text
string | predicted_class
string | confidence
float16 |
|---|---|---|
Alternate adjacent tissue sections from each animal were processed for single-labelling of ME utilizing either an immunoperoxidase or immunogold method. Sections were immersed in cryoprotectant solution (25% sucrose, 3% glycerol in 0.05 M PB) for 30 min and then briefly immersed in Freon followed by liquid nitrogen. This ‘freeze-thaw' method increases penetration of antibodies into the surface of the tissue with a minimal disruption of morphology6162. Tissue sections were incubated in a solution containing ME antibody for two nights at 4 °C. For visualization utilizing the avidin–biotin detection method63 sections were incubated with a biotinylated IgG for 30 min followed by 30 min in avidin–biotin complex solution (Vector Laboratories) and 2 min in a DAB-hydrogen peroxide solution. For visualization by immunogold, these sections were incubated with secondary antibody conjugated to gold particles. Sections were rinsed in citrate buffer and colloidal gold particles were enhanced by silver enhancement for 6 min 30 s using the IntenSEM kit (GE Healthcare Life Sciences, Pittsburgh, PA). All incubations, except the primary antibody incubation, were carried out at room temperature with continuous agitation on a shaker table and sections were rinsed between incubations in the appropriate buffer (either 0.1 M Tris-saline or 0.1 M PB). The primary antibody incubation buffer also contained 0.1% BSA.
|
study
| 99.94 |
Following the immunoperoxidase or immunogold procedure, tissue sections were fixed for 15 min in 1.0% osmium tetroxide in 0.1 M PB, washed for 10 min in 0.1 M PB, dehydrated through a graded series of ethanols, placed into propylene oxide, and then a propylene oxide:EMBed (1:1) solution overnight. Sections were then incubated in EMBed for 2 h, embedded between two sheets of Aclar plastic, and placed in an oven for 24 h at 60 °C. Regions of amygdala were glued to plastic blocks formed in Beem capsules and ultrathin sections (75 nm) from an area just below the surface of the tissue at the tissue/plastic interface, where the penetration of antibodies is optimal were collected onto copper grids. The thin sections were counterstained with uranyl acetate and Reynolds lead citrate and examined using an FEI Tecnai 12 electron microscope (Hillsboro, OR). Immunoreactive (ir) profiles were captured using an AMT camera (Woburn, MA).
|
study
| 99.94 |
Chinese Hamster Ovary (CHO) PathHunter cells expressing enzyme acceptor (EA)-tagged β-arrestin 2 and ProLink (PK)-tagged DOR (CHO-OPRD1) were from DiscoveRx (Freemont, CA). Cells were grown in F-12 media (Invitrogen 11765), containing Hyclone FBS 10%, hygromycin 300 μg ml−1 (Invitrogen 10687), G418 800 μg ml−1 (Invitrogen 10131) and maintained at 37 °C in a humidified incubator containing 5% CO2. These cells were used for β-arrestin recruitment assays and inhibition of forskolin-stimulated cAMP accumulation assays described below.
|
study
| 100.0 |
Confluent flasks of CHO-OPRD1 cells were collected with TrypLE Express, and resuspended in F-12 media supplemented with 10% FBS and 25 mM HEPES, at a density of 6.67e5 cells per ml and plated (3 μl per well) into white solid TC-treated 1,536-well plates (Corning, NY). Plates were incubated overnight at 37 °C in a 5% CO2-humidified incubator. The next day, 1 μl of increasing concentrations of naloxone (4 × final concentration in assay buffer) were added to separate columns of the assay plates containing cells. Next, increasing concentrations of BMS-986187 (40 nl of 100 × final concentration in 100% DMSO) were added to separate rows of the assay plates by acoustic dispense using an Echo-550 (Labcyte, Sunnyvale, CA) from Echo-qualified 1,536-well source plates (Labcyte). Plates were covered with a lid and incubated at room temperature for 90 min. Incubations were terminated by the addition of 2 μl PathHunter Reagent. One hour later luminescence was detected using a Viewlux imaging plate reader (PerkinElmer). All PathHunter detection reagents were purchased from DiscoveRx, other chemicals, unless otherwise stated, were from Sigma.
|
study
| 100.0 |
CHO-OPRD1 cells were grown to confluence then harvested and resuspended at 1e6 cells per ml in assay buffer (HBSS+25 mM HEPES,+0.05% BSA). Increasing concentrations of BMS-986187 (30 nl of 100 × final concentration in 100% DMSO) were added to separate rows of 1,536-well white solid NT plates by acoustic dispense using an Echo-550 (Labcyte, CA). Next, 1 μl of increasing concentrations of naloxone (at 3 × final concentration in assay buffer) were added to separate columns of the plates. Next, 1 μl of cells (1,000 cells per well) were added to all wells followed by 1 μl of forskolin (3 × final concentration in assay buffer). Plates were lidded and incubated for 45 min at RT. Incubations were terminated by the addition of Lance-Ultra cAMP detection reagent (1.5 μl of Eu-cryptate-labelled cAMP tracer in lysis buffer, followed by 1.5 μl of U-light-conjugated anti-cAMP antibody in lysis buffer). After a 1 h incubation at RT, time-resolved fluorescence was detected on a Viewlux or Envision plate reader (PerkinElmer) with excitation at 337 nm and emission reads at 615 and 665 nm. The ratiometric data (665 nm read/615 nm read) × 10,000 were then converted to cAMP (nM) based on a standard curve for cAMP (replacing the cell addition step) run at the same time and under identical conditions to the assay. Lance-Ultra cAMP detection reagents were from PerkinElmer Life Sciences. All other chemicals, unless otherwise specified, were from Sigma.
|
study
| 100.0 |
No statistical methods were used to predetermine sample size, but our samples are similar to those generally used within the field. Data distribution was assumed normal in most cases except where sample size was n<5, in which non-parametric tests were used; equal variance was also assumed although this was not formally tested. Results are reported as mean±s.e.m. and two-sided statistical analysis was performed. Statistical significance was assessed with either parametric Student's t-test (paired or unpaired), repeated analysis of variance (ANOVA), one-way ANOVA, both with Tukey's post hoc adjustment or non-parametric Mann–Whitney U and Friedman's test with Fisher's post hoc adjustment, where appropriate. Statistical analysis was performed using SigmaPlot 10.0 (Systat Software) or SPSS 22.0 (IBM).
|
study
| 99.94 |
Smoking while pregnant is the leading cause of preventable infant morbidity and mortality, as well as pregnancy complications . More than a quarter of women aged from 12 to 44 years in their first month of pregnancy report active cigarette smoking—and this prevalence is no lower than the rate among nonpregnant women aged 12 to 44 who are not pregnant . Effective smoking cessation programs targeted at pregnant women can substantially reduce maternal and infant health outcomes, including infant mortality . Although pregnant women who smoke have a higher quit rate during their pregnancy than any other time in their lives , only one-third of women are able to remain abstinent . The high burden of disease associated with smoking during pregnancy coupled with the critical window of opportunity for cessation interventions generates substantial interest in research on pregnant smokers .
|
review
| 99.9 |
Recruiting a representative sample of pregnant smokers for descriptive or intervention studies is challenging . Pregnant smokers may be reluctant to disclose smoking status due to social stigma (particularly in a clinical setting), making self-reported smoking status an error-prone measure. Furthermore, biologically confirmed smoking status (eg, cotinine testing) is expensive . While in-person recruiting in prenatal care settings has been the norm in research to date, new opportunities have emerged to leverage social media and crowdsourcing to more easily recruit pregnant smokers as research subjects. Crowdsourcing platforms are Web-based marketplaces that allow researchers to post research tasks (such as survey completion) that interested subjects can complete for pay. Crowdsourcing offers an easy way to quickly recruit a large sample of study respondents that is more diverse (geographically and sociodemographically) than the typical college student young adult sample or an in-clinic patient sample . Crowdsourcing platforms such as Amazon’s Mechanical Turk (mTurk), Soapbox Sample, and Qualtrics Panel Data draw a broad demographic of workers that can meet even very specific and targeted inclusion criteria . Compensation for research task completion through crowdsourcing platforms is typically lower than in-person research participation with substantially lower research staffing costs, making crowdsourcing an appealing option for maximizing limited research budgets . To date, Amazon’s mTurk has been the largest and best-known crowdsourcing platform due to low costs, flexibility, anonymity of workers, and, for researchers, the demographic diversity of the worker pool . Social media is another online recruitment platform that extends researchers’ reach beyond the limitations of in-person recruitment. About 74% of the 2015 US population had Internet access and more than half of that population used at least one form of social media . Social media allows for precise targeting of messages (including invitations to participate in research) to specific demographic profiles or interests. For example, the social media platform Reddit comprises many smaller interest groups called “subreddits” where members view other members’ posts, news, images, and media links. Advertisers, including researchers, can place ads on specific subreddits, such as a pregnancy or smoking cessation subreddit, to reach the desired target audience.
|
review
| 99.5 |
This study compares the characteristics of a sample of pregnant smokers (a small and temporally defined population) recruited through 4 Web-based platforms (3 crowdsourcing platforms and 1 social media site), then describes the feasibility of each platform and the cost per completed survey.
|
study
| 99.94 |
We sought a sample of pregnant smokers aged 18 years and older living in the United States for a cross-sectional survey-based study of decision-making styles and preferences for incentive-based smoking cessation programs during pregnancy. The study was approved by the institutional review board of the University of Pennsylvania. Study respondents were first asked to complete a 6-question screener created on the Qualtrics Web-based survey platform to determine eligibility. Eligible respondents who provided informed consent then completed a 93-question survey about pregnancy history, smoking history, decision-making style, and smoking cessation program preferences (see Multimedia Appendix 1 for a sample of selected questions). Participants who did not consent were not allowed to continue onto the second survey. The recruitment period ran from July 6 to July 27, 2016. In total, 308 eligible respondents completed the survey. We evaluated platforms based off of two yields: eligibility yield, defined as the percentage of participants who met the inclusion criteria out of the number of total number of respondents, and quality yield, defined as the percentage of eligible participants who correctly and appropriately answered attention and quality checks embedded throughout the survey.
|
study
| 100.0 |
Table 1 describes the recruitment platforms we used and their forms of recruitment flow, general cost, and options for researchers. We chose the platforms Amazon mTurk, Soapbox Sample, Qualtrics Panel, and Reddit due to their ease of use, relatively low cost, and the estimated number of respondents.
|
other
| 97.56 |
We used the third-party service TurkPrime (free to academic researchers) to anonymize respondents and to restrict survey dissemination to eligible and experienced mTurk workers. Participation was limited to those in the United States and those with a 95% approval rating after having completed more than 5000 human intelligence tasks (HITs in mTurk parlance) to maximize data quality. TurkPrime also batch-released the survey to ensure maximum visibility of the HIT. We varied the wording of the HIT titles (more vs less specific about survey content) to maximize participation. The screener survey initially paid US $0.01, but this was increased to US $0.02 to attract more respondents. The main survey paid US $0.10 with a US $0.70 quality bonus.
|
study
| 99.44 |
We contacted Soapbox Sample for a price quote via telephone, and they provided an estimate of US $23 per completed survey for 75 to 100 respondents, with a minimum payment of US $500 after we asked to limit the sample to pregnant smokers in the United States. At no additional cost, Soapbox assigned a project manager who oversaw the number of eligible and completed surveys each day. Soapbox rewarded participants for completing the survey in points that could later be cashed in for gift cards from various retailers. Participants received 2000 points (US $2.00 equivalent) for this survey.
|
study
| 99.5 |
Qualtrics Panel is a subdivision of Qualtrics, a private research software company specializing in Web-based data collection that partners with over 20 Web-based panel providers to supply diverse, quality respondents. We contacted Qualtrics Panel for a quote via email and they provided an initial estimate price of US $20 per completed survey for 50 eligible respondents (pregnant women in the United States who smoke). However, they could not guarantee that the target sample size of 50 respondents would be met within their existing panels. The Qualtrics project manager noted that pregnancy is a “moving target,” in addition to the difficulty of Web assessment and underreporting of smoking status due to social stigma. The manager suggested pushing the survey through all platforms of their crowdsourcing platform, charging US $10 per survey completion with a minimum payment of US $500. This price included a project manager, who added embedded data into the survey for quality assurance and monitored attention checks. Participants were paid directly through Qualtrics.
|
other
| 70.4 |
We first identified 4 Reddit subreddits of which pregnant smokers might be members. We initially planned to post a link to our screener survey directly to the most promising subreddits (eg, r/BabyBumps) but were informed by moderators that this type of survey or research promotion did not comply with subreddit guidelines. We quickly discovered that Reddit has an inexpensive and flexible auction-based system for placing advertisements. We ran several advertisements on promising Reddit subreddits pertaining to smoking cessation and pregnancy, including r/BabyBumps, r/TwoXChromosomes, r/stopsmoking, and r/Parenting. We experimented with various formats, text, and images across our different ad campaigns. All advertisements provided a link to the Qualtrics screener survey. We also varied our bid price per 1000 impressions to maximize our advertising budget. Eligible respondents who completed the main survey received a US $10 e-gift cards through GiftBit, a Web-based gift card service.
|
study
| 100.0 |
As is typical in Web-based survey research, we employed multiple attention checks and quality screens in our surveys . Attention checks confirmed that Web-based survey respondents were reading questions carefully and thoroughly. Quality screens attempted to confirm self-reported pregnancy and smoking status and confirmed that respondents spent an adequate amount of time completing the survey and were not simply checking response boxes as rapidly as possible (eg, selecting the same column repeatedly in a grid). Qualtrics Panel suggested using one-third of the median time to complete the survey as the cut-off point to determine whether respondents rushed through the survey, so we applied this criterion to every survey platform as a part of the quality screens. By platform, 0% (0/9) of respondents in mTurk, 13% (1/8) of respondents in Qualtrics Panel, 28.9% (31/107) of respondents in Soapbox Sample, and 16.9% (30/178) of respondents in Reddit did not pass the time-quality screens.
|
study
| 100.0 |
To confirm pregnancy status, quality screens checked for consistent self-reported gestational age, last menstrual period, estimated due date, and reports of real vs sham pregnancy symptoms. Quality screens for smoking status included knowing the number of cigarettes in a pack, experience of head rush when smoking (not typical for a regular smoker), and consistent reporting of smoking intensity. Additional quality screens included flagging when a respondent provided the same answers in a matrix of questions (ie, clicked answers in a straight vertical line down the page).
|
study
| 98.7 |
Completed eligibility screens and surveys from each recruitment platform were exported from Qualtrics to STATA v 14.2 (StataCorp, College Station, TX) for analysis. Descriptive statistics (mean and 95% CIs or proportions) were calculated for the completed sample by platform for the following measures: age, race, education, income, current smoking status (currently smoking in pregnancy or quit since beginning of this pregnancy), gestational age, and number of previous pregnancies. To analyze the descriptive statistics, we performed chi-square contingency test, analysis of variance, Kruskal-Wallis, and Fisher exact test. Cost data were compiled from invoices and receipts for subject payment and HIT management services (mTurk), gift cards (GiftBit for Reddit respondents), platform payments (Qualtrics Panel Data and Soapbox Sample), and Reddit ad purchases. Cost per completed survey was calculated as total costs per platform divided by number of completed, quality surveys. Eligibility yield was calculated by dividing the number of respondents who met the inclusion criteria by the number of total respondents per platform, whereas quality yield was calculated by dividing the number of quality surveys (number of completed surveys that pass the pregnancy screening, smoking screening, attention checks, quality checks, and email checks) by the total number of completed surveys per platform.
|
study
| 100.0 |
Figure 1 presents recruitment outcomes at each stage of the recruitment process by platform. All platforms could identify pregnant women who smoke and who completed the study with sufficient quality, but the yields of quality surveys from total screen for eligibility varied considerably. We observed significant differences in eligibility yield, quality yield, age, number of previous pregnancies, age of smoking initiation, current smokers, race, education, and income (P<.001).
|
study
| 100.0 |
mTurk collected a total of 30 eligible respondents out of a total 2291 sampled (1.31% eligible). Of those eligible respondents, 17 failed to complete the trial survey (nonscreener portion of the overall survey) and are therefore considered lost to follow-up due to the partitioning of the survey into a screener survey and the trial survey to maximize the quality of the surveys, and 4 produced incomplete surveys, leaving a total of 9 completed surveys. After running the attention and quality screens on the completed mTurk surveys, 0 failed the pregnancy or smoking screener or the attention or quality screens for a quality yield of 100%.
|
study
| 99.94 |
Soapbox produced 20.7% eligible (121/585) respondents out of the total sampled respondents. Of those eligible, 14 produced incomplete surveys, leaving a total of 107 completed surveys. In total, 31 surveys failed the pregnancy check, 2 failed the smoking check, 0 failed the attention checks, and 2 failed quality screens for an overall yield of 60%.
|
study
| 99.94 |
Qualtrics collected a total of 25.9% (178/686) eligible respondents out of the total sampled respondents. Of those eligible, 1 did not provide consent and 163 produced incomplete surveys, leaving a total of 14 completed surveys. One survey failed the pregnancy check, 0 failed the smoking check, 1 failed the attention checks, and 0 failed quality screens for an overall yield of 7%.
|
study
| 99.94 |
Reddit collected a total of 72.3% (206/285) eligible respondents out of the total sampled respondents. Of those eligible, 2 did not provide consent and 26 produced incomplete surveys, leaving a total of 178 completed surveys. In total, 30 surveys failed the pregnancy check, 30 failed the smoking check, 0 failed the attention checks, and 2 failed quality screens for an overall yield of 65%.
|
study
| 99.94 |
Interestingly, the amount of surveys lost between each stage of checks varied across platforms. Although we received 177 eligible respondents in Qualtrics, only 14 (92.1%) completed the survey. mTurk’s respondents produced a similar pattern with 4 out of 13 (69%) incomplete surveys. Respondents from Reddit or Soapbox completed the survey more often than respondents from Qualtrics or mTurk, with Reddit’s incompletion rates at 12.8% (26 incomplete surveys out of 204 eligible surveys) and Soapbox’s at 11.6% (14 incomplete surveys out of 121 eligible surveys). Respondents in mTurk produced higher-quality responses than any other platform, with 0% of respondents failing any of the quality or attention screens. Similar to those recruited through mTurk, respondents from Qualtrics produced high-quality surveys. Out of 14 overall completed surveys, 1 survey failed the pregnancy screening and another survey failed the quality screens. Nearly 29% (one-third) of respondents in Soapbox failed the pregnancy screening, the highest failure rate of the pregnancy screenings across platform. However, aside from this, few others failed any other screenings: 2 failed the smoking screener and 2 failed the quality screens. Reddit had the most number of surveys that failed screeners. In total, 30 surveys failed the pregnancy screening and 30 others failed the smoking screener. Most respondents passed the attention checks and the quality screens. Surprisingly, all respondents passed the attention checks, and only 5 out of 208 total respondents did not pass the quality screen.
|
study
| 100.0 |
During survey collection, we noticed a sudden spike in the number of responses we received via Reddit. The timestamp on many of these responses occurred between midnight and 8 AM. The emails affiliated with them contained domain names from outside the United States—mostly from Eastern Europe—in spite of the fact that the Reddit ads had been geographically specified to target users in the United States. Furthermore, a pattern emerged in the domains of the emails we received from Reddit users, alternating between @me.com, @hotmail.com, and @gmail.com within a relatively short time frame. This series of events led us to believe someone disseminated our survey on the Internet as an easy opportunity to make money. Consequently, we manually combed through the email addresses to check for any repetitious email addresses and suspicious email domains. After closing our survey and ending the Reddit advertisement campaigns, we received a few emails from Reddit users claiming they had completed our survey but had not received payment. Because the 3 users who reached out to our team via Reddit had emails that were similar in structure, we sought to confirm their pregnancy status by asking her due date, last menstrual period, and number of weeks pregnant at the time of survey completion. After we received each response, we compared the information given in the email with the data collected from the survey responses and then sent the payment. Therefore, this decreased Reddit’s quality yield from 65% to 29%.
|
study
| 99.94 |
More than 50% of the total sample identified as white. Over half of all respondents have at least some college education. Most of the respondents had an annual family income of US $35,000 to US $74,999. Almost three-fourths of the respondents reported still smoking at the time of survey administration. As seen in Table 2, demographics varied widely across platforms. A substantial variation in the proportion of currently smoking respondents (vs recently quit during this pregnancy) existed: from 8% of Qualtrics respondents to 88% of Reddit respondents.
|
study
| 100.0 |
Cost per completed survey and total number of completed surveys are shown in Figure 2. By far the cheapest method for distributing surveys, mTurk had an average cost per completed quality survey of US $7.78 (including the cost of completed screener surveys.) However, there seems to be a trade-off between average cost and survey completion. This platform yielded some of the fewest completed surveys.
|
study
| 99.94 |
Soapbox Sample placed a minimum fee of US $500 and priced each survey at US $24.93; after the amount of surveys we received exceeded US $500, each additional survey cost US $24.93. Because Soapbox produced a relatively high amount of low-quality surveys, the Web-based recruitment company only charged us for 60 high-quality surveys. For a total of US $1495.80 and 72 completed overall surveys, the price per completed survey was US $20.78.
|
other
| 99.6 |
Similar to Soapbox Sample, Qualtrics Panel placed a minimum fee of US $500 until the cost of completed responses exceeded US $500 (at US $10 per completed survey). Qualtrics Panel was unable to guarantee a minimum number of responses given our narrow inclusion criteria. With only 12 completed surveys from Qualtrics Panel, each completed survey cost US $41.67.
|
study
| 99.56 |
For the Reddit platform, we spent US $122.67 on Reddit ads, running a total of 9 ad campaigns on 4 subreddits that received a total of 146,885 impressions and 350 clicks. We received 178 completed responses, 95 of which received a US $10 e-gift card using Giftbit. Of the gift cards sent, 9 respondents accepted the gift but never used their reward. These respondents allowed the gift to expire and 1 respondent even canceled his or her gift. Therefore, we utilized US $850 of the US $950 spent on rewards. The average cost per completed survey was US $20.37.
|
study
| 62.56 |
In this explanatory analysis, we compared the yield from and cost of four Web-based survey respondent platforms for carrying out a cross-sectional study of a hard-to-reach population: pregnant smokers. The quantity, quality, and cost of completed surveys varied widely across platforms. Note that without optimized or standardized recruitment methods, we will have variation in yields by definition.
|
study
| 100.0 |
Soapbox and Qualtrics Panel, two similar services offering existing panels of survey respondents, produced very different yields, with the Soapbox producing more eligible surveys by a factor of 6 (Soapbox, n=72; Qualtrics Panel, n=12). The 2 platforms produced similar quality yields: 67% of Soapbox surveys and 86% of Qualtrics Panel passed the quality screens. Both companies described the challenge of recruiting pregnant smokers to complete our surveys upfront. Although Qualtrics produced a low eligible yield (26%), it produced the second-highest quality percentage of 86%. In contrast, Soapbox recruited a higher number of respondents than Qualtrics Panel could, but only 67% of Soapbox surveys were able to pass the quality screens. Going forward, we would be more likely to use Soapbox than Qualtrics Panel, given the higher yield.
|
study
| 99.44 |
Amazon’s mTurk platform, which claims to have over 500,000 workers, produced a very low eligible yield (n=9) but the highest-quality surveys (100%). We attribute the high-quality yield to using only “mTurk Masters” who had a 95% approval rating. However, use of this selective qualification could similarly have limited the number of eligible participants, attributing to our low eligible yields. Loss-to-follow up from our screener to the main survey contributed to the low yield; going forward, we will likely combine the screener into the main survey, pay a smaller fee for the screener portion, and a quality bonus for eligible completers.
|
study
| 62.88 |
Placing ads on Reddit subreddits initially appeared a promising way to drive eligible respondents to our survey. The ads we placed produced 178 completed surveys with an eligibility yield of 72%. However, its proportion of quality surveys was the lowest, with a quality yield of 29%. We were also subject to an unfortunate “hack” of the survey. This “hack” seriously diminished the credibility of the survey results derived from this platform. Going forward, we would be unlikely to use Reddit to disseminate surveys.
|
other
| 99.8 |
For cross-sectional observational studies such as our survey, the ability to generalize results from the sample to a broader population is crucial . We noted distinct sociodemographic profiles across our 4 platforms, with more variability in Reddit and mTurk samples and less in the Qualtrics and Soapbox samples. This is not surprising given, again, the very narrow inclusion criteria for our sample. Reddit and Soapbox contributed the most demographic variability in terms of gathering responses from people in various races, education levels, and income brackets. This cross-platform variability appears to somewhat alleviate the threats to external validity that come with collecting information solely through one platform. However, the benefits of multiple platform recruiting do come at a significant cost—multiple platform recruiting multiplies the complexity and monetary expenses of running a study.
|
study
| 100.0 |
We note 4 important limitations of our explanatory study. We explored only 4 of the various online recruitment platforms that could be leveraged for participant recruitment. At the time when the study was conducted, Reddit identified 12,927,467 active users. Platforms such as Facebook or Twitter may have been able to be used because of their wider user base, with Facebook boasting 1,712,000,000 users and Twitter 313,000,000 users as of the second quarter in 2016. However, Facebook’s inability to identify pregnant and smoking women in its advertising options prevented its usage in this study. Although Twitter does allow users to produce ads much like Reddit, Twitter’s reach also depends on the sender’s popularity. That is, many Twitter users must first “follow” the advertiser in order to see the advertiser’s ads. Another limitation of the study is consistency across platforms. For mTurk and Qualtrics, sample size was relatively limited. As with all studies utilizing online recruitment methods, our study relied on self-reported information. This presents the possibility that not all responses are completely accurate. A third limitation is that the method in which we recruited through Reddit may have yielded inaccurate responses. The mentions of “pregnancy” and “smoking” in our ads may have primed potential participants. This also may have been the reason for the “hack” that we experienced toward the end of the advertising campaign. Next, we recognize that we could not verify smoking status via Web. Although we attempted to design our quality screens by asking about the number of cigarettes in a pack and their preferred brand, we realize this is not a proven method of verifying smoking status. This is usually not an issue faced during in-person recruitment. For most in-person studies, smoking verification methods such as urine cotinine tests are more reliable and can be performed in the setting of a clinic. Lastly, it is important to address the intrinsic differences in the platforms that could have led to variation. First, the methods to target pregnant smokers vary by platform such that some, such as Reddit, are based off of subscriptions and readership while others, such as mTurk, are based off of demographic probability. Therefore, platforms that allow for customization and targeting might lead to a higher percentage of eligible participants than platforms that do not allow for customization. Second, given that the method of incentivizing differs across platforms, users of one platform may be more willing to complete the survey than users of another platform. However, to ensure generalizability, we attempted to use each platform as a typical research would and therefore ensured that the incentive participants received in each platform was similar to those of past researchers in the same platform. Finally, although we do not find it to be a limitation, we note that the difference in methods between mTurk and the other platforms may raise concerns. Turk Prime’s specific ability to only administer HITs to specific mTurk workers based on their anonymous ID meant that mTurk was the only platform where identifying information would not be collected but researchers could still follow up to respondents. In contrast, the Reddit platform required contact information to use as a screener. Therefore, the addition of the screener for mTurk’s platform is more of an asset than a limitation to our study.
|
study
| 100.0 |
More broadly speaking, there are limitations in the use of online recruitment when compared with in-person clinical recruitment. Online recruitment methods are limited by demographic representation, biases, and uncertainties. By nature, samples recruited through Web-based methods are not representative of the broader target population . For example, racial and ethnic disparities exist in the accessibility and frequency of computer use in the United States. However, these are minimized when analyzing Internet access via mobile devices . Similarly, those who participate in studies hosted on mTurk tend to be younger, more liberal, and more familiar with Web-based technology . Nevertheless, although mTurk is less representative than Web-based panel services or national probability samples, it may provide a more representative sample of the United States than traditional in-person sampling methods . Online recruitment may also yield lower-quality data as this paper has shown. Accountability and validity are generally more difficult to enforce in online research. Web-based studies tend to rely on self-report, and subjects can more easily provide responses that do not reflect their actual beliefs, values, or behavior. On mTurk, “spammers” and “bots” capitalize on this and find ways to receive rewards offered by a study without successfully completing the intended task with obvious adverse consequences for the data validity. Inattention and lack of intrinsic motivation may lead to superficial responses and higher attrition rates, although this can be mitigated somewhat by attention checks—supplementary questions and tasks that determine whether a participant is fully paying attention . While the distance between researcher and subject may reduce social desirability bias, Web-based research is not immune from it .
|
review
| 99.56 |
Our findings are not consistent with recent studies looking at online recruitment yields, cost, and representativeness. Other studies that have focused on mTurk as a method to recruit participants have concluded that the Web-based service is relatively inexpensive and efficient . Select studies have further suggested that small payment amounts do not appear to significantly detract from quality . Although we have confirmed that mTurk is indeed inexpensive in our study, it may not, however, have been the most cost-effective recruitment method for our purposes. The number of quality responses that we obtained through our mTurk recruitment efforts was smaller than desired. In part, this may have been due to the specificity of our selection criteria. Indeed, research has shown that mTurk samples tend to be more diverse and thus, more representative of the general population than other Web-based and in-person recruitment methods . Consequently, mTurk may be a more attractive method of recruitment for studies that have less stringent selection criteria than ours.
|
study
| 100.0 |
However, our survey confirmed recent literature regarding online recruitment for hard-to-reach populations. In a study conducted by Martinez et al, the researchers acquired tens of thousands of impressions on different Websites such as Facebook and Craigslist and mobile phone apps such as Instagram, Grindr, and Jack’d to recruit HIV-positive gay Latinos . Similarly, our study used various platforms (subreddits) within the large social media Reddit platform to push our survey to populations of interest. After reaching over 100,000 viewers, we received about 200 completed surveys, many of which were of dubious quality or validity. Given that Admon et al used Facebook to recruit a large robust sample of pregnant women through advertisements at very low costs, future research is needed to compare these crowdsourcing platforms and others with more social media sites such as Facebook, Twitter, and Instagram . Furthermore, future studies should use an in-person sample as a baseline to compare the Web-based platforms and determine efficacy.
|
study
| 99.94 |
This explanatory study confirmed significant variability in recruitment success, quality, and cost across multiple Web-based survey research platforms and social media recruitment strategies. With one exception (mTurk), we observed an inverse relationship between cost per completed survey and number of surveys completed; sample characteristics also varied by platform. We procured higher quality samples from portals that prescreened respondents for us (Soapbox and Qualtrics Panel) vs platforms that draw from a larger pool of potential respondents (mTurk and Reddit). The results of these recruitment efforts suggest that it remains challenging to strike an optimal balance between quality and quantity when recruiting hard-to-reach subjects through Web-based platforms.
|
study
| 100.0 |
Microorganisms have been the source of many chemotherapeutics used in cancer treatment, and amongst them, actinomycetes are the most promising source organisms. Actinomycetes account for about 45% of all microbial secondary metabolites, of which 7600 (80%) are produced by Streptomyces (Bérdy 2005). Over the years, the rate of discovery of new bioactive compounds has reduced, but the rediscovery of known compounds has increased (Fenical et al. 1999). Hence there is a need for bioprospecting of unexplored or underexplored habitats for unique and rare microorganisms, as these can be expected to yield a higher percentage of novel metabolites with desirable bioactivities (Bredholt et al. 2008; Pathom-aree et al. 2006). The Arctic region remains one of the least well-explored geographical locations on Earth for novel bioactive metabolites. Herein, we report on the isolation and screening of actinomycetes from sediment collected from an Arctic fjord and discovery of the production of potential anticancer natural products.
|
study
| 99.94 |
Sediment samples were collected using a van Veen grab from varying depths (50–250 m) in the Arctic Fjord ‘Kongsfjorden’ located in Ny-Ålesund, Svalbard in, July 2012. The samples were serially diluted in ice-cold sterile seawater and plated on Actinomycetes Isolation Agar (AIA) (Himedia, India) supplemented with 0.2 mg/L gentamycin, 0.25 mg/L cycloheximide, and 0.1 mg/L amphotericin B. These were incubated at 20 °C for 4 weeks at which time characteristic actinobacterial colonies were isolated and their extracts screened for anticancer activity as described below.
|
study
| 100.0 |
The isolated strains of actinomycetes were mass cultured for the production of their secondary metabolites. Briefly, a loop full of actinomycete spores was inoculated into a seawater-based seed medium (beef extract 3 g/L, peptone 5 g/L). The flasks were incubated at 20 °C for 48 h on a rotary shaker set at 150 rpm. Subsequently, these were transferred to seawater-based fermentation medium (Yang et al. 2013) (soybean meal 3 g/L, yeast extract 3 g/L, proline 1 g/L, beef extract 3 g/L, glycerol 6 mL/L, K2HPO4 0.5 g/L, MgSO4·7H2O 0.5 g/L, FeSO4·7H2O 0.5 g/L, CaCO3 2 g/L, pH 7.4) and incubated at 20 °C for 10 days on a rotary shaker at 150 rpm. The liquid cultures were centrifuged at 6500 g for 5 min, and the supernatant was extracted three times with an equal volume of ethyl acetate. The extract was concentrated under reduced vacuum on a rotary evaporator at 40 °C, and the dry residue (~10 mg) was re-dissolved in 1 mL DMSO for cytotoxicity screening against NCI-H460 non-small cell human lung cancer (NSCLC) cells as well as for chemical dereplication efforts.
|
study
| 100.0 |
Cytotoxicity evaluation of the crude extracts was performed using a sulforhodamine B (SRB) (Sigma, USA) colorimetric assay on 96-well culture plates (Skehan et al. 1990). The NCI-H460 cell line, obtained from the National Centre for Cell Science (NCCS, Pune, India), was maintained in RPMI-1640 (Himedia, India) supplemented with 10% fetal bovine serum (FBS) (Himedia, India) at 37 °C in an incubator with 5% carbon dioxide. Aliquots of 190 µL cell suspension at a density of 1.9 × 104 cells/well were pipetted into 96-well micro titer plates. The crude extracts were diluted to 1 mg/mL with sterile deionized water, and then 10 µL of each were added to each well to achieve a final concentration of 50 µg/mL. Control wells were composed of 190 µL cell suspension plus 10 µL of 10% DMSO. All assays were performed in triplicate. The plates were incubated at 37 °C in a CO2 (5%) incubator for 72 h, and fixed with 100 µL ice-cold 30% trichloroacetic acid (TCA) and incubated at 4 °C for another 1 h. The plates were gently washed four times and air-dried at room temperature. To each well, 100 µL of 0.057% (wt/vol) sulforhodamine B (SRB) prepared in deionized water with 1% acetic acid was added to each well and incubated at room temperature for 30 min. Unbound stain was removed by washing with 1% acetic acid and then the plates were air dried. To dissolve the cell bound dye, 200 µL of 10 mM Tri base solution (pH 10.5) was added to each well and the plate was shaken on a gyratory shaker for 10 min. Optical density (OD) was read at 510 nm in a microplate reader (Tecan, Switzerland). Percentage of cell-growth inhibition (GI) was calculated according to the following equation (Vichai and Kirtikara 2006):\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ {\text{Percentage}}\;\;{\text{of}}\;\;{\text{growth}}\;\;{\text{inhibition}} = 100 - {\text{percentage of control cell growth,}} $$\end{document}Percentageofgrowthinhibition=100-percentage of control cell growth, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ {\text{Percentage}}\;{\text{of}}\;{\text{control}}\;{\text{cell}}\;{\text{growth}} = ({\text{mean}}\;{\text{OD}}\;{\text{sample}} - {\text{mean}}\;{\text{OD}}\;{\text{day}}\; 0)/({\text{mean}}\;\;{\text{OD}}\;\;{\text{negative}}\;{\text{control}} - {\text{mean}}\;{\text{OD}}\;{\text{day}}\; 0) \times 100. $$\end{document}Percentageofcontrolcellgrowth=(meanODsample-meanODday0)/(meanODnegativecontrol-meanODday0)×100.
|
study
| 100.0 |
Based on the results of a primary screening effort, a potent actinomycete isolate, MCCB 248, was selected for further studies. IC50 values were determined to the NCI-H460 human lung cancer cell line as well as to a cell line derived from normal epithelial kidney cells from the African green monkey (BS-C-1). Briefly, two fold serial dilution of the crude extract of the MCCB 248 isolate was prepared to obtain concentrations ranging from 1 mg/mL to 15.625 µg/mL in 10% DMSO; these were added to the various cell lines as described above. IC50 values were determined based on probit analysis (Brownlee et al. 1952).
|
study
| 100.0 |
The 16S rRNA gene from isolate MCCB 248 was PCR-amplified, sequenced, and a phylogenetic tree was constructed. Briefly, DNA was extracted from a 48 h broth culture of strain MCCB using the PureLink Genomic DNA mini kit (Invitrogen, USA). PCR amplification of the 16S rRNA was performed using universal primers 16S1 (GAGTTTGATCCTGGCTCA) and 16S2 (ACGGCTACCTTGTTACGACTT). The amplified PCR product was purified by Exosap (Affymetrix, USA) and sequenced. Nucleotide sequence data were analyzed using BLAST and deposited in NCBI GenBank. The nucleotide sequences were aligned using Clustal W on MEGA 6 (Tamura et al. 2013). The 16S rRNA sequences of closely related actinomycetes were retrieved from GenBank, and their similarity to the present isolate was assessed at the nucleotide level. A phylogenetic tree was constructed using the neighbor-joining method with boot strap values based on 1000 replicates.
|
study
| 100.0 |
PCR based screening for polyketide synthases (PKS I & PKS II), nonribosomal peptide synthetases (NRPS), aminodeoxyisochorismate synthase (phzE), and cytochrome P450 hydroxylase (CYP) genes was performed using the degenerate primers reported previously (Izumikawa 2003; Wawrik et al. 2005; Ayuso-Sacido and Genilloud 2005; Lee et al. 2006; Schneemann et al. 2011). The composition of the reaction mixture for all PCR amplifications was: 0.4 µL template, 5 µL 2× EmeraldAmp GT PCR Master Mix (Takara Bio Inc., Japan), and 0.5 µL each of the primers (10×).
|
study
| 99.94 |
Similarity searching for the gene sequences was performed using BLASTX against the NCBI GenBank. For phylogenetic analysis, the nucleic acid sequences were translated to protein sequences and aligned with other similar biosynthetic proteins in the NCBI database using the Clustal W program on MEGA 6 (Tamura et al. 2013). A phylogenetic tree of the corresponding biosynthetic genes was constructed by the neighbor-joining method with boot strap values based on 1000 replications.
|
study
| 100.0 |
An aliquot (1 mg) of the fermentation culture extract was prepared for chemical analysis by filtration over GracePure C18-Max 100 mg/1 mL SPE cartridges (Grace Technologies, USA). Compounds were eluted from the column using acetonitrile and methanol to produce a final volume of 1 mL. This material was taken for nominal mass resolution LC-PDA-MS/MS analysis on a Thermo Finnigan system with a Surveyor PDA Plus Detector, Autosampler Plus, and LC Pump Plus coupled to an LCQ Advantage Plus mass spectrometer (Thermo Fisher Scientific, USA), and with a Phenomenex Kinetex 150 mm × 10 mm × 5 µm C18 analytical column installed (Phenomenex, USA). The UV–Vis spectrum from 200 to 600 nm and positive mode ESI mass spectrum from m/z 190–2000 were recorded, and the mass spectrometer was configured for an automated sample-dependent MS/MS scan. Data were analyzed both manually and by mass spectrometric molecular networking using the Global Natural Products Social Molecular Networking (GNPS) (Wang et al. 2016). This was performed in duplicate using both the native library searching and analog detection search modes. Additionally, for compound dereplication masses of major components of the mixture were searched manually using MarinLit and the Dictionary of Natural Products databases.
|
study
| 100.0 |
To evaluate morphological changes induced by the Streptomyces sp. MCCB 248 metabolites, NCI-H460 cells were stained with Hoechst 33342 and observed for characteristics of apoptosis using a fluorescence microscope (Zhang et al. 2007). Briefly, NCI-H460 cells, seeded in a chamber slide having 1.9 × 104 cells per well, were treated with the culture extract at its IC50 value. After 24 h of treatment, the culture medium was removed and cells were washed twice with PBS and stained with DNA specific Hoechst 33342 dye (Sigma Chemicals, USA) (2 μg/mL in PBS) for 10 min at 37 °C. At the end of staining, cells were observed under a fluorescence microscope for apoptotic features. Doxorubicin (Sigma, USA) was used as a positive control and DMSO was used as a negative control.
|
study
| 100.0 |
To detect cells undergoing apoptosis, in situ labeling of the 3′ OH end of the DNA fragments generated during apoptosis was performed using the In Situ Cell Death Detection Kit (TUNEL) (Roche Diagnostics, Switzerland) according to the manufacturer’s instructions. Briefly, NCI-H460 cells in their log phase were treated with the culture extract at its IC50 value and incubated for 24 h. Subsequently, culture medium was removed and cells were washed with PBS, air-dried and fixed with 4% paraformaldehyde (in PBS) for 1 h at 25 °C. Fixed cells were washed 3 times with PBS and incubated with permeabilization solution (1% Triton-X in 1% sodium citrate) for 2 min at 4 °C. As a positive control, NCI-H460 cells were fixed, permeabilized and treated with recombinant DNAase I (New England Biolabs, USA) for 10 min to induce DNA strand nicks. Both control and treated cells were washed twice with PBS, and then 50 µL of TUNEL reaction mixture was added to each well. The cells were incubated for 1 h at 37 °C in a humidified dark chamber and subsequently washed three times with PBS and observed under a fluorescence microscope.
|
study
| 99.94 |
Externalization of membrane phosphatidylserine (PS) is an early event occurring in cells undergoing apoptosis, and can be visualized with FITC labeled Annexin V staining. Annexin V is a Ca2+ dependent phospholipid-binding protein that has high affinity for PS, and binds to cells with exposed PS. To confirm apoptosis induction by Streptomyces sp. MCCB 248 metabolites, Annexin-V-FLOUS/Propidium iodide (PI) staining was performed as per the manufacturer’s instructions (Roche Diagnostics, Switzerland). Briefly, cells grown in chamber slides (Millicell EZ slide, Millipore Corporation, US) were treated with the MCCB 248 extract at its IC50 value. After adding the extract, cells were observed and counted under a fluorescent microscope for apoptotic features at regular intervals of treatment (0, 6, 12 and 24 h). A minimum of four different microscopic fields was counted and the average calculated and expressed as a percentage of the total cell population. Cells treated with 10% DMSO were used as a negative control.
|
study
| 100.0 |
A total of 22 morphologically distinct actinobacterial isolates were obtained from the Arctic sediment samples. Preliminary screening for anticancer activity of the extracts of these isolates resulted in the identification of one isolate, designated as MCCB 248 (Fig. 1), as possessing the most potent growth inhibition against NCI-H460 cells (Fig. 2). Upon further study, the IC50 of the MCCB 248 crude extract was found to be 8.1 and 8.2 µg/mL in NCI-H460 human non-small cell lung cancer cells and non-cancerous BS-C-1 African green monkey kidney cells, respectively. During this preliminary screening effort, it was observed that cells exposed to this extract were less confluent after 24 h of incubation, and attached to the substratum with pronounced shrinkage (Fig. 3).Fig. 1 a Colony morphology and b scanning electron micrograph of aerial mycelia of S. artemisia strain MCCB 248 after incubation for 14 days on Nutrient agar at 28 °C Fig. 2Percentage growth inhibition by various actinomycete crude extracts on NCI-H460 cell lines at 50 µg/mL (normalized to a control without extract) Fig. 3Phase contrast microscope image (20×) of NCI-H460 cells; a control cells, b treated cells with S. artemisiae MCCB 248 extract at its IC50 value for 24 h
|
study
| 100.0 |
A 16S rRNA gene sequence consisting of 1350 bp from the isolate MCCB248 identified it by BLAST analysis as belonging to the genus Streptomyces, having highest sequence similarity (99%) to the type strain Streptomyces artemisiae YIM 63135. The latter strain was isolated from surface-sterilized tissue of Artemisia annua L., collected in Yunnan Province, southwest China,and described by (Zhao et al. 2010). Moreover, phylogenetic analysis using the neighbor-joining method positioned it in a distinct clade along with Streptomyces artemisiae YIM 63135 (Fig. 4). Accordingly, the isolate MCCB 248 was identified as Streptomyces artemisiae, and hence designated as Streptomyces artemisiae MCCB 248 (GenBank accession number KP313874).Fig. 4Neighbour-joining phylogenetic dendrogram based on 16S rRNA gene sequences showing relationships between the isolated S. artemisiae MCCB 248 and related taxa
|
study
| 100.0 |
After screening for the presence of genes involved in the biosynsthetic pathways, such as type I polyketide synthase (PKS I), type II polyketide synthase (PKS II), nonribosomal peptide synthetase (NRPS), aminodeoxyisochorismate synthase (phzE), and cytochrome P450 hydroxylase (CYP), Streptomyces artemisiae MCCB 248 was found to have type I polyketide synthase (PKS I) (GenBank accession number KT251042) and nonribosomal peptide synthase (NRPS) (KT277491) genes. After NCBI GenBank BLASTX searching, the PKS 1 nucleotide sequence had its closest match with Streptomyces sp. ID05-A0179 (83%). Phylogenetic analysis of the S. artemisiae MCCB248 PKS 1 using translated nucleic acid sequences revealed that it formed a separate cluster along with Streptomyces himastatinicus ATCC 53653 and Streptomyces aurantiacus JA4570 (Supplementary material). Blast analysis of the NRPS sequence from S. artemisiae MCCB248 showed that it had closest similarity (83%) with one from Streptomyces sp. SCAU5132. Phylogenetic analysis of this NRPS using the deduced amino acid sequence positioned S. artemisiae MCCB 248 as a distinct clade in the tree (Supplementary material).
|
study
| 100.0 |
The crude extract of S. artemisiae MCCB 248 was first subjected to a C18 SPE clean-up step, and then analyzed by positive ionization LC–MS/MS analysis. Four major chemical components were determined to be present in the crude extract. These four molecules had mass spectra indicating protonated mass ions of m/z 761, 827, 879, and 913, and appeared to possess a common UV chromophore (ν = 312 nm, broad absorption from 280 to 340 nm, and ν = 240 nm). These MS/MS spectra did not match with any library entry upon molecular networking. However, they clustered together in a small molecular family, and upon library comparison with the analog search option, were suggested to be structurally related to a polyhydroxy macrolide, such as bastimolide A (Shao et al. 2015). A number of minor metabolites were also detected in the chromatogram by MS or DAD UV, but were not analyzed further due to their low abundance.
|
study
| 100.0 |
NCI-H460 cells exposed to the S. artemisiae MCCB248 extract exhibited a characteristic apoptotic morphology, such as shrinkage of cell nuclei, chromatin condensation and nuclear fragmentation (Fig. 5a, b), which indicated that one or more components of this extract induced apoptosis. This was further in evidence using a TUNEL assay, which demonstrated condensed TUNEL positive chromatin within the cell nuclei (Fig. 5c, d) when treated with the S. artemisiae MCCB 248 extract. DNase I treated cells were used as a positive control.Fig. 5Fluorescent microscope image (20×) of Hoechst 33342 stained H-460 cells; a control cells, and b S. artemisiae MCCB 248 extract treated cells. Also shown are fluorescent microscope images (40×) of the TUNEL assay of c control cells, and d S. artemisiae MCCB 248 extract treated cells for 24 h
|
study
| 100.0 |
Fluorescent microscope image (20×) of Hoechst 33342 stained H-460 cells; a control cells, and b S. artemisiae MCCB 248 extract treated cells. Also shown are fluorescent microscope images (40×) of the TUNEL assay of c control cells, and d S. artemisiae MCCB 248 extract treated cells for 24 h
|
other
| 99.7 |
In Annexin V-PI assays, a time-dependent increase in Annexin V positive cells was observed in cells treated with S. artemisiae MCCB 248 extract, implying that there was an increased PS translocation to the outer leaflet of the plasma membrane. At the beginning of treatment (0 h), a majority of the cells were negative for both Annexin V and propidium iodide (PI) staining. After 6 h of treatment, 40% of the cells were Annexin V positive and only 9% of cells were both Annexin V and PI positive. A similar observation was observed after 12 h (42% Annexin V and 13% both Annexin V and PI positive reaction), which was indicative of the early stages of apoptosis. After 24 h, 51% of cells were Annexin V positive and more cells had become positive for PI (34%), indicative of the later stages of apoptosis and signified more dead cells (Figs. 6, 7).Fig. 6Fluorescent microscope image (20×) of Annexin-V/PI double-staining assay. After treating with S. artemisiae MCCB 248 extract, cells were stained with Annexin V-FITC and propidium iodide and analyzed after 0, 6, 12 and 24 h of treatment Fig. 7Percentage of H-460 cells showing early and late apoptotic cell death at 0, 6, 12, 24 h after exposure to the extract of S. artemisiae MCCB 248 (data shown are mean of four independent observations and its standard deviation)
|
study
| 100.0 |
Actinomycetales are excellent sources of novel bioactive metabolites with potential pharmaceutical applications (Lam 2006). Actinomycetes contribute over half of the known bioactive secondary metabolites, especially in the classes of antibiotics, antitumor agents, enzymes and immunosuppressive agents (Bérdy 2005). With improved sampling and culture techniques, the isolation of new groups of actinomycetes are being made from sediments collected from even the deepest parts of the oceans (Kwon et al. 2006; Pathom-aree et al. 2006). Such efforts are yielding such chemically rich genera as Salinispora (Feling et al. 2003) and Marinispora (Kwon et al. 2006).
|
review
| 99.8 |
In the present work, 22 different actinomycetes were isolated and cultured from sediment samples collected from the Arctic fjord, Kongsfjorden. Among these was S. artemisiae MCCB248, the extract of which exhibited cytotoxicity with IC50 values of 8.1 µg/mL on NCI-H460 cells and 8.2 µg/mL on BS-C-1 cells. The biosynthetic potential of this microorganism for the production of secondary metabolites was evaluated by detecting the presence of genes involved in secondary metabolite production. The presence of PKS 1 and NRPS genes in S. artemisiae MCCB 248 suggests the possibility that it can produce bioactive secondary metabolites belonging to these two classes of natural products, or a hybrid of both. Relatively low sequence similarity of the PKS and NRPS gene sequences with those available in GenBank indicates the possibility that novel compounds are produced by S. artemisiae MCCB 248. By phylogenetic analysis of PKS 1 using the deduced amino acid sequence, it formed a separate branch along with Streptomyces himastatinicus ATCC 53653 and Streptomyces aurantiacus.
|
study
| 100.0 |
In the present study, H460 human non-small cell lung cancer cells treated with the Streptomyces sp. MCCB 248 extract showed nuclear condensation and fragmentation as evident from Hoechst 33342 staining. This is similar to what is observed with the known anticancer agent doxorubicin (Xin et al. 2012; Zhang et al. 2010). A significant number of anticancer agents display cytotoxicity by damaging DNA, leading to apoptosis (Johnstone et al. 2002). The morphological hallmark of apoptotic cell death includes shrinkage of the cell and nucleus as well as condensation of nuclear chromatin (Saraste 2000), as was observed with application of the S. artemisiae MCCB248 extract.
|
study
| 100.0 |
The DNA fragmentation observed in the TUNEL assay confirmed apoptotic cell death in cells treated with the S. artemisiae MCCB248 extract. Further, a time-dependent increase in Annexin V positive cells implied more cells had undergone a flip-flop of PS to the outer leaflet of the plasma membrane, another indicator of apoptosis. These results demonstrated that S. artemisiae MCCB 248 extract induced apoptotic cell death in NCI-H460 lung cancer cells.
|
study
| 100.0 |
The HPLC–PDA-MS/MS chemical analysis and dereplication efforts for the crude extract of S. artemisiae MCCB 248 suggested some key molecular features associated with the major components of this mixture. The MS and MS/MS spectra of the major four metabolites in the extract showed repeated losses of 18 mass units, which is typical of polyols that show neutral ion losses of water. Furthermore, the UV–Vis spectrum associated with these compounds was suggestive of a tetraene moiety in each, due to the typical absorption band from 280 to 340 nm with a clear maxima at 312 nm (Supplementary material). Taken together, these data suggest the presence of tetraene polyols in the extract, which would be in-line with the production of PKS or hybrid PKS natural products by similar actinomycetes such as the novonestmycins, separacenes, bahamaolides and marinisporolides (Kwon et al. 2009; Kim et al. 2012; Bae et al. 2013; Wan et al. 2015). However, the parent masses observed in this study were not found to correlate with any known molecules of this class in the MarinLit or Dictionary of Natural Products databases. Additionally, the molecular networking performed using GNPS failed to yield any matches against spectra present in the available MS/MS library databases for the four major metabolites present in the extract, but did suggest that these compounds could be analogs of the reported polyhydroxy macrolide natural product known as bastimolide A (Shao et al. 2015). On the other hand, of the lower abundance molecules in the extract, it was possible to identify several known diketopiperazines.
|
study
| 100.0 |
In conclusion, we have isolated and identified the actinomycete Streptomyces artemisiae MCCB 248 from an Arctic fjord that showed promising cancer cell toxicity to NCI-H460 cells in vitro. From the cell-based assays, it could be concluded that this activity likely resulted from the induction of apoptotic pathways leading to cell death. Chemical analysis, dereplication efforts and biosynthetic gene comparisons for the isolate suggested that this organism produces potentially novel bioactive secondary metabolites. Such a promising finding warrants further study, including the purification and characterization of the active compounds as well as description of their biosynthetic gene cluster(s).
|
study
| 99.94 |
Fungi are a diverse and ubiquitous eukaryotic kingdom that inhabit the terrestrial and aquatic environment and play a key role in global biogeochemical cycling as primary decomposers of organic material . Fungal decomposition of wood is dependent on a number of factors including host species, abiotic conditions, and community composition. Three types of fungi are the predominant decomposers in the environment: white rot, brown rot, and soft rot fungi . These degrade wood according to their enzymatic arsenal, breaking down cell wall polymers, penetrating the cell wall, and altering its chemistry, with the resulting constituents being taken up by the hyphae for energy and anabolism ,. Fungi and bacteria inhabit and compete for resources in ecological niches; these interactions can be powerful mutual drivers with positive and negative feedbacks ,. These bacterial-fungal interactions can be highly specific with symbiotic associations developing between bacterial cells and fungal hyphae .
|
review
| 99.9 |
The interactions between fungal and bacterial populations can play a critical role in the breakdown of lignocellulose in the environment ,,. These synergistic interactions can alter microbial community structure, development, and composition ,. Wood degradation by fungi can be inhibited or promoted by bacteria depending on the species present and the growth stage at which the association is initiated . Bacteria can alter the structural integrity of wood, providing more favourable attack sites for fungi and increasing overall decomposition rates . Furthermore, bacteria can also provide nutritional benefits to wood degrading fungi by supplying biologically fixed nitrogen that fungal hyphae transport to the wood degradation site ,,.
|
study
| 99.56 |
Woody plant material is a challenging dietary resource for animals, as plants contain recalcitrant polymers including cellulose, hemicelluloses and lignins . Employing a wood-based dietary strategy with its low nutritional quality and lack of nitrogenous compounds, xylivores must either rely on the activities of endosymbiotic microbes or produce the essential cellulose and lignin degrading enzymes. Some wood eating animals such as cockroaches and longicorn beetles have gut structures that imply cellulose digestion is primarily accomplished by endogenous cellulases rather than microbial cellulases . In contrast, the termite gut requires a greater contribution from microbial cellulose digestion , which works synergistically with endogenous cellulases to enable them to degrade 74–99% of cellulose and 65–87% hemicellulose ,. A complex resident microbiota inhabits the digestive system of the bovine rumen, which converts cellulose-rich plant mass into volatile fatty acids that are subsequently absorbed by the rumen epithelium. Additional compounds such as amino acids and vitamins B and C, are also supplied to the host ,.
|
study
| 99.94 |
Fish represent the greatest diversity of all vertebrates , however, understanding their gut microbiota and its significance is lacking compared to terrestrial vertebrates. Loricariidae is a speciose family of fish distributed in freshwater ecosystems of the Neotropics ,. One member of the Loricariidae, Panaque nigrolineatus, has been the focus of study by several groups due to its ability to imbibe large amounts of wood (up to 70% of the GI contents) . This fish uses spoon-shaped teeth and a suckermouth to allow for ingestion of woody material by rasping . Stable isotope studies provide support for the consumption of large amounts of cellulose as part of their diet ,,, which may offer selective advantage when river nutrients are limited during the dry season . The P. nigrolineatus gastrointestinal (GI) tract is approximately 10× its body length, providing a large surface area with many different microenvironments .
|
study
| 99.94 |
Previous studies have described the isolation of cellulolytic bacteria from the GI tracts and faeces of Panaque demonstrating the presence of a consortium of microorganisms performing cellulose breakdown ,. Using 16S rRNA and culture-based analyses, the enteric bacterial community of P. nigrolineatus appears distinct and specialised in each region of the GI tract. The dominant bacteria have 16S rRNA gene sequences similar to Proteobacteria, Firmicutes, Bacteriodetes and Actinobacteria ,,. The midgut contains phylotypes with high sequence similarity to cellulose degrading bacteria Clostridium, Cellulomonas, Bacteroides, Eubacterium and Aeromonas spp. as well as nitrogen-fixing Bradyrhizobium and Agrobacterium spp. that are capable of in situ nitrogen fixation . The hindgut is dominated by Bacteroidetes ,. Bacterial species richness has been shown to decrease distally from foregut, through to the midgut and hindgut. While the bacterial microbiota within the GI tracts of other fish have been studied –, comparatively little is known about the diversity, abundance, and role of the fungal microbiota in these systems . It is likely that fungi play an important role in the fish microbiome, yeasts have been identified as part of the normal microbiota of fish GI tract – and have been studied with specific relevance for fish health and yields in aquaculture.
|
study
| 99.94 |
The GI tract of P. nigrolineatus is enriched with lignocellulose and provides a unique microenvironment. The fungal population within this fish warrants investigation to better understand their role in this process and possibly identify new lignocellulose degradation pathways and microbial interactions. The aim of the present study was to examine and compare the diversity of fungal communities in different GI tract regions as a function of diet. To our knowledge, this is the first description of fungal populations using molecular techniques in the GI tract of fish.
|
study
| 100.0 |
P. nigrolineatus (L-190) were imported from South America by the fish wholesaler Aquascapesonline (Belleville, NJ). They were randomly assigned to individual, filtered, and aerated tanks kept at 29 ± 1 °C. Fish (40 mm, standard length) were fed a mixed diet of hearts of palm (Euterpe precatoria), algae pellets (Hikari Tropical Sinking Algae Wafers, Hayward, CA), and date palm wood (Phoenix dactylifera) during an acclimation period of three weeks under conditions specified by IACUC 071509JW-01. For the duration of the experiment, the fish on a mixed diet were provided with palm hearts and algae every second day while wood was constantly available. Wood was thoroughly soaked in water and autoclaved three times prior to being provided to the fish. Fish were then converted to a palm wood-only diet or a mixed diet of palm hearts and palm wood. This feeding regimen was maintained for three weeks prior to termination.
|
study
| 100.0 |
After the feeding period, one fish from each treatment was sacrificed by anaesthetic overdose in 3-aminobenzoic acid ethyl ester (MS-222, 50 mg/L) as described previously . After removing the ventral body plate, sterile ice-cold phosphate buffered saline (PBS) was added to the abdominal cavity. The intestine was separated immediately distal to the stomach, removed from the body cavity, uncoiled, and measured rapidly in cold PBS. The auxiliary lobe was separated from the intestine, which was then divided into three parts of equal length, defining foregut, midgut, and hindgut regions. Tissue samples were processed using the Qiagen (Germantown, MD, USA) DNeasy Blood and Tissue Kit with pre-treatments for Gram-positive and Gram-negative bacteria according to the manufacturer's instructions. DNA extracted from three samples of each GI tract region was pooled and processed for PCR amplification.
|
study
| 100.0 |
Primers ITS1 and ITS2 were used to amplify the ITS1 region and primers fITS7 and ITS4 to amplify the ITS2 region (Table 1) using the following parameters: initial denaturation step of 2 min at 96 °C followed by 30 cycles of denaturation for 15 s at 96 °C, annealing for 30 s at 50 °C, elongation for 60 s at 72 °C. Sequencing was performed on the Illumina MiSeq V3 platform (LGC Genomics GmbH, Berlin, Germany). Barcode sequences, adapters and primer dimer products were removed from the resulting sequence fragments using Illumina bcl2fastq 1.8.4 software and submitted to GenBank (Accession numbers SRR5808488–SRR5808499).
|
study
| 99.25 |
ITS pre-processing and OTU picking was carried out with mothur 1.35.1 . Sequences were subsampled in mothur to 60,000 reads per sample, with distances generated using USEARCH . Chimeras were eliminated using the UCHIME algorithm . The similarity threshold for ITS sequences belonging to the same operational taxonomic unit (OTU) was set to 97% and clustered by CD-HIT-EST with cluster representative sequences selected based on abundance. Taxonomic classification of OTUs was performed against the UNITE v6 database with species assigned at 97% identity threshold. Samples were normalised to 28,090, the lowest number of reads per sample for downstream analysis by Quantitative Insights into Microbial Ecology 1.9.0 (QIIME) . Alpha diversity was measured using parallel_alpha_diversity.py script using observed_species and Chao1 metrics. An OTU network was generated using the make_OTU_network.py script. The resulting network was visualized in Cytoscape (3.5.1) using a spring-embedded layout.
|
study
| 100.0 |
Fungal sequences corresponding to the ITS1 and ITS2 regions were PCR amplified from all GI tract regions of both diets. A total of 256,280 sequences, clustering into 207 OTUs, were obtained from the ITS2 amplification and analysed using USEARCH. The ITS1 sequence analysis was found to be considerably less sensitive and useful for this study and the results for this region are included in supplementary information (Table S1). For the ITS2 analysis, OTUs were binned into taxonomic groupings allowing comparison of fungal community alpha diversities across tissues and diet.
|
study
| 100.0 |
To detect changes in fungal alpha diversity, Chao1 estimations of diversity were applied to OTU distributions (Table 2). Fungal diversity increased distally with the greatest diversity in the hindgut of the mixed-diet fed fish. The opposite trend was observed in the wood-fed fish with the foregut having the most fungal diversity. These findings were supported by the rarefaction analysis, which demonstrated that the hindgut had the highest detectable species richness, while the foregut of mixed-diet fed fish had the lowest. The rarefaction analysis suggests that additional sequencing would allow more novel OTUs to be detected but the majority of the diversity present had been sampled (Figure 1). T-tests revealed there was no significant difference (P = 0.4) in the average number of fungal OTUs observed between wood or mixed-diet fish. Differences in Sobs and SChao1 suggest more unique or rare OTUs being present in the wood-fed foregut (Table 2) than any other tissue region examined.
|
study
| 100.0 |
The taxonomic composition of the microbial community varied across tissue type and diet (Figure 2, Figure 3 and Figure S1). Figure 3 provides visualisation of fungal OTUs unique to each fish GI tract region and those that were shared between two or more regions. Different OTUs were detected within each region of each fish, but the core microbiome of the fish is dominated by sequences with high similarity to Sordariomycetes and Dothideomycetes in all regions with the former more prevalent in the midgut and hindgut of the mixed-diet fed fish and the latter dominated in the midgut and hindgut of the wood-diet fed fish (Figure 3). Sequences with high sequence similarity to Fusarium oxysporum were the major OTUs detected in all tissue regions, except the wood-fed hindgut, which was dominated by sequences similar to Cirrenalia macrocephala. Other sequences present throughout the GI tracts of both dietary regimens included Aureobasidium pullulans and Debaryomyces prosopidis (both more abundant in wood-fed fish), and Malassezia restricta.
|
study
| 100.0 |
OTUs were binned into taxonomic groupings allowing comparison of fungal diversity within the GI tract of wood-fed fish and mixed-fed fish, irrespective of GI tract region. The GI tract of the mixed-fed fish was found to have the most ITS2 region sequence diversity. Chao1 analysis indicated that the wood-fed fish had a higher number of rare and unique species compared to mixed-diet fed fish (Table 2). The most prevalent classes in the wood-diet fed fish were sequences similar to Dothideomycetes (40%) and Sordariomycetes (36%) and the mixed-diet fed fish were sequences similar to Sordariomycetes (73%). Three OTUs detected from the Dothideomycetes class were found in the foregut, midgut and hindgut of the wood-diet fed fish but absent in the mixed-diet fed fish.
|
study
| 100.0 |
Each region of the GI tract was analysed for differences in community composition. Analysis did not reveal any tissue specific fungal communities, but sequences similar to the Saccharomycete genus Metschnikowia were found exclusively in the foregut of both fish while OTUs with sequences similar to Tremellomycetes and the Agaricomycete genus Stereaceae were found solely in the hindgut. These OTUs were not found in high abundance in either feeding regimen suggesting limited biological significance. However, analyses were based on the sequences of one foregut, midgut and hindgut from each diet and may not reflect actual variability amongst individuals .
|
study
| 100.0 |
In this study, the fungal communities of wood and mixed-diet fed P. nigrolineatus GI tracts were investigated via rDNA ITS sequencing. Due to complications associated with fish acquisition and rearing, we were only able to analyse one fish raised on each diet. While we recognise that a rigorous analysis of the GI tract communities requires the utilisation of several fish, we found that each GI tract region possessed a distinct fungal community and this is the first report of the presence of fungi throughout a fish GI tract.
|
study
| 100.0 |
P. nigrolineatus imbibes large quantities of wood in its diet and may have developed a symbiotic relationship with microbes to degrade this resource. Wood decomposition is dynamic and the rate of decomposition depends on many factors including priority effects and successional changes in microbial communities . Fungi have been shown to shape the composition of the bacterial communities and are thought to be more abundant in the early stages of decay, with fungal mycelia doubling faster than bacterial cells , and bacterial-fungal interactions facilitating decomposition ,,. Although bacterial-fungal interactions are vital in plant cell wall digestion, aerobic and anaerobic fungal activity has been shown to be responsible for most cell wall degradation by penetrating into plant tissues not normally available to bacteria .
|
study
| 99.94 |
Our finding that P. nigrolineatus fed a wood-diet or a mixed-diet has different fungal communities is consistent with previous and current research showing similar variations for the bacterial communities in different regions of the GI tract [30, McDonald, Watts and Schreier, manuscript in preparation]. Of particular interest is the hindgut, which contains cellulolytic bacteria ,, as well as sequences similar to C. macrocephala, which has been associated with waterlogged wood ,; any relationship between these bacteria and fungi and their role in the fish GI tract remains to be determined.
|
study
| 100.0 |
Combined with previous studies –, our results indicate that bacteria and fungi co-inhabit the GI tract of P. nigrolineatus, with the potential of degrading dietary wood. Ongoing studies [30, McDonald, Watts and Schreier, manuscript in preparation] suggest that the enteric bacterial community may lack selected enzymatic activities essential for lignocellulolytic digestion, which may be provided by the fungal community and/or host. ITS1/ITS2 sequences for several cellulase-producing fungi have been found in the present study, including those having similarity with F. oxysporum, A. pullulans, Botrytis caroliniana, Metschnikowia, Alternaria and Debaryomyces. F. oxysporum, which dominated foregut and midgut regions, excretes enodocellulases, exocellulases and β-glucosidase . These cellulolytic activities might allow the bacteria to benefit from the primary stage of cellulose degradation as part of a synergistic relationship. While there are different fungi in different regions of each fish, many may be carrying out equivalent roles, acting on cellulose to enhance and augment bacterial activities. Future studies will examine whether genes utilised for wood degradation are differentially expressed.
|
study
| 100.0 |
While we have identified the fungal microbiota within the GI tract, the type of symbiotic relationship that this partnership takes with bacteria and host is unknown. It is conceivable that during the breakdown of lignocellulose, microbes produce volatile fatty acids and amino acids, which are absorbed by the fish and provide a source of energy. Bacteria facilitate fungal decomposition of lignin , by altering wood chemistry, structure, and permeability . They may also provide nutritional benefits to wood degrading fungi via nitrogen fixation, allowing fungi to decompose nitrogen-sparse wood . An active nitrogen-fixing community has been identified in the GI tract of P. nigrolioneatus , suggesting that a mutualistic symbiosis between fungi and bacteria is possible within the fish GI tract. Confirmation of such a relationship will require further studies.
|
study
| 100.0 |
Fungi are commercially important and play a critical role in global environmental health. There is considerable interest in applied fungal research, which includes commercial production of important compounds, human health, food safety and security and crop protection . Most research to date has focused on fungi that affect human health or have commercial applications. Comparatively little is known about many of the fungal species found in the environment. Analysing fungal community roles and identities in a novel environment is challenging due to the paucity of literature and lack of available sequences. The quality of fungal sequence databases is highly variable and often lacks proper annotation and lineage designations ,. Amplifying the entire ITS region (including the 5.8S region) may be more phylogenetically informative, but may also artificially reduce microbial richness and bias community structure . In addition, the incidence of chimeric sequences also increases due to the conservation of the 5.8S region . In this study, both ITS1 and ITS2 were used for community analysis. Although, both sets of primers used for their amplification are biased for certain groups ,. In this study, the ITS2 region was found to be more sensitive in detecting novel OTUs, which could be due to the sample type or the biases and limitations of the primer sets ,,.
|
study
| 99.94 |
Different fungal communities were detected across tissue regions and dietary regimens, indicating diet and tissue type affects fungal diversity in fish. Since P. nigrolineatus does not appear to gain energy directly from the digestion of wood , it is possible that enteric fungal communities are important for wood-only diets that lacks readily available carbon and nitrogen by supplying a digestible source of carbon or other micronutrients. This study is the first to examine the fungal community in a xylivorous fish and our results indicate the presence of a diverse fungal population that may play critical roles in cellulose degradation with potential nutritional benefits for the fish. Furthermore, these previously under-studied fungal species may have novel cellulolytic and lignin degrading capabilities that could have implications for biofuel generation. Understanding the role of the fungal communities in lignocellulose degradation and their interaction with GI tract bacteria in this process is the focus of future studies.
|
study
| 99.94 |
Multidrug-resistant (MDR) bacterial infections represent a serious life-threat causing almost 50,000 deaths per year in Europe and in the US; and this number is expected to grow up to tenfold by 2050, killing more than cancer1, 2. In particular, pulmonary infections due to the Gram-negative bacterium Pseudomonas aeruginosa remain one of the major cause of morbidity and mortality3, either in intensive care units or in ventilated patients, as well as in cystic fibrosis (CF) sufferers, complicating therapy in the CF airways4–7. In parallel, the decrease in the pharmaceutical industry research pipeline for novel antimicrobial agents during the last three decades has resulted in an urgent need for the discovery of new strategies to address the vital problems of infectious diseases8, 9. Naturally occurring antimicrobial peptides (AMPs) or their derivatives stand for an appealing source for the generation of new therapeutics9–16. AMPs are ubiquitous in nature and act as the first line of defence against invading microorganisms17, 18. Although human lung epithelial cells produce AMPs (e.g. defensins and the cathelicidins LL-37)19, 20, most of them are present at very low concentrations and are salt-sensitive in vitro making it difficult for them to be active in the abnormally low pH and high-salt environment existing at the apical side of CF epithelial cells21–23. A promising therapeutic approach to defeat P. aeruginosa lung infections would be to exogenously apply AMPs in the lung environment. We recently identified a short-sized (21 amino acids long) derivative of the frog-skin AMP esculentin-1a, named Esculentin-1a(1–21)NH2 [GIFSKLAGKKIKNLLISGLKG-NH2, Esc(1–21)]24, 25, with the following attractive features: (i) a potent and rapid killing kinetics against both planktonic and biofilms forms of P. aeruginosa strains, with a pronounced membrane-perturbing activity as a plausible mode of action26. This is a highly non-specific mechanism which limits the induction of resistance compared to the highly selective conventional antibiotics e.g. tobramycin and ciprofloxacin that would no longer be able to recognize their specific and single target, after mutation27; (ii) the ability to preserve antimicrobial activity at high ionic strength, in contrast with the majority of AMPs of mammalian origin28; (iii) the ability to detoxify, in vitro, P. aeruginosa lipopolysaccharide (LPS), by inhibiting the release of TNF-α from LPS-activated macrophages28.
|
study
| 99.94 |
In addition, a diastereomer of Esc(1–21), named Esc(1–21)-1c, containing only two d-amino acid substitutions at the C-terminal region (dLeu14 and dSer17) was lately synthesized and found to be significantly more stable than the corresponding all-L peptide and less susceptible to enzymatic degradation (i.e. human and bacterial elastases)29; less toxic towards mammalian cells; more active against P. aeruginosa biofilms and more efficient in stimulating bronchial cells migration and presumably in restoring the integrity of an injured bronchial epithelium, a property which is not shown by any traditional antibiotic28, 30.
|
study
| 100.0 |
Even though AMPs are under investigation as novel therapeutics to defeat microbial infections, only a few studies have been reported to date on their antibacterial activity in the lungs of animal models of P. aeruginosa pneumonia31, 32. Remarkably, as learned from literature, when locally applied via intra-nasal or intra-tracheal route in murine models of acute lung infection, they are generally administered after a short time interval (5–15 min) from bacterial infection33, 34. Furthermore, to the best of our knowledge, no studies have been accomplished by the effect(s) of AMPs on the airway epithelial gene expression after P. aeruginosa-induced respiratory infection.
|
study
| 99.94 |
Taking into account the attractive properties of the two esculentin-derived peptides, we first evaluated their outcome on the bronchial epithelium permeability followed by their therapeutic efficacy in murine models of acute Pseudomonas lung infections, upon intra-tracheal instillation. Their effects on the expression of inflammation associated genes were also investigated. Overall, the results of our experiments have pointed out a higher in vivo antipseudomonal activity of the diastereomer Esc(1–21)-1c than its all-l counterpart without provoking any noticeable inflammation or damage at the lung level. Importantly, our work is the first demonstration of a frog-skin derived AMP to significantly promote lung clearance of P. aeruginosa when administered in a single dose at 2 hours after infection. The designed diastereomer demonstrated a higher antibacterial activity than the mammalian AMP LL-37, as well as a comparable potency to that of the clinically used colistin peptide35, 36, whose antibacterial activity is exerted through binding to LPS, the major component of the outer membrane of Gram-negative bacteria.
|
study
| 100.0 |
It was previously demonstrated that Esc(1–21) has a strong in vitro antipseudomonal activity, with a minimal inhibitory concentration (MIC) of 4 μM26. Before performing in vivo studies, the effect of the two esculentin derivatives on the integrity of human airway epithelium was analyzed at three selected peptide concentrations by measuring the transepithelial electrical resistance (TEER) in polarized human primary bronchial cells. Furthermore, the human cathelicidin AMP LL-37 was used as a reference. As shown in Fig. 1, when all peptides were used at a concentration corresponding to 2 × MIC (8 μM), they did not affect the epithelium integrity. When tested at a higher concentration (i.e. 20 μM), LL-37 initially decreased TEER, but this value recovered and was close to the initial one after 10 hours. Differently, when used at the higher concentration of 64 μM, it exhibited significantly detrimental effect on disturbing the epithelial cell tight junction and its negative effect persisted for a long period of time (up-triangle, broken line). In comparison, only a mild decrease in the TEER was observed for 64 μM of Esc(1–21) within 24 h (upside down triangle, broken line). Interestingly, Esc(1-21)-1c treatment had no measureable difference on TEER and did not disturb the membrane integrity at the same 64 μM concentration (square).Figure 1Effects of AMPs on the TEER of lung epithelial cells. Peptides in PBS were added to the apical compartment of the normal primary human bronchial epithelial cells maintained in ALI condition. TEER was measured at multiple time points (1, 2, 3, 5, 8, 10, 12 and 24 hours). Results are representative data from three independent experiments.
|
study
| 100.0 |
Effects of AMPs on the TEER of lung epithelial cells. Peptides in PBS were added to the apical compartment of the normal primary human bronchial epithelial cells maintained in ALI condition. TEER was measured at multiple time points (1, 2, 3, 5, 8, 10, 12 and 24 hours). Results are representative data from three independent experiments.
|
study
| 100.0 |
Prior to analyzing the in vivo antipseudomonal efficacy of exogenous AMPs, the ability of the selected peptides [i.e. Esc(1–21), Esc(1–21)-1c and LL-37] to elicit host immune response and eventually lead to pulmonary toxicity upon intra-tracheal delivery, was evaluated at 24 hours after their administration. The peptides were tested at a concentration of 20 μM (2 μg/mouse) and 64 μM (7 μg/mouse).
|
study
| 100.0 |
Based on the concentrations used for determining the epithelial membrane permeability (Fig. 1), 64 μM (7 μg/mouse, 0.35 mg/kg) of both Esc(1–21) and LL-37 stimulated the host immune system, causing a considerable increase in the number of neutrophils and macrophages in the bronchoalveolar lavage (BAL) compared to the amount found in the control animals receiving the vehicle phosphate buffered saline (PBS) (Fig. 2a, red bars). However, the lung inflammatory reaction was negligible when the peptides were used at 20 μM (2 μg/mouse, 0.1 mg/kg), as demonstrated by the invariant number of total immune cells in the BAL compared to PBS-treated mice (Fig. 2b). In parallel, no observable effects on inflammation-related genes expression (such as those encoding for the cytokines IL-6, IL-10 or the tumor necrosis factor-α TNFα, and NF-kB) were observed in the lungs of mice, at 24 hours after peptide treatment at a concentration of 0.1 mg/kg (Fig. 3a).Figure 2Effect of Esc(1–21), Esc(1–21)-1c and LL37 on the number of lung inflammatory cells in mice. The number of macrophages, neutrophils and total inflammatory cells in the BAL of mice was counted at 24 hours after peptide administration at 7 μg/mouse (0.35 mg/kg) (panel a) or 2 μg/mouse (0.1 mg/kg) (panel b). Results are mean ± SEM from three independent experiments; n = 4–6 mice for each group in each experiment. Following one-way analysis of variance (ANOVA), posthoc comparisons were made using the Dunnett’s multiple comparison test when the P-value was significant (p < 0.05). *p < 0.05, **p < 0.01, for peptide-treated mice versus PBS-receiving animals. Figure 3Comparison among Esc(1–21), Esc(1–21)-1c and LL-37 on the in vivo gene expression in the lungs of mice. Effects of peptides on the expression of different inflammatory genes (panel a) or mucociliary-associated genes (panel b) in the lungs of mice after 24 hours from peptide administration at 0.1 mg/kg. AMPs treatments at 0.1 mg/kg do not noticeably affect the expression of inflammation and mucociliary clearance-related genes. Results are mean ± SEM from two independent experiments; n = 4–6 mice for each group in each experiment.
|
study
| 100.0 |
Effect of Esc(1–21), Esc(1–21)-1c and LL37 on the number of lung inflammatory cells in mice. The number of macrophages, neutrophils and total inflammatory cells in the BAL of mice was counted at 24 hours after peptide administration at 7 μg/mouse (0.35 mg/kg) (panel a) or 2 μg/mouse (0.1 mg/kg) (panel b). Results are mean ± SEM from three independent experiments; n = 4–6 mice for each group in each experiment. Following one-way analysis of variance (ANOVA), posthoc comparisons were made using the Dunnett’s multiple comparison test when the P-value was significant (p < 0.05). *p < 0.05, **p < 0.01, for peptide-treated mice versus PBS-receiving animals.
|
study
| 100.0 |
Comparison among Esc(1–21), Esc(1–21)-1c and LL-37 on the in vivo gene expression in the lungs of mice. Effects of peptides on the expression of different inflammatory genes (panel a) or mucociliary-associated genes (panel b) in the lungs of mice after 24 hours from peptide administration at 0.1 mg/kg. AMPs treatments at 0.1 mg/kg do not noticeably affect the expression of inflammation and mucociliary clearance-related genes. Results are mean ± SEM from two independent experiments; n = 4–6 mice for each group in each experiment.
|
study
| 100.0 |
Furthermore, no detectable pulmonary toxicity was recorded for all peptides tested. In support of this, airway epithelial cell-associated genes expression including Foxj1 (ciliated cells) and Muc5b (mucous cells), having important roles in the lung mucociliary clearance37, was minimally affected (Fig. 3b).
|
study
| 100.0 |
Since no unwanted harmful action at the lung level was pointed out when all the selected AMPs were administered at 0.1 mg/kg, their in vivo efficacy in treating P. aeruginosa-induced respiratory infection was then examined using a mouse model of acute lung infection. The peptides were intra-tracheally administered at 2 hours after bacterial challenge and the number of colony forming units (CFUs) in lung, BAL, and spleen was determined at 6 hours after bacterial instillation. As indicated in Fig. 4a, the total lung burden as shown in number of CFU (lung homogenate + BAL) was significantly reduced (90% reduction) after AMP treatment, compared to the number found in control animals that were infected but received only the vehicle PBS (red bars). Overall, Esc(1–21)-1c revealed to be the peptide with the best in vivo antimicrobial efficacy, probably due to its longer biostability29. In addition, the significant lowering in the number of bacteria in the spleen of Esc(1–21)-1c-treated mice compared to that of control animals or those treated with Esc(1–21) or LL-37 (Fig. 4a) indicated a substantial reduction in the systemic dissemination of bacterial cells and spread of infection. In parallel, the total number of leukocytes in the infected mouse lungs after AMPs treatment was investigated. As reported in Fig. 4b, in line with the diminished bacterial burden provoked by all peptides, a lower number of immune cells, especially neutrophils, was counted in comparison with PBS-treated infected animals, 4 hours after peptide instillation (e.g. 6 hours from infection).Figure 4Comparison among Esc(1–21), Esc(1–21)-1c and LL-37 on the number of viable P. aeruginosa cells (CFU). CFU in mouse lungs (Total = lung homogenate + BAL) and spleens (panel a) as well as on the number of inflammatory cells in the BAL (panel b) of pulmonary-infected mice at 4 hours after peptide administration at 0.1 mg/kg were enumerated. Animals were intra-tracheally infected with 3 million PAO1 cells. The peptides were administered intra-tracheally, at 2 μg (0.1 mg/kg) at 2 hours after bacterial infection. The number of viable Pseudomonas cells in the lung and spleen as well as the number of inflammatory cells in the BAL were evaluated 6 hours after infection, as described in the Experimental section. Results are mean ± SEM from three independent experiments; n = 4–6 mice for each treatment group. Following one-way analysis of variance (ANOVA), posthoc comparisons were made using the Dunnett’s multiple comparison test when the P-value was significant (p < 0.05). *p < 0.05, **p < 0.01, ***p < 0.001 for peptide-treated animals versus PBS-treated mice.
|
study
| 100.0 |
Comparison among Esc(1–21), Esc(1–21)-1c and LL-37 on the number of viable P. aeruginosa cells (CFU). CFU in mouse lungs (Total = lung homogenate + BAL) and spleens (panel a) as well as on the number of inflammatory cells in the BAL (panel b) of pulmonary-infected mice at 4 hours after peptide administration at 0.1 mg/kg were enumerated. Animals were intra-tracheally infected with 3 million PAO1 cells. The peptides were administered intra-tracheally, at 2 μg (0.1 mg/kg) at 2 hours after bacterial infection. The number of viable Pseudomonas cells in the lung and spleen as well as the number of inflammatory cells in the BAL were evaluated 6 hours after infection, as described in the Experimental section. Results are mean ± SEM from three independent experiments; n = 4–6 mice for each treatment group. Following one-way analysis of variance (ANOVA), posthoc comparisons were made using the Dunnett’s multiple comparison test when the P-value was significant (p < 0.05). *p < 0.05, **p < 0.01, ***p < 0.001 for peptide-treated animals versus PBS-treated mice.
|
study
| 100.0 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.