python_code
stringlengths
0
1.02M
repo_name
stringlengths
9
48
file_path
stringlengths
5
114
import hashlib import os import urllib import warnings from typing import Any, Union, List from pkg_resources import packaging import torch from PIL import Image from torchvision.transforms import Compose, Resize, CenterCrop, ToTensor, Normalize from tqdm import tqdm from .model import build_model from .simple_tokenizer import SimpleTokenizer as _Tokenizer try: from torchvision.transforms import InterpolationMode BICUBIC = InterpolationMode.BICUBIC except ImportError: BICUBIC = Image.BICUBIC if packaging.version.parse(torch.__version__) < packaging.version.parse("1.7.1"): warnings.warn("PyTorch version 1.7.1 or higher is recommended") __all__ = ["available_models", "load", "tokenize"] _tokenizer = _Tokenizer() _MODELS = { "RN50": "https://openaipublic.azureedge.net/clip/models/afeb0e10f9e5a86da6080e35cf09123aca3b358a0c3e3b6c78a7b63bc04b6762/RN50.pt", "RN101": "https://openaipublic.azureedge.net/clip/models/8fa8567bab74a42d41c5915025a8e4538c3bdbe8804a470a72f30b0d94fab599/RN101.pt", "RN50x4": "https://openaipublic.azureedge.net/clip/models/7e526bd135e493cef0776de27d5f42653e6b4c8bf9e0f653bb11773263205fdd/RN50x4.pt", "RN50x16": "https://openaipublic.azureedge.net/clip/models/52378b407f34354e150460fe41077663dd5b39c54cd0bfd2b27167a4a06ec9aa/RN50x16.pt", "RN50x64": "https://openaipublic.azureedge.net/clip/models/be1cfb55d75a9666199fb2206c106743da0f6468c9d327f3e0d0a543a9919d9c/RN50x64.pt", "ViT-B/32": "https://openaipublic.azureedge.net/clip/models/40d365715913c9da98579312b702a82c18be219cc2a73407c4526f58eba950af/ViT-B-32.pt", "ViT-B/16": "https://openaipublic.azureedge.net/clip/models/5806e77cd80f8b59890b7e101eabd078d9fb84e6937f9e85e4ecb61988df416f/ViT-B-16.pt", "ViT-L/14": "https://openaipublic.azureedge.net/clip/models/b8cca3fd41ae0c99ba7e8951adf17d267cdb84cd88be6f7c2e0eca1737a03836/ViT-L-14.pt", "ViT-L/14@336px": "https://openaipublic.azureedge.net/clip/models/3035c92b350959924f9f00213499208652fc7ea050643e8b385c2dac08641f02/ViT-L-14-336px.pt", } def _download(url: str, root: str): os.makedirs(root, exist_ok=True) filename = os.path.basename(url) expected_sha256 = url.split("/")[-2] download_target = os.path.join(root, filename) if os.path.exists(download_target) and not os.path.isfile(download_target): raise RuntimeError(f"{download_target} exists and is not a regular file") if os.path.isfile(download_target): if hashlib.sha256(open(download_target, "rb").read()).hexdigest() == expected_sha256: return download_target else: warnings.warn(f"{download_target} exists, but the SHA256 checksum does not match; re-downloading the file") with urllib.request.urlopen(url) as source, open(download_target, "wb") as output: with tqdm(total=int(source.info().get("Content-Length")), ncols=80, unit='iB', unit_scale=True) as loop: while True: buffer = source.read(8192) if not buffer: break output.write(buffer) loop.update(len(buffer)) if hashlib.sha256(open(download_target, "rb").read()).hexdigest() != expected_sha256: raise RuntimeError(f"Model has been downloaded but the SHA256 checksum does not not match") return download_target def _convert_image_to_rgb(image): return image.convert("RGB") def _transform(n_px): return Compose([ Resize(n_px, interpolation=BICUBIC), CenterCrop(n_px), _convert_image_to_rgb, ToTensor(), Normalize((0.48145466, 0.4578275, 0.40821073), (0.26862954, 0.26130258, 0.27577711)), ]) def available_models() -> List[str]: """Returns the names of available CLIP models""" return list(_MODELS.keys()) def load(name: str, device: Union[str, torch.device] = "cuda" if torch.cuda.is_available() else "cpu", jit: bool = False, download_root: str = None): """Load a CLIP model Parameters ---------- name : str A model name listed by `clip.available_models()`, or the path to a model checkpoint containing the state_dict device : Union[str, torch.device] The device to put the loaded model jit : bool Whether to load the optimized JIT model or more hackable non-JIT model (default). download_root: str path to download the model files; by default, it uses "~/.cache/clip" Returns ------- model : torch.nn.Module The CLIP model preprocess : Callable[[PIL.Image], torch.Tensor] A torchvision transform that converts a PIL image into a tensor that the returned model can take as its input """ if device is None: device = "cuda" if torch.cuda.is_available() else "cpu" if name in _MODELS: model_path = _download(_MODELS[name], download_root or os.path.expanduser("~/.cache/clip")) elif os.path.isfile(name): model_path = name else: raise RuntimeError(f"Model {name} not found; available models = {available_models()}") try: # loading JIT archive model = torch.jit.load(model_path, map_location=device if jit else "cpu").eval() state_dict = None except RuntimeError: # loading saved state dict if jit: warnings.warn(f"File {model_path} is not a JIT archive. Loading as a state dict instead") jit = False state_dict = torch.load(model_path, map_location="cpu") if not jit: model = build_model(state_dict or model.state_dict()).to(device) if str(device) == "cpu": model.float() return model, _transform(model.visual.input_resolution) # patch the device names device_holder = torch.jit.trace(lambda: torch.ones([]).to(torch.device(device)), example_inputs=[]) device_node = [n for n in device_holder.graph.findAllNodes("prim::Constant") if "Device" in repr(n)][-1] def patch_device(module): try: graphs = [module.graph] if hasattr(module, "graph") else [] except RuntimeError: graphs = [] if hasattr(module, "forward1"): graphs.append(module.forward1.graph) for graph in graphs: for node in graph.findAllNodes("prim::Constant"): if "value" in node.attributeNames() and str(node["value"]).startswith("cuda"): node.copyAttributes(device_node) model.apply(patch_device) patch_device(model.encode_image) patch_device(model.encode_text) # patch dtype to float32 on CPU if str(device) == "cpu": float_holder = torch.jit.trace(lambda: torch.ones([]).float(), example_inputs=[]) float_input = list(float_holder.graph.findNode("aten::to").inputs())[1] float_node = float_input.node() def patch_float(module): try: graphs = [module.graph] if hasattr(module, "graph") else [] except RuntimeError: graphs = [] if hasattr(module, "forward1"): graphs.append(module.forward1.graph) for graph in graphs: for node in graph.findAllNodes("aten::to"): inputs = list(node.inputs()) for i in [1, 2]: # dtype can be the second or third argument to aten::to() if inputs[i].node()["value"] == 5: inputs[i].node().copyAttributes(float_node) model.apply(patch_float) patch_float(model.encode_image) patch_float(model.encode_text) model.float() return model, _transform(model.input_resolution.item()) def tokenize(texts: Union[str, List[str]], context_length: int = 77, truncate: bool = False) -> torch.LongTensor: """ Returns the tokenized representation of given input string(s) Parameters ---------- texts : Union[str, List[str]] An input string or a list of input strings to tokenize context_length : int The context length to use; all CLIP models use 77 as the context length truncate: bool Whether to truncate the text in case its encoding is longer than the context length Returns ------- A two-dimensional tensor containing the resulting tokens, shape = [number of input strings, context_length] """ if isinstance(texts, str): texts = [texts] sot_token = _tokenizer.encoder["<|startoftext|>"] eot_token = _tokenizer.encoder["<|endoftext|>"] all_tokens = [[sot_token] + _tokenizer.encode(text) + [eot_token] for text in texts] result = torch.zeros(len(all_tokens), context_length, dtype=torch.long) for i, tokens in enumerate(all_tokens): if len(tokens) > context_length: if truncate: tokens = tokens[:context_length] tokens[-1] = eot_token else: raise RuntimeError(f"Input {texts[i]} is too long for context length {context_length}") result[i, :len(tokens)] = torch.tensor(tokens) return result
CLIP-main
clip/clip.py
import gzip import html import os from functools import lru_cache import ftfy import regex as re @lru_cache() def default_bpe(): return os.path.join(os.path.dirname(os.path.abspath(__file__)), "bpe_simple_vocab_16e6.txt.gz") @lru_cache() def bytes_to_unicode(): """ Returns list of utf-8 byte and a corresponding list of unicode strings. The reversible bpe codes work on unicode strings. This means you need a large # of unicode characters in your vocab if you want to avoid UNKs. When you're at something like a 10B token dataset you end up needing around 5K for decent coverage. This is a signficant percentage of your normal, say, 32K bpe vocab. To avoid that, we want lookup tables between utf-8 bytes and unicode strings. And avoids mapping to whitespace/control characters the bpe code barfs on. """ bs = list(range(ord("!"), ord("~")+1))+list(range(ord("¡"), ord("¬")+1))+list(range(ord("®"), ord("ÿ")+1)) cs = bs[:] n = 0 for b in range(2**8): if b not in bs: bs.append(b) cs.append(2**8+n) n += 1 cs = [chr(n) for n in cs] return dict(zip(bs, cs)) def get_pairs(word): """Return set of symbol pairs in a word. Word is represented as tuple of symbols (symbols being variable-length strings). """ pairs = set() prev_char = word[0] for char in word[1:]: pairs.add((prev_char, char)) prev_char = char return pairs def basic_clean(text): text = ftfy.fix_text(text) text = html.unescape(html.unescape(text)) return text.strip() def whitespace_clean(text): text = re.sub(r'\s+', ' ', text) text = text.strip() return text class SimpleTokenizer(object): def __init__(self, bpe_path: str = default_bpe()): self.byte_encoder = bytes_to_unicode() self.byte_decoder = {v: k for k, v in self.byte_encoder.items()} merges = gzip.open(bpe_path).read().decode("utf-8").split('\n') merges = merges[1:49152-256-2+1] merges = [tuple(merge.split()) for merge in merges] vocab = list(bytes_to_unicode().values()) vocab = vocab + [v+'</w>' for v in vocab] for merge in merges: vocab.append(''.join(merge)) vocab.extend(['<|startoftext|>', '<|endoftext|>']) self.encoder = dict(zip(vocab, range(len(vocab)))) self.decoder = {v: k for k, v in self.encoder.items()} self.bpe_ranks = dict(zip(merges, range(len(merges)))) self.cache = {'<|startoftext|>': '<|startoftext|>', '<|endoftext|>': '<|endoftext|>'} self.pat = re.compile(r"""<\|startoftext\|>|<\|endoftext\|>|'s|'t|'re|'ve|'m|'ll|'d|[\p{L}]+|[\p{N}]|[^\s\p{L}\p{N}]+""", re.IGNORECASE) def bpe(self, token): if token in self.cache: return self.cache[token] word = tuple(token[:-1]) + ( token[-1] + '</w>',) pairs = get_pairs(word) if not pairs: return token+'</w>' while True: bigram = min(pairs, key = lambda pair: self.bpe_ranks.get(pair, float('inf'))) if bigram not in self.bpe_ranks: break first, second = bigram new_word = [] i = 0 while i < len(word): try: j = word.index(first, i) new_word.extend(word[i:j]) i = j except: new_word.extend(word[i:]) break if word[i] == first and i < len(word)-1 and word[i+1] == second: new_word.append(first+second) i += 2 else: new_word.append(word[i]) i += 1 new_word = tuple(new_word) word = new_word if len(word) == 1: break else: pairs = get_pairs(word) word = ' '.join(word) self.cache[token] = word return word def encode(self, text): bpe_tokens = [] text = whitespace_clean(basic_clean(text)).lower() for token in re.findall(self.pat, text): token = ''.join(self.byte_encoder[b] for b in token.encode('utf-8')) bpe_tokens.extend(self.encoder[bpe_token] for bpe_token in self.bpe(token).split(' ')) return bpe_tokens def decode(self, tokens): text = ''.join([self.decoder[token] for token in tokens]) text = bytearray([self.byte_decoder[c] for c in text]).decode('utf-8', errors="replace").replace('</w>', ' ') return text
CLIP-main
clip/simple_tokenizer.py
import numpy as np import pytest import torch from PIL import Image import clip @pytest.mark.parametrize('model_name', clip.available_models()) def test_consistency(model_name): device = "cpu" jit_model, transform = clip.load(model_name, device=device, jit=True) py_model, _ = clip.load(model_name, device=device, jit=False) image = transform(Image.open("CLIP.png")).unsqueeze(0).to(device) text = clip.tokenize(["a diagram", "a dog", "a cat"]).to(device) with torch.no_grad(): logits_per_image, _ = jit_model(image, text) jit_probs = logits_per_image.softmax(dim=-1).cpu().numpy() logits_per_image, _ = py_model(image, text) py_probs = logits_per_image.softmax(dim=-1).cpu().numpy() assert np.allclose(jit_probs, py_probs, atol=0.01, rtol=0.1)
CLIP-main
tests/test_consistency.py
from setuptools import setup, find_packages setup( name = 'memformer', packages = find_packages(exclude=['examples']), version = '0.3.1', license='MIT', description = 'Memformer - Pytorch', author = 'Phil Wang', author_email = 'lucidrains@gmail.com', url = 'https://github.com/lucidrains/memformer', keywords = [ 'artificial intelligence', 'attention mechanism', 'transformers', 'memory' ], install_requires=[ 'torch>=1.6', 'einops>=0.3' ], classifiers=[ 'Development Status :: 4 - Beta', 'Intended Audience :: Developers', 'Topic :: Scientific/Engineering :: Artificial Intelligence', 'License :: OSI Approved :: MIT License', 'Programming Language :: Python :: 3.6', ], )
memformer-main
setup.py
from functools import partial import torch from torch import nn import torch.nn.functional as F from torch.nn.utils.rnn import pad_sequence def top_p(logits, thres = 0.9): sorted_logits, sorted_indices = torch.sort(logits, descending=True) cum_probs = torch.cumsum(F.softmax(sorted_logits, dim=-1), dim=-1) sorted_indices_to_remove = cum_probs > (1 - thres) sorted_indices_to_remove[:, 1:] = sorted_indices_to_remove[:, :-1].clone() sorted_indices_to_remove[:, 0] = 0 sorted_logits[sorted_indices_to_remove] = float('-inf') return sorted_logits.scatter(1, sorted_indices, sorted_logits) def top_k(logits, thres = 0.9): k = int((1 - thres) * logits.shape[-1]) val, ind = torch.topk(logits, k) probs = torch.full_like(logits, float('-inf')) probs.scatter_(1, ind, val) return probs class AutoregressiveWrapper(nn.Module): def __init__(self, net, ignore_index = -100, pad_value = 0): super().__init__() self.pad_value = pad_value self.ignore_index = ignore_index self.net = net self.max_seq_len = net.max_seq_len @torch.no_grad() def generate(self, start_tokens, seq_len, eos_token = None, temperature = 1., filter_logits_fn = top_k, filter_thres = 0.9, **kwargs): was_training = self.net.training num_dims = len(start_tokens.shape) if num_dims == 1: start_tokens = start_tokens[None, :] b, t = start_tokens.shape self.net.eval() out = start_tokens input_mask = kwargs.pop('input_mask', None) if input_mask is None: input_mask = torch.full_like(out, True, dtype=torch.bool, device=out.device) for _ in range(seq_len): x = out[:, -self.max_seq_len:] input_mask = input_mask[:, -self.max_seq_len:] logits = self.net(x, input_mask=input_mask, **kwargs)[:, -1, :] filtered_logits = filter_logits_fn(logits, thres = filter_thres) probs = F.softmax(filtered_logits / temperature, dim=-1) sample = torch.multinomial(probs, 1) out = torch.cat((out, sample), dim=-1) input_mask = F.pad(input_mask, (0, 1), value=True) if eos_token is not None and (sample == eos_token).all(): break out = out[:, t:] if num_dims == 1: out = out.squeeze(0) self.net.train(was_training) return out def forward(self, x, return_loss = False, **kwargs): pad = partial(pad_sequence, batch_first = True, padding_value = self.pad_value) if not return_loss: if not isinstance(x, torch.Tensor): x = pad(x) return self.net(x, **kwargs) if isinstance(x, torch.Tensor): xi = x[:, :-1] xo = x[:, 1:] # help auto-solve an area of confusion around input masks in auto-regressive # if user supplies a mask that is only off by one from the source sequence, resolve it for them mask = kwargs.pop('src_mask', None) if mask is not None and mask.shape[1] == x.shape[1]: mask = mask[:, :-1] kwargs.update(src_mask = mask) else: xi = pad(list(map(lambda t: t[:-1], x))) xo = pad(list(map(lambda t: t[1:], x))) out = self.net(xi, **kwargs) loss = F.cross_entropy(out.transpose(1, 2), xo, ignore_index = self.ignore_index) return loss
memformer-main
memformer/autoregressive_wrapper.py
from memformer.memformer import Memformer from memformer.mrbp import memory_replay_backprop
memformer-main
memformer/__init__.py
import torch from operator import itemgetter def memory_replay_backprop( model, src, tgt, src_mask = None, tgt_mask = None ): b, *_ = src.shape # get initial memory and max sequence length from encoder mem_init = model.get_initial_mem(b) max_seq_len = model.encoder.max_seq_len # instantiate memory replay buffer replay_buffer = [mem_init] # split sequences and masks src_segs = src.split(max_seq_len, dim = 1) num_segs = len(src_segs) src_mask_segs = src_mask.split(max_seq_len, dim = 1) if src_mask is not None else ((None,) * num_segs) # for now, assume target sequence and mask is passed at the very last segment # todo - allow to tether a target sequence at any point in the segment # and attach custom loss to encoder output tgt_segs = ((None,) * (num_segs - 1)) + (tgt,) tgt_mask_segs = ((None,) * (num_segs - 1)) + (tgt_mask,) # run forwards and gather all memories prev_mem = mem_init with torch.no_grad(): for i in range(num_segs - 1): src, src_mask = map(itemgetter(i), (src_segs, src_mask_segs)) _, mem, _ = model(src, src_mask = src_mask, mems = prev_mem) replay_buffer.append(mem) prev_mem = mem # do backpropagation one segment at a time from last step to first mem_grad = torch.zeros_like(prev_mem) for i in reversed(range(num_segs)): src, src_mask, tgt, tgt_mask, mems = map(itemgetter(i), (src_segs, src_mask_segs, tgt_segs, tgt_mask_segs, replay_buffer)) mems = mems.requires_grad_() _, mems_next, tgt_loss = model(src = src, tgt = tgt, src_mask = src_mask, tgt_mask = tgt_mask, mems = mems) tgt_loss.backward(retain_graph = True) mems_next.backward(mem_grad, retain_graph = True) # if not the last step, pass the next memory's gradient back a step if i != 0: mem_grad.copy_(mems.grad.data)
memformer-main
memformer/mrbp.py
import math import torch from torch import nn, einsum from functools import partial import torch.nn.functional as F from inspect import isfunction from einops import rearrange, repeat from collections import namedtuple from memformer.autoregressive_wrapper import AutoregressiveWrapper # constants Results = namedtuple('Results', ['enc_out', 'mem', 'dec_out']) EncOnlyResults = namedtuple('EncOnlyResults', ['enc_out', 'mem']) # helpers def exists(val): return val is not None def default(val, d): if exists(val): return val return d() if isfunction(d) else d def max_neg_value(tensor): return -torch.finfo(tensor.dtype).max # keyword argument helpers def pick_and_pop(keys, d): values = list(map(lambda key: d.pop(key, None), keys)) return dict(zip(keys, values)) def group_dict_by_key(cond, d): return_val = [dict(),dict()] for key in d.keys(): match = bool(cond(key)) ind = int(not match) return_val[ind][key] = d[key] return (*return_val,) def string_begins_with(prefix, str): return str.startswith(prefix) def group_by_key_prefix(prefix, d): return group_dict_by_key(partial(string_begins_with, prefix), d) def group_by_key_prefix_and_trim(prefix, d): kwargs_with_prefix, kwargs = group_dict_by_key(partial(string_begins_with, prefix), d) kwargs_without_prefix = dict(map(lambda x: (x[0][len(prefix):], x[1]), tuple(kwargs_with_prefix.items()))) return kwargs_without_prefix, kwargs # helper classes class Residual(nn.Module): def __init__(self, fn): super().__init__() self.fn = fn def forward(self, x, **kwargs): return self.fn(x, **kwargs) + x class PreNorm(nn.Module): def __init__(self, dim, fn): super().__init__() self.fn = fn self.norm = nn.LayerNorm(dim) def forward(self, x, **kwargs): x = self.norm(x) return self.fn(x, **kwargs) # positional embedding class RelativePositionBias(nn.Module): def __init__(self, causal = False, num_buckets = 32, max_distance = 128, heads = 8): super().__init__() self.causal = causal self.num_buckets = num_buckets self.max_distance = max_distance self.relative_attention_bias = nn.Embedding(num_buckets, heads) @staticmethod def _relative_position_bucket(relative_position, causal = True, num_buckets = 32, max_distance = 128): ret = 0 n = -relative_position if causal: num_buckets //= 2 ret += (n < 0).long() * num_buckets n = torch.abs(n) else: n = torch.max(n, torch.zeros_like(n)) max_exact = num_buckets // 2 is_small = n < max_exact val_if_large = max_exact + ( torch.log(n.float() / max_exact) / math.log(max_distance / max_exact) * (num_buckets - max_exact) ).long() val_if_large = torch.min(val_if_large, torch.full_like(val_if_large, num_buckets - 1)) ret += torch.where(is_small, n, val_if_large) return ret def forward(self, qlen, klen): device = self.relative_attention_bias.weight.device q_pos = torch.arange(qlen, dtype = torch.long, device = device) k_pos = torch.arange(klen, dtype = torch.long, device = device) rel_pos = k_pos[None, :] - q_pos[:, None] rp_bucket = self._relative_position_bucket(rel_pos, causal = self.causal, num_buckets = self.num_buckets) values = self.relative_attention_bias(rp_bucket) return rearrange(values, 'i j h -> () h i j') # main classes class FeedForward(nn.Module): def __init__(self, dim, mult = 4): super().__init__() self.net = nn.Sequential( nn.Linear(dim, dim * mult), nn.GELU(), nn.Linear(dim * mult, dim) ) def forward(self, x): return self.net(x) class Attention(nn.Module): def __init__(self, dim, heads = 8, causal = False, rel_pos_emb = False): super().__init__() assert (dim % heads) == 0, 'dimension must be divisible by number of heads' dim_head = dim // heads self.scale = dim_head ** -0.5 self.heads = heads self.causal = causal self.to_q = nn.Linear(dim, dim) self.to_kv = nn.Linear(dim, dim * 2) self.to_out = nn.Linear(dim, dim) def forward(self, x, context = None, pos_emb = None, mask = None, query_mask = None, kv_mask = None, attend_self = False): b, n, _, h, scale, device = *x.shape, self.heads, self.scale, x.device if attend_self: kv_input = torch.cat((x, context), dim = 1) else: kv_input = default(context, x) q = self.to_q(x) kv = self.to_kv(kv_input).chunk(2, dim = -1) q, k, v = map(lambda t: rearrange(t, 'b n (h d) -> b h n d', h = h), (q, *kv)) dots = einsum('b h i d, b h j d -> b h i j', q, k) * scale if exists(pos_emb): pos_emb_bias = pos_emb(*dots.shape[-2:]) dots += pos_emb_bias mask_value = max_neg_value(dots) if self.causal: causal_mask = torch.ones((n, n), device = device).triu_(1).bool() dots.masked_fill_(causal_mask, mask_value) del causal_mask if any(map(exists, (query_mask, kv_mask))): query_mask = default(query_mask, lambda: torch.ones((b, n), device = device).bool()) if exists(context): kv_mask = default(kv_mask, lambda: torch.ones((b, context.shape[1]), device = device).bool()) else: kv_mask = default(kv_mask, query_mask) query_mask = rearrange(query_mask, 'b i -> b () i ()') kv_mask = rearrange(kv_mask, 'b j -> b () () j') seq_mask = query_mask * kv_mask dots.masked_fill_(~seq_mask, mask_value) del seq_mask if exists(mask): mask = rearrange(mask, 'b i j -> b () i j') dots.masked_fill_(~mask, mask_value) del mask attn = dots.softmax(dim = -1) out = einsum('b h i j, b h j d -> b h i d', attn, v) out = rearrange(out, 'b h n d -> b n (h d)') return self.to_out(out) class Encoder(nn.Module): def __init__(self, dim, depth, heads = 8): super().__init__() self.rel_pos_emb = RelativePositionBias(heads = heads) self.layers = nn.ModuleList([]) for _ in range(depth): self.layers.append(nn.ModuleList([ Residual(PreNorm(dim, Attention(dim, heads = heads, rel_pos_emb = True))), Residual(PreNorm(dim, Attention(dim, heads = heads))), Residual(PreNorm(dim, FeedForward(dim))) ])) def forward(self, x, context = None, src_mask = None): for (self_attn, cross_attn, ff) in self.layers: x = self_attn(x, pos_emb = self.rel_pos_emb, query_mask = src_mask) x = cross_attn(x, context = context) x = ff(x) return x class Decoder(nn.Module): def __init__(self, dim, depth, heads = 8): super().__init__() self.rel_pos_emb = RelativePositionBias(heads = heads, causal = True) self.layers = nn.ModuleList([]) for _ in range(depth): self.layers.append(nn.ModuleList([ Residual(PreNorm(dim, Attention(dim, heads = heads, causal = True, rel_pos_emb = True))), Residual(PreNorm(dim, Attention(dim, heads = heads))), Residual(PreNorm(dim, FeedForward(dim))), ])) def forward(self, x, context = None, src_mask = None, tgt_mask = None): for (self_attn, cross_attn, ff) in self.layers: x = self_attn(x, pos_emb = self.rel_pos_emb, query_mask = src_mask) x = cross_attn(x, context = context, query_mask = src_mask, kv_mask = tgt_mask) x = ff(x) return x class TransformerWrapper(nn.Module): def __init__(self, *, num_tokens, max_seq_len, dim, layer_blocks, heads = 8, return_logits = True): super().__init__() self.token_emb = nn.Embedding(num_tokens, dim) self.max_seq_len = max_seq_len self.layer_blocks = layer_blocks self.norm = nn.LayerNorm(dim) self.to_logits = nn.Linear(dim, num_tokens) if return_logits else nn.Identity() def forward(self, x, **kwargs): _, n, device = *x.shape, x.device x = self.token_emb(x) x = self.layer_blocks(x, **kwargs) x = self.norm(x) return self.to_logits(x) class Memformer(nn.Module): def __init__( self, *, dim, num_memory_slots, num_mem_updates = 1, encoder_only = False, mem_update_attn_heads = 8, **kwargs): super().__init__() enc_kwargs, kwargs = group_by_key_prefix_and_trim('enc_', kwargs) dec_kwargs, kwargs = group_by_key_prefix_and_trim('dec_', kwargs) assert 'dim' not in enc_kwargs and 'dim' not in dec_kwargs, 'dimension of either encoder or decoder must be set with `dim` keyword' enc_transformer_kwargs = pick_and_pop(['num_tokens', 'max_seq_len'], enc_kwargs) dec_transformer_kwargs = pick_and_pop(['num_tokens', 'max_seq_len'], dec_kwargs) self.encoder = TransformerWrapper( dim = dim, layer_blocks = Encoder(dim = dim, **enc_kwargs), return_logits = False, **enc_transformer_kwargs ) self.decoder = TransformerWrapper( dim = dim, layer_blocks = Decoder(dim = dim, **dec_kwargs), return_logits = True, **dec_transformer_kwargs ) if not encoder_only else None if exists(self.decoder): self.decoder = AutoregressiveWrapper(self.decoder) self.num_mem = num_memory_slots self.memory_slots = nn.Parameter(torch.randn(num_memory_slots, dim)) self.num_mem_updates = num_mem_updates self.mem_updater = Attention(dim, heads = mem_update_attn_heads) self.gru = nn.GRUCell(dim, dim) self.mem_ff = Residual(PreNorm(dim, FeedForward(dim))) def get_initial_mem(self, batch_size): return repeat(self.memory_slots, 'n d -> b n d', b = batch_size) def forward(self, src, tgt = None, mems = None, src_mask = None, tgt_mask = None): b, n, num_mem, device = *src.shape, self.num_mem, src.device mems = default(mems, lambda: self.get_initial_mem(b)) enc = self.encoder(src, context = mems, src_mask = src_mask) if exists(self.decoder) and exists(tgt): dec_out = self.decoder(tgt, context = enc, src_mask = tgt_mask, tgt_mask = src_mask, return_loss = True) else: dec_out = torch.tensor(0., requires_grad = True, device = device) # update memory with attention mem_mask = torch.eye(num_mem, num_mem, device = device).bool() mem_mask = repeat(mem_mask, 'i j -> b i j', b = b) mem_mask = F.pad(mem_mask, (0, n), value = True) if exists(src_mask): src_mask = rearrange(src_mask, 'b j -> b () j') mem_enc_mask = F.pad(src_mask, (num_mem, 0), value = True) mem_mask &= mem_enc_mask for _ in range(self.num_mem_updates): prev_mems = mems updated_mems = self.mem_updater(mems, enc, mask = mem_mask, attend_self = True) next_mems = self.gru( rearrange(updated_mems, 'b n d -> (b n) d'), rearrange(prev_mems, 'b n d -> (b n) d') ) mems = rearrange(next_mems, '(b n) d -> b n d', b = b) mems = self.mem_ff(mems) if not exists(self.decoder): return EncOnlyResults(enc, mems) return Results(enc, mems, dec_out)
memformer-main
memformer/memformer.py
from setuptools import setup, find_packages setup( name = 'enformer-pytorch', packages = find_packages(exclude=[]), include_package_data = True, version = '0.7.6', license='MIT', description = 'Enformer - Pytorch', author = 'Phil Wang', author_email = 'lucidrains@gmail.com', long_description_content_type = 'text/markdown', url = 'https://github.com/lucidrains/enformer-pytorch', keywords = [ 'artificial intelligence', 'transformer', 'gene-expression' ], install_requires=[ 'discrete-key-value-bottleneck-pytorch>=0.0.8', 'einops>=0.3', 'numpy', 'torch>=1.6', 'torchmetrics', 'polars', 'pyfaidx', 'pyyaml', 'transformers[torch]', ], classifiers=[ 'Development Status :: 4 - Beta', 'Intended Audience :: Developers', 'Topic :: Scientific/Engineering :: Artificial Intelligence', 'License :: OSI Approved :: MIT License', 'Programming Language :: Python :: 3.6', ], )
enformer-pytorch-main
setup.py
import torch from enformer_pytorch import Enformer enformer = Enformer.from_pretrained('EleutherAI/enformer-official-rough').cuda() enformer.eval() data = torch.load('./data/test-sample.pt') seq, target = data['sequence'].cuda(), data['target'].cuda() with torch.no_grad(): corr_coef = enformer( seq, target = target, return_corr_coef = True, head = 'human' ) print(corr_coef) assert corr_coef > 0.1
enformer-pytorch-main
test_pretrained.py
from torchmetrics import Metric from typing import Optional import torch class MeanPearsonCorrCoefPerChannel(Metric): is_differentiable: Optional[bool] = False full_state_update:bool = False higher_is_better: Optional[bool] = True def __init__(self, n_channels:int, dist_sync_on_step=False): """Calculates the mean pearson correlation across channels aggregated over regions""" super().__init__(dist_sync_on_step=dist_sync_on_step, full_state_update=False) self.reduce_dims=(0, 1) self.add_state("product", default=torch.zeros(n_channels, dtype=torch.float32), dist_reduce_fx="sum", ) self.add_state("true", default=torch.zeros(n_channels, dtype=torch.float32), dist_reduce_fx="sum", ) self.add_state("true_squared", default=torch.zeros(n_channels, dtype=torch.float32), dist_reduce_fx="sum", ) self.add_state("pred", default=torch.zeros(n_channels, dtype=torch.float32), dist_reduce_fx="sum", ) self.add_state("pred_squared", default=torch.zeros(n_channels, dtype=torch.float32), dist_reduce_fx="sum", ) self.add_state("count", default=torch.zeros(n_channels, dtype=torch.float32), dist_reduce_fx="sum") def update(self, preds: torch.Tensor, target: torch.Tensor): assert preds.shape == target.shape self.product += torch.sum(preds * target, dim=self.reduce_dims) self.true += torch.sum(target, dim=self.reduce_dims) self.true_squared += torch.sum(torch.square(target), dim=self.reduce_dims) self.pred += torch.sum(preds, dim=self.reduce_dims) self.pred_squared += torch.sum(torch.square(preds), dim=self.reduce_dims) self.count += torch.sum(torch.ones_like(target), dim=self.reduce_dims) def compute(self): true_mean = self.true / self.count pred_mean = self.pred / self.count covariance = (self.product - true_mean * self.pred - pred_mean * self.true + self.count * true_mean * pred_mean) true_var = self.true_squared - self.count * torch.square(true_mean) pred_var = self.pred_squared - self.count * torch.square(pred_mean) tp_var = torch.sqrt(true_var) * torch.sqrt(pred_var) correlation = covariance / tp_var return correlation
enformer-pytorch-main
enformer_pytorch/metrics.py
from enformer_pytorch.config_enformer import EnformerConfig from enformer_pytorch.modeling_enformer import Enformer, SEQUENCE_LENGTH, AttentionPool from enformer_pytorch.data import seq_indices_to_one_hot, str_to_one_hot, GenomeIntervalDataset, FastaInterval
enformer-pytorch-main
enformer_pytorch/__init__.py
import math import torch from torch import nn, einsum import torch.nn.functional as F from torch.utils.checkpoint import checkpoint_sequential from einops import rearrange, reduce from einops.layers.torch import Rearrange from enformer_pytorch.data import str_to_one_hot, seq_indices_to_one_hot from enformer_pytorch.config_enformer import EnformerConfig from transformers import PreTrainedModel # constants SEQUENCE_LENGTH = 196_608 TARGET_LENGTH = 896 # helpers def exists(val): return val is not None def default(val, d): return val if exists(val) else d def map_values(fn, d): return {key: fn(values) for key, values in d.items()} def exponential_linspace_int(start, end, num, divisible_by = 1): def _round(x): return int(round(x / divisible_by) * divisible_by) base = math.exp(math.log(end / start) / (num - 1)) return [_round(start * base**i) for i in range(num)] def log(t, eps = 1e-20): return torch.log(t.clamp(min = eps)) # losses and metrics def poisson_loss(pred, target): return (pred - target * log(pred)).mean() def pearson_corr_coef(x, y, dim = 1, reduce_dims = (-1,)): x_centered = x - x.mean(dim = dim, keepdim = True) y_centered = y - y.mean(dim = dim, keepdim = True) return F.cosine_similarity(x_centered, y_centered, dim = dim).mean(dim = reduce_dims) # relative positional encoding functions def get_positional_features_exponential(positions, features, seq_len, min_half_life = 3.): max_range = math.log(seq_len) / math.log(2.) half_life = 2 ** torch.linspace(min_half_life, max_range, features, device = positions.device) half_life = half_life[None, ...] positions = positions.abs()[..., None] return torch.exp(-math.log(2.) / half_life * positions) def get_positional_features_central_mask(positions, features, seq_len): center_widths = 2 ** torch.arange(1, features + 1, device = positions.device).float() center_widths = center_widths - 1 return (center_widths[None, ...] > positions.abs()[..., None]).float() def gamma_pdf(x, concentration, rate): log_unnormalized_prob = torch.xlogy(concentration - 1., x) - rate * x log_normalization = (torch.lgamma(concentration) - concentration * torch.log(rate)) return torch.exp(log_unnormalized_prob - log_normalization) def get_positional_features_gamma(positions, features, seq_len, stddev = None, start_mean = None, eps = 1e-8): if not exists(stddev): stddev = seq_len / (2 * features) if not exists(start_mean): start_mean = seq_len / features mean = torch.linspace(start_mean, seq_len, features, device = positions.device) mean = mean[None, ...] concentration = (mean / stddev) ** 2 rate = mean / stddev ** 2 probabilities = gamma_pdf(positions.float().abs()[..., None], concentration, rate) probabilities = probabilities + eps outputs = probabilities / torch.amax(probabilities, dim = -1, keepdim = True) return outputs def get_positional_embed(seq_len, feature_size, device): distances = torch.arange(-seq_len + 1, seq_len, device = device) feature_functions = [ get_positional_features_exponential, get_positional_features_central_mask, get_positional_features_gamma ] num_components = len(feature_functions) * 2 if (feature_size % num_components) != 0: raise ValueError(f'feature size is not divisible by number of components ({num_components})') num_basis_per_class = feature_size // num_components embeddings = [] for fn in feature_functions: embeddings.append(fn(distances, num_basis_per_class, seq_len)) embeddings = torch.cat(embeddings, dim = -1) embeddings = torch.cat((embeddings, torch.sign(distances)[..., None] * embeddings), dim = -1) return embeddings def relative_shift(x): to_pad = torch.zeros_like(x[..., :1]) x = torch.cat((to_pad, x), dim = -1) _, h, t1, t2 = x.shape x = x.reshape(-1, h, t2, t1) x = x[:, :, 1:, :] x = x.reshape(-1, h, t1, t2 - 1) return x[..., :((t2 + 1) // 2)] # classes class Residual(nn.Module): def __init__(self, fn): super().__init__() self.fn = fn def forward(self, x, **kwargs): return self.fn(x, **kwargs) + x class GELU(nn.Module): def forward(self, x): return torch.sigmoid(1.702 * x) * x class AttentionPool(nn.Module): def __init__(self, dim, pool_size = 2): super().__init__() self.pool_size = pool_size self.pool_fn = Rearrange('b d (n p) -> b d n p', p = pool_size) self.to_attn_logits = nn.Conv2d(dim, dim, 1, bias = False) nn.init.dirac_(self.to_attn_logits.weight) with torch.no_grad(): self.to_attn_logits.weight.mul_(2) def forward(self, x): b, _, n = x.shape remainder = n % self.pool_size needs_padding = remainder > 0 if needs_padding: x = F.pad(x, (0, remainder), value = 0) mask = torch.zeros((b, 1, n), dtype = torch.bool, device = x.device) mask = F.pad(mask, (0, remainder), value = True) x = self.pool_fn(x) logits = self.to_attn_logits(x) if needs_padding: mask_value = -torch.finfo(logits.dtype).max logits = logits.masked_fill(self.pool_fn(mask), mask_value) attn = logits.softmax(dim = -1) return (x * attn).sum(dim = -1) class TargetLengthCrop(nn.Module): def __init__(self, target_length): super().__init__() self.target_length = target_length def forward(self, x): seq_len, target_len = x.shape[-2], self.target_length if target_len == -1: return x if seq_len < target_len: raise ValueError(f'sequence length {seq_len} is less than target length {target_len}') trim = (target_len - seq_len) // 2 if trim == 0: return x return x[:, -trim:trim] def ConvBlock(dim, dim_out = None, kernel_size = 1): return nn.Sequential( nn.BatchNorm1d(dim), GELU(), nn.Conv1d(dim, default(dim_out, dim), kernel_size, padding = kernel_size // 2) ) # attention classes class Attention(nn.Module): def __init__( self, dim, *, num_rel_pos_features, heads = 8, dim_key = 64, dim_value = 64, dropout = 0., pos_dropout = 0. ): super().__init__() self.scale = dim_key ** -0.5 self.heads = heads self.to_q = nn.Linear(dim, dim_key * heads, bias = False) self.to_k = nn.Linear(dim, dim_key * heads, bias = False) self.to_v = nn.Linear(dim, dim_value * heads, bias = False) self.to_out = nn.Linear(dim_value * heads, dim) nn.init.zeros_(self.to_out.weight) nn.init.zeros_(self.to_out.bias) # relative positional encoding self.num_rel_pos_features = num_rel_pos_features self.to_rel_k = nn.Linear(num_rel_pos_features, dim_key * heads, bias = False) self.rel_content_bias = nn.Parameter(torch.randn(1, heads, 1, dim_key)) self.rel_pos_bias = nn.Parameter(torch.randn(1, heads, 1, dim_key)) # dropouts self.pos_dropout = nn.Dropout(pos_dropout) self.attn_dropout = nn.Dropout(dropout) def forward(self, x): n, h, device = x.shape[-2], self.heads, x.device q = self.to_q(x) k = self.to_k(x) v = self.to_v(x) q, k, v = map(lambda t: rearrange(t, 'b n (h d) -> b h n d', h = h), (q, k, v)) q = q * self.scale content_logits = einsum('b h i d, b h j d -> b h i j', q + self.rel_content_bias, k) positions = get_positional_embed(n, self.num_rel_pos_features, device) positions = self.pos_dropout(positions) rel_k = self.to_rel_k(positions) rel_k = rearrange(rel_k, 'n (h d) -> h n d', h = h) rel_logits = einsum('b h i d, h j d -> b h i j', q + self.rel_pos_bias, rel_k) rel_logits = relative_shift(rel_logits) logits = content_logits + rel_logits attn = logits.softmax(dim = -1) attn = self.attn_dropout(attn) out = einsum('b h i j, b h j d -> b h i d', attn, v) out = rearrange(out, 'b h n d -> b n (h d)') return self.to_out(out) # main class class Enformer(PreTrainedModel): config_class = EnformerConfig base_model_prefix = "enformer" @staticmethod def from_hparams(**kwargs): return Enformer(EnformerConfig(**kwargs)) def __init__(self, config): super().__init__(config) self.dim = config.dim half_dim = config.dim // 2 twice_dim = config.dim * 2 # create stem self.stem = nn.Sequential( nn.Conv1d(4, half_dim, 15, padding = 7), Residual(ConvBlock(half_dim)), AttentionPool(half_dim, pool_size = 2) ) # create conv tower filter_list = exponential_linspace_int(half_dim, config.dim, num = (config.num_downsamples - 1), divisible_by = config.dim_divisible_by) filter_list = [half_dim, *filter_list] conv_layers = [] for dim_in, dim_out in zip(filter_list[:-1], filter_list[1:]): conv_layers.append(nn.Sequential( ConvBlock(dim_in, dim_out, kernel_size = 5), Residual(ConvBlock(dim_out, dim_out, 1)), AttentionPool(dim_out, pool_size = 2) )) self.conv_tower = nn.Sequential(*conv_layers) # transformer transformer = [] for _ in range(config.depth): transformer.append(nn.Sequential( Residual(nn.Sequential( nn.LayerNorm(config.dim), Attention( config.dim, heads = config.heads, dim_key = config.attn_dim_key, dim_value = config.dim // config.heads, dropout = config.attn_dropout, pos_dropout = config.pos_dropout, num_rel_pos_features = config.dim // config.heads ), nn.Dropout(config.dropout_rate) )), Residual(nn.Sequential( nn.LayerNorm(config.dim), nn.Linear(config.dim, config.dim * 2), nn.Dropout(config.dropout_rate), nn.ReLU(), nn.Linear(config.dim * 2, config.dim), nn.Dropout(config.dropout_rate) )) )) self.transformer = nn.Sequential(*transformer) # target cropping self.target_length = config.target_length self.crop_final = TargetLengthCrop(config.target_length) # final pointwise self.final_pointwise = nn.Sequential( Rearrange('b n d -> b d n'), ConvBlock(filter_list[-1], twice_dim, 1), Rearrange('b d n -> b n d'), nn.Dropout(config.dropout_rate / 8), GELU() ) # create trunk sequential module self._trunk = nn.Sequential( Rearrange('b n d -> b d n'), self.stem, self.conv_tower, Rearrange('b d n -> b n d'), self.transformer, self.crop_final, self.final_pointwise ) # create final heads for human and mouse self.add_heads(**config.output_heads) # use checkpointing on transformer trunk self.use_checkpointing = config.use_checkpointing def add_heads(self, **kwargs): self.output_heads = kwargs self._heads = nn.ModuleDict(map_values(lambda features: nn.Sequential( nn.Linear(self.dim * 2, features), nn.Softplus() ), kwargs)) def set_target_length(self, target_length): crop_module = self._trunk[-2] crop_module.target_length = target_length @property def trunk(self): return self._trunk @property def heads(self): return self._heads def trunk_checkpointed(self, x): x = rearrange(x, 'b n d -> b d n') x = self.stem(x) x = self.conv_tower(x) x = rearrange(x, 'b d n -> b n d') x = checkpoint_sequential(self.transformer, len(self.transformer), x) x = self.crop_final(x) x = self.final_pointwise(x) return x def forward( self, x, target = None, return_corr_coef = False, return_embeddings = False, return_only_embeddings = False, head = None, target_length = None ): if isinstance(x, list): x = str_to_one_hot(x) elif x.dtype == torch.long: x = seq_indices_to_one_hot(x) no_batch = x.ndim == 2 if no_batch: x = rearrange(x, '... -> () ...') if exists(target_length): self.set_target_length(target_length) trunk_fn = self.trunk_checkpointed if self.use_checkpointing else self._trunk x = trunk_fn(x) if no_batch: x = rearrange(x, '() ... -> ...') if return_only_embeddings: return x out = map_values(lambda fn: fn(x), self._heads) if exists(head): assert head in self._heads, f'head {head} not found' out = out[head] if exists(target): assert exists(head), 'head must be passed in if one were to calculate loss directly with targets' if return_corr_coef: return pearson_corr_coef(out, target) return poisson_loss(out, target) if return_embeddings: return out, x return out
enformer-pytorch-main
enformer_pytorch/modeling_enformer.py
from transformers import PretrainedConfig class EnformerConfig(PretrainedConfig): model_type = "enformer" def __init__( self, dim = 1536, depth = 11, heads = 8, output_heads = dict(human = 5313, mouse= 1643), target_length = 896, attn_dim_key = 64, dropout_rate = 0.4, attn_dropout = 0.05, pos_dropout = 0.01, use_checkpointing = False, use_convnext = False, num_downsamples = 7, # genetic sequence is downsampled 2 ** 7 == 128x in default Enformer - can be changed for higher resolution dim_divisible_by = 128, **kwargs, ): self.dim = dim self.depth = depth self.heads = heads self.output_heads = output_heads self.target_length = target_length self.attn_dim_key = attn_dim_key self.dropout_rate = dropout_rate self.attn_dropout = attn_dropout self.pos_dropout = pos_dropout self.use_checkpointing = use_checkpointing self.num_downsamples = num_downsamples self.dim_divisible_by = dim_divisible_by super().__init__(**kwargs)
enformer-pytorch-main
enformer_pytorch/config_enformer.py
import torch from typing import Optional from copy import deepcopy from contextlib import contextmanager import torch.nn.functional as F from torch import nn, einsum from einops import rearrange, repeat from einops.layers.torch import Rearrange from enformer_pytorch.modeling_enformer import Enformer, poisson_loss from discrete_key_value_bottleneck_pytorch import DiscreteKeyValueBottleneck def exists(val): return val is not None def default(val, d): return val if exists(val) else d @contextmanager def null_context(): yield # better sequential def Sequential(*modules): return nn.Sequential(*filter(exists, modules)) # controlling freezing of layers def set_module_requires_grad_(module, requires_grad): for param in module.parameters(): param.requires_grad = requires_grad def freeze_all_layers_(module): set_module_requires_grad_(module, False) def unfreeze_all_layers_(module): set_module_requires_grad_(module, True) def freeze_batchnorms_(model): bns = [m for m in model.modules() if isinstance(m, nn.BatchNorm1d)] for bn in bns: bn.eval() bn.track_running_stats = False set_module_requires_grad_(bn, False) def freeze_all_but_layernorms_(model): for m in model.modules(): set_module_requires_grad_(m, isinstance(m, nn.LayerNorm)) def freeze_all_but_last_n_layers_(enformer, n): assert isinstance(enformer, Enformer) freeze_all_layers_(enformer) transformer_blocks = enformer.transformer for module in transformer_blocks[-n:]: set_module_requires_grad_(module, True) # get enformer embeddings def get_enformer_embeddings( model, seq, freeze = False, train_layernorms_only = False, train_last_n_layers_only = None, enformer_kwargs: dict = {} ): freeze_batchnorms_(model) if train_layernorms_only: assert not freeze, 'you set the intent to train the layernorms of the enformer, yet also indicated you wanted to freeze the entire model' freeze_all_but_layernorms_(model) if exists(train_last_n_layers_only): assert not freeze, 'you set the intent to train last N layers of enformer, but also indicated you wanted to freeze the entire network' freeze_all_but_last_n_layers_(model, train_last_n_layers_only) enformer_context = null_context() if not freeze else torch.no_grad() with enformer_context: embeddings = model(seq, return_only_embeddings = True, **enformer_kwargs) if freeze: embeddings.detach_() return embeddings # fine-tune wrapper classes # extra head projection, akin to how human and mouse tracks were trained class HeadAdapterWrapper(nn.Module): def __init__( self, *, enformer, num_tracks, post_transformer_embed = False, # whether to take the embeddings from right after the transformer, instead of after the final pointwise convolutional - this would add another layernorm discrete_key_value_bottleneck = False, bottleneck_num_memories = 256, bottleneck_num_codebooks = 4, bottleneck_decay = 0.9, transformer_embed_fn: nn.Module = nn.Identity(), output_activation: Optional[nn.Module] = nn.Softplus(), auto_set_target_length = True ): super().__init__() assert isinstance(enformer, Enformer) enformer_hidden_dim = enformer.dim * (2 if not post_transformer_embed else 1) self.discrete_key_value_bottleneck = discrete_key_value_bottleneck if discrete_key_value_bottleneck: enformer = DiscreteKeyValueBottleneck( encoder = enformer, dim = enformer_hidden_dim, num_memory_codebooks = bottleneck_num_codebooks, num_memories = bottleneck_num_memories, dim_memory = enformer_hidden_dim // bottleneck_num_codebooks, decay = bottleneck_decay, ) self.post_transformer_embed = post_transformer_embed self.enformer = enformer self.auto_set_target_length = auto_set_target_length if post_transformer_embed: self.enformer = deepcopy(enformer) self.enformer._trunk[-1] = nn.Identity() self.enformer.final_pointwise = nn.Identity() self.post_embed_transform = Sequential( transformer_embed_fn, nn.LayerNorm(enformer_hidden_dim) if post_transformer_embed else None ) self.to_tracks = Sequential( nn.Linear(enformer_hidden_dim, num_tracks), output_activation ) def forward( self, seq, *, target = None, freeze_enformer = False, finetune_enformer_ln_only = False, finetune_last_n_layers_only = None ): enformer_kwargs = dict() if exists(target) and self.auto_set_target_length: enformer_kwargs = dict(target_length = target.shape[-2]) if self.discrete_key_value_bottleneck: embeddings = self.enformer(seq, return_only_embeddings = True, **enformer_kwargs) else: embeddings = get_enformer_embeddings(self.enformer, seq, freeze = freeze_enformer, train_layernorms_only = finetune_enformer_ln_only, train_last_n_layers_only = finetune_last_n_layers_only, enformer_kwargs = enformer_kwargs) preds = self.to_tracks(embeddings) if not exists(target): return preds return poisson_loss(preds, target) # wrapper that allows one to supply each track with a context dimension # the context embedding will be projected into the weights and biases of the head linear projection (hypernetwork) class ContextAdapterWrapper(nn.Module): def __init__( self, *, enformer, context_dim, discrete_key_value_bottleneck = False, bottleneck_num_memories = 256, bottleneck_num_codebooks = 4, bottleneck_decay = 0.9, auto_set_target_length = True, output_activation: Optional[nn.Module] = nn.Softplus() ): super().__init__() assert isinstance(enformer, Enformer) enformer_hidden_dim = enformer.dim * 2 self.discrete_key_value_bottleneck = discrete_key_value_bottleneck if discrete_key_value_bottleneck: enformer = DiscreteKeyValueBottleneck( encoder = enformer, dim = enformer_hidden_dim, num_memory_codebooks = bottleneck_num_codebooks, num_memories = bottleneck_num_memories, dim_memory = enformer_hidden_dim // bottleneck_num_codebooks, decay = bottleneck_decay, ) self.enformer = enformer self.auto_set_target_length = auto_set_target_length self.to_context_weights = nn.Parameter(torch.randn(context_dim, enformer_hidden_dim)) self.to_context_bias = nn.Parameter(torch.randn(context_dim)) self.activation = default(output_activation, nn.Identity()) def forward( self, seq, *, context, target = None, freeze_enformer = False, finetune_enformer_ln_only = False, finetune_last_n_layers_only = None ): enformer_kwargs = dict() if exists(target) and self.auto_set_target_length: enformer_kwargs = dict(target_length = target.shape[-2]) if self.discrete_key_value_bottleneck: embeddings = self.enformer(seq, return_only_embeddings = True, **enformer_kwargs) else: embeddings = get_enformer_embeddings(self.enformer, seq, freeze = freeze_enformer, train_layernorms_only = finetune_enformer_ln_only, train_last_n_layers_only = finetune_last_n_layers_only, enformer_kwargs = enformer_kwargs) weights = einsum('t d, d e -> t e', context, self.to_context_weights) bias = einsum('t d, d -> t', context, self.to_context_bias) pred = einsum('b n d, t d -> b n t', embeddings, weights) + bias pred = self.activation(pred) if not exists(target): return pred return poisson_loss(pred, target) # wrapper that does attention aggregation of the context, which can be a list of tokens (batch x seq x dim) class ContextAttentionAdapterWrapper(nn.Module): def __init__( self, *, enformer, context_dim, heads = 8, dim_head = 64, discrete_key_value_bottleneck = False, bottleneck_num_memories = 256, bottleneck_num_codebooks = 4, bottleneck_decay = 0.9, auto_set_target_length = True, output_activation: Optional[nn.Module] = nn.Softplus() ): super().__init__() assert isinstance(enformer, Enformer) enformer_hidden_dim = enformer.dim * 2 self.discrete_key_value_bottleneck = discrete_key_value_bottleneck if discrete_key_value_bottleneck: enformer = DiscreteKeyValueBottleneck( encoder = enformer, dim = enformer_hidden_dim, num_memory_codebooks = bottleneck_num_codebooks, num_memories = bottleneck_num_memories, dim_memory = enformer_hidden_dim // bottleneck_num_codebooks, decay = bottleneck_decay, ) self.enformer = enformer self.auto_set_target_length = auto_set_target_length self.query_norm = nn.LayerNorm(enformer_hidden_dim) self.key_values_norm = nn.LayerNorm(context_dim) self.scale = dim_head ** -0.5 self.heads = heads inner_dim = heads * dim_head self.to_queries = nn.Linear(enformer_hidden_dim, inner_dim, bias = False) self.null_key = nn.Parameter(torch.randn(inner_dim)) self.null_value = nn.Parameter(torch.randn(inner_dim)) self.to_key_values = nn.Linear(context_dim, inner_dim * 2, bias = False) self.to_out = nn.Linear(inner_dim, enformer_hidden_dim) self.to_pred = Sequential( nn.Linear(enformer_hidden_dim, 1), Rearrange('b c ... 1 -> b ... c'), output_activation ) def forward( self, seq, *, context, context_mask = None, target = None, freeze_enformer = False, finetune_enformer_ln_only = False, finetune_last_n_layers_only = None ): """ b - batch n - sequence length c - number of contexts (tracks) d - dimension i - sequence length (query embeddings) j - sequence length (keys / values contexts) h - attention heads """ h = self.heads enformer_kwargs = dict() if exists(target) and self.auto_set_target_length: enformer_kwargs = dict(target_length = target.shape[-2]) if self.discrete_key_value_bottleneck: embeddings = self.enformer(seq, return_only_embeddings = True, **enformer_kwargs) else: embeddings = get_enformer_embeddings(self.enformer, seq, freeze = freeze_enformer, train_layernorms_only = finetune_enformer_ln_only, train_last_n_layers_only = finetune_last_n_layers_only, enformer_kwargs = enformer_kwargs) # perform cross attention from genetic -> context if context.ndim == 2: context = rearrange(context, 'b d -> b 1 d') q = self.to_queries(self.query_norm(embeddings)) k, v = self.to_key_values(self.key_values_norm(context)).chunk(2, dim = -1) null_k, null_v = map(lambda t: repeat(t, 'd -> b 1 d', b = context.shape[0]), (self.null_key, self.null_value)) k = torch.cat((null_k, k), dim = 1) v = torch.cat((null_v, v), dim = 1) # split out head q, k, v = map(lambda t: rearrange(t, 'b n (h d) -> b h n d', h = h), (q, k, v)) sim = einsum('b h i d, c h j d -> b c h i j', q, k) * self.scale # masking if exists(context_mask): context_mask = F.pad(context_mask, (1, 0), value = True) context_mask =rearrange(context_mask, 'b j -> b 1 1 1 j') sim = sim.masked_fill(~context_mask, -torch.finfo(sim.dtype).max) # attention attn = sim.softmax(dim = -1) # aggregate out = einsum('b c h i j, c h j d -> b c h i d', attn, v) out = rearrange(out, 'b c h n d -> b c n (h d)', h = h) # combine heads branch_out = self.to_out(out) # residual embeddings = embeddings + branch_out # to prediction pred = self.to_pred(embeddings) if not exists(target): return pred return poisson_loss(pred, target)
enformer-pytorch-main
enformer_pytorch/finetune.py
import torch import torch.nn.functional as F from torch.utils.data import Dataset import polars as pl import numpy as np from random import randrange, random from pathlib import Path from pyfaidx import Fasta # helper functions def exists(val): return val is not None def identity(t): return t def cast_list(t): return t if isinstance(t, list) else [t] def coin_flip(): return random() > 0.5 # genomic function transforms seq_indices_embed = torch.zeros(256).long() seq_indices_embed[ord('a')] = 0 seq_indices_embed[ord('c')] = 1 seq_indices_embed[ord('g')] = 2 seq_indices_embed[ord('t')] = 3 seq_indices_embed[ord('n')] = 4 seq_indices_embed[ord('A')] = 0 seq_indices_embed[ord('C')] = 1 seq_indices_embed[ord('G')] = 2 seq_indices_embed[ord('T')] = 3 seq_indices_embed[ord('N')] = 4 seq_indices_embed[ord('.')] = -1 one_hot_embed = torch.zeros(256, 4) one_hot_embed[ord('a')] = torch.Tensor([1., 0., 0., 0.]) one_hot_embed[ord('c')] = torch.Tensor([0., 1., 0., 0.]) one_hot_embed[ord('g')] = torch.Tensor([0., 0., 1., 0.]) one_hot_embed[ord('t')] = torch.Tensor([0., 0., 0., 1.]) one_hot_embed[ord('n')] = torch.Tensor([0., 0., 0., 0.]) one_hot_embed[ord('A')] = torch.Tensor([1., 0., 0., 0.]) one_hot_embed[ord('C')] = torch.Tensor([0., 1., 0., 0.]) one_hot_embed[ord('G')] = torch.Tensor([0., 0., 1., 0.]) one_hot_embed[ord('T')] = torch.Tensor([0., 0., 0., 1.]) one_hot_embed[ord('N')] = torch.Tensor([0., 0., 0., 0.]) one_hot_embed[ord('.')] = torch.Tensor([0.25, 0.25, 0.25, 0.25]) reverse_complement_map = torch.Tensor([3, 2, 1, 0, 4]).long() def torch_fromstring(seq_strs): batched = not isinstance(seq_strs, str) seq_strs = cast_list(seq_strs) np_seq_chrs = list(map(lambda t: np.fromstring(t, dtype = np.uint8), seq_strs)) seq_chrs = list(map(torch.from_numpy, np_seq_chrs)) return torch.stack(seq_chrs) if batched else seq_chrs[0] def str_to_seq_indices(seq_strs): seq_chrs = torch_fromstring(seq_strs) return seq_indices_embed[seq_chrs.long()] def str_to_one_hot(seq_strs): seq_chrs = torch_fromstring(seq_strs) return one_hot_embed[seq_chrs.long()] def seq_indices_to_one_hot(t, padding = -1): is_padding = t == padding t = t.clamp(min = 0) one_hot = F.one_hot(t, num_classes = 5) out = one_hot[..., :4].float() out = out.masked_fill(is_padding[..., None], 0.25) return out # augmentations def seq_indices_reverse_complement(seq_indices): complement = reverse_complement_map[seq_indices.long()] return torch.flip(complement, dims = (-1,)) def one_hot_reverse_complement(one_hot): *_, n, d = one_hot.shape assert d == 4, 'must be one hot encoding with last dimension equal to 4' return torch.flip(one_hot, (-1, -2)) # processing bed files class FastaInterval(): def __init__( self, *, fasta_file, context_length = None, return_seq_indices = False, shift_augs = None, rc_aug = False ): fasta_file = Path(fasta_file) assert fasta_file.exists(), 'path to fasta file must exist' self.seqs = Fasta(str(fasta_file)) self.return_seq_indices = return_seq_indices self.context_length = context_length self.shift_augs = shift_augs self.rc_aug = rc_aug def __call__(self, chr_name, start, end, return_augs = False): interval_length = end - start chromosome = self.seqs[chr_name] chromosome_length = len(chromosome) if exists(self.shift_augs): min_shift, max_shift = self.shift_augs max_shift += 1 min_shift = max(start + min_shift, 0) - start max_shift = min(end + max_shift, chromosome_length) - end rand_shift = randrange(min_shift, max_shift) start += rand_shift end += rand_shift left_padding = right_padding = 0 if exists(self.context_length) and interval_length < self.context_length: extra_seq = self.context_length - interval_length extra_left_seq = extra_seq // 2 extra_right_seq = extra_seq - extra_left_seq start -= extra_left_seq end += extra_right_seq if start < 0: left_padding = -start start = 0 if end > chromosome_length: right_padding = end - chromosome_length end = chromosome_length seq = ('.' * left_padding) + str(chromosome[start:end]) + ('.' * right_padding) should_rc_aug = self.rc_aug and coin_flip() if self.return_seq_indices: seq = str_to_seq_indices(seq) if should_rc_aug: seq = seq_indices_reverse_complement(seq) return seq one_hot = str_to_one_hot(seq) if should_rc_aug: one_hot = one_hot_reverse_complement(one_hot) if not return_augs: return one_hot # returns the shift integer as well as the bool (for whether reverse complement was activated) # for this particular genomic sequence rand_shift_tensor = torch.tensor([rand_shift]) rand_aug_bool_tensor = torch.tensor([should_rc_aug]) return one_hot, rand_shift_tensor, rand_aug_bool_tensor class GenomeIntervalDataset(Dataset): def __init__( self, bed_file, fasta_file, filter_df_fn = identity, chr_bed_to_fasta_map = dict(), context_length = None, return_seq_indices = False, shift_augs = None, rc_aug = False, return_augs = False ): super().__init__() bed_path = Path(bed_file) assert bed_path.exists(), 'path to .bed file must exist' df = pl.read_csv(str(bed_path), separator = '\t', has_header = False) df = filter_df_fn(df) self.df = df # if the chromosome name in the bed file is different than the keyname in the fasta # can remap on the fly self.chr_bed_to_fasta_map = chr_bed_to_fasta_map self.fasta = FastaInterval( fasta_file = fasta_file, context_length = context_length, return_seq_indices = return_seq_indices, shift_augs = shift_augs, rc_aug = rc_aug ) self.return_augs = return_augs def __len__(self): return len(self.df) def __getitem__(self, ind): interval = self.df.row(ind) chr_name, start, end = (interval[0], interval[1], interval[2]) chr_name = self.chr_bed_to_fasta_map.get(chr_name, chr_name) return self.fasta(chr_name, start, end, return_augs = self.return_augs)
enformer-pytorch-main
enformer_pytorch/data.py
from einops import rearrange def copy_bn(mod, vars, path): bn_offset = vars[f'{path}offset:0'] bn_scale = vars[f'{path}scale:0'] ema_path = '/'.join(path.split('/')[:-1]) + '/' bn_running_mean = vars[f'{ema_path}moving_mean/average:0'] bn_running_var = vars[f'{ema_path}moving_variance/average:0'] mod.weight.data.copy_(bn_scale) mod.bias.data.copy_(bn_offset) mod.running_var.data.copy_(rearrange(bn_running_var, '1 1 d -> d')) mod.running_mean.data.copy_(rearrange(bn_running_mean, '1 1 d -> d')) def copy_conv(mod, vars, path): bias = vars[f'{path}b:0'] weight = vars[f'{path}w:0'] mod.weight.data.copy_(rearrange(weight, 'k i o -> o i k')) mod.bias.data.copy_(bias) def copy_attn_pool(mod, vars, path): attn_pool_proj = vars[path] mod.to_attn_logits.weight.data.copy_(rearrange(attn_pool_proj, 'i o -> o i 1 1')) def copy_linear(mod, vars, path, has_bias = True): weight = vars[f'{path}w:0'] mod.weight.data.copy_(rearrange(weight, 'i o -> o i')) if not has_bias: return bias = vars[f'{path}b:0'] mod.bias.data.copy_(bias) def copy_ln(mod, vars, path): weight = vars[f'{path}scale:0'] bias = vars[f'{path}offset:0'] mod.weight.data.copy_(weight) mod.bias.data.copy_(bias) def get_tf_vars(tf_model): return {v.name: (torch.from_numpy(v.numpy()) if isinstance(v.numpy(), np.ndarray) else None) for v in tf_model.variables} def copy_tf_to_pytorch(tf_model, pytorch_model): tf_vars = get_tf_vars(tf_model) stem_conv = pytorch_model.stem[0] stem_point_bn = pytorch_model.stem[1].fn[0] stem_point_conv = pytorch_model.stem[1].fn[2] stem_attn_pool = pytorch_model.stem[2] copy_conv(stem_conv, tf_vars, 'enformer/trunk/stem/conv1_d/') copy_bn(stem_point_bn, tf_vars, 'enformer/trunk/stem/pointwise_conv_block/cross_replica_batch_norm/') copy_conv(stem_point_conv, tf_vars, 'enformer/trunk/stem/pointwise_conv_block/conv1_d/') copy_attn_pool(stem_attn_pool, tf_vars, 'enformer/trunk/stem/softmax_pooling/linear/w:0') for ind, tower_block in enumerate(pytorch_model.conv_tower): tower_bn = tower_block[0][0] tower_conv = tower_block[0][2] tower_point_bn = tower_block[1].fn[0] tower_point_conv = tower_block[1].fn[2] tower_attn_pool = tower_block[2] conv_path = f'enformer/trunk/conv_tower/conv_tower_block_{ind}/conv_block/conv1_d/' bn_path = f'enformer/trunk/conv_tower/conv_tower_block_{ind}/conv_block/cross_replica_batch_norm/' point_conv_path = f'enformer/trunk/conv_tower/conv_tower_block_{ind}/pointwise_conv_block/conv1_d/' point_bn_path = f'enformer/trunk/conv_tower/conv_tower_block_{ind}/pointwise_conv_block/cross_replica_batch_norm/' attn_pool_path = f'enformer/trunk/conv_tower/conv_tower_block_{ind}/softmax_pooling/linear/w:0' copy_bn(tower_bn, tf_vars, bn_path) copy_conv(tower_conv, tf_vars, conv_path) copy_bn(tower_point_bn, tf_vars, point_bn_path) copy_conv(tower_point_conv, tf_vars, point_conv_path) copy_attn_pool(tower_attn_pool, tf_vars, attn_pool_path) for ind, transformer_block in enumerate(pytorch_model.transformer): attn_ln_path = f'enformer/trunk/transformer/transformer_block_{ind}/mha/layer_norm/' attn_q_path = f'enformer/trunk/transformer/transformer_block_{ind}/mha/attention_{ind}/q_layer/' attn_k_path = f'enformer/trunk/transformer/transformer_block_{ind}/mha/attention_{ind}/k_layer/' attn_r_k_path = f'enformer/trunk/transformer/transformer_block_{ind}/mha/attention_{ind}/r_k_layer/' attn_v_path = f'enformer/trunk/transformer/transformer_block_{ind}/mha/attention_{ind}/v_layer/' attn_out_path = f'enformer/trunk/transformer/transformer_block_{ind}/mha/attention_{ind}/embedding_layer/' attn_content_bias_path = f'enformer/trunk/transformer/transformer_block_{ind}/mha/attention_{ind}/r_w_bias:0' attn_rel_bias_path = f'enformer/trunk/transformer/transformer_block_{ind}/mha/attention_{ind}/r_r_bias:0' ff_ln_path = f'enformer/trunk/transformer/transformer_block_{ind}/mlp/layer_norm/' # https://github.com/deepmind/deepmind-research/blob/master/enformer/enformer.py#L119 # needs to be edited to snt.Linear(channels * 2, name = 'project_in') and snt.Linear(channels, name = 'project_out') or variables are not accessible ff_linear1_path = f'enformer/trunk/transformer/transformer_block_{ind}/mlp/project_in/' ff_linear2_path = f'enformer/trunk/transformer/transformer_block_{ind}/mlp/project_out/' attn = transformer_block[0] attn_ln = attn.fn[0] mha = attn.fn[1] copy_linear(mha.to_q, tf_vars, attn_q_path, has_bias = False) copy_linear(mha.to_k, tf_vars, attn_k_path, has_bias = False) copy_linear(mha.to_rel_k, tf_vars, attn_r_k_path, has_bias = False) copy_linear(mha.to_v, tf_vars, attn_v_path, has_bias = False) copy_linear(mha.to_out, tf_vars, attn_out_path) mha.rel_content_bias.data.copy_(tf_vars[attn_content_bias_path]) mha.rel_pos_bias.data.copy_(tf_vars[attn_rel_bias_path]) ff = transformer_block[-1] ff_ln = ff.fn[0] ff_linear1 = ff.fn[1] ff_linear2 = ff.fn[4] copy_ln(attn_ln, tf_vars, attn_ln_path) copy_ln(ff_ln, tf_vars, ff_ln_path) copy_linear(ff_linear1, tf_vars, ff_linear1_path) copy_linear(ff_linear2, tf_vars, ff_linear2_path) final_bn = pytorch_model.final_pointwise[1][0] final_conv = pytorch_model.final_pointwise[1][2] copy_bn(final_bn, tf_vars, 'enformer/trunk/final_pointwise/conv_block/cross_replica_batch_norm/') copy_conv(final_conv, tf_vars, 'enformer/trunk/final_pointwise/conv_block/conv1_d/') human_linear = pytorch_model._heads['human'][0] mouse_linear = pytorch_model._heads['mouse'][0] copy_linear(human_linear, tf_vars, 'enformer/heads/head_human/linear/') copy_linear(mouse_linear, tf_vars, 'enformer/heads/head_mouse/linear/') print('success')
enformer-pytorch-main
scripts/tf_to_torch.py
import sys from setuptools import setup, find_packages sys.path[0:0] = ['big_sleep'] from version import __version__ setup( name = 'big-sleep', packages = find_packages(), include_package_data = True, entry_points={ 'console_scripts': [ 'dream = big_sleep.cli:main', ], }, version = __version__, license='MIT', description = 'Big Sleep', author = 'Ryan Murdock, Phil Wang', author_email = 'lucidrains@gmail.com', url = 'https://github.com/lucidrains/big-sleep', keywords = [ 'artificial intelligence', 'deep learning', 'transformers', 'text to image', 'generative adversarial networks' ], install_requires=[ 'torch>=1.7.1', 'einops>=0.3', 'fire', 'ftfy', 'pytorch-pretrained-biggan', 'regex', 'torchvision>=0.8.2', 'tqdm' ], classifiers=[ 'Development Status :: 4 - Beta', 'Intended Audience :: Developers', 'Topic :: Scientific/Engineering :: Artificial Intelligence', 'License :: OSI Approved :: MIT License', 'Programming Language :: Python :: 3.6', ], )
big-sleep-main
setup.py
import time import shutil import torch from big_sleep import Imagine terminate = False def signal_handling(signum,frame): global terminate terminate = True num_attempts = 4 for attempt in range(num_attempts): dream = Imagine( text = "an armchair in the form of pikachu\\an armchair imitating pikachu\\abstract", text_min = "blur\\zoom", lr = 7e-2, image_size = 512, gradient_accumulate_every = 1, save_every = 50, epochs = 5, iterations = 50, save_progress = False, bilinear = False, open_folder = False, seed = None, torch_deterministic = False, max_classes = 20, class_temperature = 2., save_date_time = False, save_best = True, experimental_resample = True, ema_decay = 0.99 ) dream() shutil.copy(dream.textpath + ".best.png", f"{attempt}.png") try: time.sleep(2) del dream time.sleep(2) torch.cuda.empty_cache() except Exception: torch.cuda.empty_cache()
big-sleep-main
test/multi_prompt_minmax.py
__version__ = '0.9.1'
big-sleep-main
big_sleep/version.py
"""Good differentiable image resampling for PyTorch.""" from functools import update_wrapper import math import torch from torch.nn import functional as F def sinc(x): return torch.where(x != 0, torch.sin(math.pi * x) / (math.pi * x), x.new_ones([])) def lanczos(x, a): cond = torch.logical_and(-a < x, x < a) out = torch.where(cond, sinc(x) * sinc(x/a), x.new_zeros([])) return out / out.sum() def ramp(ratio, width): n = math.ceil(width / ratio + 1) out = torch.empty([n]) cur = 0 for i in range(out.shape[0]): out[i] = cur cur += ratio return torch.cat([-out[1:].flip([0]), out])[1:-1] def odd(fn): return update_wrapper(lambda x: torch.sign(x) * fn(abs(x)), fn) def _to_linear_srgb(input): cond = input <= 0.04045 a = input / 12.92 b = ((input + 0.055) / 1.055)**2.4 return torch.where(cond, a, b) def _to_nonlinear_srgb(input): cond = input <= 0.0031308 a = 12.92 * input b = 1.055 * input**(1/2.4) - 0.055 return torch.where(cond, a, b) to_linear_srgb = odd(_to_linear_srgb) to_nonlinear_srgb = odd(_to_nonlinear_srgb) def resample(input, size, align_corners=True, is_srgb=False): n, c, h, w = input.shape dh, dw = size if is_srgb: input = to_linear_srgb(input) input = input.view([n * c, 1, h, w]) if dh < h: kernel_h = lanczos(ramp(dh / h, 3), 3).to(input.device, input.dtype) pad_h = (kernel_h.shape[0] - 1) // 2 input = F.pad(input, (0, 0, pad_h, pad_h), 'reflect') input = F.conv2d(input, kernel_h[None, None, :, None]) if dw < w: kernel_w = lanczos(ramp(dw / w, 3), 3).to(input.device, input.dtype) pad_w = (kernel_w.shape[0] - 1) // 2 input = F.pad(input, (pad_w, pad_w, 0, 0), 'reflect') input = F.conv2d(input, kernel_w[None, None, None, :]) input = input.view([n, c, h, w]) input = F.interpolate(input, size, mode='bicubic', align_corners=align_corners) if is_srgb: input = to_nonlinear_srgb(input) return input
big-sleep-main
big_sleep/resample.py
# Exponential Moving Average (from https://gist.github.com/crowsonkb/76b94d5238272722290734bf4725d204) """Exponential moving average for PyTorch. Adapted from https://www.zijianhu.com/post/pytorch/ema/ by crowsonkb """ from copy import deepcopy import torch from torch import nn class EMA(nn.Module): def __init__(self, model, decay): super().__init__() self.model = model self.decay = decay self.register_buffer('accum', torch.tensor(1.)) self._biased = deepcopy(self.model) self.average = deepcopy(self.model) for param in self._biased.parameters(): param.detach_().zero_() for param in self.average.parameters(): param.detach_().zero_() self.update() @torch.no_grad() def update(self): assert self.training, 'Update should only be called during training' self.accum *= self.decay model_params = dict(self.model.named_parameters()) biased_params = dict(self._biased.named_parameters()) average_params = dict(self.average.named_parameters()) assert model_params.keys() == biased_params.keys() == average_params.keys(), f'Model parameter keys incompatible with EMA stored parameter keys' for name, param in model_params.items(): biased_params[name].mul_(self.decay) biased_params[name].add_((1 - self.decay) * param) average_params[name].copy_(biased_params[name]) average_params[name].div_(1 - self.accum) model_buffers = dict(self.model.named_buffers()) biased_buffers = dict(self._biased.named_buffers()) average_buffers = dict(self.average.named_buffers()) assert model_buffers.keys() == biased_buffers.keys() == average_buffers.keys() for name, buffer in model_buffers.items(): biased_buffers[name].copy_(buffer) average_buffers[name].copy_(buffer) def forward(self, *args, **kwargs): if self.training: return self.model(*args, **kwargs) return self.average(*args, **kwargs)
big-sleep-main
big_sleep/ema.py
from big_sleep.big_sleep import BigSleep, Imagine
big-sleep-main
big_sleep/__init__.py
# this code is a copy from huggingface # with some minor modifications import torch import torch.nn as nn import torch.nn.functional as F import math import json import copy import logging import os import shutil import tempfile from functools import wraps from hashlib import sha256 import sys from io import open import boto3 import requests from botocore.exceptions import ClientError from tqdm import tqdm try: from urllib.parse import urlparse except ImportError: from urlparse import urlparse try: from pathlib import Path PYTORCH_PRETRAINED_BIGGAN_CACHE = Path(os.getenv('PYTORCH_PRETRAINED_BIGGAN_CACHE', Path.home() / '.pytorch_pretrained_biggan')) except (AttributeError, ImportError): PYTORCH_PRETRAINED_BIGGAN_CACHE = os.getenv('PYTORCH_PRETRAINED_BIGGAN_CACHE', os.path.join(os.path.expanduser("~"), '.pytorch_pretrained_biggan')) logger = logging.getLogger(__name__) # pylint: disable=invalid-name PRETRAINED_MODEL_ARCHIVE_MAP = { 'biggan-deep-128': "https://s3.amazonaws.com/models.huggingface.co/biggan/biggan-deep-128-pytorch_model.bin", 'biggan-deep-256': "https://s3.amazonaws.com/models.huggingface.co/biggan/biggan-deep-256-pytorch_model.bin", 'biggan-deep-512': "https://s3.amazonaws.com/models.huggingface.co/biggan/biggan-deep-512-pytorch_model.bin", } PRETRAINED_CONFIG_ARCHIVE_MAP = { 'biggan-deep-128': "https://s3.amazonaws.com/models.huggingface.co/biggan/biggan-deep-128-config.json", 'biggan-deep-256': "https://s3.amazonaws.com/models.huggingface.co/biggan/biggan-deep-256-config.json", 'biggan-deep-512': "https://s3.amazonaws.com/models.huggingface.co/biggan/biggan-deep-512-config.json", } WEIGHTS_NAME = 'pytorch_model.bin' CONFIG_NAME = 'config.json' def url_to_filename(url, etag=None): """ Convert `url` into a hashed filename in a repeatable way. If `etag` is specified, append its hash to the url's, delimited by a period. """ url_bytes = url.encode('utf-8') url_hash = sha256(url_bytes) filename = url_hash.hexdigest() if etag: etag_bytes = etag.encode('utf-8') etag_hash = sha256(etag_bytes) filename += '.' + etag_hash.hexdigest() return filename def filename_to_url(filename, cache_dir=None): """ Return the url and etag (which may be ``None``) stored for `filename`. Raise ``EnvironmentError`` if `filename` or its stored metadata do not exist. """ if cache_dir is None: cache_dir = PYTORCH_PRETRAINED_BIGGAN_CACHE if sys.version_info[0] == 3 and isinstance(cache_dir, Path): cache_dir = str(cache_dir) cache_path = os.path.join(cache_dir, filename) if not os.path.exists(cache_path): raise EnvironmentError("file {} not found".format(cache_path)) meta_path = cache_path + '.json' if not os.path.exists(meta_path): raise EnvironmentError("file {} not found".format(meta_path)) with open(meta_path, encoding="utf-8") as meta_file: metadata = json.load(meta_file) url = metadata['url'] etag = metadata['etag'] return url, etag def cached_path(url_or_filename, cache_dir=None): """ Given something that might be a URL (or might be a local path), determine which. If it's a URL, download the file and cache it, and return the path to the cached file. If it's already a local path, make sure the file exists and then return the path. """ if cache_dir is None: cache_dir = PYTORCH_PRETRAINED_BIGGAN_CACHE if sys.version_info[0] == 3 and isinstance(url_or_filename, Path): url_or_filename = str(url_or_filename) if sys.version_info[0] == 3 and isinstance(cache_dir, Path): cache_dir = str(cache_dir) parsed = urlparse(url_or_filename) if parsed.scheme in ('http', 'https', 's3'): # URL, so get it from the cache (downloading if necessary) return get_from_cache(url_or_filename, cache_dir) elif os.path.exists(url_or_filename): # File, and it exists. return url_or_filename elif parsed.scheme == '': # File, but it doesn't exist. raise EnvironmentError("file {} not found".format(url_or_filename)) else: # Something unknown raise ValueError("unable to parse {} as a URL or as a local path".format(url_or_filename)) def split_s3_path(url): """Split a full s3 path into the bucket name and path.""" parsed = urlparse(url) if not parsed.netloc or not parsed.path: raise ValueError("bad s3 path {}".format(url)) bucket_name = parsed.netloc s3_path = parsed.path # Remove '/' at beginning of path. if s3_path.startswith("/"): s3_path = s3_path[1:] return bucket_name, s3_path def s3_request(func): """ Wrapper function for s3 requests in order to create more helpful error messages. """ @wraps(func) def wrapper(url, *args, **kwargs): try: return func(url, *args, **kwargs) except ClientError as exc: if int(exc.response["Error"]["Code"]) == 404: raise EnvironmentError("file {} not found".format(url)) else: raise return wrapper @s3_request def s3_etag(url): """Check ETag on S3 object.""" s3_resource = boto3.resource("s3") bucket_name, s3_path = split_s3_path(url) s3_object = s3_resource.Object(bucket_name, s3_path) return s3_object.e_tag @s3_request def s3_get(url, temp_file): """Pull a file directly from S3.""" s3_resource = boto3.resource("s3") bucket_name, s3_path = split_s3_path(url) s3_resource.Bucket(bucket_name).download_fileobj(s3_path, temp_file) def http_get(url, temp_file): req = requests.get(url, stream=True) content_length = req.headers.get('Content-Length') total = int(content_length) if content_length is not None else None progress = tqdm(unit="B", total=total) for chunk in req.iter_content(chunk_size=1024): if chunk: # filter out keep-alive new chunks progress.update(len(chunk)) temp_file.write(chunk) progress.close() def get_from_cache(url, cache_dir=None): """ Given a URL, look for the corresponding dataset in the local cache. If it's not there, download it. Then return the path to the cached file. """ if cache_dir is None: cache_dir = PYTORCH_PRETRAINED_BIGGAN_CACHE if sys.version_info[0] == 3 and isinstance(cache_dir, Path): cache_dir = str(cache_dir) if not os.path.exists(cache_dir): os.makedirs(cache_dir) # Get eTag to add to filename, if it exists. if url.startswith("s3://"): etag = s3_etag(url) else: response = requests.head(url, allow_redirects=True) if response.status_code != 200: raise IOError("HEAD request failed for url {} with status code {}" .format(url, response.status_code)) etag = response.headers.get("ETag") filename = url_to_filename(url, etag) # get cache path to put the file cache_path = os.path.join(cache_dir, filename) if not os.path.exists(cache_path): # Download to temporary file, then copy to cache dir once finished. # Otherwise you get corrupt cache entries if the download gets interrupted. with tempfile.NamedTemporaryFile() as temp_file: logger.info("%s not found in cache, downloading to %s", url, temp_file.name) # GET file object if url.startswith("s3://"): s3_get(url, temp_file) else: http_get(url, temp_file) # we are copying the file before closing it, so flush to avoid truncation temp_file.flush() # shutil.copyfileobj() starts at the current position, so go to the start temp_file.seek(0) logger.info("copying %s to cache at %s", temp_file.name, cache_path) with open(cache_path, 'wb') as cache_file: shutil.copyfileobj(temp_file, cache_file) logger.info("creating metadata file for %s", cache_path) meta = {'url': url, 'etag': etag} meta_path = cache_path + '.json' with open(meta_path, 'w', encoding="utf-8") as meta_file: json.dump(meta, meta_file) logger.info("removing temp file %s", temp_file.name) return cache_path def read_set_from_file(filename): ''' Extract a de-duped collection (set) of text from a file. Expected file format is one item per line. ''' collection = set() with open(filename, 'r', encoding='utf-8') as file_: for line in file_: collection.add(line.rstrip()) return collection def get_file_extension(path, dot=True, lower=True): ext = os.path.splitext(path)[1] ext = ext if dot else ext[1:] return ext.lower() if lower else ext class BigGANConfig(object): """ Configuration class to store the configuration of a `BigGAN`. Defaults are for the 128x128 model. layers tuple are (up-sample in the layer ?, input channels, output channels) """ def __init__(self, output_dim=128, z_dim=128, class_embed_dim=128, channel_width=128, num_classes=1000, layers=[(False, 16, 16), (True, 16, 16), (False, 16, 16), (True, 16, 8), (False, 8, 8), (True, 8, 4), (False, 4, 4), (True, 4, 2), (False, 2, 2), (True, 2, 1)], attention_layer_position=8, eps=1e-4, n_stats=51): """Constructs BigGANConfig. """ self.output_dim = output_dim self.z_dim = z_dim self.class_embed_dim = class_embed_dim self.channel_width = channel_width self.num_classes = num_classes self.layers = layers self.attention_layer_position = attention_layer_position self.eps = eps self.n_stats = n_stats @classmethod def from_dict(cls, json_object): """Constructs a `BigGANConfig` from a Python dictionary of parameters.""" config = BigGANConfig() for key, value in json_object.items(): config.__dict__[key] = value return config @classmethod def from_json_file(cls, json_file): """Constructs a `BigGANConfig` from a json file of parameters.""" with open(json_file, "r", encoding='utf-8') as reader: text = reader.read() return cls.from_dict(json.loads(text)) def __repr__(self): return str(self.to_json_string()) def to_dict(self): """Serializes this instance to a Python dictionary.""" output = copy.deepcopy(self.__dict__) return output def to_json_string(self): """Serializes this instance to a JSON string.""" return json.dumps(self.to_dict(), indent=2, sort_keys=True) + "\n" def snconv2d(eps=1e-12, **kwargs): return nn.utils.spectral_norm(nn.Conv2d(**kwargs), eps=eps) def snlinear(eps=1e-12, **kwargs): return nn.utils.spectral_norm(nn.Linear(**kwargs), eps=eps) def sn_embedding(eps=1e-12, **kwargs): return nn.utils.spectral_norm(nn.Embedding(**kwargs), eps=eps) class SelfAttn(nn.Module): """ Self attention Layer""" def __init__(self, in_channels, eps=1e-12): super(SelfAttn, self).__init__() self.in_channels = in_channels self.snconv1x1_theta = snconv2d(in_channels=in_channels, out_channels=in_channels//8, kernel_size=1, bias=False, eps=eps) self.snconv1x1_phi = snconv2d(in_channels=in_channels, out_channels=in_channels//8, kernel_size=1, bias=False, eps=eps) self.snconv1x1_g = snconv2d(in_channels=in_channels, out_channels=in_channels//2, kernel_size=1, bias=False, eps=eps) self.snconv1x1_o_conv = snconv2d(in_channels=in_channels//2, out_channels=in_channels, kernel_size=1, bias=False, eps=eps) self.maxpool = nn.MaxPool2d(2, stride=2, padding=0) self.softmax = nn.Softmax(dim=-1) self.gamma = nn.Parameter(torch.zeros(1)) def forward(self, x): _, ch, h, w = x.size() # Theta path theta = self.snconv1x1_theta(x) theta = theta.view(-1, ch//8, h*w) # Phi path phi = self.snconv1x1_phi(x) phi = self.maxpool(phi) phi = phi.view(-1, ch//8, h*w//4) # Attn map attn = torch.bmm(theta.permute(0, 2, 1), phi) attn = self.softmax(attn) # g path g = self.snconv1x1_g(x) g = self.maxpool(g) g = g.view(-1, ch//2, h*w//4) # Attn_g - o_conv attn_g = torch.bmm(g, attn.permute(0, 2, 1)) attn_g = attn_g.view(-1, ch//2, h, w) attn_g = self.snconv1x1_o_conv(attn_g) # Out out = x + self.gamma*attn_g return out class BigGANBatchNorm(nn.Module): """ This is a batch norm module that can handle conditional input and can be provided with pre-computed activation means and variances for various truncation parameters. We cannot just rely on torch.batch_norm since it cannot handle batched weights (pytorch 1.0.1). We computate batch_norm our-self without updating running means and variances. If you want to train this model you should add running means and variance computation logic. """ def __init__(self, num_features, condition_vector_dim=None, n_stats=51, eps=1e-4, conditional=True): super(BigGANBatchNorm, self).__init__() self.num_features = num_features self.eps = eps self.conditional = conditional # We use pre-computed statistics for n_stats values of truncation between 0 and 1 self.register_buffer('running_means', torch.zeros(n_stats, num_features)) self.register_buffer('running_vars', torch.ones(n_stats, num_features)) self.step_size = 1.0 / (n_stats - 1) if conditional: assert condition_vector_dim is not None self.scale = snlinear(in_features=condition_vector_dim, out_features=num_features, bias=False, eps=eps) self.offset = snlinear(in_features=condition_vector_dim, out_features=num_features, bias=False, eps=eps) else: self.weight = torch.nn.Parameter(torch.Tensor(num_features)) self.bias = torch.nn.Parameter(torch.Tensor(num_features)) def forward(self, x, truncation, condition_vector=None): # Retreive pre-computed statistics associated to this truncation coef, start_idx = math.modf(truncation / self.step_size) start_idx = int(start_idx) if coef != 0.0: # Interpolate running_mean = self.running_means[start_idx] * coef + self.running_means[start_idx + 1] * (1 - coef) running_var = self.running_vars[start_idx] * coef + self.running_vars[start_idx + 1] * (1 - coef) else: running_mean = self.running_means[start_idx] running_var = self.running_vars[start_idx] if self.conditional: running_mean = running_mean.unsqueeze(0).unsqueeze(-1).unsqueeze(-1) running_var = running_var.unsqueeze(0).unsqueeze(-1).unsqueeze(-1) weight = 1 + self.scale(condition_vector).unsqueeze(-1).unsqueeze(-1) bias = self.offset(condition_vector).unsqueeze(-1).unsqueeze(-1) out = (x - running_mean) / torch.sqrt(running_var + self.eps) * weight + bias else: out = F.batch_norm(x, running_mean, running_var, self.weight, self.bias, training=False, momentum=0.0, eps=self.eps) return out class GenBlock(nn.Module): def __init__(self, in_size, out_size, condition_vector_dim, reduction_factor=4, up_sample=False, n_stats=51, eps=1e-12): super(GenBlock, self).__init__() self.up_sample = up_sample self.drop_channels = (in_size != out_size) middle_size = in_size // reduction_factor self.bn_0 = BigGANBatchNorm(in_size, condition_vector_dim, n_stats=n_stats, eps=eps, conditional=True) self.conv_0 = snconv2d(in_channels=in_size, out_channels=middle_size, kernel_size=1, eps=eps) self.bn_1 = BigGANBatchNorm(middle_size, condition_vector_dim, n_stats=n_stats, eps=eps, conditional=True) self.conv_1 = snconv2d(in_channels=middle_size, out_channels=middle_size, kernel_size=3, padding=1, eps=eps) self.bn_2 = BigGANBatchNorm(middle_size, condition_vector_dim, n_stats=n_stats, eps=eps, conditional=True) self.conv_2 = snconv2d(in_channels=middle_size, out_channels=middle_size, kernel_size=3, padding=1, eps=eps) self.bn_3 = BigGANBatchNorm(middle_size, condition_vector_dim, n_stats=n_stats, eps=eps, conditional=True) self.conv_3 = snconv2d(in_channels=middle_size, out_channels=out_size, kernel_size=1, eps=eps) self.relu = nn.ReLU() def forward(self, x, cond_vector, truncation): x0 = x x = self.bn_0(x, truncation, cond_vector) x = self.relu(x) x = self.conv_0(x) x = self.bn_1(x, truncation, cond_vector) x = self.relu(x) if self.up_sample: x = F.interpolate(x, scale_factor=2, mode='nearest') x = self.conv_1(x) x = self.bn_2(x, truncation, cond_vector) x = self.relu(x) x = self.conv_2(x) x = self.bn_3(x, truncation, cond_vector) x = self.relu(x) x = self.conv_3(x) if self.drop_channels: new_channels = x0.shape[1] // 2 x0 = x0[:, :new_channels, ...] if self.up_sample: x0 = F.interpolate(x0, scale_factor=2, mode='nearest') out = x + x0 return out class Generator(nn.Module): def __init__(self, config): super(Generator, self).__init__() self.config = config ch = config.channel_width condition_vector_dim = config.z_dim * 2 self.gen_z = snlinear(in_features=condition_vector_dim, out_features=4 * 4 * 16 * ch, eps=config.eps) layers = [] for i, layer in enumerate(config.layers): if i == config.attention_layer_position: layers.append(SelfAttn(ch*layer[1], eps=config.eps)) layers.append(GenBlock(ch*layer[1], ch*layer[2], condition_vector_dim, up_sample=layer[0], n_stats=config.n_stats, eps=config.eps)) self.layers = nn.ModuleList(layers) self.bn = BigGANBatchNorm(ch, n_stats=config.n_stats, eps=config.eps, conditional=False) self.relu = nn.ReLU() self.conv_to_rgb = snconv2d(in_channels=ch, out_channels=ch, kernel_size=3, padding=1, eps=config.eps) self.tanh = nn.Tanh() def forward(self, cond_vector, truncation): z = self.gen_z(cond_vector[0].unsqueeze(0)) # We use this conversion step to be able to use TF weights: # TF convention on shape is [batch, height, width, channels] # PT convention on shape is [batch, channels, height, width] z = z.view(-1, 4, 4, 16 * self.config.channel_width) z = z.permute(0, 3, 1, 2).contiguous() next_available_latent_index = 1 for layer in self.layers: if isinstance(layer, GenBlock): z = layer(z, cond_vector[next_available_latent_index].unsqueeze(0), truncation) next_available_latent_index += 1 else: z = layer(z) z = self.bn(z, truncation) z = self.relu(z) z = self.conv_to_rgb(z) z = z[:, :3, ...] z = self.tanh(z) return z class BigGAN(nn.Module): """BigGAN Generator.""" @classmethod def from_pretrained(cls, pretrained_model_name_or_path, cache_dir=None, *inputs, **kwargs): if pretrained_model_name_or_path in PRETRAINED_MODEL_ARCHIVE_MAP: model_file = PRETRAINED_MODEL_ARCHIVE_MAP[pretrained_model_name_or_path] config_file = PRETRAINED_CONFIG_ARCHIVE_MAP[pretrained_model_name_or_path] else: model_file = os.path.join(pretrained_model_name_or_path, WEIGHTS_NAME) config_file = os.path.join(pretrained_model_name_or_path, CONFIG_NAME) try: resolved_model_file = cached_path(model_file, cache_dir=cache_dir) resolved_config_file = cached_path(config_file, cache_dir=cache_dir) except EnvironmentError: logger.error("Wrong model name, should be a valid path to a folder containing " "a {} file and a {} file or a model name in {}".format( WEIGHTS_NAME, CONFIG_NAME, PRETRAINED_MODEL_ARCHIVE_MAP.keys())) raise logger.info("loading model {} from cache at {}".format(pretrained_model_name_or_path, resolved_model_file)) # Load config config = BigGANConfig.from_json_file(resolved_config_file) logger.info("Model config {}".format(config)) # Instantiate model. model = cls(config, *inputs, **kwargs) state_dict = torch.load(resolved_model_file, map_location='cpu' if not torch.cuda.is_available() else None) model.load_state_dict(state_dict, strict=False) return model def __init__(self, config): super(BigGAN, self).__init__() self.config = config self.embeddings = nn.Linear(config.num_classes, config.z_dim, bias=False) self.generator = Generator(config) def forward(self, z, class_label, truncation): assert 0 < truncation <= 1 embed = self.embeddings(class_label) cond_vector = torch.cat((z, embed), dim=1) z = self.generator(cond_vector, truncation) return z
big-sleep-main
big_sleep/biggan.py
import fire import random as rnd from big_sleep import Imagine, version from pathlib import Path from .version import __version__; def train( text=None, img=None, text_min="", lr = .07, image_size = 512, gradient_accumulate_every = 1, epochs = 20, iterations = 1050, save_every = 50, overwrite = False, save_progress = False, save_date_time = False, bilinear = False, open_folder = True, seed = 0, append_seed = False, random = False, torch_deterministic = False, max_classes = None, class_temperature = 2., save_best = False, experimental_resample = False, ema_decay = 0.5, num_cutouts = 128, center_bias = False, larger_model = False ): print(f'Starting up... v{__version__}') if random: seed = rnd.randint(0, 1e6) imagine = Imagine( text=text, img=img, text_min=text_min, lr = lr, image_size = image_size, gradient_accumulate_every = gradient_accumulate_every, epochs = epochs, iterations = iterations, save_every = save_every, save_progress = save_progress, bilinear = bilinear, seed = seed, append_seed = append_seed, torch_deterministic = torch_deterministic, open_folder = open_folder, max_classes = max_classes, class_temperature = class_temperature, save_date_time = save_date_time, save_best = save_best, experimental_resample = experimental_resample, ema_decay = ema_decay, num_cutouts = num_cutouts, center_bias = center_bias, larger_clip = larger_model ) if not overwrite and imagine.filename.exists(): answer = input('Imagined image already exists, do you want to overwrite? (y/n) ').lower() if answer not in ('yes', 'y'): exit() imagine() def main(): fire.Fire(train)
big-sleep-main
big_sleep/cli.py
import os import sys import subprocess import signal import string import re from datetime import datetime from pathlib import Path import random import torch import torch.nn.functional as F from torch import nn from torch.optim import Adam from torchvision.utils import save_image import torchvision.transforms as T from PIL import Image from tqdm import tqdm, trange from big_sleep.ema import EMA from big_sleep.resample import resample from big_sleep.biggan import BigGAN from big_sleep.clip import load, tokenize assert torch.cuda.is_available(), 'CUDA must be available in order to use Big Sleep' # graceful keyboard interrupt terminate = False def signal_handling(signum,frame): print('detecting keyboard interrupt, gracefully exiting') global terminate terminate = True signal.signal(signal.SIGINT,signal_handling) # helpers def exists(val): return val is not None def open_folder(path): if os.path.isfile(path): path = os.path.dirname(path) if not os.path.isdir(path): return cmd_list = None if sys.platform == 'darwin': cmd_list = ['open', '--', path] elif sys.platform == 'linux2' or sys.platform == 'linux': cmd_list = ['xdg-open', path] elif sys.platform in ['win32', 'win64']: cmd_list = ['explorer', path.replace('/','\\')] if cmd_list == None: return try: subprocess.check_call(cmd_list) except subprocess.CalledProcessError: pass except OSError: pass def create_text_path(text=None, img=None, encoding=None): input_name = "" if text is not None: input_name += text if img is not None: if isinstance(img, str): img_name = "".join(img.split(".")[:-1]) # replace spaces by underscores, remove img extension img_name = img_name.split("/")[-1] # only take img name, not path else: img_name = "PIL_img" input_name += "_" + img_name if encoding is not None: input_name = "your_encoding" return input_name.replace("-", "_").replace(",", "").replace(" ", "_").replace("|", "--").strip('-_')[:255] # tensor helpers def differentiable_topk(x, k, temperature=1.): n, dim = x.shape topk_tensors = [] for i in range(k): is_last = i == (k - 1) values, indices = (x / temperature).softmax(dim=-1).topk(1, dim=-1) topks = torch.zeros_like(x).scatter_(-1, indices, values) topk_tensors.append(topks) if not is_last: x = x.scatter(-1, indices, float('-inf')) topks = torch.cat(topk_tensors, dim=-1) return topks.reshape(n, k, dim).sum(dim = 1) def create_clip_img_transform(image_width): clip_mean = [0.48145466, 0.4578275, 0.40821073] clip_std = [0.26862954, 0.26130258, 0.27577711] transform = T.Compose([ #T.ToPILImage(), T.Resize(image_width), T.CenterCrop((image_width, image_width)), T.ToTensor(), T.Normalize(mean=clip_mean, std=clip_std) ]) return transform def rand_cutout(image, size, center_bias=False, center_focus=2): width = image.shape[-1] min_offset = 0 max_offset = width - size if center_bias: # sample around image center center = max_offset / 2 std = center / center_focus offset_x = int(random.gauss(mu=center, sigma=std)) offset_y = int(random.gauss(mu=center, sigma=std)) # resample uniformly if over boundaries offset_x = random.randint(min_offset, max_offset) if (offset_x > max_offset or offset_x < min_offset) else offset_x offset_y = random.randint(min_offset, max_offset) if (offset_y > max_offset or offset_y < min_offset) else offset_y else: offset_x = random.randint(min_offset, max_offset) offset_y = random.randint(min_offset, max_offset) cutout = image[:, :, offset_x:offset_x + size, offset_y:offset_y + size] return cutout # load biggan class Latents(torch.nn.Module): def __init__( self, num_latents = 15, num_classes = 1000, z_dim = 128, max_classes = None, class_temperature = 2. ): super().__init__() self.normu = torch.nn.Parameter(torch.zeros(num_latents, z_dim).normal_(std = 1)) self.cls = torch.nn.Parameter(torch.zeros(num_latents, num_classes).normal_(mean = -3.9, std = .3)) self.register_buffer('thresh_lat', torch.tensor(1)) assert not exists(max_classes) or max_classes > 0 and max_classes <= num_classes, f'max_classes must be between 0 and {num_classes}' self.max_classes = max_classes self.class_temperature = class_temperature def forward(self): if exists(self.max_classes): classes = differentiable_topk(self.cls, self.max_classes, temperature = self.class_temperature) else: classes = torch.sigmoid(self.cls) return self.normu, classes class Model(nn.Module): def __init__( self, image_size, max_classes = None, class_temperature = 2., ema_decay = 0.99 ): super().__init__() assert image_size in (128, 256, 512), 'image size must be one of 128, 256, or 512' self.biggan = BigGAN.from_pretrained(f'biggan-deep-{image_size}') self.max_classes = max_classes self.class_temperature = class_temperature self.ema_decay\ = ema_decay self.init_latents() def init_latents(self): latents = Latents( num_latents = len(self.biggan.config.layers) + 1, num_classes = self.biggan.config.num_classes, z_dim = self.biggan.config.z_dim, max_classes = self.max_classes, class_temperature = self.class_temperature ) self.latents = EMA(latents, self.ema_decay) def forward(self): self.biggan.eval() out = self.biggan(*self.latents(), 1) return (out + 1) / 2 class BigSleep(nn.Module): def __init__( self, num_cutouts = 128, loss_coef = 100, image_size = 512, bilinear = False, max_classes = None, class_temperature = 2., experimental_resample = False, ema_decay = 0.99, center_bias = False, larger_clip = False ): super().__init__() self.loss_coef = loss_coef self.image_size = image_size self.num_cutouts = num_cutouts self.experimental_resample = experimental_resample self.center_bias = center_bias self.interpolation_settings = {'mode': 'bilinear', 'align_corners': False} if bilinear else {'mode': 'nearest'} model_name = 'ViT-B/32' if not larger_clip else 'ViT-L/14' self.perceptor, self.normalize_image = load(model_name, jit = False) self.model = Model( image_size = image_size, max_classes = max_classes, class_temperature = class_temperature, ema_decay = ema_decay ) def reset(self): self.model.init_latents() def sim_txt_to_img(self, text_embed, img_embed, text_type="max"): sign = -1 if text_type == "min": sign = 1 return sign * self.loss_coef * torch.cosine_similarity(text_embed, img_embed, dim = -1).mean() def forward(self, text_embeds, text_min_embeds=[], return_loss = True): width, num_cutouts = self.image_size, self.num_cutouts out = self.model() if not return_loss: return out pieces = [] for ch in range(num_cutouts): # sample cutout size size = int(width * torch.zeros(1,).normal_(mean=.8, std=.3).clip(.5, .95)) # get cutout apper = rand_cutout(out, size, center_bias=self.center_bias) if (self.experimental_resample): apper = resample(apper, (224, 224)) else: apper = F.interpolate(apper, (224, 224), **self.interpolation_settings) pieces.append(apper) into = torch.cat(pieces) into = self.normalize_image(into) image_embed = self.perceptor.encode_image(into) latents, soft_one_hot_classes = self.model.latents() num_latents = latents.shape[0] latent_thres = self.model.latents.model.thresh_lat lat_loss = torch.abs(1 - torch.std(latents, dim=1)).mean() + \ torch.abs(torch.mean(latents, dim = 1)).mean() + \ 4 * torch.max(torch.square(latents).mean(), latent_thres) for array in latents: mean = torch.mean(array) diffs = array - mean var = torch.mean(torch.pow(diffs, 2.0)) std = torch.pow(var, 0.5) zscores = diffs / std skews = torch.mean(torch.pow(zscores, 3.0)) kurtoses = torch.mean(torch.pow(zscores, 4.0)) - 3.0 lat_loss = lat_loss + torch.abs(kurtoses) / num_latents + torch.abs(skews) / num_latents cls_loss = ((50 * torch.topk(soft_one_hot_classes, largest = False, dim = 1, k = 999)[0]) ** 2).mean() results = [] for txt_embed in text_embeds: results.append(self.sim_txt_to_img(txt_embed, image_embed)) for txt_min_embed in text_min_embeds: results.append(self.sim_txt_to_img(txt_min_embed, image_embed, "min")) sim_loss = sum(results).mean() return out, (lat_loss, cls_loss, sim_loss) class Imagine(nn.Module): def __init__( self, *, text=None, img=None, encoding=None, text_min = "", lr = .07, image_size = 512, gradient_accumulate_every = 1, save_every = 50, epochs = 20, iterations = 1050, save_progress = False, bilinear = False, open_folder = True, seed = None, append_seed = False, torch_deterministic = False, max_classes = None, class_temperature = 2., save_date_time = False, save_best = False, experimental_resample = False, ema_decay = 0.99, num_cutouts = 128, center_bias = False, larger_clip = False ): super().__init__() if torch_deterministic: assert not bilinear, 'the deterministic (seeded) operation does not work with interpolation (PyTorch 1.7.1)' torch.set_deterministic(True) self.seed = seed self.append_seed = append_seed if exists(seed): print(f'setting seed of {seed}') if seed == 0: print('you can override this with --seed argument in the command line, or --random for a randomly chosen one') torch.manual_seed(seed) self.epochs = epochs self.iterations = iterations model = BigSleep( image_size = image_size, bilinear = bilinear, max_classes = max_classes, class_temperature = class_temperature, experimental_resample = experimental_resample, ema_decay = ema_decay, num_cutouts = num_cutouts, center_bias = center_bias, larger_clip = larger_clip ).cuda() self.model = model self.lr = lr self.optimizer = Adam(model.model.latents.model.parameters(), lr) self.gradient_accumulate_every = gradient_accumulate_every self.save_every = save_every self.save_progress = save_progress self.save_date_time = save_date_time self.save_best = save_best self.current_best_score = 0 self.open_folder = open_folder self.total_image_updates = (self.epochs * self.iterations) / self.save_every self.encoded_texts = { "max": [], "min": [] } # create img transform self.clip_transform = create_clip_img_transform(224) # create starting encoding self.set_clip_encoding(text=text, img=img, encoding=encoding, text_min=text_min) @property def seed_suffix(self): return f'.{self.seed}' if self.append_seed and exists(self.seed) else '' def set_text(self, text): self.set_clip_encoding(text = text) def create_clip_encoding(self, text=None, img=None, encoding=None): self.text = text self.img = img if encoding is not None: encoding = encoding.cuda() #elif self.create_story: # encoding = self.update_story_encoding(epoch=0, iteration=1) elif text is not None and img is not None: encoding = (self.create_text_encoding(text) + self.create_img_encoding(img)) / 2 elif text is not None: encoding = self.create_text_encoding(text) elif img is not None: encoding = self.create_img_encoding(img) return encoding def create_text_encoding(self, text): tokenized_text = tokenize(text).cuda() with torch.no_grad(): text_encoding = self.model.perceptor.encode_text(tokenized_text).detach() return text_encoding def create_img_encoding(self, img): if isinstance(img, str): img = Image.open(img) normed_img = self.clip_transform(img).unsqueeze(0).cuda() with torch.no_grad(): img_encoding = self.model.perceptor.encode_image(normed_img).detach() return img_encoding def encode_multiple_phrases(self, text, img=None, encoding=None, text_type="max"): if text is not None and "|" in text: self.encoded_texts[text_type] = [self.create_clip_encoding(text=prompt_min, img=img, encoding=encoding) for prompt_min in text.split("|")] else: self.encoded_texts[text_type] = [self.create_clip_encoding(text=text, img=img, encoding=encoding)] def encode_max_and_min(self, text, img=None, encoding=None, text_min=""): self.encode_multiple_phrases(text, img=img, encoding=encoding) if text_min is not None and text_min != "": self.encode_multiple_phrases(text_min, img=img, encoding=encoding, text_type="min") def set_clip_encoding(self, text=None, img=None, encoding=None, text_min=""): self.current_best_score = 0 self.text = text self.text_min = text_min if len(text_min) > 0: text = text + "_wout_" + text_min[:255] if text is not None else "wout_" + text_min[:255] text_path = create_text_path(text=text, img=img, encoding=encoding) if self.save_date_time: text_path = datetime.now().strftime("%y%m%d-%H%M%S-") + text_path self.text_path = text_path self.filename = Path(f'./{text_path}{self.seed_suffix}.png') self.encode_max_and_min(text, img=img, encoding=encoding, text_min=text_min) # Tokenize and encode each prompt def reset(self): self.model.reset() self.model = self.model.cuda() self.optimizer = Adam(self.model.model.latents.parameters(), self.lr) def train_step(self, epoch, i, pbar=None): total_loss = 0 for _ in range(self.gradient_accumulate_every): out, losses = self.model(self.encoded_texts["max"], self.encoded_texts["min"]) loss = sum(losses) / self.gradient_accumulate_every total_loss += loss loss.backward() self.optimizer.step() self.model.model.latents.update() self.optimizer.zero_grad() if (i + 1) % self.save_every == 0: with torch.no_grad(): self.model.model.latents.eval() out, losses = self.model(self.encoded_texts["max"], self.encoded_texts["min"]) top_score, best = torch.topk(losses[2], k=1, largest=False) image = self.model.model()[best].cpu() self.model.model.latents.train() save_image(image, str(self.filename)) if pbar is not None: pbar.update(1) else: print(f'image updated at "./{str(self.filename)}"') if self.save_progress: total_iterations = epoch * self.iterations + i num = total_iterations // self.save_every save_image(image, Path(f'./{self.text_path}.{num}{self.seed_suffix}.png')) if self.save_best and top_score.item() < self.current_best_score: self.current_best_score = top_score.item() save_image(image, Path(f'./{self.text_path}{self.seed_suffix}.best.png')) return out, total_loss def forward(self): penalizing = "" if len(self.text_min) > 0: penalizing = f'penalizing "{self.text_min}"' print(f'Imagining "{self.text_path}" {penalizing}...') with torch.no_grad(): self.model(self.encoded_texts["max"][0]) # one warmup step due to issue with CLIP and CUDA if self.open_folder: open_folder('./') self.open_folder = False image_pbar = tqdm(total=self.total_image_updates, desc='image update', position=2, leave=True) epoch_pbar = trange(self.epochs, desc = ' epochs', position=0, leave=True) for epoch in (ep for ep in epoch_pbar if not terminate): pbar = trange(self.iterations, desc=' iteration', position=1, leave=True) image_pbar.update(0) for i in (it for it in pbar if not terminate): out, loss = self.train_step(epoch, i, image_pbar) pbar.set_description(f'loss: {loss.item():04.2f}')
big-sleep-main
big_sleep/big_sleep.py
from collections import OrderedDict from typing import Tuple, Union import torch import torch.nn.functional as F from torch import nn from pathlib import Path import hashlib import os import urllib import warnings from typing import Union, List import torch from PIL import Image from torchvision.transforms import Compose, Resize, CenterCrop, ToTensor, Normalize from tqdm import tqdm _MODELS = { "RN50": "https://openaipublic.azureedge.net/clip/models/afeb0e10f9e5a86da6080e35cf09123aca3b358a0c3e3b6c78a7b63bc04b6762/RN50.pt", "RN101": "https://openaipublic.azureedge.net/clip/models/8fa8567bab74a42d41c5915025a8e4538c3bdbe8804a470a72f30b0d94fab599/RN101.pt", "RN50x4": "https://openaipublic.azureedge.net/clip/models/7e526bd135e493cef0776de27d5f42653e6b4c8bf9e0f653bb11773263205fdd/RN50x4.pt", "ViT-B/32": "https://openaipublic.azureedge.net/clip/models/40d365715913c9da98579312b702a82c18be219cc2a73407c4526f58eba950af/ViT-B-32.pt", "ViT-L/14": "https://openaipublic.azureedge.net/clip/models/b8cca3fd41ae0c99ba7e8951adf17d267cdb84cd88be6f7c2e0eca1737a03836/ViT-L-14.pt" } def _download(url: str, root: str = os.path.expanduser("~/.cache/clip")): os.makedirs(root, exist_ok=True) filename = os.path.basename(url) expected_sha256 = url.split("/")[-2] download_target = os.path.join(root, filename) if os.path.exists(download_target) and not os.path.isfile(download_target): raise RuntimeError(f"{download_target} exists and is not a regular file") if os.path.isfile(download_target): if hashlib.sha256(open(download_target, "rb").read()).hexdigest() == expected_sha256: return download_target else: warnings.warn(f"{download_target} exists, but the SHA256 checksum does not match; re-downloading the file") with urllib.request.urlopen(url) as source, open(download_target, "wb") as output: with tqdm(total=int(source.info().get("Content-Length")), ncols=80, unit='iB', unit_scale=True) as loop: while True: buffer = source.read(8192) if not buffer: break output.write(buffer) loop.update(len(buffer)) if hashlib.sha256(open(download_target, "rb").read()).hexdigest() != expected_sha256: raise RuntimeError(f"Model has been downloaded but the SHA256 checksum does not not match") return download_target def _transform(): return Compose([ Normalize((0.48145466, 0.4578275, 0.40821073), (0.26862954, 0.26130258, 0.27577711)), ]) def available_models() -> List[str]: """Returns the names of available CLIP models""" return list(_MODELS.keys()) def load(name: str, device: Union[str, torch.device] = "cuda" if torch.cuda.is_available() else "cpu", jit=True): """Load a CLIP model Parameters ---------- name : str A model name listed by `clip.available_models()`, or the path to a model checkpoint containing the state_dict device : Union[str, torch.device] The device to put the loaded model jit : bool Whether to load the optimized JIT model (default) or more hackable non-JIT model. Returns ------- model : torch.nn.Module The CLIP model preprocess : Callable[[PIL.Image], torch.Tensor] A torchvision transform that converts a PIL image into a tensor that the returned model can take as its input """ if name in _MODELS: model_path = _download(_MODELS[name]) elif os.path.isfile(name): model_path = name else: raise RuntimeError(f"Model {name} not found; available models = {available_models()}") try: # loading JIT archive model = torch.jit.load(model_path, map_location=device if jit else "cpu").eval() state_dict = None except RuntimeError: # loading saved state dict if jit: warnings.warn(f"File {model_path} is not a JIT archive. Loading as a state dict instead") jit = False state_dict = torch.load(model_path, map_location="cpu") if not jit: model = build_model(state_dict or model.state_dict()).to(device) if str(device) == "cpu": model.float() return model, _transform() # patch the device names device_holder = torch.jit.trace(lambda: torch.ones([]).to(torch.device(device)), example_inputs=[]) device_node = [n for n in device_holder.graph.findAllNodes("prim::Constant") if "Device" in repr(n)][-1] def patch_device(module): graphs = [module.graph] if hasattr(module, "graph") else [] if hasattr(module, "forward1"): graphs.append(module.forward1.graph) for graph in graphs: for node in graph.findAllNodes("prim::Constant"): if "value" in node.attributeNames() and str(node["value"]).startswith("cuda"): node.copyAttributes(device_node) model.apply(patch_device) patch_device(model.encode_image) patch_device(model.encode_text) # patch dtype to float32 on CPU if str(device) == "cpu": float_holder = torch.jit.trace(lambda: torch.ones([]).float(), example_inputs=[]) float_input = list(float_holder.graph.findNode("aten::to").inputs())[1] float_node = float_input.node() def patch_float(module): graphs = [module.graph] if hasattr(module, "graph") else [] if hasattr(module, "forward1"): graphs.append(module.forward1.graph) for graph in graphs: for node in graph.findAllNodes("aten::to"): inputs = list(node.inputs()) for i in [1, 2]: # dtype can be the second or third argument to aten::to() if inputs[i].node()["value"] == 5: inputs[i].node().copyAttributes(float_node) model.apply(patch_float) patch_float(model.encode_image) patch_float(model.encode_text) model.float() return model, _transform() def tokenize(texts: Union[str, List[str]], context_length: int = 77) -> torch.LongTensor: """ Returns the tokenized representation of given input string(s) Parameters ---------- texts : Union[str, List[str]] An input string or a list of input strings to tokenize context_length : int The context length to use; all CLIP models use 77 as the context length Returns ------- A two-dimensional tensor containing the resulting tokens, shape = [number of input strings, context_length] """ if isinstance(texts, str): texts = [texts] sot_token = _tokenizer.encoder["<|startoftext|>"] eot_token = _tokenizer.encoder["<|endoftext|>"] all_tokens = [[sot_token] + _tokenizer.encode(text) + [eot_token] for text in texts] result = torch.zeros(len(all_tokens), context_length, dtype=torch.long) for i, tokens in enumerate(all_tokens): if len(tokens) > context_length: raise RuntimeError(f"Input {texts[i]} is too long for context length {context_length}") result[i, :len(tokens)] = torch.tensor(tokens) return result class Bottleneck(nn.Module): expansion = 4 def __init__(self, inplanes, planes, stride=1): super().__init__() # all conv layers have stride 1. an avgpool is performed after the second convolution when stride > 1 self.conv1 = nn.Conv2d(inplanes, planes, 1, bias=False) self.bn1 = nn.BatchNorm2d(planes) self.conv2 = nn.Conv2d(planes, planes, 3, padding=1, bias=False) self.bn2 = nn.BatchNorm2d(planes) self.avgpool = nn.AvgPool2d(stride) if stride > 1 else nn.Identity() self.conv3 = nn.Conv2d(planes, planes * self.expansion, 1, bias=False) self.bn3 = nn.BatchNorm2d(planes * self.expansion) self.relu = nn.ReLU(inplace=True) self.downsample = None self.stride = stride if stride > 1 or inplanes != planes * Bottleneck.expansion: # downsampling layer is prepended with an avgpool, and the subsequent convolution has stride 1 self.downsample = nn.Sequential(OrderedDict([ ("-1", nn.AvgPool2d(stride)), ("0", nn.Conv2d(inplanes, planes * self.expansion, 1, stride=1, bias=False)), ("1", nn.BatchNorm2d(planes * self.expansion)) ])) def forward(self, x: torch.Tensor): identity = x out = self.relu(self.bn1(self.conv1(x))) out = self.relu(self.bn2(self.conv2(out))) out = self.avgpool(out) out = self.bn3(self.conv3(out)) if self.downsample is not None: identity = self.downsample(x) out += identity out = self.relu(out) return out class AttentionPool2d(nn.Module): def __init__(self, spacial_dim: int, embed_dim: int, num_heads: int, output_dim: int = None): super().__init__() self.positional_embedding = nn.Parameter(torch.randn(spacial_dim ** 2 + 1, embed_dim) / embed_dim ** 0.5) self.k_proj = nn.Linear(embed_dim, embed_dim) self.q_proj = nn.Linear(embed_dim, embed_dim) self.v_proj = nn.Linear(embed_dim, embed_dim) self.c_proj = nn.Linear(embed_dim, output_dim or embed_dim) self.num_heads = num_heads def forward(self, x): x = x.reshape(x.shape[0], x.shape[1], x.shape[2] * x.shape[3]).permute(2, 0, 1) # NCHW -> (HW)NC x = torch.cat([x.mean(dim=0, keepdim=True), x], dim=0) # (HW+1)NC x = x + self.positional_embedding[:, None, :].to(x.dtype) # (HW+1)NC x, _ = F.multi_head_attention_forward( query=x, key=x, value=x, embed_dim_to_check=x.shape[-1], num_heads=self.num_heads, q_proj_weight=self.q_proj.weight, k_proj_weight=self.k_proj.weight, v_proj_weight=self.v_proj.weight, in_proj_weight=None, in_proj_bias=torch.cat([self.q_proj.bias, self.k_proj.bias, self.v_proj.bias]), bias_k=None, bias_v=None, add_zero_attn=False, dropout_p=0, out_proj_weight=self.c_proj.weight, out_proj_bias=self.c_proj.bias, use_separate_proj_weight=True, training=self.training, need_weights=False ) return x[0] class ModifiedResNet(nn.Module): """ A ResNet class that is similar to torchvision's but contains the following changes: - There are now 3 "stem" convolutions as opposed to 1, with an average pool instead of a max pool. - Performs anti-aliasing strided convolutions, where an avgpool is prepended to convolutions with stride > 1 - The final pooling layer is a QKV attention instead of an average pool """ def __init__(self, layers, output_dim, heads, input_resolution=224, width=64): super().__init__() self.output_dim = output_dim self.input_resolution = input_resolution # the 3-layer stem self.conv1 = nn.Conv2d(3, width // 2, kernel_size=3, stride=2, padding=1, bias=False) self.bn1 = nn.BatchNorm2d(width // 2) self.conv2 = nn.Conv2d(width // 2, width // 2, kernel_size=3, padding=1, bias=False) self.bn2 = nn.BatchNorm2d(width // 2) self.conv3 = nn.Conv2d(width // 2, width, kernel_size=3, padding=1, bias=False) self.bn3 = nn.BatchNorm2d(width) self.avgpool = nn.AvgPool2d(2) self.relu = nn.ReLU(inplace=True) # residual layers self._inplanes = width # this is a *mutable* variable used during construction self.layer1 = self._make_layer(width, layers[0]) self.layer2 = self._make_layer(width * 2, layers[1], stride=2) self.layer3 = self._make_layer(width * 4, layers[2], stride=2) self.layer4 = self._make_layer(width * 8, layers[3], stride=2) embed_dim = width * 32 # the ResNet feature dimension self.attnpool = AttentionPool2d(input_resolution // 32, embed_dim, heads, output_dim) def _make_layer(self, planes, blocks, stride=1): layers = [Bottleneck(self._inplanes, planes, stride)] self._inplanes = planes * Bottleneck.expansion for _ in range(1, blocks): layers.append(Bottleneck(self._inplanes, planes)) return nn.Sequential(*layers) def forward(self, x): def stem(x): for conv, bn in [(self.conv1, self.bn1), (self.conv2, self.bn2), (self.conv3, self.bn3)]: x = self.relu(bn(conv(x))) x = self.avgpool(x) return x x = x.type(self.conv1.weight.dtype) x = stem(x) x = self.layer1(x) x = self.layer2(x) x = self.layer3(x) x = self.layer4(x) x = self.attnpool(x) return x class LayerNorm(nn.LayerNorm): """Subclass torch's LayerNorm to handle fp16.""" def forward(self, x: torch.Tensor): orig_type = x.dtype ret = super().forward(x.type(torch.float32)) return ret.type(orig_type) class QuickGELU(nn.Module): def forward(self, x: torch.Tensor): return x * torch.sigmoid(1.702 * x) class ResidualAttentionBlock(nn.Module): def __init__(self, d_model: int, n_head: int, attn_mask: torch.Tensor = None): super().__init__() self.attn = nn.MultiheadAttention(d_model, n_head) self.ln_1 = LayerNorm(d_model) self.mlp = nn.Sequential(OrderedDict([ ("c_fc", nn.Linear(d_model, d_model * 4)), ("gelu", QuickGELU()), ("c_proj", nn.Linear(d_model * 4, d_model)) ])) self.ln_2 = LayerNorm(d_model) self.attn_mask = attn_mask def attention(self, x: torch.Tensor): self.attn_mask = self.attn_mask.to(dtype=x.dtype, device=x.device) if self.attn_mask is not None else None return self.attn(x, x, x, need_weights=False, attn_mask=self.attn_mask)[0] def forward(self, x: torch.Tensor): x = x + self.attention(self.ln_1(x)) x = x + self.mlp(self.ln_2(x)) return x class Transformer(nn.Module): def __init__(self, width: int, layers: int, heads: int, attn_mask: torch.Tensor = None): super().__init__() self.width = width self.layers = layers self.resblocks = nn.Sequential(*[ResidualAttentionBlock(width, heads, attn_mask) for _ in range(layers)]) def forward(self, x: torch.Tensor): return self.resblocks(x) class VisualTransformer(nn.Module): def __init__(self, input_resolution: int, patch_size: int, width: int, layers: int, heads: int, output_dim: int): super().__init__() self.input_resolution = input_resolution self.output_dim = output_dim self.conv1 = nn.Conv2d(in_channels=3, out_channels=width, kernel_size=patch_size, stride=patch_size, bias=False) scale = width ** -0.5 self.class_embedding = nn.Parameter(scale * torch.randn(width)) self.positional_embedding = nn.Parameter(scale * torch.randn((input_resolution // patch_size) ** 2 + 1, width)) self.ln_pre = LayerNorm(width) self.transformer = Transformer(width, layers, heads) self.ln_post = LayerNorm(width) self.proj = nn.Parameter(scale * torch.randn(width, output_dim)) def forward(self, x: torch.Tensor): x = self.conv1(x) # shape = [*, width, grid, grid] x = x.reshape(x.shape[0], x.shape[1], -1) # shape = [*, width, grid ** 2] x = x.permute(0, 2, 1) # shape = [*, grid ** 2, width] x = torch.cat([self.class_embedding.to(x.dtype) + torch.zeros(x.shape[0], 1, x.shape[-1], dtype=x.dtype, device=x.device), x], dim=1) # shape = [*, grid ** 2 + 1, width] x = x + self.positional_embedding.to(x.dtype) x = self.ln_pre(x) x = x.permute(1, 0, 2) # NLD -> LND x = self.transformer(x) x = x.permute(1, 0, 2) # LND -> NLD x = self.ln_post(x[:, 0, :]) if self.proj is not None: x = x @ self.proj return x class CLIP(nn.Module): def __init__(self, embed_dim: int, # vision image_resolution: int, vision_layers: Union[Tuple[int, int, int, int], int], vision_width: int, vision_patch_size: int, # text context_length: int, vocab_size: int, transformer_width: int, transformer_heads: int, transformer_layers: int ): super().__init__() self.context_length = context_length if isinstance(vision_layers, (tuple, list)): vision_heads = vision_width * 32 // 64 self.visual = ModifiedResNet( layers=vision_layers, output_dim=embed_dim, heads=vision_heads, input_resolution=image_resolution, width=vision_width ) else: vision_heads = vision_width // 64 self.visual = VisualTransformer( input_resolution=image_resolution, patch_size=vision_patch_size, width=vision_width, layers=vision_layers, heads=vision_heads, output_dim=embed_dim ) self.transformer = Transformer( width=transformer_width, layers=transformer_layers, heads=transformer_heads, attn_mask=self.build_attention_mask() ) self.vocab_size = vocab_size self.token_embedding = nn.Embedding(vocab_size, transformer_width) self.positional_embedding = nn.Parameter(torch.empty(self.context_length, transformer_width)) self.ln_final = LayerNorm(transformer_width) self.text_projection = nn.Parameter(torch.empty(transformer_width, embed_dim)) self.logit_scale = nn.Parameter(torch.ones([])) self.initialize_parameters() def initialize_parameters(self): nn.init.normal_(self.token_embedding.weight, std=0.02) nn.init.normal_(self.positional_embedding, std=0.01) if isinstance(self.visual, ModifiedResNet): if self.visual.attnpool is not None: std = self.visual.attnpool.c_proj.in_features ** -0.5 nn.init.normal_(self.visual.attnpool.q_proj.weight, std=std) nn.init.normal_(self.visual.attnpool.k_proj.weight, std=std) nn.init.normal_(self.visual.attnpool.v_proj.weight, std=std) nn.init.normal_(self.visual.attnpool.c_proj.weight, std=std) for resnet_block in [self.visual.layer1, self.visual.layer2, self.visual.layer3, self.visual.layer4]: for name, param in resnet_block.named_parameters(): if name.endswith("bn3.weight"): nn.init.zeros_(param) proj_std = (self.transformer.width ** -0.5) * ((2 * self.transformer.layers) ** -0.5) attn_std = self.transformer.width ** -0.5 fc_std = (2 * self.transformer.width) ** -0.5 for block in self.transformer.resblocks: nn.init.normal_(block.attn.in_proj_weight, std=attn_std) nn.init.normal_(block.attn.out_proj.weight, std=proj_std) nn.init.normal_(block.mlp.c_fc.weight, std=fc_std) nn.init.normal_(block.mlp.c_proj.weight, std=proj_std) if self.text_projection is not None: nn.init.normal_(self.text_projection, std=self.transformer.width ** -0.5) def build_attention_mask(self): # lazily create causal attention mask, with full attention between the vision tokens # pytorch uses additive attention mask; fill with -inf mask = torch.empty(self.context_length, self.context_length) mask.fill_(float("-inf")) mask.triu_(1) # zero out the lower diagonal return mask @property def dtype(self): return self.visual.conv1.weight.dtype def encode_image(self, image): return self.visual(image.type(self.dtype)) def encode_text(self, text): x = self.token_embedding(text).type(self.dtype) # [batch_size, n_ctx, d_model] x = x + self.positional_embedding.type(self.dtype) x = x.permute(1, 0, 2) # NLD -> LND x = self.transformer(x) x = x.permute(1, 0, 2) # LND -> NLD x = self.ln_final(x).type(self.dtype) # x.shape = [batch_size, n_ctx, transformer.width] # take features from the eot embedding (eot_token is the highest number in each sequence) x = x[torch.arange(x.shape[0]), text.argmax(dim=-1)] @ self.text_projection return x def forward(self, image, text): image_features = self.encode_image(image) text_features = self.encode_text(text) # normalized features image_features = image_features / image_features.norm(dim=-1, keepdim=True) text_features = text_features / text_features.norm(dim=-1, keepdim=True) # cosine similarity as logits logit_scale = self.logit_scale.exp() logits_per_image = logit_scale * image_features @ text_features.t() logits_per_text = logit_scale * text_features @ image_features.t() # shape = [global_batch_size, global_batch_size] return logits_per_image, logits_per_text def convert_weights(model: nn.Module): """Convert applicable model parameters to fp16""" def _convert_weights_to_fp16(l): if isinstance(l, (nn.Conv1d, nn.Conv2d, nn.Linear)): l.weight.data = l.weight.data.half() if l.bias is not None: l.bias.data = l.bias.data.half() if isinstance(l, nn.MultiheadAttention): for attr in [*[f"{s}_proj_weight" for s in ["in", "q", "k", "v"]], "in_proj_bias", "bias_k", "bias_v"]: tensor = getattr(l, attr) if tensor is not None: tensor.data = tensor.data.half() for name in ["text_projection", "proj"]: if hasattr(l, name): attr = getattr(l, name) if attr is not None: attr.data = attr.data.half() model.apply(_convert_weights_to_fp16) def build_model(state_dict: dict): vit = "visual.proj" in state_dict if vit: vision_width = state_dict["visual.conv1.weight"].shape[0] vision_layers = len([k for k in state_dict.keys() if k.startswith("visual.") and k.endswith(".attn.in_proj_weight")]) vision_patch_size = state_dict["visual.conv1.weight"].shape[-1] grid_size = round((state_dict["visual.positional_embedding"].shape[0] - 1) ** 0.5) image_resolution = vision_patch_size * grid_size else: counts: list = [len(set(k.split(".")[2] for k in state_dict if k.startswith(f"visual.layer{b}"))) for b in [1, 2, 3, 4]] vision_layers = tuple(counts) vision_width = state_dict["visual.layer1.0.conv1.weight"].shape[0] output_width = round((state_dict["visual.attnpool.positional_embedding"].shape[0] - 1) ** 0.5) vision_patch_size = None assert output_width ** 2 + 1 == state_dict["visual.attnpool.positional_embedding"].shape[0] image_resolution = output_width * 32 embed_dim = state_dict["text_projection"].shape[1] context_length = state_dict["positional_embedding"].shape[0] vocab_size = state_dict["token_embedding.weight"].shape[0] transformer_width = state_dict["ln_final.weight"].shape[0] transformer_heads = transformer_width // 64 transformer_layers = len(set(k.split(".")[2] for k in state_dict if k.startswith(f"transformer.resblocks"))) model = CLIP( embed_dim, image_resolution, vision_layers, vision_width, vision_patch_size, context_length, vocab_size, transformer_width, transformer_heads, transformer_layers ) for key in ["input_resolution", "context_length", "vocab_size"]: if key in state_dict: del state_dict[key] convert_weights(model) model.load_state_dict(state_dict) return model.eval() import gzip import html import os from functools import lru_cache import ftfy import regex as re @lru_cache() def default_bpe(): return os.path.join(os.path.dirname(os.path.abspath(__file__)), "data/bpe_simple_vocab_16e6.txt") @lru_cache() def bytes_to_unicode(): """ Returns list of utf-8 byte and a corresponding list of unicode strings. The reversible bpe codes work on unicode strings. This means you need a large # of unicode characters in your vocab if you want to avoid UNKs. When you're at something like a 10B token dataset you end up needing around 5K for decent coverage. This is a signficant percentage of your normal, say, 32K bpe vocab. To avoid that, we want lookup tables between utf-8 bytes and unicode strings. And avoids mapping to whitespace/control characters the bpe code barfs on. """ bs = list(range(ord("!"), ord("~")+1))+list(range(ord("¡"), ord("¬")+1))+list(range(ord("®"), ord("ÿ")+1)) cs = bs[:] n = 0 for b in range(2**8): if b not in bs: bs.append(b) cs.append(2**8+n) n += 1 cs = [chr(n) for n in cs] return dict(zip(bs, cs)) def get_pairs(word): """Return set of symbol pairs in a word. Word is represented as tuple of symbols (symbols being variable-length strings). """ pairs = set() prev_char = word[0] for char in word[1:]: pairs.add((prev_char, char)) prev_char = char return pairs def basic_clean(text): text = ftfy.fix_text(text) text = html.unescape(html.unescape(text)) return text.strip() def whitespace_clean(text): text = re.sub(r'\s+', ' ', text) text = text.strip() return text class SimpleTokenizer(object): def __init__(self, bpe_path: str = default_bpe()): self.byte_encoder = bytes_to_unicode() self.byte_decoder = {v: k for k, v in self.byte_encoder.items()} merges = Path(bpe_path).read_text(encoding='utf8').split('\n') merges = merges[1:49152-256-2+1] merges = [tuple(merge.split()) for merge in merges] vocab = list(bytes_to_unicode().values()) vocab = vocab + [v+'</w>' for v in vocab] for merge in merges: vocab.append(''.join(merge)) vocab.extend(['<|startoftext|>', '<|endoftext|>']) self.encoder = dict(zip(vocab, range(len(vocab)))) self.decoder = {v: k for k, v in self.encoder.items()} self.bpe_ranks = dict(zip(merges, range(len(merges)))) self.cache = {'<|startoftext|>': '<|startoftext|>', '<|endoftext|>': '<|endoftext|>'} self.pat = re.compile(r"""<\|startoftext\|>|<\|endoftext\|>|'s|'t|'re|'ve|'m|'ll|'d|[\p{L}]+|[\p{N}]|[^\s\p{L}\p{N}]+""", re.IGNORECASE) def bpe(self, token): if token in self.cache: return self.cache[token] word = tuple(token[:-1]) + ( token[-1] + '</w>',) pairs = get_pairs(word) if not pairs: return token+'</w>' while True: bigram = min(pairs, key = lambda pair: self.bpe_ranks.get(pair, float('inf'))) if bigram not in self.bpe_ranks: break first, second = bigram new_word = [] i = 0 while i < len(word): try: j = word.index(first, i) new_word.extend(word[i:j]) i = j except: new_word.extend(word[i:]) break if word[i] == first and i < len(word)-1 and word[i+1] == second: new_word.append(first+second) i += 2 else: new_word.append(word[i]) i += 1 new_word = tuple(new_word) word = new_word if len(word) == 1: break else: pairs = get_pairs(word) word = ' '.join(word) self.cache[token] = word return word def encode(self, text): bpe_tokens = [] text = whitespace_clean(basic_clean(text)).lower() for token in re.findall(self.pat, text): token = ''.join(self.byte_encoder[b] for b in token.encode('utf-8')) bpe_tokens.extend(self.encoder[bpe_token] for bpe_token in self.bpe(token).split(' ')) return bpe_tokens def decode(self, tokens): text = ''.join([self.decoder[token] for token in tokens]) text = bytearray([self.byte_decoder[c] for c in text]).decode('utf-8', errors="replace").replace('</w>', ' ') return text import gzip _tokenizer = SimpleTokenizer()
big-sleep-main
big_sleep/clip.py
from setuptools import setup, find_packages setup( name = 'rotary-embedding-torch', packages = find_packages(), version = '0.3.0', license='MIT', description = 'Rotary Embedding - Pytorch', long_description_content_type = 'text/markdown', author = 'Phil Wang', author_email = 'lucidrains@gmail.com', url = 'https://github.com/lucidrains/rotary-embedding-torch', keywords = [ 'artificial intelligence', 'deep learning', 'positional embedding' ], install_requires=[ 'einops>=0.3', 'torch>=1.6' ], classifiers=[ 'Development Status :: 4 - Beta', 'Intended Audience :: Developers', 'Topic :: Scientific/Engineering :: Artificial Intelligence', 'License :: OSI Approved :: MIT License', 'Programming Language :: Python :: 3.6', ], )
rotary-embedding-torch-main
setup.py
from rotary_embedding_torch.rotary_embedding_torch import apply_rotary_emb, RotaryEmbedding, broadcat, apply_learned_rotations
rotary-embedding-torch-main
rotary_embedding_torch/__init__.py
from math import pi, log import torch from torch import nn, einsum from einops import rearrange, repeat # helper functions def exists(val): return val is not None def broadcat(tensors, dim = -1): num_tensors = len(tensors) shape_lens = set(list(map(lambda t: len(t.shape), tensors))) assert len(shape_lens) == 1, 'tensors must all have the same number of dimensions' shape_len = list(shape_lens)[0] dim = (dim + shape_len) if dim < 0 else dim dims = list(zip(*map(lambda t: list(t.shape), tensors))) expandable_dims = [(i, val) for i, val in enumerate(dims) if i != dim] assert all([*map(lambda t: len(set(t[1])) <= 2, expandable_dims)]), 'invalid dimensions for broadcastable concatentation' max_dims = list(map(lambda t: (t[0], max(t[1])), expandable_dims)) expanded_dims = list(map(lambda t: (t[0], (t[1],) * num_tensors), max_dims)) expanded_dims.insert(dim, (dim, dims[dim])) expandable_shapes = list(zip(*map(lambda t: t[1], expanded_dims))) tensors = list(map(lambda t: t[0].expand(*t[1]), zip(tensors, expandable_shapes))) return torch.cat(tensors, dim = dim) # rotary embedding helper functions def rotate_half(x): x = rearrange(x, '... (d r) -> ... d r', r = 2) x1, x2 = x.unbind(dim = -1) x = torch.stack((-x2, x1), dim = -1) return rearrange(x, '... d r -> ... (d r)') def apply_rotary_emb(freqs, t, start_index = 0, scale = 1.): rot_dim, seq_len = freqs.shape[-1], t.shape[-2] freqs = freqs[-seq_len:, :] freqs = freqs.to(t) end_index = start_index + rot_dim assert rot_dim <= t.shape[-1], f'feature dimension {t.shape[-1]} is not of sufficient size to rotate in all the positions {rot_dim}' t_left, t, t_right = t[..., :start_index], t[..., start_index:end_index], t[..., end_index:] t = (t * freqs.cos() * scale) + (rotate_half(t) * freqs.sin() * scale) return torch.cat((t_left, t, t_right), dim = -1) # learned rotation helpers def apply_learned_rotations(rotations, t, start_index = 0, freq_ranges = None): if exists(freq_ranges): rotations = einsum('..., f -> ... f', rotations, freq_ranges) rotations = rearrange(rotations, '... r f -> ... (r f)') rotations = repeat(rotations, '... n -> ... (n r)', r = 2) return apply_rotary_emb(rotations, t, start_index = start_index) # classes class RotaryEmbedding(nn.Module): def __init__( self, dim, custom_freqs = None, freqs_for = 'lang', theta = 10000, max_freq = 10, num_freqs = 1, learned_freq = False, use_xpos = False, xpos_scale_base = 512, interpolate_factor = 1., theta_rescale_factor = 1. ): super().__init__() # proposed by reddit user bloc97, to rescale rotary embeddings to longer sequence length without fine-tuning # has some connection to NTK literature # https://www.reddit.com/r/LocalLLaMA/comments/14lz7j5/ntkaware_scaled_rope_allows_llama_models_to_have/ theta *= theta_rescale_factor ** (dim / (dim - 2)) if exists(custom_freqs): freqs = custom_freqs elif freqs_for == 'lang': freqs = 1. / (theta ** (torch.arange(0, dim, 2)[:(dim // 2)].float() / dim)) elif freqs_for == 'pixel': freqs = torch.linspace(1., max_freq / 2, dim // 2) * pi elif freqs_for == 'constant': freqs = torch.ones(num_freqs).float() else: raise ValueError(f'unknown modality {freqs_for}') self.cache = dict() self.cache_scale = dict() self.freqs = nn.Parameter(freqs, requires_grad = learned_freq) # interpolation factors assert interpolate_factor >= 1. self.interpolate_factor = interpolate_factor # xpos self.use_xpos = use_xpos if not use_xpos: self.register_buffer('scale', None) return scale = (torch.arange(0, dim, 2) + 0.4 * dim) / (1.4 * dim) self.scale_base = xpos_scale_base self.register_buffer('scale', scale) def get_seq_pos(self, seq_len, device, dtype, offset = 0): return (torch.arange(seq_len, device = device, dtype = dtype) + offset) / self.interpolate_factor def rotate_queries_or_keys(self, t, seq_dim = -2, offset = 0, freq_seq_len = None): assert not self.use_xpos, 'you must use `.rotate_queries_and_keys` method instead and pass in both queries and keys, for length extrapolatable rotary embeddings' device, dtype, seq_len = t.device, t.dtype, t.shape[seq_dim] if exists(freq_seq_len): assert freq_seq_len >= seq_len seq_len = freq_seq_len freqs = self.forward(lambda: self.get_seq_pos(seq_len, device = device, dtype = dtype, offset = offset), cache_key = f'freqs:{seq_len}|offset:{offset}') return apply_rotary_emb(freqs, t) def rotate_queries_with_cached_keys(self, q, k, seq_dim = -2): q_len, k_len = q.shape[seq_dim], k.shape[seq_dim] assert q_len <= k_len q = self.rotate_queries_or_keys(q, seq_dim = seq_dim, freq_seq_len = k_len) k = self.rotate_queries_or_keys(k, seq_dim = seq_dim) return q, k def rotate_queries_and_keys(self, q, k, seq_dim = -2): assert self.use_xpos device, dtype, seq_len = q.device, q.dtype, q.shape[seq_dim] seq = self.get_seq_pos(seq_len, dtype = dtype, device = device) freqs = self.forward(lambda: seq, cache_key = f'freqs:{seq_len}') scale = self.get_scale(lambda: seq, cache_key = f'scale:{seq_len}').to(dtype) rotated_q = apply_rotary_emb(freqs, q, scale = scale) rotated_k = apply_rotary_emb(freqs, k, scale = scale ** -1) return rotated_q, rotated_k def get_scale(self, t, cache_key = None): assert self.use_xpos if exists(cache_key) and cache_key in self.cache: return self.cache[cache_key] if callable(t): t = t() scale = 1. if self.use_xpos: power = (t - len(t) // 2) / self.scale_base scale = self.scale ** rearrange(power, 'n -> n 1') scale = torch.cat((scale, scale), dim = -1) if exists(cache_key): self.cache[cache_key] = scale return scale def forward(self, t, cache_key = None): if exists(cache_key) and cache_key in self.cache: return self.cache[cache_key] if callable(t): t = t() freqs = self.freqs freqs = einsum('..., f -> ... f', t.type(freqs.dtype), freqs) freqs = repeat(freqs, '... n -> ... (n r)', r = 2) if exists(cache_key): self.cache[cache_key] = freqs return freqs
rotary-embedding-torch-main
rotary_embedding_torch/rotary_embedding_torch.py
from setuptools import setup, find_packages setup( name = 'lambda-networks', packages = find_packages(), version = '0.4.0', license='MIT', description = 'Lambda Networks - Pytorch', author = 'Phil Wang', author_email = 'lucidrains@gmail.com', url = 'https://github.com/lucidrains/lambda-networks', keywords = [ 'artificial intelligence', 'attention mechanism', 'image recognition' ], install_requires=[ 'torch>=1.6', 'einops>=0.3' ], classifiers=[ 'Development Status :: 4 - Beta', 'Intended Audience :: Developers', 'Topic :: Scientific/Engineering :: Artificial Intelligence', 'License :: OSI Approved :: MIT License', 'Programming Language :: Python :: 3.6', ], )
lambda-networks-main
setup.py
from lambda_networks.lambda_networks import LambdaLayer λLayer = LambdaLayer
lambda-networks-main
lambda_networks/__init__.py
import torch from torch import nn, einsum from einops import rearrange # helpers functions def exists(val): return val is not None def default(val, d): return val if exists(val) else d def calc_rel_pos(n): pos = torch.meshgrid(torch.arange(n), torch.arange(n)) pos = rearrange(torch.stack(pos), 'n i j -> (i j) n') # [n*n, 2] pos[n] = (i, j) rel_pos = pos[None, :] - pos[:, None] # [n*n, n*n, 2] rel_pos[n, m] = (rel_i, rel_j) rel_pos += n - 1 # shift value range from [-n+1, n-1] to [0, 2n-2] return rel_pos # lambda layer class LambdaLayer(nn.Module): def __init__( self, dim, *, dim_k, n = None, r = None, heads = 4, dim_out = None, dim_u = 1): super().__init__() dim_out = default(dim_out, dim) self.u = dim_u # intra-depth dimension self.heads = heads assert (dim_out % heads) == 0, 'values dimension must be divisible by number of heads for multi-head query' dim_v = dim_out // heads self.to_q = nn.Conv2d(dim, dim_k * heads, 1, bias = False) self.to_k = nn.Conv2d(dim, dim_k * dim_u, 1, bias = False) self.to_v = nn.Conv2d(dim, dim_v * dim_u, 1, bias = False) self.norm_q = nn.BatchNorm2d(dim_k * heads) self.norm_v = nn.BatchNorm2d(dim_v * dim_u) self.local_contexts = exists(r) if exists(r): assert (r % 2) == 1, 'Receptive kernel size should be odd' self.pos_conv = nn.Conv3d(dim_u, dim_k, (1, r, r), padding = (0, r // 2, r // 2)) else: assert exists(n), 'You must specify the window size (n=h=w)' rel_lengths = 2 * n - 1 self.rel_pos_emb = nn.Parameter(torch.randn(rel_lengths, rel_lengths, dim_k, dim_u)) self.rel_pos = calc_rel_pos(n) def forward(self, x): b, c, hh, ww, u, h = *x.shape, self.u, self.heads q = self.to_q(x) k = self.to_k(x) v = self.to_v(x) q = self.norm_q(q) v = self.norm_v(v) q = rearrange(q, 'b (h k) hh ww -> b h k (hh ww)', h = h) k = rearrange(k, 'b (u k) hh ww -> b u k (hh ww)', u = u) v = rearrange(v, 'b (u v) hh ww -> b u v (hh ww)', u = u) k = k.softmax(dim=-1) λc = einsum('b u k m, b u v m -> b k v', k, v) Yc = einsum('b h k n, b k v -> b h v n', q, λc) if self.local_contexts: v = rearrange(v, 'b u v (hh ww) -> b u v hh ww', hh = hh, ww = ww) λp = self.pos_conv(v) Yp = einsum('b h k n, b k v n -> b h v n', q, λp.flatten(3)) else: n, m = self.rel_pos.unbind(dim = -1) rel_pos_emb = self.rel_pos_emb[n, m] λp = einsum('n m k u, b u v m -> b n k v', rel_pos_emb, v) Yp = einsum('b h k n, b n k v -> b h v n', q, λp) Y = Yc + Yp out = rearrange(Y, 'b h v (hh ww) -> b (h v) hh ww', hh = hh, ww = ww) return out
lambda-networks-main
lambda_networks/lambda_networks.py
import tensorflow as tf from einops.layers.tensorflow import Rearrange from tensorflow.keras.layers import Conv2D, BatchNormalization, Conv3D, ZeroPadding3D, Softmax, Lambda, Add, Layer from tensorflow.keras import initializers from tensorflow import einsum, nn, meshgrid # helpers functions def exists(val): return val is not None def default(val, d): return val if exists(val) else d def calc_rel_pos(n): pos = tf.stack(meshgrid(tf.range(n), tf.range(n), indexing = 'ij')) pos = Rearrange('n i j -> (i j) n')(pos) # [n*n, 2] pos[n] = (i, j) rel_pos = pos[None, :] - pos[:, None] # [n*n, n*n, 2] rel_pos[n, m] = (rel_i, rel_j) rel_pos += n - 1 # shift value range from [-n+1, n-1] to [0, 2n-2] return rel_pos # lambda layer class LambdaLayer(Layer): def __init__( self, *, dim_k, n = None, r = None, heads = 4, dim_out = None, dim_u = 1): super(LambdaLayer, self).__init__() self.out_dim = dim_out self.u = dim_u # intra-depth dimension self.heads = heads assert (dim_out % heads) == 0, 'values dimension must be divisible by number of heads for multi-head query' self.dim_v = dim_out // heads self.dim_k = dim_k self.heads = heads self.to_q = Conv2D(self.dim_k * heads, 1, use_bias=False) self.to_k = Conv2D(self.dim_k * dim_u, 1, use_bias=False) self.to_v = Conv2D(self.dim_v * dim_u, 1, use_bias=False) self.norm_q = BatchNormalization() self.norm_v = BatchNormalization() self.local_contexts = exists(r) if exists(r): assert (r % 2) == 1, 'Receptive kernel size should be odd' self.pos_conv = Conv3D(dim_k, (1, r, r), padding='same') else: assert exists(n), 'You must specify the window length (n = h = w)' rel_length = 2 * n - 1 self.rel_pos_emb = self.add_weight(name='pos_emb', shape=(rel_length, rel_length, dim_k, dim_u), initializer=initializers.random_normal, trainable=True) self.rel_pos = calc_rel_pos(n) def call(self, x, **kwargs): b, hh, ww, c, u, h = *x.get_shape().as_list(), self.u, self.heads q = self.to_q(x) k = self.to_k(x) v = self.to_v(x) q = self.norm_q(q) v = self.norm_v(v) q = Rearrange('b hh ww (h k) -> b h k (hh ww)', h=h)(q) k = Rearrange('b hh ww (u k) -> b u k (hh ww)', u=u)(k) v = Rearrange('b hh ww (u v) -> b u v (hh ww)', u=u)(v) k = nn.softmax(k) Lc = einsum('b u k m, b u v m -> b k v', k, v) Yc = einsum('b h k n, b k v -> b n h v', q, Lc) if self.local_contexts: v = Rearrange('b u v (hh ww) -> b v hh ww u', hh=hh, ww=ww)(v) Lp = self.pos_conv(v) Lp = Rearrange('b v h w k -> b v k (h w)')(Lp) Yp = einsum('b h k n, b v k n -> b n h v', q, Lp) else: rel_pos_emb = tf.gather_nd(self.rel_pos_emb, self.rel_pos) Lp = einsum('n m k u, b u v m -> b n k v', rel_pos_emb, v) Yp = einsum('b h k n, b n k v -> b n h v', q, Lp) Y = Yc + Yp out = Rearrange('b (hh ww) h v -> b hh ww (h v)', hh = hh, ww = ww)(Y) return out def compute_output_shape(self, input_shape): return (*input_shape[:2], self.out_dim) def get_config(self): config = {'output_dim': (*self.input_shape[:2], self.out_dim)} base_config = super(LambdaLayer, self).get_config() return dict(list(base_config.items()) + list(config.items()))
lambda-networks-main
lambda_networks/tfkeras.py
from setuptools import setup, find_packages setup( name = 'speculative-decoding', packages = find_packages(exclude=[]), version = '0.0.1', license='MIT', description = 'Speculative Decoding', author = 'Phil Wang', author_email = 'lucidrains@gmail.com', long_description_content_type = 'text/markdown', url = 'https://github.com/lucidrains/speculative-decoding', keywords = [ 'artificial intelligence', 'deep learning', 'transformers', 'efficient decoding' ], install_requires=[ 'beartype', 'einops>=0.6.1', 'rotary-embedding-torch>=0.3.0', 'torch>=2.0', ], classifiers=[ 'Development Status :: 4 - Beta', 'Intended Audience :: Developers', 'Topic :: Scientific/Engineering :: Artificial Intelligence', 'License :: OSI Approved :: MIT License', 'Programming Language :: Python :: 3.6', ], )
speculative-decoding-main
setup.py
import gzip import random import tqdm import numpy as np import time from functools import wraps import torch from torch.optim import Adam from torch.nn import functional as F from torch.utils.data import DataLoader, Dataset from speculative_decoding import ( Decoder, base_decoding, speculative_decoding ) # constants NUM_BATCHES = int(1e5) BATCH_SIZE = 4 GRAD_ACCUM_EVERY = 4 LEARNING_RATE = 1e-4 VALIDATE_EVERY = 100 PRIME_LENGTH = 128 GENERATE_EVERY = 500 GENERATE_LENGTH = 512 SEQ_LEN = 512 DEVICE_STR = 'cuda' if torch.cuda.is_available() else 'cpu' # helpers def cycle(loader): while True: for data in loader: yield data def decode_token(token): return str(chr(max(32, token))) def decode_tokens(tokens): return "".join(list(map(decode_token, tokens))) def benchmark(fn): @wraps(fn) def inner(*args, **kwargs): start_time = time.time() out = fn(*args, **kwargs) end_time = time.time() return out, end_time - start_time return inner # instantiate transformer device = torch.device(DEVICE_STR) model = Decoder( num_tokens = 256, dim = 512, depth = 8 ).to(device) # small model small_model = Decoder( num_tokens = 256, dim = 256, depth = 2 ).to(device) # prepare enwik8 data with gzip.open("./data/enwik8.gz") as file: data = np.frombuffer(file.read(int(95e6)), dtype=np.uint8).copy() np_train, np_valid = np.split(data, [int(90e6)]) data_train, data_val = torch.from_numpy(np_train), torch.from_numpy(np_valid) class TextSamplerDataset(Dataset): def __init__(self, data, seq_len): super().__init__() self.data = data self.seq_len = seq_len def __getitem__(self, index): rand_start = torch.randint(0, self.data.size(0) - self.seq_len, (1,)) full_seq = self.data[rand_start : rand_start + self.seq_len + 1].long() return full_seq.to(device) def __len__(self): return self.data.size(0) // self.seq_len train_dataset = TextSamplerDataset(data_train, SEQ_LEN) val_dataset = TextSamplerDataset(data_val, SEQ_LEN) train_loader = cycle(DataLoader(train_dataset, batch_size=BATCH_SIZE)) val_loader = cycle(DataLoader(val_dataset, batch_size=BATCH_SIZE)) # optimizer optim = Adam(model.parameters(), lr = LEARNING_RATE) small_optim = Adam(small_model.parameters(), lr = LEARNING_RATE) # training for i in tqdm.tqdm(range(NUM_BATCHES), mininterval = 10.0, desc = "training"): model.train() small_model.train() for _ in range(GRAD_ACCUM_EVERY): data = next(train_loader) loss = model(data, return_loss = True) small_loss = small_model(data, return_loss = True) (loss / GRAD_ACCUM_EVERY).backward() (small_loss / GRAD_ACCUM_EVERY).backward() print(f"training loss: {loss.item():.3f}") print(f"training small loss: {small_loss.item():.3f}") torch.nn.utils.clip_grad_norm_(model.parameters(), 0.5) torch.nn.utils.clip_grad_norm_(small_model.parameters(), 0.5) optim.step() optim.zero_grad() small_optim.step() small_optim.zero_grad() if i % VALIDATE_EVERY == 0: model.eval() with torch.no_grad(): valid_data = next(val_loader) loss = model(valid_data, return_loss = True) print(f"validation loss: {loss.item():.3f}") small_loss = small_model(valid_data, return_loss = True) print(f"validation small loss: {small_loss.item():.3f}") if i % GENERATE_EVERY == 0: model.eval() small_model.eval() inp = random.choice(val_dataset)[:PRIME_LENGTH] prime = decode_tokens(inp) print(f"%s \n\n %s", (prime, "*" * 100)) prompt = inp[None, ...] sampled, base_decode_elapsed = benchmark(base_decoding)(model, prompt, GENERATE_LENGTH) spec_decoding_sampled, spec_decoding_elapsed = benchmark(speculative_decoding)(model, small_model, prompt, GENERATE_LENGTH) base_decode_output = decode_tokens(sampled[0]) spec_decode_output = decode_tokens(spec_decoding_sampled[0]) print("\nbase decoding:\n\n", base_decode_output, "\n") print("\nspec decoding:\n\n", spec_decode_output, "\n") print(f'base decoding in: {base_decode_elapsed:.3f}s\n') print(f'spec decoding in: {spec_decoding_elapsed:.3f}s\n')
speculative-decoding-main
train.py
from speculative_decoding.speculative_decoding import ( Decoder, base_decoding, speculative_decoding )
speculative-decoding-main
speculative_decoding/__init__.py
import math import torch from torch.nn import Module, ModuleList from torch import nn, einsum, Tensor import torch.nn.functional as F from rotary_embedding_torch import RotaryEmbedding from beartype import beartype from einops import rearrange # helper functions def exists(val): return val is not None def default(val, d): return val if exists(val) else d # sampling helpers def log(t, eps = 1e-20): return torch.log(t.clamp(min = eps)) def gumbel_noise(t): noise = torch.zeros_like(t).uniform_(0, 1) return -log(-log(noise)) def gumbel_sample(t, temperature = 1., dim = -1): return ((t / max(temperature, 1e-10)) + gumbel_noise(t)).argmax(dim = dim) def top_k(logits, thres = 0.9): k = math.ceil((1 - thres) * logits.shape[-1]) val, ind = torch.topk(logits, k) probs = torch.full_like(logits, float('-inf')) probs.scatter_(-1, ind, val) return probs # different decoding strategies @torch.no_grad() def base_decoding( net: Module, prompt: Tensor, seq_len: int, temperature = 1., filter_thres = 0.9, ): prompt_seq_len, out = prompt.shape[-1], prompt.clone() sample_num_times = max(0, seq_len - prompt_seq_len) cache = None for _ in range(sample_num_times): logits, cache = net(out, cache = cache, return_cache = True) logits = logits[:, -1] logits = top_k(logits, thres = filter_thres) sample = gumbel_sample(logits, temperature = temperature, dim = -1) out = torch.cat((out, sample[..., None]), dim = -1) return out[..., prompt_seq_len:] @torch.no_grad() def speculative_decoding( net: Module, small_net: Module, prompt: Tensor, seq_len: int, gamma: int = 5, temperature = 1., filter_thres = 0.9, lenience = 1. ): """ eq. algorithm 1 in paper https://arxiv.org/abs/2211.17192 """ prompt_seq_len, out, device = prompt.shape[-1], prompt.clone(), prompt.device sample_num_times = max(0, seq_len - prompt_seq_len) assert prompt.shape[0] == 1, 'batched spec decoding not supported yet' cache = None small_cache = None while out.shape[-1] < seq_len: # predict with smaller network all_small_logits = [] q_sampled_out = [] for _ in range(gamma): small_logits, small_cache = small_net(out, cache = small_cache, return_cache = True) small_logits = small_logits[:, -1] small_logits = top_k(small_logits, thres = filter_thres) all_small_logits.append(small_logits) sample = gumbel_sample(small_logits, temperature = temperature, dim = -1) out = torch.cat((out, sample[..., None]), dim = -1) q_sampled_out.append(rearrange(sample, 'b -> b 1 1')) q_sampled_out = torch.cat(q_sampled_out, dim = -2) small_logits = torch.stack(all_small_logits, dim = -2) # verify with larger network logits, cache = net(out, cache = cache, return_cache = True) logits = logits[..., -(gamma + 1):, :] logits = top_k(logits, thres = filter_thres) # prob and prob of small model (p(x) and q(x) in algorithm 1) prob = (logits / temperature).softmax(dim = -1) small_prob = (small_logits / temperature).softmax(dim = -1) p = prob[:, :-1].gather(-1, q_sampled_out) q = small_prob.gather(-1, q_sampled_out) * lenience r = random_uniform = torch.zeros_like(q).float().uniform_(0, 1) n = accepted = (((r > (p / q)).cumsum(dim = -1)) == 0).sum().item() prob_next = prob[:, -1] if n < gamma: adjusted_prob = F.relu(prob[:, n] - small_prob[:, n]) prob_next = adjusted_prob / adjusted_prob.sum(dim = -1, keepdim = True) out = out[:, :-(gamma - n)] # adjust cache next_seq_len = out.shape[-1] cache = cache[..., :next_seq_len, :] small_cache = small_cache[..., :next_seq_len, :] # sample the additional token next_token = torch.multinomial(prob_next, 1) out = torch.cat((out, next_token), dim = -1) return out[..., prompt_seq_len:] # norm class RMSNorm(Module): def __init__(self, dim): super().__init__() self.scale = dim ** 0.5 self.gamma = nn.Parameter(torch.ones(dim)) def forward(self, x): return F.normalize(x, dim = -1) * self.scale * self.gamma # attention and feedforward class CausalAttention(Module): def __init__( self, dim, *, rotary_emb: RotaryEmbedding, dim_head = 64, heads = 8, ): super().__init__() self.scale = dim_head ** -0.5 self.heads = heads dim_inner = dim_head * heads self.norm = RMSNorm(dim) self.rotary_emb = rotary_emb self.to_qkv = nn.Linear(dim, dim_inner * 3, bias = False) self.to_out = nn.Linear(dim_inner, dim, bias = False) def forward( self, x, cache = None ): h, device = self.heads, x.device x = self.norm(x) q, k, v = rearrange(self.to_qkv(x), 'b n (qkv h d) -> qkv b h n d', qkv = 3, h = h) if exists(cache): ck, cv = cache k = torch.cat((ck, k), dim = -2) v = torch.cat((cv, v), dim = -2) cached_kv = torch.stack((k, v)) q, k = self.rotary_emb.rotate_queries_with_cached_keys(q, k) sim = einsum('b h i d, b h j d -> b h i j', q, k) * self.scale i, j = sim.shape[-2:] causal_mask = torch.ones((i, j), device = device, dtype = torch.bool).triu(j - i + 1) sim = sim.masked_fill(causal_mask, -torch.finfo(sim.dtype).max) attn = sim.softmax(dim = -1) out = einsum('b h i j, b h j d -> b h i d', attn, v) out = rearrange(out, 'b h n d -> b n (h d)') out = self.to_out(out) return out, cached_kv def FeedForward(dim, mult = 4): dim_inner = dim * mult return nn.Sequential( RMSNorm(dim), nn.Linear(dim, dim_inner), nn.GELU(), nn.Linear(dim_inner, dim) ) # main class class Decoder(Module): def __init__( self, *, num_tokens, dim, depth, heads = 8, dim_head = 64, ff_mult = 4, weight_tie_layers = False, ignore_index = -1 ): super().__init__() self.token_emb = nn.Embedding(num_tokens, dim) self.layers = ModuleList([]) rotary_emb = RotaryEmbedding(dim = dim_head) attn = None ff = None for _ in range(depth): if not weight_tie_layers or not (exists(attn) and exists(ff)): attn = CausalAttention(dim = dim, dim_head = dim_head, heads = heads, rotary_emb = rotary_emb) ff = FeedForward(dim = dim, mult = ff_mult) self.layers.append(ModuleList([attn, ff])) self.to_logits = nn.Sequential( RMSNorm(dim), nn.Linear(dim, num_tokens, bias = False) ) self.ignore_index = ignore_index def forward( self, x, return_loss = False, return_cache = False, cache = None ): if return_loss: x, labels = x[:, :-1], x[:, 1:] x = self.token_emb(x) # next cache new_cached_kvs = [] # if cache passed in, just use the last token if exists(cache): assert not self.training num_tokens_keep = x.shape[-2] - cache.shape[-2] x = x[:, -num_tokens_keep:] cache = default(cache, []) iter_cache = iter(cache) for attn, ff in self.layers: residual = x attn_out, cached_kv = attn(x, cache = next(iter_cache, None)) x = residual + attn_out new_cached_kvs.append(cached_kv) x = ff(x) + x new_cached_kvs = torch.stack(new_cached_kvs) logits = self.to_logits(x) if not return_loss: if not return_cache: return logits return logits, new_cached_kvs return F.cross_entropy( rearrange(logits, 'b n c -> b c n'), labels, ignore_index = self.ignore_index )
speculative-decoding-main
speculative_decoding/speculative_decoding.py
from setuptools import setup, find_packages setup( name = 'TPDNE-utils', packages = find_packages(exclude=[]), version = '0.0.11', license='MIT', description = 'TPDNE', include_package_data = True, author = 'Phil Wang', author_email = 'lucidrains@gmail.com', long_description_content_type = 'text/markdown', url = 'https://github.com/lucidrains/TPDNE', keywords = [ 'thispersondoesnotexist' ], install_requires = [ 'beartype', 'einops>=0.6', 'jinja2', 'numpy', 'pillow' ], classifiers=[ 'Development Status :: 4 - Beta', 'Intended Audience :: Developers', 'Topic :: Scientific/Engineering :: Artificial Intelligence', 'License :: OSI Approved :: MIT License', 'Programming Language :: Python :: 3.6', ], )
TPDNE-main
setup.py
import os import sys import numpy as np from time import time, sleep from pathlib import Path from functools import wraps from PIL import Image from beartype import beartype from beartype.typing import Callable, Optional from einops import rearrange, repeat # templating from jinja2 import Environment, FileSystemLoader script_path = Path(__file__) current_dir = script_path.parents[0] environment = Environment(loader = FileSystemLoader(str(current_dir))) nginx_template = environment.get_template('nginx.conf.tmpl') systemd_service_template = environment.get_template('tpdne.service.tmpl') # helper functions def exists(val): return val is not None # handle everything that was confusing to me when first encountering image tensors def auto_handle_image_tensor(t): if t.ndim == 4: # assume batch is first dimension and take first sample t = t[0] if t.ndim == 2: # very rare case, but assume greyscale t = rearrange(t, 'h w -> h w 1') if t.shape[0] <= 3: # channel first t = rearrange(t, 'c h w -> h w c') assert t.shape[-1] <= 3, 'image tensor must be returned in the shape (height, width, channels), where channels is either 3 or 1' if t.shape[-1] == 1: t = repeat(t, 'h w 1 -> h w c', c = 3) # handle scale if t.dtype == np.float: has_negatives = np.any(t < 0) if has_negatives: t = t * 127.5 + 128 else: t = t * 255 t = t.astype(np.uint8) return t.clip(0, 255) # main function @beartype def sample_image_and_save_repeatedly( fn: Callable[..., np.ndarray], # function that returns a ndarray of shape (3, <width>, <height>) output_path: str = './out/random', # path to the output image, without extension (will be saved as webp) *, call_every_ms: int = 250, # how often to sample tmp_dir: str = '/tmp', # to store temporary images, before symbolically linking to the output path num_rotated_tmp_images: int = 10, image_format: str = 'jpeg', verbose: bool = True, quality = 99, resize_image_to: Optional[int] = None, generate_favicon: bool = True, favicon_size: int = 32, generate_nginx_conf: bool = True, symbolic_link_nginx_conf: bool = True, nginx_sites_available_path: str = '/etc/nginx/sites-available', nginx_conf_filename = 'default', generate_systemd_service_conf: bool = False, systemd_service_path: str = '/etc/systemd/system', systemd_service_name = 'tpdne', domain_name = '_' ): assert 0 < quality <= 100 assert favicon_size in {16, 32} assert image_format in {'jpeg', 'png', 'webp'} tmp_dir = Path(tmp_dir) output_path = Path(output_path) assert output_path.suffix == '', 'output path suffix will be automatically determined by `image_format` keyword arg' output_path = output_path.with_suffix(f'.{image_format}') call_every_seconds = call_every_ms / 1000 assert tmp_dir.is_dir() root = output_path.parents[0] root.mkdir(parents = True, exist_ok = True) tmp_image_index = 0 # linking nginx if generate_nginx_conf: nginx_sites_path = Path(nginx_sites_available_path) nginx_sites_conf_path = nginx_sites_path / nginx_conf_filename assert nginx_sites_path.is_dir() nginx_conf_text = nginx_template.render( root = str(root.resolve()), index = output_path.name, server_name = domain_name ) tmp_conf_path = Path(tmp_dir / 'nginx.server.conf') tmp_conf_path.write_text(nginx_conf_text) print(f'nginx server conf generated at {str(tmp_conf_path)}') if symbolic_link_nginx_conf: os.system(f'ln -nfs {str(tmp_conf_path)} {nginx_sites_conf_path}') print(f'nginx conf linked to {nginx_sites_conf_path}\nrun `systemctl reload nginx` for it to be in effect') if generate_systemd_service_conf and not exists(os.getenv('LAUNCHED_FROM_SYSTEMD', None)): systemd_service_path = Path(systemd_service_path) systemd_service_conf_path = systemd_service_path / f'{systemd_service_name}.service' assert systemd_service_path.is_dir() systemd_conf_text = systemd_service_template.render( working_directory = str(current_dir.resolve()), python_executable = sys.executable, script_path = str(script_path.resolve()) ) tmp_service_path = Path(tmp_dir / 'tpdne.services') tmp_service_path.write_text(systemd_conf_text) os.system(f'ln -nfs {str(tmp_service_path)} {str(systemd_service_conf_path)}') print(f'service {systemd_service_name}.service created at {str(systemd_service_conf_path)}') print(f'run `systemctl enable {systemd_service_name}.service` to start this script') print(f'then run `systemctl status {systemd_service_name}.service` to see the status') exit() # invoke `fn` in a while loop while True: start = time() image_tensor = fn() image_tensor = auto_handle_image_tensor(image_tensor) tmp_image_index = (tmp_image_index + 1) % num_rotated_tmp_images tmp_path = str(tmp_dir / f'{tmp_image_index}.{image_format}') pil_image = Image.fromarray(image_tensor, 'RGB') if exists(resize_image_to): pil_image = pil_image.resize((resize_image_to, resize_image_to)) # depending on image format, pass in different kwargs on pillow image save image_save_kwargs = dict() if image_format == 'jpeg': image_save_kwargs = dict(optimize = True, progressive = True) elif image_format == 'webp': image_save_kwargs = dict(format = 'webp') # save image to tmp path pil_image.save(tmp_path, quality = quality, **image_save_kwargs) # symbolically link to the live output path # if one tries to serve directly from the tmp path, client can receive incomplete images os.system(f'ln -nfs {tmp_path} {output_path}') if generate_favicon: tmp_favicon_path = str(tmp_dir / f'favicon_{tmp_image_index}.png') output_favicon_path = output_path.parents[0] / 'favicon.png' small_pil_image = pil_image.resize((favicon_size, favicon_size)) small_pil_image.save(tmp_favicon_path) os.system(f'ln -nfs {tmp_favicon_path} {output_favicon_path}') elapsed = time() - start if verbose: print(f'{elapsed:.3f}s - tmp image at {tmp_path}, output image at {output_path}') # make sure images are generated at least after `call_every_ms` milliseconds if elapsed >= call_every_seconds: continue sleep(call_every_seconds - elapsed)
TPDNE-main
TPDNE_utils/tpdne.py
from TPDNE_utils.tpdne import sample_image_and_save_repeatedly
TPDNE-main
TPDNE_utils/__init__.py
from setuptools import setup, find_packages setup( name = 'unet_stylegan2', packages = find_packages(), scripts=['bin/unet_stylegan2'], version = '0.5.1', license='GPLv3+', description = 'StyleGan2 with UNet Discriminator, in Pytorch', author = 'Phil Wang', author_email = 'lucidrains@gmail.com', url = 'https://github.com/lucidrains/unet-stylegan2', keywords = ['generative adversarial networks', 'artificial intelligence'], install_requires=[ 'fire', 'numpy', 'retry', 'tqdm', 'torch', 'torchvision', 'pillow', 'linear_attention_transformer>=0.12.1' ], classifiers=[ 'Development Status :: 4 - Beta', 'Intended Audience :: Developers', 'Topic :: Scientific/Engineering :: Artificial Intelligence', 'License :: OSI Approved :: MIT License', 'Programming Language :: Python :: 3.6', ], )
unet-stylegan2-master
setup.py
import torch import torch.nn.functional as F def DiffAugment(x, types=[]): for p in types: for f in AUGMENT_FNS[p]: x = f(x) return x.contiguous(memory_format = torch.contiguous_format) def rand_brightness(x): x = x + (torch.rand(x.size(0), 1, 1, 1, dtype=x.dtype, device=x.device) - 0.5) return x def rand_saturation(x): x_mean = x.mean(dim=1, keepdim=True) x = (x - x_mean) * (torch.rand(x.size(0), 1, 1, 1, dtype=x.dtype, device=x.device) * 2) + x_mean return x def rand_contrast(x): x_mean = x.mean(dim=[1, 2, 3], keepdim=True) x = (x - x_mean) * (torch.rand(x.size(0), 1, 1, 1, dtype=x.dtype, device=x.device) + 0.5) + x_mean return x def rand_translation(x, ratio=0.125): shift_x, shift_y = int(x.size(2) * ratio + 0.5), int(x.size(3) * ratio + 0.5) translation_x = torch.randint(-shift_x, shift_x + 1, size=[x.size(0), 1, 1], device=x.device) translation_y = torch.randint(-shift_y, shift_y + 1, size=[x.size(0), 1, 1], device=x.device) grid_batch, grid_x, grid_y = torch.meshgrid( torch.arange(x.size(0), dtype=torch.long, device=x.device), torch.arange(x.size(2), dtype=torch.long, device=x.device), torch.arange(x.size(3), dtype=torch.long, device=x.device), ) grid_x = torch.clamp(grid_x + translation_x + 1, 0, x.size(2) + 1) grid_y = torch.clamp(grid_y + translation_y + 1, 0, x.size(3) + 1) x_pad = F.pad(x, [1, 1, 1, 1, 0, 0, 0, 0]) x = x_pad.permute(0, 2, 3, 1).contiguous()[grid_batch, grid_x, grid_y].permute(0, 3, 1, 2).contiguous(memory_format = torch.contiguous_format) return x def rand_cutout(x, ratio=0.5): cutout_size = int(x.size(2) * ratio + 0.5), int(x.size(3) * ratio + 0.5) offset_x = torch.randint(0, x.size(2) + (1 - cutout_size[0] % 2), size=[x.size(0), 1, 1], device=x.device) offset_y = torch.randint(0, x.size(3) + (1 - cutout_size[1] % 2), size=[x.size(0), 1, 1], device=x.device) grid_batch, grid_x, grid_y = torch.meshgrid( torch.arange(x.size(0), dtype=torch.long, device=x.device), torch.arange(cutout_size[0], dtype=torch.long, device=x.device), torch.arange(cutout_size[1], dtype=torch.long, device=x.device), ) grid_x = torch.clamp(grid_x + offset_x - cutout_size[0] // 2, min=0, max=x.size(2) - 1) grid_y = torch.clamp(grid_y + offset_y - cutout_size[1] // 2, min=0, max=x.size(3) - 1) mask = torch.ones(x.size(0), x.size(2), x.size(3), dtype=x.dtype, device=x.device) mask[grid_batch, grid_x, grid_y] = 0 x = x * mask.unsqueeze(1) return x AUGMENT_FNS = { 'color': [rand_brightness, rand_saturation, rand_contrast], 'translation': [rand_translation], 'cutout': [rand_cutout], }
unet-stylegan2-master
unet_stylegan2/diff_augment.py
from unet_stylegan2.unet_stylegan2 import Trainer, StyleGAN2, NanException
unet-stylegan2-master
unet_stylegan2/__init__.py
import os import sys import math import fire import json from tqdm import tqdm from math import floor, log2 from random import random from shutil import rmtree from functools import partial import multiprocessing import numpy as np import torch from torch import nn from torch.utils import data import torch.nn.functional as F from torch.optim import Adam from torch.autograd import grad as torch_grad import torchvision from torchvision import transforms from linear_attention_transformer import ImageLinearAttention from PIL import Image from pathlib import Path try: from apex import amp APEX_AVAILABLE = True except: APEX_AVAILABLE = False from unet_stylegan2.diff_augment import DiffAugment assert torch.cuda.is_available(), 'You need to have an Nvidia GPU with CUDA installed.' num_cores = multiprocessing.cpu_count() # constants EXTS = ['jpg', 'jpeg', 'png', 'webp'] EPS = 1e-8 # helper classes class NanException(Exception): pass class EMA(): def __init__(self, beta): super().__init__() self.beta = beta def update_average(self, old, new): if old is None: return new return old * self.beta + (1 - self.beta) * new class RandomApply(nn.Module): def __init__(self, prob, fn, fn_else = lambda x: x): super().__init__() self.fn = fn self.fn_else = fn_else self.prob = prob def forward(self, x): fn = self.fn if random() < self.prob else self.fn_else return fn(x) class Residual(nn.Module): def __init__(self, fn): super().__init__() self.fn = fn def forward(self, x): return self.fn(x) + x class Flatten(nn.Module): def __init__(self, index): super().__init__() self.index = index def forward(self, x): return x.flatten(self.index) class Rezero(nn.Module): def __init__(self, fn): super().__init__() self.fn = fn self.g = nn.Parameter(torch.zeros(1)) def forward(self, x): return self.fn(x) * self.g # one layer of self-attention and feedforward, for images attn_and_ff = lambda chan: nn.Sequential(*[ Residual(Rezero(ImageLinearAttention(chan, norm_queries = True))), Residual(Rezero(nn.Sequential(nn.Conv2d(chan, chan * 2, 1), leaky_relu(), nn.Conv2d(chan * 2, chan, 1)))) ]) # helpers def default(value, d): return d if value is None else value def cycle(iterable): while True: for i in iterable: yield i def cast_list(el): return el if isinstance(el, list) else [el] def is_empty(t): if isinstance(t, torch.Tensor): return t.nelement() == 0 return t is None def raise_if_nan(t): if torch.isnan(t): raise NanException def loss_backwards(fp16, loss, optimizer, **kwargs): if fp16: with amp.scale_loss(loss, optimizer) as scaled_loss: scaled_loss.backward(**kwargs) else: loss.backward(**kwargs) def gradient_penalty(images, outputs, weight = 10): batch_size = images.shape[0] gradients = torch_grad(outputs=outputs, inputs=images, grad_outputs=list(map(lambda t: torch.ones(t.size()).cuda(), outputs)), create_graph=True, retain_graph=True, only_inputs=True)[0] gradients = gradients.reshape(batch_size, -1) return weight * ((gradients.norm(2, dim=1) - 1) ** 2).mean() def calc_pl_lengths(styles, images): num_pixels = images.shape[2] * images.shape[3] pl_noise = torch.randn(images.shape).cuda() / math.sqrt(num_pixels) outputs = (images * pl_noise).sum() pl_grads = torch_grad(outputs=outputs, inputs=styles, grad_outputs=torch.ones(outputs.shape).cuda(), create_graph=True, retain_graph=True, only_inputs=True)[0] return (pl_grads ** 2).sum(dim=2).mean(dim=1).sqrt() def noise(n, latent_dim): return torch.randn(n, latent_dim).cuda() def noise_list(n, layers, latent_dim): return [(noise(n, latent_dim), layers)] def mixed_list(n, layers, latent_dim): tt = int(torch.rand(()).numpy() * layers) return noise_list(n, tt, latent_dim) + noise_list(n, layers - tt, latent_dim) def latent_to_w(style_vectorizer, latent_descr): return [(style_vectorizer(z), num_layers) for z, num_layers in latent_descr] def image_noise(n, im_size): return torch.FloatTensor(n, im_size, im_size, 1).uniform_(0., 1.).cuda() def leaky_relu(p=0.2): return nn.LeakyReLU(p) def evaluate_in_chunks(max_batch_size, model, *args): split_args = list(zip(*list(map(lambda x: x.split(max_batch_size, dim=0), args)))) chunked_outputs = [model(*i) for i in split_args] if len(chunked_outputs) == 1: return chunked_outputs[0] return torch.cat(chunked_outputs, dim=0) def styles_def_to_tensor(styles_def): return torch.cat([t[:, None, :].expand(-1, n, -1) for t, n in styles_def], dim=1) def set_requires_grad(model, bool): for p in model.parameters(): p.requires_grad = bool def slerp(val, low, high): low_norm = low / torch.norm(low, dim=1, keepdim=True) high_norm = high / torch.norm(high, dim=1, keepdim=True) omega = torch.acos((low_norm * high_norm).sum(1)) so = torch.sin(omega) res = (torch.sin((1.0 - val) * omega) / so).unsqueeze(1) * low + (torch.sin(val * omega) / so).unsqueeze(1) * high return res def warmup(start, end, max_steps, current_step): if current_step > max_steps: return end return (end - start) * (current_step / max_steps) + start def log(t, eps = 1e-6): return torch.log(t + eps) def cutmix_coordinates(height, width, alpha = 1.): lam = np.random.beta(alpha, alpha) cx = np.random.uniform(0, width) cy = np.random.uniform(0, height) w = width * np.sqrt(1 - lam) h = height * np.sqrt(1 - lam) x0 = int(np.round(max(cx - w / 2, 0))) x1 = int(np.round(min(cx + w / 2, width))) y0 = int(np.round(max(cy - h / 2, 0))) y1 = int(np.round(min(cy + h / 2, height))) return ((y0, y1), (x0, x1)), lam def cutmix(source, target, coors, alpha = 1.): source, target = map(torch.clone, (source, target)) ((y0, y1), (x0, x1)), _ = coors source[:, :, y0:y1, x0:x1] = target[:, :, y0:y1, x0:x1] return source def mask_src_tgt(source, target, mask): return source * mask + (1 - mask) * target # dataset def convert_rgb_to_transparent(image): if image.mode == 'RGB': return image.convert('RGBA') return image def convert_transparent_to_rgb(image): if image.mode == 'RGBA': return image.convert('RGB') return image class expand_greyscale(object): def __init__(self, num_channels): self.num_channels = num_channels def __call__(self, tensor): return tensor.expand(self.num_channels, -1, -1) def resize_to_minimum_size(min_size, image): if max(*image.size) < min_size: return torchvision.transforms.functional.resize(image, min_size) return image class Dataset(data.Dataset): def __init__(self, folder, image_size, transparent = False, aug_prob = 0.): super().__init__() self.folder = folder self.image_size = image_size self.paths = [p for ext in EXTS for p in Path(f'{folder}').glob(f'**/*.{ext}')] convert_image_fn = convert_transparent_to_rgb if not transparent else convert_rgb_to_transparent num_channels = 3 if not transparent else 4 self.transform = transforms.Compose([ transforms.Lambda(convert_image_fn), transforms.Lambda(partial(resize_to_minimum_size, image_size)), transforms.Resize(image_size), RandomApply(aug_prob, transforms.RandomResizedCrop(image_size, scale=(0.5, 1.0), ratio=(0.98, 1.02)), transforms.CenterCrop(image_size)), transforms.ToTensor(), transforms.Lambda(expand_greyscale(num_channels)) ]) def __len__(self): return len(self.paths) def __getitem__(self, index): path = self.paths[index] img = Image.open(path) return self.transform(img) # augmentations def random_float(lo, hi): return lo + (hi - lo) * random() def random_crop_and_resize(tensor, scale): b, c, h, _ = tensor.shape new_width = int(h * scale) delta = h - new_width h_delta = int(random() * delta) w_delta = int(random() * delta) cropped = tensor[:, :, h_delta:(h_delta + new_width), w_delta:(w_delta + new_width)].clone() return F.interpolate(cropped, size=(h, h), mode='bilinear') def random_hflip(tensor, prob): if prob > random(): return tensor return torch.flip(tensor, dims=(3,)) class AugWrapper(nn.Module): def __init__(self, D, image_size, types): super().__init__() self.D = D self.types = types def forward(self, images, prob = 0., detach = False): if random() < prob: images = random_hflip(images, prob=0.5) images = DiffAugment(images, types=self.types) if detach: images.detach_() return self.D(images), images # stylegan2 classes class EqualLinear(nn.Module): def __init__(self, in_dim, out_dim, lr_mul = 1, bias = True): super().__init__() self.weight = nn.Parameter(torch.randn(out_dim, in_dim)) if bias: self.bias = nn.Parameter(torch.zeros(out_dim)) self.lr_mul = lr_mul def forward(self, input): return F.linear(input, self.weight * self.lr_mul, bias=self.bias * self.lr_mul) class StyleVectorizer(nn.Module): def __init__(self, emb, depth, lr_mul = 0.1): super().__init__() layers = [] for i in range(depth): layers.extend([EqualLinear(emb, emb, lr_mul), leaky_relu()]) self.net = nn.Sequential(*layers) def forward(self, x): x = F.normalize(x, dim=1) return self.net(x) class RGBBlock(nn.Module): def __init__(self, latent_dim, input_channel, upsample, rgba = False): super().__init__() self.input_channel = input_channel self.to_style = nn.Linear(latent_dim, input_channel) out_filters = 3 if not rgba else 4 self.conv = Conv2DMod(input_channel, out_filters, 1, demod=False) self.upsample = nn.Upsample(scale_factor = 2, mode='bilinear', align_corners=False) if upsample else None def forward(self, x, prev_rgb, istyle): b, c, h, w = x.shape style = self.to_style(istyle) x = self.conv(x, style) if prev_rgb is not None: x = x + prev_rgb if self.upsample is not None: x = self.upsample(x) return x class Conv2DMod(nn.Module): def __init__(self, in_chan, out_chan, kernel, demod=True, stride=1, dilation=1, **kwargs): super().__init__() self.filters = out_chan self.demod = demod self.kernel = kernel self.stride = stride self.dilation = dilation self.weight = nn.Parameter(torch.randn((out_chan, in_chan, kernel, kernel))) nn.init.kaiming_normal_(self.weight, a=0, mode='fan_in', nonlinearity='leaky_relu') def _get_same_padding(self, size, kernel, dilation, stride): return ((size - 1) * (stride - 1) + dilation * (kernel - 1)) // 2 def forward(self, x, y): b, c, h, w = x.shape w1 = y[:, None, :, None, None] w2 = self.weight[None, :, :, :, :] weights = w2 * (w1 + 1) if self.demod: d = torch.rsqrt((weights ** 2).sum(dim=(2, 3, 4), keepdim=True) + EPS) weights = weights * d x = x.reshape(1, -1, h, w) _, _, *ws = weights.shape weights = weights.reshape(b * self.filters, *ws) padding = self._get_same_padding(h, self.kernel, self.dilation, self.stride) x = F.conv2d(x, weights, padding=padding, groups=b) x = x.reshape(-1, self.filters, h, w) return x class GeneratorBlock(nn.Module): def __init__(self, latent_dim, input_channels, filters, upsample = True, upsample_rgb = True, rgba = False): super().__init__() self.upsample = nn.Upsample(scale_factor=2, mode='bilinear', align_corners=False) if upsample else None self.to_style1 = nn.Linear(latent_dim, input_channels) self.to_noise1 = nn.Linear(1, filters) self.conv1 = Conv2DMod(input_channels, filters, 3) self.to_style2 = nn.Linear(latent_dim, filters) self.to_noise2 = nn.Linear(1, filters) self.conv2 = Conv2DMod(filters, filters, 3) self.activation = leaky_relu() self.to_rgb = RGBBlock(latent_dim, filters, upsample_rgb, rgba) def forward(self, x, prev_rgb, istyle, inoise): if self.upsample is not None: x = self.upsample(x) inoise = inoise[:, :x.shape[2], :x.shape[3], :] noise1 = self.to_noise1(inoise).permute((0, 3, 2, 1)) noise2 = self.to_noise2(inoise).permute((0, 3, 2, 1)) style1 = self.to_style1(istyle) x = self.conv1(x, style1) x = self.activation(x + noise1) style2 = self.to_style2(istyle) x = self.conv2(x, style2) x = self.activation(x + noise2) rgb = self.to_rgb(x, prev_rgb, istyle) return x, rgb def double_conv(chan_in, chan_out): return nn.Sequential( nn.Conv2d(chan_in, chan_out, 3, padding=1), leaky_relu(), nn.Conv2d(chan_out, chan_out, 3, padding=1), leaky_relu() ) class DownBlock(nn.Module): def __init__(self, input_channels, filters, downsample=True): super().__init__() self.conv_res = nn.Conv2d(input_channels, filters, 1, stride = (2 if downsample else 1)) self.net = double_conv(input_channels, filters) self.down = nn.Conv2d(filters, filters, 3, padding = 1, stride = 2) if downsample else None def forward(self, x): res = self.conv_res(x) x = self.net(x) unet_res = x if self.down is not None: x = self.down(x) x = x + res return x, unet_res class UpBlock(nn.Module): def __init__(self, input_channels, filters): super().__init__() self.conv_res = nn.ConvTranspose2d(input_channels // 2, filters, 1, stride = 2) self.net = double_conv(input_channels, filters) self.up = nn.Upsample(scale_factor = 2, mode='bilinear', align_corners=False) self.input_channels = input_channels self.filters = filters def forward(self, x, res): *_, h, w = x.shape conv_res = self.conv_res(x, output_size = (h * 2, w * 2)) x = self.up(x) x = torch.cat((x, res), dim=1) x = self.net(x) x = x + conv_res return x class Generator(nn.Module): def __init__(self, image_size, latent_dim, network_capacity = 16, transparent = False, no_const = False, fmap_max = 512): super().__init__() self.image_size = image_size self.latent_dim = latent_dim self.num_layers = int(log2(image_size) - 1) filters = [network_capacity * (2 ** (i + 1)) for i in range(self.num_layers)][::-1] set_fmap_max = partial(min, fmap_max) filters = list(map(set_fmap_max, filters)) init_channels = filters[0] filters = [init_channels, *filters] in_out_pairs = zip(filters[:-1], filters[1:]) self.no_const = no_const if no_const: self.to_initial_block = nn.ConvTranspose2d(latent_dim, init_channels, 4, 1, 0, bias=False) else: self.initial_block = nn.Parameter(torch.randn((1, init_channels, 4, 4))) self.initial_conv = nn.Conv2d(filters[0], filters[0], 3, padding=1) self.blocks = nn.ModuleList([]) self.attns = nn.ModuleList([]) for ind, (in_chan, out_chan) in enumerate(in_out_pairs): not_first = ind != 0 not_last = ind != (self.num_layers - 1) num_layer = self.num_layers - ind attn_fn = attn_and_ff(in_chan) self.attns.append(attn_fn) block = GeneratorBlock( latent_dim, in_chan, out_chan, upsample = not_first, upsample_rgb = not_last, rgba = transparent ) self.blocks.append(block) def forward(self, styles, input_noise): batch_size = styles.shape[0] image_size = self.image_size if self.no_const: avg_style = styles.mean(dim=1)[:, :, None, None] x = self.to_initial_block(avg_style) else: x = self.initial_block.expand(batch_size, -1, -1, -1) x = self.initial_conv(x) styles = styles.transpose(0, 1) rgb = None for style, block, attn in zip(styles, self.blocks, self.attns): if attn is not None: x = attn(x) x, rgb = block(x, rgb, style, input_noise) return rgb class Discriminator(nn.Module): def __init__(self, image_size, network_capacity = 16, transparent = False, fmap_max = 512): super().__init__() num_layers = int(log2(image_size) - 3) num_init_filters = 3 if not transparent else 4 blocks = [] filters = [num_init_filters] + [(network_capacity) * (2 ** i) for i in range(num_layers + 1)] set_fmap_max = partial(min, fmap_max) filters = list(map(set_fmap_max, filters)) filters[-1] = filters[-2] chan_in_out = list(zip(filters[:-1], filters[1:])) chan_in_out = list(map(list, chan_in_out)) down_blocks = [] attn_blocks = [] for ind, (in_chan, out_chan) in enumerate(chan_in_out): num_layer = ind + 1 is_not_last = ind != (len(chan_in_out) - 1) block = DownBlock(in_chan, out_chan, downsample = is_not_last) down_blocks.append(block) attn_fn = attn_and_ff(out_chan) attn_blocks.append(attn_fn) self.down_blocks = nn.ModuleList(down_blocks) self.attn_blocks = nn.ModuleList(attn_blocks) last_chan = filters[-1] self.to_logit = nn.Sequential( leaky_relu(), nn.AvgPool2d(image_size // (2 ** num_layers)), Flatten(1), nn.Linear(last_chan, 1) ) self.conv = double_conv(last_chan, last_chan) dec_chan_in_out = chan_in_out[:-1][::-1] self.up_blocks = nn.ModuleList(list(map(lambda c: UpBlock(c[1] * 2, c[0]), dec_chan_in_out))) self.conv_out = nn.Conv2d(3, 1, 1) def forward(self, x): b, *_ = x.shape residuals = [] for (down_block, attn_block) in zip(self.down_blocks, self.attn_blocks): x, unet_res = down_block(x) residuals.append(unet_res) if attn_block is not None: x = attn_block(x) x = self.conv(x) + x enc_out = self.to_logit(x) for (up_block, res) in zip(self.up_blocks, residuals[:-1][::-1]): x = up_block(x, res) dec_out = self.conv_out(x) return enc_out.squeeze(), dec_out class StyleGAN2(nn.Module): def __init__(self, image_size, latent_dim = 512, fmap_max = 512, style_depth = 8, network_capacity = 16, transparent = False, fp16 = False, steps = 1, lr = 1e-4, ttur_mult = 2, no_const = False, lr_mul = 0.1, aug_types = ['translation', 'cutout']): super().__init__() self.lr = lr self.steps = steps self.ema_updater = EMA(0.995) self.S = StyleVectorizer(latent_dim, style_depth, lr_mul = lr_mul) self.G = Generator(image_size, latent_dim, network_capacity, transparent = transparent, no_const = no_const, fmap_max = fmap_max) self.D = Discriminator(image_size, network_capacity, transparent = transparent, fmap_max = fmap_max) self.SE = StyleVectorizer(latent_dim, style_depth, lr_mul = lr_mul) self.GE = Generator(image_size, latent_dim, network_capacity, transparent = transparent, no_const = no_const) # wrapper for augmenting all images going into the discriminator self.D_aug = AugWrapper(self.D, image_size, aug_types) set_requires_grad(self.SE, False) set_requires_grad(self.GE, False) generator_params = list(self.G.parameters()) + list(self.S.parameters()) self.G_opt = Adam(generator_params, lr = self.lr, betas=(0.5, 0.9)) self.D_opt = Adam(self.D.parameters(), lr = self.lr * ttur_mult, betas=(0.5, 0.9)) self._init_weights() self.reset_parameter_averaging() self.cuda() self.fp16 = fp16 if fp16: (self.S, self.G, self.D, self.SE, self.GE), (self.G_opt, self.D_opt) = amp.initialize([self.S, self.G, self.D, self.SE, self.GE], [self.G_opt, self.D_opt], opt_level='O1') def _init_weights(self): for m in self.modules(): if type(m) in {nn.Conv2d, nn.Linear}: nn.init.kaiming_normal_(m.weight, a=0, mode='fan_in', nonlinearity='leaky_relu') for block in self.G.blocks: nn.init.zeros_(block.to_noise1.weight) nn.init.zeros_(block.to_noise2.weight) nn.init.zeros_(block.to_noise1.bias) nn.init.zeros_(block.to_noise2.bias) def EMA(self): def update_moving_average(ma_model, current_model): for current_params, ma_params in zip(current_model.parameters(), ma_model.parameters()): old_weight, up_weight = ma_params.data, current_params.data ma_params.data = self.ema_updater.update_average(old_weight, up_weight) update_moving_average(self.SE, self.S) update_moving_average(self.GE, self.G) def reset_parameter_averaging(self): self.SE.load_state_dict(self.S.state_dict()) self.GE.load_state_dict(self.G.state_dict()) def forward(self, x): return x class Trainer(): def __init__(self, name, results_dir, models_dir, image_size, network_capacity, transparent = False, batch_size = 4, mixed_prob = 0.9, gradient_accumulate_every=1, lr = 2e-4, ttur_mult = 2, num_workers = None, save_every = 1000, trunc_psi = 0.6, fp16 = False, no_const = False, aug_prob = 0., dataset_aug_prob = 0., cr_weight = 0.2, apply_pl_reg = False, lr_mul = 0.1, *args, **kwargs): self.GAN_params = [args, kwargs] self.GAN = None self.name = name self.results_dir = Path(results_dir) self.models_dir = Path(models_dir) self.config_path = self.models_dir / name / '.config.json' assert log2(image_size).is_integer(), 'image size must be a power of 2 (64, 128, 256, 512, 1024)' self.image_size = image_size self.network_capacity = network_capacity self.transparent = transparent self.no_const = no_const self.aug_prob = aug_prob self.lr = lr self.ttur_mult = ttur_mult self.lr_mul = lr_mul self.batch_size = batch_size self.num_workers = num_workers self.mixed_prob = mixed_prob self.save_every = save_every self.steps = 0 self.av = None self.trunc_psi = trunc_psi self.apply_pl_reg = apply_pl_reg self.pl_mean = None self.gradient_accumulate_every = gradient_accumulate_every assert not fp16 or fp16 and APEX_AVAILABLE, 'Apex is not available for you to use mixed precision training' self.fp16 = fp16 self.d_loss = 0 self.g_loss = 0 self.last_gp_loss = 0 self.last_cr_loss = 0 self.pl_length_ma = EMA(0.99) self.init_folders() self.loader = None self.dataset_aug_prob = dataset_aug_prob self.cr_weight = cr_weight def init_GAN(self): args, kwargs = self.GAN_params self.GAN = StyleGAN2(lr = self.lr, ttur_mult = self.ttur_mult, lr_mul = self.lr_mul, image_size = self.image_size, network_capacity = self.network_capacity, transparent = self.transparent, fp16 = self.fp16, no_const = self.no_const, *args, **kwargs) def write_config(self): self.config_path.write_text(json.dumps(self.config())) def load_config(self): config = self.config() if not self.config_path.exists() else json.loads(self.config_path.read_text()) self.image_size = config['image_size'] self.network_capacity = config['network_capacity'] self.transparent = config['transparent'] self.no_const = config.pop('no_const', False) del self.GAN self.init_GAN() def config(self): return {'image_size': self.image_size, 'network_capacity': self.network_capacity, 'transparent': self.transparent, 'no_const': self.no_const} def set_data_src(self, folder): self.dataset = Dataset(folder, self.image_size, transparent = self.transparent, aug_prob = self.dataset_aug_prob) self.loader = cycle(data.DataLoader(self.dataset, num_workers = default(self.num_workers, num_cores), batch_size = self.batch_size, drop_last = True, shuffle=True, pin_memory=True)) def train(self): assert self.loader is not None, 'You must first initialize the data source with `.set_data_src(<folder of images>)`' if self.GAN is None: self.init_GAN() self.GAN.train() total_disc_loss = torch.tensor(0.).cuda() total_gen_loss = torch.tensor(0.).cuda() batch_size = self.batch_size image_size = self.GAN.G.image_size latent_dim = self.GAN.G.latent_dim num_layers = self.GAN.G.num_layers aug_prob = self.aug_prob apply_gradient_penalty = self.steps < 4000 or self.steps % 4 == 0 apply_path_penalty = self.apply_pl_reg and self.steps % 32 == 0 dec_loss_coef = warmup(0, 1., 30000, self.steps) cutmix_prob = warmup(0, 0.25, 30000, self.steps) apply_cutmix = random() < cutmix_prob backwards = partial(loss_backwards, self.fp16) # train discriminator avg_pl_length = self.pl_mean self.GAN.D_opt.zero_grad() for i in range(self.gradient_accumulate_every): get_latents_fn = mixed_list if random() < self.mixed_prob else noise_list style = get_latents_fn(batch_size, num_layers, latent_dim) noise = image_noise(batch_size, image_size) w_space = latent_to_w(self.GAN.S, style) w_styles = styles_def_to_tensor(w_space) generated_images = self.GAN.G(w_styles, noise).clone().detach() (fake_enc_out, fake_dec_out), fake_aug_images = self.GAN.D_aug(generated_images, detach = True, prob = aug_prob) real_images = next(self.loader).cuda() real_images.requires_grad_() (real_enc_out, real_dec_out), real_aug_images = self.GAN.D_aug(real_images, prob = aug_prob) enc_divergence = (F.relu(1 + real_enc_out) + F.relu(1 - fake_enc_out)).mean() dec_divergence = (F.relu(1 + real_dec_out) + F.relu(1 - fake_dec_out)).mean() divergence = enc_divergence + dec_divergence * dec_loss_coef disc_loss = divergence if apply_cutmix: mask = cutmix( torch.ones_like(real_dec_out), torch.zeros_like(real_dec_out), cutmix_coordinates(image_size, image_size) ) if random() > 0.5: mask = 1 - mask cutmix_images = mask_src_tgt(real_aug_images, fake_aug_images, mask) cutmix_enc_out, cutmix_dec_out = self.GAN.D(cutmix_images) cutmix_enc_divergence = F.relu(1 - cutmix_enc_out).mean() cutmix_dec_divergence = F.relu(1 + (mask * 2 - 1) * cutmix_dec_out).mean() disc_loss = disc_loss + cutmix_enc_divergence + cutmix_dec_divergence cr_cutmix_dec_out = mask_src_tgt(real_dec_out, fake_dec_out, mask) cr_loss = F.mse_loss(cutmix_dec_out, cr_cutmix_dec_out) * self.cr_weight self.last_cr_loss = cr_loss.clone().detach().item() disc_loss = disc_loss + cr_loss * dec_loss_coef if apply_gradient_penalty: if random() < 0.5: gp = gradient_penalty(real_images, (real_enc_out,)) else: gp = gradient_penalty(real_images, (real_dec_out,)) * dec_loss_coef self.last_gp_loss = gp.clone().detach().item() disc_loss = disc_loss + gp disc_loss = disc_loss / self.gradient_accumulate_every disc_loss.register_hook(raise_if_nan) backwards(disc_loss, self.GAN.D_opt) total_disc_loss += divergence.detach().item() / self.gradient_accumulate_every self.d_loss = float(total_disc_loss) self.GAN.D_opt.step() # train generator self.GAN.G_opt.zero_grad() for i in range(self.gradient_accumulate_every): style = get_latents_fn(batch_size, num_layers, latent_dim) noise = image_noise(batch_size, image_size) w_space = latent_to_w(self.GAN.S, style) w_styles = styles_def_to_tensor(w_space) generated_images = self.GAN.G(w_styles, noise) (fake_enc_output, fake_dec_output), _ = self.GAN.D_aug(generated_images, prob = aug_prob) loss = fake_enc_output.mean() + F.relu(1 + fake_dec_output).mean() gen_loss = loss if apply_path_penalty: pl_lengths = calc_pl_lengths(w_styles, generated_images) avg_pl_length = np.mean(pl_lengths.detach().cpu().numpy()) if not is_empty(self.pl_mean): pl_loss = ((pl_lengths - self.pl_mean) ** 2).mean() if not torch.isnan(pl_loss): gen_loss = gen_loss + pl_loss gen_loss = gen_loss / self.gradient_accumulate_every gen_loss.register_hook(raise_if_nan) backwards(gen_loss, self.GAN.G_opt) total_gen_loss += loss.detach().item() / self.gradient_accumulate_every self.g_loss = float(total_gen_loss) self.GAN.G_opt.step() # calculate moving averages if apply_path_penalty and not np.isnan(avg_pl_length): self.pl_mean = self.pl_length_ma.update_average(self.pl_mean, avg_pl_length) if self.steps % 10 == 0 and self.steps > 20000: self.GAN.EMA() if self.steps <= 25000 and self.steps % 1000 == 2: self.GAN.reset_parameter_averaging() # save from NaN errors checkpoint_num = floor(self.steps / self.save_every) if any(torch.isnan(l) for l in (total_gen_loss, total_disc_loss)): print(f'NaN detected for generator or discriminator. Loading from checkpoint #{checkpoint_num}') self.load(checkpoint_num) raise NanException # periodically save results if self.steps % self.save_every == 0: self.save(checkpoint_num) if self.steps % 1000 == 0 or (self.steps % 100 == 0 and self.steps < 2500): self.evaluate(floor(self.steps / 1000)) self.steps += 1 self.av = None @torch.no_grad() def evaluate(self, num = 0, num_image_tiles = 8, trunc = 1.0): self.GAN.eval() ext = 'jpg' if not self.transparent else 'png' num_rows = num_image_tiles latent_dim = self.GAN.G.latent_dim image_size = self.GAN.G.image_size num_layers = self.GAN.G.num_layers # latents and noise latents = noise_list(num_rows ** 2, num_layers, latent_dim) n = image_noise(num_rows ** 2, image_size) # regular generated_images = self.generate_truncated(self.GAN.S, self.GAN.G, latents, n, trunc_psi = self.trunc_psi) torchvision.utils.save_image(generated_images, str(self.results_dir / self.name / f'{str(num)}.{ext}'), nrow=num_rows) # moving averages generated_images = self.generate_truncated(self.GAN.SE, self.GAN.GE, latents, n, trunc_psi = self.trunc_psi) torchvision.utils.save_image(generated_images, str(self.results_dir / self.name / f'{str(num)}-ema.{ext}'), nrow=num_rows) # mixing regularities def tile(a, dim, n_tile): init_dim = a.size(dim) repeat_idx = [1] * a.dim() repeat_idx[dim] = n_tile a = a.repeat(*(repeat_idx)) order_index = torch.LongTensor(np.concatenate([init_dim * np.arange(n_tile) + i for i in range(init_dim)])).cuda() return torch.index_select(a, dim, order_index) nn = noise(num_rows, latent_dim) tmp1 = tile(nn, 0, num_rows) tmp2 = nn.repeat(num_rows, 1) tt = int(num_layers / 2) mixed_latents = [(tmp1, tt), (tmp2, num_layers - tt)] generated_images = self.generate_truncated(self.GAN.SE, self.GAN.GE, mixed_latents, n, trunc_psi = self.trunc_psi) torchvision.utils.save_image(generated_images, str(self.results_dir / self.name / f'{str(num)}-mr.{ext}'), nrow=num_rows) @torch.no_grad() def generate_truncated(self, S, G, style, noi, trunc_psi = 0.75, num_image_tiles = 8): latent_dim = G.latent_dim if self.av is None: z = noise(2000, latent_dim) samples = evaluate_in_chunks(self.batch_size, S, z).cpu().numpy() self.av = np.mean(samples, axis = 0) self.av = np.expand_dims(self.av, axis = 0) w_space = [] for tensor, num_layers in style: tmp = S(tensor) av_torch = torch.from_numpy(self.av).cuda() tmp = trunc_psi * (tmp - av_torch) + av_torch w_space.append((tmp, num_layers)) w_styles = styles_def_to_tensor(w_space) generated_images = evaluate_in_chunks(self.batch_size, G, w_styles, noi) return generated_images.clamp_(0., 1.) @torch.no_grad() def generate_interpolation(self, num = 0, num_image_tiles = 8, trunc = 1.0, save_frames = False): self.GAN.eval() ext = 'jpg' if not self.transparent else 'png' num_rows = num_image_tiles latent_dim = self.GAN.G.latent_dim image_size = self.GAN.G.image_size num_layers = self.GAN.G.num_layers # latents and noise latents_low = noise(num_rows ** 2, latent_dim) latents_high = noise(num_rows ** 2, latent_dim) n = image_noise(num_rows ** 2, image_size) ratios = torch.linspace(0., 8., 100) frames = [] for ratio in tqdm(ratios): interp_latents = slerp(ratio, latents_low, latents_high) latents = [(interp_latents, num_layers)] generated_images = self.generate_truncated(self.GAN.SE, self.GAN.GE, latents, n, trunc_psi = self.trunc_psi) images_grid = torchvision.utils.make_grid(generated_images, nrow = num_rows) pil_image = transforms.ToPILImage()(images_grid.cpu()) frames.append(pil_image) frames[0].save(str(self.results_dir / self.name / f'{str(num)}.gif'), save_all=True, append_images=frames[1:], duration=80, loop=0, optimize=True) if save_frames: folder_path = (self.results_dir / self.name / f'{str(num)}') folder_path.mkdir(parents=True, exist_ok=True) for ind, frame in enumerate(frames): frame.save(str(folder_path / f'{str(ind)}.{ext}')) def print_log(self): pl_mean = default(self.pl_mean, 0) print(f'G: {self.g_loss:.2f} | D: {self.d_loss:.2f} | GP: {self.last_gp_loss:.2f} | PL: {pl_mean:.2f} | CR: {self.last_cr_loss:.2f}') def model_name(self, num): return str(self.models_dir / self.name / f'model_{num}.pt') def init_folders(self): (self.results_dir / self.name).mkdir(parents=True, exist_ok=True) (self.models_dir / self.name).mkdir(parents=True, exist_ok=True) def clear(self): rmtree(f'./models/{self.name}', True) rmtree(f'./results/{self.name}', True) rmtree(str(self.config_path), True) self.init_folders() def save(self, num): save_data = {'GAN': self.GAN.state_dict()} if self.GAN.fp16: save_data['amp'] = amp.state_dict() torch.save(save_data, self.model_name(num)) self.write_config() def load(self, num = -1): self.load_config() name = num if num == -1: file_paths = [p for p in Path(self.models_dir / self.name).glob('model_*.pt')] saved_nums = sorted(map(lambda x: int(x.stem.split('_')[1]), file_paths)) if len(saved_nums) == 0: return name = saved_nums[-1] print(f'continuing from previous epoch - {name}') self.steps = name * self.save_every load_data = torch.load(self.model_name(name)) self.GAN.load_state_dict(load_data['GAN']) if self.GAN.fp16 and 'amp' in load_data: amp.load_state_dict(load_data['amp'])
unet-stylegan2-master
unet_stylegan2/unet_stylegan2.py
from setuptools import setup, find_packages setup( name = 'transformer-in-transformer', packages = find_packages(), version = '0.1.2', license='MIT', description = 'Transformer in Transformer - Pytorch', author = 'Phil Wang', author_email = 'lucidrains@gmail.com', url = 'https://github.com/lucidrains/transformer-in-transformer', keywords = [ 'artificial intelligence', 'deep learning', 'transformer', 'image classification' ], install_requires=[ 'einops>=0.3', 'torch>=1.6' ], classifiers=[ 'Development Status :: 4 - Beta', 'Intended Audience :: Developers', 'Topic :: Scientific/Engineering :: Artificial Intelligence', 'License :: OSI Approved :: MIT License', 'Programming Language :: Python :: 3.6', ], )
transformer-in-transformer-main
setup.py
from transformer_in_transformer.tnt import TNT
transformer-in-transformer-main
transformer_in_transformer/__init__.py
import torch import torch.nn.functional as F from torch import nn, einsum from einops import rearrange, repeat from einops.layers.torch import Rearrange # helpers def exists(val): return val is not None def default(val, d): return val if exists(val) else d def divisible_by(val, divisor): return (val % divisor) == 0 def unfold_output_size(image_size, kernel_size, stride, padding): return int(((image_size - kernel_size + (2 * padding)) / stride) + 1) # classes class PreNorm(nn.Module): def __init__(self, dim, fn): super().__init__() self.norm = nn.LayerNorm(dim) self.fn = fn def forward(self, x, **kwargs): return self.fn(self.norm(x), **kwargs) class FeedForward(nn.Module): def __init__(self, dim, mult = 4, dropout = 0.): super().__init__() self.net = nn.Sequential( nn.Linear(dim, dim * mult), nn.GELU(), nn.Dropout(dropout), nn.Linear(dim * mult, dim) ) def forward(self, x): return self.net(x) class Attention(nn.Module): def __init__( self, *, dim, heads = 8, dim_head = 64, dropout = 0. ): super().__init__() inner_dim = heads * dim_head self.heads = heads self.scale = dim_head ** -0.5 self.to_qkv = nn.Linear(dim, inner_dim * 3, bias = False) self.to_out = nn.Sequential( nn.Linear(inner_dim, dim), nn.Dropout(dropout) ) def forward(self, x): b, n, d, h = *x.shape, self.heads q, k, v = self.to_qkv(x).chunk(3, dim = -1) q, k, v = map(lambda t: rearrange(t, 'b n (h d) -> (b h) n d', h = h), (q, k, v)) sim = einsum('b i d, b j d -> b i j', q, k) * self.scale attn = sim.softmax(dim = -1) out = einsum('b i j, b j d -> b i d', attn, v) out = rearrange(out, '(b h) n d -> b n (h d)', h = h) return self.to_out(out) # main class class TNT(nn.Module): def __init__( self, *, image_size, patch_dim, pixel_dim, patch_size, pixel_size, depth, num_classes, channels = 3, heads = 8, dim_head = 64, ff_dropout = 0., attn_dropout = 0., unfold_args = None ): super().__init__() assert divisible_by(image_size, patch_size), 'image size must be divisible by patch size' assert divisible_by(patch_size, pixel_size), 'patch size must be divisible by pixel size for now' num_patch_tokens = (image_size // patch_size) ** 2 self.image_size = image_size self.patch_size = patch_size self.patch_tokens = nn.Parameter(torch.randn(num_patch_tokens + 1, patch_dim)) unfold_args = default(unfold_args, (pixel_size, pixel_size, 0)) unfold_args = (*unfold_args, 0) if len(unfold_args) == 2 else unfold_args kernel_size, stride, padding = unfold_args pixel_width = unfold_output_size(patch_size, kernel_size, stride, padding) num_pixels = pixel_width ** 2 self.to_pixel_tokens = nn.Sequential( Rearrange('b c (h p1) (w p2) -> (b h w) c p1 p2', p1 = patch_size, p2 = patch_size), nn.Unfold(kernel_size = kernel_size, stride = stride, padding = padding), Rearrange('... c n -> ... n c'), nn.Linear(channels * kernel_size ** 2, pixel_dim) ) self.patch_pos_emb = nn.Parameter(torch.randn(num_patch_tokens + 1, patch_dim)) self.pixel_pos_emb = nn.Parameter(torch.randn(num_pixels, pixel_dim)) layers = nn.ModuleList([]) for _ in range(depth): pixel_to_patch = nn.Sequential( nn.LayerNorm(pixel_dim), Rearrange('... n d -> ... (n d)'), nn.Linear(pixel_dim * num_pixels, patch_dim), ) layers.append(nn.ModuleList([ PreNorm(pixel_dim, Attention(dim = pixel_dim, heads = heads, dim_head = dim_head, dropout = attn_dropout)), PreNorm(pixel_dim, FeedForward(dim = pixel_dim, dropout = ff_dropout)), pixel_to_patch, PreNorm(patch_dim, Attention(dim = patch_dim, heads = heads, dim_head = dim_head, dropout = attn_dropout)), PreNorm(patch_dim, FeedForward(dim = patch_dim, dropout = ff_dropout)), ])) self.layers = layers self.mlp_head = nn.Sequential( nn.LayerNorm(patch_dim), nn.Linear(patch_dim, num_classes) ) def forward(self, x): b, _, h, w, patch_size, image_size = *x.shape, self.patch_size, self.image_size assert divisible_by(h, patch_size) and divisible_by(w, patch_size), f'height {h} and width {w} of input must be divisible by the patch size' num_patches_h = h // patch_size num_patches_w = w // patch_size n = num_patches_w * num_patches_h pixels = self.to_pixel_tokens(x) patches = repeat(self.patch_tokens[:(n + 1)], 'n d -> b n d', b = b) patches += rearrange(self.patch_pos_emb[:(n + 1)], 'n d -> () n d') pixels += rearrange(self.pixel_pos_emb, 'n d -> () n d') for pixel_attn, pixel_ff, pixel_to_patch_residual, patch_attn, patch_ff in self.layers: pixels = pixel_attn(pixels) + pixels pixels = pixel_ff(pixels) + pixels patches_residual = pixel_to_patch_residual(pixels) patches_residual = rearrange(patches_residual, '(b h w) d -> b (h w) d', h = num_patches_h, w = num_patches_w) patches_residual = F.pad(patches_residual, (0, 0, 1, 0), value = 0) # cls token gets residual of 0 patches = patches + patches_residual patches = patch_attn(patches) + patches patches = patch_ff(patches) + patches cls_token = patches[:, 0] return self.mlp_head(cls_token)
transformer-in-transformer-main
transformer_in_transformer/tnt.py
from setuptools import setup, find_packages setup( name = 'learning-to-expire-pytorch', packages = find_packages(exclude=['examples']), version = '0.0.2', license='MIT', description = 'Learning to Expire - Pytorch', author = 'Phil Wang', author_email = 'lucidrains@gmail.com', url = 'https://github.com/lucidrains/learning-to-expire-pytorch', keywords = [ 'artificial intelligence', 'attention mechanism', 'transformers', 'memory' ], install_requires=[ 'torch>=1.6', 'einops>=0.3' ], classifiers=[ 'Development Status :: 4 - Beta', 'Intended Audience :: Developers', 'Topic :: Scientific/Engineering :: Artificial Intelligence', 'License :: OSI Approved :: MIT License', 'Programming Language :: Python :: 3.6', ], )
learning-to-expire-pytorch-main
setup.py
from learning_to_expire_pytorch.learning_to_expire_pytorch import ExpireSpanTransformerXL
learning-to-expire-pytorch-main
learning_to_expire_pytorch/__init__.py
import torch from torch import nn, einsum import torch.nn.functional as F from einops import rearrange, repeat from collections import namedtuple # constants Memory = namedtuple('Memory', ['mems', 'elapsed_times']) # helpers def exists(val): return val is not None def default(val, d): return val if exists(val) else d def safe_cat(tensors, dim = -1): tensors = list(filter(exists, tensors)) if len(tensors) == 1: return tensors[0] return torch.cat(tensors, dim = dim) def safe_add(tensor, n): if not exists(tensor): return None return tensor + n # positional embedding def rel_shift(t): b, h, i, j, device, dtype = *t.shape, t.device, t.dtype zero_pad = torch.zeros((b, h, i, 1), device = device, dtype = dtype) concatted = torch.cat([zero_pad, t], dim = -1) shifted = concatted.view(b, h, j + 1, i)[:, :, 1:] return shifted.view_as(t) class SinusoidalEmbedding(nn.Module): def __init__(self, dim): super().__init__() inv_freq = 1. / (10000 ** (torch.arange(0, dim, 2).float() / dim)) self.register_buffer('inv_freq', inv_freq) def forward(self, x): n, device = x.shape[1], x.device t = torch.arange(n - 1, -1, -1, device = device).type_as(self.inv_freq) sinusoid_inp = einsum('i , j -> i j', t, self.inv_freq) emb = torch.cat((sinusoid_inp.sin(), sinusoid_inp.cos()), dim = -1) return emb # expire span logic class ExpireSpan(nn.Module): def __init__(self, dim, max_mem_len, ramp_length): super().__init__() self.max_mem_len = max_mem_len self.ramp_length = ramp_length self.to_expiration = nn.Linear(dim, 1) nn.init.constant_(self.to_expiration.bias.data, val = -self.max_mem_len) def forward(self, mem, time, seq_len): exps = self.to_expiration(mem).squeeze(-1).sigmoid() * self.max_mem_len exps = rearrange(exps, 'b j -> b () () j') t = rearrange(time, 'b j -> b () () j') r = F.pad(exps - t, (0, seq_len), value = 1.) mask = torch.clamp((r / self.ramp_length) + 1, min = 0., max = 1.) return exps, mask # classes class PreNorm(nn.Module): def __init__(self, dim, fn): super().__init__() self.norm = nn.LayerNorm(dim) self.fn = fn def forward(self, x, **kwargs): x = self.norm(x) return self.fn(x, **kwargs) class FeedForward(nn.Module): def __init__(self, dim, mult = 4): super().__init__() self.net = nn.Sequential( nn.Linear(dim, dim * mult), nn.GELU(), nn.Linear(dim * mult, dim) ) def forward(self, x): return self.net(x) class CausalAttention(nn.Module): def __init__(self, dim, heads = 8): super().__init__() dim_head = dim // heads self.heads = heads self.scale = dim_head ** -0.5 self.to_pos = nn.Linear(dim, dim_head) self.to_q = nn.Linear(dim, dim) self.to_kv = nn.Linear(dim, dim * 2) self.to_out = nn.Linear(dim, dim) def forward(self, x, pos_emb, mem = None, expire_mask = None): n, h, scale, device = x.shape[1], self.heads, self.scale, x.device q = self.to_q(x) mem_len = mem.shape[1] if exists(mem) else 0 context = safe_cat((mem, x), dim = 1) kv = self.to_kv(context).chunk(2, dim = -1) q, k, v = map(lambda t: rearrange(t, 'b n (h d) -> b h n d', h = h), (q, *kv)) dots = einsum('b h i d, b h j d -> b h i j', q, k) * scale # calculate relative positional contribution pos = self.to_pos(pos_emb) pos_dots = einsum('b h i d, j d -> b h i j', q, pos) * scale pos_dots = rel_shift(pos_dots) pos_dots = F.pad(pos_dots, (mem_len, 0), value = 0) dots += pos_dots # causal mask mask = torch.ones(dots.shape[-2:], device = device).triu_(mem_len + 1).bool() mask = rearrange(mask, 'i j -> () () i j') dots.masked_fill_(mask, float('-inf')) del mask # attention attn = dots.softmax(dim = -1) if exists(expire_mask): attn = attn * expire_mask out = einsum('b h i j, b h j d -> b h i d', attn, v) out = rearrange(out, 'b h n d -> b n (h d)') return self.to_out(out) class ExpireSpanTransformerXL(nn.Module): def __init__( self, *, num_tokens, dim, depth, seq_len, heads = 8, num_memory_blocks = 10, expire_loss_coef = 1e-6, ramp_length = 128): super().__init__() self.token_emb = nn.Embedding(num_tokens, dim) self.sinusoidal_emb = SinusoidalEmbedding(dim) self.dim = dim self.depth = depth self.seq_len = seq_len self.max_mem_len = num_memory_blocks * seq_len self.expire_loss_coef = expire_loss_coef self.layers = nn.ModuleList([]) for _ in range(depth): self.layers.append(nn.ModuleList([ ExpireSpan(dim, self.max_mem_len, ramp_length), PreNorm(dim, CausalAttention(dim, heads = heads)), PreNorm(dim, FeedForward(dim)), ])) self.to_logits = nn.Linear(dim, num_tokens) def forward(self, x, memory = None): b, n, d, device = *x.shape, self.dim, x.device x = self.token_emb(x) pos_emb = self.sinusoidal_emb(x) hidden_states = [] expire_masks_layers = [] mems_layers = memory.mems if exists(memory) else ((None,) * self.depth) times_layers = memory.elapsed_times if exists(memory) else ((None,) * self.depth) aux_loss = torch.tensor(0., requires_grad = True) for (mem, time, (expire_span, attn, ff)) in zip(mems_layers, times_layers, self.layers): hidden_states.append(x) exps, expire_mask = expire_span(mem, time, seq_len = n) if exists(mem) else (None, None) expire_masks_layers.append(expire_mask) if self.training and exists(time): forget_time_thres = torch.randint(0, self.max_mem_len, (b, 1), device = device) forget_dropout_mask = (time < forget_time_thres).float() forget_dropout_mask = rearrange(forget_dropout_mask, 'b n -> b () () n') forget_dropout_mask = F.pad(forget_dropout_mask, (0, n), value = 1.) expire_mask *= forget_dropout_mask x = attn(x, pos_emb = pos_emb, mem = mem, expire_mask = expire_mask) + x x = ff(x) + x if exists(exps): # unsure if this is implemented correctly # paper seems to suggest only adding l1 auxiliary loss for expirations that yield a soft masking value on the ramp (between 0 or 1) expiring_exps_mask = (expire_mask > 0) & (expire_mask < 1.) expiring_exps = exps.masked_select(expiring_exps_mask[..., :-n]) aux_loss = aux_loss + (expiring_exps / self.seq_len).sum() * self.expire_loss_coef logits = self.to_logits(x) if self.seq_len == n: if exists(expire_mask): mems_layers_new = [] times_layers_new = [] for mems, times, expire_mask in zip(mems_layers, times_layers, expire_masks_layers): expire_mask = rearrange(expire_mask, 'b () () i -> b i') # discard expired memories expired_exps_mask = (expire_mask <= 0)[..., :-n] # it is not possible to expire different amounts of memories across batches # for now, will just expire the minimum of the expired memories across batches num_to_expire = min(expired_exps_mask.sum(dim = -1)) _, indices = expired_exps_mask.float().topk(k = num_to_expire, dim = -1) even_expired_exps_mask = torch.zeros_like(expired_exps_mask, device = device).scatter(-1, indices, 1.).bool() mems = mems.masked_select(~even_expired_exps_mask.unsqueeze(-1)) mems = mems.reshape(b, -1, d) mems_layers_new.append(mems) times = times.masked_select(~even_expired_exps_mask) times = times.reshape(b, -1) times_layers_new.append(times) mems_layers = mems_layers_new times_layers = times_layers_new new_memories = map(lambda t: safe_cat(t, dim = 1), list(zip(mems_layers, hidden_states))) new_memories = map(lambda t: t[:, -self.max_mem_len:].detach(), new_memories) new_times = torch.arange(n - 1, -1, -1, device = device) new_times = repeat(new_times, 'n -> b n', b = b) new_elapsed_times = map(lambda t: safe_cat((safe_add(t, n), new_times), dim = 1), times_layers) new_elapsed_times = map(lambda t: t[-self.max_mem_len:], new_elapsed_times) memory = Memory(list(new_memories), list(new_elapsed_times)) return logits, memory, aux_loss
learning-to-expire-pytorch-main
learning_to_expire_pytorch/learning_to_expire_pytorch.py
from setuptools import setup, find_packages setup( name = 'simple-hierarchical-transformer', packages = find_packages(exclude=[]), version = '0.1.2', license='MIT', description = 'Simple Hierarchical Transformer', author = 'Phil Wang', author_email = 'lucidrains@gmail.com', long_description_content_type = 'text/markdown', url = 'https://github.com/lucidrains/simple-hierarchical-transformer', keywords = [ 'artificial intelligence', 'deep learning', 'transformers', 'attention mechanism', 'hierarchical' ], install_requires=[ 'accelerate', 'einops>=0.4', 'local-attention', 'torch>=1.6', 'vector-quantize-pytorch>=1.1.5' ], classifiers=[ 'Development Status :: 4 - Beta', 'Intended Audience :: Developers', 'Topic :: Scientific/Engineering :: Artificial Intelligence', 'License :: OSI Approved :: MIT License', 'Programming Language :: Python :: 3.6', ], )
simple-hierarchical-transformer-main
setup.py
import gzip import random import tqdm import numpy as np import torch from torch.optim import Adam from torch.nn import functional as F from torch.utils.data import DataLoader, Dataset from simple_hierarchical_transformer import HierarchicalTransformer from accelerate import Accelerator # hf accelerator accelerator = Accelerator() device = accelerator.device acc_print = accelerator.print # constants NUM_BATCHES = int(1e5) BATCH_SIZE = 2 GRADIENT_ACCUMULATE_EVERY = 8 LEARNING_RATE = 1e-4 VALIDATE_EVERY = 100 PRIME_LENGTH = 128 GENERATE_EVERY = 500 SEQ_LEN = 2048 GENERATE_LENGTH = 1024 # helpers def cycle(loader): while True: for data in loader: yield data def decode_token(token): return str(chr(max(32, token))) def decode_tokens(tokens): return "".join(list(map(decode_token, tokens))) # instantiate transformer model = HierarchicalTransformer( num_tokens = 256, dim = 1024, depth = 8, seq_len = SEQ_LEN, hierarchies = (1, 2), window_sizes = (32, 64), use_flash_attn = True ).to(device) # prepare enwik8 data with gzip.open("./data/enwik8.gz") as file: data = np.frombuffer(file.read(int(95e6)), dtype=np.uint8).copy() np_train, np_valid = np.split(data, [int(90e6)]) data_train, data_val = torch.from_numpy(np_train), torch.from_numpy(np_valid) class TextSamplerDataset(Dataset): def __init__(self, data, seq_len): super().__init__() self.data = data self.seq_len = seq_len def __getitem__(self, index): rand_start = torch.randint(0, self.data.size(0) - self.seq_len, (1,)) full_seq = self.data[rand_start : rand_start + self.seq_len + 1].long() return full_seq.to(device) def __len__(self): return self.data.size(0) // self.seq_len train_dataset = TextSamplerDataset(data_train, SEQ_LEN) val_dataset = TextSamplerDataset(data_val, SEQ_LEN) train_loader = cycle(DataLoader(train_dataset, batch_size=BATCH_SIZE)) val_loader = cycle(DataLoader(val_dataset, batch_size=BATCH_SIZE)) # optimizer optim = Adam(model.parameters(), lr = LEARNING_RATE) model, optim, train_loader, val_loader = accelerator.prepare( model, optim, train_loader, val_loader ) # training for i in tqdm.tqdm(range(NUM_BATCHES), mininterval = 10.0, desc = "training"): model.train() for _ in range(GRADIENT_ACCUMULATE_EVERY): loss, (ce_loss, recon_loss, prophet_loss) = model(next(train_loader), return_loss = True) accelerator.backward(loss / GRADIENT_ACCUMULATE_EVERY) acc_print(f"training loss: {ce_loss.item()}") accelerator.clip_grad_norm_(model.parameters(), 0.5) optim.step() optim.zero_grad() if i % VALIDATE_EVERY == 0: model.eval() with torch.no_grad(): _, (ce_loss, *_) = model(next(val_loader), return_loss = True) acc_print(f"validation loss: {ce_loss.item()}") if i % GENERATE_EVERY == 0: model.eval() inp = random.choice(val_dataset)[:PRIME_LENGTH] prime = decode_tokens(inp) acc_print(f"%s \n\n %s", (prime, "*" * 100)) sample = model.generate(inp[None, ...], GENERATE_LENGTH) output_str = decode_tokens(sample[0]) acc_print(output_str, "\n")
simple-hierarchical-transformer-main
train.py
import torch from torch import nn, einsum import torch.nn.functional as F from collections import namedtuple from functools import wraps from packaging import version from einops import rearrange # constants Config = namedtuple('EfficientAttentionConfig', ['enable_flash', 'enable_math', 'enable_mem_efficient']) # helpers def exists(val): return val is not None def once(fn): called = False @wraps(fn) def inner(x): nonlocal called if called: return called = True return fn(x) return inner print_once = once(print) # main class class Attend(nn.Module): def __init__( self, causal = False, use_flash_attn = False ): super().__init__() self.causal = causal self.register_buffer("mask", None, persistent=False) self.use_flash_attn = use_flash_attn assert not (use_flash_attn and version.parse(torch.__version__) < version.parse('2.0.0')), 'in order to use flash attention, you must be using pytorch 2.0 or above' # determine efficient attention configs for cuda and cpu self.cpu_config = Config(True, True, True) self.cuda_config = None if not torch.cuda.is_available() or not use_flash_attn: return device_properties = torch.cuda.get_device_properties(torch.device('cuda')) if device_properties.major == 8 and device_properties.minor == 0: print_once('A100 GPU detected, using flash attention if input tensor is on cuda') self.cuda_config = Config(True, False, False) else: print_once('Non-A100 GPU detected, using math or mem efficient attention if input tensor is on cuda') self.cuda_config = Config(False, True, True) def get_mask(self, n, device): if exists(self.mask) and self.mask.shape[-1] >= n: return self.mask[:n, :n] mask = torch.ones((n, n), device=device, dtype=torch.bool).triu(1) self.register_buffer("mask", mask, persistent=False) return mask def flash_attn(self, q, k, v, mask = None): _, heads, q_len, _, k_len, is_cuda = *q.shape, k.shape[-2], q.is_cuda # Check if mask exists and expand to compatible shape # The mask is B L, so it would have to be expanded to B H N L if exists(mask): mask = rearrange(mask, 'b j -> b 1 1 j') mask = mask.expand(-1, heads, q_len, -1) # Check if there is a compatible device for flash attention config = self.cuda_config if is_cuda else self.cpu_config # pytorch 2.0 flash attn: q, k, v, mask, causal, softmax_scale with torch.backends.cuda.sdp_kernel(**config._asdict()): out = F.scaled_dot_product_attention( q, k, v, attn_mask = mask, is_causal = self.causal ) return out def forward(self, q, k, v, mask = None): """ einstein notation b - batch h - heads n, i, j - sequence length (base sequence length, source, target) d - feature dimension """ n, device = q.shape[-2], q.device scale = q.shape[-1] ** -0.5 if self.use_flash_attn: return self.flash_attn(q, k, v, mask = mask) # similarity sim = einsum("b h i d, b h j d -> b h i j", q, k) * scale # key padding mask if exists(mask): mask = rearrange(mask, 'b j -> b 1 1 j') sim = sim.masked_fill(~mask, -torch.finfo(sim.dtype).max) # causal mask if self.causal: causal_mask = self.get_mask(n, device) sim = sim.masked_fill(causal_mask, -torch.finfo(sim.dtype).max) # attention attn = sim.softmax(dim=-1) # aggregate values out = einsum("b h i j, b h j d -> b h i d", attn, v) return out
simple-hierarchical-transformer-main
simple_hierarchical_transformer/attention.py
import math from functools import partial from itertools import zip_longest import torch import torch.nn.functional as F from torch import nn, einsum from einops import rearrange, repeat from einops.layers.torch import Rearrange from simple_hierarchical_transformer.attention import Attend from typing import Tuple from local_attention import LocalMHA from vector_quantize_pytorch import RandomProjectionQuantizer # constants mlist = nn.ModuleList Linear = partial(nn.Linear, bias = False) LocalMHA = partial(LocalMHA, causal = True, prenorm = True) # helper functions def exists(val): return val is not None def is_power_of_two(n): return math.log2(n).is_integer() def all_unique(arr): return len(set(arr)) == len(arr) def apply_fns(fns, tensors): return [fn(tensor) for fn, tensor in zip(fns, tensors)] def cast_tuple(t, length = 1): return t if isinstance(t, tuple) else ((t,) * length) def default(*vals): for val in vals: if exists(val): return val return None def eval_decorator(fn): def inner(model, *args, **kwargs): was_training = model.training model.eval() out = fn(model, *args, **kwargs) model.train(was_training) return out return inner # sampling helpers def log(t, eps = 1e-20): return t.clamp(min = eps).log() def gumbel_noise(t): noise = torch.zeros_like(t).uniform_(0, 1) return -log(-log(noise)) def gumbel_sample(t, temperature = 1., dim = -1): return ((t / max(temperature, 1e-10)) + gumbel_noise(t)).argmax(dim = dim) def top_k(logits, thres = 0.9): k = int((1 - thres) * logits.shape[-1]) val, ind = torch.topk(logits, k) probs = torch.full_like(logits, -torch.finfo(logits.dtype).max) probs.scatter_(1, ind, val) return probs # rotary positional embedding w/ xpos # https://arxiv.org/abs/2104.09864 # https://arxiv.org/abs/2212.10554v1 class RotaryEmbedding(nn.Module): def __init__( self, dim, scale_base = 512, use_xpos = True ): super().__init__() inv_freq = 1.0 / (10000 ** (torch.arange(0, dim, 2).float() / dim)) self.register_buffer("inv_freq", inv_freq) self.use_xpos = use_xpos self.scale_base = scale_base scale = (torch.arange(0, dim, 2) + 0.4 * dim) / (1.4 * dim) self.register_buffer('scale', scale) @property def device(self): return next(self.buffers()).device def forward(self, seq_len): device = self.device t = torch.arange(seq_len, device = device).type_as(self.inv_freq) freqs = torch.einsum('i , j -> i j', t, self.inv_freq) freqs = torch.cat((freqs, freqs), dim = -1) if not self.use_xpos: return freqs, torch.ones(1, device = device) power = (t - (seq_len // 2)) / self.scale_base scale = self.scale ** rearrange(power, 'n -> n 1') scale = torch.cat((scale, scale), dim = -1) return freqs, scale def rotate_half(x): x1, x2 = x.chunk(2, dim=-1) return torch.cat((-x2, x1), dim=-1) def apply_rotary_pos_emb(pos, t, scale = 1.): seq_len = t.shape[-2] pos = pos[..., -seq_len:, :] if not isinstance(scale, (int, float)): scale = scale[..., -seq_len:, :] return (t * pos.cos() * scale) + (rotate_half(t) * pos.sin() * scale) def apply_rotary_pos_emb_qk(rotary_emb, q, k): freqs, scale = rotary_emb q = apply_rotary_pos_emb(freqs, q, scale) k = apply_rotary_pos_emb(freqs, k, scale ** -1) return q, k # token shift, from Peng et al of RWKV def token_shift(t): t, t_shift = t.chunk(2, dim = -1) t_shift = F.pad(t_shift, (0, 0, 1, -1)) return torch.cat((t, t_shift), dim = -1) # hierarchy related classes def pad_seq_to_multiple(t, mult): seq_len = t.shape[-2] next_seq_len_mult = math.ceil(seq_len / mult) * mult remainder = next_seq_len_mult - seq_len if remainder == 0: return t, seq_len t = F.pad(t, (0, 0, 0, remainder), value = 0.) return t, seq_len def curtail_seq_to_multiple(t, mult): seq_len = t.shape[-2] prev_seq_len_mult = (seq_len // mult) * mult remainder = seq_len - prev_seq_len_mult if remainder == 0: return t t = t[..., :prev_seq_len_mult, :] return t def hierarchical_cat(tokens, strides: Tuple[int, ...]): assert len(tokens) == len(strides) if all([s == 1 for s in strides]): return torch.cat(tokens, dim = -1) tokens = [repeat(t, 'b n d -> b (n s) d', s = s) for t, s in zip(tokens, strides)] min_seq_len = min([t.shape[-2] for t in tokens]) tokens = [t[..., :min_seq_len, :] for t in tokens] return torch.cat(tokens, dim = -1) class CausalConv(nn.Module): def __init__( self, dim_in, dim_out, kernel_size, stride = 1 ): super().__init__() self.causal_padding = kernel_size - 1 self.conv = nn.Conv1d(dim_in, dim_out, kernel_size, stride = stride) def forward(self, x): x = F.pad(x, (self.causal_padding, 0)) return self.conv(x) class Compress(nn.Module): def __init__( self, *, dim, dim_out, num_tokens = None, stride = 1, compress_factor = 1, expansion_factor = 4, dim_head = 64, heads = 8, ignore_index = 0, should_recon = False, should_prophet = False, prophet_num_predictions = None ): super().__init__() assert compress_factor > 0 and is_power_of_two(compress_factor) self.stride = stride self.no_compress = compress_factor == 1 self.compress_factor = compress_factor self.should_recon = should_recon self.should_prophet = should_prophet if self.no_compress: self.compress_fn = Linear(dim, dim_out) if dim != dim_out else nn.Identity() return dim_inner = int(dim * expansion_factor) self.compress_fn = nn.Sequential( Rearrange('b n d -> b d n'), CausalConv(dim, dim_inner, compress_factor, stride = stride), nn.SiLU(), nn.Conv1d(dim_inner, dim_out, 1), Rearrange('b d n -> b n d') ) if should_recon: assert exists(num_tokens) self.to_recon = Linear(dim_out, compress_factor * num_tokens) if should_prophet: assert exists(prophet_num_predictions) self.to_prophet = Linear(dim_out, prophet_num_predictions) self.ignore_index = ignore_index def prophet(self, h, ids): if not self.should_prophet: return torch.zeros((), device = h.device).requires_grad_() c = self.compress_factor seq_len = ids.shape[-1] prophet_logits = self.to_prophet(h) prophet_logits = rearrange(prophet_logits, 'b n (c d) -> (b c) d n', c = c) prophet_ids = F.pad(ids, (-1, c), value = self.ignore_index) prophet_ids = tuple(prophet_ids[:, i:(seq_len + i)] for i in range(c)) prophet_ids = torch.stack(prophet_ids, dim = 1) prophet_ids = rearrange(prophet_ids, 'b c n -> (b c) n') if self.stride > 1: prophet_ids = prophet_ids[..., ::self.stride] prophet_loss = F.cross_entropy(prophet_logits, prophet_ids, ignore_index = self.ignore_index) return prophet_loss def recon(self, h, ids): assert self.should_recon if self.no_compress: return torch.zeros((), device = h.device).requires_grad_() c = self.compress_factor seq_len = ids.shape[-1] recon_logits = self.to_recon(h) recon_logits = rearrange(recon_logits, 'b n (c d) -> (b c) d n', c = c) recon_ids = F.pad(ids, (c - 1, 0), value = self.ignore_index) recon_ids = tuple(recon_ids[:, i:(seq_len + i)] for i in range(c)) recon_ids = torch.stack(recon_ids, dim = 1) recon_ids = rearrange(recon_ids, 'b c n -> (b c) n') if self.stride > 1: recon_ids = recon_ids[..., ::self.stride] recon_loss = F.cross_entropy(recon_logits, recon_ids, ignore_index = self.ignore_index) return recon_loss def forward(self, x): return self.compress_fn(x) class HierarchicalMerge(nn.Module): def __init__( self, dims: Tuple[int, ...], dim_out, h_strides = 1 ): super().__init__() dim = sum(dims) strides = cast_tuple(h_strides, len(dims)) assert len(strides) == len(dims) self.strides = strides self.net = nn.Sequential( RMSNorm(dim), nn.Linear(dim, dim_out * 2), nn.SiLU(), nn.Linear(dim_out * 2, dim_out) ) def forward(self, tokens): x = hierarchical_cat(tokens, self.strides) return self.net(x) # classes class RMSNorm(nn.Module): def __init__(self, dim): super().__init__() self.scale = dim ** 0.5 self.gamma = nn.Parameter(torch.ones(dim)) def forward(self, x): return F.normalize(x, dim = -1) * self.scale * self.gamma class FeedForward(nn.Module): def __init__(self, dim, mult = 4): super().__init__() dim_inner = int(dim * mult) self.net = nn.Sequential( RMSNorm(dim), Linear(dim, dim_inner), nn.GELU(), Linear(dim_inner, dim) ) def forward(self, x): return self.net(x) class Attention(nn.Module): def __init__( self, dim, dim_head = 64, heads = 8, use_flash_attn = False ): super().__init__() self.scale = dim_head ** -0.5 self.heads = heads dim_inner = dim_head * heads self.norm = RMSNorm(dim) self.rotary_emb = RotaryEmbedding(dim_head) self.attend = Attend(causal = True, use_flash_attn = use_flash_attn) self.to_qkv = Linear(dim, dim_inner * 3) self.to_out = Linear(dim_inner, dim) def forward(self, x): n = x.shape[-2] x = self.norm(x) q, k, v = self.to_qkv(x).chunk(3, dim = -1) q, k, v = map(lambda t: rearrange(t, 'b n (h d) -> b h n d', h = self.heads), (q, k, v)) rotary_emb = self.rotary_emb(n) q, k = apply_rotary_pos_emb_qk(rotary_emb, q, k) out = self.attend(q, k, v) out = rearrange(out, 'b h n d -> b n (h d)') return self.to_out(out) class HierarchicalBlock(nn.Module): def __init__( self, dim, dim_head = 64, heads = 8, window_size = None, compress_factor = 1, stride = 1, ff_mult = 4 ): super().__init__() self.stride = stride assert is_power_of_two(compress_factor) self.compress_factor = compress_factor self.no_compress = compress_factor == 1 assert not exists(window_size) or window_size >= 0 self.has_attn = window_size != 0 self.attn = None if self.has_attn: attn_klass = Attention if exists(window_size): attn_klass = partial(LocalMHA, window_size = window_size) self.attn = attn_klass(dim = dim, dim_head = dim_head, heads = heads) self.ff = FeedForward(dim = dim, mult = ff_mult) def forward(self, x): c = self.compress_factor axial_dim = c // self.stride x, orig_seq_len = pad_seq_to_multiple(x, axial_dim) # hierarchical attention is performed with a simple axial attention # this, and using a convolution for compressing at the beginning # is one of the improvements on top of hourglass transformer # the downside is that the savings are only O(c) instead of O(c ** 2) as in hourglass transformer # you can get the O(c ** 2) saving by setting the hierarchical stride == c, but you'll see that performance is much worse, as some tokens will have a c - 1 token gap to the last hierarchical token if not self.no_compress: x = rearrange(x, 'b (n c) d -> (b c) n d', c = axial_dim) if exists(self.attn): x = self.attn(token_shift(x)) + x x = self.ff(token_shift(x)) + x if not self.no_compress: x = rearrange(x, '(b c) n d -> b (n c) d', c = axial_dim) return x[:, :orig_seq_len] class HierarchicalTransformer(nn.Module): def __init__( self, *, num_tokens, dim, depth, seq_len = 2048, dim_head = 64, heads = 8, ff_mult = 4, hierarchies = 1, window_sizes = None, hierarchical_stride = 1, hierarchy_merge_all = False, # whether to pass the pooled hierarchical information back to all hierarchies or just one doing the prediction ignore_index = 0, use_flash_attn = False, recon_loss_weight = 0.1, prophet_loss_weight = 0., prophet_loss_use_quantized = False, # for prophet, whether to use the next 1x token ids, or use the ids from random projection quantization prophet_quantized_use_embed = False, predict_hierarchy = None, predict_use_all_hierarchy = False, rq_num_codebooks = 4, rq_codebook_dim = 256, rq_codebook_size = 1024, ): super().__init__() self.seq_len = seq_len hierarchies = cast_tuple(hierarchies) assert all_unique(hierarchies), 'hierarchies compression factors must be all unique integers' assert all([*map(is_power_of_two, hierarchies)]), 'only powers of two allowed for hierarchies' self.hierarchies = hierarchies # just use a simple tuple list per hyperparameter to customize each hierarchy num_hierarchies = len(hierarchies) dims = cast_tuple(dim, num_hierarchies) assert len(dims) == num_hierarchies window_sizes = cast_tuple(window_sizes, num_hierarchies) assert len(window_sizes) == num_hierarchies dim_head = cast_tuple(dim_head, num_hierarchies) assert len(dim_head) == num_hierarchies heads = cast_tuple(heads, num_hierarchies) assert len(heads) == num_hierarchies ff_mult = cast_tuple(ff_mult, num_hierarchies) assert len(ff_mult) == num_hierarchies hierarchical_stride = cast_tuple(hierarchical_stride, num_hierarchies) assert all([*map(is_power_of_two, hierarchical_stride)]), 'all hierarchical strides must be power of two' assert all([s <= h for s, h in zip(hierarchical_stride, hierarchies)]), 'all strides must be less than the compression factor of the hierarchy' self.h_strides = hierarchical_stride assert len(hierarchical_stride) == num_hierarchies # this determines to which hierarchy is everything pooled into for final prediction # however, final next token prediction can also use all hierarchies with `predict_use_all_hierarchy` predict_hierarchy = default(predict_hierarchy, min(hierarchies)) self.predict_hierarchy_index = hierarchies.index(predict_hierarchy) hierarchy_predict_dim = dims[self.predict_hierarchy_index] self.hierarchy_merge_all = hierarchy_merge_all assert hierarchy_merge_all or self.h_strides[self.predict_hierarchy_index] == 1, 'the hierarchy level being used for final next token prediction must have compression stride of 1' # training related loss weights self.recon_loss_weight = recon_loss_weight self.prophet_loss_weight = prophet_loss_weight should_recon = recon_loss_weight > 0 should_prophet = prophet_loss_weight > 0 self.should_recon = should_recon self.should_prophet = should_prophet self.prophet_loss_use_quantized = prophet_loss_use_quantized self.prophet_quantized_use_embed = prophet_quantized_use_embed # token embedding dim_token_emb = max(dims) self.token_emb = nn.Embedding(num_tokens, dim_token_emb) # hierarchy compressions - 1x just uses the base token_emb weights self.compressors = mlist([]) for dim, hierarchy, stride in zip(dims, hierarchies, hierarchical_stride): self.compressors.append(Compress( dim = dim_token_emb, dim_out = dim, num_tokens = num_tokens, compress_factor = hierarchy, stride = stride, should_recon = should_recon, should_prophet = should_prophet, prophet_num_predictions = ((hierarchy * num_tokens) if not prophet_loss_use_quantized else (rq_num_codebooks * rq_codebook_size)) )) # post token embedding norms self.post_token_emb_norms = mlist([nn.LayerNorm(dim) for dim in dims]) # layers self.layers = mlist([]) self.dims = dims self.hierarchical_merges = mlist([]) self.need_hierarchical_merge = num_hierarchies > 1 for _ in range(depth): hierarchical_layer = mlist([]) # add a transformer block for each layer in the hierarchy for hierarchy, h_stride, h_dim, h_window_size, h_dim_head, h_heads, h_ff_mult in zip(hierarchies, hierarchical_stride, dims, window_sizes, dim_head, heads, ff_mult): # make sure the window size never exceeds the effective sequence length effective_seq_len = seq_len // hierarchy if exists(h_window_size) and h_window_size > effective_seq_len: print(f'window size for hierarchy {hierarchy}x is greater than effective sequence length - setting window size to None (which would use normal full attention)') h_window_size = None # add attention and feedforward hierarchical_layer.append( HierarchicalBlock( dim = h_dim, dim_head = h_dim_head, heads = h_heads, window_size = h_window_size, compress_factor = hierarchy, stride = h_stride, ff_mult = h_ff_mult ) ) self.layers.append(hierarchical_layer) # for merging the information across hierarchies # for now, only one direction, from all hierarchies to the hierarchy that is being used to make predictions on, set by predict_hierarchy_index above if not self.need_hierarchical_merge: continue merge = HierarchicalMerge( dims = dims, dim_out = hierarchy_predict_dim if not self.hierarchy_merge_all else sum(dims), h_strides = hierarchical_stride ) self.hierarchical_merges.append(merge) # final post-transformer norms, for all hierarchies self.norms = mlist([nn.LayerNorm(dim) for dim in dims]) # random projection quantizer, for another approach to hierarchical predictive coding if self.prophet_loss_use_quantized: rpq_klass = partial( RandomProjectionQuantizer, num_codebooks = rq_num_codebooks, codebook_dim = rq_codebook_dim, codebook_size = rq_codebook_size ) self.rand_proj_quantizers = mlist([rpq_klass(dim = dim) for dim in dims]) self.rq_num_codebooks = rq_num_codebooks # to logit, for hierarchy set at predict_hierarchy_index, or all hierarchies self.predict_use_all_hierarchy = predict_use_all_hierarchy logit_dim_in = sum(dims) if predict_use_all_hierarchy else hierarchy_predict_dim self.to_logits = Linear(logit_dim_in, num_tokens) # training related loss parameters self.ignore_index = ignore_index @torch.no_grad() @eval_decorator def generate( self, prompt, seq_len, temperature = 1.0, filter_thres = 0.9, **kwargs ): b, t, device = *prompt.shape, prompt.device out = prompt for _ in range(seq_len): logits = self.forward(out[:, -self.seq_len:], **kwargs)[:, -1] filtered_logits = top_k(logits, thres = filter_thres) sample = gumbel_sample(filtered_logits, temperature = temperature) sample = rearrange(sample, 'b -> b 1') out = torch.cat((out, sample), dim = -1) return out[:, t:] @property def device(self): return next(self.parameters()).device def forward( self, ids, return_loss = False, return_hierarchical_token_embeds = False, return_hierarchical_embeds = False, ablate_hierarchical_merge = False, return_random_proj_quantize_ids = False ): """ einops notation: b - batch n - sequence length c - compression factor d - dimension """ # if training, predict next token in sequence if return_loss: ids, labels = ids[:, :-1], ids[:, 1:] # assert seq len assert ids.shape[-1] <= self.seq_len # get token embeddings, and pad to multiple of compression factor x = self.token_emb(ids) # for every hierarchy, compress token embeddings appropriately to the hierarchical embeddings tokens = [] for compress in self.compressors: tokens.append(compress(x)) # save hierarchical tokens right before norm for random projection quantization, if needed post_compressed_tokens = tokens # post embedding norms tokens = apply_fns(self.post_token_emb_norms, tokens) # if one wants all the compressed token embeds # just to investigate the space if return_hierarchical_token_embeds: return tokens # layers for layer, merge in zip_longest(self.layers, self.hierarchical_merges): tokens = apply_fns(layer, tokens) # pool the information all hierarchies # and then update the tokens that will be used to make the final autoregressive prediction if not self.need_hierarchical_merge or ablate_hierarchical_merge: continue pooled = merge(tokens) if self.hierarchy_merge_all: tokens = [(t + p[..., ::s, :]) for t, p, s in zip(tokens, pooled.split(self.dims, dim = -1), self.h_strides)] else: predict_tokens = tokens[self.predict_hierarchy_index] predict_tokens = predict_tokens + pooled tokens[self.predict_hierarchy_index] = predict_tokens # final normalized embeddings embeds = apply_fns(self.norms, tokens) # if the researcher wants the randomly projected ids of either compressed tokens or embeddings of the hierarchies if return_random_proj_quantize_ids: assert self.prophet_loss_use_quantized quantize_input = embeds if self.prophet_quantized_use_embed else post_compressed_tokens hierarchical_ids = apply_fns(self.rand_proj_quantizers, quantize_input) return hierarchical_ids # if one wants all the normalized hierarchical embeds if return_hierarchical_embeds: return embeds # select the hierarchical embeddings that will be doing the predicting if self.predict_use_all_hierarchy: predict_embed = hierarchical_cat(embeds, self.h_strides) else: predict_embed = embeds[self.predict_hierarchy_index] # logits for predicting next token logits = self.to_logits(predict_embed) if not return_loss: return logits ce_loss_fn = partial(F.cross_entropy, ignore_index = self.ignore_index) # autoregressive loss (predictive coding) logits = rearrange(logits, 'b n c -> b c n') ce_loss = ce_loss_fn(logits, labels) # reconstruction losses for hierarchy tokens recon_losses = prophet_losses = torch.zeros((), device = self.device).requires_grad_() if self.should_recon: for compress, t in zip(self.compressors, embeds): recon_loss = compress.recon(t, ids) recon_losses = recon_losses + recon_loss # prophet losses for hierarchy tokens if self.should_prophet: if self.prophet_loss_use_quantized: # using random projected quantizer of the next hierarchical token quantize_input = embeds if self.prophet_quantized_use_embed else post_compressed_tokens hierarchical_ids = apply_fns(self.rand_proj_quantizers, quantize_input) for hierarchy, stride, compress, embed, pred_ids in zip(self.hierarchies, self.h_strides, self.compressors, embeds, hierarchical_ids): if hierarchy == 1: continue prophet_logits = compress.to_prophet(embed) axial_dim = hierarchy // stride prophet_logits = curtail_seq_to_multiple(prophet_logits, axial_dim) pred_ids = curtail_seq_to_multiple(pred_ids, axial_dim) prophet_logits, pred_ids = map(lambda t: rearrange(t, 'b (n c) ... -> (b c) n ...', c = axial_dim), (prophet_logits, pred_ids)) prophet_logits = rearrange(prophet_logits[:, :-1], 'b n (q c) -> (b q) c n', q = self.rq_num_codebooks) pred_ids = rearrange(pred_ids[:, 1:], 'b n q -> (b q) n') prophet_loss = ce_loss_fn(prophet_logits, pred_ids) prophet_losses = prophet_losses + prophet_loss else: # or predicting the next N 1x base token ids # like prophetnet paper for compress, t in zip(self.compressors, embeds): prophet_loss = compress.prophet(t, ids) prophet_losses = prophet_losses + prophet_loss # total loss total_loss = ce_loss + recon_losses * self.recon_loss_weight + prophet_losses * self.prophet_loss_weight return total_loss, (ce_loss, recon_losses, prophet_losses)
simple-hierarchical-transformer-main
simple_hierarchical_transformer/simple_hierarchical_transformer.py
from simple_hierarchical_transformer.simple_hierarchical_transformer import HierarchicalTransformer
simple-hierarchical-transformer-main
simple_hierarchical_transformer/__init__.py
from setuptools import setup, find_packages setup( name = 'flamingo-pytorch', packages = find_packages(exclude=[]), version = '0.1.2', license='MIT', description = 'Flamingo - Pytorch', author = 'Phil Wang', author_email = 'lucidrains@gmail.com', url = 'https://github.com/lucidrains/flamingo-pytorch', long_description_content_type = 'text/markdown', keywords = [ 'artificial intelligence', 'deep learning', 'transformers', 'attention mechanism', 'visual question answering' ], install_requires=[ 'einops>=0.4', 'einops-exts', 'torch>=1.6' ], classifiers=[ 'Development Status :: 4 - Beta', 'Intended Audience :: Developers', 'Topic :: Scientific/Engineering :: Artificial Intelligence', 'License :: OSI Approved :: MIT License', 'Programming Language :: Python :: 3.6', ], )
flamingo-pytorch-main
setup.py
import torch from torch import nn, einsum import torch.nn.functional as F from einops import rearrange, repeat from einops_exts import rearrange_many, repeat_many def exists(val): return val is not None def FeedForward(dim, mult = 4): inner_dim = int(dim * mult) return nn.Sequential( nn.LayerNorm(dim), nn.Linear(dim, inner_dim, bias = False), nn.GELU(), nn.Linear(inner_dim, dim, bias = False) ) class PerceiverAttention(nn.Module): def __init__( self, *, dim, dim_head = 64, heads = 8 ): super().__init__() self.scale = dim_head ** -0.5 self.heads = heads inner_dim = dim_head * heads self.norm_media = nn.LayerNorm(dim) self.norm_latents = nn.LayerNorm(dim) self.to_q = nn.Linear(dim, inner_dim, bias = False) self.to_kv = nn.Linear(dim, inner_dim * 2, bias = False) self.to_out = nn.Linear(inner_dim, dim, bias = False) def forward(self, x, latents): """ einstein notation b - batch t - time n - sequence d - dimension """ x = self.norm_media(x) latents = self.norm_latents(latents) b, m, h = *x.shape[:2], self.heads q = self.to_q(latents) # the paper differs from Perceiver in which they also concat the key / values derived from the latents to be attended to kv_input = torch.cat((x, latents), dim = -2) k, v = self.to_kv(kv_input).chunk(2, dim = -1) q, k, v = rearrange_many((q, k, v), 'b t n (h d) -> b h t n d', h = h) q = q * self.scale # attention sim = einsum('... i d, ... j d -> ... i j', q, k) sim = sim - sim.amax(dim = -1, keepdim = True).detach() attn = sim.softmax(dim = -1) out = einsum('... i j, ... j d -> ... i d', attn, v) out = rearrange(out, 'b h t n d -> b t n (h d)', h = h) return self.to_out(out) class PerceiverResampler(nn.Module): def __init__( self, *, dim, depth, dim_head = 64, heads = 8, num_latents = 64, num_media_embeds = 4, ff_mult = 4 ): super().__init__() self.latents = nn.Parameter(torch.randn(num_latents, dim)) self.media_pos_emb = nn.Parameter(torch.randn(num_media_embeds, 1, dim)) self.layers = nn.ModuleList([]) for _ in range(depth): self.layers.append(nn.ModuleList([ PerceiverAttention(dim = dim, dim_head = dim_head, heads = heads), FeedForward(dim = dim, mult = ff_mult) ])) self.norm = nn.LayerNorm(dim) def forward(self, x): if x.ndim == 3: x = rearrange(x, 'b n d -> b 1 n d') times = x.shape[1] x = x + self.media_pos_emb[:times] latents = repeat(self.latents, 'n d -> b m n d', b = x.shape[0], m = x.shape[1]) for attn, ff in self.layers: latents = attn(x, latents) + latents latents = ff(latents) + latents return self.norm(latents) # gated cross attention class MaskedCrossAttention(nn.Module): def __init__( self, *, dim, dim_head = 64, heads = 8, only_attend_immediate_media = True ): super().__init__() self.scale = dim_head ** -0.5 self.heads = heads inner_dim = dim_head * heads self.norm = nn.LayerNorm(dim) self.to_q = nn.Linear(dim, inner_dim, bias = False) self.to_kv = nn.Linear(dim, inner_dim * 2, bias = False) self.to_out = nn.Linear(inner_dim, dim, bias = False) # whether for text to only attend to immediate preceding image, or all images self.only_attend_immediate_media = only_attend_immediate_media def forward( self, x, media, media_locations = None ): b, t, m = media.shape[:3] h = self.heads x = self.norm(x) q = self.to_q(x) media = rearrange(media, 'b t n d -> b (t n) d') k, v = self.to_kv(media).chunk(2, dim = -1) q, k, v = rearrange_many((q, k, v), 'b n (h d) -> b h n d', h = h) q = q * self.scale sim = einsum('... i d, ... j d -> ... i j', q, k) if exists(media_locations): text_time = media_locations.cumsum(dim = -1) # at each boolean of True, increment the time counter (relative to media time) media_time = torch.arange(t, device = x.device) + 1 # text time must equal media time if only attending to most immediate image # otherwise, as long as text time is greater than media time (if attending to all previous images / media) mask_op = torch.eq if self.only_attend_immediate_media else torch.ge text_to_media_mask = mask_op(rearrange(text_time, 'b i -> b 1 i 1'), repeat(media_time, 'j -> 1 1 1 (j m)', m = m)) sim = sim.masked_fill(~text_to_media_mask, -torch.finfo(sim.dtype).max) sim = sim - sim.amax(dim = -1, keepdim = True).detach() attn = sim.softmax(dim = -1) if exists(media_locations) and self.only_attend_immediate_media: # any text without a preceding media needs to have attention zeroed out text_without_media_mask = text_time == 0 text_without_media_mask = rearrange(text_without_media_mask, 'b i -> b 1 i 1') attn = attn.masked_fill(text_without_media_mask, 0.) out = einsum('... i j, ... j d -> ... i d', attn, v) out = rearrange(out, 'b h n d -> b n (h d)') return self.to_out(out) class GatedCrossAttentionBlock(nn.Module): def __init__( self, *, dim, dim_head = 64, heads = 8, ff_mult = 4, only_attend_immediate_media = True ): super().__init__() self.attn = MaskedCrossAttention(dim = dim, dim_head = dim_head, heads = heads, only_attend_immediate_media = only_attend_immediate_media) self.attn_gate = nn.Parameter(torch.tensor([0.])) self.ff = FeedForward(dim, mult = ff_mult) self.ff_gate = nn.Parameter(torch.tensor([0.])) def forward( self, x, media, # media tensor, encoded by perceiver resample - (batch, time, latents, dim) media_locations = None # boolean tensor indicating positions of media - (batch, sequence) ): x = self.attn(x, media, media_locations = media_locations) * self.attn_gate.tanh() + x x = self.ff(x) * self.ff_gate.tanh() + x return x
flamingo-pytorch-main
flamingo_pytorch/flamingo_pytorch.py
from flamingo_pytorch.flamingo_pytorch import PerceiverResampler, GatedCrossAttentionBlock from flamingo_pytorch.flamingo_palm import FlamingoPaLM
flamingo-pytorch-main
flamingo_pytorch/__init__.py
import torch import torch.nn.functional as F from einops import rearrange, repeat from torch import einsum, nn from flamingo_pytorch.flamingo_pytorch import GatedCrossAttentionBlock, PerceiverResampler # helper functions def exists(val): return val is not None # for controlling freezing during training of flamingo def set_module_requires_grad_(module, requires_grad): for param in module.parameters(): param.requires_grad = requires_grad def freeze_all_layers_(module): set_module_requires_grad_(module, False) def unfreeze_all_layers_(module): set_module_requires_grad_(module, True) def freeze_model_and_make_eval_(model): model.eval() freeze_all_layers_(model) # normalization # they use layernorm without bias, something that pytorch does not offer class LayerNorm(nn.Module): def __init__(self, dim): super().__init__() self.gamma = nn.Parameter(torch.ones(dim)) self.register_buffer("beta", torch.zeros(dim)) def forward(self, x): return F.layer_norm(x, x.shape[-1:], self.gamma, self.beta) # residual class Residual(nn.Module): def __init__(self, fn): super().__init__() self.fn = fn def forward(self, x): return self.fn(x) + x # rotary positional embedding # https://arxiv.org/abs/2104.09864 class RotaryEmbedding(nn.Module): def __init__(self, dim): super().__init__() inv_freq = 1.0 / (10000 ** (torch.arange(0, dim, 2).float() / dim)) self.register_buffer("inv_freq", inv_freq) def forward(self, max_seq_len, *, device): seq = torch.arange(max_seq_len, device=device, dtype=self.inv_freq.dtype) freqs = einsum("i , j -> i j", seq, self.inv_freq) return torch.cat((freqs, freqs), dim=-1) def rotate_half(x): x = rearrange(x, "... (j d) -> ... j d", j=2) x1, x2 = x.unbind(dim=-2) return torch.cat((-x2, x1), dim=-1) def apply_rotary_pos_emb(pos, t): return (t * pos.cos()) + (rotate_half(t) * pos.sin()) # classic Noam Shazeer paper, except here they use SwiGLU instead of the more popular GEGLU for gating the feedforward # https://arxiv.org/abs/2002.05202 class SwiGLU(nn.Module): def forward(self, x): x, gate = x.chunk(2, dim=-1) return F.silu(gate) * x # parallel attention and feedforward with residual # discovered by Wang et al + EleutherAI from GPT-J fame class ParallelTransformerBlock(nn.Module): def __init__(self, dim, dim_head=64, heads=8, ff_mult=4): super().__init__() self.norm = LayerNorm(dim) attn_inner_dim = dim_head * heads ff_inner_dim = dim * ff_mult self.fused_dims = (attn_inner_dim, dim_head, dim_head, (ff_inner_dim * 2)) self.heads = heads self.scale = dim_head**-0.5 self.rotary_emb = RotaryEmbedding(dim_head) self.fused_attn_ff_proj = nn.Linear(dim, sum(self.fused_dims), bias=False) self.attn_out = nn.Linear(attn_inner_dim, dim, bias=False) self.ff_out = nn.Sequential( SwiGLU(), nn.Linear(ff_inner_dim, dim, bias=False) ) # for caching causal mask and rotary embeddings self.register_buffer("mask", None, persistent=False) self.register_buffer("pos_emb", None, persistent=False) def get_mask(self, n, device): if self.mask is not None and self.mask.shape[-1] >= n: return self.mask[:n, :n] mask = torch.ones((n, n), device=device, dtype=torch.bool).triu(1) self.register_buffer("mask", mask, persistent=False) return mask def get_rotary_embedding(self, n, device): if self.pos_emb is not None and self.pos_emb.shape[-2] >= n: return self.pos_emb[:n] pos_emb = self.rotary_emb(n, device=device) self.register_buffer("pos_emb", pos_emb, persistent=False) return pos_emb def forward(self, x): """ einstein notation b - batch h - heads n, i, j - sequence length (base sequence length, source, target) d - feature dimension """ n, device, h = x.shape[1], x.device, self.heads # pre layernorm x = self.norm(x) # attention queries, keys, values, and feedforward inner q, k, v, ff = self.fused_attn_ff_proj(x).split(self.fused_dims, dim=-1) # split heads # they use multi-query single-key-value attention, yet another Noam Shazeer paper # they found no performance loss past a certain scale, and more efficient decoding obviously # https://arxiv.org/abs/1911.02150 q = rearrange(q, "b n (h d) -> b h n d", h=h) # rotary embeddings positions = self.get_rotary_embedding(n, device) q, k = map(lambda t: apply_rotary_pos_emb(positions, t), (q, k)) # scale q = q * self.scale # similarity sim = einsum("b h i d, b j d -> b h i j", q, k) # causal mask causal_mask = self.get_mask(n, device) sim = sim.masked_fill(causal_mask, -torch.finfo(sim.dtype).max) # attention sim = sim - sim.amax(dim=-1, keepdim=True).detach() attn = sim.softmax(dim=-1) # aggregate values out = einsum("b h i j, b j d -> b h i d", attn, v) # merge heads out = rearrange(out, "b h n d -> b n (h d)") return self.attn_out(out) + self.ff_out(ff) # transformer class FlamingoPaLM(nn.Module): def __init__( self, *, dim, num_tokens, depth, dim_head=64, heads=8, ff_mult=4, media_token_id=3, cross_attn_every=3, img_encoder=None, perceiver_num_latents=64, perceiver_depth=2, max_video_frames = None, only_attend_immediate_media=True ): super().__init__() self.token_emb = nn.Embedding(num_tokens, dim) self.media_token_id = media_token_id # you need to reserve a special token id for media self.video_frame_pos_emb = nn.Parameter(torch.randn(max_video_frames, dim)) if exists(max_video_frames) else None self.img_encoder = img_encoder freeze_model_and_make_eval_(self.img_encoder) self.perceiver_resampler = PerceiverResampler( dim=dim, depth=perceiver_depth, dim_head=dim_head, heads=heads, num_latents=perceiver_num_latents ) self.layers = nn.ModuleList([]) for ind in range(depth): self.layers.append(nn.ModuleList([ Residual(ParallelTransformerBlock(dim=dim, dim_head=dim_head, heads=heads, ff_mult=ff_mult)), GatedCrossAttentionBlock(dim=dim, dim_head=dim_head, heads=heads, only_attend_immediate_media=only_attend_immediate_media) if not (ind % cross_attn_every) else None ])) self.to_logits = nn.Sequential( LayerNorm(dim), nn.Linear(dim, num_tokens, bias=False) ) # they used embedding weight tied projection out to logits, not common, but works self.to_logits[-1].weight = self.token_emb.weight nn.init.normal_(self.token_emb.weight, std=0.02) def forward( self, text, *, images=None, videos=None, embeds=None ): batch, device = text.shape[0], text.device flamingo_mode = any([exists(t) for t in (images, videos, embeds)]) # automatically take care of freezing or unfreezing depending on what is passed in if flamingo_mode: # in flamingo mode, freeze everything but perceiver and gated cross attention freeze_all_layers_(self) unfreeze_all_layers_(self.perceiver_resampler) [unfreeze_all_layers_(cross_attn) for _, cross_attn in self.layers if exists(cross_attn)] else: unfreeze_all_layers_(self) # derive the media token ids (as a boolean tensor), for calculating the masked cross attention if flamingo_mode: media_locations = text == self.media_token_id text_tokens = self.token_emb(text) assert not (exists(embeds) and (exists(images) or exists(video))) # encode videos or images into embeddings # with the img_encoder passed in at init # it can also accept precomputed image embeddings if exists(images): assert exists(self.img_encoder), 'img_encoder must be passed in for automatic image encoding' images = rearrange(images, 'b t ... -> (b t) ...') with torch.no_grad(): embeds = self.img_encoder(images) embeds = rearrange(embeds, '(b t) ... -> b t ...', b = batch) if exists(videos): assert exists(self.img_encoder), 'img_encoder must be passed in for automatic video encoding' batch, media, num_times, *_ = videos.shape videos = rearrange(videos, '... c h w -> (...) c h w') with torch.no_grad(): embeds = self.img_encoder(videos) embeds = rearrange(embeds, '(b m t) ... -> b m t ...', b = batch, m = media, t = num_times) video_time_pos_emb = repeat(self.video_frame_pos_emb[:num_times], 't d -> b m t n d', b = batch, m = media, n = embeds.shape[-2]) embeds = embeds + video_time_pos_emb embeds = rearrange(embeds, 'b m t n d -> b m (t n) d') if exists(embeds): embeds = self.perceiver_resampler(embeds) # go through layers for attn_ff, flamingo_cross_attn in self.layers: text_tokens = attn_ff(text_tokens) # if image embeds exist and flamingo cross attention set for the layer # do the cross attention if exists(flamingo_cross_attn) and exists(embeds): text_tokens = flamingo_cross_attn( text_tokens, embeds, media_locations = media_locations ) return self.to_logits(text_tokens)
flamingo-pytorch-main
flamingo_pytorch/flamingo_palm.py
from setuptools import setup, find_packages setup( name = 'cross-transformers-pytorch', packages = find_packages(), version = '0.0.2', license='MIT', description = 'Cross Transformers - Pytorch', author = 'Phil Wang', author_email = 'lucidrains@gmail.com', url = 'https://github.com/lucidrains/cross-transformers-pytorch', keywords = [ 'artificial intelligence', 'attention mechanism', 'cross attention', 'few shot learning' ], install_requires=[ 'torch>=1.6', 'einops>=0.3' ], classifiers=[ 'Development Status :: 4 - Beta', 'Intended Audience :: Developers', 'Topic :: Scientific/Engineering :: Artificial Intelligence', 'License :: OSI Approved :: MIT License', 'Programming Language :: Python :: 3.6', ], )
cross-transformers-pytorch-main
setup.py
from cross_transformers_pytorch.cross_transformers_pytorch import CrossTransformer
cross-transformers-pytorch-main
cross_transformers_pytorch/__init__.py
import torch from torch import nn, einsum import torch.nn.functional as F from einops import rearrange class CrossTransformer(nn.Module): def __init__( self, dim = 512, dim_key = 128, dim_value = 128 ): super().__init__() self.scale = dim_key ** -0.5 self.to_qk = nn.Conv2d(dim, dim_key, 1, bias = False) self.to_v = nn.Conv2d(dim, dim_value, 1, bias = False) def forward(self, model, img_query, img_supports): """ dimensions names: b - batch k - num classes n - num images in a support class c - channels h, i - height w, j - width """ b, k, *_ = img_supports.shape query_repr = model(img_query) *_, h, w = query_repr.shape img_supports = rearrange(img_supports, 'b k n c h w -> (b k n) c h w', b = b) supports_repr = model(img_supports) query_q, query_v = self.to_qk(query_repr), self.to_v(query_repr) supports_k, supports_v = self.to_qk(supports_repr), self.to_v(supports_repr) supports_k, supports_v = map(lambda t: rearrange(t, '(b k n) c h w -> b k n c h w', b = b, k = k), (supports_k, supports_v)) sim = einsum('b c h w, b k n c i j -> b k h w n i j', query_q, supports_k) * self.scale sim = rearrange(sim, 'b k h w n i j -> b k h w (n i j)') attn = sim.softmax(dim = -1) attn = rearrange(attn, 'b k h w (n i j) -> b k h w n i j', i = h, j = w) out = einsum('b k h w n i j, b k n c i j -> b k c h w', attn, supports_v) out = rearrange(out, 'b k c h w -> b k (c h w)') query_v = rearrange(query_v, 'b c h w -> b () (c h w)') euclidean_dist = ((query_v - out) ** 2).sum(dim = -1) / (h * w) return -euclidean_dist
cross-transformers-pytorch-main
cross_transformers_pytorch/cross_transformers_pytorch.py
from setuptools import setup, find_packages setup( name = 'spear-tts-pytorch', packages = find_packages(exclude=[]), version = '0.2.1', license='MIT', description = 'Spear-TTS - Pytorch', author = 'Phil Wang', author_email = 'lucidrains@gmail.com', long_description_content_type = 'text/markdown', url = 'https://github.com/lucidrains/spear-tts-pytorch', keywords = [ 'artificial intelligence', 'deep learning', 'transformers', 'attention mechanism', 'text-to-speech' ], install_requires=[ 'audiolm-pytorch>=1.2.8', 'beartype', 'einops>=0.6.1', 'rotary-embedding-torch>=0.3.0', 'torch>=1.6', 'tqdm', 'x-clip>=0.12.2' ], classifiers=[ 'Development Status :: 4 - Beta', 'Intended Audience :: Developers', 'Topic :: Scientific/Engineering :: Artificial Intelligence', 'License :: OSI Approved :: MIT License', 'Programming Language :: Python :: 3.6', ], )
spear-tts-pytorch-main
setup.py
from spear_tts_pytorch.spear_tts_pytorch import ( TextToSemantic, SpeechSpeechPretrainWrapper, SemanticToTextWrapper, TextToSemanticWrapper, SemanticToTextDatasetGenerator ) from spear_tts_pytorch.trainer import ( SpeechSpeechPretrainer, SemanticToTextTrainer, TextToSemanticTrainer ) from spear_tts_pytorch.data import ( GeneratedAudioTextDataset, MockDataset )
spear-tts-pytorch-main
spear_tts_pytorch/__init__.py
import torch from torch import nn, einsum import torch.nn.functional as F from collections import namedtuple from functools import wraps from packaging import version from einops import rearrange # constants Config = namedtuple('EfficientAttentionConfig', ['enable_flash', 'enable_math', 'enable_mem_efficient']) # helpers def exists(val): return val is not None def once(fn): called = False @wraps(fn) def inner(x): nonlocal called if called: return called = True return fn(x) return inner print_once = once(print) # main class class Attend(nn.Module): def __init__( self, dropout = 0., causal = False, flash = False ): super().__init__() self.dropout = dropout self.attn_dropout = nn.Dropout(dropout) self.causal = causal self.register_buffer("mask", None, persistent=False) self.flash = flash assert not (flash and version.parse(torch.__version__) < version.parse('2.0.0')), 'in order to use flash attention, you must be using pytorch 2.0 or above' # determine efficient attention configs for cuda and cpu self.cpu_config = Config(True, True, True) self.cuda_config = None if not torch.cuda.is_available() or not flash: return device_properties = torch.cuda.get_device_properties(torch.device('cuda')) if device_properties.major == 8 and device_properties.minor == 0: print_once('A100 GPU detected, using flash attention if input tensor is on cuda') self.cuda_config = Config(True, False, False) else: print_once('Non-A100 GPU detected, using math or mem efficient attention if input tensor is on cuda') self.cuda_config = Config(False, True, True) def get_mask(self, i, j, device): n = max(i, j) if exists(self.mask) and self.mask.shape[-1] >= n: mask = self.mask[:n, :n] else: mask = torch.ones((n, n), device = device, dtype = torch.bool).triu(1) self.register_buffer("mask", mask, persistent = False) return mask[-i:, :] def flash_attn(self, q, k, v, mask = None): _, heads, q_len, _, k_len, causal, is_cuda, device = *q.shape, k.shape[-2], self.causal, q.is_cuda, q.device # Recommended for multi-query single-key-value attention by Tri Dao # kv shape torch.Size([1, 512, 64]) -> torch.Size([1, 8, 512, 64]) if k.ndim == 3: k = rearrange(k, 'b ... -> b 1 ...').expand_as(q) if v.ndim == 3: v = rearrange(v, 'b ... -> b 1 ...').expand_as(q) # Check if mask exists and expand to compatible shape # The mask is B L, so it would have to be expanded to B H N L if exists(mask): mask = rearrange(mask, 'b j -> b 1 1 j') mask = mask.expand(-1, heads, q_len, -1) # Check if there is a compatible device for flash attention config = self.cuda_config if is_cuda else self.cpu_config # if q and k lengths differ (caching of key/values), and causal, manually construct causal attn mask as float, as not supported (flash attn 2 will support this eventually) if causal and q_len != k_len: causal_mask = self.get_mask(q_len, k_len, device = device) if exists(mask): mask = mask & ~causal_mask else: mask = ~causal_mask causal = False # pytorch 2.0 flash attn: q, k, v, mask, dropout, causal, softmax_scale with torch.backends.cuda.sdp_kernel(**config._asdict()): out = F.scaled_dot_product_attention( q, k, v, attn_mask = mask, dropout_p = self.dropout if self.training else 0., is_causal = causal ) return out def forward(self, q, k, v, mask = None): """ einstein notation b - batch h - heads n, i, j - sequence length (base sequence length, source, target) d - feature dimension """ n, device = q.shape[-2], q.device scale = q.shape[-1] ** -0.5 if self.flash: return self.flash_attn(q, k, v, mask = mask) # similarity sim = einsum("b h i d, b h j d -> b h i j", q, k) * scale # key padding mask if exists(mask): mask = rearrange(mask, 'b j -> b 1 1 j') sim = sim.masked_fill(~mask, -torch.finfo(sim.dtype).max) # causal mask if self.causal: i, j = sim.shape[-2:] causal_mask = self.get_mask(i, j, device) sim = sim.masked_fill(causal_mask, -torch.finfo(sim.dtype).max) # attention attn = sim.softmax(dim = -1) attn = self.attn_dropout(attn) # aggregate values out = einsum("b h i j, b h j d -> b h i d", attn, v) return out
spear-tts-pytorch-main
spear_tts_pytorch/attend.py
import math from pathlib import Path from functools import partial import torch import torch.nn.functional as F from torch.nn.utils.rnn import pad_sequence from torch import Tensor, nn, einsum, FloatTensor, IntTensor, LongTensor from torch.nn import Module, ModuleList from torch.utils.data import Dataset from einops import rearrange, repeat, pack from audiolm_pytorch import FairseqVQWav2Vec, HubertWithKmeans from audiolm_pytorch.data import get_dataloader from rotary_embedding_torch import RotaryEmbedding from beartype import beartype from beartype.door import is_bearable from beartype.typing import Optional, Union, Callable, Literal, Tuple, List from x_clip.tokenizer import tokenizer from spear_tts_pytorch.attend import Attend from tqdm import tqdm # helpers def exists(val): return val is not None def default(val, d): return val if exists(val) else d def empty(t: Tensor): return t.numel() == 0 def set_eos_id(t: Tensor, eos_id: int, pad_id: int): eos_indices = ((t == pad_id).cumsum(dim = -1) == 0).sum(dim = -1, keepdim = True).long() batch_range = torch.arange(t.shape[0], device = t.device, dtype = torch.long) batch_range = rearrange(batch_range, '... -> ... 1') t = F.pad(t, (0, 1), value = pad_id) t[batch_range, eos_indices] = eos_id return t def batch_unique_consecutive(t, pad_value = 0.): unique_arr = [torch.unique_consecutive(el) for el in t.unbind(dim = 0)] return pad_sequence(unique_arr, batch_first = True, padding_value = pad_value) def mask_after_eos(target, eos_id, pad_id): mask = (target == eos_id).cumsum(dim = -1) > 0 mask = F.pad(mask, (1, -1), value = False) return target.masked_fill(mask, pad_id) # freezing and unfreezing helpers def set_requires_grad_(module: Module, requires_grad: bool): for p in module.parameters(): p.requires_grad = requires_grad def freeze(module: Module): set_requires_grad_(module, False) def unfreeze(module: Module): set_requires_grad_(module, True) # sampling helpers def eval_decorator(fn): def inner(self, *args, **kwargs): was_training = self.training self.eval() out = fn(self, *args, **kwargs) self.train(was_training) return out return inner def log(t, eps = 1e-20): return torch.log(t.clamp(min = eps)) def gumbel_noise(t): noise = torch.zeros_like(t).uniform_(0, 1) return -log(-log(noise)) def gumbel_sample(t, temperature = 1., dim = -1): return ((t / max(temperature, 1e-10)) + gumbel_noise(t)).argmax(dim = dim) def top_p(logits, thres = 0.9): sorted_logits, sorted_indices = torch.sort(logits, descending=True) cum_probs = torch.cumsum(F.softmax(sorted_logits, dim=-1), dim=-1) sorted_indices_to_remove = cum_probs > (1 - thres) sorted_indices_to_remove[:, 1:] = sorted_indices_to_remove[:, :-1].clone() sorted_indices_to_remove[:, 0] = 0 sorted_logits[sorted_indices_to_remove] = float('-inf') return sorted_logits.scatter(1, sorted_indices, sorted_logits) def top_k(logits, thres = 0.9): k = math.ceil((1 - thres) * logits.shape[-1]) val, ind = torch.topk(logits, k) probs = torch.full_like(logits, float('-inf')) probs.scatter_(1, ind, val) return probs # rmsnorm class RMSNorm(nn.Module): def __init__(self, dim): super().__init__() self.scale = dim ** 0.5 self.gamma = nn.Parameter(torch.ones(dim)) def forward(self, x): return F.normalize(x, dim = -1) * self.scale * self.gamma # feedforward class GEGLU(nn.Module): def forward(self, x): x, gate = x.chunk(2, dim = -1) return F.gelu(gate) * x def FeedForward(dim, mult = 4, dropout = 0.): dim_inner = int(dim * mult * 2 / 3) return nn.Sequential( RMSNorm(dim), nn.Linear(dim, dim_inner * 2), GEGLU(), nn.Dropout(dropout), nn.Linear(dim_inner, dim) ) # attention class Attention(nn.Module): def __init__( self, dim, *, dim_head = 64, heads = 8, causal = False, dim_context = None, dropout = 0., rotary_emb: Optional[RotaryEmbedding] = None, flash = False ): super().__init__() dim_context = default(dim_context, dim) self.heads = heads self.scale = dim_head ** -0.5 dim_inner = heads * dim_head self.rotary_emb = rotary_emb self.attend = Attend( causal = causal, flash = flash, dropout = dropout ) self.norm = RMSNorm(dim) self.attn_dropout = nn.Dropout(dropout) self.to_q = nn.Linear(dim, dim_inner, bias = False) self.to_kv = nn.Linear(dim_context, dim_inner * 2, bias = False) self.to_out = nn.Linear(dim_inner, dim, bias = False) def forward( self, x, context = None, mask = None ): has_context = exists(context) h = self.heads x = self.norm(x) context = default(context, x) q, k, v = (self.to_q(x), *self.to_kv(context).chunk(2, dim = -1)) q, k, v = map(lambda t: rearrange(t, 'b n (h d) -> b h n d', h = h), (q, k, v)) if exists(self.rotary_emb): assert not has_context q, k = self.rotary_emb.rotate_queries_with_cached_keys(q, k) out = self.attend(q, k, v, mask = mask) out = rearrange(out, 'b h n d -> b n (h d)') return self.to_out(out) # transformer class Transformer(nn.Module): def __init__( self, *, dim, depth, dim_head = 64, heads = 8, causal = False, attn_dropout = 0., ff_mult = 4, ff_dropout = 0., cross_attend = False, attn_flash = False ): super().__init__() rotary_emb = RotaryEmbedding(dim_head) self.layers = nn.ModuleList([]) for _ in range(depth): self.layers.append(nn.ModuleList([ Attention(dim = dim, causal = causal, dim_head = dim_head, heads = heads, dropout = attn_dropout, rotary_emb = rotary_emb, flash = attn_flash), Attention(dim = dim, dim_head = dim_head, heads = heads, dropout = attn_dropout, flash = attn_flash) if cross_attend else None, FeedForward(dim = dim, mult = ff_mult, dropout = ff_dropout) ])) self.final_norm = RMSNorm(dim) def forward( self, x, mask = None, context = None, context_mask = None ): has_context = exists(context) for attn, maybe_cross_attn, ff in self.layers: x = attn(x, mask = mask) + x if exists(maybe_cross_attn): assert has_context x = maybe_cross_attn(x, context = context, mask = context_mask) + x x = ff(x) + x return self.final_norm(x) # class SpeechOrTextLiteral = Union[ Literal['speech'], Literal['text'] ] SemanticModelType = Union[ FairseqVQWav2Vec, HubertWithKmeans ] class TextToSemantic(Module): @beartype def __init__( self, dim, *, num_text_token_ids, source_depth, target_depth, tokenizer_encode: Optional[Callable] = None, use_openai_tokenizer = False, wav2vec: Optional[SemanticModelType] = None, num_semantic_token_ids = None, dim_head = 64, heads = 8, attn_dropout = 0., ff_mult = 4, ff_dropout = 0., semantic_pad_id = -1, text_pad_id = 0, autoset_semantic_eos_id = True, autoset_text_eos_id = True, attn_flash = False ): super().__init__() self.dim = dim self.wav2vec = wav2vec self.tokenizer_encode = tokenizer_encode if use_openai_tokenizer: assert not exists(tokenizer_encode) self.tokenizer_encode = tokenizer.tokenize num_semantic_token_ids = wav2vec.codebook_size if exists(wav2vec) else num_semantic_token_ids assert exists(num_semantic_token_ids), 'you need to either pass in a wav2vec model from audiolm-pytorch, or specify the number of semantic token ids with num_semantic_token_ids' self.num_semantic_token_ids = num_semantic_token_ids self.num_text_token_ids = num_text_token_ids # padding id, for deriving attention mask automatically if not passed in self.semantic_pad_id = semantic_pad_id self.text_pad_id = text_pad_id self.pad_id = dict( speech = semantic_pad_id, text = text_pad_id ) # eos id self.autoset_eos_id = dict( speech = autoset_semantic_eos_id, text = autoset_text_eos_id ) self.eos_id = dict( speech = num_semantic_token_ids, text = num_text_token_ids ) # embedding semantic_token_emb = nn.Embedding(num_semantic_token_ids + int(autoset_semantic_eos_id), dim) text_token_emb = nn.Embedding(num_text_token_ids + int(autoset_text_eos_id), dim) self.semantic_token_emb = semantic_token_emb self.token_emb = nn.ModuleDict(dict( speech = semantic_token_emb, text = text_token_emb )) # respective start tokens self.start_token = nn.ParameterDict(dict( speech = nn.Parameter(torch.randn(dim)), text = nn.Parameter(torch.randn(dim)) )) # projection to logits to_semantic_logit = nn.Linear(dim, num_semantic_token_ids, bias = False) to_text_logit = nn.Linear(dim, num_text_token_ids, bias = False) to_semantic_logit.weight = semantic_token_emb.weight to_text_logit.weight = text_token_emb.weight self.to_logits = nn.ModuleDict(dict( speech = to_semantic_logit, text = to_text_logit )) # source and target attention layers self.source_transformer = Transformer( dim = dim, dim_head = dim_head, heads = heads, depth = source_depth, attn_dropout = attn_dropout, ff_mult = ff_mult, ff_dropout = ff_dropout, causal = False, attn_flash = attn_flash ) self.target_transformer = Transformer( dim = dim, dim_head = dim_head, heads = heads, depth = target_depth, attn_dropout = attn_dropout, ff_mult = ff_mult, ff_dropout = ff_dropout, causal = True, cross_attend = True, attn_flash = attn_flash ) @property def device(self): return next(self.parameters()).device def load(self, path, strict = True): # Return pkg so that if this function gets called from within a Trainer function call, # the trainer can also access the package loaded from the checkpoint. path = Path(path) assert path.exists() pkg = torch.load(str(path), map_location = 'cpu') self.load_state_dict(pkg['model'], strict = strict) return pkg # a set of freezing / unfreezing utils # then rely on get_optimizer to filter out the parameters that do not require grad from being exposed to optimizer def unfreeze_all(self): unfreeze(self) def freeze_encoder(self): freeze(self.source_transformer) def freeze_encoder_below_layer(self, layer: int): """ for the final training of text-to-semantic on pseudo-labelled dataset they freeze the encoder part way up to a certain layer """ unfreeze(self.source_transformer) for ind, module in enumerate(self.source_transformer.layers): current_layer = ind + 1 if current_layer <= layer: freeze(module) def freeze_decoder(self): freeze(self.target_transformer) def freeze_speech_emb(self): freeze(self.token_emb['speech']) self.start_token['speech'].requires_grad = False def freeze_text_emb(self): freeze(self.token_emb['text']) self.start_token['text'].requires_grad = False # sampling function @torch.no_grad() @eval_decorator @beartype def generate( self, source: Union[List[str], Tensor], *, source_type: SpeechOrTextLiteral, target_type: SpeechOrTextLiteral, temperature = 1., filter_logits_fn = top_k, filter_thres = 0.9, source_mask: Optional[Tensor] = None, max_length = 2048, beam_search_decode = False, beam_size = 4, return_source = False ): if isinstance(source, (FloatTensor)) and source_type == 'speech': assert exists(self.wav2vec), 'wav2vec should be passed in, if generating with source as raw soundwave' source = self.wav2vec(source) if is_bearable(source, List[str]): assert exists(self.tokenizer_encode) source = self.tokenizer_encode(source) source = source.to(self.device) batch = source.shape[0] source_token_emb = self.token_emb[source_type] source_pad_id = self.pad_id[source_type] # all target modules and parameters target_token_emb = self.token_emb[target_type] target_start_token = self.start_token[target_type] target_to_logit = self.to_logits[target_type] target_pad_id = self.pad_id[target_type] target_eos_id = self.eos_id[target_type] # auto set eos id if self.autoset_eos_id[source_type]: source_eos_id = self.eos_id[source_type] source = set_eos_id(source, source_eos_id, pad_id = source_pad_id) # if source mask is not passed in # automatically derive by the padding id of the modality if not exists(source_mask) and source.dtype == torch.long: source_mask = source != source_pad_id # source embedding source_emb = source_token_emb(source) source_emb = self.source_transformer(source_emb, mask = source_mask) # decode target target = torch.empty((batch, 0), dtype = torch.long, device = self.device) start_token = repeat(target_start_token, 'd -> b 1 d', b = batch) # loop to decode if not beam_search_decode: for _ in tqdm(range(max_length)): target_emb = target_token_emb(target) target_emb = torch.cat((start_token, target_emb), dim = 1) # target attention target_emb = self.target_transformer(target_emb, context = source_emb, context_mask = source_mask) # decoder logits logits = target_to_logit(target_emb) logits = logits[:, -1] logits = filter_logits_fn(logits, thres = filter_thres) sampled = gumbel_sample(logits, temperature = temperature) target, _ = pack((target, sampled), 'b *') if not self.autoset_eos_id[target_type]: continue is_eos = target == target_eos_id all_eos = is_eos.any(dim = -1).all() if not all_eos: continue target = mask_after_eos(target, target_eos_id, target_pad_id) break else: beam = [(target, 0.0)] batch_range = torch.arange(batch, device = self.device, dtype = torch.long) batch_range = rearrange(batch_range, 'b -> b 1') for _ in tqdm(range(max_length)): all_candidates = [] for sentence, sentence_prob in beam: target_emb = target_token_emb(sentence) target_emb = torch.cat((start_token, target_emb), dim = 1) # target attention target_emb = self.target_transformer(target_emb, context = source_emb, context_mask = source_mask) # decoder logits logits = target_to_logit(target_emb) logits = logits[:, -1] log_probs = torch.log_softmax(logits / max(temperature, 1e-10), dim = -1) topk_log_probs, topk_ids = log_probs.topk(beam_size, dim = -1) for i in range(beam_size): candidate = torch.cat([sentence, topk_ids[..., i:i + 1]], dim = -1) candidate_prob = sentence_prob + topk_log_probs[..., i] all_candidates.append((candidate, candidate_prob)) # concat into shape (beam, batch, seq), (beam, batch) candidates, candidate_probs = map(partial(torch.stack, dim = 1), zip(*all_candidates)) # sort by candidate scores across beams sorted_indices = candidate_probs.sort(dim = 1, descending = True).indices sorted_candidates = candidates[batch_range, sorted_indices] sorted_candidate_probs = candidate_probs[batch_range, sorted_indices] # reconstitute ordered List[Tuple[Tensor, Tensor]] ordered = list(zip(*map(partial(torch.unbind, dim = 1), (sorted_candidates, sorted_candidate_probs)))) beam = ordered[:beam_size] # check if we've hit eos for all sequences all_eos = all([((sentence == target_eos_id).any(dim = -1)).all() for sentence, _ in beam]) if all_eos: break target = beam[0][0] if exists(target_eos_id): target = mask_after_eos(target, target_eos_id, target_pad_id) if not return_source: return target return source, target @beartype def forward( self, source: Union[List[str], Tensor], target: Union[List[str], Tensor], *, source_type: SpeechOrTextLiteral, target_type: SpeechOrTextLiteral, source_mask: Optional[Tensor] = None, target_mask: Optional[Tensor] = None, return_loss = False, return_logits = False ): if isinstance(source, FloatTensor) and source_type == 'speech': assert exists(self.wav2vec), 'wav2vec should be passed in, if generating with source as raw soundwave' source = self.wav2vec(source) if is_bearable(source, List[str]): assert exists(self.tokenizer_encode) source = self.tokenizer_encode(source) source = source.to(self.device) if is_bearable(target, List[str]): assert exists(self.tokenizer_encode) target = self.tokenizer_encode(target) target = target.to(self.device) assert source.shape[0] == target.shape[0] batch = source.shape[0] source_token_emb = self.token_emb[source_type] source_pad_id = self.pad_id[source_type] # all target modules and parameters target_token_emb = self.token_emb[target_type] target_start_token = self.start_token[target_type] target_to_logit = self.to_logits[target_type] target_pad_id = self.pad_id[target_type] # auto set eos id if self.autoset_eos_id[source_type]: source_eos_id = self.eos_id[source_type] source = set_eos_id(source, source_eos_id, pad_id = source_pad_id) if self.autoset_eos_id[target_type] and return_loss: target_eos_id = self.eos_id[target_type] target = set_eos_id(target, target_eos_id, pad_id = target_pad_id) # if source/target mask is not passed in # automatically derive by the padding id of the modality if not exists(source_mask) and source.dtype == torch.long: source_mask = source != source_pad_id if not exists(target_mask) and target.dtype == torch.long: target_mask = target != target_pad_id # attend to bos target_mask = F.pad(target_mask, (1, 0), value = True) # embedding source_emb = source_token_emb(source) target_emb = target_token_emb(target) start_token = repeat(target_start_token, 'd -> b 1 d', b = batch) target_emb = torch.cat((start_token, target_emb), dim = 1) # source attention source_emb = self.source_transformer(source_emb, source_mask) # target attention target_emb = self.target_transformer(target_emb, mask = target_mask, context = source_emb, context_mask = source_mask) # decoder logits logits = target_to_logit(target_emb) if not return_loss: return logits assert not empty(target) logits = rearrange(logits[:, :-1], 'b n c -> b c n') loss = F.cross_entropy( logits, target, ignore_index = target_pad_id ) if return_logits: return loss, logits else: return loss # pretraining modules def get_mask_subset_prob(mask, prob, min_mask = 0): batch, seq, device = *mask.shape, mask.device num_to_mask = (mask.sum(dim = -1, keepdim = True) * prob).clamp(min = min_mask) logits = torch.rand((batch, seq), device = device) logits = logits.masked_fill(~mask, -1) randperm = logits.argsort(dim = -1).float() num_padding = (~mask).sum(dim = -1, keepdim = True) randperm -= num_padding subset_mask = randperm < num_to_mask subset_mask.masked_fill_(~mask, False) return subset_mask class SpeechSpeechPretrainWrapper(nn.Module): @beartype def __init__( self, model: TextToSemantic, wav2vec: Optional[SemanticModelType] = None, deletion_prob: float = 0.6, reconstruct_seq: bool = False, mask_id = None ): super().__init__() self.model = model self.wav2vec = default(wav2vec, model.wav2vec) self.deletion_prob = deletion_prob self.reconstruct_seq = reconstruct_seq # whether to reconstruct the entire sequence, or just output the deleted ones in order self.mask_id = mask_id def forward( self, x ): is_raw_audio = x.dtype == torch.float if is_raw_audio: assert exists(self.wav2vec) with torch.no_grad(): self.wav2vec.eval() x = self.wav2vec(x, flatten = False) batch = x.shape[0] mask = torch.ones_like(x, dtype = torch.bool, device = self.model.device) if exists(self.mask_id): assert self.reconstruct_seq, 'reconstruct_seq must be true if mask id is provided' mask = mask.masked_fill(x == self.model.semantic_pad_id, False) delete_mask = get_mask_subset_prob(mask, self.deletion_prob) source = x.masked_fill(delete_mask, self.mask_id) else: delete_mask = get_mask_subset_prob(mask, self.deletion_prob) source = rearrange(x[~delete_mask], '(b n) -> b n', b = batch) if self.reconstruct_seq: target = x else: target = rearrange(x[delete_mask], '(b n) -> b n', b = batch) loss, logits = self.model( source, target, source_type = 'speech', target_type = 'speech', return_loss = True, return_logits = True ) return loss, logits # wrapper for backtranslation task class SemanticToTextWrapper(nn.Module): @beartype def __init__( self, model: TextToSemantic ): super().__init__() self.model = model def forward( self, semantic_token_ids, grapheme_token_ids, ): source = semantic_token_ids target = grapheme_token_ids loss, logits = self.model( source, target, source_type = 'speech', target_type = 'text', return_loss = True, return_logits = True ) return loss, logits # wrapper for text to semantic task class TextToSemanticWrapper(nn.Module): @beartype def __init__( self, model: TextToSemantic ): super().__init__() self.model = model def forward( self, grapheme_token_ids, semantic_token_ids, ): source = grapheme_token_ids target = semantic_token_ids loss, logits = self.model( source, target, source_type = 'text', target_type = 'speech', return_loss = True, return_logits = True ) return loss, logits # wrapper for generating the pseudo-labelled audio to text dataset class SemanticToTextDatasetGenerator(nn.Module): @beartype def __init__( self, model, *, dataset: Dataset, folder = './generated-audio-text-pairs', batch_size = 4, delimiter_id: int = -1, audio_pad_id = None, text_pad_id = 0 ): super().__init__() self.model = model self.dataset = dataset self.dl = get_dataloader(dataset, batch_size = batch_size) self.delimiter_id = delimiter_id self.audio_pad_id = audio_pad_id self.text_pad_id = text_pad_id self.folder = Path(folder) self.folder.mkdir(exist_ok = True, parents = True) def forward( self, max_length = 2048, beam_search_decode = False, **generate_kwargs ): delimiter = torch.tensor([self.delimiter_id], device = self.model.device) counter = 0 for audio, in self.dl: audio_semantic_ids, text_ids = self.model.generate( source = audio, source_type = 'speech', target_type = 'text', return_source = True, max_length = max_length, beam_search_decode = beam_search_decode, **generate_kwargs ) for audio_semantic_id, text_id in zip(audio_semantic_ids, text_ids): if exists(self.audio_pad_id): audio_pad_mask = audio_semantic_id == self.audio_pad_id audio_semantic_id = audio_semantic_id[~audio_pad_mask] if exists(self.text_pad_id): text_pad_mask = text_id == self.text_pad_id text_id = text_id[~text_pad_mask] row, _ = pack([audio_semantic_id, delimiter, text_id], '*') path = str(self.folder / f'{counter}.pt') torch.save(row, path) counter += 1
spear-tts-pytorch-main
spear_tts_pytorch/spear_tts_pytorch.py
import re from pathlib import Path from shutil import rmtree from beartype import beartype from beartype.door import is_bearable from beartype.typing import Union, Optional, Tuple import torch from torch import nn, LongTensor, IntTensor from torch.utils.data import ConcatDataset from torch.optim.lr_scheduler import CosineAnnealingLR from torch.utils.data import Dataset, random_split from audiolm_pytorch import FairseqVQWav2Vec, HubertWithKmeans from audiolm_pytorch.data import get_dataloader from audiolm_pytorch.optimizer import get_optimizer from spear_tts_pytorch.spear_tts_pytorch import SpeechSpeechPretrainWrapper, TextToSemantic, SemanticToTextWrapper, TextToSemanticWrapper from spear_tts_pytorch.data import GeneratedAudioTextDataset from accelerate import Accelerator, DistributedType # constants IndicesTensor = Union[LongTensor, IntTensor] # make sure only one trainer is instantiated ONE_TRAINER_INSTANTIATED = False def check_one_trainer(): global ONE_TRAINER_INSTANTIATED assert not ONE_TRAINER_INSTANTIATED, 'only one Trainer can be instantiated at a time for training' ONE_TRAINER_INSTANTIATED = True # helpers def exists(val): return val is not None def noop(*args, **kwargs): pass def cycle(dl): while True: for data in dl: yield data def cast_tuple(t): return t if isinstance(t, (tuple, list)) else (t,) def yes_or_no(question): answer = input(f'{question} (y/n) ') return answer.lower() in ('yes', 'y') def accum_log(log, new_logs): for key, new_value in new_logs.items(): old_value = log.get(key, 0.) log[key] = old_value + new_value return log def checkpoint_num_steps(checkpoint_path): """Returns the number of steps trained from a checkpoint based on the filename. Filename format assumed to be something like "/path/to/speech.speech.20000.pt" which is for 20k train steps. Returns 20000 in that case. """ results = re.findall(r'\d+', str(checkpoint_path)) if len(results) == 0: return 0 return int(results[-1]) class SpeechSpeechPretrainer(nn.Module): @beartype def __init__( self, model: TextToSemantic, wav2vec: Optional[Union[FairseqVQWav2Vec, HubertWithKmeans]], *, num_train_steps, num_warmup_steps, batch_size, dataset: Optional[Dataset] = None, deletion_prob: float = 0.6, reconstruct_seq: bool = False, mask_id = None, lr = 3e-4, initial_lr = 1e-5, grad_accum_every = 1, wd = 0., max_grad_norm = 0.5, valid_frac = 0.05, random_split_seed = 42, log_every = 10, save_results_every = 100, save_model_every = 1000, results_folder = './results', accelerate_kwargs: dict = dict(), split_batches = False, drop_last = False, force_clear_prev_results = None ): super().__init__() check_one_trainer() self.accelerator = Accelerator( split_batches = split_batches, **accelerate_kwargs ) self.model = model self.wav2vec = wav2vec self.train_wrapper = SpeechSpeechPretrainWrapper( model = model, wav2vec = wav2vec, deletion_prob = deletion_prob, reconstruct_seq = reconstruct_seq, mask_id = mask_id ) self.register_buffer('steps', torch.Tensor([0])) self.num_train_steps = num_train_steps self.num_warmup_steps = num_warmup_steps self.batch_size = batch_size self.grad_accum_every = grad_accum_every # optimizers self.lr = lr self.initial_lr = initial_lr self.optim = get_optimizer(model.parameters(), lr = lr, wd = wd) self.scheduler = CosineAnnealingLR(self.optim, T_max = num_train_steps) # max grad norm self.max_grad_norm = max_grad_norm # create dataset self.ds = dataset # split for validation if valid_frac > 0: train_size = int((1 - valid_frac) * len(self.ds)) valid_size = len(self.ds) - train_size self.ds, self.valid_ds = random_split(self.ds, [train_size, valid_size], generator = torch.Generator().manual_seed(random_split_seed)) self.print(f'training with dataset of {len(self.ds)} samples and validating with randomly splitted {len(self.valid_ds)} samples') else: self.valid_ds = self.ds self.print(f'training with shared training and valid dataset of {len(self.ds)} samples') assert len(self.ds) >= batch_size, 'dataset must have sufficient samples for training' assert len(self.valid_ds) >= batch_size, f'validation dataset must have sufficient number of samples (currently {len(self.valid_ds)}) for training' # dataloader self.dl = get_dataloader(self.ds, batch_size = batch_size, shuffle = True, drop_last = drop_last) self.valid_dl = get_dataloader(self.valid_ds, batch_size = batch_size, shuffle = True, drop_last = drop_last) # prepare with accelerator ( self.train_wrapper, self.optim, self.scheduler, self.dl, self.valid_dl ) = self.accelerator.prepare( self.train_wrapper, self.optim, self.scheduler, self.dl, self.valid_dl ) # dataloader iterators self.dl_iter = cycle(self.dl) self.valid_dl_iter = cycle(self.valid_dl) self.log_every = log_every self.save_model_every = save_model_every self.save_results_every = save_results_every self.results_folder = Path(results_folder) if self.is_main and force_clear_prev_results is True or (not exists(force_clear_prev_results) and len([*self.results_folder.glob('**/*')]) > 0 and yes_or_no('do you want to clear previous experiment checkpoints and results?')): rmtree(str(self.results_folder)) self.results_folder.mkdir(parents = True, exist_ok = True) hps = {"num_train_steps": num_train_steps, "num_warmup_steps": num_warmup_steps, "learning_rate": lr, "initial_learning_rate": lr} self.accelerator.init_trackers("speechspeech", config=hps) def save(self, path): pkg = dict( model = self.accelerator.get_state_dict(self.model), optim = self.optim.state_dict(), scheduler = self.scheduler.state_dict() ) torch.save(pkg, path) def load(self, path): model = self.accelerator.unwrap_model(self.model) pkg = model.load(path) self.optim.load_state_dict(pkg['optim']) self.scheduler.load_state_dict(pkg['scheduler']) # + 1 to start from the next step and avoid overwriting the last checkpoint self.steps = torch.tensor([checkpoint_num_steps(path) + 1], device=self.device) def print(self, msg): self.accelerator.print(msg) def generate(self, *args, **kwargs): return self.train_wrapper.generate(*args, **kwargs) @property def device(self): return self.accelerator.device @property def is_distributed(self): return not (self.accelerator.distributed_type == DistributedType.NO and self.accelerator.num_processes == 1) @property def is_main(self): return self.accelerator.is_main_process @property def is_local_main(self): return self.accelerator.is_local_main_process def warmup(self, step): if step < self.num_warmup_steps: return self.initial_lr + (self.lr - self.initial_lr) * step / self.num_warmup_steps else: return self.lr def train_step(self): steps = int(self.steps.item()) self.model.train() # adjust the lr according to the schedule if steps < self.num_warmup_steps: # Apply warmup lr = self.warmup(steps) for param_group in self.optim.param_groups: param_group['lr'] = lr else: # After warmup period, start to apply CosineAnnealingLR self.scheduler.step() # logs logs = {} # update vae (generator) for _ in range(self.grad_accum_every): x, = next(self.dl_iter) loss, _ = self.train_wrapper(x) self.accelerator.backward(loss / self.grad_accum_every) accum_log(logs, {'loss': loss.item() / self.grad_accum_every}) if exists(self.max_grad_norm): self.accelerator.clip_grad_norm_(self.model.parameters(), self.max_grad_norm) self.optim.step() self.optim.zero_grad() # log if not (steps % self.log_every): self.print(f"{steps}: loss: {logs['loss']:0.3f}") self.accelerator.log({"train_loss": logs['loss']}, step=steps) # sample results every so often self.accelerator.wait_for_everyone() if self.is_main and not (steps % self.save_results_every): x, = next(self.valid_dl_iter) with torch.inference_mode(): self.train_wrapper.eval() valid_loss, _ = self.train_wrapper(x) self.print(f'{steps}: valid loss {valid_loss:0.3f}') self.accelerator.log({"valid_loss": valid_loss}, step=steps) # save model every so often if self.is_main and not (steps % self.save_model_every): model_path = str(self.results_folder / f'speech.speech.{steps}.pt') self.save(model_path) self.print(f'{steps}: saving model to {str(self.results_folder)}') self.steps += 1 return logs def train(self, log_fn = noop): while self.steps < self.num_train_steps: logs = self.train_step() log_fn(logs) self.print('training complete') class SemanticToTextTrainer(nn.Module): @beartype def __init__( self, model: TextToSemantic, *, num_train_steps, num_warmup_steps, batch_size, dataset: Optional[Dataset] = None, lr = 3e-4, initial_lr = 1e-5, grad_accum_every = 1, wd = 0., max_grad_norm = 0.5, valid_frac = 0.05, random_split_seed = 42, log_every = 10, save_results_every = 100, save_model_every = 1000, results_folder = './results', accelerate_kwargs: dict = dict(), split_batches = False, drop_last = False, force_clear_prev_results = None ): super().__init__() check_one_trainer() self.accelerator = Accelerator( split_batches = split_batches, **accelerate_kwargs ) self.model = model self.train_wrapper = SemanticToTextWrapper(model = model) self.register_buffer('steps', torch.Tensor([0])) self.num_train_steps = num_train_steps self.num_warmup_steps = num_warmup_steps self.batch_size = batch_size self.grad_accum_every = grad_accum_every # when doing backtranslation # encoder is frozen (and presumably all the speech embeddings) model.unfreeze_all() model.freeze_speech_emb() model.freeze_encoder() # optimizers # get_optimizer should filter out frozen parameters (ones with requires_grad set to False) # https://github.com/lucidrains/audiolm-pytorch/blob/main/audiolm_pytorch/optimizer.py#L24 self.optim = get_optimizer( model.parameters(), lr = lr, wd = wd, filter_by_requires_grad = True ) self.lr = lr self.initial_lr = initial_lr self.scheduler = CosineAnnealingLR(self.optim, T_max = num_train_steps) # max grad norm self.max_grad_norm = max_grad_norm # create dataset self.ds = dataset # split for validation if valid_frac > 0: train_size = int((1 - valid_frac) * len(self.ds)) valid_size = len(self.ds) - train_size self.ds, self.valid_ds = random_split(self.ds, [train_size, valid_size], generator = torch.Generator().manual_seed(random_split_seed)) self.print(f'training with dataset of {len(self.ds)} samples and validating with randomly splitted {len(self.valid_ds)} samples') else: self.valid_ds = self.ds self.print(f'training with shared training and valid dataset of {len(self.ds)} samples') assert len(self.ds) >= batch_size, 'dataset must have sufficient samples for training' assert len(self.valid_ds) >= batch_size, f'validation dataset must have sufficient number of samples (currently {len(self.valid_ds)}) for training' # dataloader self.dl = get_dataloader(self.ds, batch_size = batch_size, shuffle = True, drop_last = drop_last) self.valid_dl = get_dataloader(self.valid_ds, batch_size = batch_size, shuffle = True, drop_last = drop_last) # prepare with accelerator ( self.train_wrapper, self.optim, self.scheduler, self.dl, self.valid_dl ) = self.accelerator.prepare( self.train_wrapper, self.optim, self.scheduler, self.dl, self.valid_dl ) # dataloader iterators self.dl_iter = cycle(self.dl) self.valid_dl_iter = cycle(self.valid_dl) self.log_every = log_every self.save_model_every = save_model_every self.save_results_every = save_results_every self.results_folder = Path(results_folder) if self.is_main and force_clear_prev_results is True or (not exists(force_clear_prev_results) and len([*self.results_folder.glob('**/*')]) > 0 and yes_or_no('do you want to clear previous experiment checkpoints and results?')): rmtree(str(self.results_folder)) self.results_folder.mkdir(parents = True, exist_ok = True) hps = {"num_train_steps": num_train_steps, "num_warmup_steps": num_warmup_steps, "learning_rate": lr, "initial_learning_rate": lr} self.accelerator.init_trackers("semantictext", config=hps) def save(self, path): pkg = dict( model = self.accelerator.get_state_dict(self.model), optim = self.optim.state_dict(), scheduler = self.scheduler.state_dict() ) torch.save(pkg, path) def load(self, path, restore_optimizer = True): model = self.accelerator.unwrap_model(self.model) pkg = model.load(path) if restore_optimizer: self.optim.load_state_dict(pkg['optim']) self.scheduler.load_state_dict(pkg['scheduler']) # + 1 to start from the next step and avoid overwriting the last checkpoint self.steps = torch.tensor([checkpoint_num_steps(path) + 1], device=self.device) def print(self, msg): self.accelerator.print(msg) def generate(self, *args, **kwargs): return self.train_wrapper.generate(*args, **kwargs) @property def device(self): return self.accelerator.device @property def is_distributed(self): return not (self.accelerator.distributed_type == DistributedType.NO and self.accelerator.num_processes == 1) @property def is_main(self): return self.accelerator.is_main_process @property def is_local_main(self): return self.accelerator.is_local_main_process def warmup(self, step): if step < self.num_warmup_steps: return self.initial_lr + (self.lr - self.initial_lr) * step / self.num_warmup_steps else: return self.lr def train_step(self): steps = int(self.steps.item()) self.model.train() # adjust the lr according to the schedule if steps < self.num_warmup_steps: # Apply warmup lr = self.warmup(steps) for param_group in self.optim.param_groups: param_group['lr'] = lr else: # After warmup period, start to apply CosineAnnealingLR self.scheduler.step() # logs logs = {} # update vae (generator) for _ in range(self.grad_accum_every): semantic_token_ids, grapheme_token_ids = next(self.dl_iter) loss, _ = self.train_wrapper(semantic_token_ids = semantic_token_ids, grapheme_token_ids = grapheme_token_ids) self.accelerator.backward(loss / self.grad_accum_every) accum_log(logs, {'loss': loss.item() / self.grad_accum_every}) if exists(self.max_grad_norm): self.accelerator.clip_grad_norm_(self.model.parameters(), self.max_grad_norm) self.optim.step() self.optim.zero_grad() # log if not (steps % self.log_every): self.print(f"{steps}: loss: {logs['loss']:0.3f}") self.accelerator.log({"train_loss": logs['loss']}, step=steps) # sample results every so often self.accelerator.wait_for_everyone() if self.is_main and not (steps % self.save_results_every): semantic_token_ids, grapheme_token_ids = next(self.valid_dl_iter) with torch.inference_mode(): self.train_wrapper.eval() valid_loss, _ = self.train_wrapper(semantic_token_ids = semantic_token_ids, grapheme_token_ids = grapheme_token_ids) self.print(f'{steps}: valid loss {valid_loss:0.3f}') self.accelerator.log({"valid_loss": valid_loss}, step=steps) # save model every so often if self.is_main and not (steps % self.save_model_every): model_path = str(self.results_folder / f'semantic.text.{steps}.pt') self.save(model_path) self.print(f'{steps}: saving model to {str(self.results_folder)}') self.steps += 1 return logs def train(self, log_fn = noop): while self.steps < self.num_train_steps: logs = self.train_step() log_fn(logs) self.print('training complete') class TextToSemanticTrainer(nn.Module): @beartype def __init__( self, model: TextToSemantic, *, num_train_steps, num_warmup_steps, batch_size, dataset: Optional[Dataset] = None, generated_audio_text_dataset_folder = None, dataset_delimiter_id = -1, lr = 3e-4, initial_lr = 1e-5, grad_accum_every = 1, wd = 0., max_grad_norm = 0.5, valid_frac = 0.05, random_split_seed = 42, log_every = 10, save_results_every = 100, save_model_every = 1000, results_folder = './results', accelerate_kwargs: dict = dict(), split_batches = False, drop_last = False, force_clear_prev_results = None, freeze_encoder_layers_below = 2 ): super().__init__() check_one_trainer() self.accelerator = Accelerator( split_batches = split_batches, **accelerate_kwargs ) self.model = model self.train_wrapper = TextToSemanticWrapper(model = model) self.register_buffer('steps', torch.Tensor([0])) self.num_train_steps = num_train_steps self.num_warmup_steps = num_warmup_steps self.batch_size = batch_size self.grad_accum_every = grad_accum_every # when doing text to semantic generation # encoder is partially frozen and decoder is frozen model.unfreeze_all() model.freeze_speech_emb() model.freeze_encoder_below_layer(freeze_encoder_layers_below) model.freeze_decoder() # optimizers # get_optimizer should filter out frozen parameters (ones with requires_grad set to False) # https://github.com/lucidrains/audiolm-pytorch/blob/main/audiolm_pytorch/optimizer.py#L24 self.optim = get_optimizer( model.parameters(), lr = lr, wd = wd, filter_by_requires_grad = True ) self.lr = lr self.initial_lr = initial_lr self.scheduler = CosineAnnealingLR(self.optim, T_max = num_train_steps) # max grad norm self.max_grad_norm = max_grad_norm # create dataset datasets = [] if exists(dataset): assert len(dataset) > 0 and is_bearable(dataset[0], Tuple[IndicesTensor, IndicesTensor]), 'audio-text dataset must return text and semantic token ids as a tuple of two tensors' datasets.append(dataset) if exists(generated_audio_text_dataset_folder): pseudo_labelled_dataset = GeneratedAudioTextDataset( folder = generated_audio_text_dataset_folder, delimiter_id = dataset_delimiter_id ) datasets.append(pseudo_labelled_dataset) # concat the small labelled dataset with the pseudo-labelled dataset at the folder designated assert len(datasets) > 0 self.ds = ConcatDataset(datasets) # split for validation if valid_frac > 0: train_size = int((1 - valid_frac) * len(self.ds)) valid_size = len(self.ds) - train_size self.ds, self.valid_ds = random_split(self.ds, [train_size, valid_size], generator = torch.Generator().manual_seed(random_split_seed)) self.print(f'training with dataset of {len(self.ds)} samples and validating with randomly splitted {len(self.valid_ds)} samples') else: self.valid_ds = self.ds self.print(f'training with shared training and valid dataset of {len(self.ds)} samples') assert len(self.ds) >= batch_size, 'dataset must have sufficient samples for training' assert len(self.valid_ds) >= batch_size, f'validation dataset must have sufficient number of samples (currently {len(self.valid_ds)}) for training' # dataloader self.dl = get_dataloader(self.ds, batch_size = batch_size, shuffle = True, drop_last = drop_last) self.valid_dl = get_dataloader(self.valid_ds, batch_size = batch_size, shuffle = True, drop_last = drop_last) # prepare with accelerator ( self.train_wrapper, self.optim, self.scheduler, self.dl, self.valid_dl ) = self.accelerator.prepare( self.train_wrapper, self.optim, self.scheduler, self.dl, self.valid_dl ) # dataloader iterators self.dl_iter = cycle(self.dl) self.valid_dl_iter = cycle(self.valid_dl) self.save_model_every = save_model_every self.save_results_every = save_results_every self.log_every = log_every self.results_folder = Path(results_folder) if self.is_main and force_clear_prev_results is True or (not exists(force_clear_prev_results) and len([*self.results_folder.glob('**/*')]) > 0 and yes_or_no('do you want to clear previous experiment checkpoints and results?')): rmtree(str(self.results_folder)) self.results_folder.mkdir(parents = True, exist_ok = True) hps = {"num_train_steps": num_train_steps, "num_warmup_steps": num_warmup_steps, "learning_rate": lr, "initial_learning_rate": lr} self.accelerator.init_trackers("textsemantic", config=hps) def save(self, path): pkg = dict( model = self.accelerator.get_state_dict(self.model), optim = self.optim.state_dict(), scheduler = self.scheduler.state_dict() ) torch.save(pkg, path) def load(self, path, restore_optimizer = True): model = self.accelerator.unwrap_model(self.model) pkg = model.load(path) if restore_optimizer: self.optim.load_state_dict(pkg['optim']) self.scheduler.load_state_dict(pkg['scheduler']) # + 1 to start from the next step and avoid overwriting the last checkpoint self.steps = torch.tensor([checkpoint_num_steps(path) + 1], device=self.device) def print(self, msg): self.accelerator.print(msg) def generate(self, *args, **kwargs): return self.train_wrapper.generate(*args, **kwargs) @property def device(self): return self.accelerator.device @property def is_distributed(self): return not (self.accelerator.distributed_type == DistributedType.NO and self.accelerator.num_processes == 1) @property def is_main(self): return self.accelerator.is_main_process @property def is_local_main(self): return self.accelerator.is_local_main_process def warmup(self, step): if step < self.num_warmup_steps: return self.initial_lr + (self.lr - self.initial_lr) * step / self.num_warmup_steps else: return self.lr def train_step(self): steps = int(self.steps.item()) self.model.train() # adjust the lr according to the schedule if steps < self.num_warmup_steps: # Apply warmup lr = self.warmup(steps) for param_group in self.optim.param_groups: param_group['lr'] = lr else: # After warmup period, start to apply CosineAnnealingLR self.scheduler.step() # logs logs = {} # update vae (generator) for _ in range(self.grad_accum_every): semantic_token_ids, grapheme_token_ids = next(self.dl_iter) loss, _ = self.train_wrapper(semantic_token_ids = semantic_token_ids, grapheme_token_ids = grapheme_token_ids) self.accelerator.backward(loss / self.grad_accum_every) accum_log(logs, {'loss': loss.item() / self.grad_accum_every}) if exists(self.max_grad_norm): self.accelerator.clip_grad_norm_(self.model.parameters(), self.max_grad_norm) self.optim.step() self.optim.zero_grad() # log if not (steps % self.log_every): self.print(f"{steps}: loss: {logs['loss']:0.3f}") self.accelerator.log({"train_loss": logs['loss']}, step=steps) # sample results every so often self.accelerator.wait_for_everyone() if self.is_main and not (steps % self.save_results_every): semantic_token_ids, grapheme_token_ids = next(self.valid_dl_iter) with torch.inference_mode(): self.train_wrapper.eval() valid_loss, _ = self.train_wrapper(semantic_token_ids = semantic_token_ids, grapheme_token_ids = grapheme_token_ids) self.print(f'{steps}: valid loss {valid_loss:0.3f}') self.accelerator.log({"valid_loss": valid_loss}, step=steps) # save model every so often if self.is_main and not (steps % self.save_model_every): model_path = str(self.results_folder / f'text.semantic.{steps}.pt') self.save(model_path) self.print(f'{steps}: saving model to {str(self.results_folder)}') self.steps += 1 return logs def train(self, log_fn = noop): while self.steps < self.num_train_steps: logs = self.train_step() log_fn(logs) self.print('training complete')
spear-tts-pytorch-main
spear_tts_pytorch/trainer.py
from pathlib import Path import torch from torch.utils.data import Dataset from beartype import beartype # mock dataset class MockDataset(Dataset): def __init__(self, length: int): self.length = length def __len__(self): return self.length def __getitem__(self, ind): return torch.randn(1024) # generated audio-text dataset class GeneratedAudioTextDataset(Dataset): @beartype def __init__( self, folder: str, delimiter_id: int = -1 ): self.folder = Path(folder) assert self.folder.exists() and self.folder.is_dir() self.paths = list(self.folder.glob('*.pt')) self.delimiter_id = delimiter_id def __len__(self): return len(self.paths) def __getitem__(self, ind): path = self.paths[ind] tensor = torch.load(str(path)) delimiter_mask = tensor == self.delimiter_id assert delimiter_mask.any(), f'delimeter (<audio> <delimeter> <text>) not found' ind = (delimiter_mask.cumsum(dim = -1) == 0).sum().item() return tensor[:ind], tensor[(ind + 1):]
spear-tts-pytorch-main
spear_tts_pytorch/data.py
from setuptools import setup, find_packages setup( name = 'coordinate-descent-attention', packages = find_packages(exclude=[]), version = '0.0.11', license='MIT', description = 'Coordinate Descent Attention - Pytorch', author = 'Phil Wang', author_email = 'lucidrains@gmail.com', long_description_content_type = 'text/markdown', url = 'https://github.com/lucidrains/coodinate-descent-attention', keywords = [ 'artificial intelligence', 'deep learning', 'attention mechanism' ], install_requires=[ 'einops>=0.6.1', 'torch>=1.6', 'colt5-attention>=0.9.0' ], classifiers=[ 'Development Status :: 4 - Beta', 'Intended Audience :: Developers', 'Topic :: Scientific/Engineering :: Artificial Intelligence', 'License :: OSI Approved :: MIT License', 'Programming Language :: Python :: 3.6', ], )
coordinate-descent-attention-main
setup.py
import gzip import random import tqdm import numpy as np import torch from torch.optim import Adam from torch.nn import functional as F from torch.utils.data import DataLoader, Dataset from coordinate_descent_attention import Transformer, AutoregressiveWrapper # constants NUM_BATCHES = int(1e5) BATCH_SIZE = 4 GRADIENT_ACCUMULATE_EVERY = 4 LEARNING_RATE = 1e-4 VALIDATE_EVERY = 100 PRIME_LENGTH = 128 GENERATE_EVERY = 500 GENERATE_LENGTH = 512 SEQ_LEN = 512 # helpers def cycle(loader): while True: for data in loader: yield data def decode_token(token): return str(chr(max(32, token))) def decode_tokens(tokens): return "".join(list(map(decode_token, tokens))) # instantiate transformer model = Transformer( num_tokens = 256, dim = 512, depth = 8, seq_len = SEQ_LEN, attn_use_coor_descent = True, ff_use_coor_descent = True, attn_coor_descent_sparsity_k = 2, ff_coor_descent_sparsity_k = 128, coor_descent_iters = 25 ) model = AutoregressiveWrapper(model).cuda() # prepare enwik8 data with gzip.open("./data/enwik8.gz") as file: data = np.frombuffer(file.read(int(95e6)), dtype=np.uint8).copy() np_train, np_valid = np.split(data, [int(90e6)]) data_train, data_val = torch.from_numpy(np_train), torch.from_numpy(np_valid) class TextSamplerDataset(Dataset): def __init__(self, data, seq_len): super().__init__() self.data = data self.seq_len = seq_len def __getitem__(self, index): rand_start = torch.randint(0, self.data.size(0) - self.seq_len, (1,)) full_seq = self.data[rand_start : rand_start + self.seq_len + 1].long() return full_seq.cuda() def __len__(self): return self.data.size(0) // self.seq_len train_dataset = TextSamplerDataset(data_train, SEQ_LEN) val_dataset = TextSamplerDataset(data_val, SEQ_LEN) train_loader = cycle(DataLoader(train_dataset, batch_size=BATCH_SIZE)) val_loader = cycle(DataLoader(val_dataset, batch_size=BATCH_SIZE)) # optimizer optim = Adam(model.parameters(), lr = LEARNING_RATE) # training for i in tqdm.tqdm(range(NUM_BATCHES), mininterval = 10.0, desc = "training"): model.train() for _ in range(GRADIENT_ACCUMULATE_EVERY): loss = model(next(train_loader)) loss.backward(loss / GRADIENT_ACCUMULATE_EVERY) print(f"training loss: {loss.item()}") torch.nn.utils.clip_grad_norm_(model.parameters(), 0.5) optim.step() optim.zero_grad() if i % VALIDATE_EVERY == 0: model.eval() with torch.no_grad(): loss = model(next(val_loader)) print(f"validation loss: {loss.item()}") if i % GENERATE_EVERY == 0: model.eval() inp = random.choice(val_dataset)[:PRIME_LENGTH] prime = decode_tokens(inp) print(f"%s \n\n %s", (prime, "*" * 100)) sample = model.generate(inp[None, ...], GENERATE_LENGTH) output_str = decode_tokens(sample[0]) print(output_str, "\n")
coordinate-descent-attention-main
train.py
import torch from torch import nn import torch.nn.functional as F from einops import rearrange # helper function def exists(val): return val is not None def eval_decorator(fn): def inner(model, *args, **kwargs): was_training = model.training model.eval() out = fn(model, *args, **kwargs) model.train(was_training) return out return inner # top k filtering def top_k(logits, thres = 0.9): k = int((1 - thres) * logits.shape[-1]) val, ind = torch.topk(logits, k) probs = torch.full_like(logits, -torch.finfo(logits.dtype).max) probs.scatter_(1, ind, val) return probs class AutoregressiveWrapper(nn.Module): def __init__( self, net, pad_value = 0 ): super().__init__() self.seq_len = net.seq_len self.pad_value = pad_value self.net = net @torch.no_grad() @eval_decorator def generate( self, prompt, seq_len, temperature=1.0, filter_thres=0.9, **kwargs ): b, t, device = *prompt.shape, prompt.device out = prompt for _ in range(seq_len): logits = self.net(out[:, -self.seq_len:], **kwargs)[:, -1] filtered_logits = top_k(logits, thres = filter_thres) probs = F.softmax(filtered_logits / temperature, dim = -1) sample = torch.multinomial(probs, 1) out = torch.cat((out, sample), dim = -1) out = out[:, t:] return out def forward(self, x, **kwargs): x, labels = x[:, :-1], x[:, 1:] logits = self.net(x, **kwargs) logits = rearrange(logits, "b c n -> b n c") return F.cross_entropy(logits, labels)
coordinate-descent-attention-main
coordinate_descent_attention/autoregressive_wrapper.py
from coordinate_descent_attention.coordinate_descent_attention import Transformer, Attention from coordinate_descent_attention.autoregressive_wrapper import AutoregressiveWrapper
coordinate-descent-attention-main
coordinate_descent_attention/__init__.py
import torch import torch.nn.functional as F from torch import nn, einsum from einops import rearrange, repeat from colt5_attention import coor_descent from colt5_attention.triton_coor_descent import triton_coor_descent # helpers def exists(val): return val is not None def default(val, d): return val if exists(val) else d # classes class FeedForward(nn.Module): def __init__( self, dim, mult = 4, use_coor_descent = False, coor_descent_iters = 20, coor_descent_sparsity_k = None, coor_descent_eps = 1e-1, coor_descent_eps_init = 4., coor_descent_eps_decay = 0.7, ): super().__init__() dim_hidden = int(dim * mult) self.use_coor_descent = use_coor_descent self.coor_descent_iters = coor_descent_iters self.coor_descent_sparsity_k = default(coor_descent_sparsity_k, dim_hidden // 10) self.coor_descent_eps = coor_descent_eps self.coor_descent_eps_init = coor_descent_eps_init self.coor_descent_eps_decay = coor_descent_eps_decay self.proj_in = nn.Sequential( nn.LayerNorm(dim), nn.Linear(dim, dim_hidden), ) self.proj_out = nn.Linear(dim_hidden, dim) def forward(self, x): x = self.proj_in(x) if self.use_coor_descent: x = triton_coor_descent( x, n_iters = self.coor_descent_iters, k = self.coor_descent_sparsity_k, eps = self.coor_descent_eps, eps_init = self.coor_descent_eps_init, eps_decay = eslf.coor_descent_eps_decay, checkpoint_segments = self.coor_descent_iters // 5 ) else: x = F.gelu(x) return self.proj_out(x) class Attention(nn.Module): def __init__( self, dim, dim_head = 64, heads = 8, use_coor_descent = False, coor_descent_iters = 20, coor_descent_sparsity_k = 1, coor_descent_eps = 1e-1, coor_descent_eps_init = 4., coor_descent_eps_decay = 0.7, attn_null_kv = 0, learned_sparsity_k = False ): super().__init__() self.scale = dim_head ** -0.5 self.heads = heads dim_inner = dim_head * heads self.use_coor_descent = use_coor_descent self.coor_descent_iters = coor_descent_iters self.coor_descent_sparsity_k = coor_descent_sparsity_k self.coor_descent_eps = coor_descent_eps self.coor_descent_eps_init = coor_descent_eps_init self.coor_descent_eps_decay = coor_descent_eps_decay self.to_learned_k = None if learned_sparsity_k: self.to_learned_k = nn.Linear(dim, heads) nn.init.constant_(self.to_learned_k.bias, -10) self.norm = nn.LayerNorm(dim) self.null_kv = nn.Parameter(torch.randn(2, heads, attn_null_kv, dim_head)) self.to_qkv = nn.Linear(dim, dim_inner * 3, bias = False) self.to_out = nn.Linear(dim_inner, dim, bias = False) def forward(self, x): b, n, h, device, dtype = *x.shape[:2], self.heads, x.device, x.dtype x = self.norm(x) # get queries, keys, values, and split heads q, k, v = self.to_qkv(x).chunk(3, dim = -1) q, k, v = map(lambda t: rearrange(t, 'b n (h d) -> b h n d', h = h), (q, k, v)) # add null key value if needed if self.null_kv.numel() > 0: nk, nv = map(lambda t: repeat(t, 'h n d -> b h n d', b = b), self.null_kv) k = torch.cat((nk, k), dim = -2) v = torch.cat((nv, v), dim = -2) # measure similarity q = q * self.scale sim = einsum('b h i d, b h j d -> b h i j', q, k) i, j = sim.shape[-2:] causal_mask = torch.ones((i, j), device = device, dtype = torch.bool).triu(j - i + 1) # whether to use coordinate descent or not if self.use_coor_descent: if exists(self.to_learned_k): sparsity_k = self.to_learned_k(x).sigmoid() * (self.coor_descent_sparsity_k - 1) + 1 sparsity_k = rearrange(sparsity_k, 'b i h -> (b h i)') else: sparsity_k = torch.ones(i, device = device, dtype = dtype) * self.coor_descent_sparsity_k causal_mask = repeat(causal_mask, 'i j -> b h i j', b = sim.shape[0], h = sim.shape[1]) attn = triton_coor_descent( sim, n_iters = self.coor_descent_iters, k = sparsity_k, eps = self.coor_descent_eps, eps_decay = self.coor_descent_eps_decay, eps_init = self.coor_descent_eps_init, mask = ~causal_mask, checkpoint_segments = self.coor_descent_iters // 5 ) else: sim = sim.masked_fill(causal_mask, -torch.finfo(sim.dtype).max) attn = sim.softmax(dim = -1) # aggregate out = einsum('b h i j, b h j d -> b h i d', attn, v) # combine heads out = rearrange(out, 'b h n d -> b n (h d)') return self.to_out(out) # transformer class Transformer(nn.Module): def __init__( self, *, num_tokens, dim, seq_len, depth, dim_head = 64, heads = 8, ff_mult = 4, attn_use_coor_descent = False, ff_use_coor_descent = False, attn_coor_descent_sparsity_k = 2, ff_coor_descent_sparsity_k = 2, coor_descent_iters = 15, coor_descent_eps = 1e-1, attn_null_kv = 0, learned_sparsity_k = False ): super().__init__() self.seq_len = seq_len self.token_emb = nn.Embedding(num_tokens, dim) self.pos_emb = nn.Embedding(seq_len, dim) self.layers = nn.ModuleList([]) coor_kwargs = dict( coor_descent_iters = coor_descent_iters, coor_descent_eps = coor_descent_eps, ) for _ in range(depth): self.layers.append(nn.ModuleList([ Attention( dim, dim_head = dim_head, heads = heads, use_coor_descent = attn_use_coor_descent, coor_descent_sparsity_k = attn_coor_descent_sparsity_k, attn_null_kv = attn_null_kv, learned_sparsity_k = learned_sparsity_k, **coor_kwargs ), FeedForward( dim, ff_mult, use_coor_descent = ff_use_coor_descent, coor_descent_sparsity_k = ff_coor_descent_sparsity_k, **coor_kwargs ) ])) self.to_logits = nn.Sequential( nn.LayerNorm(dim), nn.Linear(dim, num_tokens) ) def forward(self, x): n, device = x.shape[-1], x.device assert n <= self.seq_len x = self.token_emb(x) x = x + self.pos_emb(torch.arange(n, device = device)) for attn, ff in self.layers: x = attn(x) + x x = ff(x) + x return self.to_logits(x)
coordinate-descent-attention-main
coordinate_descent_attention/coordinate_descent_attention.py
# -*- coding: utf-8 -*- """HyenaDNA training & inference example (Public) This code is adapted from the original colab tutorial on HyenaDNA. Check that out for an easier entry point into the code. We provide the code here as an example for those who want something outside collab, with Huggingface integration. Original file is located at https://colab.research.google.com/drive/1wyVEQd4R3HYLTUOXEEQmp_I8aNC_aLhL """ #@title Imports # for HyenaDNA specifically import torch import math import torch import torch.nn as nn import torch.nn.functional as F from functools import partial from einops import rearrange from typing import Optional from functools import partial from torch import Tensor from torchvision.ops import StochasticDepth from collections import namedtuple import numpy as np import os import json from pathlib import Path from typing import Dict, List, Optional, Sequence, Union from transformers.tokenization_utils import AddedToken, PreTrainedTokenizer """# HyenaDNA """ #@title Hyena layer def fftconv(u, k, D): """ We apply a convolution through the fourier domain (from the Convolution Theorem) """ seqlen = u.shape[-1] fft_size = 2 * seqlen k_f = torch.fft.rfft(k, n=fft_size) / fft_size u_f = torch.fft.rfft(u.to(dtype=k.dtype), n=fft_size) if len(u.shape) > 3: k_f = k_f.unsqueeze(1) y = torch.fft.irfft(u_f * k_f, n=fft_size, norm='forward')[..., :seqlen] out = y + u * D.unsqueeze(-1) return out.to(dtype=u.dtype) @torch.jit.script def mul_sum(q, y): return (q * y).sum(dim=1) class OptimModule(nn.Module): """ Interface for Module that allows registering buffers/parameters with configurable optimizer hyperparameters """ def register(self, name, tensor, lr=None, wd=0.0): """Register a tensor with a configurable learning rate and 0 weight decay""" if lr == 0.0: self.register_buffer(name, tensor) else: self.register_parameter(name, nn.Parameter(tensor)) optim = {} if lr is not None: optim["lr"] = lr if wd is not None: optim["weight_decay"] = wd setattr(getattr(self, name), "_optim", optim) class Sin(nn.Module): """The Sin activation function for the Hyena Filter function.""" def __init__(self, dim, w=10, train_freq=True): super().__init__() self.freq = nn.Parameter(w * torch.ones(1, dim)) if train_freq else w * torch.ones(1, dim) def forward(self, x): return torch.sin(self.freq * x) class PositionalEmbedding(OptimModule): def __init__(self, emb_dim: int, seq_len: int, lr_pos_emb: float=1e-5, **kwargs): """Complex exponential positional embeddings for Hyena filters.""" super().__init__() self.seq_len = seq_len # The time embedding fed to the filteres is normalized so that t_f = 1 t = torch.linspace(0, 1, self.seq_len)[None, :, None] # 1, L, 1 if emb_dim > 1: bands = (emb_dim - 1) // 2 # To compute the right embeddings we use the "proper" linspace t_rescaled = torch.linspace(0, seq_len - 1, seq_len)[None, :, None] w = 2 * math.pi * t_rescaled / seq_len # 1, L, 1 f = torch.linspace(1e-4, bands - 1, bands)[None, None] z = torch.exp(-1j * f * w) z = torch.cat([t, z.real, z.imag], dim=-1) self.register("z", z, lr=lr_pos_emb) self.register("t", t, lr=0.0) def forward(self, L): return self.z[:, :L], self.t[:, :L] class ExponentialModulation(OptimModule): """The window function applied to the output of the (MLP) filter function.""" def __init__( self, d_model, fast_decay_pct=0.3, slow_decay_pct=1.5, target=1e-2, modulation_lr=0.0, modulate: bool=True, shift: float = 0.05, **kwargs ): super().__init__() self.modulate = modulate self.shift = shift max_decay = math.log(target) / fast_decay_pct min_decay = math.log(target) / slow_decay_pct deltas = torch.linspace(min_decay, max_decay, d_model)[None, None] self.register("deltas", deltas, lr=modulation_lr) def forward(self, t, x): if self.modulate: decay = torch.exp(-t * self.deltas.abs()) x = x * (decay + self.shift) return x class HyenaFilter(OptimModule): def __init__( self, d_model, emb_dim=3, # dim of input to MLP, augments with positional encoding order=16, # width of the implicit MLP fused_fft_conv=False, seq_len=1024, lr=1e-3, lr_pos_emb=1e-5, dropout=0.0, w=1, # frequency of periodic activations wd=0, # weight decay of kernel parameters bias=True, num_inner_mlps=2, normalized=False, **kwargs ): """ Implicit long filter with modulation. Args: d_model: number of channels in the input emb_dim: dimension of the positional encoding (`emb_dim` - 1) // 2 is the number of bands order: width of the FFN num_inner_mlps: number of inner linear layers inside filter MLP Note: filter_dropout is not implemented """ super().__init__() self.d_model = d_model self.use_bias = bias self.fused_fft_conv = fused_fft_conv self.bias = nn.Parameter(torch.randn(self.d_model)) self.dropout = nn.Dropout(dropout) act = Sin(dim=order, w=w) self.emb_dim = emb_dim assert emb_dim % 2 != 0 and emb_dim >= 3, "emb_dim must be odd and greater or equal to 3 (time, sine and cosine)" self.seq_len = seq_len self.pos_emb = PositionalEmbedding(emb_dim, seq_len, lr_pos_emb) self.implicit_filter = nn.Sequential( nn.Linear(emb_dim, order), act, ) for i in range(num_inner_mlps): self.implicit_filter.append(nn.Linear(order, order)) self.implicit_filter.append(act) self.implicit_filter.append(nn.Linear(order, d_model, bias=False)) self.modulation = ExponentialModulation(d_model, **kwargs) self.normalized = normalized for c in self.implicit_filter.children(): for name, v in c.state_dict().items(): optim = {"weight_decay": wd, "lr": lr} setattr(getattr(c, name), "_optim", optim) def filter(self, L, *args, **kwargs): z, t = self.pos_emb(L) h = self.implicit_filter(z) h = self.modulation(t, h) return h def forward(self, x, L, k=None, bias=None, *args, **kwargs): if k is None: k = self.filter(L) # Ensure compatibility with filters that return a tuple k = k[0] if type(k) is tuple else k y = fftconv(x, k, bias) return y class HyenaOperator(nn.Module): def __init__( self, d_model, l_max, order=2, filter_order=64, dropout=0.0, filter_dropout=0.0, **filter_args, ): r""" Hyena operator described in the paper https://arxiv.org/pdf/2302.10866.pdf Args: d_model (int): Dimension of the input and output embeddings (width of the layer) l_max: (int): Maximum input sequence length. Defaults to None order: (int): Depth of the Hyena recurrence. Defaults to 2 dropout: (float): Dropout probability. Defaults to 0.0 filter_dropout: (float): Dropout probability for the filter. Defaults to 0.0 """ super().__init__() self.d_model = d_model self.l_max = l_max self.order = order inner_width = d_model * (order + 1) self.dropout = nn.Dropout(dropout) self.in_proj = nn.Linear(d_model, inner_width) self.out_proj = nn.Linear(d_model, d_model) self.short_filter = nn.Conv1d( inner_width, inner_width, 3, padding=2, groups=inner_width ) self.filter_fn = HyenaFilter( d_model * (order - 1), order=filter_order, seq_len=l_max, channels=1, dropout=filter_dropout, **filter_args ) def forward(self, u, *args, **kwargs): l = u.size(-2) l_filter = min(l, self.l_max) u = self.in_proj(u) u = rearrange(u, 'b l d -> b d l') uc = self.short_filter(u)[...,:l_filter] *x, v = uc.split(self.d_model, dim=1) k = self.filter_fn.filter(l_filter)[0] k = rearrange(k, 'l (o d) -> o d l', o=self.order - 1) bias = rearrange(self.filter_fn.bias, '(o d) -> o d', o=self.order - 1) for o, x_i in enumerate(reversed(x[1:])): v = self.dropout(v * x_i) v = self.filter_fn(v, l_filter, k=k[o], bias=bias[o]) y = rearrange(v * x[0], 'b d l -> b l d') y = self.out_proj(y) return y #@title Self-Attention (alternative) """ If you'd like to try the HyenaDNA model using attention instead, you can. ie, use a regular decoder only Transformer. """ class SelfAttention(nn.Module): """Implement the scaled dot product attention with softmax. Arguments --------- softmax_scale: The temperature to use for the softmax attention. (default: 1/sqrt(d_keys) where d_keys is computed at runtime) attention_dropout: The dropout rate to apply to the attention (default: 0.0) """ def __init__(self, causal=False, softmax_scale=None, attention_dropout=0.0): super().__init__() self.causal = causal self.softmax_scale = softmax_scale self.dropout_p = attention_dropout def forward(self, qkv, causal=None, key_padding_mask=None): """Implements the multihead softmax attention. Arguments --------- qkv: The tensor containing the query, key, and value. (B, S, 3, H, D) causal: if passed, will override self.causal key_padding_mask: boolean mask to apply to the attention weights. True means to keep, False means to mask out. (B, S) """ batch_size, seqlen = qkv.shape[0], qkv.shape[1] causal = self.causal if causal is None else causal q, k, v = qkv.unbind(dim=2) softmax_scale = self.softmax_scale or 1.0 / math.sqrt(q.shape[-1]) scores = torch.einsum('bthd,bshd->bhts', q, k * softmax_scale) if key_padding_mask is not None: padding_mask = torch.full((batch_size, seqlen), -10000.0, dtype=scores.dtype, device=scores.device) padding_mask.masked_fill_(key_padding_mask, 0.0) # TD [2022-09-30]: Adding is faster than masked_fill_ (idk why, just better kernel I guess) scores = scores + rearrange(padding_mask, 'b s -> b 1 1 s') if causal: # "triu_tril_cuda_template" not implemented for 'BFloat16' # So we have to construct the mask in float causal_mask = torch.triu(torch.full((seqlen, seqlen), -10000.0, device=scores.device), 1) # TD [2022-09-30]: Adding is faster than masked_fill_ (idk why, just better kernel I guess) scores = scores + causal_mask.to(dtype=scores.dtype) attention = torch.softmax(scores, dim=-1, dtype=v.dtype) attention_drop = F.dropout(attention, self.dropout_p if self.training else 0.0) output = torch.einsum('bhts,bshd->bthd', attention_drop, v) return output class MHA(nn.Module): """Multi-head self-attention and cross-attention """ def __init__(self, embed_dim, num_heads, bias=True, dropout=0.0, softmax_scale=None, causal=False, layer_idx=None, dwconv=False,return_residual=False,device=None, dtype=None) -> None: """ return_residual: whether to return the input x along with the output. This is for performance reason: for post-norm architecture, returning the input allows us to fuse the backward of nn.Linear with the residual connection. """ factory_kwargs = {'device': device, 'dtype': dtype} super().__init__() self.embed_dim = embed_dim self.causal = causal self.layer_idx = layer_idx self.dwconv = dwconv self.return_residual = return_residual self.num_heads = num_heads assert self.embed_dim % num_heads == 0, "self.kdim must be divisible by num_heads" self.head_dim = self.embed_dim // num_heads linear_cls = nn.Linear linear_resid_cls = LinearResidual inner_attn_cls = SelfAttention if not self.return_residual: self.Wqkv = linear_cls(embed_dim, 3 * embed_dim, bias=bias, **factory_kwargs) else: self.Wqkv = linear_resid_cls(embed_dim, 3 * embed_dim, bias=bias, **factory_kwargs) if self.dwconv: self.dwconv_qkv = nn.Conv1d(3 * embed_dim, 3 * embed_dim, kernel_size=3, padding=2, groups=3 * embed_dim) self.inner_attn = inner_attn_cls(causal=causal, softmax_scale=softmax_scale, attention_dropout=dropout) # output projection always have the bias (for now) self.out_proj = linear_cls(embed_dim, embed_dim, **factory_kwargs) def forward(self, x, key_padding_mask=None, **kwargs): """ Arguments: x: (batch, seqlen, hidden_dim) (where hidden_dim = num heads * head dim) if cu_seqlens is None and max_seqlen is None, else (total, hidden_dim) where total is the is the sum of the sequence lengths in the batch. cu_seqlens: (batch_size + 1,), dtype torch.int32. The cumulative sequence lengths of the sequences in the batch, used to index into x. Only applicable when using FlashAttention. max_seqlen: int. Maximum sequence length in the batch. key_padding_mask: boolean mask, True means to keep, False means to mask out. (batch, seqlen). Only applicable when not using FlashAttention. mixer_subset: for cross-attention only. If not None, will take a subset of x before applying the query projection. Useful for e.g., ViT where we only care about the CLS token in the last layer. inference_params: for generation. Adapted from Megatron-LM (and Apex) https://github.com/NVIDIA/apex/blob/3ff1a10f72ec07067c4e44759442329804ac5162/apex/transformer/testing/standalone_transformer_lm.py#L470 """ kwargs = ({'key_padding_mask': key_padding_mask, **kwargs}) if not self.return_residual: qkv = self.Wqkv(x) else: qkv, x = self.Wqkv(x) if self.dwconv: qkv = rearrange(self.dwconv_qkv(rearrange(qkv, 'b s d -> b d s'))[..., :-2], 'b d s -> b s d').contiguous() qkv = rearrange(qkv, '... (three h d) -> ... three h d', three=3, d=self.head_dim) context = self.inner_attn(qkv, **kwargs) out = self.out_proj(rearrange(context, '... h d -> ... (h d)')) return out if not self.return_residual else (out, x) #@title MLP layer """ The MLP layer after the mixer layer (HyenaOperator). """ class Mlp(nn.Module): def __init__(self, in_features, hidden_features=None, out_features=None, activation=F.gelu, return_residual=False, device=None, dtype=None): """ From https://github.com/HazyResearch/flash-attention/blob/main/flash_attn/modules/mlp.py """ factory_kwargs = {'device': device, 'dtype': dtype} super().__init__() out_features = out_features or in_features hidden_features = hidden_features or in_features self.return_residual = return_residual self.fc1 = nn.Linear(in_features, hidden_features, **factory_kwargs) self.activation = activation self.fc2 = nn.Linear(hidden_features, out_features, **factory_kwargs) def forward(self, x): y = self.fc1(x) y = self.activation(y) y = self.fc2(y) return y if not self.return_residual else (y, x) #@title Block layer (Hyena + MLP layers) """ A block consists of a Mixer layer (Hyena or attention), and a MLP layer. """ class LinearResidual(nn.Linear): """Wrap nn.Linear to return the residual as well. For compatibility with FusedDense. """ def forward(self, input: torch.Tensor) -> torch.Tensor: return super().forward(input), input class Block(nn.Module): def __init__(self, dim, mixer_cls=None, mlp_cls=None, norm_cls=nn.LayerNorm, dropout_cls=nn.Dropout, prenorm=True, resid_dropout1=0., resid_dropout2=0., drop_path1=0., drop_path2=0., return_residual=False, residual_in_fp32=False): """ From https://github.com/HazyResearch/flash-attention/blob/main/flash_attn/modules/block.py For prenorm=True, this Block has a slightly different structure compared to a regular prenorm Transformer block. The standard block is: LN -> MHA -> Dropout -> Add -> LN -> MLP -> Dropout -> Add. [Ref: https://arxiv.org/abs/2002.04745] Here we have: Dropout -> Add -> LN -> MHA -> Dropout -> Add -> LN -> MLP, returning both the hidden_states (output of the MLP) and the residual. This is for performance reasons, as we can fuse the dropout, add and LayerNorm. The residual needs to be provided (except for the very first block). For prenorm=False, this Block has the same structure as a regular postnorm Transformer block: MHA -> Dropout -> Add -> LN -> MLP -> Dropout -> Add -> LN. return_residual: whether each of the sub-layers (mixer and mlp) will return the residual. This is for performance reason: for post-norm architecture, returning the input allows us to fuse the backward of nn.Linear with the residual connection. """ super().__init__() self.prenorm = prenorm self.return_residual = return_residual self.residual_in_fp32 = residual_in_fp32 if self.residual_in_fp32: assert self.prenorm, 'residual_in_fp32 is only compatible with prenorm=True' if mixer_cls is None: mixer_cls = partial(MHA, num_heads=dim // 64) if mlp_cls is None: mlp_cls = partial(Mlp, hidden_features=4 * dim) self.mixer = mixer_cls() self.dropout1 = dropout_cls(resid_dropout1) self.drop_path1 = StochasticDepth(drop_path1, mode='row') self.norm1 = norm_cls(dim) self.mlp = mlp_cls(dim) if not isinstance(self.mlp, nn.Identity): self.dropout2 = dropout_cls(resid_dropout2) self.drop_path2 = StochasticDepth(drop_path2, mode='row') self.norm2 = norm_cls(dim) def forward(self, hidden_states, residual = None, mixer_subset=None, mixer_kwargs=None): r"""Pass the input through the encoder layer. Args: hidden_states: the sequence to the encoder layer (required). residual: if postnorm, residual=None, If prenorm, hidden_states = Attn/MLP(LN(residual)) mixer_subset: for cross-attention only. If not None, will take a subset of x before applying the query projection. Useful for e.g., ViT where we only care about the CLS token in the last layer. """ if self.prenorm: dropped = self.drop_path1(self.dropout1(hidden_states)) residual = (dropped + residual) if residual is not None else dropped hidden_states = self.norm1(residual.to(dtype=self.norm1.weight.dtype)) if self.residual_in_fp32: residual = residual.to(torch.float32) if mixer_kwargs is None: mixer_kwargs = {} if mixer_subset is not None: mixer_kwargs['mixer_subset'] = mixer_subset hidden_states = self.mixer(hidden_states, **mixer_kwargs) if mixer_subset is not None: residual = residual[:, mixer_subset] if not isinstance(self.mlp, nn.Identity): dropped = self.drop_path2(self.dropout2(hidden_states)) residual = (dropped + residual) if residual is not None else dropped hidden_states = self.norm2(residual.to(dtype=self.norm2.weight.dtype)) if self.residual_in_fp32: residual = residual.to(torch.float32) hidden_states = self.mlp(hidden_states) return hidden_states, residual else: assert residual is None mixer_out = self.mixer( hidden_states, **(mixer_kwargs if mixer_kwargs is not None else {}) ) if self.return_residual: # mixer out is actually a pair here mixer_out, hidden_states = mixer_out hidden_states = self.norm1((self.drop_path1(self.dropout1(mixer_out)) + hidden_states).to(dtype=self.norm1.weight.dtype)) if not isinstance(self.mlp, nn.Identity): mlp_out = self.mlp(hidden_states) if self.return_residual: # mlp out is actually a pair here mlp_out, hidden_states = mlp_out hidden_states = self.norm2((self.drop_path2(self.dropout2(mlp_out)) + hidden_states).to(dtype=self.norm2.weight.dtype)) return hidden_states def create_mixer_cls(layer=None, attn_layer_idx=None, attn_cfg=None, layer_idx=None, device=None, dtype=None): factory_kwargs = {'device': device, 'dtype': dtype} if attn_layer_idx is not None and layer_idx in attn_layer_idx: causal = True if attn_cfg is None else attn_cfg.pop('causal', True) mha_cls = MHA mixer_cls = partial(mha_cls, causal=causal, layer_idx=layer_idx, **(attn_cfg if attn_cfg is not None else {}),**factory_kwargs) else: # mixer_cls = instantiate(registry.layer, layer, partial=True, layer_idx=layer_idx, **factory_kwargs) mixer_cls = partial(HyenaOperator, **layer) return mixer_cls def create_mlp_cls(d_model, d_inner=None, device=None, dtype=None): factory_kwargs = {'device': device, 'dtype': dtype} inner_dim = d_inner if d_inner is not None else 4 * d_model mlp_cls = partial(Mlp, hidden_features=inner_dim, activation=partial(F.gelu, approximate='tanh'), **factory_kwargs) return mlp_cls def create_block(d_model, d_inner=None, layer=None, attn_layer_idx=None, attn_cfg=None, layer_norm_epsilon=1e-5, resid_dropout1=0.0, resid_dropout2=0.0, residual_in_fp32=False, layer_idx=None, device=None, dtype=None): factory_kwargs = {'device': device, 'dtype': dtype} mixer_cls = create_mixer_cls(layer=layer, attn_layer_idx=attn_layer_idx, attn_cfg=attn_cfg, layer_idx=layer_idx, **factory_kwargs) mlp_cls = create_mlp_cls(d_model, d_inner=d_inner, **factory_kwargs) norm_cls = partial(nn.LayerNorm, eps=layer_norm_epsilon, **factory_kwargs) block = Block(d_model, mixer_cls, mlp_cls, norm_cls=norm_cls, prenorm=True, resid_dropout1=resid_dropout1, resid_dropout2=resid_dropout2,residual_in_fp32=residual_in_fp32) block.layer_idx = layer_idx return block # https://github.com/huggingface/transformers/blob/c28d04e9e252a1a099944e325685f14d242ecdcd/src/transformers/models/gpt2/modeling_gpt2.py#L454 def _init_weights(module, n_layer, initializer_range=0.02, rescale_prenorm_residual=True, glu_act=False): if isinstance(module, nn.Linear): nn.init.normal_(module.weight, std=initializer_range) if module.bias is not None: nn.init.zeros_(module.bias) elif isinstance(module, nn.Embedding): nn.init.normal_(module.weight, std=initializer_range) if rescale_prenorm_residual: # Reinitialize selected weights subject to the OpenAI GPT-2 Paper Scheme: # > A modified initialization which accounts for the accumulation on the residual path with model depth. Scale # > the weights of residual layers at initialization by a factor of 1/√N where N is the # of residual layers. # > -- GPT-2 :: https://openai.com/blog/better-language-models/ # # Reference (Megatron-LM): https://github.com/NVIDIA/Megatron-LM/blob/main/megatron/model/gpt_model.py for name, p in module.named_parameters(): if name in ["out_proj.weight", "fc2.weight"]: # Special Scaled Initialization --> There are 2 Layer Norms per Transformer Block nn.init.normal_(p, mean=0.0, std=initializer_range / math.sqrt(2 * n_layer)) # If using GLU activation for now, we scale the std by 2 elif name in ["output_linear.0.weight"]: # Special Scaled Initialization --> There are 2 Layer Norms per Transformer Block if not glu_act: nn.init.normal_(p, mean=0.0, std=initializer_range / math.sqrt(2 * n_layer)) else: out_features = p.shape[0] # Multiplying the first half of the matrix by 2 since sigmoid scales it down by 0.5 # on average. nn.init.normal_(p[:out_features // 2], mean=0.0, std=initializer_range / math.sqrt(2 * n_layer) * 2) #@title Backbone model (stack of blocks) """ A backbone model consists of a stack of blocks. If you use attention, then positional embeddings are included. When using Hyena, then the pos emb revert to doing nothing. """ class GPT2Embeddings(nn.Module): def __init__(self, embed_dim, vocab_size, max_position_embeddings, padding_idx=None, word_embed_proj_dim=None, device=None, dtype=None): """ If max_position_embeddings <= 0, there's no position embeddings If word_embe_proj_dim is not None (e.g., OPT-350m), we embed to that dimension the project up to embed_dim """ factory_kwargs = {'device': device, 'dtype': dtype} super().__init__() if word_embed_proj_dim is None: self.word_embeddings = nn.Embedding(vocab_size, embed_dim, padding_idx=padding_idx, **factory_kwargs) self.project_in = None else: self.word_embeddings = nn.Embedding(vocab_size, word_embed_proj_dim, padding_idx=padding_idx, **factory_kwargs) self.project_in = nn.Linear(word_embed_proj_dim, embed_dim, bias=False, **factory_kwargs) self.max_position_embeddings = max_position_embeddings if self.max_position_embeddings > 0: self.position_embeddings = nn.Embedding(max_position_embeddings, embed_dim, **factory_kwargs) def forward(self, input_ids, position_ids=None): """ input_ids: (batch, seqlen) position_ids: (batch, seqlen) """ batch_size, seqlen = input_ids.shape embeddings = self.word_embeddings(input_ids) if self.project_in is not None: embeddings = self.project_in(embeddings) if self.max_position_embeddings > 0: if position_ids is None: position_ids = torch.arange(seqlen, dtype=torch.long, device=input_ids.device) position_embeddings = self.position_embeddings(position_ids) embeddings = embeddings + position_embeddings return embeddings class LMBackbone(nn.Module): def __init__(self, d_model: int, n_layer: int, d_inner: int, vocab_size: int, process_group=None, layer=None, attn_layer_idx=None, attn_cfg=None, max_position_embeddings=0, resid_dropout: float = 0.0, embed_dropout: float = 0.1, layer_norm_epsilon: float = 1e-5, initializer_cfg=None,residual_in_fp32=False, device=None, dtype=None, **kwargs) -> None: factory_kwargs = {'device': device, 'dtype': dtype} super().__init__() self.process_group = process_group self.residual_in_fp32 = residual_in_fp32 # note max_position_embeddings is 0 for Hyena, and therefore isn't used self.embeddings = GPT2Embeddings(d_model, vocab_size, max_position_embeddings, **factory_kwargs) self.layers = nn.ModuleList([create_block( d_model, d_inner=d_inner, layer=layer, attn_layer_idx=attn_layer_idx, attn_cfg=attn_cfg, layer_norm_epsilon=layer_norm_epsilon, resid_dropout1=embed_dropout if i == 0 else resid_dropout, resid_dropout2=resid_dropout, residual_in_fp32=residual_in_fp32,layer_idx=i, **factory_kwargs, ) for i in range(n_layer)]) self.drop_f = nn.Dropout(resid_dropout) self.ln_f = nn.LayerNorm(d_model, eps=layer_norm_epsilon, **factory_kwargs) self.apply(partial(_init_weights, n_layer=n_layer, **(initializer_cfg if initializer_cfg is not None else {}))) def forward(self, input_ids, position_ids=None): hidden_states = self.embeddings(input_ids, position_ids=position_ids,) residual = None for layer in self.layers: hidden_states, residual = layer(hidden_states, residual) dropped = self.drop_f(hidden_states) residual = (dropped + residual) if residual is not None else dropped hidden_states = self.ln_f(residual.to(dtype=self.ln_f.weight.dtype)) return hidden_states #@title Decoder head layer """ A simple decoder head (using MLP) to predict a sequence level classification. You have the option to average across all the tokens in a sequence or using the "last" token to classify. At least, those 2 worked best for us, but we provide other "modes" as well. We only need this for classification. Otherwise we'll use the hidden states of the backbone as embeddings. """ class SequenceDecoder(nn.Module): def __init__( self, d_model, d_output=None, l_output=None, use_lengths=False, mode="last" ): super().__init__() self.output_transform = nn.Identity() if d_output is None else nn.Linear(d_model, d_output) if l_output is None: self.l_output = None self.squeeze = False elif l_output == 0: # Equivalent to getting an output of length 1 and then squeezing self.l_output = 1 self.squeeze = True else: assert l_output > 0 self.l_output = l_output self.squeeze = False self.use_lengths = use_lengths self.mode = mode if mode == 'ragged': assert not use_lengths def forward(self, x, state=None, lengths=None, l_output=None): """ x: (n_batch, l_seq, d_model) Returns: (n_batch, l_output, d_output) """ if self.l_output is None: if l_output is not None: assert isinstance(l_output, int) # Override by pass in else: # Grab entire output l_output = x.size(-2) squeeze = False else: l_output = self.l_output squeeze = self.squeeze if self.mode == "last": restrict = lambda x: x[..., -l_output:, :] elif self.mode == "first": restrict = lambda x: x[..., :l_output, :] elif self.mode == "pool": restrict = lambda x: ( torch.cumsum(x, dim=-2) / torch.arange( 1, 1 + x.size(-2), device=x.device, dtype=x.dtype ).unsqueeze(-1) )[..., -l_output:, :] def restrict(x): L = x.size(-2) s = x.sum(dim=-2, keepdim=True) if l_output > 1: c = torch.cumsum(x[..., -(l_output - 1) :, :].flip(-2), dim=-2) c = F.pad(c, (0, 0, 1, 0)) s = s - c # (B, l_output, D) s = s.flip(-2) denom = torch.arange( L - l_output + 1, L + 1, dtype=x.dtype, device=x.device ) s = s / denom return s elif self.mode == "sum": restrict = lambda x: torch.cumsum(x, dim=-2)[..., -l_output:, :] # TODO use same restrict function as pool case elif self.mode == 'ragged': assert lengths is not None, "lengths must be provided for ragged mode" # remove any additional padding (beyond max length of any sequence in the batch) restrict = lambda x: x[..., : max(lengths), :] else: raise NotImplementedError( "Mode must be ['last' | 'first' | 'pool' | 'sum']" ) # Restrict to actual length of sequence if self.use_lengths: assert lengths is not None x = torch.stack( [ restrict(out[..., :length, :]) for out, length in zip(torch.unbind(x, dim=0), lengths) ], dim=0, ) else: x = restrict(x) if squeeze: assert x.size(-2) == 1 x = x.squeeze(-2) x = self.output_transform(x) return x def step(self, x, state=None): # Ignore all length logic return self.output_transform(x) #@title Model (backbone + head) """ Putting it all together, the model consists of a backbone model and a decoder head (you can turn off head for embeddings only too). Here we use a simple head to do multi-classification, but can also swap the head to do next token prediction too. We defer to the main HyenaDNA for that code, since pretraining with next token prediction isn't quite feasible on colab. """ class HyenaDNAModel(nn.Module): def __init__(self, d_model: int, n_layer: int, d_inner: int, vocab_size: int, layer=None, attn_layer_idx=None, attn_cfg=None, max_position_embeddings=0, resid_dropout: float = 0.0, embed_dropout: float = 0.1, layer_norm_epsilon: float = 1e-5, initializer_cfg=None,residual_in_fp32=False, pad_vocab_size_multiple: int = 1, use_head=False, n_classes: int = 2, device=None, dtype=None, **kwargs) -> None: factory_kwargs = {'device': device, 'dtype': dtype} super().__init__() if vocab_size % pad_vocab_size_multiple != 0: vocab_size += pad_vocab_size_multiple - (vocab_size % pad_vocab_size_multiple) self.use_head = use_head # check if layer (config) has d_model (HF code differs from main Safari code) if 'd_model' not in layer: layer['d_model'] = d_model self.backbone = LMBackbone( d_model=d_model, n_layer=n_layer, d_inner=d_inner, vocab_size=vocab_size, layer=layer, attn_layer_idx=attn_layer_idx, attn_cfg=attn_cfg, max_position_embeddings=max_position_embeddings, resid_dropout=resid_dropout, embed_dropout=embed_dropout, layer_norm_epsilon=layer_norm_epsilon, initializer_cfg=initializer_cfg, residual_in_fp32=residual_in_fp32, **factory_kwargs, **kwargs ) # we only need a head if doing classification, otherwise we'll use the # hidden states as embeddings if self.use_head: self.head = SequenceDecoder(d_model=d_model, d_output=n_classes, l_output=0, mode='pool') # Initialize weights and apply final processing self.apply(partial(_init_weights, n_layer=n_layer, **(initializer_cfg if initializer_cfg is not None else {}))) # if self.use_head: # self.tie_weights() # def tie_weights(self): # self.head.weight = self.backbone.embeddings.word_embeddings.weight def forward(self, input_ids, position_ids=None, state=None): # state for the repo interface hidden_states = self.backbone(input_ids, position_ids=position_ids) if self.use_head: return self.head(hidden_states) else: return hidden_states """# Data pipeline """ #@title Tokenizer """ Just a simple character level tokenizer. From: https://github.com/dariush-bahrami/character-tokenizer/blob/master/charactertokenizer/core.py CharacterTokenzier for Hugging Face Transformers. This is heavily inspired from CanineTokenizer in transformers package. """ class CharacterTokenizer(PreTrainedTokenizer): def __init__(self, characters: Sequence[str], model_max_length: int, padding_side: str='left', **kwargs): """Character tokenizer for Hugging Face transformers. Args: characters (Sequence[str]): List of desired characters. Any character which is not included in this list will be replaced by a special token called [UNK] with id=6. Following are list of all of the special tokens with their corresponding ids: "[CLS]": 0 "[SEP]": 1 "[BOS]": 2 "[MASK]": 3 "[PAD]": 4 "[RESERVED]": 5 "[UNK]": 6 an id (starting at 7) will be assigned to each character. model_max_length (int): Model maximum sequence length. """ self.characters = characters self.model_max_length = model_max_length bos_token = AddedToken("[BOS]", lstrip=False, rstrip=False) eos_token = AddedToken("[SEP]", lstrip=False, rstrip=False) sep_token = AddedToken("[SEP]", lstrip=False, rstrip=False) cls_token = AddedToken("[CLS]", lstrip=False, rstrip=False) pad_token = AddedToken("[PAD]", lstrip=False, rstrip=False) unk_token = AddedToken("[UNK]", lstrip=False, rstrip=False) mask_token = AddedToken("[MASK]", lstrip=True, rstrip=False) super().__init__( bos_token=bos_token, eos_token=sep_token, sep_token=sep_token, cls_token=cls_token, pad_token=pad_token, mask_token=mask_token, unk_token=unk_token, add_prefix_space=False, model_max_length=model_max_length, padding_side=padding_side, **kwargs, ) self._vocab_str_to_int = { "[CLS]": 0, "[SEP]": 1, "[BOS]": 2, "[MASK]": 3, "[PAD]": 4, "[RESERVED]": 5, "[UNK]": 6, **{ch: i + 7 for i, ch in enumerate(characters)}, } self._vocab_int_to_str = {v: k for k, v in self._vocab_str_to_int.items()} @property def vocab_size(self) -> int: return len(self._vocab_str_to_int) def _tokenize(self, text: str) -> List[str]: return list(text) def _convert_token_to_id(self, token: str) -> int: return self._vocab_str_to_int.get(token, self._vocab_str_to_int["[UNK]"]) def _convert_id_to_token(self, index: int) -> str: return self._vocab_int_to_str[index] def convert_tokens_to_string(self, tokens): return "".join(tokens) def build_inputs_with_special_tokens( self, token_ids_0: List[int], token_ids_1: Optional[List[int]] = None ) -> List[int]: sep = [self.sep_token_id] cls = [self.cls_token_id] result = cls + token_ids_0 + sep if token_ids_1 is not None: result += token_ids_1 + sep return result def get_special_tokens_mask( self, token_ids_0: List[int], token_ids_1: Optional[List[int]] = None, already_has_special_tokens: bool = False, ) -> List[int]: if already_has_special_tokens: return super().get_special_tokens_mask( token_ids_0=token_ids_0, token_ids_1=token_ids_1, already_has_special_tokens=True, ) result = [1] + ([0] * len(token_ids_0)) + [1] if token_ids_1 is not None: result += ([0] * len(token_ids_1)) + [1] return result def create_token_type_ids_from_sequences( self, token_ids_0: List[int], token_ids_1: Optional[List[int]] = None ) -> List[int]: sep = [self.sep_token_id] cls = [self.cls_token_id] result = len(cls + token_ids_0 + sep) * [0] if token_ids_1 is not None: result += len(token_ids_1 + sep) * [1] return result def get_config(self) -> Dict: return { "char_ords": [ord(ch) for ch in self.characters], "model_max_length": self.model_max_length, } @classmethod def from_config(cls, config: Dict) -> "CharacterTokenizer": cfg = {} cfg["characters"] = [chr(i) for i in config["char_ords"]] cfg["model_max_length"] = config["model_max_length"] return cls(**cfg) def save_pretrained(self, save_directory: Union[str, os.PathLike], **kwargs): cfg_file = Path(save_directory) / "tokenizer_config.json" cfg = self.get_config() with open(cfg_file, "w") as f: json.dump(cfg, f, indent=4) @classmethod def from_pretrained(cls, save_directory: Union[str, os.PathLike], **kwargs): cfg_file = Path(save_directory) / "tokenizer_config.json" with open(cfg_file) as f: cfg = json.load(f) return cls.from_config(cfg)
hyena-dna-main
standalone_hyenadna.py
#@title Huggingface Pretrained Wrapper """ This is script is a simple HuggingFace wrapper around a HyenaDNA model, to enable a one click example of how to load the pretrained weights and get embeddings. It will instantiate a HyenaDNA model (model class is in the `standalone_hyenadna.py`), and handle the downloading of pretrained weights from HuggingFace. Check out the colab notebook for a simpler and more complete walk through of how to use HyenaDNA with pretrained weights. """ import json import os import subprocess import torch # import transformers from transformers import PreTrainedModel import re from standalone_hyenadna import HyenaDNAModel from standalone_hyenadna import CharacterTokenizer # helper 1 def inject_substring(orig_str): """Hack to handle matching keys between models trained with and without gradient checkpointing.""" # modify for mixer keys pattern = r"\.mixer" injection = ".mixer.layer" modified_string = re.sub(pattern, injection, orig_str) # modify for mlp keys pattern = r"\.mlp" injection = ".mlp.layer" modified_string = re.sub(pattern, injection, modified_string) return modified_string # helper 2 def load_weights(scratch_dict, pretrained_dict, checkpointing=False): """Loads pretrained (backbone only) weights into the scratch state dict.""" # loop thru state dict of scratch # find the corresponding weights in the loaded model, and set it # need to do some state dict "surgery" for key, value in scratch_dict.items(): if 'backbone' in key: # the state dicts differ by one prefix, '.model', so we add that key_loaded = 'model.' + key # breakpoint() # need to add an extra ".layer" in key if checkpointing: key_loaded = inject_substring(key_loaded) try: scratch_dict[key] = pretrained_dict[key_loaded] except: raise Exception('key mismatch in the state dicts!') # scratch_dict has been updated return scratch_dict class HyenaDNAPreTrainedModel(PreTrainedModel): """ An abstract class to handle weights initialization and a simple interface for downloading and loading pretrained models. """ base_model_prefix = "hyenadna" def __init__(self, config): pass def forward(self, input_ids, **kwargs): return self.model(input_ids, **kwargs) @classmethod def from_pretrained(cls, path, model_name, download=False, config=None, device='cpu', use_head=False, n_classes=2, ): # first check if it is a local path pretrained_model_name_or_path = os.path.join(path, model_name) if os.path.isdir(pretrained_model_name_or_path) and download == False: if config is None: config = json.load(open(os.path.join(pretrained_model_name_or_path, 'config.json'))) else: hf_url = f'https://huggingface.co/LongSafari/{model_name}' subprocess.run(f'rm -rf {pretrained_model_name_or_path}', shell=True) command = f'mkdir -p {path} && cd {path} && git lfs install && git clone {hf_url}' subprocess.run(command, shell=True) if config is None: config = json.load(open(os.path.join(pretrained_model_name_or_path, 'config.json'))) scratch_model = HyenaDNAModel(**config, use_head=use_head, n_classes=n_classes) # the new model format loaded_ckpt = torch.load( os.path.join(pretrained_model_name_or_path, 'weights.ckpt'), map_location=torch.device(device) ) # need to load weights slightly different if using gradient checkpointing if config.get("checkpoint_mixer", False): checkpointing = config["checkpoint_mixer"] == True or config["checkpoint_mixer"] == True else: checkpointing = False # grab state dict from both and load weights state_dict = load_weights(scratch_model.state_dict(), loaded_ckpt['state_dict'], checkpointing=checkpointing) # scratch model has now been updated scratch_model.load_state_dict(state_dict) print("Loaded pretrained weights ok!") return scratch_model #################################################################################################### """# Inference (450k to 1M tokens)! If all you're interested in is getting embeddings on long DNA sequences (inference), then we can do that right here in Colab! * We provide an example how to load the weights from Huggingface. * On the free tier, which uses a T4 GPU w/16GB of memory, we can process 450k tokens / nucleotides. * For processing 1M tokens, you'll need an A100, which Colab offers as a paid tier. * (Don't forget to run the entire notebook above too) -- To pretrain or fine-tune the 1M long sequence model (8 layers, d_model=256), you'll need 8 A100s 80GB, and all that code is in the main repo! """ #@title Single example import json import os import subprocess # import transformers from transformers import PreTrainedModel def inference_single(): ''' this selects which backbone to use, and grabs weights/ config from HF 4 options: 'hyenadna-tiny-1k-seqlen' # fine-tune on colab ok 'hyenadna-small-32k-seqlen' 'hyenadna-medium-160k-seqlen' # inference only on colab 'hyenadna-medium-450k-seqlen' # inference only on colab 'hyenadna-large-1m-seqlen' # inference only on colab ''' # you only need to select which model to use here, we'll do the rest! pretrained_model_name = 'hyenadna-small-32k-seqlen' max_lengths = { 'hyenadna-tiny-1k-seqlen': 1024, 'hyenadna-small-32k-seqlen': 32768, 'hyenadna-medium-160k-seqlen': 160000, 'hyenadna-medium-450k-seqlen': 450000, # T4 up to here 'hyenadna-large-1m-seqlen': 1_000_000, # only A100 (paid tier) } max_length = max_lengths[pretrained_model_name] # auto selects # data settings: use_padding = True rc_aug = False # reverse complement augmentation add_eos = False # add end of sentence token # we need these for the decoder head, if using use_head = False n_classes = 2 # not used for embeddings only # you can override with your own backbone config here if you want, # otherwise we'll load the HF one in None backbone_cfg = None device = 'cuda' if torch.cuda.is_available() else 'cpu' print("Using device:", device) # instantiate the model (pretrained here) if pretrained_model_name in ['hyenadna-tiny-1k-seqlen', 'hyenadna-small-32k-seqlen', 'hyenadna-medium-160k-seqlen', 'hyenadna-medium-450k-seqlen', 'hyenadna-large-1m-seqlen']: # use the pretrained Huggingface wrapper instead model = HyenaDNAPreTrainedModel.from_pretrained( './checkpoints', pretrained_model_name, download=True, config=backbone_cfg, device=device, use_head=use_head, n_classes=n_classes, ) # from scratch elif pretrained_model_name is None: model = HyenaDNAModel(**backbone_cfg, use_head=use_head, n_classes=n_classes) # create tokenizer tokenizer = CharacterTokenizer( characters=['A', 'C', 'G', 'T', 'N'], # add DNA characters, N is uncertain model_max_length=max_length + 2, # to account for special tokens, like EOS add_special_tokens=False, # we handle special tokens elsewhere padding_side='left', # since HyenaDNA is causal, we pad on the left ) #### Single embedding example #### # create a sample 450k long, prepare sequence = 'ACTG' * int(max_length/4) tok_seq = tokenizer(sequence) tok_seq = tok_seq["input_ids"] # grab ids # place on device, convert to tensor tok_seq = torch.LongTensor(tok_seq).unsqueeze(0) # unsqueeze for batch dim tok_seq = tok_seq.to(device) # prep model and forward model.to(device) model.eval() with torch.inference_mode(): embeddings = model(tok_seq) print(embeddings.shape) # embeddings here! # # uncomment to run! (to get embeddings) inference_single() # to run this, just call: # python huggingface.py
hyena-dna-main
huggingface.py
import copy import os import random import time from functools import partial, wraps from typing import Callable, List, Sequence import hydra import numpy as np import pytorch_lightning as pl import torch import torch.nn as nn import wandb from hydra.utils import get_original_cwd from omegaconf import DictConfig, OmegaConf from pytorch_lightning.loggers import WandbLogger from pytorch_lightning.utilities import rank_zero_only, rank_zero_warn from pytorch_lightning.strategies.ddp import DDPStrategy from tqdm.auto import tqdm from pytorch_lightning.strategies.ddp import DDPStrategy import src.models.nn.utils as U import src.utils as utils import src.utils.train from src.dataloaders import SequenceDataset # TODO make registry from src.tasks import decoders, encoders, tasks from src.utils import registry from src.utils.optim_groups import add_optimizer_hooks log = src.utils.train.get_logger(__name__) # Turn on TensorFloat32 (speeds up large model training substantially) import torch.backends torch.backends.cuda.matmul.allow_tf32 = True torch.backends.cudnn.allow_tf32 = True OmegaConf.register_new_resolver('eval', eval) OmegaConf.register_new_resolver('div_up', lambda x, y: (x + y - 1) // y) # Lots of annoying hacks to get WandbLogger to continuously retry on failure class DummyExperiment: """Dummy experiment.""" def nop(self, *args, **kw): pass def __getattr__(self, _): return self.nop def __getitem__(self, idx) -> "DummyExperiment": # enables self.logger.experiment[0].add_image(...) return self def __setitem__(self, *args, **kwargs) -> None: pass def rank_zero_experiment(fn: Callable) -> Callable: """Returns the real experiment on rank 0 and otherwise the DummyExperiment.""" @wraps(fn) def experiment(self): @rank_zero_only def get_experiment(): return fn(self) return get_experiment() or DummyExperiment() return experiment class CustomWandbLogger(WandbLogger): def __init__(self, *args, **kwargs): """Modified logger that insists on a wandb.init() call and catches wandb's error if thrown.""" super().__init__(*args, **kwargs) @property @rank_zero_experiment def experiment(self): r""" Actual wandb object. To use wandb features in your :class:`~pytorch_lightning.core.lightning.LightningModule` do the following. Example:: .. code-block:: python self.logger.experiment.some_wandb_function() """ if self._experiment is None: if self._offline: os.environ["WANDB_MODE"] = "dryrun" attach_id = getattr(self, "_attach_id", None) if wandb.run is not None: # wandb process already created in this instance rank_zero_warn( "There is a wandb run already in progress and newly created instances of `WandbLogger` will reuse" " this run. If this is not desired, call `wandb.finish()` before instantiating `WandbLogger`." ) self._experiment = wandb.run elif attach_id is not None and hasattr(wandb, "_attach"): # attach to wandb process referenced self._experiment = wandb._attach(attach_id) else: # create new wandb process while True: try: self._experiment = wandb.init(**self._wandb_init) break except Exception as e: print("wandb Exception:\n", e) t = random.randint(30, 60) print(f"Sleeping for {t} seconds") time.sleep(t) # define default x-axis if getattr(self._experiment, "define_metric", None): self._experiment.define_metric("trainer/global_step") self._experiment.define_metric("*", step_metric="trainer/global_step", step_sync=True) return self._experiment class SequenceLightningModule(pl.LightningModule): def __init__(self, config): # Disable profiling executor. This reduces memory and increases speed. try: torch._C._jit_set_profiling_executor(False) torch._C._jit_set_profiling_mode(False) except AttributeError: pass super().__init__() # Passing in config expands it one level, so can access by self.hparams.train instead of self.hparams.config.train self.save_hyperparameters(config, logger=False) # Dataset arguments self.dataset = SequenceDataset.registry[self.hparams.dataset._name_]( **self.hparams.dataset ) # Check hparams self._check_config() # PL has some bugs, so add hooks and make sure they're only called once self._has_setup = False self.setup() ## Added by KS def setup(self, stage=None): if not self.hparams.train.disable_dataset: self.dataset.setup() # We need to set up the model in setup() because for some reason when training with DDP, one GPU uses much more memory than the others # In order to not overwrite the model multiple times during different stages, we need this hack # TODO PL 1.5 seems to have an option to skip hooks to avoid this # https://github.com/PyTorchLightning/pytorch-lightning/issues/5410#issuecomment-762257024 if self._has_setup: return else: self._has_setup = True # Convenience feature: if model specifies encoder, combine it with main encoder encoder_cfg = utils.to_list(self.hparams.encoder) + utils.to_list( self.hparams.model.pop("encoder", None) ) decoder_cfg = utils.to_list( self.hparams.model.pop("decoder", None) ) + utils.to_list(self.hparams.decoder) # Instantiate model self.model = utils.instantiate(registry.model, self.hparams.model) if (name := self.hparams.train.post_init_hook['_name_']) is not None: kwargs = self.hparams.train.post_init_hook.copy() del kwargs['_name_'] for module in self.modules(): if hasattr(module, name): getattr(module, name)(**kwargs) # Instantiate the task self.task = utils.instantiate( tasks.registry, self.hparams.task, dataset=self.dataset, model=self.model ) # Create encoders and decoders encoder = encoders.instantiate( encoder_cfg, dataset=self.dataset, model=self.model ) decoder = decoders.instantiate( decoder_cfg, model=self.model, dataset=self.dataset ) # Extract the modules so they show up in the top level parameter count self.encoder = U.PassthroughSequential(self.task.encoder, encoder) self.decoder = U.PassthroughSequential(decoder, self.task.decoder) self.loss = self.task.loss self.loss_val = self.task.loss if hasattr(self.task, 'loss_val'): self.loss_val = self.task.loss_val self.metrics = self.task.metrics self.train_torchmetrics = self.task.train_torchmetrics self.val_torchmetrics = self.task.val_torchmetrics self.test_torchmetrics = self.task.test_torchmetrics def load_state_dict(self, state_dict, strict=False): if self.hparams.train.pretrained_model_state_hook['_name_'] is not None: model_state_hook = utils.instantiate( registry.model_state_hook, self.hparams.train.pretrained_model_state_hook.copy(), partial=True, ) state_dict = model_state_hook(self.model, state_dict) print("Custom load_state_dict function is running.") # strict==True will require all modules to match # strict==False can allow encoder/decoder to be loaded from scratch too return super().load_state_dict(state_dict, strict=strict) def _check_config(self): assert self.hparams.train.state.mode in [None, "none", "null", "reset", "bptt", "tbptt"] assert ( (n := self.hparams.train.state.n_context) is None or isinstance(n, int) and n >= 0 ) assert ( (n := self.hparams.train.state.n_context_eval) is None or isinstance(n, int) and n >= 0 ) def _initialize_state(self): """Called at model setup and start of epoch to completely reset state""" self._state = None self._memory_chunks = [] def _reset_state(self, batch, device=None): """Called to construct default_state when necessary, e.g. during BPTT""" device = device or batch[0].device self._state = self.model.default_state(*batch[0].shape[:1], device=device) def _detach_state(self, state): if isinstance(state, torch.Tensor): return state.detach() elif isinstance(state, tuple): return tuple(self._detach_state(s) for s in state) elif isinstance(state, list): return [self._detach_state(s) for s in state] elif isinstance(state, dict): return {k: self._detach_state(v) for k, v in state.items()} elif state is None: return None else: raise NotImplementedError def _process_state(self, batch, batch_idx, train=True): """Handle logic for state context.""" # Number of context steps key = "n_context" if train else "n_context_eval" n_context = self.hparams.train.state.get(key) # Don't need to do anything if 0 context steps. Make sure there is no state if n_context == 0 and self.hparams.train.state.mode not in ['tbptt']: self._initialize_state() return # Reset state if needed if self.hparams.train.state.mode == "reset": if batch_idx % (n_context + 1) == 0: self._reset_state(batch) # Pass through memory chunks elif self.hparams.train.state.mode == "bptt": self._reset_state(batch) with torch.no_grad(): # should be unnecessary because individual modules should handle this for _batch in self._memory_chunks: self.forward(_batch) # Prepare for next step self._memory_chunks.append(batch) self._memory_chunks = self._memory_chunks[-n_context:] elif self.hparams.train.state.mode == 'tbptt': _, _, z = batch reset = z["reset"] if reset: self._reset_state(batch) else: self._state = self._detach_state(self._state) # def forward(self, batch): # """Passes a batch through the encoder, backbone, and decoder""" # # z holds arguments such as sequence length # x, y, *z = batch # z holds extra dataloader info such as resolution # if len(z) == 0: # z = {} # else: # assert len(z) == 1 and isinstance(z[0], dict), "Dataloader must return dictionary of extra arguments" # z = z[0] # x, w = self.encoder(x, **z) # w can model-specific constructions such as key_padding_mask for transformers or state for RNNs # x, state = self.model(x, **w, state=self._state) # self._state = state # x, w = self.decoder(x, state=state, **z) # return x, y, w def forward(self, batch): return self.task.forward(batch, self.encoder, self.model, self.decoder, self._state) def step(self, x_t): x_t, *_ = self.encoder(x_t) # Potential edge case for encoders that expect (B, L, H)? x_t, state = self.model.step(x_t, state=self._state) self._state = state # x_t = x_t[:, None, ...] # Dummy length # x_t, *_ = self.decoder(x_t, state=state) # x_t = x_t[:, 0, ...] x_t, *_ = self.decoder.step(x_t, state=state) return x_t def _shared_step(self, batch, batch_idx, prefix="train"): self._process_state(batch, batch_idx, train=(prefix == "train")) x, y, w = self.forward(batch) # Loss if prefix == 'train': loss = self.loss(x, y, **w) else: loss = self.loss_val(x, y, **w) # Metrics metrics = self.metrics(x, y, **w) metrics["loss"] = loss metrics = {f"{prefix}/{k}": v for k, v in metrics.items()} # Calculate torchmetrics torchmetrics = getattr(self, f'{prefix}_torchmetrics') torchmetrics(x, y, loss=loss) log_on_step = 'eval' in self.hparams and self.hparams.eval.get('log_on_step', False) and prefix == 'train' self.log_dict( metrics, on_step=log_on_step, on_epoch=True, prog_bar=True, add_dataloader_idx=False, sync_dist=True, ) # log the whole dict, otherwise lightning takes the mean to reduce it # https://pytorch-lightning.readthedocs.io/en/stable/visualize/logging_advanced.html#enable-metrics-for-distributed-training self.log_dict( torchmetrics, on_step=log_on_step, on_epoch=True, prog_bar=True, add_dataloader_idx=False, sync_dist=True, ) return loss def on_train_epoch_start(self): # Reset training torchmetrics self.task._reset_torchmetrics("train") def training_epoch_end(self, outputs): # Log training torchmetrics super().training_epoch_end(outputs) def on_validation_epoch_start(self): # Reset all validation torchmetrics for name in self.val_loader_names: self.task._reset_torchmetrics(name) def validation_epoch_end(self, outputs): # Log all validation torchmetrics super().validation_epoch_end(outputs) def on_test_epoch_start(self): # Reset all test torchmetrics for name in self.test_loader_names: self.task._reset_torchmetrics(name) def test_epoch_end(self, outputs): # Log all test torchmetrics super().test_epoch_end(outputs) def training_step(self, batch, batch_idx, dataloader_idx=0): loss = self._shared_step(batch, batch_idx, prefix="train") # Log the loss explicitly so it shows up in WandB # Note that this currently runs into a bug in the progress bar with ddp (as of 1.4.6) # https://github.com/PyTorchLightning/pytorch-lightning/pull/9142 # We additionally log the epochs under 'trainer' to get a consistent prefix with 'global_step' loss_epoch = {"trainer/loss": loss, "trainer/epoch": self.current_epoch} self.log_dict( loss_epoch, on_step=True, on_epoch=False, prog_bar=False, add_dataloader_idx=False, sync_dist=True, ) # Log any extra info that the models want to expose (e.g. output norms) metrics = {} for module in list(self.modules())[1:]: if hasattr(module, "metrics"): metrics.update(module.metrics) self.log_dict( metrics, on_step=True, on_epoch=False, prog_bar=False, add_dataloader_idx=False, sync_dist=True, ) return loss def validation_step(self, batch, batch_idx, dataloader_idx=0): ema = ( self.val_loader_names[dataloader_idx].endswith("/ema") and self.optimizers().optimizer.stepped ) # There's a bit of an annoying edge case with the first (0-th) epoch; it has to be excluded due to the initial sanity check if ema: self.optimizers().swap_ema() loss = self._shared_step( batch, batch_idx, prefix=self.val_loader_names[dataloader_idx] ) if ema: self.optimizers().swap_ema() return loss def test_step(self, batch, batch_idx, dataloader_idx=0): return self._shared_step( batch, batch_idx, prefix=self.test_loader_names[dataloader_idx] ) def configure_optimizers(self): # Set zero weight decay for some params if 'optimizer_param_grouping' in self.hparams.train: add_optimizer_hooks(self.model, **self.hparams.train.optimizer_param_grouping) # Normal parameters all_params = list(self.parameters()) params = [p for p in all_params if not hasattr(p, "_optim")] optimizer = utils.instantiate(registry.optimizer, self.hparams.optimizer, params) del self.hparams.optimizer._name_ # Add parameters with special hyperparameters hps = [getattr(p, "_optim") for p in all_params if hasattr(p, "_optim")] hps = [ # dict(s) for s in set(frozenset(hp.items()) for hp in hps) dict(s) for s in sorted(list(dict.fromkeys(frozenset(hp.items()) for hp in hps))) # dict(s) for s in dict.fromkeys(frozenset(hp.items()) for hp in hps) ] # Unique dicts print("Hyperparameter groups", hps) for hp in hps: params = [p for p in all_params if getattr(p, "_optim", None) == hp] optimizer.add_param_group( {"params": params, **self.hparams.optimizer, **hp} ) ### Layer Decay ### if self.hparams.train.layer_decay['_name_'] is not None: get_num_layer = utils.instantiate( registry.layer_decay, self.hparams.train.layer_decay['_name_'], partial=True, ) # Go through all parameters and get num layer layer_wise_groups = {} num_max_layers = 0 for name, p in self.named_parameters(): # Get layer id for each parameter in the model layer_id = get_num_layer(name) # Add to layer wise group if layer_id not in layer_wise_groups: layer_wise_groups[layer_id] = { 'params': [], 'lr': None, 'weight_decay': self.hparams.optimizer.weight_decay } layer_wise_groups[layer_id]['params'].append(p) if layer_id > num_max_layers: num_max_layers = layer_id # Update lr for each layer for layer_id, group in layer_wise_groups.items(): group['lr'] = self.hparams.optimizer.lr * (self.hparams.train.layer_decay.decay ** (num_max_layers - layer_id)) # Reset the torch optimizer's param groups optimizer.param_groups = [] for layer_id, group in layer_wise_groups.items(): optimizer.add_param_group(group) # Print optimizer info for debugging keys = set([k for hp in hps for k in hp.keys()]) # Special hparams utils.train.log_optimizer(log, optimizer, keys) # Configure scheduler if "scheduler" not in self.hparams: return optimizer lr_scheduler = utils.instantiate( registry.scheduler, self.hparams.scheduler, optimizer ) scheduler = { "scheduler": lr_scheduler, "interval": self.hparams.train.interval, # 'epoch' or 'step' "monitor": self.hparams.train.monitor, "name": "trainer/lr", # default is e.g. 'lr-AdamW' } # See documentation for how to configure the return # https://pytorch-lightning.readthedocs.io/en/latest/api/pytorch_lightning.core.lightning.html#pytorch_lightning.core.lightning.LightningModule.configure_optimizers return [optimizer], [scheduler] def train_dataloader(self): return self.dataset.train_dataloader(**self.hparams.loader) def _eval_dataloaders_names(self, loaders, prefix): """Process loaders into a list of names and loaders""" if utils.is_dict(loaders): return [ f"{prefix}/{k}" if k is not None else prefix for k in loaders.keys() ], list(loaders.values()) elif utils.is_list(loaders): return [f"{prefix}/{i}" for i in range(len(loaders))], loaders else: return [prefix], [loaders] def _eval_dataloaders(self): # Return all val + test loaders val_loaders = self.dataset.val_dataloader(**self.hparams.loader) test_loaders = self.dataset.test_dataloader(**self.hparams.loader) val_loader_names, val_loaders = self._eval_dataloaders_names(val_loaders, "val") test_loader_names, test_loaders = self._eval_dataloaders_names( test_loaders, "test" ) # Duplicate datasets for ema if self.hparams.train.ema > 0.0: val_loader_names += [name + "/ema" for name in val_loader_names] val_loaders = val_loaders + val_loaders test_loader_names += [name + "/ema" for name in test_loader_names] test_loaders = test_loaders + test_loaders # adding option to only have val loader at eval (eg if test is duplicate) if self.hparams.train.get("remove_test_loader_in_eval", False): return val_loader_names, val_loaders # adding option to only have test loader at eval elif self.hparams.train.get("remove_val_loader_in_eval", False): return test_loader_names, test_loaders # default behavior is to add test loaders in eval else: return val_loader_names + test_loader_names, val_loaders + test_loaders def val_dataloader(self): val_loader_names, val_loaders = self._eval_dataloaders() self.val_loader_names = val_loader_names return val_loaders def test_dataloader(self): test_loader_names, test_loaders = self._eval_dataloaders() self.test_loader_names = ["final/" + name for name in test_loader_names] return test_loaders ### pytorch-lightning utils and entrypoint ### def create_trainer(config, **kwargs): callbacks: List[pl.Callback] = [] logger = None # WandB Logging if config.get("wandb") is not None: # Pass in wandb.init(config=) argument to get the nice 'x.y.0.z' hparams logged # Can pass in config_exclude_keys='wandb' to remove certain groups import wandb logger = CustomWandbLogger( config=utils.to_dict(config, recursive=True), settings=wandb.Settings(start_method="fork"), **config.wandb, ) # Lightning callbacks if "callbacks" in config: for _name_, callback in config.callbacks.items(): if config.get("wandb") is None and _name_ in ["learning_rate_monitor"]: continue log.info(f"Instantiating callback <{registry.callbacks[_name_]}>") callback._name_ = _name_ callbacks.append(utils.instantiate(registry.callbacks, callback)) # Add ProgressiveResizing callback if config.callbacks.get("progressive_resizing", None) is not None: num_stages = len(config.callbacks.progressive_resizing.stage_params) print(f"Progressive Resizing: {num_stages} stages") for i, e in enumerate(config.callbacks.progressive_resizing.stage_params): # Stage params are resolution and epochs, pretty print print(f"\tStage {i}: {e['resolution']} @ {e['epochs']} epochs") # Configure ddp automatically n_devices = config.trainer.get('devices', 1) if isinstance(n_devices, Sequence): # trainer.devices could be [1, 3] for example n_devices = len(n_devices) if n_devices > 1 and config.trainer.get('strategy', None) is None: config.trainer.strategy = dict( _target_='pytorch_lightning.strategies.DDPStrategy', find_unused_parameters=False, gradient_as_bucket_view=True, # https://pytorch-lightning.readthedocs.io/en/stable/advanced/advanced_gpu.html#ddp-optimizations ) # Init lightning trainer log.info(f"Instantiating trainer <{config.trainer._target_}>") # special processing for seqlen warmup scheduler (reload) if config.callbacks.get("seqlen_warmup_reload", None) is not None: # we need to instantiate manually instead of with hydra, since it expects a dict instead of a hydra config for the accumulate_grad_batches # so we convert everything to dicts (from hydra configs) trainer_config_dict = dict(config.trainer) epochs_cume = 0 # track cumulative epochs accumulate_grad_schedule = {} # contains the accumulate_grad_batches schedule to init the trainer for stage in config.callbacks.seqlen_warmup_reload.stage_params: batch_size = stage['batch_size'] # curr batch size at this stage grad_accum_factor = config.train.global_batch_size // batch_size # grad accum factor for this stage accumulate_grad_schedule[epochs_cume] = grad_accum_factor # set the grad accum factor for this stage epochs_cume += stage['epochs'] # increment epochs_cume for next stage trainer_config_dict['accumulate_grad_batches'] = accumulate_grad_schedule # set the accumulate_grad_batches schedule trainer_config_dict.pop('_target_') # only hydra uses this to instantiate # Set DDPStrategy to work with pl.Trainer config.trainer.pop('strategy') trainer_config_dict['strategy'] = DDPStrategy(find_unused_parameters=False, gradient_as_bucket_view=True) trainer = pl.Trainer(**trainer_config_dict, callbacks=callbacks, logger=logger) else: trainer = hydra.utils.instantiate(config.trainer, callbacks=callbacks, logger=logger) return trainer def train(config): if config.train.seed is not None: pl.seed_everything(config.train.seed, workers=True) trainer = create_trainer(config) model = SequenceLightningModule(config) # Load pretrained_model if specified if config.train.get("pretrained_model_path", None) is not None: # PTL style. Note, method returns a new model object, and need to pass config. model = SequenceLightningModule.load_from_checkpoint( config.train.pretrained_model_path, config=config, strict=config.train.pretrained_model_strict_load, ) # Run initial validation epoch (useful for debugging, finetuning) if config.train.validate_at_start: print("Running validation before training") trainer.validate(model) if config.train.ckpt is not None: trainer.fit(model, ckpt_path=config.train.ckpt) else: trainer.fit(model) if config.train.test: trainer.test(model) @hydra.main(config_path="configs", config_name="config.yaml") def main(config: OmegaConf): # Process config: # - register evaluation resolver # - filter out keys used only for interpolation # - optional hooks, including disabling python warnings or debug friendly configuration config = utils.train.process_config(config) # Pretty print config using Rich library utils.train.print_config(config, resolve=True) train(config) if __name__ == "__main__": main()
hyena-dna-main
train.py
import torch import torch.nn.functional as F from einops import rearrange from fftconv import fftconv_fwd, fftconv_bwd def fftconv_ref(u, k, D, dropout_mask): seqlen = u.shape[-1] fft_size = 2 * seqlen k_f = torch.fft.rfft(k, n=fft_size) / fft_size u_f = torch.fft.rfft(u.to(dtype=k.dtype), n=fft_size) y = torch.fft.irfft(u_f * k_f, n=fft_size, norm='forward')[..., :seqlen] out = y + u * D.unsqueeze(-1) return (F.gelu(out) * rearrange(dropout_mask, 'b H -> b H 1')).to(dtype=u.dtype) def fftconv_fast(u, k, D, dropout_mask): """Fuse padding + rfft + pointwise mult + ifft + multiply with D + gelu + dropout """ seqlen = u.shape[-1] fft_size = 2 * seqlen k_f = torch.fft.rfft(k, n=fft_size) out = fftconv_fwd(u, k_f, D, dropout_mask, fft_size) return out def fftconv_fast_bwd(dout, u, k, D, dropout_mask=None): seqlen = u.shape[-1] fft_size = 2 * seqlen k_f = torch.fft.rfft(k, n=fft_size) dx, dk_f, dD = fftconv_bwd(dout, u, k_f, D, dropout_mask, fft_size) dk = torch.fft.irfft(dk_f, n=fft_size, norm='forward')[..., :seqlen] return dx, dk, dD device = 'cuda' dtype = torch.float32 # dtype = torch.float16 batch_size = 64 H = 256 fft_size = 2048 seqlen = 1024 dropout_prob = 0.37 torch.manual_seed(0) u = torch.randn(batch_size, H, seqlen, device=device, dtype=dtype, requires_grad=True) k = torch.randn(H, seqlen, device=device, requires_grad=True) D = torch.randn(H, device=device, requires_grad=True) dropout_mask = F.dropout(torch.ones(batch_size, H, device=device), dropout_prob) out = fftconv_ref(u, k, D, dropout_mask) out = fftconv_fast(u, k, D, dropout_mask) g = torch.randn_like(out) fftconv_fast_bwd(g, u, k, D, dropout_mask)
hyena-dna-main
csrc/fftconv/launch_fftconv.py
# Adapted from https://github.com/NVIDIA/apex/blob/master/setup.py import torch from torch.utils.cpp_extension import BuildExtension, CppExtension, CUDAExtension, CUDA_HOME from setuptools import setup, find_packages import subprocess import sys import warnings import os # ninja build does not work unless include_dirs are abs path this_dir = os.path.dirname(os.path.abspath(__file__)) def get_cuda_bare_metal_version(cuda_dir): raw_output = subprocess.check_output([cuda_dir + "/bin/nvcc", "-V"], universal_newlines=True) output = raw_output.split() release_idx = output.index("release") + 1 release = output[release_idx].split(".") bare_metal_major = release[0] bare_metal_minor = release[1][0] return raw_output, bare_metal_major, bare_metal_minor def check_cuda_torch_binary_vs_bare_metal(cuda_dir): raw_output, bare_metal_major, bare_metal_minor = get_cuda_bare_metal_version(cuda_dir) torch_binary_major = torch.version.cuda.split(".")[0] torch_binary_minor = torch.version.cuda.split(".")[1] print("\nCompiling cuda extensions with") print(raw_output + "from " + cuda_dir + "/bin\n") if (bare_metal_major != torch_binary_major) or (bare_metal_minor != torch_binary_minor): raise RuntimeError( "Cuda extensions are being compiled with a version of Cuda that does " "not match the version used to compile Pytorch binaries. " "Pytorch binaries were compiled with Cuda {}.\n".format(torch.version.cuda) + "In some cases, a minor-version mismatch will not cause later errors: " "https://github.com/NVIDIA/apex/pull/323#discussion_r287021798. " "You can try commenting out this check (at your own risk)." ) def raise_if_cuda_home_none(global_option: str) -> None: if CUDA_HOME is not None: return raise RuntimeError( f"{global_option} was requested, but nvcc was not found. Are you sure your environment has nvcc available? " "If you're installing within a container from https://hub.docker.com/r/pytorch/pytorch, " "only images whose names contain 'devel' will provide nvcc." ) def append_nvcc_threads(nvcc_extra_args): _, bare_metal_major, bare_metal_minor = get_cuda_bare_metal_version(CUDA_HOME) if int(bare_metal_major) >= 11 and int(bare_metal_minor) >= 2: return nvcc_extra_args + ["--threads", "4"] return nvcc_extra_args if not torch.cuda.is_available(): # https://github.com/NVIDIA/apex/issues/486 # Extension builds after https://github.com/pytorch/pytorch/pull/23408 attempt to query torch.cuda.get_device_capability(), # which will fail if you are compiling in an environment without visible GPUs (e.g. during an nvidia-docker build command). print( "\nWarning: Torch did not find available GPUs on this system.\n", "If your intention is to cross-compile, this is not an error.\n" "By default, Apex will cross-compile for Pascal (compute capabilities 6.0, 6.1, 6.2),\n" "Volta (compute capability 7.0), Turing (compute capability 7.5),\n" "and, if the CUDA version is >= 11.0, Ampere (compute capability 8.0).\n" "If you wish to cross-compile for a single specific architecture,\n" 'export TORCH_CUDA_ARCH_LIST="compute capability" before running setup.py.\n', ) if os.environ.get("TORCH_CUDA_ARCH_LIST", None) is None: _, bare_metal_major, bare_metal_minor = get_cuda_bare_metal_version(CUDA_HOME) if int(bare_metal_major) == 11: os.environ["TORCH_CUDA_ARCH_LIST"] = "6.0;6.1;6.2;7.0;7.5;8.0" if int(bare_metal_minor) > 0: os.environ["TORCH_CUDA_ARCH_LIST"] = "6.0;6.1;6.2;7.0;7.5;8.0;8.6" else: os.environ["TORCH_CUDA_ARCH_LIST"] = "6.0;6.1;6.2;7.0;7.5" print("\n\ntorch.__version__ = {}\n\n".format(torch.__version__)) TORCH_MAJOR = int(torch.__version__.split(".")[0]) TORCH_MINOR = int(torch.__version__.split(".")[1]) cmdclass = {} ext_modules = [] raise_if_cuda_home_none("fftconv") # Check, if CUDA11 is installed for compute capability 8.0 cc_flag = [] # cc_flag.append("-gencode") # cc_flag.append("arch=compute_70,code=sm_70") cc_flag.append("-gencode") cc_flag.append("arch=compute_80,code=sm_80") ext_modules.append( CUDAExtension( 'fftconv', [ 'fftconv.cpp', 'fftconv_cuda.cu', ], extra_compile_args={'cxx': ['-g', '-march=native', '-funroll-loops'], 'nvcc': ['-O3', '--threads', '4', '-lineinfo', '--use_fast_math', '-std=c++17', '-arch=compute_70'] # extra_compile_args={'cxx': ['-O3'], # 'nvcc': append_nvcc_threads(['-O3', '-lineinfo', '--use_fast_math', '-std=c++17'] + cc_flag) }, include_dirs=[os.path.join(this_dir, 'mathdx/22.02/include')] ) ) torch.utils.cpp_extension.COMMON_NVCC_FLAGS.remove('-D__CUDA_NO_HALF2_OPERATORS__') setup( name="fftconv", version="0.1", description="FFTConv for state-space models", ext_modules=ext_modules, cmdclass={"build_ext": BuildExtension} if ext_modules else {}, )
hyena-dna-main
csrc/fftconv/setup.py
import math import re import numpy as np # N = 8192 N = 16384 # The case of 0 / N is special, we want to simplify it to 0 / 2 instead of 0 / 1 numerator = np.arange(1, N // 8 + 1) gcd = np.gcd(numerator, N) num = numerator // gcd denom = N // gcd lut_vals = ['T_2_0'] + [f'T_{d}_{n}' for n, d in zip(num, denom)] lut_string = f"static const __device__ float2 lut_mine_sp_8_{N}[{N // 8 + 1}] = {{\n {','.join(lut_vals)}\n}};" print(lut_string) # Only define new values if it's not already in the cuFFTDx lookup table cufftdx_lut_filename = 'mathdx/22.02/include/cufftdx/include/database/lut_defines_0.hpp.inc' matches = set() reg = re.compile(f'^#define T_{N}_([0-9]+) ') with open(cufftdx_lut_filename, 'r') as f: for line in f: if (match := reg.match(line)) is not None: matches.add(int(match[1])) numerator = np.arange(1, N // 8 + 1, 2) angle = -2 * math.pi * numerator.astype(np.float64) / N cos, sin = np.cos(angle), np.sin(angle) defs = [f'#define T_{N}_{n} {{{c:.40f},{s:.40f}}}' for n, c, s in zip(numerator, cos, sin) if n not in matches] def_string = '\n'.join(defs) print(def_string)
hyena-dna-main
csrc/fftconv/lut_code_gen.py
#!/usr/bin/env python3 import argparse import yaml from tqdm import tqdm import typing as tp import numpy as np import pandas as pd from copy import deepcopy from collections import OrderedDict import torch torch.backends.cuda.matmul.allow_tf32 = True torch.backends.cudnn.allow_tf32 = True import torch.nn.functional as F import pytorch_lightning as pl from einops import rearrange, repeat import sys, os FILEDIR = os.path.realpath(__file__) sys.path.append(os.path.join(FILEDIR, '..')) from src.models.sequence.long_conv_lm import ConvLMHeadModel # from src.dataloaders.icl_genomics_dataloader import ICLGenomics from src.dataloaders.genomics import ICLGenomics def exists(x): return x is not None DEVICE = torch.device("cuda" if torch.cuda.is_available() else "cpu") def soft_prompting(): parser = argparse.ArgumentParser() parser.add_argument("--ckpt_path", help="Path to pretrained model checkpoint") parser.add_argument("--dataset", default='none') parser.add_argument("--config", default='./configs/evals/soft_prompting_genomics.yaml') parser.add_argument("--results", default='./results/soft_prompting') args = parser.parse_args() os.makedirs(args.results, exist_ok=True) # load configs config = yaml.load(open(args.config, 'r'), Loader=yaml.FullLoader) cfg_model = config['model'].copy() cfg_dataset = config['dataset'].copy() cfg_tuning = config['tuning'].copy() np.random.seed(config['seed']) torch.manual_seed(config['seed']) rng = np.random.RandomState(config['seed']) # dataset_name num_seqs num_classes median_len std # dummy_mouse_enhancers_ensembl 1210 2 2381 984.4 # demo_coding_vs_intergenomic_seqs 100_000 2 200 0 # demo_human_or_worm 100_000 2 200 0 # human_enhancers_cohn 27791 2 500 0 # human_enhancers_ensembl 154842 2 269 122.6 # human_ensembl_regulatory 289061 3 401 184.3 # human_nontata_promoters 36131 2 251 0 # human_ocr_ensembl 174756 2 315 108.1 # chrom_names = [ # 'chr11', 'chr13', 'chr15', 'chr17', 'chr19', 'chr21', 'chr2', 'chr4', 'chr6', 'chr8', 'chr10', 'chr12', # 'chr14', 'chr16', 'chr18', 'chr20', 'chr22', 'chrX', 'chrY', 'chr1', 'chr3', 'chr5', 'chr7', 'chr9' # ] nuc_chars = list('ACGTN') characters = nuc_chars # + chrom_names label_to_token = {0: 'A', 1: 'N'} datasets = { 'dummy_mouse_enhancers_ensembl': { 'max_length': 3200, 'd_output': 2, 'characters': characters, 'label_to_token': label_to_token, }, # 'demo_coding_vs_intergenomic_seqs': { # 'max_length': 202, # 'd_output': 2, # 'characters': characters, # 'label_to_token': label_to_token # }, # 'demo_human_or_worm': { # 'max_length': 202, # 'd_output': 2, # 'characters': characters, # 'label_to_token': label_to_token, # }, 'human_enhancers_cohn': { 'max_length': 502, 'd_output': 2, 'characters': characters, 'label_to_token': label_to_token, }, 'human_nontata_promoters': { 'max_length': 251, #253 'd_output': 2, 'characters': characters, 'label_to_token': label_to_token, }, 'human_enhancers_ensembl': { 'max_length': 320, 'd_output': 2, 'characters': characters, 'label_to_token': label_to_token, }, 'human_ensembl_regulatory': { 'max_length': 600, 'd_output': 3, 'characters': characters, 'label_to_token': {0: 'A', 1: 'G', 2: 'N'}, }, 'human_ocr_ensembl': { 'max_length': 420, 'd_output': 2, 'characters': characters, 'label_to_token': label_to_token, } } df_results = [] df_i = 0 ds_iter = datasets.items() if args.dataset=='none' else zip([args.dataset], [datasets[args.dataset]]) for dataset, dataset_cfg in ds_iter: print(f'\nDataset {dataset}...') for shots in cfg_dataset['shots']: print(f'...with {shots} shots...') cfg = cfg_dataset.copy() cfg.update(dataset_cfg) cfg['dataset_name'] = dataset cfg['shots'] = shots loader = ICLGenomics(**cfg) loader.setup() for soft_tokens in cfg_tuning['soft_tokens']: print(f'...and {soft_tokens} soft tokens...') # print('Pretrained model...') pretrained_model = load_model( cfg_model=cfg_model, ckpt_path=args.ckpt_path, n_soft_tokens=soft_tokens, soft_token_pdrop=cfg_tuning['soft_token_pdrop'], max_length=cfg['max_length'] if shots>0 else None ) pretrained_model.to(DEVICE) if soft_tokens>0: # we only tune when using soft tokens! print('...tuning...') pretrained_model = tune_model( pretrained_model, #deepcopy(pretrained_model).to(DEVICE), loader, cfg_tuning, rng=rng ) print('...evaluating...') acc = eval_on_loaders(pretrained_model, {dataset: loader})[dataset] df_results.append( pd.DataFrame({ 'dataset': dataset, 'model': 'pretrained', 'shots': shots, 'soft_tokens': soft_tokens, 'eval_acc': acc }, index=[df_i]) ) df_i += 1 pd.concat(df_results).to_csv( os.path.join( args.results, f'soft_prompting_performance_{dataset}.csv' ) ) del pretrained_model def load_model( cfg_model: tp.Dict, ckpt_path: str=None, n_soft_tokens: int=0, soft_token_pdrop: float=0., max_length: int=None ): model = ConvLMHeadModel(**cfg_model) if ckpt_path is not None: state_dict = torch.load(ckpt_path, map_location='cpu') # loads model from ddp by removing prexix to single if necessary torch.nn.modules.utils.consume_prefix_in_state_dict_if_present( state_dict["state_dict"], "model." ) model_state_dict = state_dict["state_dict"] # need to remove torchmetrics. to remove keys, need to convert to list first for key in list(model_state_dict.keys()): if "torchmetrics" in key: model_state_dict.pop(key) model.load_state_dict(model_state_dict) return LitModel(model, n_soft_tokens=n_soft_tokens, soft_token_pdrop=soft_token_pdrop, max_length=max_length) class LitModel(pl.LightningModule): def __init__(self, model, n_soft_tokens: int=0, soft_token_pdrop: float=0., max_length: int=None ): super().__init__() self.model = model requires_grad(self.model, False) # we only want to train soft tokens self.max_length = max_length d_model = self.model.lm_head.weight.shape[1] self.n_soft_tokens = n_soft_tokens soft_tokens = torch.nn.Parameter(torch.zeros(n_soft_tokens, d_model)) if n_soft_tokens>0 else None if exists(soft_tokens): torch.nn.init.normal_(soft_tokens, mean=0.0, std=0.02) self.soft_tokens = soft_tokens self.soft_tokens_drop = torch.nn.Dropout(soft_token_pdrop) if soft_token_pdrop>0 else torch.nn.Identity() def forward(self, x: torch.Tensor): # get embeddings with torch.no_grad(): hidden_states = self.model.backbone.embeddings(x) # attach soft tokens if exists(self.soft_tokens): hidden_states = torch.cat([ repeat(self.soft_tokens_drop(self.soft_tokens), 'n d -> b n d', b=hidden_states.shape[0]), hidden_states ], dim=1) # forward residual = None for layer in self.model.backbone.layers: hidden_states, residual = layer(hidden_states, residual) dropped = self.model.backbone.drop_f(hidden_states) residual = (dropped + residual) if residual is not None else dropped hidden_states = self.model.backbone.ln_f(residual.to(dtype=self.model.backbone.ln_f.weight.dtype)) return self.model.lm_head(hidden_states) def step(self, batch: tp.Tuple[torch.Tensor], phase: str='train'): # get ys x, y = batch['x'].to(DEVICE), batch['y'].to(DEVICE) labels_idx = x.shape[1]-1 if exists(self.max_length): x = torch.cat([x, y], dim=1) labels_idx = self.get_labels_idx(x) y = x[:,labels_idx] # forward logits = self(x) logits = logits[:,self.n_soft_tokens:] # we exclude soft tokens logits = logits[:,labels_idx-1] # previous token predicts target if logits.ndim>2: logits = rearrange(logits, 'b n c -> (b n) c') if y.ndim==2: y = rearrange(y, 'b n -> (b n)') # compute loss/acc loss = F.cross_entropy(logits, y) preds = logits.argmax(axis=-1) acc = torch.mean((preds==y).to(torch.float32)) return {'loss': loss, 'acc': acc} def get_labels_idx(self, x): return np.concatenate([ [self.max_length+1], np.arange((2*self.max_length)+4, x.shape[1], self.max_length+3) ]) def tune_model(model, loader, cfg_tuning, verbose: bool=True, rng: np.random.RandomState=None): rng = np.random.RandomState(0) if rng is None else rng optimizer = torch.optim.AdamW( model.parameters(), weight_decay=float(cfg_tuning['weight_decay']), lr=float(cfg_tuning['lr']) ) scheduler = torch.optim.lr_scheduler.ReduceLROnPlateau( optimizer=optimizer, mode='min', factor=0.1, patience=0 ) best_model = deepcopy(model) requires_grad(best_model, False) step = 0 losses, accs, val_losses = [], [], [] for epoch in range(cfg_tuning['max_epochs']): if verbose: print(f'Epoch {epoch}...') # train epoch: model.train() for i, (x,y) in enumerate(loader.train_dataloader()): batch = {'x': x, 'y': y} model.on_train_batch_start(batch=batch, batch_idx=step) with torch.cuda.amp.autocast(): out = model.step(batch) loss, acc = out['loss'], out['acc'] loss.backward() torch.nn.utils.clip_grad_norm_(model.parameters(), cfg_tuning.get('gradient_clip_val', 1.0)) losses.append(loss.cpu().detach().numpy().mean()) accs.append(acc.cpu().detach().numpy()) # accumulate gradients of N batches if (i + 1) % cfg_tuning['accumulate_grad_batches'] == 0: optimizer.step() optimizer.zero_grad() # update_ema(ema, model, decay=cfg_tuning['ema_decay']) step += 1 # eval epoch: model.eval() val_loss = [] with torch.no_grad(): for x, y in loader.val_dataloader(): batch = {'x': x, 'y': y} model.on_train_batch_start(batch=batch, batch_idx=step) out = model.step(batch) loss, acc = out['loss'], out['acc'] val_loss.append(loss.cpu().detach().numpy()) val_losses.append(np.mean(val_loss)) if val_losses[-1]==np.min(val_losses): # also covers first epoch update_ema(best_model, model, decay=0) scheduler.step(val_losses[-1]) if verbose: print(f'\tstep {step}; avg. val loss: {val_losses[-1]:1.4f}') if (epoch > 0 and sum(val_losses[-1] >= val_losses[:-1])>1) or (epoch+1)>=cfg_tuning['max_epochs']: break best_model = best_model.to(DEVICE) requires_grad(best_model, True) # we turn grads back on for completion, even though model will not be trained further... return best_model #, ema @torch.no_grad() def update_ema(ema_model, model, decay=0.999): ema_params = OrderedDict(ema_model.named_parameters()) model_params = OrderedDict(model.named_parameters()) for name, param in model_params.items(): ema_params[name].mul_(decay).add_(param.data, alpha=1 - decay) def requires_grad(model, flag=True): for p in model.parameters(): p.requires_grad = flag def eval_on_loaders(model, loaders): results = {} for name, loader in loaders.items(): print(f'Evaluating on {name} data...') all_acc = [] val_loader = loader.val_dataloader() for x,y in tqdm(val_loader): x = x.to(DEVICE) with torch.no_grad(): logits = model(x) logits = logits[:, -1] logits = logits.cpu().detach().numpy() batch_preds = logits.argmax(axis=-1) # batch_preds = np.array(batch_preds) y = y.cpu().detach().numpy() batch_preds = batch_preds.flatten() y = y.flatten() acc = (batch_preds == y).mean() all_acc.append(acc) results[name] = np.mean(all_acc) print(f"{name}; full eval. accuracy: {results[name]:1.4f}") return results if __name__ == "__main__": soft_prompting()
hyena-dna-main
evals/soft_prompting_genomics.py
#!/usr/bin/env python3 import argparse import yaml from tqdm import tqdm import typing as tp import numpy as np import pandas as pd from copy import deepcopy from collections import OrderedDict import torch torch.backends.cuda.matmul.allow_tf32 = True torch.backends.cudnn.allow_tf32 = True import torch.nn.functional as F import pytorch_lightning as pl from einops import rearrange import sys, os FILEDIR = os.path.realpath(__file__) sys.path.append(os.path.join(FILEDIR, '..')) from src.models.sequence.long_conv_lm import ConvLMHeadModel # from src.dataloaders.icl_genomics_dataloader import ICLGenomics from src.dataloaders.genomics import ICLGenomics # TODO: # Make use of maximum long context: either put entire downstream dataset in context # or add many tunable soft tokens (soft prompting)! # -> just fill the context up one way or another and show whats possible! DEVICE = torch.device("cuda" if torch.cuda.is_available() else "cpu") def instruction_tuned_ICL(): parser = argparse.ArgumentParser() parser.add_argument("--ckpt_path", help="Path to pretrained model checkpoint") parser.add_argument("--config", default='./configs/evals/instruction_tuned_genomics.yaml') parser.add_argument("--results", default='./results/instruction_tuned_genomics') args = parser.parse_args() os.makedirs(args.results, exist_ok=True) # load configs config = yaml.load(open(args.config, 'r'), Loader=yaml.FullLoader) cfg_model = config['model'].copy() cfg_dataset = config['dataset'].copy() cfg_tuning = config['tuning'].copy() np.random.seed(config['seed']) torch.manual_seed(config['seed']) rng = np.random.RandomState(config['seed']) # dataset_name num_seqs num_classes median_len std # dummy_mouse_enhancers_ensembl 1210 2 2381 984.4 # demo_coding_vs_intergenomic_seqs 100_000 2 200 0 # demo_human_or_worm 100_000 2 200 0 # human_enhancers_cohn 27791 2 500 0 # human_enhancers_ensembl 154842 2 269 122.6 # human_ensembl_regulatory 289061 3 401 184.3 # human_nontata_promoters 36131 2 251 0 # human_ocr_ensembl 174756 2 315 108.1 nuc_chars = list('ACGTN') characters = nuc_chars # + chrom_names label_to_token = {0: 'A', 1: 'N'} datasets = { 'human_enhancers_cohn': { 'max_length': 502, 'd_output': 2, 'characters': characters, 'label_to_token': label_to_token, }, 'human_nontata_promoters': { 'max_length': 251, #253 'd_output': 2, 'characters': characters, 'label_to_token': label_to_token, }, 'human_enhancers_ensembl': { 'max_length': 320, 'd_output': 2, 'characters': characters, 'label_to_token': label_to_token, }, 'human_ensembl_regulatory': { 'max_length': 600, 'd_output': 3, 'characters': characters, 'label_to_token': {0: 'A', 1: 'G', 2: 'N'}, }, 'human_ocr_ensembl': { 'max_length': 420, 'd_output': 2, 'characters': characters, 'label_to_token': label_to_token, } } print('\n\nEvaluating instruction-tuned ICL performance... ') df_results = [] df_i = 0 for tuning_samples in cfg_tuning['tuning_samples']: print(f'...when tuning on {tuning_samples} samples...') for shots in cfg_dataset['shots']: print(f'...with {shots} shots...') for dataset, dataset_cfg in datasets.items(): print(f'...from dataset {dataset}...') print(f'Collecting tuning data...') cfg = cfg_dataset.copy() cfg.update(dataset_cfg) cfg['dataset_name'] = dataset cfg['shots'] = shots loader = ICLGenomics(**cfg) loader.setup() # collect tuning samples tuning_X = [] train_loader = iter(loader.train_dataloader()) samples_collected = 0 for x, y in tqdm(train_loader): n = min(tuning_samples, x.shape[0]) tuning_X.append(torch.cat([x[:n], y[:n]], dim=1)) samples_collected += n if samples_collected >= tuning_samples: print(f'...stop becuase {tuning_samples} samples collected.') break tuning_X = torch.cat(tuning_X, dim=0) if shots>0: tuning_y_idx = np.concatenate([ [cfg['max_length']+1], np.arange((2*cfg['max_length'])+4, tuning_X.shape[1], cfg['max_length']+3) ]) else: tuning_y_idx = cfg['max_length']+1 tuning_y = tuning_X[:,tuning_y_idx] tuning_loss_mask = tuning_y_idx-1 # prediction is always from previous token print('Tuning pretrained model...') pretrained_model = load_model(cfg_model, args.ckpt_path) pretrained_model.to(DEVICE) tuned_pretrained_model = tune_model( deepcopy(pretrained_model).to(DEVICE), tuning_X, tuning_y, cfg_tuning, loss_mask=tuning_loss_mask, rng=rng ) # print('Tuning untrained model...') # scratch_model = load_model(cfg_model) # scratch_model.to(DEVICE) # tuned_scratch_model = tune_model( # scratch_model, # tuning_X, # tuning_y, # cfg_tuning, # loss_mask=tuning_loss_mask, # rng=rng # ) print('Evaluating ICL performance...') for label, model in zip( ['tuned_pretrained'], #, 'scratchtrained' [tuned_pretrained_model] # tuned_scratch_model ): print(f'{label}:') acc = eval_on_loaders(model, {dataset: loader})[dataset] df_results.append( pd.DataFrame({ 'dataset': dataset, 'tuning_samples': tuning_samples, 'model': label, 'shots': shots, 'eval_acc': acc }, index=[df_i]) ) df_i += 1 pd.concat(df_results).to_csv( os.path.join(args.results, 'instruction_tuned_genomics.csv') ) def load_model(cfg_model, ckpt_path: str=None): model = ConvLMHeadModel(**cfg_model) if ckpt_path is not None: state_dict = torch.load(ckpt_path, map_location='cpu') # loads model from ddp by removing prexix to single if necessary torch.nn.modules.utils.consume_prefix_in_state_dict_if_present( state_dict["state_dict"], "model." ) model_state_dict = state_dict["state_dict"] # need to remove torchmetrics. to remove keys, need to convert to list first for key in list(model_state_dict.keys()): if "torchmetrics" in key: model_state_dict.pop(key) model.load_state_dict(model_state_dict) return LitModel(model) class LitModel(pl.LightningModule): def __init__(self, model): super().__init__() self.model = model def forward(self, x: torch.Tensor): return self.model(x)[0] def step(self, batch: tp.Tuple[torch.Tensor], loss_mask: tp.Union[int, np.ndarray]=-1, phase: str='train'): x, y = batch['x'].to(DEVICE), batch['y'].to(DEVICE) loss_mask = -1 if loss_mask is None else loss_mask out = self(x) logits = out.logits[:,loss_mask] if logits.ndim>2: logits = rearrange(logits, 'b n c -> (b n) c') if y.ndim==2: y = rearrange(y, 'b n -> (b n)') loss = F.cross_entropy(logits, y) preds = logits.argmax(axis=-1) acc = torch.mean((preds==y).to(torch.float32)) return {'loss': loss, 'acc': acc} def tune_model(model, X, y, cfg_tuning, max_epochs: int=1, loss_mask=None, verbose: bool=True, rng: np.random.RandomState=None): rng = np.random.RandomState(0) if rng is None else rng # # we use expected moving average of model for downstream ICL... # ema = deepcopy(model).to(DEVICE) # requires_grad(ema, False) # update_ema(ema, model, decay=0) # Ensure EMA is initialized with synced weights # ema.eval() optimizer = torch.optim.AdamW( model.parameters(), weight_decay=float(cfg_tuning['weight_decay']), lr=float(cfg_tuning['lr']) ) # split train/eval n_samples = X.shape[0] train_idx = np.arange(n_samples) batch_size = min(len(train_idx), cfg_tuning['batch_size']) epoch = 0 step = 0 losses, accs = [], [] stop_training = False while not stop_training: if verbose: print(f'Epoch {epoch}...') # train epoch: model.train() rng.shuffle(train_idx) batch_i, batch_start = 0, 0 while batch_start+batch_size <= len(train_idx): idx = train_idx[batch_start:batch_start+batch_size] batch = {'x': X[idx], 'y': y[idx]} model.on_train_batch_start(batch=batch, batch_idx=step) out = model.step(batch, loss_mask=loss_mask) loss, acc = out['loss'], out['acc'] loss.backward() torch.nn.utils.clip_grad_norm_(model.parameters(), cfg_tuning.get('gradient_clip_val', 1.0)) losses.append(loss.cpu().detach().numpy().mean()) accs.append(acc.cpu().detach().numpy()) # accumulate gradients of N batches if (batch_i + 1) % cfg_tuning['accumulate_grad_batches'] == 0: optimizer.step() optimizer.zero_grad() # update_ema(ema, model, decay=cfg_tuning['ema_decay']) step += 1 print(f'step: {step}; train loss: {losses[-1]}, acc: {accs[-1]}') batch_start += batch_size batch_i += 1 epoch += 1 if epoch>=max_epochs: stop_training = True return model #, ema @torch.no_grad() def update_ema(ema_model, model, decay=0.999): ema_params = OrderedDict(ema_model.named_parameters()) model_params = OrderedDict(model.named_parameters()) for name, param in model_params.items(): ema_params[name].mul_(decay).add_(param.data, alpha=1 - decay) def requires_grad(model, flag=True): for p in model.parameters(): p.requires_grad = flag def eval_on_loaders(model, loaders): results = {} for name, loader in loaders.items(): print(f'Evaluating on {name} data...') all_acc = [] val_loader = loader.val_dataloader() for batch in tqdm(val_loader): x, y = batch x = x.to(DEVICE) with torch.no_grad(): out = model(x) if type(out) == tuple: out = out[0] logits = out.logits[:, -1] logits = logits.cpu().detach().numpy() batch_preds = logits.argmax(axis=-1) # batch_preds = np.array(batch_preds) y = y.cpu().detach().numpy() batch_preds = batch_preds.flatten() y = y.flatten() acc = (batch_preds == y).mean() all_acc.append(acc) results[name] = np.mean(all_acc) print(f"{name}; full eval. accuracy: {results[name]:1.4f}") return results if __name__ == "__main__": instruction_tuned_ICL()
hyena-dna-main
evals/instruction_tuned_genomics.py
import torch import argparse import os import sys import yaml from tqdm import tqdm import json from src.models.sequence.long_conv_lm import DNAEmbeddingModel from src.tasks.decoders import SequenceDecoder from src.dataloaders import SequenceDataset import numpy as np from src.dataloaders.datasets.hg38_char_tokenizer import CharacterTokenizer from src.dataloaders.genomic_bench_dataloader import GenomicBenchmark from src.dataloaders.nucleotide_transformer_dataloader import NucleotideTransformer try: from tokenizers import Tokenizer except: pass genomic_benchmark_datasets = ["dummy_mouse_enhancers_ensembl", "demo_coding_vs_intergenomic_seqs", "demo_human_or_worm", "human_enhancers_cohn", "human_enhancers_ensembl", "human_ensembl_regulatory", "human_nontata_promoters", "human_ocr_ensembl"] nucleotide_datasets = [""] class HG38Inference: '''Model (backbone + decoder) inference, initially for enhancer model, but can be modified for other classification tasks as well. model_cfg, dict: config for entire model, backbone and decoder head ckpt_path, str: path to config max_seq_len, int: max seq len of model (technically in the model_cfg already, but more explicit) ''' def __init__(self, cfg, ckpt_path, max_seq_len, use_dataloader=False): self.max_seq_len = max_seq_len self.backbone, self.decoder, self.tokenizer = self.load_model(cfg, ckpt_path) self.device = torch.device("cuda" if torch.cuda.is_available() else "cpu") self.backbone = self.backbone.to(self.device) self.decoder = self.decoder.to(self.device) # load dataloader if given if use_dataloader: self.loader = self.get_dataloader(cfg) def get_dataloader(self, config): cfg = yaml.load(open(config, 'r'), Loader=yaml.FullLoader) dataset_name = cfg['dataset']["dataset_name"] if dataset_name in genomic_benchmark_datasets: loader = GenomicBenchmark(**cfg['dataset']) else: # assume the rest are in the nucleotide trans datasets loader = NucleotideTransformer(**cfg['dataset']) loader.setup() return loader def predict_on_list(self, seqs): """ makes predictions just given a list of string sequences, handles all the tokenizers, and tensor conversion """ preds = [] # sample code to loop thru each sample and tokenize first (char level) for seq in tqdm(seqs): if isinstance(self.tokenizer, Tokenizer): seq = self.tokenizer.encode(seq).ids else: seq = self.tokenizer.encode(seq) # can accept a batch, shape [B, seq_len, hidden_dim] embeddings, _ = self.backbone(torch.tensor([seq]).to(device=self.device)) pred = self.decoder(embeddings) preds.append(pred) # we provide the predictions (you can pass back embeddings if you wish) return preds def predict_from_loader(self): """ Don't forget this returns a list of the labels too with the predictions """ all_preds = [] all_labels = [] # by default we'll use the test dataloader, but you can grab val_dataloader or train_dataloader too for i, batch in enumerate(self.loader.test_dataloader()): print('batch {}'.format(i)) x, y = batch x = x.to(self.device) # y = y.to(self.device) # save the labels y all_labels.append(y.cpu().detach().numpy()) embeddings, _ = self.backbone(x) pred_batch = self.decoder(embeddings) # take argmax of the predictions pred_batch = torch.argmax(pred_batch, dim=1) all_preds.append(pred_batch.cpu().detach().numpy()) # convert list to tensor all_preds = np.concatenate(all_preds, axis=0) all_labels = np.concatenate(all_labels, axis=0) return all_preds, all_labels def load_model(self, cfg, ckpt_path): # get the configs cfg = yaml.load(open(cfg, 'r'), Loader=yaml.FullLoader) train_cfg = cfg['train'] # grab section `train` section of config model_cfg = cfg['model'] # grab the `model` section of config self.d_output = train_cfg['d_output'] # number of classes the head was trained on # the state dict has both the backbone model and the decoder (normally as a Lightning module), but we need to instantiate both separately # when not using Lightning. # instantiate the model backbone = DNAEmbeddingModel(**model_cfg) # instantiate the backbone separately from the decoder # instantiate the decoder decoder = SequenceDecoder(model_cfg['d_model'], d_output=self.d_output, l_output=0, mode='pool') # needs to know the d_model state_dict = torch.load(ckpt_path, map_location='cpu') # has both backbone and decoder # loads model from ddp by removing prexix to single if necessary torch.nn.modules.utils.consume_prefix_in_state_dict_if_present( state_dict["state_dict"], "model." ) model_state_dict = state_dict["state_dict"] # need to remove torchmetrics. to remove keys, need to convert to list first for key in list(model_state_dict.keys()): if "torchmetrics" in key: model_state_dict.pop(key) # the state_dict keys slightly mismatch from Lightning..., so we fix it here decoder_state_dict = {} decoder_state_dict['output_transform.weight'] = model_state_dict.pop('decoder.0.output_transform.weight') decoder_state_dict['output_transform.bias'] = model_state_dict.pop('decoder.0.output_transform.bias') # now actually load the state dict to the decoder and backbone separately decoder.load_state_dict(decoder_state_dict, strict=True) backbone.load_state_dict(model_state_dict, strict=True) # setup tokenizer tokenizer = CharacterTokenizer( characters=['A', 'C', 'G', 'T', 'N'], model_max_length=self.max_seq_len + 2, # add 2 since default adds eos/eos tokens, crop later add_special_tokens=False, ) return backbone, decoder, tokenizer if __name__ == "__main__": """ Example cmd for loading a pretrained model (that was finedtuned). This checkpoint was trained on the 'human_nontata_promoters path' dataset. # (from safari-internal-inf root, note the -m and no '.py') python -m evals.hg38_inference_decoder --config /home/workspace/eric/safari-internal/configs/evals/hg38_decoder.yaml \ --ckpt_path /home/workspace/eric/safari-internal/outputs/2023-04-14/04-32-17-578382/checkpoints/val/accuracy.ckpt # enhancer (genomic benchmark) python -m evals.hg38_inference_decoder --config /home/workspace/eric/safari-internal/configs/evals/hg38_decoder.yaml \ --ckpt_path /home/workspace/eric/safari-internal/outputs/2023-04-12/23-40-51-542457/checkpoints/val/mcc.ckpt --output_path /home/workspace/eric/safari-internal/outputs # config is located here: configs/evals/hg38_decoder.yaml # download the checkpoints from google drive, and put it in the outputs/ dir https://drive.google.com/drive/folders/11cDmLZgBHr3KkiCtS2V6sqI3Kf8lTW39?usp=share_link # enhancer weights, from nucleotide transformer, binary classification /home/workspace/eric/safari-internal/outputs/2023-04-12/23-40-51-542457/checkpoints/val/mcc.ckpt https://drive.google.com/drive/folders/1wIijtwlqWwzNe_0d3meAXSk7oYJ2POMC?usp=share_link # promoter tata weights /home/workspace/eric/safari-internal/outputs/2023-05-01/04-13-05-495708/checkpoints/val/f1_macro.ckpt note, this model is larger, 2 layers, d_model=256 (not 128!!), and d_inner=1024 https://drive.google.com/drive/folders/1tbIUYwScEox4SLFqeZIFp7Z4YvmIN0M3?usp=share_link # In general, you need to make sure there config has the same model settings as it was trained on. """ parser = argparse.ArgumentParser() parser.add_argument( "--config", default=f"", ) parser.add_argument( "--ckpt_path", default=f"", help="Path to model state dict checkpoint" ) parser.add_argument( "--output_path", default=f"", help="Path to where to save npy file" ) args = parser.parse_args() task = HG38Inference(args.config, args.ckpt_path, max_seq_len=1024, use_dataloader=True) # sample sequence, can pass a list of seqs (themselves a list of chars) # seqs = ["ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT"] # if you just have a list of sequences, as strings, you can use this function, returns list # preds = task.predict_on_list(seqs) # return a list of predictions # print(preds[0].shape) # shape is [batch, 2] for binary class prediction # OR... # or if you rather use the existing dataloader for the enhancer dataset, you can call this instead # returns a np array preds, labels = task.predict_from_loader() # print(preds.shape) # shape is [batch, 2] for binary class prediction # calculate accuracy of preds vs labels acc = np.mean(preds.squeeze() == labels.squeeze()) print("Acc: ", acc) breakpoint() pred_path = os.path.join(args.output_path, "preds.npy") label_path = os.path.join(args.output_path, "labels.npy") # save as numpy arr preds_np = np.array(preds) labels_np = np.array(labels) with open(pred_path, 'wb') as f: np.save(f, preds_np) with open(label_path, 'wb') as f: np.save(f, labels_np)
hyena-dna-main
evals/hg38_inference_decoder.py
import torch import argparse import os import sys import yaml from tqdm import tqdm import json sys.path.append(os.environ.get("SAFARI_PATH", ".")) from src.models.sequence.long_conv_lm import ConvLMHeadModel # from transformers import AutoTokenizer, GPT2LMHeadModel # from spacy.lang.en.stop_words import STOP_WORDS from src.dataloaders.datasets.hg38_char_tokenizer import CharacterTokenizer try: from tokenizers import Tokenizer except: pass # https://github.com/openai/gpt-2/issues/131#issuecomment-492786058 # def preprocess(text): # text = text.replace("“", '"') # text = text.replace("”", '"') # return '\n'+text.strip() class HG38Encoder: "Encoder inference for HG38 sequences" def __init__(self, model_cfg, ckpt_path, max_seq_len): self.max_seq_len = max_seq_len self.model, self.tokenizer = self.load_model(model_cfg, ckpt_path) self.device = torch.device("cuda" if torch.cuda.is_available() else "cpu") self.model = self.model.to(self.device) def encode(self, seqs): results = [] # sample code to loop thru each sample and tokenize first (char level) for seq in tqdm(seqs): if isinstance(self.tokenizer, Tokenizer): tokenized_seq = self.tokenizer.encode(seq).ids else: tokenized_seq = self.tokenizer.encode(seq) # can accept a batch, shape [B, seq_len, hidden_dim] logits, __ = self.model(torch.tensor([tokenized_seq]).to(device=self.device)) # Using head, so just have logits results.append(logits) return results def load_model(self, model_cfg, ckpt_path): config = yaml.load(open(model_cfg, 'r'), Loader=yaml.FullLoader) model = ConvLMHeadModel(**config['model_config']) state_dict = torch.load(ckpt_path, map_location='cpu') # loads model from ddp by removing prexix to single if necessary torch.nn.modules.utils.consume_prefix_in_state_dict_if_present( state_dict["state_dict"], "model." ) model_state_dict = state_dict["state_dict"] # need to remove torchmetrics. to remove keys, need to convert to list first for key in list(model_state_dict.keys()): if "torchmetrics" in key: model_state_dict.pop(key) model.load_state_dict(state_dict["state_dict"]) # setup tokenizer if config['tokenizer_name'] == 'char': print("**Using Char-level tokenizer**") # add to vocab tokenizer = CharacterTokenizer( characters=['A', 'C', 'G', 'T', 'N'], model_max_length=self.max_seq_len + 2, # add 2 since default adds eos/eos tokens, crop later add_special_tokens=False, ) print(tokenizer._vocab_str_to_int) else: raise NotImplementedError("You need to provide a custom tokenizer!") return model, tokenizer if __name__ == "__main__": SAFARI_PATH = os.getenv('SAFARI_PATH', '.') parser = argparse.ArgumentParser() parser.add_argument( "--model_cfg", default=f"{SAFARI_PATH}/configs/evals/hyena_small_150b.yaml", ) parser.add_argument( "--ckpt_path", default=f"", help="Path to model state dict checkpoint" ) args = parser.parse_args() task = HG38Encoder(args.model_cfg, args.ckpt_path, max_seq_len=1024) # sample sequence, can pass a list of seqs (themselves a list of chars) seqs = ["ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT"] logits = task.encode(seqs) print(logits) print(logits[0].logits.shape) breakpoint()
hyena-dna-main
evals/hg38_inference.py
import math import torch import torch.nn.functional as F from sklearn.metrics import f1_score, roc_auc_score from functools import partial import torchmetrics.functional as tm_f import torch.distributions as dist from sklearn.metrics import f1_score, roc_auc_score, matthews_corrcoef from torchmetrics import Metric from torchmetrics.classification import MulticlassRecall, MulticlassPrecision class CorrectAggregatedMetric(Metric): """This is needed to calculate some metrics b/c small batch sizes cause aggregation via a simple average to be off, as some classes might not be present in batch but will get penalized with a 0.""" def __init__(self, class_idx: int, dist_sync_on_step=False): # call `self.add_state`for every internal state that is needed for the metrics computations # dist_reduce_fx indicates the function that should be used to reduce # state from multiple processes super().__init__(dist_sync_on_step=dist_sync_on_step) self.class_idx = torch.tensor(class_idx) self.add_state("numerator", default=torch.tensor(0.0), dist_reduce_fx="sum") self.add_state("denominator", default=torch.tensor(0.0), dist_reduce_fx="sum") def _update(self, numerator, denominator, preds, y) -> tuple: raise NotImplemented def update(self, logits: torch.Tensor, y: torch.Tensor): # update metric states preds = torch.argmax(logits, dim=-1) logits = logits.view(-1, logits.shape[-1]) y = y.view(-1) assert preds.shape == y.shape, f"preds shape {preds.shape} != y shape {y.shape}" self.numerator, self.denominator = self._update(self.numerator, self.denominator, preds, y) def compute(self): # compute final result value = self.numerator.float() / self.denominator if self.denominator > 0 else torch.tensor(0.0) return value def reset(self): self.numerator = torch.tensor(0.0) self.denominator = torch.tensor(0.0) class AccuracyPerClass(CorrectAggregatedMetric): """Calculate per class accuracy, i.e. P(y_hat = class_idx AND y = class_idx OR y_hat != class_idx AND y != class_idx) """ def _update(self, numerator, denominator, preds, y) -> tuple: # Filter down to the class of interest class_idx = self.class_idx relevant_idxs = (y == class_idx) numerator += (preds[relevant_idxs] == class_idx).sum() denominator += relevant_idxs.sum() relevant_idxs = (y != class_idx) numerator += (preds[relevant_idxs] != class_idx).sum() denominator += relevant_idxs.sum() return numerator, denominator class PrecisionPerClass(CorrectAggregatedMetric): """Calculate per class precision, i.e. P(y_hat = y | y_hat = class_idx) """ def _update(self, numerator, denominator, preds, y) -> tuple: # Filter down to the class of interest class_idx = self.class_idx relevant_idxs = (preds == class_idx) numerator += (preds[relevant_idxs] == y[relevant_idxs]).sum() denominator += relevant_idxs.sum() return numerator, denominator class RecallPerClass(CorrectAggregatedMetric): """Calculate per class recall, i.e. P(y_hat = y | y = class_idx) """ def _update(self, numerator, denominator, preds, y) -> tuple: # Filter down to the class of interest class_idx = self.class_idx relevant_idxs = (y == class_idx) numerator += (preds[relevant_idxs] == y[relevant_idxs]).sum() denominator += relevant_idxs.sum() return numerator, denominator def mcc(logits, y): logits = logits.view(-1, logits.shape[-1]) y = y.view(-1) y_hat = torch.argmax(logits, dim=-1) return matthews_corrcoef(y.cpu().numpy(), y_hat.cpu().numpy()) def last_k_ppl(logits, y, seq_len=1024, k=None): ''' Calculate perplexity for last k tokens in a sequence. logits: (batch_size * seq_len, vocab_size), note, already flattened y: (batch_size * seq_len), note, already flattened seq_len: int, length of each sequence in the batch k: if None, use all tokens in sequence returns: (batch_size,) ppl for each sequence in the batch ''' if k is None: k = 0 # use the entire sequence # need to reshape logits and y to be (batch_size, seq_len, vocab_size) and (batch_size, seq_len) # respectively # breakpoint() logits = logits.view(-1, seq_len, logits.shape[-1]) y = y.view(-1, seq_len) # only use the last k values of seq dim in logits and y logits = logits[:, -k:, :] y = y[:, -k:] # reshape to flatten the batch and seq_len dimensions logits = logits.reshape(-1, logits.shape[-1]) y = y.reshape(-1) # get avg and put on cpu return F.cross_entropy(logits, y, reduction='none').view(y.shape[0], -1).mean().exp().cpu() def _student_t_map(mu, sigma, nu): sigma = F.softplus(sigma) nu = 2.0 + F.softplus(nu) return mu.squeeze(axis=-1), sigma.squeeze(axis=-1), nu.squeeze(axis=-1) def student_t_loss(outs, y): mu, sigma, nu = outs[..., 0], outs[..., 1], outs[..., 2] mu, sigma, nu = _student_t_map(mu, sigma, nu) y = y.squeeze(axis=-1) nup1_half = (nu + 1.0) / 2.0 part1 = 1.0 / nu * torch.square((y - mu) / sigma) Z = ( torch.lgamma(nup1_half) - torch.lgamma(nu / 2.0) - 0.5 * torch.log(math.pi * nu) - torch.log(sigma) ) ll = Z - nup1_half * torch.log1p(part1) return -ll.mean() def gaussian_ll_loss(outs, y): mu, sigma = outs[..., 0], outs[..., 1] y = y.squeeze(axis=-1) sigma = F.softplus(sigma) ll = -1.0 * ( torch.log(sigma) + 0.5 * math.log(2 * math.pi) + 0.5 * torch.square((y - mu) / sigma) ) return -ll.mean() def binary_cross_entropy(logits, y): # BCE loss requires squeezing last dimension of logits so it has the same shape as y # requires y to be float, since it's overloaded to represent a probability return F.binary_cross_entropy_with_logits(logits.squeeze(-1), y.float()) def binary_accuracy(logits, y): return torch.eq(logits.squeeze(-1) >= 0, y).float().mean() def padded_cross_entropy(logits, y, pad_mask, pad_value=-1): """Will ignore the pad value in label (eg, -1) logits: (batch_size, seq_len, vocab_size) y: (batch_size, seq_len) pad_mask: (batch_size, seq_len) """ # need to apply pad mask to y y_pad = y + pad_mask * pad_value logits = logits.view(-1, logits.shape[-1]) y_pad = y_pad.view(-1) return F.cross_entropy(logits, y_pad, ignore_index=pad_value) def cross_entropy(logits, y, ignore_index=-100): logits = logits.view(-1, logits.shape[-1]) y = y.view(-1) return F.cross_entropy(logits, y, ignore_index=ignore_index) def soft_cross_entropy(logits, y, label_smoothing=0.0): logits = logits.view(-1, logits.shape[-1]) # target is now 2d (no target flattening) return F.cross_entropy(logits, y, label_smoothing=label_smoothing) def accuracy(logits, y): logits = logits.view(-1, logits.shape[-1]) preds = torch.argmax(logits, dim=-1) if y.numel() > logits.shape[0]: # Mixup leads to this case: use argmax class y = y.argmax(dim=-1) y = y.view(-1) return torch.eq(preds, y).float().mean() def accuracy_ignore_index(logits, y, ignore_index=-100): num_classes = logits.shape[-1] preds = torch.argmax(logits, dim=-1) logits = logits.view(-1, logits.shape[-1]) y = y.view(-1) accuracy = tm_f.classification.accuracy(preds, y, 'multiclass', num_classes=num_classes, ignore_index=ignore_index, average='micro') return accuracy def accuracy_at_k(logits, y, k=1): logits = logits.view(-1, logits.shape[-1]) if y.numel() > logits.shape[0]: # Mixup leads to this case: use argmax class y = y.argmax(dim=-1) y = y.view(-1) return torch.topk(logits, k, dim=-1)[1].eq(y.unsqueeze(-1)).any(dim=-1).float().mean() def f1_binary(logits, y): logits = logits.view(-1, logits.shape[-1]) y = y.view(-1) y_hat = torch.argmax(logits, dim=-1) return f1_score(y.cpu().numpy(), y_hat.cpu().numpy(), average="binary") def f1_macro(logits, y): logits = logits.view(-1, logits.shape[-1]) y = y.view(-1) y_hat = torch.argmax(logits, dim=-1) return f1_score(y.cpu().numpy(), y_hat.cpu().numpy(), average="macro") def f1_micro(logits, y): logits = logits.view(-1, logits.shape[-1]) y = y.view(-1) y_hat = torch.argmax(logits, dim=-1) return f1_score(y.cpu().numpy(), y_hat.cpu().numpy(), average="micro") def roc_auc_macro(logits, y): logits = logits.view( -1, logits.shape[-1] ).detach() # KS: had to add detach to eval while training y = y.view(-1) return roc_auc_score( y.cpu().numpy(), F.softmax(logits, dim=-1).cpu().numpy()[:, 1], average="macro" ) def roc_auc_micro(logits, y): logits = logits.view(-1, logits.shape[-1]) y = y.view(-1) return roc_auc_score( y.cpu().numpy(), F.softmax(logits, dim=-1).cpu().numpy()[:, 1], average="micro" ) def mse(outs, y, len_batch=None): # assert outs.shape[:-1] == y.shape and outs.shape[-1] == 1 # outs = outs.squeeze(-1) if len(y.shape) < len(outs.shape): assert outs.shape[-1] == 1 outs = outs.squeeze(-1) if len_batch is None: return F.mse_loss(outs, y) else: # Computes the loss of the first `lens` items in the batches # TODO document the use case of this mask = torch.zeros_like(outs, dtype=torch.bool) for i, l in enumerate(len_batch): mask[i, :l, :] = 1 outs_masked = torch.masked_select(outs, mask) y_masked = torch.masked_select(y, mask) return F.mse_loss(outs_masked, y_masked) def forecast_rmse(outs, y, len_batch=None): # TODO: generalize, currently for Monash dataset return torch.sqrt(F.mse_loss(outs, y, reduction='none').mean(1)).mean() def mae(outs, y, len_batch=None): # assert outs.shape[:-1] == y.shape and outs.shape[-1] == 1 # outs = outs.squeeze(-1) if len(y.shape) < len(outs.shape): assert outs.shape[-1] == 1 outs = outs.squeeze(-1) if len_batch is None: return F.l1_loss(outs, y) else: # Computes the loss of the first `lens` items in the batches mask = torch.zeros_like(outs, dtype=torch.bool) for i, l in enumerate(len_batch): mask[i, :l, :] = 1 outs_masked = torch.masked_select(outs, mask) y_masked = torch.masked_select(y, mask) return F.l1_loss(outs_masked, y_masked) # Metrics that can depend on the loss def loss(x, y, loss_fn): """ This metric may be useful because the training loss may add extra regularization (e.g. weight decay implemented as L2 penalty), while adding this as a metric skips the additional losses """ return loss_fn(x, y) def bpb(x, y, loss_fn): """ bits per byte (image density estimation, speech generation, char LM) """ return loss_fn(x, y) / math.log(2) def ppl(x, y, loss_fn): return torch.exp(loss_fn(x, y)) # should have a better way to do this output_metric_fns = { "binary_cross_entropy": binary_cross_entropy, "cross_entropy": cross_entropy, "padded_cross_entropy": padded_cross_entropy, "binary_accuracy": binary_accuracy, "precision": MulticlassPrecision, "precision_per_class": PrecisionPerClass, "recall": MulticlassRecall, "recall_per_class": RecallPerClass, "accuracy": accuracy, "accuracy_per_class": AccuracyPerClass, "accuracy_ignore_index": accuracy_ignore_index, 'accuracy@3': partial(accuracy_at_k, k=3), 'accuracy@5': partial(accuracy_at_k, k=5), 'accuracy@10': partial(accuracy_at_k, k=10), "eval_loss": loss, "mcc": mcc, "mse": mse, "mae": mae, "forecast_rmse": forecast_rmse, "f1_binary": f1_binary, "f1_macro": f1_macro, "f1_micro": f1_micro, "roc_auc_macro": roc_auc_macro, "roc_auc_micro": roc_auc_micro, "soft_cross_entropy": soft_cross_entropy, # only for pytorch 1.10+ "student_t": student_t_loss, "gaussian_ll": gaussian_ll_loss, } loss_metric_fns = { "loss": loss, "bpb": bpb, "ppl": ppl, } metric_fns = {**output_metric_fns, **loss_metric_fns} # TODO py3.9
hyena-dna-main
src/tasks/metrics.py
# Inspired by https://github.com/NVIDIA/NeMo/blob/main/nemo/collections/common/metrics/perplexity.py # But we compute the perplexity correctly: exp(average(nll)), not average(exp(nll)) # Also adapted from https://github.com/Lightning-AI/metrics/blob/master/src/torchmetrics/text/perplexity.py # But we pass in the loss to avoid recomputation from typing import Any, Dict, Optional import torch import torch.nn.functional as F from torch import Tensor from torchmetrics import Metric try: from flash_attn.losses.cross_entropy import CrossEntropyLoss except ImportError: CrossEntropyLoss = torch.nn.CrossEntropyLoss try: from apex.transformer import parallel_state except ImportError: parallel_state = None class Perplexity(Metric): r""" Perplexity measures how well a language model predicts a text sample. It's calculated as the average number of bits per word a model needs to represent the sample. Args: kwargs: Additional keyword arguments, see :ref:`Metric kwargs` for more info. Examples: >>> import torch >>> preds = torch.rand(2, 8, 5, generator=torch.manual_seed(22)) >>> target = torch.randint(5, (2, 8), generator=torch.manual_seed(22)) >>> target[0, 6:] = -100 >>> metric = Perplexity(ignore_index=-100) >>> metric(preds, target) tensor(5.2545) """ is_differentiable = True higher_is_better = False full_state_update = False total_log_probs: Tensor count: Tensor def __init__(self, **kwargs: Dict[str, Any]): super().__init__(**kwargs) self.add_state("total_log_probs", default=torch.tensor(0.0, dtype=torch.float64), dist_reduce_fx="sum") self.add_state("count", default=torch.tensor(0, dtype=torch.int64), dist_reduce_fx="sum") self.loss_fn = CrossEntropyLoss() def update(self, preds: Tensor, target: Tensor, loss: Optional[Tensor] = None) -> None: # type: ignore """Compute and store intermediate statistics for Perplexity. Args: preds: Probabilities assigned to each token in a sequence with shape [batch_size, seq_len, vocab_size]. target: Ground truth values with a shape [batch_size, seq_len]. """ count = target.numel() if loss is None: loss = self.loss_fn(preds, target) self.total_log_probs += loss.double() * count self.count += count def compute(self) -> Tensor: """Compute the Perplexity. Returns: Perplexity """ return torch.exp(self.total_log_probs / self.count) class NumTokens(Metric): """Keep track of how many tokens we've seen. """ # TODO: how do we prevent the reset between the epochs? The reset happens on the 1st batch # of the next epoch. # Right now the hack is that we override reset(), which would mess up the forward method. # We then override forward to do the right thing. is_differentiable = False higher_is_better = False full_state_update = False count: Tensor def __init__(self, **kwargs: Dict[str, Any]): super().__init__(**kwargs) self.add_state("count", default=torch.tensor(0, dtype=torch.int64), dist_reduce_fx="sum", persistent=True) # We want the count to be saved to state-dict if parallel_state is not None and not parallel_state.is_unitialized(): self.tensor_parallel_world_size = parallel_state.get_tensor_model_parallel_world_size() else: self.tensor_parallel_world_size = 1 def update(self, preds: Tensor, target: Tensor, loss: Optional[Tensor] = None) -> None: # type: ignore self.count += target.numel() // self.tensor_parallel_world_size def compute(self) -> Tensor: return self.count def reset(self): count = self.count super().reset() self.count = count # Adapted from https://github.com/Lightning-AI/metrics/blob/master/src/torchmetrics/metric.py def _forward_reduce_state_update(self, *args: Any, **kwargs: Any) -> Any: """forward computation using single call to `update` to calculate the metric value on the current batch and accumulate global state. This can be done when the global metric state is a sinple reduction of batch states. """ self.update(*args, **kwargs) return self.compute() torchmetric_fns = { "perplexity": Perplexity, "num_tokens": NumTokens, }
hyena-dna-main
src/tasks/torchmetrics.py
from typing import Optional, List, Tuple import math import functools import collections import torch import torch.nn as nn import torch.nn.functional as F from einops import rearrange from omegaconf import ListConfig from src.models.nn.components import ReversibleInstanceNorm1dInput, ReversibleInstanceNorm1dOutput, \ TSNormalization, TSInverseNormalization from src.models.nn.adaptive_softmax import AdaptiveEmbedding, ProjectedAdaptiveLogSoftmax import src.tasks.metrics as M from src.tasks.torchmetrics import torchmetric_fns as tm_mine import src.models.nn.utils as U import torchmetrics as tm from src.utils.config import to_list, instantiate from torchmetrics import MetricCollection class BaseTask: """ Abstract class that takes care of: - loss function - arbitrary metrics - forward pass - (optional) encoder module that interfaces with dataset (inputs) and model - (optional) decoder module that interfaces with dataset (targets) and model """ encoder = None decoder = None def __init__(self, dataset=None, model=None, loss=None, loss_val=None, metrics=None, torchmetrics=None): """ This class is allowed to grab attributes directly off a constructed dataset and model object """ self.dataset = dataset self.model = model if metrics is None: metrics = [] self.metric_names = to_list(metrics) if torchmetrics is None: torchmetrics = [] self.torchmetric_names = to_list(torchmetrics) self._tracked_torchmetrics = {} # The decoder might pass through arguments that the loss needs (e.g. sequence lengths) # but might also pass through extraneous arguments (e.g. sampling rate) # Wrap loss and metrics so that they accept kwargs and # Create loss function self.loss = instantiate(M.output_metric_fns, loss, partial=True) self.loss = U.discard_kwargs(self.loss) if loss_val is not None: self.loss_val = instantiate(M.output_metric_fns, loss_val, partial=True) self.loss_val = U.discard_kwargs(self.loss_val) torchmetrics = MetricCollection(self._init_torchmetrics()) self.train_torchmetrics = torchmetrics.clone(prefix='train/') self.val_torchmetrics = torchmetrics.clone(prefix='val/') self.test_torchmetrics = torchmetrics.clone(prefix='test/') def _init_torchmetrics(self): """ Instantiate torchmetrics. """ tracked_torchmetrics = {} for name in self.torchmetric_names: if name in tm_mine: tracked_torchmetrics[name] = tm_mine[name]().to('cuda') elif name in ['AUROC', 'StatScores', 'Precision', 'Recall', 'F1', 'F1Score']: tracked_torchmetrics[name] = getattr(tm, name)(average='macro', num_classes=self.dataset.d_output, compute_on_step=False).to('cuda') elif '@' in name: k = int(name.split('@')[1]) mname = name.split('@')[0] tracked_torchmetrics[name] = getattr(tm, mname)(average='macro', num_classes=self.dataset.d_output, compute_on_step=False, top_k=k).to('cuda') else: tracked_torchmetrics[name] = getattr(tm, name)(compute_on_step=False).to('cuda') return tracked_torchmetrics def _reset_torchmetrics(self, prefix=None): """ Reset torchmetrics for a prefix associated with a particular dataloader (e.g. train, val, test). Generally do this at the start of an epoch. """ all_prefixes = [prefix] if prefix is not None else self._tracked_torchmetrics for prefix in all_prefixes: if prefix in self._tracked_torchmetrics: self._tracked_torchmetrics[prefix].reset() def get_torchmetrics(self, prefix): """ Compute torchmetrics for a prefix associated with a particular dataloader (e.g. train, val, test). Generally do this at the end of an epoch. """ return {name: self._tracked_torchmetrics[prefix][name].compute() for name in self.torchmetric_names} def torchmetrics(self, x, y, prefix, loss=None): """ Update torchmetrics with new x, y . Prefix corresponds to a particular dataloader (e.g. train, val, test). Generally call this every batch. """ if prefix not in self._tracked_torchmetrics: self._init_torchmetrics(prefix) self._tracked_torchmetrics[prefix](x, y, loss=loss) # for name in self.torchmetric_names: # if name.startswith('Accuracy'): # if len(x.shape) > 2: # # Multi-dimensional, multi-class # self._tracked_torchmetrics[prefix][name].update(x.transpose(1, 2), y.squeeze()) # continue # self._tracked_torchmetrics[prefix][name].update(x, y) def get_torchmetrics(self, prefix): return self._tracked_torchmetrics[prefix] def metrics(self, x, y, **kwargs): """ Metrics are just functions output metrics are a function of output and target loss metrics are a function of loss (e.g. perplexity) """ output_metrics = { name: U.discard_kwargs(M.output_metric_fns[name])(x, y, **kwargs) for name in self.metric_names if name in M.output_metric_fns } loss_metrics = { name: U.discard_kwargs(M.loss_metric_fns[name])(x, y, self.loss, **kwargs) for name in self.metric_names if name in M.loss_metric_fns } return {**output_metrics, **loss_metrics} def forward(self, batch, encoder, model, decoder, _state): """Passes a batch through the encoder, backbone, and decoder""" # z holds arguments such as sequence length x, y, *z = batch # z holds extra dataloader info such as resolution if len(z) == 0: z = {} else: assert len(z) == 1 and isinstance(z[0], dict), "Dataloader must return dictionary of extra arguments" z = z[0] x, w = encoder(x, **z) # w can model-specific constructions such as key_padding_mask for transformers or state for RNNs x, state = model(x, **w, state=_state) self._state = state x, w = decoder(x, state=state, **z) return x, y, w class Scalar(nn.Module): def __init__(self, c=1): super().__init__() self.c = c def forward(self, x): return x * self.c class LMTask(BaseTask): def forward(self, batch, encoder, model, decoder, _state): """Passes a batch through the encoder, backbone, and decoder""" # z holds arguments such as sequence length x, y, *z = batch # z holds extra dataloader info such as resolution if len(z) == 0: z = {} else: assert len(z) == 1 and isinstance(z[0], dict), "Dataloader must return dictionary of extra arguments" z = z[0] x, w = encoder(x, **z) # w can model-specific constructions such as key_padding_mask for transformers or state for RNNs x, state = model(x, **w, state=_state) self._state = state x, w = decoder(x, state=state, **z) x = x.logits x = rearrange(x, '... C -> (...) C') y = rearrange(y, '... -> (...)') return x, y, w class MultiClass(BaseTask): def __init__(self, *args, **kwargs): super().__init__(*args, **kwargs) self.continual_metrics = {} for name in self.metric_names: if name.endswith('_per_class'): for spec_idx, spec in enumerate(self.dataset.species): self.continual_metrics[name + '_' + spec] = M.output_metric_fns[name](spec_idx) def metrics(self, x, y, **kwargs): output_metrics = {} for name in self.metric_names: if name in M.output_metric_fns: if name.endswith('_per_class'): for spec_idx, spec in enumerate(self.dataset.species): self.continual_metrics[name + '_' + spec] = self.continual_metrics[name + '_' + spec].to(x.device) self.continual_metrics[name + '_' + spec].update(x, y) output_metrics[name + '_' + spec] = self.continual_metrics[name + '_' + spec].compute() elif name in ['precision', 'recall']: self.continual_metrics[name] = self.continual_metrics[name].to(x.device) output_metrics[name] = self.continual_metrics[name](x, y) else: output_metrics[name] = U.discard_kwargs(M.output_metric_fns[name])(x, y, **kwargs) loss_metrics = { name: U.discard_kwargs(M.loss_metric_fns[name])(x, y, self.loss, **kwargs) for name in self.metric_names if name in M.loss_metric_fns } return {**output_metrics, **loss_metrics} def _reset_torchmetrics(self, prefix=None): super()._reset_torchmetrics(prefix) for name in self.metric_names: if name.endswith('_per_class'): for spec_idx, spec in enumerate(self.dataset.species): self.continual_metrics[name + '_' + spec].reset() class HG38Task(LMTask): def __init__(self, dataset=None, model=None, loss=None, loss_val=None, metrics=None, torchmetrics=None, last_k_ppl=None, per_token_ppl=None): """ Extending LMTask to add custom metrics for HG38 task last_k_ppl: config for custom ppl, with hparams to pass with it per_token_ppl: config for per token ppl calc, with list of k (ppls) to track """ self.dataset = dataset self.model = model if metrics is None: metrics = [] self.metric_names = to_list(metrics) self.last_k_ppl = last_k_ppl self.per_token_ppl = per_token_ppl if torchmetrics is None: torchmetrics = [] self.torchmetric_names = to_list(torchmetrics) self._tracked_torchmetrics = {} # The decoder might pass through arguments that the loss needs (e.g. sequence lengths) # but might also pass through extraneous arguments (e.g. sampling rate) # Wrap loss and metrics so that they accept kwargs and # Create loss function self.loss = instantiate(M.output_metric_fns, loss, partial=True) self.loss = U.discard_kwargs(self.loss) if loss_val is not None: self.loss_val = instantiate(M.output_metric_fns, loss_val, partial=True) self.loss_val = U.discard_kwargs(self.loss_val) torchmetrics = MetricCollection(self._init_torchmetrics()) self.train_torchmetrics = torchmetrics.clone(prefix='train/') self.val_torchmetrics = torchmetrics.clone(prefix='val/') self.test_torchmetrics = torchmetrics.clone(prefix='test/') # Create custom metrics for last k ppl # last_k_ppl is a list of dicts (configs), so loop thru them if self.last_k_ppl is not None: self.custom_ppl_dict = {} for k in self.last_k_ppl: key_name = "last_" + str(k) + "_ppl" # create config custom_ppl_config = {"_name_": "last_k_ppl", "k": k, "seq_len": self.dataset.max_length} k_ppl_fn = instantiate(M.output_metric_fns, custom_ppl_config, partial=True) k_ppl_fn = U.discard_kwargs(k_ppl_fn) self.custom_ppl_dict[key_name] = k_ppl_fn # Create custom metric for per token ppl if self.per_token_ppl is not None: per_token_ppl_config = {"_name_": "per_token_ppl", "ks": self.per_token_ppl["ks"], "seq_len": self.dataset.max_length} per_token_fn = instantiate(M.output_metric_fns, per_token_ppl_config, partial=True) per_token_fn = U.discard_kwargs(per_token_fn) self.per_token_fn = per_token_fn def metrics(self, x, y, **kwargs): """ Need to modify metrics to include custom metrics """ output_metrics = { name: U.discard_kwargs(M.output_metric_fns[name])(x, y, **kwargs) for name in self.metric_names if name in M.output_metric_fns } loss_metrics = { name: U.discard_kwargs(M.loss_metric_fns[name])(x, y, self.loss, **kwargs) for name in self.metric_names if name in M.loss_metric_fns } # loop thru all custom ppls and add them to output_metrics if self.last_k_ppl is not None: for key_name, k_ppl_fn in self.custom_ppl_dict.items(): output_metrics[key_name] = k_ppl_fn(x, y, **kwargs) # loop thru all custom ppls and add them to output_metrics if self.per_token_ppl is not None: # returns k ppl values, (averaged over batch) per_k_ppl = self.per_token_fn(x, y, **kwargs) # loop over ks to log metric for ind, k in enumerate(self.per_token_ppl["ks"]): key_name = "ppl_at_{}".format(k) k = k-1 # 0 index in the background output_metrics[key_name] = per_k_ppl[ind] # should be in order return {**output_metrics, **loss_metrics} class AdaptiveLMTask(BaseTask): def __init__( self, div_val, cutoffs : List[int], tie_weights : bool, tie_projs : List[bool], init_scale=1.0, bias_scale=0.0, dropemb=0.0, dropsoft=0.0, **kwargs, ): super().__init__(**kwargs) n_tokens = self.dataset.n_tokens d_model = self.model.d_model d_output = self.model.d_output encoder = AdaptiveEmbedding( n_tokens, d_model, d_model, cutoffs=cutoffs, div_val=div_val, init_scale=init_scale, dropout=dropemb, ) if tie_weights: assert d_model == d_output emb_layers = [i.weight for i in encoder.emb_layers] else: emb_layers = None # Construct decoder/loss emb_projs = encoder.emb_projs loss = ProjectedAdaptiveLogSoftmax( n_tokens, d_output, d_output, cutoffs, div_val=div_val, tie_projs=tie_projs, out_projs=emb_projs, out_layers_weights=emb_layers, bias_scale=bias_scale, dropout=dropsoft, ) self.encoder = encoder self.loss = loss registry = { 'base': BaseTask, 'multiclass': MultiClass, 'lm': LMTask, 'hg38': HG38Task, }
hyena-dna-main
src/tasks/tasks.py
import torch import torch.nn as nn import torch.nn.functional as F from einops import rearrange, reduce import src.models.nn.utils as U import src.utils as utils import src.utils.config import src.utils.train log = src.utils.train.get_logger(__name__) class Decoder(nn.Module): """This class doesn't do much but just signals the interface that Decoders are expected to adhere to TODO: is there a way to enforce the signature of the forward method? """ def forward(self, x, **kwargs): """ x: (batch, length, dim) input tensor state: additional state from the model backbone *args, **kwargs: additional info from the dataset Returns: y: output tensor *args: other arguments to pass into the loss function """ return x def step(self, x): """ x: (batch, dim) """ return self.forward(x.unsqueeze(1)).squeeze(1) class SequenceDecoder(Decoder): def __init__( self, d_model, d_output=None, l_output=None, use_lengths=False, mode="last" ): super().__init__() self.output_transform = nn.Identity() if d_output is None else nn.Linear(d_model, d_output) if l_output is None: self.l_output = None self.squeeze = False elif l_output == 0: # Equivalent to getting an output of length 1 and then squeezing self.l_output = 1 self.squeeze = True else: assert l_output > 0 self.l_output = l_output self.squeeze = False self.use_lengths = use_lengths self.mode = mode if mode == 'ragged': assert not use_lengths def forward(self, x, state=None, lengths=None, l_output=None): """ x: (n_batch, l_seq, d_model) Returns: (n_batch, l_output, d_output) """ if self.l_output is None: if l_output is not None: assert isinstance(l_output, int) # Override by pass in else: # Grab entire output l_output = x.size(-2) squeeze = False else: l_output = self.l_output squeeze = self.squeeze if self.mode == "last": restrict = lambda x: x[..., -l_output:, :] elif self.mode == "first": restrict = lambda x: x[..., :l_output, :] elif self.mode == "pool": restrict = lambda x: ( torch.cumsum(x, dim=-2) / torch.arange( 1, 1 + x.size(-2), device=x.device, dtype=x.dtype ).unsqueeze(-1) )[..., -l_output:, :] def restrict(x): L = x.size(-2) s = x.sum(dim=-2, keepdim=True) if l_output > 1: c = torch.cumsum(x[..., -(l_output - 1) :, :].flip(-2), dim=-2) c = F.pad(c, (0, 0, 1, 0)) s = s - c # (B, l_output, D) s = s.flip(-2) denom = torch.arange( L - l_output + 1, L + 1, dtype=x.dtype, device=x.device ) s = s / denom return s elif self.mode == "sum": restrict = lambda x: torch.cumsum(x, dim=-2)[..., -l_output:, :] # TODO use same restrict function as pool case elif self.mode == 'ragged': assert lengths is not None, "lengths must be provided for ragged mode" # remove any additional padding (beyond max length of any sequence in the batch) restrict = lambda x: x[..., : max(lengths), :] else: raise NotImplementedError( "Mode must be ['last' | 'first' | 'pool' | 'sum']" ) # Restrict to actual length of sequence if self.use_lengths: assert lengths is not None x = torch.stack( [ restrict(out[..., :length, :]) for out, length in zip(torch.unbind(x, dim=0), lengths) ], dim=0, ) else: x = restrict(x) if squeeze: assert x.size(-2) == 1 x = x.squeeze(-2) x = self.output_transform(x) return x def step(self, x, state=None): # Ignore all length logic return self.output_transform(x) class TokenDecoder(Decoder): """Decoder for token level classification""" def __init__( self, d_model, d_output=3 ): super().__init__() self.output_transform = nn.Linear(d_model, d_output) def forward(self, x, state=None): """ x: (n_batch, l_seq, d_model) Returns: (n_batch, l_output, d_output) """ x = self.output_transform(x) return x class NDDecoder(Decoder): """Decoder for single target (e.g. classification or regression)""" def __init__( self, d_model, d_output=None, mode="pool" ): super().__init__() assert mode in ["pool", "full"] self.output_transform = nn.Identity() if d_output is None else nn.Linear(d_model, d_output) self.mode = mode def forward(self, x, state=None): """ x: (n_batch, l_seq, d_model) Returns: (n_batch, l_output, d_output) """ if self.mode == 'pool': x = reduce(x, 'b ... h -> b h', 'mean') x = self.output_transform(x) return x class StateDecoder(Decoder): """Use the output state to decode (useful for stateful models such as RNNs or perhaps Transformer-XL if it gets implemented""" def __init__(self, d_model, state_to_tensor, d_output): super().__init__() self.output_transform = nn.Linear(d_model, d_output) self.state_transform = state_to_tensor def forward(self, x, state=None): return self.output_transform(self.state_transform(state)) class RetrievalHead(nn.Module): def __init__(self, d_input, d_model, n_classes, nli=True, activation="relu"): super().__init__() self.nli = nli if activation == "relu": activation_fn = nn.ReLU() elif activation == "gelu": activation_fn = nn.GELU() else: raise NotImplementedError if ( self.nli ): # Architecture from https://github.com/mlpen/Nystromformer/blob/6539b895fa5f798ea0509d19f336d4be787b5708/reorganized_code/LRA/model_wrapper.py#L74 self.classifier = nn.Sequential( nn.Linear(4 * d_input, d_model), activation_fn, nn.Linear(d_model, n_classes), ) else: # Head from https://github.com/google-research/long-range-arena/blob/ad0ff01a5b3492ade621553a1caae383b347e0c1/lra_benchmarks/models/layers/common_layers.py#L232 self.classifier = nn.Sequential( nn.Linear(2 * d_input, d_model), activation_fn, nn.Linear(d_model, d_model // 2), activation_fn, nn.Linear(d_model // 2, n_classes), ) def forward(self, x): """ x: (2*batch, dim) """ outs = rearrange(x, "(z b) d -> z b d", z=2) outs0, outs1 = outs[0], outs[1] # (n_batch, d_input) if self.nli: features = torch.cat( [outs0, outs1, outs0 - outs1, outs0 * outs1], dim=-1 ) # (batch, dim) else: features = torch.cat([outs0, outs1], dim=-1) # (batch, dim) logits = self.classifier(features) return logits class RetrievalDecoder(Decoder): """Combines the standard FeatureDecoder to extract a feature before passing through the RetrievalHead""" def __init__( self, d_input, n_classes, d_model=None, nli=True, activation="relu", *args, **kwargs ): super().__init__() if d_model is None: d_model = d_input self.feature = SequenceDecoder( d_input, d_output=None, l_output=0, *args, **kwargs ) self.retrieval = RetrievalHead( d_input, d_model, n_classes, nli=nli, activation=activation ) def forward(self, x, state=None, **kwargs): x = self.feature(x, state=state, **kwargs) x = self.retrieval(x) return x class PackedDecoder(Decoder): def forward(self, x, state=None): x, _ = nn.utils.rnn.pad_packed_sequence(x, batch_first=True) return x # For every type of encoder/decoder, specify: # - constructor class # - list of attributes to grab from dataset # - list of attributes to grab from model registry = { "stop": Decoder, "id": nn.Identity, "linear": nn.Linear, "sequence": SequenceDecoder, "nd": NDDecoder, "retrieval": RetrievalDecoder, "state": StateDecoder, "pack": PackedDecoder, "token": TokenDecoder, } model_attrs = { "linear": ["d_output"], "sequence": ["d_output"], "nd": ["d_output"], "retrieval": ["d_output"], "state": ["d_state", "state_to_tensor"], "forecast": ["d_output"], "token": ["d_output"], } dataset_attrs = { "linear": ["d_output"], "sequence": ["d_output", "l_output"], "nd": ["d_output"], "retrieval": ["d_output"], "state": ["d_output"], "forecast": ["d_output", "l_output"], "token": ["d_output"], } def _instantiate(decoder, model=None, dataset=None): """Instantiate a single decoder""" if decoder is None: return None if isinstance(decoder, str): name = decoder else: name = decoder["_name_"] # Extract arguments from attribute names dataset_args = utils.config.extract_attrs_from_obj( dataset, *dataset_attrs.get(name, []) ) model_args = utils.config.extract_attrs_from_obj(model, *model_attrs.get(name, [])) # Instantiate decoder obj = utils.instantiate(registry, decoder, *model_args, *dataset_args) return obj def instantiate(decoder, model=None, dataset=None): """Instantiate a full decoder config, e.g. handle list of configs Note that arguments are added in reverse order compared to encoder (model first, then dataset) """ decoder = utils.to_list(decoder) return U.PassthroughSequential( *[_instantiate(d, model=model, dataset=dataset) for d in decoder] )
hyena-dna-main
src/tasks/decoders.py
import datetime import math from typing import ForwardRef import torch from torch import nn import torch.nn.functional as F from einops import rearrange, repeat import src.models.nn.utils as U import src.utils as utils import src.utils.config from src.models.sequence.block import SequenceResidualBlock from src.models.nn.components import Normalization class Encoder(nn.Module): """Encoder abstraction Accepts a tensor and optional kwargs. Outside of the main tensor, all other arguments should be kwargs. Returns a tensor and optional kwargs. Encoders are combined via U.PassthroughSequential which passes these kwargs through in a pipeline. The resulting kwargs are accumulated and passed into the model backbone. """ def forward(self, x, **kwargs): """ x: input tensor *args: additional info from the dataset (e.g. sequence lengths) Returns: y: output tensor *args: other arguments to pass into the model backbone """ return x, {} class PositionalIDEncoder(Encoder): def forward(self, x): position_ids = torch.arange(x.shape[-1], dtype=torch.long, device=x.device) position_ids = repeat(position_ids, 'l -> b l', b=x.shape[0]) return x, { 'position_ids': position_ids } # Adapted from https://github.com/pytorch/examples/blob/master/word_language_model/model.py class PositionalEncoder(Encoder): r"""Inject some information about the relative or absolute position of the tokens in the sequence. The positional encodings have the same dimension as the embeddings, so that the two can be summed. Here, we use sine and cosine functions of different frequencies. .. math:: \text{PosEncoder}(pos, 2i) = sin(pos/10000^(2i/d_model)) \text{PosEncoder}(pos, 2i+1) = cos(pos/10000^(2i/d_model)) \text{where pos is the word position and i is the embed idx) Args: d_model: the embed dim (required). dropout: the dropout value (default=0.1). max_len: the max. length of the incoming sequence (default=5000). Examples: >>> pos_encoder = PositionalEncoder(d_model) """ def __init__(self, d_model, dropout=0.1, max_len=16384, pe_init=None): super().__init__() self.dropout = nn.Dropout(p=dropout) if pe_init is not None: self.pe = nn.Parameter(torch.empty(max_len, 1, d_model)) nn.init.normal_(self.pe, 0, pe_init) # self.pe = pe.unsqueeze(1) else: pe = torch.zeros(max_len, d_model) position = torch.arange(0.0, max_len).unsqueeze(1) div_term = torch.exp( -math.log(10000.0) * torch.arange(0.0, d_model, 2.0) / d_model ) pe[:, 0::2] = torch.sin(position * div_term) pe[:, 1::2] = torch.cos(position * div_term) self.register_buffer("pe", pe) self.attn_mask = None def forward(self, x): r"""Inputs of forward function Args: x: the sequence fed to the positional encoder model (required). lens: actual lengths of sequences Shape: x: [l_sequence, n_batch, d_model] Returns: [l_sequence, n_batch, d_model] attn_mask: [l_sequence, l_sequence] padding_mask: """ x = x + self.pe[: x.size(-2)] return self.dropout(x) class ClassEmbedding(Encoder): # Should also be able to define this by subclassing Embedding def __init__(self, n_classes, d_model): super().__init__() self.embedding = nn.Embedding(n_classes, d_model) def forward(self, x, y): x = x + self.embedding(y).unsqueeze(-2) # (B, L, D) return x class Conv1DEncoder(Encoder): def __init__(self, d_input, d_model, kernel_size=25, stride=1, padding='same'): super().__init__() self.conv = nn.Conv1d( in_channels=d_input, out_channels=d_model, kernel_size=kernel_size, stride=stride, padding=padding, ) def forward(self, x): # BLD -> BLD x = self.conv(x.transpose(1, 2)).transpose(1, 2) return x class LayerEncoder(Encoder): """Use an arbitrary SequenceModule layer""" def __init__(self, d_model, prenorm=False, norm='layer', layer=None): super().__init__() # Simple stack of blocks layer["transposed"] = False self.layer = SequenceResidualBlock( d_input=d_model, prenorm=prenorm, layer=layer, residual='R', norm=norm, pool=None, ) def forward(self, x): x, _ = self.layer(x) # Discard state return x class TimestampEmbeddingEncoder(Encoder): """ General time encoder for Pandas Timestamp objects (encoded as torch tensors). See MonashDataset for an example of how to return time features as 'z's. """ cardinalities = { 'day': (1, 31), 'hour': (0, 23), 'minute': (0, 59), 'second': (0, 59), 'month': (1, 12), 'year': (1950, 2010), # (1800, 3000) used to be (1970, datetime.datetime.now().year + 1) but was not enough for all datasets in monash 'dayofweek': (0, 6), 'dayofyear': (1, 366), 'quarter': (1, 4), 'week': (1, 53), 'is_month_start': (0, 1), 'is_month_end': (0, 1), 'is_quarter_start': (0, 1), 'is_quarter_end': (0, 1), 'is_year_start': (0, 1), 'is_year_end': (0, 1), 'is_leap_year': (0, 1), } def __init__(self, d_model, table=False, features=None): super().__init__() self.table = table self.ranges = {k: max_val - min_val + 2 for k, (min_val, max_val) in self.cardinalities.items()} # padding for null included if features is None: pass else: self.cardinalities = {k: v for k, v in self.cardinalities.items() if k in features} if table: self.embedding = nn.ModuleDict({ attr: nn.Embedding(maxval - minval + 2, d_model, padding_idx=0) for attr, (minval, maxval) in self.cardinalities.items() }) else: self.embedding = nn.ModuleDict({ attr: nn.Linear(1, d_model) for attr in self.cardinalities }) def forward(self, x, timestamps=None): for attr in timestamps: mask = timestamps[attr] == -1 timestamps[attr] = timestamps[attr] - self.cardinalities[attr][0] timestamps[attr][mask] = 0 if self.table: x = x + self.embedding[attr](timestamps[attr].to(torch.long)) else: x = x + self.embedding[attr]((2 * timestamps[attr] / self.ranges[attr] - 1).unsqueeze(-1)) #x = x + self.embedding(timestamps[attr].to(torch.float)).unsqueeze(1) return x class TimeEncoder(Encoder): def __init__(self, n_tokens_time, d_model, timeenc=0): super().__init__() self.timeenc = timeenc if self.timeenc == 0: self.encoders = nn.ModuleList( [nn.Embedding(v, d_model) for v in n_tokens_time] ) else: self.encoders = nn.Linear(len(n_tokens_time), d_model) self.mask_embed = nn.Embedding(2, d_model) def forward(self, x, mark=None, mask=None): assert mark is not None and mask is not None, "Extra arguments should be returned by collate function" if self.timeenc == 0: assert mark.size(-1) == len(self.encoders) embeddings = [ embed(z) for embed, z in zip(self.encoders, torch.unbind(mark, dim=-1)) ] time_encode = torch.sum(torch.stack(embeddings), dim=0) else: time_encode = self.encoders(mark) mask_encode = self.mask_embed(mask.squeeze(-1)) return x + time_encode + mask_encode # (B, L, d_model) class PackedEncoder(Encoder): def forward(self, x, len_batch=None): assert len_batch is not None x = nn.utils.rnn.pack_padded_sequence( x, len_batch.cpu(), enforce_sorted=False, batch_first=True, ) return x class OneHotEncoder(Encoder): def __init__(self, n_tokens, d_model): super().__init__() assert n_tokens <= d_model self.d_model = d_model def forward(self, x): return F.one_hot(x.squeeze(-1), self.d_model).float() class Conv2DPatchEncoder(Encoder): """ For encoding images into a sequence of patches. """ def __init__(self, d_input, d_model, filter_sizes, flat=False): """ d_input: dim of encoder input (data dimension) d_model: dim of encoder output (model dimension) filter_sizes: tuple with fh, fw flat: if image is flattened from dataloader (like in cifar), then we need to reshape back to 2D before conv """ fh, fw = filter_sizes self.flat = flat super().__init__() assert len(filter_sizes) == 2 self.encoder = nn.Conv2d(d_input, d_model, kernel_size=(fh, fw), stride=(fh, fw)) def forward(self, x): """ x shape expected = [b, h, w, c] returns tuple with x, with new shape = [b, seq_len, c_out] """ x = rearrange(x, 'b h w c -> b c h w') x = self.encoder(x) x = rearrange(x, 'b c h w -> b (h w) c') return x # For every type of encoder/decoder, specify: # - constructor class # - list of attributes to grab from dataset # - list of attributes to grab from model registry = { "stop": Encoder, "id": nn.Identity, "embedding": nn.Embedding, "linear": nn.Linear, "position": PositionalEncoder, "position_id": PositionalIDEncoder, "class": ClassEmbedding, "pack": PackedEncoder, "time": TimeEncoder, "onehot": OneHotEncoder, "conv1d": Conv1DEncoder, "patch2d": Conv2DPatchEncoder, "timestamp_embedding": TimestampEmbeddingEncoder, "layer": LayerEncoder, } dataset_attrs = { "embedding": ["n_tokens"], "linear": ["d_input"], # TODO make this d_data? "class": ["n_classes"], "time": ["n_tokens_time"], "onehot": ["n_tokens"], "conv1d": ["d_input"], "patch2d": ["d_input"], } model_attrs = { "embedding": ["d_model"], "linear": ["d_model"], "position": ["d_model"], "class": ["d_model"], "time": ["d_model"], "onehot": ["d_model"], "conv1d": ["d_model"], "patch2d": ["d_model"], "timestamp_embedding": ["d_model"], "layer": ["d_model"], } def _instantiate(encoder, dataset=None, model=None): """Instantiate a single encoder""" if encoder is None: return None if isinstance(encoder, str): name = encoder else: name = encoder["_name_"] # Extract dataset/model arguments from attribute names dataset_args = utils.config.extract_attrs_from_obj( dataset, *dataset_attrs.get(name, []) ) model_args = utils.config.extract_attrs_from_obj(model, *model_attrs.get(name, [])) # Instantiate encoder obj = utils.instantiate(registry, encoder, *dataset_args, *model_args) return obj def instantiate(encoder, dataset=None, model=None): encoder = utils.to_list(encoder) return U.PassthroughSequential( *[_instantiate(e, dataset=dataset, model=model) for e in encoder] )
hyena-dna-main
src/tasks/encoders.py
from typing import Any import pytorch_lightning as pl from pytorch_lightning.utilities import rank_zero_only from pytorch_lightning.utilities.parsing import AttributeDict class ParamsLog(pl.Callback): """ Log the number of parameters of the model """ def __init__( self, total: bool = True, trainable: bool = True, fixed: bool = True, ): super().__init__() self._log_stats = AttributeDict( { 'total_params_log': total, 'trainable_params_log': trainable, 'non_trainable_params_log': fixed, } ) @rank_zero_only def on_fit_start(self, trainer: pl.Trainer, pl_module: pl.LightningModule) -> None: logs = {} if self._log_stats.total_params_log: logs["params/total"] = sum(p.numel() for p in pl_module.parameters()) if self._log_stats.trainable_params_log: logs["params/trainable"] = sum(p.numel() for p in pl_module.parameters() if p.requires_grad) if self._log_stats.non_trainable_params_log: logs["params/fixed"] = sum(p.numel() for p in pl_module.parameters() if not p.requires_grad) if trainer.logger: trainer.logger.log_hyperparams(logs)
hyena-dna-main
src/callbacks/params.py
import torch from pytorch_lightning import Callback, Trainer, LightningModule import logging log = logging.getLogger(__name__) # We want a logger for each process, not just the rank 0 def l2_promote(): import ctypes _libcudart = ctypes.CDLL('libcudart.so') # Set device limit on the current device # cudaLimitMaxL2FetchGranularity = 0x05 pValue = ctypes.cast((ctypes.c_int*1)(), ctypes.POINTER(ctypes.c_int)) _libcudart.cudaDeviceSetLimit(ctypes.c_int(0x05), ctypes.c_int(128)) _libcudart.cudaDeviceGetLimit(pValue, ctypes.c_int(0x05)) assert pValue.contents.value == 128 def set_affinity(trainer): try: from src.utils.gpu_affinity import set_affinity nproc_per_node = torch.cuda.device_count() affinity = set_affinity(trainer.local_rank, nproc_per_node, 'socket_unique_continuous') log.info(f'{trainer.local_rank}: thread affinity: {affinity}') # TD [2022-05-07] Somehow calling this causes GPU 0 to allocate extra ~800MB of memory per # number of GPUs (e.g., 6.4GB of extra memory in a 8-GPU setup). H/t Dan. # l2_promote() except: pass class GpuAffinity(Callback): """Set GPU affinity and increase the L2 fetch granularity. Adapted from https://github.com/NVIDIA/DeepLearningExamples/tree/master/PyTorch/LanguageModeling/Transformer-XL """ def setup(self, trainer: Trainer, pl_module: LightningModule, stage=None) -> None: set_affinity(trainer)
hyena-dna-main
src/callbacks/gpu_affinity.py
### https://github.com/HazyResearch/transformers/blob/master/src/callbacks/wandb_callbacks.py import glob import os from typing import List import matplotlib.pyplot as plt import pandas as pd import seaborn as sn import torch import wandb from pytorch_lightning import Callback, Trainer from pytorch_lightning.loggers import LoggerCollection, WandbLogger from pytorch_lightning.utilities import rank_zero_only from sklearn import metrics from sklearn.metrics import f1_score, precision_score, recall_score def get_wandb_logger(trainer: Trainer) -> WandbLogger: """Safely get Weights&Biases logger from Trainer.""" if isinstance(trainer.logger, WandbLogger): return trainer.logger if isinstance(trainer.logger, LoggerCollection): for logger in trainer.logger: if isinstance(logger, WandbLogger): return logger raise Exception( "You are using wandb related callback, but WandbLogger was not found for some reason..." ) class WatchModel(Callback): """Make wandb watch model at the beginning of the run.""" def __init__(self, log: str = "gradients", log_freq: int = 100): self.log = log self.log_freq = log_freq @rank_zero_only def on_train_start(self, trainer, pl_module): logger = get_wandb_logger(trainer=trainer) logger.watch(model=trainer.model, log=self.log, log_freq=self.log_freq) class UploadCodeAsArtifact(Callback): """Upload all *.py files to wandb as an artifact, at the beginning of the run.""" def __init__(self, code_dir: str): self.code_dir = code_dir @rank_zero_only def on_train_start(self, trainer, pl_module): logger = get_wandb_logger(trainer=trainer) experiment = logger.experiment code = wandb.Artifact("project-source", type="code") for path in glob.glob(os.path.join(self.code_dir, "**/*.py"), recursive=True): code.add_file(path) experiment.log_artifact(code) class UploadCheckpointsAsArtifact(Callback): """Upload checkpoints to wandb as an artifact, at the end of run.""" def __init__(self, ckpt_dir: str = "checkpoints/", upload_best_only: bool = False): self.ckpt_dir = ckpt_dir self.upload_best_only = upload_best_only @rank_zero_only def on_train_end(self, trainer, pl_module): logger = get_wandb_logger(trainer=trainer) experiment = logger.experiment ckpts = wandb.Artifact("experiment-ckpts", type="checkpoints") if self.upload_best_only: ckpts.add_file(trainer.checkpoint_callback.best_model_path) else: for path in glob.glob(os.path.join(self.ckpt_dir, "**/*.ckpt"), recursive=True): ckpts.add_file(path) experiment.log_artifact(ckpts) class LogConfusionMatrix(Callback): """Generate confusion matrix every epoch and send it to wandb. Expects validation step to return predictions and targets. """ def __init__(self): self.preds = [] self.targets = [] self.ready = True def on_sanity_check_start(self, trainer, pl_module) -> None: self.ready = False def on_sanity_check_end(self, trainer, pl_module): """Start executing this callback only after all validation sanity checks end.""" self.ready = True def on_validation_batch_end( self, trainer, pl_module, outputs, batch, batch_idx, dataloader_idx ): """Gather data from single batch.""" if self.ready: self.preds.append(outputs["preds"]) self.targets.append(outputs["targets"]) def on_validation_epoch_end(self, trainer, pl_module): """Generate confusion matrix.""" if self.ready: logger = get_wandb_logger(trainer) experiment = logger.experiment preds = torch.cat(self.preds).cpu().numpy() targets = torch.cat(self.targets).cpu().numpy() confusion_matrix = metrics.confusion_matrix(y_true=targets, y_pred=preds) # set figure size plt.figure(figsize=(14, 8)) # set labels size sn.set(font_scale=1.4) # set font size sn.heatmap(confusion_matrix, annot=True, annot_kws={"size": 8}, fmt="g") # names should be uniqe or else charts from different experiments in wandb will overlap experiment.log({f"confusion_matrix/{experiment.name}": wandb.Image(plt)}, commit=False) # according to wandb docs this should also work but it crashes # experiment.log(f{"confusion_matrix/{experiment.name}": plt}) # reset plot plt.clf() self.preds.clear() self.targets.clear() class LogF1PrecRecHeatmap(Callback): """Generate f1, precision, recall heatmap every epoch and send it to wandb. Expects validation step to return predictions and targets. """ def __init__(self, class_names: List[str] = None): self.preds = [] self.targets = [] self.ready = True def on_sanity_check_start(self, trainer, pl_module): self.ready = False def on_sanity_check_end(self, trainer, pl_module): """Start executing this callback only after all validation sanity checks end.""" self.ready = True def on_validation_batch_end( self, trainer, pl_module, outputs, batch, batch_idx, dataloader_idx ): """Gather data from single batch.""" if self.ready: self.preds.append(outputs["preds"]) self.targets.append(outputs["targets"]) def on_validation_epoch_end(self, trainer, pl_module): """Generate f1, precision and recall heatmap.""" if self.ready: logger = get_wandb_logger(trainer=trainer) experiment = logger.experiment preds = torch.cat(self.preds).cpu().numpy() targets = torch.cat(self.targets).cpu().numpy() f1 = f1_score(preds, targets, average=None) r = recall_score(preds, targets, average=None) p = precision_score(preds, targets, average=None) data = [f1, p, r] # set figure size plt.figure(figsize=(14, 3)) # set labels size sn.set(font_scale=1.2) # set font size sn.heatmap( data, annot=True, annot_kws={"size": 10}, fmt=".3f", yticklabels=["F1", "Precision", "Recall"], ) # names should be uniqe or else charts from different experiments in wandb will overlap experiment.log({f"f1_p_r_heatmap/{experiment.name}": wandb.Image(plt)}, commit=False) # reset plot plt.clf() self.preds.clear() self.targets.clear() class LogImagePredictions(Callback): """Logs a validation batch and their predictions to wandb. Example adapted from: https://wandb.ai/wandb/wandb-lightning/reports/Image-Classification-using-PyTorch-Lightning--VmlldzoyODk1NzY """ def __init__(self, num_samples: int = 8): super().__init__() self.num_samples = num_samples self.ready = True def on_sanity_check_start(self, trainer, pl_module): self.ready = False def on_sanity_check_end(self, trainer, pl_module): """Start executing this callback only after all validation sanity checks end.""" self.ready = True def on_validation_epoch_end(self, trainer, pl_module): if self.ready: logger = get_wandb_logger(trainer=trainer) experiment = logger.experiment # get a validation batch from the validation dat loader val_samples = next(iter(trainer.datamodule.val_dataloader())) val_imgs, val_labels = val_samples # run the batch through the network val_imgs = val_imgs.to(device=pl_module.device) logits = pl_module(val_imgs) preds = torch.argmax(logits, axis=-1) # log the images as wandb Image experiment.log( { f"Images/{experiment.name}": [ wandb.Image(x, caption=f"Pred:{pred}, Label:{y}") for x, pred, y in zip( val_imgs[: self.num_samples], preds[: self.num_samples], val_labels[: self.num_samples], ) ] } ) class LogDT(Callback): """ Log the dt values (from NeurIPS 2021 LSSL submission) """ def on_train_epoch_end(self, trainer, pl_module): log_dict = {} for name, m in pl_module.model.named_modules(): if pl_module.hparams.train.get('log_dt', False) \ and hasattr(m, "log_dt"): log_dict[f"{name}.log_dt"] = ( m.log_dt.detach().cpu().numpy().flatten() ) log_dict[f"{name}.log_dt.image"] = wandb.Image( m.log_dt.detach().cpu().numpy().flatten().reshape(1, -1) ) log_dict[f"{name}.log_dt"] = wandb.Table( dataframe=pd.DataFrame( {"log_dt": m.log_dt.detach().cpu().numpy().flatten()} ) ) if torch.distributed.is_initialized() and torch.distributed.get_rank() == 0: if trainer.logger is not None: trainer.logger.experiment.log(log_dict)
hyena-dna-main
src/callbacks/wandb.py
### https://github.com/HazyResearch/transformers/blob/master/src/callbacks/speed_monitor.py # Adapted from https://pytorch-lightning.readthedocs.io/en/latest/_modules/pytorch_lightning/callbacks/gpu_stats_monitor.html#GPUStatsMonitor # We only need the speed monitoring, not the GPU monitoring import time from typing import Any from pytorch_lightning import Callback, Trainer, LightningModule from pytorch_lightning.utilities import rank_zero_only from pytorch_lightning.utilities.parsing import AttributeDict from pytorch_lightning.utilities.types import STEP_OUTPUT class Timer(Callback): """Monitor the speed of each step and each epoch. """ def __init__( self, step: bool = True, inter_step: bool = True, epoch: bool = True, val: bool = True, ): super().__init__() self._log_stats = AttributeDict( { 'step_time': step, 'inter_step_time': inter_step, 'epoch_time': epoch, 'val_time': val, }) def on_train_start(self, trainer: Trainer, pl_module: LightningModule) -> None: self._snap_epoch_time = None def on_train_epoch_start(self, trainer: Trainer, pl_module: LightningModule) -> None: self._snap_step_time = None self._snap_inter_step_time = None self._snap_epoch_time = time.time() def on_train_batch_start( self, trainer: Trainer, pl_module: LightningModule, batch: Any, batch_idx: int, ) -> None: if self._log_stats.step_time: self._snap_step_time = time.time() if not self._should_log(trainer): return logs = {} if self._log_stats.inter_step_time and self._snap_inter_step_time: # First log at beginning of second step logs["timer/inter_step"] = (time.time() - self._snap_inter_step_time) # * 1000 if trainer.logger: trainer.logger.log_metrics(logs, step=trainer.global_step) @rank_zero_only def on_train_batch_end( self, trainer: Trainer, pl_module: LightningModule, outputs: STEP_OUTPUT, batch: Any, batch_idx: int, ) -> None: if self._log_stats.inter_step_time: self._snap_inter_step_time = time.time() if not self._should_log(trainer): return logs = {} if self._log_stats.step_time and self._snap_step_time: logs["timer/step"] = (time.time() - self._snap_step_time) # * 1000 if trainer.logger: trainer.logger.log_metrics(logs, step=trainer.global_step) @rank_zero_only def on_train_epoch_end(self, trainer: Trainer, pl_module: LightningModule,) -> None: logs = {} if self._log_stats.epoch_time and self._snap_epoch_time: logs["timer/epoch"] = time.time() - self._snap_epoch_time if trainer.logger: trainer.logger.log_metrics(logs, step=trainer.global_step) def on_validation_epoch_start(self, trainer: Trainer, pl_module: LightningModule) -> None: self._snap_val_time = time.time() @rank_zero_only def on_validation_epoch_end(self, trainer: Trainer, pl_module: LightningModule,) -> None: logs = {} if self._log_stats.val_time and self._snap_val_time: logs["timer/validation"] = time.time() - self._snap_val_time if trainer.logger: trainer.logger.log_metrics(logs) # , step=trainer.global_step) @staticmethod def _should_log(trainer) -> bool: return (trainer.global_step + 1) % trainer.log_every_n_steps == 0 or trainer.should_stop
hyena-dna-main
src/callbacks/timer.py
r""" Sequence Length Warmup by Reloading ==================== Change sequence lengths according to a stage schedule. The stage parameters sets the sequence length and batch size. TODO (not yet supported): If batch size is not provided for that stage, calculate the batch size based on the sequence length reshaping into the batch size. """ import numpy as np from pytorch_lightning.callbacks import Callback import src.utils as utils from src.utils import registry class SeqlenWarmupReload(Callback): def __init__(self, stage_params: list): """ stage_params is a list of dicts e.g. stage_params = [ {'seq_len': 512, 'epochs': 50}, {'seq_len': 256, 'epochs': 30}, {'seq_len': 128, 'epochs': 20}, ] """ super().__init__() assert len(stage_params) > 0, 'No stages specified' assert all([{'seq_len', 'epochs'} <= set(stage.keys()) for stage in stage_params]), \ 'stage_params must contain keys: seq_len and epochs' self.stage_params = stage_params self.stage_epochs_cume = np.cumsum([stage['epochs'] for stage in stage_params]) self._current_stage = 0 def _verify_stages(self, trainer, model): # Double-check that stage parameters are correct, otherwise we'll fail in the middle of training for stage in self.stage_params: if hasattr(stage, 'scheduler'): # Verify that we can actually create the scheduler when we need to update it in each stage scheduler = utils.instantiate(registry.scheduler, {**model.hparams.scheduler, **stage['scheduler']}, trainer.optimizers[0]) del scheduler def on_train_start(self, trainer, model) -> None: # Verify all the stage parameters are correct self._verify_stages(trainer, model) print(f"Training starts at {trainer.current_epoch}") if trainer.current_epoch == 0: # Update the model to the first stage self._update_to_current_stage(trainer, model) else: # Preemption or resumption of progressive resizing # Update the stage to the current one self._current_stage = int(np.searchsorted(self.stage_epochs_cume - 1, trainer.current_epoch)) self._starting_stage = np.any(trainer.current_epoch == self.stage_epochs_cume) print("Seq Len Warmup: Restarting at Stage {}".format(self._current_stage)) if self._starting_stage: self._update_lr_scheduler(trainer, model) # Set the dataloader and model self._update_dataloaders(trainer, model) # self._update_model(trainer, model) # we don't need to update the model, yet return super().on_train_start(trainer, model) def _update_lr_scheduler(self, trainer, model): if not hasattr(self.stage_params[self._current_stage], 'scheduler'): # No scheduler specified, so don't update the current scheduler return assert len(trainer.lr_schedulers) == 1 # Reinitialize the scheduler # We don't need to carry over information from the last scheduler e.g. the last_epoch property, # because that will mess with the new scheduler when we step it hparams = {**model.hparams.scheduler, **self.stage_params[self._current_stage]['scheduler']} # Note that passing in the optimizer below is okay: the scheduler will be reinitialized and doesn't seem to inherit any current lr info from the optimizer trainer.lr_schedulers[0]['scheduler'] = utils.instantiate(registry.scheduler, hparams, trainer.optimizers[0]) print("\tChanged scheduler to {}".format(hparams)) def _update_dataloaders(self, trainer, model): # Set the train resolution and reset the dataloader # set new seq len and reset the dataloader # max_length should be set in the config of the dataloader seq_len = self.stage_params[self._current_stage]['seq_len'] model.hparams.loader.max_length = seq_len # we need to resize the batch size too batch_size = self.stage_params[self._current_stage].get('batch_size', None) # need to change the dataset params, and the set the phase, which reinits the dataset model.dataset.max_length = seq_len # progressively update the seq len # model.dataset.max_length_val = seq_len # we update the val len to be same as train # model.dataset.max_length_test = seq_len # we don't change the test set, always the longest model.dataset.batch_size = batch_size # need to adjust the batch size # model.dataset.batch_size_eval = batch_size * 2 # # model.dataset.dataset_train.max_length = seq_len model.dataset.init_datasets() # reinit the datasets with new batch size and seq len trainer.reset_train_dataloader(model) # tells PTL to use the new dataloaders/datasets trainer.reset_val_dataloader(model) print('\tAt epoch {}, changed Seq Len to {}, and batch size to {}'.format(trainer.current_epoch, seq_len, batch_size)) # def _update_model(self, trainer, model): # if not hasattr(self.stage_params[self._current_stage], 'bandlimit'): # return # Update the bandlimit value for the model: this is a hack to make sure the model is updated # Iterate over all the modules # for module in model.modules(): # if hasattr(module, 'bandlimit'): # module.bandlimit = self.stage_params[self._current_stage]['bandlimit'] # print('\tChanged bandlimit to {}'.format(self.stage_params[self._current_stage]['bandlimit'])) def _update_to_current_stage(self, trainer, model): print("Seq Len Warmup: Moving to Stage {}".format(self._current_stage)) # Update the train dataloader, model and scheduler self._update_dataloaders(trainer, model) # self._update_model(trainer, model) self._update_lr_scheduler(trainer, model) def on_train_epoch_end(self, trainer, model): """ Check to see if new stage is reached for the next epoch, and if so, prepare the new stage by changing the dataloader. (We do next epoch so that the dataloader is prepared before the next epoch) """ next_epoch = trainer.current_epoch + 1 # Check if stage should be increased if next_epoch >= self.stage_epochs_cume[self._current_stage] and self._current_stage < len(self.stage_params) - 1: self._current_stage += 1 self._update_to_current_stage(trainer, model) return super().on_train_epoch_end(trainer, model)
hyena-dna-main
src/callbacks/seqlen_warmup_reload.py
import pytorch_lightning as pl from pytorch_lightning.utilities import rank_zero_only from pytorch_lightning.utilities.parsing import AttributeDict from omegaconf import OmegaConf class TrackNorms(pl.Callback): # TODO do callbacks happen before or after the method in the main LightningModule? # @rank_zero_only # needed? def on_after_training_step(self, batch, batch_idx, trainer: pl.Trainer, pl_module: pl.LightningModule): # Log extra metrics metrics = {} if hasattr(pl_module, "_grad_norms"): metrics.update(pl_module._grad_norms) self.log_dict( metrics, on_step=True, on_epoch=False, prog_bar=False, add_dataloader_idx=False, sync_dist=True, ) def on_after_backward(self, trainer: pl.Trainer, pl_module: pl.LightningModule): # example to inspect gradient information in tensorboard if OmegaConf.select(trainer.hparams, 'trainer.track_grad_norms'): # TODO dot notation should work with omegaconf? norms = {} for name, p in pl_module.named_parameters(): if p.grad is None: continue # param_norm = float(p.grad.data.norm(norm_type)) param_norm = torch.mean(p.grad.data ** 2) norms[f"grad_norm.{name}"] = param_norm pl_module._grad_norms = norms
hyena-dna-main
src/callbacks/norms.py
import numpy as np from pytorch_lightning.callbacks import Callback import src.utils as utils from src.utils import registry class ProgressiveResizing(Callback): def __init__(self, stage_params: list): """ stage_params is a list of dicts e.g. stage_params = [ {'resolution': 4, 'epochs': 50}, # 32 x 32 {'resolution': 2, 'epochs': 30}, # 64 x 64 {'resolution': 1, 'epochs': 20}, # 128 x 128 ] """ super().__init__() assert len(stage_params) > 0, 'No stages specified' assert all([{'resolution', 'epochs'} <= set(stage.keys()) for stage in stage_params]), \ 'stage_params must contain keys: resolution and epochs' self.stage_params = stage_params self.stage_epochs_cume = np.cumsum([stage['epochs'] for stage in stage_params]) self._current_stage = 0 def _verify_stages(self, trainer, model): # Double-check that stage parameters are correct, otherwise we'll fail in the middle of training for stage in self.stage_params: if hasattr(stage, 'scheduler'): # Verify that we can actually create the scheduler when we need to update it in each stage scheduler = utils.instantiate(registry.scheduler, {**model.hparams.scheduler, **stage['scheduler']}, trainer.optimizers[0]) del scheduler def on_train_start(self, trainer, model) -> None: # Verify all the stage parameters are correct self._verify_stages(trainer, model) print(f"Training starts at {trainer.current_epoch}") if trainer.current_epoch == 0: # Update the model to the first stage self._update_to_current_stage(trainer, model) else: # Preemption or resumption of progressive resizing # Update the stage to the current one self._current_stage = int(np.searchsorted(self.stage_epochs_cume - 1, trainer.current_epoch)) self._starting_stage = np.any(trainer.current_epoch == self.stage_epochs_cume) print("Progressive Resizing: Restarting at Stage {}".format(self._current_stage)) if self._starting_stage: self._update_lr_scheduler(trainer, model) # Set the dataloader and model self._update_dataloaders(trainer, model) self._update_model(trainer, model) return super().on_train_start(trainer, model) def _update_lr_scheduler(self, trainer, model): if not hasattr(self.stage_params[self._current_stage], 'scheduler'): # No scheduler specified, so don't update the current scheduler return assert len(trainer.lr_schedulers) == 1 # Reinitialize the scheduler # We don't need to carry over information from the last scheduler e.g. the last_epoch property, # because that will mess with the new scheduler when we step it hparams = {**model.hparams.scheduler, **self.stage_params[self._current_stage]['scheduler']} # Note that passing in the optimizer below is okay: the scheduler will be reinitialized and doesn't seem to inherit any current lr info from the optimizer trainer.lr_schedulers[0]['scheduler'] = utils.instantiate(registry.scheduler, hparams, trainer.optimizers[0]) print("\tChanged scheduler to {}".format(hparams)) def _update_dataloaders(self, trainer, model): # Set the train resolution and reset the dataloader model.hparams.loader.train_resolution = self.stage_params[self._current_stage]['resolution'] trainer.reset_train_dataloader(model) print('\tChanged resolution to {}'.format(self.stage_params[self._current_stage]['resolution'])) def _update_model(self, trainer, model): if not hasattr(self.stage_params[self._current_stage], 'bandlimit'): return # Update the bandlimit value for the model: this is a hack to make sure the model is updated # Iterate over all the modules for module in model.modules(): if hasattr(module, 'bandlimit'): module.bandlimit = self.stage_params[self._current_stage]['bandlimit'] print('\tChanged bandlimit to {}'.format(self.stage_params[self._current_stage]['bandlimit'])) def _update_to_current_stage(self, trainer, model): print("Progressive Resizing: Moving to Stage {}".format(self._current_stage)) # Update the train dataloader, model and scheduler self._update_dataloaders(trainer, model) self._update_model(trainer, model) self._update_lr_scheduler(trainer, model) def on_train_epoch_end(self, trainer, model): """ Check to see if new stage is reached for the next epoch, and if so, prepare the new stage by changing the dataloader. (We do next epoch so that the dataloader is prepared before the next epoch) """ next_epoch = trainer.current_epoch + 1 # Check if stage should be increased if next_epoch >= self.stage_epochs_cume[self._current_stage] and self._current_stage < len(self.stage_params) - 1: self._current_stage += 1 self._update_to_current_stage(trainer, model) return super().on_train_epoch_end(trainer, model)
hyena-dna-main
src/callbacks/progressive_resizing.py
""" ET Dataset from Informer Paper. Dataset: https://github.com/zhouhaoyi/ETDataset Dataloader: https://github.com/zhouhaoyi/Informer2020 """ from typing import List import os import numpy as np import pandas as pd from pandas.tseries import offsets from pandas.tseries.frequencies import to_offset import torch from torch.utils import data from torch.utils.data import Dataset, DataLoader import warnings warnings.filterwarnings("ignore") from src.dataloaders.base import SequenceDataset, default_data_path class TimeFeature: def __init__(self): pass def __call__(self, index: pd.DatetimeIndex) -> np.ndarray: pass def __repr__(self): return self.__class__.__name__ + "()" class SecondOfMinute(TimeFeature): """Minute of hour encoded as value between [-0.5, 0.5]""" def __call__(self, index: pd.DatetimeIndex) -> np.ndarray: return index.second / 59.0 - 0.5 class MinuteOfHour(TimeFeature): """Minute of hour encoded as value between [-0.5, 0.5]""" def __call__(self, index: pd.DatetimeIndex) -> np.ndarray: return index.minute / 59.0 - 0.5 class HourOfDay(TimeFeature): """Hour of day encoded as value between [-0.5, 0.5]""" def __call__(self, index: pd.DatetimeIndex) -> np.ndarray: return index.hour / 23.0 - 0.5 class DayOfWeek(TimeFeature): """Hour of day encoded as value between [-0.5, 0.5]""" def __call__(self, index: pd.DatetimeIndex) -> np.ndarray: return index.dayofweek / 6.0 - 0.5 class DayOfMonth(TimeFeature): """Day of month encoded as value between [-0.5, 0.5]""" def __call__(self, index: pd.DatetimeIndex) -> np.ndarray: return (index.day - 1) / 30.0 - 0.5 class DayOfYear(TimeFeature): """Day of year encoded as value between [-0.5, 0.5]""" def __call__(self, index: pd.DatetimeIndex) -> np.ndarray: return (index.dayofyear - 1) / 365.0 - 0.5 class MonthOfYear(TimeFeature): """Month of year encoded as value between [-0.5, 0.5]""" def __call__(self, index: pd.DatetimeIndex) -> np.ndarray: return (index.month - 1) / 11.0 - 0.5 class WeekOfYear(TimeFeature): """Week of year encoded as value between [-0.5, 0.5]""" def __call__(self, index: pd.DatetimeIndex) -> np.ndarray: return (index.isocalendar().week - 1) / 52.0 - 0.5 def time_features_from_frequency_str(freq_str: str) -> List[TimeFeature]: """ Returns a list of time features that will be appropriate for the given frequency string. Parameters ---------- freq_str Frequency string of the form [multiple][granularity] such as "12H", "5min", "1D" etc. """ features_by_offsets = { offsets.YearEnd: [], offsets.QuarterEnd: [MonthOfYear], offsets.MonthEnd: [MonthOfYear], offsets.Week: [DayOfMonth, WeekOfYear], offsets.Day: [DayOfWeek, DayOfMonth, DayOfYear], offsets.BusinessDay: [DayOfWeek, DayOfMonth, DayOfYear], offsets.Hour: [HourOfDay, DayOfWeek, DayOfMonth, DayOfYear], offsets.Minute: [ MinuteOfHour, HourOfDay, DayOfWeek, DayOfMonth, DayOfYear, ], offsets.Second: [ SecondOfMinute, MinuteOfHour, HourOfDay, DayOfWeek, DayOfMonth, DayOfYear, ], } offset = to_offset(freq_str) for offset_type, feature_classes in features_by_offsets.items(): if isinstance(offset, offset_type): return [cls() for cls in feature_classes] supported_freq_msg = f""" Unsupported frequency {freq_str} The following frequencies are supported: Y - yearly alias: A M - monthly W - weekly D - daily B - business days H - hourly T - minutely alias: min S - secondly """ raise RuntimeError(supported_freq_msg) def time_features(dates, timeenc=1, freq="h"): """ > `time_features` takes in a `dates` dataframe with a 'dates' column and extracts the date down to `freq` where freq can be any of the following if `timeenc` is 0: > * m - [month] > * w - [month] > * d - [month, day, weekday] > * b - [month, day, weekday] > * h - [month, day, weekday, hour] > * t - [month, day, weekday, hour, *minute] > > If `timeenc` is 1, a similar, but different list of `freq` values are supported (all encoded between [-0.5 and 0.5]): > * Q - [month] > * M - [month] > * W - [Day of month, week of year] > * D - [Day of week, day of month, day of year] > * B - [Day of week, day of month, day of year] > * H - [Hour of day, day of week, day of month, day of year] > * T - [Minute of hour*, hour of day, day of week, day of month, day of year] > * S - [Second of minute, minute of hour, hour of day, day of week, day of month, day of year] *minute returns a number from 0-3 corresponding to the 15 minute period it falls into. """ if timeenc == 0: dates["month"] = dates.date.apply(lambda row: row.month, 1) dates["day"] = dates.date.apply(lambda row: row.day, 1) dates["weekday"] = dates.date.apply(lambda row: row.weekday(), 1) dates["hour"] = dates.date.apply(lambda row: row.hour, 1) dates["minute"] = dates.date.apply(lambda row: row.minute, 1) dates["minute"] = dates.minute.map(lambda x: x // 15) freq_map = { "y": [], "m": ["month"], "w": ["month"], "d": ["month", "day", "weekday"], "b": ["month", "day", "weekday"], "h": ["month", "day", "weekday", "hour"], "t": ["month", "day", "weekday", "hour", "minute"], } return dates[freq_map[freq.lower()]].values if timeenc == 1: dates = pd.to_datetime(dates.date.values) return np.vstack( [feat(dates) for feat in time_features_from_frequency_str(freq)] ).transpose(1, 0) class StandardScaler: def __init__(self): self.mean = 0.0 self.std = 1.0 def fit(self, data): self.mean = data.mean(0) self.std = data.std(0) def transform(self, data): mean = ( torch.from_numpy(self.mean).type_as(data).to(data.device) if torch.is_tensor(data) else self.mean ) std = ( torch.from_numpy(self.std).type_as(data).to(data.device) if torch.is_tensor(data) else self.std ) return (data - mean) / std def inverse_transform(self, data): mean = ( torch.from_numpy(self.mean).type_as(data).to(data.device) if torch.is_tensor(data) else self.mean ) std = ( torch.from_numpy(self.std).type_as(data).to(data.device) if torch.is_tensor(data) else self.std ) return (data * std) + mean class InformerDataset(Dataset): def __init__( self, root_path, flag="train", size=None, features="S", data_path="ETTh1.csv", target="OT", scale=True, inverse=False, timeenc=0, freq="h", cols=None, eval_stamp=False, eval_mask=False, ): # size [seq_len, label_len, pred_len] # info if size == None: self.seq_len = 24 * 4 * 4 self.label_len = 24 * 4 self.pred_len = 24 * 4 else: self.seq_len = size[0] self.label_len = size[1] self.pred_len = size[2] # init assert flag in ["train", "test", "val"] type_map = {"train": 0, "val": 1, "test": 2} self.set_type = type_map[flag] self.features = features self.target = target self.scale = scale self.inverse = inverse self.timeenc = timeenc self.freq = freq self.cols = cols self.eval_stamp = eval_stamp self.eval_mask = eval_mask self.forecast_horizon = self.pred_len self.root_path = root_path self.data_path = data_path self.__read_data__() def _borders(self, df_raw): num_train = int(len(df_raw) * 0.7) num_test = int(len(df_raw) * 0.2) num_vali = len(df_raw) - num_train - num_test border1s = [0, num_train - self.seq_len, len(df_raw) - num_test - self.seq_len] border2s = [num_train, num_train + num_vali, len(df_raw)] return border1s, border2s def _process_columns(self, df_raw): if self.cols: cols = self.cols.copy() cols.remove(self.target) else: cols = list(df_raw.columns) cols.remove(self.target) cols.remove("date") return df_raw[["date"] + cols + [self.target]] def __read_data__(self): self.scaler = StandardScaler() df_raw = pd.read_csv(os.path.join(self.root_path, self.data_path)) df_raw = self._process_columns(df_raw) border1s, border2s = self._borders(df_raw) border1 = border1s[self.set_type] border2 = border2s[self.set_type] if self.features == "M" or self.features == "MS": cols_data = df_raw.columns[1:] df_data = df_raw[cols_data] elif self.features == "S": df_data = df_raw[[self.target]] if self.scale: train_data = df_data[border1s[0] : border2s[0]] self.scaler.fit(train_data.values) data = self.scaler.transform(df_data.values) else: data = df_data.values df_stamp = df_raw[["date"]][border1:border2] df_stamp["date"] = pd.to_datetime(df_stamp.date) data_stamp = time_features(df_stamp, timeenc=self.timeenc, freq=self.freq) self.data_x = data[border1:border2] if self.inverse: self.data_y = df_data.values[border1:border2] else: self.data_y = data[border1:border2] self.data_stamp = data_stamp def __getitem__(self, index): s_begin = index s_end = s_begin + self.seq_len r_begin = s_end - self.label_len r_end = r_begin + self.label_len + self.pred_len seq_x = self.data_x[s_begin:s_end] seq_x = np.concatenate( [seq_x, np.zeros((self.pred_len, self.data_x.shape[-1]))], axis=0 ) if self.inverse: seq_y = np.concatenate( [ self.data_x[r_begin : r_begin + self.label_len], self.data_y[r_begin + self.label_len : r_end], ], 0, ) raise NotImplementedError else: # seq_y = self.data_y[r_begin:r_end] # OLD in Informer codebase seq_y = self.data_y[s_end:r_end] # OLD in Informer codebase # seq_x_mark = self.data_stamp[s_begin:s_end] # seq_y_mark = self.data_stamp[r_begin:r_end] if self.eval_stamp: mark = self.data_stamp[s_begin:r_end] else: mark = self.data_stamp[s_begin:s_end] mark = np.concatenate([mark, np.zeros((self.pred_len, mark.shape[-1]))], axis=0) if self.eval_mask: mask = np.concatenate([np.zeros(self.seq_len), np.ones(self.pred_len)], axis=0) else: mask = np.concatenate([np.zeros(self.seq_len), np.zeros(self.pred_len)], axis=0) mask = mask[:, None] # Add the mask to the timestamps: # 480, 5 # mark = np.concatenate([mark, mask[:, np.newaxis]], axis=1) seq_x = seq_x.astype(np.float32) seq_y = seq_y.astype(np.float32) if self.timeenc == 0: mark = mark.astype(np.int64) else: mark = mark.astype(np.float32) mask = mask.astype(np.int64) return torch.tensor(seq_x), torch.tensor(seq_y), torch.tensor(mark), torch.tensor(mask) def __len__(self): return len(self.data_x) - self.seq_len - self.pred_len + 1 def inverse_transform(self, data): return self.scaler.inverse_transform(data) @property def d_input(self): return self.data_x.shape[-1] @property def d_output(self): if self.features in ["M", "S"]: return self.data_x.shape[-1] elif self.features == "MS": return 1 else: raise NotImplementedError @property def n_tokens_time(self): if self.freq == 'h': return [13, 32, 7, 24] elif self.freq == 't': return [13, 32, 7, 24, 4] else: raise NotImplementedError class _Dataset_ETT_hour(InformerDataset): def __init__(self, **kwargs): super().__init__(**kwargs) def _borders(self, df_raw): border1s = [ 0, 12 * 30 * 24 - self.seq_len, 12 * 30 * 24 + 4 * 30 * 24 - self.seq_len, ] border2s = [ 12 * 30 * 24, 12 * 30 * 24 + 4 * 30 * 24, 12 * 30 * 24 + 8 * 30 * 24, ] return border1s, border2s def _process_columns(self, df_raw): return df_raw @property def n_tokens_time(self): assert self.freq == "h" return [13, 32, 7, 24] class _Dataset_ETT_minute(_Dataset_ETT_hour): def __init__(self, data_path="ETTm1.csv", freq="t", **kwargs): super().__init__(data_path=data_path, freq=freq, **kwargs) def _borders(self, df_raw): border1s = [ 0, 12 * 30 * 24 * 4 - self.seq_len, 12 * 30 * 24 * 4 + 4 * 30 * 24 * 4 - self.seq_len, ] border2s = [ 12 * 30 * 24 * 4, 12 * 30 * 24 * 4 + 4 * 30 * 24 * 4, 12 * 30 * 24 * 4 + 8 * 30 * 24 * 4, ] return border1s, border2s @property def n_tokens_time(self): assert self.freq == "t" return [13, 32, 7, 24, 4] class _Dataset_Weather(InformerDataset): def __init__(self, data_path="WTH.csv", target="WetBulbCelsius", **kwargs): super().__init__(data_path=data_path, target=target, **kwargs) class _Dataset_ECL(InformerDataset): def __init__(self, data_path="ECL.csv", target="MT_320", **kwargs): super().__init__(data_path=data_path, target=target, **kwargs) class InformerSequenceDataset(SequenceDataset): @property def n_tokens_time(self): # Shape of the dates: depends on `timeenc` and `freq` return self.dataset_train.n_tokens_time # data_stamp.shape[-1] @property def d_input(self): return self.dataset_train.d_input @property def d_output(self): return self.dataset_train.d_output @property def l_output(self): return self.dataset_train.pred_len def _get_data_filename(self, variant): return self.variants[variant] _collate_arg_names = ["mark", "mask"] # Names of the two extra tensors that the InformerDataset returns def setup(self): self.data_dir = self.data_dir or default_data_path / 'informer' / self._name_ self.dataset_train = self._dataset_cls( root_path=self.data_dir, flag="train", size=self.size, features=self.features, data_path=self._get_data_filename(self.variant), target=self.target, scale=self.scale, inverse=self.inverse, timeenc=self.timeenc, freq=self.freq, cols=self.cols, eval_stamp=self.eval_stamp, eval_mask=self.eval_mask, ) self.dataset_val = self._dataset_cls( root_path=self.data_dir, flag="val", size=self.size, features=self.features, data_path=self._get_data_filename(self.variant), target=self.target, scale=self.scale, inverse=self.inverse, timeenc=self.timeenc, freq=self.freq, cols=self.cols, eval_stamp=self.eval_stamp, eval_mask=self.eval_mask, ) self.dataset_test = self._dataset_cls( root_path=self.data_dir, flag="test", size=self.size, features=self.features, data_path=self._get_data_filename(self.variant), target=self.target, scale=self.scale, inverse=self.inverse, timeenc=self.timeenc, freq=self.freq, cols=self.cols, eval_stamp=self.eval_stamp, eval_mask=self.eval_mask, ) class ETTHour(InformerSequenceDataset): _name_ = "etth" _dataset_cls = _Dataset_ETT_hour init_defaults = { "size": None, "features": "S", "target": "OT", "variant": 0, "scale": True, "inverse": False, "timeenc": 0, "freq": "h", "cols": None, } variants = { 0: "ETTh1.csv", 1: "ETTh2.csv", } class ETTMinute(InformerSequenceDataset): _name_ = "ettm" _dataset_cls = _Dataset_ETT_minute init_defaults = { "size": None, "features": "S", "target": "OT", "variant": 0, "scale": True, "inverse": False, "timeenc": 0, "freq": "t", "cols": None, } variants = { 0: "ETTm1.csv", 1: "ETTm2.csv", } class Weather(InformerSequenceDataset): _name_ = "weather" _dataset_cls = _Dataset_Weather init_defaults = { "size": None, "features": "S", "target": "WetBulbCelsius", "variant": 0, "scale": True, "inverse": False, "timeenc": 0, "freq": "h", "cols": None, } variants = { 0: "WTH.csv", } class ECL(InformerSequenceDataset): _name_ = "ecl" _dataset_cls = _Dataset_ECL init_defaults = { "size": None, "features": "S", "target": "MT_320", "variant": 0, "scale": True, "inverse": False, "timeenc": 0, "freq": "h", "cols": None, } variants = { 0: "ECL.csv", }
hyena-dna-main
src/dataloaders/et.py
from . import et, genomics from .base import SequenceDataset
hyena-dna-main
src/dataloaders/__init__.py
# Adapted from https://github.com/huggingface/transformers/blob/master/examples/pytorch/language-modeling/run_clm.py # Adapted from https://github.com/HazyResearch/flash-attention/blob/main/training/src/datamodules/language_modeling_hf.py from pathlib import Path from typing import Any, List, Union from torch.utils.data.dataloader import DataLoader, Dataset from transformers import AutoTokenizer from datasets import Dataset from src.dataloaders.base import SequenceDataset, default_data_path from src.dataloaders.fault_tolerant_sampler import RandomFaultTolerantSampler from src.dataloaders.fault_tolerant_sampler import FaultTolerantDistributedSampler # genomics datasets from src.dataloaders.datasets.hg38_char_tokenizer import CharacterTokenizer from src.dataloaders.datasets.hg38_dataset import HG38Dataset from src.dataloaders.datasets.genomic_bench_dataset import GenomicBenchmarkDataset from src.dataloaders.datasets.nucleotide_transformer_dataset import NucleotideTransformerDataset from src.dataloaders.datasets.chromatin_profile_dataset import ChromatinProfileDataset from src.dataloaders.datasets.species_dataset import SpeciesDataset from src.dataloaders.datasets.icl_genomics_dataset import ICLGenomicsDataset from src.dataloaders.datasets.hg38_fixed_dataset import HG38FixedDataset """ Dataloaders for genomics datasets, including pretraining and downstream tasks. First works in HyenaDNA project, May 2023. """ class HG38(SequenceDataset): """ Base class, other dataloaders can inherit from this class. You must implement the following functions: - __init__ - setup You can then use (already have access to) the following functions: - train_dataloader - val_dataloader - test_dataloader """ ###### very important to set this! ###### _name_ = "hg38" # this name is how the dataset config finds the right dataloader ######################################### def __init__(self, bed_file, fasta_file, tokenizer_name=None, dataset_config_name=None, max_length=1024, d_output=2, rc_aug=False, max_length_val=None, max_length_test=None, val_ratio=0.0005, val_split_seed=2357, use_fixed_len_val=False, add_eos=True, detokenize=False, val_only=False, batch_size=32, batch_size_eval=None, num_workers=1, shuffle=False, pin_memory=False, drop_last=False, fault_tolerant=False, ddp=False, fast_forward_epochs=None, fast_forward_batches=None, replace_N_token=False, pad_interval=False, *args, **kwargs): self.dataset_config_name = dataset_config_name self.tokenizer_name = tokenizer_name self.d_output = d_output self.rc_aug = rc_aug # reverse compliment augmentation self.max_length = max_length self.max_length_val = max_length_val if max_length_val is not None else max_length self.max_length_test = max_length_test if max_length_test is not None else max_length self.val_ratio = val_ratio self.val_split_seed = val_split_seed self.val_only = val_only self.add_eos = add_eos self.detokenize = detokenize self.batch_size = batch_size self.batch_size_eval = batch_size_eval if batch_size_eval is not None else self.batch_size self.num_workers = num_workers self.shuffle = shuffle self.pin_memory = pin_memory self.drop_last = drop_last self.bed_file = bed_file self.fasta_file = fasta_file self.use_fixed_len_val = use_fixed_len_val self.replace_N_token = replace_N_token self.pad_interval = pad_interval # handle if file paths are None (default paths) if self.bed_file is None: self.bed_file = default_data_path / self._name_ / 'human-sequences.bed' if self.fasta_file is None: self.fasta_file = default_data_path / self._name_ / 'hg38.ml.fa' if fault_tolerant: assert self.shuffle self.fault_tolerant = fault_tolerant if ddp: assert fault_tolerant self.ddp = ddp self.fast_forward_epochs = fast_forward_epochs self.fast_forward_batches = fast_forward_batches if self.fast_forward_epochs is not None or self.fast_forward_batches is not None: assert ddp and fault_tolerant def setup(self, stage=None): """Set up the tokenizer and init the datasets.""" # TODO instantiate with registry if self.tokenizer_name == 'char': print("**Using Char-level tokenizer**") self.tokenizer = CharacterTokenizer( characters=['A', 'C', 'G', 'T', 'N'], model_max_length=self.max_length + 2, # add 2 since default adds eos/eos tokens, crop later add_special_tokens=False, ) elif self.tokenizer_name == 'bpe': print("**using pretrained AIRI tokenizer**") self.tokenizer = AutoTokenizer.from_pretrained('AIRI-Institute/gena-lm-bert-base') self.vocab_size = len(self.tokenizer) self.init_datasets() # creates the datasets. You can also just create this inside the setup() here. def init_datasets(self): """Init the datasets (separate from the tokenizer)""" # delete old datasets to free memory if hasattr(self, 'dataset_train'): self.dataset_train.fasta.seqs.close() del self.dataset_train.fasta.seqs # delete old datasets to free memory if hasattr(self, 'dataset_test'): self.dataset_test.fasta.seqs.close() del self.dataset_test.fasta.seqs # Create all splits: torch datasets self.dataset_train, self.dataset_val, self.dataset_test = [ HG38Dataset(split=split, bed_file=self.bed_file, fasta_file=self.fasta_file, max_length=max_len, tokenizer=self.tokenizer, # pass the tokenize wrapper tokenizer_name=self.tokenizer_name, add_eos=self.add_eos, return_seq_indices=False, shift_augs=None, rc_aug=self.rc_aug, return_augs=False, replace_N_token=self.replace_N_token, pad_interval=self.pad_interval) for split, max_len in zip(['train', 'valid', 'test'], [self.max_length, self.max_length_val, self.max_length_test]) ] if self.use_fixed_len_val: # we're placing the fixed test set in the val dataloader, for visualization!!! # that means we should track mode with test loss, not val loss # new option to use fixed val set print("Using fixed length val set!") # start end of chr14 and chrX grabbed from Enformer chr_ranges = {'chr14': [19726402, 106677047], 'chrX': [2825622, 144342320], } self.dataset_val = HG38FixedDataset( chr_ranges=chr_ranges, fasta_file=self.fasta_file, max_length=self.max_length, pad_max_length=self.max_length, tokenizer=self.tokenizer, add_eos=True, ) return def train_dataloader(self, *args: Any, **kwargs: Any) -> DataLoader: """ The train dataloader """ if self.shuffle and self.fault_tolerant: shuffle = False # TD [2022-12-26]: We need the distributed_sampler_kwargs in case of model parallel: # In that case the number of replicas and the data parallel rank are more complicated. distributed_sampler_kwargs = self.trainer.distributed_sampler_kwargs sampler = (FaultTolerantDistributedSampler(self.dataset_train, **self.trainer.distributed_sampler_kwargs) if self.ddp else RandomFaultTolerantSampler(self.dataset_train)) # TD [2022-08-06]: Only the DDP sampler supports fast-forwarding for now # We assume that it's being resumed with the same number of GPUs if self.ddp and self.fast_forward_epochs is not None and self.fast_forward_batches is not None: sampler.load_state_dict({ 'epoch': self.fast_forward_epochs, 'counter': self.fast_forward_batches * self.batch_size }) else: shuffle = self.shuffle sampler = None return self._data_loader(self.dataset_train, batch_size=self.batch_size, shuffle=shuffle, sampler=sampler) def val_dataloader(self, *args: Any, **kwargs: Any) -> Union[DataLoader, List[DataLoader]]: """ The val dataloader """ return self._data_loader(self.dataset_val, batch_size=self.batch_size_eval) def test_dataloader(self, *args: Any, **kwargs: Any) -> Union[DataLoader, List[DataLoader]]: """ The test dataloader """ return self._data_loader(self.dataset_test, batch_size=self.batch_size_eval) def _data_loader(self, dataset: Dataset, batch_size: int, shuffle: bool = False, sampler=None) -> DataLoader: return DataLoader( dataset, batch_size=batch_size, num_workers=1, # Data is already in memory, we don't need many workers shuffle=shuffle, sampler=sampler, drop_last=self.drop_last, pin_memory=self.pin_memory, ) def load_state_dict(self, checkpoint): if self.fault_tolerant: self.fast_forward_epochs = checkpoint['loops']['fit_loop']['epoch_progress']['current']['completed'] # TD [2022-08-07] ['epoch_loop.batch_progress']['total']['completed'] is 1 iteration # behind, so we're using the optimizer's progress. This is set correctly in seq.py. self.fast_forward_batches = checkpoint['loops']['fit_loop']['epoch_loop.batch_progress']['current']['completed'] # At this point the train loader hasn't been constructed yet class GenomicBenchmark(HG38): _name_ = "genomic_benchmark" l_output = 0 # need to set this for decoder to work correctly def __init__(self, dataset_name, dest_path=None, tokenizer_name='char', d_output=None, rc_aug=False, max_length=1024, use_padding=True, max_length_val=None, max_length_test=None, padding_side='left', val_ratio=0.0005, val_split_seed=2357, add_eos=False, detokenize=False, val_only=False, batch_size=32, batch_size_eval=None, num_workers=1, shuffle=True, pin_memory=False, drop_last=False, fault_tolerant=False, ddp=False, fast_forward_epochs=None, fast_forward_batches=None, *args, **kwargs): self.dataset_name = dataset_name self.dest_path = dest_path self.tokenizer_name = tokenizer_name self.d_output = d_output self.rc_aug = rc_aug self.max_length = max_length self.use_padding = use_padding self.max_length_val = max_length_val if max_length_val is not None else max_length self.max_length_test = max_length_test if max_length_test is not None else max_length self.padding_side = padding_side self.val_ratio = val_ratio self.val_split_seed = val_split_seed self.val_only = val_only self.add_eos = add_eos self.detokenize = detokenize self.batch_size = batch_size self.batch_size_eval = batch_size_eval if batch_size_eval is not None else self.batch_size self.num_workers = num_workers self.shuffle = shuffle self.pin_memory = pin_memory self.drop_last = drop_last if self.dest_path is None: self.dest_path = default_data_path / self._name_ if fault_tolerant: assert self.shuffle self.fault_tolerant = fault_tolerant if ddp: assert fault_tolerant self.ddp = ddp self.fast_forward_epochs = fast_forward_epochs self.fast_forward_batches = fast_forward_batches if self.fast_forward_epochs is not None or self.fast_forward_batches is not None: assert ddp and fault_tolerant def setup(self, stage=None): # TODO instantiate with registry if self.tokenizer_name == 'char': print("**Using Char-level tokenizer**") self.tokenizer = CharacterTokenizer( characters=['A', 'C', 'G', 'T', 'N'], model_max_length=self.max_length + 2, # add 2 since default adds eos/eos tokens, crop later add_special_tokens=False, padding_side=self.padding_side, ) # Create all splits: torch datasets (only train/test in this benchmark) self.dataset_train, self.dataset_val = [ GenomicBenchmarkDataset(split=split, max_length=max_len, dataset_name=self.dataset_name, tokenizer=self.tokenizer, # pass the tokenize wrapper tokenizer_name=self.tokenizer_name, use_padding=self.use_padding, d_output=self.d_output, add_eos=self.add_eos, dest_path=self.dest_path, rc_aug=self.rc_aug, return_augs=False) for split, max_len in zip(['train', 'val'], [self.max_length, self.max_length_val]) ] def test_dataloader(self, *args: Any, **kwargs: Any) -> Union[DataLoader, List[DataLoader]]: """ The test dataloader, it's a dummy loader just to make the trainer happy, we don't use it.""" return self._data_loader(self.dataset_val, batch_size=self.batch_size_eval) class NucleotideTransformer(HG38): _name_ = "nucleotide_transformer" l_output = 0 # need to set this for decoder to work correctly def __init__(self, dataset_name, dest_path=None, tokenizer_name='char', d_output=None, rc_aug=False, max_length=1024, use_padding=True, max_length_val=None, max_length_test=None, padding_side='left', val_ratio=0.0005, val_split_seed=2357, add_eos=False, detokenize=False, val_only=False, batch_size=32, batch_size_eval=None, num_workers=1, shuffle=True, shuffle_eval=None, pin_memory=False, drop_last=False, fault_tolerant=False, ddp=False, fast_forward_epochs=None, fast_forward_batches=None, *args, **kwargs): self.dataset_name = dataset_name self.dest_path = dest_path self.tokenizer_name = tokenizer_name self.d_output = d_output self.rc_aug = rc_aug self.max_length = max_length self.use_padding = use_padding self.max_length_val = max_length_val if max_length_val is not None else max_length self.max_length_test = max_length_test if max_length_test is not None else max_length self.padding_side = padding_side self.val_ratio = val_ratio self.val_split_seed = val_split_seed self.val_only = val_only self.add_eos = add_eos self.detokenize = detokenize self.batch_size = batch_size self.batch_size_eval = batch_size_eval if batch_size_eval is not None else self.batch_size self.num_workers = num_workers self.shuffle = shuffle self.shuffle_eval = shuffle_eval if shuffle_eval is not None else shuffle # default is to use the same as train shuffle arg self.pin_memory = pin_memory self.drop_last = drop_last if self.dest_path is None: self.dest_path = default_data_path / self._name_ if fault_tolerant: assert self.shuffle self.fault_tolerant = fault_tolerant if ddp: assert fault_tolerant self.ddp = ddp self.fast_forward_epochs = fast_forward_epochs self.fast_forward_batches = fast_forward_batches if self.fast_forward_epochs is not None or self.fast_forward_batches is not None: assert ddp and fault_tolerant def setup(self, stage=None): # TODO instantiate with registry if self.tokenizer_name == 'char': print("**Using Char-level tokenizer**") self.tokenizer = CharacterTokenizer( characters=['A', 'C', 'G', 'T', 'N'], model_max_length=self.max_length + 2, # add 2 since default adds eos/eos tokens, crop later add_special_tokens=False, padding_side=self.padding_side, ) # Create all splits: torch datasets (only train/test in this benchmark) self.dataset_train, self.dataset_val = [ NucleotideTransformerDataset(split=split, max_length=max_len, tokenizer=self.tokenizer, # pass the tokenize wrapper dataset_name = self.dataset_name, tokenizer_name=self.tokenizer_name, use_padding=self.use_padding, d_output=self.d_output, add_eos=self.add_eos, dest_path=self.dest_path, rc_aug=self.rc_aug, return_augs=False) for split, max_len in zip(['train', 'val'], [self.max_length, self.max_length_val]) ] def val_dataloader(self, *args: Any, **kwargs: Any) -> Union[DataLoader, List[DataLoader]]: """ The val dataloader """ return self._data_loader(self.dataset_val, batch_size=self.batch_size_eval, shuffle=self.shuffle_eval) def test_dataloader(self, *args: Any, **kwargs: Any) -> Union[DataLoader, List[DataLoader]]: """ The test dataloader """ # note: we're combining val/test into one return self._data_loader(self.dataset_val, batch_size=self.batch_size_eval, shuffle=self.shuffle_eval) class ChromatinProfile(HG38): _name_= 'chromatin_profile' l_output = 0 # need to set this for decoder to work correctly for seq level def __init__(self, data_path, ref_genome_path, ref_genome_version=None, tokenizer_name=None, dataset_config_name=None, max_length=1000, d_output=2, rc_aug=False, add_eos=True, val_only=False, batch_size=32, batch_size_eval=None, num_workers=1, shuffle=False, pin_memory=False, drop_last=False, fault_tolerant=False, ddp=False, fast_forward_epochs=None, fast_forward_batches=None, *args, **kwargs): self.data_path = data_path self.ref_genome_path = ref_genome_path self.ref_genome_version = ref_genome_version self.dataset_config_name = dataset_config_name self.tokenizer_name = tokenizer_name self.d_output = d_output self.rc_aug = rc_aug # reverse compliment augmentation self.max_length = max_length self.add_eos = add_eos self.val_only=val_only self.batch_size = batch_size self.batch_size_eval = batch_size_eval if batch_size_eval is not None else self.batch_size self.num_workers = num_workers self.shuffle = shuffle self.pin_memory = pin_memory self.drop_last = drop_last if fault_tolerant: assert self.shuffle self.fault_tolerant = fault_tolerant if ddp: assert fault_tolerant self.ddp = ddp self.fast_forward_epochs = fast_forward_epochs self.fast_forward_batches = fast_forward_batches if self.fast_forward_epochs is not None or self.fast_forward_batches is not None: assert ddp and fault_tolerant def setup(self, stage=None): if self.tokenizer_name == 'char': print("**Using Char-level tokenizer**") self.tokenizer = CharacterTokenizer( characters=['A', 'C', 'G', 'T', 'N'], model_max_length=self.max_length + 2, # add 2 since default adds eos/eos tokens, crop later add_special_tokens=False, ) elif self.tokenizer_name == 'bpe': print("**using pretrained AIRI tokenizer**") self.tokenizer = AutoTokenizer.from_pretrained('AIRI-Institute/gena-lm-bert-base') self.vocab_size = len(self.tokenizer) # Create all splits: torch datasets if self.val_only: splits=['val']*3 else: splits=['train','val','test'] self.dataset_train, self.dataset_val, self.dataset_test = [ ChromatinProfileDataset( max_length=self.max_length, ref_genome_path = self.ref_genome_path, ref_genome_version = self.ref_genome_version, coords_target_path = f'{self.data_path}/{split}_{self.ref_genome_version}_coords_targets.csv', tokenizer=self.tokenizer, tokenizer_name=self.tokenizer_name, use_padding=True, ) for split in splits ] class Species(HG38): _name_ = "species" l_output = 0 # need to set this for decoder to work correctly def __init__(self, species: list, species_dir: str, tokenizer_name=None, dataset_config_name=None, d_output=None, max_length=1024, rc_aug=False, max_length_val=None, max_length_test=None, cache_dir=None, val_ratio=0.0005, val_split_seed=2357, add_eos=True, detokenize=False, val_only=False, batch_size=32, batch_size_eval=None, num_workers=1, shuffle=False, pin_memory=False, drop_last=False, fault_tolerant=False, ddp=False, fast_forward_epochs=None, fast_forward_batches=None, chromosome_weights='uniform', species_weights='uniform', total_size=None, task='species_classification', remove_tail_ends=False, cutoff_train=0.1, cutoff_test=0.2, *args, **kwargs): self.dataset_config_name = dataset_config_name self.tokenizer_name = tokenizer_name self.rc_aug = rc_aug # reverse compliment augmentation self.cache_dir = None if cache_dir is None else Path(cache_dir).expanduser() self.max_length = max_length self.max_length_val = max_length_val if max_length_val is not None else max_length self.max_length_test = max_length_test if max_length_test is not None else max_length self.val_ratio = val_ratio self.val_split_seed = val_split_seed self.val_only = val_only self.add_eos = add_eos self.detokenize = detokenize self.batch_size = batch_size self.batch_size_eval = batch_size_eval if batch_size_eval is not None else self.batch_size self.num_workers = num_workers self.shuffle = shuffle self.pin_memory = pin_memory self.drop_last = drop_last self.species = species # list of species to load self.species_dir = species_dir self.chromosome_weights = chromosome_weights self.species_weights = species_weights self.total_size = total_size self.task = task self.remove_tail_ends = remove_tail_ends self.cutoff_train = cutoff_train self.cutoff_test = cutoff_test self.d_output = len(self.species) if fault_tolerant: assert self.shuffle self.fault_tolerant = fault_tolerant if ddp: assert fault_tolerant self.ddp = ddp self.fast_forward_epochs = fast_forward_epochs self.fast_forward_batches = fast_forward_batches if self.fast_forward_epochs is not None or self.fast_forward_batches is not None: assert ddp and fault_tolerant def setup(self, stage=None): if self.tokenizer_name == 'char': print("**Using Char-level tokenizer**") self.tokenizer = CharacterTokenizer( characters=['A', 'C', 'G', 'T', 'N'], model_max_length=self.max_length + 2, # add 2 since default adds eos/eos tokens, crop later add_special_tokens=False, ) elif self.tokenizer_name == 'bpe': print("**using pretrained AIRI tokenizer**") self.tokenizer = AutoTokenizer.from_pretrained('AIRI-Institute/gena-lm-bert-base') else: raise ValueError(f"Invalid tokenizer name: {self.tokenizer_name}") self.vocab_size = len(self.tokenizer) # Create datasets self.init_datasets() def init_datasets(self): # delete old datasets # NOTE: For some reason only works to close files for train if hasattr(self, 'dataset_train'): for spec in list(self.dataset_train.fastas.keys()): for chromosome in list(self.dataset_train.fastas[spec].keys()): self.dataset_train.fastas[spec][chromosome].close() del self.dataset_train.fastas[spec][chromosome] if hasattr(self, 'dataset_val'): pass if hasattr(self, 'dataset_test'): pass # Create all splits: torch datasets self.dataset_train, self.dataset_val, self.dataset_test = [ SpeciesDataset(species=self.species, species_dir=self.species_dir, split=split, max_length=max_len, total_size=self.total_size * (1 if split == 'test' else (self.max_length_test + 2) // max_len), # See the same # of tokens every epoch across train/val/test tokenizer=self.tokenizer, # pass the tokenize wrapper tokenizer_name=self.tokenizer_name, add_eos=self.add_eos, rc_aug=self.rc_aug, chromosome_weights=self.chromosome_weights, species_weights=self.species_weights, task=self.task, remove_tail_ends=self.remove_tail_ends, cutoff_train=self.cutoff_train, cutoff_test=self.cutoff_test, ) for split, max_len in zip(['train', 'valid', 'test'], [self.max_length, self.max_length_val, self.max_length_test]) ] return class ICLGenomics(HG38): _name_ = "icl_genomics" l_output = 0 # need to set this for decoder to work correctly def __init__(self, dataset_name, dest_path=None, tokenizer_name='char', d_output=None, rc_aug=False, max_length=1024, use_padding=True, max_length_val=None, max_length_test=None, shots=1, label_to_token=None, add_eos=True, characters=None, padding_side='left', val_ratio=0.0005, val_split_seed=2357, detokenize=False, val_only=False, batch_size=32, batch_size_eval=None, num_workers=0, shuffle=True, pin_memory=False, drop_last=False, fault_tolerant=False, ddp=False, fast_forward_epochs=None, fast_forward_batches=None, use_shmem=True, *args, **kwargs): self.dataset_name = dataset_name self.dest_path = dest_path self.tokenizer_name = tokenizer_name self.d_output = d_output self.rc_aug = rc_aug self.max_length = max_length self.use_padding = use_padding self.max_length_val = max_length_val if max_length_val is not None else max_length self.max_length_test = max_length_test if max_length_test is not None else max_length self.padding_side = padding_side self.val_ratio = val_ratio self.val_split_seed = val_split_seed self.val_only = val_only self.shots = shots # num shots in ICL sample self.label_to_token = label_to_token # this maps the label to a token in the vocab already, arbitrary self.add_eos = add_eos self.characters = list('ACTGN') if characters is None else characters self.detokenize = detokenize self.batch_size = batch_size self.batch_size_eval = batch_size_eval if batch_size_eval is not None else self.batch_size self.num_workers = num_workers self.shuffle = shuffle self.pin_memory = pin_memory self.drop_last = drop_last if fault_tolerant: assert self.shuffle self.fault_tolerant = fault_tolerant if ddp: assert fault_tolerant self.ddp = ddp self.fast_forward_epochs = fast_forward_epochs self.fast_forward_batches = fast_forward_batches if self.fast_forward_epochs is not None or self.fast_forward_batches is not None: assert ddp and fault_tolerant self.use_shmem = use_shmem # if self.use_shmem: # assert cache_dir is not None def setup(self, stage=None): # TODO instantiate with registry if self.tokenizer_name == 'char': print("**Using Char-level tokenizer**") self.tokenizer = CharacterTokenizer( characters=self.characters, model_max_length=self.max_length + 2, # add 2 since default adds eos/eos tokens, crop later add_special_tokens=False, ) self.vocab_size = len(self.tokenizer) # Create all splits: torch datasets self.dataset_train, self.dataset_val = [ ICLGenomicsDataset( dataset_name=self.dataset_name, split=split, shots=self.shots, use_padding=self.use_padding, d_output=self.d_output, max_length=max_len, dest_path=self.dest_path, tokenizer=self.tokenizer, # pass the tokenize wrapper tokenizer_name=self.tokenizer_name, label_to_token=self.label_to_token, rc_aug=self.rc_aug, add_eos=self.add_eos, ) for split, max_len in zip(['train', 'val'], [self.max_length, self.max_length_val]) ] def test_dataloader(self, *args: Any, **kwargs: Any) -> Union[DataLoader, List[DataLoader]]: """ The test dataloader, it's a dummy loader just to make the trainer happy, we don't use it.""" return self._data_loader(self.dataset_val, batch_size=self.batch_size_eval) class HG38Fixed(HG38): _name_ = "hg38_fixed" """Just used for testing a fixed length, *non-overlapping* dataset for HG38.""" def __init__(self, fasta_file=None, chr_ranges=None, pad_max_length=None, batch_size=32, max_length=None, num_workers=1, add_eos=True, shuffle=False, pin_memory=False, drop_last=False, fault_tolerant=False, ddp=False, fast_forward_epochs=None, fast_forward_batches=None, *args, **kwargs): self.fasta_file = fasta_file self.chr_ranges = chr_ranges self.max_length = max_length self.pad_max_length = pad_max_length self.add_eos = add_eos self.batch_size = batch_size self.batch_size_eval = batch_size self.num_workers = num_workers self.shuffle = shuffle self.pin_memory = pin_memory self.drop_last = drop_last if fault_tolerant: assert self.shuffle self.fault_tolerant = fault_tolerant if ddp: assert fault_tolerant self.ddp = ddp self.fast_forward_epochs = fast_forward_epochs self.fast_forward_batches = fast_forward_batches if self.fast_forward_epochs is not None or self.fast_forward_batches is not None: assert ddp and fault_tolerant if self.fasta_file is None: self.fasta_file = default_data_path / "hg38" / 'hg38.ml.fa' if self.chr_ranges is None: # start end of chr14 and chrX grabbed from Enformer self.chr_ranges = {'chr14': [19726402, 106677047], 'chrX': [2825622, 144342320], } def setup(self, stage=None): # Create tokenizer tokenizer = CharacterTokenizer( characters=['A', 'C', 'G', 'T', 'N'], model_max_length= self.max_length + 2, # add 2 since default adds eos/eos tokens, crop later add_special_tokens=False, ) # we only need one self.dataset_train = HG38FixedDataset( fasta_file=self.fasta_file, chr_ranges=self.chr_ranges, # a dict of chr: (start, end) to use for test set max_length=self.max_length, pad_max_length=self.pad_max_length, tokenizer=tokenizer, add_eos=self.add_eos, ) self.dataset_val = self.dataset_train self.dataset_test = self.dataset_train # if __name__ == '__main__': # """Quick test using dataloader. Can't call from here though.""" # loader = HG38( # bed_file='/home/exnx/enformer-pytorch/data/basenji/human-sequences.bed', # fasta_file='/home/exnx/enformer-pytorch/data/basenji/hg38.ml.fa', # tokenizer_name='char_level', max_length=2000 # ) # breakpoint() # it = iter(ds) # elem = next(it) # print(len(elem)) # breakpoint()
hyena-dna-main
src/dataloaders/genomics.py
# Adapted from https://github.com/Lightning-AI/lightning/blob/2845e7565dbe6b765ae32870e7d2bc456529c30a/tests/tests_pytorch/utilities/test_auto_restart.py#L1397 from typing import Iterator import math import torch from torch.utils.data import RandomSampler, DistributedSampler class RandomFaultTolerantSampler(RandomSampler): def __init__(self, *args, generator=None, **kwargs): # generator = torch.Generator().manual_seed(seed) # super().__init__(*args, generator=generator, **kwargs) # TD [2022-07-17]: We don't force the seed to be zero. We generate random seed, # which should be reproducible if pl.seed_everything was called before hand. # This means that changing the seed of the experiment will also change the # sampling order. if generator is None: seed = int(torch.empty((), dtype=torch.int64).random_().item()) generator = torch.Generator().manual_seed(seed) super().__init__(*args, generator=generator, **kwargs) self.counter = 0 # self.start_counter = 0 self.restarting = False def state_dict(self): return {"random_state": self.state, "counter": self.counter} def load_state_dict(self, state_dict): self.generator.set_state(state_dict.get("random_state")) self.counter = state_dict["counter"] # self.start_counter = self.counter self.restarting = True # TD [2022-08-28] Setting the len will cause PL to think there are only a few batches left per # epoch, and subsequent epoch will have very few batches. # def __len__(self): # # We need a separate self.start_counter because PL seems to call len repeatedly. # # If we use len(self.data_source) - self.counter then PL will think the epoch ends # # when we're only half way through. # return len(self.data_source) - self.start_counter def __iter__(self) -> Iterator[int]: n = len(self.data_source) self.state = self.generator.get_state() indices = torch.randperm(n, generator=self.generator).tolist() if not self.restarting: self.counter = 0 else: indices = indices[self.counter:] self.restarting = False # self.start_counter = self.counter for index in indices: self.counter += 1 yield index self.counter = 0 # self.start_counter = self.counter class FaultTolerantDistributedSampler(DistributedSampler): def __init__(self, *args, **kwargs): super().__init__(*args, **kwargs) self.counter = 0 # self.start_counter = 0 self.restarting = False def state_dict(self): return {"epoch": self.epoch, "counter": self.counter} def load_state_dict(self, state_dict): self.epoch = state_dict["epoch"] self.counter = state_dict["counter"] # self.start_counter = self.counter self.restarting = True # TD [2022-08-28] Setting the len will cause PL to think there are only a few batches left per # epoch, and subsequent epoch will have very few batches. # def __len__(self) -> int: # return self.num_samples - self.start_counter def __iter__(self): if self.shuffle: # deterministically shuffle based on epoch and seed g = torch.Generator() g.manual_seed(self.seed + self.epoch) indices = torch.randperm(len(self.dataset), generator=g).tolist() # type: ignore[arg-type] else: indices = list(range(len(self.dataset))) # type: ignore[arg-type] if not self.drop_last: # add extra samples to make it evenly divisible padding_size = self.total_size - len(indices) if padding_size <= len(indices): indices += indices[:padding_size] else: indices += (indices * math.ceil(padding_size / len(indices)))[:padding_size] else: # remove tail of data to make it evenly divisible. indices = indices[:self.total_size] assert len(indices) == self.total_size # subsample indices = indices[self.rank:self.total_size:self.num_replicas] assert len(indices) == self.num_samples if not self.restarting: self.counter = 0 else: indices = indices[self.counter:] self.restarting = False # self.start_counter = self.counter for index in indices: self.counter += 1 yield index self.counter = 0 # self.start_counter = self.counter
hyena-dna-main
src/dataloaders/fault_tolerant_sampler.py