \\
\hline
C4 & 0.0434 (15) & 0.0199 (12) & 0.0204 (12) & −0.0063 (11) & 0.0057 (10) & −0.0029 (9) \\
\hline
C5 & 0.0416 (15) & 0.0216 (12) & 0.0199 (12) & −0.0021 (10) & 0.0062 (10) & 0.0026 (9) \\
\hline
C6 & 0.0269 (12) & 0.0174 (11) & 0.0209 (11) & −0.0006 (9) & 0.0073 (9) & 0.0001 (9) \\
\hline
C7 & 0.0281 (12) & 0.0162 (11) & 0.0224 (11) & −0.0009 (9) & 0.0068 (9) & −0.0005 (8) \\
\hline
C8 & 0.0239 (12) & 0.0188 (11) & 0.0254 (12) & −0.0003 (9) & 0.0051 (9) & −0.0010 (9) \\
\hline
C9 & 0.0588 (18) & 0.0260 (13) & 0.0251 (13) & −0.0116 (12) & 0.0108 (12) & 0.0001 (10) \\
\hline
C10 & 0.0624 (19) & 0.0225 (13) & 0.0392 (16) & −0.0129 (13) & 0.0161 (13) & 0.0020 (11) \\
\hline
C11 & 0.0424 (15) & 0.0314 (14) & 0.0280 (13) & −0.0042 (11) & 0.0014 (11) & −0.0060 (11) \\
\hline
C12 & 0.0400 (15) & 0.0221 (12) & 0.0269 (13) & −0.0029 (10) & 0.0031 (11) & 0.0039 (10) \\
\hline
N1 & 0.0310 (11) & 0.0168 (9) & 0.0223 (10) & −0.0024 (8) & 0.0067 (8) & −0.0006 (7) \\
\hline
N2 & 0.0413 (12) & 0.0175 (10) & 0.0232 (10) & −0.0064 (9) & 0.0070 (9) & 0.0002 (8) \\
\hline
N3 & 0.0429 (12) & 0.0189 (10) & 0.0232 (10) & −0.0071 (9) & 0.0067 (9) & 0.0009 (8) \\
\hline
N4 & 0.0281 (10) & 0.0161 (9) & 0.0222 (10) & −0.0016 (8) & 0.0053 (8) & 0.0011 (7) \\
\hline
N5 & 0.0408 (13) & 0.0244 (11) & 0.0416 (13) & −0.0077 (10) & 0.0102 (10) & −0.0075 (9) \\
\hline
Ni1 & 0.0263 (2) & 0.0140 (2) & 0.0186 (2) & −0.00180 (17) & 0.00564 (16) & −0.00025 (16) \\
\hline
O1 & 0.0322 (10) & 0.0267 (9) & 0.0246 (9) & −0.0036 (8) & 0.0101 (8) & −0.0021 (7) \\
\hline
O2 & 0.0288 (10) & 0.0329 (10) & 0.0228 (9) & 0.0044 (8) & 0.0054 (7) & −0.0001 (7) \\
\hline
O3 & 0.0420 (11) & 0.0222 (9) & 0.0288 (10) & −0.0034 (8) & 0.0088 (8) & −0.0015 (7) \\
\hline
\end{tabular}
\end{table}
|
PMC2977209_table_1
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{OSNA} & \multicolumn{3}{c|}{\textbf{HISTOLOGIC INVESTIGATION}} \\
\hline
& \textbf{Macrometastases} & \textbf{Micrometastases} & \textbf{Negative} \\
\hline
++ & 27 & 2 & 2 (1) \\
\hline
+ & 8 & - & 3 (2) \\
\hline
- & 3 (2) & - & 139 \\
\hline
Total & 38 (37) & 2 & 144 (142) \\
\hline
\end{tabular}
\end{table}
|
PMC2944157_table_1
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \textbf{A Genome} & \textbf{B Genome} & \textbf{EST Seq} & \textbf{GSS Seq} & \textbf{Over all} \\
\hline
Primer Design Success & 70516 (84\%) & 66471 (88\%) & 5296 (72\%) & 1549 (86\%) & 143832 (85\%) \\
\hline
Primer Design Fail & 13104 (16\%) & 9204 (12\%) & 2069 (28\%) & 260 (15\%) & 24637 (15\%) \\
\hline
Non Redundant Primer & 61886 (88\%) & 57491 (86\%) & 5059 (96\%) & 1496 (97\%) & 119540 (83\%) \\
\hline
\end{tabular}
\end{table}
|
PMC4488140_table_1
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{Score-ranked}} & \multicolumn{2}{c|}{\textbf{SILE-ranked}} \\
\hline
\textbf{Protein conformation} & \textbf{\textbf{Sequence}} & \textbf{\textbf{Heavy atom count}} & \textbf{\textbf{Sequence}} & \textbf{\textbf{Heavy atom count}} \\
\hline
ETS1 & IYW & 35 & TKT & 24 \\
\hline
ETS2 & GYY & 29 & GGD & 17 \\
\hline
ETS3 & YKE & 31 & YKE & 31 \\
\hline
ETS4 & KWR & 35 & SYG & 23 \\
\hline
ETS5 & HAY & 28 & TTG & 19 \\
\hline
ETS6 & KEY & 31 & KEY & 31 \\
\hline
ETS7 & RYW & 38 & SFG & 22 \\
\hline
ETS8 & LWY & 35 & SYA & 24 \\
\hline
ETS9 & EHW & 34 & TDY & 28 \\
\hline
ETS10 & WYV & 34 & KSD & 24 \\
\hline
ETS11 & DYW & 35 & YSY & 31 \\
\hline
ETS12 & KEW & 33 & TYF & 31 \\
\hline
\end{tabular}
\end{table}
|
PMC3227621_table_3
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \textbf{Placebo (n = 62)} & \textbf{30 mg/d LDX (n = 119)} & \textbf{50 mg/d LDX (n = 116)} & \textbf{70 mg/d LDX (n = 121)} & \textbf{All LDX Doses (n = 356)} \\
\hline
Baseline [Mean (SD)] & 6.9 (1.34) & 7.4 (1.69) & 7.4 (1.51) & 7.2 (1.42) & 7.3 (1.54) \\
\hline
Endpoint [Mean (SD)] & 7.0 (1.33) & 7.2 (1.21) & 7.0 (1.44) & 7.0 (1.61) & 7.1 (1.43) \\
\hline
Change [LS Mean (SE)] & -0.1 (0.15) & -0.1 (0.11) & -0.3 (0.11) & -0.2 (0.11) & -0.2 (0.07) \\
\hline
\end{tabular}
\end{table}
|
PMC2732626_table_1
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Codon} & \textbf{50} & \textbf{51} & \textbf{59} & \textbf{108} & \textbf{164} \\
\hline
Wild type & Cys (C) TGT & Asn (N) AAT AAC & Cys (C) TGT & Ser (S) AGC & Ile (I) ATA \\
\hline
Mutant & Arg (R) CGT & Ile (I) ATT & Arg (R) CGT & Asn (N) AAC Thr (T) ACC & Leu (L) TTA \\
\hline
\end{tabular}
\end{table}
|
PMC3213132_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Sequence} & \textbf{Raw mapped read counts} & \textbf{miRDeep2, score} & \textbf{TaqMan Cp value} \\
\hline
\textbf{Sequence} 1 ucaggucccuguucgggcgcca & Sample 1: 759 Sample 2: 62 Sample 3: 271 & 0.9 0.9 0.9 & 19.57 18.86 19.36 \\
\hline
\textbf{Sequence} 2 ucacccuggacugacucucagg & Sample 1: 373 Sample 2: 44 Sample 3: 15 & 5.4 5.4 5.4 & 36.22 36.18 37.27 \\
\hline
\textbf{Sequence} 3 agccccucugagacucugaaaga & Sample 1: 49 Sample 2: 2 Sample 3: 6 & 5.5 0.5 2.5 & – – – \\
\hline
\end{tabular}
\end{table}
|
PMC3585423_table_0
|
|
\begi\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}{table}
\ce\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}teri\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}g
\label{tab:tablelabel}
\begi\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}{tabular}{|l|l|l|l|l|l|l|l|l|l|l|}
\hli\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}e
& \multicolum\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}{2}{c|}{\textbf{All}} & \multicolum\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}{2}{c|}{\textbf{Group A}} & \multicolum\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}{2}{c|}{\textbf{Group B}} & \multicolum\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}{2}{c|}{\textbf{Group C}} & \multicolum\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}{2}{c|}{\textbf{Group D}} \\
\hli\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}e
& \textbf{\textbf{\textbf{\textbf{\textbf{n}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\%}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{n}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\%}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{n}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\%}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{n}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\%}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{n}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\%}}}}} \\
\hli\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}e
\textbf{All} bysta\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}der-wit\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}essed OHCAs & 95,072 & & 53,482 & & 38,077 & & 1,597 & & 1,916 \\
\hli\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}e
1-mo\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}th survival & 7,722 & 8.1 & 3,608 & 6.7 & 3,642 & 9.6 & 185 & 11.6 & 287 & 15.0 \\
\hli\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}e
CPC at 1 mo\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}th \\
\hli\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}e
Good performa\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}ce & 2,754 & 2.9 & 1,026 & 1.9 & 1,562 & 4.1 & 43 & 2.7 & 123 & 6.4 \\
\hli\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}e
Moderate disability & 659 & 0.7 & 317 & 0.6 & 294 & 0.8 & 17 & 1.1 & 31 & 1.6 \\
\hli\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}e
Severe cerebral disability & 1,117 & 1.2 & 560 & 1.0 & 489 & 1.3 & 28 & 1.8 & 40 & 2.1 \\
\hli\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}e
Vegetative status or worse & 3,171 & 3.3 & 1,694 & 3.2 & 1289 & 3.4 & 97 & 6.1 & 91 & 4.7 \\
\hli\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}e
Bysta\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}der-wit\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}essed OHCAs with i\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}itial VF of cardiac origi\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}} & 11,970 & & 5,840 & & 5,518 & & 229 & & 383 \\
\hli\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}e
1-mo\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}th survival & 2,903 & 24.3 & 1,247 & 21.4 & 1,443 & 26.2 & 74 & 32.3 & 139 & 36.3 \\
\hli\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}e
CPC at 1 mo\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}th \\
\hli\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}e
Good performa\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}ce & 1,436 & 12.0 & 524 & 9.0 & 810 & 14.7 & 27 & 11.8 & 75 & 19.6 \\
\hli\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}e
Moderate disability & 297 & 2.5 & 137 & 2.3 & 130 & 2.4 & 10 & 4.4 & 20 & 5.2 \\
\hli\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}e
Severe cerebral disability & 395 & 3.3 & 197 & 3.4 & 173 & 3.1 & 10 & 4.4 & 15 & 3.9 \\
\hli\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}e
Vegetative status or worse & 771 & 6.4 & 387 & 6.6 & 329 & 6.0 & 27 & 11.8 & 28 & 7.3 \\
\hli\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}e
\e\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}d{tabular}
\e\textbf{\textbf{\textbf{\textbf{\textbf{n}}}}}d{table}
|
PMC3219985_table_1
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \textbf{T 10 min} & \textbf{T 20 min} & \textbf{T 30 min} & \textbf{T 40 min} \\
\hline
BIS & 64 (18-96) & 58 (15-93) & 62 (16-94) & 66 (20-98) \\
\hline
OAA/S & 4 (1-5) & 3-4 (1-5) & 3-4 (1-5) & 3-4 (1-5) \\
\hline
Ramsay & 3-4 (1-6) & 4 (1-6) & 3-4 (1-6) & 3-4 (1-6) \\
\hline
\end{tabular}
\end{table}
|
PMC3194365_table_1
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\multirow{2}{*}{\textbf{Word Type}} & \multicolumn{2}{c|}{\textbf{Repetitions}} & \multirow{2}{*}{\textbf{Difference}} & \multirow{2}{*}{All \textbf{Repetitions}} \\
\hline
\textbf{1–3} & \textbf{4–6} \\
\hline
Neutral \\
\hline
Color-Consistent & 729 (13) & 720 (12) & −9 & 725 (12) \\
\hline
Color-Inconsistent & 725 (13) & 738 (13) & +13 & 731 (12) \\
\hline
Taboo \\
\hline
Color-Consistent & 792 (16) & 742 (12) & −50 & 767 (13) \\
\hline
Color-Inconsistent & 798 (16) & 770 (13) & −28 & 784 (13) \\
\hline
\end{tabular}
\end{table}
|
PMC4627001_table_1
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
C14H12ClN3S & F(000) = 600 \\
\hline
Mr = 289.78 & m−3 Dx = 1.364 Mg \\
\hline
Monoclinic, P21/n & Mo Kα radiation, λ = 0.71073 Å \\
\hline
Hall symbol: -P 2yn & Cell parameters from 752 reflections \\
\hline
a = 15.082 (5) Å & θ = 2.4–19.2° \\
\hline
b = 6.560 (2) Å & mm−1 µ = 0.41 \\
\hline
c = 15.205 (5) Å & T = 293 K \\
\hline
β = 110.272 (8)° & Plate, light-pink \\
\hline
Å3 V = 1411.2 (8) & 0.39 × 0.21 × 0.02 mm \\
\hline
Z = 4 \\
\hline
\end{tabular}
\end{table}
|
PMC3100056_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{ID number} & \textbf{Sex} & \textbf{Origin} & \textbf{Immigrant} & \textbf{Organisation} & \textbf{No. staff in the clinic*} & \textbf{No. of immigrant staff} \\
\hline
46 & Female & Denmark & No & Single practitioner & 4 & 1 \\
\hline
47 & Female & Denmark & No & Single practitioner & 3 & 0 \\
\hline
48 & Male & Denmark & No & Partnership practice & 7 & 0 \\
\hline
49 & Female & Turkey & Yes & Single practitioner & 3 & 2 \\
\hline
50 & Female & Denmark & No & Shared practice & 5 & 3 \\
\hline
51 & Female & Denmark & No & Single practitioner & 2 & 0 \\
\hline
52 & Female & Denmark & No & Shared practice & 10 & 0 \\
\hline
53 & Male & Afghanistan & Yes & Single practitioner & 4 & 3 \\
\hline
54 & Female & Denmark & No & Shared practice & 4 & 0 \\
\hline
\end{tabular}
\end{table}
|
PMC3568406_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Years} & \textbf{Treatments} & \multicolumn{2}{c|}{\textbf{kg-1) Organic carbon (g}} & \multicolumn{2}{c|}{\textbf{kg-1) Labile organic carbon (g}} \\
\hline
& & \textbf{\textbf{0–20 cm}} & \textbf{\textbf{20–40 cm}} & \textbf{\textbf{0–20 cm}} & \textbf{\textbf{20–40 cm}} \\
\hline
\multirow{4}{*}{2008} & H & 17$\pm$0.71a2 & 11$\pm$0.6a & — & — \\
\hline
M & 17$\pm$0.2ab & 11$\pm$0.8a & — & — \\
\hline
L & 15$\pm$0.5b & 9$\pm$1.0b & — & — \\
\hline
CK & 15$\pm$0.9b & 9$\pm$0.3b & — & — \\
\hline
\multirow{4}{*}{2009} & H & 17$\pm$0.3a & 11$\pm$1.1a & — & — \\
\hline
M & 17$\pm$0.6ab & 11$\pm$0.4a & — & — \\
\hline
L & 16$\pm$0.5bc & 9$\pm$0.7b & — & — \\
\hline
CK & 15$\pm$0.4c & 9$\pm$0.4b & — & — \\
\hline
\multirow{4}{*}{2010} & H & 17$\pm$0.4a & 12$\pm$0.3a & 6.5$\pm$0.3ab & 4.1$\pm$0.1ab \\
\hline
M & 17$\pm$0.3ab & 12$\pm$1.0a & 6.5$\pm$0.3ab & 4.1$\pm$0.3ab \\
\hline
L & 16$\pm$0.3bc & 9$\pm$0.6b & 5.8$\pm$0.2b & 3.8$\pm$0.1b \\
\hline
CK & 15$\pm$0.3c & 9$\pm$0.4b & 3.5$\pm$0.2c & 2.9$\pm$0.9c \\
\hline
\multirow{4}{*}{2011} & H & 18$\pm$0.2a & 14$\pm$0.8a & 6.6$\pm$0.2a & 4.4$\pm$0.1a \\
\hline
M & 17$\pm$0.2a & 13$\pm$0.5b & 6.5$\pm$0.2a & 4.3$\pm$0.1a \\
\hline
L & 16$\pm$0.1b & 11$\pm$03bc & 5.7$\pm$0.2b & 3.9$\pm$0.3a \\
\hline
CK & 15$\pm$0.2b & 10$\pm$0.5c & 3.7$\pm$0.3c & 3.1$\pm$0.2b \\
\hline
\end{tabular}
\end{table}
|
PMC4400158_table_3
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& & \multicolumn{2}{c|}{\textbf{MMP-10 expression}} \\
\hline
& \textbf{No. of cases} & \textbf{Low} & \textbf{High} & \textbf{P value} \\
\hline
Non-neoplastic epithelium & 30 & 28(93.3\%) & 2(6.7\%) & P,0.001 \\
\hline
HNSCC & 116 & 27(23.3\%) & 89(76.7\%) \\
\hline
Pattern of invasion \\
\hline
Grade I & 9 & 8(88.9\%) & 1(11.1\%) & P,0.001 \\
\hline
Grade II & 12 & 10(83.3\%) & 2(16.7\%) \\
\hline
Grade III & 62 & 8(12.9\%) & 54(87.1\%) \\
\hline
Grade IV & 33 & 1(3\%) & 32(97.0\%) \\
\hline
Stage grouping \\
\hline
I & II & 15 & 8(53.5\%) & 7(46.7\%) & P,0.001 \\
\hline
III & IV & 34 & 1(2.9\%) & 33(97.1\%) \\
\hline
Metastasis \\
\hline
2 & 51 & 22(43.1\%) & 29(56.9\%) & P,0.001 \\
\hline
+ & 65 & 5(7.7\%) & 60(92.3\%) \\
\hline
\end{tabular}
\end{table}
|
PMC3187776_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{Year} & \multicolumn{2}{c|}{\textbf{Women}} & \multicolumn{2}{c|}{\textbf{Men}} & \multicolumn{2}{c|}{\textbf{All}} & \multirow{2}{*}{\textbf{Incidence sex CI)a ratio (95 \%}} \\
\hline
& \textbf{\textbf{\textbf{Cases/popul.}}} & \textbf{\textbf{\textbf{Crude IR (95 \% CI) [standardized IR]}}} & \textbf{\textbf{\textbf{Cases/popul.}}} & \textbf{\textbf{\textbf{Crude IR (95 \% CI) [standardized IR]}}} & \textbf{\textbf{\textbf{Cases/popul.}}} & \textbf{\textbf{\textbf{Crude IR (95 \% CI) [standardized IR]}}} \\
\hline
1996 & 231/ 1,944,984 & 11.9 (10.4, 13.5) [12.0 (10.5, 13.6)] & 57/ 1,929,333 & 3.0 (2.2, 3.8) [3.1 (2.3, 4.0)] & 288/ 3,874,317 & 7.4 (6.6, 8.3) [7.5 (6.7, 8.5)] & 4.0 (3.0, 5.4) \\
\hline
1997 & 246/ 1,983,109 & 12.4 (10.9, 14.1) [12.4 (10.9, 14.1)] & 79/ 1,965,474 & 4.0 (3.2, 5.0) [4.1 (3.2, 5.1)] & 325/ 3,948,583 & 8.2 (7.4, 9.2) [8.3 (7.4, 9.3)] & 3.1 (2.4, 4.0) \\
\hline
1998 & 238/ 2,002,595 & 11.9 (10.4, 13.5) [11.9 (10.5, 13.5)] & 87/ 1,980,518 & 4.4 (3.5, 5.4) [4.4 (3.6, 5.5)] & 325/ 3,983,113 & 8.2 (7.3, 9.1) [8.2 (7.4, 9.2)] & 2.7 (2.1, 3.5) \\
\hline
1999 & 269/ 2,018,796 & 13.3 (11.8, 15.0) [13.2 (11.6, 14.8)] & 79/ 1,992,579 & 4.0 (3.1, 4.9) [4.0 (3.1, 4.9)] & 348/ 4,011,375 & 8.7 (7.8, 9.6) [8.6 (7.7, 9.6)] & 3.4 (2.6, 4.3) \\
\hline
2000 & 246/ 2,033,853 & 12.1 (10.6, 13.7) [11.9 (10.5, 13.5)] & 94/ 2,005,377 & 4.7 (3.8, 5.7) [4.7 (3.8, 5.7)] & 340/ 4,039,230 & 8.4 (7.6, 9.4) [8.3 (7.5, 9.3)] & 2.6 (2.0, 3.3) \\
\hline
2001 & 255/ 2,053,217 & 12.4 (10.9, 14.0) [12.2 (10.8, 13.8)] & 95/ 2,023,047 & 4.7 (3.8, 5.7) [4.7 (3.8, 5.7)] & 350/ 4,076,264 & 8.6 (7.7, 9.5) [8.5 (7.6, 9.4)] & 2.6 (2.1, 3.4) \\
\hline
2002 & 243/ 2,066,320 & 11.8 (10.3, 13.3) [11.6 (10.2, 13.1)] & 89/ 2,031,858 & 4.4 (3.5, 5.4) [4.3 (3.5, 5.3)] & 332/ 4,098,178 & 8.1 (7.3, 9.0) [8.0 (7.2, 8.9)] & 2.7 (2.1, 3.4) \\
\hline
2003 & 228/ 2,079,214 & 11.0 (9.6, 12.5) [10.8 (9.4, 12.3)] & 85/ 2,043,182 & 4.2 (3.3, 5.1) [4.1 (3.3, 5.1)] & 313/ 4,122,396 & 7.6 (6.8, 8.5) [7.5 (6.7, 8.4)] & 2.6 (2.1, 3.4) \\
\hline
2004 & 235/ 2,096,756 & 11.2 (9.8, 12.7) [11.1 (9.7, 12.6)] & 76/ 2,058,414 & 3.7 (2.9, 4.6) [3.7 (2.9, 4.6)] & 311/ 4,155,170 & 7.5 (6.7, 8.4) [7.4 (6.6, 8.3)] & 3.0 (2.3, 3.9) \\
\hline
2005 & 194/ 2,117,446 & 9.2 (7.9, 10.6) [9.0 (7.7, 10.3)] & 96/ 2,079,342 & 4.6 (3.7, 5.6) [4.5 (3.6, 5.5)] & 290/ 4,196,788 & 6.9 (6.1, 7.8) [6.8 (6.0, 7.6)] & 2.0 (1.6, 2.5) \\
\hline
2006 & 235/ 2,141,450 & 11.0 (9.6, 12.5) [10.8 (9.4, 12.3)] & 81/ 2,102,130 & 3.9 (3.1, 4.8) [3.7 (2.9, 4.6)] & 316/ 4,243,580 & 7.5 (6.7, 8.3) [7.3 (6.5, 8.2)] & 2.9 (2.2, 3.7) \\
\hline
2007 & 193/ 2,173,994 & 8.9 (7.7, 10.2) [8.6 (7.4, 9.9)] & 73/ 2,135,530 & 3.4 (2.7, 4.3) [3.4 (2.6, 4.3)] & 266/ 4,309,524 & 6.2 (5.5, 7.0) [6.0 (5.3, 6.8)] & 2.6 (2.0, 3.4) \\
\hline
2008b & 311/ 2,210,657 & 14.1 (12.6, 15.7) [13.8 (12.3, 15.4)] & 107/ 2,173,653 & 4.9 (4.0, 6.0) [4.6 (3.8, 5.6)] & 418/ 4,384,310 & 9.5 (8.6, 10.5) [9.3 (8.4, 10.2)] & 2.9 (2.3, 3.6) \\
\hline
1996–2008 & 3124/ 26,922,391 & 11.6 (11.2, 12.0) [11.5 (11.1, 11.9)] & 1098/ 26,520,437 & 4.1(3.9, 4.4) [4.1 (3.8, 4.3)] & 4222/ 53,442,828 & 7.9 (7.7, 8.1) [7.8 (7.6, 8.1)] & 2.8 (2.6, 3.0) \\
\hline
\end{tabular}
\end{table}
|
PMC4608995_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Variables} & \textbf{R values} & \textbf{P} \\
\hline
Age (Y/O) & −0.011 & 0.8443 \\
\hline
index(kg/m2) Body mass & 0.105 & 0.0529 \\
\hline
Semen amount (ml) & 0.037 & 0.4964 \\
\hline
(x106) Sperm count & 0.130 & 0.0165 \\
\hline
Sperm motility (\%) & 0.004 & 0.9448 \\
\hline
Sperm morphology (\%) & 0.002 & 0.9755 \\
\hline
\end{tabular}
\end{table}
|
PMC3520831_table_1
|
|
\begi\textbf{n}{table}
\ce\textbf{n}teri\textbf{n}g
\label{tab:tablelabel}
\begi\textbf{n}{tabular}{|l|l|l|l|l|l|}
\hli\textbf{n}e
& \textbf{n} & \multicolum\textbf{n}{2}{c|}{U\textbf{n}ivariate} & \multicolum\textbf{n}{2}{c|}{\textbf{Multivariatef}} \\
\hli\textbf{n}e
& & \textbf{5‑year (\%)} & \textbf{\textbf{p}} & \textbf{OR (95\% CI)} & \textbf{\textbf{p}} \\
\hli\textbf{n}e
Age (years) & & & <0.01 & 1.71 (0.99–2.99) & 0.06 \\
\hli\textbf{n}e
<70 & 130 & 82 \\
\hli\textbf{n}e
>71 & 280 & 90 \\
\hli\textbf{n}e
stagea T & & & <0.01 & 1.88 (0.96–3.71) & 0.07 \\
\hli\textbf{n}e
T1–2 & 315 & 92 \\
\hli\textbf{n}e
T3–4 & 95 & 74 \\
\hli\textbf{n}e
(\textbf{n}g/mL)b iPSA & & & <0.01 & 1.76 (0.83–3.72) & 0.14 \\
\hli\textbf{n}e
≦20 & 258 & 91 \\
\hli\textbf{n}e
>20 & 151 & 82 \\
\hli\textbf{n}e
scorec Gleaso\textbf{n} & & & <0.01 & 3.06 (1.60–5.81) & <0.001 \\
\hli\textbf{n}e
2–7 & 308 & 91 \\
\hli\textbf{n}e
8–10 & 92 & 75 \\
\hli\textbf{n}e
grou\textbf{\textbf{p}}d Risk & & & <0.01 & 1.30 (0.47–3.63) & 0.62 \\
\hli\textbf{n}e
Low-i\textbf{n}termediate risk & 191 & 92 \\
\hli\textbf{n}e
High-very high risk & 214 & 83 \\
\hli\textbf{n}e
Date of treatme\textbf{n}t & & & 0.11 & 1.41 (0.66–3.02) & 0.37 \\
\hli\textbf{n}e
1998–2005 & 199 & 90 \\
\hli\textbf{n}e
2006–2009 & 211 & 86 \\
\hli\textbf{n}e
(mo\textbf{n}ths)e ADT & & & 0.45 & 1.07 (0.47–2.44) & 0.87 \\
\hli\textbf{n}e
<6 & 63 & 91 \\
\hli\textbf{n}e
≧6 & 338 & 88 \\
\hli\textbf{n}e
Radiatio\textbf{n} dose & & & 0.06 & 1.51 (0.67–3.40) & 0.32 \\
\hli\textbf{n}e
<70 Gy & 145 & 85 \\
\hli\textbf{n}e
≧70 Gy & 265 & 92 \\
\hli\textbf{n}e
Hy\textbf{\textbf{p}}erthermia & & & 0.18 & 1.21 (0.65–2.26) & 0.54 \\
\hli\textbf{n}e
Yes & 141 & 86 \\
\hli\textbf{n}e
No & 269 & 88 \\
\hli\textbf{n}e
Prostate MRI study & & & 0.33 & 1.57 (0.89–2.77) & 0.12 \\
\hli\textbf{n}e
Yes & 189 & 86 \\
\hli\textbf{n}e
No & 221 & 90 \\
\hli\textbf{n}e
\e\textbf{n}d{tabular}
\e\textbf{n}d{table}
|
PMC4502053_table_1
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \multirow{2}{*}{\textbf{Male Mean $\pm$ SD}} & \multirow{2}{*}{\textbf{Female Mean $\pm$ SD}} & \multirow{2}{*}{\textbf{P value}} \\
\hline
\\
\hline
Forelimbs & 1.94a 24.94 $\pm$ & 0.83b 22.50 $\pm$ & 0.012 \\
\hline
Hind limbs & 2.07a 25.61 $\pm$ & 0.5b 23.33 $\pm$ & 0.024 \\
\hline
\end{tabular}
\end{table}
|
PMC3701551_table_4
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{Chromosome} & \textbf{Start} & \textbf{End} & \textbf{Samples} & \textbf{Samples}a # & \textbf{Length} & \textbf{Cytoband} \\
\hline
1 & 146258078 & 148749860 & h-1, h-2, a & 3 & 2491783 & 1q21.1-q21.2 \\
\hline
5 & 45437574 & 49631829 & h-1, h-2, d & 3 & 4194256 & 5p12-q11.1 \\
\hline
5 & 117360252 & 120214932 & h-1, h-2, f & 3 & 2854681 & 5q23.1 \\
\hline
5 & 120214932 & 122586267 & h-1, h-2, f, g & 4 & 2371336 & 5q23.1-23.2 \\
\hline
7 & 57594442 & 62282881 & h-1, h-2, b, f & 4 & 4688440 & 7p11.2-q11.21 \\
\hline
8 & 129121122 & 131617749 & h-1, h-2, b & 3 & 2496628 & 8q24.21-q24.22 \\
\hline
8 & 132434559 & 139244531 & h-1, h-2, b & 3 & 6809973 & 8q24.22-24.23 \\
\hline
10 & 37363792 & 37599485 & h-1, h-2, e & 3 & 235694 & 10p11.21 \\
\hline
10 & 37599485 & 37874740 & h-1, h-2, e, g & 4 & 275256 & 10p11.21 \\
\hline
10 & 37874740 & 42217616 & h-1, h-2, c, e, g & 5 & 4342877 & 10p11.21-q11.21 \\
\hline
12 & 33982292 & 36255461 & h-1, h-2, a, d & 4 & 2273170 & 12p11.1-q11 \\
\hline
13 & 35366458 & 43580724 & h-1, h-2, g & 3 & 8214267 & 13q13.3-14.11 \\
\hline
16 & 28924029 & 29606107 & h-1, h-2, c & 3 & 682079 & 16p11.2 \\
\hline
16 & 29606107 & 29657036 & h-1, h-2, c, f & 4 & 50930 & 16p11.2 \\
\hline
16 & 29657036 & 29680943 & h-1, h-2, c, d, f & 5 & 23908 & 16p11.2 \\
\hline
16 & 29680943 & 31277953 & h-1, h-2, b, c, d, f & 6 & 1597011 & 16p11.2 \\
\hline
16 & 34467305 & 34647935 & h-1, h-2, a, b, c, d, f, g & 8 & 180631 & 16p11.1 \\
\hline
16 & 34647935 & 45122807 & h-1, h-2, a, c, d, f, g & 7 & 10474873 & 16p11.1-q11.2 \\
\hline
16 & 45122807 & 47094922 & h-1, h-2, a, b, c, d, f, g & 8 & 1972116 & 16q11.2-q12.1 \\
\hline
17 & 29659797 & 32811528 & h-1, h-2, a & 3 & 3151732 & 17q12 \\
\hline
19 & 37676724 & 40349191 & h-1, h-2, a & 3 & 2672468 & 19q13.11-13.12 \\
\hline
21 & 19821557 & 20188026 & h-1, h-2, g & 3 & 366470 & 21q21.2 \\
\hline
\end{tabular}
\end{table}
|
PMC3105082_table_2
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
D—H···A & D—H & H···A & D···A & D—H···A \\
\hline
O1—H1···N1 & 0.82 & 1.85 & 2.562 (4) & 145 \\
\hline
\end{tabular}
\end{table}
|
PMC2968541_table_1
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Genes} & \textbf{Direction} & \textbf{Sequence} & \textbf{Length} \\
\hline
\multirow{2}{*}{Shh(m)} & Forward & TTCTGTGAAAGCAGAGAACTCC & 112 bp \\
\hline
Reverse & GGGACGTAAGTCCTTCACCA \\
\hline
\multirow{2}{*}{Shh(r)} & Forward & AGTGGACATCACCACGTCTG & 139 bp \\
\hline
Reverse & CACCGAGTTCTCTGCTTTCA \\
\hline
\multirow{2}{*}{Dhh(m)} & Forward & GGGACCTCGTACCCAACTAC & 90 bp \\
\hline
Reverse & CTTTGCAACGCTCTGTCATC \\
\hline
\multirow{2}{*}{Dhh(r)} & Forward & TTCAAGGATGAGGAGAACAGC & 58 bp \\
\hline
Reverse & GCTCTTTGCAACGCTCTGT \\
\hline
\multirow{2}{*}{Ihh(m)} & Forward & TTGCCTACAAGCAGTTCAGC & 142 bp \\
\hline
Reverse & CGTCCTTGAAGATGATGTCG \\
\hline
\multirow{2}{*}{Ihh(r)} & Forward & TCACTGGCCATCTCTGTCAT & 111 bp \\
\hline
Reverse & GCGGCCCTCATAGTGTAAAG \\
\hline
\multirow{2}{*}{Ptch1(m)} & Forward & GGTGGTTCATCAAAGTGTCG & 145 bp \\
\hline
Reverse & GGCATAGGCAAGCATCAGTA \\
\hline
\multirow{2}{*}{Ptch2 (m)} & Forward & TTGCACCTTTACTGCTCCAG & 97 bp \\
\hline
Reverse & TGTACCAAGGTGGCTCCATA \\
\hline
\multirow{2}{*}{Smo (m)} & Forward & GCAACAAGTATGGGTTGCTG & 87 bp \\
\hline
Reverse & CGCCAGTGAGTTATCAGCTT \\
\hline
\multirow{2}{*}{Gli1 (r)} & Forward & GGGACTATGTGCTATGCCAA & 131 bp \\
\hline
Reverse & AGTGCCAAACATGGCAAATA \\
\hline
\multirow{2}{*}{Il-10 (r)} & Forward & CCCAGAAATCAAGGAGCATT & 129 bp \\
\hline
Reverse & TCATTCTTCACCTGCTCCAC \\
\hline
\multirow{2}{*}{Gapdh(rodent)} & Forward & TCGGACCACCATTGTGATAG & 164 bp \\
\hline
Reverse & CATTTCCTGCTGTCTGCATT \\
\hline
\end{tabular}
\end{table}
|
PMC3431299_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Specificity} & \textbf{Specification} & \textbf{Working conc.} & \textbf{Source (Product no.)} \\
\hline
GRO-a & Rabbit polyclonal & mg/ml 2 & Peprotech (500-P92) \\
\hline
GRO-a & Mouse IgG1 & mg/ml 5 & R&D Systems (MAB275) \\
\hline
IL-8 & Mouse IgG1 & mg/ml 2 & Peprotech (500-M08) \\
\hline
MCP-1 & Mouse IgG2B & mg/ml 2 & R&D Systems (MAB679) \\
\hline
E-selectin & Mouse IgG1 & mg/ml 1 & Becton Dickinson (550023) \\
\hline
EEA-1 & Mouse IgG1 & mg/ml 1.2 & BD Transduction Laboratories (610457) \\
\hline
CD63 & Mouse IgG1 & mg/ml 2 & DSHB, University of Iowa (clone H5C6) \\
\hline
VWF & Rabbit polyclonal & 1/2000 & DAKO (A0082) \\
\hline
\end{tabular}
\end{table}
|
PMC3398041_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& & \multicolumn{3}{c|}{\textbf{CurrentDelay τ}} \\
\hline
& & \textbf{Zone 3} & \textbf{Zone 2} & \textbf{Zone 1} \\
\hline
\multirow{2}{*}{|x(t) − xeq|} & $\leq$ 0.1 & σ1 = 0.05 & σ2 = 0.2 & σ3 = 0.3 \\
\hline
> 0.1 & σ4 = 0.1 & σ5 = 0.7 & σ6 = 0.9 \\
\hline
\end{tabular}
\end{table}
|
PMC4507601_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\multirow{3}{*}{\textbf{Variable}} & \multirow{3}{*}{\textbf{Primigravidae (n = 189)}} & \multirow{3}{*}{\textbf{Gravidity Secundigravidae (n = 21)}} & \multirow{3}{*}{\textbf{Multigravidae (n = 72)}} \\
\hline
\\
\hline
\\
\hline
HIV infection & 83 (43.9\%) & 13 (61.9\%) & 44 (61.1\%) \\
\hline
Parasitemia & 38 (20.3\%) & 3 (14.3\%) & 4 (5.6\%) \\
\hline
anemiaa Maternal & 75 (39.7\%) & 11 (52.4\%) & 30 (41.7\%) \\
\hline
Birth Weight 6 SD, g & 29426404 & 29206606 & 29336552 \\
\hline
\end{tabular}
\end{table}
|
PMC2821912_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|}
\hline
& \textbf{Platform} & \textbf{Patients} & \textbf{Stage} & \textbf{Surgery} & \textbf{Operative time mean (min)} & \textbf{Blood loss mean (mL)} & \textbf{Mean lymph node count} & \textbf{Comprehensive surgicopathologic staging (\%) N} & \textbf{Complications} & \textbf{Port site relapse (\%) N} \\
\hline
& da Vinci & 102 & Ia–IVa & Radical hysterectomy & 237 & 109 & 22 & 102 (100\%) & 2 bowel injuries, 1 lymphocele, 1 vaginal dehiscence & Not reported \\
\hline
& da Vinci & 103 & Ia–IIIc & Radical hysterectomy & 283 & 75 & 33 & 102 (99\%) & 1 bowel injury, 2 lymphatic injuries, 0 vaginal dehiscence & Not reported \\
\hline
& da Vinci & 56 & Ia–IIIc & Radical hysterectomy & 177 & 105 & 19 & 56 (100\%) & 1 ileus, 1 respiratory failure, 4 vaginal dehiscences & Not reported \\
\hline
& da Vinci & 85 & Ia–II & Radical hysterectomy & 242 & 99 & 29 & 85 (100\%) & 11 (13\%) complications, 2 vaginal dehiscences & Not reported \\
\hline
& da Vinci & 100 & Ia–IIIc & Radical hysterectomy & 171 & 103 & 19 & 100 (100\%) & 5 (5\%) complications, 5 vaginal dehiscences & Not reported \\
\hline
& da Vinci & 25 & Ia–IIIc & Radical hysterectomy & 180 & 67 & 18 & 25 (100\%) & 2 vessel injuries, 2 thrombosis, 2 vaginal dehiscences & Not reported \\
\hline
\end{tabular}
\end{table}
|
PMC3236394_table_1
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \textbf{Control} & \textbf{Flax drink} & \textbf{Flax bread} & \textbf{P for diet} \\
\hline
Body weight (kg) & & & & NS \\
\hline
Before & 71.7 $\pm$ 10.1 & 71.9 $\pm$ 10.5 & 71.7 $\pm$ 10.2 \\
\hline
After & 71.4 $\pm$ 9.9 & 71.3 $\pm$ 10.0 & 71.1 $\pm$ 9.7 \\
\hline
Systolic BP (mmHg) & & & & NS \\
\hline
Before & 120.1 $\pm$ 9.6 & 124.1 $\pm$ 8.7 & 122.4 $\pm$ 10.2 \\
\hline
After & 120.5 $\pm$ 9.6 & 123.9 $\pm$ 9.0 & 123.0 $\pm$ 11.1 \\
\hline
Diastolic BP (mmHg) & & & & NS \\
\hline
Before & 68.4 $\pm$ 5.9 & 70.1 $\pm$ 5.9 & 69.1 $\pm$ 8.1 \\
\hline
After & 67.8 $\pm$ 5.2 & 69.5 $\pm$ 6.8 & 69.0 $\pm$ 7.0 \\
\hline
Triglyceride (mmol/l) & & & & NS \\
\hline
Before & 0.85 $\pm$ 0.31 & 0.87 $\pm$ 0.35 & 0.76 $\pm$ 0.25 \\
\hline
After & 0.71 $\pm$ 0.20 & 0.75 $\pm$ 0.22 & 0.71 $\pm$ 0.24 \\
\hline
Insulin (pmol/l) & & & & NS \\
\hline
Before & 26.2 $\pm$ 10.7 & 27.4 $\pm$ 10.2 & 26.3 $\pm$ +11.8 \\
\hline
After & 28.9 $\pm$ 10.4 & 26.2 $\pm$ 10.6 & 28.2 $\pm$ 12.8 \\
\hline
Glucose (mmol/l) & & & & NS \\
\hline
Before & 5.3 $\pm$ 0.3 & 5.4 $\pm$ 0.3 & 5.3 $\pm$ 0.4 \\
\hline
After & 5.3 $\pm$ 0.2 & 5.3 $\pm$ 0.3 & 5.3 $\pm$ 0.3 \\
\hline
Fecal parameters \\
\hline
Transit time (h) & 49.7 $\pm$ 3.1 & 43.9 $\pm$ 3.3 & 47.9 $\pm$ 3.3 & NS \\
\hline
Fecal excretion (g/d) & 121 $\pm$ 12 & 142 $\pm$ 13 & 119 $\pm$ 13 & NS \\
\hline
Excretion of DM (g/d) & 28 $\pm$ 2.2 & 33 $\pm$ 2.3 & 30 $\pm$ 2.3 & NS \\
\hline
\% DM in feces & 24.9 $\pm$ 1.1 & 25.0 $\pm$ 1.1 & 26.9 $\pm$ 1.1 & NS \\
\hline
Energy excretion (kJ/d) & a 565 $\pm$ 45 & b 694 $\pm$ 45 & ab 606 $\pm$ 44 & 0.053 \\
\hline
\% Energy excreted & a 4.51 $\pm$ 0.38 & b 5.51 $\pm$ 0.39 & ab 4.92 $\pm$ 0.39 & 0.061 \\
\hline
Fat excreted (g/d) & a 3.20 $\pm$ 0.30 & b 4.96 $\pm$ 0.31 & a 3.76 $\pm$ 0.31 & < 0.001 \\
\hline
\% Fat excreted & a 3.46 $\pm$ 0.33 & c 5.21 $\pm$ 0.33 & b 4.09 $\pm$ 0.34 & < 0.001 \\
\hline
\end{tabular}
\end{table}
|
PMC3307491_table_2
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
D—H···A & D—H & H···A & D···A & D—H···A \\
\hline
C2—H2···Cg3i & 0.93 & 2.84 & 3.778 (4) & 148 \\
\hline
C14—H14···Cg2ii & 0.93 & 2.97 & 3.658 (5) & 147 \\
\hline
\end{tabular}
\end{table}
|
PMC2984074_table_3
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Variable} & \textbf{No. of raw observations} & \textbf{Total ED visits 2001–2009 (estimated 1000s)} & \textbf{Annual ED visits (estimated 1000s)} & \textbf{Percentage of pediatric ED visits (95\% CI)} \\
\hline
Total ED visits & 322,745 & 1,052,914 & 116,990 & NA \\
\hline
Pediatric (age <18 years) ED visits 2001–2009 & 76,444 & 253,417 & 28,157 & NA \\
\hline
ED visits with “Infection” & 26,059 & 86,906 & 9,656 & 34.3 (33.5–35.1) \\
\hline
ED visits with “Organ Dysfunction” & 794 & 2,640 & 293 & 1.04 (0.94–1.15) \\
\hline
ED visits with severe sepsis + (“Infection” “Organ Dysfunction”) & 266 & 855 & 95 & 0.34 (0.29–0.39) \\
\hline
\end{tabular}
\end{table}
|
PMC3661074_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Variables} & \textbf{Number of participants (\%)} \\
\hline
Mean age of participants ( $\pm$SD) & 49(SD $\pm$ 11 years) \\
\hline
Age group* \\
\hline
<40 years & 55(20.1\%) \\
\hline
41-50 years & 98(35.9\%) \\
\hline
51-60 years & 86(31.5\%) \\
\hline
>60 years & 34(12.5\%) \\
\hline
Gender \\
\hline
Male & 155(57\%) \\
\hline
Female & 118(43\%) \\
\hline
Occupation^ \\
\hline
Labor & 66(24\%) \\
\hline
Employee & 72(26\%) \\
\hline
House Wife & 105(39\%) \\
\hline
Retired & 30(11\%) \\
\hline
Socioeconomic! \\
\hline
Low income & 95(35\%) \\
\hline
Middle income & 148(54\%) \\
\hline
High Income & 30(11\%) \\
\hline
Education Status \\
\hline
Uneducated & 45(17\%) \\
\hline
Primary (5 years) & 63(23\%) \\
\hline
Secondary(10 years) & 80(29\%) \\
\hline
Higher secondary & above (>10 years) & 85(31\%) \\
\hline
\end{tabular}
\end{table}
|
PMC3542150_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \textbf{Sham (n = 3)} & \multicolumn{2}{c|}{\textbf{Control (n = 13)}} & \multicolumn{2}{c|}{\textbf{AST-120 (n = 11)}} \\
\hline
& \textbf{\textbf{\textbf{4 weeks}}} & \textbf{\textbf{0 week}} & \textbf{\textbf{\textbf{4 weeks}}} & \textbf{\textbf{0 week}} & \textbf{\textbf{\textbf{4 weeks}}} \\
\hline
BW (g) & 493 $\pm$ 15 & 452 $\pm$ 22 & 490 $\pm$ 19 & 462 $\pm$ 17 & 486 $\pm$ 43 \\
\hline
SBP (mmHg) & 124 $\pm$ 7 ** & 173 $\pm$ 20 & 177 $\pm$ 21 & 169 $\pm$ 23 & 169 $\pm$ 24 \\
\hline
Cr (mg/dL) & 0.60 $\pm$ 0.10 ** & 1.03 $\pm$ 0.12 & 1.06 $\pm$ 0.26 & 1.04 $\pm$ 0.18 & 0.98 $\pm$ 0.26 \\
\hline
Ccr (mL/min) & 2.09 $\pm$ 0.29 ** & 1.06 $\pm$ 0.26 & 1.29 $\pm$ 0.38 & 1.11 $\pm$ 0.28 & 1.43 $\pm$ 0.4 \\
\hline
\end{tabular}
\end{table}
|
PMC3509710_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Score} & \textbf{0} & \textbf{1} & \textbf{2} & \textbf{3} & \textbf{4} \\
\hline
Serum bilirubin (reference range \textbf{3}–\textbf{2}\textbf{0} mmol/L) & <\textbf{1}\textbf{0}\textbf{0} & \textbf{1}\textbf{0}\textbf{0}–\textbf{1}5\textbf{0} & \textbf{1}5\textbf{1}–\textbf{2}\textbf{0}\textbf{0} & \textbf{2}\textbf{0}\textbf{1}–\textbf{3}\textbf{0}\textbf{0} & >\textbf{3}\textbf{0}\textbf{0} \\
\hline
Serum aspartate transaminase (reference range 7–\textbf{4}\textbf{0} IU/L) & <\textbf{1}\textbf{0}\textbf{0} & \textbf{1}\textbf{0}\textbf{0}–\textbf{1}5\textbf{0} & \textbf{1}5\textbf{1}–\textbf{2}\textbf{0}\textbf{0} & \textbf{2}\textbf{0}\textbf{1}–\textbf{3}\textbf{0}\textbf{0} & >\textbf{3}\textbf{0}\textbf{0} \\
\hline
Prothrombin time prolongation (seconds) & <\textbf{4} & \textbf{4}–8 & 9–\textbf{1}\textbf{2} & \textbf{1}\textbf{3}–\textbf{2}\textbf{0} & >\textbf{3}\textbf{0} \\
\hline
Patients with a WPI score $\geq$7 need urgent liver transplantation \\
\hline
\end{tabular}
\end{table}
|
PMC3189562_table_2
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{\textbf{Specimen ID}} & \textbf{\textbf{Genotype profile}} & \textbf{\textbf{Specimen ID}} & \textbf{\textbf{Genotype profile}} \\
\hline
1* & 6 & 47* & 6, 18 \\
\hline
2 & 6, 66, 40 & 48 & 6, 16, 53 \\
\hline
3 & 6,11,51,53 & 49* & 6 \\
\hline
4* & 6 & 50* & 6 \\
\hline
5* & 11 & 51 & 11, 35 \\
\hline
6 & 11, 55 & 52 & 11, 45 \\
\hline
7 & 39 & 53* & 6 \\
\hline
8 & 6, 18, 31, 33, 51, 66, 68, 70 & 54* & 6 \\
\hline
9 & 6, 51, 66 & 55 & 6, 39, 66 \\
\hline
10 & 11, 16, 66 & 56* & 6 \\
\hline
11 & 6, 11, 52, 53, 68 & 57* & 6 \\
\hline
12 & 6, 18, 33, 39, 52 & 58 & 6, 51 \\
\hline
13* & 11 & 59 & 11, 51, 53 \\
\hline
14 & 11, 53 & 60 & 11, 18, 52, 53, 59, 70 \\
\hline
15 & 31, 33, 53, 56 & 61 & 11, 16, 52, 74 \\
\hline
16 & 6, 31, 51, 66, 68 & 62 & 11, 16, 51, 66 \\
\hline
17 & 6, 59 & 63 & 6, 18, 31 \\
\hline
18 & 6, 53 & 64 & 11, 51, 53 \\
\hline
19* & 11 & 65 & 6, 33, 39, 51, 53 \\
\hline
20 & 6, 11, 66 & 66* & 6,16,18 \\
\hline
21 & 6, 45, 52, 53 & 67 & 18, 70 \\
\hline
22* & 6 & 68* & 6 \\
\hline
23* & 6 & 69* & 6, 11 \\
\hline
24* & 11 & 70 & 6, 16 \\
\hline
25* & 6, 18 & 71* & 6 \\
\hline
26 & 18, 53 & 72* & 6 \\
\hline
27* & 6 & 73* & 16 \\
\hline
28 & 33 & 74* & 11 \\
\hline
29 & 6, 51, 66 & 75 & 18, 51, 53 \\
\hline
30* & 11 & 76* & 11 \\
\hline
31 & 6, 11, 40, 31, 45, 53, 70 & 77 & 16, 45, 59 \\
\hline
32* & 6, 16, 18 & 78 & 40 \\
\hline
33 & 16, 33, 35, 51, 52 & 79 & 6, 18, 31, 53 \\
\hline
34* & 6 & 80 & 6, 16, 53 \\
\hline
35* & 11, 16 & 81* & 6 \\
\hline
36* & 6, 18 & 82 & 16, 18, 58 \\
\hline
37* & 6, 18 & 83* & 11 \\
\hline
38* & 6, 11 & 84 & 6, 18, 53, 68, 70 \\
\hline
39 & 6, 11, 31, 33, 35, 39 & 85 & 18, 45 \\
\hline
40* & 6 & 86 & 6, 51 \\
\hline
41 & 6, 31, 33, 40, 52, 53, 58, 68 & 87* & 6 \\
\hline
42 & 6, 11, 51 & 88* & 6 \\
\hline
43 & 6, 18, 45 & 89 & 16, 18, 51, 45 \\
\hline
44* & 6. 11 & 90 & 11, 18, 51 \\
\hline
45 & 11, 51 & 91 & 11, 51, 52 \\
\hline
46 & 11, 59 & 92 & 6, 16, 33 \\
\hline
\end{tabular}
\end{table}
|
PMC2724505_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
& \textbf{forward} & \textbf{backward} \\
\hline
off/off axle & m−1 0.44 & m−1 0.45 \\
\hline
off/on axle & m−1 0.46 & m−1 0.40 \\
\hline
\end{tabular}
\end{table}
|
PMC3673095_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
Rigaku R-AXIS RAPIDII diffractometer & 7981 reflections with I > 2σ(I) \\
\hline
mm-1 Detector resolution: 10.00 pixels & Rint = 0.025 \\
\hline
ω scans & θmax = 30.0º \\
\hline
Absorption correction: numerical (ABSCOR; Higashi, 1999) & h = −36→36 \\
\hline
Tmin = 0.855, Tmax = 0.930 & k = −9→8 \\
\hline
42942 measured reflections & l = −24→25 \\
\hline
9398 independent reflections \\
\hline
\end{tabular}
\end{table}
|
PMC2959702_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
Age (years) & 38.5 $\pm$ 11.5 (18-65) \\
\hline
Male/female, n & 240/68 \\
\hline
ISS & 25.5 $\pm$ 8.2 \\
\hline
$\geq$ 16, <25, n & 143 \\
\hline
$\geq$ 25, n & 165 \\
\hline
Injured body regions \\
\hline
Head, n (AIS points) & 115 (1.9 $\pm$ 1.7) \\
\hline
Thorax, n (AIS points) & 123 (3.3 $\pm$ 1.3) \\
\hline
Abdomen, n (AIS points) & 97 (3.0 $\pm$ 1.9) \\
\hline
Extremities, n(AIS points) & 165 (2.2 $\pm$ 1.1) \\
\hline
Number of regions injured \\
\hline
Two, n & 186 \\
\hline
Three, n & 99 \\
\hline
All four, n & 23 \\
\hline
Organ dysfunction \\
\hline
One, n & 95 \\
\hline
Two, n & 101 \\
\hline
Three or above, n & 59 \\
\hline
Sepsis, n (\%) & 147(47.7) \\
\hline
\end{tabular}
\end{table}
|
PMC2811917_table_1
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Nostoc sp. strain PCC 7120} & \textbf{asr0689} & \textbf{asr0690} & \textbf{\textbf{alr069}1} & \textbf{\textbf{alr069}2} & \textbf{alr069} \\
\hline
Nostoc punctiforme ATCC 29133 & Npun_R0366 & Npun_R0365 & Npun_R0367 & Npun_R0364 & Npun_R0363 \\
\hline
\end{tabular}
\end{table}
|
PMC3126725_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Product} & \multirow{2}{*}{\textbf{W/o herbicides}} & \multicolumn{2}{c|}{\textbf{With pre-emergent herbicides}} & \multicolumn{4}{c|}{\textbf{With \textbf{nap + met} and post-emergent herbicides}} & \multicolumn{4}{c|}{\textbf{With \textbf{glyp}hosate and post-emergent herbicides}} \\
\hline
& \textbf{glyp} & \textbf{nap + met} & \textbf{\textbf{paraq}} & \textbf{Halos} & \textbf{trif} & \textbf{rim} & \textbf{\textbf{paraq}} & \textbf{halos} & \textbf{glyp} + \textbf{trif} & \textbf{glyp} + \textbf{rim} \\
\hline
Midas@ 98:2 & 22.2 & 22.4 & 22.5 & 22.6 & 22.5 & 22.5 & 22.5 & 22.5 & 22.4 & 22.2 & 22.4 \\
\hline
Midas@ EC Bronze & 73.7 & 73.8 & 74 & 74.1 & 74 & 74 & 74 & 74 & 73.8 & 73.7 & 73.8 \\
\hline
Midas@ 50:50 & 79.5 & 79.6 & 79.7 & 79.9 & 79.7 & 79.7 & 79.8 & 79.8 & 79.6 & 79.5 & 79.6 \\
\hline
Midas@ Gold & 130 & 130.1 & 130.2 & 130.3 & 130.2 & 130.2 & 130.2 & 130.2 & 130.1 & 130 & 130.1 \\
\hline
Midas@ 33:67 & 138.7 & 138.9 & 139 & 139.1 & 139 & 139 & 139 & 139 & 138.9 & 138.7 & 138.9 \\
\hline
Midas@ 25:75 & 195.5 & 195.7 & 195.8 & 195.9 & 195.8 & 195.8 & 195.8 & 195.8 & 195.7 & 195.5 & 195.7 \\
\hline
Telone II +Pic & 93.9 & 94 & 94.1 & 94.3 & 94.1 & 94.1 & 94.2 & 94.2 & 94 & 93.9 & 94 \\
\hline
Telone C17 + Pic & 104.8 & 104.9 & 105 & 105.2 & 105 & 105 & 105 & 105.1 & 104.9 & 104.8 & 104.9 \\
\hline
Telone C35 + Pic & 121.7 & 121.9 & 122 & 122.1 & 122 & 122 & 122 & 122 & 121.9 & 121.7 & 121.9 \\
\hline
Pic Clor 60 + Pic & 148.5 & 148.6 & 148.7 & 148.8 & 148.7 & 148.7 & 148.7 & 148.7 & 148.6 & 148.5 & 148.6 \\
\hline
Telone II +Vapam & 68.6 & - & - & - & - & - & - & - & - & - & - \\
\hline
Telone C17 Vapam & 79.5 & - & - & - & - & - & - & - & - & - & - \\
\hline
Telone C35 +Vapam & 96.4 & - & - & - & - & - & - & - & - & - & - \\
\hline
Pic Clor 60+ Vapam & 123.1 & - & - & - & - & - & - & - & - & - & - \\
\hline
MeBr & 107.2 & - & - & - & - & - & - & - & - & - & - \\
\hline
\end{tabular}
\end{table}
|
PMC3290991_table_6
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Target Gene} & \textbf{Primer Name} & \textbf{Sequence (5’-3’)} & \textbf{Tm (°C)} & \textbf{G+C Content (\%)} & \textbf{Product Size (bp)} \\
\hline
\multirow{2}{*}{glyA} & F-JK & TGGCGGACATTTAACTCATGGTGC & 59.6 & 50 & 264 \\
\hline
R-JK & CCTGCCACAACAAGACCTGCAATA & 59.5 & 50 \\
\hline
\multirow{2}{*}{ask} & F-JK & GGCTCCTTTAATGGCCGCAAGATT & 59.8 & 50 & 306 \\
\hline
R-JK & AGACTATCGTCGCGTGATTTAGCG & 58.5 & 50 \\
\hline
\end{tabular}
\end{table}
|
PMC3199738_table_3
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Gene accession number} & \textbf{Primer/probe} & \textbf{Sequence} & \textbf{Product size (bp)} \\
\hline
\multirow{3}{*}{Human mithocondrial genome NC_012920} & Mito F & TTAAACACATCTCTGCCAAACC & 150 \\
\hline
Mito R & AGATTAGTAGTATGGGAGTGGGA \\
\hline
Mito P & AA CCC TAA CAC CAG CCT AAC CAG A \\
\hline
\multirow{3}{*}{β2M Human accession number M17987} & β2M F & CTTTCTGGCTGGATTGGTATCT & 100 \\
\hline
β2M R & CAGAATAGGCTGCTGTTCCTAC \\
\hline
β2M P & AG TAG GAA GGG CTT GTT CCT GCT G \\
\hline
\end{tabular}
\end{table}
|
PMC4392628_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Data Setb} & \textbf{Descriptionc} & \textbf{Number, TCAACCTTAT SAGE Tagsd} & \textbf{Data Set TCAACCTTAT, TAGS/Millione} & \textbf{Data Set, Total Tags in SAGE Libraryf} \\
\hline
GSM383793 & Mammary gland, DCIS-4, High Grade, Comedo & 10 & 165 & 60605 \\
\hline
GSM383790 & Mammary gland, IDC, Node+, Gr3, ER+, PR+ & 8 & 119 & 67070 \\
\hline
GSM383827 & Metastasis to Node, from Primary Gr3, ER-, PR- & 5 & 111 & 45087 \\
\hline
GSM383796 & Mammary gland, IDC-4 High Gr, Node-, ER-, erbB2-, p53+ & 7 & 109 & 64095 \\
\hline
GSM383794 & Mammary gland, DCIS, High Grade, Comedo & 4 & 93 & 43098 \\
\hline
GSM383795 & Mammary gland, IDC-3, Low Gr, Node-, ER+, erbB2-, p53- & 5 & 73 & 68891 \\
\hline
GSM383797 & Breast CA, IDC-5, Low Grade, ER+, erbB2-, p53- & 4 & 66 & 60451 \\
\hline
GSM383789 & Mammary gland, IDC, Node+, Gr3 ER-, PR-, & 1 & 25 & 39364 \\
\hline
GSM383828 & Metastasis to Node, from Primary Gr3, ER+, PR+ & 1 & 17 & 60343 \\
\hline
GSM383824 & Metastasis to Lung, Primary Gr3, ER+, PR-low, Her2- & 0 & N/A & 49794 \\
\hline
GSM383829 & Mammary gland, Gestational Hyperplasia & 1 & 16 & 61704 \\
\hline
\end{tabular}
\end{table}
|
PMC2876993_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Total} & \textbf{C-F} & \textbf{C-A} & \textbf{Phylotype} & \textbf{p-value} & \textbf{FDR} \\
\hline
47198 & 21705 & 25493 & Bacteria \\
\hline
4325 & 1288 & 3037 & Streptococcus sanguinis & 0 & 0 \\
\hline
3520 & 1205 & 2315 & Veillonella parvula & 0 & 0 \\
\hline
1220 & 697 & 523 & Granulicatella elegans & 0 & 0 \\
\hline
1220 & 381 & 839 & Streptococcus gordonii & 0 & 0 \\
\hline
1189 & 867 & 322 & Abiotrophia defectiva & 0 & 0 \\
\hline
865 & 168 & 697 & Campylobacter gracilis & 0 & 0 \\
\hline
643 & 544 & 99 & Campylobacter showae & 0 & 0 \\
\hline
633 & 420 & 213 & Streptococcus infantis & 0 & 0 \\
\hline
601 & 146 & 455 & Streptococcus constellatus & 0 & 0 \\
\hline
578 & 8 & 570 & Streptococcus mutans & 0 & 0 \\
\hline
359 & 269 & 90 & Fusobacterium nucleatum & 0 & 0 \\
\hline
350 & 266 & 84 & Selenomonas infelix & 0 & 0 \\
\hline
250 & 190 & 60 & Streptococcus australis & 0 & 0 \\
\hline
141 & 118 & 23 & Catonella morbi & 0 & 0 \\
\hline
93 & 85 & 8 & Veillonella criceti & 0 & 0 \\
\hline
81 & 73 & 8 & Capnocytophaga leadbetteri & 0 & 0 \\
\hline
511 & 158 & 353 & Campylobacter concisus & 6.358E212 & 2.500E211 \\
\hline
225 & 54 & 171 & Kingella denitrificans & 3.282E211 & 1.220E210 \\
\hline
76 & 62 & 14 & Veillonella sp. & 4.642E210 & 1.640E209 \\
\hline
48 & 1 & 47 & Streptococcus sobrinus & 1.020E209 & 3.430E209 \\
\hline
62 & 52 & 10 & Porphyromonas sp. & 2.109E209 & 6.780E209 \\
\hline
88 & 68 & 20 & Capnocytophaga sputigena & 3.765E209 & 1.160E208 \\
\hline
1302 & 702 & 600 & Gemella haemolysans & 5.810E209 & 1.710E208 \\
\hline
96 & 72 & 24 & Neisseria elongata & 1.133E208 & 3.200E208 \\
\hline
48 & 41 & 7 & Abiotrophia sp. & 4.158E208 & 1.130E207 \\
\hline
77 & 59 & 18 & Parvimonas micra & 6.722E208 & 1.760E207 \\
\hline
1421 & 557 & 864 & Neisseria subflava & 1.845E207 & 4.660E207 \\
\hline
26 & 25 & 1 & Prevotella sp. & 2.837E207 & 6.920E207 \\
\hline
101 & 72 & 29 & Lautropia mirabilis & 3.270E207 & 7.710E207 \\
\hline
49 & 40 & 9 & Fusobacterium canifelinum & 5.468E207 & 1.250E206 \\
\hline
74 & 55 & 19 & Neisseria sp. & 9.834E207 & 2.170E206 \\
\hline
370 & 124 & 246 & Streptococcus salivarius & 1.344E206 & 2.880E206 \\
\hline
47 & 38 & 9 & Selenomonas dianae & 1.601E206 & 3.330E206 \\
\hline
72 & 53 & 19 & Gemella sanguinis & 2.517E206 & 5.090E206 \\
\hline
273 & 88 & 185 & Streptococcus intermedius & 4.817E206 & 9.410E206 \\
\hline
58 & 44 & 14 & Neisseria bacilliformis & 4.925E206 & 9.410E206 \\
\hline
12047 & 5747 & 6300 & Streptococcus mitis & 1.168E205 & 2.170E205 \\
\hline
76 & 16 & 60 & Leptotrichia wadei & 1.271E205 & 2.250E205 \\
\hline
31 & 26 & 5 & Campylobacter rectus & 2.300E205 & 3.970E205 \\
\hline
2864 & 1424 & 1440 & Streptococcus oralis & 3.526E205 & 5.940E205 \\
\hline
112 & 73 & 39 & Porphyromonas catoniae & 4.503E205 & 7.400E205 \\
\hline
18 & 0 & 18 & Corynebacterium matruchotii & 9.021E205 & 1.450E204 \\
\hline
71 & 49 & 22 & Leptotrichia sp. & 9.780E205 & 1.540E204 \\
\hline
\end{tabular}
\end{table}
|
PMC3592792_table_1
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \textbf{U11} & \textbf{U22} & \textbf{U33} & \textbf{U12} & \textbf{U13} & \textbf{U23} \\
\hline
Zn1 & 0.0209 (3) & 0.0234 (3) & 0.0286 (3) & 0.0006 (2) & 0.0037 (2) & 0.0055 (2) \\
\hline
Cl2 & 0.0251 (6) & 0.0269 (6) & 0.0310 (6) & 0.0003 (5) & 0.0074 (5) & 0.0040 (5) \\
\hline
Cl3 & 0.0238 (6) & 0.0367 (7) & 0.0359 (7) & 0.0048 (5) & 0.0079 (5) & 0.0140 (5) \\
\hline
Cl4 & 0.0414 (7) & 0.0246 (6) & 0.0303 (6) & −0.0007 (5) & 0.0031 (5) & 0.0032 (5) \\
\hline
Cl5 & 0.0256 (6) & 0.0321 (7) & 0.0434 (8) & −0.0064 (5) & −0.0049 (5) & 0.0156 (6) \\
\hline
S6 & 0.0210 (6) & 0.0287 (6) & 0.0299 (6) & 0.0014 (5) & 0.0004 (5) & 0.0036 (5) \\
\hline
C7 & 0.018 (2) & 0.024 (2) & 0.031 (3) & 0.0051 (18) & 0.0061 (19) & 0.004 (2) \\
\hline
N8 & 0.022 (2) & 0.025 (2) & 0.034 (2) & 0.0004 (16) & 0.0037 (17) & 0.0024 (18) \\
\hline
C9 & 0.028 (3) & 0.024 (2) & 0.028 (2) & 0.0062 (19) & 0.009 (2) & 0.002 (2) \\
\hline
C10 & 0.032 (3) & 0.021 (2) & 0.028 (3) & 0.003 (2) & 0.004 (2) & −0.003 (2) \\
\hline
C11 & 0.045 (3) & 0.025 (3) & 0.029 (3) & −0.001 (2) & 0.004 (2) & −0.001 (2) \\
\hline
C12 & 0.061 (4) & 0.026 (3) & 0.032 (3) & −0.009 (3) & 0.013 (3) & −0.003 (2) \\
\hline
C13 & 0.043 (3) & 0.029 (3) & 0.044 (3) & 0.002 (2) & 0.023 (3) & −0.004 (2) \\
\hline
C14 & 0.026 (3) & 0.030 (3) & 0.045 (3) & 0.001 (2) & 0.010 (2) & 0.001 (2) \\
\hline
N15 & 0.026 (2) & 0.035 (2) & 0.029 (2) & −0.0015 (18) & 0.0020 (18) & 0.0060 (19) \\
\hline
N16 & 0.034 (2) & 0.028 (2) & 0.032 (2) & −0.0031 (19) & 0.0012 (19) & 0.0066 (19) \\
\hline
C17 & 0.023 (2) & 0.026 (2) & 0.032 (3) & −0.0024 (19) & 0.007 (2) & 0.006 (2) \\
\hline
S18 & 0.0268 (6) & 0.0231 (6) & 0.0308 (6) & −0.0029 (5) & 0.0068 (5) & 0.0054 (5) \\
\hline
C19 & 0.021 (2) & 0.029 (3) & 0.034 (3) & 0.0000 (19) & 0.010 (2) & 0.006 (2) \\
\hline
C20 & 0.028 (3) & 0.027 (3) & 0.035 (3) & 0.002 (2) & 0.011 (2) & 0.005 (2) \\
\hline
C21 & 0.029 (3) & 0.031 (3) & 0.030 (3) & −0.007 (2) & 0.008 (2) & −0.002 (2) \\
\hline
C22 & 0.029 (3) & 0.019 (2) & 0.041 (3) & −0.0046 (19) & 0.010 (2) & −0.004 (2) \\
\hline
C23 & 0.028 (3) & 0.022 (2) & 0.036 (3) & −0.0003 (19) & 0.011 (2) & 0.004 (2) \\
\hline
C24 & 0.022 (2) & 0.025 (2) & 0.032 (3) & 0.0034 (19) & 0.011 (2) & 0.003 (2) \\
\hline
N25 & 0.028 (2) & 0.0190 (19) & 0.031 (2) & 0.0027 (16) & 0.0072 (18) & 0.0060 (17) \\
\hline
\end{tabular}
\end{table}
|
PMC3120423_table_1
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
& \multicolumn{4}{c|}{\textbf{All participants}} & \multicolumn{4}{c|}{\textbf{\textbf{\textbf{\textbf{\textbf{P}}}}atients with RA}} \\
\hline
& \multicolumn{2}{c|}{\textbf{With subclinical atherosclerosis N = 16/74}} & \multicolumn{2}{c|}{\textbf{With plaque N = 15/ 74}} & \multicolumn{2}{c|}{\textbf{With subclinical atherosclerosis N = 15/42}} & \multicolumn{2}{c|}{\textbf{With plaque N = 12/ 42}} \\
\hline
& \textbf{\textbf{\textbf{\textbf{β}}}} & \textbf{\textbf{\textbf{\textbf{P}}}} & \textbf{\textbf{\textbf{\textbf{β}}}} & \textbf{\textbf{\textbf{\textbf{P}}}} & \textbf{\textbf{\textbf{\textbf{β}}}} & \textbf{\textbf{\textbf{\textbf{P}}}} & \textbf{\textbf{\textbf{\textbf{β}}}} & \textbf{\textbf{\textbf{\textbf{P}}}} \\
\hline
Age (years) & 0.145 & 0.003a & 0.152 & 0.003a & 0.202 & 0.002 & 0.154 & 0.008a \\
\hline
ESR (mm/h) & 0.045 & 0.005 & 0.038 & 0.010 & 0.027 & ns & 0.030 & ns \\
\hline
Fibrinogen (g/l) & 1.006 & 0.005 & 1.061 & 0.004 & 0.666 & ns & 0.852 & 0.041 \\
\hline
RF positive (\%) & 2.185 & 0.002 & 1.213 & 0.047 & 1.497 & ns & 1.063 & ns \\
\hline
vWF (\% activity) & 1.290 & 0.026 & 0.897 & ns & 1.535 & 0.045 & 0.263 & ns \\
\hline
Smoking habits (cigarettes/day) & 0.065 & ns & 0.062 & ns & 0.181 & 0.037a & 0.072 & ns \\
\hline
Rheumatoid arthritis presence & 2.846 & 0.008a & 1.352 & 0.049a & NA & & NA \\
\hline
\end{tabular}
\end{table}
|
PMC4527675_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{Outpatient Rehab (n = 53)} & \textbf{Transition Care (n = 29)} & \textbf{Total (n = 82)} \\
\hline
Attachment \\
\hline
I can have all of the love and friendship that I want & 34 (64.2\%) & 13 (44.8\%) & 47 (57.3\%) \\
\hline
I can have some of the love and friendship that I want & 13 (24.5\%) & 12 (41.8\%) & 25 (30.5\%) \\
\hline
I can have a little of the love and friendship that I want & 5 (9.4\%) & 4 (13.8\%) & 9 (11.0\%) \\
\hline
I cannot have any of the love and friendship that I want & 1 (1.9\%) & - & 1 (1.2\%) \\
\hline
Security \\
\hline
I can think about the future without any concern & 17 (32.1\%) & 14 (48.3\%) & 31 (37.8\%) \\
\hline
I can think about the future with only a little concern & 21 (39.6\%) & 8 (27.6) & 29 (35.4\%) \\
\hline
I can only think about the future with some concern & 9 (17.0\%) & 7 (24.1\%) & 16 (19.5\%) \\
\hline
I can only think about the future with a lot of concern & 6 (11.3\%) & - & 6 (7.3\%) \\
\hline
Role \\
\hline
I am able to do all of the things that make me feel valued & 13 (24.5\%) & 7 (24.1\%) & 20 (24.4\%) \\
\hline
I am able to do many of the things that make me feel valued & 20 (37.4\%) & 8 (27.6\%) & 28 (34.2\%) \\
\hline
I am able to do a few of the things that make me feel valued & 15 (28.3\%) & 9 (31.0\%) & 24 (29.3\%) \\
\hline
I am unable to do any of the things that make me feel valued & 5 (9.43\%) & 5 (17.2\%) & 10 (12.2\%) \\
\hline
Enjoyment \\
\hline
I can have all of the enjoyment and pleasure that I want & 18 (34.00\%) & 9 (31.0\%) & 27 (32.9\%) \\
\hline
I can have a lot of the enjoyment and pleasure that I want & 22 (41.5\%) & 9 (31.0\%) & 31 (37.8\%) \\
\hline
I can have a little of the enjoyment and pleasure that I want & 12 (22.6\%) & 9 (31.0\%) & 21 (25.6\%) \\
\hline
I cannot have any of the enjoyment and pleasure that I want & 1 (1.9\%) & 2 (6.9\%) & 3 (3.7\%) \\
\hline
Control \\
\hline
I am able to be completely independent & 13 (24.5\%) & 2 (6.9\%) & 15 (18.3\%) \\
\hline
I am able to be independent in many things & 25 (47.2\%) & 16 (55.2\%) & 41 (50.0\%) \\
\hline
I am able to be independent in a few things & 13 (24.5\%) & 9 (31.0\%) & 22 (26.8\%) \\
\hline
I am unable to be at all independent & 2 (3.8\%) & 2 (6.9\%) & 4 (4.9\%) \\
\hline
\end{tabular}
\end{table}
|
PMC3439273_table_1
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{\textbf{\textbf{miRNA}}} & \textbf{\textbf{\textbf{fold change}}} & \textbf{\textbf{\textbf{P_Value}}} & \textbf{\textbf{\textbf{miRNA}}} & \textbf{\textbf{\textbf{fold change}}} & \textbf{\textbf{\textbf{P_Value}}} & \textbf{\textbf{\textbf{miRNA}}} & \textbf{\textbf{\textbf{fold change}}} & \textbf{\textbf{\textbf{P_Value}}} \\
\hline
miR-145 & -16.393 & 0.000 & let-7c & -3.636 & 0.003 & miR-422a & -2.793 & 0.010 \\
\hline
miR-143 & -7.194 & 0.000 & let-7b & -3.623 & 0.003 & miR-199b-3p & -2.646 & 0.011 \\
\hline
miR-99b & -5.566 & 0.001 & miR-365 & -3.484 & 0.003 & miR-199a-3p & -2.632 & 0.014 \\
\hline
miR-99a & -5.348 & 0.001 & miR-28–5p & -3.401 & 0.003 & miR-10b & -2.577 & 0.016 \\
\hline
miR-451 & -5.051 & 0.001 & miR-574–3p & -3.300 & 0.004 & miR-140–3p & -2.558 & 0.016 \\
\hline
miR-23b & -4.630 & 0.001 & miR-378i & -3.185 & 0.004 & miR-10a & -2.342 & 0.021 \\
\hline
miR-100 & -4.608 & 0.001 & miR-27b & -3.058 & 0.006 & miR-409–5p & -2.222 & 0.023 \\
\hline
miR-125b & -4.386 & 0.001 & miR-26a & -2.985 & 0.007 & miR-181c & -2.058 & 0.028 \\
\hline
miR-768–3p & -4.219 & 0.001 & miR-126 & -2.950 & 0.009 & miR-150 & -1.976 & 0.030 \\
\hline
miR-125a-5p & -4.184 & 0.001 & miR-195 & -2.950 & 0.009 & let-7i & -1.876 & 0.032 \\
\hline
miR-214 & -3.774 & 0.002 & let-7g & -2.817 & 0.009 \\
\hline
\end{tabular}
\end{table}
|
PMC4372559_table_4
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Pi yin name} & \textbf{Latin name} & \textbf{Part used} & \textbf{Weight} & \textbf{Chinese medicine treatment functions} \\
\hline
Ma Huang & Ephedra sinica Stapf. & Stems & 154 g & Ma Huang resolves the exterior and diffuses the lungs, stops coughing, and levels panting. \\
\hline
Gui Zhi & Cinnamomum cassia Presl. & Twigs and branches & 154 g & Gui Zhi resolves the exterior and scatters cold. When combined with Ma Huang, Gui Zhi strengthens Ma Huang’s function of promoting diaphoresis. \\
\hline
Bai Shao & Paeonia lactiflora Pall. & Roots & 154 g & Bai Shao is used to harmonize the blood to regulate qi. \\
\hline
Gan Jiang & Zingiber officinale Rosc. & Rhizomes & 154 g & Gan Jian scatter cold, dispel dampness. \\
\hline
Xi Xin & Asarum heterotropoides Fr. Schm. & Whole & 77 g & Xi Xin prevents wind cold. \\
\hline
Zhi Gan Cao & Glycyrrhiza uralensis Fisch. & Roots & 154 g & Mix-fried Gan Cao harmonizes the other medicinal in this formula. \\
\hline
Fa Ban Xia & Pinellia ternate (Thunb.) Breit. & Rhizomes & 231 g & Ban Xia transforms phlegm and down bears the qi. \\
\hline
Wu Wei Zi & Schisandra chinensis (Turcz.) Baill. & Fruits & 154 g & Wu Wei Zi engenders fluids, constrains the lung qi, and helps stabilize panting. \\
\hline
\end{tabular}
\end{table}
|
PMC3574648_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \textbf{Panic disorder (ms)} & \textbf{Control (ms)} & \textbf{t value} & \textbf{P value (2-tailed t-test)} \\
\hline
Class A & 63.81 (14.71) & 54.55 (10.14) & 2.20 & .035 \\
\hline
Class B & 58.47 (10.47) & 61.03 (13.75) & 2.63 & n.s. \\
\hline
Class C & 64.21 (18.92) & 66.63 (18.17) & 2.39 & n.s. \\
\hline
Class D & 83.40 (25.34) & 74.14 (17.62) & 1.27 & n.s. \\
\hline
\end{tabular}
\end{table}
|
PMC3146502_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{Coal}} & \multicolumn{2}{c|}{\textbf{Wood}} \\
\hline
\textbf{Cancer Site} & \textbf{\textbf{Studies}} & \textbf{\textbf{OR* (95\% CI)}} & \textbf{\textbf{Studies}} & \textbf{\textbf{OR* (95\% CI)}} \\
\hline
Cervical & 1 & 3.46 (1.08- 11.10) & 2 & 10.29 (3.27- 32.40) \\
\hline
Oral & 1 & 1.47 (0.19- 11.67) & 3 & 2.45 (1.81- 3.30) \\
\hline
Nasopharyngeal & 1 & 1.86 (1.28- 2.72) & 5 & 1.77 (1.07- 2.91) \\
\hline
Pharyngeal & 2 & 3.35 (1.08-10.39) & 3 & 2.56 (1.20- 5.49) \\
\hline
Esophageal & 1 & 1.50 (0.48- 4.71) & 2 & 2.13 (1.05 – 4.30) \\
\hline
Laryngeal & 2 & 4.45 (2.03- 9.74) & 3 & 1.54 (0.81- 2.94) \\
\hline
\end{tabular}
\end{table}
|
PMC4377187_table_3
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{Improved >5°} & \textbf{Stable +-5°} & \textbf{Progressed > 5°} \\
\hline
Total cases (1338 cases) & 899 67.19\% & 372 27.80\% & 67 5.00\% \\
\hline
Group Risser 0 (174 cases) & 85 48.89\% & 54 31.11\% & 35 20\% \\
\hline
\end{tabular}
\end{table}
|
PMC3069938_table_5
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{Group A (HTN)}} & \multirow{2}{*}{\textbf{\textbf{\textbf{value P}}}} & \multicolumn{2}{c|}{\textbf{Group B (non-HTN)}} & \multirow{2}{*}{\textbf{\textbf{\textbf{value P}}}} & \multicolumn{2}{c|}{\textbf{All}} & \multirow{2}{*}{\textbf{\textbf{\textbf{value P}}}} \\
\hline
& \textbf{\textbf{\textbf{Phase I (−KRG)}}} & \textbf{\textbf{\textbf{Phase II (+KRG)}}} & \textbf{\textbf{\textbf{Phase I (−KRG)}}} & \textbf{\textbf{\textbf{Phase II (+KRG)}}} & \textbf{\textbf{\textbf{Phase I (−KRG)}}} & \textbf{\textbf{\textbf{Phase II (+KRG)}}} \\
\hline
BW predialysis (Kg) & 65.3 $\pm$ 15.5 & 65.4 $\pm$ 15.4 & 0.862 & 61.6 $\pm$ 18.8 & 61.7 $\pm$ 18.8 & 0.218 & 63.4 $\pm$ 17.2 & 63.4 $\pm$ 17.1 & 0.415 \\
\hline
BW postdialysis (Kg) & 62.7 $\pm$ 15.0 & 62.8 $\pm$ 15.0 & 0.296 & 59.0 $\pm$ 18.1 & 58.9 $\pm$ 18.1 & 0.888 & 60.7 $\pm$ 16.6 & 60.7 $\pm$ 16.6 & 0.994 \\
\hline
Dry BW (Kg) & 62.5 $\pm$ 15.0 & 62.6 $\pm$ 15.0 & 0.054 & 59.0 $\pm$ 18.1 & 59.0 $\pm$ 18.2 & 0.386 & 60.7 $\pm$ 16.6 & 60.7 $\pm$ 16.6 & 0.282 \\
\hline
Target UF (L) & 2.6 $\pm$ 1.0 & 2.6 $\pm$ 0.9 & 0.616 & 2.7 $\pm$ 1.0 & 2.8 $\pm$ 1.1 & 0.322 & 2.6 $\pm$ 1.0 & 2.7 $\pm$ 1.0 & 0.33 \\
\hline
Actual UF (L) & 2.8 $\pm$ 1.1 & 2.7 $\pm$ 1.0 & 0.850 & 2.7 $\pm$ 1.1 & 3.0 $\pm$ 1.6 & 0.198 & 2.7 $\pm$ 1.1 & 2.9 $\pm$ 1.4 & 0.338 \\
\hline
\% target UF & 100.0 21.5 $\pm$ & 106.4 39.1 $\pm$ & 0.231 & 103.8 10.4 $\pm$ & 103.0 10.6 $\pm$ & 0.794 & 102.0 16.5 $\pm$ & 104.6 27.6 $\pm$ & 0.319 \\
\hline
\end{tabular}
\end{table}
|
PMC3356894_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Lab findings (reference limits)} & \textbf{Admission} & \textbf{ICU Day 1} & \textbf{Day 2} & \textbf{Day 3} & \textbf{Day 4} & \textbf{Day 5} & \textbf{Day 6} & \textbf{Day 7} \\
\hline
Troponin T (norm < 0,1 μg/l) & 0,3 & 0,62 & 0,72 & 0,31 & 0,31 & 0,2 \\
\hline
Ejection fraction (norm > 53\%) & 30 & - & - & 45 & - & - & 55 \\
\hline
Vasopressor therapy & + & + & + \\
\hline
Mechanical ventilation & + & + & + & + & + & + & + & + \\
\hline
WBC 103/μl (3,8-10,8 × & 32 & 16 & 15,5 & 7 & 7 & 8 & 6 \\
\hline
103/μl) Platelets (150-450 × & 132 & 115 & 79 & 24 & 38 & 58 & 71 & 104 \\
\hline
PTT (20-36 sec.) & 65 & 45 & 38 & 36 & 30 \\
\hline
INR (norm 1,0) & 1,2 & 1,4 & 1,5 & 1,3 & 1,1 & 1,1 \\
\hline
D-Dimer (< 0,5 mg/l) & >4 & >4 & >4 & >4 & >4 & >4 \\
\hline
CRP < 10 mg/l & <1 & 7,5 & 84 & 126 & 78 & 46 & 35 \\
\hline
Creatinine (61,9-106 μmol/l) & 182 & 118 & 140 & 160 & 114 & 94 & 88 \\
\hline
Base excess ($\pm$ 2) & -20,7 & NR & NR & NR & NR & NR & NR & NR \\
\hline
pH (7,35-7,45) & 6,9 & NR & NR & NR & NR & NR & NR & NR \\
\hline
Lactate (0,55-2,2 mmol/l) & 17,1 & NR & NR & NR & NR & NR & NR & NR \\
\hline
ASAT (10-45 U/l) & 1927 & 1495 & 936 & 638 & 492 \\
\hline
\end{tabular}
\end{table}
|
PMC2827361_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
Bruker APEXII CCD area-detector diffractometer & 1660 reflections with I > 2σ(I) \\
\hline
Radiation source: fine-focus sealed tube & Rint = 0.034 \\
\hline
graphite & θmax = 26.4°, θmin = 2.7° \\
\hline
φ and ω scans & h = −7→10 \\
\hline
8707 measured reflections & k = −13→10 \\
\hline
2122 independent reflections & l = −26→25 \\
\hline
\end{tabular}
\end{table}
|
PMC3151905_table_1
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Characteristic} & \textbf{N} \\
\hline
Staff clinical role \\
\hline
Ancillary staff & 6 \\
\hline
\textbf{N}urse & 43 \\
\hline
Physician & 36 \\
\hline
Hospital police & 21 \\
\hline
Gender \\
\hline
Male & 44 \\
\hline
Female & 62 \\
\hline
Age group \\
\hline
21 to 25 & 2 \\
\hline
26 to 30 & 36 \\
\hline
31 to 35 & 14 \\
\hline
36 to 40 & 13 \\
\hline
41 to 45 & 12 \\
\hline
46 to 50 & 9 \\
\hline
51 to 55 & 11 \\
\hline
56 or older & 9 \\
\hline
\end{tabular}
\end{table}
|
PMC4651583_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \textbf{U11} & \textbf{U22} & \textbf{U33} & \textbf{U12} & \textbf{U13} & \textbf{U23} \\
\hline
N1 & 0.0359 (13) & 0.0329 (15) & 0.0509 (16) & −0.0098 (12) & 0.0133 (11) & −0.0121 (14) \\
\hline
O1 & 0.0304 (11) & 0.0629 (16) & 0.0810 (15) & −0.0155 (11) & 0.0121 (10) & −0.0133 (14) \\
\hline
C2 & 0.0326 (15) & 0.0445 (19) & 0.0402 (15) & −0.0056 (14) & 0.0077 (12) & −0.0024 (14) \\
\hline
N2 & 0.0345 (13) & 0.0397 (15) & 0.0424 (14) & −0.0085 (12) & 0.0127 (11) & −0.0152 (12) \\
\hline
O2 & 0.0342 (10) & 0.0475 (13) & 0.0588 (12) & −0.0081 (11) & 0.0064 (9) & −0.0169 (11) \\
\hline
C3 & 0.0330 (14) & 0.0476 (19) & 0.0453 (17) & −0.0025 (15) & 0.0073 (12) & −0.0029 (15) \\
\hline
O3 & 0.0322 (9) & 0.0479 (13) & 0.0481 (11) & −0.0059 (10) & 0.0115 (8) & −0.0154 (10) \\
\hline
O4 & 0.0389 (11) & 0.0542 (15) & 0.0574 (13) & −0.0152 (11) & 0.0138 (9) & −0.0229 (12) \\
\hline
C5 & 0.0346 (15) & 0.0343 (18) & 0.0359 (14) & −0.0045 (13) & 0.0125 (11) & 0.0009 (13) \\
\hline
C6 & 0.0299 (13) & 0.0330 (16) & 0.0305 (14) & −0.0062 (12) & 0.0088 (10) & −0.0015 (13) \\
\hline
C7 & 0.0410 (17) & 0.077 (3) & 0.077 (2) & −0.0029 (19) & 0.0215 (15) & −0.028 (2) \\
\hline
C8 & 0.0330 (14) & 0.0361 (18) & 0.0351 (14) & −0.0045 (13) & 0.0072 (11) & −0.0050 (13) \\
\hline
C9 & 0.0340 (14) & 0.0340 (17) & 0.0375 (15) & −0.0004 (13) & 0.0077 (11) & −0.0011 (14) \\
\hline
C10 & 0.0370 (15) & 0.0457 (19) & 0.0394 (16) & 0.0007 (15) & 0.0091 (12) & −0.0102 (15) \\
\hline
C11 & 0.112 (3) & 0.051 (2) & 0.063 (2) & −0.001 (2) & 0.050 (2) & −0.003 (2) \\
\hline
C12 & 0.091 (3) & 0.039 (2) & 0.069 (2) & 0.002 (2) & 0.035 (2) & −0.0075 (19) \\
\hline
\end{tabular}
\end{table}
|
PMC3297942_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \multirow{2}{*}{\textbf{CPAP adherence ,4 h/night n = 491}} & \multirow{2}{*}{\textbf{CPAP adherence $4 h/night n = 1820}} & \multirow{2}{*}{\textbf{Odds Ratio}} & \multirow{2}{*}{\textbf{95\% CI}} & \multirow{2}{*}{\textbf{P-value}} \\
\hline
\\
\hline
Sleep apnea characteristics \\
\hline
Apnea-hypopnea index, events/hour & 37.76619.61 & 41.43620.73 & 0.991 & [0.986; 0.996] & 0.0007 \\
\hline
SpO2,90\%, \% of recording time & 14.07618.42 & 16.91620.02 & 0.992 & [0.986; 0.998] & 0.0143 \\
\hline
Technical aspects of CPAP treatment \\
\hline
CPAP treatment modalities \\
\hline
auto-adjusted pressure vs constant, \% & 88.20 & 86.50 & 1.160 & [0.854; 1.574] & 0.3415 \\
\hline
Additional heated Humidification, \% & 31.40 & 31.40 & 0.989 & [0.798; 1.227] & 0.9219 \\
\hline
Type of interface, \% (nasal as reference) \\
\hline
Nasal & 50.30 & 65.70 & \multicolumn{2}{c|}{Overall test} & ,0.0001 \\
\hline
Oronasal & 37.30 & 23.20 & 2.090 & [1.676; 2.608] & ,0.0001 \\
\hline
Nasal pillows & 12.40 & 11.10 & 1.439 & [1.047; 1.978] & 0.0249 \\
\hline
Effective pressure level ($9 vs ,9 cmH2O) & 8.6462.44 & 9.0962.38 & 0.768 & [0.623; 0.946] & 0.0013 \\
\hline
CPAP-related side-effects \\
\hline
Nasal Congestion, \% & 15.90 & 11.20 & 1.485 & [1.119; 1.970] & 0.0061 \\
\hline
Ocular irritation, \% & 8.10 & 6.40 & 1.301 & [0.895; 1.892] & 0.1677 \\
\hline
Dry mouth, \% & 33.40 & 23.20 & 1.650 & [1.328; 2.050] & ,0.0001 \\
\hline
Choking sensation under CPAP, \% & 23.60 & 6.30 & 4.603 & [3.472; 6.102] & ,0.0001 \\
\hline
Headaches, \% & 3.50 & 3.10 & 1.115 & [0.643; 1.935] & 0.6984 \\
\hline
Psychologically percieved inconveniance, \% & 28.50 & 10.50 & 3.403 & [2.658; 4.357] & ,0.0001 \\
\hline
Family tolerance, \% & 7.30 & 7.40 & 1.000 & [0.682; 1.466] & 0.9993 \\
\hline
Aerophagia, \% & 4.30 & 3.80 & 1.116 & [0.678; 1.837] & 0.6669 \\
\hline
\end{tabular}
\end{table}
|
PMC3654912_table_3
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \multirow{2}{*}{\textbf{Control (n = 15)}} & \multirow{2}{*}{\textbf{PBS (n = 19)}} & \multirow{2}{*}{\textbf{serum (n = 9)}} & \multirow{2}{*}{\textbf{endometriotic fluid (n = 10)}} & \multirow{2}{*}{\textbf{Pa}} \\
\hline
\\
\hline
ICM & 25.4 $\pm$ 6.0 & 20.7 $\pm$ 6.5 & 23.3 $\pm$ 4.8 & 18.7 $\pm$ 7.7 & 0.0555 \\
\hline
TE & 38.7 $\pm$ 7.4 & 38.6 $\pm$ 8.1 & 44.6 $\pm$ 9.7 & 37.3 $\pm$ 10.8 & 0.2745 \\
\hline
Total & 64.1 $\pm$ 8.1 & 59.3 $\pm$ 9.9 & 67.9 $\pm$ 11.7 & 55.9 $\pm$ 14.1 & 0.0653 \\
\hline
\end{tabular}
\end{table}
|
PMC3551806_table_1
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{Location} & \textbf{Design} & \textbf{Outcome} & \textbf{N} & \textbf{Risk factors} & \textbf{Protective factors} & \textbf{Reference} \\
\hline
Bihar, India & Household level case-control & Kala-azar & 48 case, 46 control HH & ,0.001)1, Mud plastered house (4.45, migration into village (3.1, ,0.05), ,0.05), vegetation near house (2.8, proximity to prior case (not quantified) & & [28] \\
\hline
Central Terai, \textbf{N}epal & Case-control & Kala-azar & 84 cases, 105 controls & Cracked mud house walls (2.3, ,0.05), palpably damp floor (4.0, ,0.01), ,0.05), sleeps outside warm months (2.0, laborer as household head (2.8, ,0.01) & Owns cow or buffalo (0.34, ,0.01), sleeps under bed net in warm months p,0.001), (0.2, sleeps on cot (0.44, p,0.01), $3 rooms (0.27, p,0.001) & [30] \\
\hline
Bihar, India & Case-control & Kala-azar & 134 cases, 406 controls & Another disease in past year (3.6, ,0.01), history of kala-azar in household (1.8, ,0.05), mud walls (2.4, ,0.001), granary in house (4.3, ,0.001), bamboo near house (2.3 (,0.01), house not sprayed in past 6 months (3.4, ,0.001) & & [31] \\
\hline
Uttar Pradesh, India & Cross-sectional & Kala-azar & 2203 & Previous kala-azar case in household (42.2, ,0.001), sleeps outside, $3 people per room, increasing cattle density (1.24, ,0.01 in village 1; in village 2), age $15 years (2.2, p,0.05) & \textbf{N}S2 Bed net use (but ownership low) & [26] \\
\hline
Mymensingh, Bangladesh & Cross-sectional & Kala-azar & 2356 & Previous kala-azar case in same household (25.6, ,0.001) or within 50 m (2.9, ,0.001), ,0.001) age 3–45 years (3.7, & Always sleeps in net in warm months (0.69, ,0.01), each additional cow per m2 ,0.01) 1000 (0.81, & [27] \\
\hline
Mymensingh, Bangladesh & Hospital-based case-control & Kala-azar & 60 cases, 60 controls & Mud house (28.9, ,0.001), sleeping on floor (2.1, p not given) & Bed net use \textbf{N}S & [34] \\
\hline
\multicolumn{2}{c|}{Studies of subclinical} \\
\hline
West Bengal, India & Cross-sectional & Positive LST & 150 & Increasing age, proximity to previous case of kala-azar3 & & [10] \\
\hline
Eastern Terai, \textbf{N}epal & Cross-sectional & Positive serology & 373 & [1.6–8.5]4), Proximity to ponds (3.7 family size $6 (4.4 [1.6–12.6]), mud house (3.0 [1.1–7.6]), age $15 years (5.5 [1.2–25.0]) & Bed net use \textbf{N}S & [32] \\
\hline
West Bengal, India & Retrospective cohort & Seroconver- sion over 1 year & 751 & Water body within 25 m (2.1 [1.4–4.5]), house dampness (2.4 [1.7–3.7]), livestock ownership (2.1[1.5–3.8]), Muslim religion (1.7 [1.3–2.4]) & Sleeps inside (0.6[0.4–0.8]), sleeps clothed (0.5[0.5–0.7]), always sleeps under bed net (0.7[0.5–0.9]) & [33] \\
\hline
Mymensingh, Bangladesh & Cross-sectional & Positive LST & 1379 & Previous kala-azar case in same household (2.86, ,0.001) or within 50 m (1.72, ,0.01), each 10-year increase in age (1.48, ,0.001), m2 additional cow per 1000 (1.17, ,0.05) & Bed net use \textbf{N}S & [7] \\
\hline
Mymensingh, Bangladesh & Cross-sectional & Positive serology & 1379 & Previous kala-azar case in same household (1.85, ,0.05), each 10-year increase in age ,0.05) (1.12, & Bed net use \textbf{N}S & [7] \\
\hline
Mymensingh, Bangladesh & Cross-sectional & Kala-azar vs seropositive & 1379 & Previous kala-azar case in same household (2.85, ,0.01) & Consumption of beef or goat at least twice per month (0.49, ,0.05), each 10-year increase in age (0.74, ,0.001) & [7] \\
\hline
\end{tabular}
\end{table}
|
PMC2817719_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{Pneumonia patients (n = 135/185)}} & \multicolumn{2}{c|}{\textbf{Control subjects (n = 22/25)}} \\
\hline
& \textbf{\textbf{Monomicrobial}} & \textbf{\textbf{Polymicrobial}} & \textbf{\textbf{Monomicrobial}} & \textbf{\textbf{Polymicrobial}} \\
\hline
Case number & 32 & 82 & 3 & 15 \\
\hline
Age, yr (SD) & 58.5 (13.9) & 62.9 (14.7) & 74 (13.4) & 54.2 (17.3) \\
\hline
Male gender & 16 & 46 & 3 & 7 \\
\hline
Female gender & 16 & 36 & 0 & 8 \\
\hline
Immunocompromized & 15 & 20 & 1 & 4 \\
\hline
ARDS & 15 & 19 & 0 & 4 \\
\hline
CPIS (SD) & 3.7 (1.8) & 3.6 (1.7) & 4.6 (0.5) & 4 (1.4) \\
\hline
SOFA score (SD) & 6.9 (3.1) & 6.7 (3.6) & 6.3 (3.7) & 5.4 (2.6) \\
\hline
Radiologic score (SD) & 5.5 (2.9) & 4.8 (3.2) & 3.6 (3.2) & 5.3 (2.8) \\
\hline
uC Temperature, (SD) & 37.6 (1) & 37.8 (1.7) & 37.2 (1.2) & 37.6 (1.4) \\
\hline
Initial antibiotic therapy & 18 & 33 & 2 & 9 \\
\hline
Less than 2 days prior to sampling & 6 & 17 & 0 & 3 \\
\hline
3 days or more prior to sampling & 12 & 16 & 2 & 6 \\
\hline
Length of ICU stay prior to sampling, d (SD) & 6.1 (9.1) & 6.3 (10) & 1.6 (1.1) & 13.1 (15.6) \\
\hline
Total length of hospital stay, d (SD) & 26 (29.7) & 28.2 (23.3) & 4.3 (1.5) & 36.6 (35.9) \\
\hline
Length of MV prior to sampling, d (SD) & 6.8 (10.3) & 7.1 (11.2) & 1.3 (0.5) & 6.3 (7.2) \\
\hline
Sepsis & 7 & 19 & 0 & 3 \\
\hline
Septic shock & 15 & 38 & 1 & 7 \\
\hline
ICU mortality (\%) & 16 (50) & 23 (28) & 1 (33) & 3 (20) \\
\hline
\end{tabular}
\end{table}
|
PMC3289664_table_1
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
Enraf–Nonius CAD-4 diffractometer & Rint = 0.031 \\
\hline
Monochromator: graphite & θmax = 30.0º \\
\hline
T = 298(2) K & θmin = 2.3º \\
\hline
ω/2θ scans & h = −17→18 \\
\hline
Absorption correction: multi-scan (SADABS; Sheldrick, 1996) & k = −17→17 \\
\hline
Tmin = 0.121, Tmax = 0.145 & l = −17→17 \\
\hline
10422 measured reflections & 2 standard reflections \\
\hline
2912 independent reflections & every 150 reflections \\
\hline
2734 reflections with I > 2σ(I) & intensity decay: 2\% \\
\hline
\end{tabular}
\end{table}
|
PMC2961625_table_1
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Group} & \textbf{Number} & \textbf{Age, mean years ($\pm$ SD)} & \textbf{(M/F)a Sex} & \textbf{mean/105 ($\pm$ Proviral load cell SD)} & \textbf{First reported symptoms, mean years ($\pm$ SD)} \\
\hline
Non-infected & 31 & 45.7 (612.2) & 9/22 & N/Ab & N/A \\
\hline
HACc & 26 & (612.9) 42.9 & 11/15 & (62,312.2) 2,105.4 & N/A \\
\hline
HAM/TSPd & 19 & (69.1) 54.9 & 4/15 & (63,544.6) 6,180.9 & (69.7) 13 \\
\hline
\end{tabular}
\end{table}
|
PMC3527467_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Characteristics} & \multicolumn{2}{c|}{\textbf{Total patients}} \\
\hline
& \textbf{No} & \textbf{\%} \\
\hline
Male & 322 & 168 \\
\hline
Female & 34 & 66 \\
\hline
\textbf{No} formal education & 76 & 16 \\
\hline
School educated & 360 & 73 \\
\hline
College educated & 54 & 11 \\
\hline
,35 Age: years & 168 & 34 \\
\hline
.35 years & 322 & 66 \\
\hline
Marital status: Single & 164 & 33 \\
\hline
Married & 281 & 57 \\
\hline
Separated/ Divorced/ Widowed & 45 & 9 \\
\hline
Occupation: Unemployed & 202 & 41 \\
\hline
Daily wages & 91 & 19 \\
\hline
Self-employed & 42 & 9 \\
\hline
Salaried & 130 & 26 \\
\hline
Others & 25 & 5 \\
\hline
Income: ,Rs 2500 & 68 & 14 \\
\hline
Rs 2501–Rs 5000 & 216 & 44 \\
\hline
.Rs 5000 & 179 & 36 \\
\hline
\textbf{No}t applicable & 27 & 6 \\
\hline
Treatment Category: Category I & 299 & 61 \\
\hline
Category II & 85 & 17 \\
\hline
Category III & 106 & 22 \\
\hline
Rx phase: Intensive Phase & 46 & 9 \\
\hline
Continuation Phase & 444 & 91 \\
\hline
\end{tabular}
\end{table}
|
PMC3096635_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \multicolumn{4}{c|}{\textbf{NF1 marker}} & \multicolumn{2}{c|}{\textbf{MPNST marker}} \\
\hline
& \textbf{IFN-γ} & \textbf{EGFR} & \textbf{IL-6} & \textbf{TNF-α} & \textbf{IGFBP1} & \textbf{RANTES} \\
\hline
Sensitivity: & 90,4 & 90,4 & 90,4 & 90,4 & 90,0 & 90,0 \\
\hline
Specificity: & 70,7 & 14,6 & 51,2 & 68,3 & 50,0 & 25,7 \\
\hline
NPV & 88,0 & 60,3 & 84,2 & 87,7 & 79,3 & 72,0 \\
\hline
PPV & 75,5 & 51,4 & 64,9 & 74,0 & 65,9 & 58,1 \\
\hline
cut off (ng/ml): & 0,15 & 8,57 & 0,34 & 0,59 & 13,77 & 30,72 \\
\hline
\end{tabular}
\end{table}
|
PMC3648455_table_1
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
Name & Helen V. Kosmidis \\
\hline
Country & Greece \\
\hline
Position & Director of Paediatric Oncology Department \\
\hline
Institution & Children’s Hospital ‘Aglaia Kyriajou’ Athens \\
\hline
\end{tabular}
\end{table}
|
PMC3223943_table_7
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\multicolumn{2}{c|}{\textbf{Mesh type}} & \textbf{Composition} & \textbf{Degradation mechanism} & \textbf{Resorption time} \\
\hline
\textbf{DEXON} & \textbf{Covidien (Mansfield, MA)} & \textbf{Polyglycolic acid (PGA)} & \textbf{Hydrolysis} & \textbf{2-3 months} \\
\hline
VICRYL & Ethicon, Inc. (Somerville, NJ) & Copolymer of glycolide and lactide & \textbf{Hydrolysis} & \textbf{2-3 months} \\
\hline
GORE BIO-A & W.L. Gore & Assoc., Inc. (Flagstaff, AZ) & Copolymer of poly(glycolide: trimethylene carbonate) & \textbf{Hydrolysis} and enzymatic mechanisms & 6 months \\
\hline
TIGR Matrix & Novus Scientific (Uppsala, Sweden) & \multicolumn{3}{c|}{Comprised of 2 fibers with differing composition and resorption time} \\
\hline
\multicolumn{2}{c|}{Fiber no. 1} & Copolymer of polyglycolide, polylactide, and polytrimethylene carbonate & \textbf{Hydrolysis} & 4 months \\
\hline
\multicolumn{2}{c|}{Fiber no. 2} & Copolymer of polylactide and polytrimethylene carbonate & \textbf{Hydrolysis} & 36 months \\
\hline
PHASIX & C. R. Bard, Inc./Davol Inc. (Warwick, RI) & Poly-4-hydroxybutyrate (P4HB) & \textbf{Hydrolysis} and enzymatic mechanisms & 12–18 months \\
\hline
\end{tabular}
\end{table}
|
PMC3679684_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Variables} & \textbf{Total} & \multicolumn{2}{c|}{\textbf{Number of patients (\%)}} & \textbf{Chi-square test} \\
\hline
& & \textbf{EDA low expression} & \textbf{EDA high expression} & \textbf{P value} \\
\hline
Age (year) \\
\hline
,61 & 49 & 15 (30.6) & 34 (69.4) & 0.092a \\
\hline
$61 & 66 & 14 (21.2) & 52 (78.8) \\
\hline
Gender \\
\hline
Male & 64 & 19 (29.7) & 45 (70.3) & 0.078a \\
\hline
Female & 51 & 10 (19.6) & 41 (80.4) \\
\hline
Lymph node metastasis \\
\hline
Present & 44 & 6 (13.6) & 38 (86.4) & 0.014a \\
\hline
Absent & 71 & 23 (32.4) & 48 (67.6) \\
\hline
Grade \\
\hline
well and moderately differentiated & 85 & 25 (29.4) & 60 (70.6) & 0.041b \\
\hline
poorly and non-differentiated & 30 & 4 (13.3) & 26 (86.7) \\
\hline
Clinical stage \\
\hline
early stage & 65 & 21 (32.3) & 44 (67.7) & 0.026a \\
\hline
advanced stage & 50 & 8 (16.0) & 42 (84.0) \\
\hline
\end{tabular}
\end{table}
|
PMC3322170_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Variable} & \textbf{KK5 Contribution (\%)} & \textbf{KK15 Contribution (\%)} \\
\hline
Tree Cover & 31.69 & 33.55 \\
\hline
Annual Mean Temperature & 23.35 & 3.41 \\
\hline
Mean Diurnal Temperature Range & 6.45 & 15.15 \\
\hline
Precipitation Warmest Quarter & 0.56 & 23.03 \\
\hline
\end{tabular}
\end{table}
|
PMC3289636_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Sample number} & \textbf{Name of sample} & \textbf{Source} \\
\hline
1 & \textbf{King of chrysanthemum buds} & Hangzhou, Zhejiang \\
\hline
2 & Chrysanthemum buds & Huangshan, Anhui \\
\hline
3 & Chrysanthemum buds & Sheyang, Jiangsu \\
\hline
4 & Chrysanthemum buds & Tongxiang, Zhejiang \\
\hline
5 & Chrysanthemum buds & Jiaozuo, Henan \\
\hline
6 & Chrysanthemum buds & Linyi, Shandong \\
\hline
7 & Chrysanthemum buds & Lin’an, Zhejiang \\
\hline
8 & Chrysanthemum buds & Kunming, Yunnan \\
\hline
9 & Chrysanthemum buds & Yulin, Guangxi \\
\hline
10 & Chrysanthemum buds & Bozhou, Anhui \\
\hline
11 & Chrysanthemum morifolium & Hangzhou, Zhejiang \\
\hline
12 & Chrysanthemum indicum & Bozhou, Anhui \\
\hline
\end{tabular}
\end{table}
|
PMC4430653_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Age at stopfollow} & \textbf{All individuals} & \textbf{Cancer cases (\%)} \\
\hline
0-4 & 551,205 & 3,405 (0.62) \\
\hline
5-9 & 508,742 & 2,277 (0.45) \\
\hline
10-14 & 566,083 & 2,017 (0.36) \\
\hline
15-19 & 585,185 & 2,753 (0.47) \\
\hline
20-24 & 493,490 & 3,728 (0,76) \\
\hline
25-29 & 454,454 & 5,161 (1.14) \\
\hline
30-34 & 446,358 & 6,537 (1.46) \\
\hline
35-39 & 411,925 & 8,014 (1.95) \\
\hline
40-44 & 376,844 & 12,213 (2.71) \\
\hline
45-49 & 296,309 & 13,364 (4.51) \\
\hline
50-54 & 273,077 & 17,052 (6.24) \\
\hline
55-59 & 276,905 & 20,842 (7.53) \\
\hline
60-64 & 264,047 & 20,190 (7.65) \\
\hline
65-69 & 178,049 & 14,516 (8.15) \\
\hline
70- & 109,678 & 4,827 (4.40) \\
\hline
All & 5,657,455 & 134,896 (2.33) \\
\hline
\end{tabular}
\end{table}
|
PMC3103479_table_1
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{First author} & \textbf{Year} & \textbf{S1} & \textbf{S2} & \textbf{S3} & \textbf{S4} & \textbf{C1a} & \textbf{C1b} & \textbf{O1} & \textbf{O2} & \textbf{O3} & \textbf{OQ} \\
\hline
Bieli † [10] & 2007 & * & * & * & - & * & * & - & * & - & +/− \\
\hline
Bottema [26] & 2010 & * & * & NA & * & - & - & - & * & - & +/− \\
\hline
Custovic [62] & 2011 & * & * & - & * & * & * & - & * & * & + \\
\hline
Eder † [25] & 2004 & * & * & * & - & * & * & - & * & - & +/− \\
\hline
Ege † [22] & 2007 & * & * & * & - & * & * & - & * & - & +/− \\
\hline
Fageras Bottcher † [39] & 2004 & - & * & * & - & * & * & * & * & - & +/− \\
\hline
Guerra [11] & 2004 & * & * & - & * & * & * & - & - & - & +/− \\
\hline
Jones [48] & 2002 & - & * & NA & * & - & - & - & - & - & – \\
\hline
Kabesch † [13] & 2004 & * & * & NA & * & - & - & - & * & - & +/− \\
\hline
Kerkhof [56] & 2010 & * & * & * & * & * & * & - & * & - & + \\
\hline
Lange [63] & 2011 & * & * & NA & - & * & * & * & * & - & + \\
\hline
Lodrup Carlsen [51] & 2010 & * & * & NA & * & * & * & - & * & * & + \\
\hline
O’Donnell [36] & 2004 & * & * & NA & - & * & * & - & * & * & + \\
\hline
Reijmerink [41] & 2010 & * & * & NA & * & - & - & - & * & - & +/− \\
\hline
Rothenbacher [53] & 2005 & * & * & * & * & * & * & - & - & * & + \\
\hline
Simpson [8] & 2006 & * & * & * & * & * & * & - & * & * & + \\
\hline
Snijders † [52] & 2006 & * & * & * & * & * & * & - & - & * & + \\
\hline
Soferman [54] & 2004 & - & * & NA & * & * & * & * & * & * & + \\
\hline
\end{tabular}
\end{table}
|
PMC3602113_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
D—H···A & D—H & H···A & D···A & D—H···A \\
\hline
O3—H3···O2 & 0.84 & 1.77 & 2.5171 (19) & 146 \\
\hline
O1—H1···O2i & 0.84 & 1.81 & 2.6475 (19) & 174 \\
\hline
\end{tabular}
\end{table}
|
PMC3089340_table_3
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|}
\hline
& \textbf{Leadership} & \textbf{Culture} & \textbf{Evaluation} & \textbf{Social Capital} & \textbf{Formal Interactions} & \textbf{Informal Interactions} & \textbf{Structural/ Electronic Resources} & \textbf{Org Slack– Staff} & \textbf{Org Slack– Space} & \textbf{Org Slack– Time} \\
\hline
\textbf{Leadership} & 1.000 \\
\hline
\textbf{Culture} & 0.611 & 1.000 \\
\hline
\textbf{Evaluation} & 0.409 & 0.534 & 1.000 \\
\hline
\textbf{Social Capital} & 0.115 & 0.235 & 0.201 & 1.000 \\
\hline
\textbf{Formal Interactions} & 0.393 & 0.608 & 0. 367 & 0.390 & 1.000 \\
\hline
\textbf{Informal Interactions} & 0.400 & 0.628 & 0.465 & 0.185 & 0.510 & 1.000 \\
\hline
\textbf{Structural/ Electronic Resources} & 0.225 & 0.347 & 0.438 & 0.777 & 0.440 & 0.289 & 1.000 \\
\hline
\textbf{Org Slack– Staff} & 0.166 & 0.265 & 0.346 & 0.663 & 0.353 & 0.257 & 0.886 & 1.000 \\
\hline
\textbf{Org Slack– Space} & 0.136 & 0.221 & 0.282 & 0.544 & 0.249 & 0.148 & 0.664 & 1.00 & 1.000 \\
\hline
\textbf{Org Slack– Time} & 0.082 & 0.149 & 0.186 & 0.332 & 0.199 & 0.188 & 0.320 & 0.447 & 0.369 & 1.000 \\
\hline
\end{tabular}
\end{table}
|
PMC4476584_table_4
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Model} & \textbf{R2Y†} & \textbf{Q2†} & \textbf{CV-ANOVA} \\
\hline
All class & 0.446 & 0.358 & 0.0005 \\
\hline
Control-treated & 0.982 & 0.976 & 3.05E-07 \\
\hline
Formula-treated & 0.985 & 0.980 & 2.30E-08 \\
\hline
Control-formula & 0.864 & 0.464 & 0.367* \\
\hline
\end{tabular}
\end{table}
|
PMC4412571_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Lamb behaviour} & \textbf{Ewe sniffing and licking} & \textbf{Ewe orientation} \\
\hline
Abnormal ventral lying & rs = 0.194, P = 0.084 & rs = 0.256, P = 0.022 \\
\hline
Abnormal lateral lying & rs = 0.312, P = 0.005 & rs = 0.541, P<0.001 \\
\hline
Abnormal standing & rs = 0.308, P = 0.005 & rs = 0.464, P<0.001 \\
\hline
Active Pain Behaviour & rs = 0.403, P<0.001 & rs = 0.579, P<0.001 \\
\hline
Active Pain Behaviour + tail wag & rs = 0.487, P<0.001 & rs = 0.540, P<0.001 \\
\hline
Restlessness & rs = 0.482, P<0.001 & rs = 0.524, P<0.001 \\
\hline
REQ & rs = 0.490, P<0.001 & rs = 0.592, P<0.001 \\
\hline
REW & rs = 0.527, P<0.001 & rs = 0.563, P<0.001 \\
\hline
Teat-seeking (L1) & rs = 0.071, P = 0.534 & rs = -0.161, P = 0.155 \\
\hline
\end{tabular}
\end{table}
|
PMC4517774_table_3
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \textbf{bb (n = 134)} & \textbf{Bb (n = 215)} & \textbf{BB (n = 107)} & \textbf{P-value} \\
\hline
Follow-up time $\pm$ SD (years) & 4,6 $\pm$ 0,7 & 4,6 $\pm$ 1,2 & 4,6 $\pm$ 1,0 & 0,949 \\
\hline
Age $\pm$ SD (years) & 64,4 $\pm$ 7,7 & 65,2 $\pm$ 8,0 & 63,4 $\pm$ 8,2 & 0,165 \\
\hline
Height SD (m) $\pm$ & 1,53 0,06 $\pm$ & 1,53 0,06 $\pm$ & 1,51 0,07 $\pm$ & 0,079 \\
\hline
Weight SD (kg) $\pm$ & 64 10,7 $\pm$ & 63,1 10,8 $\pm$ & 62 10,2 $\pm$ & 0,343 \\
\hline
Annual percentage weight change $\pm$ SD & 1,34 $\pm$ 4,27 & 0,42 $\pm$ 3,85 & 0,41 $\pm$ 3,98 & 0,083 \\
\hline
BMI $\pm$ SD (kg/cm2) & 27,23 $\pm$ 4,86 & 26,93 $\pm$ 5,14 & 27,13 $\pm$ 5,56 & 0,862 \\
\hline
Energy intake $\pm$ SD (kcal) & 2274,9 $\pm$ 759,4 & 2257,4 $\pm$ 691,7 & 2253,3 $\pm$ 664,0 & 0,967 \\
\hline
Calcium intake SD (gr/day) (crude) $\pm$ & 1193,5 473,9 $\pm$ & 1249,1 506,6 $\pm$ & 1156,9 468,1 $\pm$ & 0,296 \\
\hline
Calcium intake $\pm$ SD (gr/day) (energy adjusted) & 1191,2 $\pm$ 41,1 & 1249,8 $\pm$ 32,7 & 1158,4 $\pm$ 46,1 & 0,069 \\
\hline
Baseline FN BMD $\pm$ SD (g/cm2) & 0,700 $\pm$ 0,092 & 0,713 $\pm$ 0,058 & 0,691 $\pm$ 0,103 & 0,096 \\
\hline
Follow-up FN BMD $\pm$ SD (g/cm2) & 0,685 $\pm$ 0,093 & 0,683 $\pm$ 0,093 & 0,689 $\pm$ 0,0952 & 0,844 \\
\hline
Baseline TR BD (g/cm2) $\pm$ & 0,557 0,086 $\pm$ & 0,562 0,084 $\pm$ & 0,541 0,082 $\pm$ & 0,132 \\
\hline
Follow-up TR BMD (g/cm2) $\pm$ & 0,572 0,097 $\pm$ & 0,567 0,083 $\pm$ & 0,576 0,084 $\pm$ & 0,653 \\
\hline
Baseline L2-L4 BMD $\pm$ (g/cm2) & 0,747 $\pm$ 0,070 & 0,737 $\pm$ 0,071 & 0,768 $\pm$ 0,069 & 0,409 \\
\hline
Follow-up L2-L4 BMD $\pm$ (g/cm2) & 0,759 $\pm$ 0,087 & 0,750 $\pm$ 0,089 & 0,755 $\pm$ 0,091 & 0,597 \\
\hline
Baseline Ad-SoS (m/s) & 2001,719 $\pm$ 68,418 & 2002,71 $\pm$ 74,896 & 2013,66 $\pm$ 77,127 & 0,386 \\
\hline
Follow-up Ad-Sos (m/s) & 1928,169 100,260 $\pm$ & 1929,164 100,027 $\pm$ & 1940,35 114,861 $\pm$ & 0,609 \\
\hline
\end{tabular}
\end{table}
|
PMC4579091_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{residues} & \textbf{group} & \textbf{VMMS–1} & \textbf{NMR[36]} \\
\hline
Asn1 & α-NH3 & 9.5$\pm$0.5 & 7.7$\pm$0.1 \\
\hline
Asp11 & β-COOH & 2.7$\pm$0.4 & 3.9$\pm$0.05 \\
\hline
His22 & imidazole & 7.5$\pm$0.5 & 6.8$\pm$0.1 \\
\hline
Glu24 & γ-COOH & 4.6$\pm$0.3 & 4.1$\pm$0.1 \\
\hline
Asp27 & β-COOH & 4.5$\pm$0.5 & 4.0$\pm$0.1 \\
\hline
Asp40 & β-COOH & 3.5$\pm$0.5 & 3.6$\pm$0.1 \\
\hline
Asp46 & β-COOH & 5.5$\pm$0.5 & 3.8$\pm$0.1 \\
\hline
Glu51 & γ-COOH & 5.4$\pm$0.5 & ~4 \\
\hline
Arg53 & α-COOH & 4.6$\pm$0.4 & 3.5$\pm$0.1 \\
\hline
\end{tabular}
\end{table}
|
PMC4624693_table_2
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\multirow{2}{*}{\textbf{Gene}} & \multicolumn{2}{c|}{\textbf{Number of Exons}} & \multirow{2}{*}{\textbf{Sequencing Size (bp)}} & \multirow{2}{*}{\textbf{Polymorphism Typea}} & \multirow{2}{*}{Location in \textbf{Gene}} & \multirow{2}{*}{\textbf{Genomic Locationb}} & \multirow{2}{*}{\textbf{Concordancec}} \\
\hline
\textbf{Total} & \textbf{Sequenced} \\
\hline
GDF15 & 2 & 2 & 1067 & A to T non-syn T/S & Exon 2 & 4,704,137 & 3/4 \\
\hline
LSM4 & 5 & 2 & 486 & — & & & 0 \\
\hline
JUND & 1 & 1 & 302 & — & & & 0 \\
\hline
KIAA1683 & 6 & 6 & 3586 & 37 SNPs & & & 9/10 \\
\hline
\multirow{5}{*}{CIST1} & 4 & 4 & 1623 & T to C non-syn V/A & Exon 1 & 4,911,890 & 4/5 \\
\hline
& & & C to T non-syn T/M & Exon 2 & 4,914,545 & 9/10 \\
\hline
& & & C to A non-syn L/M & Exon 2 & 4,914,833 & 8/10 \\
\hline
& & & A to G 39 UTR & Exon 4 & 4,916,672 & 0/3 \\
\hline
& & & T to G & Intron 12 & 4,920,670 & 3/5 \\
\hline
\end{tabular}
\end{table}
|
PMC3276122_table_1
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Gene} & \textbf{Primers} & \textbf{Primer sequences} & \textbf{Cell lines} & \textbf{Fold-difference} \\
\hline
\multirow{4}{*}{BTG2 (1q32.1)} & BTG2-RT 3f/3r & (59-gaaccgacatgctccc-39) (59-cagtggtgtttgtagtga-39) & ICF 1 vs. C 1 & 22.142 (p = 0.001) \\
\hline
& & ICF 2 vs. C2 & 25.460 (p = 0.013) \\
\hline
BTG2-RT 4f/4r & (59-aataaaagccaaacct-39) (59-gctttccacttttctcca-39) & ICF 1 vs. C 1 & 22.071 (p = 0.004) \\
\hline
& & ICF 2 vs. C 2 & 22.624 (p = 0.001) \\
\hline
\multirow{4}{*}{CNN3 (1p21.3)} & CNN3-RT 3f/3r & (59-taacattacagccggtgg-39) (59-aggagcagcacagtatt-39) & ICF 1 vs. C 1 & +2.046 (p = 0.001) \\
\hline
& & ICF 2 vs. C2 & +4.854 (p = 0.001) \\
\hline
CNN3-RT 4f/4r & (59-gcaattggatagaagagg-39) (59-ggactcgttgaccttct-39) & ICF 1 vs. C 1 & +2.104 (p = 0.001) \\
\hline
& & ICF 2 vs. C2 & +2.019 (p = 0.001) \\
\hline
\multirow{2}{*}{ID3 (1p36.12)} & ID3-RT 4f/4r & (59-caaactatgccaaggcg-39) (59-cgcattgttacagaaagtca-39) & ICF 1 vs. C1 & 22.432 (p = 0.012) \\
\hline
& & ICF 2 vs. C 2 & 22.556 (p = 0.001) \\
\hline
\multirow{4}{*}{RGS1 (1q31.2)} & RGS1-RT 3f/3r & (59-acagatagtatcaagcgca-39) (59-gcgcctggataactttc-39) & ICF 1 vs. C1 & +2.847 (p = 0.001) \\
\hline
& & ICF 2 vs. C2 & +4.512 (p = 0.004) \\
\hline
RGS1-RT 4f/4r & (59-aagcgcagaaggaatg-39) (59-gcgcctggataactttca-39) & ICF 1 vs. C1 & +2.898 (p = 0.001) \\
\hline
& & ICF 2 vs. C2 & +2.107 (p = 0.005) \\
\hline
\multirow{4}{*}{F13A1 (6p25.1)} & F13A1-RT 1f/1r & (59-cgtcaacctgcaagag-39) (59-cgaccaatgacgtattcc-39) & ICF 1 vs. C1 & +1.472 (p = 0.001) \\
\hline
& & ICF 2 vs. C 2 & +3.517 (p = 0.001) \\
\hline
F13A1-RT 1f/2r & (59-cgtcaacctgcaagag-39) (59-acatagaaagactgccct-39) & ICF 1 vs. C 1 & +5.378 (p = 0.009) \\
\hline
& & ICF 2 vs. C2 & +2.843 (p = 0.001) \\
\hline
\end{tabular}
\end{table}
|
PMC2894064_table_3
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Assay} & \textbf{Cells} & \textbf{Average IC50 (nM)} \\
\hline
Inhibition of IL-6-induced pSTAT3 & U937 & 0.4 \\
\hline
Inhibition of IL-6-induced pSTAT3 & Human monocytes & 3.1 \\
\hline
Inhibition of IL-6-induced proliferation & B9 & 0.7 \\
\hline
\end{tabular}
\end{table}
|
PMC4640888_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{Depth} & \textbf{n = 2} & \textbf{n = 3} & \textbf{n = 4} & \textbf{n = 6} & \textbf{n = 8} & \textbf{n = 12} \\
\hline
\textbf{25\%} & \textbf{\textbf{0.02}} & \textbf{\textbf{0.02}} & \textbf{0.04} & \textbf{\textbf{\textbf{0.03}}} & \textbf{\textbf{\textbf{0.03}}} & \textbf{\textbf{\textbf{0.03}}} \\
\hline
50\% & \textbf{\textbf{\textbf{0.03}}} & \textbf{\textbf{\textbf{0.03}}} & \textbf{0.04} & 0.05 & \textbf{0.04} & \textbf{\textbf{\textbf{0.03}}} \\
\hline
75\% & \textbf{0.04} & 0.06 & 0.05 & 0.07 & \textbf{0.04} & \textbf{0.04} \\
\hline
100\% & \textbf{0.04} & 0.06 & 0.06 & 0.06 & 0.05 & \textbf{0.04} \\
\hline
\end{tabular}
\end{table}
|
PMC3560154_table_1
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Reference} & \textbf{Sex} & \textbf{Age} & \textbf{ANCA} & \textbf{Vasculitis Classification} & \textbf{Kidney} & \textbf{ENT} & \textbf{Organ Lungs} & \textbf{Involvement Eyes} & \textbf{Skin} & \textbf{Joints} & \textbf{Non-valvular cardiac lesion} \\
\hline
Stöllberger [19] & M & 56 & \textbf{ANCA} -, anti-PR3 + & Unknown & Yes & - & - & - & Yes & Yes & - \\
\hline
Levine [15] & M & 28 & - & Wegener’s granulomatosis & Yes & Yes & Yes & - & - & - & Yes \\
\hline
\multirow{2}{*}{Davenport [6]} & M & 19 & c-\textbf{ANCA} +, anti-PR3 + & Wegener’s granulomatosis & Yes & Yes & Yes & Yes & Yes & Yes & - \\
\hline
M & 53 & c-\textbf{ANCA} +, anti-PR3 + & Wegener’s granulomatosis & Yes & - & - & - & - & - & Yes \\
\hline
Grant [10] & M & 32 & c-\textbf{ANCA} + & Wegener’s granulomatosis & - & Yes & - & Yes & Yes & Yes & Yes \\
\hline
Goodfield [9] & M & 25 & c-\textbf{ANCA} + & Wegener’s granulomatosis & - & Yes & Yes & - & - & - & Yes \\
\hline
Bruno [4] & F & 63 & \textbf{ANCA} + & Wegener’s granulomatosis & - & Yes & Yes & - & - & - & Yes \\
\hline
Herbst [12] & F & 56 & \textbf{ANCA} - & Wegener’s granulomatosis & - & - & Yes & - & - & Yes & Yes \\
\hline
Gerbracht [8] & M & 20 & - & Wegener’s granulomatosis & Yes & Yes & Yes & - & - & - & - \\
\hline
Greidinger [11] & M & 15 & c-\textbf{ANCA} + & Wegener’s granulomatosis & Yes & Yes & Yes & - & Yes & Yes & - \\
\hline
Leff [14] & M & 17 & c-\textbf{ANCA} + & Wegener’s granulomatosis & - & Yes & Yes & - & Yes & Yes & - \\
\hline
Yanda [20] & F & 77 & - & Wegener’s granulomatosis & Yes & Yes & Yes & Yes & Yes & - & - \\
\hline
Dabbagh [5] & M & 16 & - & Wegener’s granulomatosis & Yes & Yes & Yes & Yes & - & - & - \\
\hline
Fox [7] & M & 20 & \textbf{ANCA} + & Wegener’s granulomatosis & Yes & Yes & Yes & Yes & Yes & Yes & - \\
\hline
Anthony [2] & M & 48 & c-\textbf{ANCA} +, anti-PR3 + & Wegener’s granulomatosis & - & Yes & Yes & - & Yes & Yes & - \\
\hline
Paik [17] & M & 48 & c-\textbf{ANCA} + & Wegener’s granulomatosis & - & Yes & Yes & - & - & - & - \\
\hline
Mishell [16] & M & 65 & \textbf{ANCA} +, anti-PR3 + & Wegener’s granulomatosis & Yes & - & Yes & Yes & Yes & - & - \\
\hline
Ramakrishnan [18] & F & 44 & c-\textbf{ANCA} + & Wegener’s granulomatosis & Yes & - & Yes & - & - & - & - \\
\hline
Attaran [3] & M & 52 & - & Wegener’s granulomatosis & - & Yes & - & - & - & - & - \\
\hline
Koyalakonda [13] & M & 52 & - & Wegener’s granulomatosis & - & Yes & - & Yes & - & - & - \\
\hline
Present report & M & 44 & p-\textbf{ANCA} +, anti-PR3 - & Wegener’s granulomatosis & - & Yes & - & - & - & - & - \\
\hline
\end{tabular}
\end{table}
|
PMC3050781_table_1
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Charactristics} & \textbf{IPI} & \textbf{KPI} & \textbf{Current model} \\
\hline
\multirow{5}{*}{Parameters} & Age .60 years & LDH .normal & Age .60 years \\
\hline
LDH .normal & B symptoms & LDH .normal \\
\hline
ECOG PS = 2–4 & Regional LN involvement & CRP.10 mg/L \\
\hline
Stage III/IV & Stage III/IV & ,35 Albumin g/L \\
\hline
Extranodal sites $2 \\
\hline
\multirow{4}{*}{Risk groups} & Low (score = 0–1) & Low (score = 0) & Group 1 (score = 0) \\
\hline
Intermediate (score = 2–3) & Low intermediate (score = 1) & Group 2 (score = 1) \\
\hline
High (score = 4–5) & High intermediate (score = 2) & Group 3 (score = 2) \\
\hline
& High (score = 3–4) & Group 4 (score = 3–4) \\
\hline
\multirow{3}{*}{Pros} & a. Have been widely validated in many B-cell subtypes of NHL & a. Balance the distribution of patients in different risk groups better than the \textbf{IPI} and current model & a. Incorporates both the indicators of the inflammatory response and tumor burden \\
\hline
b. Can efficiently distinguish 3 groups of patients with different overall survival & b. Can efficiently distinguish 4 groups of patients with different overall survival & b. Can efficiently distinguish 4 groups of patients with different overall survival and can efficiently distinguish patients in the low risk \textbf{IPI} group \\
\hline
c. Can significantly discriminate between the adjacent two risk groups & c. Have been validated in external cohort & c. Can significantly discriminate between the adjacent two risk groups \\
\hline
\multirow{2}{*}{Cons} & a. Proportion of patients in each risk group is unequal and 84.3\% of the patients are allocated in low risk group & a. Failed to significantly discriminate between the neighboring two risk groups & a. Have not been validated in an external large sample of cohort \\
\hline
b. Failed to distinguish patients within the low risk group \\
\hline
\end{tabular}
\end{table}
|
PMC3665788_table_2
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{UPN} & \textbf{Sex} & \textbf{Age} & \textbf{Disease} & \textbf{Cell source} & \textbf{Blast (\%)} & \textbf{Karyotype} \\
\hline
1 & F & 80 & AML without maturation & BM & 72 & 46,XX,del(1)(p36.1),-7,add(9)(q12),-17,+2mar[13]/46,XX,add(9)(q22)[3]/46,XX[9] \\
\hline
2 & M & 27 & AML with RUNX1/ RUNX1T1 & BM & 25 & 46,XY,t(8;21)(q22;q22),inv(9)(p12q13)[16]/46,XY,inv(9)(p12q13)[4] \\
\hline
3 & M & 76 & AML with maturation & BM & 40 & 46,XY[20] \\
\hline
4 & F & 83 & AML without maturation & BM & 44 & 46,XX,del(5)(q21q35),-17,der(17;21)(q10;q10),+add(21)(q22),+mar[16]/ 46,idem, der(21;22)(q10;q10)[4] \\
\hline
5 & F & 44 & AML, pure erythroid leukemia & BM & 2.3 & 46,XX[20] \\
\hline
6 & F & 55 & AML with inv(16) & PB & 59 & 50,XX, add(7), +8, +14, der(16)t(11;16), inv(16)(p13.1q22), +20, +21 / 50,XX,add (7),+8,+14,add(16),+?20, +21[17]/46,XX[3] \\
\hline
7 & F & 80 & AML without maturation & PB & 35 & 46,XX,del(1)(p36.1),-7,add(9)(q12),-17,+2mar[13]/46,XX,add(9)(q22)[3]/46,XX[9] \\
\hline
8 & M & 26 & CML BP & BM & 30 & 45,X,-Y, t(9;22)(q34;q11.2)[20] \\
\hline
9 & F & 61 & CML CP & BM & 3 & 46,XX,t(9;22)(q34;q11.2)[20] \\
\hline
10 & M & 56 & CML CP & BM & 2 & 46,XY,t(9;22)(q34:q11.2)[20] \\
\hline
11 & F & 53 & CML CP & BM & 1 & 46,XX,t(9:22)(q34:q11.2)[20] \\
\hline
12 & M & 60 & CML CP & PB & 8 & 46,XY,t(9;22)(q34;q11.2)[20] \\
\hline
\end{tabular}
\end{table}
|
PMC4466365_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Wrist} & \textbf{Wrapper: NB} & \textbf{Wrapper: LR} & \textbf{LASSO: LR} \\
\hline
Left & L-PPI, L-PSD-0-13Hz & L-PPI, L-Sum-30p, L-Sum-30p-PPI, L-Asys-HR75, L-PSD-0-13Hz & L-PPI, L-PDI, L-Sum-30p-PPI, L-Sum-1.12v, L-Asys-HR75, L-PSD-w1, L-PSD-w2, L-PSD-0-13Hz \\
\hline
Right & R-PPI, R-PDI, R-PSD-0-13Hz & R-PPI, R-PSD-0-13Hz & R-PPI, R-PDI, R-Sum-1.12v, R-Sum-1.12v-PPI, R-PSD-w1, R-PSD-0-13Hz \\
\hline
\end{tabular}
\end{table}
|
PMC4499170_table_4
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Cytokine} & \textbf{WithoutEm\textbf{p}hysema (n = 80)} & \textbf{WithEm\textbf{p}hysema (n = 80)} & \textbf{p} \\
\hline
EGF \textbf{p}g/mL & 157.5(100.2) & 116.96(142.6) & 0.06 \\
\hline
IL-15 \textbf{p}g/mL & 6.44(4.2) & 4.88(3.63) & 0.02 \\
\hline
IL-1ra\textbf{p}g/mL & 19.23(12.62) & 14.84(15.64) & 0.04 \\
\hline
IL-8 \textbf{p}g/mL & 7.33(5.07) & 6.63(4.38) & 0.01 \\
\hline
MCP-1 \textbf{p}g/mL & 216.2(78.8) & 210.43(91.67) & 0.46 \\
\hline
MIP-1b \textbf{p}g/mL & 69.55(35.91) & 68.73(41.39) & 0.09 \\
\hline
TGF-a \textbf{p}g/mL & 3.18(4.62) & 3.97(7.88) & 0.27 \\
\hline
TNF-a \textbf{p}g/mL & 8.06(4.49) & 6.95(4.23) & 0.16 \\
\hline
VEGF \textbf{p}g/mL & 158.8(163.6) & 163.0(216.9) & 0.18 \\
\hline
\end{tabular}
\end{table}
|
PMC3618450_table_1
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Method} & \textbf{Magnification} & \textbf{Sensitivity (\%)} & \textbf{Number of meaningless regions} \\
\hline
\multirow{4}{*}{Itti’s} & × 4 & 47.3 $\pm$ 13.7 & 50786 \\
\hline
× 10 & 40.0 $\pm$ 13.5 & 152743 \\
\hline
× 20 & 47.6 $\pm$ 17.2 & 23332 \\
\hline
× 40 & 44.1 $\pm$ 21.8 & 7879 \\
\hline
\multirow{4}{*}{Achanta’s} & × 4 & 45.5 $\pm$ 7.9 & 12207 \\
\hline
× 10 & 41.4 $\pm$ 11.3 & 48751 \\
\hline
× 20 & 20.3 $\pm$ 8.2 & 31294 \\
\hline
× 40 & 14.0 $\pm$ 8.3 & 7017 \\
\hline
\multirow{4}{*}{Ours} & × 4 & 69.7 $\pm$ 13.6 & 5647 \\
\hline
× 10 & 66.0 $\pm$ 12.0 & 18753 \\
\hline
× 20 & 71.3 $\pm$ 14.0 & 1518 \\
\hline
× 40 & 61.5 $\pm$ 16.9 & 526 \\
\hline
\end{tabular}
\end{table}
|
PMC3079595_table_1
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \textbf{U11} & \textbf{U22} & \textbf{U33} & \textbf{U12} & \textbf{U13} & \textbf{U23} \\
\hline
Na & 0.0170 (9) & 0.0170 (9) & 0.0148 (13) & 0.0085 (5) & 0.000 & 0.000 \\
\hline
Br & 0.0178 (3) & 0.0178 (3) & 0.0232 (4) & 0.00892 (14) & 0.000 & 0.000 \\
\hline
N1 & 0.0150 (18) & 0.023 (2) & 0.0201 (19) & 0.0123 (16) & −0.0004 (16) & 0.0018 (17) \\
\hline
C1 & 0.016 (2) & 0.021 (2) & 0.0103 (19) & 0.0130 (19) & 0.0007 (17) & 0.0021 (18) \\
\hline
C2 & 0.016 (2) & 0.015 (2) & 0.0085 (18) & 0.0055 (18) & −0.0035 (17) & −0.0003 (17) \\
\hline
O1 & 0.0137 (16) & 0.0197 (16) & 0.0122 (13) & 0.0076 (14) & 0.0021 (13) & 0.0031 (12) \\
\hline
\end{tabular}
\end{table}
|
PMC3629471_table_1
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
& \multicolumn{8}{c|}{\textbf{TMLR\textbf{P}/TUR\textbf{P}, TMLR\textbf{P}/TU\textbf{P}K\textbf{P}}} \\
\hline
& \multirow{2}{*}{\textbf{No. of}} & & & & \multicolumn{4}{c|}{\textbf{Heterogeneity}} \\
\hline
\textbf{Outcomes} & \textbf{No. of} patients & \textbf{\textbf{P} value} & \textbf{WMD (95\% CI)} & \textbf{Chi2} & \textbf{df} & \textbf{P} & \textbf{I2 (\%)} \\
\hline
Qmax (ml/s) \\
\hline
1 month & 4, 3 & 194/172, 167/167 & 0.15, 0.33 & 0.64[− 0.22,1.51], 0.51[− 0.50,1.52] & 3.00, 3.88 & 3, 2 & 0.39, 0.14 & 0, 48 \\
\hline
3 months & 6, 3 & 348/311, 173/180 & 0.15, 0.06 & 0.39[− 0.15,0.93], 0.77[− 1.59,0.04] − & 5.98, 0.13 & 5, 2 & 0.31, 0.94 & 16, 0 \\
\hline
6 months & 3, 3 & 195/167, 167/210 & 0.65, 0.06 & − 0.32[− 1.71,1.07], 0.86[− 0.05,1.77] & 4.71, 1.03 & 2, 2 & 0.09, 0.60 & 58, 0 \\
\hline
12 months & 4, 2 & 237/212, 123/124 & 0.70, 0.72 & 0.21[− 0.87, 1.28], − 0.34[− 2.23,1.55] & 0.32, 0.04 & 2, 1 & 0.85, 0.84 & 0, 0 \\
\hline
\textbf{P}VR (ml) \\
\hline
1 month & 3, 3 & 164/142, 167/167 & 0.18, 0.66 & 2.01[− 0.90,4.92], 0.73[− 4.03,2.56] − & 7.23, 0.84 & 2, 2 & 0.03, 0.66 & 72, 0 \\
\hline
3 months & 5, 3 & 308/271, 173/180 & 0.41, 0.32 & 0.62[− 0.84,2.07], − 0.80[− 2.38,0.79] & 2.39, 2.08 & 4, 2 & 0.66, 0.35 & 0, 4 \\
\hline
6 months & 3, 3 & 195/167, 167/210 & 0.18, 0.05 & − 1.11[− 2.76,0.53], 1.30[− 0.01,2.62] & 2.48, 0,15 & 2, 2 & 0.29, 0.93 & 19, 0 \\
\hline
12 months & 4, 2 & 237/212, 123/124 & 0.24, 0.55 & 1.11[− 2.94,0.73], 1.01[− 4.32,2.31] − − & 0.28, 0.01 & 2, 1 & 0.78, 0.93 & 0, 0 \\
\hline
QoL \\
\hline
1 months & 4, 2 & 194/172, 124/124 & < 0.0001, 0.003 & 0.28[0.15, 0.40], 0.09[0.03,0.15] & 1.03, 2.43 & 3, 1 & 0.79, 0.12 & 0, 59 \\
\hline
3 months & 5, 3 & 308/271, 173/180 & 0.60, 0.50 & 0.04[− 0.12,0.21], − 0.08[− 0.30,0.14] & 3.12, 6.12 & 3, 2 & 0.37, 0.05 & 4, 67 \\
\hline
6 months & 3, 3 & 195/167, 167/124 & 0.32, 0.88 & 0.20[− 0.21,0.61], 0.01[− 0.17,0.14] − & 0.00, 0.11 & 1, 1 & 1.00, 0.74 & 0, 0 \\
\hline
12 months & 4, 2 & 237/212, 123/124 & 0.74, 0.65 & − 0.04[− 0.25,0.18], 0.05[− 0.17,0.26] & 13.02, 0.58 & 2, 1 & 0.001, 0.44 & 85. 0 \\
\hline
I\textbf{P}SS \\
\hline
1 months & 4, 3 & 194/172, 167/167 & 0.54, 0.29 & 0.51[− 1.14,2.17], − 0.30[− 0.85,0.25] & 18.45, 2.56 & 3, 2 & 0.0004, 0.28 & 84, 22 \\
\hline
3 months & 6, 3 & 348/311, 173/180 & 0.20, 0.07 & 0.23[− 0.59,0.12], 0.31[− 0.02,0.64] − & 4.41, 1.92 & 5, 2 & 0.49, 0.38 & 0, 0 \\
\hline
6 months & 3, 3 & 135/167, 167/210 & 0.79, 0.26 & 0.60[− 0.35,0.46], 0.44[− 0.33,1.20] & 0.41, 1.05 & 2,1 & 0.81, 0.31 & 0, 5 \\
\hline
12 months & 4, 2 & 237/212, 123/124 & 0.32, 0.48 & − 0.28[− 0.84,0.28], 0.43[− 0.76,1.62] & 0.22, 0.06 & 2, 1 & 0.90, 0.80 & 0, 0 \\
\hline
\end{tabular}
\end{table}
|
PMC4595764_table_1
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Preincubation time (min)} & \textbf{Inhibition \% (*)} \\
\hline
3 & 48 \\
\hline
30 & 82 \\
\hline
60 & 92 \\
\hline
90 & 96 \\
\hline
120 & 100 \\
\hline
\end{tabular}
\end{table}
|
PMC3335049_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Factors of behavioural change} & \textbf{Strategy} \\
\hline
Awareness factors knowledge, risk perception and cues to action & Educating participants on their current CVD risk factors, with regard to their size and (risk communication). changeability Thereafter, translating this to behavioural change in their personal situation. Raising awareness by providing personal and normative behavioural feedback following motivational interviewing techniques. \\
\hline
Predisposing factors genetic predisposition, current lifestyle, personal characteristics and information factors. & Tailoring the communication of CVD risk factors and lifestyle counseling to the genetically predisposed risk of the participants and their personal characteristics (age, gender, members of the household) and their current lifestyle behaviour. A multi-channel approach is chosen, thereby offering the intervention by internet, face-to-face and by telephone. \\
\hline
Motivational factors attitude, social influence and self-efficacy & Giving personal feedback to participant’s self-reported attitude and self-efficacy and by involving the social environment of the participant in making action plans. \\
\hline
Ability factors, & Stimulating participants to make action plans and discussing how to overcome possible barriers in behavioural change, thereby following motivational interviewing techniques. \\
\hline
\end{tabular}
\end{table}
|
PMC2834628_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Item} & \textbf{Jan–Dec 2013 (1 site)} & \textbf{\textbf{Target}} & \textbf{Jan–Aug 2014 (16 sites)} & \textbf{\textbf{Target}} \\
\hline
Health workers involved in IPT & 14 & 14 & 77 & 100 \\
\hline
TB/IPT screening algorithms & 2 & 2 & 17 & 20 \\
\hline
TB screening tools & 2 & 2 & 31 & 31 \\
\hline
INH available for the period & 224 boxes & 840 boxes & 3192 boxes & 8200 boxes \\
\hline
Pyridoxine available for the period & 75 bottles & 288 bottles & 1384 bottles & 2952 bottles \\
\hline
Vehicle & 1 & 1 & 1 & 1 \\
\hline
Motor cycles & 1 & 1 & 6 & 11 \\
\hline
IEC materials (pamphlets) & 0 & 2000 & 0 & 20,000 \\
\hline
\end{tabular}
\end{table}
|
PMC4583726_table_1
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{\textbf{gene}tic variant/condition} & \textbf{gene} & \textbf{infectious disease} & \textbf{year reported} & \textbf{reference} \\
\hline
sickle haemoglobin & HBB & Plasmodium falciparum malaria & 1954 & [1] \\
\hline
the Duffy blood group & DARC & Plasmodium vivax malaria & 1976 & [4] \\
\hline
prion protein \textbf{gene} variant & PRNP & Creutzfeldt–Jakob disease & 1991 & [29] \\
\hline
Melanesian ovalocytosis & SLC4A1 & P. falciparum malaria & 1995 & [30] \\
\hline
D32 CC chemokine receptor-5 & CCR5 & HIV-1 infection & 1996 & [2] \\
\hline
blood group non-secretion & FUT2 & Norwalk virus diarrhoea & 2003 & [31] \\
\hline
\end{tabular}
\end{table}
|
PMC3267114_table_0
|
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{Land cover} & \textbf{Gross gain} & \textbf{Gross loss} & \textbf{Gross total} & \textbf{Net change} & \textbf{Ratio of absolute net change to gross total} & \textbf{Net change}, based on SECP extent (\%) & \textbf{Sector change, based on 2001 land cover (\%)} \\
\hline
Shrubland & 198,913 & 168,698 & 367,612 & 30,215 & 0.08 & 0.18 & 2.84 \\
\hline
Herbaceous wetland & 49,118 & 39,315 & 88,433 & 9803 & 0.11 & 0.06 & 0.50 \\
\hline
Bare & 24,701 & 16,833 & 41,534 & 7867 & 0.19 & 0.05 & 9.17 \\
\hline
Grassland & 279,717 & 160,563 & 440,281 & 119,154 & 0.27 & 0.73 & 27.56 \\
\hline
Evergreen forest & 229,956 & 404,503 & 634,459 & -174,547 & 0.28 & -1.06 & -6.18 \\
\hline
Cropland & 14,516 & 37,562 & 52,078 & -23,046 & 0.44 & -0.14 & -2.03 \\
\hline
Pasture/hay & 7636 & 27,148 & 34,785 & -19,512 & 0.56 & -0.12 & -1.53 \\
\hline
Woody wetland & 19,354 & 104,054 & 123,409 & -84,700 & 0.69 & -0.52 & -1.84 \\
\hline
Water & 34,937 & 2962 & 37,899 & 31,976 & 0.84 & 0.19 & 4.64 \\
\hline
Deciduous/ mixed forest & 291 & 7405 & 7696 & -7114 & 0.92 & -0.04 & -6.19 \\
\hline
Urban/ developed & 110,082 & 177 & 110,259 & 109,904 & 1 & 0.67 & 5.05 \\
\hline
Total extent of change & 969,222 \\
\hline
Absolute net change & & & & 617,838 \\
\hline
\end{tabular}
\end{table}
|
PMC4617848_table_5
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.