text
string | predicted_class
string | confidence
float16 |
---|---|---|
Hypothetical model of bacteria-mediated EGR1 induction in host epithelial cells. At the host cell surface, the bacteria may stimulate β1-integrin and/or EGFR. All strains tested exhibit absolute requirement for β1-integrin expression to trigger EGR1 induction (shown in Figure 5). Inhibition of EGFR by PD153035 blocked induction of EGR1 by all strains (shown in Figure 4). Thereby, suggesting that activation of EGFR through β1-integrin as a possible mechanism for bacteria mediated induction of EGR1. Bacterial contact with the host cells was required for the induction of EGR1 response (shown in Figure 3). Integrins and EGFR can activate several signaling molecules inside the host cell that can in turn lead to induction of EGR1. Signaling through ERK1/2 was critical for all strains, since the induction of EGR1 was blocked by ERK1/2 inhibitor (Figure 4). Also other signaling factors are partially involved in a species-dependent manner. Data suggest that H. pylori, N. gonorrhoeae and S. Enteritidis can signal through JNK to upregulate EGR1, whereas PKA is utilized only by S. Enteritidis.
|
study
| 100.0 |
Many bacteria have been shown to associate with integrins (Hauck et al., 2012). Integrins can induce EGR1 expression through different signaling pathways (Lee et al., 2008; Cabodi et al., 2009). Here, we demonstrate for the first time that β1-integrins are often necessary for the bacterial induction of EGR1. Several bacteria have been shown to activate the EGFR, including N. menigitidis, N. gonorroeae, H. pylori, S. Typhimurium and P. aeruginosa. Often, this activation is indirect and mediated by bacterial induction of the cleavage of EGFR ligands by metalloproteases, allowing the ligands to bind to and activate EGFR (Keates et al., 2001; Zhang et al., 2004; Slanina et al., 2014). The importance of EGFR for EGR1 upregulation has been demonstrated in several studies (Meagawa et al., 2009; Voena et al., 2013). One study has shown the involvement of EGFR in the induction of EGR1 by a bacterial stimulus, H. pylori (Keates et al., 2005). Here, we confirm the importance of EGFR in EGR1 regulation and additionally demonstrate that EGFR is a common signaling molecule in bacteria-mediated EGR1 induction. Further, our data shows that ERK1/2 is another common signaling molecule in this process, but that EGR1 can also occasionally be induced by the JNK and PKA pathways.
|
study
| 100.0 |
Crosstalk between integrins and growth factor receptors has been extensively studied and can be bidirectional (Giancotti and Tarone, 2003). Cabodi et al. showed that integrin-EGFR complex formation is necessary for EGR1 expression that is induced by integrin-mediated adhesion (Cabodi et al., 2009). Inhibition of β1-integrin caused significant (p < 0.05) reduction in the induction of EGR1 by N. meningitidis, N. gonorrhoeae, S. pyogenes, H. pylori, and S. Enteritidis. In addition, the inhibition of EGFR completely abrogated the induction of EGR1 by N. meningitidis, N. gonorrhoeae, S. pyogenes, H. pylori, and S. Enteritidis.
|
study
| 100.0 |
In addition to the bacterial species described in the literature, we show that several other bacterial strains can upregulate EGR1 expression. EGR1 induction seems to be a general response of epithelial cells to bacterial colonization. In addition, we observed cell type specificity and variation in the signaling pathways used by different bacteria. Therefore, it is unlikely that EGR1 is induced by one molecule that is conserved among bacteria. Furthermore, heat killed S. Enteritidis was sufficient for EGR1 induction whereas other bacteria show requirement for viability and direct contact with the host cell. However, the role of surface molecule or bacterial component released in the supernatant upon heat treatment of S. Enteritidis needs further investigation. This result indicates a difference in the nature of bacterial EGR1 inducing factors. There are some indications in literature on the type of components could be involved, which represent a variety of molecules. For example, the type IV secretion system encoded by the Cag pathogenicity island is required for EGR1 induction by H. pylori (Keates et al., 2005). S. aureus can upregulate EGR1 through peptidoglycan (Xu et al., 2001). The molecule that is required by the bacteria also most likely depends on the host cell type. EGR1 upregulation by S. Typhimurium SL1344 and enteropathogenic E. coli in epithelial cells is dependent on their type III secretion systems (de Grado et al., 2001; Hannemann et al., 2013), whereas LPS from E. coli and Salmonella minnesota can induce EGR1 in monocytes (Coleman et al., 1992; Guha and Mackman, 2002).
|
study
| 99.94 |
EGR1 is a transcription factor with many downstream targets. It has been shown that EGR1 can bind to the promotors of several proteins involved in inflammation, such as the pro-inflammatory cytokines IL6, IL8 and TNF, and stimulate their expression (Shi et al., 2002; Droin et al., 2003; Hoffmann et al., 2008; Ma et al., 2009; Lin et al., 2014). In this way, EGR1 could help the host to mount an initial defense against invading pathogens.
|
study
| 99.94 |
Among the targets of EGR1 are many genes that are involved in proliferation and prevention of apoptosis, which gives EGR1 a putative role in the development of cancer. Indeed, EGR1 is overexpressed in certain cancers, such as prostate cancer, gastric cancer and cervical cancer (Eid et al., 1998; Akutagawa et al., 2008; Zheng et al., 2010). Bacterial infections have been linked to cancer, mainly through epidemiological studies. The most widely accepted link is between H. pylori, which was the first bacterium to be declared as a carcinogen, and gastric cancer (Sokic-Milutinovic et al., 2015). However, other associations have been made, such as S. enterica as a causative agent of gallbladder cancer (Scanu et al., 2015). The upregulation of EGR1 upon bacterial infection is therefore a possible important event in bacteria-associated cancer development.
|
review
| 99.9 |
EGR1 can be upregulated by bacteria in host cells, and ERK has often been identified as a key signaling molecule in this process. The study has certain limitations imposed by the adopted experiments for adhesion assays. The bacteria were not removed after adding to the epithelial cells. Therefore, during the incubation period, the bacteria could grow and alter the composition of the medium with respect to nutrient composition and release of metabolites. The study has certain limitations imposed by the adopted experiments for adhesion assays. The bacteria were not removed after adding to the epithelial cells. Therefore, during the incubation period, the bacteria could grow and alter the composition of the medium with respect to nutrient composition and release of metabolites. However, both heat-killed and live S. Typhimurium were able to induce EGR1 at 2 h post infection (Figure 3E). Also, cell type specificity in the bacteria-mediated induction of EGR1 was observed in different cell lines (Figure 2). These observations indicated that bacteria-mediated EGR1 induction might not be due to alterations in the composition of the growth media. Instead, there is a possible role of an interaction between the bacteria and host in the bacteria-mediated induction of EGR1. Identification of the bacterial component(s) that induce EGR1 signaling and the consequences of the EGR1 induction toward bacterial pathogenicity or host defense require further investigation. The present study shows how widespread the EGR1 response is among bacteria and adds EGFR and integrin signaling as important contributors to EGR1 induction.
|
study
| 100.0 |
Crocker Range Park (CRP) is located in the west coast of Sabah, East Malaysia in Borneo (latitude 5°07' to 5°56'N and longitude 115°50' to 116°28'E). This park is about 110 km long and 15 km wide, covering an area of 139,919 ha, making it the largest terrestrial park and protected area in Sabah. This park was first designated as a Forest Reserve under the Forest Ordinance in 1969 but was subsequently converted to a State Park in 1984 for the conservation of natural resources and ecosystems, under the jurisdiction of Sabah Parks Trustees (Usui et al. 2006). In June 2014, Crocker Range was designated as a UNESCO Biosphere Reserve consisting of the whole area of CRP and the three forest reserves within the range.
|
other
| 99.9 |
CRP, in the past, had received less attention from bryologists when compared to Kinabalu Park. These two parks are both on the Crocker Range which is the longest range in Sabah, extending from Kudat (northern tip of Borneo) to Sipitang (southern part of Sabah). CRP has become more accessible after the establishment of seven substations within the park between the years 2003 and 2005 and the opening of a new road system from Ulu Kimanis (western part) to Keningau Town (eastern part), cutting through the central part of the park. Another factor which may have contributed to the lesser attention received by CRP is the fact that its highest peak is only 2,076 m a.s.l., just half of that of Mount Kinabalu (4,059 m a.s.l.). Nevertheless, 27% of the total area of CRP is more than 1,000 m a.s.l., with 16 peaks above this height (Usui et al. 2006).
|
other
| 99.9 |
To date, only two studies on mosses from this park have been published. Suleiman and Akiyama (2004) reported 126 species of mosses belonging to 74 genera and 27 families, collected during the CRP Scientific Expedition in 2002 at Ulu Kimanis and adjacent areas within the elevations of 500–1,400 m a.s.l. Recently, Suleiman and Jotan (2015) reported 38 species and three varieties of mosses belonging to 17 genera and 11 families collected during a diversity study of epiphytic mosses along the Minduk Sirung Trail, a new 12 km trail connecting Mount Alab and Mahua substations (north-eastern part). In their study, mosses were collected from only three sampling areas of 20 m × 20 m.
|
study
| 99.56 |
There are two other unpublished studies on mosses in CRP. The first one was by Kong (2006), who conducted a study on the diversity of mosses in Keningau Research Permanent Plot which is only 50 m × 50 m. She collected 40 species belonging to 26 genera and 14 families. The second one was by Chin (2008), who has studied the diversity of epiphytic mosses within 0–2 m of tree trunks, in the Mount Alab Permanent Research Plot (50 m × 50 m). She collected 20 species in 10 genera and seven families in this mossy forest (1,700–1,800 m a.s.l.). The present report attempts to produce a comprehensive checklist of mosses found in CRP based on collections from the year 2002 to 2008 and herbarium specimens deposited in the BORNEENSIS Herbarium of the Institute for Tropical Biology and Conservation, Universiti Malaysia Sabah (BORH) and Herbarium of Museum of Nature and Human Activities, Hyogo (HYO).
|
study
| 99.7 |
All specimens of mosses from the following 12 localities within the park were examined and identified. Areas covered are Inobong Visitor and Research Station, Mount Alab, Mile 32-Longkogungan Village, Longkogungan-Kuyungon Village, Salt Trail, Mahua Substation, Mount Minduk Sirung, CRP Headquaters, Ulu Senagang Substation, Melalap Substation, Ulu Membakut Substation and Ulu Kimanis Substation (Figure 1). These localities range from lowland to upper montane forests, covering secondary to primary forests, from 50 m to 2,000 m a.s.l. Details of the collection localities are listed in Table 1. Identified specimens were deposited at BORH and a set of duplicates were sent to the Herbarium of Sabah Park (SNP). Some duplicates were also deposited at HYO, Herbarium of University of Malaya (KLU) and Herbarium of Royal Botanic Gardens Victoria (MEL).
|
other
| 96.5 |
A total of 1,403 specimens of mosses from CRP were examined during this study. Amongst these, 293 species, three subspecies and eight varieties belonging to 118 genera and 36 families were identified (Table 2 and Appendix 1). The five dominant families of mosses in CRP are Calymperaceae with 35 species and one subspecies (11.8%), followed by Sematophyllaceae with 32 species and two varieties (11.2%), Pylaisiadelphaceae with 21 species and one variety (7.2%), Dicranaceae with 21 species (6.9%) and Daltoniaceae with 20 species (6.6 %). All of these families, except for Dicranaceae, are lowland families as ca. 70% of CRP land area is below 1,000m a.s.l.
|
study
| 100.0 |
The species richness of mosses in the study area is very high; 40% of the total of 766 species and infra-specific taxa reported from Borneo and 47% of the total of 651 species and infra-specific taxa reported from Sabah (Andi and Suleiman 2005, Suleiman et al. 2006, 2009, 2011a, 2011b, 2017, Suleiman and Akiyama 2007, Higuchi et al. 2008, Akiyama 2010, Ho et al. 2010, Ellis et al. 2010, 2015, 2016a, 2016b, Andi et al. 2015, Chua and Suleiman 2015, Mohamed et al. 2010, Suleiman and Rimi 2016).
|
study
| 99.94 |
Out of the 293 species, three subspecies and eight varieties of mosses in CRP, six are new to Borneo and 13 are new to Sabah (Table 3). Amongst the six species new to Borneo, four were found in the lowland areas between 70 m and 680 m a.s.l. Lowland areas in Borneo have not been given enough bryological attention, probably due to the misconception that the lowland rainforest has poor species richness of bryophytes. For instance, Chaetomitrium lancifolium, which was collected at 70 m a.s.l. in CRP, represents a second known record after its type collection from the Maluku Islands (see Appendix 1 for details).
|
other
| 86.4 |
Several of the mosses found in CRP are of temperate entities and rarely reported in Borneo, namely Claopodium prionophyllum, Elmeriobryum philippinense, Entodon plicatus, Erythrodontium squarrosum, Leucomium strumosum, Mesonodon flavescens, Oxyrrhynchium vagans, Pseudoleskeopsis zippelii, Regmatodon declinatus and Schoenobryum concavifolium. Five of these species, namely Claopodium prionophyllum, Entodon plicatus, Erythrodontium squarrosum, Mesonodon flavescens and Oxyrrhynchium vagans, have only been collected once in Borneo (Dixon 1916, Iwatsuki and Noguchi 1975, Akiyama et al. 2001). Elmeriobryum philippinense was collected during the study and reported as new to Borneo by Ellis et al. (2016a). In addition, three species endemic to Borneo were also found in this park: Benitotania elimbata, Ectropothecium ptychofolium and Acroporium ramicola (Appendix 1).
|
study
| 99.94 |
Crocker Range Park ranks the second highest (cf. Table 4) in terms of number of mosses reported from mountainous areas in Borneo (Frahm et al. 1990, Suleiman and Edwards 2002, Suleiman and Akiyama 2004, Higuchi et al. 2008, Akiyama et al. 2001, Andi et al. 2015, Suleiman et al. 2011b). CRP recorded about 40% of the mosses reported from Borneo although the highest point in CRP is only 2,076 m a.s.l. This indicates that CRP has high species richness of mosses, second to that of Mount Kinabalu. Meanwhile, the number of mosses on Mount Trus Madi and Mount Lumaku were much lower, with 26% and 17%, respectively. Although Mount Trus Madi is much higher in terms of elevation, the number of mosses reported from the mountain was far lower than from CRP. Mount Lumaku, on the other hand, has a similar height to the highest peak of CRP but its species richness is only about half that of CRP. Two of the contributing factors are that CRP receives a high annual rainfall and it has a relatively larger area of pristine primary lowland forests than Mount Trus Madi and Mount Lumaku. Nonetheless, a diversity study should be carried out to determine the true diversity of these areas.
|
study
| 100.0 |
CRP is a huge protected area and large parts of this park have not been surveyed during the present study. Thus, additional explorations in less accessible areas will definitely increase the number of mosses in this park and provide a better understanding of the distribution of species within the park. The large area of lowland forests in CRP is an asset to this protected area as it harbours important species of mosses and other plants. Large areas of lowland forest in other parts of Borneo have been cleared for agriculture and development, adding to the importance of conservation of this UNESCO Biosphere Reserve. This study identifies CRP as one of the hotspots of moss diversity in Borneo.
|
other
| 99.8 |
Hepatoblastoma (HB) is the most common liver malignancy in children. HB usually occurs in the first 3 years of life. The incidence is slowly but steadily increasing at a rate of 1.2-1.5 cases/million/year, partly due to prematurity and very low birth weight [1, 2]. The development of adjuvant, neo-adjuvant chemotherapy as well as the new surgical resection methods significantly improved the patients’ survival rate in the last decades . Despite these significant achievements in HB treatment, the prognosis of patients with metastasis and those who are at a stage of pretreatment extent of disease (PRETEXT) IV remains unfavorable . Thus, novel targeted therapy strategies against HB are highly needed. To achieve this goal, a better characterization of the molecular genetics and signaling pathways underlying HB pathogenesis is imperative.
|
review
| 99.9 |
Using exome sequencing approaches, recent studies have identified multiple genetic modifications in human HB samples, including gain-of-function mutations of CTNNB1 and CAPRIN2, and loss-of-function mutations of Axin1 and SPOP . Among them, mutations of CTNNB1 and CAPRIN2 genes lead to the activation of the canonical Wnt pathway, a major driver genetic event promoting HB development [6, 7]. Point mutations as well as in-frame deletions of the exon 3 in CTNNB1 gene have been detected in ∼80% of human HB patients. These mutations lead to stabilization, nuclear localization, and activation of β-catenin transcriptional activity, with consequent induction of a large number of target genes involved in proliferation, survival, migration, and invasion [8, 9]. It is important to underline that while β-catenin cascade is essential for HB development , over-expression of either full length, N-terminal deleted mutation (ΔN90), or point mutation (S45Y) forms of β-catenin alone is not sufficient to promote HB formation in mice. This evidence suggests that activation of additional signaling pathways is required, and these pathways may synergize with activated Wnt/β-catenin cascade to promote HB development . In a recent study from our group, we found that Yes-associated protein (YAP), the transcriptional co-activator downstream of the Hippo tumor suppressor pathway, is activated in most human HB samples, with coordinated activation of YAP and β-catenin being detected in ∼80% of HB . Importantly, co-expression of activated YAP and β-catenin in the mouse liver via hydrodynamic transfection led to HB formation in mice . Our study, therefore, establishes YAP as a second signal that synergizes with β-catenin to promote HB development. However, the molecular mechanisms whereby YAP promotes HB formation remain unknown.
|
study
| 100.0 |
The mammalian target of rapamycin (mTOR) pathway is a central regulator of tissue growth and homeostasis . It is comprised of two multiple protein complexes: mTOR complex 1 (mTORC1) and 2 (mTORC2), with regulatory-associated protein of mammalian target of rapamycin (Raptor) and rapamycin-insensitive companion of mTOR (Rictor) as unique protein components for mTORC1 and mTORC2, respectively . De-regulation of the mTOR pathway is frequently found in human cancers , including hepatocellular carcinoma (HCC), the most common form of primary liver cancer [14, 15]. Temsirolimus, a first generation mTOR inhibitor, is approved by the Food and Drug Administration (FDA) for the treatment of advanced stage renal cell carcinoma . Similarly, targeting the mTOR signaling has been considered a promising strategy for the treatment of HCC . However, studies on the functional contribution of the mTOR pathway to HB development are lacking.
|
review
| 99.9 |
In the present study, we found that mTORC1 is activated in human HB cell lines as well as YAP/β-catenin-induced mouse HB tissues. A key role of mTORC1 in HB development was substantiated by subsequent functional studies. Mechanistically, we found that YAP induces the expression of the amino acid transporter SLC38A1, leading to the activation of mTORC1. Therefore, our study strongly suggests that mTORC1 is a major signaling event downstream of activated YAP along HB development. The results obtained also support the further testing of mTOR inhibitors for the treatment of human HB.
|
study
| 100.0 |
As a first step to study the functional crosstalk between YAP and mTORC1 in HB, we analyzed the protein levels of β-catenin, YAP, TAZ (a paralog of YAP), and members of the mTOR pathway using two human HB cell lines, namely Hep293TT and HepG2 cells [18, 19]. The SNU449 human HCC cell line that harbors a mutation in the Pten tumor suppressor gene (thus displaying a constitutively high mTOR activity) was used as positive control. Both Hep293TT and HepG2 HB cell lines have N-terminal truncated forms of β-catenin, which could be readily detected as a lower band by Western blotting (Figure 1A). Total and nuclear YAP and TAZ were found to be expressed in the three cell lines, supporting the activation of the two protooncogenes in these cells (Figure 1A and 1C). Activation of mTORC1 in Hep293TT and HepG2 cells was evidenced by the elevated levels of phosphorylated/activated (p)-mTOR, phosphorylated/inactivated (p)-4EBP1, phosphorylated/activated (p)-S6K and phosphorylated/activated (p)-RPS6 (Figure 1A). Furthermore, levels of mTORC2 targets, including phosphorylated (p)-NDRG1 and phosphorylated/activated (p)-AKT (S473) were elevated, thus indicating the activation of mTORC2 in Hep293TT and HepG2 cells. In contrast, levels of PDK1 substrate phosphorylated/activated (p)-AKT (T308) were very low/undetectable by Western blotting in Hep293TT and HepG2 cell lines, whereas they were induced in SNU449 HCC cells (Figure 1A). Next, we analyzed the expression of these pathways in YAP/β-catenin-induced mouse HB tumor tissues (Figure 1B-1D). Consistently, truncated β-catenin and nuclear YAP and TAZ could be found in mouse HB tissues. In addition, levels of p-mTOR, p-S6K, p-RPS6 and p-4EBP1 were all higher in HB tumor tissues than normal liver tissues, supporting the activation of mTORC1 in YAP/β-catenin-induced HB tumors.
|
study
| 100.0 |
A. Representative Western blotting of YAP, TAZ, β-catenin as well as proteins from the AKT/mTOR pathway in Hep293TT and HepG2 HB cells, and SNU449 HCC cells. B. Representative Western blotting from wild-type (WT) and YAP/β-catenin-induced mouse HB samples. C. Nuclear expression of YAP [YAP (n)] and TAZ [TAZ (n)] in the human HB cell lines (upper level) and mouse HB tissues (lower level). Histone H3 was used as loading control for nuclear extraction; and β-tubulin as loading control for cytoplasmic extraction. D. Immunohistochemistry showing strong upregulation of phosphorylated (p-)/activated RPS6 (a surrogate marker of mTORC1 activation) in YAP/β-catenin-induced mouse HB samples. Magnifications: upper level: 100×, scale bar = 200μm; Lower level: 200×, scale bar = 100μm.
|
study
| 100.0 |
Next, we determined whether HB cells are sensitive to mTOR inhibitors. For this purpose, we chose MLN0128, a second generation mTOR inhibitor . Unlike allosteric mTOR inhibitors (such as Rapamaycin), which partially inhibit mTORC1, MLN0128 has been shown to complete suppress mTORC1 activity as indicated by the strong inhibition of p-4EBP1 . Importantly, both Hep293TT and HepG2 cells were found to be highly sensitive to MLN0128, with an IC50 around 50nM (Figure 2A). At the molecular level, administration of MLN0128 led to an increased inhibition of mTORC1 targets, including p-mTOR, p-RPS6 and p-4EBP1, in a dose-dependent manner (Figure 2B). In the time course study, sustained inhibition of p-mTOR, p-S6K, p-RPS6 and p-4EBP1 was detected when Hep293TT and HepG2 cells were treated with MLN0128 at 50nM (Figure 2C). Furthermore, MLN0128 dramatically decreased cell proliferation and increased cell apoptosis in a dose-dependent manner (Figure 2D and 2E). Consistently, pro-survival proteins, including Survivin and MCL-1, were found to be decreased, whereas the pro-apoptotic protein Bak was upregulated in MLN0128 treated HB cell lines. Consistent with increased apoptosis, cleaved caspase 3 levels were highest in Hep293TT and HepG2 cells treated with MLN0128 (Figure 2C).
|
study
| 100.0 |
A. IC50 of MLN0128 for HepG2 and Hep293TT HB cells. B. Western blotting showing the downregulation of mTORC1 upon various concentrations of MLN0128 treatment in HepG2 and Hep293TT cell lines. C. Western blotting of mTOR- and apoptosis pathway-related proteins in HepG2 and Hep293TT cells treated with MLN0128 at its IC50 concentration. Graph showing D. BrdU incorporation based proliferation analysis and E. relative apoptosis after various concentrations of MLN0128 treatment at different time courses (24, 48 and 72 hours) in HepG2 and Hep293TT cell lines. Data are presented as mean ± SEM. *** P < 0.001; A. vs control (untreated cells); B. vs DMSO; and C. vs MLN0128 50nM.
|
study
| 100.0 |
Since Raptor is the unique and functional component of mTORC1, we performed Cre/LoxP mediated Raptor knockout by hydrodynamic tranfection in Raptorfl/fl mice. The study design is similar to what we have published previously . In brief, either pT3-EF1a (pT3, empty vector control) or pT3-EF1a-Cre (Cre) plasmid was co-injected with YAPS127A and ΔN90-β-catenin plasmids into Raptorfl/fl mice (Figure 3A). Mice were monitored and sacrificed when they were moribund or 21.3 weeks post injection. All the pT3 treated mice developed a lethal burden of liver tumors by 12.3 weeks post injection and were euthanized. In striking contrast, all Cre injected mice remained healthy until 21.3 weeks post injection (Figure 3B and Table 1). Upon dissection, within 10 to 12 weeks post injection, all pT3 injected mice showed massive liver tumors with high liver weight as well as liver/body ratio (Figure 3C and 3D). Histologically, tumor cells resembled fetal or crowded fetal subtype of human HB, characterized by small cell size as well as small round or oval nuclei . Tumor cells were highly proliferative, as indicated by Ki67 staining. At this time point, all Cre injected mice showed the absence of tumor lesions on the liver surface, with normal liver weight and liver/body ratio (Figure 3C and 3D). Histological examination revealed that the liver of Cre injected mice was completely normal with no microscopic lesions (Figure 3D). At 15 to 21 weeks post injection, small tumor nodules could be found in Cre injected mouse livers (Figure 3D). Histologically, tumors were exclusively HB, with frequent Ki67 positive cells (Figure 3D).
|
study
| 100.0 |
A. Study design. B. Survival curve. C. Liver weight and liver/body weight of YAP/β-catenin/pT3EF1α (pT3) and YAP/β-catenin/pT3EF1α-Cre (Cre) injected mice. Data are presented as mean ± SEM. *** P < 0.001; ns, not significant. D. Gross images of livers, HE and Ki67 staining in pT3 and Cre mouse livers. Magnifications: 40× (HE), scale bar = 500μm; 200× (Ki67), scale bar = 100μm.
|
study
| 99.94 |
Next, we investigated the possible mechanisms whereby mTORC1 is activated in HB. In this regard, a recent study suggested that YAP and TAZ regulate SLC38A1 and SLC7A5 expression in human HCC cells, leading to mTORC1 activation . Therefore, we tested the hypothesis that YAP and TAZ may function to regulate mTORC1 in an analogous manner in HB. For this purpose, we first determined the expression of amino acid transporters SLC38A1, SLC7A5, and SLC1A5 in normal liver and YAP/β-catenin-induced HB tissues. Connective tissue growth factor (CTGF), a well-known target of YAP, was used as positive control (Figure 4A). Importantly, we found that in YAP/β-catenin-induced HB tumors, only SLC38A1 expression was upregulated (Figure 4A). Next, we investigated whether amino acids were required for human HB cell growth and mTORC1 activation. For this purpose, Hep293TT and HepG2 cells were cultured in amino acid free medium (Figure 4B and 4C). Of note, we found that deprivation of amino acids strongly inhibited Hep293TT and HepG2 cell growth (Figure 4B), and it led to the reduction of mTORC1 activation, as indicated by decreased p-mTOR, p-S6K, p-RPS6, and p-4EBP1 levels (Figure 4C). Thus, the results support the hypothesis that amino acids are key activators of mTORC1 in HB cells.
|
study
| 100.0 |
A. Expression of CTGF, SLC38A1, SLC1A5, and SLC7A5 in wild type (WT) liver and YAP/β-catenin-induced HB by qRT-PCR. Data are presented as mean ± SEM. * P < 0.05, ** P < 0.01; ns, not significant. B. Relative cell viability in amino acid deficient (AA-) medium compared to that in regular medium (control). C. Western blotting showing that amino acid deprivation inhibits mTORC1 activation in HepG2 and Hep293TT cells.
|
study
| 100.0 |
We further investigated whether YAP and TAZ control mTORC1 activity in HB cells. For this goal, we silenced YAP, either alone or in association with TAZ, using siRNAs in Hep293TT and HepG2 cells. We found that, indeed, when YAP and TAZ were concomitantly silenced, p-RPS6 levels were significantly decreased (Figure 5A). Next, we determined whether YAP and TAZ modulate SLC38A1 expression. Again, YAP alone, TAZ alone or YAP and TAZ together were silenced in Hep293TT and HepG2 cells. Expression of SLC38A1 and YAP/TAZ target genes (CTGF and cysteine-rich 61 or CYR61) was analyzed using qRT-PCR. As expected, concomitant silencing of YAP and TAZ triggered downregulation of CTGF, CYR61, and SLC38A1 in Hep293TT and HepG2 cells (Figure 5B). Finally, using chromatin immunoprecipitation (ChIP) assay, we found that YAP binds to the promoter region of SLC38A1 (Figure 5C) in HepG2 and Hep293TT cells, supporting the hypothesis that YAP directly regulates SLC38A1 expression in HB cells.
|
study
| 100.0 |
HepG2 and Hep293TT cells were transfected with indicated siRNA for 48-72 hours, siY+T: siYAP+siTAZ. A. Expression of YAP, TAZ and phosphorylated/activated (p)-RPS6 were measured by Western blotting. B. qRT-PCR was used to analyze CTGF, CYR61, and SLC38A1 expression. Data are presented as mean ± SEM. * P < 0.05, ** P < 0.01, *** P < 0.001. C. Direct binding of YAP to SLC38A1 promoter analyzed by chromatin immunoprecipitation (ChIP)-PCR in HepG2 and Hep293TT cells.
|
study
| 100.0 |
Since YAP synergizes with β-catenin to induce HB formation, we next determined whether β-catenin also regulates SLC38A1 expression. However, no significant changes in SLC38A1 mRNA and protein levels were detected in HB cell lines upon β-catenin silencing (Figure 6), thus indicating that modulation of SLC38A1 expression is β-catenin-independent in HB cells.
|
study
| 100.0 |
SLC38A1 mRNA levels were detected following silencing of β-catenin in HepG2 A. and Hep293TT B. cell lines by qRT-PCR. Data are presented as mean ± SEM. *** P < 0.001, ns, not significant. No changes in SLC38A1 protein levels were detected in HepG2 C. and Hep293TT D. cell lines following silencing of β-catenin, as revealed by Western blotting.
|
study
| 100.0 |
Finally, we assessed the levels of p-4EBP1, a surrogate marker of mTORC1 activation, and SLC38A1 in a collection of human HB specimens (n = 28) by immunohistochemistry (Figure 7). Strikingly, strong immunoreactivity for p-4EBP1 and SLC38A1 proteins was detected in most tumor tissues when compared with corresponding non-tumorous surrounding liver tissues (Figure 7). Specifically, increased levels of SLC38A1 and p-4EBP1 were detected in 20 of 28 (71.4%) and 23 of 28 (82.1%) HB specimens, respectively. Of note, 18 of 20 (90%) HB showing upregulation of SLC38A1 also displayed elevated levels of p-4EBP1. No significant association was found between the levels of SLC38A1 and/or p-4EBP1 with clinicopathologic features of the patients, including age, gender, etiology, histology subtype, recurrence or lung metastasis (data not shown).
|
study
| 100.0 |
Immunohistochemical pattern of phosphorylated/inactivated (p-)4EBP1, a surrogate marker of mTORC1 activation, and SLC38A1 in two human hepatoblatoma specimens. The two hepatoblastomas A., B. are depicted in two magnifications (40X and 200X; upper and lower panels, respectively) and show strong immunoreactivity for both mTORC1 and SLC38A1 in the tumor part (T) when compared with non-tumorous surrounding liver tissues (ST). H&E, haematoxylin and eosin staining.
|
study
| 99.94 |
HB is a malignant form of liver cancer occurring in infants and children [1, 2]. Similar to other tumor types, multiple genetic alternations are likely to be required for the development of HB. In particular, somatic mutations of the CNNTB1 gene leading to the activation of Wnt/β-catenin signaling cascade, are a well-documented major driver genetic event in HB development [4, 5]. A recent body of evidence indicates that YAP is another, pivotal factor commonly activated in HB . In particular, it has been shown that concomitant activation of β-catenin and YAP results in HB formation in mice . Also, silencing of YAP and/or β-catenin leads to decreased proliferation of HB cell lines . However, the precise mechanisms by which YAP promotes HB development are not known. In this study, we demonstrate that mTORC1 is activated in both human HB cell lines and mouse YAP/β-catenin-induced tumor tissues. The importance of the mTORC1 pathway along HB development is underscored by the finding that inhibition of mTORC1 by either MLN0128 treatment or ablation of Raptor strongly suppresses HB occurrence in mice. Furthermore, we showed that YAP and its paralog TAZ regulate the expression of the amino acid transporter SLC38A1 in human HB cell lines, leading to mTORC1 activation (Figure 8). Our investigation therefore provides novel mechanistic insight into how YAP and TAZ may contribute to HB formation.
|
study
| 99.94 |
The mTOR pathway is a major signaling cascade regulating tumor cell growth and metabolism . Thus, targeting the mTOR pathway is considered to be a valid therapeutic approach for cancer treatment . Studies of mTOR pathway in HB are still scanty. Hartmann et al. reported that in 24 human HB specimens, p-mTOR expression was detected in 96% (23/24) cases . Similarly, in the present study, we show the activation of mTORC1 (as revealed by p-4EBP1 immunohistochemistry) in the large majority of HB specimens from an independent collection. In addition, it has been found that Rapamycin inhibits proliferation and induces apoptosis in HepG2, HepT1, and Huh6 human HB cells in vitro. Rapamycin also suppresses Huh6 growth in a xenograft model . Altogether, these data indicate that mTOR, and particularly mTORC1, is frequently activated in human HB. Thus, targeting mTORC1 might be beneficial for HB treatment. However, the mechanisms promoting mTORC1 activation in HB were not investigated to date. In our current investigation, we provide a novel mechanism by which YAP and TAZ activate mTORC1, namely via transcriptional upregulation of SLC38A1. In this regard, the concordant data obtained in the YAP/β-catenin mouse model, HB cell lines, and human HB specimens strongly suggest that the same mechanism of mTORC1 induction is at play along murine and human HB development. Nonetheless, larger human HB collections should be analyzed to further substantiate the present findings. Although we found that YAP contributes to HB development via activation of mTORC1, we cannot exclude that YAP promotes HB occurrence also through additional molecular mechanisms. For instance, it has been recently shown that the transcription factor Forkhead Box M1 (FOXM1) is a major player along hepatocellular carcinoma development driven by YAP overexpression . Preliminary data from our laboratory show that the functional interplay between YAP and FOXM1 is also present in human HB cell lines (Supplementary Figure 1). Additional investigation is required to determine the importance of FOXM1 in YAP-dependent HB development.
|
study
| 100.0 |
Furthermore, our data suggest the functional redundancy of YAP and its paralog TAZ in regulating SLC38A1 expression and mTORC1 activity in human HB cells. While the relevance of YAP in HB is underscored by a body of experimental evidence, including the findings from the present study, there is no study on the role of TAZ in this tumor type. Our results support the possible involvement of TAZ in HB, and this issue clearly warrants further studies. In particular, it would be highly important to determine whether YAP and TAZ, besides SLC38A1 and mTORC1, regulate the same or distinct pathways in HB.
|
study
| 100.0 |
Solute carrier (SLC) proteins are large families of membrane transporters involving multiple cellular activities, such as nutrient uptake, waste removal, and iron transport . Recent studies have indicated the key roles of amino acid transporters along tumor development , especially in regulating the mTOR pathway . For instance, a recent work from our group indicates that SLC1A5 and SLC7A6 are direct targets of c-Myc and are required for c-Myc induced mTORC1 activation in HCC . Also, SLC1A5 mediated glutamine uptake was found to be required for lung cancer cell growth . The functional roles of amino acid transporters in HB formation are not well characterized. In this study, we demonstrate that SLC38A1 is regulated by YAP and TAZ in HB cells. Unlike YAP and TAZ, which are nuclear proteins and are difficult to be targeted by small molecules or antibody antagonists, SLC families of transporter proteins are clearly druggable. Indeed, SLC targeting drugs have been widely used for the treatment of multiple diseases, including, central nervous system disorders, cardiovascular disease, and antineoplastic treatment . Thus, our study supports the development of drugs that target SLC38A1 for HB therapy.
|
study
| 99.94 |
The construct used for the mice, including pT3-EF1α-YAPS127A, pT3-EF1α-ΔN90-β-catenin, pT3-EF1α, pT3-EF1α-Cre, and pCMV/sleeping beauty transposase (SB), were described previously [11, 21]. All the plasmids were purified using the Endotoxin free Maxi prep kit (Sigma-Aldrich, St. Louis, MO, USA).
|
study
| 99.94 |
Wild-type FVB/N mice were obtained from Jackson Laboratory (Bar Harbor, ME). Raptorfl/+ mice were purchased from the Jackson Laboratory (Bar Harbor, ME, USA; stock: 013188) and intercrossed to generate Raptorfl/fl mice. SB-mediated hydrodynamic injections were performed as described . Briefly, for the HB tumorigenesis model, 20 μg of pT3-EF1α-YAPS127A and 20 μg of pT3-EF1αH-ΔN90-β-catenin along with SB transposase in a ratio of 25:1 were delivered into the FVB/N mouse by hydrodynamic injection. These two plasmids contain constitutively active forms of YAP and β-catenin protooncogenes. For further knocking out Raptor in the HB model, either 40μg pT3-EF1a or 40μg pT3-EF1a-Cre were co-injected with 20μg pT3-EF1α-YAPS127A and 20μg pT3-EF1α-ΔN90-beta-catenin together as well as 3.2μg pCMV-SB in Raptorfl/fl mice. All mice were monitored closely and euthanized as described in the main text. Mice were fed and monitored according to protocols approved by the Committee for Animal Research at the University of California, San Francisco.
|
study
| 100.0 |
The Hep293TT cell line was kindly provided to us by Dr. Gail Tomlinson from the University of Texas Southwestern Medical Center. Hep293TT cells were cultured in Roswell Park Memorial Institute (RPMI) 1640 medium, 25mM Hepes, 10% fetal bovine serum (FBS) and 1% penicillin/ streptomycin (Gibco). HepG2 and SNU449 cells were purchased from ATCC and they were cultured in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% FBS and 1% penicillin/ streptomycin. To block mTORC1 signaling, MLN0128 (LC Laboratories), a second generation of mTOR kinase inhibitor was diluted to gradient concentration and added to the cells. Dimethyl sulfoxide (DMSO) was diluted and used as control. After 48 hours treatment, cells were stained with crystal violet or collected for protein analysis. Cell proliferation and apoptosis were assessed using the BrdU Cell Proliferation Assay Kit (Cell Signaling Technology Inc) and the Cell Death Detection Elisa Plus Kit (Roche Molecular Biochemicals, Indianapolis, IN), respectively, following the manufacturers’ instructions.
|
study
| 99.94 |
For amino acid deprivation experiments, Amino Acid Free Medium (US Biological, Salem, MA) was added to the cells. Subsequently, cells were stained with crystal violet or collected for protein analysis. For gene silencing studies, cells were plated in 6-well plates and transfected with 30 pmol siRNA targeting YAP (ID# s20366; ThermoFisher Scientific, Waltham, MA), TAZ (ID# s24789; ThermoFisher Scientific), TEAD4 (ID# 107036; ThermoFisher Scientific), and β-catenin (ID# AM51331; ThermoFisher Scientific), either alone or in combination using Lipofectamine RNAiMAX (Life Technologies) according to the manufacturer’s instructions. A scramble small interfering RNA (siRNA; ID# 4390844; ThermoFisher Scientific) was used as negative control RNA. 48-72h post transfection, cells were collected for protein and RNA analysis. Experiments were repeated at least three times in triplicate.
|
study
| 100.0 |
Cells were crosslinked in 1% formaldehyde (Polysciences, Inc. #18814) for 7 min at room temperature. After glycine quenching, cell pellets were collected, and sonicated using the Diagenode Bioruptor. Sonication was performed at high power, 30s on, 30s off, 5 min per cycle, for a total of 3 cycles. The sheared chromatin was incubated with protein A beads (ZYMO Research, Irvine, CA) and antibodies (YAP, 14074, Cell Signaling Technology; or Rabbit IgG, 2729, Cell Signaling Technology). DNA was purified using the Zymo-Spin ChIP Kit (D5210) and quantified by PCR. The primer sequences used for PCR were: human SLC38A1 promoter region primer forward (F): 5’- CAAGATTTGGATGTGCCACTTAG -3’; human SLC38A1 promoter region primer reverse (R): 5’- TGATTCCTCTATTCACTGTGTGCT-3’.
|
study
| 99.94 |
Liver tissues or cell pellets were homogenized or suspended in lysis buffer [30 mM Tris (pH 7.5), 150 mM NaCl, 1% NP-40, 0.5% Na deoxycholate, 0.1% SDS, 10% glycerol, and 2mM EDTA] containing the Complete Protease Inhibitor Cocktail (ThermoFisher Scientific). Protein concentrations were determined with the Bio-Rad Protein Assay Kit (Bio-Rad, Hercules, CA) using bovine serum albumin as a standard. Aliquots of 30 μg lysates were denatured by boiling in Tris-Glycine SDS Sample Buffer (Bio-Rad), separated by SDS-PAGE, and transferred to nitrocellulose membranes (Bio-Rad) by electroblotting. Membranes were blocked in 5% non-fat dry milk in Tris-buffered saline containing 0.1% Tween 20 for 1 hour and probed with following specific antibodies: AKT (9272), Phospho-AKT(S473) (4060), Phospho-AKT(T308) (13038), Phospho-mTOR (2971), Phospho-p70 S6 Kinase (9205), Phospho-RPS6 (4858), Phospho-4E-BP1(T37/46) (2855), Phospho-4E-BP1(S65) (9451), Phospho-NDRG1 (5482), Survivin (2808), YAP/TAZ (8418), Cleaved Caspase-3 (CC-3) (9664), Mcl-1 (94296), Bcl-Xl (2764), Bak (12105; Cell Signaling Technology), SLC38A1 (HPA052272; Sigma-Aldrich, St. Louis, MO). Anti-β-catenin antibody (610153) was purchased from BD Biosciences (Franklin Lakes, NJ). Anti-GAPDH (MAB374; EMD Millipore, Billerica, MA), anti-β-Actin (A5441; Sigma-Aldrich, St. Louis, MO), and anti-β-tubulin (6046; Abcam) antibodies were used as loading controls. Each primary antibody was followed by incubation with horseradish peroxidase-secondary antibody (Jackson ImmunoResearch Laboratories Inc., West Grove, PA) diluted 1:10000 for 1 hour and then visualized by the Super Signal West Dura (ThermoFisher Scientific). For nuclear protein extraction, proteins were extracted by using the Cytoplasmic Extraction Reagent I and II (ThermoFisher Scientific). After thoroughly removing the supernatant (cytoplasmic extract), Nuclear Extraction Reagent (ThermoFisher Scientific) was added for the nuclear protein extraction. Aliquots of 5-10 μg of nuclear and cytoplasmic lysates were used for Western blotting. Isolation of cytoplasmic proteins was validated by β-tubulin, while Histone H3 (D1H2) (4499; Cell Signaling Technology) was used as loading control of nuclear proteins.
|
study
| 100.0 |
qRT-PCR reactions were performed with 100 ng of cDNA on the whole sample collection and cell lines, using an ABI Prism 7000 Sequence Detection System and TaqMan Universal PCR Master Mix (ThermoFisher Scientific). Reaction conditions were: 10 min of denaturation at 95°C and 40 cycles at 95°C for 15 s and at 60°C for 1 min. Quantitative values were calculated by the PE Biosystems Analysis software and expressed as N target (NT). NT = 2-ΔCt, wherein ΔCt value of each sample was calculated by subtracting the average Ct value of the target gene from the average Ct value of the ribosomal RNA (rRNA) gene. Primers used in the study include: 18S rRNA Forward (F): 5’-CGGCTACCACATCCAAGGAA-3’, Reverse (R): 5’-GCTGGAATTACCGCGGCT-3’; Mouse CTGF: F: 5’-GGGCCTCTTCTGCGATTTC-3’, R: 5’- ATCCAGGCAAGTGCATTGGTA-3’; Mouse SLC38A1: F: 5′-AGCAACGACTCTAATGACTTCAC-3’, R: 5’-CCTCCTACTCTCCCGATCTGA-3’; Mouse SLC7A5: F: 5′-CTACGCCTACATGCTGGAGG-3’, R: 5’-GAGGGCCGAATGATGAGCAG-3’; Mouse SLC1A5: F: 5′-TTCGCTATCGTCTTTGGTGTG-3’, R: 5’-ATGGTGGCATCATTGAAGGAG-3’; Human CTGF: F: 5′-CAGCATGGACGTTCGTCTG-3’, R: 5’-AACCACGGTTTGGTCCTTGG-3’; Human CYR61: F: 5′-GGTCAAAGTTACCGGGCAGT-3’, R: 5’-GGAGGCATCGAATCCCAGC-3’; Human SLC38A1: F: 5′-AACCTCCTTAGGCATGTCTGT-3’, R: 5’-GCAAAGGCGAGTCCCAAAAT-3’; Human YAP1: F: 5’-TAGCCCTGCGTAGCCAGTTA-3’, R: 5’-TCATGCTTAGTCCACTGTCTGT-3’; Human TEAD4: F: 5’-GGACACTACTCTTACCGCATCC-3’, R: 5’-TCAAAGACATAGGCAATGCACA-3’; Human FOXM1: F: 5’-TTGCCCGAGCACTTGGAATC-3’, R: 5’-GTATGAGCTGACCCGTGGT-3’. Predesigned primers for human β-catenin (ID# Hs00355049_m1) were purchased from Applied Biosystems (Foster City, CA).
|
study
| 100.0 |
Liver specimens were fixed in 4% paraformaldehyde overnight at 4°C and embedded in paraffin. Hematoxylin & Eosin (H&E) staining on 4μm liver sections was performed to characterize histopathologically liver preneoplastic and neoplastic lesions in mice. Immunohistochemistry was performed as described previously . Briefly, antigen retrieval was achieved in deparaffinized sections by boiling in 10mM sodium citrate buffer (pH 6.0) for 10 min. After a blocking step with the 5% goat serum and Avidin-Biotin blocking kit (Vector Laboratories, Burlingame, CA), the slides were incubated with primary antibodies overnight at 4°C. Primary antibodies used for the experiment are as follows: p-RPS6 (4858; Cell Signaling Technology), Ki67 (RM-9106; Thermo Fisher Scientific), p-4EBP1 (2855; Cell Signaling Technology), and SLC38A1 (HPA052272; Sigma-Aldrich, St. Louis, MO). These primary antibodies were selected for the analysis since they have been extensively validated by the manufacturers for immunohistochemistry. After washes, slides were incubated in 3% H2O2 for 20 minutes to quench the endogenous peroxidase, then followed by one hour of secondary antibody incubation. Signal was detected by the Vectastain ABC Elite Kit (Vector Laboratories) and visualized by DAB (Vector Laboratories).
|
study
| 99.94 |
A collection of formalin-fixed, paraffin-embedded human HB (n = 28) samples was used in the present study. The clinicopathological features of liver cancer patients are summarized in Table 2. HB specimens were collected at the Medical University of Greifswald (Greifswald, Germany) and from the Archives of the Pathology Departments of Semmelweis University (Budapest, Hungary). Institutional Review Board approval was obtained at the local Ethical Committee of the Medical University of Greifswald and the Regional Ethical Committee of the Semmelweis University. Informed consent was obtained from all subjects.
|
study
| 99.94 |
All data are presented as mean ± SEM. Statistical analysis was performed using two-tailed unpaired t test or Tukey-Kramer test. P value < 0.05 was considered significant. Overall survival was estimated according to Kaplan-Meier and Log-rank (Mantel-Cox) test. All statistics were performed with Prism 6, version 6.0 (GraphPad Software Inc., La Jolla, CA).
|
study
| 99.9 |
In the large boreal forest of Canada, global warming should be leading to an increase in average daily temperature of at least 2 °C (scenario B1) by 2050 (IPCC, 2014) and to rises in the frequency and duration of summertime episodes of extreme heat waves and drought (Romero-Lankao et al., 2014). It is unclear today whether changes in average climatic factors or extreme events will be the main drivers of species responses to climate change. Downregulation of net CO2 uptake as a result of global warming may reduce species fitness and ecosystem feedback on the global carbon cycle (Sage et al., 2008). It is important to understand how physiological processes involved in photosynthetic and respiration rates will respond to future climatic regimes in order to (1) accurately predict climate change effect on carbon uptake at different scales (Way and Yamori, 2014), (2) reduce the uncertainty around the anticipated feedbacks of forest ecosystems, and global carbon cycle to climate change (Niu et al., 2012; Girardin et al., 2016) and (3) determine the intrinsic acclimation and genetic abilities of tree species to adapt to climate change in the short and longer terms (Bigras, 2000; Way and Sage, 2008b; Gunderson et al., 2010). Thermal acclimation of both dark respiration (Rd) and net photosynthetic rate (An) through biochemical, biophysical and structural adjustments may help plants to maintain a positive carbon balance in warming conditions (Medlyn et al., 2002; Atkin et al., 2005; Sage et al., 2008; Way and Yamori, 2014). However, the extent to which thermal acclimation may help boreal conifer species to cope with global warming remains poorly understood. Currently, few reports show a lack, or very limited thermal acclimation, of An for boreal tree species (Way and Sage, 2008a, b; Dillaway and Kruger, 2010; Ow et al., 2010; Silim et al., 2010; Zhang et al., 2015). Conversely, it has been reported that boreal tree species may show a moderate to strong thermal acclimation of Rd in response to experimental warming (Gunderson et al., 2000; Ow et al., 2008; Way and Sage, 2008b; Silim et al., 2010; Zhang et al., 2015; Reich et al., 2016), or following a thermal latitudinal gradient (Tjoelker et al., 2009; Dillaway and Kruger, 2011).
|
review
| 98.0 |
Thermal acclimation of CO2 exchange has been mostly investigated in controlled conditions using static day–night temperature treatments or from seasonal variation in CO2 exchange in response to the seasonal courses of temperature (Hikosaka et al., 2006; Way and Yamori, 2014; Yamori et al., 2014). Although these studies helped increase our understanding of the processes involved in thermal acclimation, their results cannot realistically be used to infer thermal responses in natural conditions, and consequently to better evaluate the quantitative aspects of tree responses to global warming. The main reason for this is the lack of representation of diurnal and daily temperature variations during the growing season, which are especially important in boreal regions. In addition, it is unclear whether or not thermal acclimation of An to temporal variation in temperature during the growing season and spatial variation in temperature along a climate gradient may result from similar physiological adjustments. In fact, the predominant role of photoperiod in the regulation of the seasonal pattern of photosynthetic rate, also known as the phenology of photosynthesis, is still largely controversial for tree species (Busch et al., 2007; Bauerle et al., 2012; Stinziano and Way, 2017).
|
review
| 99.0 |
Thermal acclimation of both An and Rdvaries widely among tree species depending on their thermal environment (Aitken et al., 2008; Dillaway and Kruger, 2010; Way and Yamori, 2014; Reich et al., 2016). Thermal acclimation of An can improve or at least maintain plant photosynthetic performance when the growth temperature regime shifts from cold to warm through adjustments of one or more photosynthetic components (Way and Yamori, 2014). This may occur via (1) the shift in the thermal optimum of An (Topt) towards the warm growing temperature, (2) the increase or maintenance of the photosynthetic rate at Topt (Aopt) in the new growing temperature conditions, (3) the shift in both Aopt and Topt (Way and Yamori, 2014), or (4) the increase or maintenance of the photosynthetic rate with respect to growth temperature (Agrowth). The mechanisms involved in thermal acclimation of photosynthesis include adjustment in (1) thermal responses of both maximum rate of carboxylation (Vcmax) and maximum electron transport rate (Jmax) (activation and deactivation energy), (2) basal Vcmax measured at a reference temperature of 25 °C (Vcmax25) and Jmax25, (3) the ratio of Jmax25 to Vcmax25, and (4) thermal responses of mesophyll (gm) and stomatal conductance (gs) (Kattge and Knorr, 2007; Warren, 2008; Silim et al., 2010; Way and Yamori, 2014).
|
study
| 99.94 |
Thermal acclimation of Rd in response to the increase in temperature may occur via (i) a downregulation of the basal rate of Rd (so-called type II acclimation), (2) a decrease in Q10 (rise in Rd with a 10 °C increase in temperature) (type I acclimation), or (3) a combination of both types (Atkin and Tjoelker, 2003; Atkin et al., 2005; Way and Yamori, 2014; Reich et al., 2016).
|
study
| 99.94 |
Mineral nutrition is one of several physiological attributes that contribute to the improvement of survival, growth and physiology of tree seedlings after outplanting (Margolis and Brand, 1990). Several studies showed that net photosynthesis, dark respiration and survival were closely related to nitrogen levels in needles (Lamhamedi and Bernier, 1994; Tjoelker et al., 1999; Poorter et al., 2009). Needle nitrogen concentration (Nmass) varies with site climatic conditions, including temperature (Friend et al., 1989). However, little is known about the role of Nmass in thermal acclimation of An and Rd. For instance, Tjoelker et al. (2009) showed that both type I and II acclimation of Rd were unrelated to Nmass in Pinus banksiana.
|
study
| 99.94 |
Clinal variation in growth and other functional traits as a result of local genetic adaptation to climate of origin has been reported for several boreal tree species (Li et al., 1997; Andalo et al., 2005; Aitken et al., 2008; Benomar et al., 2016). However, little evidence exists regarding the genetic differentiation in the thermal acclimation capacity and its involvement in growth clinal variation. Recently, Drake et al. (2017) found similar thermal responses (both An and Rd) in response to an experimental warming (under controlled conditions) of three seed sources of Eucalyptus tereticornis despite a large geographical distance among them and a 13 °C difference in mean annual temperature at seed origin. Similar results were reported for Pinus banksiana (Tjoelker et al., 2009). In contrast, Ishikawa et al. (2007) showed intraspecific variation in thermal acclimation of An among Plantago asiatica populations, which was related to the capacity of adjustement of the Jmax25 to Vcmax25 ratio.
|
study
| 99.75 |
White spruce (Picea glauca) is one of the ecologically and commercially most important conifer species of the boreal forest of Canada (Beaulieu et al., 2009). It is the subject of large reforestation efforts and several intensive breeding programmes in Canada (Mullin et al., 2011). It has been shown not to be optimally adapted to local climate conditions in relation to recent temperature warming (e.g. Andalo et al., 2005). But to our knowledge, no one has investigated the temperature response of both photosynthesis and respiration to determine the thermal acclimation capacity and potential adaptive differences among seed sources from geographically distant regions, which could affect the productivity of forest ecosystems and assisted migration strategies. The objectives of this study were (1) to evaluate the thermal acclimation of photosynthesis and respiration of two geographically distant white spruce seed sources in response to short-term variation in climatic conditions during a growing season and to long-term variation in growing conditions along a regional thermal gradient of 5.5 °C, and (2) to assess the involvement of morphological, biochemical and biophysical processes in the temperature response of photosynthesis.
|
study
| 99.94 |
The two white spruce seed sources used in this study were chosen to represent the south and north of the large commercial forest zone in Québec. They came from two first-generation seed orchards (SO1-1 and SO1-5) commonly used for reforestation in Québec, Canada (Fig. 1), distant from each other by 550 km and 2.2° of latitude (Table 1). They are clonal seed orchards made of grafted plus-trees that were selected in local natural stands. They each pertain to one of the two broadly defined white spruce breeding zones in Québec, Canada, which differ mostly in latitude and associated mean annual temperature (Li et al., 1997). Orchard SO1-1 represents the southern seed source and SO1-5 the northern seed source (Fig. 1). Open-pollinated seeds were collected in each seed orchard for two consecutive years (2008 and 2009) and mixed, making up one seedlot per seed orchard. Seedling production was conducted under nursery conditions at the Pépinière forestière of Saint-Modeste (Québec, Canada, 47°50′ N, 69°30′ W) and subjected to standard cultural practices during two consecutive growing seasons (Lamhamedi et al., 2006; Villeneuve et al., 2016).
|
study
| 100.0 |
Eight forest sites representative of the white spruce commercial zone in Québec, Canada, were selected for this study (Table 1, Fig. 1). They cover latitudinal and longitudinal transects of 4.6° and 14°, respectively. Plantations were established in the spring of 2013 for the localities of Watford, Asselin and Deville, in the spring of 2014 for the localities of Wendover, Picard and Lac Bergeron, and in the spring of 2015 for the localities of Dorion and Rousseau. The Watford and Wendover sites were formerly occupied by black spruce (Picea mariana) plantations that were harvested in 2012. All other sites, covered by natural forest stands, were also harvested in 2012. Physico-chemical soil properties of plantation sites assessed during the second growing season after plantation are provided in Supplementary Data Table S1.
|
study
| 99.94 |
Two-year-old seedlings were planted at densities of 2000 stems per hectare. Seedling height and root collar diameter (mean ± s.d.) before planting were 38.3 ± 3.6 and 6.9 ± 0.9 mm respectively. Before planting, seedling nutrient concentrations (stem, needles and roots) were assessed using three composite samples (five seedlings/composite sample) per seed orchard (data not shown). The results confirmed that the seedlings met the 28 morphophysiological standards used for white spruce containerized seedling production in Québec (Veilleux et al., 2010).
|
study
| 100.0 |
Seedlings were planted at each site following a randomized complete block design with four blocks. Each seed source was randomly assigned to a plot within a block. The size of each plot was about 730 m2 and contained 144 trees (12 × 12 rows of trees) in which only the 64 interior trees were considered for analyses, leaving 4 × 4 rows of border trees as a buffer zone. The total number of planted seedlings was 9216, corresponding to 144 seedlings × 4 blocks × 2 seed sources × 8 sites.
|
study
| 99.94 |
For each plantation site, climatic data (Table 1) were interpolated from data collected from 2013–16 in nearby weather stations using the BioSIM software (Régnière and St-Amant, 2007). Furthermore, permanent weather stations were installed in the Watford, Asselin and Deville sites since 2013, with collected data used to confirm the accuracy of BioSIM data. Climate conditions varied considerably among the sites during the two years of the experiment (Table 1). Mean annual temperature (MAT) was highly influenced by site location. It differed by 5.5 °C between the coolest and the warmest sites. Total growing season precipitation (TGSP) decreased with the longitude of the plantation sites (Table 1).
|
study
| 100.0 |
Natural climatic gradients usually consider geographical and environmental factors such as latitude, longitude, altitude, annual and seasonal mean temperature and precipitation. In the present study, the term ‘climatic gradient’ is used as a simplifier and refers to the annual and seasonal mean temperature gradient, given that the focus of our study was mostly related to change in temperature regime, which was the most variable climatic factor among the plantation sites (Table 1).
|
study
| 100.0 |
Gas exchange measurements were made with two portable open-path gas-exchange systems (Li-6400, Li-Cor, Lincoln, NE, USA), equipped with a Lighted Conifer Chamber (6400-22L, Li-Cor, Lincoln, NE, USA) and the expanded Temperature Control Kit (6400-88, Li-Cor, Lincoln, NE, USA). Temperature (T) response curves of shoot respiration (Rd–T) and net photosynthesis (An–T) were generated for one randomly selected plant per plot at each plantation site (2 seed sources × 3 blocks × 8 sites = 48). Both An–T and Rd–T curves were assessed using 1-year-old needles of the uppermost lateral shoot. The measurements were carried out in June 2015 in the plantations of Watford, Asselin, Deville, Wendover and Lac Bergeron, and in June 2016 in the plantations of Watford, Dorion, Picard and Rousseau. At the Watford, Asselin, Deville and Picard sites, plants were at their third growing season, whereas those at the remaining sites were at their second growing season. The results obtained in Watford during the third and fourth growing seasons were quite similar for thermal acclimation-related traits, which suggested the absence of an age effect on the observed patterns.
|
study
| 100.0 |
The expanded temperature control kit, which contains two water jackets through which water is circulated using a submersible pump, was used to make measurements at low temperatures (10 and 15 °C). The water channels were connected to a water bath and the temperature was controlled by adding ice water. For temperatures above 25 °C, the seedling and the entire gas-exchange system were covered by a plastic tent (hand-made closed chamber using transparent plastic and wood pickets, and measuring 1 m × 1 m 1.5 m). The temperature within the plastic tent was brought to the desired temperature, i.e. between 30 and 40 °C, using a portable 1500 W ceramic heater (CZ448, Comfort Zone, Pottsville, PA, USA). This made it possible to maintain the difference between the ambient air and that within the conifer chamber below 2 °C, and to prevent water condensation in the exhaust tube or in the cuvette. In fact, because of the large volume of the conifer chambers, there is an important issue of water condensation when the temperature in the chamber is warmer than that of the entering air.
|
study
| 99.6 |
Cuvette temperature during measurement varied systematically from low (10 °C) to high (40 °C) by 5 °C increments, and measurements were taken systematically in order from low to high temperature. Seedlings were allowed to acclimate for at least 20 min for each new temperature, before recording data. The attachment points of the shoot to the cuvette walls were taped (adhesive putty) to avoid leaks into and out of the cuvette. Photosynthesis (An) was measured under saturating photosynthetically active radiation (PAR = 1000 µmol m−2 s−1) and at 400 µmol mol−1 of CO2. Following An measurement, the light source was turned off and Rd was recorded after at least 15 min of darkness. The vapor pressure deficit (VPD) in the conifer chamber ranged from 0.6 to 3.6 kPa. During measurement, the entering air passed through the drierite column (anhydrous calcium sulphate) to maintain the air humidity (RH) below 75 % at the lower temperature (10 °C). At higher temperatures, a minimum RH of 45 % was maintained by adding water vapour to the air inside the plastic chamber. For each sample, data required to build An–T and Rd–T curves were collected generally within 4–5 h.
|
study
| 100.0 |
Seasonal patterns of Rd–T and An–T were determined at the Watford site during the growing season of 2016. The measurements were taken each month from May to October. The measurements were performed on the same shoot from six seedlings that were different from those used previously for A–Ci–T (see below) and those measured in 2015. For practical reasons, we chose the tallest seedlings (with a long shoot) within each subplot. At the end of measurements, in October, the shoots did not show any visible damage and loss of initial leaf area.
|
study
| 99.94 |
During the active growing season, A–Ci response curves at temperature 10, 15, 20, 25, 30, 35 and 40 °C were generated in July 2015 at the Watford and Deville plantation sites (respectively the easiest to access among southern and northern sites) and again in July 2016 at the Watford plantation site. The A–Ci response curve measurements were taken after 20 min of steady-state conditions at the ambient atmospheric CO2 partial pressure (Ca = 400 µmol mol−1) and at saturated photosynthetic active radiation (PAR = 1000 µmol m−2 s−1). Thereafter, for a given temperature, the reference CO2 (Ca) was changed in the following order: 400, 350, 300, 250, 200, 100, 50, 400, 500, 600, 700, 800, 1000, 1200, 1400 and 1500 µmol mol−1. Values were recorded based on the stability of photosynthesis, stomatal conductance, CO2 and water vapour concentrations. For each foliage sample, data collections to build the A–Ci–T curves were completed within two or three consecutive days. Most of the A–Ci curves at 35 and 40 °C measured in 2015 at the Watford and Deville sites failed to converge and estimates could not be obtained. All measured gas exchange were corrected based on the measured projected needles area (see below).
|
study
| 100.0 |
The photosynthetic parameters (Vcmax, Jmax and gm) were estimated simultaneously by fitting the A–Ci curves with the non-rectangular hyperbola version of the biochemical model of C3 (Farquhar et al., 1980) following Ethier and Livingston (2004). This method is based on the principle that mesophyll conductance (gm) is not infinite, which reduces the curvature of the A–Ci curve. The net assimilation rate (An) is given by:
|
study
| 100.0 |
where Vcmax is the maximum rate of carboxylation (µmol CO2 m−2 s−1), O is the partial atmospheric pressure of O2 (mmol mol−1),Γ* is the CO2 compensation point in the absence of mitochondrial respiration, Rday is mitochondrial respiration in the light (µmol CO2 m−2 s−1), Ci is the intercellular concentration of CO2 (µmol mol−1), Cc is the chloroplastic concentration of CO2 (µmol mol−1), Kc (µmol mol−1) and Ko (mmol mol−1) are the Michaelis–Menten constants of Rubisco for CO2 and O2, respectively, J is the rate of electron transport (µmol CO2 m−2 s−1), Jmax is the maximum rate of electron transport (µmol CO2 m−2 s−1), Q is the incident PAR (µmol m−2 s−1), α is the quantum efficiency, which represents the initial slope of the photosynthetic light response curve, and gm is mesophyll conductance (mol CO2 m−2 s−1).
|
study
| 99.44 |
The model was fitted using non-linear regression techniques (Proc NLIN, SAS). To fit the model, the measured dark respiration (Rd) values were used as proxy for Rday in order to reduce the number of parameters estimated by the model. Respiration occurring in daylight (Rday), which is assumed to be primarily mitochondrial respiration, was assumed to approximate dark respiration (Rd), as observed for black spruce by Way and Sage (2008b). The values at 25 °C used for Kc and Ko were 272 µmol mol−1 and 166 mmol mol−1, respectively (Sharkey et al., 2007), and its temperature dependency is given by:
|
study
| 100.0 |
where c is a scaling constant, Ha (kJ mol−1), is the activation energy and R is the universal gas constant. The scaling constant (c) values are 35.98, 12.37 and 11.18 for Kc, Ko and Γ*, respectively. The values of Ha are 80.99, 23.72 and 24.46 for Kc, Ko and Γ*, respectively (Sharkey et al., 2007).
|
study
| 99.94 |
Both Jmax–T and Vcmax–T data showed a deactivation at high temperatures. Thereafter, the response of Vcmax and Jmax to needle temperature were fitted using a modified Arrhenius function (the peaked model) (Johnson et al., 1942) following Medlyn et al. (2002):
|
study
| 100.0 |
where K(Tk) is the Vcmax or Jmax at temperature Tk which is the leaf temperature in Kelvin, K25 is the value of Vcmax or Jmax at Tref = 25 °C, R is the universal gas constant (8.314 J mol−1 K−1), Ha (kJ mol−1) is the activation energy, Hd (kJ mol−1) is the energy of deactivation and ΔS (J mol−1) is an entropy term.
|
other
| 98.3 |
The model was fitted using non-linear regression techniques (Proc NLIN, SAS). The value of Hd was fixed to 200 kJmol−1 according to Medlyn et al. (2002) in order to reduce the number of parameters estimated by the model. However, the model underestimates the value of Topt. Consequently, we first estimated Topt using eqn (9) and then used the obtained value to solve for Ha and ΔS using eqns (11) and (12) simultaneously.
|
study
| 100.0 |
Rubisco-limited (Ac) and RuBP regeneration-limited (Aj) net photosynthetic rates (An) were calculated at temperature ranging from 10 to 40 °C using eqns (2)–(5). Values of Vcmax and J were estimated from fitted parameters in our study. Rday was assumed to approximate Rd (see above).
|
study
| 100.0 |
Following the measurements of gas exchange, the shoots were carefully removed from the cuvette, harvested, placed in plastic bags and refrigerated (−20 °C). Projected needle area was measured using WinSeedle (Version 2007 Pro, Regent Instruments, Québec, Canada). Samples were then oven-dried for 72 h at 56 °C and their dry mass was determined. Specific leaf area (SLA) was calculated as the ratio of projected needle area (cm2) to needle dry mass (g). Dried needles were ground to a fine powder in a ball mill. Needle nitrogen concentration (Nmass, mg g−1) was determined using a LECO elemental analyser (LECO Corporation, St Joseph, MI, USA). Nitrogen on a projected area basis (Narea) was calculated as Nmass divided by SLA.
|
study
| 99.94 |
All analyses were conducted with SAS/STAT software version 9.4 (SAS Institute, Cary, NC, USA). Response variables were analysed separately using a general linear mixed model with the effects of site and seed source (seed orchard) and their interaction considered as fixed effects, while block was treated as a random effect. Data were transformed whenever required to satisfy normality of residuals and homoscedasticity. Means were compared using the Tukey test; differences were considered significant at P < 0.05. We compared Ha, ΔS and Topt for Vcmax, Jmax and gm between the two seed sources by non-parametric tests using proc NPAR1WAY. Proc REG and proc NLIN were used to examine the relationship between response variables and climate of plantation sites. The lack of A–Ci curves at 35 and 40 °C from measurements at the Watford and Deville sites in 2015 made it difficult to examine the site effect on Ha and Topt of Vcmax and Jmax. To overcome this problem, we used a repeated-measures analysis of variance (ANOVA) with temperature from 10 to 30 °C as a repeated measure factor.
|
study
| 100.0 |
Total height growth after two growing seasons (H2) was affected by both site and seed source effects (Table 2). However, the interaction between the two factors was not significant, suggesting that the two seed sources showed similar patterns of growth in response to changes in growing conditions along the climatic gradient (Table 2). The highest and lowest average of H2 were observed at the Dorion (76 ± 11 cm) and Deville (51 ± 7 cm) sites, respectively (Fig. 2). Seedlings from the southern seed source were significantly taller than those from the northern seed source (Fig. 2). No statistically significant relationships could be found between H2 and prevailing climatic and soil conditions at the plantation sites (Supplementary Data Fig. S1).
|
study
| 100.0 |
H 2 (cm), height growth after two growing seasons; Topt (°C), optimal temperature for net (An) and gross (Ag) photosynthetic rate; Aopt (µmol m−2 s−1), photosynthetic rate at Topt. gs_25, stomatal conductance at a reference temperature of 25°C; Q10, rate of change in dark respiration with a 10 °C increase in temperature; Rd10 (µmol m−2 s−1), basal rate of dark respiration (at 10 °C); Nmass, needle nitrogen concentration (mg g−1); SLA, specific leaf area (cm2 g−1).
|
other
| 99.9 |
Total height (mean ± s.d.) at the end of the second growing season (H2) of white spruce seedlings from two seed sources grown at eight forest plantation sites. Means having the same letters are not significantly different at α = 0.05. Wend, Wendover; Dori, Dorion; Watf, Watford; Pica, Picard; Asse, Asselin; Devi, Deville; Rous, Rousseau; LacB, Lac Bergeron; South, southern seed source (SO1-1); north, northern seed source (SO1-5).
|
study
| 99.5 |
The temperature response curves of both net and gross photosynthesis followed a parabolic shape (Fig. 3). The thermal optimum (Topt) of net photosynthesis (An) averaged 19 ± 1.2 °C and was not variable across plantation sites and seed sources (Tables 2 and 3). Net photosynthetic rate (Aopt) at Topt varied significantly among sites (Table 2), with the lowest value of Aopt occurring at the Wendover and Lac Bergeron sites, which were the warmest and coldest sites, respectively (Table 3). Aopt followed a quadratic relationship with mean July temperature of the plantation site (MJT) for the southern seed source but not for the northern one (Fig. 4). Basal rate of Rd (Rd10) and Q10 showed similar responses among seed sources but differed across plantation sites (Table 2). The lowest mean values of Rd10 were measured at the warmest sites, such as Wendover and Dorion (Table 3), while the highest mean values of Q10 occurred at Lac Bergeron, the coldest plantation site (Table 3). Topt and Q10 of dark respiration were not related to climatic variables at the plantation sites (Fig. 4). Rd10 was negatively and linearly related to MJT for the southern seed source (Fig. 4). The temperature response curve of gross photosynthesis (Ag) showed a shape similar to that of An (Fig. 3). The average Topt of Ag, 22.7 ± 1.3 °C, was not affected by either site or seed source (Table 2).
|
study
| 100.0 |
Temperature response curves of (A) net photosynthesis (An), (B) dark respiration (Rd), and (C) gross photosynthesis (Ag) of two geographically distant white spruce seed sources grown in eight plantation sites (n = 6). For site abbreviations see legend of Fig. 2. At Picard (Pica), the measurements were limited to Rd and the northern seed source.
|
study
| 99.9 |
Thermal optimum (Topt) and Aopt of An varied greatly during the growing season (from May to October). Topt and Aopt showed no interaction effect of seed source and month during the growing season (Table 4). Mean Topt varied from 12.6 to 19.5 °C and was highest in June and August and lowest in May (Fig. 5). Mean Aopt was higher in June than in May (Fig. 5). Both Aopt for the northern seed source and Topt for both seed sources were correlated with mean temperature 5 d before measurements (Fig. 4). The basal rate of Rd (Rd10) but not Q10 varied greatly during the growing season and neither of them showed any interaction effect of seed source and month (Table 4). Mean Rd10 was higher in May than in the remaining months excluding October (Fig. 5). Rd10 was negatively and linearly related to mean temperature 5 d before measurements (Fig. 4). In contrast, Q10 was not related to mean temperature 5 d before measurements (Fig. 4).
|
study
| 100.0 |
Relationships of thermal acclimation-related traits with climatic conditions along a latitudinal gradient (spatial) and during a growing season (temporal gradient) for two geographically distant white spruce seed sources. MJT, mean July temperature of plantation site during the two growing seasons (1 year before and current year of measurement); MTBM, mean temperature 5 d before measurements; Topt, optimal temperature for net photosynthetic rate; Aopt, photosynthetic rate at Topt; Rd10, basal rate of respiration (T = 10 °C); Q10, rate of change in Rd with a 10 °C increase in temperature. South SS, southern seed source (SO1-1); North SS, northern seed source (SO1-5).
|
study
| 99.94 |
Seasonal patterns of thermal acclimation-related traits of two geographically distant white spruce seed sources during the 2016 growing season in the Watford plantation site. Values are mean ± s.d, n = 6. Values for July are not included in the anlaysis because they are from other seedlings (those used for A–Ci curve measurements). Means having the same letters are not significantly different α = 0.05. For abbreviations see legend of Fig. 4.
|
study
| 99.94 |
For the 2015 measurements (third growing season), repeated measures ANOVA showed that the temperature response curve of Vcmax and Jmax (for temperatures between 10 and 30 °C) was not different between the southern (Watford) and northern (Deville) plantation sites (Table 5). The Jmax25:Vcmax25 ratio averaged 2.5 ± 0.2 and was also not different between the two plantation sites and not different between the two seed sources. For the measurements conducted only in the Watford plantation site in 2016 (fourth growing season), the temperature response curve of Vcmax, Jmax and gm displayed marked increases with temperature, followed by decreases above Topt (Fig. 6). The optimal temperature (Topt) for Vcmax and Jmax was higher for the southern seed source than for the northern one (Table 6). Topt for gm was similar for the two seed sources and averaged 28 ± 1.1 °C. The activation energy (Ha) for Jmax was greater for the southern seed source than for northern one but this was not the case for Vcmax (Table 6). Also, the entropy term of Vcmax was greater for the northern seed source than for the southern one (Table 6).
|
study
| 100.0 |
Repeated-measures ANOVA of maximal rate of carboxylation (Vcmax) and maximal rate of electron transport (Jmax) in response to needle temperature of two geographically distant white spruce seed sources during the third growing season in Watford and Deville plantation sites (respectively the easiest to access among southern and northern sites)
|
study
| 99.6 |
Temperature response curve of (A) the maximum carboxylation capacity of rubisco (Vcmax), (B) the maximum electron transport rate (Jmax) and (C) mesophyll conductance to CO2 (gm) of two geographically distant white spruce seed sources measured in the Watford plantation site in 2016 (fourth growing season) (n = 3). South SS, southern seed source (SO1-1); North SS, northern seed source (SO1-5).
|
study
| 99.94 |
The temperature responses of Rubisco-limited (Ac) and RuBP regeneration-limited (Aj) net photosynthesis (An) were similar among seed sources. Except at 40 °C, Aj was higher than Ac (Fig. 7). Consequently, changes in temperature dependence of photosynthesis were mainly Vcmax-dependent for temperature range between 10 and 40 °C.
|
study
| 100.0 |
Biochemical limitations of An in response to needle temperature for (A) the southern seed source and (B) the northern seed source. An was modelled at Ca= 400 ppm by Farquhar modelling using measured gs and estimated gm from A–Ci. The response of An is defined by the minimum value of either Rubisco-limited (Ac) (solid curve) or RuBP regeneration-limited (Aj) net photosynthesis (dashed curve).
|
study
| 99.94 |
Specific leaf area was not affected either by site or seed source (Table 2; Supplementary Data Fig. S2). In addition, it was not related to the climate of the plantation sites (MJT) (P ≥ 0.10). Needle nitrogen concentration (Nmass) was similar among seed sources but was affected by sites (Table 2). Similar results were obtained using needle nitrogen content per unit of needle projected area. Mean Nmass was greater in the Asselin, Deville and Picard sites than in the Lac Bergeron, Wendover and Dorion sites (Supplementary Data Fig. S2). Both Rd10 and Aopt were unrelated to leaf nitrogen (Nmass) (Supplementary Data Fig. S3).
|
study
| 100.0 |
Under future climate change, temperature will likely remain the most important factor driving boreal forest productivity and species distribution, with potential effects on the composition and structure of natural populations. However, thermal acclimation of physiological processes, particularly photosynthesis, could help mitigate the predicted decrease in net productivity associated with global warming (Way and Yamori, 2014; Girardin et al., 2016). Consequently, a better understanding of acclimation of both photosynthesis (An) and dark respiration (Rd) to warming might provide valuable information to predict the capacity of species to adapt under climate change, and help improve the predictive accuracy of process-based models (Slot et al., 2014; Lombardozzi et al., 2015). Investigations of thermal acclimation of An and Rd in natural conditions are limited compared with those conducted under controlled conditions. Studies conducted along a natural latitudinal gradient should be valuable to investigate growth habit and the thermal acclimation capacity at the intraspecific level, as it takes into account the seasonal fluctuations in temperature (monthly and daily temperature range) as well as the complex interactions with other climatic and non-climatic factors. The present study provides an exhaustive assessment of thermal acclimation of photosynthesis and dark respiration for a conifer under natural conditions, with valuable insights into the temperature responses of photosynthetic capacity attributes (Vcmax and Jmax) and mesophyll conductance under natural conditions. The present results are original in clearly showing a lack of thermal acclimation of net photosynthesis (An) and evidence for type II acclimation of dark respiration (Rd) in response to long-term (2–4 years) variation in temperature along the regional climatic gradient of 5.5 °C for both the southern and northern white spruce seed sources tested.
|
study
| 99.94 |
Boreal tree species, which are well adapted to cold temperature, were often assumed to be limited in their capacity to adapt to warm conditions (Girardin et al., 2016). We showed that the qualitative aspect of thermal acclimation of photosynthesis, such as the ability to shift the thermal optimum (Topt) of An, was lacking. Topt was similar along the climatic gradient and was close to the mean July temperature at southern plantation sites. Our results do not agree with those of previous studies on other species of Picea conducted in controlled conditions, which showed a shift in Topt when the growing temperature was increased by 10 °C (Way and Sage, 2008a; Zhang et al., 2015). Despite the variation in mean temperature (MAT and MJT), a similar range of temperatures (minimum and maximum) along the climatic gradient tested here may explain the unchanging Topt of photosynthesis observed in our study. Increased or constant photosynthetic rate at Topt towards a warmer environment has been widely used as a quantitative proxy of thermal acclimation of photosynthesis (Way and Yamori, 2014). In accordance with results of previous studies on other Picea species (Way and Sage, 2008a; Zhang et al., 2015), we showed the inability of the two seed sources to maintain photosynthetic performance (Aopt) in warmer sites. In addition, the relationship between Aopt and the growing temperature along the gradient followed a quadratic shape, which may suggest adaptation to a narrow climate niche. However, this pattern may also result from complex interaction between soil and climatic conditions (temperature and precipitation) along the climatic gradient tested here rather than temperature per se (Reich and Oleksyn, 2004; Chi et al., 2013; Scafaro et al., 2016). In our study, variation in leaf nitrogen content appeared to play a minor role in photosynthetic adjustments.
|
study
| 100.0 |
In the present study, the temperature response of An was Rubisco-limited (Vcmax) over the entire range of needle temperature (10–40 °C), which follows the common trend observed for cold-adapted species (Kattge and Knorr, 2007; Sage and Kubien, 2007; Sage et al., 2008; Yamori et al., 2010). This result suggests that the observed lack of thermal acclimation potential of white spruce may result from (1) lack of nitrogen reallocation from Aj to Ac and (2) Rubisco activase (RCA) lability. The similar Jmax25:Vcmax25 ratio between the southern and northern plantation sites is in accordance with our previous results during the second growing season at the same sites for six seed sources, including those used here (Benomar et al., 2016), and with other reports (Sage et al., 2008; Dillaway and Kruger, 2010). This lack of adjustment of nitrogen invested in Rubisco (and other soluble proteins involved in the Calvin cycle) may be due to cold adaptation-related constraints on nitrogen allocation. In fact, it has been reported that cold-adapted species allocate more nitrogen to Jmax as a compensatory response to low temperature (Yamori et al., 2010). Vcmax depends not only on Rubisco concentration but also on its activation state (inhibited/activated) (Salvucci and Crafts-Brandner, 2004; Sage et al., 2008). The activation state of Rubisco is regulated by RCA, a heat-labile enzyme using energy via ATP hydrolysis to release inhibitors from the active site of Rubisco (Crafts-Brandner and Salvucci, 2000; Yamori and von Caemmerer, 2009). A decrease in RCA activity has been documented as a primary cause of reduced Rubisco activity and then photosynthetic performance in response to increasing growth temperature (Yamori and von Caemmerer, 2009). Investigations regarding genetic variation in RCA and its activity in response to temperature in white spruce would help refine our understanding of the observed biochemical photosynthetic responses to temperature.
|
study
| 100.0 |
Although a lack of thermal acclimation of photosynthesis seems to be common to all boreal tree species (Way and Sage, 2008a; Dillaway and Kruger, 2010), thermal acclimation of dark respiration was reported to be moderate to strong for several tree species of the boreal forest, including white spruce (Tjoelker et al., 1999, 2009; Dillaway and Kruger, 2011; Reich et al., 2016; Wei et al., 2017). It seems that the firm acclimation of Rd (predominantly by the downshift in Q10) could reduce the negative impact of rising temperatures on photosynthesis under climate change (Atkin et al., 2005; Reich et al., 2016). In accordance with the recent results of Reich et al. (2016) for white spruce and the results of Tjoelker et al. (1999) for black spruce, we showed evidence for type II acclimation of Rd, as indicated by a downshift of Rd10 with increasing plantation site temperature. However, we could not show consistent evidence for type I acclimation of Rd (Fig. 4) as in Reich et al. (2016), and Tjoelker et al. (1999) for different white spruce and black spruce seed sources. The average Q10 value (1.50 ± 0.15) observed in this study was similar to that obtained with a white spruce population from northern Minnesota, USA (Reich et al., 2016). The small change noted in Q10 was not congruent with the important change in climate observed from site to site. Whether this lack of change in Q10 is related to the regional temperature gradient and seed sources tested in the present study, or to intrinsic species physiological performance needs to be examined (Wei et al., 2017).
|
study
| 100.0 |
Needle nitrogen concentration had little impact on the thermal acclimation of Rd, as indicated by similar results when Rd was expressed in nitrogen units. The observed type II acclimation of Rd might be a consequence of a change in needle mitochondria density or by mitochondrial overexpression of alternative oxidase (AOX) (Atkin et al., 2005).
|
study
| 100.0 |
We observed thermal acclimation of both needle respiration and photosynthetic rate in response to seasonal variation in temperature (i.e. reduction in Rd10 at higher temperatures and increase in Topt and Aopt with increasing temperature). Aopt reached a maximum value in June and September, with a clear linear relationship with temperature as expressed in 5-d mean temperature windows. It is still unclear whether photosynthesis phenology relies on temperature or photoperiod cues (Busch et al., 2007; Bauerle et al., 2012; Stinziano and Way, 2017). Unfortunately, our results cannot help clarify this issue. In fact, the decrease in An from June to August may be related to a decline in photosynthesis following bud set or to the increase in mean temperature. On the other hand, the increase in An from August to September cannot be linked to photoperiod. The similar values of Topt observed from June to August is in accordance to the pattern along the latitudinal gradient. The strong adjustment in Topt to lower temperatures in May and October, which may relate to a change in the activation energy of Vcmax, represents good evidence for higher acclimation of An to cold temperature in white spruce. The latter may explain the higher performance of seed sources from Québec in northern regions of Canada, such as Alberta (Lu et al., 2014).
|
study
| 100.0 |
The temperature at the location of origin of seed sources (climate of origin) in our study had no effect on their thermal acclimation-related traits. This result may be interpreted as a lack of intraspecific genetic variation in the thermal acclimation of photosynthesis, as recently reported for Eucalyptus tereticornis seedlings grown under controlled conditions (Drake et al., 2017). However, the limitations imposed by our experiment do not allow a clear conclusion to be drawn. In fact, the southern seed source experienced only a 1.7 °C warming in mean July temperature at the most southern plantation site of Wendover (Table 1). Consequently, we could formulate two hypotheses. First, despite a difference of 2 °C in mean July temperature of geographical origins between the two white spruce seed sources used in this study, their parents may have experienced historically a similar range of temperatures, which would explain the lack of difference in Topt between them. Thus, it would be interesting to test other seed sources from more meridional origins and warmer local climates, such as from southern Ontario and the USA, to further test the existence of genetic differentiation in thermal acclimation of photosynthesis. Our second hypothesis relates to the warming conditions experienced by seed sources in the southern plantation sites, which are likely insufficient to detect intraspecific variation in the thermal acclimation of photosynthesis that would be related to local genetic adaptation. Thus, using more southern plantation sites or augmented warming conditions in controlled environments would be necessary to test this last hypothesis.
|
study
| 100.0 |
Our results indicate that the photosynthesis of seedlings of two white spruce seed sources from southern and northern origins had a lower thermal optimum of photosynthesis and no ability to acclimate to warmer temperature. In contrast, the seedlings showed a clear acclimation of dark respiration by the downshift of the basal rate of Rd. However, dark respiration acclimation was insufficient to counterbalance the low photosynthetic rate in warmer plantation sites. In addition, the temperature response of photosynthesis was limited by Rubisco capacity, which suggests an effect of Rubisco activase or a lack of adjustment of nitrogen allocation. The results highlight the need for more research on thermal responses of photosynthesis and its biochemical limitations, with particular emphasis on Rubisco activase and on understanding of the main cues of photosynthesis phenology in spruces and other boreal forest trees. Together with monitoring at a more mature stage, this should help evaluate the effect of predicted autumnal warming on the global trend of photosynthesis. Overall, our results on growth and thermal acclimation-related traits for photosynthesis and dark respiration suggest that white spruce populations from southern Québec are already above their thermal thresholds and will remain so under predicted climate warming.
|
study
| 100.0 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.