text
string | predicted_class
string | confidence
float16 |
|---|---|---|
Test performance of antibodies immobilized in SPR system in identification of bacteria in ulcer secretions, compared to culture results, were calculated using the following formulas:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ \mathrm{Negative}\ \mathrm{P}\mathrm{redictive}\ \mathrm{value}\ \left(\mathrm{N}\mathrm{P}\mathrm{V}\right)=\frac{\mathrm{Number}\ \mathrm{of}\ \mathrm{true}\ \mathrm{negatives}}{\left(\mathrm{N}\mathrm{umber}\ \mathrm{of}\ \mathrm{true}\ \mathrm{negatives}\right) + \left(\mathrm{N}\mathrm{umber}\ \mathrm{of}\ \mathrm{false}\ \mathrm{negatives}\right)} $$\end{document}NegativePredictivevalueNPV=NumberoftruenegativesNumberoftruenegatives+Numberoffalsenegatives\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ \mathrm{Positive}\ \mathrm{P}\mathrm{redictive}\ \mathrm{value}\ \left(\mathrm{P}\mathrm{P}\mathrm{V}\right) = \frac{\mathrm{Number}\ \mathrm{of}\ \mathrm{true}\ \mathrm{positives}}{\left(\mathrm{Number}\ \mathrm{of}\ \mathrm{true}\ \mathrm{positives}\right) + \left(\mathrm{Number}\ \mathrm{of}\ \mathrm{false}\ \mathrm{positives}\right)} $$\end{document}PositivePredictivevaluePPV=NumberoftruepositivesNumberoftruepositives+Numberoffalsepositives\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ \mathrm{Specificity} = \frac{\mathrm{Number}\ \mathrm{of}\ \mathrm{true}\ \mathrm{negatives}}{\left(\mathrm{Number}\ \mathrm{of}\ \mathrm{true}\ \mathrm{negatives}\right) + \left(\mathrm{Number}\ \mathrm{of}\ \mathrm{false}\ \mathrm{positives}\right)} $$\end{document}Specificity=NumberoftruenegativesNumberoftruenegatives+Numberoffalsepositives\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ \mathrm{Sensitivity} = \frac{\mathrm{Number}\ \mathrm{of}\ \mathrm{true}\ \mathrm{positives}}{\mathrm{Number}\ \mathrm{of}\ \mathrm{true}\ \mathrm{positives} + \left(\mathrm{Number}\ \mathrm{of}\ \mathrm{false}\ \mathrm{negatives}\right)} $$\end{document}Sensitivity=NumberoftruepositivesNumberoftruepositives+Numberoffalsenegatives
|
study
| 100.0 |
The specificity of the developed antibodies was studied by the assessment of binding affinity of heat-killed bacterial strains to antibodies immobilized in the SPR system (Table 1). The SPR analysis of ulcer secretions using biosensor chips immobilized with antibodies developed against P. aeruginosa, S. aureus, E. fecalis, and S. epidermidis determined that S. aureus was found in 6/10 cultures from chronic ulcers and there was binding affinity to antibodies against S. aureus in 5/6 SPR analyses. S. aureus grew in 2/5 ulcer secretions from patients that had undergone breast cancer surgery and there was a binding affinity to S. aureus antibodies in both cases. E. fecalis grew in 1/10 ulcer secretion from chronic ulcers, however there was a positive binding to antibodies against E. fecalis in 3/10 specimens. There was no binding affinity to antibodies against E. fecalis in the ulcer secretions from healthy staff or patients who underwent breast cancer surgery (Table 2).Table 1Specificity test of in vitro antibodiesControlsAnti-S. aureus Anti-S. epidermidis Anti-E. fecalisAnti-P. aeruginosa Anti-C. perfringens Anti- B. fragilis Anti-P. oralis Anti-E. coli Anti-Streptococcus sp. S. aureus 25000000000 S. epidermidis 01030000000 E. fecalis 00244000000 P. aeruginosa 00036.400000 C.perfringens 000031.80000 B. fragilis 00000230.1000 P. oralis 00000057000 E. coli 0000000185.50 Streptococcus sp. 00000000278.3Anti-guinea pig IgG000000000Anti-human IgG279140646.5439342.375.8809.2234.6461.1Table 2Affinity of ulcer secretions to the immobilised antibodies in SPR system and the correlation to culture resultsUlcer secretionCulture resultsBinding to the produced antibodies in SPR systemAnti-P. aeruginosa Anti-S. aureus Anti-E. fecalis Anti-S. epidermidis Ulcer secretion from patients with chronic ulcer1 Staphylococcus aureus + Enterobacter cloacae negativepositivenegativepositive2 Staphylococcus aureus + Echerichia coli negativepositivenegativenegative3 Staphylococcus aureus + Pseudomonas aeroginosa negativepositivenegativenegative4 Staphylococcus aureus negativenegativenegativenegative5 Proteus mirabilis + coagulase negative staphylococcus negativenegativepositivepositive6negativenegativenegativenegativenegative7 Pseudomonas aeruginosa + Enterococcus fecalis positivenegativepositivenegative8 Staphylococcus aureus negativepositivenegativepositive9 Staphylococcus aureus negativepositivepositivepositive10negativenegativenegativenegativenegativeUlcer secretion from patients post breast cancer surgery1negativenegativenegativenegativepositive2negativenegativenegativenegativepositive3negativenegativenegativenegativepositive4 Staphylococcus aureus negativepositivenegativenegative5 Staphylococcus aureus negativepositivenegativenegativeUlcer secretion from healthy volunteers post skin biopsy in fore-arm1negativenegativenegativenegativepositive2negativenegativenegativenegativenegative3negativenegativenegativenegativenegative4negativenegativenegativenegativepositive5negativenegativenegativenegativepositive6negativenegativenegativenegativepositive7negativenegativenegativenegativepositive8negativenegativenegativenegativepositive9negativenegativenegativenegativepositive
|
study
| 100.0 |
Test performance for detection of pathogens in ulcer secretions by SPR using in vitro antibodies, compared with conventional culture techniques, showed results for S. aureus with 87.5 % sensitivity, 100 % specificity, positive predictive value (PPV) 100 % and negative predictive value (NPV) 94 % and for E. fecalis with 100 % sensitivity, 91.3 % specificity, PPV 33.3 % and NPV 100 % (Tables 2 and 3).Table 3Test performance of binding to the produced antibodies immobilized in SPR system in comparison to conventional ulcer secretion culturesSPR/cultureFalse positive (SPR)True positive (culture)False negative (SPR)True negative (culture)Total Staphylococcus aureus 0711624 Enterococcus fecalis 2102124Sensitivity for Staphylococcus aureus was 87.5 %, specificity 100 %, PPV 100 % and NPV 94 %. Sensitivity for Enterococcus fecalis was 100 %, specificity 91.3 %, PPV 33.3 % and NPV 100 %
|
study
| 100.0 |
The electron microscope images showed a specific interaction of anti-E. fecalis antibodies to E. fecalis in a monoculture preparation but not in a monoculture preparations of S. aureus or E. coli (Figs. 2 and 3). Furthermore, in a bacterial co-culture preparation containing the three bacterial strains (E. fecalis, S. aureus, and E. coli), anti-E. fecalis antibodies bound specifically only to the surface of few cocci (shown in arrows) but not to the other bacteria (Additional file 2).Fig. 2Co-culture of three bacterial strains: Staphylococcus aureus, Enterococcus fecalis, and Escherichia coli. Anti- Enterococcus fecalis antibodies incubated with the co-culture bound to some cocci but not to the other cocci or rods (white arrows). This interaction was visualized by electron microscopy by adding gold labled anti human IgG antibodies to the mediumFig. 3Co-culture of Enterococcus fecalis and Staphylococcus aureus incubated with anti-Enterococcus fecalis antibodies and visualized by electron microscopy. Please note the antibodies covering some cocci in the co-culture of two bacterial strains (white arrow)
|
study
| 100.0 |
Co-culture of three bacterial strains: Staphylococcus aureus, Enterococcus fecalis, and Escherichia coli. Anti- Enterococcus fecalis antibodies incubated with the co-culture bound to some cocci but not to the other cocci or rods (white arrows). This interaction was visualized by electron microscopy by adding gold labled anti human IgG antibodies to the medium
|
study
| 99.8 |
In the present work, the case of a middle-aged woman with persistent infection caused by E. fecalis and the ultimate outcome motivated a development of a non-culture bacterial detection method in management of complicated patient cases. The objective was to further increase the knowledge regarding the detection of life-threatening silent infections. Anti-bacterial in vitro human antibodies were developed from patients at convalescence and immobilized in a SPR system and used for assessment of presence of bacteria in ulcer secretions. Compared to culture results, the produced antibodies could recognize the microorganism with quite high test performance.
|
clinical case
| 99.9 |
In the field of medical diagnostics and the treatment of patients, the practitioner only has a narrow perspective on the factual preconditions of disease development and the true origin of the symptoms. Diagnostic tools give the clinician valuable insight into the characteristics of the pathology and help in choosing the best path of intervention . Previous medical records are seldom studied in detail and it is quite acceptable for medical personnel to attempt to treat the complications of chronic inflammatory processes by managing the symptoms and organ failures temporarily . However, a great number of different infectious agents may contribute to the patient’s sicknesses and sometimes the main cause is identified and successfully treated [17–20]. Yet, the reasons for and circumstances in which there is a transition from acute to chronic infection and inflammation are still not well understood. To better understand this transition, the relevant factors and components have to be characterized and identified.
|
review
| 99.9 |
An acute inflammatory process is the immediate result of the body’s recognition of and reaction to a foreign pathogen and the body’s attempt to eliminate the intruder . A prolonged chronic inflammatory process might depend on the persistence of the pathogens because of the nature of the invaders and/or the inability of the host to eliminate this intruder . The constant host-microbe interactions are exhausting to the host body . During an acute inflammatory response, the natural defensive reaction is more devastating to the body than the invasion itself. The contrary occurs during chronic inflammation, where the overgrowth of an otherwise hidden infection might cause septicemia, micro-circulatory defects, ischemia, and chronic organ failure . Chronic sepsis and multiple organ failure can be consequences of a prolonged chronic inflammatory process . In many cases, the source of inflammation is known, however with poor prospects of eliminating it. Bacteria in the planktonic shape might often be sensitive to immune responses and antibiotics, whereas the coexistence of bacteria in a biofilm makes them resistant to antibiotics. This also contributes to the development of new drug resistant strains [26, 27]. Therefore, it is most important to find out the reason why the infection succeeds in persisting, before it becomes invasive. As a model of chronic organ injury, we have investigated patients with chronic ulcers and have tried to clarify why some ulcers do not heal [28–31]. Periodontitis has been studied in our group with special focus on the role of P. gingivalis in chronic inflammatory diseases . We have shown that stimulation of lymphocytes from a patient who suffered from periodontitis with P. gingivalis caused maturation of cells into antibody secreting, CD38-expressing plasma cells, 2–3 weeks after stimulation. The results from SPR analysis of crevicular fluid samples from patients with periodontitis and controls correlated significantly with RT-PCR results (p >0.05) .
|
study
| 100.0 |
Although the recent advances in science have succeeded in development of highly sensitive and specific nucleic-acid based methods, PCR analysis was not performed on the ulcer secretion that was assessed in the present study. The production of antibodies in vitro against bacteria was not meant to replace a highly technologic PCR method in detection of bacteria. We aimed to develop a method to specifically prove the presence of pathogenic bacteria. Upon detection of such bacteria we have recently succeeded to treat several complicated polymicrobial infections focused on gram-positive bacteria with antibiotic therapy including ampicillin or vancomycin . This might have an impact on decreasing extended spectrum beta-lactamase (ESBL)-producing organisms that colonize chronic wounds. The finding that the SPR method did not detect culture verified bacteria in two ulcer secretions (Table 2), may be due to a low sensitivity of the SPR method. Though we have produced the antibodies at convalescence from lymphocytes of patients that had undergone infection with pathogenic bacteria, another reason for false negative result in two cases might be that the antibodies detect the pathogens with specified epitopes. This mechanism is one of our goals to be investigated in future studies.
|
study
| 100.0 |
Biofilms are poorly investigated as a source of chronic inflammation and multi-resistant bacteria in biofilms and chronic organ dysfunction are huge clinical problems. The lack of scientific evidence demonstrating a near association between silent organ dysfunction and an infectious focus is a major problem in clinical medicine. We have attempted to produce antibodies using memory cells of patients that had undergone a severe infection caused by a pathogen in order to detect pathogens in polymicrobial environments. In future studies, we aim to identify and produce antibodies against epitopes that reflect the presence of pathogenic key bacteria in biofilms.
|
study
| 100.0 |
Calpains 1 and 2 (or µ and m) are ubiquitous calcium-activated proteases involved in pathological cardiovascular remodelling and development of inflammatory kidney diseases. Both proteases share many similar substrates and their activity is blunted by calpastatin, their natural, ubiquitous and specific inhibitor1. Since the deletion of both calpains 1 and 2 is lethal, we previously developed transgenic mice overexpressing rabbit calpastatin, which contains a substrate-like inhibitory sequence similar to mouse calpastatin (CalpTG mice)2. These mice have normal baseline calpain activity and phenotype and the increase in calpastatin expression has been shown previously to blunt specifically calpain activation in models of glomerulonephritis, sepsis, ischemia or pathological neo-angiogenesis2–5. Unlike synthetic inhibitors, calpastatin inhibits selectively calpains and not other proteases. Calpains promote inflammation onset through several mechanisms. They degrade IκBα on a specific PEST sequence, leading to NF-κB activation and pro-inflammatory cytokines production1, 6. In addition to cytokine transcription, calpains promote interleukin-1α (IL-1α) maturation and activation7. Calpains also limit glucocorticoid anti-inflammatory activity by degrading HSP-90 and are essential for inflammatory cell recruitment, migration and diapedesis1, 8, 9. Accordingly, calpastatin overexpression limits NF-κB activation and inflammatory cell migration10, 11.
|
study
| 99.94 |
We previously described that calpains promote the development of inflammatory and fibrotic lesions in kidney and arteries in response to angiotensin II, and that calpastatin overexpression protected mice against these lesions10. Interestingly, angiotensin II, through AT-1 receptor signalling, promotes vascular aging12. Moreover, calpains are potent mediators of neurological diseases, including Alzheimer disease13, 14. A specific feature of tissue aging is the development of an inflammatory phenotype, including overexpression of innate immunity and inflammasome-related cytokines, so-called “inflammaging”15. Although its expression is weak and difficult to assess in vivo, one of the main cytokine linked to inflammaging is interleukin-1α (IL-1α)16. It was therefore tempting to speculate that calpains would promote vascular and kidney aging. At last, proteomic analysis performed in Klotho-invalidated mice revealed that in the absence of Klotho, the main anti-aging mechanism identified to date, alpha-spectrin clivage was strongly increased. Further analyses identified that this clivage was specific to calpains, evidencing thereby that Klotho may decrease calpain activity17.
|
study
| 99.94 |
We hypothesized that calpains would promote aging and especially kidney and cardiovascular lesions related to aging. We show hereafter that specific calpain inhibition by calpastatin overexpression decreases tissue inflammation and kidney and vascular lesions related to aging.
|
study
| 100.0 |
To assess the evolution of calpain expression with aging in kidney cortex, we measured protein and mRNA expression of calpain 1 and 2 in CalpTG and WT mice (Fig. 1A–F). There was no significant modification of calpain expression with aging (Fig. 1A–F). As expected and previously described2–5, 9–11, only CalpTG mice expressed the calpastatin transgene (Fig. 1G–H).Figure 1Calpastatin overexpression decreases calpain activity in aged mice. Western blots and quantitative PCR have been performed by using kidney cortex extracts from 2-months old (2mo) and 2 years old (2 yr) wild type (WT) and CalpTG (TG) mice. There was no significant difference of calpain 1 expression in WT and CalpTG mice at 2 months or 2 years at the protein level (A,B, n = 6/group) or at the RNA level (C, n = 6/group). Similarly, calpain 2 expression did not differ significantly between the 2 groups at the protein level (D,E, n = 6/group) or at the mRNA level (F, n = 6/group). As expected and previously described, only CalpTG mice expressed the transgenic rabbit calpastatin (G, n = 6/group). Mouse calpastatin mRNA expression did not differ among the different groups (H, n = 6/group). Calpain activity was measured by the ratio of the 145 kDa specific breakdown product of spectrin A by calpains, indexed to the intact spectrin. Calpains activity was similar at 2 months but significantly decreased in 2-years old CalpTG mice in comparison to aged WT mice (I,J, *p < 0.05, n = 6/group).
|
study
| 100.0 |
Calpastatin overexpression decreases calpain activity in aged mice. Western blots and quantitative PCR have been performed by using kidney cortex extracts from 2-months old (2mo) and 2 years old (2 yr) wild type (WT) and CalpTG (TG) mice. There was no significant difference of calpain 1 expression in WT and CalpTG mice at 2 months or 2 years at the protein level (A,B, n = 6/group) or at the RNA level (C, n = 6/group). Similarly, calpain 2 expression did not differ significantly between the 2 groups at the protein level (D,E, n = 6/group) or at the mRNA level (F, n = 6/group). As expected and previously described, only CalpTG mice expressed the transgenic rabbit calpastatin (G, n = 6/group). Mouse calpastatin mRNA expression did not differ among the different groups (H, n = 6/group). Calpain activity was measured by the ratio of the 145 kDa specific breakdown product of spectrin A by calpains, indexed to the intact spectrin. Calpains activity was similar at 2 months but significantly decreased in 2-years old CalpTG mice in comparison to aged WT mice (I,J, *p < 0.05, n = 6/group).
|
study
| 100.0 |
Calpain activity has been assessed in vivo in kidney cortex by measuring alpha-spectrin cleavage and the production of the 145 kDa specific breakdown product, as usually performed (2–5,10). Calpain activity was significantly lower in kidneys from CalpTG mice at 2 years when compared to WT mice (Fig. 1I–J, p = 0.041).
|
study
| 100.0 |
Renal histology has been analysed in young and aged WT and CalpTG mice (Fig. 2A–D). Aging was characterized by a significant decrease in the number of glomeruli in WT mice only (Fig. 2C, p = 0.0022). At 2 years, CalpTG mice developed less glomerulosclerosis than WT mice (Fig. 2D, p = 0.0085). CalpTG mice were also protected against the development of interstitial fibrosis at 2 years (Fig. 2E–G, p = 0.0005).Figure 2Calpastatin overexpression protects against kidney aging. At 2 years, CalpTG (TG) mice kidney was less impacted by aging than WT mice bred in the same conditions (A,B). The number of glomeruli/field decreased in WT animals at 2 years (C, *p < 0.05, n = 10/group). By contrast, the number of glomeruli did not decrease significantly in CalpTG animals. At 2 years, kidneys were affected by glomerulosclerosis and enlarged glomeruli in WT animals, but these lesions were significantly less important in CalpTG mice (D, **p < 0.01, n = 10/group, magnification ×200). Fibrosis quantification was assessed by sirius red morphometry under polarized light, revealing that at 2 years, interstitial fibrosis surface was reduced in CalpTG mice when compared to aged WT (E–G, ***p < 0.001, n = 10/group, magnification ×200). Beta-galactosidase activity, a marker of senescence was dramatically reduced at 2 years in CalpTG mice (H–J, *p < 0.05, n = 5/group, magnification ×200). p21, another classical marker of senescence was also less expressed in CalpTG animals at 2 years (K, *p < 0.05, n = 6/group). Kim-1, a marker of tubular injury increased significantly with aging only in WT mice (L, **p < 0.01, n = 6/group). Telomere shortening was significantly more important in WT mice at 2 years in comparison to CalpTG animals (M, **p < 0.01, n = 10/group). The protection of telomeres in CalpTG mice could not be ascribed to increased telomerase activity (N, n = 8/group).
|
study
| 100.0 |
Calpastatin overexpression protects against kidney aging. At 2 years, CalpTG (TG) mice kidney was less impacted by aging than WT mice bred in the same conditions (A,B). The number of glomeruli/field decreased in WT animals at 2 years (C, *p < 0.05, n = 10/group). By contrast, the number of glomeruli did not decrease significantly in CalpTG animals. At 2 years, kidneys were affected by glomerulosclerosis and enlarged glomeruli in WT animals, but these lesions were significantly less important in CalpTG mice (D, **p < 0.01, n = 10/group, magnification ×200). Fibrosis quantification was assessed by sirius red morphometry under polarized light, revealing that at 2 years, interstitial fibrosis surface was reduced in CalpTG mice when compared to aged WT (E–G, ***p < 0.001, n = 10/group, magnification ×200). Beta-galactosidase activity, a marker of senescence was dramatically reduced at 2 years in CalpTG mice (H–J, *p < 0.05, n = 5/group, magnification ×200). p21, another classical marker of senescence was also less expressed in CalpTG animals at 2 years (K, *p < 0.05, n = 6/group). Kim-1, a marker of tubular injury increased significantly with aging only in WT mice (L, **p < 0.01, n = 6/group). Telomere shortening was significantly more important in WT mice at 2 years in comparison to CalpTG animals (M, **p < 0.01, n = 10/group). The protection of telomeres in CalpTG mice could not be ascribed to increased telomerase activity (N, n = 8/group).
|
study
| 100.0 |
CalpTG mice had a reduced beta-galactosidase activity, a marker of senescence in response to oxidative stress, in tubular cells at 2 years (Fig. 2H–J, p = 0.031). The expression of p21, another marker of senescence was also reduced in aged CalpTG mice (Fig. 2K, p = 0.01). Kim-1 expression, a marker of tubular injury was significantly increased with aging in WT mice but not in CalpTG mice kidney cortex (Fig. 2L, p = 0.0043).
|
study
| 100.0 |
The telomere lenght was also preserved in aged CalpTG mice in comparison to aged WT animals (Fig. 2M, p = 0.007). This could not be ascribed to an increased telomerase activity (Fig. 2N). To assess whether calpastatin transgene could by itself protect against replicative senescence, a culture of tubular cells from CalpTG and WT mice kidneys has been performed during 5 months. There was no difference in telomere length shortening or p21 expression in vitro, evidencing that the differences of telomere shortening observed in vivo result from cellular interactions with the environment, e.g. oxydative stress (Fig. 3A,B).Figure 3Calpastatin overexpression in tubular cells in vitro does not protect against aging. Prominin 1 positive proximal tubular cells have been isolated by flow cytometry and cultured during 5 months. After 12 passages, telomere lenght decreased similarly in cells from WT and CalpTG (TG) mice (A, n = 3). In addition, after 6 passages, a similar proportion of WT and CalpTG cells expressed p21, a classical marker of senescence (B, n = 3).
|
study
| 100.0 |
Calpastatin overexpression in tubular cells in vitro does not protect against aging. Prominin 1 positive proximal tubular cells have been isolated by flow cytometry and cultured during 5 months. After 12 passages, telomere lenght decreased similarly in cells from WT and CalpTG (TG) mice (A, n = 3). In addition, after 6 passages, a similar proportion of WT and CalpTG cells expressed p21, a classical marker of senescence (B, n = 3).
|
study
| 100.0 |
Aging was associated with the medial wall thickening of renal interlobar arteries, that was in a large part prevented in CalpTG mice (Fig. 4A,B,E, p = 0.0015). Similarly, aorta medial wall surface was less increased with aging in CalpTG mice, in contrast with WT mice (Fig. 4C,D,F, p = 0.0011). CalpTG mice were also protected against the heart remodelling that occurs with aging (Fig. 4G, p = 0.015). The modifications in heart weight were actually due to cardiomyocyte hypertrophy since morphometric analyses evidenced that the number of cardiomyocyte nuclei/surface decreased with aging, but to a lower extent in CalpTG mice (Fig. 4H, p = 0.0002).Figure 4Calpastatin overexpression protects against cardiovascular aging. Mean media surface of interlobar arteries was significantly less increased in CalpTG (TG) mice at 2 years in comparison to WT mice (A,B,E, **p < 0.01, n = 10/group, magnification ×400). Similarly, aorta remodelling was less important in CalpTG mice (C,D,F, **p < 0.01, n = 10/group, magnification ×200). Heart weight increased with aging but less in CalpTG mice than in WT animals (G, *p < 0.05, n = 10/group). This increase in heart weight was due to cellular hypertrophy since the number of nuclei per field at 400x magnification was significantly lower in WT in comparison to CalpTG mice (H, ***p < 0.001, n = 5/group).
|
study
| 100.0 |
Calpastatin overexpression protects against cardiovascular aging. Mean media surface of interlobar arteries was significantly less increased in CalpTG (TG) mice at 2 years in comparison to WT mice (A,B,E, **p < 0.01, n = 10/group, magnification ×400). Similarly, aorta remodelling was less important in CalpTG mice (C,D,F, **p < 0.01, n = 10/group, magnification ×200). Heart weight increased with aging but less in CalpTG mice than in WT animals (G, *p < 0.05, n = 10/group). This increase in heart weight was due to cellular hypertrophy since the number of nuclei per field at 400x magnification was significantly lower in WT in comparison to CalpTG mice (H, ***p < 0.001, n = 5/group).
|
study
| 100.0 |
To analyse whether calpastatin protection against cardiovascular remodelling or even kidney lesions would result from changes in hemodynamics, a specific set of invasive experiments has been performed in one-year old CalpTG and WT mice (Fig. 5). We did not observe any change in arterial blood pressure, renal blood flow or measured glomerular filtration rate at one year (Fig. 5A–C). One year-old CalpTG mice heart weight was 135 ± 9 mg whereas WT mice heart weight was 159 ± 9 mg (n = 7/group, p = 0.05), suggesting that cardiovascular remodelling was ongoing at this time (Fig. 5D).Figure 5Calpastatin overexpression does not impact hemodynamic or renal blood flow. At one year, blood pressure, renal blood flow and glomerular filtration rate (GFR) were similar in CalpTG (TG) and WT mice, evidencing that calpastatin does not protect kidney through hemodynamic improvement (A–C, n = 6–10/group). Although hemodynamic features were similar, there was a trend toward lower heart mass in CalpTG (TG) mice at one year (D, p = 0.05, n = 7/group).
|
study
| 100.0 |
Calpastatin overexpression does not impact hemodynamic or renal blood flow. At one year, blood pressure, renal blood flow and glomerular filtration rate (GFR) were similar in CalpTG (TG) and WT mice, evidencing that calpastatin does not protect kidney through hemodynamic improvement (A–C, n = 6–10/group). Although hemodynamic features were similar, there was a trend toward lower heart mass in CalpTG (TG) mice at one year (D, p = 0.05, n = 7/group).
|
study
| 100.0 |
The difference between CalpTG and WT mice in skin phenotype was evident at two years (Fig. 6A,B). There were less lipofuscine deposits, a classical feature of skin aging, in CalpTG mice at 2 years than in WT animals (Fig. 6C–F). In addition, telomere shortening with aging was significant in WT mice but not in CalpTG mice (Fig. 6G, p = 0.0047).Figure 6Calpastatin overexpression protects against skin aging. At 2 years, CalpTG (TG) mice (B) were phenotypically less impacted by aging than WT mice bred in the same conditions (A). There was a macroscopic evidence that CalpTG (TG) mice fur was less affected by aging than WT mice. In addition, we observed less lipofuscin deposits in the skin after hematoxylin eosin staining (C,D, white arrow, magnification ×200) or by using lipofuscine autofluorescent properties (E,F, white arrow, magnification ×200). Moreover, telomere lenght decreased significantly in WT mice skin but not in CalpTG skin (G, **p < 0.01, n = 10/group).
|
study
| 100.0 |
Calpastatin overexpression protects against skin aging. At 2 years, CalpTG (TG) mice (B) were phenotypically less impacted by aging than WT mice bred in the same conditions (A). There was a macroscopic evidence that CalpTG (TG) mice fur was less affected by aging than WT mice. In addition, we observed less lipofuscin deposits in the skin after hematoxylin eosin staining (C,D, white arrow, magnification ×200) or by using lipofuscine autofluorescent properties (E,F, white arrow, magnification ×200). Moreover, telomere lenght decreased significantly in WT mice skin but not in CalpTG skin (G, **p < 0.01, n = 10/group).
|
study
| 100.0 |
Astrocyte process lenght decreases in aged mice brain, especially in the hippocampus CA1 area. CalpTG mice had a relatively preserved mean astrocytic process lenght at 2 years when compared to aged WT mice, confirming the deleterious role of calpains in brain aging (Fig. 7A–E, p = 0.016). We also addressed whether brain blood barrier function would be protected in CalpTG mice by assessment of MECA-32 staining in hippocampus subdivisions, but we did not evidence significant differences between the different groups (not shown).Figure 7Calpastatin overexpression protects against brain aging. The mean astrocytic lenght decreases with aging in the CA1 area of the hippocampus. This lenght was similar in 2-months old (2 mo) animals (A,B,E, magnification ×600). Aged CalpTG (TG) mice were less affected by this decrease than 2 years (2 yr) old WT mice (C,D,E, *p < 0.05, n = 6/group, magnification ×600).
|
study
| 100.0 |
Calpastatin overexpression protects against brain aging. The mean astrocytic lenght decreases with aging in the CA1 area of the hippocampus. This lenght was similar in 2-months old (2 mo) animals (A,B,E, magnification ×600). Aged CalpTG (TG) mice were less affected by this decrease than 2 years (2 yr) old WT mice (C,D,E, *p < 0.05, n = 6/group, magnification ×600).
|
study
| 100.0 |
Although CalpTG mice exhibited less aging-related features, the lifespan was not extended in this group (Fig. 8A). Most of CalpTG mice died with an abdominal distension and autopsies revealed voluminous spleens compressing abdominal organs.Figure 8Calpastatin overexpression is associated to an increased frequency of spleen tumors. Most of CalpTG (TG) mice died with an abdominal distension due to a massive splenomegaly, there was no difference of survival rate between WT and CalpTG mice (A, n = 25/group). Among the 10 CalpTG mice sacrificed at 2 years, 7 had an apparently normal spleen but 3 were affected by splenic tumors, compressing abdominal organs (B). Aged WT mice spleens had a classical follicular architecture and white pulp containing regular lymphocytes (C, magnification ×50). Splenic architecture was disrupted in CalpTG tumoral spleens, white pulp could not be differentiated from red pulp (D, magnification ×50) and fibrosis was evident in the most severe cases (E, magnification ×50). Erythroblastic hyperplasia with evidence of dyserythropoiesis (*), and compact megacaryocytes clusters with nuclear atypia (arrows) were typical features of abnormal myeloid intrasplenic proliferation (F, magnification ×200). The partial loss of factor VIII expression by megacaryocytes (arrow) among clusters confirmed the myelodysplasic syndrome (G, magnification ×400).
|
study
| 100.0 |
Calpastatin overexpression is associated to an increased frequency of spleen tumors. Most of CalpTG (TG) mice died with an abdominal distension due to a massive splenomegaly, there was no difference of survival rate between WT and CalpTG mice (A, n = 25/group). Among the 10 CalpTG mice sacrificed at 2 years, 7 had an apparently normal spleen but 3 were affected by splenic tumors, compressing abdominal organs (B). Aged WT mice spleens had a classical follicular architecture and white pulp containing regular lymphocytes (C, magnification ×50). Splenic architecture was disrupted in CalpTG tumoral spleens, white pulp could not be differentiated from red pulp (D, magnification ×50) and fibrosis was evident in the most severe cases (E, magnification ×50). Erythroblastic hyperplasia with evidence of dyserythropoiesis (*), and compact megacaryocytes clusters with nuclear atypia (arrows) were typical features of abnormal myeloid intrasplenic proliferation (F, magnification ×200). The partial loss of factor VIII expression by megacaryocytes (arrow) among clusters confirmed the myelodysplasic syndrome (G, magnification ×400).
|
study
| 100.0 |
Among the 10 CalpTG mice sacrificed at two years to assess aging-related lesions, three had a massive tumoral spleen (Fig. 8B). Histopathological analyses of these tumoral spleens revealed myeloid cell proliferation. Aged WT mice spleens had a preserved follicular architecture and white pulp containing regular lymphocytes, without fibrosis (Fig. 8C). Splenic architecture was disrupted in CalpTG tumoral spleens, white pulp disappeared among red pulp (Fig. 8D) and expansive eosinophilic fibrosis was observed in the most severe cases (Fig. 8E). Erythroblastic hyperplasia with dyserythropoiesis features, and compact megacaryocytes clusters with nuclear atypia evidenced abnormal myeloid intrasplenic proliferation (Fig. 8F). The partial loss of factor VIII expression by megacaryocytes was an hallmark of myelodysplasic syndrome (Fig. 8G). No blastic proliferation has been observed.
|
study
| 100.0 |
In order to identify the main pathways involved in aging-related lesions, high throughput RNA analyses (RNA-Seq) have been in performed in WT and CalpTG mice renal cortex. Differential expression analysis and pathways analysis revealed that most of differentially expressed pathways were related to immune cell response and that many cytokines involved in innate immunity and particularly in inflammasome activation were differentially regulated between the 2 groups (Fig. 9A,B).Figure 9Genes differentially expressed in aged WT and CalpTG mice are related to inflammatory pathways. Heatmap representation of genes differentially expressed between old WT and CalpTG (TG) mice. Eighty-two renal-expressed transcripts have been found significantly differentially expressed between groups. Corresponding genes were represented using the Pheatmap R package, unsupervised clustering, Manhattan method (A, n = 6/group). Kegg and biocarta pathways found significantly enriched when comparing old WT and CalpTG mice (B). Pathways are immune related suggesting that large parts of difference observed are associated with inflammaging-related genes.
|
study
| 100.0 |
Genes differentially expressed in aged WT and CalpTG mice are related to inflammatory pathways. Heatmap representation of genes differentially expressed between old WT and CalpTG (TG) mice. Eighty-two renal-expressed transcripts have been found significantly differentially expressed between groups. Corresponding genes were represented using the Pheatmap R package, unsupervised clustering, Manhattan method (A, n = 6/group). Kegg and biocarta pathways found significantly enriched when comparing old WT and CalpTG mice (B). Pathways are immune related suggesting that large parts of difference observed are associated with inflammaging-related genes.
|
study
| 100.0 |
According to RNA-Seq results, further analyses were conducted to compare immune cell infiltrate and cytokine expression in WT and CalpTG mice. Immunohistochemistry evidenced that macrophage infiltration of the renal tissue increased with aging in WT mice but not in TG mice (Fig. 10A–C, p = 0.028). Since immune cell infiltrate was heterogeneous, tissue flow cytometry experiments have been performed in another set of aged and young CalpTG and WT mice to count immune cells and to identify whether macrophages polarization would be influenced by calpains. The proportion of CD45+ immune cells/prominin 1+ proximal tubular cells increased significantly with aging in WT mice but not in CalpTG mice (Fig. 10D–F, p < 0.05). The number of macrophages and lymphocytes infiltrating kidney tissue was significantly increased with aging in WT mice only (Fig. 10G,H, p < 0.05). The proportion of CD11c positive (M1) macrophages was similar in both groups, suggesting that calpain inhibition did not modify macrophages polarization (Fig. 10I,J). The proportion of M2 macrophages (CD206+) was too low to be quantified appropriately (not shown). At last, we confirmed that the expression of cytokines related to inflammasome activation and the main alarmins IL1-α or IL-1β increased with aging in kidneys of WT but not CalpTG mice (Fig. 10K,L, p < 0.05).Figure 10Calpastatin overexpression protects against kidney inflammaging. Kidney infiltration by F4/80+ macrophages was assessed first by immunohistochemistry, evidencing a significant increase with aging in WT mice only (A–C, *p < 0.05, n = 8/group, magnification ×400). To improve immune cell quantification, tissue flow cytometry has been performed in another set of experiments to assess the CD45+ (immune cells)/prominin1+ (proximal tubular cells) ratio, evidencing that immune cell infiltrate increased significantly in WT mice only (D–F, *p < 0.05, n = 4–6/group). The proportion of macrophages, including M1 CD11+ macrophages, and lymphocytes was significantly increased in old WT mice kidneys only (G,H,I *p < 0.05, n = 4–6/group). Nevertheless, the proportion of M1 macrophages was similar in both WT and CalpTG kidneys (J, n = 4–6/group). Il-1α expression was very faint in kidney tissue but significantly higher at 2 years in WT mice kidneys when compared to young mice kidneys (K, *p < 0.05, n = 6/group). Il-1β was quantitatively more expressed but its expression differed significantly only between aged WT and young CalpTG (TG) (L, *p < 0.05, n = 6/group).
|
study
| 100.0 |
Calpastatin overexpression protects against kidney inflammaging. Kidney infiltration by F4/80+ macrophages was assessed first by immunohistochemistry, evidencing a significant increase with aging in WT mice only (A–C, *p < 0.05, n = 8/group, magnification ×400). To improve immune cell quantification, tissue flow cytometry has been performed in another set of experiments to assess the CD45+ (immune cells)/prominin1+ (proximal tubular cells) ratio, evidencing that immune cell infiltrate increased significantly in WT mice only (D–F, *p < 0.05, n = 4–6/group). The proportion of macrophages, including M1 CD11+ macrophages, and lymphocytes was significantly increased in old WT mice kidneys only (G,H,I *p < 0.05, n = 4–6/group). Nevertheless, the proportion of M1 macrophages was similar in both WT and CalpTG kidneys (J, n = 4–6/group). Il-1α expression was very faint in kidney tissue but significantly higher at 2 years in WT mice kidneys when compared to young mice kidneys (K, *p < 0.05, n = 6/group). Il-1β was quantitatively more expressed but its expression differed significantly only between aged WT and young CalpTG (TG) (L, *p < 0.05, n = 6/group).
|
study
| 100.0 |
To assess whether calpain inhibition would affect the synthesis of IL-1α and IL-1β alarmins, the two main cytokines related to NLRP3 inflammasome activation and inflammaging, complementary analyses were conducted in vitro and in vivo. First, bone-marrow derived macrophages were isolated. We observed that the synthesis of IL-1α and IL-1 β at the mRNA level was globally reduced by calpastatin in response to all inflammasome activators tested (Fig. 11A,B, p = 0.01 and p = 0.05 respectively, ANOVA). Specific calpain inhibition decreased IL-1β concentration in the extracellular milieu in reponse to both particulate and non-particulate inflammasome activators (Fig. 11D, p = 0.003, ANOVA). Of notice, IL-α synthesis was also decreased by calpain inhibition but specifically after macrophage exposure to sodium urate and silica crystals, particulate activators of inflammasome (Fig. 11C, p = 0.008). In addition, we assessed IL-α and IL-1β synthesis at an early phase in a monosodium urate (MSU) peritonitis model. CalpTG mice had lower expression of both IL-1α and IL-1β cytokines, consistent with the in vitro experiments and in vivo observations in aged mice (Fig. 11E,F, p = 0.008).Figure 11Calpastatin overexpression inhibits IL-1α and Il-1β synthesis in vitro and in vivo. In vitro, macrophages isolated from WT and CalpTG (TG) mice bones have been exposed to sodium urate crystals (MSU), Silica crystals (Si.), Adenosine TriPhosphate (ATP) or Nigericin (Niger.), with or without priming by Lipopolysaccharides (LPS). IL-1α and IL-1β expression at the mRNA level was globally reduced (ANOVA) by calpastatin overexpression (A,B, n = 4/condition). Similarly, IL-1α and IL-1β cytokine production by macrophages was also globally reduced by calpastatin overexpression, especially IL-1α synthesis after exposure to particulate inflammasome activators MSU and Si. (C,D, *p < 0.05, **p < 0.01 (post test), n = 4/condition). In vivo, MSU crystals have been injected to WT and CalpTG (TG) mice intraperitonally. IL-1α and IL-1β cytokines have been measured early (3 hours) in the peritoneal fluid, their synthesis was dramatically reduced in CalpTG mice (E,F, **p < 0.01, n = 5/group).
|
study
| 100.0 |
Calpastatin overexpression inhibits IL-1α and Il-1β synthesis in vitro and in vivo. In vitro, macrophages isolated from WT and CalpTG (TG) mice bones have been exposed to sodium urate crystals (MSU), Silica crystals (Si.), Adenosine TriPhosphate (ATP) or Nigericin (Niger.), with or without priming by Lipopolysaccharides (LPS). IL-1α and IL-1β expression at the mRNA level was globally reduced (ANOVA) by calpastatin overexpression (A,B, n = 4/condition). Similarly, IL-1α and IL-1β cytokine production by macrophages was also globally reduced by calpastatin overexpression, especially IL-1α synthesis after exposure to particulate inflammasome activators MSU and Si. (C,D, *p < 0.05, **p < 0.01 (post test), n = 4/condition). In vivo, MSU crystals have been injected to WT and CalpTG (TG) mice intraperitonally. IL-1α and IL-1β cytokines have been measured early (3 hours) in the peritoneal fluid, their synthesis was dramatically reduced in CalpTG mice (E,F, **p < 0.01, n = 5/group).
|
study
| 100.0 |
The specific inhibition of calpains by calpastatin overexpression protected CalpTG mice against aging-related lesions, especially vascular and kidney lesions. Calpain inhibition reduced kidney inflammaging as evidenced by RNAseq analyses, tissular flow cytometry, immunohistochemistry and complementary in vitro and in vivo models. To our knowledge, this study is the first to identify calpains as a potent inflammaging mediator.
|
study
| 100.0 |
A protective role of calpain inhibition against aging-related processes has been previously demonstrated previously in neurological disorders. Actually, synthetic calpain inhibitors improved memory and synaptic transmission in a mouse model of Alzheimer disease, and specific calpain inhibition by calpastatin prevented neurodegeneration and restored normal lifespan in tau P301L mice, possibly by limiting the toxic forms of tau18, 19.
|
study
| 99.2 |
We have previously demonstrated that specific calpain inhibition reduced inflammation, cardiovascular and kidney lesions induced by angiotensin II infusion10. CalpTG mice had a reduced response to angiotensin II signalling and impaired NF-κB activation in kidney and heart tissue10. Scalia et al. evidenced that calpains are involved in the endothelial adhesion molecule expression in response to angiotensin II/AT1R signalling through the degradation of I-κB and, hence, the upregulation of NF-κB20. Furthermore, a pivotal role for calpains in mediating angiotensin II-induced atherosclerosis has been demonstrated21. Overexpression of calpastatin in bone marrow-derived cells attenuated significantly angiotensin-II induced inflammation and suppressed macrophage migration and adhesion properties. These studies evidence that the renin angiotensin system (RAS) promotes kidney and vascular lesions through a calpain dependent mobilisation of inflammatory cells, independently from alteration of blood pressure22.
|
study
| 99.94 |
During the past years, several lines of evidence argued for an important role of RAS and especially angiotensin II in the development of aging lesions, especially in kidney and arteries12. Genetic disruption of the AT1a receptor prevented aging-related progression of cardiac hypertrophy and fibrosis, and extended mouse lifespan23. To a lesser extent, RAS pharmacological inhibition was also able to protect against aging related lesions in murine models24, 25. Interestingly, we observed that calpain inhibition decreased features of aging particularly in the kidney and the cardiovascular system. Specific calpain inhibition was associated to less cardiovascular hypertrophy and remodelling already present at one year, independently from changes in hemodynamic features and blood pressure at that time. Kidneys from CalpTG mice exhibited less fibrosis and less glomerular lesions. Senescence markers including p21 and beta-galactosidase activity were dramatically lower in CalpTG mice cells, indicating that oxidative stress was reduced. Genome-wide gene expression analyses in 2-years old mice highlighted that inflammation-related pathways differed dramatically between the 2 groups, particularly transcripts of genes involved in innate immunity, NLRP3 inflammasome formation and NF-κB activation. We confirmed that immune cell and especially macrophage infiltration was reduced in CalpTG mice kidneys. There was no difference in M1/M2 polarization, suggesting that inflammatory cell recruitment was influenced by the calpain system but not macrophage polarization.
|
study
| 100.0 |
We have previously described that CalpTG mice were protected against inflammation in models of glomerulonephritis, sepsis or allograft rejection but this is the first demonstration that blunting calpain activity protects against inflammaging2, 3, 11. Interestingly, calpain-induced inflammatory processes and classical inflammaging features share similarities. Inflammaging is characterized by a low grade of chronic and systemic inflammation in aging, in the absence of systemic infection or inflammatory disease15. One of the main mechanisms involved in inflammaging onset is the NLRP3 inflammasome activation by mitochondrial reactive oxygen species. NLRP3 is a multiproteic complex activating caspase 1, IL-1α, IL-1β and IL-18 processing and synthesis26. The synthesis of IL-1α and IL-1β mRNA in response to various NLRP3 inflammasome activators were reduced in CalpTG macrophages. Of notice, the production of IL-1α protein was impacted by calpain inhibition in response to the particulate inflammasome activators (MSU and silica) but much lower in response to ATP or nigericin. This observation is in accordance with the observation by Gross et al. that particulate activators, but not nigericin and ATP, are able to induce IL-1α secretion in a way partly independent of the inflammasome, but involving calcium influx and calpain activation27.
|
study
| 100.0 |
There is a complex feedback loop between senescence and inflammation. The observation that tubular cells isolated from CalpTG mice are not protected against senescence in vitro suggests that calpains promote first inflammation, which then leads to cellular senescence but we cannot rule out that in vivo, senescent cells participate in the vicious circle promoting inflammation. Cellular senescence is characterized by the secretion of proinflammatory cytokines (senescence associated secretory phenotype or SASP) including IL-1α, IL-1β, IL-6 or TNF-alpha. NF-κB regulates the majority of genes that comprise the SASP and NF-κB has been demonstrated to drive aging in brain and to be required to enforce many features of aging in a tissue specific manner28–30. We and other groups have previously evidenced that NF-κB nuclear translocation and activity was reduced in cells and tissues from CalpTG mice10, 22. Here, genome-wide gene expression profiling revealed that cytokines whose synthesis is regulated by NF-κB and that are involved in innate immune response were effectively down-regulated in old CalpTG mice in comparison to old controls.
|
study
| 100.0 |
Although IL-1α is a potent cytokine whose role in kidney lesions and inflammaging is emerging, its expression is much lower than IL-1β expression in vivo and difficult to assess31. The in vivo model of MSU-induced peritonitis allowed to evidence that both IL-1α and IL-1β production was reduced at an early phase in CalpTG mice, suggesting that calpains actually promote IL-1α and IL-1β synthesis in response to cellular stress in vivo.
|
study
| 100.0 |
The main limitation of our study is that despite clearly reduced features of aging in CalpTG mice, lifespan did not significantly differ between the 2 groups. This was due to an increased frequency of spleen tumors in calpTG mice, due to myeloid cell proliferation and fibrosis. We have previously highlighted that calpain inhibition would exert both pro and antitumoral effects in CalpTG mice32. In addition, we have evidenced that splenocytes from CalpTG mice have an increased proliferative response in vitro 11. This is a specific feature of splenocytes since calpain inhibition is usually known to decrease (or have no impact) on cell proliferation1, 5. We demonstrated that calpain inhibition amplifies IL-2 signalling via the stabilization of the IL-2 receptor γ-c common chain, providing an explanation for the proliferation response11. Interestingly, the γ-c common chain is required to activate JAK3 kinase, which has been implicated in the development of meloproliferative disorders33. One may therefore hypothesize that sustained γ-c common chain signalling would in turn promote myeloproliferative disorders. This hypothesis requires further studies including bone marrow analyses.
|
study
| 100.0 |
At last, it would be of interest to determine whether kidney-specific overexpression of calpastatin is sufficient to protect mice against kidney aging or whether its overexpression in immune cells (especially macrophages) is required to limit inflammaging.
|
study
| 94.44 |
As a conclusion, we have evidenced that calpains are a key mediator of inflammaging, especially in the kidney tissue, and that their long-term specific inhibition decreases the impact of aging, markers of senescence and inflammaging mediators. Among the mechanisms involved, SASP-related cytokines production is clearly impacted by calpain inhibition. These results highlight the deleterious role of inflammaging in kidney and vascular lesions occurring with aging.
|
study
| 99.94 |
Studies were conducted in female mice overexpressing rabbit calpastatin (CalpTG) and control mice (WT) on a C57/bl6 background, bred and housed in similar conditions in a pathogen free zone. These mice were created and characterized in our laboratory. All procedures involving mice were conducted in accordance with national guidelines, institutional policies, local ethical committee and Research Ministry. The experimental protocol was approved by the Charles Darwin Ethical committee and validated by the French research Ministry (Authorization number: Ce5/2012/00686.01).
|
study
| 99.9 |
Mice were housed in constant temperature room with a 12 h dark/light cycle and fed ad libitum on standard mouse chow. In a first study, 35 CalpTG and 35 WT mice have been bred and housed together. At two years, 10 mice from each group have been randomized and sacrificed to perform tissue analysis. The 50 other mice were used to perform a survival study. Some of these mice, in the calpTG group, developed distorted abdomen due to splenic lymphoma and were about to die: these animals have been sacrificed in accordance with ethical guidelines but were not excluded from the survival analyses. All other mice participating in the survival study died spontaneously. Ten CalpTG and 10 WT mice bred in similar conditions have been sacrificed at 2 months (“young” groups). In a second step, 10 CalpTG and 10 WT female mice have been bred and housed in similar conditions for one year to perform hemodynamic studies at 12 months. At last, a specific set of 6 CalpTG and 6 WT female mice has been bred together and sacrificed at 2 years to perform kidney flow cytometry tissue analysis, and four 2-months old CalpTG and WT mice have been used as “young” controls.
|
study
| 100.0 |
MSU crystals were prepared with 500 ml of boiling water and 2 g of uric acid (U2625, Sigma Aldrich). pH solution was maintained at 8 by adding NaOH (1 M). Solution was cooled and kept 24 hours during crystals formation. Crystals were filtered in 100 µm sieve before washing in ethanol and warm sterilization. Peritonitis was induced in 8-weeks old WT and CalpTG females by intraperitoneal (I.P.) injection of 3 mg MSU diluted in 0.5 ml PBS. After 3 hours, peritoneal cavity was flushed with 3 ml PBS heparin for 3 mn. Peritoneal fluid was centrifugated at 4 °C and supernatant has been analyzed by ELISA for Interleukine 1 α (Il-1α) and β (Il-1β) (MLA00, MLB00C, R&D systems).
|
study
| 100.0 |
Kidney fragments from WT or CalpTG mouse have been incubated in 1 mg/ml collagenase 1 solution (Gibco, Life technologies) for 3 mn at 37 °C. Tissue was passed in 100 µm and 40 µm sieves to collect renal tubular cells. Cells were grown in a specific medium to promote tubular cells growth and differentiation containing HAM’s F12 and DMEM medium, insulin 5 µg/ml (I1882, Sigma), dexamethasone 5.10−8 M (D8893, Sigma), selenium 60 nM (S913, Sigma), transferrin 5 µg/mL (T1428, Sigma), triiodothyronine 10−9 M (T5516, Sigma), EGF from mouse 10 ng/mL (E4127, Sigma), HEPES 20 mM (15630-056, GIBCO), Glutamine 2 mM (25030024, Gibco), 2% Fetal calf serum (Invitrogen), and 0.5% D-Glucose (Sigma).
|
study
| 100.0 |
Bone marrow cells from tibia, femur and humerus of donor mice (WT or CalpTG) were obtained after bones were flushed with 1 ml of PBS. Cells were passed through 70 µm sieve, treated with ACK and finally incubated for 7 to 10 days at 37 °C in a medium containing HAM’s F12 250 ml, DMEM 250 ml, decomplemented fetal calf serum 10%, glutamine 200 mmol.l−1 and mouse recombinant M-CSF 10 ng.ml−1 (ML 416, R&D systems) to obtain adherent BMDM. BMDM were plated in 96 wells (5.105.ml−1) and primed with 10 ng.ml−1 Lipopolysaccharides (LPS) from Escherichia coli 055:B5 (Sigma-Aldrich) during 3 hours and treated with inflammasome activators for 1 to 6 hours: MSU 300 µg.ml−1 (Invivogen), silica particles 100 µg.ml−1 (Invivogen), ATP 5 mmol.l−1 (Sigma-Aldrich) and Nigericin 5 µmol.l−1 (Invivogen). Il-1α and Il-1β excretions were measured in cell supernatant by ELISA (MLA00, MLB00C, R&D systems). Cells mRNA has been collected using the RNeasy kit (Qiagen) according to manufacturer’s instructions.
|
study
| 100.0 |
Kidneys, heart, aorta, skin and spleen from mice of each group were immersed in AFA and formalin (formaldehyde 4%) solution or snap-frozen. After 24 h in formalin solution, brains have been immersed in 20% sucrose solution for 24 hours and then frozen at −80 °C. Formalin-fixed tissues were embedded in paraffin after conventional processing (alcohol dehydration), and 4-µm thick sections were stained with Masson trichromic solution, hematoxylin-eosin or sirius red in picric acid solution. Heart nuclei were stained with DAPI (Invitrogen, Thermofischer scientific, 1/2000) and cell count/surface was performed to assess myocardic hypertrophy by using an Image J software-based Macro. Perpendicular cross-sections at standardized distance from the renal hilus (0.3 mm) have been performed to measure kidney interlobar arteries media surface. Similarly, four sections of the thoracic descending aorta have been performed to assess the mean media surface for each animal. The number of glomeruli/field, the surface of all glomeruli, and urinary chamber have been measured in 10 renal cortex Masson-stained sections at 200x magnification. For each animal, the mean value has been considered. Kidney fibrosis has been assessed by measuring sirius red-stained surface under polarized light in 10 renal cortex sections at 200x magnification. For each animal, the mean value has been considered. All measures have been performed by using AnalySIS® software.
|
study
| 100.0 |
β-Galactosidase-related staining was performed on 10 µm unfixed kidney sections with Senescence β-Galactosidase Staining Kit accpording to manufacturer’s instructions (Cell signaling technology, #9860). Stained surface has been measured in 8 renal cortex sections at 200x magnification. For each animal, the mean value has been considered. All measures have been performed by using AnalySIS® software.
|
study
| 99.9 |
Four-micrometer-thick sections of paraffin-embedded kidneys were dewaxed, heated in citric acid solution and next incubated with antibodies. After blockade of endogenous peroxidase, sections were immunostained with a rat anti-F4/80 monoclonal antibody (MCA497GA, ABD Serotec, 1/2000). The mean cell count was performed on 10 sections at 400x magnification. Four-micrometer-thick cryostat sections were fixed with acetone for 7 min. After blockade of endogenous peroxidase, sections were stained with a mouse anti-CD3 monoclonal antibody (A0452, Dako, 1/200). The mean cell count was performed on 10 sections at 400x magnification. Immunostaining was revealed by specific Histofin (Nichirei Biosciences) and AEC (k34769, Dako) and counterstaining was performed with hematoxylin QS (Vector). An aqueous mounting media was used (Scytek laboratory).
|
study
| 99.9 |
Brains were cut into 10 µm coronal sections after spotting of hypothalamus. Sections were rehydrated and then heated in pH6 citric acid bath. After blocking and permeabilization with PBS BSA 2% and Triton 0.1%, astrocytes were marked with a rabbit anti-GFAP polyclonal antibody (ab7260, Abcam, 1/2000), and secondary antibody Alexa Fluor 488 goat anti rabbit (A11008, Invitrogen, 1/1000). Nucleus was marked with DAPI (Invitrogen, Thermofischer scientific, 1/2000). Astrocytic process measures were performed on 6 stacks of images of hippocampus CA1 region for each mouse. Each stack was obtained by addition of photos at 600x magnification by using an Olympus ix83 microscope and CellSens Dimension software. Astrocytes morphometry was carried out with Image J software, using the plugin NeuronJ. The mean length of astrocytes processes was calculated for each mouse.
|
study
| 99.94 |
Tubular cells in culture were fixed with frozen methanol and permeabilized with PBS plus BSA 2% and triton 0.5% solution. Cells were marked with a rabbit anti-p21 monoclonal antibody (ab109199, Abcam, 1/200).Secondary antibody was Alexa Fluor 488 goat anti rabbit (A11008, Invitrogen, 1/1000). Nucleus was marked with DAPI (Invitrogen thermofischer scientific, 1/2000).
|
study
| 94.94 |
Proteins from WT and CalpTG tissues were extracted in RIPA lysis buffer and protease inhibitor cocktail (1 µg/ml, Sigma). After homogenization, the lysate was centrifuged at 1000 × g for 1 h and the supernatant was frozen at −80 °C. Protein concentration was measured using the Bradford method. 20 µg of protein was separated by electrophoresis on a Bis-Tris gel 4–12% (Novex, Thermofisher). After proteins were transferred onto PVDF membrane, aspecific sites were blocked in PBS Tween and 5% milk solution before incubation with primary antibody overnight at 4 °C. Membrane was washed, then incubated for one hour with secondary antibody conjugated with peroxidase. ECL (RPN 3222, GE Healthcare life sciences) was applied 5 mn on membrane for chemiluminescent reaction. Reaction was revealed on radiographic films (Films were scanned onGS-800 Calibrated Densitometer) or read in Syngen Pxi imager (Ozyme). Optical densities were measured using the software Image J or with GeneSys software (Ozyme). Primary antibodies used were mouse monoclonal antibody anti-spectrin alpha chain (nonerythroid) (MAB1622, Chemicon Millipore, 1/1000), rabbit polyclonal antibody anti-calpain 1 domain IV, (ab39170, Abcam, 1/4000), rabbit polyclonal antibody anti-calpain 2 amino terminal end domain I (ab 39167, Abcam, 1/2000), rabbit polyclonal antibody anti-GAPDH (G9545, Sigma Aldrich, 1/50000),. Secondary antibodies used were anti mouse IgG antibody (NA931V, GE Healthcare, 1/10 000); anti rabbit IgG F (ab 1) 2 fragment antibody (NA9340V GE Healthcare, 1/4000), goat polyclonal antibody to rabbit Ig Secondary G-H & L (ab 6721, Abcam, 1/5000).
|
study
| 100.0 |
One-year old mice were anesthetized by pentobarbital sodium (50–60 mg/kg body weight intraperitoneally; Nembutal; Abbott, Chicago, IL) and moved to a servo-controlled table kept at 37 °C. The left femoral artery was catheterized for measurement of arterial pressure, and a femoral venous catheter was used for infusion of volume replacement. Bovine serum albumin (4.75 g/dl of saline solution) was infused initially at 50 μl/min to replace surgical losses, and then at 10 μl/min for maintenance. Arterial pressure was measured via a pressure transducer in left femoral artery (Statham P23 DB, Gould, Valley View, OH), and renal blood flow was measured by a flowmeter (0.5 v probe; Transonic systems TS420, Ithaca, NY). To assess GFR, continuous injection of FITC-inulin infusion was performed at 1 mg.ml−1 and urine and blood collections were performed every 15 mn after equilibration. Inulin was measured by fluorometric method. GFR was calculated by measuring renal clearance of inulin over 3 period of time (formula UxV/P, U: urine concentration of inulin, P: plasma concentration of inulin and V: urine output).
|
study
| 100.0 |
Two kidneys from WT and CalpTG, aged and young, mice were dissociated by using a gentleMACS Dissociator (Miltenyi Biotec). Tissue was then passed through a 30 µm sieve. Cells were platted during 30 mn at 4 °C with mouse Fc Block (Miltenyi Biotec). Antibodies were incubated during one hour at +4 °C before analyses with flow cytometry MACSquant analyser (Miltenyi Biotec). Antibodies used were: mouse anti-CD45 PERCP (130-102-469, Miltenyi Biotec), mouse anti-F4/80 PE (130-102-422, Miltenyi Biotec), mouse anti-CD11c APC(17-0114, eBioscience), mouse anti-CD45 vioblue (130-102-430, Miltenyi Biotec), mouse nti-CD3 Violetfluor 450 (75-0032, Tonbo biosciences), mouse anti-Prominin1 APC (130-092-335, Miltenyi Biotec). Results are expressed as ratio of immune cells/tubular cells (prominin1 positive cells), an internal control allowing to quantify immune cells infiltrate in the whole kidney.
|
study
| 100.0 |
mRNA from kidney cortex was extracted using the RNeasy kit (Qiagen) according to manufacturer’s instructions. RNA concentration was measured by using NanoDrop1000 spectrophotometer (ThermoScientific). RNA were reverse transcribed using Maxima First Strand cDNA Synthesis Kit (Thermoscientific) and PCR was performed using SYBR green and specific primers on a light cycler 480 (Roche). Expression levels were normalized to the house keeping gene GusB (beta-glucuronidase) or 18 S using lightcycler advanced relative quantification program (Roche). Primers used were from eurogentec: Rabbit Cast s: AGCCAGCAAGTCGCTCAG and as: CCATCTCTTTGCTGATTGGAA, mouse Cast s: TCGCAAGTTGGTGGTACAAG and as: CTCCCCAAACTTGCTGCTT, mouse Calpn1 s: AGTGGAAAGGACCCTGGAGT and as: TCTCGTTCATAGGGGTCCAC, mouse Calpn2 s: TGGCTTCGGCATCTATGAG and as: AAGTTTTTGCCGAGGTGGAT, mouse IL1 alpha s: TTGGTTAAATGACCTGCAACA and as: GAGCGCTCACGAACAGTTG, mouse IL1 beta s: TGTAATGAAAGACGGCACACC and as: TCTTCTTTGGGTATTGCTTGG, mouse p21 var1/2 s: TGCGCTTGGAGTGATAGAAA and as: AACATCTCAGGGCCGAAA, mouse Gusb s: CTCTGGTGGCCTTACCTGAT and as: CAGTTGTTGTCACCTTCACCTC, mouse 18 S s: AAGCATTCTGAAATTGGCTCA and as: GTCTCAATCCAGAATGATCAGGT.
|
study
| 99.94 |
Genomic DNA was extracted from 25 mg renal cortex, skin, heart or tubular cells on column DNeasy blood and tissue kit (Qiagen). DNA quality was verified on Nanodrop 1000 (ThermoScientific). Amplification of genomic telomeres present in DNA was realized in a Light Cycler 480 (Roche) using SYBR green and 2.5 pmol of each specific probe: s CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT, as GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT, or of a domestic gene, here 36B4 s ACTGGTCTAGGACCCGAGAAG, as TCCCACCTTGTCTCCAGTCT. Denaturation of 5 mn at 95 °C was followed by 30 cycles of development for heart and kidney extracts or 35 cycles for skin extracts. Every cycle consisted of 3 stages (denaturation 15 seconds in 95 °C, hybridization 20 seconds in 52 °C for telomeres or 56 °C for 36B4, strain 15 seconds in 72 °C). Fluorescence was measured at the end of every cycle. After an exponential phase, obtaining of a tray at the end of PCR allowed to calculate a cycle threshold (Ct) for every target DNA, reflection of their initial quantity. Finally, the specificity of PCR product was verified thanks to the curve of fusion realized at the end of PCR. Telomerase activity in kidney was performed with the Telotaggg PCR ELISA kit according to manufacturer’s instructions (12209136001, Roche).
|
study
| 100.0 |
RNA samples from kidney cortex coming from either old C57BL6J (n = 6) or Calpastatin transgenic (CalpTG) mice (n = 6) of high quality (RNA Integrity Number >6) were processed to create mRNA libraries using TrueSeq reagents (Illumina, san diego, California). Clusters were created for Illumina RNA-Sequencing using a CBot system and sequencing was carried out on 2 lanes of HiSeq. 2000 to produce paired-end reads (75 bases length, 29 to 35 millions of reads per sample) and organized per lane to avoid sequencing batch effects. After demultiplexing, bare-coding removal, quality control, paired-end reads were processed from Fastq Sanger format to compact-reads format and then align with STAR (default parameters) to the mouse reference genome (mGC37/mm9). Data alignment and analysis were performed using the GobyWeb interface using Ensembl version 55. Differential expression was computed using the EdgeR package from bioconductor. Data were also examined visually in the Integrative Genomic Viewer (http://www.broadinstitute.org/igv/) respective of Ensembl Annotation (Ensembl version 55) (Anders et al., 2013; Dorff et al., 2013; Robinson et al., 2010). Normalized gene expression level was measured by counts per millions (CPM). Genes that were significantly differentially expressed (DE) between groups (WT vs. CalpT q < 0.05, Edge R P-value adjusted for multiple testing with the Benjamini Hochberg approach) were next selected by their Fold change |LogFC| > 1.2 to build heatmap (R package Pheatmap) and pathway using David 6.8 available at https://david.ncifcrf.gov/home.jsp.
|
study
| 100.0 |
Data are expressed as mean ± SEM. The results were analyzed by non parametric Mann-Whitney and Kruskal-Wallis with Dunn’s multiple comparison test, with the exception of flow cytometry analyses and interleukin-1 dosages which have been analysed by ANOVA and Bonferroni post tests. Results with p < 0.05 were considered statistically significant.
|
study
| 99.94 |
Legionellae are gram-negative, facultative intracellular bacteria that are responsible for sporadic and epidemic outbreaks of atypical community-acquired pneumonia (CAP)1. The clinical presentation is “atypical” in that, in addition to pneumonia, there is often extrapulmonary organ infection and a noted resistance to Beta Lactam antibiotics. The atypical CAP presentation can also occur during infection with other bacterial pathogens such as Chlamydia pneumoniae, Chlamydia psittaci, Mycoplasma pneumoniae, Francisella tularensis and Coxiella burnetii. Accurate attribution of the correct etiologic agent can, therefore, be challenging.
|
other
| 99.9 |
The best-known legionellosis is a severe atypical CAP referred to as Legionnaire’s Disease (LD)12. The first report of LD was among attendees of the bicentennial celebration of the American Legion Auxiliary2 in 1976, where transmission occurred via the hotel air conditioning system. Another, lesser known, legionellosis is Pontiac Fever3 characterized by mild flu-like symptoms without pneumonia. Because legionellae inhabit freshwater ecosystems, they are often found in man-made water systems such as showers, spas, hospital heating systems, cooling towers, ventilation and air conditioning units, and decorative water fountains, which are the usual sources for aerosolization of the organism and subsequent clinical outbreaks. In addition, legionellae are able to form biofilms, and survive and replicate in the soil and within amoeba, which can shield them from environmental disinfectants, creating an even larger public health threat45.
|
review
| 99.8 |
L. pneumophila serogroup 1 (Lp1) is the leading cause of LD, accounting for up to 92% of clinically recognized legionellosis infections in the US and Europe1. Although Lp1 predominates as the cause of LD, it is not found at disproportionately higher rates in the environment than the 16 other Lp serogroups. L. bozemanii serogroups 1 and 2, L. dumoffii, and L. micdadei, account for most of the remaining human infections67. Other species of Legionellae rarely cause disease except for L. longbeachae where high rates of infection and disease have been reported in Australia and New Zealand8. According to the Centers for Disease Control and Prevention (CDC), the number of cases reported rose 217% while the incidence rate of legionellosis in the US increased almost 200% between 2000 and 20099. In 2015, there were 15 outbreaks in the US and Europe with a 10% case fatality rate in addition to the growing number of cases caused by non- Lp species. There is also a recent report of probable person-to-person transmission10. These collective findings drive home the critical need to better characterize legionellae to improve our understanding of their biology and epidemiology to advance the design of strategic interventions.
|
review
| 99.5 |
While sequence-based typing (SBT) has been used for outbreak investigations because of its historically lower cost, whole genome sequencing (WGS) of eight Lp1 and Lp12 strains, in addition to a large number of Lp1 strains linked to geographic outbreaks1112131415161718, has revealed how genetic exchange plays a role in shaping the virulence potential of the species. Genes encoding features such as drug resistance islands, secretion systems and a large repertoire of secreted effector proteins19 are part of the mobile accessory portion of the pan-genome.
|
study
| 100.0 |
These prior WGS studies have analyzed outbreaks within a specific area but none have evaluated the population genomics of all 17 Lp serogroups and the 18 other Legionella species associated with human disease, albeit rarely, to understand their evolutionary strategies. Here, we compared the dynamics of genome change both within Lp and across the Legionella genus. Our genomics analyses encompassed 43 species and serogroups of Legionella, including 33 strains (Lp serogroups 2 through 17, and 17 other Legionella species) sequenced in the present study along with nine Lp1 strains and L. longbeachae that were publically available.
|
study
| 100.0 |
To improve our understanding of evolutionary forces acting on Legionella species, we performed comparative genomic analyses to elucidate population structure and estimate the effects of homologous recombination. The analysis set consisted of 10 published and 33 Legionella genomes sequenced in this study, including Legionella species occasionally reported as etiologic agents of human disease and Lp subtypes 2 through 17 (Table 1). Genomes were assembled using a hybrid assembly of Roche 454 and Illumina in this study where each genome project contained at least 3 million sequencing reads (combined Illumina and 454 sequencing technologies) (Supplementary Table 1).
|
study
| 100.0 |
Contigs from assembled shotgun data were annotated for genes and RNA features using the PROKKA pipeline20. The average number of protein-coding genes across the genus was around 3,200 (Supplementary Table 1). Predicted genes were classified as either core or accessory within the Legionella genus pan-genome using OrthoMCL21. Genus phylogeny of whole genome data was inferred using maximum likelihood (ML) phylogeny of the concatenated progressiveMAUVE alignment22 of 759,392 nucleotides of the 1140 protein-coding genes (Fig. 1), the ML phylogeny of the concatenated alignment of 299,244 amino acid residues of the 1140 translated core genes (Supplementary Figure 1), and a ClonalFrame nucleotide-based phylogenetic analysis23. The latter has the advantage of removing most recombinant regions of the DNA alignment from consideration. All three approaches yielded similar phylogenetic tree topologies from which four clades were defined (Fig. 1): Clade 1 (red) contained only Lp strains, Clade 2 (green) contained eight Legionella species: L. birminghamensis, L. erythra, L. nautarum, L. maceachernii, L. micdadei, L. jordanis, L. jamestowniensis and L. brunensis; Clade 3 (blue) nine Legionella species: L. cincinnatiensis, L. longbeachae NSW150, L. dumoffii, L. cherii, L. wadsworthii, L. bozemanii 1, L. bozemanii 2, L. tucsonensis and L. anisa, and Clade 4 only L. rowbothamii. Lp strains were a monophyletic group based on the whole genome phylogeny (Fig. 2).
|
study
| 100.0 |
Based on the annotations described above, we enumerated the Legionella pan-genome and how accessory genes defined species relationships. We identified 12,977 ortholog gene families in all 43 genomes based on OrthoMCL clustering with a BLASTP identity cutoff of 10−5. Supplementary Figure 2A shows the barplot listing the number of gene clusters found in each genome. There were 1140 core gene families in all 43 genomes, representing the core genes in Legionella species, which were used in downstream phylogenetic, recombination and positive selection analyses.
|
study
| 100.0 |
The pan-genome rarefaction curve did not level out, indicating the pan-genome is “open” (i.e., not fully sampled) for the 19 Legionella, species (Supplementary Figure 2B). The Heaps law parameter α, a measure of the rate of novel information discovery24, was estimated to be 0.63. Values of α greater than 1 suggest a closed pan-genome. Using the matrix of gene family distribution across Legionella, we fitted a binomial mixture model implemented by the binomixEstimate function in the micropan R package25. This function estimated a series of mixture models with increasing complexity and used the Bayesian Information Criterion (BIC), estimating the optimum Legionella pan-genome size to be 30,275 genes (Supplementary Figure 2C).
|
study
| 100.0 |
To investigate patterns of shared gene content, we ran a principal component analysis (PCA) on the gene family distribution matrix using the panpca function (micropan R package). Around 34% of the total variation among the genomes was seen along the 2 principal components (Supplementary Figure 3). Genomes in the same clade formed non-overlapping groups. Species that formed clades (based on relatedness of core genome nucleotide sequences) were also more similar to each other in families of accessory genes.
|
study
| 100.0 |
We assigned functions to representative members of each family through BLASTX alignment to the BLAST2GO database26. Following the common trend in bacterial species pan-genomes, most core gene families mapped to a Gene Ontology (GO) category. Most of the accessory genes, however, could not be assigned with the exception of genes responsible for horizontal gene transfer (HGT) (e.g., transposition) and signal transduction (Supplementary Table 2a,b).
|
study
| 100.0 |
There were 1160 Clade 1 specific genes (Supplementary Table 3a), 3078 Clade 2 specific genes (Supplementary Table 3b), 2452 Clade 3 specific genes (Supplementary Table 3c), and 507 Clade 4 specific genes (Supplementary Table 3d). The tetracycline destructase gene was found in two Clade 2 species (L. jordanis and L. nautarum) and in Clade 3 species L. longbeachae but not in the other two clades.
|
study
| 100.0 |
Legionella systems for secreting effector proteins into the host cell environment are a key factor in intracellular survival and virulence827. Confirming and extending a previous finding8, we identified that the Dot/Icm type IVB secretion system (T4BSS) and Lsp type II secretion system (T2SS) belonged to the core genome of all Legionella species. However, we found that Legionella species are variable in their type IVA secretion systems (T4ASS) as they were present in different species except for the P-type, which was present in all species and codes for conjugative pili required for mating828 (Table 1). The F-type T4ASS also codes for pili but was missing from genomes Lp2, Lp3, Lp6 and L. cherii while the Lvh (Legionella virB homologue) T4ASS, which is involved in spread of infection from environmental niches828, was identified in only 10 Legionella genomes: 6 genomes from Clade 1; and 2 from Clade 3 (L. bozemanii serogroup 2 and L. dumoffii) (Table 1). Interestingly, Lp3 and Lp6 had Lvh T4ASS but not the F-type T4ASS in their genomes. Recently identified Genomic Islands (GI) T4SS (GI-T4SS), GI-T4SS-1 and GI-T4SS-2, which were found in Lp 130b and recognized to be involved in host adaptation29, were identified across Lp serogroups; 2 clusters each were present in Lp6, Lp11, Lp12, and Lp16 while a single cluster was present in Lp3, Lp7 Lp10, and Lp17 (Table 1). A single cluster of GI-T4SS (GI-T4SS-1) was also identified in non-Lp species L. cherii and L. dumoffii, both in Clade 3.
|
study
| 100.0 |
Because these data were from draft genome assemblies, we could not identify plasmid contigs with certainty. We looked for nine previously identified Legionella species plasmids available in GenBank (accessed 12/29/2016) in our genomes. L. dumoffii (Clade 3) and L. jamestowniensis (Clade 2), carry the Lp Lorraine plasmid pLELO (GI Accession: NC_018141) with 100% identity. Similarly, Lp13 and Lp5 had the Lp Lens plasmid pLPL. We also found partial matches to several other Legionella plasmids in 25 genomes (BLASTN identity >95%), suggesting that other strains contain plasmid genes.
|
study
| 100.0 |
We tested for clade-specific signatures of positive selection using PAML30, and identified 10 core genes (FDR p-value < 0.05) in Clade 1 compared to the other clades. These genes had no known relationship to Legionella virulence or interactions with each other based on searching the STRING database31. Clade 2 had the highest number of genes under positive selection (362 genes) followed by Clade 3 (170 genes) (Supplementary Table 4a,c,e). Eight genes total were under positive selection in all 3 clades sans Clade 4. Ninety-seven core genes showed evidence of positive selection in both Clades 2 and 3. T4SS protein IcmL was under positive selection in both Clades 2 and 3, while IcmC and IcmG were under positive selection only in Clade 3. Similarly, the T2SS protein LspJ was under selection only in Clade 3, while LspD was under selection only in Clade 2. There were 272 and 78 clade-specific core genes under selection in Clades 2 and 3, respectively.
|
study
| 100.0 |
Results of GO enrichment analysis of genes identified as under positive selection are shown in Supplementary Table 4b,d,f). Additionally, we performed GO enrichment analysis on genes estimated to be gained or lost on the terminal branches of each clade32 (Supplementary Table 5a–d). As expected most of the enriched GO terms mapped to functions associated with horizontally transferred elements such as CRISPRs (Clustered Regularly Interspaced Short Palindromic Repeats).
|
study
| 100.0 |
CRISPRs offer an alternative view on foreign DNA entering Legionella than the pan-genome estimated by comparative genomics. CRISPRs are bacterial adaptive immune systems for protection against DNA from non-hosts such as infecting phage33. They consist of cas genes and adjacent tandem arrays of short spacer DNA originating from the target organism. Cas-RNA spacer complexes destroy non-host DNA via specific binding. CRISPR spacer arrays are effectively a sampling of recently introduced foreign DNA. CRISPRs were previously identified in Lp Alcoy and Paris genomes15. Here, we identified another 22 ‘typical’ CRISPR sequences with at least two spacers in 13 Legionella genomes using CRISPRfinder34 (Supplementary Table 6). Some genomes had multiple CRISPR sequences: three were identified in Lp13 and Lp14, and two in Lp5, Lp7, and Lp11 (Supplementary Table 6; Supplementary Data 1). Lp5 had a CRISPR array with the highest number of spacers at 70. We also discovered questionable/putative CRISPRs that had one or few spacers (Supplementary Table 6; Supplementary Data 1). A CRISPR database search revealed the presence of four types of putative CRISPR-associated proteins: Cas large protein; Cas3; Cas1; and RAMP Csd1 family protein. Spacer sequences were specific for each strain. Of 555 spacer sequences in the Legionella genomes, 38 overlapped based on DNA sequence identity using the dnaclust tool35. Surprisingly, only 42/555 (7.6%) of the spacers were found to match a Legionella protein in the pan-genome database constructed using BLASTX with percent identity over the alignment length of >90%. Recently, Rao et al.36 identified 440 spacers in the L. pneumophila CRISPR-cas system, experimentally identifying the first known target of this system: a 30 kilobase episome (LME-1) of unknown function where interbacterial transfer is guarded against by CRISPR-Cas. Out of the 440 spacers identified, 277 spacers, of which 185 were unique, had exact matches with the 555 spacers identified in the present study. LME-1 was identified only in the Lp7 genome. These results suggest that a larger pool of foreign DNA infects Legionella than is reflected in the pan-genome, which counts only genes stably integrated into the genome.
|
study
| 100.0 |
Bacterial species are diverse in population structure, some being quite clonal (e.g., Mycobacterium tuberculosis)37 while others show high levels of recombination (e.g., Neisseria gonorrhoeae and Legionella spp.)141623. Recombination in a bacterial species is predicted to result in linkage disequilibrium, decaying as the distance between loci in the genome increases38. Similar to the acquisition of accessory genes by HGT, homologous recombination is potentially a way for bacterial species to share fitness gains under environmental selection pressure39. We measured linkage disequilibrium between alleles of core genes in the genus and found strong linkage up to ~20 kb, which tailed off to background levels after 100 kb (Fig. 3a,b). Levels of linkage disequilibrium decay fell somewhere between that seen for Chlamydia trachomatis and E. coli, suggesting that significant levels of homologous recombination occur between core genes. Using three classic substitution analysis methods (PHI, NSS and Maximum-Chi2) implemented for detecting intragenic homologous recombination, 119 core genes showed significant evidence for recombination (FDR corrected p-value <0.1) in at least one method (Supplementary Table 7a–c).
|
study
| 100.0 |
The impact of fixed recombination events was quantified by applying the ClonalFrame algorithm on the Lp genome alignment (intraspecific alignment; 1,028,806 bp). We detected recombination events on all branches of the clonal genealogy (Fig. 4). ClonalFrame estimated two values, ρ/θ and r/m, where the former measures the frequency of occurrence of recombination relative to mutation and the latter how important the effect of recombination is in genetic diversification relative to mutation. The ρ/θ was 0.124 (95% credibility interval of 0.177–0.133), implying that fixed recombination events have transferred relatively large portions of the genome between strains and/or serogroups. The r/m was 2.174 (95% credibility interval of 2.092–2.241), demonstrating that recombination events have played a larger role in shaping Lp genomes. The importance of recombination in Lp is supported by a study where 69 Lp1 genome sequenced samples isolated over 11 years in Spain showed that 98% of SNP diversity between strains was explained by only 16 recombination events18. The r/m value reported between these strains was 47.93.
|
study
| 100.0 |
We also estimated recombination based on a MAUVE alignment of all 43 Legionella genomes (759,392 bp): ρ/θ was estimated at 0.562 (95% credibility interval of 0.31–0.911) and the r/m value was 6.941 (95% credibility interval of 3.693–11.255) (Supplementary Figure 2). These values are not directly comparable to the values based on the intraspecific alignment, which is larger and covers more diverse regions of the conserved core genome, but they suggest recombination may be similarly important in other Legionella species.
|
study
| 100.0 |
Since ClonalFrame revealed that recombination has been a major factor in Legionella species evolution, we investigated how genetic variation is apportioned across species using BAPS40 and ChromoPainter + fineSTRUCTURE41. Both methods establish genetically differentiated groups and infer possible admixture occurring among those groups. As input, we used the 759,392 nucleotide MAUVE alignment based on conserved blocks of all 43 genomes. BAPS estimated the presence of 15 populations (Fig. 5) at the finest hierarchical level (within the Lp species), while ChromoPainter + fineSTRUCTURE assigned individual Legionella genomes to 21 populations (Fig. 6).
|
study
| 100.0 |
Overall, the population assignment of Legionella genomes was correlated to the groupings of ML-based phylogeny (Fig. 1a), BAPS, and fineSTRUCTURE, even though there were differences in population assignments at the lowest resolution within a clade, mainly due to methodological differences in the sensitivity of each method in assigning into populations. fineSTRUCTURE grouped Lp into 9 groups. However, BAPS clustered Lp serogroups into 7 groups. The main difference was that one large cluster assigned by BAPS included Lp2, 4, 5, 7, 9 11, 14, and 16 but were split into three groups by fineSTRUCTURE. In addition, fineSTRUCTURE grouped Lp1 Paris into a single cluster whereas BAPS grouped it with Lp HL06041035 and Lp13. While BAPS grouped species in Clade 2 into 4 groups, fineSTRUCTURE grouped them into 5. The main differences were that BAPs grouped L. erythra and L. birminghamensis into two separate populations while fineSTRUCTURE assigned them to a single population. Similarly, fineSTRUCTURE assigned L. jordanis and L. nautram into 2 singleton populations but BAPS grouped them together into 2 separate populations along with 2 other Legionella species in each of the populations. Clade 3 species were grouped into 4 populations in the BAPS analysis while fineSTRUCTURE grouped them into 6 populations by splitting the BAPS populations again into finer populations as well as re-assigning species into different populations. The single Clade 4 species, L. rowbothamii, was s distinct population in BAPS analysis (Fig. 5).
|
study
| 100.0 |
Based on the fineSTRUCTURE coancestry matrix visualized as a heatmap (Fig. 6), there appeared to be genetic exchange events occurring within and across each Legionella species, especially between Clades 2 and 3 but few events between Lp and other species. The color of each cell of the matrix indicated the expected number of genetic markers imported from a donor genome (x-axis) to a recipient genome (y-axis). Clade 3 species L. wadsworthii, L. cherri and L. dumoffii were admixed based on fineSTRUCTURE analysis (Fig. 6), although BAPS (Fig. 5) showed little evidence of DNA imports into these three genomes. All Legionella genomes in Clade 2 except L. maceachernii and L. micdadei showed signs of admixtures across all genomes in Clade 3 according to fineSTRUCTURE (Fig. 6), but BAPS analysis did not reveal any admixtures. The only sign of admixture predicted by BAPS analysis, excluding Clade 1, was between Clade 3 species L. anisa and L. bozemanii serogroup 2, which was also found by fineSTRUCTURE. Of the 25 Lp genomes in Clade 1, BAPS analysis revealed admixture signals in eight genomes: Lp1 Philadelphia, Lp LPE509, Lp 570-CO-H, and Lp3, Lp5, Lp11, Lp14 and Lp15. fineSTRUCTURE analysis also indicated small levels of admixtures across some Clade 1 genomes, which was not as evident as in BAPS.
|
study
| 100.0 |
Both BAPS and fineSTRUCTURE analysis revealed the absence of DNA exchange between Clade 1 and the other clades, indicating a possible sexual isolation of Lp serogroups from other Legionella species. To understand the nature of recombination predicted by ClonalFrame analysis, we tried to assign the origin of each event by a BLASTN pipeline described in Methods. However, recombinant sequences could not be matched to a particular ancestor in any other Legionella species.
|
study
| 100.0 |
As an alternative approach to identify potential admixture (and possible HGT), we created phylogenies for all gene families and then screened for phylogenies where there was an absence of congruity with the general pattern for the genome (see methods; Fig. 7). We screened for clade monophyly using the monophyletic function of the R ape package42 as well as the TOPD/FMTS43 tree congruence tool. Potentially incongruent trees were verified by manual inspection. For rapid processing, we used UPGMA distance based trees as we were comparing features of the gross topology44. Of the 1140 core genes, only 66 were found to have phylogenies with the whole genome (Supplementary Figure 4a). All of the inconsistencies fell in Clades 2 and 3: there was no evidence of an allele from another clade within the Lp species. For accessory genes, the rate was higher but these were still a relatively small proportion of the whole (145/2379) (Supplementary Figure 4b). In this case, 31 genes had a polyphyletic distribution. These were either genes that encoded hypothetical proteins, or functions associated with plasmids and phages.
|
study
| 100.0 |
Over the past 10 years, comparative genomics studies have been piecing together the ways in which individual bacterial genomes are related to larger taxonomic groups. Because bacteria are very diverse and every taxon has unique aspects to its ecology and genetics, this work has been mostly an empirical effort, aimed at estimating some of the basic parameters of evolution. Here, we characterized the genus level pan-genome, species-wide core genome and deciphered features of the natural history of Legionella based on comparative analyses of 43 genomes, encompassing all those that commonly or rarely cause human disease6.
|
study
| 99.94 |
We determined 1140 genes as the ‘perfect’ core genome in Legionella species. Previous estimates of core genome sizes are available only for Lp1 where 815 and 2745 genome comparisons estimated the size to be 2405 and 2173 genes, respectively. A very recent study18 calculated the presence of 3120 core genes based on the comparison of 69 strains of Lp1, which were part of outbreaks occurring in Alcoy, Spain, over 11 years, in addition to nine Lp1 reference strains. This latter analysis did not capture the ‘true’ estimate of core genes because a distribution of Legionella species was not included.
|
study
| 100.0 |
One of the principal findings of our work is that Legionella phylogeny resolve into four distinct clades based, in general, on human host-virulence demarcations (Fig. 1A). The obvious question to ask is, what are the genetic features that distinguish these groups of species? Clade 1 comprises only the Lp serogroups, which are responsible for approximately 92% of LD cases. Clade 2 are rarely associated with human disease while Clade 3 species are associated with LD and Pontiac Fever with L. longbeachae causing ~30% of LD cases in Australia and New Zealand. Clade 4 contains the only legionella-like amoebal pathogen (LLAP) species in the database, L. rowbothamii, which is associated with co-infection with other pathogens and is unlikely to be the sole causative organism in human disease. We did not find evidence to suggest adaptation through acquisition of known metabolic pathways. However, the function of many accessory genes is unattributed at this time, so we may be missing some of the picture through our partial existing knowledge.
|
study
| 100.0 |
The four clades were distinguished by differences in genes that fell into GO categories such as DNA exchange (probably species-specific phages, transposons and plasmids) and signal transduction. Recent genome analysis has shown that the repertoire of secreted effector proteins with highly variable protein domains is largely species-specific19. Based on our PCA analysis, the species within each clade formed non-overlapping groups and were also more similar regarding accessory gene families. This suggests that Legionella as a group may use broadly similar and conserved machinery for intracellular infection and growth in humans as in a myriad of soil and water protists5 but differ from each other in the presence of genes that promote adaptations to specific niches by providing environmental sensing and shifts in virulence. For example, Clade 1 represents all Lp serogroups. For Lp1, a recent study of 21 clinical isolates (ST191) from an outbreak of LD in Scotland identified mutation, recombination and HGT that had occurred in the environmental Legionella population before human infection46. WGS of the isolates revealed three regions of high SNP density and four distinct subtypes. Included in the set of genes transferred horizontally were those encoding the Lvh T4ASS located on a plasmid-like element that has been implicated in host cell entry and intracellular replication28 at low temperature. Variation in clinical virulence was linked to strain-dependent differences in T4ASS46. In our study, the Lvh T4ASS was identified in only 10 genomes: 6 of 9 Clade 1 Lp1 genomes, and Clade 3 L. bozemanii serogroup 2 and L. dumoffii. Our findings suggest that Lvh T4ASS is not an essential virulence factor and confirms that the Lvh system is not widespread among Legionella species outside of Lp4748. Additionally, we found that the P-type T4ASS was present in all Legionella genomes whereas the F-type T4ASS was missing in Lp2, 3 and 6, and in L. cherii. Such a heterogeneous distribution of these different T4ASS across the Legionella species is additional evidence of the plasticity of these genomes.
|
study
| 100.0 |
Clade 3 species include L. longbeachae that, along with Lp, accounts for over 95% of LD cases8. L. longbeachae was previously reported to contain an accessory gene, the tetracycline destructase, that was probably acquired by HGT from the soil, the natural habitat of this species49. The destructase confers tetracycline resistance to L. longbeachae, and has not been reported in Lp50 or any other Legionella species. While we found no evidence for the gene in any of the Lp1 or 16 other Lp serogroups, it was present in Clade 2 species L. jordanis and L. nautarum with 100% homology to the destructase in L. longbeachae. Since doxycycline is one of the first line drugs for treating legionellosis in the outpatient setting, presence of this gene may have led to the success of L. longbeachae in causing LD and to the success of the other species in causing human disease. L. jordanis has been association with human disease with a dozen or so recent cases reported5152. The acquisition of the destructase coupled with these reports may indicate a shift in virulence and the tip of the iceberg in terms of their potential for increasing the prevalence of human disease.
|
study
| 100.0 |
Clade 4 includes L. rowbothamii, a species that was recognized in 200153. The organism belongs to a group of species that were historically called legionella-like amoebal pathogens (LLAP) because of their obligate intracellular parasitism of protozoa and lack of growth in media that is used to isolate Legionella54. LLAPs have been isolated from various water supplies during investigations of LD55. However, while there is speculation and some data suggesting that LLAPs may be associated with human disease, they more often are found as a co-infection with other respiratory pathogens such as Streptococcus pneumoniae and respiratory syncytial virus555657. L. rowbothamii is the only LLAP in our dataset and, therefore, it is not surprising that it forms a unique clade.
|
study
| 99.94 |
Adaptation to host species probably involves sensing the unique features of their intracellular environment and responding by producing secreted effectors that have actions, which are specific to their milieu. Because so little research has been done outside of the L. pneumophila species, we are unable to annotate most of the molecular machinery used in these other diverse Legionella species. Legionella host adaptation may parallel the situation found in Chlamydiaceae, another group of pathogens with a broad and diverse range of hosts, where adaptation is driven primarily by amino acid change in conserved proteins and secreted effectors under strong diversifying selection58. Indeed, a large number of diverse effectors have recently been identified among 38 Legionella species19.
|
study
| 100.0 |
In this study, we uncovered the patterns of DNA shuffling between Legionella species. We showed that, in the core genome, linkage disequilibrium breaks down with increasing genetic distance between markers and that each strain contained regions of its genome most likely to be affected by homologous recombination. Evidence for recombination within the Lp species has been noted previously171845. As expected, the BAPs population structure analysis predicted admixture within Lp populations (Fig. 5). However, our analyses suggest that homologous recombination is almost exclusively an intraspecies event. We could not trace any sources of the potentially recombinant regions identified by ClonalFrame to a source outside of Lp. Population structure analysis in general offered little evidence of interspecies DNA admixture with the odd exception of the L. bozemanii serogroup 2 strain (Fig. 6). Although most accessory genes showed little evidence of interspecies transfer, a significant minority (144/2379) had a phylogenetic pattern consistent with HGT between Legionella spp. We also found near identical versions of two Lp plasmids in other Legionella clades. This pattern of gene flow, mostly occurring within species but with rare instances of sharing between congeners, has been termed ‘fuzzy species’59.
|
study
| 100.0 |
The mechanisms of recombination that have been shown for Lp include transformation and conjugation (reviewed in ref. 60). It is generally held that Lp1 strains that produce type IV pili are naturally competent for DNA transformation. While indigenous conjugative plasmids have been isolated from clinical and environmental Legionella and there is a recognized chromosome-based system for plasmid transfer, the majority of Lp1 strains do not contain these plasmids, as mentioned above, and are therefore unlikely to be necessary for virulence60. The CRISPR spacer analysis revealed that there is apparently a large ‘dark’ Legionella pan-genome, consisting of non-chromosomal DNA, presumably bacteriophage, suggesting that the true size of the pan-genome is considerably larger than the model-based estimation of 30,275. Interestingly, our GO and CRISPR findings for the monomorphic Lp serogroups, which are predicted to have an almost closed pan-genome and very few unique strain-specific genes, suggest that there is selective acquisition of genes that have enabled the organism to defend against phage attacks and to survive in both environmental and protozoan/eukaryotic hosts. These data indicate that the pool of foreign DNA in the environment able to be incorporated into the species is much greater than the number of genes that have actually been fixed in the chromosome.
|
study
| 98.44 |
In total, 43 genomes representing Lp1 (Philadelphia, Paris, Corby, Lorraine, LPE509, and Alcoy) and Lp serogroups Lp2-17 (including Lp12 strain 570-CO-H), L. pneumophila subspecies (Thunder Bay and HL06041035), and 17 other species L. longbeachae, L. bozemanii (serogroups 1 and 2), L. dumoffii, L. micdadei, L. birminghamensis, L. brunensis, L. cherii, L. cincinnatiensis, L. erythra, L. jamestowniensis, L. jordanis, L. maceachernii, L. nautarum, L. rowbothamii, L. tucsonensis, L. wadsworthii, and L. anisa were used for comparative genomics analyses of which 33 were sequenced in this study (Supplementary Table 1). Genomic DNA from the 33 serogroups and species was sequenced with both 454 and Illumina (76 bp single end) technology. Burnstein et al.19 recently genome sequenced different strains from the current study including L. anisa, L. bozemanii, L. brunensis, L. cherii, L. cincinnatiensis, L. dumoffii, L. erythra, L. jamestowniensis, L. jordanis, L. maceachernii, L. micdadei, and L. nautarum.
|
study
| 100.0 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.