text
string | predicted_class
string | confidence
float16 |
|---|---|---|
Bird sampling was performed with permissions from landowners and the regional Department of the Environment (Comunidad de Madrid; Junta de Andalucía; Junta de Extremadura) and all the experimental procedures were approved by The Doñana Biological Station Ethics Committee on Animal Experimentation (CEEA-EBD) by CSIC Ethics Committee (CEC). Birds were captured in mistnets and retained until manipulation in cloth bags to keep them safe and calm. All sampled birds were released unharmed at the site of capture after manipulation.
|
other
| 99.94 |
DNA extraction from cutaneous lesions and PCR amplification for APV were realized as previously described . First, a multiplex PCR to detect poxvirus (APV) or papillomavirus (PV) infection was carried out using BconPVF1/BconPVR1 and P4b1060F/P4b1060R. If poxvirus was amplified, a second specific PCR, M2925-M2926 which targets fpv167 locus, was used to obtain a sequence that could be compared with published sequences. The presence of bird DNA was confirmed in all samples by amplification of a fragment of the cytochrome (cyt) b gene . Extraction blanks, PCR negatives and standard negative controls were used in all PCRs, and were consistently negative.
|
study
| 100.0 |
First year birds for which visual sexing according to plumage characteristics was not possible, were sexed using molecular tools. Genomic DNA was extracted from the cell fraction of each blood sample using a semi-automatic Maxwell kit method (Maxwell®16 LEV system Research, Promega, Madison, WI) which involves an enzymatic lysis using proteinase K followed by a purification of DNA using magnetic beads that bind to DNA . The sex identification test employs the primer pair CHD-P2 (5’ TCTGCATCGCTAAATCCTTT 3’) and CHD-P8 (5’ CTCCCAAGGATGAGRAAYTG 3’) to amplify a CHD gene fragment. Each PCR reaction was performed with approximately 20 ng of genomic DNA as template using the following conditions: an initial denaturing step at 94°C for 2 min, 55°C for 30 s, 72°C for 1 min was followed by 34 cycles of 92°C for 30 s, 50°C for 30 s and 72°C for 45 s. A final run at 72°C for 5 min completed the program. The reaction products were checked by running in a 1.5% agarose gels for band visualization and sexing of each sample.
|
study
| 99.94 |
Amplicons were Sanger sequenced in both directions. The nucleotide sequences obtained were analyzed with Lasergene Suite (DNAStar, Madison, USA). Consensus sequences were compared with poxvirus sequences available using the National Center for Biotechnology Information’s Basic Local Alignment Search Tool (BLAST; http://www.ncbi.nlm.nih.gov/blast/Blast.cgi).
|
study
| 99.94 |
We determined the phylogenetic relationships between the strains of APV infecting house sparrows by building a phylogenetic tree using novel sequences from this study and published ones. We used a 448 bp fragment sequence using the simple PCR-M2925/26 set, which is homologous to sequences used in previous phylogenetic analyses of APV.
|
study
| 100.0 |
Strains differing by at least one nucleotide were downloaded from GenBank (access date 29th of September of 2015) resulting in 66 P4b strains including the two strains found in house sparrows in this study. The most appropriate nucleotide substitution model was found under a Bayesian information criterion with PartitionFinder : HKY+I+G. We inferred the phylogenetic relationships with a Bayesian analysis using BEAST 2.0 after setting the parameters for the BEAST-run in BEAUTI 2.0 . Markov Monte Carlo Chains (MCMC’s) were run for 109 generations sampling every 10,000 trees using a Yule speciation prior and an estimated molecular strict clock since our data could not reject this model based on the underlying log normal distribution standard deviation (ucld.stdev) values histogram in Tracer v1.5 (http://tree.bio.ed.ac.uk/software/tracer/). All estimated sample sizes were higher than 200 and the resulting 100.000 trees were summarized in TreeAnnotator v2.1.2 (http://beast.bio.ed.ac.uk/treeannotator) after removing a 25% burn-in and are displayed in Figtree v1.4.2 (http://tree.bio.ed.ac.uk/software/figtree/).
|
study
| 100.0 |
Prevalence of APV lesions was analyzed using General Linear Mixed Model with binomial distributed error and logit link function. Presence/absence of lesions was included in the model as the response variable, trios and site within each trio as random factors and habitat, sex, age, month and year as fixed independent factors. Only individuals with known age and sex were included in the analyses. Statistical analyses focus only on southern Spain data due to the larger dataset available and standardized sampling. Data from central Spain were used for comparison of prevalences and phylogenetic analyses. Models were fit using the GLIMMIX procedure in SAS 9.4.
|
study
| 100.0 |
We found cutaneous lesions on the unfeathered parts of the body in several house sparrows surveys carried out in Spain. Lesions were wart-like growths (0.5–6 mm in diameter) which can range in colour from yellow or white in the early stages to brown or black when the formation of crusty scabs become. Smaller lesions can be quite cryptic. Frequently these regions are bordered by erythema. The lesions were seen more frequently in lower legs and feet (S1 Fig). The mean prevalence of pox-like lesions in a survey of 2,341 house sparrows from southern Spain (Huelva) was 3.2%, ranging from 2.8% in 2013 to 3.5% in 2014 (Fig 1). Using the 1,866 first captures of house sparrows with known sex and age, no differences in prevalence were found between years (F1,14 = 0.39, p = 0.54), nor months (F4,25 = 0.89, p = 0.49). Prevalence was also similar in urban, agricultural and natural habitats (F2,12 = 0.30, p = 0.75), and did not differ between males and females (F1,14 = 0.30, p = 0.60). However, the prevalence of APV lesions in southern Spain was higher in yearling birds (F1,14 = 20.57, p = 0.0005).
|
study
| 100.0 |
We could only test 47 birds from the 75 individuals (63%) from southern Spain with pox-like lesions, including 33 swabs (13 from 2013 and 20 from 2014) and 14 tissue samples (all from 2014) (Table 1). APV infections were confirmed by molecular amplification in 64% of them, including 26 swabs (79%) and 4 tissues (29%). In central Spain, pox-like skin lesions were observed in ten house sparrows; swab samples were collected from all ten birds and additional tissue samples were collected from five of the ten birds. Overall, APV infection was confirmed in six of the ten house sparrows with avian pox-like skin lesions observed in central Spain. Four of the ten swabs obtained in central Spain were PCR positive, while APV infections were confirmed in each of the five tissue samples tested.
|
study
| 100.0 |
Two different strains named CNPV-PD1 and CNPV-PD2 (Table 2) were identified in house sparrows from southern Spain (proportions 8:1 and 7:7 in 2013 and 2014). Only the strain CNPV-PD2 was found in house sparrows captured in central Spain. The phylogenetic analysis, which included 66 sequences of 448 nucleotides in length (some data bank sequences were shorter than the amplicon from this study), shows CNPV-PD1 and CNPV-PD2 placed in two subclades B2 and B1, respectively; both Canarypox-like viruses (Fig 2). CNPV-PD1 was the predominant sequence in southern Spain in 2013 (100% in natural and 83% in agricultural areas), but it was less common in 2014 (50% in natural and urban areas), though this variation was not statistically significant. This strain shows 100% identity to an APV from an american flamingo (Phoenicopterus ruber ruber) at Lisbon Zoo, Portugal (HQ875129) [a houbara bustard (Chlamydotis undulata) in Morocco (LK021660), a great bustard (Otis tarda) in Hungary (KC018066) and shares 70% similarity to FWPV and CNPV. This sequence shows two amino acid insertions and one deletion at the N-terminal sequenced region compared to all other APV strains. CNPV-PD2 clusters with CNPV and has been found in Passeriformes and other bird orders in Europe and USA (Fig 3).
|
study
| 100.0 |
The maximum coverage for all nine sequences is 357 nt, though coverage for seven haplotypes is 538 nt. Canarypoxvirus (CNPV) strains are shown in red; Fowlpoxvirus (FWPV) strains are blue. Number of nucleotide substitutions are marked on the line by a solid circle, or shown in parenthesis (when numerous). The continent and avian order of detection, and number of known host species (N = x), are shown below each strain. Note that FWPV-PD1 and PD2 are identical in the 357 nt sequence, but differ at five nt sites in the extended 538 nt sequence (resolution determined only from the extended 538 nt sequence, is indicated by a dotted line). Geographic and host taxonomic information associated with these sequences is based on the extended 538 nt sequence.
|
study
| 100.0 |
We did not observe significant changes in the distribution of genotypes CNPV-PD1 and CNPV-PD2 between the two years of sampling or among the different areas (Fig 4), although most CNPV-PD2 was identified in the second year in natural and urban landscapes, adjacent to wetlands.
|
study
| 100.0 |
Most literature on APV infection describes case-reports or outbreak studies. By contrast, we focus on the prevalence of endemic disease in a single wild bird host. This is the first large-scale study of APV prevalence in house sparrows; previous studies have used more limited samples sizes [8,13,20,23,32–35]. We found a moderate prevalence (around 3%) of pox-like lesions in several areas in Spain. Similarly, in a study on 81 house sparrows captured in Hawaii authors found prevalences of 2.5% and 4.9% of active and inactive avian pox lesions, respectively . Conversely, in closely related Spanish sparrows (P. hispanolensis), Smits and co-workers did not find APV affected birds in the Canary Islands (n = 128). The prevalence reported here is similar to that found in blackcaps (3.7%) from the Czech Republic .
|
study
| 99.94 |
We did not find any significant difference in the prevalence of avian pox-like lesions in house sparrows by sex, habitat type or month during the study period. APV disease frequency has been correlated to wet seasons and rain patterns. Higher frequency has been described during winter , autumn in temperate climates or in years with high precipitation . Our results suggest that factors favouring virus transmission did not evidence temporal variation within the study period (2013–2014) in the study area. However, birds were captured during few months overlapping with the highest abundance of mosquitoes , potentially favouring virus transmission. In addition, factors including the cyclical boom in immune naïve hatch-year birds may also play a role in the observed prevalences. In fact, higher pox prevalences are more frequently reported in juveniles than in adults [2,4,16,40,41, this study]. This fact could be due to the naïve immunological status of juvenile birds or the existence of frequent asymptomatic infections in adults. Additionally, a higher mortality rate of infected juvenile birds may result in a differential prevalence between adults and juveniles.
|
study
| 100.0 |
The literature shows contradictory results about the differences of poxvirus infection in diverse habitats Some authors have suggested prevalence may depend on parasite type and transmission methods . This fact may explain our results, where no significant differences were found between habitat categories.
|
study
| 99.94 |
Most studies on the prevalence of avian pox in wild birds have relied solely on the observation of individuals with cutaneous lesions and missing digits and, therefore, report a presumptive diagnosis. We confirmed viral infection by molecular analysis in 63% of all lesions tested (from approximately 50% of birds with visual lesions examined). This result fits within the values previously found in studies using tissue samples (52.1% to 82.2%) . Negative results by molecular testing may be due to superficial sampling techniques; the necessity of using minimally invasive sampling of live birds may have led to some false negative results. They may also be due to lesions caused by historic infections with poxvirus, for which no viral DNA remains detectable. Alternatively, these lesions could be caused by other organisms including bacteria or mites . Overall, >1/3 of our samples tested negative for Avipox amplification. While it is probable that these are false negative results, we concur with Parker et al. that tests are required to confirm a diagnosis based on the macroscopic appearance of lesions.
|
study
| 99.94 |
To date, most samples used to confirm APV infection by molecular amplification are biopsies from large lesions. When lesions are very small, researchers usually avoid obtaining biopsies to avoid injuring birds. Swab collection can avoid this problem, particularly considering the good results shown in our southern Spain samples (78.8%). The lower proportion (four from ten) of positives obtained from swabs collected from cutaneous lesions in house sparrows captured in central Spain may be due to the different swab buffers used between localities. Swabs from southern Spain were conserved in virus transport buffer which likely improves the preservation of the viral genome for molecular analysis while samples from central Spain were stored only in PBS. However, this may represent biases introduced by the individual who collected the samples—note also the variation in results in positive tissue samples from southern Spain (Huelva) (28.6%) and central Spain (all of the five samples analyzed). As such best collection methods merit further investigation.
|
study
| 100.0 |
Although it is well known that the same host species can be infected with different strains of APV, the genetic diversity of strains in different hosts has been poorly studied. Currently, a total of nine APV strains have been identified in house sparrows globally, seven of which are in the canarypox clade and two in fowlpox. Three strains have been found that infect house sparrows in Spain, CNPV-PD1 to CNPV-PD3, although CNPV-PD3, highly similar to CNPV-PD2, has been identified only from a museum skin collected from central Spain in 1911 . The genotype CNPV-PD1 has been detected infecting other species in the Iberian Peninsula and North Africa (Lisbon and Morocco) . Although the subclade B2 consists of isolates from Sturnidae (starlings and mynahs), to date no APV has been detected in Sturnidae in Spain. The genotype CNPV-PD2 has been found in numerous wild bird species around the world. In Spain, this genotype was found in Passeriformes sampled in 2007 belonging to the genera Cyanistes, Periparus and Sylvia and in two museum voucher specimens dated from 1911 from the genera Loxia and Passer . All samples were negative for papillomavirus but to date this viral infection has never been diagnosed in house sparrows.
|
study
| 99.94 |
In conclusion, our results reveal the active circulation of two different APV genotypes in house sparrows from Spain, with variable prevalence between age classes. In addition, our results confirm that visual inspection and molecular testing of lesions provide an incomplete estimate of APV circulation in house sparrow populations. First, the minimally invasive sampling methods employed in this study of live wild birds can involve a percentage of false negatives. Whilst the skin lesions had a characteristic appearance consistent with avian pox in this species, PCR was only able to detect avian poxvirus DNA in 63% of cases. Moreover individuals which display clinical signs of disease may not represent all individuals with current infection, nor do they capture complete information on historic infection. Further studies of seroprevalence would be extremely useful for obtaining an estimate of the real exposure to this virus in wild bird populations.
|
study
| 100.0 |
A composite material is obtained by the combination of two or more chemically distinguishable initial components that shows a significant proportion of the raw materials’ properties, thereby delivering a better combination of properties according to the principle of combined action. The continuous phase is called the matrix, while the discontinuous one is known as the reinforcer . The matrix material can be metal, ceramic or polymer, while the reinforcer can be a particle, fiber or sheet .
|
other
| 99.9 |
Among sustainable materials, natural fiber composites have such advantages as low cost, light weight, comparable specific strength and stiffness to traditional fiber composites, being renewable and possessing formability with low investment, as well as being environmental friendly .
|
other
| 99.9 |
A vital role that determines such composites performance is the interfacial bonding between fiber and matrix. Usually, the plant-based fiber composite shows limited interaction between the hydrophylic fibers and matrices of common hydrophobic nature that allows poor interfacial bonding affecting the mechanical performance negatively and reducing moisture resistance that drives long term properties .
|
other
| 99.75 |
The interfacial bonding can be achieved in several ways, including mechanical interlocking, electrostatic bonding, inter-diffusion bonding and chemical bonding . The latter is of particular importance since it delivers strong improvement of composite performance and such a strategy can be applied to the fiber or the matrix. The chemical approach includes treatments of alkali, acetyl, silane, benzyl, acryl, permanganate, peroxide, isocyanate, titanate, zirconate and acrylonitrile reactions plus maleated anhydride grafted coupling agent, but enzyme treatments are becoming more popular due to environmental concerns .
|
other
| 99.44 |
Several aerogels of cellulose–silica nanocomposites were prepared by sol-gel method application. The in situ formation of silica in the cellulose gel was obtained with tetraethyl orthosilicate (TEOS) precursor and drying with supercritical CO2 was required for conversion of composite to aerogel . While another working group approach to prepare aerogels involved methoxytrimethylsilane (MTMS) as silica precursor, the aerogel was obtained by using a freeze dryer . Both reports are very successful but also very energy demanding and time consuming, since several days are required to reach the product. Another group prepared organic–inorganic hybrids of cellulose–silica incorporated with polyhedral oligomeric silsesquioxanes (POSS) by using γ-aminopropyltriethoxy silane (γ-APTES) as a crosslinking agent. Even though the POSS amine particles are well dispersed at the nanometer scale throughout the cellulose matrix, this method is costly .
|
review
| 55.38 |
In order to obtain composite materials by an accessible and low-cost method, we have adapted the percolating approach of the solvent exchange method applied to nanofibers of cellulose that involve first forming a three-dimensional template through a self-assembly of the fibers, then filling the percolating architecture with a selected polymer. Before this method, it was impossible to incorporate cellulose particles into nonpolar polymers without the use of surfactants or chemical modifications .
|
study
| 100.0 |
This work strategy has been employed to avoid using crosslinkers agents and catalysts in order to incorporate the inorganic nanoparticles into the matrix; instead, we used the percolating approach to prepare the surface of cellulose fibers by the solvent-exchange method for effective facial interaction with inorganic particles of hydrophobic behavior, such as nanosilica, to design a new hybrid material of homogenous composition. The main feature of this work is to produce nanocomposites using cellulose as the matrix and not as the reinforcer of any other polymer, with no chemical modifications for interacting with inorganic nanoparticles, following a very facile and cost-effective method. This innovative method significantly reduces the complete synthesis time of the cellulose matrix composites from several days to only a few hours, since it comprises only one step of facile cellulose surface modification. On the other hand, the energy consumed during synthesis is very low and cost-effective, delivering a Trametes versicolor resistance cellulose-based hybrid composite with no antifungal agent added, thereby demonstrating low moisture absorption and high dimensional stability, that also shows improved thermal stability against pristine cellulose.
|
study
| 100.0 |
The nanocomposites synthesis requires the starting precursor materials: silicon dioxide of Aerosil 200, 12 nm particle size with 200 m2/g surface area from EVONIK named ASi and silicon dioxide of 100 nm from AVAN-nanoSil named NSi; the cellulose fibers of 20 micron, named C20, were provided by Aldrich (Saint Louis, MO, USA). The first solvent exchange step was adding water in droplets to the cellulose fibers and gently stirring for 15 min to get a gel, then ethanol was added in droplets at 1:1 volume ratio. Stirring was maintained more than 1 h, and then the second solvent exchange step was applied, adding acetone in droplets at 1:2 volume ratio according to water volume. At this point, the surface modified cellulose by solvent exchange method can be dried and named AG20, while the as-received cellulose is named C20. Stirring was still maintained for 3 h more; nanosilica, previously wet with acetone, was added while stirring for 10 min more and 20 min of an ultrasound bath of 40 kHz was also applied, taking care that the temperature did not exceed 40 °C. Finally, the resultant dough was dried at 60 °C in an oven, in order to obtain a fine powder.
|
study
| 100.0 |
The first 8 composite samples were synthesized according to the amounts indicated in Table 1 in order to determine the highest amount of nanosilica that can be uniformly dispersed into the two kinds of matrix prepared: C20 and AG20. There are two main parameters that distinguish these composites; one concerns the kind of matrix: CP1, CP2, CP11 and CP12 contain C20 while CP3, CP4, CP13 and CP14 contain AG20. The other parameter is the amount of NSi increased from 25 to 100 in steps of 25 wt % for every matrix set, giving place to 8 samples in total. In order to determine which one of these matrices can rightly disperse the nanoparticles up to 100 wt %, 4 more samples were synthesized according to Table 1, using only the silica nanoparticles of 12 nm, ASi, in 75 and 100 wt %, comparing the matrix of C20 in CP19 and CP20 and the matrix of AG20 in CP21 and CP22, in order to observe the influence of such silica nanoparticles on the macro and microstructure and properties of the final composites.
|
study
| 100.0 |
The FTIR spectra (Attenuated Total Reflectance mode) were recorded using a Perkin Elmer Spectrum (Akron, OH, USA) 100 with 16 scans per sample. The differential scanning calorimetry (DSC) and thermogravimetric analysis (TGA) were performed simultaneously by TGA-DSC Discovery of TA Instrument (New Castle, DE, USA). TGA was recorded for 50–500 °C at 10 °C/min under air atmosphere, while the DSC was run for 150–550 °C at 10 °C/min under nitrogen atmosphere, but the crucible lid was pierced seven times, allowing the gas to escape. SEM images were registered at high vacuum for secondary electrons with acceleration voltage of 1–5 kV, recorded by field-emission equipment JEOL JSM-7600F (Tokyo, Japan). The sample was dispersed by ultrasound bath in isopropyl alcohol.
|
study
| 100.0 |
The standard test of resistance to Trametes versicolor (CDBB-H-1051) followed the ASTM D-1413-07 test method for wood preservatives by laboratory soil-block cultures . The test-blocks, made of composite, were 2 cm on each face and were oven-dried and maintained in a desiccator until fungi impregnation. In order to cast such a composite-block, the composite-powder was agglutinated by adding acryl-styren resin Joncryl 1522 from BASF (Ludwigshafen, Germany). For comparison, a second viny-acrylic resin, called QV from POLIMEROS ESPECIALES (Cuautitlán Izcalli, Mexico) was applied as a film to cover the test-block surface over selected test blocks. All test-blocks were sterilized. The Malt Agar substrate was prepared with 2% Malt extract and 1.5% Agar, while the blind test contained just water and 1.5% Agar. The soil culture bottles were prepared with a 10 mm square fungus inoculum section, aged for three weeks, then placed over the wood feeder strip and incubated until it was covered by mycelium. Then these culture bottles were ready to receive the test blocks. After 12 weeks in the incubation room, the calculation of weight loss of every test block was performed according to Equation (1). (1)T1−T2T1×100 where T1 is the initial weight and T2 is the final weight.
|
study
| 99.94 |
The most intense absorption peaks of C20, Figure 1, are found in 3342 cm−1 due to OH frequency region of intramolecular hydrogen bond vibration of secondary alcohol C3–OH⋯O5 jointly with the 3277 cm−1 peak due to the similar vibration of C2 secondary alcohol , and within the area of 1200–1000 cm−1 several absorption peaks are present due to C–O stretching vibrations from the glucose ring skeletal vibration .
|
study
| 100.0 |
The weak antisymmetric vibration of C–O–C is in 1161 cm−1 of the glycoside links, while the 1106 cm−1 vibration is probably due to the C–O group which belongs to the same secondary alcohol as the one at the origin of the OH stretch mode at 3277 cm−1. The most intense band is in 1033 cm−1 due to C–O group of C6H2–O6H primary alcohols in dominant conformation, while its secondary conformation is observed in 1000 cm−1. The next band in 1055 cm−1 is due also to C–O group of C3–O3H secondary alcohols .
|
study
| 100.0 |
The FTIR spectrum of NSi looks very different from cellulose, Figure 1, since it only shows a very intense band in 1052 cm−1, due to asymmetric mode of Si–O–Si correlated with the next intense band due to symmetric mode of the same Si–O–Si found in 800 cm−1 while the weak band in 1741 cm−1 is related to C=O group vibration since NSi is a modified silica .
|
study
| 100.0 |
On the other hand, the FTIR spectra of composites CP1 and CP2, Figure 1, clearly shows that the band in 1741 cm−1 is only present in CP2, the composite of equal proportions of cellulose and silica, indicating that the organic matrix is segregating it and it is accepting no more than 43 wt % of NSi to disperse homogeneously into the fibers of the composite CP1. Such behavior is also observed in Figure 2, showing the scale only from 1800–750 cm−1 for zooming the weakest bands, where the spectrum of CP4 shows the same band of 1741 cm−1, meaning that the surface modification of pure cellulose to get AG20 is not affecting the fibers capacity to receive and disperse higher amounts of inorganic particles from 43 to 50 wt %.
|
study
| 100.0 |
Figure 3 shows the same scale as that of Figure 2, in order to compare the effect of surface modification by solvent exchange method in CP19 up to CP22, when the inorganic particle size is just 12 nm of ASi. Firstly, ASi shows a weak band in 978 cm−1, such band is absent in NSi. A study of fly ash activation reports an intense band in 989 cm−1 related to Si–O asymmetric stretching vibration, which explains that the lower wavenumber of this band was associated with a lower degree of crosslinking of the amorphous phase of silica . The same weak band appears in the composites between 980 and 983 cm−1. The CP20 spectrum looks much more like ASi than CP19 but CP21 and CP22 spectra look much more like the cellulose matrix or like CP19, indicating that the pure cellulose composites accept the inorganic particles up to 43 wt %, while the cellulose matrix modified by solvent-exchange method, AG20, disperses up to 50 wt % even retaining the cellulose characteristic vibration bands in CP22. Such behavior has been observed in previous works of this working group . The high amounts of inorganic nanoparticles and also the particle size dispersed into the AG20 matrix will affect also the thermal stability of the composites.
|
study
| 100.0 |
The weak band in 1635 cm−1 has been related to the fibers water absorption ; it was observed in C20, Figure 1, and even with less intensity in AG20, Figure 2, but it is practically not seen in Figure 3, thereby indicating that the fibers’ hydrophilic character was dramatically reduced, since hydroxyl groups exposition was hindered by the silica nanoparticles .
|
study
| 100.0 |
Some authors suggest that after surface modification of the fibers, the presence of peaks in the region near to 450, 800 and 1100 cm−1 indicate that chemical bonding between cellulose and silica nanoparticles is taking place, since the band in 1100 cm−1 is assigned to Si–O–C stretching vibration . In this study, even when no precursors of the inorganic nanoparticles were used and no crosslinking agent or catalyst was used, the characteristic vibration bands of cellulose and silica were observed in these hybrid composites produced in a facile synthesis way.
|
study
| 100.0 |
The dispersion of the reinforcers within the matrix C20 and AG20 in the composites was analyzed by scanning electron microscopy. The comparison of micrographs of CP2 vs. CP4 and CP20 vs. CP22 under 100,000 magnifications are shown in Figure 4. The micrograph of CP2 shows an aggregation of well delimited sphere shapes particles that are bigger than 300 nm while the CP4 micrograph shows, for the same magnification, a more continuous surface of such aggregation of sphere-shaped particles containing the biggest one of 150 nm. This comparison enabled us to consider that using the same quality of reinforcer, NSi, the composite resulting is affected by applying solvent exchange method to the pure matrix. Such a reaction could result in improved embedding of the filler within CP4 matrix, strengthened by the enhanced filler matrix interactions due to the matrix surface modification. However, the particle size distribution of every composite must be measured in the near future in order to clarify how this treatment is affecting the composites. The comparison of CP20 and CP22 focuses the attention on the effect of particle size since ASi is the filler that shows nearly one-tenth of NSi size. The micrograph of CP20 enabled us to see a more homogeneous distribution of particle size with values of 24 and 55 nm (not shown in picture) while the CP22 micrograph shows an even more continuous surface indicating that again the modification of the matrix has affected the distribution of filler giving place to a nice continuous morphology. In sum, we can say that using the filler of ASi (12 nm size) is very convenient for producing homogeneous composites when the matrix has been modified by a solvent exchange method such as AG20. Comparing the four composites micrographs allows us to see a progressive plasticizing effect that is clear in CP22 where the matrix is AG20 and the filler is ASi in 50 wt % content. This effect is very important to notice since no agglutinating resin was added in these composites.
|
study
| 100.0 |
Exactly the opposite effect has been observed in a study of cellulose acetate butyrate (CAB) and cellulose nanowhiskers (CNW) hybrids obtained with nearly the same method used by us. Under 25,000× the CAB looks neat and smooth on the contrary the nanocomposite containing 12 wt % of CNW under 50,000× shows voids and also dots considered as transversal sections of whiskers embedded in the matrix, the absence of aggregates at micrometer scale confirms the good dispersion of CNWs but no smooth surface or plasticized result is observed in these hybrid materials .
|
study
| 100.0 |
In order to determine the silica content in the composites, TGA measurement was carried out in air. Figure 5 shows the TGA curves of CP2, CP4, CP20 and CP22. In these samples, the thermal degradation occurs mainly at about 324 °C, but the most interesting point is the residual weight remaining at 500 °C. The composite CP20 of C20 matrix and ASi reinforcer contains residual weight of 47.3%, that is close to the nominal 50 wt % remanent according to the formulation indicating that this composite released 2.7 wt % more than expected. On the other hand, composite CP22 of AG20 matrix and ASi reinforcer contains residual weight of 53.7% indicating that this formulation retained 3.7 wt %, possibly due to the inorganic particles stabilization into the matrix fibers net. About composite CP2 of C20 matrix and NSi reinforcer according to the formulation 50 wt % of residual silica content must be expected, but this sample retains only 41% indicating again that 9% is released in excess, akin to CP20. In such C20 matrix samples, an excess of mass is released after 500 °C treatment. On the contrary, composite CP4 of AG20 matrix and NSi reinforcer releases only 38 wt % retaining 62 wt %, meaning that 12% more weight is retained in this composite in comparison with the calculated content of silica. An excess of weight is found in the composites of AG20 matrix after 500 °C treatment as in the case of CP22. An explanation of this large amount of residual mass in CP4 could relay in the thermal capability of NSi that can be shielding the composite matrix avoiding its complete thermal degradation due to the chemical functionalization of NSi that it is not the case for ASi.
|
study
| 100.0 |
The complete series of composites, 25, 50, 75 and 100 wt/wt, of C20 and AG20 matrix with the same reinforcer NSi was measured. The data comparison indicates that the residual mass amount even at 550 °C shows a trend from 20% up to 55% when 75% of reinforcer was added, but it differs significantly when the higher amount of filler is contained, 100%, meaning the 50% of composite total mass; when C20 is the matrix it delivers just 41% of residual mass while in AG20 matrix it is 62 wt %. Such a result suggests that the matrix treated by solvent exchange method is better stabilized by the reinforcer retaining more mass than the matrix that is just untreated.
|
study
| 100.0 |
Recent studies have been conducted of thermal degradation of pure cellulose microfibrils with no content of hemicelluloses, pectins and lignin informed by TGA and dTGA measurements under nitrogen gas the maximum of thermal degradation at 370 °C, but the complete thermal event starts at 250 finishing at 380 °C with 16 wt % of residual mass after 450 °C . While a study by TGA and dTGA of the same cellulose powder used in this work under the same heating rate shows its maximum thermal degradation at 317 °C, but the complete thermal event takes also from 270 to 340 °C with a residual mass of 4 wt % after 420 °C .
|
study
| 100.0 |
About the thermal stability of cellulose/silica hybrid composites, created by a sol-gel method using TEOS precursor of silica, bleached pulp and tungstophosphoric acid (H3PW12O40) (EPTA). The thermal degradation of the organic material was observed at 305 °C and at 345–350 °C for the hybrid materials indicating that with 51% (wt/wt) of SiO2 content in the cellulosic composites clearly confers higher thermal resistance to those materials. This communication also relates the thermal conductivity coefficient of these materials with the effect of silica content showing its capacity as conventional insulation material .
|
study
| 100.0 |
When using bacterial cellulose (BC) hydrogel for preparing composites with TEOS, the BC hydrogel was immersed into 10 and 20% aqueous TEOS dispersions delivering silica deposited on BC microfibrils via silanol. The TGA measurements indicated that thermal degradation occurs at 320 °C and after 500 °C the silica content was 43 wt % of the hybrid composite prepared with 20% TEOS. Those TGA curves look very similar to those of CP2 and CP4 of this work .
|
study
| 100.0 |
Another group of data also supports the synergy effect of the synthetic process, that it generates materials with new properties and potential applications. When SiO2 nanoparticles were chemically bonded on the surface of the cellulose fibers the thermal stability of these fibers was improved. Even a reduction of up to 50% in the moisture adsorption capacity of the modified cellulose fibers was observed . Although these study hybrid composites were produced by a very facile synthesis, its thermal behavior shows very competitive performance.
|
study
| 100.0 |
The results found by DSC are quite interesting, since it is reported that cellulose pyrolysis shows a clear endothermic peak around 350 °C, but at temperatures higher than 400 °C exothermal properties of the related reactions in cellulose pyrolysis were observed . In the present study, the effect of reinforce particle size on the same matrix, AG20, is analyzed on CP4 with NSi and CP22 with ASi, see Figure 6. The comparison of C20, AG20 against the composites shows a small endothermic peak around 310 °C: 306 in C20 and 311 in AG20 while in CP4 no endothermic peak was found but the degradation starts at 225 °C marking a clear difference with CP22 being the only composite that shows a small exothermic peak with maximum at 300 °C. When the temperature increased the next peak was exothermic, showing a clear shifting from 363 (C20) to 373 (AG20). CP22 and CP4 show that maximum in 347 and 349, respectively, but the last one also shows a shoulder found at lower temperature, 335 °C. The second exothermic peak shows a similar maximum among the composites and raw material: 505 (CP22), 507 (C20) and 511 (AG20), CP4 shows the maximum in 472 °C with the highest heat flow of all of them. In contrast, the composite with the lowest heat flow is CP22. The behavior of these composites is consistent with the mass loss observed by TGA measurements. Table 2 features the characteristic thermal events of selected composites and raw materials.
|
study
| 100.0 |
Among other working groups that have studied the degradation process of cellulose by DSC, one group found that degradation already starts at 220 °C, finishing at 475 °C with total mass loss of 97.6% . They related the pyrolysis onset temperature by DTA with the cellulose crystallinity index citing the publication of Ciolacu and Popa, when the cellulose shows the lowest crystallinity index the degradation takes place at lowest temperature but the heating rate must be also considered . The solvent exchange treatment brought better thermal stability to AG20 starting its thermal degradation 25 °C higher than pristine cellulose.
|
study
| 100.0 |
Another group that employed bleached pulp, TEOS and several catalysts to obtain hybrid materials by sol-gel method found, by TGA and DSC, that as the degree of the silica crosslinking increases the thermal stability of composites increases as well, even though the highest amount of silica incorporated was just 31.3% wt/wt. This explains that the endothermic peaks found in the region 310–340 °C correspond to segmental motions in the hybrid materials under degradation .
|
study
| 100.0 |
Considering the fact that the sol-gel method suggests covalent bonding between cellulose and silica in hybrids, we believe that no covalent bonding is present in our hybrid materials, since the thermal degradation starts with an exothermic peak in CP22, a rather electrostatic interaction takes place instead; however, dedicated work to clarify this effect is under progress.
|
study
| 99.94 |
The antifungal activities of the 4 samples of hybrid composites of CP22 composition were registered according to the ASTM D-1413 standard test method, just pure and with the film of QV 528 over some samples surface. Both images in Figure 7 show the comparison of Trametes versicolor growth on the composites cubes. The CP22 cube with no QV resin film coat shows no growth of fungi while CP22 with QV resin film shows just little overgrown by the test fungi. However, the weights record demonstrated that such QV resin is preserving the CP22 surface against the fungi attack since CP22 (a) shows a higher decrease of weight, 9%, while CP22 (b) decreased only 7.3 wt %. We must think about the chemical composition of each resin in order to explain this result. The acryl styrene resin (Joncryl) contains aromatic groups keeping the fungi growing at minimum since aromatics are toxic for the microorganism but the fungi can migrate into the composite bulk through the surface defects . On the other hand, the vinyl acrylic resin (QV) contains aliphatic groups mainly favoring the fungi growth but when the resin film is adhered over the composites surface covering its defects it rejects humidity adsorption preventing the fungi attack. The growth inhibition of Trametes versicolor in these hybrid composites can be related also to its water absorption capability, lower water absorption means lower fungus growth capacity but no water absorption standard test was performed on these composites. The antifungal effect is on the same order that the decay resistance to the same fungus when untreated southern yellow pine particles were blended with 10% urea formaldehyde resin under the AWPA E10-91 standard test method for solid wood showing weight loss of just 8.1% of the particle board total weight after 12 weeks exposure .
|
study
| 100.0 |
A comparison of enzymolysis degradation by cellulase of sisal fibers and sisal self- reinforced composites has shown that under cellulose-to-specimen weight ratio of 1% after 10 h of reaction the composites are less susceptible to enzyme aided biodegradation than the fibers. The buffer solution of cellulase can only immigrate into the composite bulk through surface defects indicating low reaction probability .
|
study
| 100.0 |
The same standard test D1413 was applied to wood plastic composites (WPC), specimens prepared by hot press system with 40% polypropylene and 60% particles of pine, maple or oak wt/wt. After 12 weeks of Trametes versicolor exposure, the maple samples showed 16 wt % loss while the oak samples showed 13 wt % loss . All these cases have shown lower resistance to T. versicolor than the composites prepared by our method.
|
study
| 99.94 |
On the other hand, these kinds of composites could be also used to protect paper artwork from deterioration of Aspergillus versicolor growth applying a thin film of composite to prevent the re-growth of fungi after cleaning the paper surface by microwave heating that has recently been reported by an Italian research group .
|
other
| 99.9 |
An environmentally friendly one-pot method was designed after the percolation approach for avoiding the grafting of molecules to the cellulose surface or the functionalization of the inorganic filler, silica nanoparticles. The key step of this work is using the solvent exchange strategy for not drying the cellulose matrix, keeping the voids of biopolymer net to host the inorganic nanoparticles. The surface modification of cellulose by this method allowed the observation of its macroscopic hydrophobicity providing compatibility with the inorganic reinforcer up to 50 wt % registered by SEM images. Even when no contact angles of the samples were measured, we can say that the nanocomposite itself shows hydrophobic behavior hindering the fungal growth, thereby demonstrating high capability to use this material in exteriors such as building façades or as thermal insulator fillers, even when the material is not an aerogel.
|
study
| 100.0 |
This facile and cost-effective synthetic method prepares an uncommon kind of nanocomposite, since cellulose from several sources and varied types of particles and sizes are commonly used for reinforcing synthetic polymers or other biopolymers such as starch, but it is not commonly used as matrix, except for all cellulose composites . Also, the simplicity of the applied method opens up the possibility for application in high-volume processes of polymers that nowadays require the ability to withstand higher temperatures.
|
other
| 58.3 |
Acute lung injury (ALI) and the more severe form termed acute respiratory distress syndrome (ARDS) are associated with an estimated mortality of 40–50%1. Causes of ALI may be direct (pneumonia, aspiration, inhalational injury, etc.) or indirect (sepsis, pancreatitis, blood transfusion, etc.). ALI is characterized by increased vascular permeability caused by dysfunction of the alveolar-capillary membrane, lung edema, neutrophil-derived inflammation, and surfactant dysfunction2. During the course of ALI/ARDS, resident lung cells such as alveolar macrophages (AMΦ) are stimulated to release chemoattractants, which recruit inflammatory cells to migrate from the intravascular space across the endothelium and epithelium into the airspaces3.
|
review
| 99.75 |
Macrophage activation in response to microbial infection depends on Toll-like receptors (TLRs), which are a family of pattern recognition receptors (PRRs) and key regulators of both innate and adaptive immunity4. TLRs are among the most well-studied PRRs because of their ability to detect a variety of pathogen-associated molecular patterns (PAMPs), such as lipids, proteins, lipoproteins, and nucleic acids56. To date, 10 human and 12 murine TLRs have been identified, and each TLR has a specific set of ligands. Specifically, TLR4 recognizes the lipopolysaccharide (LPS) of gram-negative bacteria78, while TLR3 recognizes viral double-stranded RNA (dsRNA), which is a common intermediate of viral replication and a potent indicator of infection. TLR3 also responds to the synthetic analog polyriboinosinic:polyribocytidylic acid (poly (I:C)) to induce type I interferon (IFN) and inflammatory cytokine/chemokine production910. TLR3 is expressed on immune cells, including myeloid dendritic cells (DCs) and macrophages, as well as non-immune cells such as fibroblasts, epithelial cells, and neurons11. Macrophages express TLR3 both on their cell surface and in the early endosome. Although TLR3 on the cell surface participates in dsRNA recognition, TLR3-mediated signaling is initiated from the endosomal compartment1213. In addition, RNA released from damaged cells or mRNA can also be recognized by TLR31415. Several studies in TLR3-deficient mice have demonstrated that TLR3 participates in the generation of protective immunity against some viral infections. Numerous studies have documented the importance of TLR cross talk, and multiple signaling pathways contribute to synergistic TLR ligand-dependent cytokine expression. In 2001, Alexopoulou L. et al.16 reported in Nature that following an intraperitoneal injection of LPS into mice, dramatic up-regulation of the expression of TLR3 mRNA was observed in all tissues except the thymus, suggesting that the expression of TLR3 is inducible. Of note, a particularly high expression level of TLR mRNA was observed in lung tissue. These results raised the possibility that bacterial infection can induce sensitivity to viral infection. This observation prompted us to further investigate the mechanism of TLR4-TLR3 cross talk in AMΦ.
|
study
| 99.94 |
In the present study, using both an in vivo ALI mouse model and the in vitro culture of AMΦ from TLR4−/− and MyD88−/− mice, we demonstrate that LPS up-regulation of TLR3 in AMΦ is dependent on TLR4-MyD88-NF-κB signaling. The functional relevance of the amplification in TLR4-induced TLR3 expression in AMΦ was demonstrated by a marked increase in the expression of the chemokines and cytokines, including macrophage inflammatory protein-2 (MIP-2), macrophage chemoattractant protein-1 (MCP-1), tumor necrosis factor-alpha (TNF-α), and interleukin-6 (IL-6), in the ALI mouse model. Furthermore, we observed alveolar-capillary permeability and the induction of polymorphonuclear leukocyte (PMN) migration in response to sequential challenges with LPS and Poly I:C. Thus, TLR3 up-regulation in AMΦ is dependent on TLR4-MyD88-NF-κB signaling, which may represent an important mechanism responsible for amplifying PMN migration.
|
study
| 100.0 |
To detect the expression of TLR3 in LPS-induced AMΦ, which were isolated from the bronchoalveolar lavage fluid (BALF) of wild-type (WT) mice, LPS was administered at 5 different dosages (0, 0.01, 0.1, 1, and 10 μg/ml). TLR3 expression increased with 0.1 μg/ml but was markedly increased following treatment with 1 μg/ml LPS, and the increase in TLR3 expression trended back to the basal level at 10 μg/ml LPS (Fig. 1A,B). As shown in Fig. 1C, a 1 μg/ml LPS challenge of AMΦ from WT mice was associated with an increase in TLR3 protein expression at 4 h and a more marked increase at 6 h, while the increase in TLR3 expression trended back to the basal level at 8 h. The TLR3 mRNA expression changes shown in Fig. 1D paralleled the protein expression changes. In addition, we obtained the same results using quantitative PCR (Fig. 1E,F). These results suggest that LPS, a TLR4 ligand, can induce TLR3 expression in AMΦ.
|
study
| 100.0 |
As shown in Fig. 2A, LPS (1 μg/ml) challenge of AMΦ, which were isolated from WT mice, resulted in an increase in TLR3 protein expression at 4 h and a marked increase at 6 h. However, in AMΦ from TLR4−/− mice, LPS failed to induce TLR3 expression (Fig. 2A), indicating that TLR4 signaling mediates the LPS-induced up-regulation of TLR3. All TLRs, with the exception of TLR3, utilize MyD88, and TLR4/MyD88 signaling pathway is the primary signaling pathway used to induce the expression of pro-inflammatory cytokines17. However, TLR4 can signal through both MyD88-dependent and -independent pathways, and the MyD88-independent signaling for TLR4 results in the production of type I IFNs18. To address the role of MyD88 in mediating the LPS-TLR4-induced up-regulation of TLR3, LPS (1 μg/ml) was administered to AMΦ from MyD88−/− mice, and TLR3 expression was assessed. As shown in Fig. 2A, MyD88 deficiency prevented LPS-induced up-regulation of TLR3. The changes in the mRNA expression of TLR3 are shown in Fig. 2B, and these results corresponded to the observed changes in protein expression. As shown in Fig. 2C, the localization of TLR3 was further investigated in AMΦ by immunofluorescence. In the absence of LPS, TLR3 was found within small vesicles throughout the cytoplasm. TLR3-containing vesicles increased in a time-dependent manner in AMΦ from WT mice, but not in TLR4−/− or Myd88−/− mice, and similar results were observed using quantitative PCR (Fig. 2D).
|
study
| 100.0 |
Activation of both NF-κB and MAPK can occur in the presence of MyD88. NF-κB p65 was detected using nuclear protein extracts from AMΦ to determine whether LPS-TLR4 up-regulation of TLR3 was the result of activation of NF-κB. As shown in Fig. 3A, in response to LPS in WT mice, the expression of NF-κB p65 increased at 2.5 h and reached a significant level at 4.5 h. However, in TLR4−/− mice, LPS failed to induce nuclear NF-κB p65 expression.
|
study
| 100.0 |
To address the role of NF-κB in mediating the LPS-induced up-regulation of TLR3, we determined the effects of IKK-NBD, an NF-κB inhibitor1920, on LPS-induced TLR3 expression in AMΦ. As shown in Fig. 3B,C, IKK-NBD (100 μM) prevented the LPS-induced up-regulation of TLR3 mRNA and protein expression in AMΦ isolated from WT mice. We observed similar results by quantitative PCR (Fig. 3D). These results demonstrate that NF-κB signaling plays a role in mediating TLR4-TLR3 cross talk.
|
study
| 100.0 |
To address the physiological relevance of LPS/TLR4 activation and TLR3 expression in AMΦ, we assessed MIP-2 expression in the lungs using sequential challenges of LPS and Poly I:C. Injection of LPS at time 0 followed by a saline injection (Group 3) at 4 h resulted in a marked increase in MIP-2 expression by 6 h after LPS challenge, which was further increased at 8 h and then returned to the basal level by 10 h after LPS challenge (Fig. 4A). Saline injection at time 0 and Poly I:C injection (5 μg/g body weight, intratracheally administered) (Group 2) at 4 h caused a very small increase in MIP-2 expression. However, the sequential injection of LPS at time 0 and Poly I:C injection at 4 h (at a time when TLR3 was up-regulated) (Group 4) stimulated augmented MIP-2 expression compared with single LPS (Group 3) or Poly I:C (Group 2) challenge (Fig. 4A). In contrast, the sequential injection of Poly I:C at 4 h after LPS failed to induce increased MIP-2 expression in TLR4−/− mice (Group 5) compared with single Poly I:C challenge (Group 2) (Fig. 4A), and sequential challenge with Poly I:C after LPS caused only a similar increase as that observed for LPS alone in TLR3−/− mice (Group 6). The changes in the mRNA expression of MIP-2 shown in Fig. 4B paralleled those observed for protein expression.
|
study
| 100.0 |
Because AMΦ production of chemokines, such as MIP-2, is an important determinant of PMN migration, we also addressed the role of LPS/TLR4-mediated up-regulation of TLR3 in regulating PMN migration in the lungs. PMNs were counted in the BALF of WT, TLR4−/−, and TLR3−/− mice. In the LPS (Group 3) and Poly I:C (Group 2) only injection groups, MIP-2 caused a slight increase in PMN migration in WT mice when compared with the saline control (Group 1). Sequential injection of Poly I:C at 4 h after the initial LPS injection (Group 4) markedly increased PMN migration in WT mice compared with the other groups. However, sequential challenge with LPS and Poly I:C did not significantly increase PMN migration in TLR4−/− mice compared with WT mice (Fig. 5). Moreover, there was a similar increase in AMΦ after sequential challenge with LPS and Poly I:C in TLR3−/− mice (Group 6) when compared to LPS alone (Group 3). Additionally, the observed MIP-2 expression level in the lung was consistent with PMN migration. Together, these data show the important role of TLR4 signaling and AMΦ MIP-2 expression in mediating PMN migration in response to the up-regulation of TLR3 expression.
|
study
| 100.0 |
To address the effect of LPS/TLR4-mediated activation of TLR3 in AMΦ on inflammatory cytokines, we assessed TNF-α and IL-6 in the serum and BALF, as well as the chemokines MIP-2 and MCP-1 in the BALF, following sequential intratracheal challenges with LPS and Poly I:C. In the ALI animal model, LPS was injected intratracheally at time 0, and Poly I:C was injected intratracheally at 4 h (the time point when TLR3 was up-regulated in AMΦ as described above). Enzyme-linked immunosorbent assays (ELISAs) were used to assess MIP-2 and MCP-1 in the BALF as well as IL-6 and TNF-α in both the BALF and serum at 8 h. LPS (Group 3) or Poly I:C (Group 2) alone induced a slight increase in MIP-2, MCP-1, IL-6, and TNF-α when compared with the saline control (Group 1) (Fig. 6), whereas sequential challenge with LPS and Poly I:C (Group 4) stimulated a marked increase in MIP-2, MCP-1, IL-6, and TNF-α expression. However, the sequential challenge with LPS and Poly I:C did not significantly increase MIP-2, MCP-1, IL-6, and TNF-α in TLR4−/− mice (Group 5) when compared to WT mice (Group 4). The sequential challenge with LPS and Poly I:C also led to a similar increase in TLR3−/− mice (Group 6) when compared to the LPS alone group (Group 3) (Fig. 6).
|
study
| 100.0 |
Because chemokine-dependent PMN migration and inflammatory cytokine secretion are important determinants of ALI, we next addressed the role of LPS/TLR4-mediated up-regulation of TLR3 in alveolar-capillary permeability using Evan’s blue, which binds albumin, in WT, TLR4−/−, and TLR3−/− mice. We assessed permeability at 4, 6, 8, and 10 h after LPS/Poly I:C administration. As shown in Fig. 7A, at the 8 h time point, either LPS (Group 3) or Poly I:C (Group 2) alone caused a slight increase in permeability in WT mice when compared to the saline (SAL) control (Group 1). In contrast, LPS/Poly I:C (Group 4) caused a further increase in alveolar-capillary permeability in WT mice when compared with the LPS/SAL group. In TLR4−/− mice (Group 5), alveolar-capillary permeability was markedly attenuated in response to LPS/Poly I:C challenge compared with WT mice (Group 4). The alveolar-capillary permeability was similar to the results observed for LPS alone (Group 3) when TLR3−/− mice were used (Group 6). As shown in Fig. 7B, the histopathology of lung tissues was also assessed 8 h following LPS/Poly I:C administration. Injection of LPS at time 0 followed by a saline injection (Group 3) at 4 h caused marked changes in lung histopathology at 8 h. A saline injection at time 0 and a Poly I:C injection (5 μg/g body weight, intratracheally administered) at 4 h resulted in minimal changes (Group 2). However, the sequential injection of LPS at time 0 and Poly I:C injection at 4 h (at a time when TLR3 was up-regulated) in WT mice (Group 4) led to augmented changes in histopathology, including diffuse interstitial edema and inflammatory cell infiltration, compared with the single LPS or Poly I:C challenge. In contrast, the sequential injection of Poly I:C at 4 h after LPS failed to induce augmented histopathology changes in TLR4−/− mice (Group 5) compared with WT mice. In addition, we did not observe augmented histopathology changes in TLR3 mice (Group 6) and instead observed a change similar to that observed for LPS alone (Group 3). Taken together, these data show the important role of LPS/TLR4 signaling in the up-regulation of TLR3 expression in ALI.
|
study
| 99.94 |
AMΦ, which are located in the alveolar compartment of the lungs, provide a key initiation signal for ALI212223. Previous studies have shown that the later phase of ALI is neutrophil-dependent24, while AMΦ contribute to the acute phase of lung injury. Once activated by bacteria or viruses, AMΦ generate and release a multitude of mediators, such as cytokines (IL-6, TNF-α) and chemokines (MCP-1, MIP-2)2526. These mediators act as chemoattractants for the migration of large numbers of activated inflammatory cells, such as monocytes and neutrophils, into the airspaces27.
|
study
| 99.94 |
Synergy between viral and bacterial TLR signaling, which leads to amplification of the inflammatory response, has been reported previously28. Additionally, Tian X. et al. found that Poly I:C enhanced susceptibility to secondary pulmonary infections by bacteria29. Co-stimulation with LPS and Poly I:C markedly enhances the immune response, although the mechanism for this combined effect remains poorly understood. Alexopoulou L. et al.16 found that when LPS was injected intraperitoneally, TLR3 expression in lung tissue was dramatically up-regulated, which suggests that the expression of TLR3 is inducible. Pan et al.30 provided direct evidence that LPS induces TLR3 expression via a TLR4-MyD88-IRAK-TRAF6-NF-κB-dependent signaling pathway in human peripheral blood monocytes and monocytic cell lines, such as THP-1 cells. Furthermore, we observed that LPS could induce TLR3 expression in a dose- and time-dependent manner in AMΦ. The stimulation of TLR4 by LPS induces the release of critical proinflammatory cytokines that are necessary to activate a potent immune response. Indeed, LPS/TLR4 signaling has been intensively studied in recent years313233. In our study, the role of TLR4 signaling in regulating TLR3 expression was clearly shown using TLR4−/− mice. LPS challenge in WT mice induced the up-regulation of TLR3, whereas this response was impaired in TLR4−/− mice. The major adaptor molecules that bind to the intracellular domain of TLR4 are MyD88 and TRIF3435, and our results showed that MyD88 mediated the TLR4-TLR3 cross talk, as LPS challenge of MyD88−/− mice failed to induce TLR3 expression. Furthermore, the activation of NF-κB was associated with an increase in TLR3 expression after LPS challenge and a reduced expression of TLR3 in AMΦ in which NF-κB was inhibited by IKK-NBD. Therefore, these results demonstrate an important role for TLR4-MyD88-NF-κB in mediating TLR3 expression.
|
study
| 100.0 |
ALI is caused by an uncontrolled systemic inflammatory response that results from direct (aspiration, pneumonia, ventilation-induced lung injury, etc.) or indirect injury (sepsis, hemorrhagic shock, etc.), leading to the activation of AMΦ and the sequestration of neutrophils3. Excessive recruitment of leukocytes is critical to the pathogenesis of ALI. Neutrophils are the first leukocytes to be recruited to sites of inflammation in response to chemokines released by activated AMΦ36. Specifically, stimulation of AMΦ leads to the release of chemokines, which induce neutrophils to migrate from the intravascular space across the endothelium and epithelium into the airspaces27. According to the relative position of the cysteine residues, chemokines have been classified into four subfamilies (CXC, CC, C, and CX3C). Among these, MIP-2, which is also known as CXCL2, is thought to play a major role in mediating neutrophil recruitment37. Belperio J.A. et al.38 found that lung expression of MIP-2 was correlated with lung injury and neutrophil sequestration during the pathogenesis of ventilation-induced lung injury, and CXCR2−/− mice show a marked reduction in neutrophil sequestration and lung injury. Additionally, MIP-2 was shown to be up-regulated in the lungs and BALF of animals, which was associated with neutrophil accumulation in the lungs after LPS administration394041. Furthermore, Villar J. et al. showed that a CXCL2 polymorphism is associated with better outcomes in patients with severe sepsis42. In the present study, we observed that LPS/TLR4 signaling up-regulated TLR3 expression in AMΦ. This cross talk between TLR4 and TLR3 in AMΦ resulted in the amplification of cytokine (IL-6, TNF-α) and chemokine (MIP-2, MCP-1) expression in response to LPS and Poly I:C, which activate TLR4 and TLR3, respectively, and subsequently led to enhanced PMN sequestration into the lung, which was found to be correlated with ALI based on the assessment of alveolar-capillary permeability and histological sections of lung tissue. Thus, the present study demonstrates a novel mechanism by which LPS can induce AMΦ to up-regulate TLR3 expression, through a TLR4-Myd88-NF-κB-dependent pathway, thereby sensitizing AMΦ to TLR3 ligands and promoting enhanced lung inflammation (Fig. 8).
|
study
| 100.0 |
In clinical scenarios, a variety of pathogens are involved in lung infections. In particular, viral infections are a significant risk factor for acquiring bacterial infections4344. TLR3 is thought to be a major mediator of the cellular response to viral infection, because it responds to dsRNA, a common by-product of viral replication45. TLR3 has been implicated in infections by mouse cytomegalovirus (MCMV), reoviruses, lymphocytic choriomeningitis virus (LCMV), and influenza A virus (IAV)9. TLR3−/− mice are more resistant to lethal West Nile virus, a mosquito-borne ssRNA flavivirus, which causes human disease of variable severity46, and show reduced inflammation and lethality upon IAV infection4748. Thus, up-regulation of TLR3 may contribute to an increased lung immune response to viral infection following a bacterial infection. Despite the relatively well-known role of viral infections in promoting bacterial infections, it is still not clear whether bacterial infections also promote viral infections. Therefore, our results are the first to offer new insight into this topic. There is also a growing body of evidence showing that most patients have a mixture of bacterial and viral infection4950, and the cross talk between TLR4 and TLR3 induces a synergistic inflammatory response in cases of mixed infection. Cameron R.J. et al.49 found that bacterial and viral pathogens interact to cause additional increases in inflammatory markers and an exacerbation of disease severity in patients with chronic obstructive pulmonary disease (COPD). TLR3 has been shown to respond to dsRNA, a replication intermediary for many viruses, but the heterologous RNA released from necrotic cells or that is generated by in vitro transcription, such as mRNA, also stimulates TLR3 signaling and induces immune activation. Indeed, Cavassani KA15 observed TLR3 activation during experimental polymicrobial sepsis and ischemia gut injury in the absence of an exogenous viral stimulus, and TLR3−/− mice were protected from the lethal effects of sustained inflammation. Moreover, treatment with a TLR3 antibody could attenuate the tissue injury associated with gut ischemia and significantly decrease sepsis-induced mortality. Therefore, TLR3 serves as a regulator of the amplification of the immune response as well as an endogenous sensor of necrosis, independent of viral activation. Our study showed that up-regulation of TLR3 significantly amplified IL-6, TNF-α, MCP-1, and MIP-2 expression, which then enhanced PMN migration and finally led to ALI.
|
study
| 99.94 |
TLR cross talk has obvious advantages for the host in protecting against infectious agents, because it enhances the initial immune reaction to pathogen infection and better primes the host for mounting a more robust adaptive immune response. The concept that multiple TLR-ligand interactions are required for effective host resistance to pathogens has important implications for the design of vaccinations and immunotherapies against infectious diseases. Several studies have convincingly shown the improved efficacy of treatment with multiple TLR ligands compared with single TLR ligands in stimulating cellular immune responses in vivo. For example, co-administration of poly I:C and CpG ODNs increased serum cytokine production in a mouse tumor model when compared to the administration of either of the ligands alone51. Bone-marrow-derived DCs exposed to both poly I:C and a TLR7 ligand more effectively stimulated cytotoxic T lymphocyte responses compared to DCs exposed to either TLR ligand alone52. These studies provide an important conceptual foundation to examine the protective efficacy of multiple TLR-ligand combinations in vaccines against infectious diseases. However, synergistic amplification of the inflammation response may be detrimental, because it can result in immune over-activation, which hampers immune homeostasis. As a consequence of an overactive response, the function of various organ systems may be compromised, resulting in multiple organ dysfunction syndrome (MODS) and death. Cytokines (TNF-α and IL-6) are important components of the immune system because they act as messengers between cells, but they are also involved in many pathological aspects of the cascade leading to systemic inflammatory response syndrome (SIRS) and ultimately MODS. According to the two-hit hypothesis53, patients who survive the initial inflammatory insult may die following a relatively minor second event that would not normally be life-threatening. In this study, viral (poly I:C) stimulation as a relatively minor secondary insult, led to an exaggerated secondary inflammatory response. Thus, understanding the mechanism of this two-hit phenomenon may help to devise novel therapeutic strategies to prevent overwhelming and life-threatening inflammatory conditions such as septic shock and trauma-induced SIRS.
|
study
| 99.94 |
Male C57BL/6 wild type mice were purchased from the Laboratory Animal Research Center of Shanghai. TLR4 knockout (TLR4−/−) mice, MyD88 knockout (MyD88−/−) mice and TLR3 knockout (TLR3−/−) were obtained from Dr. Billiar’s lab at the University of Pittsburgh. All mice used are on a C57BL/6 background. All experimental protocols involving animals were approved by Institution Animals Care and Use Committee of Tongji and Pittsburgh University. The experiments were performed in accordance with the National Institutes of Health Guidelines for the Use of Laboratory Animals. Mice were 8–12 weeks of age at the time of experiments and were maintained on standard rodent chow and water ad libitum. Animals were anesthetized with 100 mg/kg ketamine and 10 mg/kg xylazine administered intraperitoneally. Animals were intratracheally administered LPS (5 μg/g body wt; Escherichia coli O111:B4; Sigma, St. Louis, MO) in 50 μl of saline (SAL) or SAL at first time, then after 4 h intratracheally administered Poly I:C (5 μg/g body wt; 31852-29-6; Invivogen) in 50 μl of saline (SAL) or SAL alone at the second time using a MicroSpray syringe. The animals were randomly in one of four groups: SAL/SAL, SAL/Poly I:C, LPS/SAL, and LPS/Poly I:C. At various time points, a 20G sterile catheter was inserted into the trachea to collect bronchoalveolar lavage fluid (BALF) as previously described54. Blood samples were immediately obtained by cardiac puncture and transferred to the laboratory for analysis of cytokines (IL-6, TNF-α), chemokines (MIP-2, MCP-1) in serum and BALF by ELISA. PMN counts in BALF were determined on Wright-Giemsa-stained slides. Briefly, total cell counts were determined on a grid hemocytometer. Then a total of 500 cells were counted in cross-section per sample, and the number of PMNs was calculated as the total cell count times the percentage in the BALF sample. The lungs were rapidly removed from all mice and washed in ice-cold saline. Half of the lung tissues were stored at −80 °C prior to biochemical analyses including MIP-2 expression in lung lysates was measured by Western blotting and RT-PCR, while the other half of the lung tissue was fixed in 4% formalin solution in preparation for histopathological analyses. For histological analysis, lung tissue samples were fixed in 4% paraformaldehyde in PBS overnight at 4 °C. The samples were then dehydrated, embedded in paraffin, and cut into 5 μm sections. After deparaffinization, the tissues were stained with hematoxylin and eosin (H&E) for histological analysis. Lung sections were scored for lung injury, including the following: (1) alveolar and capillary edema, (2) intravascular and peri-bronchial influx of inflammatory cells, (3) thickness of the alveolar wall, and (4) hemorrhage. The items were semiquantitatively scored as none, minimal, light, moderate, or severe (score 0, 1, 2, 3 or 4, respectively) by a pathologist blinded to the experimental group. The lung injury score was obtained by averaging the score from the animals within each group.
|
study
| 100.0 |
BAL was performed as previously described54. Normally, the BAL fluid contains ~91% of AMΦ and ~9% of other cells, including PMN and lymphocytes. The immunomagnetic separation system was used to isolate AMΦ. Magnetic nanoparticle-conjugated antibody (CD11b MicroBeads, Miltenyi Biotec) was chosen to label and remove PMN and lymphocytes. The resulting cells consisted of >98% macrophages, and cell viability was >95%. AMΦ from wild type, TLR4−/−, TLR3−/− and MyD88−/− mice were cultured in DMEM containing 10% FBS and 10 μl/ml penicillin/streptomycin for 2 days, then they were washed three times with PBS and the medium was changed to low-serum medium (1% FBS). Cells were stimulated with LPS (NC, 0.01, 0.1, 1, 10 μg/ml) for 0–8 h in DMEM containing 10% FBS at a concentration of 1 × 106 cells/ml of medium. TLR3 expression in the AMΦ lysates was measured by Western blotting and RT-PCR.
|
study
| 100.0 |
Alveolar-capillary permeability was assessed with Evans blue albumin (EBA) as previous described5455. Evans blue (0.5% EB, Sigma-Aldrich, St Louis, MO, USA) was dissolved in Ca2+/Mg2+-free phosphate-buffered saline (PBS; Sigma-Aldrich), and conjugated to albumin (4% EBA) that was prepared by adding bovine serum albumin (Sigma-Aldrich). After thoroughly dissolving by gently stirring with a magnetic bar, the EBA solution was filtered through a 0.22 μm syringe filter and aliquots were stored at −80 °C until use. Each aliquot was used only once for each experiment. To evaluate alveolar-capillary barrier function, EBA (25 mg/kg body weight) was injected into the internal jugular vein 1 h before euthanasia and lung harvesting. Blood samples were obtained from the right heart, and the pulmonary vasculature was subsequently infused with 1 mL PBS. The right lung was ligated at the level of the right mainstem bronchus, excised, blotted dry, weighed and stored in liquid nitrogen until these samples were used for EBA analysis. After freeze/thaw, the lung tissue was homogenized in 2 mL PBS and incubated with an additional 2 mL of formamide (Sigma-Aldrich) (18 h; 60 °C). Formamide extracts were centrifuged (15,000 g × 30 min; 4 °C), and the centrifuged supernatants were collected to quantify lung EBA content using a dual-wavelength (620 nm and 740 nm) spectrophotometric method. Pulmonary EBA absorbance at 620 nm was corrected by a correction factor with EBA absorbance at 740 nm. The EBA permeability index was calculated by dividing pulmonary EBA absorbance at 620 nm/g of lung tissue by plasma EBA absorbance at 620 nm.
|
study
| 100.0 |
Nuclear protein extracts were prepared from AMΦ following the kit instructions of Thermo Scientific (NE-PER Nuclear and Cytoplasmic Extraction Reagents, 78833, Thermo Fisher). AMΦ were harvested with trypsin-EDTA and then centrifuge at 500 × g for 5 minutes. After washing cells twice with PBS, pellet by centrifugation at 500 × g for 3 minutes and discarded the supernatant. Adding CER I (protease inhibitors and PMSF) to the cell pellet, vortex the tube vigorously for 15 s, then incubated the tube on ice for 10 minutes. Added CER II to the tube and vortex for 5 s on the highest setting, incubated the tube on ice for 1 minute. The tube was centrifuged for 5 minutes at 16,000 × g, then transferred the supernatant (cytoplasmic extract) to a clean pre-chilled tube. Nuclei pellet was suspended in NER and vortex for 15 s. Placed the sample on ice and continued vortexing for 15 s every 10 minutes, for a total of 40 minutes. After centrifuged at 16,000 × g for 10 minutes, supernatants containing nuclear proteins were frozen in liquid nitrogen in small aliquots and store at −80 °C. Protein quantification was performed using BCA protein assay.
|
study
| 99.94 |
AMΦ and lung tissues were lysated in radio-immunoprecipitation lysis buffer (RIPA), protease inhibitors (Roche, Mannheim, Germany) and phenylmethylsulfonyl fluoride (PMSF). Protein concentrations were subsequently determined by standard BCA assay. After addition of 6 × sodium dodecyl sulfate (SDS) loading buffer, equivalent amounts of protein were heated (100 °C; 5 min) and separated by gel electrophoresis using a 10% SDS-polyacrylamide electrophoresis gel. Resolved proteins were then transferred to a nitrocellulose membrane and blocked with Tris-buffered saline containing Tween-20 (TBST) and 5% nonfat milk (1 h; 24 °C). Nitrocellulose membranes were incubated overnight at 4 °C with primary antibody against TLR3 (ab62566; Abcam, Hong Kong, China), NF-κB p65 (ab7970, Abcam, Hong Kong, China), Abcam, MIP-2 (ab25130, Hong Kong, China), PCNA (ab18197, Abcam, Hong Kong, China) and β-actin (ab8226, Abcam, Hong Kong, China). The membranes were washed in TBST three times, incubated with secondary antibody (926-32221 IRDye 680 mouse-anti-rabbit secondary antibody; Licor Biosciences, Lincoln, NE, USA) for 1 h at 37 °C and then washed in TBST three additional times. The membranes were determined by using an Odyssey image analysis system (Licor Biosciences). Western blots were quantitated using Quantity One software (Bio-Rad, Foster City, CA, USA) and normalized to β-actin and PCNA signal.
|
study
| 100.0 |
Total RNA was extracted from AMΦ and lung tissues using the TRIzol reagent (Sigma-Aldrich) and following the manufacturer’s instructions. Total RNA was then reverse transcribed using a PrimeScript RT reagent kit (TaKaRa Bio Inc. Shiga, Japan). Primers for TLR3 amplification (162 bp) were: position 91 forward 5′-GTGAGATACAACGTAGCTGACTG-3′, position 231 reverse 5′-TCCTGCATCCAAGATAGCAAGT-3′. Primers for MIP-2 amplification (108 bp) were: position 62 forward 5′-CCAACCACCAGGCTACAGG-3′, position 169 reverse 5′-GCGTCACACTCAAGCTCTG-3′. Primers for β-actin amplification (154 bp) were: position 163 forward 5′-GGCTGTATTCCCCTCCATCG-3′, position 295 reverse 5′-CCAGTTGGTAACAATGCCATGT-3′. The product of reverse transcription was amplified by following the Premix Taq Version 2.0 instructions (TaKaRa Bio Inc.). PCR products were separated using a 2% agarose gel and identified by SYBR green staining. Expression of mRNA was quantitated using Image Lab software (Bio-Rad) and normalized to the β-actin signal.
|
study
| 99.94 |
Quantitative real-time PCR (qPCR) reactions were performed using Fast SYBR Green Master Mix (Thermo Fisher) in Applied Biosystems 7900HT Fast Real-Time PCR system according to the manufacturer’s instructions. The cycling conditions were 95 °C for 10 min followed by 40 cycles of 95 °C for 10 s, 60 °C for 30 s. At the end of the last cycle, the temperature was increased from 65 °C to 95 °C (0.1 °C/s) to produce a melting curve. The specificity of amplification was assessed for each sample by melting curve analysis. Each PCR product showed a single peak. The size of the amplicon was checked by electrophoresis. Agarose gel electrophoresis revealed a single product of the expected size. The analysis of the expression of TLR3 relative to the β-actin was performed with software in relative quantification mode following the manufacturer’s instruction. The following criteria of sequences of all primers used in this study were applied in the course of designing the primers: product size from 100 to 500 bp, primer size from 17 to 23 bp, and a mean melting temperature of 60 °C.
|
study
| 100.0 |
AMΦ were cultured for a defined time period, fixed in 4% paraformaldehye/1 × PBS for 15 min. Cells were washed three timers with 1 × PBS and permeabilized using 0.1% Triton X-100 in 1 × PBS, and blocked with 5% BSA for 45 min and sequentially administered primary antibody and secondary antibody (Alexa-488-conjugated donkey anti rabbit secondary antibody). Nuclei were stained with DAPI for immunofluoresence analysis. Stained cells were examined and recorded using EVOSfl fluorescence microscopy.
|
study
| 99.94 |
The Data are presented as the means ± SEM of the indicated number of experiments and analyzed using ANOVA; post hoc testing was performed using the Bonferroni modification of the t-test. The individual studies performed throughout this work represent at least five independent studies. Power analyses were performed by using a Type I error probability of 0.05, with a power of 0.9, to determine the sample size necessary to reject the null hypothesis. All statistical analyses were carried out using the GraphPad Prism 5 program.
|
study
| 99.94 |
In recent years, driven by the rise of wireless sensor network, Internet of things, Radio Vehicular Networks , Cloud Systems and other Cyber-Physical Systems, the development of radio frequency identification (RFID) industries has reached a new milestone. It makes the breakthrough progress in all areas of production and life, especially in the financial payment, retail supply chain, clothing supply chain, logistics, and product traceability. Those followed by the gradually expanding of RFID market. IDTechEx found that in 2015, the total RFID market was worth $10.1 billion, up from $9.5 billion in 2014 and $8.8 billion in 2013, and it will rise to $13.2 billion in 2020. As a result, the appetite for funding for RFID technology is growing rapidly. According to PrivCo statistics, there were 23 well-known RFID-related companies’ mergers and acquisitions (M&A) in the three years from 2013 to 2015, and in 2014 alone, 10 cases of M&A deals in related industries occurred .
|
other
| 99.9 |
As business valuation tasks appear throughout time in M&A operation, they are often solved with dozens of different models, for instance payback period method, non-discounted approach, discount algorithm, net present value method, present value index method, real options approach (ROA),etc. In business valuation system, profit forecasting is an important input for calculating value of the acquired company's worth. In M&A operation, buyers use profit forecasting for managing business evaluation and pricing strategies. Keeping a high profit forecasting accuracy is important due to low profit margins in the industry. It would be beneficial for all but especially for the buyers when they could have a solution that can play a role of expert for them and give them lowest profit forecasting error for all of business valuation tasks.
|
other
| 99.9 |
In general, profit forecasting is a difficult task as it is affected by a group of indicators which descript the conditions of the external and internal environment of the company. Holistic overview of the current literature indicates that profit forecasting methods are mainly divided into two categories. One is statistical methods, such as regression model (RM), time series analysis, and gray system theory, another is neural network (NN) method. However, little attention has been directed to network graph (NG) method. To address these problems, we define NG to describe the non-linear relationship between the company's net profitability and its external and internal environment factors, and develop the enhanced community mining method (ECMM) based on Bayesian method (BM) for company profit predicting. ECMM successfully models the complex nonlinearity and gives better results than the traditional RMs and NN methods because ECMM can set flexible coefficients for different values of the independent variable and adopt complex nonlinear function to map the relationship between the independent variables and dependent variable. In ECMM, BM is adopted to express the clustering rules of NG’s nodes. Furthermore, the improved bacterial foraging optimization algorithm (IBFOA) is developed to calculate Bayesian probability function (BPF) as well as to optimize their parameters. IBFOA is distinctive because it generates new solution according to the statistical analysis of the existing solutions and adaptively adjusts its parameters, those can increase the diversity of the population and avoid the prematurity. Last but not least, we use bi-objective method to assess the accuracy of prediction and Pareto boundary method (PBM) is created to integrate the two indicators into one objective function, as a result the reliability of the valuation model is improved.
|
study
| 99.94 |
Based on the predict result of the company’s future net profit by ECMM, the company value is assessed using ROA since it is preferred in valuing projects where uncertainty is high . Simulation results of RFID companies in China show that the proposed method can significantly improve the accuracy and reliability of ROA.
|
other
| 99.9 |
The rest of paper is organized as follows: Section 2 presents the company valuation system. Section 3 provides ECMM in NG. In section 4, IBFOA is proposed. In section 5, experiments with real word data are used to demonstrate the workability of our proposed method. Section 6 offers the conclusions.
|
other
| 99.94 |
The proposed business valuation system of RFID companies is depicted in Fig 1. It consists of the following modules: key factors, profit forecasting, and business valuation. In the first module the key external and internal factors affecting the company profitability are identified. In the second module, IBFOA is designed to find communities in NG and ECMM is developed to forecast the company profit. Business valuation module assesses the value of RFID companies according to the forecast results of ECMM, which gives a full consideration on the investment opportunity value of the RFID companies.
|
other
| 99.9 |
Development of efficient methods to accurately estimate the company value requires assessing the conditions of the external and internal environment of the company. We consider the specific application environment for the products of each RFID company, for example, in the financial system, real estate, logistics, retail, product traceability, vehicle, railway, software system and other industries. Since downstream company usually purchases the large majority of its needs from the upstream company, downstream industry boom index is adopted to descript the demand scale of the downstream companies. The other external environment factors include domestic economic growth, inflation, and interest rate. And the factors depicting the internal conditions of the company consist of financial indicators which describe company's health survival and development capacity, company operation indicators that characterize business operating capacity, profitability indicators that represent the corporation profitability, and development capacity indicators that depict company potential ability for expanding scale and growing strength. The factor hierarchy structure shown in Fig 2 illustrates key factors which are said to impact on the company future profit growth. A total number of 29 indicators are considered, and all these 29 indicators can be further grouped into 8 dimensions. Once the key factors affected the profit are identified, we develop the value evaluation model which integrates these factors into a cause-effect framework, as shown in the following sections.
|
study
| 100.0 |
There is uncertainty over the future rewards from the RFID investment, and these investments are partially or completely irreversible. ROA are most valuable when uncertainty is high, therefore we use ROA to calculate the company value, which is given by the following formula.
|
other
| 99.94 |
s.t. Va=∑i=1nFi(1+r)i+Vs(2) Vc=VSN(d1)−Xe−rTN(d2)(3) Y=Va(1+r)T(4) d1=ln(VSY)+(r+12σ2)σT(5) d2=d1−σT,(6) where Va is the discounted value of real assets obtained by discounted cash flow method. Vc is the discounted value of future growth opportunities, i.e. the discounted value of options. Fi is the net profit at year i and obtained with ECMM, which is provided in next section. r is risk-free interest rate, VS is the current value of the company, which is determined by tangible assets, such as currencies, buildings, real estate, vehicles, inventories, and equipment. Y is the final price of the company, T is the option expiration period, σ is the volatility of asset returns, N(x) is the cumulative probability distribution function of standard normal distribution.
|
other
| 99.9 |
NG is formally defined as: G = (W; E), where W is the set of network nodes, E is the set of edges. Nodes denote independent or dependent variables. If two nodes appear in the same sample, an edge is drawn between them. We divide NG nodes into three categories: (a) evaluation factor node representing each evaluation factor, (b) classification node which denotes a grade of one evaluation factor, and (c) output node or clustering center node indicating one grade of output variable. Notice that each output node indicating the clustering center of one community. Each edge is assigned a weight by counting the number of its occurrences in dataset. An example of constructing a NG from the dataset shown in Table 1 is provided as follows.
|
study
| 100.0 |
In Table 1, Xi means sample i, Ii represents evaluation factor node i, Zij represents the jth classification node of evaluation factor i, similarly, Ci is the clustering center node and presents the ith grade node of output variable. In a sample, evaluation factor nodes, the classification nodes which indicates the value of each evaluation factor and the output node which denotes the sample output are indicated by 1, and other nodes are indicated by 0. Fig 3 shows NG generated from dataset in Table 1.
|
study
| 100.0 |
Basic measures of NG include: the node degree distribution, average path length, clustering coefficient, degree of correlation coefficient, betweenness, etc . However, these measures usually indicate the structure features of NG, rather than expresses the clustering rules implied in network. In this study, we propose the index of clustering credibility, namely, the posterior probability of the node belonging to a community. The credibility index helps to discover the rules hidden in the network.
|
other
| 97.75 |
The basis unit of clustering rules of NG in Fig 3 can be represented as Fig 4, which indicates that: if the co-occurrence number of Ii and Ck is Uik, and that of Ii and Zij is dij, the number of Zij belonging to community Ck is αijk. In this paper, the main idea of CM is to determine whether node Zij can be allocated to community Ck, but the clustering rule in Fig 4 still fails to intuitively judge the credibility of node Zij belongings to community Ck. As a result, BPF is adopted to figure out the credibility of a node belonging to each community.
|
study
| 71.1 |
In Fig 4, the credibility of node Zij belongs to community Ck is mainly decided by parameter Uik, αijk, and dij. According to the definition of NG, we have Uik=∑h=1Hαihk. Therefore, the clustering credibility of node Zij is only determined by αijk and dij. However, constrained by the number of RFID companies in real life, adequate samples cannot be collected. So αijk and dij obtained by the finite samples are not representative and only according to these two parameters, it is difficult to get the accurate clustering credibility of a node. Thus, we add offset εijk and βij to αijk and dij, respectively.
|
study
| 99.94 |
Accordingly, the posterior probability of node Zij belongs to community Ck is P(Ck|Zij;dij;αijk;βij;εijk), and the estimated parameters are εijk and βij. As BM is suitable for the situation where the variables for classification are parametric variables, it is used to obtain this posterior probability . To sample X, in order to judge its output, we need to calculate the posterior probability P(Ck|Zij;dij;αijk;βij;εijk), then decide the community which Zij belongs to. According to Bayesian formula, we have P(Ck|Zij;dij;αijk;βij;εijk)=P(Ck|dij;αijk;βij;εijk)P(Zij|Ck;dij;αijk;βij;εijk)P(Zij|dij;αijk;βij;εijk)(7)
|
other
| 98.1 |
The derived equation above shows that by observing the value of P(Ck|dij;αijk;βij;εijk) and P(Zij|Ck;dij;αijk;βij;εijk), the posterior probability of node Zij belongs to community Ck can be converted to the posterior probability P(Ck|Zij;dij;αijk;βij;εijk).
|
other
| 99.7 |
P(Zij|Ck;dij;αijk;βij;εijk) is the class-conditional prior probability, and using the traditional method to obtain its expression is very difficult. Generally, if a node belongs to a community, the link density between it and the cluster center node of the community is high, otherwise the link density between these nodes is low. That is similar to the interaction force between particles in the electric field, namely the weak force among nodes result in low density and the high force among nodes leads to high density. Accordingly, P(Zij|Ck;dij;αijk;βij;εijk) can be approximately defined by Gaussian potential function (GPF) which is mainly used to describe the interaction force of electric particles, as is shown in Eq 8. P(Zij|Ck;dij;αijk;βij;εijk)=e−dij+βij(αijk+εijk)θ,(8) where the impact factor θ is used to adjust the influence boundary.
|
study
| 100.0 |
After all the posterior probabilities of each classification nodes in a particular sample X being annotated to each category have been calculated, the overall probability for input sample X to be annotated to a particular category, Ck is calculated (i.e. D(X,Ck)), which is shown in Eq 9.
|
other
| 92.8 |
In order to improve the prediction reliability of the algorithm, we optimize two objectives, i.e. MSE and ME, simultaneously. We utilize versatile computational intelligent models such as PBM for handling this type of problems. MSE and ME is shown in Eq 11 and Eq 12, respectively. MSE=1n∑i∈Ω(Fi−F^i)2,(11) ME=maxi∈Ω{|Fi−F^i|},(12) where Ω represents the set of all prediction samples, Fi is the actual output of sample i, F^i is the predicted output of sample i, n is the number of prediction samples.
|
study
| 99.9 |
Define that as long as MSE or ME of an solution is not dominated by others, the solution is not dominated by others, that is, given population P, for p, q∈P, if MSE(p) < MSE(q) or ME(p) < ME(q), then p is not dominated by q. Then the main steps of ranking solutions using single non-dominated sorting method (SNDSM) are shown as follows:
|
other
| 99.7 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.