text
stringlengths 4
179k
| predicted_class
stringclasses 5
values | confidence
float64 0
100
|
|---|---|---|
Unsurprisingly, the measurement of interindividual differences in BER and NER repair in primary lymphocytes was found to be possible only in lymphocytes that were induced to proliferate. This requirement was observed the first time a host cell reactivation assay was performed on primary lymphocytes to measure NER . However, the fact that background expression levels of luciferase expression can still be measured in non-induced cells confirms that this requirement is due to a true lack of significant repair in non-induced cells, and not just an issue with transfection or measuring low level of reporter activity.
|
other
| 33.34 |
There is, however, no absolute requirement to induce proliferation in order to measure DSB in primary lymphocytes , at least for the NHEJ and SSA pathways that we found to be functional in non-cycling cells . Still, many DSB repair assays in lymphocytes published in the literature have been performed in induced cells . In many cases, it is because one of the objectives is to measure homologous recombination (HR) that will only occur in cycling cells during the S phase . However, the choice to induce cells for proliferation rather than use them uninduced might sometimes also have been based on the assumption that non cycling cells are generally not proficient at DNA repair . Our own data showed that DSB repair is much more efficient (~ 3 fold) in induced cells compared to non-induced ones (Fig 2A and 2B), but the DRC varied with time post-induction, making it unclear what factor(s) might be controlling the level of repair in induced cells. Analyzing SSA repair (a sub-pathway of HR) in non-cycling cells might not be a perfect proxy of the DRC in HR for the individual, but comparing NHEJ and SSA of an identical DSB (with ApaI and XhoI overhangs in both cases) should be able to address the question of whether cells show preference in resolving the DSB towards end-joining (NHEJ) vs a homology-directed pathway that first requires strand resection (SSA). Those two systems are thought to be in competition with each other for the repair of the same breaks, the choice between direct end-joining and strand resection being thought to be predictive of preferential repairs in an error-prone or error-free manner, respectively (recent reviews in [45–48]). Although SSA repair is obviously error-prone as it leads to deletions, our results contradict this notion that end-joining and strand resection are in direct competition for the same DSB repair in the cells we analyzed. Low NHEJ is never associated with a relatively high SSA and in fact, NHEJ and SSA are clearly positively correlated to each other in both primary lymphocytes and LCLs (Fig 2C). A recently identified sub-pathway of NHEJ (alt-NHEJ) has been shown to use strand resection and micro-homologies of a few nucleotides for the repair of DSB breaks by end-joining . This constitutes a possible functional connection between SSA and end-joining repair if alt-NHEJ were to be the main mechanism of NHEJ in our experimental system. Analyzing multiple repair events at the sequence level should help determine if micro-homologies were used and therefore if alt-NHEJ is a major contributor to the observed repair.
|
other
| 29.33 |
When we compared primary lymphocytes to the LCLs obtained from the same individual, no significant correlation in either NHEJ or SSA repair could be found (Table 2). Although repair in LCLs might still represent the individual’s DRC to a certain extent, this is consistent with some previous work that indicated that LCLs might not reflect accurately repair in primary cells [36–38].
|
other
| 33.47 |
An intriguing result from DSB repair measurements in non-induced lymphocytes of healthy individuals was that both NHEJ and SSA repair were inversely correlated to the age at time of blood draw of the individual (age range 22–61 years–Fig 5). This result is consistent with a previous demonstration that NHEJ decreased in aging mice using a transgenic model and the observation of a trend towards a decline in DSB repair with age in human primary lymphocytes as measured with the neutral Comet Assay and γH2AX response after γ–irradiation . However, the latter results required the analysis of more than 200 individuals (in non-induced peripheral blood cells) and some sophisticated statistical analysis to ascertain the relation of repair to age. In our case, the raw data (the % EYFP positive cells) for NHEJ repair in cells of 16 individuals was sufficient to see an inverse correlation with age of the donor r = -0.764 (p<0.0006), indicating that host cell reactivation is likely a better method to investigate the effect of age on NHEJ repair. Interestingly, NHEJ was globally much higher in LCLs (~2 fold, see shift of the trendline towards higher NHEJ in Fig 2C) than in non-induced lymphocytes and the correlation of repair to age was mostly lost in LCLs derived from the same individuals. This indicates that changes of NHEJ with age might not be irreversible, but possibly regulatory in nature. Overall, our data suggest that NHEJ and SSA are closely co-regulated together, and that the level of repair can be affected by age, the induction of proliferation and/or the EBV transformation. The mechanism of DSB repair regulation in cells remained to be determined but always showed a certain consistent pattern when investigating the same cell type, as manifested by the identical slopes observed in the relationship of NHEJ to SSA (Fig 2C).
|
other
| 29.39 |
We found a similar close relationship between DRC by BER and NER with a strong correlation found in both primary induced T cells and in LCLs (Table 3 and Fig 3C), but once again with a lack of correlation when comparing repair in primary lymphocytes and LCLs of the same individuals (Table 2). BER and NER assays are very similar in nature as they both measure the inhibition of luciferase transcription on the very same template caused by different types of transcription-blocking DNA modifications (8-oxoG for BER, pyrimidine dimers for NER). They were also systematically measured using separate parallel transfections in the same experiment and we cannot exclude that the observed correlation is the result of a technical bias related to the technique of host-cell reactivation itself (e.g., measuring a function related to the capacity of expressing transgene from a plasmid template after transfection rather than differences in repair per se). This explanation is unlikely, though, as the level of background luciferase expression was similar for all individuals in non-induced T cells for both BER and NER templates (Fig 3A and 3B). As a result, the ability to measure luciferase activity in lymphocytes seemed comparable between individuals and only the induction of repair (by cell activation) allowed the detection of differences in luciferase activity between individuals. The BER to NER correlation could also be the effect of a cellular function other than repair that affects both assays in the same manner, and that could then be measured by two separate methods. For example, an individual’s capacity to perform transcriptional bypass on damaged template could have such an effect on both BER and NER assays, and RNA polymerase II does transcribe through 8-oxoG , and even through CPDs . However, the fact that the correlation was also there in LCLs (Fig 4C), even if there was no correlation between primary lymphocytes and LCLs for the same individuals (Table 1) suggests that BER and NER, just like NHEJ and SSA, are simply co-regulated in a manner that is not entirely understood, so that when one type of activity is enhanced, so is the other. As a result, interindividual differences that we measured might reflect interindividual differences in the regulations of the pathways rather than in repair efficiency itself.
|
other
| 30.94 |
Regardless of what external factor might be influencing the repair measurements, the most striking results obtained from measuring DRC in our patient samples was the dramatic and quasi systematic decrease in both form of DSB repair associated with the aHCT itself (p<0.0001 for NHEJ and p = 0.0002 for SSA) when comparing the lymphocytes of the same individuals before and after transplant (Fig 4). The mechanism and cause of that decrease remains to be determined, and one cannot infer from our results anything about the repair in cells of the myeloid lineage, which are the ones involved in secondary t-MDS/AML. However, all blood cells, including lymphocytes and myeloid cells, derive from the same stem cells whether before or after the transplantation, and it is possible that the lower repair in peripheral blood lymphocytes is simply a manifestation of changes in hematopoietic stem cells in those individuals, just like the DSB repair in peripheral blood lymphocytes of healthy individuals was somehow the manifestation of these individuals’ age. CD34+ cells mobilized for aHCT in patients that later developed t-MDS/AML have been shown to present alterations in their DSB repair pathway as measured by microarray analysis and it is possible that the repair deficiency post-aHCT was already present prior to the transplant, although possibly only in a subset of cells. Chemotherapy treatments of the primary lymphoma occurred prior to the harvesting of the hematopoietic stem cells and are likely to have resulted in the accumulation of DNA damage and subsequent mutations. Another major known factor that plays a role in accumulation of DNA damage in hematopoietic stem cells is ageing . Patients undergoing aHCT regenerate marrow function from a limited number of mobilized stem cells and this replication stress to replenish the blood marrow is also likely to lead de novo mutations in those cells. As a result, the decrease in DSB repair after aHCT might reflect the necessity to replicate extensively to reconstitute the whole hematopoietic system from a limited number of stem cells, or it could be that the transplant itself could form a selection mechanism for cells with lower repair capacity, whether directly or indirectly, through the ability to mobilize stem cells and/or to recolonize the bone marrow after aHCT. Investigating DRC in stem cell donors and recipients post-HCT in the context of allogeneic stem cell transplantations might be able to isolate specifically the effect of the transplant itself on DSB repair from other potential changes associated with chemotherapeutic treatments that might be relevant to autologous transplant cases. Either way, the lower repair post-transplant seemed to be a stable feature among the samples investigated (taken 100 days to 5 years post-aHCT–S1 Fig) as there was no trend for repair to decrease or increase within this time frame (data not shown). For those individuals with data both before and after aHCT, the average decrease in NHEJ of 6.9% associated with the transplant is higher than expected if caused by simple ageing. Based on the calculated rate of decrease of NHEJ repair observed for healthy individuals (0.37% decrease/year) in Fig 5, the average time difference of 21.6 months between the two measurements would be expected to lead to a decrease in NHEJ of only 0.65%, which is much lower than what was measured. One possibility is that transplanted stem cells show signs of accelerated ageing compared to never transplanted cells.
|
other
| 31.77 |
We could not identify any difference in DRC existing prior to aHCT that could help predict which individuals are at higher risk of later developing t-MDS/AML. However, whether caused by the transplant itself and/or influenced by exposure to treatments, there is evidence that lymphocytes of patients post-transplant are greatly compromised in their ability to repair DSB. It remains to be determined whether the measured effect of transplantation on repair capacity is involved in making transplant patients, as a group, more susceptible for t-MDS/AML.
|
other
| 29.3 |
A decrease in NER with age has been shown previously in human fibroblasts, which was associated with a decrease in DNA repair-related gene expression . We did not find any association of BER nor NER with age in our samples (S6 Fig), but the age-related differences might be have been masked in lymphocytes by the need to induce the cells for proliferation to analyze for those types of repair.
|
other
| 34.88 |
Finally, we analyzed the DRC for all 4 pathways in patients’ T lymphocytes (non-induced for NHEJ and SSA, induced for BER and NER) either before or after aHCT. Identifying individuals that are most at risk before the transplant would be most relevant as the treatment could be adapted accordingly. We did not find any form of DRC that was significantly different in individuals that later developed t-MDS/AML (cases), as compared to matched individuals that did not (controls). There were some differences, though, that could be identified in pre-aHCT patients when compared to the group of healthy individuals. NHEJ was marginally higher in patients (cases and controls combined) than in healthy individuals after adjusting for age (p = 0.0149). Moreover, BER in control patients, but not in cases, was also lower than for healthy individuals (p = 0.0013). Maybe more meaningful, pre-aHCT patient samples did not show the correlation between NHEJ and SSA that was observed for every other group of samples analyzed, including the very same individuals at a time point post-aHCT (Table 3). Moreover, there was also absolutely no relationship of the NHEJ repair capacity to the patient’s age in pre-aHCT patients (r = 0.004, p = 0.984 –Table 5). Overall, this indicates several abnormalities in the DRC of pre-aHCT patient samples, which raises the question of the ability of such samples to reliably represent an individual’s repair capacity. It has been suggested that DRC in lymphocytes of cancer patients might be greatly affected by the general inflammation associated with the disease [57–59] or possibly by the cancer treatment itself. Consistent with that hypothesis, we had observed that DSB repair measurements by host-cell reactivation assays, even in lymphocytes from healthy individuals, could be influenced by factors in the environment of the cells, such as the presence of reactive oxygen species . The DRC in lymphoma patients might be therefore more predictive of their outcome if it could be measured prior to any treatment, rather than after a large number of chemotherapy cycles, as is the case for the patients in this cohort that were recruited immediately prior to aHCT.
|
other
| 32.28 |
Therefore, this study aimed to (1) investigate the effect of dietary types (CP levels) on feed and nutrient intakes (DMI, DMI/kg LW, DMI/kg LW0.75, CPI and NDFI) in Tibetan sheep and yaks, (2) evaluate the growth performance in Tibetan sheep and yaks fed different diets, (3) account economic returns in Tibetan sheep and yaks fed different diets during cold season. Finally, we expected to find an optimal diet improving domestic livestock’s growth performance, increasing economic returns for pastoralists and alleviating grazing pressure of local cool-season pasture during cold season on the QTP.
|
other
| 34.94 |
During the experiment, all animals were cared for according to the Guide for the Care and Use of Laboratory Animals, the Ministry Science and Technology of People’s Republic of China (2002) . The experimental design and procedures were approved by the Animal Ethic and Welfare Committee of the Northwest Institute of Plateau Biology, Chinese Academy of Sciences (NWIPB, CAS). All animals had free access to diet and water; they were well treated and no animal died during this study.
|
other
| 39.03 |
Each individual is represented by a code of 1 or 2 letter(s) (aHCT patients) or a combination H+number (healthy individuals). Commas separate each individuals’ code name. The nature of the sample (category of individual and/or time point) used is indicated. All samples indicated have some data represented in the study but we did not obtain data for all of those samples and/or for all of the tests performed. In all cases, samples analyzed were taken prior to any t-MDS/AML diagnosis. For more details on the data used, including pairing of specific t-MDS/AML cases to specific controls, refer to the file presenting the raw data (S1 File).
|
other
| 32.03 |
Host cell reactivation assay plasmid pM1-Luc was treated with methylene blue + visible light (MB) or UVC (UV) to generate damage classically repaired by BER (8-oxoG) or NER (pyrimidine dimers), respectively. The damage frequency generated by the treatment in the transcribed strand of firefly luciferase is quantified using 5 cycles of primer extension from a Cy5.5-labeled CMV-F primer (CGCAAATGGGCGGTAGGCGTG) using the LongAmp polymerase (New England Biolabs) on a BamHI-digested template. (A) Map of luciferase gene in pM1-Luc plasmid. (B) Cy5.5 signal after primer extension and 3.5% urea denaturating PAGE. The level of full length extension remaining on damaged templates (2.7kb) measures the proportion of plasmids undamaged in the luciferase coding sequence and can serve as quality control of damage level for each batch of plasmid generated for repair assays. The proportion of plasmid with blocking damage in the luciferase coding sequence can be inferred from the missing extensions as compared to the undamaged template control.
|
other
| 35.62 |
Qinghai-Tibet plateau (QTP) is an ecological functional zone and ecological security defense for China and even Asia due to its unique geographical location and climate characteristics . Meanwhile, QTP is an important animal husbandry production zone, playing a vital role in improving local pastoralists’ livelihood .
|
other
| 30.38 |
Tibetan sheep (Ovis aries) and yaks (Bos grunniens) are the two major ruminant species, playing an increasingly important role on the Tibetan rangeland due to their excellent adaptability and production performance [4–7]. It is estimated with a population of about 13 million domestic yaks and 50 million Tibetan sheep are living on the QTP , providing local herdsmen with daily necessities like meat, milk, wool, skins, fuel and economic benefit . Tibetan sheep and yaks breeding have laid a solid foundation of alpine pastoral economy and pastoralists’ livelihood on the QTP.
|
other
| 32.3 |
Under traditional grazing management, domestic livestock mainly lived on natural herbage of local pasture without feed supplementing . Animals always suffered seasonal live-weight variations and viciously cycled in “alive in summer, strong in autumn, thin in winter, tired in spring”, due to seasonal fluctuations in herbage supply (biomass and nutrient content) and the contradiction between herbage supply and livestock’s requirement on the alpine rangeland . When cold season came, grazing animals survived from inadequate herbage, low temperature and cold environment, which usually causing poor nutrition, health-related problem, low growth performance and even death of grazing livestock . As a result, pastoralists suffered huge economic loss due to serious live-weight loss in grazing animals during cold season. Feed efficiency (total herbage intakes/total live-weight gain) and the off-take rate of livestock were quiet low under traditional grazing management . More seriously, the vicious cycle was aggravated yearly due to over-stocking rate of livestock and irrational utilization of natural pasture on the QTP [16–18].
|
other
| 32.12 |
In order to improve the production efficiency of alpine pastoral grass-livestock husbandry, “Two-stage” management has been gradually adopted by local pastoralists in recent years. Domestic animals usually grazed on natural pasture during warm season (June to October), then, turned to warm-shed feeding during cold season (November to May). The newly mode significantly shortened livestock’s breeding cycle and increased economic returns for local herdsmen . Dietary crude protein was an important factor affecting livestock’s growth performance and economic returns . However, local pastoralists often choose/use dried hays (with low CP and high fiber contents) during warm-shed feeding period , which usually resulting in low growth performance and low economic returns. Here, we hypothesized that changing dietary processing methods (changing dietary CP levels) could affect animals’ feed intakes, growth performance, feed efficiency and economic returns during cold season on the QTP.
|
other
| 32.44 |
The oats hay was sown in early June 2014 and harvested in early October 2014 by a reaping machine, bounded into cubic bundles with approximately 19~22 kg, then stored in a dry and ventilated place. During the experiment, oats hay was chopped into 3~5 cm long pieces using a forage rubber to encourage animals’ feed intake. The oats silage was made by fresh oats herbage harvested in late September of 2014. The fresh oats herbage was cut into 5~8 cm long pieces by a harvester. Silage bacterial strain (made by Taiwan Yaxin Biotechnology Co. Ltd.) was added to fresh oats herbage with a recommended proportion of 100 mg for 5 ton silage, then stored in a silage pool and sealed for 70~90 days before feeding animals. Total mixed ration was fully mixed by oats hay, concentrate feeds, pre-mix, salt and water according to suitable proportions, using a mechanical agitator last for 45~55 mins to ensure nutritional equilibrium. Ingredients and nutrient composition of experiment diets was presented in Table 1.
|
other
| 32.56 |
Samples of different diets were collected and dried in forced-air oven at 60°C to constant weights (DM), then ground through a 1—mm sieve screen for further analyses. Total nitrogen (N) was measured according to Kjeldahl procedure and CP content was calculated by total N (CP = 6.25×N) ; Ether extract (EE) was determined by the Soxhlet system ; Neutral detergent fiber (NDF) and acid detergent fiber (ADF) were measured according to the methods described by Van Soest et al .
|
other
| 37.4 |
The field study was conducted in Qinghai Modern Prataculture Development Co., Ltd. (35°34′11″N, 100°46′45″E, altitude 3150 m) of Guinan County, Hainan Tibetan Autonomous Prefecture of Qinghai province, China. Climate here was dominated by plateau continental climate with short warm/growing season and long cold/non-growing season. The mean annual temperature was 3.1°C with extreme high 31.8°C in July and extreme low –29.2°C in January. The mean annual precipitation was 485.8 mm. Local cool-season pasture was alpine meadow dominated by Kobresia humilis, Elymus nutans, Kobresia capillifolia, Stipa capillata, Poa annua and Carex atrofusca et al.
|
other
| 33.38 |
The study was established from December 15th of 2014 to May 2nd of 2015. Twenty four yearling Tibetan sheep (25.29±3.95 kg LW) and twenty two-year-old yaks (100.62±4.55 kg LW) with familiar body conditions were randomly assigned to four groups (n = 6 for Tibetan sheep and n = 5 for yaks), fed oats hay (OH), oats silage (OS), total mixed ration (TMR) and traditionally grazed on the local cool-season pasture (TG, treat as control). Before the experiment, warm-shed was sprayed using sodium hydroxide for disinfection; animals were fed deworming tablets to against internal parasites. A 14-day advance experiment was conducted to promote animals adapting to given diet and experimental environment. While the formal experiment began, animals in warm-shed were fed twice a day at 8:30 and 17:00, separately. Grazing animals were labeled and grazed with livestock crowd on the local cool-season pasture without feed supplementing, grazing activities usually lasted from 8:30 to 17:30 (about 9 hours per day), then entered shelter for overnight. All animals had freely access to multi-nutrient blocks and water over a 135-day experiment. Experimental animals were carefully observed for the occurrence of any health-related problems and records were taken throughout the entire experiment.
|
other
| 38.94 |
Animals were weighted by a special electronic balance (YIY-OCS-1T, made by Shanghai YiYu Electronics Technology Co., Ltd., with a sensitivity of 100 g) before morning feeding and grazing activities, at the beginning and every 15 days of the 135-day experiment. The total live-weight gain was calculated as the difference between final live-weight and initial live-weight; average daily live-weight gain (ADG) was defined as total live-weight gain divided by experiment time (day); gain rate was calculated by ratio of total live-weight gain to initial live-weight; feed efficiency was defined as ratio of total DM consume to total live-weight gain; breeding profit was calculated by the difference between the benefit of live-weight gain and total feed cost. Net economic benefit (NEB) was determined by the following equation, NEB=(Gw×Pm)∕(Te×DMI×Pd)−1
|
other
| 39.5 |
Data was initially processed by Microsoft Excel 2010 and presented as mean±S.E., one-way analysis of variance (ANOVA) with Duncan multi-comparison test was used to determine the effect of dietary types on feed intakes (DMI, DMI/kg LW, DMI/ kg LW0.75, CPI and NDFI), live-weight gain, gain rate, feed efficiency, breeding profit and net economic benefit. All analysis were achieved using soft package SPSS (Statistical Package for the Social Sciences, Version 20.0). Statistical significance differ when P < 0.05.
|
other
| 31.89 |
The daily DM and nutrient intakes of animals fed different diets were presented in Table 2. There were significant differences of DMI, CPI and NDFI among TMR, OH, OS and TG diets in both Tibetan sheep and yaks (P < 0.05). DMI/kg LW was in the order TMR > OS > OH > TG in Tibetan sheep and TMR > OH > OS > TG in yaks. However, no significant difference of DMI/kg LW was determined between TMR and OH in both Tibetan sheep and yaks (P > 0.05). When expressed on metabolic LW (LW0.75) basis, DMI of TMR was higher than other three diets in both Tibetan sheep and yaks. Grazing animals (TG) shared the least DMI, DMI /kg LW, DMI/kg LW0.75 and CPI among four treatments (P < 0.05).
|
other
| 31.2 |
Average daily live-weight gain of every 15 days (ADG-15ds) during the experiment was presented in Fig 1. The figure indicated that ADG-15ds in TMR, OH and OS groups were better than TG group. Grazing animals suffered serious daily live-weight loss while warm-shed feeding animals shared great daily live-weight gain in most stages. No significant difference (P > 0.05) was determined of ADG-15ds in OH and OS groups (except 105–120 day period in Tibetan sheep). Fig 2 presented live-weight changes of animals fed different diets; which indicated that warm-shed feeding was more efficient in promoting growth performance in domestic animals during the entire experiment.
|
other
| 32.1 |
Grazing animals suffered serious live-weight loss (–5.66 kg, –20.54% in Tibetan sheep and –12.40 kg, –12.52% in yaks) under traditional grazing management (Table 3). By contrast, total live-weight gains of warm-shed feeding Tibetan sheep were 25.33 kg/sheep for TMR, 12.08 kg/sheep for OH and 14.33 kg/sheep for OS, which accounting for 107.45%, 47.94% and 61.92% of their initial live-weights, respectively. There was no significant difference of total live-weight gain, gain rate and ADG in Tibetan sheep feed OH and OS diets (P > 0.05). Total live-weight gains of warm-shed feeding yaks were 82.40 kg/yak for TMR, 53.32 kg/yak for OH and 30.70 kg/yak for OS, which accounting for 67.34%, 61.40% and 34.16% of their initial live-weights, respectively. Significant differences of total live-weight gain and ADG were found in yaks fed different diets (P < 0.05).
|
other
| 30.66 |
Feed efficiency was an important index reflecting digestion and absorption efficiency of a given dietary . In this study, feed efficiency of Tibetan sheep fed TMR and OS maintained a relative efficient level after 45th day of the experiment (Fig 3), OH was the least efficient in feed conversion among three given diets. There was a trend that dietary with higher CP level was better in feed efficiency in Tibetan sheep. Feed efficiency of yaks fed TMR and OH maintained a relative efficient level after 60th day of the experiment, OS was the least efficient among three given diets. Overall results indicated that feed efficiency of TMR (7.65 for Tibetan sheep and 8.50 for yaks) was better as compared to OH and OS (Table 3).
|
other
| 29.17 |
We expected to find a proper diet promoting domestic animals’ growth performance, increasing local herdsmen’s breeding profit and alleviating grazing pressure of local cool-season pasture. Our results indicated that total mixed ration was an appropriate diet in improving feed intakes, growth performance, feed efficiency and economic returns in both Tibetan sheep and yaks, which should be considered by local herdsmen to improve their breeding profit during cold season.
|
other
| 29.78 |
Daily DMI was in the order TMR > OH > OS > TG and CPI was in the order TMR > OS > OH > TG in both Tibetan sheep and yaks. When expressed on LW and metabolic LW (LW0.75) basis, DMI of TMR, OH and OS were significantly increased as compared to TG. The NDFI was in the order OH > OS > TMR > TG for Tibetan sheep and OH > TMR > TG > OS for yaks. Grazing animals shared the least DM and nutrient intakes during the experiment (Table 2).
|
other
| 31.55 |
Breeding profits of Tibetan sheep fed different diets were 205.01 ¥/sheep for TMR, 16.18 ¥/sheep for OH, 136.30 ¥/sheep for OH and –119.00 ¥/sheep for TG, respectively. Net economic benefits were 0.63 for TMR, 0.05 for OH and 0.58 for OS (Table 4), respectively. There was no significant difference of breeding profit and economic benefit in Tibetan sheep fed OS and TMR (P > 0.05). Breeding profits of yaks fed different diets were 1016.71 ¥/yak for TMR, 734.14 ¥/yak for OH, 248.32 ¥/yak for OS and –333.31 ¥/yak for TG, respectively. Net economic benefits were 0.85 for TMR, 1.04 for OH and 0.43 for OS. Significant difference of breeding profit was determined among yaks fed TMR, OH and OS (P < 0.05); however, there was no significant difference of net economic benefit (P > 0.05) in yaks fed OH and TMR diets. TMR was a proper diet in increasing the breeding profits for local herdsmen during cold season.
|
other
| 26.92 |
Tibetan sheep and domestic yaks are important resources for herdsmen who live in the alpine pastoral area as providing them daily necessities and economic income. However, under traditional grazing management, production efficiency of alpine pastoral husbandry and feed efficiency was quiet low due to irrational grazing-management regime and environmental factors . In addition, natural grassland degradation became increasingly serious due to over-stocking and irrational utilization of nature pasture, which hampered the sustainable development of alpine pastoral grass-livestock husbandry on the QTP .
|
study
| 29.55 |
DMI was an important index in ruminant nutrition, which was affected by dietary nutrient levels, live-weight, health condition, production level, management and temperature etc. [30–32]. Under traditional grazing management, Tibetan sheep and yaks grazed on standing dormant herbage which was insufficient in biomass, crude protein and digestible carbohydrate contents . With cold-season extension, standing herbage biomass and nutrient content decreased dramatically, leading to herbage shortage for grazing animals (November to May). As a result, grazing animals suffered inadequate DMI and inferior nutrients which could not meet their daily requirement .
|
other
| 32.66 |
Warm-shed feeding animals were offered diets with high CP contents; animals could freely seek forage to meet their daily DM requirement. In this study, a trend that higher dietary CP content encourage animals’ DM and nutrient intakes was found, which was agreed with Phengvichith V in goats , Negesse T in growing male Saanen kids , Antti N in male goat kids , and Li in Liaoning Cashmere Goat . Herbage silage could maintain a relative higher CP content of fresh oats as compared to dried oats hay . TMR was an advanced technology produce dietary with balanced nutrition and good palatability , promoting domestic animals’ DM intakes and feed efficiency [43–45]. In this study, TMR worked best in promoting feed and nutrient intakes in both Tibetan sheep and yaks (Table 2); the reasons could be related to its palatability, higher CP content, balanced nutrition , and low rumen fill effect of TMR . During current experiment, TMR was full mixed from oats hay, concentrate feeds, pre-mix, salt and water. Reasonable oats hay length (2–4 cm), moderate concentrate feed proportion (42.2%), long mixed time (45–55 min) higher CP content (10.31%) and proper feed moisture (31.6%) ensured nutritional equilibrium and good palatability of TMR diet as compared to OH, OS and standing herbage. As a result, TMR diet avoided partial eclipse and malnutrition of warm-shed feeding animals and encouraged animals’ DM and nutrient intakes. In addition, the difference of temperature inside and outside the warm-shed was also an important factor affecting animals’ feed intake .
|
study
| 30.16 |
Warm-shed feeding animals shared great daily live-weight gains while grazing animals suffered serious daily live-weight loss in most stages during the experiment. Total live-weight gain was in the order TMR > OS > OH > TG in Tibetan sheep and TMR > OH > OS > TG in yaks (Table 4), no significant difference of total live-weight gain was determined in Tibetan sheep fed OH and OS diets (P > 0.05).
|
other
| 31.95 |
Under traditional grazing management, standing herbage biomass and nutrient content of local pasture decreased sharply during cold season, animals need to move more distance to seek herbage to meet their daily DM requirements . Grazing animals consumed more energy and fat to oppose cold stress and maintain grazing activities as compared to warm-shed feeding animals, resulting in low growth performance, health-related problems and even death . Tibetan sheep could lose 12.4%~43.7% of their initial live-weights , domestic yak could lose 25%~30% of their initial live-weights during cold season , which accounted for 80%~120% their live-weights that gained during last warm season . In this study, grazing Tibetan sheep lost 20.54% and grazing yaks lost 12.52% of their initial live-weights during cold season, which meant heavy economic loss to local herdsmen.
|
study
| 31.28 |
Breeding profit for Tibetan sheep was in the order TMR > OS > OH > TG. Grazing Tibetan sheep suffered –119.00 ¥/sheep loss mainly due to serious live-weight loss during cold season. Net economic benefits were 0.63:1, 0.05:1 and 0.58:1 for TMR, OH and OS, respectively. Sheep fed OH gained much live-weight but shared low breeding profit and net economic benefit than Tibetan sheep fed OS. This could be explained that the benefit of live-weight gain of sheep fed OH was about flat with total feed cost (Table 4). Higher CP dietary contributed to high net economic benefit in Tibetan sheep was determined in current study.
|
study
| 29.55 |
When came to yaks, breeding profit was in the order TMR > OH > OS > TG. Grazing yaks suffered the lowest economic returns among four treatments, yaks with higher DMI (TMR > OH > OS > TG, Table 2) shared better live-weight gain, resulting in higher benefit of live-weight gain and breeding profit. Net economic benefits were 0.84:1, 1.04:1 and 0.43:1 for TMR, OH and OS, respectively. No significant difference of net economic benefit in yaks fed OH and TMR was determined (P > 0.05). The difference of net economic benefit was possibly attributed to different growth performance of yaks fed different diets. Yaks fed OH shared the highest net economic benefit. Dietary with moderate CP content shared a reasonable economic benefit was expected, which was agreed with Dong in yaks . Dietary with moderate concentrate feed level (TMR) was also acceptable for its efficiency in improving growth performance and breeding profit in domestic animals. Other report also obtained that diet with moderate concentrate feed produce reasonable economic returns .
|
study
| 30.86 |
Under warm-shed feeding, diets were rich in CP content (Table 1); air temperature was higher inside the warm-shed. Animals could freely seek diets, multi-nutrient block and fresh water to meet their growth requirements. In addition, warm-shed feeding reduced animal activities and energy consume as compared to traditional grazing, resulting in better growth performance of animals during harsh cold season. We found that total live-weight gain of animals fed higher CP diet was better (P < 0.05), which was agree with Dong in yaks , and Mulligan F in cattle . This may be related to more DM and nutrient intakes of TMR as compared to other three diets . The total live-weight gain of yaks fed oats silage (OS) was not met to our expectations, perhaps due to yak rumen could not adapt well to single oats silage diet, further study need to be conducted to evaluate the associated effect of concentrate and oats silage in yaks, relevant study in yaks was still sparse nowadays.
|
study
| 32.2 |
Feed efficiency was in the order of TMR > OS > OH > TG for Tibetan sheep and TMR > OH > OS > TG for yaks. Dietary with higher CP obtained better feed efficiency and animals’ growth performance, which was agreed with Chen in yaks , and Li in Dorper × Thin-tailed han crossbred weaning lambs . The reasonable forage/concentrate ratio, stable feed value and proper feed moisture of TMR diet could increase rumen microbial activity and protein synthesis rate, maintaining normal fermentation, digestion, absorption and metabolic activities of domestic livestock, resulting in better growth performance and feed efficiency.
|
study
| 30.72 |
Here, we evaluated the effect of dietary types on feed intakes, animal performance and economic benefit in domestic livestock during cold season on the QTP. Under traditional grazing management, domestic yaks and Tibetan sheep suffered serious live-weight loss, while, TMR, OS and OH significantly improved animals’ feed intakes, live-weight gain, feed efficiency and economic returns. Higher CP dietary obtained better growth performance, feed efficiency and breeding profit was determined in current study. TMR worked better in improving feed intakes, animal performance and economic returns, mainly due to its higher dietary CP content, nutritional equilibrium, proper feed moisture and good palatability, which should be considered by local herdsmen for promoting animals performance and increasing their breeding profit during cold season on the QTP.
|
study
| 30.39 |
I first met Bill Paul in 1971 at an extremely low point in my career. I was looking for a new supervisor for my postdoctoral training as I had just spent about 18 months working in a lab where I had accomplished absolutely nothing. Bill had just been appointed Chief of the Laboratory of Immunology, was quite understanding of my situation, and advised me to speak with Ira Green about potential opportunities in his lab. Ira took me on as postdoc and pointed me in the right direction. Bill also assumed a co-supervisory role particularly on projects that he and Ira had studied together for many years dealing with the function of immune response genes. I thrived in this environment and after only two full years as a postdoc was offered a tenured position in the Laboratory of Immunology where I have remained for the past 45 years. My lab and Bill’s lab were immediately adjacent to each other on the 11th floor of the Clinical Center and we had numerous interactions on a daily basis. For over 20 years we had joint data and journal clubs for our groups every Wednesday and Friday morning. One fringe benefit of these discussions was that my postdoctoral fellows benefited from Bill’s wisdom and criticism. His comments were always delivered in a gentle fashion often pointing out major areas of deficiency or steps in the wrong direction. The fellows always accepted them and never felt threatened as they were always perceived as constructive. I am not certain my comments on his fellow’s presentations were always similarly perceived! When we began our studies on T regulatory cells even I was somewhat leery as to how Bill would react to our attempts to redefine T suppression after its death in the 1980s. Bill was actually quite receptive of our approach and continued to encourage me to continue even after I received a negative review from our advisory committee. He was particularly proud to announce to the committee that I received the William Coley Award in 2004 for our studies on regulatory T cells in spite of their negative comments.
|
study
| 29.05 |
In 2002, I wrote a review entitled “CD4+CD25+ Suppressor T Cells: More Questions Than Answers (1).” Foxp3 had yet to be discovered as the marker for this lineage and the term “Regulatory” rather than “Suppressor,” had not yet become the convention. Over the past 15 years, this field has seen tremendous growth and the therapeutic manipulation of T regulatory (Treg) function has reached the clinic. Certain aspects of the field that have received great attention and many of the questions I posed in 2002 have been answered. However, some questions remain unanswered and our lack of knowledge of these aspects of the field in my view has clearly hindered progress in the clinical application of Treg either to boost their function in autoimmunity or disable their function in malignancy. In this review, I will focus on several questions that I believe remain unanswered.
|
study
| 30.52 |
My group (2) and the Sakaguchi group (3) described the first assays for the measurement of the suppressor function of CD4+CD25+ T cells in vitro. Although this type of assay was rapidly adopted by almost all investigators in the field, a number of issues have emerged that render interpretation of the results of these experiments problematic. In general, these assays involve the measurement of the proliferation of mouse non-Treg cells (either CD4+ or CD8+) triggered by TCR signaling in the presence of a titration of highly purified Treg cells. In the original studies, soluble anti-CD3 stimulation was used to trigger the TCR and the assay was always performed in the presence of accessory cells (T-depleted spleen cells, or more recently dendritic cells) that were needed to cross-link the anti-CD3 antibody and provide co-stimulatory signals. The addition of anti-CD28 was not recommended, as it was more difficult to achieve significant suppression with greater levels of TCR stimulation. The basis for this recommendation was the observation that Treg primarily inhibited proliferation by blocking IL-2 production by the responder population and anti-CD28 enhances IL-2 production by prolonging IL-2 mRNA half-life. The initial studies attempting to adapt this assay for use with human Treg frequently incorporated anti-CD28 co-stimulation to achieve significant levels of stimulation. While suppression was observed under these culture conditions, higher numbers of Tregs were required to achieve significant suppression and ratios of 1:1 (Treg:responder) were frequently employed. However, assay conditions very similar to those used in the mouse can be used with human cells (4). Significant levels of stimulation in the absence of anti-CD28 with the most commonly used anti-CD3 antibodies (OKT3 and UCHT1) can readily be achieved when a population of HLA-DR+ non-T cells are used as an accessory cell population.
|
other
| 30.34 |
Why is it important to have a reliable in vitro assay for Treg suppressor function? It has been proposed and in fact widely accepted that defects in Treg function play an important role in the pathogenesis of autoimmune disease in man (5). While some early studies claimed that patients with certain autoimmune diseases had a decreased percentage or even absolute number of Treg in their peripheral blood, the overwhelming consensus today is that patients with autoimmune diseases have normal numbers of Treg at least in their circulation. A defect in numbers in target organs remains possible, but difficult to assess in man. It therefore follows that Tregs from patients with autoimmune diseases must be functionally abnormal. The number of autoimmune diseases with purported defects in Treg function as detected in vitro has recently been summarized by Grant et al. (6). Defects in virtually all the common autoimmune diseases including SLE, MS, T1D, RA, autoimmune thyroid disease, psoriasis, IBD, primary biliary sclerosis, autoimmune hepatitis, and primary sclerosing cholangitis have been described. Indeed, it would be difficult to publish a paper claiming normal Treg function in any of these diseases. There are a number of reasons for defective Treg suppression in vitro in autoimmune disease: Environmental—the production of pro-inflammatory cytokines by APC such as IL-6 (7) which can provide a potent co-stimulatory signal for T effector cell expansion and render the responder T cells resistance to suppression. IL-6 could also act on Treg cells and reverse their suppressive function or result in their conversion to Th17 cells.T effector cell intrinsic resistance to suppression.Treg intrinsic defects including defective generation, survival, stability, or altered TCR repertoire. Finally, specific defects in one of the proposed mechanisms of Treg-mediated suppression.
|
study
| 30.69 |
Environmental—the production of pro-inflammatory cytokines by APC such as IL-6 (7) which can provide a potent co-stimulatory signal for T effector cell expansion and render the responder T cells resistance to suppression. IL-6 could also act on Treg cells and reverse their suppressive function or result in their conversion to Th17 cells.
|
study
| 29.95 |
A number of investigators questioned the use of the soluble anti-CD3 and accessory cell approach and claimed that the use of a defined number of anti-CD3 coated or anti-CD3 and anti-CD28 coated beads was a much more precise method for stimulating T cell activation. Although Tregs are capable of inhibiting responses induced by this activation protocol, suppression again almost always required 1:1 or at best 1:2 ratios of Treg to responder cells and no suppression was frequently seen at lower ratios of Treg to responder cells. A number of questions can be raised about the use of antibody bound to beads or anti-CD3 coated plates. T cell stimulation by antibody coupled to solid surfaces may result in a qualitatively distinct signal from stimulation induced by antigen presented on professional APC or even soluble anti-CD3 stimulation in the presence of APC. In our initial studies in the mouse on Treg suppression in vitro (2), we found that it was exceedingly difficult to suppress T cell stimulation induced by plate bound anti-CD3. Furthermore, this resistance to suppression was not overcome by using lower concentrations of anti-CD3 to coat the plate. Our interpretation of this result was that fewer T cells were triggered to proliferate at lower concentration of plate bound antibody, but that every T cell that bound to the solid phase stimulus still received a potent signal which was resistant to Treg-mediated suppression. This question has yet to be resolved and the use of a two cell assays versus a three cell assay remains controversial.
|
study
| 28.64 |
The second issue raised by these experiments is the cellular target of Treg-mediated suppression. One of the simplest explanations for our failure to achieve significant suppression with solid phase coupled stimuli is that the target of Treg-mediated suppression in vitro is not the responder T cell but the APC. A wide variety of cell types have been described as direct targets of Treg-mediated suppression (Table 1), yet after 20 years of study, it remains unclear whether the APC or the responder T cell or both are targeted by Tregs in the widely used in vitro suppression assay. While multiple mechanisms of Treg-mediated suppression have been proposed (see below), suppression of APC function or delivery of APC-derived co-stimulatory signals have achieved the greatest attention. If the APC is the primary target for Treg suppression in vivo, it would be ideal to employ an in vitro assay that would mimic the in vivo action of Treg.
|
other
| 30.34 |
While dissection of which of these factors are operative in a given autoimmune disease is clearly doable in a well-characterized animal model, in human disease in the presence of normal numbers or percentages of Treg cells, one must rely on in vitro assays of suppressor function. The question to be addressed is whether in vitro suppression assays are capable of detecting major or even minor alterations in Treg function that mimic their defective function in vivo. The approach I have used to begin to address this question is to ask whether defects in Treg suppression in vitro can be detected with Treg cells derived from mice who develop autoimmune disease secondary to a deletion or mutation of a given gene specifically in Treg cells [Traf3 (8), CD28 (9), id2/id3 (10), ubc13 (11), Itch (12), NF-κB p65 (13), Helios (14), ThPoK/LRF (15), A384Tmutant of Foxp3 (16), and EZH2 (17)]. The thymic development of Treg is normal in all these strains and all have normal numbers of Treg cells; while all have moderate to severe autoimmune disease, but all have normal Treg suppressor function in vitro. Notably, when tested, Treg from many of these strains exhibit abnormal function in vivo in their capacity to suppress the adoptive transfer of IBD in immunodeficient mice following the transfer of naïve T cells. In a number of other studies of mouse strains with selective deletion of genes in Treg cells and resultant manifestation of severe autoimmunity [Bach2 (18), satb1 (19), IRF-4 and Blimp1 (20), and LKB1 (21)], the investigators have not even bothered to test Treg suppressor function in vitro.
|
study
| 27.83 |
What factors could account for the failure of in vitro suppression assays to detect defects in Treg suppressor function? The Foxp3+ Treg population is heterogeneous and can be broadly subdivided into a naïve/quiescent/resting cell subpopulation and into a memory/effector/activated subpopulation. These two populations in the mouse can be distinguished by the differential expression of CD44 (22) or Ly-6C (23). The memory/effector subpopulation (CD44hi, Ly-6C−) appears to undergo increased TCR signals in vivo based on increased levels of CD5 expression and CD3ζ phosphorylation (23). Most importantly, the memory population contains a high percentage of cycling cells (~10%/day) based on Ki-67 staining (Figure 1). By contrast, when analyzed in vitro, Treg are characterized as anergic or non-responsive and fail to proliferate when stimulated with anti-CD3 alone, when stimulated with combinations or anti-CD3 and anti-CD28, or with high concentrations of IL-2 (2). The memory phenotype subpopulation manifests much higher suppressive activity in vivo (23). Furthermore, deletion of TCR expression from Treg results in a selective loss of the cycling MP Treg combined with a loss of Treg-mediated suppressor function in vivo (24). Thus, one major distinction between Treg function in vitro versus in vivo is the failure to see proliferating Treg under any culture conditions in vitro. It is quite possible that the activated/memory/effector Treg do not survive in vitro and their function is, therefore, never actually measured in standard in vitro assays. As the proliferating memory phenotype Treg are the major suppressive population in vivo, the relationship of what we observe in suppression assays in vitro to their physiologic suppressive function vivo remains unclear. While this conclusion is primarily based on studies with mouse Treg cells and human Treg cells may manifest different properties, I remain skeptical that we can use in vitro assays to define a defect in Treg suppressor function in autoimmune disease in man.
|
other
| 30.42 |
The leading candidate for the most predominant suppressor mechanisms utilized by Treg is the downregulation of the expression of CD80/CD86 expression on DCs which is mediated by CTLA-4 expressed on Treg cells. It was first noted that Treg were the only lymphocyte population that expressed CTLA-4 constitutively and several early studies demonstrated that Treg suppression could be reversed in vitro (29) and in vivo (30) by anti-CTLA-4. This model received strong support for the studies of Wing et al. (31) which demonstrated that selective deletion of CTLA-4 expression from Treg resulted in the rapid development of autoimmune disease. Furthermore, Qureshi et al. (32) demonstrated that CTLA-4 was capable of selectively removing CD80/CD86 from the cell surface of DCs by a process of transendocytosis ultimately resulting in the degradation of CD80/CD86 within the Treg. Taken together these studies appear to offer a solid experimental foundation that this pathway is the major one utilized by Treg. However, several more recent studies suggest that the function of CTLA-4 in Treg is considerably more complex. First, it should be pointed out that in the studies of Qureshi et al. (32), CTLA-4 on activated conventional T cells could also mediate the transendocytosis of CD80/CD86. Thus, this pathway is not specific for Treg. Second, the recent studies of Paterson et al. (33) which demonstrated that specific deletion of CTLA-4 from the adult mouse Treg resulted in enhanced Treg proliferation in vivo and was accompanied by increased Treg suppressor function in vivo. Similarly, we have observed (34) that the homeostatic proliferation of Treg in vivo can be markedly enhanced by treatment of mice with anti-CTLA-4. The enhanced proliferation of Treg in this model was accompanied by enhanced proliferation of memory phenotype CD4+ and CD8+ T cells consistent with a loss of Treg suppressor function. Thus, after almost 20 years of intensive study, the role of CTLA-4 in Treg function remains unclear.
|
study
| 31.38 |
The second pathway of Treg-mediated suppression that deserves further discussion is whether consumption of IL-2 by Treg plays any role in Treg-mediated suppression. When we first presented the results of our Treg suppression assays in one of our joint lab meetings some 20 years ago, Bill’s first reaction was that they must be inhibiting by functioning as “IL-2 sinks” a concept originally proposed in the early 1980s (35). We always took Bill’s advice seriously and were then obligated to rule out this mechanism. We demonstrated that Treg inhibited proliferation by blocking the induction of IL-2 mRNA production in the responder T cell (2) and this observation was confirmed by many groups (36). The one exception being the studies of Pandiyan et al. (37) who claimed that Treg consume IL-2 and inhibit the proliferation of Foxp3− T cells leading to Bim-mediated apoptosis. A number of observations have biased me against the concept of the “IL-2 sink” as an important pathway of Treg-mediated suppression: (A) It is widely assumed that because Treg express high levels of CD25 that they have high number of high affinity IL-2 receptors. In fact, no one has determined the number of high-affinity IL-2 receptors on Treg and it is likely that while they probably express in the range of 50,000 CD25 molecules that they express at least a log lower CD122 and CD132 molecules resulting in a level of expression of the high affinity IL-2R (the tri-molecular complex) similar to that seen on activated Foxp3− CD4+ T cells. (B) The addition of exogenous IL-2 has no effect on Treg-mediated suppression of IL-2 production by CD4+ Foxp3− T cells at the mRNA level (38). (C) In a trans-species model where human Treg can efficiently suppress mouse responder cells, the addition of a blocking anti-human CD25 had no effect on the suppressive function of the human Treg (4). (D) While IL-2 is critical for T cell proliferation and expansion in vitro, the expansion of CD4+Foxp3− T cells in vivo in response to antigen stimulation occurs in the absence of IL-2 signaling, as antigen-specific T cells lacking CD25 expression expand as well as wild-type T cells following antigen recognition (28).
|
study
| 30.64 |
T regulatory Treg cells represent one of the most active cycling lymphocyte populations in vivo. After gating on Foxp3+ T cells, we then gated on the activated/effector/memory subset as define by high levels of CD44 expression. The CD44hi population was then stained for Ki-67 expression. Ki-67 positivity reflects cell division over the previous 48-h period.
|
other
| 34.84 |
One of the fundamental questions that one can raise regarding defects in Treg function is which mechanism of Treg-mediated suppression is actually defective? I have summarized (Figure 2) many of the proposed pathways by which Treg may manifest their suppressor effector function including release of soluble suppressor factors, cytolysis, disruption of metabolic pathways, and pathways used to selectively target DCs. The prevailing view in the field is that there is not one universal pathway by which Treg mediate suppression and that Treg have the luxury of picking from this large list of mechanisms to find one (or more) suitable for a particular situation or inflammatory niche. In fact, there are very few in vivo studies clearly supporting this hypothesis. One common mistake is that neutralization of a given pathway, for example, blocking the action of IL-10 (25) or TGF-beta with resultant loss of suppression, indicates that Treg are using only that pathway to mediate suppression. The alternative explanation is that the contribution of these suppressor cytokines is necessary, but not sufficient, for Treg-mediated suppression. Thus, in the xeno-graft versus host disease (GVHD) model (26) production of TGF-beta by Treg is required for prevention of disease, but Treg could also using other pathways at the same time. Indeed, Treg production of TGF-beta may only be required under “super-inflammatory” conditions such as xeno-GVHD, as mice with a selective deletion of TGF-beta in Treg do not exhibit an autoimmune phenotype (27). A similar scenario can be proposed for the requirement of IL-10 production for Treg-mediated protection from IBD, but not for the much less inflammatory autoimmune gastritis where IL-10-deficient Treg are fully protective (28).
|
study
| 32.22 |
In addition to potentially functioning as an “IL-2 sink” for the inhibition of T effector proliferation, IL-2 may also play a critical role to support the maintenance of Foxp3 expression, Treg survival, and Treg proliferation by triggering the STAT5 pathway. However, it should be noted that the Treg subpopulation that appears to be responding to IL-2 homeostatically is the resting Treg population, not the activated cycling population suppressive population. In our studies, IL-2 played no role in Treg cycling in vivo (22). Chinen et al. (39) have attempted to resolve some of these issues by deleting expression of CD25 from Treg in combination with the expression of a constitutively active form of STAT5. The expression of the active form of STAT5 rescued mice from the autoimmune disease present in the CD25 deficient mice. These studies revealed that expression of CD25 on Treg was not needed for suppression of CD4+ responder T cells, but IL-2 consumption by CD25 expressed on Treg played a major role in suppression of CD8+ T cells. One explanation for this dichotomy is that CD8+ T cells are more sensitive to IL-2 signaling than CD4+ T cells. While these elegant genetic studies appeared to resolve the issue of IL-2 consumption at least for suppression of CD4+ T cell responses, more recent studies have shown that Treg cells expressing phospho-STAT5 localize in clusters in lymph nodes with IL-2 producing CD4+ Foxp3− T cells (40). This localized response of Treg to IL-2 signaling also appeared to enhance their suppressive function. Thus, while deprivation of CD4+ effector T cells of IL-2 by Treg may not be play a role in suppression, the action of IL-2 locally produced by T effectors on Treg may be critical for their optimal suppressive activity presumably mediated by pathways other than IL-2 consumption. Indeed, we demonstrated over a decade ago that the initial production of IL-2 by responder T cells was required to activate the suppressor function of Treg which in turn suppressed the subsequent production of IL-2 by responder T cells (38).
|
study
| 30.17 |
One of the major conclusions drawn from studies of Treg suppressor function in vitro using both polyclonal Treg cells and antigen-specific Treg cells is that following stimulation via their TCR, the suppressor effector function of Treg is completely antigen non-specific. Thus, once activated by their cognate antigen, Treg specific for antigen A could suppress the proliferation of T effectors specific for antigen B (41). This concept is supported by studies which demonstrated that antigen-specific Treg cells are more potent inhibitors of disease than polyclonal Treg (42). However, our understanding of the mechanisms of Treg-mediated suppression in vivo is in a less advanced stage that our understanding of Treg-mediated suppression in vitro. A number of fundamental questions need to be addressed including: (1) the site of suppression (target organ or lymphoid tissues), (2) do Tregs inhibit homing of effector cells to the target organ, (3) can polyclonal Treg migrate to the target organ, (4) does suppression in vivo require the continuous presence of the Treg, (5) is suppression reversible, or (6) has a permanent state of tolerance been induced. None of these questions has definitively been answered and solutions are needed for the development of rational Treg therapies. Most importantly, we need reductionist models in vivo that will allow each aspect of the activation of T effector cell response to be analyzed. The field appears to be satisfied with studies demonstrating defective Treg suppressive activity in the classic cell transfer model of induction of IBD using polyclonal Treg, as originally described by Powrie and collaborators (43). However, this model is very complex as disease may be mediated by different T effector subsets (Th1 or Th17), involves both anti-self and anti-non-self responses as contribution of the intestinal microbiome is critical. Very few studies have addressed how Treg with defects in transcription factor function or signaling pathways actually fail to mediate suppression in vivo.
|
study
| 34.06 |
I have already discussed the significance of neutralizing Treg suppression with antibodies to suppressor cytokines. An extension of this approach to dissecting mechanisms of Treg-mediated suppression has been to reverse suppression with antibodies to cell surface antigens expressed on Treg cells that play a role in the process of suppression. We (44) and others (45) first described that polyclonal or monoclonal antibodies to a member of tumor necrosis receptor superfamily, the GITR (TNFRSF18), could reverse Treg-mediated suppression in vitro. However, this conclusion was rapidly drawn into question as CD4+ Foxp3− T cells can also express the GITR and more importantly expression of the GITR is rapidly upregulated on Foxp3− T cells following TCR activation. Indeed, when we cultured combinations of WT and GITR−/− Treg and effector T cells, we only observed reversal of suppression when the GITR was expressed on the responder T effector cells (46). Thus, engagement of the GITR on T effector cells by an agonistic antibody rendered the responder T cells resistant to suppression. It is highly likely that a similar induction of resistance to suppression in T effector cells is responsible for the purported reversal of Treg suppressor function (47) by agonistic antibodies to OX40 (CD137).
|
other
| 28.72 |
The most prominent member of the TNFRSF family that has been implicated in Treg function is TNF itself. Several studies with human T cells have reported that TNF could inhibit the function of Treg and that anti-TNF treatment of patients with RA resulted in restoration of defective Treg function when measured in vitro (48). However, TNF has also been demonstrated to have potent co-stimulatory function on T effector cells and it is likely that the TNF may have exerted its function on the T effectors rendering them resistant to suppression in a manner similar to the studies in the mouse with anti-GITR. Recent studies have failed to reproduce the deleterious effects of TNF on Treg function and have actually demonstrated that exposure of human Treg to TNF increased their expression of CD25 and Foxp3 (49).
|
study
| 29.81 |
It remains possible that future studies may identify cell surface antigens on Treg that are involved in Treg-mediated suppression. Hopefully, such studies will result in the development of agonistic antibodies that can either selectively expand Treg, enhance or alternatively reverse their suppressive function. While the studies discussed above were based on the enhanced expression of several members of this family on Treg (GITR, OX40, and TNFRII), the effects of these reagents in vitro and probably in vivo were mediated by their action as co-stimulatory molecules for T effector cells. Although this is a valuable lesson to have learned, it also has potentially clinical applications. In animal models, antibodies to the GITR have been shown to partially deplete Treg in vivo in the tumor microenvironment and to simultaneously provide co-stimulatory signals to CD4+ and CD8+ T effector cells resulting in inhibition of tumor growth (50). The usefulness of such reagents in the clinic remains to be evaluated.
|
other
| 29.25 |
The concept that Treg cells could only be generated in the thymus was challenged by studies in the mid-2000s (51, 52) which demonstrated that Treg cells could be generated both in vivo (pTreg) and in vitro (iTreg) from peripheral CD4+ Foxp3− T cells. TGF-beta plays a prominent role in the process, particularly in vitro. While there is little dispute about both of these phenomena, the significance, size, and function of the pTreg pool remains to be fully characterized. A significant impediment to progress has been a lack of a defined marker for thymus derived (tTreg). We have suggested that Helios is a useful marker of tTreg (53). Other groups have suggested that neuropilin-1 (Nrp1) is a more useful and more specific marker (54). There are important differences in the expression of these two antigens. First, Helios is a transcription factor thereby limiting its usefulness for isolation, although we now have generated a faithful Helios reporter mouse. Helios is expressed by 70–80% of Treg in peripheral lymphoid tissues and by a somewhat lower percentage (50–60%) of mucosal derived Treg. By contrast, Nrp1 is expressed by 85% of peripheral Treg. The mAb generated against mouse Helios cross-reacts with human Helios and reacts with 80% of Treg in human peripheral blood. Both Helios and Nrp1 can be expressed by conventional T cells in the mouse, although we have not been able to detect Helios expression in human non-Treg under any conditions in vivo or in vitro (55). The expression of Nrp1 by human Treg is unclear. One major deficiency of using Nrp1 as a marker of tTreg is that its expression is regulated by TGF-beta. Thus, pTreg generated in the central nervous system were shown to be suppressive, but uniformly expressed Nrp1; iTreg generated in culture in the presence of TGF-beta are uniformly Nrp1+ (54). Furthermore, the percentage of Nrp1+ Treg is greatly reduced in mice with a T cell-specific deletion of TGF-beta clearly demonstrating that the constitutive expression of Nrp1 is closely regulated by TGF-beta (unpublished observations).
|
study
| 30.12 |
For these reasons, we strongly favor the use of Helios as a definitive marker of tTreg. However, it is incumbent upon us to prove that this is the case. In order to study the differences between Helios+ and Helios− Treg, we have generated a Helios-GFP/Foxp3-RFP double reporter mouse. The Helios+ Treg population expressed a more activated phenotype and had slightly higher suppressive capability in vitro. Both subsets were equivalent in their ability to suppress IBD in vivo and both subsets expressed a highly demethylated TSDR, with slightly higher demethylation in the Helios+ Treg subset. This result is consistent with the concept that pTreg generated in vivo are relatively stable (56). Upon transfer to normal mice, both Helios+ and Helios− Treg cells maintained equal Foxp3 stability and Foxp3+Helios+ Treg maintained stable expression of Helios. Preliminary analysis of the TCR repertoire of both subsets by deep sequencing revealed little to no overlap of the two populations consistent with distinct origins of the subsets (unpublished observations). Taken together, our data indicate that Helios expression can differentiate two distinct populations of Treg with overlapping functions, most likely representing tTreg (Helios+) and stable peripherally induced pTreg (Helios−). However, considerable controversy still exists regarding the use of Helios as a marker for tTreg (57, 58) and caution should still be exerted when using this marker.
|
other
| 30.94 |
Several studies over the past 5 years have challenged the notion that Foxp3+ Treg cell lineage is stable and have raised the possibility that Treg cells can lose Foxp3 expression particularly when present in an inflammatory milieu resulting in “reprogramming” of Treg to potentially pathogenic T effector cells (59). As Treg express an anti-self biased TCR repertoire, these re-programmed Treg would represent a potential potent population of T cells capable of inducing autoimmune disease. As complete deletion of Treg from adult mice results in exuberant inflammation and death in 10–15 days (60), the maintenance of Treg stability is critical to the survival of the host. For this reason, we favor the view that most tTreg are very stable and are unlikely to lose Foxp3 expression. Nevertheless, the studies of Treg instability are convincing and need to be addressed. One possibility is that the unstable population of Treg primarily develops from the pTreg population. pTregs represent logical candidates for instability even though most may have a demethylated TSDR. Alternatively, a minor population of pTreg may not be fully committed to the Treg lineage. The studies of Miyao et al. (61) clearly demonstrate the existence of a small population of Treg that can readily lose Foxp3 expression and can rapidly expand in vivo and thus appear to represent a large percentage of Treg in fate mapping studies. Other studies suggest that tTreg can also manifest Foxp3 instability (62). The recent demonstration (63) of a population of unstable and dysfunctional Treg in the tumor microenvironment that still maintain Foxp3 expression adds further complexity to our understanding of the role of “ex-Tregs.” Studies in the future need to resolve the issue of tTreg versus pTreg and the role of Treg stability. It is unclear if the loss of Treg stability contributes to the pathogenesis of any human autoimmune diseases, but this is a difficult issue to address experimentally.
|
study
| 32.22 |
Although many of the issues posed above have not yet been completely addressed, the use of Treg for cellular biotherapy has already reached the clinic in studies for the prevention of GVHD following stem cell transplantation (64) as well as autoimmune disease (65). The successful use of low-dose IL-2 treatment to expand Treg in two clinical trials (66, 67) has stimulated great interest. A recent perusal of ClinicalTrials.gov has revealed 181 proposed studies involving the use of Treg cells and a number of trials of low dose IL-2 treatment alone or in combination with Treg cellular therapy are planned. Of note, no studies are listed using specific pharmacologic manipulation of Treg function or using monoclonal antibodies to enhance or suppress Treg function. My own view is that the development of such reagents is required before we will have the necessary tools for the therapeutic manipulation of Treg cell function in man. As emphasized in this review, further studies of the biological properties of Treg, particularly the specific mechanisms of suppression utilized in given disease states, are needed as the foundation for the development of pharmacologic reagents.
|
study
| 28.05 |
In conclusion, I would like to thank Bill Paul for supporting my career for the past 40 years. He was always available for discussions and freely provided advice on an almost daily basis. I will miss him most during our weekly data clubs and journal clubs. He was a master at pointing out great science and terrific critique of marginal experiments.
|
study
| 29.5 |
The author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The handling Editor declared a shared affiliation, though no other collaboration, with the author.
|
clinical case
| 36 |
In Norway, cereals are produced in a cool, continental climate between 59° and 65° north. Barley cultivation amounts to about half the cereal acreage, while the rest is mainly wheat and oats. Most cereals are grown in monoculture. Domestic wheat production supplies 50%–70% of the human consumption, while barley and oats provide carbohydrates for the production of animal feed concentrate. This review is based on a risk assessment from the Norwegian Scientific Committee for Food Safety (VKM) and is supplemented with some recently published results. The aim of the risk assessment was to provide a scientific evaluation for risk management related to the need of further measures to reduce the risks posed by exposure to mycotoxin-producing fungi in cereals.
|
study
| 27.42 |
Deoxynivalenol (DON) and analogues are the most common mycotoxins in Norwegian-grown cereals . Previously, Fusarium culmorum was considered the main producer of DON in temperate regions of Europe, including Norway . Towards the end of the 20th century, Fusarium graminearum became the main cause of DON contamination in European cereals . A similar shift in Fusarium species towards increased occurrence of F. graminearum and reduction in F. culmorum prevalence has been reported from Norway . When Hofgaard et al. analysed 500 samples of spring wheat and oats from Norwegian farms collected during 2004–2009, DON concentrations were above 100 µg/kg in 66% of the oats and 70% of the spring wheat samples. The surveillance of mycotoxins in Norwegian cereal grains reported annual mean DON concentrations in oats from 100–2400 g/kg during the years 2002–2015, with the peak concentration in 2012 . Analyses of domestic cereals harvested in 2011 revealed median DON levels of 150 µg/kg in barley, 383 µg/kg in wheat, and 1070 µg/kg in oats, while the maximum DON concentrations were five to seven times higher, and 7230 µg/kg was found in one oat sample . In domestic samples collected during 2004–2009, F. graminearum DNA (≥0.1 pg per ng plant DNA) was detected in 69% of the oat samples and 62% of the spring wheat samples. There was a significant positive association between F. graminearum DNA content and DON+3-acetyl DON (3ADON), while F. culmorum DNA was not correlated with the DON content .
|
other
| 28.31 |
Although the 15-acetyl DON (15ADON) chemotype has been detected in Norway, the 3ADON chemotype is the most prevalent DON producer in the country . Yli-Mattila et al. found that 3ADON is dominant in Northern Europe, while in Central and South Europe, 15ADON has become the dominant chemotype. The Joint Food and Agriculture Organization of the United Nations/World Health Organization (FAO/WHO) Expert Committee on Food Additives (JECFA) concluded that the toxicity of the acetylated derivatives is equal to that of DON . Global warming may in the future lead to higher precipitation in the main cereal-producing countries of North-Western Europe, which is predicted to increase the DON contamination of cereals by up to three times .
|
study
| 34.38 |
DON is reported to inhibit protein synthesis and induce the transcription of specific transcription factors related to inflammatory responses at low concentrations, while immunosuppression and cytotoxicity dominate at higher concentrations . The main clinical effects of exposure to DON are reduced weight gain, inflammation at low doses, and reduced immune responses at higher doses. DON is shown to upregulate the expression of proinflammatory genes and several other genes related to (amongst others) communications between the innate and the adaptive immune systems and to cell–cell signaling . DON also altered the expression of several genes involved in gastrointestinal disease, inflammatory disease, and response network. Furthermore, DON affected the gastrointestinal barrier, and induced a significant increase in levels of mRNA coding for interleukin (IL)-8, IL-1α, and IL-1β, tumor necrosis factor alfa (TNF-α) in porcine gut epithelial cells and in porcine jejunal explants alterations, which could be associated with intestinal inflammatory disease in humans . DON increased the permeability through the gut epithelial layer both in vivo and in vitro . Several national and international human risk assessments of DON have been published . The current human tolerable daily intake (TDI) applied by both JECFA and the European Union is 1 µg/kg bw/day . The TDI is based on the reduction in feed intake and weight gain in a two-year study in mice . This TDI is also applied in Norway.
|
study
| 35.78 |
Since the DON-producing Fusarium fungi grow and produce toxins in cereal grains, the exposure estimations are based on the occurrence in cereal-based products only. The occurrence data have been retrieved from the monitoring programme for mycotoxins in food for the Norwegian Food Safety Authority (NFSA) for the years 2008–2011 . All samples were analysed by the Norwegian Veterinary Institute, which is the National Reference Laboratory for mycotoxins in food and feed. NFSA monitors DON levels in flour and not-finalised cereal products with the aim of limiting the required number of food categories to be sampled and rather increase the sample numbers in each category of flour instead. The decision was based on a desire to design a cost-effective monitoring programme.
|
other
| 29.56 |
The mycotoxin concentrations used in the exposure calculations are presented in Table 1. Mycotoxins were measured in four different flour products and in infant porridge. The highest and lowest mycotoxin concentrations during the years 2008–2011 for each flour type are presented in the table to illustrate the annual variations. Infant porridge was only analysed in 2008. The levels in samples below the limit of detection (LOD) were set to 0.5 × LOD when calculating the mean concentrations. The number of samples below the LOD were, however, low (<10% of the samples in each flour category), so this had little impact on the total mean concentrations of DON.
|
other
| 28.61 |
Consumption data from three Norwegian dietary surveys were used. For 1-year-old and 2-year-old children, mothers filled in a semi-quantitative food frequency questionnaire covering the last 14 days. The study was conducted in 2006 and 2007. For 4-, 9-, and 13-year-old participants, food intakes were recorded by filling in a pre-coded food diary for four days . The study was conducted in 2000 and 2001. For adults aged 18–70 years, two times 24-h recalls were chosen as the dietary assessment method. The study was conducted in 2010–2011 . The consumption of different flour categories was extracted from these data based on calculations using standard recipes for all cereal-contaminated food items. A brief description of all dietary surveys used in the calculations is given in .
|
other
| 34.25 |
Occurrence data (Table 1) and consumption data (Table 2) were used to calculate the DON exposure for different age groups (Table 3). To illustrate the annual variation, the exposure was calculated using the mean concentrations from the year with the lowest DON concentrations in flour (mean low) and from the year with the highest DON concentrations in flour (mean high). The exposures were calculated using individual food consumption data, and the mean and high (95th percentile) intakes were calculated using the individual dietary intakes (Table 3).
|
other
| 32.78 |
DON was present in virtually all flour samples . The current TDI is a group TDI applying to the sum of DON and its acetylated forms, but not DON-3 glucoside, which is probably also present in cereal samples. The acetylated forms and DON-3 glucoside were not included in the analysis of survey samples on which the present study is based, and the intake of these forms could therefore not be estimated. It has previously been shown that 3-ADON would add approximately 10% to the DON-levels, while 15-ADON was rarely present . The occurrence of DON-3 glucoside in Norwegian grain has not been investigated in representative samples so far.
|
study
| 28.48 |
The estimated mean intakes of DON from cereal-based food were in the range of or exceeding the TDI for the 1- to 4-year-old children (Table 3). The estimated intake was highest for the 2-year-olds, probably due to high consumption of grain-based food in relation to a low body weight. In the year with the highest occurrence of DON in flour, the mean exposure was estimated to be twice as high as the TDI, and the high exposure was estimated to be 3.5 times higher than the TDI of 1 µg/kg bw in 2-year old children (Table 3). A considerably higher estimated exposure in children than in adults corresponded well with previous findings from a Norwegian study on the occurrence of DON in human urine, where DON concentrations were two-to-three-fold higher in the urine of 3–9 year-olds compared to adults . In agreement with the exposure estimations in this paper, the biomonitoring study confirmed the ubiquitous exposure to DON in Norway. DON and DON-related metabolites were present in 99% of the Norwegian urine samples. The heterogeneous distribution of mycotoxins—including DON—in food makes sampling critical and calculations of the intake based on occurrence in food more uncertain. Use of biomonitoring methods to estimate the exposure circumvent these uncertainties . Furthermore, the use of biomonitoring includes exposure from all sources, not only selected food items. The total exposure to DON was, however, not estimated by Brera et al. . Furthermore, the total urine volume excretion was not recorded, and only samples of morning urine were analysed. The total exposure can therefore not easily be calculated from the data.
|
study
| 29.1 |
The estimated exposure of adults in Norway is higher than the exposures estimated for adult Swedish , Belgian , Dutch , French , and Spanish populations. The estimated dietary intake of DON in Norwegian children is also higher than the corresponding estimated intakes in other European countries . Since the Norwegian study is the only study in which the estimates are based only on the DON occurrence in flour and not food items as eaten, the discrepancies in the methodologies may be a contributing factor to these apparent differences. Furthermore, there are uncertainties related to both the methodologies used for the dietary surveys and for the representativeness of samples used in the calculations. However, to reduce the uncertainties related to sampling, the sampling in this study has been performed at the end of the processing of flour, and each sample is collected to represent one day’s production. A more detailed discussion of these uncertainties is given in .
|
other
| 29.95 |
It is of concern that the estimated exposure in young children exceeds the TDI. It should, however, be pointed out that the maximal estimated DON exposure in children (high consumers, maximal measured DON concentration) exceeds the TDI by not more than 3.5-fold, meaning a reduction of the safety margin established by JECFA by the same factor. JECFA derived the TDI by introducing a safety margin of 100 to the No Observed Adverse Effect Level (NOAEL) in a study on clinical effects in mice . There is, however, an uncertainty in the exposure estimates, since known modified forms of DON (such as the acetylated forms and DON-3-glucoside) are not included in the exposure estimates. The toxicological relevance of the latter is also uncertain.
|
study
| 30.16 |
An Acute Reference Dose (ARfD) of 8 µg/kg bw has been established for DON . Oat flakes may have high DON concentrations (Table 1). Even if oat flakes are not the main contributor to the mean DON exposure, it is common to eat large portions of oat flakes as breakfast cereal or oatmeal porridge.
|
study
| 31.67 |
To illustrate a worst-case acute exposure, the amount of oat flakes or wheat bread a person would have to consume to reach the ARfD was estimated using the highest measured concentrations. A a 2-year-old child with a body weight of 12.8 kg, would have to consume 132 g oat flakes, corresponding to about 1100 g ready-to-eat oat meal porridge, or 91 g wheat, corresponding to 132 g based bread (approximately 3.5 slices of bread), to exceed the ARfD.
|
other
| 32.06 |
DON is the most common mycotoxin in Norwegian cereals and it is the main mycotoxin of concern in domestic food products. Analyses of domestic grain show an increase in the mean concentrations of DON in barley, oats, and wheat during the last decade. Since the turn of the century, the most important DON producer—F. graminearum—has been detected at higher levels than previously in Norway. Of the Fusarium species infecting Norwegian cereals only F. graminearum is significantly and positively correlated to DON content. In the last decade, a precipitation increase during the cereal flowering season has been correlated with an increase in Fusarium infection rate and the occurrence of DON in oats and wheat.
|
study
| 30.17 |
The estimated mean exposures to DON in years with low and mean concentrations of DON in flour and oats, respectively, were in the range of or exceeded the TDI by almost two times in 1-year-old infants and 2-year-old children. In years with high mean DON concentrations, the high (95-percentile) exposures exceeded the TDI by up to 3.5 times in 1-, 2-, 4-, and 9-year-olds. The Norwegian Scientific Committee on Food Safety concluded that exceeding the TDI in infants and children is of concern, although the TDI is not a threshold for toxicity. The estimated dietary intakes of DON in adolescent and adult populations were equal to or below the TDI, and are therefore not a health concern. Acute exposure to DON is of no concern in any age group.
|
study
| 28.3 |
There are uncertainties related to the representativeness of the data. Each food sample was taken during one day of production and is considered to represent the production at the mill that day. There are uncertainties related to the analytical measurements. The laboratory estimated the expanded uncertainty to 40%. The uncertainty will, however, be to either side of the true value. The uncertainty is therefore likely to decrease with increasing number of samples. The human exposure estimates are based on the DON level in flour. There may be a certain reduction during food processing, but these changes are considered to be small due to the high stability of DON.
|
other
| 29.25 |
The occurrence data for DON in Norwegian cereals are scarce. There is a need for more systematic surveillance, especially focusing on products with high wheat and oat content. Grain infected by Fusarium-species in the field is more toxic than grain with the corresponding amount of pure toxin added. There is a need to identify the unknown factors in naturally-infected grain that add to the toxic effect.
|
study
| 32.8 |
The coating of nanoparticles is an essential step to improve the particle thermostability , to create a protective layer between particle and environment or to enhance particle dispersion in liquids. Silicon oxide is one of the preferred nontoxic and almost inert coating materials.
|
other
| 28.9 |
Many coating techniques use liquid phase reactions with additional steps such as washing, drying and separation . Moreover, impurities from solvents remain in the final solid coatings. Therefore, gas phase coating techniques are generally preferred (e.g., for atomic layer deposition , for flames and for plasma enhanced chemical vapor deposition (CVD) ).
|
clinical case
| 26.69 |
Most publications on SiOx coatings deal with the coating of flat surfaces, but few groups used it to coat nanoparticles directly in the gas phase. Homogeneous coatings can be performed in non-continuous devices such as fluidized bed reactors . In flame synthesis, direct coating of gas born nanoparticles such as TiO2, may be performed in a continuous one-step process.
|
clinical case
| 26.53 |
A more versatile coating method is the CVD that can be induced by photochemistry and plasmas. In dielectric barrier discharges (DBD), plasma filaments produce reactive species (electrons, photons, radicals, excited species and more stable ozone and nitrogen oxides in air), triggering the polymerization of organic and organo-metal precursors. For the coating of substrates, the precursors can be injected in the DBD or in post-DBD for SiOx coatings , as well as for functional polymer coatings . For the coating of supported particles by plasma, Mori et al. , Kogoma et al. and Brüser et al. used batch processes.
|
study
| 28.3 |
The direct SiOx coating of suspended nanoparticles in gases using atmospheric pressure DBD is an emerging field . Nessim et al. used HMDSO (hexamethyldisiloxane) and TEOS for the coating of particles either directly in a plasma as Vons et al. , or in post-DBD . As for flat surface coating, the precursor injection in the DBD leads to a loss of functionality of the gaseous precursor reacting with plasma species in the gap, to particles electro-collection on surfaces in the gap and to discharge destabilization that hampers the economics of the process.
|
study
| 27.39 |
Here, post-DBD injection of the organo-silicon precursor is tested to avoid electrode coating so as to achieve stable DBD production of active species with subsequent controlled thickness of SiOx coatings of nanoparticles versus tetraethyl orthosilicate (TEOS) concentration and reaction duration. The setup and operating conditions are presented. Preliminary tests confirm that plasma species trigger the post-DBD conversion of TEOS into solid SiOx coatings of nanoparticles. DBD operating conditions are then scanned to produce ozone and dinitrogen pentoxide. In the selected conditions, subsequent sections present the coating of spherical particles and of agglomerates separately versus reaction duration and concentrations of reactants (plasma species and TEOS). Finally, properties of coated agglomerates for thermal stabilization of catalyst particles and for photoactivity control are depicted.
|
review
| 27.05 |
The experimental setup is shown in Figure 1. The first step is the production of nanoparticles with defined size, concentration and morphology (spheres or agglomerates). Then, a controlled amount of precursor is added. The third step is the post-DBD injection of this TEOS/nanoparticles aerosol, mixed with plasma species. Finally, post-DBD reaction times are tuned in different volumes.
|
other
| 29.03 |
The metal core particles were produced in a spark discharge generator (SDG) without any side products in the gas stream . Two electrodes of the same material with a 5 mm gap were polarized with a high voltage DC power supply. Then, repetitive sparks develop between the electrodes leading to vaporization and nucleation into nanoparticles . The preferred material was platinum for its high TEM contrast and applications, e.g., in catalysis. Due to the high number concentrations of small primary particles large fractal agglomerates formed rapidly behind the SDG in 1 L/min N2 (standard liter per minute, nitrogen 5.0). Figure 2 (left) shows such agglomerates, converted into spherical particles (right) by sintering in a tube furnace at 1000 °C. Pt, Cu, Ti, Ni and Fe have been used in the spark generator to produce similar nanoparticles, agglomerated or spherical after sintering, which could be size selected with a Radial Differential Mobility Analyzer (RDMA) downstream of an X-ray source to establish a known charge distribution.
|
other
| 30.81 |
Among the organo-silicon precursors, tetraethyl orthosilicate (TEOS, Si(OC2H5)4) is one of the most prominent. Due to its non-hazardous character, TEOS is easy to handle. Moreover, its relatively low vapor pressure facilitates the addition of small amounts of gaseous precursor and it reacts more slowly compared to other precursors and is therefore suitable to achieve nano-sized SiOx coatings.
|
other
| 27 |
The mixing of the TEOS with the particles is done in a simple T-piece prior to post-DBD injection. A second flow of nitrogen below 30 mL/min is used to transport the precursor vapor from a bottle. The nitrogen does not bubble through the precursor but flows over the surface of the liquid to prevent the formation and transport of droplets. In the bottle kept at room temperature (24 °C), the distance between the gas inlet and the surface of the initially liquid TEOS is kept constant at 5 mm.
|
other
| 28.98 |
The precursor concentration was measured by Fourier transform infrared spectroscopy (FTIR, Tensor 27, Bruker Optik GmbH, Ettlingen, Germany) on the Si–O absorbance near 1100 cm−1, directly after the mixing of all gas flows downstream of the DBD reactor (Figure 1), i.e., at the entrance of the post-DBD reaction chamber. It can be tuned from 0.3 to 4.1 ppmv (below 0.2% of TEOS saturation vapor pressure of 242 Pa at 24 °C), without affecting significantly the total flow of 3 L/min (plus a maximum of 30 mL/min of the N2-TEOS mixture).
|
other
| 28.48 |
The DBD is made of two stainless steel parts that hold a quartz glass tube with an inner diameter of 13 mm and a thickness of 1.5 mm serving as dielectric (see inset of Figure 1). On the outside of the glass tube, an electrode made of copper adhesive tape is connected to the high voltage AC power supply. A stainless steel disc (diameter: 12 mm, length: 2 mm) is fixed on the grounded central stainless steel tube in front of the polarized external electrode. Plasma filaments then occur in the 0.5 mm ring-shaped gap between the metal disc and the dielectric, in a so-called monoDBD .
|
other
| 30.34 |
To limit the electrode temperature below 100 °C, the generator frequency was fixed to 41 kHz. The voltage was measured with a HV probe. The current pulses related to each plasma filament were recorded via a 50 Ω input resistor to evaluate the charge and the energy per filament as well as the power, calculated, with n the number of periods and T the period duration, according to: (1)P=1n·T·∫nTu(t)·i(t)dt
|
other
| 31.03 |
The particles and the precursor flow through a stainless steel tube (4.57 mm inner diameter) without contact with the plasma. The combined aerosol flow from the spark generator and the TEOS bottle was injected into the inner tube at 1 L/min N2 varying only slightly with the small amount of precursor gas flow. A 1:1 mixture of nitrogen and filtered air was injected at 2 L/min into the DBD gap to transport plasma species downstream of the DBD up to the post-DBD mixing with the aerosol/precursor mixture. The total flow of about 3 L/min was injected in the post-DBD reaction volume. To enhance the mixing of plasma species and of the particle/TEOS aerosol flow, a static mixer was placed about 8 mm downstream of the DBD so that there is no reflux of TEOS into the discharge zone. As shown in Figure 1, it deflects the inner flow towards smaller tubes near the outer diameter of the mixer, leading to turbulent mixing of the two gas flows.
|
other
| 29.22 |
The influence of the reaction duration was tested with different tubes as reaction chambers with laminar flow leading to defined transit time distributions. Unless stated otherwise, the selected conditions defined from the preliminary results detailed in Section 3.2, are specified in Table 1.
|
other
| 28.34 |
Downstream of the reaction chamber, the coated particles were collected at 0.2 L/min in a bypass across a lacey transmission electron microscopy (TEM) grid for 2 min. As a consequence, the particles analyzed with the TEM refer to different ages since condensation and heterogeneous reactions still happen during the 2 min collection. However, for the presentation of the experimental data, the beginning of the sampling was chosen as time reference. Then, the TEM grid was removed and stored in ambient air for at least 20 min before being transferred under ultra-high vacuum into the TEM. Coupled with the energy-dispersive X-ray spectroscopy (EDX) sensor, size, coating thickness and atomic composition of the coated particles were characterized.
|
other
| 39.12 |
On-line measurements of the particle number size distributions were obtained with a scanning mobility particles sizer (SMPS Grimm 5.403, GRIMM Aerosol Technik GmbH & Co. KG, Ainring, Germany). Assuming spherical particles, the coating thickness is defined as half the difference of the mobility equivalent mode diameters of non-coated and coated particles.
|
other
| 36.66 |
The coated surface of particles was estimated by aerosol photoemission measurements (APE) . Downstream of an electrostatic precipitator, the neutral aerosol exposed to UV is charged positively due to electron emission from metal nanoparticles. The aerosol charge, measured with a Faraday Cup Electrometer after an ion trap is proportional to the uncoated active surface area.
|
other
| 36.94 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.