text
string | predicted_class
string | confidence
float16 |
|---|---|---|
Overall, the signalling effect/role of an individual SL could be defined on spatial-temporal basis with at least five parameters: (a) subcellular localisation, (b) regulation (c) chain length specificity, (d) kinetics of trafficking and (e) mechanism of action. For example, phosphorylation of 1–3% cytosolic SPH may double the levels of S1P that acts on G protein-coupled receptor (GPCR) to elicit a specific response in a particular cellular locality for certain period of time (Hannun & Obeid, 2008). Such signalling events can be described as a function of cytosolic S1P that is regulated by S1P Kinase, with the signal caused through the interaction of S1P with a GPCR. The elucidation of such complex systems remains challenging and a comprehensive discussion of the issue is beyond the scope of this review. However, an additional layer of significant complexity in terms of the pathogenic protozoa arises when considering the SL signalling network in the case of obligate intracellular parasites, where host SL biosynthesis, and its interaction with parasite de novo synthesis, must be taken into account.
|
review
| 99.9 |
The intimate parasite–host interaction in terms of SL metabolism has been well documented; L. major pathogenic amastigotes isolated from mammalian hosts showed normal IPC levels (Zhang et al. 2005) despite lacking LCB2, a functional SPT and the ability to synthesis CER de novo. Alterations in host, macrophage, cell SL biosynthesis upon infection may compensate for this deficiency (Ghosh et al., 2001, 2002). These studies suggest a complex and multifaceted interplay between host and parasite SL metabolism comprising nutritional factors and signalling pathways that could modulate parasite survival and/or host defence (Zhang et al. 2010). Similar observations have been reported in the apicomplexan parasites (Romano et al. 2013). This highlights the striking potential of host and parasite SL modulation as an anti-protozoal target, as is similarly proposed for pathogenic fungi (Zhang et al. 2010; Ramakrishnan et al. 2013).
|
review
| 99.7 |
Classically dissecting the role and locale of critical enzymatic steps in SL biosynthesis and assessing the effect on the parasite fitness and virulence could turn into an overwhelmingly challenging task aggravated by: the complexity of the metabolic pathway itself; the ability of the parasite to salvage (Coppens, 2013), hijack and remodel host SL; and developmental regulation during the parasitic life cycle, which adds another layer of intricacy rendering the deconvolution of any observed effects difficult to interpret. Fortunately, many of those problems can be now overcome with advances in technology. High resolution localization studies in protozoan parasites can benefit greatly from new microscopic techniques such as Airy-scan (Huff, 2015), super-resolution microscopy (Florentino et al. 2014) and upcoming technologies, e.g. phase-modulation nanoscopy (Pal, 2015; Ward & Pal, 2017), which can elucidate spatial arrangement of proteins of interest within the parasite to reveal potential interaction partners and shed light on mechanistic features. Similarly, new advances in chemical probes, and SL analogues in particular, such as bifunctional lipid technology (Haberkant & Holthuis, 2014) coupled with high throughput proteomic (Ramaprasad et al. 2015), could identify different interaction partners that would help map the biosynthetic pathway and its critical interactions. The effects of these probes on the parasite (and host) cell can now be comprehensively evaluated by monitoring the transcriptome, proteome, metabolomics (Watson, 2010) and lipidome (Marechal et al. 2011). Such studies could reveal multiple windows of opportunity to exploit as potential drug targets. The targets identified in this way can now be rapidly genetically validated in the parasitic protozoa by applying modern gene editing technologies, such as CRISPR/Cas9 (Sugi et al. 2016). Compared with the classical methodologies, this tool enables fast and efficient application for single gene (Serpeloni et al. 2016), and systematic genome-wide knockout generation (Sidik et al. 2016). Additionally, the development of novel orthogonal approach for conditional knockout strategies, e.g. tetracycline-induced gene disruption Tet-system (Meissner et al. 2002), rapamycin-induced Cre recombinase-assisted gene excision (Andenmatten et al. 2013; Collins et al. 2013; Jimenez-Ruiz et al. 2014), has allowed testing of essential gene functionality, in Leishmania spp. (Duncan et al. 2016) and T. gondii (Pieperhoff et al. 2015).
|
review
| 99.9 |
Aside from the increase ability to robustly validate targets such as SL biosynthesis, global collaboration between academia and pharmaceutical partners is expediting the process of drug discovery of new anti-protozoal drugs. For example, within the sphere of targeting SL biosynthesis in the protozoa, we have managed several projects with industrial partners, MRCT and Tres Cantos Open Lab Foundation (https://www.openlabfoundation.org, an initiative of GlaxoSmithKline), in the pursuit of identifying new compound scaffolds active against the Leishmania spp IPC synthase utilising yeast (Norcliffe et al. 2014) as a vehicle for drug discovery (Denny & Steel, 2015). The generated results and techniques could readily be translated to other disease targets. Other global initiatives include Open Innovation Drug Discovery, Eli Lilly, which is focused on cancer, cardiovascular disease, endocrine disorders, neuroscience and tuberculosis. The Centers for Therapeutic Innovation, facilitates Pfizer and academic researchers to work together in order to develop new biologics programs and WIPO Re:Search, provide participant researchers with access to patents and expertise related to drug discovery for 19 NTDs, malaria and tuberculosis (Sheridan, 2011).
|
review
| 99.8 |
Finally, SL biosynthesis represents a gold mine for new drug targets alongside at least two axes, de novo synthesis and salvage and remodelling. On one hand, the protozoan de novo SL biosynthetic pathway comprises three key steps, and considering their divergence compared with the mammalian host, identifying specific inhibitors for those could open an opportunity for anti-protozoal drugs with synergistic effects and lower incidences of resistance. On the other hand, the nature of obligate intracellular parasites dictates that further efforts should be directed towards the catabolic/salvage pathway where parasite–host dependencies could be exploited in order to identify additional key steps, or host enzymes, where inhibitors would exert further synergism with the de novo inhibitors.
|
review
| 99.0 |
To summarize, the landscape of anti-protozoan drug discovery requires immediate attention: with the re-evaluation of knowledge gained, the application of recent technologies; and the support of coordinated global discovery efforts. The multifaceted effects of SLs as a dynamic matrix of interaction (spatial and temporal) and function makes SL biosynthesis highly alluring for drug intervention, after all, everybody needs SLs, right?
|
other
| 78.6 |
The symptoms of the RLS were first described by Willis (1685) and then published by Ekbom (1960). Despite being introduced hundreds of years ago, it’s still a poorly recognized disorder because of the unclear pathophysiology and relatively low morbidity, resulting in limited recognition by primary care physicians and common misdiagnosis and under-diagnosis. RLS is considered as a common neurological sensorimotor disorder that manifests as an irresistible urge to move the body to relieve the uncomfortable sensations. There’s a significant circadian rhythm of the RLS, as it commonly worsens at night.
|
review
| 99.9 |
It has been concluded that the prevalence rate ranged from 3.9 to 15% of the general population (Ohayon et al., 2012) from recent epidemiologic analyses of different countries. The estimated prevalence of the RLS is around 7–10% in Caucasians (Ohayon et al., 2012) while there is a much lower incidence ranging from 0.1 to 12% among Asian population (Cho et al., 2009; Tsuboi et al., 2009; Chen et al., 2010; Panda et al., 2012; Shi et al., 2015). Compared with other countries, RLS is much more common in western countries. As numerous studies in western countries indicated the prevalence of 10, 10–15, and 5.5% in United States, Canada, and Europe (United Kingdom, Spain, Germany, Italy), respectively (Phillips et al., 2000; Ohayon and Roth, 2002). On the other hand, studies from Asian countries showed a pretty low prevalence rate of RLS. The first Indian population study on RLS revealed a prevalence of 2.9% (Panda et al., 2012) while a prevalence of 0.96% among inhabitants of Ajimu in Japan who were older than 65 years old (Tsuboi et al., 2009). Another RLS study in Shanghai, China revealed a prevalence rate of 1.4% among 2941 eligible individuals older than 18 years old (Shi et al., 2015). The significant difference between different ethnic populations may be due to different genetic background, ethnicity, geography, and environmental influences including natural environment and diet habits. The different populations targeted, research methodologies and diagnosis criteria used may contribute to this result as well.
|
review
| 99.9 |
Most surveys have concluded that the prevalence and severity of the RLS both increase with age (Phillips et al., 2000; Ohayon and Roth, 2002), suggesting that the neurodegenerative process may play an important role in RLS. Life style of older people and the senile changes including cardiovascular changes and metabolism changes is also related to RLS (Koh et al., 2015; Cassel et al., 2016). In adults, the incidence of RLS is twice as high in women than in men (Berger et al., 2004), which may result from the hormones such as estrogen and progesterone and different social roles.
|
review
| 99.75 |
The age of onset varies widely from childhood to over 90 years of age. Though most patients in clinical practice are middle-aged or older, juvenile onset is not rare. 38–45% of adult patients complain about first symptoms before the age of 20 (Walters et al., 1996; Montplaisir et al., 1997). A study in 2007 found rates of 1.9 and 2.0% in 8–11 years old and 12–17 years old children and adolescence, respectively. Another study using a different diagnostic criteria for RLS in children that published in 2003 revealed a prevalence of 5.9% (Kotagal and Silber, 2004). A newest pediatric RLS diagnostic criteria that include consideration of typical words used by children, differential diagnosis and comorbidity was published in 2013 (Picchietti et al., 2013). But no gender difference is found in pediatric RLS (Per et al., 2017). This gender difference in adult but not in children might be due to pregnancy because nulliparous women have about the same prevalence of RLS as males (Berger et al., 2004). The different classifications of RLS including primary and secondary RLS may also contribute to these findings. Sleep, mood, cognition, and quality of life are significantly affected in pediatric RLS patients (Picchietti and Picchietti, 2010). And ADHD, depressive symptoms, and anxiety are very common comorbidities of pediatric RLS patients (Pullen et al., 2011).
|
review
| 99.9 |
Restless legs syndrome manifests as an overwhelming urge to move the body to relieve the uncomfortable sensations, primarily when resting, sitting, or sleeping. The uncomfortable feelings are always described by the patients as “creeping, crawling tingling, tingling, pulling, or painful” deep inside the limbs (Trenkwalder et al., 2005), unilaterally or bilaterally occurring with the knees, the ankles or even the whole lower limbs (Trenkwalder et al., 2005). Sometimes even the phantom limbs can be involved (Skidmore et al., 2009). Commonly it affects the patient’s sleep. Insomnia is the most common reason for a patient with RLS to search for consult in clinical practice. The most common bedtime problems caused by RLS is difficulty initiating sleep (Mohri et al., 2008). It has a significant circadian pattern which presents as worsening symptoms in the evening and short remission in the morning after waking up (Kushida et al., 2007). The longer the course of the disease, the more likely the symptoms affect the arms or the other places of the body besides the legs. It’s not uncommon that patients developed arm restless syndrome with progressive disease (Freedom and Merchut, 2003). Movement such as walking, stretching, or bending the legs relieves the discomfort at least temporarily and partially (Trenkwalder et al., 2005).
|
review
| 99.9 |
Restless legs syndrome affects the patient’s HRQoL to different degrees according to various severities of the symptoms. HRQoL is measured by 36-Item Short Form Health Survey (SF-36), a 36 item survey used to construct eight scales among physical and mental health and health transition. Most patients have mild symptoms, only 11.9% of them seek for consult, while about 3.4% of all the patients need drug treatment (Hening, 2004). The main morbidities except for extreme discomfort were sleep loss and disruption of normal activities (Trenkwalder et al., 2005). Patients with mild or moderate symptoms manifested discomfort with less frequency, lower severity, and less influence of the symptoms on their sleep. Comparing with the general population, patients with severe or very severe RLS symptoms always reported apparent deficits (10–40 points on 100-points scales) in physical functioning, bodily pain, general health, vitality, social functioning, role-physical, and role-emotion (Trenkwalder et al., 2005). With deficient sleep at night, severely affected patients might complain about having difficulty in their daily life including their jobs and social activities (Kushida et al., 2007). A significant higher probability of 25% with ADHD were found in RLS patients compared to general population (Pullen et al., 2011). On the other hand, 20% of ADHD patients meet criteria for RLS as well (Zak et al., 2009; Yilmaz et al., 2011). Pathophysiological pathways of ADHD remains poorly understood, but the most popular theory is the dopamine deficit theory, which could be a shared pathway with RLS (Swanson et al., 2007). BTBD9, a RLS risk allele, may be related to certain subtypes of ADHD, which responds well to iron supplementation treatment (Schimmelmann et al., 2009). Disruption of sleep length and quality, daytime alertness can contribute to depression and anxiety. Increasing sympathetic tone due to PLMS may lead to cardiovascular disease and high blood pressure (Stevens, 2015).
|
review
| 99.9 |
Different from in adults, pain is a common presentation in pediatric RLS. 45% of children use the terms pain and hurts or hurting which makes growing pains a common misdiagnosis in pediatric RLS (Picchietti et al., 2013). And children always use their own words like “need to move, want to move and got to kick (Picchietti et al., 2011)” to describe “urge”. ADHD is also a very common comorbidity in pediatric RLS. Except for bad impact on sleep, mood and cognition, behavioral and educational changes are very common in pediatric RLS (Picchietti et al., 2013). It might be due to disruption of homework and ability to concentrate.
|
review
| 99.8 |
Both sensory and motor symptoms show significant circadian rhythm in RLS, which display as a peak at similar time at night. A study showed the increase in melatonin secretion to be the only changes preceding the sensory and motor symptoms in RLS patients, indicating melatonin might affect the symptoms by its inhibitory effect on dopamine secretion in central nervous system (Michaud et al., 2004). The intensity of RLS symptoms peaks on the falling phase of the core body temperature, another endogenous marker of circadian rhythm, while it decreases when core temperature increases (Hening et al., 1999; Barriere et al., 2005).
|
study
| 91.2 |
Previous studies have shown that plasma dopamine and its metabolites changes with circadian rhythm not only just in humans (Sowers and Vlachakis, 1984), but also in CSF in primate animals (Perlow et al., 1977) and in the striatum of rat (Schade et al., 1995; Castaneda et al., 2004). Another study indicated that the dopamine receptor responsiveness is modulated by the circadian rhythm at the level of spinal cord in decapitated Drosophila melanogaster (Andretic and Hirsh, 2000). Moreover, it has been revealed that sensitivity of dopamine receptors increased at night at the level of tubero-infundibular-dopaminergic system (Garcia-Borreguero et al., 2004). Additionally, a circadian variation of serum iron paralleled the CSF dopamine, as well as the severity of symptoms (Garcia-Borreguero et al., 2004). However, it is unclear whether the brain iron concentrations changes would follow this pattern.
|
study
| 92.5 |
Periodic limb movement disorder, previously known as nocturnal myoclonus, is defined as involuntary movements of the patient’s limb or torso during awake or sleep which the patient is not aware of, different from the voluntary movement of the limb to relieve the discomfort in RLS patients (Hening et al., 1999; Trenkwalder et al., 2005). Nevertheless, it’s a very common phenomenon in RLS patients. A previous study indicated that PLMS was found in around 80% of RLS patients (Montplaisir et al., 1997). On the contrary, not a large percentage of patients having PLMS presented RLS. PLMS, which is not a specific feature for RLS patients, can be associated to many other conditions. The PSG is usually employed to measure the movements, while actigraphy is a helpful method for diagnosing and measuring PLMW or PLMS. PLMS is diagnosed on PSG by at least continuous four muscle contractions lasting 0.5–10 s and recurring during intervals of 5–90 s. The minimum amplitude of a leg movement event is an 8 μV increases in EMG voltage above resting EMG (Iber et al., 2007) in diagnostic criteria for PLMD.
|
review
| 99.25 |
A movement in PLMS starting in sleep can continue when waking up and vice versa. On the other hand, arousals happening before or during a movement event do not change the assessment of that event (Iber et al., 2007). Immobilization test is to measure PLMW in which the patient is asked to lie perfectly still. The PSG records the time the patient can stay still and the limb movements during an hour. It can be used to quantify the severity of RLS, to follow up the patient’s course of disease and to monitor treatment response (Trenkwalder et al., 2005).
|
other
| 99.9 |
The diagnostic criteria have experienced a lot of improvements and revisions in the history, including the earliest informal Ekbom’s “criteria” for RLS in 1960, then DCSAD restless legs DIMS or DOES syndrome – essential features in 1979, ICSD diagnostic criteria for RLS in 1990, IRLSSG “minimal” criteria for diagnosis of RLS in 1995 and NIH/IRLSSG (NIH) “essential” criteria for diagnosis of RLS in 2003 (Allen et al., 2014). On the basis of previous diagnostic criteria, the four essential diagnostic criteria of RLS published by NIH/IRLSSG in 2003 emphasized the importance of the urge to move the legs in diagnosing RLS. The four essential criteria are shown below (Table 1).
|
review
| 99.9 |
Although, 2003 NIH/IRLSSG diagnostic criteria have defined RLS in a much more detailed way than those previous criteria. The same disadvantage still exist in this criteria, RLS “mimics” can’t be excluded according to this diagnostic criteria. Such as conditions like cramps, positional discomfort and local leg pathology. Then the diagnostic criteria were recently revised again by the IRLSSG in 2012 (International Restless Legs Syndrome Study Group, 2012). Comparing with 2003 NIH/IRLSSG diagnostic criteria, 2012 revised RLS diagnostic criteria have added an important essential criterion, noting that RLS should be differentiated with other conditions with similar symptoms such as myalgia, venous stasis, leg edema, arthritis, habitual foot tapping, and so on (International Restless Legs Syndrome Study Group, 2012). 2012 revised RLS diagnostic criteria also stated the stipulation of clinical course and clinical significance of RLS as presented (International Restless Legs Syndrome Study Group, 2012). The newest diagnostic criteria (Table 2) is much more rigorous than 2003 IRLSSG diagnostic criteria.
|
review
| 99.9 |
Specifier for clinical significance of RLS emphasizes that the influence of RLS on the patient’s function in social, occupational, educational, or other important areas should be evaluated. Different from in adults, functional consequences of RLS in children are mainly behavioral and educational domains (Arbuckle et al., 2010). The new diagnostic criteria set up a more rigorous method to ascertain a RLS case with more specific criteria and excluding standards. It has improved the validity of RLS diagnosis. On the other hand, it helps to classify the patient’s clinical course and clinical significance which helps the physician to better monitor the progression of RLS and support better cases for research samples (Allen et al., 2014). The specifier for clinical course does not apply for pediatric RLS or special cases of RLS secondary to pregnancy or medication (Picchietti et al., 2013). Generally, mild RLS severity with no family history, and young age at RLS onset are predictors of RLS remission. While most patients with severe RLS show a chronic clinical course (Lee et al., 2016).
|
review
| 99.9 |
Periodic limb movement during sleep is a very identified sign in RLS patients. It is found that 80–89% of RLS patients have excessive PLMS than same aged people (Montplaisir et al., 1997). PLMS is not very specific for RLS since it is a frequent condition among adults aged over 45 years (Hornyak et al., 2007). When PLMS present in a pattern different than expected for age excluding the states of other disease or medication, PLMS can support the diagnosis of RLS.
|
review
| 97.6 |
Considering that children might not understand the term “urge”, simple straightforward prompts should be asked, like “Do your legs bother you?” or “Do your legs bother you at night?” And common descriptions used by children about RLS sensations are “need to move, want to move and got to kick (Picchietti et al., 2011)”. RLS mimics like ADHD, sore leg muscles, growing pains and dermatitis should be carefully considered when diagnosing pediatric RLS (Picchietti et al., 2013).
|
review
| 98.0 |
Comparing with the previous diagnostic criteria, 2012 revised RLS diagnostic criteria is the only criteria that developed by a large international number of RLS clinical and research experts through an interdisciplinary, international and evidence-based approach which ensure it to be a world-wide consensus criteria which reduces the risk of cultural bias and avoids arbitrary and improve the validity. The specifiers for clinical course and significance are able to provide a method to define different target population which would help clinicians and researchers to offer better prevention and treatment strategies for specific groups of patients and to better elucidate etiopathogenesis (Allen et al., 2014).
|
review
| 99.9 |
On the other hand, some disadvantages still exist since the diagnostic criteria for RLS are subjective, some more objective and reliable diagnostic criteria need to be brought up for a further diagnosis and classification of RLS, such as biological markers, genetic features, PLMS measuring, polysomnography, and actigraphy changes. Some new tools are to be developed for standardize case ascertainment (Allen et al., 2014). A case-control study in Germany reveals that inositol metabolites increased specifically in RLS patients (Schulte et al., 2016). This might be a discovery approach using serum metabolite profiling in RLS.
|
review
| 99.7 |
Primary RLS is considered to be idiopathic when the cause is truly unknown. Among the idiopathic RLS, 40.9–92% of whom had a family history of RLS, indicating the important role of genetic factors in developing RLS (Winkelman et al., 1996; Winkelmann et al., 2002; Tison et al., 2005).
|
review
| 72.6 |
Most secondary RLS cases have an onset after 40 years old. Secondary RLS are those associated with a variety of neurological disorders, iron deficiency, pregnancy, or chronic renal failure (Winkelman et al., 1996; Curgunlu et al., 2012; Srivanitchapoom et al., 2014). A study in Turkey revealed that severity of RLS symptoms is very closely related to low ferritin level (Curgunlu et al., 2012). In the earliest studies of RLS, some revealed that 25% of RLS patients have iron deficiency condition. The other correlated factors were diabetic peripheral neuropathy (Zobeiri and Shokoohi, 2014), painful neuropathies (Rutkove et al., 1996), ADHD (Roy et al., 2015), migraine (Zanigni et al., 2014), AS (Tekatas and Pamuk, 2015), leprosy (Padhi and Pradhan, 2014), inflammatory chronic demyelinating neuropathies like multiple sclerosis (Deriu et al., 2009) and Guillain–Barré syndrome (Marin et al., 2010), thyroid disease (Rodriguez Martin et al., 2015), poliomyelitis (Kumru et al., 2014), chronic venous disorder (McDonagh et al., 2007), autoimmune disease including Sjögren’s syndrome (Theander et al., 2010), rheumatoid arthritis (Hening and Caivano, 2008), inflammatory bowel disease (Becker et al., 2015), and Crohn’s disease (Hoek et al., 2015). Epidemiology studies also showed that the prevalence of RLS significantly increased in post-stroke patients, mainly in patients whose stroke topography lied on pyramidal tract and the basal ganglia-brainstem axis which were primarily involved in motor functions (Sechi and Sechi, 2013). Some certain drugs can cause or worsen RLS symptoms, such as psycotropics like antidepressants and neuroleptics, dopaminergic drugs, and some other drugs (Giudice, 2010) such as cumulative dopaminergic agonists effects in Parkinson’s disease patients (McDonagh et al., 2007). A study revealed that the strongest evidence for drug-induced RLS are for the following: escitalopram, fluoxetine, L-dopa/carbidopa and pergolide, L-thyroxine, mianserin, mirtazapine, olanzapine, and tramadol (Hoque and Chesson, 2010).
|
review
| 99.9 |
According to the onset age of the symptoms, RLS is divided into early-onset RLS and late-onset RLS. Early-onset RLS refers to those who firstly have the symptoms before 45 years old. While late-onset RLS patients have the symptoms from or after 45 years old. A higher familial history rate was found in early-onset RLS comparing to late-onset RLS (Kotagal and Silber, 2004). Various clinical courses with periodic remissions are common in early-onset RLS. While a chronic progressive clinical course with more severe symptoms are seen in late-onset RLS. Pediatric RLS are always misdiagnosed as “growing pain”. Current researches demonstrate a relatively iron deficiency and renal failure to be exacerbating factors for pediatric RLS (Kotagal and Silber, 2004; Davis et al., 2005; Applebee et al., 2009; Sinha et al., 2009). Commonly pediatric RLS should be differentiated from ADHD while only RLS patients presents the need to move because of leg discomfort but not difficulty “sitting still” (Trenkwalder et al., 2005).
|
review
| 99.9 |
Very common conditions which should be differentiated with RLS include leg cramps, positional discomfort, local leg injury, arthritis, leg edema, venous stasis, peripheral neuropathy, radiculopathy, habitual foot tapping/leg rocking, anxiety, myalgia, and drug-induced akathisia (Allen et al., 2014). They can mimic RLS in different ways. Leg cramps are presented as knot of the muscle. Positional discomfort can be relieved by a positional shift. Arthritis patients have a limitation of the joints or joint erythema. Myalgias present as muscle soreness. Numbness happen to neuropathy patients as well as RLS patients, and both venous stasis and leg edema can manifest as swelling in the limbs (Davis et al., 2005; Applebee et al., 2009; Sinha et al., 2009; Karroum et al., 2012). Less common differential diagnostic conditions included myelopathy, myopathy, vascular or neurogenic claudication, hypotensive akathisia, orthostatic tremor, painful legs, and moving toes (Allen et al., 2014). Differential diagnosis is really important to RLS patients for their further treatment. Therefore clinical physicians have created additional diagnostic questionnaires and scales to improve the diagnosis of RLS in clinical practice (Popat et al., 2010). RLS-NIH questionnaire, developed in 2002 with three mandatory questions, showed sensitivity and specificity of 86 and 45% respectively (Popat et al., 2010). On the basis of this, an the RLS-EXP showed the sensitivity and specificity of 81 and 73% respectively (Popat et al., 2010). The CH-RLSq is more commonly used in clinical practice and by researchers.
|
review
| 99.9 |
Early in 1953, Nordlander (1953) first proposed that iron deficiency might be an important part of the pathophysiological process in RLS which was supported by consistent prevalence studies and recent pharmacological researches. Low serum iron levels (normal range: 50–170 μg/dL for men; 65–176 μg/dL for women; 50–120 μg/dL for children) presented in 25% of patients with severe RLS (Ekbom, 1960). While 43% of patients complaining of “leg restless” were found to be in the condition of iron deficiency (Matthews, 1976). The severity of the symptoms was found to be correlated with serum ferritin levels (normal range: 15–200 ng/mL for men; 12–150 ng/mL for women; 7–140 ng/mL for children) (O’Keeffe et al., 1994; Mizuno et al., 2005). Numbers of pharmacological studies of iron supplement for RLS gained therapeutic effects (Nordlander, 1953). CSF biological studies showed lower iron and ferritin levels in RLS patients, along with higher transferrin levels (Mizuno et al., 2005). However, a current study has suggested that in normal circumstances, the brain does not respond to peripheral variations in iron status (Ward et al., 2014). This might explain why some RLS patients had a normal or over-loaded serum iron level while their CSF iron level was decreased. Various medical imaging studies including ultrasound studies and MRI studies revealed a decreased iron levels in the substantia nigra and putamen, especially in the very severe patients (Schmidauer et al., 2005; Moon et al., 2014). Other studies demonstrated iron decrease in the red nucleus, thalamus and the pallidum (Haba-Rubio et al., 2005; Rizzo et al., 2013). However, MRI was not capable of locating the iron deficiency condition to particular cells up to now. Autopsy studies also reported a decrease in iron concentration in the substantia nigra (Moon et al., 2014).
|
review
| 99.9 |
15–25% of pregnant women have RLS in Western countries according to prevalence studies (Lee et al., 2001; Neau et al., 2010). A peak prevalence of RLS in pregnant women mainly occurred in the third trimester and gained a remission by 1 month after delivery (Ismailogullari et al., 2010). Surveys manifested that nulliparous women were at the same risk of RLS as same aged men, while the risk for women were increased after one pregnancy (OR 1.98) and two pregnancies (OR 3.04), even more after three or more pregnancies (OR 3.57) (Berger et al., 2004; Pantaleo et al., 2010). These findings may explain the gender difference in RLS prevalence. The reason why pregnant women have higher risk of having RLS remains unknown. One reason is that an increased demand of iron in pregnant women results in relative iron deficiency. The other established factors included hormonal status (prolactin, progesterone and estrogen), folate deficiency and stretch or compression of nerves due to fetal growth conflicting (Pantaleo et al., 2010; Pereira et al., 2013). Psychomotor behavioral change during the last weeks of pregnancy might also contribute to the symptoms. Anxiety, insomnia, and fatigue are always associated with pregnancy in the last trimester.
|
review
| 99.8 |
Studies have revealed approximate prevalence of 20–30% RLS in hemodialysis than the prevalence of 3.9–15% among the general populations (Ohayon et al., 2012). A study including 166 patients in Serbian showed 22.7% of patients on hemodialysis were under the condition of RLS (Nikic et al., 2007). Other studies indicated a prevalence of 14.8% among 176 patients on hemodialysis in Brazil (Goffredo Filho et al., 2003) and a prevalence of 37.4% in 163 patients on hemodialysis in Iran (Rohani et al., 2015). Some of the studies revealed a predominance of female patients with RLS rather than male patients on hemodialysis (Al-Jahdali et al., 2009; La Manna et al., 2011; Haider et al., 2014), while a recent study in Saudi displayed no statistically difference between two genders (Wali and Alkhouli, 2015). Most of the RLS patients among end-stage renal disease indicated moderate to severe symptoms compared to most mild RLS symptoms among general populations (Wali and Alkhouli, 2015). Iron deficiency in end-stage renal disease patients may lead to anemia and affect the dopamine metabolism, contributing to RLS (Nikic et al., 2007), and uremia-related peripheral neuropathy and high serum calcium can be part of the physiology of RLS (Nikic et al., 2007). However, in a recent report, iron deficiency, anemia, and calcium were not found to be statistically related to RLS in hemodialysis patients (Wali and Alkhouli, 2015). Previous studies showed conflicts about the association between BMI and RLS in end-stage renal disease patients. A study with a large cohort found that the prevalence of RLS in end-stage renal disease patients was positively related to their BMI (Gao et al., 2009). The OR for RLS was 1.42 (95% CI: 1.3–1.6; p < 0.0001) for patients with BMI from 23 to 30 kg/m2 and 1.60 (95% CI: 1.5–1.8; p < 0.0001) for patients with highest BMI compared with patients with lowest BMI (Gao et al., 2009). Decreased number of dopamine receptors in obese people’s brain was considered to be the possible reason (Wang et al., 2001). However, another previous study revealed no such relationships (Kim et al., 2008). A recent cross-sectional study between control group, renal transplantation group and hemodialysis group found that prevalence in renal transplantation is significantly lower than in hemodialysis patients (Kahvecioglu et al., 2016). RLS is very prevalent in end-stage renal disease patients, and hemodialysis patients with RLS were found to have a higher risk of muscle atrophy (Giannaki et al., 2011), cardio/cerebrovascular events and mortality (Lin C.H. et al., 2015). To prevent more morbidity in end-stage renal disease patients, their RLS should be diagnosed in early stage and receive standard treatment of RLS or have a renal transplantation as soon as possible.
|
review
| 99.9 |
It’s widely accepted that the local brain iron level plays an important role in RLS pathophysiology, however, the mechanism is still unclear. Recent studies demonstrated that the iron deficiency in brain was related to the function of blood-brain interface, as BBBs endothelial cells acted as an iron reservoir for the brain. A dysfunction of iron regulatory protein in the microvasculature incited dysregulation of iron transport across the BBB, resulting in a decrease of iron storage in endothelial cells (Lee et al., 2001). Biochemical studies on the effect of iron in brain indicated that several proteins containing iron were included in various processes like oxidative phosphorylation, oxygen transportation, myelin production and the synthesis and metabolism of neurotransmitters (Ward et al., 2014). Therefore, iron deficiency can lead to cellular damage by oxidation and modification of cellular compounds such as lipids, carbohydrates, protein, and DNA from hydroxyl radical production (Ward et al., 2014). The interactions between impaired neuronal iron uptake and the functions of the neuromelanin-containing and dopamine-producing cells play important roles in RLS pathophysiology (Michaud et al., 2004). Decreased extracellular dopamine, DAT, D1 and D2 receptors are found in iron deficiency, indicating that iron affect the brain dopaminergic transmission in different ways (Dauvilliers and Winkelmann, 2013).
|
review
| 99.3 |
A large number of pharmacological studies and clinical findings have provided evidence for the important role of dopaminergic system dysfunction in RLS (Winkelmann et al., 2001; Paulus and Trenkwalder, 2006; Galbiati et al., 2015). An improvement of RLS symptoms was found in patients receiving low-dose dopaminergic medications (Paulus and Trenkwalder, 2006; Galbiati et al., 2015) while a worsening of RLS symptoms in patients receiving dopamine antagonists (Winkelmann et al., 2001). The need for dopaminergic agonists to cross the BBB to be effective in RLS symptoms indicated that dopaminergic system in central nervous system was entailed in RLS pathophysiology rather than in peripheral nervous system (Garcia-Borreguero and Williams, 2014). Tyrosine hydroxylase is a rate-limiting step enzyme for the conversion of levodopa to dopamine. As iron is a cofactor of this enzyme, iron deficiency can alter the dopaminergic system in the brain (Dauvilliers and Winkelmann, 2013). Dopaminergic A11 cells, located in the midbrain and close to hypothalamus, have long axons and project diffusely throughout the spinal cord (Clemens and Hochman, 2004). They are the major source of dopamine in spinal cord. A11 cells arrive in the dorsal horn, then project to the motoneuronal site (Holstege et al., 1996). It’s found that stereotaxic bilateral 6-hydroxydopamine lesions into the A11 nucleus can result in an increased average number of standing episodes and total standing time comparing to the sham rats (Ondo et al., 2000), suggesting an important role of A11 dopaminergic cells in pathophysiological pathways in RLS. A significantly decreased N-acetylaspartate, creatinine ratio, and N-acetylaspartate concentrations were found in the medial thalamus of RLS patients in a recent study using proton magnetic resonance spectroscopy (Rizzo et al., 2012). Functional MRI and PET studies concluded an important role of medial thalamic nuclei in RLS pathophysiology. The medial thalamic nuclei are part of the limbic system, which is modulated by dopaminergic afferents. Another study found thalamic activity changes in the thalamocotrical circuit (Goulart et al., 2014). Therefore, it was hypothesized that the dopaminergic dysfunction might lead to an impairment of the medial pain system (Garcia-Borreguero and Williams, 2014; Goulart et al., 2014) and then caused the uncomfortable symptoms of RLS. Pharmacological studies also demonstrated that opioids had a protective effect in some RLS patients. An in vitro study in rats found that iron deficiency can cause cell death, mainly dopaminergic cells in substantia nigra and opioids could protect them from cell death under the condition of iron deprivation (Sun et al., 2011). The authors concluded from this result that an intact endogenous opioid system and opioid treatment could prevent the dopamine system from dysfunction in iron deficiency patients (Sun et al., 2011). A study of tsDCS in RLS patients showed supportive evidence of spinal cord hyperexcitability (Heide et al., 2014).
|
review
| 99.9 |
Studies demonstrate a strong relationship between genetic predisposition and early-onset RLS, of which more than 60% reveal a positive familial history. Moreover, inheritance was found to be related to late-onset RLS and secondary RLS (Winkelmann et al., 2000; Xiong et al., 2010; Yang et al., 2011). A study among 249 Canadian RLS patients found a family history existed in 77.1% of them while the rest 22.9% were sporadic (Yang et al., 2011). Variants in MEIS1, BTBD9 and MAP2K5/SKOR1 resulted in a much higher risk of RLS among a US population (Yang et al., 2011). So far, the GWASs have reported the following susceptible SNPs in association with RLS: MEIS1 (chromosome 2p14), BTBD9 (chromosome 6p21.2), PTPRD (chromosome 9p24.1-p23), MAP2K5/SCOR1 (chromosome 15q23) and chromosome 16q12.1 (Berger et al., 2002; Hogl et al., 2005; Stefansson et al., 2007; Schormair et al., 2008). Main function of these genes was related to embryonic neuronal development and limb development (Dauvilliers and Winkelmann, 2013; Garcia-Borreguero and Williams, 2014). In RLS autopsy cases, MEIS1 gene was found to be associated with an increase in H-ferritin, L-ferritin and divalent metal transporter-1 RNA expression in the thalamus (Catoire et al., 2011), suggesting MEIS1 gene mutants predisposed to lower iron condition. Another study used RNA interference techniques in a lymphoblastoid cell line in which the MEIS mRNA expression was blocked (Silver et al., 2010). Forty-eight hours later, an increase in transferring-2 receptor, ferroportin mRNA and BTBD9, and a decrease in hepcidin mRNA expression were observed (Silver et al., 2010), indicating that MEIS1 controlled cellular iron transfer to mitochondria, cellular export of iron and potentially affected BTBD9 expression and its downstream iron modulation. The effect of MEIS1 on iron homeostasis was also shown in Caenorhabditis elegans (Catoire et al., 2011). A study using dBTBD9 mutant flies showed significantly decreased brain dopamine and abnormal sleep phenotype which was completely retrieved by administering with pramipexole, a dopamine D2 receptor agonist (Freeman et al., 2012). Furthermore, RLS symptoms can be reconstructed by knocking-down dBTBD9 expression. While over expression of BTBD9 in HEK cells showed that the gene controlled iron homeostasis through the regulation of IRP2 (Freeman et al., 2012). The authors suggested that the BTBD9 protein belonged to a protein family which contained substrate adaptors for the Cul3 class (Freeman et al., 2012). Cul3 class of E3 ubiquitin ligases was shown to regulate sleep in flies (Stavropoulos and Young, 2011). A susceptible view point was that BTBD9 played a role in dopamine biosynthesis by unclear mechanisms (Shaw and Duntley, 2012). These SNPs had strong association with PLM in RLS patients (Moore et al., 2014). The exact pathophysiological pathways of these genes still remain unclear. An SNP study in the Spanish Caucasian population suggested a modest but significant association between vitamin D receptor rs731236 SNP and the risk for RLS. RLS patients carrying the allelic variant rs731236G had an earlier onset age while those carrying the allelic variant rs731236GG had more severe symptoms (Jimenez-Jimenez et al., 2015). A weak association between heme oxygenase genetic variants HMOX1 rs2071746 polymorphism and the risk of developing RLS was found in the Spanish population (Garcia-Martin et al., 2015). Linkage analyses in families identified several genetic loci for RLS: RLS1 (chromosome 12q12–q21), RLS2 (14q13–q21), RLS3 (9p24–p22), RLS4 (2q33), RLS5 (20p13), RLS6 (19p13), and RLS7 (16p12.1) (Desautels et al., 2001, 2005; Bonati et al., 2003; Kemlink et al., 2007). The authors suggested the inheritance mode of RLS could be a recessive mode or a dominant mode with variable of inheritance. The main SNP findings are summarized as below (Table 3).
|
review
| 99.8 |
Previous theories about dopaminergic effect on RLS pathophysiology mainly focused on substantia nigra and dopaminergic A11 cell group (Ondo et al., 2000; Trenkwalder and Paulus, 2010), nevertheless, changes in dopaminergic neurons in basal ganglia in RLS patients were also found in autopsy studies. This result might be related to iron deficiency in brain (Connor et al., 2003). Dopaminergic projections to the spinal cord originate exclusively from A11 cell group (Noga et al., 2004). Dopamine acted as an excitatory and inhibitory neurotransmitter in spinal cord to regulate sensory, motor as well as autonomic functions (Dauvilliers and Winkelmann, 2013). Recent studies reported frequent PLMS in patients with spinal cord injury, indicating the center role of spinal cord in RLS pathophysiology process (Dauvilliers and Winkelmann, 2013). It might also result from the decreasing supraspinal inhibition to the spinal cord. Functional MRI studies showed changes of thalamic and cerebral activation in RLS (Bucher et al., 1997). However, postmortem studies in RLS patients showed no evidence of changes in the volume of tyrosine kinase (+) neurons or gliosis changes in A11 region in the posterior hypothalamus (Earley et al., 2009). This might result from the fact that only six cases are included in this study or the hypothesis that the manifestations of RLS may be secondary to dopamine metabolism or changes in the distal A11 synapses which is not as easily detected as structural or quantity changes in the cell bodies (Earley et al., 2009). Another recent study indicated that domperidone, a dopamine antagonist that cannot cross the BBB increased the frequency of RLS in patients with Parkinson’s Disease, proposing that peripheral dopaminergic neurons might play an important role in RLS (Rios Romenets et al., 2013). It’s widely believed that iron deficiency in brain causes the decrease in dopaminergic function which then motivates spinal hyperexcitability, leading to the spontaneous sensory and motor movements of RLS (Garcia-Borreguero and Williams, 2014).
|
review
| 99.8 |
Treatment before RLS, three aspects should be considered: lifestyle change, medication effect and iron deficiency (defined as ferritin < 75 ng/mL or iron/TIBC ratio < 20%) (Mackie and Winkelman, 2015). Lifestyle like sleep deprivation, alcohol or tobacco use, decreased motility, or in medication (dopamine antagonists, antihistamines or serotonergic antidepressants, opioid discontinuation or blood loss) can result in earlier onset or increase severity in RLS symptoms. A detailed inquiry for the patient should be carried out. Treatment of RLS mainly include pharmacological and non-pharmacological treatment.
|
other
| 99.8 |
Dopaminergic agents are considered to be the first-line treatment for RLS, including pramipexole and ropinirole (Garcia-Borreguero et al., 2013; Silber et al., 2013). Pergolide and cabergoline are not recommended due to their association with increased risk of valvular heart disease (Zanettini et al., 2007). Ropinirole has a faster onset with shorter duration, while rotigotine is commonly used as a transdermal patch which continuously provides stable plasma drug concentrations, resulting in its particular therapeutic effect on patients with symptoms throughout the day (Mackie and Winkelman, 2015). α2δ agonists have become increasingly important in treating RLS, for being considered as possible first-line agents for RLS. A recent double-blind study over 12-week period compared the efficacy of pregabalin, pramipexole and placebo, demonstrating a better efficacy of pregabalin rather than dopamine agonist or placebo (Hubner et al., 2013). Moreover, the difference of the efficacy varied with drug doses (Hubner et al., 2013). Opioids have been found to be effective in treating RLS, but the potential drug abuse and side effects including respiratory depression and constipation limit its use in RLS, as they are not commonly advised as initial treatment of choice. A recent study on treating first-line agents refractory RLS with extended-release oxycodone–naloxone combination showed very impressive and persistent effect of this combination on RLS symptoms (Trenkwalder et al., 2013). Other pharmacological treatments include iron supplement, some other anticonvulsants and benzodiazepines. The choice of two major first-line agents should be considered with their side effects. Dopamine agonists can cause somnolence and ICDs like compulsive gambling or over-eating, while common side effects of α2δ agonists are weight gain, dizziness and gait instability. As a result, for initial treatment of RLS patients, dopaminergic agents are used as first-line agents in patients with very severe symptoms, over-weighted, comorbid depression, risk of falls, or cognitive impairment (Garcia-Borreguero et al., 2013), while α2δ agonists are advised as first-line agents in patients with severe sleep disturbance, comorbid anxiety, RLS-related pain, or previous history of ICDs (Garcia-Borreguero et al., 2013). Evidence-based guidelines on treating RLS were published by EFNS and IRLSSG in 2012 and 2013 respectively. Many other pharmacological treatment reviews and research papers of RLS have been published recently (Garcia-Borreguero and Williams, 2014; Hornyak et al., 2014). A conclusion of several medications is shown above (Table 4).
|
review
| 99.9 |
Other drugs such as dopaminergic agents (piribedil), anticonvulsants (gabapentin), opioids (tramadol, methodone), iron, hypnotic and sedative agents, folate, vitamin B12, magnesium, vitamin E, botulinum toxin, physiotherapy, phototherapy, and aerobic exercises are not recommended in clinical practice due to insufficient evidence. However, they can be used as auxiliary drugs concerning to the symptoms and comorbidities of the patient.
|
other
| 99.9 |
As depression is a very common comorbidity in RLS and many antidepressants such as selective serotonin reuptake inhibitors (SSRIs) and tricyclic antidepressants (TCAs) can worsen the symptoms of RLS, treatment of depression in RLS patients should be cautious. Since bupropion, a newer antidepressant, doesn’t show any evidence of exacerbation of RLS symptoms, it is used as an effective antidepressant in these patients (Mackie and Winkelman, 2015).
|
review
| 99.75 |
Restless legs syndrome is very common in women during pregnancy and lactation, with a prevalence of 15–25% (Hubner et al., 2013). Guidelines on treating RLS during pregnancy and lactation have been published by IRLSSG in 2014 (Picchietti et al., 2015) (Table 5). Once RLS is diagnosed in pregnancy, non-medicine treatment should be considered firstly. Patients should be educated about the natural course of RLS during pregnancy, in which RLS commonly remits or disappears after delivery. Moderate exercise and avoidance of aggravated factors such as iron deficiency, long-term immobility, serotonergic antidepressants should be suggested. Iron level should be measured to decide whether to treat the patient with iron. Iron therapy (oral or intravenous) should be given when serum ferritin < 75 ug/L. When serum ferritin > 75 ug/L with refractory RLS, drug treatment should be considered.
|
review
| 99.9 |
Loss of efficacy and augmentation are two main treatment failures after a long course of treatment of RLS. The probable reasons of them might be the natural worsening of RLS symptoms over time or compensatory response of CNS to chronic drug treatment (Mackie and Winkelman, 2015). Iron deficiency should be treated with iron supplement. Both of the intravenous and oral iron formulations are proved to be effective in some RLS patients (Trotti et al., 2012; Hornyak et al., 2014). Further study about effect of iron therapy in all RLS patients or only a certain type of RLS remains to be investigated.
|
review
| 99.9 |
Augmentation refers to a worsening of the symptoms that occurs very commonly among RLS patients after long-term treatment with some certain medications. An overall augmentation rate of 5.6% was reported (Liu et al., 2016). All the current dopaminergic drugs and another non-dopaminergic drug tramadol have been reported to show some degree of augmentation (Trenkwalder et al., 2007; Vetrugno et al., 2007; Hogl et al., 2010; Oertel et al., 2011), which are thought to be related to dose and duration of medication and individual factors such as iron deficiency (Garcia-Borreguero et al., 2013). The highest incidence rate of augmentation occurred with levodopa was up to 60–80% in RLS patients (Hogl et al., 2010). In addition, incidence rate was reported to be higher in patients treating with shorter-acting dopaminergic agents (pramipexole, ropinirole) than longer-acting dopaminergic agents (rotigotine, cabergoling). A possible explanation is the masking of earlier symptom onset by longer-acting dopaminergic agents (Garcia-Borreguero and Williams, 2014). To prevent augmentation, it is important to initiate the treatment with α2δ agonists for milder RLS patients (Silber et al., 2013), and a lowest effective dose of dopaminergic agents should be established to decrease the incidence and delay the occurrence of augmentation (Silber et al., 2013). Management of augmentation is not to increase the dose of dopaminergic agents, but to add a non-dopaminergic agent as a combination strategy (Silber et al., 2013). Moreover, loss of efficacy is the reduction of drug efficacy over time. In these cases, RLS symptoms are not worse than before initiating the treatment (Garcia-Borreguero and Williams, 2014), a combination therapy is recommended in loss of efficacy to decrease the side effects of certain medications, as well as to prevent augmentation.
|
review
| 99.9 |
Sleep hygiene should be corrected before all the pharmacological treatment. Sleep deprivation, sleep disturbances and factors that can result in insomnia should all be avoided. Another common but easily neglected disorder is OSAS. Early treatment for OSAS is beneficial for improving sleep for RLS patients. Other non-pharmacological treatments have been proven to be effective in RLS. tsDCS showed a short-lasting clinical improvement in idiopathic RLS patients (Heide et al., 2014), while high-frequency rTMS resulted in an significant improvement in the motor symptoms and sleep disturbances in RLS patients (Lin Y.C. et al., 2015). But these non-pharmacological treatment for RLS studies are scarce. They show some advantages in symptomatic RLS patients who do not respond to or do not tolerate the classic pharmacological treatments. It may bring brand new solutions to these patients. On the other hand, these methods are non-invasive and safe, no significant side effects have been observed yet. Developing these new methods can be a great benefit for RLS patients.
|
review
| 99.9 |
There have been a lot of advances in the fields of RLS in recent years, as the diagnostic criteria have been revised in 2012. A deeper insight in pathophysiology of RLS has put iron metabolism dysfunction in an important position, as well as dopaminergic system dysfunction, has been demonstrated. Guidelines of long-term treatment of RLS are published by IRLSSG in 2013 to help with the treatment of RLS for clinicians. Prevention and management of augmentation for long-term treatment has been improved through clinical experience and researches. More researches should be done to discover the pathophysiology, and to find better treatment and management of augmentation of RLS.
|
review
| 99.9 |
SG: drafting the manuscript and the tables; HJ, CH, JL, XX, GZ: giving advice on conception and design; JH, NX: revising the manuscript; ZL: giving advice on conception and design; TW: conception and design. Giving final approval of the version to be published.
|
other
| 99.94 |
Macrophages are important, multifunctional cells in the innate immune system. Their ability adopt a spectrum of phenotypes that perform greatly different functions in response to diverse activators has become increasingly recognized (1). IFN-γ is an important pro-inflammatory cytokine in responses to certain pathogens, promoting toll-like receptor expression and inducing greater production of nitric oxide, pro-inflammatory cytokines, such as TNFα (2, 3) and extracellular proteases, including some metalloproteinases (4), which together promote invasion of macrophages to sites of inflammation and enhance microbial killing. IFN-γ is also an established link between the innate and acquired immune systems, especially in the context of autoimmunity, where it not only promotes activation of Thelper1 lymphocytes but also increases major histocompatibility complex (MHCII) expression leading to enhanced antigen presentation by macrophages (3). Macrophages activated by IFN-γ are believed to provoke tissue injury, for example joint destruction during rheumatoid arthritis and atherosclerotic plaque rupture leading to myocardial infarctions (5). On the other hand, IL-4 or IL-13 provoke a macrophage phenotype that has greater scavenger receptor activity and increased release of anti-inflammatory and fibrogenic factors (6, 7), suggesting a primary role in clearance of cell debris and promotion of tissue repair. Although apparently more benign, these macrophages may help tumor cells evade immune surveillance and can provoke allergy or lung hypersensitivity (6, 7). Greater understanding of the mechanisms that underlie generation of these diverse macrophage phenotypes is, therefore, warranted in order to design strategies to avoid these unwanted complications.
|
review
| 99.9 |
Responses to IFN-γ are mediated through signal transducer and activator of transcription-1 and several so-called interferon response factors (IRFs) (8–10), especially IRF-7 and IRF-9 (1), whereas IL-4 and IL-13 activate STAT-6 (11) and IRF-4 (1). Consequently, IFN-γ and IL-4 provoke widely different transcriptional responses, effectively defining their divergent phenotypes (12). Moreover, the ability of IFN-γ to downregulate many IL-4-induced genes [for example cluster E vs F of reference (12) and module 15 of reference (1)] amplifies these phenotypic differences. Participation of epigenetic mechanisms in macrophage polarization has also been demonstrated (13). In particular, the ability of IFN-γ or IL-4 to alter the local histone code, which determines whether the relevant transcription factors have access to promoter sequences, has been implicated in their ability to drive cells toward different phenotypes (14–17). However, knowledge regarding the role of specific histone-modifying enzymes is presently fragmentary and sometimes conflicting (13). We, therefore, took an unbiased approach by using an RT-qPCR array of 84 epigenetic regulators to investigate the impact of IFN-γ and IL-4, singly and in combination (to look for antagonistic effects) on human primary macrophages. We identified 11 genes up- or downregulated by the cytokines but some of these were affected, at least in part, secondary to inhibition of cell proliferation. Lysine demethylase 6B (KDM6B) was the only putative activator of transcription that was upregulated by both IFN-γ and IL-4, thereby implying a functional role in promoting gene expression by both cytokines. To investigate this hypothesis directly, the functional consequences of inhibiting and silencing KDM6B were investigated further.
|
study
| 100.0 |
Monocytes were isolated from the EDTA anticoagulated blood of healthy volunteers. Written informed consent was given under National Research Ethics Service approval from Frenchay Research Ethics Committee reference 09/H0107/22 and South West 4 Research Ethics Committee reference 10/HO102/72, respectively. Mononuclear cells were isolated using Ficoll-Paque Plus (GE Healthcare Life Sciences), red blood cells were lysed with 150 mM ammonium chloride/0.1% BSA, and monocytes were allowed to adhere to plastic in RPMI 1640/1% human serum AB (SigmaAldrich) for 1 h. Non-adherent cells were removed with warm Dulbecco’s phosphate buffered saline (D-PBS; Gibco), and the medium was replaced with RPMI 1640/10% fetal bovine serum (FBS; SigmaAldrich) for 1 h. Based on staining with Rabbit anti-(human CD14) antibody, Ab78313, adhered cells were at least 85% monocytes. Monocytes were differentiated into macrophages in RPMI 1640 medium containing 10% FBS and 20 ng/mL of colony-stimulating factor-1 (human recombinant CSF-1, R & D systems), which was replenished on day 3. Approximately 80% of the resulting cells were macrophages based on positive staining with mouse monoclonal anti-CD68 (M0876, Dako). Differentiated macrophages were treated for 6, 18, 32 and 48 h in the same medium with either 100 ng/mL of recombinant human interferon-γ (IFN-γ) (R & D systems) or 10 ng/mL of recombinant human interleukin-4 (IL-4) (R & D systems). AZD1152 was purchased from Selleck.
|
study
| 99.94 |
Total RNA was isolated from the macrophages prepared from three different healthy donors using the PureLink™ RNA Mini Kit (Ambion). Total RNA was quantified using an ND1000 NaNo Drop spectrophotometer, and 100 ng were reversed transcribed using the QuantiTect Reverse Transcription Kit (Qiagen) with additional genomic DNA elimination step indicated in the manufacturer’s instructions. For quantitative polymerase chain reaction (qPCR), the cDNA samples were diluted 1:3 in 10 mM Tris–HCl, pH 8.0 and amplified using the LightCycler 480 SYBR Green I Master mix (Roche) in an Eco Real-Time PCR System (Illumina), using primer sets shown in Table 1. Data were normalized to total RNA in each reaction. For qPCR array, RNA from three different donors was analyzed using the Human Epigenetic Chromatin Modification Enzymes RT2 Profiler PCR Array (Qiagen) according to the manufacturer’s protocol. Briefly, total RNA (400 ng, genomic DNA eliminated) was reverse transcribed using RT2 First Strand Kit (Qiagen) and diluted in RNase-free water. The amplification reaction was conducted in 384 well format in a Roche LightCycler 480 (95°C 10 min for one cycle followed by 95°C 15 s and 60°C 1 min for 45 cycles). Threshold cycle (CT) values were exported and analyzed using web based SABiosciences PCR Array Data Analysis Software.1 A panel of five housekeeping genes integral to the array were used to calculate for each probe ΔCT = (CT probe − CT average of housekeeping genes). The values of ΔΔCT = ΔCT experimental sample − ΔCT control were calculated for each probe and converted to fold changes = (2(−ΔΔCT)). For transcriptomic analysis, purified RNA samples from four different donors were submitted to the Illumina Gene Expression ServiceXS (Leiden, Netherlands) and were processed for analysis on the Illumina HumanHT-12 v4 microarray as described in detail.2 The results were deposited under number GSE83957. Fold changes and statistics (multiple testing corrections) of generated raw data were performed using GeneSpring (Agilent Technologies). Venn Diagrams were generated by using web-based software.3 Gene ontology enrichment (GOE) and KEGG pathway analysis were performed using the DAVID public database.4
|
study
| 100.0 |
Macrophages were lysed in SDS lysis buffer [2% SDS (w/v)/16% glycerol (v/v) in 50 mM Tris, pH 6.8]. Protein was measured (Micro BCA kit, Thermo Scientific Pierce). Equal amounts of reduced protein were fractionated by SDS-polyacrylamide gel electrophoresis, transferred to PVDF membranes (Merck Millipore), blocked in TBST/5% skimmed milk followed by incubation in primary antibody. Proteins were detected using appropriate HRP-conjugated secondary antibodies (SigmaAldrich) and enhanced chemiluminescence (Immobilon, Merck Millipore) and Hyperfilm™ ECL (GE Healthcare Life Sciences). The antibodies used were Phospho-Rb-Ser807/811, E2F1, KDM6A, and SMYD3 (Cell Signaling), Histone H3 and Histone H3-Phospho S10 (Abcam), GAPDH (Millipore), and p27kip1 (BD Biosciences).
|
study
| 99.94 |
To measure S-phase entry to the cell cycle, macrophages were labeled with 10 µM BrdU (SigmaAldrich) for 24 h. Cell proliferation was quantitated by immunohistochemistry as previously described (18). The percentage of BrdU positive nuclei was counted using NIH ImageJ software.
|
study
| 99.94 |
Recombinant adenovirus encoding for human p27kip1 was a kind gift from Professor Betsy Nabel (NIH, MD, USA). This virus and a control adenovirus expressing destabilized, enhanced green fluorescent protein (dsEGFP) were used as described previously (19). To generate the adenovirus expressing E2F1, the plasmid E2F1 wt-pGex2TK containing the coding sequence for human E2F1 from William Kaelin (20), was purchased from Addgene (Addgene plasmid # 21668). It was amplified using KOD DNA polymerase (Merck-Millipore, UK) to include EcoRI and BamH1 flanking sites and subcloned into the shuttle vector pDC515io from Microbix (ON, Canada). Recombination (Flp/FRT mediated) was performed in 293IQ cells to inhibit transgene protein expression (a gift from Dr. D. Matthews, University of Bristol) (21). For gene silencing, short hair pin (Sh) sequences were predicted using http://cancan.cshl.edu/RNAi_central/RNAi.cgi?type=shRNA. The sequences used to silence KDM6A, 5′CTGCCATTAAATGCTACTTAAATAGTGAAGCCACAGATGTATTTAAGTAGCATTTAATGGCAT3′, KDM6B, 5′CGCCCAGTCTGTGAAACCGAAGTAGTGAAGCCACAGATGTACTTCGGTTTCACAGACTGGGCA3′ and firefly luciferase, 5′CGCCTGAAGTCTCTGATTAATAGTGAAGCCACAGATGTATTAATCAGAGACTTCAGGCGGT3′, as a control, were embedded in the backbone of the primary microRNA-30, as described previously (22) and were synthesized by Eurofins. DNA sequences for modified microRNA-30 were synthesized by Eurofins, cloned into the Nhe1-BamH1 sites of the shuttle vector pDC515 and adenoviruses were generated as described above. Virus stocks were purified by CsCl banding and titrated by plaque assay. Monocytes differentiated for 4 days were infected with Ad-p27kip1 or Rad66 at 108 plaque forming units (pfu)/ml for 24 h. Alternatively, cells were infected with Ad-E2F1 or Ad-dsEGFP at 5 × 107 pfu/mL for 20 h followed by further 18 h treatment in the presence of IFN-γ or IL-4. For gene silencing, cells were infected with shKDM6A, shKDM6B, or shLuciferase (shLUC) viruses at 2 × 108 pfu/ml for 72 h before stimulation with IFN-γ or IL-4 for 6 h.
|
study
| 100.0 |
Normality of data sets was analyzed by the method of Kolmogorov and Smironov. Differences between means of normally distributed variables with similar variances were analyzed using a paired Student’s t-test or, for multiple comparisons, ANOVA followed by a Dunnett or Student–Newman–Keuls post-test, as appropriate. For the array, data from the Benjamini–Hochberg method were used for multiple testing correction. All data are from independent experiments on cells from different donors and are presented as mean ± SE. *indicates p < 0.05, **indicates p < 0.01, ***indicates p < 0.001.
|
study
| 99.94 |
To identify optimal time points for transcriptomic analysis, we measured changes in the mRNA expression of phenotypic markers SOCS3 (23) and CD206 (12). As expected, IFN-γ but not IL-4 induced SOCS3 mRNA expression (Figure 1A), which was significant by 6 h and remained maximal at 18 and 32 h: it then declined but was still significantly elevated above untreated controls at 48 h (Figure 1A). Also as expected, IL-4 stimulated but IFN-γ inhibited CD206 mRNA expression after 48 h (Figure 1B). Interestingly, however, IFN-γ and IL-4 both induced CD206 to a similar extent at 6 h but the effect of IL-4 increased further from 18-48 h, whereas that of IFN-γ waned such that CD206 expression had declined below control levels after 32 and 48 h (Figure 1B). We, therefore, chose the 18 h and 48 h samples from these experiments to capture the differential effects of IFN-γ and IL-4 on steady-state mRNA levels of 84 epigenetic regulators using a commercially available RT-qPCR array. The combination of IFN-γ and IL-4 was also investigated because antagonistic interactions might enhance phenotypic differences (see Introduction). The results were normalized against a panel of five housekeeping genes integral to the profiler and significant changes were identified by using the array manufacturer’s software, which yielded values of mean fold change and p values after false discovery rate correction (Table 2). Eight significant differences and three non-significant trends that were subsequently found significant by conventional RT-qPCR are highlighted in bold. There were more significant responses to IFN-γ (10 gene changes at 18 h, of which 7 persisted at 48 h) than IL-4 (7 gene changes, only 2 of which were significant at both 18 h and 48 h). Contrary to our expectation of antagonistic responses, IFN-γ and IL-4 appeared to produce additive effects on the expression of epigenetic regulators (Table 2). The significant changes from the RT-qPCR screen were validated and extended by a detailed time course study using the full set of samples (Figures 2A–C and 3A–H). All the significant changes observed in the array were confirmed; and also the trends toward increase of KDM6B by IL-4 and decrease of KAT2A and SETD6 by IFN-γ were shown to be significant by standard RT-qPCR normalized against total RNA, which meets current recommendations (24). Only three genes, namely CIITA, KDM6B, and NCOA1 showed increased expression (Figures 2A–C), whereas the other 8, namely AURKB, ESCO2, KAT2A, PRMT7, SETD6, SMYD3, SUV39H1, and WHSC1 showed decreased expression (Figures 3A–H). The IFN-γ-induced increases in CIITA, KDM6B, and NCOA1 showed a similar pattern to SOCS3, with significant induction by 6 h and a tendency to decline thereafter (Figures 1A and 2A–C). The IL-4-induced increase in KDM6B was also significant by 6 h of treatment but then declined, unlike CD206, which remained elevated (Figures 1B and 2B). The decreased expression of AURKB, ESCO2, KAT2A, PRMT7, SETD6, SMYD3, SUV39H1, and WHSC1 was delayed to 18 h and beyond (Figures 3A–H). In the few cases, where it was possible, we sought to confirm the mRNA data by protein or activity measurements. In the case of SMYD3, IFN-γ significantly reduced protein levels after 48 h (Figure 4A). Either IFN-γ or IL-4 inhibited AURKB activity measured by the phosphorylation of histone3 on serine-10 (H3pS-10) (Figure 4B) (25). Consistent with this, we demonstrated that AZD1152, a pharmacological inhibitor of AURKB (26) also inhibited H3pS-10 to the same extent as either IFN-γ or IL-4 (Figure 4C).
|
study
| 100.0 |
Time course analysis of SOC3 and CD206 mRNA in response to interferon-γ or interleukin-4 (IL-4). Time course analyses of mRNA levels (RT-qPCR) of SOC3 and CD206 mRNA in response to by IFN-γ or IL-4 treatment of 4-day differentiated human monocyte-derived macrophages. (A) SOC3 and (B) CD206. Results are expressed as mRNA relative to time 0 untreated control. IFN-γ (solid line) and IL-4 (dashed line). Data are the mean ± SEM, n = 3 blood donors. p Values were calculated using ANOVA with Dunnett post-test. *indicates p < 0.05, **indicates p < 0.01 compared with control.
|
study
| 100.0 |
Four-day differentiated human monocyte-derived macrophages were treated with 100 ng/mL IFN-γ or 10 ng/mL IL-4 singly or in combination for 18 h or 48 h. Extracted RNA samples were subjected to analysis by the Human Epigenetic Chromatin Modification Enzymes RT2 Profiler PCR Array (QIAGEN). p Values were calculated based on full plate normalization with twofold change as a cut off value (hence the blank values) and using a Student’s t-test of the replicate 2(-Delta Ct) values for each gene in the control group and treatment groups.
|
study
| 100.0 |
AURKB, aurora kinase B; CIITA, class II major histocompatibility complex transactivator; ESCO2, Establishment of Sister Chromatid Cohesion N-Acetyltransferase 2; KAT2A, lysine acetyltransferase 2A, PCAF-B; NCOA1, nuclear receptor coactivator 1, Steroid Receptor Coactivator-1 (SRC-1); KDM6B, Lysine Demethylase 6B, JMJD3; PRMT7, Protein Arginine Methyltransferase 7; SETD6, SET Domain Containing 6; SMYD3, SET And MYND Domain Containing 3; SUV39H1, Suppressor Of Variegation 3-9 Homolog 1; WHSC1, Wolf-Hirschhorn Syndrome Candidate 1.
|
other
| 99.94 |
Validation of upregulated genes. Time course analyses of mRNA levels (RT-qPCR) of genes upregulated by IFN-γ or interleukin-4 (IL-4) treatment of 4-day differentiated human monocyte-derived macrophages. (A) CIITA, (B) KDM6B, and (C) NCOA1. Results are expressed as mRNA relative to time 0 untreated control. IFN-γ (solid line) and IL-4 (dashed line). Data are the mean ± SEM, n = 3 blood donors. p Values were calculated using ANOVA with Dunnett post-test. *indicates p < 0.05, **indicates p < 0.01 compared with control.
|
study
| 100.0 |
Validation of downregulated genes. Time course analyses of mRNA levels (RT-qPCR) of genes downregulated by IFN-γ and/or interleukin-4 (IL-4) treatment of 4-day differentiated human monocyte-derived macrophages. (A) AURKB, (B) ESCO2, (C) KAT2A, (D) PRMT7, (E) SETD6, (F) SMYD3, (G) SUV39H1, and (H) WHSC1. Results are expressed as mRNA relative to time 0 untreated control. IFN-γ (solid line) and IL-4 (dashed line). Data are the mean ± SEM, n = 3 blood donors. p Values were calculated using ANOVA with Dunnett post-test. *indicates p < 0.05, **indicates p < 0.01 compared with control.
|
study
| 100.0 |
Effect of IFN-γ, interleukin-4 (IL-4) or AZD1152 on SMYD3 protein and AURKB activity. Four-day differentiated human blood monocyte-derived macrophages were treated with IFN-γ or IL-4 for 24 h or as indicated. Extracts were prepared for Western blotting of (A) SMYD3, (B) Histone H3-S10 phosphorylation (H3pS-10), and phosphorylated retinoblastoma protein and the densitometry results were expressed relative to untreated control. (C) H3pS-10 after treatment with 100 nM AZD1152, a pharmacological inhibitor of AURKB, or vehicle (DMSO) for 8 h. (D) 10 µM BrdU was added for a further 24 h and the percentage of nuclear BrdU positive cells was determined by immunocytochemistry and counting. Data are the mean ± SEM, n = 3 blood donors. p Values were calculated using a paired or a single value t-test as appropriate. *indicates p < 0.05, **indicates p < 0.01, ***indicates p < 0.001 compared with 24 h control.
|
study
| 100.0 |
Interestingly, phosphorylation of H3pS-10 by AURKB is necessary for chromatin reorganization during mitosis (27–29), ESCO2 promotes sister chromatid cohesion (30), SUV39H1 also has a role in chromosome segregation (31, 32) and WHSC1 has been ascribed a role in DNA repair during replication (33). Hence all these enzymes have established roles in cell division. Consistent with other previous literature (34, 35), we found that IFN-γ or IL-4 inhibited phosphorylation of retinoblastoma protein (Rb, Figure 4B), confirming that they arrested cells at the G1/S checkpoint in the cell cycle (36). Treatment with either IFN-γ or IL-4 also profoundly decreased BrdU incorporation as a marker of DNA replication in our macrophages (Figure 4D). These observations led us to question whether decreased expression of histone-modifying genes by IFN-γ or IL-4 might be the incidental consequence of inhibiting proliferation.
|
study
| 100.0 |
To investigate the relationship between proliferation and mRNA levels of epigenetic regulators further, we cultured macrophages differentiated for 6 days for four more days either with or without growth factors, which arrests cells in the early G1 phase of the cell cycle. Consistent with this, prolonged culture decreased phosphorylated retinoblastoma protein (pRb) and H3pS-10 levels and these effects were even greater without growth factors (Figure 5A). Furthermore, BrdU incorporation after 10 days of differentiation declined by a further 76% (n = 4, p = 0.002) when growth factors were omitted. Similarly, expression of AURKB and ESCO2 mRNA each declined significantly between 6 and 10 days of culture and the decrease was greater after growth factor depletion (Figures 5B,C), suggesting that their expression was at least partly dependent on proliferation. Growth factor depletion did not affect IFN-γ or IL-4 upregulated genes, CIITA, KDM6B, or NCOA1, or the downregulated genes KAT2A, PRMT7, SETD6, or SMYD3 (Figure 5D). SUV39H1 and WHSC1 expression showed non-significant trends toward reduction (Figure 5D).
|
study
| 100.0 |
Effect of growth factor depletion on the proliferation of macrophages, AURKB activity and mRNA levels of AURKB, ESCO2, SUV39H1, and WHSC1. Human blood monocytes were differentiated in 10% FBS and CSF-1 for 6 days. On day 6, cells were either extracted for Western blotting and mRNA isolation or kept in culture until day 10 in either serum-free RPMI 1640 or serum and CSF-1 supplemented media before extraction. (A) Levels of phosphorylated retinoblastoma protein and AURKB activity (H3pS-10) were measured by Western blotting. Levels of mRNA relative to day 6 differentiated macrophages were determined by RT-qPCR for (B) AURKB, (C) ESCO2, (D) other genes as indicated. Data are the mean ± SEM, n = 3 blood donors. p Values were calculated using an ANOVA with Student–Newman–Keuls post-test. *indicates p < 0.05, **indicates p < 0.01, ***indicates p < 0.001.
|
study
| 100.0 |
IFN-γ or IL-4 arrest cell proliferation at the G1/S checkpoint thanks to elevation of the cyclin-dependent kinase inhibitor p21Cip1 (34, 35). We sought to inhibit proliferation at the G1/S checkpoint by an alternative mechanism. Given that gene silencing is inefficient in macrophages, we overexpressed the cyclin-dependent kinase inhibitor p27kip1 (37) from an adenovirus. Infection with the p27kip1 expressing virus increased p27kip1 protein, as expected (Figure 6A), and dramatically decreased BrdU incorporation (Figure 6B), pRb (Figure 6C) and H3pS-10 (Figure 6D). Hyperphosphorylation of Rb releases the S-phase transcription factor, E2F, which induced multiple genes that include Cyclin E and proliferating cell nuclear antigen (PCNA) (38). As expected, therefore, overexpression of p27kip1 profoundly decreased mRNA levels of cyclin E (84 ± 2%) and PCNA (86 ± 6%, both n = 3, p < 0.01), confirming G1/S blockade. Overexpression of p27kip1 decreased mRNA levels of AURKB, ESCO2, SUV39H1, and WHSC1 (Figure 6E), to a similar extent as IFN-γ or IL-4. By contrast, levels of the other genes downregulated by IFN-γ, namely KAT2A, PRMT7, SETD6, and SMYD3 were not significantly reduced by p27kip1 overexpression (Figure 6E) and were, therefore, clearly independent of inhibition of proliferation by either growth factor depletion or p27kip1 overexpression. Steady-state mRNA levels of the genes upregulated by IFN-γ or IL-4, namely CIITA, KDM6B, and NCOA1, were not decreased or even increased by overexpression of p27kip1 (Figure 6E).
|
study
| 100.0 |
Effect of overexpression of the cyclin-dependent kinase inhibitor p27Kip1. Human blood monocytes differentiated for 4 days were infected with a recombinant adenovirus overexpressing p27kip1 (Ad:p27) or control, destabilized, enhanced green fluorescent protein at 1 × 108 plaque forming units/ml for 24 h. (A) p27kip1 protein overexpression by Western blotting. (B) BrdU was added 24 h after adenovirus infection in fresh medium for further 24 h and proliferation measured as percentage BrdU positive cells using immunocytochemistry. (C) A representative Western blot and relative levels of phosphorylated retinoblastoma protein. (D) A representative Western blot and relative levels H3pS-10. p Values were calculated using paired or single value t test. *indicates p < 0.05, **indicates p < 0.01 and ***indicates p < 0.001 compared with Ad:control. (E) Effect of p27 overexpression on the mRNA levels of genes regulated by IFN-γ and interleukin-4. p Values calculated using an ANOVA with Dunnett post-test, **indicates p < 0.01 compared with Ad:control. Data are presented as the mean ± SEM, n = 3 blood donors.
|
study
| 100.0 |
It has been suggested that AURKB is a direct target of transcription factor E2F (29). Furthermore, when we interrogated the ENCODE database, we found chromatin immunoprecipitation evidence for binding of E2F transcription factors to the proximal promoters of the AURKB, ESCO2, SUV39H1, and WHSC1 genes, whereas CIITA, KDM6B, and NCOA1 had no such sites. We, therefore, investigated whether the effects of IFN-γ or IL-4 on AURKB, ESCO2, SUV39H1, and WHSC1 could be reversed by adenovirus-mediated overexpression of E2F1. Infection with the E2F1 expressing virus increased E2F1 protein (Figure 7A) and, as expected, the mRNA levels of the known E2F responsive genes, Cyclin E and PCNA (38) (Figures 7B,C). E2F1 gene transfer completely reversed the inhibitory effect of IFN-γ and IL-4 on AURKB, ESCO2, SUV39H1, and WHSC1 mRNA levels (Figures 7D–G), except in the case of AURKB for which the effect of IL-4 was only partly reversed (Figure 7D). These data provided further support for the conclusion that the effects of IFN-γ or IL-4 on these genes were, at least partly, mediated indirectly through inhibition of proliferation.
|
study
| 100.0 |
Effect of overexpressing transcription factor E2F1. Human blood monocytes differentiated for 4 days were infected with a recombinant adenovirus overexpressing transcription factor E2F1 or control destabilized, enhanced green fluorescent protein at 5 × 107 plaque forming units/ml for 20 h. IFN-γ or interleukin-4 (IL-4) were then added for 18 h in fresh medium. (A) Overexpression of E2F1 protein was determined using Western blotting. (B) Levels of Cyclin E mRNA or (C) proliferating cell nuclear antigen mRNA were quantified using RT-qPCR. Concentrations of mRNA for (D) AURKB, (E) ESCO2, (F) SUV39H1, and (G) WHSC1 are expressed relative to untreated Ad:control. p Values were calculated using ANOVA with Student–Newman–Keuls post-test. *indicates p < 0.05, **indicates p < 0.01, ***indicates p < 0.001, compared with Ad:control #indicates p < 0.05 compared with Ad:control + IL-4 and AdE2F1 alone. Data are presented as the mean ± SEM, n = 4 blood donors.
|
study
| 100.0 |
From the above results we concluded that increased expression of CIITA, KDM6B, and NCOA1 and decreased expression of KAT2A, PRMT7, SETD6, and SMYD3 was independent of any effects on proliferation. To begin to understand the impact of these changes on macrophage phenotype, we chose to further investigate KDM6B, which was the only transcriptional enhancer that was increased at the mRNA level by both IFN-γ and IL-4. Given that the action of KDM6B is demethylation of lysine 27 on histone3, which is associated with increased gene transcription (13), this upregulation might be expected to promote transcriptional responses to both cytokines. Conversely, inhibition and silencing of KDM6B might decrease gene expression associated with IFN-γ and IL-4. To narrow down the search for those genes regulated by KDM6B, either on its own or in combination with KDM6A, we first performed a microarray study of transcripts upregulated by IFN-γ or IL-4 in the presence and absence of the combined KDM6A and B inhibitor GSK-J4 (39). From preliminary time course and dose-response studies (results not shown), 6 h exposure was sufficient and 60 µM GSK-J4 was chosen because it significantly suppressed TNFα induction by lipopolysaccharide (LPS) by approximately 70% [confirming previous results (39)]. CD206 induction by IL-4 was also inhibited, albeit by only 30% (both p < 0.05), whereas a housekeeping gene, 36B4, was not affected. From these pre-validated samples, the transcriptomic analysis showed that IFN-γ significantly upregulated 906 and IL-4 upregulated 271 transcripts after 6 h (a complete gene list is deposited under GSE83957). Only 62 of these (6%) were upregulated by both IFN-γ and IL-4, which confirms the differential phenotypes stimulated by these two cytokines, as demonstrated more extensively previously (1). This data also emphasizes how unusual KDM6B is in being upregulated by both IFN-γ and IL-4. Of the 831 IFN-γ upregulated transcripts recognized by the genevenn program used to generate Venn diagrams, 181 (22%) were significantly decreased by the additional presence of GSK-J4 (Figure 8A). Using GOE and KEGG pathway analysis, these genes were associated with several aspects of immune cell function and transcriptional activation (Tables 3 and 4). Of the 254 IL-4 upregulated transcripts only 28 (11%) were significantly reduced by the additional presence of GSK-J4 (Figure 8B). There were insufficient genes in this cluster to perform GOE or KEGG pathway analysis. Only two transcripts (C17orf87 and LOC650919), neither associated with a known function, were common to both lists. The genes most inhibited by GSK-J4 in the presence of either IFN-γ or IL-4 are illustrated by heat maps in Figures 8C,D, respectively, with the details of these and further genes listed in Table 5. Heading the list of IFN-γ upregulated, GSK-J4 downregulated genes were CCL7 and CCL8, which are known genes associated with activation by IFN-γ (40). Heading the list of IL-4 upregulated, GSK-J4 downregulated gene was CD209, which is an established IL-4 responsive gene (41). A selection of the more abundant transcripts that were inhibited at least twofold by GSK-J4, were chosen for further analysis. Because there were so few abundant IL-4 stimulated, GSK-J4 inhibited transcripts in the array, we also included CD206, which was used for initial sample validation but just failed to reach significance in the array experiment (i.e., a false negative). First, upregulation by IFN-γ or IL-4 and its reversal by GSK-J4 was confirmed by RT-qPCR (Figures 8E,F, respectively). GSK-J4 is non-selective for KDM6A and KDM6B (39). Hence, to distinguish the roles of KDM6A and KDM6B, the effects of silencing one, the other or both was investigated by using shRNA. Given that silencing is difficult in primary macrophages, we used adenovirus-mediated delivery of shRNAs selective for KDM6A or KDM6B and compared these to delivery of a control adenovirus that expressed shRNA against firefly luciferase (shLUC). The housekeeping gene, 36B4, was also studied as a further control. Based on mRNA levels, silencing of KDM6A and B was highly selective, albeit incomplete at the maximum tolerable adenovirus dose (Figure 9A). Specificity and efficacy was confirmed at the protein level for KDM6A (Figure 9B) but no suitable antibody is available for KDM6B. The effects of KDM6A and B silencing were measured in the presence of IFN-γ or IL-4. From these results, the induction of CCL7 by IFN-γ depended selectively on KDM6A, whereas that of VAMP5 required KDM6A and B redundantly (Figure 9C). The induction of CD206 by IL-4 also required KDM6A and B redundantly, whereas that of PALLD depended selectively on KDM6B (Figure 9C). We concluded that a subgroup of transcripts upregulated by IFN-γ or IL-4 depended on KDM6B, either on its own or redundantly with KDM6A.
|
study
| 100.0 |
Effect of KDM6 inhibitor, GSK-J4, on the transcriptome of IFN-γ or interleukin-4 (IL-4) stimulated macrophages. Human blood monocytes differentiated for 4 days were pre-treated with 60 µM GSK-J4 or vehicle (DMSO) for 0.5 h and were then treated with either 100 ng/mL of IFN-γ or 10 ng/mL of IL-4 for further 6 h. Purified RNA samples (n = 4 donors) were analyzed on the Illumina Human HT-12v4 microarray or by standard RT-qPCR. Venn diagrams summarizing changes in response to (A) GSK-J4 ± IFN-γ or (B) GSK-J4 ± IL-4. Heat maps of 10 genes inhibited by GSK-J4 more than twofold that were upregulated by (C) IFN-γ or (D) IL-4 [the scale is log(fold change)]. Validation of selected changes in response to (E) GSK-J4 ± IFN-γ or (F) GSK-J4 ± IL-4 using RT-qPCR. Data are presented as the mean ± SEM for n = 4 blood donors. **indicates p < 0.01, ***indicates p < 0.001 vs IFN-γ or IL-4 alone.
|
study
| 100.0 |
Four-day human monocyte-derived macrophages were treated with IFN-γ or IL-4 in the presence of DMSO vehicle or 60 µM GSK-J4 with DMSO alone as control. Fold changes in mRNA expression from the Illumina HumanHT-12 v4 microarray were calculated using GeneSpring. p Values calculated using the Benjamini–Hochberg false discovery rate for multiple testing correction were in all cases <0.05 (n = 4 separate donors).
|
study
| 100.0 |
Effect of shRNA silencing of KDM6A and KDM6B. Human blood monocytes differentiated for 4 days were infected with 2 × 108 pfu/ml of each individual shRNA adenovirus for 72 h and were then treated with no addition, 100 ng/mL of IFN-γ, or 10 ng/mL of interleukin-4 (IL-4) for further 6 h. (A) The levels of mRNAs for KDM6A, KDM6B, or housekeeping gene, 36B4, were measured in cells infected with adenovirus expressing shKDM6A or shKDM6B were normalized against those with shLuciferase (shLUC) as control. (B) Protein of levels KDM6A and housekeeping gene GAPDH under the same conditions. (C) The effects of shKDM6A, shKDM6B, individually, or together on mRNA levels of genes upregulated by IFN-γ or IL-4. Data are presented as the mean ± SEM relative to shLUC for n = 6 blood donors. *indicates p < 0.05, **indicates p < 0.01 vs shLUC.
|
study
| 100.0 |
Using a focused array, we demonstrated that IFN-γ or IL-4 modulate the mRNA expression of at least seven epigenetic regulators in human blood monocyte-derived macrophages, independently of any effects on cell proliferation. CIITA, KDM6B, and NCOA1 showed increased mRNA expression within 6 h of stimulation, whereas KAT2A, PRMT7, SETD6, and SMYD3 showed decreased expression that required at least 18 h of treatment. The effects were confirmed at the level of protein for SMYD3. Based on similar effects of growth factor depletion or overexpression of p27kip1, we concluded that IFN-γ or IL-4 decreased expression of AURKB, ESCO2, SUV39H1 and WHSC1 mRNA and AUKB activity, at least partly, as a consequence of cell cycle arrest at the G1/S checkpoint. Furthermore, this decreased expression could be reversed by overexpression of E2F1, which is known from published chromatin immunoprecipitation (ENCODE) studies to bind directly to the relevant promoter regions. These data expand the list of epigenetic regulators the expression of which is regulated by IFN-γ and IL-4. As a first step to establishing whether these changes impact on macrophage phenotype, we demonstrated by pharmacological inhibition and shRNA silencing that KDM6B participates in a subset of the divergent gene expression changes in response to IFN-γ and IL-4.
|
study
| 100.0 |
In general, several families of enzymes that can alter the phosphorylation, acetylation, and methylation status of specific histone residues play a major role in epigenetic regulation (42–44). Histone H3S-10 phosphorylation catalyzed by AURKB has been implicated in chromatin condensation during mitosis (45, 46). Moreover, the finding that AURKB is an E2F target (29) led to the conclusion that it is a useful marker of cell proliferation, similar to PCNA. Our data showing that AURKB is downregulated by IFN-γ and IL-4-induced cell cycle arrest and is restored by the E2F1 extend these conclusions to primary macrophages. Previous work showing that the AURKB inhibitor, AZD1152, abrogates growth of human acute myeloid leukemia cells (47) and that growth arrest of mouse Raw264.7 macrophages by H. Pylori is associated with downregulation of AURKB (48) are also consistent with our conclusions.
|
study
| 100.0 |
Histone acetyl transferases (HATs) promote opening of the chromatin and enhance transcription, whereas histone de-acetylases (HDACs) have the opposite effect (49–51). The ability of CIITA to recruit HATs, including KAT2A (also known as pCAF-B) and NCOA1 (also known as SRC-1), to the promoter of the major histocompatibility complex-II (MHC-II) gene, has been extensively studied in macrophages (52, 53). Given the previous literature, CIITA upregulation by IFN-γ could be seen as a positive control for our array study. However, we also found CIITA to be upregulated to a lesser extent by IL-4, and both effects were independent of cell proliferation. Upregulation of NCOA1 selectively by IFN-γ most likely enhances the effects CIITA (52, 53) but downregulation of KAT2A seems paradoxical. However, this might also enhance the action of IFN-γ by decreasing acetylation and potentiating the functions of IRFs (54). The HAT, ESCO2, was also downregulated by IFN-γ or IL-4, although from our data this appeared to be mainly the consequence of the inhibition of cell proliferation. As its full name “Establishment of Sister Chromatid Cohesion N-Acetyltransferase” implies, ESCO2 has a known role in mitosis (30). It functions as part of the cohesion complex and its mutation leads to the cohesinopathy, Roberts syndrome (55). However, cohesin (and perhaps therefore ESCO2) has also been ascribed a wider role in gene transcription (56–58) and ESCO2 participates in Notch signaling (59), observations that might have implications for proliferating macrophages, although this remains to be investigated. Overall, our results imply that treatment with IFN-γ has the ability to both increase and decrease activity of specific HATs, thereby increasing or decreasing expression of different genes. In future experiments, beyond the present scope, it will be interesting to investigate the effects of manipulating levels of the HATs we have identified as up- or downregulated on both positive and negative transcriptional responses to IFN-γ. Recent data from the group of de Winther and colleagues showed, for example, that IFN-γ treatment specifically altered the acetylation status of the promoters of two downregulated genes, Il1b and Il6, in mouse macrophages (60), although the role of specific HATs and HDACs in these changes was not defined. We did not detect effects of IFN-γ or IL-4 on mRNA expression of any of the HDACs-1 to -11 that were included in our RT-qPCR screen. However, other mechanisms including changes in recruitment and activation of HATs and HDACs at specific promoters also contributes to acetylation status (61).
|
study
| 99.94 |
Histone methyl transferases (HMTs) and lysine de-methylases (KDMs) can be stimulatory or inhibitory to transcription depending on the site and degree of methylation that is optimal (62). For example, H3K4 methylation has important consequences for both enhancer and promoter activity of macrophage specific genes (63). Mono and di-methylation appear permissive for enhancers but tri-methylation for promoters of LPS-sensitive genes (61). A previous study on human macrophages stimulated with LPS and IFN-γ (64) showed increased H3K4 methylation associated with increased expression of the HMT, myeloid lymphoid leukemia (MLL). Given that we did not see any change in MLL expression with IFN-γ alone (absent from Table 2), it is possible that this is an effect of LPS, although this requires verification. In our study, the HMTs, PRMT7, SETD6, and SMYD3, were downregulated after priming by IFN-γ alone, independently of inhibition of proliferation. PRMT7 is a member of the PRMT histone arginine methylases, whereas SETD6 and SMYD3 are lysine methyl transferases. PRMT7 upregulates expression of metalloproteinase-9 (MMP-9) (65) in breast carcinoma cells but its role in macrophages is unknown. The related PRMT4 promotes major histocompatibility II (MHCII) gene expression (52). SETD6 activity has been linked to repression of the nuclear factor κB (NF-κB) system (66, 67) and upregulation of estrogen-responsive genes (68) in other cell types but there appears to have been very little previous work in mouse or human macrophages beyond demonstrating its presence preferentially in alternatively activated human macrophages, consistent with our results (64). SMYD3 di- and tri-methylates H3K4 residues (62). Although not an S-phase gene, SMYD3 has been identified as essential for cancer cell proliferation (69). It also plays a role in rescue from senescence (70), estrogen response (71), and MMP-9 induction (72) in various cancer cell lines. SMYD3 is also little studied in macrophages, although a previous study demonstrated its downregulation by a combination of LPS and IFN-γ, which is consistent with our findings (64).
|
study
| 99.94 |
In addition, the HMTs, SUV39H1, and WHSC1, were downregulated by IFN-γ or IL-4, at least in part, as a consequence of cell cycle arrest. Since SUV39H1 methylates H3K9 and places a repressive mark (62), it is predicted to reduce transcription of susceptible genes. Interestingly, one of the genes decreased by SUV39H1 in macrophages is p21waf1 (73), the cyclin-dependent kinase inhibitor that is responsible for inhibition of proliferation by IFN-γ or IL-4 (34, 35). Conversely, expression of p21waf1 indirectly downregulates SUV39H1, which implies a mutual feedback mechanism that presumably fine tunes the rate of proliferation. WHSC1 is a candidate gene implicated in Wolf-Hirschhorn syndrome, which is caused by deletions within the chromosome 4p16.3 region (74, 75). It has the ability to methylate several lysine residues in H3 and H4 (76) and could, therefore, act as a transcriptional activator or repressor. It has been ascribed a variety of functions, including in replicative DNA repair (33), which implies a role in S phase, but also in sustaining NF-κB pathway activity in tumors (77), which suggests activity may be present in other phases of the cell cycle. So far, there appears to be no knowledge regarding its role in macrophages.
|
study
| 99.94 |
We chose to prioritize the lysine demethylase, KDM6B, for study in greater detail because it removes repressive H3K27Me3 marks and is, therefore, a putative transcriptional activator. It is also amenable to selective pharmacological inhibition, which would lead to downregulation of target gene expression. Furthermore, KDM6B has been previously implicated in macrophage polarization by either bacterial LPS or IL-4, depending on the source of macrophages investigated. For example, KDM6B is upregulated in response to bacterial LPS in both mouse (78) and human (39) macrophages; and as many as 70% of LPS responsive genes in mouse macrophages recruit KDM6B to their promoters (15). This does not always lead to H3K27 demethylation (15) but KDM6A and B nevertheless act redundantly to potentiate responses to LPS in human macrophages (39). Other work in mouse macrophages showed that KDM6B can be upregulated by IL-4 in a STAT-6-dependent manner and that it is essential for IL-4 induced polarization in vitro and in response to certain kinds of parasitic infection in vivo (14, 17). However, no previous study has investigated the role of KDM6B on both pro-inflammatory and anti-inflammatory polarization in the same preparation of macrophages. Our transcriptomic study demonstrated for the first time that KDM6A and B play a part in polarization by IFN-γ, although a smaller proportion of genes (approximately 20%) appear to be affected than for responses to LPS (39). Likewise, KDM6B modulates some IL-4 polarization genes alone or redundantly with KDM6A in human macrophages but this seems to be a much small proportion (11%) than in mouse macrophages (14, 17). The finding that KDM6A and B acted redundantly for some processes is consistent with the previous study on LPS (39).
|
study
| 99.94 |
Our studies significantly expand knowledge of the expression changes in epigenetic regulators during polarization of human macrophages. Upregulation or downregulation of genes does not necessarily imply that these will be the only enzymes that play a major role in responses to IFN-γ or IL-4. However, the previous literature on CIITA and NCOA1 together with our new results with KDM6B illustrates the importance of upregulated genes. Importantly, we identify several changes that are independent of inhibition of proliferation, a complicating factor that appears to have been overlooked in previous studies. However, those changes partly dependent of proliferation may also be of significance. Indeed, recent work has highlighted the importance of proliferation in replenishing populations of resident macrophages (79). There have also been interesting findings in models of inflammation, especially atherosclerotic plaque formation (80), suggesting that proliferation rather than recruitment may play the major role in sustaining macrophage numbers. From our data, proliferation has a major impact on epigenetic programing, and this undoubtedly influences macrophage behavior. Future work, beyond the present scope, should probe into the downregulated genes we have identified, many of which are virtually unstudied in macrophages. However, we recognize that mechanisms other than changes in expression level regulate the function of epigenetic writers, readers and erasers at the promoters and enhancers of pro- and anti-inflammatory genes (61, 81). Except in the case of KDM6B, the contribution that the expression changes we observed make to epigenetic regulation in macrophages remains to be established.
|
study
| 100.0 |
GY-B performed and interpreted part of the experimental work and helped prepare the manuscript. MB contributed to the experimental design, interpretation of results, and writing of the manuscript. GS-N planned, performed, and interpreted the molecular biology component of the work. CH interpreted the microarray data. AN planned the study and led the interpretation of the results and writing of the manuscript.
|
other
| 99.94 |
The anticancer effects of radiation for patients with left‐sided breast cancer might be partly negated by radiation therapy (RT)‐associated cardiac toxicity. 1 , 2 , 3 Since the heart can be displaced medially, inferiorly, and posterior (i.e., away from the left breast) during deep inspiration in most patients, one approach to reduce incidental cardiac irradiation is to treat patients specifically during this portion of the respiratory cycle (e.g., using DIBH). This approach allows one to typically maintain coverage of the target tissues yet markedly reduce the degree of incidental cardiac irradiation. 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , 14
|
review
| 99.44 |
AlignRT (Vision RT Ltd., London, UK) has been used in our clinic for routine DIBH implementation. It continually tracks the position of multiple points on the patient's surface within the treated area and thus assesses variations in both translational and rotational displacements during treatment. We herein use the information stored from our patients treated with AlignRT to quantify the degree of breath‐hold motion and its dosimetric consequences.
|
study
| 94.94 |
Although there were reports on the breath‐hold motion using various systems, 15 , 16 based on our knowledge, no one has reported the corresponding dosimetric effect. We modified our in‐house treatment planning system (TPS) so that it can process the actual patient motion information and calculate the dosimetric variation due to the motion. We describe how the calculation was done in the Materials and Methods section below. The purpose of this study was to answer a clinical question: How much dosimetric variation the breath‐hold motion might generate compared to the plan?
|
study
| 100.0 |
Details of the AlignRT beam hold system have been reported. 17 , 18 , 19 Briefly, the AlignRT beam hold system consists of three ceiling‐mounted camera pods that work together to generate a 3D surface image of the patient. To set up and track patients, the system needs a reference image and a verification image. The CT skin rendering was our default reference image. Actual patient's surface was used as reference when bolus was needed for the treatment. The accuracy of the patient's surface capture was verified by port films. The system registers each verification image to the reference to determine, in real time, the differences between the reference and verification images, including three translational and three rotational displacements — the Real Time Deltas (RTD). For a given patient, the RTDs were calculated against the same reference image for the entire treatment. In other words, RTDs were absolute displacements to the same surface. Automatic gating was implemented. Tolerance levels are set (for permitted differences between the reference and verification images) for the radiation beam to be turned “on” automatically. For most patients, ±3 mm and ± 3° were used for the translational and rotational differences, respectively.
|
study
| 99.94 |
All patients were treated in the supine position. A patient is considered to have set up to the breath‐hold surface if the RTDs of the current breath‐hold region of interest (ROI) to the planned one are within predetermined tolerances. During treatment, the therapists provide audio coaching (e.g., “breathe in a tad more”) through intercom, as needed. Patient is instructed to take a deep breath and hold it, and the radiation beam is turned on automatically while the patient is holding breath and all RTDs are within the tolerance. Gated portal films are taken at least once per week, alternating between medial and lateral tangential films.
|
other
| 99.9 |
AlignRT uses an iterative closest point (ICP)‐based algorithm for surface matching. The algorithm registers the verification surface to the reference surface and calculates the shortest distance (by minimizing the mean squared error of these two surfaces). The distance is reported in the format of RTDs. We assume that the isocenter location relative to the surface does not change during the breath hold. Therefore, by knowing how much the surface deviates, we know where the isocenter has moved. The tangential beams can be moved accordingly and the delivered dose can, therefore, be calculated.
|
other
| 99.9 |
An Institutional Review Board (IRB) had been approved to retrospectively analyze DIBH patient data. The stored motion log files (that contain the translational and rotational displacement data over time) for 30 patients treated with tangential fields for left‐sided breast, delivered during DIBH, in our clinic from 2012 and 2013 were analyzed. Fractionation schedules included 200 cGy×23 fractions (11 patients), 267 cGy×16 fractions (10 patients), 200 cGy×25 fractions (8 patients), and 180 cGy×28 fractions (1 patient). The internal mammary nodes (IMN) were intended to be included in the tangential fields in 10 patients. Whenever IMN was included as part of the tangential beams, the volume of the IMN covered by 40 Gy was evaluated. If part of the IMN was not covered by 40 Gy, a separate electron boost might be needed to bring IMN to the desired dose. Electron boost is beyond the scope of this study, and will not be discussed here. Since the IMN is always at the edge of the tangential beams, even a small amount of motion might affect its coverage. Therefore, we included the IMN coverage in this study, as well.
|
study
| 100.0 |
RTDs were recorded four to seven times per second, depending on the size of the ROI (longer times needed to process images for larger ROIs). A typical ROI was selected to include the external skin of the treatment area. For each patient, the RTD recording frequency is approximately the same throughout the treatment course. At each recorded instance, the three translational and three rotational RTDs were calculated, and these RTDs represented the breath‐hold motion. Since the RTDs were calculated against the same reference ROI (the default was the planning CT skin rendering) for each fraction for both setup and treatment, the interfraction variations in breath‐hold position would not propagate to treatment RTDs. The RTDs along with their corresponding beam‐on/off status were saved in a motion log file, and only the beam‐on portions were considered. For each patient, RTDs from all treatments were included, and then the mean, standard deviation, maximum, and minimum of the RTDs were calculated (for each of the three translational and three rotational parameters). The average motion (the mean and standard deviation) was calculated using the absolute values of the RTDs. The signed RTDs were used to estimate the delivered dose.
|
study
| 100.0 |
The DIBH plan was generated on the breath‐hold CT scan without considering breath‐hold motion (i.e., RTDs were zero). However, there is always a certain level of motion and thus predetermined RTD tolerances (±3 mm and ± 3°) are used clinically. Our DIBH clinical planning guidelines can be found in Tang et al. (20)
|
other
| 95.0 |
We modified our in‐house TPS so that the motion information from the RTD measurements can be used to recalculate a more accurate estimate of the actual delivered dose (compares to the planned dose using CT without considering any breath‐hold motion). For each position (set of recorded RTDs), the dose was recomputed using our modified in‐house treatment planning system, and the equally weighted average of the multiple resultant doses was computed. As an example, considering a total number of n positions (n sets of RTDs) recorded, the dose was recomputed for each recorded position on the original treatment plan. The final dose was the summation of all the n dose results and then divided by n. The RTDs were sampled at approximately the same rates. For each patient, the clinical patient dose statistics (delivered dose statistics) were compared to those from the treatment plan (that assumes no breath‐hold motion). Heart and lungs doses were considered for the treatment plan. We did not have clearly defined constrains for these two organs at risk (OAR). Instead, our clinicians tried to minimize the heart and lung dose while balancing the competing target coverage. Mean heart dose and lungs V20 were studied. For patients whom the IMN were being targeted, the percentage of the IMN receiving 40 Gy was considered, as this is the dose level that our clinicians usually aim to electively irradiate these nodes. More specifically, IMN 40 Gy percentage coverage and IMN mean dose were considered. Scattered plots were used to compare the planned and delivered doses. The averaged mean, standard deviation, maximum, and minimum over all patients were reported.
|
study
| 100.0 |
Figure 4 shows the corresponding heart and lungs DVHs. The 50% line has been pushed closer to the heart and the 80% line has been pushed slightly away from the heart. The 100% and 98% isodose lines were different than the plan. Less than 1% heart and lungs DVH difference was observed in Fig. 4. We typically do not contour PTV for breast or chest wall treatment. Therefore no PTV DVH comparison can be shown.
|
study
| 100.0 |
5, 6 illustrate an example of the planned and delivered IMN 40 Gy percentage coverage (planned was 94.5%, and delivered was 68.1%) and DVHs. The planned IMN was covered entirely by the 80% isodose line. However, at least one‐third of the IMN was outside of 80% isodose line in the delivered dose distribution. The delivered IMN DVH was lower than the planned.
|
study
| 99.94 |
An example of the planned (left) and delivered (right) axial CT images demonstrating changes in the IMN coverage. The prescription was 200 cGy×23. The mean RTDs are (0.06, 0.15, 0.78, 0.68, −0.57, 2.76), and the SDs of the R TDs are (1.01, 1.41, 0.78, 0.52, 0.25, 0.44).
|
clinical case
| 99.4 |
The data presented demonstrate that AlignRT system provides a reproducible setup throughout treatment, with typical breath‐hold motions of <1 mm. The dosimetric consequences of these subtle breath‐hold motions are similarly small. Gierga et al. (15) performed a similar study and noted delivered and planned breath‐hold positions typically to have means around 2 mm in each direction. We used ±3 mm and ± 3° as the RTD tolerance, and the Gierga study used ±5 mm (no rotational tolerance was reported). We have simulated the motion using mean RTDs from the Gierga study, 1.0 mm SD, and their tolerance to estimate corresponding dosimetric effect. A patient (with IMN) with average motion was selected. RTDs of (2.2 mm±1.0 mm, 2.3 mm±1.0 mm, 2.0 mm±1.0 mm) and tolerance of ±5 mm were generated (0° rotational motion was used as it was not reported in the Gierga study). Delivered dose was estimated the same way in this study. In more detail, 200 entries of RTDs were simulated using the means and standard deviations listed above. Each RTD entry corresponds to an isocenter shift, and each isocenter shift results a deviated dose distribution. The final dose distribution was an equal‐weighted average of all 200 varied ones. The same orientation system shown in Fig. 1 was used for this simulation (i.e., 2.2 mm, −0.5 mm, 1 mm), which means that the isocenter moved posterior 2.2 mm, left 0.5 mm, and superior 1 mm. The estimated heart mean dose using ±5 mm tolerance was 110 cGy, the estimate using ±3 mm tolerance on the same patient was 106 cGy, and the planned dose was 97 cGy; the lungs V20 were 7.74%, 7.72%, and 6.66%; the corresponding IMN mean doses were 4983 cGy, 4970 cGy, and 4958 cGy; the corresponding IMN 40 Gy coverage were 100%, 100%, and 100%. It appears that, by increasing the tolerance, the average motion was increased as well, and it might result in slightly higher delivered heart mean dose, lungs V20, and IMN dose. A thorough study is needed to make meaningful conclusion.
|
study
| 100.0 |
Audio coaching was used for all the patients in our study. Cerviño et al. (21) demonstrated an improvement in reproducibility with visual coaching vs. no coaching (0.5 mm vs. 2 mm). Vikstrom et al. (22) also represented the implementation of the visual coaching. We are considering a visual feedback system in our clinic, as well.
|
study
| 99.94 |
All the DIBH patients in this study were treated in the supine position. Another way to reduce dose to the heart is to treat patients in the prone position with free breathing. The dosimetric results of these two techniques are different. Also the contralateral breast dose is often evaluated in the prone treatments. A recent study (23) has shown that prone free breathing yields lower mean lung dose and V20 than supine DIBH. The mean heart dose and contralateral breast receiving >5 Gy were significantly lower in supine DIBH than prone free breathing. Although this study investigated only planned dose without considering patient motion, it still provides dosimetric information of prone free‐breathing and supine DIBH. For prone free‐breathing treatments, the interfraction motion (patient setup) is often greater than the intrafraction patient motion. Unfortunately, no study was found at this point to show the corresponding dosimetric impact.
|
study
| 100.0 |
Since both the patient setup RTDs and the treatment beam‐on/off RTDs were absolute displacements calculated against the same reference surface image throughout the treatment course, the dosimetric analysis on beam‐on portions of the RTDs provided a reasonable estimate of the breath‐hold motion effect compare to the plan. In other words, the setup uncertainties to the delivered dose do not propagate to the breath‐hold motion induced uncertainties.
|
study
| 99.8 |
There are several shortcoming of our analysis. We assumed a rigid body model (i.e., that the relative position of the chest/breast and heart was constant). This clearly is not the case. Nevertheless, this is a reasonable assumption, given the goals of the analysis. Surface has been proven to be a reasonable surrogate for DIBH patient setup from a port film analysis in Tang et al. (20) A total of 270 port films from 50 patients was analyzed to assess patient surface based setup accuracy. The distance between the field edge and the anterior pericardial shadow was measured on port films and corresponding digitally reconstructed radiographs (DRR). The reported discrepancy was 0.2±0.19 cm, which was fairly reproducible. On the other hand, it was reported that the interfraction DIBH motion of the heart had reproducibility of 3 mm in the anterior–posterior (AP), 7 mm in the superior–inferior (SI), and 3 mm in the left–right (LR) directions. (24) Moderate correlation was found between surface and heart setup errors in Alderliesten et al.: (13) R2=0.53, 0.37, 0.64 in AP, SI, and LR directions, respectively. Therefore, an inclusion of a more sophisticated model (i.e., deformable registration) might make the analysis more accurate. However, one should carefully evaluate the trade‐off between the complexity of the analysis and the degree of the benefit. In cases where the IMNs are targeted and where they are receiving (nearly or) full dose, they tend to be close to the field edge. If the beam is too deep, the nodal targets remain in the field, but the dose does not increase. Conversely, if the beam is too shallow, the dose can decline rapidly due to the proximity to the beam edge. Thus, the dosimetric consequences of breath‐hold motions are not symmetric (underdosage is more common than overdosage). Similarly, for structures that are well out of the planned beams, such as the heart in most of our cases, the exact reverse occurs. If the beam is too shallow, the dose remains low, and if the beam is too deep, the dose can increase (motion tends to increase the cardiac dose; which is to say that overdosage is more common than underdosage).
|
study
| 100.0 |
Considering absolute value, the averaged mean motion during deep inspiration breath hold was smaller than or nearly 1 mm and 1°. This reflects the relative reproducibility of the patient breath hold. On average, the mean heart dose and lungs V20 are reasonably close to what has been planned. IMN 40 Gy coverage might be modestly reduced for certain cases.
|
study
| 92.06 |
Factor V deficiency (F5D) is a rare hematological disorder with an estimated incidence of 1 case per million people. Until now, more than 200 cases have been recorded worldwide in the literature. F5D patients present with various clinical manifestations. Although mucosal bleeding is the most common, fatal bleeding complications are also possible. Thus, F5D increases the difficulty of invasive testing, and surgical and procedural treatments. When long-term antithrombotic drugs, including antiplatelet agents and anticoagulants, are required in patients at high risk of bleeding, one of the biggest challenges is coronary intervention to treat coronary artery disease. Most studies recommend preinterventional or preoperative supplementation with fresh frozen plasma (FFP) to reduce bleeding risk. However, in addition to the bleeding risk caused by antithrombotic therapy, the hypercoagulable state in coronary intervention has an adverse effect on stent thrombosis, mortality, and prognosis during the postinterventional period. The contemporary standard therapy for significant coronary artery stenosis is implanting a drug-eluting stent (DES). However, because implanting a DES delays endothelial healing and requires long-term antithrombotic therapy, DES implantation in an F5D patient is very complex. No antithrombotic therapy study to date has been reported for F5D patients undergoing coronary stenting. Herein, we report a case of an F5D patient who underwent coronary stenting in the absence of an FFP transfusion and who received successful maintenance therapy using a single antiplatelet agent with recurrent multiple mucosal bleeding events after coronary stenting.
|
clinical case
| 99.94 |
A 73-year-old woman presented with chest discomfort and New York Heart Association class 2 dyspnea when she climbed stairs 2 weeks ago. She was not taking any medication except hypnotics, and her only cardiovascular risk factor was old age. Although she had had 3 natural childbirths, she had no history of surgery or blood transfusions. No specific findings were observed upon physical examination, electrocardiography (ECG), or chest x-ray imaging, and cardiac biomarkers were within the normal range, but the D-dimer, prothrombin time (PT), partial thromboplastin time (PTT), and activated PTT levels were prolonged. Transthoracic echocardiography showed a normal left ventricular ejection fraction and no regional wall motion abnormality. On the basis of the exercise-induced ECG changes in the treadmill exercise test, coronary angiography was planned to conduct decision-making for appropriate management and prognosis assessment (class I, level of evidence B). After 300 mg of aspirin and 180 mg of ticagrelor were administered, coronary angiography was performed via the right radial artery. A significant stenosis was noted in the left anterior descending coronary artery and right coronary artery; thus coronary stenting was performed successfully using DES stents (Fig. 1). Unexpectedly, D-dimer, PT, and PTT prolongation were maintained at 6 and 24 hours after coronary stenting, and hemoglobin (HgB) decreased from 11.3 to 9.5 g/dL. Although ecchymosis and oozing were present at the right radial artery puncture site, no evidence of bleeding was observed. Aspirin (100 mg daily) and ticagrelor (90 mg twice daily) were administered to prevent a stent thrombosis. The test values to identify the causes of prolonged coagulopathy fell within the normal range. Epistaxis and blood-tinged sputum occurred on day 3 after coronary stenting. Because HgB had dropped to 8.5 g/dL, chest and abdominal computed tomography scans were performed to confirm the possibility of internal bleeding; however, no abnormal findings were observed except aortic calcification. The antiplatelet therapy measured using the Multiplate Analyzer (Roche Diagnostics, Mannheim, Germany) was adequate, but the daily dose of the antithrombotic agent was reduced to 100 mg of aspirin and 90 mg of ticagrelor. After transfusing 2 units of packed red cells, HgB remained >10 g/dL (Fig. 2). On day 5, factor V activity was 14% (reference range 60%–120%), but other laboratory findings, including factor VIII activity, were all within normal ranges; she was diagnosed with F5D based on low factor V activity. Hematochezia occurred on day 6, and ischemic colitis was confirmed via sigmoidoscopy (Fig. 3). After fasting, except antithrombotic agents and intravenous antibiotic treatment, a general diet was made available starting on day 8, and HgB was maintained consistently above 10 g/dL. However, PT, PTT, and D-dimer prolongation persisted. The area under the curve (AUC) was 20 (reference range 1–41) for ticagrelor and 18 (reference range 1–29) for aspirin with the daily maintenance dose of 90 mg of ticagrelor and 100 mg of aspirin, with which she was discharged on day 10.
|
clinical case
| 100.0 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.