text
string | predicted_class
string | confidence
float16 |
|---|---|---|
We identified 853 publications of which 103 met our criteria for inclusion (Fig 1 and S1 File). 79 publications (77%) used mice and 24 (23%) used rats. 67 publications (65%) used male animals, 9 (9%) used females, 17 (16%) used mixed populations, and gender was not reported in 10 (10%) publications. At the initiation of treatment 43 animals (42%) were juvenile, 26 (25%) were adult, 10 (10%) were mature and age was not reported in 24 (23%) publications.
|
study
| 99.94 |
74 articles (72%) used subcutaneous administration, with 27 (26%) using intraperitoneal, oral in 1 (1%), and was not stated in 1 study (1%). We categorised the dose of d-galactose into 4 groups: 0–60 mg/kg (17%). 100–125 mg/kg (35%), 150–250 mg/kg (27%) and 300–1250 mg/kg (20%). We categorized the duration of d-galactose exposure used to induce ageing as 7–40 days (10%), 42 days (22%), 49–56 days (45%) and 60–112 days (23%).
|
study
| 99.94 |
78 studies reported neurobehavioural outcomes, all related to cognition; 43 (55%) articles used Morris water maze (MWM) test to evaluate cognition-related neurobehavioral outcome, with 21 (26.%) using the shuttle box task, 7 (9%) Y-maze test, 5 (6%) novel object recognition (NOR) test, and one each for the T-maze test and the radial arm maze test. 60 studies reported neurochemical outcomes; 15 (25%) evaluated protein carbonyl, 15 (25%) measured AChE, 11 TNF-α, 7 IL-1, 5 IL-6, 4 Bax and 3 Bcl-2.
|
review
| 99.75 |
Overall, d-galactose administration in rodents impaired cognition-related outcomes by 1.79 SMD (95% confidence interval (CI), 1.49 to 2.08, 78 comparisons; Fig 2). There was substantial heterogeneity between studies (χ2 = 382.37, I2 = 79.9%, degree of freedom (d.f.) = 77, p <0.0005). D-galactose administration also resulted in neurochemical changes consistent with ageing (effect size 3.20 SMD, 95% confidence interval (CI) 2.95 to 3.44, 250 comparisons, S2 File). Again, there was substantial heterogeneity between studies (χ2 = 1517.45, I2 = 83.6%, d.f. = 249, p <0.0005).
|
study
| 99.94 |
After excluding experiments in which the age of the animal was not stated the mature group had the largest (2.14 SMD, 95% CI, 0.91 to 3.37) and the adult group had the smallest (1.66 SMD, 95% CI, 1.06 to 2.25: χ2 for difference = 304.26, Τ2 = 1.07, I2 = 81.9%, d.f. = 55, p<0.0005) change in the cognition-related NBS (Fig 3A).
|
study
| 100.0 |
There was no dose- response effect; the largest impairment was found with 0–50 mg/kg of d-galactose (2.25 SMD, 95% CI, -1.75 to 2.76) and the smallest with 400–1250 mg/kg (1.73 SMD, 95% CI, 1.15 to 2.31: χ2 for difference = 304.26, Τ2 = 1.07, I2 = 81.9%, d.f. = 55, p<0.0005; Fig 3B).
|
study
| 100.0 |
The largest effect was seen in experiments using the shuttle box task detected the highest (2.34 SMD, 95% CI, 1.7 to 2.89) and the smallest in those using the radial arm maze task (0.19 SMD, 95% CI, -0.73 to 1.11: χ2 for difference = 339.48, Τ2 = 1.12, I2 = 77.3%, d.f. = 77, p<0.0005; Fig 3D). We found no significant effect on the impairment in NBS of the model duration, route of administration, animal gender or rodent type (mouse versus rat).
|
study
| 100.0 |
The juvenile group showed the largest (3.54 SMD, 95% CI, 2.79 to 4.29) and the group where age was not stated the smallest (2.20 SMD, 95% CI, 1.81 to 2.58), reduction in the abundance of SOD (χ2 = 283.09, Τ2 = 1.73, I2 = 78.8%, d.f. = 60, p<0.0005; Fig 4A).
|
study
| 100.0 |
For dose, animals receiving 100-125mg/kg dose had the largest (3.31 SMD, 95% CI, 2.55 to 4.07) and those receiving 150–250 mg/kg the smallest (2.21 SMD, 95% CI, 1.61 to 2.81) reduction in the abundance of SOD (χ2 = 283.09, Τ2 = 1.73, I2 = 78.8%, d.f. = 60, p<0.0005; Fig 4B).
|
study
| 100.0 |
Swiss Albino strain showed the largest (9.10 SMD, 95% CI, -8.39 to 26.61) and Albino the smallest (1.04 SMD, 95% CI, -2.28 to 0.19, χ2 for difference = 283.09, Τ2 = 1.73, I2 = 78.8%, d.f. = 60, p<0.0005; Fig 4C) change in SOD level. The administration duration of 60–112 days had the highest (3.23 SMD, 95% CI, 2.39 to 4.07) and 7–40 days the lowest (1.49 SMD, 95% CI, 0.20 to 2.78, χ2 for difference = 283.09, Τ2 = 1.73, I2 = 78.8%, d.f. = 60, p<0.0005; Fig 4D) impact on the fold of decrease in SOD level.
|
study
| 100.0 |
For MDA, the juvenile age category had the largest (3.42 SMD, 95% CI, 2.75 to 4.08) and mature animals the smallest (2.12 SMD, 95% CI, 0.14 to 4.10) change in MDA levels (χ2 for difference = 335.91, Τ2 = 1.90, I2 = 80.6%, d.f. = 65, p<0.0005; Fig 5A). The Balb/c strain showed the largest (9.15 SMD, 95% CI, 1.53 to 16.78) and Swiss Albino the smallest (0.53 SMD, 95% CI, 0.05 to 1.12) change in MDA level (χ2 = 335.91, Τ2 = 1.90, I2 = 80.6%, d.f. = 65, p<0.0005; Fig 5B). Duration of administration of 60–112 days had the largest (3.74 SMD, 95% CI, 2.55 to 4.93) and 7–40 days the smallest (1.52 SMD, 95% CI, 0.76 to 2.28) change in MDA level (χ2 = 283.09, Τ2 = 1.73, I2 = 78.8%, d.f. = 60, p<0.0005; Fig 5C). We found no significant impact of the route of administration, drug dose category, animal gender and rodent type on the change in MDA level.
|
study
| 100.0 |
For GSH-px, the effect was largest in females (4.52 SMD, 95% CI, 2.98 to 6.07) and the unknown group had the smallest (2.60 SMD, 95% CI, 1.71 to 3.48) effect on GSH-px levels (χ2 = 234.85, Τ2 = 2.39, I2 = 80.8%, d.f. = 45, p<0.0005; Fig 6A). The Balb/c strain showed the largest (11.92 SMD, 95% CI, 3.10 to 20.74) and Albino the smallest (1.58 SMD, 95% CI, 0.21 to 2.96) effect on GSH-px (χ2 = 234.85, Τ2 = 2.39, I2 = 80.8%, d.f. = 45, p<0.0005; Fig 6B). Stratifying the data according to the dose of drug, model duration, rodent type, route of administration and animal age, had no significant impact on the change in GSH-px level.
|
study
| 100.0 |
All of the articles had been published in peer-reviewed journals. Forty-three (42%) publications had statement of potential conflicts of interest. Eighty-eight (85%) articles reported compliance with animal welfare regulations. Random allocation to group was reported in 79 (77%) studies. Four (4%) studies reported blinded induction of the model. No study reported a sample size calculation method and only one study each (1%) study reported either animal exclusions or the blinded assessment of outcome (Fig 7). There was no statistically significant impact of these items on reported effect sizes for behavioural or neurochemical outcomes.
|
review
| 99.1 |
Study designs in the d-galactose model of ageing appear to have a significant but inconsistent impact on the cognition-related neurobehavioral scores and on neurochemical outcomes including SOD, MDA, and GSH-px. However, we did not see effects of factors such as age, gender, dose for other neurochemical outcomes such as PCs, Bax, Bcl-2, AChE, IL-1, 6 and TNF-α. This may be due to the low number of publications assessing these outcomes. Although these findings support the ability of d-galactose treatment to model features of brain ageing, our findings should be interpreted with some caution because of the limitations of the present study and of the included publications.
|
study
| 99.94 |
We used a modified CAMARADES’ study quality checklist to evaluate the internal and external validity of the included publications. This checklist encompassed items such as random allocation to group (model/sham), blinded model induction, blinded assessment of outcome, sample size calculation, compliance with animal welfare regulations, statement of potential conflicts of interest, reporting of animal exclusions, and publication in peer reviewed journal. We and others have previously shown that publications with low methodological quality have a tendency to overstate effect sizes . The quality of publications included in this meta-analysis was only modest (a median 3 out of 8 checklist items were present). Important meaures to reduce the risk of bias such as blinded induction of the model, blinded assessment of the outcome, sample size calculation and reporting of animal exclusions were all reported only rarely. A further concern is the remarkable heterogeneity between studies, which suggests the presence of other factors driving the effects seen. Identification of these factors would be important to better define the optimum use of this model, particularly if it to be used as the basis of selecting drugs for clinical trials. Future studies should also report measures to reduce the risk of bias, such as those included in the study quality checklist developed by CAMARADES for animal studies quality assessment or tfor example that proposed by Downs and Black .
|
review
| 97.8 |
Here we found that administration of d-galactose at a dose of 0–50 mg/kg had the largest effect on the impairment of NBS in the rodent. However, the effect on SOD—the only neurochemical outcome where an effect of dose was apparent–occurred at doses between 100–125 mg/kg.
|
study
| 100.0 |
We also found that d-galactose-induced impairment in the NBS was maximal in the mature rodent, but effects on SOD and MDA were highest in the juvenile group. This may be due to the small number of observations, or reflect a delay between the neurochemical and neurobehavioural effects of d-galactose.
|
study
| 100.0 |
Further, in our dataset, we saw that animal strain is an important factor in both d-galactose-induced NBS and neurochemical outcome impairment, where the LACA strain showed the highest impairment in NBS. Experiments using Swiss albino showed the largest effect on SOD, those using Balb/c the largest effects on GSH-px and MDA levels. Also, the different number of animals used in each group might affect the results as studies with a small number of animals giving imprecise results.
|
study
| 100.0 |
However, this study failed to find a statistically significant impact of study quality and design factors on d-galactose model of ageing in other neurochemical outcomes including PCs, Bax, Bcl-2, AChE, IL-1, 6 and TNF-α. This may be due to the small number of studies evaluating these factors in the included publications.
|
study
| 100.0 |
Our meta-analysis had some potential limitations and its outcomes should be interpreted with caution. First, this study was observational and based on the results of existing published data; therefore our findings can be considered as hypothesis generating only. Second, the quality of the included articles was in general low, and because these studies tend to overstate outcomes we may have overestimated the effect sizes. Thirdly, it is possible that this literature is confounded by publication bias . However, the use of conventional approaches to assess for the likelihood of publication bias performs poorly in small studies with SMD estimates of effect size, and so we elected not to proceed with this here. Finally, the power of stratified meta-analysis to detect the impact of independent variables is limited, and we estimate (based on simulation studies) power of only 20% to detect an impact of a 1 SMD difference in observed effect .
|
study
| 99.94 |
Brain ageing research using d-galactose model in rodent, which mimics age-related cognitive impairment and oxidative stress, has recently gained a remarkable attention. Our results represented an overview of different aspects of the rodent d-galactose model and the neurobehavioral and neurochemical outcomes reported to better understand the characteristics of the model. This meta-analysis indicates the inconsistency and heterogeneity of the included publications, perhaps due to modest reported study quality or to other factors which influence the performance of the model which have not been identified here. These shortcomings should be addresses before efficacy in d-galactose models can be used as a signal to proceed with human clinical trials.
|
review
| 99.9 |
Coastal lagoons are transitional aquatic systems that mediate transfers between the terrestrial environment and the ocean, including potential environmental stressors . Lagoons are an evolving coastal landform that may go through a cycle from an open embayment, to a partially back-barrier lagoon with progressive infilling, to a segmentation into small lagoons with unstable inlets and then lakes (Fig 1A). The evolution of coastal lagoons is the result of the balance between the processes which act to reduce the size of a lagoon and those, which act to increase it . For a given lagoon status, the combination of rate of accretion and sea rise will determine the volumetric capacity of the lagoon, its import/export status, and the resultant evolution . The relative importance of a particular process in a lagoon depends upon the environmental setting in which the lagoon is located and the evolutionary path followed by a lagoon depends upon the magnitude and relative importance of each of the operative processes . The dynamism of these forces promotes both long-term and short-term changes in these ecosystems. In the long-term (months and years), it influences the connectivity with the sea, while in the short-term (tidal cycles), it affects the amount of seawater inflow. According to the present connectivity with the sea, these coastal water bodies can roughly be divided into three major types: open (permanently connected to the sea), the intermittently open/closed (which includes seasonally or non-seasonally closed or those normally closed), and the closed (presently without permanent open bar, the coastal lakes).
|
other
| 73.3 |
Open lagoons are characterized by a wide spatio/temporal range in environmental conditions (e.g., salinity, temperature, oxygen), biological productivity and movement of resources and consumers with other adjacent marine areas . In contrast, coastal lakes are largely more homogeneous in their environmental conditions than open lagoons. Intermittently open/closed lagoons and lakes (ICOLL) show dramatic environmental changes over a short period of time, especially concerning hydrodynamics, salinity gradient, sediment composition and concentration of organic matter . This shift from a completely open coastal lagoon to a coastal lake causes abrupt changes in the biota as expected by the alternative stable state model (Fig 1B dashed line). The environmental shift might be induced by natural processes over geological scales, or by anthropogenic activities at the ecological scale, such as hydrological management , artificially connecting coastal lakes to the sea or modifications as a result of climate change .
|
study
| 99.9 |
Although the shift in biodiversity patterns is theoretically sound, there is a lack of empirical evidence to support it. So far, shifts in biodiversity patterns for coastal lagoons have been restricted to single lagoons and water column assemblages . The benthic system has gained little attention. Typically, the benthic systems of open lagoons are composed of a number of estuarine resident and many temporary marine species . The species composition in intermittent lagoons may be variable according to the current connectivity state. After blocking events (depending on rainfall regime and time of closure), they might become more homogeneous and dominated by freshwater species, typical of coastal lakes [9, 20,21,22]. These isolated observations suggest that the benthic system may not respond gradually after a blocking/opening event (dot-dashed line, Fig 1B), but may respond abruptly showing two alternative stable states (dashed line, Fig 1B).
|
study
| 99.94 |
In this study, we investigate to what extent the differences in openness of coastal lagoons structure meiofauna communities. Meiofauna comprises a group of benthic organisms ranging from 0.5 mm to 0.05 mm . They are omnipresent in all types of marine habitats occurring in high abundances and number of species. Given their short life cycles and tight relationship with the sediment composition , meiofauna is an ideal tool to investigate short- to long-term changes in coastal lagoons. We assume that open and closed lagoons are two alternative states of equilibria, and that intermittent lagoons are the transition phase between them. Based on this assumption, we expect that the benthic system will respond accordingly showing two alternative stable states. Additionally, we expect that (1) open lagoons will have higher regional richness and abundance as resources and consumers move among adjacent habitats; (2) absence of barriers and fauna movements by outlets will increase similarity between open lagoons, while the isolation would increase dissimilarity (species turnover) between closed lagoons; (3) openness generates environmental gradients which will increase dissimilarities within lagoons.
|
study
| 100.0 |
Coastal lagoons were sampled along the ~430 km coast of Santa Catarina State, South Brazil (Fig 2). This coastline can be divided into two major segments:—from the north border, in Itapoá, up to the Cape Santa Marta, at Laguna, the coast is N-S orientated, highly embayed with rocky headlands alternating with small bays;—southwards of Laguna, the straight NE-SW coast is dominated by high energy sandy shores. The most frequent swell wave direction along this coast is from the south, with average heights of 2.5 m; the coast has a micro-tidal regime with higher tides in the north (mean astronomic tide 1 m in Itapoá) than in the south (0.5 in Laguna); the general alongshore littoral drift is from S-SE to ENE-NE, but local reversals take place during strong NE conditions . Coastal lagoons are mainly concentrated in central/southern portions of the coast (Fig 2).
|
other
| 96.7 |
Fifteen coastal lagoons/lakes (5 closed- Peri, Jaguaruna, Faxinal, Esteves, Cavera; 5 open—Camacho Laguna, Conceição, Barra Velha, São Francisco; 5 intermittent -Lagoinha do Leste, Garopaba, Ibiraquera, Urussanga, Sombrio) were sampled in the austral summer 2012. The lagoons are marginally urbanized, and sampling points have been selected out of the urbanization range to avoid potential influence of anthropogenic impacts. In each of the lagoons, 9 meiofauna samples and 3 of sediment samples (granulometry and total organic content) were taken in the outer and inner portions of the lagoons (a total of 18 samples of meiofauna and 6 samples of sediment per lagoon). The samples of each sample portion were taken dozens of meters apart from each other. For the closed lagoons, inner samples were those taken westward in the most interior region, while the outer samples were taken eastward near the sand barrier (exact location of sampling sites are available in S1 Table). Water salinity was measured in situ with a multiparameter YSI. Meiofaunal shallow subtidal samples (<1m depth) were taken with a plastic syringe of 2 cm in diameter pushed to a depth of 10 cm. They were immediately fixed in 4% formalin, later sieved through a 63 μm mesh and extracted by flotation with Ludox TM (specific gravity: 1.18). Samples were then evaporated with anhydrous glycerol and permanent slides were made . Sediment samples were taken with a PVC corer tube (10 cm Ø and 5 cm height). Granulometry was done by sieving and pipetting analysis and total organic content was determined by loss of ignition (550°C for 4 hours). Carbonate content of sediments samples was determined by acid digestion .
|
study
| 100.0 |
Nematode univariate descriptors were the number of genera (richness; S), density (inds. 10 cm-2; N) and Shannon-Wiener diversity index (log2; H'). As functional attributes of the assemblages across the studied lagoons, we analysed the nematode feeding types , and the index of trophic diversity (1-ITD) based on the proportion of each feeding type. Because the study encompasses both marine/estuarine and freshwater nematodes we used five feeding types: selective deposit feeders (1A), nonselective deposit feeders (1B), epigrowth feeders (2A), predators/omnivores (2B) and vascular plant feeders (3).
|
study
| 100.0 |
Differences in nematode descriptors and functional attributes among typologies (fixed factor: closed, ICOLL and open), lagoon (random factor: 5 closed, 5 open and 5 ICOLL, nested in typology) and location (random factor: inner and outer, nested in lagoons and nested in typology) were tested with a permutational analysis of variance (PERMANOVA) run on Euclidean distance matrices with 9999 permutations, and the residuals were permuted under a reduced model . To visualize the similarity of the meiofauna composition among different lagoon typologies and location within lagoons, similarity matrices were constructed based on the Bray-Curtis similarity measure. Ordination was done by nMDS, and significance tests for differences in the multivariate structure of nematode assemblages performed using PERMANOVA . The variation in species composition of nematode assemblages (beta diversity) was decomposed into replacement and richness difference using abundance data dissimilarities and the Sorensen index . These analyses were performed using the R software . Total β-diversity and decomposed replacement and richness differences were analyzed using PERMANOVA tests with the same design described above. The decomposition of beta diversity can be done by two methods, the “POD” and “BAS” . Although both indices may not show congruent patterns , in the present study they showed agreement for total dissimilarity and replacement. For richness, the BAS method returned negative sums of squares for the factor typology, while the POD did not (see Results).
|
study
| 100.0 |
Differences in the environmental variables (salinity, mean grain size, sorting, total organic content, sand, silt and clay percentages) were also tested using PERMANOVA using the same design as for the fauna. The relationships between environmental variables and nematode assemblages were explored using distance-based redundancy analysis (dbRDA) that enabled us visualize the percentage of variability in the original data explained by the axis and the relative contributions of each of the predictor variables on the assemblage structure .
|
study
| 100.0 |
A total of 106 genera of nematodes was recorded, among which 19 were recorded in the closed lagoons, 71 in the intermittently open/closed, and 68 in the open lagoons (Table 1). Most of the nematode genera recorded in open lagoons (70.5%) were those typically found in brackish or marine waters. This proportion was reduced in ICOLLs (49%) with an increasing number of brackish/freshwater or freshwater genera. In closed lagoons, freshwater or brackish/freshwater genera accounted for 95% of the collected fauna. Only 5 genera occurred in all the three types of lagoons, namely Anonchus (Aphanolaimidae), Anoplostoma (Anoplostomatidae), Desmodora (Desmodoridae), Dichromadora and Hypodontolaimus (Chromadoridae). The percentage of exclusive genera (those found exclusively in only one type of lagoon) decreased with increasing connectivity: 13 genera occurred exclusively in the closed lagoons (65%), 26 in the intermittently open/closed (35%) and 21 in open lagoons (30%; Table 1). Trischistoma (Trypilidae), Semitobrilus (Trobilidae) and Ironus (Ironidae) were the most abundant genera in closed lagoons, accounting for 55% of the nematodes collected. At the intermittently open/closed and open, the genera Microlaimus (Microlaimidae), Spirinia and Desmodora (Desmodoridae) were the most abundant genera in both types of lagoons (Table 1).
|
study
| 100.0 |
Total number of genera, number of brackish/freshwater genera of according to , percentages genera found exclusively in lagoon types (exclusive genera), frequent genera, minimum–maximum densities of nematodes (and average inds.10cm-2), and the most abundant genera (inds.10cm-2) in closed, intermittently open/closed and open lagoons of Santa Catarina coast, South Brazil. A complete list of nematode genera, environment (brackish/freshwater), and mean densities in each lagoon typology can be found in S2 Table.
|
study
| 99.94 |
The number of genera and diversity of nematodes were significantly higher in the open lagoons, followed by intermittent and were lowest at closed ones (Table 2 and Fig 3). Density was significantly higher in open lagoons and ICOLLs than in closed ones (Fig 3). Differences in the univariate measures between individual lagoons/lakes occurred mostly within the closed ones (S3 Table). Significant differences between outer and inner portions increased with lagoon connectivity. In the closed lagoons, the descriptors did not show any significant differences between inner and outer portions; in ICOLLs, nematode richness, diversity and density were, in general, higher in outer portion, or did not differ significantly (S4 Table). All descriptors differed significantly in open lagoons, where richness and diversity were higher in the outer portion and density was higher in the inner parts of the lagoons (Fig 3 and S4 Table).
|
study
| 100.0 |
Nematode trophic structure differed significantly among lagoon typologies. While closed lagoons were largely dominated by predator/omnivores (mean of 54%), in ICOLLs and open lagoons nonselective deposit feeders and epigrowth feeders were significantly more abundant (mean of 39% and 32% respectively) (Fig 4 and S5 Table). Selective deposit feeders (with a mean around 16%) did not differ significantly among typologies (S5 Table). Abundances of vascular plant feeders significantly decreased with openness (Fig 4, S5 and S6 Tables). The index of trophic diversity was significantly lower in closed lagoons, intermediate in ICOLLs and higher in the open lagoons (Fig 4 and Table 2). Significant variations in trophic diversity among lagoons within individual typology and at scale of locations within the lagoon were not detected (Table 2).
|
study
| 100.0 |
The non-metric multidimensional scaling (nMDS) analysis revealed substantial differences in nematode assemblages between connected and closed lagoons, but not between locations within the lagoons (Fig 5). The results of the PERMANOVA showed that the greatest variation in the data dissimilarities occurred due to differences in connectivity rather than between locations within lagoons (Table 3). The statistical tests confirmed that nematode assemblages of closed lagoons differed significantly from more connected ones (Table 3). The PERMANOVA tests also revealed that nematode assemblages of inner and outer portion of closed lagoons did not differ significantly, whilst in the ICOLLS and open they did (Table 3). The analysis of the average similarity between/within lagoons showed that nematodes assemblages from the open lagoons were more similar to each other than those from the closed ones (Table 3). As lagoons lose connectivity with the sea, nematode composition became more dissimilar. Internal similarities, conversely, were higher within closed lagoons, decreasing as lagoons gain connectivity. The results of these analyses were consistent whether analysed by means of presence/absence or relative abundances.
|
study
| 100.0 |
The variability in genera composition (β-diversity) differed significantly according to lagoon typology and location (Table 4). Total β-diversity was significantly higher in closed lagoons, intermediate in ICOLLs and lower in the open lagoons (Fig 6 and S7 Table). Significant variations in β-diversity among lagoons within individual typology were mainly detected in closed ones (S8 Table). At the scale of locations within the lagoon, the genera variability was lower than at the scale of lagoon. Total genera variability between locations varied significantly in open lagoons and ICOLLs, but not in closed ones (S9 Table). The relative contributions of replacement and richness components to the nematode genera variability also differed significantly among lagoon typologies, with and increasing dominance of replacement over richness as lagoon connectivity increased (Fig 6).
|
study
| 100.0 |
Salinity values increased with increasing connectivity and were significantly higher at the outer portions of ICOLLs and open lagoons; salinity did not vary within closed lagoons (S10, S11, S12 and S13 Tables). In general, granulometry was relatively homogeneous among the lagoons, with sediments composed of moderately sorted fine sands (mean grain size and sediment sorting did not vary significantly among nor within lagoons). Grain size, sand, silt + clay percentages did not vary significantly among typologies, nor among lagoons within individual typology (S10 Table). However, total organic content was higher in the inner portion of open lagoons and ICOLLs, while sand percentages were higher in the outer portion of more connected lagoons (S10 and S13 Tables).
|
study
| 100.0 |
The distance-based RDA ordination (Fig 7) indicated that the first two axes explained 30.5% of the variability in the faunal data and 81.1% of the relationship between nematode genera and the environmental variables (Fig 7). The first axis (responsible for 68.4% of the fitted model relating the fauna-environmental variables) was strongly related to salinity, and represented the connectivity gradient from the closed to the permanently open lagoons. The second axis, responsible for 12.7%, was related to sediment sorting, silt and carbonate percentages, and represented the variation within the lagoons.
|
study
| 100.0 |
Using particular lagoon status over space as replicates of their evolution over time, we observed that open and closed lagoons are mutually exclusive alternative states of equilibrium, and that ICOLLs are an intermediate or transition phase between them. The gradient in the structural connectivity between lagoons and the sea, due to their regime shifts, changes the movement of resources and consumers, and the internal physico-chemical gradients that directly affected the regional species diversity, abundance and trophic status. Whereas the lack of barriers and the fauna movements through the inlets increased similarity between the more connected lagoons, isolation increased variation in the composition of nematode assemblages with species losses and decrease of trophic diversity between closed lagoons.
|
study
| 100.0 |
Intermittently open/closed lagoons are particularly important in the understanding of biological and physico-chemical shifts between coastal lagoons/lakes. This is because, in the short-term, changes in the connectivity of ICOLLs leads to drastic environmental changes , shifting between the lacustrine or the lagoonar equilibrium state. The sampled ICOLLs in this study were not in the same status of closure (3 were closed and 2 were open) and our expectations were that nematode assemblages of the ICOLLs would be grouped with the closed or the open lagoon samples depending on their inlet state. Instead, we found that ICOLLs univariate and multivariate descriptors of the nematodes assemblages had an intermediate structure between lagoons and coastal lakes. ICOLLs are typically characterized by low freshwater inflow, which leads to sand berm formation across the mouth, preventing mixing with ocean water . Besides, high intra and inter-annual variability in rainfalls and discharges are typical of ICOLLs . A possible mechanistic explanation for the transitional structure of the nematode assemblages is the intermediate pattern of isolation compared to lagoons and coastal lakes. Increasing isolation from open ocean conditions also alters the structure of foraminiferans and macrobenthic assemblages, leading to a decrease in diversity and changes of species . The higher diversity of nematode assemblages in brackish water compared to freshwater reflects both the input of marine species and the presence of strong environmental gradients and higher environmental heterogeneity. Overall freshwater nematode communities are impoverished when compared to marine and brackish systems . Regarding nematode abundance, higher values in open lagoons and ICOLLs probably reflects the amount of organic matter. Although just marginally significant, closed lagoons had lower TOC than ICOLL and open ones. Moreover, TOC was significantly higher in the outer portion of open lagoons and ICOLLs, as observed for nematode abundances, giving support to the hypothesis that TOC plays a significant role in nematode abundances .
|
study
| 100.0 |
Our results further showed that similarities of the nematode assemblages within and between lagoons also change according to the stable state. While habitat connection and faunal exchange by open inlets increased similarity between more connected lagoons, with variations in the composition controlled by gradients, isolation increased variability of nematode assemblages between closed lagoons. At the same time, internal variability was higher within open lagoons than in closed lagoons, with ICOLL again assuming an intermediate position. This pattern may emerge as a result of the connectivity that modulates the degree to which the inlet state facilitates or impedes the exchange of matter, energy and specimens among landscape elements. Besides, differences in structural connectivity can lead to internal homogeneity or strong physico-chemical gradients that directly affect species composition.
|
study
| 100.0 |
While the low variability of nematode assemblages among lagoons is likely to be a result of faunal transport due to their physical link, the high dissimilarities of the assemblages between coastal lakes might be consequence of their spatially disconnection and exposure to different environmental conditions as a result of the discrete and variable surroundings. The coastal lakes could be colonized by different adjacent freshwater sources, by flooding events or phoresy . Moreover, some common taxa of freshwater and brackish habitats, such as enoplids and chromadorids, could be dispersed from the nearby coastal areas by wind, salt spray or sea foam . Although nematode composition and abundance are known to be closed related to the lakes trophic state and related sediment characteristics , in the present study, all coastal lakes can be classified as oligotrophic, with bottoms composed of clean sandy sediments and very low total organic content (<0.5%). Our results indicated that the nematode assemblages of coastal lakes are primarily structured by the intrinsic properties within each lake and to a possible limited dispersion ability of nematodes between lakes.
|
study
| 100.0 |
Natural and gradual shifts from lagoons to lakes are long-term processes that result from large-scale (e.g. sea-level and climate changes) and local processes (e.g. sediment supply, alongshore drift, coastal morphology) . The impoverishment of the nematode assemblages and the substitution of brackish water species by freshwater species also promotes a change in the trophic status of the benthic system and a significant decrease of trophic diversity. The dominant genera of closed lagoons Semitobrilus and Trischistoma are predators, while the genera Desmodora and Theristus are, respectively, epigrowth and non-selective deposit feeders . These findings indicate that the availability of trophic resources is strongly affected by shifts from lagoons to lakes, resulting in loss of functional diversity. Similar result was also observed for meiofauna in hard-bottom macroalgal meadow/barren regime shift . Besides, natural shifts may also interact with human interventions, increasing the speed of the shift and changing the dynamics of coastal lagoon evolution . Our results from the large-scale sampling program showed that as lagoons lose connectivity, gradually shifting the state, local processes within individual ICOLLs and particularly within lakes become increasingly more important factors in the structuring of these communities than differences in large scale process (such as geomorphology or biogeography). The main implication of these findings is that depending on the local stable state we may end up with alternative regional pattern of biodiversity.
|
study
| 100.0 |
These findings also have direct implications for management and conservation plans of lagoon environments. As an intermediate state, ICOLLs would play a key role in the management of regime shifts and, based on our results, the most suitable approach for management purposes would be to consider each ICOLL as a unique situation requiring a localized approach, slowing environmental change towards the tipping point (e.g., sediment infill). In the particular case of subtropical coastal lagoons, this imposes additional difficulties as they are mostly distributed among unplanned populated areas. As ICOLLs typically have small river catchments, it makes them sensitive to changing inflow conditions . Poor occupation practices within lagoon floodplains can result in pressure for intervention—dredging and bulldozing to artificially breach or close the lagoon inlet, potentially reducing resilience. Monitoring, establishment of local estuarine management plan and permanent policy review would ensure that the most ecologically appropriate and cost effective options are being implemented at any given location .
|
other
| 99.9 |
We conducted an extensive sampling program, using specific lagoon status over space as replicates of their evolution over time, and observed that open and closed lagoons are mutually exclusive alternative states of equilibrium, and ICOLLs are an intermediate or transition phase between them. The gradual regime shift of coastal lagoons, as they lose connectivity with the sea, changes the movement of resources and consumers, and the internal physico-chemical gradients that directly affected regional diversity, abundance and trophic status. Absence of barriers increased the diversity of nematode assemblages and the similarity between the fauna of more connected lagoons. Isolation increased the variation in species composition between lagoons and similarities within lagoons. As local processes within individual lagoons become increasingly more important as they lose connectivity, depending on the local stable state an alternative regional pattern of biodiversity may emerge.
|
study
| 100.0 |
Feline haemotropic mycoplasmas (haemoplasmas) are small epierythrocytic Gram-negative bacteria, which can only survive by parasitism of erythrocytes and which cause feline infectious anemia. The feline haemoplasma group consists of at least three species, Mycoplasma haemofelis (Mhf), Candidatus Mycoplasma haemominutum (CMhm) and Candidatus Mycoplasma turicensis (CMt) [1–3]. Infections with these three species differ in severity with Mhf inducing the most severe symptoms such as anorexia, depression, fever and anemia; whereas the CMhm and CMt infected cats rarely show any clinical signs [4–6]. CMhm usually require co-infection with another haemoplasma or immune-compromised conditions to cause disease and the pathogenic potential of CMt most likely also depends on cofactors [7–9].
|
study
| 97.9 |
Feline haemoplasmas are widely distributed in pet cats throughout the world, although the prevalence varies geographically [9–13]. These variations may be due to differences in climate as studies have shown a correlation between haemoplasma prevalence and warmer climate [9–11, 14]. The higher prevalence is suggested to be due to presence of a higher number of blood-sucking arthropods, which are suspected to be vectors for haemoplasmas [12, 15]. The risk of infection has also been associated with several other factors, such as age, gender and breed [10–12].
|
study
| 99.94 |
Haemoplasmas have never been cultured in vitro and identification is usually based on cytological examination of blood smears . However, this method has proven inefficient due to low sensitivity and specificity resulting in false negative results. Development of PCR based methods has increased the sensitivity of identification of the organisms in blood samples [9, 12, 16–18]. Feline infectious anemia was initially reported in Denmark in 1974, but the prevalence is unknown . In this study, we used PCR methods to determine the prevalence of feline haemoplasmas in the blood of convenience samples of cats from Denmark and evaluated possible associations to breed, age, gender and symptoms.
|
study
| 100.0 |
Seventy-three blood samples, representing blood from 67 cats sampled during 2007–2008 were used. Forty-six of the samples had been collected from patients at the University Hospital for Companion Animals, Faculty of Health and Medical Sciences, University of Copenhagen. The remaining 27 blood samples were collected at veterinary clinics throughout Denmark. The blood samples were collected from both diseased cats and cats attending the clinics for routine health checks. From four of the cats from the University Hospital we had samples in duplicate or triplicate. These samples were used as controls for the PCR reaction to confirm that we obtained identical results on repeated testing. For 62 cats, information on age, breed and gender was available. Anamnesis and clinical findings were available for all cats admitted to the University Hospital and from ten samples from the other clinics. The blood samples were obtained by venal puncture and stored in 2.5 ml EDTA-vials at −80 °C. Blood samples obtained from the University Hospital were all subjected to haematological examination using the ADVIA 120 haematology system including erythrocyte count, haemoglobin-, haematocrit- and mean cell volume (MCV) values.
|
study
| 100.0 |
Conventional PCR: 0.8 µM of each primer M-forward: 5′ ACGAAAGTCTGATGGAGCAATA 3′ and M-reverse: 5′ ACGCCCAATAAATCCGRATAAT 3′ . PCR was performed using the Thermo Hybaid PCR express machine using the following conditions, Segment 1: 94 °C 1 min, Segment 2: 94 °C 1 min, 60 °C 1 min, 72 °C 30 min at 45 cycles and Segment 3: 72 °C for 10 min.
|
other
| 99.9 |
RT-PCR: 0.3 µM of the HPLC purified primers, M-forward: 5′ ACGAAAGTCTGATGGAGCAATA 3′ and M-reverse: 5′ ACGCCCAATAAATCCGRATAAT 3′ . RT-PCR was performed using the Mx30000P® and Brilliant® SYBR Green QPCR master mix (Stratagene, California, USA) essentially as described by the manufacturer. The RT-PCR reaction was run under the following conditions: Segment 1: Initial denaturation 95 °C 10 min, Segment 2: 95 °C 30 s, 60 °C 1 min, 72 °C 30 s, for 40 cycles, Segment 3: 95 °C 1 min, ramp down to 55 °C and ramp up from 55 to 95 °C. Dissociation temperatures were 77.4 °C for CMhm, 78.0 °C for Mhf and 79.5 °C for CMt. Primers for both conventional and RT-PCR amplify products of 193 bp for CMhm and 170 bp for both Mhf and CMt.
|
study
| 99.44 |
DNA from Mhf, CMhm and CMt was used as positive controls for the PCR methods . The samples were used as positive controls in the initial analysis to confirm that the used PCR and RT-PCR conditions could produce the expected PCR products. After confirmation, the 16S rRNA PCR fragments from the first haemoplasma-positive blood samples (Mhf and CMhm) were used and cloned using the TOPO TA Cloning® Kit as described by the manufacturer (Invitrogen, Denmark). Since we found no CMt positive cats, we also cloned the CMt 16S rRNA. All cloned fragments were sequenced, confirming that the DNA was of the expected sequence. Plasmid purification was done using the QIAprep® spin miniprep kit from Qiagen. Sequencing of the cloned samples was done using 0.8 µM of each of the primers M13-forward: 5′ GTAAAACGACGGCCAGT 3′ and M13-reverse: 5′ AACAGCTATGACCATG 3′. These plasmids were used as positive controls in the PCR and RT-PCR analysis of the blood samples using the M-forward and M-reverse primers as described under the two PCR methods.
|
study
| 100.0 |
Statistical analysis on the available information on gender, age and breed was done using GraphPad Prism 5 (https://www.graphpad.com). Fischer´s exact test was used to test for association between presence of Mhf/CMhm and age, gender and breed. Mann–Whitney U-test was used to test for significant differences in the haematological variables.
|
study
| 99.94 |
Blood samples collected from 67 Danish cats were investigated to estimate the prevalence of carriage of the three haemoplasmas, CMhm, Mhf and CMt. For each cat, information about breed, gender, age and symptoms/diagnosis were obtained when possible (Additional file 1: Table S1). The haemoplasmas are non-culturable in vitro and accurate diagnosis is currently reliant on detection of bacterial DNA using PCR assays . Eleven animals were found to be positive among the 67 cats tested (Table 1). Ten cats were positive using both conventional and RT-PCR while one additional cat was positive by RT-PCR only. Carriage of multiple haemoplasma species was not detected. From four PCR negative cats [cats 4, 5, 10, 15 (Additional file 1: Table S1)], more than one sample was analyzed [samples 51, 11, 38, 29, 41 and 55 (Additional file 1: Table S1)], and all samples yielded the same negative result upon repeated testing.Table 1Haemoplasma prevalence in blood from 67 cats in Denmark determined by PCR and RT-PCRSpeciesPositive by PCRPrevalence PCR (%)95% CIPositive by RT-PCRPrevalence RT-PCR (%)95% CIMhf11.50–4.411.50–4.4CMhm913.45.2–21.61014.96.4–23.4CMt00Total1014.96.4–23.41116.47.5–25.3 Mhf Mycoplasma haemofelis, CMhm Candidatus Mycoplasma haemominutum, CMt Candidatus Mycoplasma turicensis, CI confidence interval
|
study
| 100.0 |
Based on fragment sizes, 10 positive samples were judged as harboring CMhm, while one fragment corresponded to Mhf/CMt. Since the PCR products of Mhf and CMt positive cats are of equal size, all PCR products were sequenced to confirm the results and discriminate between these two species. The sequencing revealed that the 10 CMhm positive samples indeed contained DNA from CMhm. Seven had 100% identity (E value: 3e−74) to GenBank accession number EU170604 and three had 97–100% identity (E value: 3e−69) to EU839985. The one sample identified as Mhf/CMt showed 98% identity (E value: 3e−58) to Mhf EU839978. We found no samples with homology to CMt among the Mhf/CMt positive samples, corresponding to 0% prevalence with a confidence interval between 0 and 4.7%. Control DNA from CMt did result in the expected sequence of the PCR fragment, showing that the primers did amplify the CMt DNA.
|
study
| 100.0 |
The statistical tests for significant differences in haematological values in cats being CMhm positive/negative showed no significant differences (P > 0.5). One cat (Additional file 1: Table S1, no. 73) which was positive for Mhf, suffered from dehydration, weight loss and anorexia and the haematology of this cat showed abnormal values. Haemoglobin, haematocrit and total erythrocyte counts were decreased, whereas MCV was increased compared to normal reference interval (Table 2). The blood smear showed several epierythrocytic organisms on every erythrocyte, anisocytosis, polychromasia and regeneration with reticulocytes and metarubricytes. The smear also contained lymphoblasts.Table 2Haematology results for Mhf positive cat no. 73ParameterValueReference intervalTotal erythrocyte count (billion/L)1.495–10Haemoglobin (mmol/L)2.005–9.3Haematocrit (L/L)0.090.24–0.45Mean cell volume (MCV) (fL)60.440–57
|
clinical case
| 97.5 |
The univariable analyses for risk factors showed significantly higher carriage frequency in cats ≥ 8 years old compared to younger cats (P < 0.05), and a higher prevalence among domestic cats compared to purebred cats (P < 0.05). One of the cats (Additional file 1: Table S1, no. 42) was diagnosed as feline immunodeficiency virus (FIV) positive and was also infected with CMhm. Among males, 23.5% (8/34) carried haemoplasma species, whereas only 9.4% (3/32) of the females were positive. Although, prevalence in males seemed higher than in females, the difference was not statistically significant (P > 0.05).
|
study
| 100.0 |
The current study provides the first prevalence estimate of carriage of feline haemoplasma species in Denmark. The prevalence of CMhm and Mhf infections was 14.9 and 1.5% respectively when using RT-PCR. One sample, being positive by RT-PCR, was not identified as CMhm when using conventional PCR. Previous studies have shown a similar prevalence in other European countries [9, 19, 20]. The study was performed by the use of a convenience-sampled cat population. The cats included were examined by a veterinarian and represented both diseased cats and cats attending the clinic for routine health checks. This corresponds to the approach used in other studies [11, 13].
|
study
| 100.0 |
The most frequent haemoplasma found in the Danish cats was CMhm. Feline CMhm infections are often subclinical with only minor haematological changes [17, 22, 23] and in accordance with this, we found no significant difference in haematological values in cats being CMhm positive or negative.
|
study
| 99.94 |
This higher prevalence of CMhm carriage compared to the other haemoplasma species could be due to the lack of symptoms in these cats thus possibly allowing propagation and spread of the agent. Transmission between cats has been suggested, but not definitely demonstrated, to occur through biting wounds and from mother to offspring. Also haemoplasma DNA has been detected in the cat flea Ctenocephalides felis and ticks [12, 24]. Furthermore, these asymptomatic cats may impose a risk with the increased use of feline blood for transfusion. The only case of Mhf infection showed signs of haemoplasmosis with major haematological changes with a marked decreased erythrocyte count, and abnormal haemoglobin and haematocrit values. Furthermore the cat had an increased reticulocyte count and presence of nucleated erythrocytes. These findings supports the current view that Mhf is the most pathogenic species, and the one most often found associated with clinical disease .
|
clinical case
| 96.5 |
We did not detect any CMt in the cats sampled in this study. Other prevalence studies have previously shown that CMt seems to be the least prevalent haemoplasma in Europe, ranging from 0 to 2.3% [12, 21, 26, 27]. In these studies, the sample sizes were between 3 to 20 times larger than our number of cats. A larger sample size could therefore be needed in order to conclude whether CMt is present in Denmark.
|
study
| 100.0 |
The significance of a positive PCR result should always be compared with clinical signs, pathological findings, haematological features and possible concurrent or complicating diseases. More severe clinical signs have occurred in cats experimentally dual-infected with Mhf and CMhm than in cats with mono-infection with either of the species and in cats spontaneously infected with both Mhf and CMhm [6, 28]. Based on PCR and sequencing of the PCR products, we found no samples with more than one haemoplasma species. The only CMhm positive cat in our study was diagnosed as FIV positive. The risk of infections with haemoplasma has previously been associated with concurrent diseases such as feline leukemia virus (FeLV) and FIV. Cats co-infected with FeLV develop a more severe anaemia than cats only infected with CMhm and FIV infection was shown to be associated with an increased risk of co-infection with CMhm and Mhf [7, 14, 29].
|
study
| 99.94 |
The risk of infection with feline haemoplasmas has been associated with different factors, such as age, gender, breed, environment, flea infestation and concurrent diseases [10–12, 15, 21]. Our results showed a statistical association between age and carriage of haemoplasma species, with an increased prevalence in older cats. These finding are consistent with findings in previous studies [12, 21, 26]. An association between risk of infection and increasing age may simply reflect a cumulative risk of exposure, since complete clearance of the organism once a cat has become infected has not been demonstrated. We also found higher prevalence of haemoplasma in domestic cats compared to purebred cats. Purebred cats are often held indoor, whereas domestic cats more often allowed being outdoor, where risk of exposure is higher.
|
study
| 99.94 |
This is the first study to investigate carriage of feline haemoplasma among Danish cats. The study showed a prevalence of 16.4% with CMhm as the most prevalent species. Age and breed was significantly associated with haemoplasma carriage. These results are in accordance with similar studies from other parts of Europe, USA and Japan.
|
study
| 99.94 |
Tellurium (Te) is a group 16 metalloid element related to sulphur and oxygen. It possesses stable oxidation states of +VI (tellurate), +IV (tellurite), 0 (elemental Te), and −II (telluride). The majority is found in the hydrosphere as tellurate and in the lithosphere as tellurides of gold and silver . The most harmful forms of Te to microorganisms are the oxyanions, especially tellurite, with concentrations as low as 1 µg/mL being highly toxic . However, the ability to reduce it to the elemental form allows certain bacterial species to resist concentrations up to 4000 µg/mL . The means by which this compound exerts its toxicity is still debated, however, the strong oxidative properties , confirmed by an E° of 0.827 V for the TeO3−2/Te redox couple , are likely among the reasons.
|
study
| 99.94 |
Tellurite exposure can cause the formation of intracellular radical oxygen species (ROS) , leading to cellular damage. Catalases, the key enzymatic defence against ROS, play a role in mitigating the detrimental effects of the toxin. In Staphylococcus epidermidis, this family of enzymes is also capable of using TeO32− as a substrate, reducing it to Te , therefore minimizing the negative impact on cells. In E. coli, reduction of tellurite can occur through the actions of nitrate reductases, however, this is a non-specific reaction . Other enzymes, such as the thiol:disulfide oxidoreductase of Rhodobacter capsulatus , GutS from E. coli , among others have been implicated in tellurite resistance and/or reduction. Although they are associated with low to moderate levels of resistance, it is not their primary specific function. In the case of R. capsulatus, multiple approaches to dealing with tellurite have been observed. One involves maintaining redox poise during photosynthetic growth through the reduction of tellurite , while another is based on reduced uptake of the tellurite oxyanion. With the latter, acetate permease is responsible for TeO32− influx and competition between it and acetate for entry into the cell results in higher resistance. Even at low concentrations (60 ng/mL), acetate impacts tellurite entry , limiting toxicity. A related approach has been identified in E. coli. Mutation to a phosphate transport system provided enhanced resistance , which allowed tellurite ingress. Lastly, certain microorganisms can somewhat neutralize Te oxyanions by production of volatile organic telluride compounds, such as dimethyltelluride , however, such approach to detoxification delivers negligible removal.
|
review
| 99.44 |
While the aforementioned physiological reactions are utilized for TeO32− resistance and/or reduction, none involves a specific tellurite reductase. Our understanding of how bacteria carry this out is limited. Unlike for selenate resistance/reduction, where specific reductases have been identified, such in cells of Thauera selenatis , only a single example of a tellurite specific reductase has been isolated to date from the Bacillus sp. STG-83 . Although not proven, this bacterium might be capable of dissimilatory anaerobic reduction, therefore, the enzyme is likely respiratory in nature. Investigation into the strategies for tellurite reduction has just begun to expand. Recently, several bacterial species have been isolated that are highly resistant to tellurite (up to 2700 µg/mL) . Among bacteria possessing very high level resistance are aerobic anoxygenic phototrophs (AAP) isolated from extreme environments . This group of bacteria seems to have evolved an inherent ability to deal with this oxyanion. Therefore, we set forth to investigate the physiological and metabolic effects of TeO32− on cells, factors affecting reduction, and differences in expression of a reducing system by AAP inhabiting extreme environments. Species chosen were Erythromicrobium ezovicum (strain E1), Erythromicrobium hydrolyticum (E4(1)), Erythromicrobium ramosum (E5), Erythromonas ursincola (KR99), Sandaracinobacter sibiricus (RB 16-17), and Roseococcus thiosulfatophilus (RB3). All are freshwater bacteria from cyanobacterial mats developed around thermal springs in the Baikal Lake region in Russia . They reduce very high levels of tellurite to elemental Te under aerobic conditions .
|
study
| 100.0 |
Bacteria chosen for study include Erythromicrobium ezovicum (strain E1), Erythromicrobium hydrolyticum (E4(1)), Erythromicrobium ramosum (E5), Erythromonas ursincola (KR99), Sandaracinobacter sibiricus (RB 16-17), and Roseococcus thiosulfatophilus (RB3) . They were grown aerobically in the dark at their optimal temperature (28 °C) on an incubator shaker (200 rpm) in liquid rich organic (RO) or liquid minimal salts (MS) media containing either glutamate, pyruvate, and malate or glutamate, pyruvate, and yeast extract each at 1.5 g/L, at pH 9.0 unless otherwise stated. All results are an average of three replicates.
|
study
| 100.0 |
Metalloid resistance, utilization of organic substrates, variation in pH, level of aeration, and protein and ATP production were all examined in the presence of K2TeO3. Resistance was confirmed in RO liquid medium with varying concentrations of K2TeO3 (100, 250, 500, 750, 1000, and 1500 µg/mL). Growth was monitored spectrophotometrically at A950, an established method for estimating growth and reduction in the presence of tellurite, over 96 h . All growth for subsequent experiments was monitored at A950 with 500 µg/mL (strains E1, E4(1), E5, and KR99) or 100 µg/mL (RB3 and RB 16-17) K2TeO3 in liquid culture over 96 h, unless otherwise described. The effect of carbon sources on growth and reduction was investigated by transfer of actively growing cells to MS liquid medium, pH 7.8, with K2TeO3 containing one of: acetate, butyrate, citrate, ethanol, fructose, glucose, glutamate, L-glutamine, lactate, malate, pyruvate, or succinate at either 1.5 or 3.0 g/L. The solubility of K2TeO3, and therefore the availability in solution, changes with pH that is why the effect of pH on resistance and reduction was tested. As the addition of K2TeO3 to the growth medium caused the formation of precipitates under acidic conditions and strains could not grow beyond pH 9.5, only pH range 7.0 to 9.0 was considered. Liquid medium was adjusted with 0.5 N NaOH to the desired pH. The role of oxygenation was analyzed in an incubator shaker set to 100 (low), 200 (typical) or 300 (high) rpm. Once optimal conditions were established, strains were grown at those parameters with 500 or 1000 µg/mL (strains E1, E4(1), E5, and KR99) or 100 or 500 µg/mL (RB3 and RB 16-17) K2TeO3. To observe the effect of tellurite on cellular protein and ATP levels, measurements were taken in its presence and absence over 48 h. Protein was assayed by the Bradford method and ATP was monitored with an ATP Bioluminescence Kit from Sigma-Aldrich, following extraction from samples with perchloric acid .
|
study
| 100.0 |
Tellurite reductase expression experiments were carried out as recently published , with one modification: 100 µg/mL chloramphenicol was used for strain RB 16-17 instead of tetracycline. Detection of TeO32− reduction in cell extracts and localization of reductase activity was performed as described . Rate of reduction (1 unit equal to 1 µg tellurite reduced/µg protein/h) was calculated for each cellular fraction. For isolation of membranes, cells were broken by French Press and centrifuged at 20,000 rpm for 1 h to remove debris. The supernatant was collected and ultracentrifuged at 60,000 rpm for 12 h. The membrane pellet was then washed with 10 mM Tris HCl, pH 8.0. Membranes were resuspended in their respective growth media containing K2TeO3.
|
study
| 100.0 |
Growth of AAP in the presence of different K2TeO3 concentrations confirmed these bacteria possess a high level resistance. Strains appear to be similar, resisting and reducing up to 1500 µg/mL, however, optimal growth and reduction occurred at 500 µg/mL K2TeO3 for E1, E4(1), E5, and KR99, while 100 µg/mL K2TeO3 was best for RB3 and RB 16-17. With respect to media composition, we observed that it does have an effect, as has been previously reported . Although many different carbon sources and combinations were tested, only three media compositions gave optimal growth and reduction. Strains E4(1), RB3, and RB 16-17 performed best in complex RO medium, while E5 and KR99 preferred defined MS medium containing a combination of glutamate, malate, and pyruvate. E1 showed the best results in MS medium with glutamate and pyruvate, however, some yeast extract was still required, suggesting a need for the undefined component of this complex organic substrate. To determine if the specific combination, but not the increased organics, was responsible for increased growth and reduction with tellurite, each individual source was tested at 3.0 g/L. Single organic carbon sources at increased concentrations were not as good as the combination. All tested strains grew and reduced K2TeO3 optimally at pH 9.0 and aeration was achieved at 200 rpm (Table 1). However, reduction still occurred at 100 and 300 rpm, albeit at much reduced levels.
|
study
| 100.0 |
While it has been shown that proteins, specifically those containing reduced thiol groups, can be damaged by TeO32− , its direct effect on highly resistant bacteria is unclear. With the majority of known impacts of tellurite on cells being negative , except for the select few species that can anaerobically respire on TeO32− , we expected there would be reduced growth and, therefore, decreased protein in its presence. Indeed, strains E1, E4(1), RB3, and RB 16-17 showed a drop in protein production as expected (57.8%, 21.3%, 66.1%, and 41.5%, respectively) (Figure 1B). However, KR99 and E5 had an increase in protein levels (66.6% and 21.2%, respectively) (Figure 1A).
|
study
| 100.0 |
Exposure to tellurite in aerobically grown E. coli causes a loss of the transmembrane proton gradient leading to depletion of intracellular ATP . Therefore, we predicted that ATP levels in our experiments might be decreased. As expected, this was observed for E1, E4(1), RB3, and RB 16-17 (35.9%, 31.9%, 55.9%, and 48.8% decrease per unit protein, respectively) (Figure 1D). However, unexpectedly, E5 and KR99 cells produced higher levels of ATP in the presence of tellurite (38.9% and 15.2% increase, respectively) (Figure 1C). For these two strains, an increase was measured in both protein and ATP, and for E1, E4(1), RB3, and RB 16-17 a decrease in each case.
|
study
| 100.0 |
Protein and ATP production in the presence versus absence of K2TeO3. (A) Strain KR99. Similar results for E5; (B) Strain E1. Similar results for E4(1), RB3, and RB 16-17. ♦—No K2TeO3; ▲—500 µg/mL K2TeO3; (C) Strain KR99. Similar results for E5; (D) Strain E1. Similar results for E4(1), RB3, and RB 16-17. ♦—No K2TeO3; ▀—500 µg/mL K2TeO3. Error bars represent one standard deviation.
|
study
| 99.94 |
Generally, if a bacterium must induce expression of a protein to cope with the presence of a harmful substance, a lag phase will be observed during a primary exposure, while the specific product/enzyme is being prepared . However, during subsequent exposure, a lag phase is usually unnecessary, since everything required for synthesis is ready. Such phenomenon has been observed in experiments with tellurite as well as some other metal(loid) oxyanions, for example U(VI) . To determine if tellurite reduction involves de novo production of a specific enzyme, growth physiology during primary and secondary exposure was compared. If growth parameters in both cases were similar, it is likely that the reducing enzyme was constitutively present. However, a lag phase detected during primary exposure, but absent in secondary, would imply the need for initiation of transcription. Strains E1, E5, KR99, RB3, and RB 16-17 all possessed similar growth rates during both primary and secondary exposure (Figure 3A), indicating a constitutive reductase. The remaining strain E4(1) was the exception. Growth was significantly hindered during secondary exposure (Figure 3B). As a result, it could not be determined if there was a lag phase during primary exposure.
|
study
| 100.0 |
Upon halting protein synthesis with tetracycline or chloramphenicol, we found strains E1, E5, KR99, RB3, and RB 16-17 were still capable of reducing tellurite, supporting a constitutive system. In cells of E4(1) reduction was inhibited, indicating de novo preparations are required. To further support the idea that the enzyme(s) responsible for reduction are constitutive, reduction in the cell lysates was analyzed (Figure 3). Lysates of E1, E5, KR99, RB3, and RB 16-17 cells were capable of reducing K2TeO3 without prior exposure (Figure 3A), whereas those of E4(1) could not (Figure 3B), even following exposure (Figure 3C).
|
study
| 100.0 |
Reductase activity in cellular fractions. (A) Cell lysate of strain E1 grown without prior exposure to K2TeO3. Similar results were found for KR99, E5, RB3, and RB 16-17; (B) Lysate of strain E4(1) grown without prior exposure to K2TeO3; (C) Lysate of E4(1) cells grown with prior exposure to K2TeO3. Initial darkening at 0 h is due to the trace presence of previously reduced K2TeO3 from prior exposure; (D) Periplasmic fraction of KR99 without K2TeO3 exposure. No reductase activity observed. Similar results for E5, E4(1), E1, RB3 and RB 16-17; (E) Spheroplast fraction of E1 without prior K2TeO3 exposure containing reductase activity. Similar results for E5, KR99, RB3, and RB 16-17; (F) Spheroplast lysate of KR99 without prior K2TeO3 exposure containing reductase activity. Similar results for E5, E1, RB3, and RB 16-17; (G) E4(1) spheroplast fraction. No reductase activity observed with or without prior K2TeO3 exposure; (H) E4(1) spheroplast lysate. No reductase activity observed with or without prior K2TeO3 exposure.
|
study
| 100.0 |
While all strains, with the exception of E4(1), possessed a constitutive tellurite reductase, its location was unknown. Therefore, strains were fractionated and each fraction monitored for reduction. No reductase activity was observed in the periplasm of any strain (Figure 3D), however, E1, E5, KR99, RB3, and RB 16-17 all possessed activity in the spheroplast and spheroplast lysate (Figure 3E,F). In the case of E4(1), no activity was observed in any fraction with or without prior exposure to TeO32− (Figure 3G,H), strictly confirming a possibility of reduction in intact cells only. Upon separation of the membranes from the cytoplasmic contents, activity was detected for E1, E5, KR99, RB3, and RB 16-17. The rate of reduction was calculated for each fraction (Figure 4). Strain KR99 possessed the highest rate of 0.284 units in the membranes. The strain with the second highest rate was E5 (0.159 units in the membranes), followed by E1 (0.056 units in the membranes), RB3 (0.038 units in spheroplast), and RB 16-17 (0.024 units in spheroplast).
|
study
| 100.0 |
Our understanding of AAPs in general and their interaction with tellurite in particular is still poor with many questions remaining. Obviously, the composition of the growth medium influences the level of resistance. Previous work has shown that in complex medium resistance to tellurite can be increased . In this study we found a similar trend, with E1, E4(1), RB3, and RB 16-17 favoring RO medium. However, E5 and KR99 preferred a defined medium containing glutamate, pyruvate, and malate. We do not know why such a difference was seen. Perhaps these carbon sources are involved with, or can be directly utilized by, the TCA cycle , providing an advantage in energy generation under the stress of K2TeO3 pressure. Therefore, with conditions conducive to easier growth, the negative impact of tellurite can be overcome. It is also likely that these compounds are acting similar to how acetate does in R. capsulatus, competing with tellurite for cellular entry, thereby increasing resistance .
|
study
| 100.0 |
The impact of TeO32− on cellular proteins generally, as expected, resulted in decrease. However, there were also some unexpected turns. Strains E5 and KR99 surprisingly produced more protein in the presence of tellurite. The reason for this increase is unclear, however, there is precedent, as the bacterium strain EG13 also has increased biomass production (4.5 fold) in the presence of other metalloid oxyanions (NaVO3) compared to metal free medium . It has been suggested that reduction of metal(loid) oxyanions can help dispose of excess electrons through the reoxidation of NADH, FADH2, or quinones, therefore retaining optimal redox poise in vivo . This may result in optimal conditions for growth being maintained longer than in the absence of the oxyanion. Possibly, something similar is happening in KR99 and E5. An increase/decrease in biomass resulted in corresponding increased/decreased ATP, as one would expect.
|
study
| 100.0 |
Interestingly, strains E1, E5, KR99, RB3, and RB 16-17 appear to possess similar strategies for tellurite reduction, in both expression and location. While this may imply they are alike, the ability of each strain to reduce and resist tellurite is different , which suggests they may actually have different sets of physiological reactions to interact with the oxyanion. Also, one can see reduction profiles in strains RB3 and RB 16-17 differ from the others, with whole cells having a higher rate than fractions even though activity is present in membranes. It is possible more than one mechanism is employed for reducing tellurite and/or some other cellular component is required for maximal effectiveness. Further research is needed to elucidate the exact approach utilized here. Strain E4(1) was the only one requiring a fully functional intact cell, as well as de novo protein preparations, for reduction. Other studied species capable of tellurite reduction/resistance at very high levels have been reported to possess a similar requirement , and may share a comparable physiology. Possibly, E4(1) has an operational membrane electron transport system similar to Shewanella oneidensis MR-1 developed for Fe(III), Mn(IV), and V(V) reduction .
|
study
| 100.0 |
In this work, we have established that among different species of AAP, two strategies for tellurite reduction may be required. First, there is a constitutive membrane associated reduction pathway, as seen in E1, E5, KR99, RB3, and RB 16-17. The second, requires de novo protein synthesis and fully functional unbroken cells, found in strain E4(1). The identified approaches were not completely unexpected as similarities exist to previously established physiological responses to metal(loid) oxyanions. Membrane associated metal(loid) reduction has been previously observed in R. capsulatus and Enterobacter cloacae EV-SA01 . There is also precedent for the need of fully intact cells . It is likely that there are several integral components associated with the outer membrane, periplasm, and inner membrane which are all involved in reducing tellurite. Hence, removal of one component results in loss of function of the entire system. This complex coordinated arrangement is published for reduction of other metal oxyanions .
|
study
| 100.0 |
In summary, this paper broadens what we know about the strategies used by AAP for tellurite reduction and shows that more than one approach has evolved in this physiological group of bacteria to deal with this toxic compound. These strategies differ from the only known example of a tellurite specific reductase system, in Gram positive bacterium Bacillus STG-83 . Our investigation has provided a stepping stone for future investigation of the key enzymes and pathways that provide the AAP capability to resist extremely high concentrations of toxic oxyanions.
|
study
| 99.94 |
Much research has sought to elucidate the neurobiological mechanisms underlying reward and addiction. The majority of this work has focused on the traditional mesolimbic reward circuitry in the brain. This pathway originates with dopamine (DA) neurons in the ventral tegmental area (VTA) and projects primarily to the nucleus accumbens (NAc) in the ventral striatum, but it also projects to the amygdala, the bed nucleus of stria terminalis, the lateral septal area and the lateral hypothalamus1.
|
review
| 99.6 |
The activity of VTA DA neurons is inhibited or excited by somatosensory stimuli, such as tactile or noxious stimulation2, 3. Tactile stimulation of the forelimb inhibits DA release in the contralateral striatum4, 5, while noxious stimulation applied to the tail enhances DA release in the NAc6, suggesting that the mesolimbic reward system is modulated by somatosensory input. We and others have shown that sensory stimulation reduces drug craving behaviors through the modulation of the mesolimbic DA systems in rats and humans7–9. The application of acupuncture, widely accepted as a form of peripheral sensory stimulation10, to the ulnar tunnel (also called as HT7 Shenmen Acupoint or Guyon’s Canal) decreases DA release in the NAc by activating GABA neurons in the VTA, resulting in the suppression of cocaine, morphine and ethanol self-administration11–13. We have previously reported that inhibition of drug-seeking behaviors is mediated via activation of specific fiber types in the ulnar nerve. Mechanical stimulation of the ulnar nerve activates peripheral sensory afferents, such as Pacinian and Meissner corpuscles, which are conveyed via large A-fibers within the nerve trunk, and inhibits the locomotor activating effects of cocaine11, providing further evidence that the activation of primary sensory fibers can attenuate the reinforcing effects of drugs of abuse in the reward system. However, the central links between somatosensory and brain reward systems are not completely understood.
|
study
| 99.94 |
There are two main somatosensory pathways in the spinal cord that relay sensory signals from the periphery to brain. The dorsal column (DC)-medial lemniscus pathway transmits innocuous tactile information, while the spinothalamic tract (STT) conveys noxious signals, including pain and temperature14. As there is compelling evidence that innocuous or noxious stimulation influences the mesolimbic DA system2, 15, the spinal ascending pathways, such as DC and STT, likely play a role in linking the peripheral sensory system to reward circuits. In addition, the lateral habenula (LHb), a key epithalamic structure interconnecting sensory inputs to mesolimbic DA systems, has been reported to be critically involved in processing of peripheral sensory inputs and reward16–18.
|
review
| 73.9 |
To identify the ascending spinal pathway contributing to peripheral stimulation-induced inhibition of drug-induced behaviors, we hypothesized that: 1) Selective lesions of the DC or STT pathways would affect sensory stimulation-induced inhibition of cocaine locomotor activity; 2) DC nuclei would be activated by specific peripheral stimulation; 3) Surgical transection of the DC or STT pathways would decrease the inhibition of cocaine modulation of the NAc by peripheral stimulation; 4) Peripheral stimulation would activate the lateral habenula (LHb); and 5) LHb lesions would disrupt sensory stimulation-induced effects on cocaine locomotion or neuronal activation in NAc.
|
study
| 100.0 |
Systemic injection of cocaine (15 mg/kg, i.p.) markedly increased locomotor activity, which lasted for approximately 60 min from the peak magnitude at 10 min (Con; Fig. 1A). Mechanical stimulation (MS) of the ulnar area (Ulna MS) near HT7 acupoint for 20 sec, which is sufficient to activate A- and C-fibers11, attenuated cocaine enhancement of locomotor activity, while MS of the radial site did not alter cocaine-induced locomotor activity (Rad MS; Fig. 1A). Mechanical stimulation of the ulnar site after sectioning the ulnar nerve had no effect on cocaine-induced locomotion (Fig. 1B; p > 0.05), suggesting that somatosensory-induced inhibition of cocaine-induced locomotion was mediated through activation of the ulnar nerve. Ulna MS did not affect locomotor activity in saline-injected rats (Fig. 1C), suggesting that Ulna MS attenuated cocaine-evoked locomotion, but not generalized locomotion. As ulnar MS produced consistent and reproducible inhibitory effects on cocaine-induced locomotion in our previous11 and present studies; MS was applied only to the ulnar site in subsequent experiments.Figure 1Mechanical stimulation of the ulnar nerve suppresses cocaine-induced locomotor activity. (A) Mechanical stimulation (MS) of the ulnar site (Ulna MS; n = 6) significantly attenuated the locomotor response to cocaine, compared to the control group that received cocaine only (Con; n = 6) *p < 0.05 vs. Con; # p < 0.05 vs. Rad MS. Mechanical stimulation of the radial site (Rad MS; n = 6) did not alter cocaine-induced locomotion. (B) The inhibitory effect of ulnar MS on cocaine locomotion was not observed in rats with ulnar nerve injury (Ulna X + Ulna MS; n = 8) when compared to control rats with ulnar nerve injury (Ulna X; n = 8). The term ‘X’ denotes lesion or injury. (C) Ulna MS did not affect locomotion in the control rats injected with saline (Ulna MS; n = 5).
|
study
| 100.0 |
Mechanical stimulation of the ulnar nerve suppresses cocaine-induced locomotor activity. (A) Mechanical stimulation (MS) of the ulnar site (Ulna MS; n = 6) significantly attenuated the locomotor response to cocaine, compared to the control group that received cocaine only (Con; n = 6) *p < 0.05 vs. Con; # p < 0.05 vs. Rad MS. Mechanical stimulation of the radial site (Rad MS; n = 6) did not alter cocaine-induced locomotion. (B) The inhibitory effect of ulnar MS on cocaine locomotion was not observed in rats with ulnar nerve injury (Ulna X + Ulna MS; n = 8) when compared to control rats with ulnar nerve injury (Ulna X; n = 8). The term ‘X’ denotes lesion or injury. (C) Ulna MS did not affect locomotion in the control rats injected with saline (Ulna MS; n = 5).
|
study
| 100.0 |
To evaluate the role of the DC somatosensory pathway in ulnar MS-induced inhibition of cocaine locomotion, bilateral lesions of the DC were made at the C3 level 7–10 days before testing (Fig. 2A1 and A2). Inhibition of cocaine locomotion by ulnar MS was prevented by DC lesions (the term ‘X’ refers to ‘lesion’; two-way ANOVA: group factor F = 4.095, p = 0.050; time factor F = 6.202, p < 0.001; interaction F = 0.603, p = 0.804; Fig. 2A3), or by bilateral lesions of the CN, the second-order neurons in the DC pathway (p < 0.05, CN X + MS vs. Sham + MS, Fig. 2B1–3). Taken together, these results indicate that the DC pathway mediates ulnar MS-induced inhibition of cocaine locomotion.Figure 2The role of the dorsal column somatosensory pathway in ulnar nerve inhibition of cocaine-induced locomotion. (A) Dorsal column lesions (DC X) were introduced bilaterally at the C3 level of the spinal cord (A1), as shown in a representative image of toluidine blue staining (A2). Mechanical stimulation (MS) of the ulnar site (MS) reduced cocaine-induced locomotion (Sham + MS; n = 10), compared to the control group (DC X; n = 6), which was blocked by surgical lesion of DC prior to MS (DC X + MS; n = 7; A3). *p < 0.05 vs. Sham + MS. (B) When CN lesions (CN X) were performed bilaterally 7–10 days prior to the experiment (B1 and B2), MS of the ulnar site failed to reduce cocaine locomotion (CN X + MS; n = 10), compared to the control groups of CN X (CN X; n = 5), Sham (n = 5) and Sham + MS (n = 5; B3). *p < 0.05 vs. CN X + MS. (C) Representative waveforms and peri-stimulus time histograms of in vivo extracellular recordings in CN neurons (C1–2). Ulnar MS markedly increased CN WDR (n = 6) and LT (n = 7) spiking activity (C3). *p < 0.05 vs. Baseline. (D) Increased expression of c-fos immunopositive cells following ulnar stimulation (MS, n = 6; D1 & D3) in the dorsomedial portion of the CN (D2), compared to the control group (Con, n = 6; D1). Bar = 20 µm. *p < 0.05 vs. Con (D3). Figure 3The effects of STT or VPL lesions on the ulnar inhibition of cocaine locomotion. (A) STT lesions (STT X) at the C3 level of the spinal cord (A1–2) did not affect ulnar MS-induced inhibition of cocaine-induced locomotion (STT X + MS; n = 8) when compared to the control group (STT X; n = 7) or ulnar stimulation without STT lesion (Sham + MS; n = 6; A3). *p < 0.05 vs. STT X. Representative images of STT lesions stained by toluidine blue (A2). (B) Bilateral chemical lesions of the VPL (B1–2) block the inhibitory effects of cocaine locomotion by ulnar MS (VPL X + MS; n = 7), compared to the control groups of VPL X (n = 7) and Sham + MS (n = 6; B3). *p < 0.05 vs. Sham + MS or VPL X + MS.
|
study
| 100.0 |
The role of the dorsal column somatosensory pathway in ulnar nerve inhibition of cocaine-induced locomotion. (A) Dorsal column lesions (DC X) were introduced bilaterally at the C3 level of the spinal cord (A1), as shown in a representative image of toluidine blue staining (A2). Mechanical stimulation (MS) of the ulnar site (MS) reduced cocaine-induced locomotion (Sham + MS; n = 10), compared to the control group (DC X; n = 6), which was blocked by surgical lesion of DC prior to MS (DC X + MS; n = 7; A3). *p < 0.05 vs. Sham + MS. (B) When CN lesions (CN X) were performed bilaterally 7–10 days prior to the experiment (B1 and B2), MS of the ulnar site failed to reduce cocaine locomotion (CN X + MS; n = 10), compared to the control groups of CN X (CN X; n = 5), Sham (n = 5) and Sham + MS (n = 5; B3). *p < 0.05 vs. CN X + MS. (C) Representative waveforms and peri-stimulus time histograms of in vivo extracellular recordings in CN neurons (C1–2). Ulnar MS markedly increased CN WDR (n = 6) and LT (n = 7) spiking activity (C3). *p < 0.05 vs. Baseline. (D) Increased expression of c-fos immunopositive cells following ulnar stimulation (MS, n = 6; D1 & D3) in the dorsomedial portion of the CN (D2), compared to the control group (Con, n = 6; D1). Bar = 20 µm. *p < 0.05 vs. Con (D3).
|
study
| 100.0 |
The effects of STT or VPL lesions on the ulnar inhibition of cocaine locomotion. (A) STT lesions (STT X) at the C3 level of the spinal cord (A1–2) did not affect ulnar MS-induced inhibition of cocaine-induced locomotion (STT X + MS; n = 8) when compared to the control group (STT X; n = 7) or ulnar stimulation without STT lesion (Sham + MS; n = 6; A3). *p < 0.05 vs. STT X. Representative images of STT lesions stained by toluidine blue (A2). (B) Bilateral chemical lesions of the VPL (B1–2) block the inhibitory effects of cocaine locomotion by ulnar MS (VPL X + MS; n = 7), compared to the control groups of VPL X (n = 7) and Sham + MS (n = 6; B3). *p < 0.05 vs. Sham + MS or VPL X + MS.
|
study
| 100.0 |
To determine if ulnar MS activates the CN directly, we performed single-unit extracellular recordings in anesthetized rats (Fig. 2C). Figure 2C2 shows the waveforms and the peri-stimulus spike histogram during the recording of a CN neuron. Of 13 recorded CN neurons, 6 were classified as having a wide dynamic range (WDR), 7 neurons were characterized as having a low threshold (LT), and 0 high threshold (HT) neurons were found. The baseline activity of LT and WDR neurons were 0.8 ± 0.3 spikes/sec and 2.1 ± 1.5 spikes/sec, respectively. Ulnar MS markedly increased the firing rate of CN LT neurons to 25.2 ± 5.98 Hz and WDR neurons to 43.6 ± 16.4 Hz (p < 0.05, Fig. 2C3). To identify the region of the CN activated by ulnar MS, we examined c-fos expression in the CN after stimulation in another subset of rats. The number of c-fos immunopositive cells was significantly increased in the CN after ulnar MS (11 ± 0.57) compared to control groups (Con, 0.66 ± 0.66) (Fig. 2D1–3, p < 0.05) and were detected mainly in the dorsomedial portion of the CN (Fig. 2D2).
|
study
| 100.0 |
To evaluate the role of the STT pathway in the inhibition of cocaine-induced locomotor activity by ulnar MS, STT lesions were made by surgically cutting the ventrolateral columns at the C3 level 7–10 days before testing (Fig. 3A1 and A2). STT lesions did not alter the inhibitory effects of ulnar MS on cocaine locomotion (p > 0.05, STT X + MS vs. Sham + MS, Fig. 3A3), suggesting that the STT pathway does not play a role in these processes (Fig. 3A). In an experiment to evaluate the role of the VPL, the third-order neurons of the DC pathway, in the inhibition of cocaine-induced locomotor activation by ulnar MS, chemical lesion of the VPL by ibotenic acid (Fig. 3B1 and B2) effectively blocked the ulnar MS effects (VPL X + MS vs. Sham + MS; two-way ANOVA: group factor F = 7.010, p = 0.017; time factor F = 14.122, p < 0.001; interaction F = 2.584, p = 0.016; Fig. 3B3), confirming the VPL mediation of DC input.
|
study
| 100.0 |
The LHb conveys inhibitory reward signals that inhibit VTA DA neurons and DA release in the NAc19, and neurons in the LHb can be excited by peripheral stimulation20. To determine if ulnar MS might activate the LHb, we measured brain temperature, an indicator of metabolic neural activation21. LHb temperature following ulnar MS increased to 0.073 ± 0.013 °C over baseline and recovered to baseline shortly after stimulation (LHb; Fig. 4A1–3), while no significant changes of temperature were seen during ulnar MS in control sites, 1.3 mm apart from LHb (Con; Fig. 4A1–3). To provide evidence for LHb activation and specific LHb projections to the VTA/RMTg, we examined the expression of c-fos in LHb neurons retrogradely labeled from the VTA/RMTg. The number of c-fos positive cells in the LHb increased approximately 2-fold in rats undergoing ulnar MS compared to naïve rats (p = 0.003; Fig. 4B1–3). Numbers of c-fos positive cells in retrogradely labeled LHb neurons significantly increased in ulnar MS-treated rats compared to naïve rats (Fig. 4C1–4; Con vs. MS. P < 0.05), suggesting that VTA/RMTg-projecting LHb neurons were activated by ulnar MS. To identify the role of the LHb in sensory inhibition of cocaine locomotion, electrolytic lesions of LHb were made bilaterally (Fig. 4D1–2). LHb lesions impaired the inhibition of cocaine locomotion by ulnar MS (LHb X + MS), compared to control group (Sham + MS; Fig. 4D3). To further confirm that the neurons in the LHb were evoked during ulnar MS, extracellular recordings were performed in LHb. The mean firing rates of LHb neurons (n = 21 from 7 rats) during ulnar MS increased from 2.44 ± 0.6 spikes/sec to 28.95 ± 3.8 Hz and returned to baseline (2.43 ± 0.71 Hz) shortly after termination of ulnar MS (p < 0.05, Fig. 5A1–3). To see a putative VPL-LHb link, we explored whether VPL lesion could interrupt the neuronal activation of LHb following peripheral stimulation. The c-fos expression in the LHb increased following ulnar MS (12.29 ± 1.62), compared to controls (Con, 4.04 ± 0.27), which was prevented by VPL lesion (VPL X + MS, 5.42 ± 1.88; Fig. 5B4, p < 0.05).Figure 4The role of VTA/RMTg projections to the lateral habenula (LHb) on ulnar inhibition of cocaine locomotion. (A) Ulnar MS increases LHb temperature (A1–3). (B) Activation of LHb neurons projecting to the VTA/RMTg regions following ulnar stimulation. The number of c-fos positive cells in the LHb increased by approximately 2-fold in ulnar MS rats (MS, B2-B3; n = 5) compared to rats in the control group (Con; B1; n = 5). (C) c-fos LHb positive cells (C2) were labeled retrogradely with fluorogold (FG; yellow; C1) injected into the VTA/RMTg regions (C1–3). The number of c-fos positive cells double-labeled with FG significantly increased in ulnar MS (n = 5), compared to control (Con; n = 5; C4). # p < 0.05 vs. Con. (D) Electrolytic lesions of LHb (LHb X; D1–2) prevented ulnar MS-induced inhibition of cocaine-induced locomotion (LHb X + MS; n = 5), compared to the control groups of LHb lesion only (n = 5) and Sham + MS (n = 5) (D3). # p < 0.05 vs. LHb X. *p < 0.05 vs. Sham + MS. Figure 5The role of the VPL in the neural activation of LHb following ulnar MS. (A) Extracellular single-unit recordings in the LHb during ulnar MS. Representative waveforms (A1) and peri-stimulus time histograms (A2). Single-unit activities of LHb neurons were markedly evoked during ulnar MS (n = 7) (A2–3). # p < 0.05 vs. Before. (B) Ulnar stimulation (MS, n = 5; B2, B4) significantly increased the numbers of c-fos immunopositive cells, compared to control (Con, n = 5; B1, B4), which was prevented in the rats injected with ibotenic acid into VPL (VPL X, n = 5; B3–4). # p < 0.05, Con vs. MS; *p < 0.05, MS vs. VPL X + MS. Bar = 20 µm.
|
study
| 100.0 |
The role of VTA/RMTg projections to the lateral habenula (LHb) on ulnar inhibition of cocaine locomotion. (A) Ulnar MS increases LHb temperature (A1–3). (B) Activation of LHb neurons projecting to the VTA/RMTg regions following ulnar stimulation. The number of c-fos positive cells in the LHb increased by approximately 2-fold in ulnar MS rats (MS, B2-B3; n = 5) compared to rats in the control group (Con; B1; n = 5). (C) c-fos LHb positive cells (C2) were labeled retrogradely with fluorogold (FG; yellow; C1) injected into the VTA/RMTg regions (C1–3). The number of c-fos positive cells double-labeled with FG significantly increased in ulnar MS (n = 5), compared to control (Con; n = 5; C4). # p < 0.05 vs. Con. (D) Electrolytic lesions of LHb (LHb X; D1–2) prevented ulnar MS-induced inhibition of cocaine-induced locomotion (LHb X + MS; n = 5), compared to the control groups of LHb lesion only (n = 5) and Sham + MS (n = 5) (D3). # p < 0.05 vs. LHb X. *p < 0.05 vs. Sham + MS.
|
study
| 100.0 |
The role of the VPL in the neural activation of LHb following ulnar MS. (A) Extracellular single-unit recordings in the LHb during ulnar MS. Representative waveforms (A1) and peri-stimulus time histograms (A2). Single-unit activities of LHb neurons were markedly evoked during ulnar MS (n = 7) (A2–3). # p < 0.05 vs. Before. (B) Ulnar stimulation (MS, n = 5; B2, B4) significantly increased the numbers of c-fos immunopositive cells, compared to control (Con, n = 5; B1, B4), which was prevented in the rats injected with ibotenic acid into VPL (VPL X, n = 5; B3–4). # p < 0.05, Con vs. MS; *p < 0.05, MS vs. VPL X + MS. Bar = 20 µm.
|
study
| 100.0 |
To evaluate if ulnar stimulation could suppress NAc activity, we examined the expression of c-fos in the NAc by acute cocaine injection following surgical lesion of either DC, STT or LHb. The numbers of c-fos positive cells were significantly increased in cocaine-treated rats compared to controls. The cocaine-induced increase in c-fos positive neurons was attenuated by ulnar MS, which was prevented when the DC was lesioned, but not when the STT was lesioned (Fig. 6A1–6). In another set of animals, we repeated this experiment after disruption of the LHb. Electrolytic lesion of LHb prior to ulnar stimulation blocked the inhibitory effect of ulnar stimulation on cocaine-induced c-fos expression in the NAc (Fig. 6B1–5).Figure 6The effects of DC or LHb lesions on ulnar inhibition of cocaine-induced c-fos expression in the NAc. (A) The cocaine-induced increase in c-fos positive neurons in NAc (A2; Cocaine, n = 6) was attenuated by ulnar stimulation (A3; Cocaine + MS, n = 6), which was prevented when the DC was damaged (A4; DC X + Cocaine + MS, n = 6), but not STT (A5–6; STT + Cocaine + MS, n = 6). A1, control (Con); *p < 0.05, Bar = 20 µm. (B) The cocaine-induced increase in c-fos positive neurons in NAc (B2; Cocaine, n = 6) was attenuated by ulnar stimulation (B3; Cocaine + MS, n = 6), which was prevented when the LHb was damaged (B4–5; LHb X + Cocaine + MS, n = 6). B1, control (Con); *p < 0.05, Bar = 20 µm.
|
study
| 100.0 |
The effects of DC or LHb lesions on ulnar inhibition of cocaine-induced c-fos expression in the NAc. (A) The cocaine-induced increase in c-fos positive neurons in NAc (A2; Cocaine, n = 6) was attenuated by ulnar stimulation (A3; Cocaine + MS, n = 6), which was prevented when the DC was damaged (A4; DC X + Cocaine + MS, n = 6), but not STT (A5–6; STT + Cocaine + MS, n = 6). A1, control (Con); *p < 0.05, Bar = 20 µm. (B) The cocaine-induced increase in c-fos positive neurons in NAc (B2; Cocaine, n = 6) was attenuated by ulnar stimulation (B3; Cocaine + MS, n = 6), which was prevented when the LHb was damaged (B4–5; LHb X + Cocaine + MS, n = 6). B1, control (Con); *p < 0.05, Bar = 20 µm.
|
study
| 100.0 |
The DC somatosensory pathway is involved in signaling innocuous information from A-fiber mechanoreceptors that mediate tactile discrimination, well-localized touch, vibration and proprioception14. We and others have provided indirect evidence implicating the DC pathway in the modulation of the midbrain DA system. Stimulation of HT7 acupoint over the ulnar nerve (known as Guyon’s Canal) inhibits cocaine-induced locomotion via activation of A-fiber and also prevents DA release and drug-seeking behaviors by ethanol, cocaine and morphine11–13, 22, 23. Sciatic nerve stimulation at a low threshold current inhibits the activity of most DA neurons in the substantia nigra24. The present study showed that the DC pathway was directly involved in peripheral inhibition of cocaine-induced psychomotor response and suggests a novel functional role of the DC pathway in conveying inhibitory signals from the periphery to the brain reward center. Bilateral stimulation of the forearm radial site did not affect cocaine-induced behaviors, which is consistent with previous studies11, 25. Indeed, it was reported that unilateral stimulation of the radial nerve at low thresholds produces opposite effects on DA activity in anesthetized cats, characterized by DA decrease in the contralateral midbrain and DA increase in the ipsilateral midbrain26. When bilaterally stimulated as in the present study, the radial nerve did not have a significant effect on midbrain DA activity or cocaine-induced psychomotor behaviors.
|
study
| 99.94 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.