text
string | predicted_class
string | confidence
float16 |
|---|---|---|
Table 2Themes and examples across community listening sessionsThemesExamples from transcriptsUncertainties of underrepresented populations regarding research participation▪ “…I don’t feel like they give it to you straightforward if you want to participate. You want to be involved in it, but there’s a sixth sense from things that you’ve seen in the past with medical research…”▪ “I just think it’s what people have alluded to… if you are participating in research that involves trying out a drug that they are not 100 % sure of how it is going to affect you, I don’t think I’d want to be that guinea pig”▪ “I was going to say safety, depending on what type of research it is. If they are testing a new drug, what are the possible side effects or any ramifications from something unknown?”Ineffective communication about research opportunities and research findings▪ “I was in the E.R. without any interpreter. There was no interpreter, and they refused to get an interpreter.”▪ “Yeah, I would like to see us get more information in the black community. We don’t get information, pertinent, information. I’m not being racist, but white folks know about what’s going on…”▪ “You want to be updated on their progress… on what they had learned. They need to show you proof that they are making progress…”Research on primary care and prevention are priorities for underrepresented populations in research▪ “I would like to see more focus on preventative healthcare … you know, the things that we should do to prevent these things from happening, to prevent heart disease, diabetes and stroke.”▪ “…one time I went to do the research. I had never taken anything. One set of nurses were so condescending…Her energy was not good. I wasn’t going to come back. It was just horrible.”▪ “…most of the time the doctors will say, “You’re okay.” Okay, then what are my numbers? What are my levels? What are my blood sugar levels? They don’t say anything. They just say, “You’re okay.” So, really, I want to find out what’s going on”Research teams need training in communication and cultural humility▪ “It makes me wonder… do you think there’s a stigma attached to the people, for example, who get the food stamps? Maybe that’s why we don’t talk about it as a society…”▪ “Sometimes when I tell them I’m deaf, they give me a piece of braille paper.”▪ “I participated in research and I done it about three times… One was about body fat. They said I was obese. How dare they?”
|
other
| 99.9 |
Eliminating disparities in health and health care is a top priority identified by the US Department of Health and Human Services’ Healthy People 2020 initiative . Increasing the participation of underrepresented populations in research is a mechanism to reduce health disparities . Though there is a long-standing mandate, the National Institute of Health Revitalization Act, for the inclusion of women and minorities in research , few studies have made it a priority to incorporate underrepresented populations throughout the research process . This study illustrates the mutual benefit/shared authority of an academic-community partnership to capture health and research priorities along with research experiences among a diverse group of underrepresented populations.
|
other
| 99.8 |
The NRC played a key role in the design and implementation of the sessions by recruiting participants and creating, reviewing, and providing feedback on the materials used during the sessions. The NRC helped set the geographical boundaries for the listening sessions based on their experience and relationship with the population of interest. Our target audience, identified by community leaders, are often overlooked within the research enterprise: HUD housing communities, Spanish-speaking communities, and individuals with disabilities. The conversational nature of the CLSs and engagement with the community during the process enabled us to identify and prioritize the health and research concerns of underrepresented communities surrounding the Nashville surrounding area.
|
other
| 99.9 |
Defining research priorities is essential to guiding science, research development, and improving health outcomes. Top health and research priorities from the community perspective were identified; a novel contribution to the literature. Since community members rarely have the opportunity to provide input in health research, it was important to gauge their areas of priority. Priorities included cancer, Alzheimer’s disease, cardiovascular disease, and diabetes. Perceived barriers to research, both physical and behavioral, were consistent with the literature [17, 21]. Participants with positive research experiences reported more positive views towards research than those who had limited knowledge of research, or those knowledgeable of research and its historical abuses . Participants further stressed the need to gain more knowledge on research in general, as well as mechanisms to provide information on researchers and studies. Compelling suggestions were to receive information through community meetings (implying researchers must be visible in the community), educating the community on the “nature” of research, and being responsive to community-preferred modes of research dissemination. Last, this study demonstrates that while providers play a major role in their patients’ health and research decision-making, they engage in ineffective communication on the topics of concern to the CLSs. Identifying mechanisms that promote patient-centered medical homes and research opportunities are necessary to improving individuals’ comfort in engaging in research and preventive health activities.
|
study
| 95.44 |
Similar to past studies on barriers to minority participation in research , we found that these underrepresented populations had queries concerning their potential participation. Example questions from these participants included: (1) “Where and how do I find out about research studies?” (2) “What is the purpose of participating in research?” (3) “How will this study affect my safety?” and (4) “What happens when the study is complete?” As an initial step to address these concerns, we developed a frequently asked questions handout that we shared with the participants at the completion of the sessions. This handout explained the benefits of participating in research, legal safeguards that are in place (IRB, informed consent, and the Patient Bill of Rights), and local resources to learn about opportunities to participate in research. To further address these concerns, Table 3 provides recommendations informed by study participants for engaging underrepresented populations, ideas that can potentially keep them engaged in research.
|
study
| 99.9 |
Table 3Recommendations for engaging underrepresented populationsEstablish a line of communication between researcher and community during all phases of researchBroadly disseminate research opportunities implementing user-friendly strategiesTransparency regarding risks of research to participants and communityDistribution of more comprehensive, up-to-date information on clinical research and researchersRecognition of community members as partners in researchBuild trust between community, academicians, and clinicians by teaching these individuals to engage in effective, bi-directional communication among these groups. This will help to gain an understanding of each stakeholders research needs in order to improve research participation of underrepresented groupsUse of engagement strategies to ensure communications are person-centered
|
other
| 99.9 |
The community was engaged in all phases of the research process, including the development of this paper, a process ensuring the community voice heard. Because this study was exploratory and descriptive in nature, the researchers gained insight on local health and research experiences (e.g., barriers, concerns), as well as underrepresented populations’ expectations in order to participate in research. An in-depth understanding was gained through the participant-driven CLSs, the free-form approach which provided content-rich themes, and the use of the constant comparison method .
|
study
| 99.9 |
The results of this study may not be generalizable to other underrepresented populations beyond the Nashville, Davidson county corridor of Tennessee. However, we purport the findings will provide valuable guidance for conducting CLSs in other similar areas and with other underrepresented populations. Lastly, it is plausible that researchers’ personal biases could interfere with the collection of data and interpretation of the results; however, the CLSs were facilitated by the community partner and the transcriptions were provided verbatim for analysis, minimizing researchers’ influence on the data. The subsequent theme analyses were double coded and divergent codes resolved by consensus.
|
study
| 99.94 |
This study sought to implement an innovative, community-engaged research approach to identify research priorities of underrepresented populations while documenting the concerns that contribute to poor rates of participation in research. Results of this study and more like it could be leveraged to impact health disparities that are due in part to poor community engagement. Further studies are needed to determine if these findings resonate with hard to reach populations in other geographical areas. Application of this approach to highlight health priorities, research experiences, and the research needs of these populations could potentially unmask new strategies to facilitate underrepresented community members’ involvement along the entire research continuum.
|
study
| 99.94 |
Reactive oxygen species (ROS), including superoxide (O2−·), hydrogen peroxide (H2O2), and hydroxyl radical, is important cellular toxicants that generated as products or by‐products in cells. A series of antioxidant mechanisms maintain intracellular redox homeostasis. When they deficit, overproduction of ROS causes DNA mutations and protein dysfunction, which eventually leads to cell injury and aging. The thiomethyl group that exists on the surface exposed methionine (Met) residues has been recognized as a key endogenous antioxidant defense (Ruan et al., 2002; Davies, 2005; Wood et al., 2009; Kim, 2013), providing for efficient scavenging of oxidants. To maintain the effective content of Met (Ruan et al., 2002), methionine sulfoxide reductase A (MsrA) plays a central role. MsrA reduced the oxidate of Met (methionine sulfoxide, MetO) back to Met and increased resistance of organisms to oxidative stress (Weissbach et al., 2002; Koc et al., 2004). Interestingly, MsrA was previously reported as a regulator of lifespan to increase longevity in animals, including Drosophila, yeast, and mice (Ruan et al., 2002; Koc et al., 2004; Chung et al., 2010). Gene expression decreased for MsrA in senescent cells and aged animals (Gabbita et al., 1999; Oien et al., 2009), and this decline was associated with the accumulation of oxidized proteins during aging. MsrA deficiency has been involved in the pathophysiology of aging‐related diseases (Yermolaieva et al., 2004; Pal et al., 2007; Oien et al., 2008; Prentice et al., 2008). Thus, pharmacological enhancement of MsrA function seems to be reasonable therapeutic strategy against aging in clinics. Only very few approaches are available to enhance MsrA function, such as activators like fusaricidin (Cudic et al., 2016), substrates including L‐Met and S‐methyl‐L‐cysteine (Wassef et al., 2007; Wood et al., 2009), and upregulation of endogenous MsrA (Novoselov et al., 2010; Wu et al., 2013a).
|
review
| 99.9 |
Despite MsrA has been identified in numerous organisms, and its role in the reduction in MetO has been described well (Ruan et al., 2002; Weissbach et al., 2002), little is known about how MsrA reduces ROS to confer its antioxidant capability. Previously, the antioxidation property of MsrA is considered as the natural antioxidation activity of Met residues (Davies, 2005). Recent studies by our group and other laboratories have indicated that MsrA may exert antioxidant effect through other potential pathways (Lim et al., 2011, 2013; Wu et al., 2013a; Fan et al., 2015), such as facilitating the reaction of Met with ROS via a stereospecific Met oxidase activity (Lim et al., 2011, 2013). Although Met emerges as a good substrate for the peroxidase activity of MsrA, there are many difficulties in systematic application of methionine in vivo, for its rapid metabolism and high risk of acute coronary events (Virtanen et al., 2006). Here, we used a homology modeling tool to search the better substrates for the stereospecific methyl sulfide oxidase activity of MsrA. We found that dimethyl sulfide (DMS), a main metabolite that produced by marine algae or fermentative bacteria (Scarlata & Ebeler, 1999; Avsar et al., 2004), was a good substrate for MsrA‐catalytic antioxidation. We demonstrated that the reaction between DMS and free radicals was catalyzed by an MsrA‐dependent mechanism and this enzymatic process leads to the beneficial effects of DMS on cytoprotection and longevity.
|
study
| 99.94 |
Homology modeling was used to analyze structure interactions between potential substrates and MsrA (see detail in supplementary methods). In previous studies, it has been shown that in the first step of MsrA‐catalytic oxidation, a sulfenic acid residue on Cys72 of MsrA forms by ROS attacking (MsrA‐CYO). Thus, we analyzed the orientation of different MsrA substrates in the active site of MsrA‐CYO (Fig. S1A–F). We found DMS adopts a preferred orientation with the distance of O‐S 3.8 Å (Table S1). In the presence of DMS binding, the distances of donor and acceptor atoms (D‐H···A) between the O atom from CYO72, the H atom from Tyr103‐OH, and Glu115‐COOH were 3.6 and 1.6 Å, respectively. Another question is whether the preferred orientation of DMS in the active site formed easily. Thus, energy barrier was used to evaluate the difficulty of orientation. Steering molecular dynamics (SMD) can operate single molecules to move closer or apart just like the working mode of atomic force microscopy. For oxidative reaction catalyzed by MsrA, substrates including DMS were pulled 16 Å away from MsrA and then pulled to the active site of MsrA. Curves of works showed how much energy was required to pull substrates to the active site as close as possible (Fig. S2A,B). It was obvious that much less energy was required for pulling DMS than Met substrates, indicating that the formation of sulfonium intermediate on DMS occurs more easily. As shown in Fig. S2C, DMS fitted properly in the catalytic pocket of MsrA, which also indicated DMS was a dominant substrate of MsrA.
|
study
| 100.0 |
The DMS conformation from docking experiment indicated that DMS could easily bind to the catalytic pocket of MsrA (Fig. 1A), which was composed of side chains of Cys72, Phe73, Trp74, Tyr103, and Glu115. To confirm this point, firstly, we asked whether DMS could directly bind to the pocket of MsrA. The active rat recombined MsrA protein (3 μm) was incubated with different concentrations of DMS, and its binding was measured by fluorescence anisotropy. As shown in Fig. 1B, the anisotropy value of MsrA reduced with the increasing amount of DMS at near‐physiological concentrations (1–5 μm), indicating a direct binding of DMS to MsrA.
|
study
| 100.0 |
MsrA catalyzes the DMS‐mediated scavenging of radicals via formation of sulfonium intermediate at residues Cys72, Tyr103, Glu115. (A) DMS could easily bind to the catalytic pocket of MsrA, which is composed of side chains of Cys72, Phe73, Trp74, Tyr103, and Glu115. (B) Steady‐state fluorescence anisotropy values are shown as a function of increased concentrations of DMS. The concentration of MsrA was 3 μm. (C) The effect of 0.1 mm DMS on the signal intensity of DMPO‐OH adducts in the presence of MsrA or nonactive MsrA was evaluated under the same experimental conditions (n = 5, Student's t‐test, **P < 0.01 vs. no enzyme group). The peak intensity of EPR was expressed as a relative change in comparison with 0.1 mm DMS treatment, which was set to 100%. (D) The transform rate of DMS into DMSO in the presence of active MsrA or nonactive MsrA was determined by GC‐MS method (n = 6, Student's t‐test, **P < 0.01 vs. control). (E) The catalytic activity of single site mutant enzymes was detected by the reaction of scavenging OH˙ radicals. The activity of native enzyme was set as 100%, and boiled enzyme was set as negative control (n = 6, **P < 0.01 vs. control, Student's t‐test). Data are expressed as mean ± SEM.
|
study
| 100.0 |
Previous studies indicate that DMS exhibits antioxidant function in marine algae (Sunda et al., 2002). We proposed that MsrA may increase the antioxidant activity of DMS. By luminol chemiluminescence assays in a Fenton reaction system, it was shown that H2O2‐induced luminescence was not inhibited by 0.1 mm DMS (97 ± 6% of control, shown in Fig. S3A). Neither MsrA nor nonactive MsrA alone (1 μm) had a perceptible effect on the luminescence intensity (Fig. S3B). Meanwhile, cotreated with 0.1 mm DMS and MsrA (1 μm), but not nonactive MsrA, remarkably reduced the luminescence signal intensity to 52 ± 5% (P < 0.01, Fig. S3C). In electron paramagnetic resonance (EPR) assay, hydroxyl radical was induced by Fenton reaction and trapped by DMPO to form a stable spin adduct DMPO‐OH. The signal intensity of DMPO‐OH adducts was not changed by MsrA or nonactive MsrA alone (1 μm, Fig. S4). However, cotreatment with 0.1 mm DMS and MsrA (1 μm) decreased the DMPO‐OH signals to 73 ± 1% when compared to the group cotreated with 0.1 mm DMS and nonactive MsrA (Fig. 1C), which strongly suggested that MsrA increased DMS‐mediated reduction in OH˙. Then, we monitored the effect of MsrA on the reaction between ROS and DMS in vitro by detecting the reaction product. Increased amount of DMSO could be detected by GC‐MS, which supported by the catalytic activity of MsrA (Fig. 1D). MsrA facilitated the formation of DMSO from 3.3 ± 1.6% to 46.4 ± 4.3% (P < 0.01).
|
study
| 100.0 |
As predicated, Tyr103 and Glu115 facilitated the transfer of oxygen atom to DMS via the formation of hydrogen bond (Fig. S2A). The Phe73 and Trp74 increased the binding of DMS to the pocket via the hydrophobic force. To validate this model, three single site mutants (Cys72Ser, Tyr103Ala, and Glu115Ala) were built. The peroxidase activity was measured by the ability to scavenge hydroxyl radicals in EPR tests (Fig. 1E). Notably, mutagenesis of Cys72 strongly diminished the peroxidase activity (Cys72Ser: 2 ± 2% of wild‐type), while the catalytic activity of Tyr103Ala and Glu115Ala decreased remarkably to 74 ± 6% and 67 ± 6% of wild‐type (P < 0.01), respectively, indicating that Cys72 is the most critical one among these three residues. Furthermore, it was found that the predicted key residues (Cys72, Tyr103, and Glu115) were conservative in various organisms (Fig. S1), indicating that this catalytic mechanism may exist extensively.
|
study
| 100.0 |
Based on the results of computation, we hypothesize that MsrA bounds to DMS and promoted its antioxidant capacity via facilitating the reaction of DMS with ROS through a sulfonium intermediate (Fig. 2A), followed by the release of dimethyl sulfoxide (DMSO) (Fig. 2B).
|
study
| 100.0 |
MsrA promotes the radical‐scavenging capacity of DMS. (A) We proposed the oxygen atom on the sulfenic acid was derived from H2O2 or other ROS. A lone pair of electrons on the DMS sulfur attacked the sulfenic sulfur to form the positively charged sulfonium intermediate. Glu115 and Tyr103 acted as a proton donor and stabilized by hydrogen bonding with DMS. With the release of DMSO, the reduced form of MsrA was formed. (B) The working hypothesis of DMS‐DMSO recycle system was illustrated. (C) PC12 cells were pretreated with 0, 1, or 5 μm DMS for 30 min and then incubated with AA (100 μg mL−1 for 30 min). The levels of intracellular ROS were detected with H2 DCFDA. The fluorescence intensity of DCF was determined (n = 6–9, one‐way ANOVA, ## P < 0.01 vs. control, **P < 0.01 vs. AA.). The scale bar represented 100 μm. (D) Rat brain tissues were pretreated with DMS (0, 1, 10, or 100 μm for 30 min) and then incubated with H2O2 (250 μm for 30 min). The MDA contents were determined by a MDA test kit. n = 8, one‐way ANOVA, ## P < 0.01 vs. control, **P < 0.01 vs. H2O2 group. (E) Cell culture medium with or without DMS (5 μM) was added into the culture wells for 30 min. And then, PC12 cells were incubated with AA (100 μg mL−1 for 10 min) in the presence of DMPO. Then, EPR signal of DMPO‐OH spin adduct was detected (n = 4, Student's t‐test, ## P < 0.01 vs. control, **P < 0.01 vs. AA). The levels of EPR peak intensity were expressed as a relative change in comparison with the untreated control, which was set to 100%.
|
study
| 100.0 |
To further investigate the biological function of DMS, we observed the effect of DMS on cell lines. ROS production in PC12 cells was stimulated by antimycin A (AA), a mitochondrial respiratory complex III inhibitor. AA increased the levels of O2−·, followed by conversion into other ROS, as judged by the fluorescence signals emitted by the oxidized forms of ROS probes. 2′,7′‐dichlorodihydrofluorescein (H2DCF) was used to evaluate total ROS. Application of AA (100 μg mL−1) for 0.5 h induced an increase of the total ROS level to 256 ± 15% of control (Fig. 2C, P < 0.01). Pretreatment of PC12 cells with DMS (1 and 5 μm) significantly decreased the ROS level to 125 ± 14% and 100 ± 18% of control, respectively (P < 0.01, Fig. 2C). We found that at both low concentration (1 μm) and high concentrations (10 and 100 μm), DMS significantly attenuated H2O2‐induced lipid peroxidation from 159 ± 7% to 131 ± 4%, 123 ± 6% and 120 ± 8% in the brain, respectively (P < 0.01, Fig. 2D). Hydroxyl radical was detected by EPR assay. Cellular radicals were induced as previous report (Ohsawa et al., 2007). DMPO was added to capture the OH˙ radical. As shown in Fig. 2E, AA raised the spin signal to 325 ± 52% of basal level (P < 0.01), and this was reduced to 90 ± 15% of basal level by 5 μm DMS (P < 0.01).
|
study
| 100.0 |
MsrA has longevity benefits in different organisms. As a substrate of the peroxidase activity of MsrA, DMS may exert longevity benefits. In Drosophila, the lipid oxidation product MDA decreased significantly with the treatment of DMS (10 μm) in aged Drosophila from 15.2 ± 0.5 nmol mg−1 protein to 11.3 ± 0.6 nmol mg−1 protein (Fig. 3A, P < 0.01). We further tested whether DMS exerted lifespan‐extending properties in Drosophila. The mean survival time of control group was 48.25 ± 0.91 day. Meanwhile, the mean survival time was extended to 54.80 ± 1.06 day (10 μm), 59.95 ± 1.11 day (100 μm), and 55.99 ± 0.58 day (1000 μm) with DMS exposure (Fig. 3B, P < 0.01). However, DMS did not prolong the lifespan of Drosophila at low concentrations (1, 2, or 5 μm, Fig. S5).
|
study
| 100.0 |
DMS has longevity benefits in Caenorhabditis elegans and Drosophila via reducing accumulated oxidative damage. (A) MDA contents in adult (20 days) and aged flies (45 days) were measured (20 flies in a sample, n = 6 independent samples, Student's t‐test, **P < 0.01). (B) Lifespan analyses of wild‐type flies exposed to DMS (10, 100 or 1000 μm). n = 200, log‐rank post hoc Kaplan–Meier survival analysis, P < 0.01 vs. control. (C) DMS reduced the levels of superoxide. Representative images of aged and adult worms labeled with the MitoSOX red. The scale bar represented 100 μm. (D) Quantification of superoxide levels by MitoSOX labeling (n = 6, Student's t‐test, ## P < 0.01 vs. adult, **P < 0.01 vs. aged worms). (E) Lifespan analyses of wild‐type nematodes exposed to DMS (1, 5, or 10 μm). n = 70, log‐rank post hoc Kaplan–Meier survival analysis, P < 0.01 vs. control. (F) MDA contents in adult (5 days) and aged worms (20 days) were measured (20 worms in a sample, n = 6 independent samples, Student's t‐test, # P < 0.05 vs. adult control, *P < 0.05 vs. aged control).
|
study
| 100.0 |
A similar effect of DMS was observed in C. elegans. MitoSOX red was used to detect the superoxide contents in aged C. elegans (Fig. 3C,D). The amount of superoxide in aged worms (reach median lifespan of control group) increased to 330 ± 44% of the superoxide level of adult worms (P < 0.01). Treatment with 10 μm DMS remarkably decreased superoxide content to 228 ± 26% (P < 0.01). Worms were fed with DMS medium at three different concentrations: 1, 5 and 10 μm. The mean survival time of DMS‐treated worms was extended from 21.00 ± 0.52 day to 22.77 ± 0.59 day (1 μm), 25.23 ± 0.72 day (5 μm), and 26.11 ± 0.71 day (10 μm), respectively (Fig. 3E, P < 0.01). The MDA content decreased significantly with DMS (5 μm) treatment in aged worms from 161 ± 10% to 125 ± 13% of control (Fig. 3F, P < 0.05). These results support the hypothesis that DMS mediates longevity via alleviating the accumulated oxidative damage in aged animals.
|
study
| 100.0 |
As a human original cell line, SH‐SY5Y cell was used to confirm the cytoprotective effects of DMS. As shown in Fig. 4A, we found that DMS did not change the cell survival rate of SH‐SHY5Y cell in micromolar range. In Fig. 4B, H2O2 (150 μm) was used to induce oxidative stress on SH‐SY5Y cells. After treatment for 12 h, the cell viability of SH‐SY5Y cells decreased to 59 ± 7% of control group. DMS increased the cell viability of SH‐SY5Y cells under oxidative stress to 81 ± 2% at 6.25 μm, 90 ± 3% at 12.5 μm, 88 ± 3% at 25 μm, 82 ± 4% at 50 μm, and 76 ± 4% at 100 μm (Fig. 4B). In the trypan blue test, DMS at 12.5 μm increased the cell viability of SH‐SY5Y cells under oxidative stress from 22 ± 5% to 48 ± 5% (Fig. 4C).
|
study
| 100.0 |
DMS exerts cytoprotection against oxidative stress. (A) Cell viability in SH‐SY5Y cells after treatment with DMS for 12 h (n = 8). (B) The SH‐SY5Y cells were pretreated with or without DMS (6.25, 12.5, 25, 50, or 100 μm) for 30 min. After the incubation of H2O2 (150 μm for 12 h), the cell survival rate was measured with MTT test kit (n = 8, ## P < 0.01 vs. control, *P < 0.05, and **P < 0.01 vs. H2O2 group). (C) The SH‐SY5Y cells were pretreated with or without 12.5 μm DMS. After 12‐h incubation with or without 150 μm H2O2, cell viability was tested by trypan blue test (n = 7, ## P < 0.01 vs. control and ** P < 0.01 vs. H2O2 group). (D‐E) The SH‐SY5Y cells were pretreated with DMS (6.25, 12.5, 25, 50, or 100 μm) or Met (50, 100, 500, or 1000 μm) for 30 min. After the incubation of MPP (2 mm for 48 h), the cell survival rate was measured with MTT test kit (n = 8, ## P < 0.01 vs. control, *P < 0.05 and **P < 0.01 vs. MPP group).
|
study
| 100.0 |
To test the effect of DMS on the concentration of extracellular oxidants, the MPP model was used to identify the cytoprotection of DMS. SH‐SY5Y cells were treated with or without 2 mm MPP for 48 h; then, the cell viability was evaluated by MTT test. Compared with MPP‐treated group (66 ± 4% of control, P < 0.01 vs. control), the cell viability in DMS‐treated groups increased to 76 ± 2% (6.2 μm), 79 ± 3% (12.5 μm), 82 ± 3% (25 μm), 84 ± 3% (50 μm), and 84 ± 5% (100 μm, Fig. 4D). Meanwhile, the cell viability of Met‐treated group raised from 52 ± 1% to 61 ± 4% (100 μm), 62 ± 5% (500 μm), and 70 ± 6% (1000 μm) of control (Fig. 4E).
|
study
| 100.0 |
We then analyzed how DMS at low micromolar range scavenged ROS in PC12 cells. Considering the intrinsic catalytic function of MsrA in the oxidation of thiomethyl groups, we tested whether the antioxidation effect of DMS is dependent on MsrA. After treatment with lentiviral‐expressed specific short hairpin RNAs (shRNA) against MsrA (Fig. S6), the expression level of MsrA decreased to 22 ± 6% (n = 6, P < 0.01 vs. control). As shown in Fig. 5A,B, DMS decreased the AA‐induced superoxide production in PC12 cells from 178 ± 8% of control group to 129 ± 8% (P < 0.01). However, in MsrA shRNA group, the effect of DMS (10 μm) on AA‐induced superoxide production was abolished (Fig. 5C,D, 241 ± 13% in DMS group vs. 212 ± 14% in AA group of MsrA shRNA), suggesting that MsrA‐catalytic oxidation of thiomethyl group is involved in DMS‐mediated antioxidation. After MsrA knockdown by shRNA, the protective effect of DMS (5 μm) on cell viability against H2O2 was also abolished. With control shRNA, the DMS increased the cell viability of PC12 cells from 68 ± 2% in H2O2 group to 93 ± 3% in DMS group (Fig. 5E, P < 0.01). With MsrA shRNA, DMS showed little effects on the cell viability under oxidative stress (70 ± 4% in H2O2 model group vs. 78 ± 4% in DMS group). The protective effect of DMS on lipid peroxidation was also abolished, which resembled the findings in the H2O2‐induced cell death. As shown in Fig. 5F, the MDA content of DMS group (162 ± 9%) showed no difference with that in H2O2 model group (160 ± 7%).
|
study
| 100.0 |
MsrA knockdown abolishes the cytoprotective effect and longevity benefits of DMS. PC12 cells were transfected with control shRNA (A) or MsrA shRNA (C). The transfected cells were pretreated with or without DMS (5 μm for 30 min) and then incubated with AA (100 μg mL−1 for 30 min). (B, D) The release of superoxide was determined by the MitoSOX red fluorescence. n = 6, Student's t‐test, ## P < 0.01 vs. control, **P < 0.01 vs. AA. The scale bar represents 50 μm. (E‐F) The H2O2 (250 μm, 12 h) was introduced into the culture medium after treatment with DMS (5 μm for 30 min). (E) The cell survival rates were measured with MTT test (n = 8, Student's t‐test, ## P < 0.01 vs. control, **P < 0.01 vs. H2O2). (F) MDA contents in cultured cells were measured (n = 8, Student's t‐test, ## P < 0.01 vs. control, **P < 0.01 vs. H2O2). (G) Lifespan analyses of control flies and dMsrA RNAi flies (n = 400, log‐rank post hoc Kaplan–Meier survival analysis, P > 0.05 vs. UAS‐GAL4). (H) Lifespan analyses of control worms (L4440) and F43E2.5 (msra‐1 RNAi) worms (n = 60, log‐rank post hoc Kaplan–Meier survival analysis, P > 0.05 vs. L4440). (I) Survival rates of worms (5‐day‐old adult) in each group were evaluated after 3 h in S‐basal buffer containing H2O2 (10 mm) in 20 °C (n = 60 from three independent tests, Student's t‐test, **P < 0.01 vs. control RNAi).
|
study
| 100.0 |
To confirm that MsrA involved in the mechanism of DMS‐mediated longevity, the level of MsrA was downregulated by UAS‐GAL4 system (Fig. S7A). As shown in Fig. 5G, DMS failed to prolong the lifespan in MsrA RNAi group, indicating that the lifespan extension effect of DMS is dependent on MsrA activity. Then, we used feeding RNAi (F43E2.5 plasmid) to decrease the msra‐1 expression to 10 ± 5% of control group (L4440 plasmid) in C. elegans (Fig. S7B). In msra‐1 RNAi group, lifespan was significantly shortened from 22.5 ± 0.8 day to 17.8 ± 0.6 day, which suggested that MsrA plays a critical role. DMS (10 μm) could not extend lifespan in msra‐1 RNAi group (Fig. 5H). Thus, MsrA was required in the effect of DMS on worm longevity.
|
study
| 100.0 |
In Fig. 5I, H2O2 was used to introduce oxidative stress to test the resistance of worms. The survival rates of worms in each group were evaluated after 3 h in S‐basal buffer containing H2O2 (10 mm). The survival rate of DMS‐treated raised from 44 ± 2% (control RNAi) to 62 ± 4% (control RNAi with DMS, P < 0.01). However, DMS failed to elevate the survival rate of worms treated with RNAi plasmid. The survival rate of msra‐1 RNAi group (28 ± 2%) showed no significant difference with that of msra‐1 RNAi with DMS group (33 ± 6%).
|
study
| 100.0 |
We used HPLC to test the concentration of endogenous DMSO in PC12 cells (see details in supplementary methods). The endogenous cellular DMSO was at 5.73 nmol per 5 × 106 cell count. As shown in Fig. 6A, the DMSO content in H2O2‐treated groups raised significantly to 184 ± 16% and 281 ± 20% of control, respectively (**P < 0.01 vs. control, Fig. 6A). Then, MsrA shRNA was used to test whether MsrA played a vital role in the formation of DMSO (Fig. 6B). Knockdown of MsrA exhibited little effect on the concentration of endogenous DMSO in PC12 cells (Fig. 6B), which may be resulted from a bidirectional role of MsrA in the endogenous DMSO content: increasing DMSO generation under oxidative stress and reducing DMSO back to DMS using reducing substrates. Under H2O2‐induced oxidative stress, the DMSO formation in MsrA‐treated group decreased from 162 ± 14% to 123 ± 16% (P < 0.01 vs. control shRNA with H2O2 group, Fig. 6B). We also tested the concentration of endogenous DMSO in blood and brain samples using both GC‐MS and HPLC. However, little endogenous DMSO was detected, which may be resulted by the limit of detection.
|
study
| 100.0 |
Identification of DMS as an endogenous antioxidant that declines with aging. (A) The levels of DMSO in PC12 cells were measured by HPLC after treatment of H2O2 (250 μm)/DMS (1 mm) for 12 h (n = 6, Student's t‐test, ## P < 0.01 vs. control, **P < 0.01 vs. H2O2). (B) PC12 cells were transfected with MsrA shRNA or control shRNA before the treatment of DMS (1 mm). And then, the DMSO contents were evaluate after H2O2 (250 μm) treatment for 12 h (n = 6, Student's t‐test, ## P < 0.01 vs. control, **P < 0.01 vs. H2O2). (C) The levels of DMS in different tissues of adult rat (brain, heart, and blood) were detected by GC‐MS assay, which were shown in a histogram (n = 6). (D)The tissues of different species (rat brain, mouse brain, and whole body of Drosophila or Caenorhabditis elegans) were also detected (n = 6). (E) The DMS levels in adult and aged rat samples were measured by SPME‐GC‐MS method (n = 6, **P < 0.01 vs. adult, Student's t‐test).
|
study
| 100.0 |
Previous reports have reported the existence of DMS in blood circulation of mammals (Blom et al., 1988; Miekisch et al., 2001). We firstly quantified the amount of endogenous DMS in different organisms by gas chromatography (GC)–mass spectrometry (MS). After being concentrated by solid‐phase microextraction (SPME), DMS was separated by GC followed by identification with MS (Fig. S8). The levels of DMS were 1.14 ± 0.24 nmol g−1 wet tissue (at about 1 μm) in rat brain, 2.42 ± 0.09 nmol g−1 wet tissue (at about 2 μm) in rat heart, and 1.09 ± 0.11 nmol g−1 wet tissue (at about 1 μm) in mice brain (Fig. 6A), respectively. The level of DMS in C. elegans and Drosophila was 0.19 ± 0.04 nmol g−1 wet tissue and 0.19 ± 0.02 nmol g−1 wet tissue, respectively (Fig. 6B), which was much lower in the tissues of mice and rats. More interesting, in aged group (20 months), the concentrations of DMS in brain and heart tissues of rats were significantly decreased from 1.17 ± 0.14 nmol g−1 to 0.64 ± 0.04 nmol g−1 (brain cortex) and from 2.53 ± 0.12 to 1.44 ± 0.07 nmol g−1 (heart), respectively (P < 0.01, Fig. 6C).
|
study
| 100.0 |
The present study provided the first systematic identification of DMS as a catalytic antioxidant to protect cells and extend lifespan via the peroxidase activity of MsrA. After binding to the catalytic pocket of MsrA and forming of a positively charged sulfonium intermediate, DMS scavenged harmful radicals, reduced oxidative stress in the cell model, and mediated longevity. Considering the existence of DMS in the organisms is conserved, including C. elegans, Drosophila, mouse, rat, and human, DMS may act as a new member in the family of the physiologic antioxidative molecules.
|
study
| 99.94 |
DMS scavenges ROS via its thiomethyl groups. The antioxidation of DMS may not only be due to its natural antioxidant activity. Recent discovery of a MsrA‐centered catalytic mechanism raises the possibility of the physiologically regulated oxidation of thiomethyl groups in organism (Wu et al., 2013a; Fan et al., 2015). Thus, the antioxidation effect of DMS after MsrA knockdown was observed. We found that MsrA activity was required for the beneficial effects of DMS against oxidative stress. Furthermore, we established a computational model to visualize structural interactions between DMS and MsrA. Under oxidative stress, ROS induced a sulfenic acid residue on Cys72 of MsrA, followed by the reaction between oxygen atom on CYO72 and S atom of DMS. The Phe73 and Trp74 in MsrA facilitated DMS to bind the active center via hydrophobic bond, and Tyr103 and Glu115 increased the oxygen atom transfer from the CYO72 to the S atom of DMS via hydrogen bond. The peroxidase activity of MsrA significantly facilitated the reactivity of DMS at a low concentration. Furthermore, MsrA may increase the antioxidation of DMS via other mechanisms. Under oxidative condition, the oxydation product of DMS, DMSO, has been historically recognized as a strong scavenger of free radicals, which may secondarily react with radicals. The reaction between DMSO and OH˙ may underlie the total radical‐scavenging capacity of DMS. Under reduced condition, MsrA can reduce DMSO back into DMS, which may be critical in the availability of DMS. The mechanisms of DMS‐mediated radical‐scavenging capacity were illustrated in Fig. 2A,B.
|
study
| 100.0 |
In the present study, we have addressed novel MsrA‐catalytic antioxidant defense. We found that low‐molecular sulfides, such as DMS, could serve as the substrate of MsrA to scavenge oxidative stressors. The lone pair electrons on the methylthiol‐sulfur nucleophilicity of sulfide attack the sulfenic sulfur in active site to form the positively charged sulfonium intermediate. Then, MsrA catalyzes the transition and releases the sulfoxide. It should be noted that DMS and other thiomethyl‐containing compounds, such as free methionine, methyl mercaptan, and dimethyl disulfide, may work synergistically with the Met residues. An MsrA‐regulated endogenous catalytic antioxidant network of low‐molecular methyl sulfides may also confer a good antioxidation defense in vivo.
|
study
| 100.0 |
MsrA deficiency has been involved in the pathophysiology of aging‐related diseases (Yermolaieva et al., 2004; Pal et al., 2007; Oien et al., 2008; Prentice et al., 2008). Previous study has reported that msra‐1 absence decreases median survival of long‐lived daf‐2 worms (Minniti et al., 2009). In our study, lifespan in msra‐1 RNAi group was significantly shortened from 22.5 ± 0.8 day to 17.8 ± 0.6 day, indicating that MsrA plays a critical role in lifespan of worms (Fig. 5H). In flies, reducing MsrA activity exhibited little effect on the lifespan. It seems that the role of MsrA in lifespan is conditionally important in response to certain stresses. As a catalytic antioxidant, under MsrA deficiency, the organism may be vulnerable to stress and other compensatory mechanisms may be activated to alleviate its effect on lifespan. Enhancement of MsrA system may be beneficial for lifespan by reducing accumulated oxidative damage, as previous reports have revealed that upregulation of MsrA system increases longevity in animals, including Drosophila and yeast (Ruan et al., 2002; Koc et al., 2004; Chung et al., 2010). Only very few approaches are available to enhance MsrA function, such as activators like fusaricidin (Cudic et al., 2016), supplement of its substrates (Wassef et al., 2007; Wood et al., 2009), and upregulation of endogenous MsrA (Novoselov et al., 2010; Wu et al., 2013a).One remarkable finding of the present study is that food supplement of DMS extended the lifespan of C. elegans and Drosophila via an MsrA‐dependent manner and improves the life condition under oxidative stress. These results support the connection between our observed effects on longevity and antioxidant‐mediated cytoprotective mechanisms. However, other multiple mechanisms may be involved in the effect of DMS on the ROS profile, such as alterations in metabolism and gene expression. Considering the low‐molecular weight, endogenous origin, and easy preparation, it is possible that supplement of DMS‐rich and methyl sulfide‐rich foods including beer, cheese, and marine products may serve as a potential nutritional strategy to enhance MsrA function and prevent aging.
|
study
| 99.9 |
As the major sulfide emitted to the atmosphere by the marine microorganisms (Wolfe et al., 1999; Todd et al., 2009), DMS has been historically recognized in the atmospheric circulation (Cameron‐Smith et al., 2011). Although current studies have focused on its role in the lower organisms (Wolfe et al., 1999; Sunda et al., 2002; Todd et al., 2007), DMS has been found in the blood circulation of mammals, including human being (DeBose & Nevitt, 2008; Mochalski et al., 2014), and recognized as a potent chemoattractant for animals and a disgusting component of bad breath (DeBose & Nevitt, 2008; Nevitt, 2008). However, other physiological role of DMS in mammals remains to be unmasked. We found that at near‐physiological level, DMS reduced the level of ROS in cell lines and alleviated oxidative stress. Thus, DMS may emerge as a physiologic cytoprotectant against oxidative stress‐induced cell death and aging.
|
study
| 99.94 |
In summary, this study shows that DMS induced cytoprotection against oxidative stress‐induced cell death and aging via an MsrA‐catalytic mechanism. A missing role of thiomethyl‐containing compounds, such as DMS, methyl mercaptan, and dimethyl disulfide, in the anti‐aging should been assigned in the mammals. With respect to analogues of DMS, its reaction priority and evolutionarily conservation suggest a similar function of DMS in humans.
|
study
| 100.0 |
AA, dithiothreitol (DTT), H2DCF, H2O2, DMPO, DMS, DMSO, and penicillin–streptomycin were purchased from Sigma‐Aldrich (St. Louis, MO, USA). MitoSox red was purchased from Invitrogen (Waltham MA, USA). DMEM/F12, RPMI1640 and fetal bovine serum were purchased from HyClone (Logan, UT, USA). NaBH4 was obtained from Sinopharm chemical reagent (Shanghai, China). SPME holder and 75‐μm carboxen‐PDMS SPME fiber was purchased from Supelco (Bellefonte, PA, USA). Ni‐Trap nickel‐chelating column was obtained from Qiagen (Hilden, Germany). Thrombin kit was purchased from New England Biolabs (Ipswich, MA, USA). Fast Mutagenesis System was obtained from Transgene (Beijing, China). MDA and cell survival rate kits were obtained from Jiancheng Biotech (Nanjing, China).
|
other
| 99.9 |
The wild‐type C. elegans N2 worms were grown on E. coli OP50 using standard techniques on 20 °C (Brenner, 1974). The RNAi worms were feed with E. coli HT115 containing plasmid L4440 or F43E2.5 (Minniti et al., 2009). The worms were kindly provided by Dr. An‐bing Shi. The wild‐type Drosophila stock w1118 was kindly provided by Dr. Jin Shan. Actin‐GAL4 and UAS‐dMsrA‐RNAi were procured from the Tsinghua Fly Center (THFC). The Drosophila strain w1118 was used in all control crosses and as the background for generation of transgenic lines. All Drosophila stocks were maintained, and all experiments were conducted at 25 °C on a 12‐h: 12‐h light: dark cycle at constant humidity using standard sugar/yeast/agar (SYA) media. Adult male Sprague Dawley rats and C57BL/6J mice were obtained from the Experimental Animals of Tongji Medical College, Huazhong University of Science and Technology. The rats/mice were housed on a controlled 12‐h: 12‐h light cycle at a constant temperature (24 ± 1 °C) with free access to water and food and allowed to acclimate a week. The use of animals for experimental procedures was conducted in accordance with the Guide for Care and Use of Laboratory Animals as adopted and promulgated by the National Institutes of Health. The experimental procedures were approved by the Animal Welfare Committee of Huazhong University of Science & Technology.
|
study
| 99.94 |
Different tissue samples were collected and prepared as described by published report (Al Mardini et al., 1984). In brief, the whole blood was collected in heparin anticoagulated tubes, sealed in glass GC bottles, and then stored at −80 °C before use. The samples was placed on ice, weighed, and added to four parts Tris–HCl buffer (pH 7.0) before sonication. One milliliter of aliquots was subsequently added to septum bottles and treated in the same way. The DMS produced was stripped, cryo‐trapped, redissolved in water, and then analyzed by SPME‐GC‐MS. After removal of DMS by purge and cryo‐trapping, DMSO was reduced to DMS using NaBH4 and analyzed by SPME‐GC‐MS. Headspace sampling of DMS was carried out with a SPME holder equipped with a 75‐μm carboxen‐PDMS SPME fiber. Samples were incubated for 5 min at 35 °C and then extracted for 10 min at the same temperature. Then, the GC/MS analysis was performed with GC‐MS analysis using Agilent 6890N‐5975B GC‐MS system (Agilent Technologies, Santa Clara, CA, USA). The injector temperature was 200 °C, and injections/SPME desorptions were made in splitless mode. Helium was used as a carrier gas with linear velocity 40 cm s−1. The MS analyses were carried out in a SIM scan mode, with a scan of m/z 47 and 62. Electron ionization was used at energy of 70 eV. The temperature of the ion source and the transfer line was 190 and 150 °C, respectively. The acquisition of chromatographic data was performed by means of the Chemstation Software (Agilent).
|
study
| 100.0 |
Dimethyl pyridine N oxide (DMPO) was used as a free radical trapper. EPR signals were detected with a Bruker e‐scan EPR spectrometer (Burker, Karlsruhe, Germany) as previous report (Ohsawa et al., 2007). We produced hydroxyl radical (OH˙) by the Fenton reaction in the mixture of 0.25 mm H2O2 and 0.1 mm FeSO4 in the presence of 0.1 mm DMPO. The spin traps, DMS (0.1, 1, or 10 mm), and MsrA/nonactive MsrA (1 μm) were added before the Fe (II) and H2O2. Samples (20 μL) were loaded into a quartz tube, and the EPR spectra were recorded at room temperature. The EPR microwave power was set to 4.88 mW. The modulation frequency was 9.76 GHz. The time constant was 81.92 ms, and conversion time was 81.92 ms. A sweep time of 41.94 s was used. Each sample was scanned once. A sweep width of 100 G was used for experiments with DMPO. The receiver gain was set to 3.17 × 103. Simulation and fitting of the EPR spectra were performed using the Bruker WinEPR program.
|
study
| 100.0 |
The rat recombined MsrA was prepared and purified from E. coli BL21, as described in our previous report (Wu et al., 2013b). In brief, MsrA coding region was ligated into the restricted pET‐32a (+) vector using phage T4 DNA ligase. BL21 cells were transformed with the recombinant plasmid and grown in LB medium. The cells were harvested, and cell lysis was applied to a 4 mL Ni‐Trap nickel‐chelating column. The N‐terminal His‐tag of recombinant peptide was removed using a Thrombin kit. The activity of recombinant MsrA was monitored by detecting both MetO‐reducing activity and methyl sulfoxide‐dependent oxidation of DTT.
|
study
| 100.0 |
The single site mutant plasmids were constructed with Fast Mutagenesis System. The primers were listed below as follows: Cys72SerF:5′‐ TTTGGAATGGGCAGCTTCTGGGGAGCT ‐3′R:5′‐ TGCCCATTCCAAATACAGCCATCTG ‐3′Tyr103AlaF:5′‐ ACACGCAATCCCACCGCCAAAGAGGTC ‐3′R:5′‐ GCGGTGGGATTGCGTGTGTAGCCTCCT ‐3′Glu115AlaF:5′‐ AAAACCGGTCACGCAGCAGTCGTCCGG ‐3′R:5′‐ GCTGCGTGACCGGTTTTTTCTGAGCA ‐3′
|
other
| 99.6 |
The steady‐state fluorescence anisotropy measurements were performed with a PerkinElmer LS55 spectrofluorometer using a quartz cuvette at room temperature as described by previous report (Pillai et al., 2015). Excitation and emission slits with a band pass of 5 nm were used for all measurements. The anisotropy values were calculated from the equation below,r=IVV−GIVHIVV+2GIVHwhere IVV and IVH are the measured fluorescence intensities with the excitation polarizer vertically oriented and emission polarizer vertically and horizontally oriented, respectively. G is the instrumental correction factor and is the ratio of the efficiencies of the detection system for vertically and horizontally polarized light and is equal to IHV/IHH.
|
study
| 100.0 |
PC12 and SH‐SY5Y cell lines were obtained from JRDUN Biotechnology (Shanghai, China). The PC12 cells were cultured in RPMI1640 supplemented with 15% horse serum, 2.5% fetal bovine serum, and 100 U mL−1 penicillin–streptomycin. The SH‐SY5Y cells were cultured in DMEM/F12 supplemented with 10% fetal bovine serum and 100 U mL−1 penicillin–streptomycin.
|
other
| 99.9 |
A third generation of self‐inactivating lentivirus vector (GeneChem, Shanghai, China) containing a CMV‐driven GFP reporter and a U6 promoter upstream of the cloning sites (Age I and EcoR I) was used for cloning shRNAs. The target sequence for rat MsrA was 5′‐AGCACGTCAGCTTTGAGGA‐3′ and for control scrambled shRNA was 5′‐TTCTCCGAACGTGTCACGT‐3′. PC12 cells were infected with lentivirus at a multiplicity of infection (MOI) of 20 for 8 h. Then, the medium was replaced with fresh complete medium. After 72 h, cells were observed under fluorescence microscopy to confirm that more than 80% of cells were GFP‐positive.
|
study
| 100.0 |
Data are expressed as mean ± SEM Significance of differences between groups was determined by Student's t‐test or LSD test post hoc ANOVA. The Kaplan–Meier method was used to compare the differences in survival rates between groups. A P‐value < 0.05 was considered statistically significant.
|
study
| 99.9 |
This work was supported by grants from the National Basic Research Program of China (the 973 Program, No. 2013CB531303 to Dr. J.G.C.; No. 2014CB744601 to F.W.) and the National Natural Scientific Foundation of China (NSFC, No. 81302754 to P.F.W). It was also supported by PCSIRT (No. IRT13016), the National Key Scientific Instrument and Equipment Development Project of China (No. 2013YQ03092306) and Science Fund for Creative Research Groups of the Natural Science Foundation of Hubei Province (2015CFA020) to J.G.C.
|
other
| 99.94 |
Strength training is a promising intervention for the prevention and amelioration of several pathologies, and leads to a reduced all-cause mortality risk . Nevertheless, an acute bout of resistance exercise may lead to a catastrophic occurrence due to artery dissection . This is a consequence of the vascular stress provoked by the extreme pressure response that occurs during strength training . Despite the fact that artery dissection is a rare condition, systemic hypertension may yield extremely dangerous levels of wall stress, in some cases reaching the breaking point of the wall strength. This might occur particularly in individuals with a pre-existing enlargement of an artery . However, strength training provides unique health benefits , which outweigh its possible risks, and is usually safe for the general population .
|
review
| 99.9 |
The pressure response in dynamic resistance exercise has been studied traditionally using the leg press exercise as a model . During a leg press set, there is an excessive pressure response during the first repetition . This is the consequence of mainly four factors. Firstly, the feet elevation from the resting to the exercise position . Secondly, the isometric contraction during the position adjustment before the beginning of the exercise . Thirdly, the effort performed to overcome the absence of elastic energy stored in the muscles . Fourthly, an excessive intrathoracic pressure that is the consequence of all the previous issues . During the next few repetitions, there is a v-shape pressure response. This occurs simultaneously with an enhanced use of the elastic energy, which is stored in the muscles in an absence of fatigue . The v-shape pressure response is a hemodynamic advantage, since some repetitions can be performed without an elevation of the blood pressure . Once the fatigue begins and increases, there is a progressive increment in the systemic pressure response. This originates reflexively in the active muscles due to the mismatch between blood flow and metabolic demands . There is also an augmenting intrathoracic pressure due to the Valsalva maneuver . The junction between both causes leads to a peak pressure response, which occurs at the last repetition, before the occurrence of muscular failure .
|
study
| 100.0 |
The Valsalva maneuver is particularly performed when lifting heavy loads, or when light loads are lifted to failure. In a situation of muscular disadvantage , the maneuver pressurizes the abdominal cavity, which aligns the trunk better, and creates a rigid compartment, which facilitates the application of force to the reel of the leg press machine. Because of the exaggerated pressure response that occurs, the maneuver is commonly discouraged by coaches . Nevertheless, when the Valsalva maneuver is attempted, the pressure response is somewhat attenuated, but never truly dampened . In fact, the rigid compartment that the Valsalva maneuver creates is needed to reduce the spinal disc compressive forces that increase. Therefore, by lifting safely, the maneuver should not be discouraged .
|
other
| 99.9 |
Despite the need for a Valsalva maneuver for a safer lift, an exaggerated pressure response indeed increases the transient risk of artery dissection, even in young healthy individuals . Therefore, the loading parameters used in the session should be carefully selected, to guarantee the vascular integrity of the trainee, while maximizing the benefits of strength training. In this sense, convenient strategies to reduce the pressure response include selecting a rational number of sets and a sufficient break between sets , and choosing a reasonable compromise between intensity of load and the length of the set with that particular load .
|
other
| 99.9 |
In relation to the latter, it was previously suggested that the pressure response, occurring with a particular intensity of load, is more affected by the length of the set performed, than the intensity of the load, per se . Thus, protocols such as the interrepetition rest design (IRD), allowing a lower glycolytic involvement, as a consequence of the reduction in muscular fatigue , might be an attractive option, compared to continuous designs (CD). This is because IRD prevents the exacerbated increase in the pressure response, when one is close to muscular failure. Nevertheless, muscular failure would occur with a preeminent intrathoracic pressure response due to the start of a new set in every repetition . On the other hand, CD has a higher glycolytic involvement due to muscular fatigue, which may considerably increase the reflex pressure response . However, at the same time, CD might benefit, in part, from the v-shape pressure response advantage. One can perform the repetitions, which occur in the set, without muscular fatigue .
|
study
| 99.94 |
Three reports previously studied this particular topic , but probably the resting time (2–10 s) between repetitions, or groups of repetitions in the short sets, was not enough to maintain the phosphocreatine muscle content , thus failing to avoid the involvement of the glycolytic metabolism when comparing it with continuous sets. In our study, we aimed to compare the pressure response of an IRD, with enough resting time of a CD. Additionally, we aimed to understand the progression of the systolic blood pressure (SBP) in a CD to estimate the effect of accumulated repetitions on the increasing rate of SBP throughout the set. Our inference is that the IRD would have a lower pressure response in comparison with the CD, as a consequence of a lower glycolytic involvement, despite the lack of the v-shape pressure response advantage. Additionally, we also hypothesized that the increase of SBP throughout a set can be estimated based on the accumulated number of repetitions.
|
study
| 100.0 |
Fifteen healthy participants (10 men and 5 women) with at least six months of weight-lifting experience volunteered (age: 24 ± 2 years; height: 1.74 ± 0.08 m; body mass: 67.7 ± 9.0 kg; resting heart rate (HR): 58 ± 13 bpm; SBP: 113 ± 8 mmHg; diastolic blood pressure (DBP): 66 ± 7; 10-repetition maximum on leg press (10RM): 211 ± 37 kg). All participants were screened and excluded if they had a previous history of cardiovascular disease, or were taking any medication or substance that could potentially affect the results. Participants signed an informed consent and were suitably informed about their rights. The research project obtained the formal ethical approval by the University of A Coruña and was in full compliance with the Declaration of Helsinki.
|
study
| 99.94 |
Participants attended seven different days in total at the same time (±1 h), separated by a 72 h lapse. Before testing, they were asked to refrain from alcohol, caffeine, nicotine, and exercise for 24 h, and to fast for three hours. Participants underwent three orientations, two testing and two experimental sessions. In all sessions, warm-ups consisted of five minutes of submaximal treadmill exercises at 70–90% of the estimated maximum HR, five minutes of joint mobilization, and 2 sets of 10 repetitions with the 50% of the 10RM load.
|
study
| 100.0 |
In the orientation sessions, participants were instructed on how to perform the leg press exercise, and to learn testing procedures to obtain appropriate, quality hemodynamic values throughout the experimental sessions. The leg press was performed in an eccentric–concentric fashion using a diagonal sled-type machine (Biotech Fitness, São Paulo, Brazil). Participants were asked to push the reel from the lock to the position in which they had their knees fully extended, and then to start the movement. They were asked to lower the weight in a controlled manner, until reaching 90° of flexion in both hip joints and knees, touching the knees with a rubber band. After reaching this position, participants had to return to the position of full knee extension, performing the repetitions at the maximal intended velocity.
|
study
| 99.94 |
The two experimental sessions were performed in a randomized order. Both sessions consisted of performing a total of 40 repetitions with 720 s of total rest, at the 10RM load. Therefore, the work-to-rest ratio was equated between sessions. The IRD consisted of 40 individual repetitions with 18.5 s of rest between repetitions, with the intensity of effort at 10% (i.e., 1 repetition performed out of 10 feasible repetitions). The CD consisted of 5 sets of 8 repetitions with 180 s of rest between sets, with the intensity of effort at 80% (i.e., 8 out of 10). A schematic representation of the experimental sessions is presented in Figure 1.
|
study
| 100.0 |
Continuous three-lead electrocardiogram and beat-by-beat blood pressure (BP) were obtained using a Task Force Monitor (CNSystems, Graz, Austria). The electrocardiogram was used for obtaining HR at a rate of 1000 Hz. Finger BP on the left hand was obtained with a pneumatic cuff by photoplethysmography with a sampling frequency of 100 Hz. The arm of the pneumatic cuff was held by a sling with the finger’s cuff at the fourth intercostal space level. Finger BP was automatically and continuously transformed into brachial BP by the device with an oscillometer placed on the right arm. SBP and DBP obtained the higher and lower values of the BP trace, respectively. Additionally, pulse pressure (PP) was calculated as SBP–DBP and double product (DP) was computed as HR × SBP and reported in bpm × mmHg × 10−2.
|
study
| 99.9 |
Data were analysed at baseline during the last 5 min of a 10-min period and during the 40 repetitions of the experimental sessions semi-recumbent on the leg press machine. The precautions to avoid data loss were (a) placing the right arm in a supinated position on a chair to prevent grasping the machine; (b) avoidance of odd flexions or contractions, neither with the arm or the finger with the plethysmography cuff; and (c) maintenance of a normal breathing pattern, since a strong Valsalva maneuver may affect the BP collection by plethysmography; however, the Valsalva maneuver was not forbidden . Data were only considered suitable for analysis when at least 80% of the total BP tracing of every session was collected. The percentage of valid data in six participants was lower than 80% in the IRD, so only nine participants (7 men and 2 women) were compared between sessions.
|
study
| 100.0 |
For every repetition, the total duration of each repetition, as the sum of the concentric and eccentric parts, was collected with a dynamic measuring device (T-Force System, Ergotech, Murcia, Spain) attached to the sled of the leg press. The total duration of each repetition was used to select the higher SBP value of that particular repetition, and the HR and DBP values belonging to the same cardiac beat. For each design, the average of the total, concentric, and eccentric time of all repetitions were analyzed as indicators of total, concentric, and eccentric time under tension (TUT), respectively .
|
study
| 99.94 |
Descriptive statistics are shown as mean ± standard deviation. Reliability of the 10RM was tested with the intra-class correlation coefficient (ICC = 0.99). Normality was tested using the Shapiro–Wilk test. A 2 × 2 repeated measures analysis of variance (ANOVA) was used to analyze the effect of the session (i.e., IRD vs. CD) across time (baseline vs. during exercise). During exercise, the mean of the SBP peaks of the 40 repetitions (and the HR, DBP, PP, and DP of the same cardiac beat) and the peak SBP of the session were analyzed. Additionally, a separated two-way ANOVA was also used to analyze the effect of the session across time for SBP during the first (i.e., 1st, 9th, 17th, 25th, 33th) or eighth (i.e., 8th, 16th, 24th, 32th, 40th) repetition of every set in the CD in comparison with the concomitant repetition in the IRD. Pairwise comparisons were performed using Bonferroni correction and p ≤ 0.05 was established as significance level. A paired t-test was used to analyze the effect of the session on the duration of the total, concentric, and eccentric TUT of the 40 repetitions.
|
study
| 100.0 |
The prediction of the progression of SBP in the CD was performed with a one-way repeated measures ANOVA of 9 levels (baseline and the eight repetitions of the first set). Individual linear regressions of SBP on repetitions that were significantly different from the baseline after the v-shape were obtained. Thereafter, only the participants with an individual correlation higher than 0.8 between repetitions and SBP (n = 12) were considered to perform a linear mixed model analysis to estimate the increase ratio (i.e., slope: mmHg/repetition) and the variability of this slope between individuals. Linear mixed models are suitable for regression analysis with correlated data . Thereby, three random coefficient models were fitted (Model 1: intercept and the slope as both fixed and random effects. Model 2: Model 1 plus adding 10RM load as fixed effect. Model 3: Model 1 plus 10RM × repetition interaction as a fixed effect to consider the load’s effect on the slope). From the different tested models, Model 1 was used since it was the most parsimonious (6 parameters vs. 7 in the rest) and with the best global goodness of fit as assessed by −2log likelihood test. Statistical analyses were performed using IMB SPSS Statistics 19.0 (IBM, Armonk, NY, USA).
|
study
| 100.0 |
Hemodynamic values before exercise were not significantly different between protocols for all variables (p > 0.05). Regarding SBP responses (Table 1), for the mean of the SBP peaks of the 40 repetitions there was a significant interaction between session and time (p = 0.018), such that both (p < 0.001) IRD and CD were higher during the sessions in comparison with the baselines, and SBP values during the IRD were higher than the values during the CD (p = 0.013). There was no main effect of the session (p = 0.052), and a main effect of time was reported (p < 0.001), with higher values during exercise compared with its baseline values. The progression of the SBP peaks during the 40 repetitions is descriptively reported in Figure 2.
|
study
| 100.0 |
In regard to the peak SBP of the session (Table 1), there was not a significant interaction between session and time (p = 0.492). Besides, there was not a main effect of session (p = 0.517). However, there was a main effect of time (p < 0.001), as peak values during the session were higher than baseline values.
|
study
| 100.0 |
For the SBP peaks of the initial and final repetitions of the five sets during the CD, in comparison with the concomitant repetitions in the IRD, there were not significant interactions between session and time either for initial (p = 0.194) or final (p = 0.564) repetitions. There was not a main effect of session either for initial (p = 0.274) nor for final (p = 0.467) repetitions. There was a main effect of time for both initial (p < 0.001) and final (p < 0.001) repetitions, with values increasing during new sets.
|
study
| 100.0 |
The rest of the hemodynamic variables are reported in Table 2. For HR, there was a significant interaction (p < 0.001), as both protocols increased HR during the session versus the baseline values (p < 0.001), but HR during the IRD was lower in comparison with the CD (p < 0.001). Besides, there was a main effect of session (p < 0.001), with lower HR values during the IRD in comparison with the CD, and a main effect of time (p < 0.001). DBP analysis reported no significant interaction for DBP (p = 0.056) and no main effect of session (p = 0.14). Also, a main effect of time was reported (p < 0.001). PP analysis indicated a significant interaction (p = 0.002), where PP increased during the IRD, in comparison with the CD (p < 0.001) and the baseline values (p = 0.017). A significant main effect of session was also noted (p < 0.001), with higher values during the IRD in comparison with the CD. Besides, a main effect of time was not reported (p = 0.14). Finally, for DP there was no interaction (p = 0.069) and no significant main effect of session (p = 0.097). Besides, a significant main effect of time was observed (p < 0.001). For HR, DBP, and DP, the main effect of time reported higher values during exercise in comparison with the baseline.
|
study
| 100.0 |
Total TUT was not significantly different (p > 0.05) between protocols (IRD: 1757 ± 199 ms; CD 1736 ± 242 ms). IRD was significantly shorter during concentric TUT (p = 0.004, 769 ± 60 ms) and significantly longer (p = 0.033, 988 ± 161 ms) during eccentric TUT in comparison with CD (870 ± 91 ms and 866 ± 195 ms, respectively).
|
study
| 100.0 |
For the lineal mixed model analysis (Figure 3). The ANOVA test of SBP during the first set of CD revealed a significant main effect (p < 0.001), with pairwise comparisons showing significantly higher values in 1st and 4th–8th repetitions in comparison with the baseline (p < 0.001). Fitting Model 1 to these data showed a fixed effect of repetition (i.e., estimated population slope in the repetition SBP relationship) of 7.28 mmHg (standard error: 1.27; p < 0.001). Random effect analyses estimated a standard deviation of 3.83 mmHg, and therefore, an intersubject variance of 14.68 (mmHg/rep)2 for the slope of regression (7.28 ± (1.96 × 3.83)).
|
study
| 100.0 |
There were two main findings in this study: (a) in contradiction with our hypothesis, the IRD produced an increase in the mean of the SBP peaks in comparison with the CD due to the lack of the v-shape advantage; and (b) in the first set of the CD, we observed a progressive linear increase in SBP from the fourth repetition, estimated at around 7 mmHg per repetition.
|
study
| 100.0 |
Our data showed that when the intensity of load and work-to-rest ratio are equal, set configuration defines the SBP response, as was previously suggested . Differences between designs may be a consequence of dissimilar reflex pressor responses and distinct intrathoracic pressures as a consequence of different needs on the Valsalva maneuver execution . In this sense, despite the fact that we did not analyze the metabolic demands of the protocols, IRDs have a higher concentric velocity (i.e., a shorter concentric TUT), which is negatively correlated with the glycolytic involvement . Since glycolytic involvement determines the reflex pressure response , this suggests that during the IRD, the pressor response from a peripheral origin was potentially reduced in comparison with the CD. On the other hand, an individual repetition produces an excessive intrathoracic pressure in comparison with subsequent repetitions , thus propagating and increasing the momentarily SBP into the next individual repetition, to a greater extent than the CD does.
|
study
| 100.0 |
Otherwise, the CD might have a remarkable SBP response from a reflexive origin, since during the last repetitions there is an increase in the metabolic demands of active muscles , and an augmented intrathoracic pressure, to facilitate the application of force to the reel in a situation of muscular fatigue . Nevertheless, differences between protocols only occurred during the v-shape of the CD due to an advantageous SBP response (Figure 1), which occurs simultaneously with an enhanced use of the elastic energy, stored in the muscles in an absence of fatigue . It is important to note that differences were not observed either at the beginning or at end of every set, nor at peak SBP values of the sessions when comparing both protocols.
|
study
| 100.0 |
Our results agree with two previous studies comparing cluster set designs with continuous set designs . These designs observed higher increases in SBP response, with two to ten seconds of resting time in the middle of the set, in comparison with the continuous ones. Oddly, our data disagree with the lower values observed in an IRD with 3 s of rest between repetitions in comparison with a CD . The divergence of the results may be due to three different methodological reasons. Firstly, our leg press had an eccentric–concentric fashion in comparison with the concentric–eccentric structure of Baum et al. Secondly, in comparison with the work-to-rest ratio matched designs in our study, the protocols in the study of Baum et al. were unequal. They had the same resting time between sets but a greater total resting time in their IRD, because of the addition of the rests between repetitions, but without adjusting their CD. Additionally, while we collected the peak SBP value for every repetition, Baum et al. collected the whole SBP response (i.e., 50% resting time and 50% concentric and eccentric contractions time). These two reasons may have greatly reduced the SBP response in their study . Thirdly, the times participants lifted their feet in our IRD (i.e., one for every repetition, 40 times) might have affected SBP in a greater magnitude than Baum et al.’s (i.e., three times), since after every lifting of their feet, SBP shifted upwards .
|
study
| 100.0 |
Peak SBP responses during our study exceeded the recommended limit of 200 mmHg to maintain aortic integrity ; as was previously reported, (MacDougall et al., 1992, 1985) fatal events did not occur. Regardless, it would be wise to develop protocols that minimize these peaks to achieve a safer design. Accordingly, stopping the session just after the v-shape during a theoretical CD may help to ensure the lowest values of SBP. In our study, this occurred analytically after the third repetition and descriptively after the third or fourth repetition (Figure 1). Thus, future studies should analyze the pressure response during cluster designs with an intensity of effort around 30–40% (i.e., 30–40% out of the total feasible repetitions in a set), while allowing long rests between sets . In our study, the increase in SBP during the first set was estimated at an increase of ~7 mmHg per repetition after the forth one, with every new repetition. Additionally, the intersubject variability predicted individual increasing profiles from null to 15 mmHg. In this regard, the development of regression studies will help to anticipate the increase in the pressure response. It will also help stop the set when necessary, in order to reduce the risk of aneurysm rupture. This is when training with continuous designs is needed, such as for eliciting a hypotensive effect . On the other hand, while it seems that IRD might be the best option, when the aim of the resistance training session is to guarantee the electrical integrity of the heart , it may not be the best option when trying to maintain the lowest pressure response possible during the exercise. In this particular case, a set that ends around the nadir of the v-shape response would be the predilected option.
|
study
| 100.0 |
This study is not without limitations. Even if efforts were made to obtain appropriate hemodynamic values, data were lost in some participants during the IRD. When leg press was the preferred exercise with intraarterial catheterization , it may not be the best exercise with photoplethysmography, since loss of data has been already reported . A better option may be the leg extension exercise since loss of data was not previously informed . Besides, while metabolism involvement and intrathoracic pressure were not tested, an inference based on previous studies, describing the response during a set, allowed us a rational explanation of the differences. Lastly, the implementation of our results on the weight room should still be carried out with caution, since, in our analysis, we chose the blood pressure peaks of every repetition. This differs from previous literature, in which analyses were performed considering all beats of every repetition .
|
study
| 100.0 |
An IRD produced an increase of SBP in the mean of the SBP peaks during the 40 repetitions in comparison with a CD, due to the lack of the v-shape advantage during the former. The increase in SBP was predictable with a mixed linear model during the first set of the CD, with a progressive increase once the nadir was reached during the third repetition. While none of the designs may help to have the actual lowest pressure response possible, these study findings will help to better control the SBP response during a set in resistance exercise.
|
study
| 100.0 |
The developing digestive system of the embryonic and larval zebrafish is a well-established model system for the study of vertebrate gastrointestinal physiology and metabolism. Metabolic and regulatory pathways for gastrointestinal system development, intestinal and liver cell differentiation, digestion, and nutrient uptake and transport are highly conserved between zebrafish and humans (1–7). The functional regionalization of the intestine also appears to be conserved among vertebrates including zebrafish with respect to transcription factor expression in epithelial cells over the length of the intestine (8). Additionally, the transparency of the developing larva makes it ideal for live imaging experiments: The larval zebrafish has a functional and visible liver, pancreas, gallbladder, intestine, and intestinal microbiota by 5 days post-fertilization (dpf) when it begins to feed. The zebrafish is also suitable for large-scale and high-throughput experiments due to its small size and high fertility (a single pair can produce hundreds of embryos in a day). Finally, as the importance of the gut microbiome to studies of nutritional physiology is becoming increasingly clear; the larval zebrafish microbiota are well-characterized, and germ-free and gnotobiotic models are available (9).
|
review
| 99.9 |
The zebrafish zygote contains a large yolk cell which is absorbed over the first 5 days of life and supplies the developing embryo with nutrients. The yolk consists of a lipid and protein rich core with a cellular syncytium at its periphery, called the yolk syncytial layer (YSL). The YSL exports amino acids, hydrolyzes complex lipids to release fatty acids, and synthesizes lipoproteins, which export lipid to the developing embryo until it is able to feed independently (10). The intestine of the larval zebrafish is open at both ends and ready to absorb exogenous food at 5 dpf, though the non-enterocyte secretory cell populations do not differentiate until later larval stages (11). Once the intestinal tract is open, the gut microbiota are acquired from the media. At this time, colonization occurs essentially immediately and is maintained throughout life with the main source of variation in bacterial community composition being changes in diet (12).
|
study
| 100.0 |
Both the embryonic and larval zebrafish are valuable models of lipid uptake and trafficking, respectively, from the yolk cell and the diet. This review encompasses the roles of lipid remodeling, lipoproteins, intestinal lipid transport proteins, and the gut microbiota in lipid processing during zebrafish development.
|
review
| 99.9 |
The majority of the mass of a zebrafish zygote consists of the yolk, a lipid-rich structure that is gradually depleted by transport of its contents to the embryo as it develops into a free-feeding larva. Yolk lipids are packaged into lipoproteins in the YSL before being exported to the body of the developing zebrafish. Lipoproteins are lipid-transporting structures consisting of a neutral lipid interior bounded by a phospholipid (PL) and cholesterol monolayer, carrying one or more apolipoproteins. Apolipoproteins mediate interactions among lipoproteins, cellular receptors, and lipid-processing enzymes. The zebrafish genome contains analogs of every major human apolipoprotein, but there are some differences in patterns of expression and function. Due to the teleost genome duplication, zebrafish have multiple paralogs of each apolipoprotein gene. Human lipid metabolism genes with corresponding zebrafish paralogs discussed in this review are summarized in Table 1. There are 11 apolipoprotein genes in the apoB, apoA-IV, apoE, and apoA-I families, and all are expressed in the YSL (13) (Figure 1). Whole-mount in situ hybridization reveals that expression of some apolipoprotein genes is localized to subregions of the YSL, suggesting a previously uncharacterized compartmentalization of this structure. For example, mRNA encoding apoA-IV appears to be specific to the yolk extension at earlier stages (though different paralogs in this family are concentrated here at different points in development), while members of the other apolipoprotein families are expressed more evenly throughout the YSL (13). The significance of these potential YSL subdomains has yet to be described, but it is possible that there is a relationship to the regionalization of the developing intestine.
|
review
| 99.9 |
Zebrafish apolipoprotein genes are expressed in the yolk syncytial layer (YSL). The developing zebrafish embryo gradually absorbs lipids from its yolk (a), which is surrounded by the YSL. At 1–5 dpf, the yolk ball is lengthened along the tail of the embryo forming the yolk extension (b). In situ hybridization reveals expression of all 11 zebrafish apolipoprotein genes in the apoB, apoA-IV, apoE, and apoA-I families in the YSL at 1 day post-fertilization. Adapted and reprinted from Miyares et al. (18), and Otis et al. (13), under a CC-BY license.
|
study
| 99.94 |
Although the expression of apolipoprotein genes in the developing embryo and larva has been thoroughly characterized, the lipoprotein profile at these stages is less well defined. Most work on fish lipoproteins has focused on adults, likely due to the difficulty of obtaining adequate blood samples from larvae (19). Secretion of very low-density lipoprotein (VLDL) particles from the yolk has been demonstrated by electron microscopy (20, 21). The YSL also expresses apoA-I and apoA-II, which are found in HDL (high-density lipoprotein) particles and chylomicrons but not LDL (low-density lipoprotein) or VLDL (13, 14). ApoB, which is a component of chylomicrons, LDL, and VLDL, has a vital role in the export of yolk lipids. Microsomal triglyceride (TG) transfer protein (MTP) packages TGs into ApoB-containing lipoproteins. ApoB is degraded if it is not associated with lipid so, in the absence of MTP function, ApoB is not functional (22). In mtp−/− mutant zebrafish larvae, lipids are trapped in the yolk (characterized by retention of yolk volume, an increase in yolk opacity, and a reduction in neutral lipid in the body) and larvae do not survive beyond 5 days (23). Additionally, unlike their wild-type siblings, mtp−/− embryos retain fluorescent fatty acid injected into the yolk and do not export it or its fluorescent products to the circulation (18). The ability of mtp−/− larvae to grow and survive to 5 dpf suggests that some lipid must be transported out of the yolk in order for membranes to be synthesized, possibly through the synthesis of HDL-like particles that contain ApoA-I and do not require MTP for their assembly.
|
study
| 99.94 |
According to a recently published developmental study of lipid composition performed by liquid chromatography-mass spectrometry (LC-MS), at the time of fertilization, embryo lipids are approximately 40% cholesterol, 35% PL, and 9% TG, with less abundant species, including mono- and di-glycerides, cholesterol esters (CE), ceramides, and lysophospholipids, making up the remainder (24). Over the first 5 days of life, a linear decrease in the molar amount of most lipid species is observed in the yolk with a corresponding increase in the embryonic/larval body. Some exceptions have been observed: TG in the body remains consistently low as it is depleted from the yolk, suggesting that yolk TGs are primarily broken down and either oxidized for energy or resynthesized into other lipid products. Interestingly, CE, the other “energy storage” lipid class, is exchanged evenly from the yolk to the body during this period of development with the total amount remaining the same (24). Cholesterol synthesis in animal cells is tightly controlled in response to the cholesterol content of membranes via regulation of HMG-CoA reductase expression, and esterification is a major mechanism by which excess cholesterol is neutralized (25). One possible reason that CE is not depleted during the lecithotrophic (yolk-feeding) period of development is that breaking down CE for fatty acid oxidation would result in an overabundance of cholesterol. Favoring glycerolipids as an early energy source, therefore, would be important for cholesterol homeostasis, while CE from the yolk could be repackaged into intracellular lipid droplets for later oxidation or storage in adipocytes. Free cholesterol in the yolk and the body decrease and increase, respectively, at the same apparent rate between 24 h and 5 days of development, but the cholesterol content of the body at 5 dpf is less than the initial amount in the yolk (24). It is likely that this portion of the cholesterol is directed to synthesis of steroid hormones and bile, though these compounds were not measured in this study.
|
study
| 100.0 |
Phospholipid dynamics in the developing embryo also appear to be more complex than simple yolk to body trafficking: while other PL classes seem to move gradually from the yolk to the body, phosphatidylcholine (PC) levels in the yolk increase over the first 24 h, then decrease over the next 4 days while remaining relatively constant in the body (24). Though the specific lipid composition of zebrafish embryonic lipoproteins has not been investigated, one possible explanation is that the initial increase in PC goes to building the outer monolayer on lipoproteins exported from the yolk. It is possible that when this lipoprotein-associated PC reaches the body, it is in excess and is either oxidized or remodeled.
|
study
| 100.0 |
Although Fraher and colleagues’ published analysis of their LC-MS data set was limited to discussion of developmental changes in lipid classes, quantitation of all individual lipid species was published as a supplement to the manuscript. These data provide an opportunity to examine the changes in individual lipid species that occur during the first 5 days of zebrafish development. For example, the major PL classes are defined by head group (e.g., PCs, phosphatidylethanolamines, phosphatidylserines, etc.), but each of these classes comprises thousands of different molecules with different types of fatty acid “tails.” Modern mass spectrometry technologies optimized for lipidomics can differentiate between individual lipid species at this level of resolution because they can precisely determine the mass to charge ratio (m/z) of each analyte in a mixture and because they employ a second step in which the molecules are fragmented and the subsequent m/z values of these fragments are also determined. Complex lipids such as PLs are identified using m/z values calculated from molecular formulas and expected fragmentation patterns, and are annotated in Fraher’s supplemental data and other lipidomics data sets as “Head Group (FA 1/FA 2).” The most abundant PL in animal cell membranes, for example, is PC with the saturated 16-carbon fatty acid palmitate and the monounsaturated 18-carbon fatty acid oleate and is annotated as PC(16:0/18:1). When the specific fatty acid composition of a complex lipid cannot be determined, only the total fatty acid carbon chain length and number of unsaturated carbon–carbon bonds is given [e.g., PC(34:1)].
|
review
| 91.6 |
When trends in the amounts of individual lipids in Fraher’s data set are examined, results suggest that changes in the PL profile are consistent with an increase in membrane PL in the larval body that is expected to occur with increasing growth. However, the trends in total amounts of PL present in the yolk and body are skewed by changes in individual PL species. Specifically, PC(18:2/20:4) is a major PL in the body at the start of development and shows a large decrease by 5 dpf. However, the expected major PC components of cell membranes including PC(34:1) and other PCs with total chain lengths in the low 30s increase over the course of larval development as expected. It is possible that longer-chain PLs predominate in lipoproteins but are a minor species in cell membranes, a model supported by a large increase in the amount of PC(18:2/20:4) in the yolk over the course of development (this species is the only PL in the yolk whose total molar amount increases over 1–5 days, though other PL species increase in the yolk in terms of percentage of total lipid). PLs containing the fatty acid arachidonic acid (20:4) are the precursor of eicosanoids, a class of signaling molecules with roles in regulating inflammation, vascular physiology, and stem cell activity (26, 27).
|
study
| 100.0 |
This finding suggests eicosanoids as an important area of interest in the ongoing characterization of yolk utilization in the zebrafish. Although the physiological implications of changes in individual lipids were not within the scope of this published work, the rich MS data set that was produced highlights the importance of examining behavior of individual lipids in studies of metabolism and transport.
|
study
| 100.0 |
The embryonic and larval zebrafish yolk is metabolically active not just in lipid transport, but also in the synthesis and remodeling of complex lipids, as was demonstrated through the injection of radioactive and fluorescently labeled lipids into the larval yolk followed by thin layer chromatography (TLC) analysis of the products of these metabolic tracers (18). Fatty acids labeled with BODIPY-FL?(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene; a green fluorescent small molecule tag) or radioactive fatty acids injected into the yolk of 3 dpf larval zebrafish were both metabolized into complex lipids including PL, CE, and TG and transported throughout the developing body. Furthermore, injection of radioactive oleate showed that the yolk synthesizes complex lipids at the earliest stages of development, as radioactive TG and PL products were found in embryos injected as early as 0.75 hours post-fertilization (hpf). While the rate of incorporation of radioactive oleate into each PL class was consistent in embryos and larvae aged 0.75–3 dpf, larvae injected at 3 dpf were the only group to synthesize labeled CE, and there was a large increase in the amount of radioactive TG at later stages as well (18). When BODIPY-C12 was injected into the yolk of 24 hpf zebrafish embryos and yolk and body lipids were analyzed separately by TLC 1–6 h post injection (hpi), fluorescent complex lipids including TG, CE, and several unidentified species were produced in the yolk at early time points. Some fluorescent complex lipids were detected in the body at 6 hpi (24). (It is not known whether fluorescent PL was synthesized in this experiment as the assay only detected nonpolar lipids.) Injection of fluorescent PL into the yolk at 24 hpf resulted in fluorescent diglyceride and unidentified complex lipid species in the yolk, but no identified products in the body up to 6 hpi (24). Taken together, this and other evidence shows that the yolk is metabolically active throughout development and can both break down and synthesize complex lipids (18, 24, 28) (Table 2).
|
study
| 100.0 |
The larval zebrafish undergoes a switch from a lecithotrophic state to a free-feeding animal during its fifth day of development, so by the time its yolk supply is depleted it must be able to digest and absorb nutrients from exogenous food sources. The ability to precisely control timing of the first meal is an advantage of this model as processing of dietary lipids by enterocytes can be observed without interference from lipids absorbed from previous meals. Additionally, because the larva retains its transparency for several weeks after it becomes free-feeding, it is possible to perform live imaging experiments with either single meals or ongoing defined diets in the same system.
|
study
| 99.94 |
Most dietary lipid consumed by animals enters the intestine not in the form of free fatty acids, but in complex lipids. Dietary TGs, PLs, and CE must be broken down by intestinal lipases in the lumen before the components of these molecules can cross the enterocyte membrane. As the fatty acids in these molecules are all linked by ester bonds, the intestinal lipases secreted by the exocrine pancreas are versatile and process a wide range of dietary lipids so that they can be absorbed (30). Following lipolysis, dietary lipid products form micelles in the intestinal lumen, which are emulsified in this aqueous environment by bile. The composition of bile varies between species and there are significant differences between teleost fish and humans, but its function is conserved (31, 32).
|
study
| 99.94 |
As they do in mammals, enteroendocrine cells in zebrafish secrete a wide range of hormones including serotonin, which influences motility and appetite, and cholecystokinin (CCK), which stimulates gall bladder contraction and release of digestive enzymes from the pancreas (33, 34). The zebrafish genome contains two CCK paralogs; ccka is expressed in the digestive system of adults (no data are available for larvae at this time) and both ccka and cckb are expressed in the brain starting at 24 hpf (35, 36). In mammals, CCK promotes lipid digestion by stimulating the gall bladder to secrete bile, but does not increase lipase activity (37, 38). Similarly, larval zebrafish treated with a CCK receptor antagonist show reduced protease activity while intestinal phospholipase activity is unaffected (30). Enteroendocrine cells expressing serotonin begin to appear in the larval zebrafish intestine at 5 dpf. They may be detected by immunohistochemistry for serotonin, and are distinguished from the enteric neurons (which also express serotonin) by their shape and location in the epithelium. By 8 dpf, 10–18 enteroendocrine cells per larva may be observed in the distal intestine (posterior to the swim bladder) (11). A notable difference is that the larval zebrafish intestine does not have crypts, where enteroendocrine cells would be located in mammals.
|
study
| 100.0 |
The intestinal microbiota is required for normal enteroendocrine cell development (11). In germ-free larval zebrafish, 0–6 enteroendocrine cells were observed at 8 dpf (the total number of cells in the distal intestinal epithelium did not vary between germ-free and conventional groups). Larvae raised germ-free until 5 dpf, and then colonized with the conventional microbiota, developed normal numbers of enteroendocrine cells, suggesting that the yet-unidentified signal from the microbiota that promotes enteroendocrine cell development is not required before 5 dpf. Higher gut motility was observed in zebrafish larvae raised germ-free, suggesting a possible connection to digestive problems (including irritable bowel disease) observed in humans when the gut microbiota is disrupted (11). The lower number of serotonin-positive cells could explain this physiological effect as serotonin regulates gut motility in humans (33).
|
study
| 100.0 |
Dietary lipids are imported from the intestinal lumen across the apical enterocyte membrane by several different mechanisms depending on their class. After complex lipids (including both glycerolipids and CE) are digested to yield fatty acids, monoglycerides, and/or lysophospholipids, these products may cross membranes by a variety of transport processes conserved among zebrafish and mammals.
|
study
| 99.56 |
Cholesterol is taken up by enterocytes by a mechanism that requires the Niemann-Pick C1-Like 1 (NPC1L1) transport protein (39, 40). This membrane-associated protein is located at the brush border of enterocytes and is translocated to an intracellular compartment when cells are exposed to cholesterol; current models postulate a clathrin-dependent endocytic mechanism in which NPC1L1 is internalized along with a cholesterol cargo, which then moves through endosomes to the endoplasmic reticulum where it can be packaged into membranes or used to synthesize cholesterol ester (41, 42). NPC1L1 is encoded in the zebrafish genome, and several lines with point mutations in this gene have been created through the Sanger Institute Zebrafish Mutation Project (43). Ezetimibe, an inhibitor of NPC1L1-mediated cholesterol absorption that is used to treat hypercholesterolemia in humans, also blocks dietary cholesterol absorption in larval zebrafish (44–46). This creates an opportunity to use the zebrafish model to study physiological effects of modulating metabolic availability of a single component of a mixed-lipid diet. Regulation of NPC1L1 activity remains largely uncharacterized, although there is evidence from studies in humans given statins (inhibitors of cholesterol synthesis) that NPC1L1 expression levels increase in response to low intracellular cholesterol levels, suggesting that there may be an unidentified genetic mechanism that regulates NPC1L1 expression that could counteract the effects of statins by upregulating import of dietary cholesterol (47).
|
study
| 99.94 |
Fatty acid transfer proteins (FATPs) are a family of integral membrane proteins that facilitate transport of fatty acids into cells, including transport of dietary fatty acids into enterocytes. FATPs act in concert with acyl-coA synthetases (ACSs), which activate the newly imported fatty acids so that they are ready to form ester bonds and be incorporated into complex lipids (48, 49). There is evidence from mammalian and cell culture models that both the FATP and ACS families play roles in regulating preferential uptake of some dietary fatty acids over others, and in the partitioning of dietary fatty acids among complex lipids (48, 50). The zebrafish genome encodes 9 ACSL (ACSs specific to long-chain fatty acids, the type of fatty acid most abundant in animals including zebrafish) gene paralogs in six families. Expression of this class of genes is ubiquitous in adults, with proteins corresponding to seven of nine paralogs detectable by Western blot in most tissues including the gut (51). Expression of ACSL genes in the larva is more regionalized: in the acsl1 family, acsl1b mRNA is detectable in the YSL and gut in early larval stages. The acsl1a paralog is not expressed in the YSL, and no expression data are available for early-gut development (17). Only acsl1a is expressed in the gut in adults (51). Acsl4a mRNA is present in both the YSL and the larval gut (52). Expression of acsl4b and acsl5 is detectable in the YSL, but expression data are not available from larval stages after the gut has begun to develop (17) (Figure 2). Expression data are unavailable for the other acsl paralogs at any embryonic or larval stage, but what is known about expression of acsl genes in this model suggests potential division of function among paralogs similar to that suggested by regionalized apolipoprotein gene expression.
|
study
| 99.94 |
Acyl-CoA synthetases are expressed in the larval zebrafish yolk syncytial layer (YSL) and intestine. (A) In situ hybridization reveals expression of acsl1b, acsl4b, and acsl5 in the YSL at 24 hpf, and acsl1b in the developing gut at 2 dpf. Adapted from Ref. (17). (B) acsl4a is expressed in the gut and central nervous system (cns) of the 4 dpf larval zebrafish, and in the YSL at 24 hpf and earlier. Reprinted from Ref. (52), Figure S1E in Supplementary Material, under a CC-BY license. (C) fatp4/acsvl4 is expressed in the gut (especially the anterior bulb) of the 5 dpf larval zebrafish. Adapted from Ref. (53).
|
study
| 99.94 |
Compared with the ACSs, there is far less coverage of zebrafish FATPs in the current literature. As of now, no studies of FATP function in this model system have been published and only one genomic sequence is annotated as a FATP in the Ensembl database; FATP3/ACSVL3/SLC27A3 [with 7 paralogs, all annotated as members of solute carrier family 27 (slc27)]. The other six putative FATP paralogs are annotated as SLC27A1A and B {both with 65% protein sequence identity to human SLC27A1/FATP1/ACSVL5 [a mitochondrial long-chain FATP (54)], using the NCBI protein BLAST tool}, SLC27A2A (47% protein sequence identity to human SLC27A2/FATP2/ACSVL1), SLC27A2B (55% protein sequence identity to human SLC27A2/FATP2/ACSVL1), SLC27A4 (70% protein sequence identity to human SLC27A4/FATP4/ACSVL4), and SLC27A6 (57% protein sequence identity to human SLC27A6/FATP6/ACSVL2). The chromosomal locations of all of these putative fatp genes are conserved between the human and zebrafish genomes (syntenic analysis by ZFIN). Zebrafish SLC27A2A is expressed in the adult liver (55), and SLC27A4 is expressed in the anterior gut at 5 dpf (53) (Figure 2). No expression data are available for other adult organs, earlier larval stages, or the other putative FATPs at this time. However, as FATP4 is the primary fatty acid transporter on the apical brush border of human enterocytes, the similarity in expression between zebrafish and humans supports the larval zebrafish as a model in the investigation of FATP function in dietary fatty acid absorption (56).
|
study
| 99.94 |
The relative contributions of FATP4, other membrane-associated fatty acid-binding proteins, and passive diffusion to uptake of dietary fatty acids by enterocytes in larval zebrafish are not known. A recent review proposes a model in which the transmembrane receptor protein CD36, Caveolin 1 (Cav1), and FATP4 all act as fatty acid transporters at the enterocyte brush border, and in which passive diffusion of long-chain fatty acid salts across the enterocyte membrane plays a major role in adsorption (57). Larval zebrafish express CD36 and Cav1 in the intestine as well as FATP4 and, therefore, present an opportunity to apply live whole-animal imaging tools toward investigations of the roles of each of these proteins in dietary fatty acid processing (58, 59). [Cav1 is located on the basolateral membrane of enterocytes in zebrafish and not at the brush border and, therefore, is unlikely to participate directly in uptake of fatty acids from the intestinal lumen (59).] In sum, despite tight conservation of FATPs and other fatty acid transporters, and their intestinal expression throughout the vertebrates, their physiological role in the intestine remains unclear.
|
review
| 99.9 |
The bacterial population of the intestine also plays an important role in dietary lipid uptake and metabolism. Fermentation by the gut microbiota allows host animals to utilize dietary plant polysaccharides that would otherwise be indigestible by converting them to metabolizable short-chain fatty acids and monosaccharides (60). Multiple studies over the last decade have shown effects of changes in composition of the gut microbiota on adiposity, serum lipids, and tissue lipids in mammals (61–66). However, determining mechanisms by which bacteria may cause global changes in vertebrate host physiology has been difficult as the composition of the gut microbiota also changes in response to changes in diet (67, 68). The larval zebrafish model was recently used to investigate aspects of the relationship between gut bacteria and lipids involving processes other than short-chain fatty acid synthesis: when larvae raised germ-free were given a high-fat meal labeled with fluorescent fatty acids, less fluorescence accumulated in the intestinal epithelium when compared with conventionally raised larvae, showing that at least some members of the microbiota are necessary to promote uptake of dietary lipids. Monoassociated larvae (larvae raised germ-free and then inoculated with a single bacterial species) colonized with the Firmicutes strain Exiguobacterium sp. were used to demonstrate that this bacterial strain alone was sufficient to promote intestinal fatty acid uptake to a point where fluorescence could be observed in extra-intestinal tissues. Furthermore, experiments using conditioned media from this strain and two others also revealed significant increases in enterocyte lipid droplet number over untreated germ-free larvae, suggesting that a factor secreted by these species is involved in promoting dietary lipid uptake (69). The exact mechanism for this host–microbe relationship is currently uncharacterized, as is the evolutionary advantage of promoting host lipid uptake for these microbial species.
|
review
| 98.75 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.