Effect of NLRP3 inflammasome genes polymorphism on disease susceptibility and response to TNF-α inhibitors in Iraqi patients with rheumatoid arthritis
Metadata
Authors: Abdullah Abbas Awni, Zainab Oday Hamed, Ahmed Abdul-Hassan Abbas, Ahmed Sahib Abdulamir Journal: Heliyon Date: 2023 Jun 1 DOI: 10.1016/j.heliyon.2023.e16814 PMID: 37332933 PMCID: PMC10275785 URL: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10275785/ PDF: https://pmc.ncbi.nlm.nih.gov/articles/PMC10275785/pdf/main.pdf
Abstract
Background: Rheumatoid arthritis (RA) is a genetically predisposed, systemic, chronic, inflammatory disease. Immune system dysregulation and inherited susceptibility polymorphisms suggest that this type of variation is functional and may help predict disease susceptibility and develop new therapeutic strategies. Anti-TNF-alpha (TNF-α) drugs are highly effective RA treatments, but not all patients respond the same way. It's important to figure out whether RA risk alleles can identify and predict anti-TNF-α-responsiveness in RA patients.
Aims of the study: Examine the function of the NLR family pyrin domain containing 3 (NLRP3) and caspase recruitment domain family member 8 (CARD8) genes polymorphisms and their morbid genotypes and alleles in RA patients and apparently healthy controls. In addition, their role in disease susceptibility, severity, and response to anti-TNF-α therapy. Also, examine how single nucleotide polymorphisms (SNPs) affect serum levels of pro-inflammatory cytokines like TNF-α and interleukin (IL)-1β.
Materials and methods: 100 RA patients (88 females, 12 males) and 100 apparently healthy people (86 females, 14 males) were examined. To measure serum TNF-α and IL-1β, Elabscience sandwich ELISA kits were used. Iraq Biotech, Turkey DNA extraction kit was used to extract genomic DNA from whole blood. CARD8 (rs2043211) and NLRP3 (rs4612666) were genotyped using Agilent, AriaMx, USA, through Tri-Plex SYBR Green-based real-time PCR allelic discrimination assays. Geneious software, version 2019.2.2, used to design primers from published sequences (GenBank accession no. GCA 009914755.1). Primer specificity was determined by NCBI's BLAST.
Results: Study found that there is association between cytokines serum level and 28-joints disease activity score (DAS-28). The level of TNF-α increases with the higher DAS-28 (r2 = 0.45, P < 0.0001). Also, IL- 1β level increases with higher DAS-28 (r2 = 0.51, P < 0.0001). There were no statistically significant variations between patients with RA and the control group in the distribution of CARD8 SNP rs2043211 and NLRP3 SNP rs4612666 genotypes (P = 0.17 and 0.08 respectively) as well their alleles (P = 0.059 and 0.879 respectively). CARD8 (rs2043211) TT genotype was more frequent in patients with higher DAS-28 (P < 0.0001) and higher TNF-α and IL-1β serum levels (P < 0.0001 for both). Also, NLRP3 (rs4612666) TT genotype was more frequent in patients with higher DAS-28 (P < 0.0001) and higher TNF-α and IL- 1β serum levels (P < 0.0001 for both). Interestingly, this study revealed that CARD8 (rs2043211) and NLRP3 (rs4612666) variant genotypes are associated with lower response to anti-TNF-α drugs.
Conclusions: Serum TNF-α and IL-1β correlate with DAS-28 and disease activity. Non-responders have elevated TNF-α and IL-1β. CARD8 rs2043211 and NLRP3 rs4612666 variant polymorphisms are associated with high serum TNF-α and IL-1β, active disease course, poor disease outcomes, and low response to anti-TNF-α therapy.
Keywords: Rheumatoid arthritis, Etanercept, Infliximab, IL-1β, TNF-α, NLRP3, CARD8, Single nucleotide polymorphism (SNP)
Background
Rheumatoid arthritis (RA) is a genetically predisposed, systemic, chronic, inflammatory disease. Immune system dysregulation and inherited susceptibility polymorphisms suggest that this type of variation is functional and may help predict disease susceptibility and develop new therapeutic strategies. Anti-TNF-alpha (TNF-α) drugs are highly effective RA treatments, but not all patients respond the same way. It's important to figure out whether RA risk alleles can identify and predict anti-TNF-α-responsiveness in RA patients.
Aims of the study
Examine the function of the NLR family pyrin domain containing 3 (NLRP3) and caspase recruitment domain family member 8 (CARD8) genes polymorphisms and their morbid genotypes and alleles in RA patients and apparently healthy controls. In addition, their role in disease susceptibility, severity, and response to anti-TNF-α therapy. Also, examine how single nucleotide polymorphisms (SNPs) affect serum levels of pro-inflammatory cytokines like TNF-α and interleukin (IL)-1β.
Materials and methods
100 RA patients (88 females, 12 males) and 100 apparently healthy people (86 females, 14 males) were examined. To measure serum TNF-α and IL-1β, Elabscience sandwich ELISA kits were used. Iraq Biotech, Turkey DNA extraction kit was used to extract genomic DNA from whole blood. CARD8 (rs2043211) and NLRP3 (rs4612666) were genotyped using Agilent, AriaMx, USA, through Tri-Plex SYBR Green-based real-time PCR allelic discrimination assays. Geneious software, version 2019.2.2, used to design primers from published sequences (GenBank accession no. GCA 009914755.1). Primer specificity was determined by NCBI's BLAST.
Results
Study found that there is association between cytokines serum level and 28-joints disease activity score (DAS-28). The level of TNF-α increases with the higher DAS-28 (r^2^2 = 0.45, P < 0.0001). Also, IL- 1β level increases with higher DAS-28 (r^2^2 = 0.51, P < 0.0001). There were no statistically significant variations between patients with RA and the control group in the distribution of CARD8 SNP rs2043211 and NLRP3 SNP rs4612666 genotypes (P = 0.17 and 0.08 respectively) as well their alleles (P = 0.059 and 0.879 respectively). CARD8 (rs2043211) TT genotype was more frequent in patients with higher DAS-28 (P < 0.0001) and higher TNF-α and IL-1β serum levels (P < 0.0001 for both). Also, NLRP3 (rs4612666) TT genotype was more frequent in patients with higher DAS-28 (P < 0.0001) and higher TNF-α and IL- 1β serum levels (P < 0.0001 for both). Interestingly, this study revealed that CARD8 (rs2043211) and NLRP3 (rs4612666) variant genotypes are associated with lower response to anti-TNF-α drugs.
Conclusions
Serum TNF-α and IL-1β correlate with DAS-28 and disease activity. Non-responders have elevated TNF-α and IL-1β. CARD8 rs2043211 and NLRP3 rs4612666 variant polymorphisms are associated with high serum TNF-α and IL-1β, active disease course, poor disease outcomes, and low response to anti-TNF-α therapy.
**Keywords:**Keywords: Rheumatoid arthritis, Etanercept, Infliximab, IL-1β, TNF-α, NLRP3, CARD8, Single nucleotide polymorphism (SNP)
1. Introduction
Rheumatoid arthritis (RA) is an autoimmune disease characterized by chronic inflammation and joint damage [11]. Genetic and environmental factors have been implicated in RA pathogenesis, but the exact causes are unknown. RA pathogenesis also involves abnormal immune responses, both innate and adaptive. Many cytokines are involved in RA pathogenesis and persistence [22]. As producers of cytokines and antigen presentation by phagocytes, innate immune system cells are crucial to disease initiation and maintenance [33]. Monocytes/macrophages that release tumor necrosis factor (TNF)-α and interleukin (IL)-1β contribute to joint inflammation. B-lymphocytes (B-cells) could control the immune response direction through antibody production by independent mechanism. Such processes include the presentation of antigen and the release of pro-inflammatory cytokines [44].
Innate and adaptive immune system activation are linked. Several studies have shown that NLR family pyrin domain containing 3 (NLRP3) inflammasome affects this relationship [55]. NLRP3, a complex multimeric protein, controls inflammatory immune response, apoptosis, and the release of pro-inflammatory cytokines like IL-1β as an upstream activator of nuclear factor κ-light-chain-enhancer of activated B-lymphocytes (NF-κB) signaling [66]. Inflammasome activation is tightly regulated by many processes, including transcription of NF-κB-dependent NLRP3 and IL-1β and endogenous proteins like caspase domain-containing protein 8 (CARD8), which physically interacts with caspase-1 and negatively regulates caspase-1-dependent IL-1β expression and NF-κB activation [77].
CARD8 and NLRP3 polymorphisms affect RA susceptibility and severity, according to several studies. Addobbati et al. (2018) found that CARD8 rs2043211 SNP (A > T) is associated with disease severity in RA clinical manifestations [88]. Patients homozygous for the T allele had higher functional disability. The rs2043211 polymorphism introduces a premature stop codon (Cysteine > Stop) that produces a severely truncated protein [99]. CARD8 role in inflammasome biology is unknown. CARD8 may modulate NLRP3 activation or induce NF-κB inflammasomes independently [1010]. CARD8 variation increases IL-1β secretion, especially when combined with NLRP3 rs35829419 [1111]. In addition, this variation associated with increased induction and translocation of NF-κB activity to the nucleus, resulting in high constitutive levels of RA inflammatory mediators like pro-IL-1β and TNF-α [1212]. Synovial cell proliferation and bone and cartilage degradation have also been linked to NF-κB [1313].
RA treatment aims to promote remission or very low disease activity. Biological therapies improve clinical and radiographic outcomes for some RA patients. Hypoxia activates the NLRP3-inflammasome in active RA. Therefore, it is hypothesized that NLRP3-inflammasome is activated before biologics in RA patients and that anti-TNF-α therapy may modulate this activation [1414].
NLRP3 gene polymorphism rs4612666T was associated with decreased expression. There was a relationship between two variants of NLRP3 (rs4925659 and rs10925026) and the European League Against Rheumatism (EULAR) response. rs10925026 and rs4925648 in NLRP3 were associated with good versus no response. Rs10925026 C allele was associated with non-response, while rs4925659's A allele with improved response. rs4925659 variant had modest RA susceptibility with (rs10159239), but not rs10925026 or rs4925648 [1414]. Kastbom et al. (2010) found a link between CARD8 p. C10X polymorphism and RA severity in Swedish and Spanish patients. (c.30 TA, rs2043211) produces a premature stop codon (p.C10X). Compared to NLRP3/CARD8+/+, the combination of p. Q705K/p. C10X in NLRP3/CARD8 (−/−, denoting the two minor alleles) was significantly more frequent in RA patients [1515]. In early RA studies, the p. C10X CARD8 variant was linked to inflammatory activity and overrepresented in anti-TNF-α patients. RA has persistent innate immune system activation [1616].
European Alliance of Associations for Rheumatology (EULAR) response was nominally correlated with CARD8 SNP (rs11672725), with the T allele enhancing response [88].
Disease susceptibility and response to anti-TNF-α drugs suggest different genetic regulatory mechanisms in RA patients [1717]. Anti-TNF-α agents have greatly improved RA symptoms, but not all patients respond [1818]. Better diagnosis, treatment, and healthcare cost reduction are new concerns [1919]. The discovery of inherited variations (polymorphisms) and their relationship to immune system dysregulation, immune complex-mediated disease, and disease susceptibility suggests that this type of variation is functional and evolutionary and can help predict disease susceptibility and develop new therapeutic strategies [2020]. It is essential to determine whether these RA risk genotypes or alleles can pinpoint RA predisposition and predict patients’ response to biological drug before therapy. NLRP3 SNP rs4612666 and CARD8 SNP rs2043211 were examined in RA patients and healthy controls to determine their morbid genotypes and alleles. Additionally, examine the association of gene polymorphisms with disease susceptibility, severity, response to anti-TNF-α therapy, and serum TNF-α and IL-1β levels.
2. Patients, materials and methods
The study recruited 100 patients with EULAR-defined RA and 100 apparently healthy subjects. All signed a biomedical research consent form. Ethical approval was obtained from the Institutional Review Board (IRB) - College of Medicine/Al-Nahrain University. All patients were diagnosed and treated by rheumatologists at Baghdad Teaching Hospital - Rheumatology Unit from November 2018 to March 2020. RA patients with other chronic diseases and those treated with Etanercept or infliximab for less than 3 months were excluded from the study. As a control, apparently healthy subjects of similar age and sex were recruited. Venous blood was collected for genetic studies and measurement of serum level TNF-α and IL-1β. Age, gender, number of tender (TEN) and swollen (SW) joints were collected from RA patients. Visual analogue scale (VAS) of pain and disease activity were assessed by rheumatologist, Also, type of anti-TNF-α drug. DAS-28 assessed clinical disease activity, including remission, according to EULAR criteria. DAS-28 scores were used to divide patients into responders and non-responders subgroups (Table 1Table 1).
Table 1.
EULAR-defined disease activity and treatment response after 3 months.
| DAS-28 score | Disease activity/Response |
|---|---|
| DAS-28 < 2.60 | Remission |
| DAS-28 ≥ 2.60 and ≤ 3.20 | Low or mild disease activity |
| DAS-28 > 3.20 and ≤ 5.10 | Moderate disease activity |
| DAS-28 > 5.10 | High or severe disease activity |
| ΔDAS-28 ≥ 1.2 and DAS-28 ≤ 3.2 | Responders |
| ΔDAS-28 ≤ 1.2 and DAS28 ≤ 5.1 | Non-responders |
| Genomic DNA was extracted from EDTA-anti-coagulated venous blood using Iraq Biotech Co., Turkey DNA extraction kit from whole blood according to the manufacturer's instructions. Primers were designed according to the published sequences (GenBank accession no. GCA_009914755.1) using Geneious software, version 2019.2.2. The software introduced a mismatch at the −2 position of the 3′ end of both allele-specific primers to increase reaction specificity (Table 2Table 2). The lyophilized primers were prepared according to Integrated DNA Technologies' (IDT, USA) instructions. BLAST program at national center for biotechnology information (NCBI) was used to determine the specificity of the primers (www.ncbi.nlm.nih.gov/blastwww.ncbi.nlm.nih.gov/blast). |
Table 2.
The NLRP3 rs4612666 and CARD8 rs2043211 SNP primer sets.
| Gene | SNP | Primers | Set Ta |
|---|---|---|---|
| CARD8 | rs2043211-COM | TTTCTGAGACCCTTTGTGACAT | 54.7 |
| rs2043211-A | CAGGAACAGCACGGAACA | ||
| rs2043211-T | CAGGAACAGCACGGATCA | ||
| NLRP3 | rs4612666-COM | ACAACAATGTGAAGTGCTTA | 51.2 |
| rs4612666-A | GCTCCCACCAATACTACA | ||
| rs4612666-G | GCTCCCACCAATACTACG | ||
| CARD8 (rs2043211) and NLRP3 (rs4612666) were genotyped using SYBR Green-based Tri-Plex real-time PCR allelic discrimination assay using AriaMx, Agilent, USA. In a total volume of 20 μL containing 10 μL of 2x SYBR Green PCR Master, 1 μL of each primer per reaction, 2 μL of the genomic DNA dilution, and distilled water to the final volume was mixed. The PCR thermal profile was as follows: an initial denaturation step (95 °C for 3 min, 1 cycle) was followed by amplification and quantification steps repeated for 40 cycles (95 °C for 5 s, primer set annealing temperature for 15sec (54.7 for CARD8 SNP and 51.2 for NLRP3 SNP), 72 °C for 20 s, with a single fluorescence measurement at the end of the elongation step at 72 °C). A high-resolution melting curves (HRMs) were constructed by lowering the temperature to 55 °C and later increasing the temperature by 0.2 °C each 30 s to 95 °C while continuously measuring the change in fluorescence. Melting temperature (Tm) values were automatically assigned a plot generated by the Agilent AriaMx software. Sandwich-ELISA Kits from Elabscience, USA, was used to measure TNF-α and IL-1β serum levels. The procedure was carried out in accordance with the manufacturer instructions. BioTek ELISA reader, USA, was used for all measurements. Statistical analysis operated using SPSS Statistics (V 25.0; IBM SPSS Software, USA). A P < 0.05 (exact two-sided) was accepted as level of significance. Continuous variables were subjected to a normality test. If the data had a normal distribution, the tt-test or analysis of variance (ANOVA) was used to compare means. Therefore, these variables were expressed as mean ± standard deviation (SD). Binomial variables were expressed as numbers and percentages and analyzed with Chi-square test. Binary logistic regression was used to calculate odds ratios (ORs) and the corresponding 95% confidence intervals (CIs) in order to assess the association between polymorphisms different genotypes and alleles in RA patients. |
3. Results
3.1. Demographic and clinical features of the patients and controls
The proportion of females to males in both the patient and control groups were comparable statistically (P = 0.67). RA is 7.33 times more common in women than men, females made up 88% of RA patients.
The mean age of female patients was 49.84 (±11.69) and the mean age of female controls was 53.09 (±10.52), P = 0.056. The mean age of males in patients and controls was 39.33 (±9.59) and 44.86 (±10.26), respectively, P = 0.171 (Table 3Table 3).
Table 3.
Sex and age of patients and control participants.
| Parameters | Patient (n = 100) | Control (n = 100) | Total (n = 200) | P value |
|---|---|---|---|---|
| SexCount (Percent) | Female | 88 (88%) | 86 (86%) | 174 (174%) |
| Male | 12 (12%) | 14 (14%) | 26 (26%) | |
| Age (Years)Mean (±SD) | Female | 49.84 (11.69) | 53.09 (10.52) | 51.45 (11.22) |
| Male | 39.33 (9.59) | 44.86 (10.26) | 42.31 (10.15) | 0.171 |
| Thirty-four of 100 RA patients (14 etanercept and 20 infliximab) did not respond to anti-TNF-α therapy, while 66 (38 and 28) did. Table 4Table 4 shows that the difference in treatment response between the two drugs was not statistically significant (P = 0.120). Moreover, after 3 months of treatment, the DAS-28 was 3.89 (±0.98) compared to 4.92 (±1.29) at baseline. Etanercept and infliximab had similar DAS-28 scores after 3 months (P = 0.88). 63% of RA patients had moderate disease activity, 19% low, and 10% high. Only 8% of patients had remission after 3 months of treatment. As shown in Table 4Table 4, the effects of the two drugs were comparable (P = 0.32). Most RA males responded better to anti-TNF-α than females (P = 0.045) and showed lower DAS-28 after 3 months, with mean of 2.77 versus 4.04 respectively (P = 0.0001), despite baseline mean was not significantly different between sexes (P = 0.902). The disease activity was significantly different between males and females (P < 0.0001), and males were more likely to respond to anti-TNF-α treatment after 3 months, showing remission or low disease activity than females. High disease activity was found in 0/12 male patients. |
Table 4.
Clinical characteristics of RA patients.
| Parameters | Type of Drug | P value | Sex | P value |
|---|---|---|---|---|
| Etanercept (n = 52) | Infliximab (n = 48) | Total | Female (n = 88) | Male (n = 12) |
| ResponseCount (Percent) | Non-responders | 14 (14%) | 20 (20%) | 34 (34%) |
| Responders | 38 (38%) | 28 (28%) | 66 (66%) | 55 (55%) |
| DAS-28 scoreMean (±SD) | Baseline | 5.30 (1.08) | 4.51 (1.39) | 4.92 (1.29) |
| After 3 months | 3.90 (0.91) | 3.87 (1.07) | 3.89 (0.98) | 0.881 |
| Disease activity after 3 monthsCount (Percent) | Remission | 2 (2%) | 6 (6%) | 8 (8%) |
| Low | 11 (11%) | 8 (8%) | 19 (19%) | 13 (13%) |
| Moderate | 35 (35%) | 28 (28%) | 63 (63%) | 61 (61%) |
| High | 4 (4%) | 6 (6%) | 10 (10%) | 10 (10%) |
| RA patients had higher TNF-α levels than controls, with a mean concentration of 7.84 pg/mL versus 6.09 pg/mL, P = 0.0005. IL-1β levels were also significantly higher in patients than controls, with a mean concentration of 2.18 pg/mL versus 1.21 pg/mL respectively (P < 0.0001). In RA patients taking infliximab or etanercept, serum TNF-α and IL-1β levels were measured. Etanercept and infliximab-treated RA patients had similar IL-1β levels (P = 0.168). TNF-α was higher in infliximab-treated patients, but not significant (P = 0.088). DAS-28 correlated positively with TNF-α (r^2^2 = 0.45, P < 0.0001) and IL- 1β (r^2^2 = 0.51, P < 0.0001). TNF-α and IL-1β concentrations were significantly higher in patients with moderate to high disease activity and lower in those in remission or low disease activity (P = 0.001 and < 0.0001). Most responders had lower IL-1β and TNF-α (P < 0.0001). Low levels of pro-inflammatory cytokines were linked to biologic anti-TNFα agent responsiveness by blood cytokine profiling (Table 5Table 5). |
Table 5.
Serum TNF-α and IL- 1β in the patients and control groups.
| Parameters | TNF-α | IL- 1β |
|---|---|---|
| Mean (SD) | P value | Mean (SD) |
| GroupMean (±SD) | Patients | 7.84 (5.57) |
| Control | 6.09 (2.79) | 1.20 (0.58) |
| Type of drugMean (±SD) | Etanercept | 6.93 (4.67) |
| Infliximab | 8.83 (6.30) | 2.39 (1.38) |
| Disease activity after 3 monthsMean (±SD) | Remission | 4.52 (1.83) |
| Low | 5.34 (2.26) | 1.53 (0.61) |
| Moderate | 8.15 (6.1) | 2.25 (1.3) |
| High | 13.31 (3.79) | 3.68 (1.22) |
| ResponseMean (±SD) | Non-responder | 13.68 (5.50) |
| Responder | 4.83 (2.18) | 1.57 (0.58) |
| DAS-28 score | (Pearson correlation) | 0.45 |
3.2. Genotype and allele frequencies of CARD8 rs2043211 and NLRP3 rs4612666 polymorphisms in RA
RA patients and controls had similar CARD8 rs2043211 and NLRP3 rs4612666 genotype distributions (P = 0.17 and 0.08 respectively), where no deviations from Hardy–Weinberg equilibrium were detected for the genotype distribution. In addition, patients and controls had comparable CARD8 (rs2043211) and NLRP3 allele frequencies, P = 0.059 and 0.879, respectively (Table 6Table 6).
Table 6.
Genotype and allele frequencies in patients and control groups.
| Parameters | CARD8 rs2043211 (A > T) | P value | NLRP3 rs4612666 (C > T) | P value |
|---|---|---|---|---|
| Patients | Control | Patients | Control | |
| Genotype frequencies | Homozygous wild | 37 | 48 | 0.17 |
| Heterozygous | 47 | 43 | 42 | 54 |
| Homozygous variant | 16 | 9 | 11 | 4 |
| Allele frequencies | 121/79 | 139/61 | 0.059 | 68/32 |
| Minor allele frequencies (MAF) | 0.395 | 0.305 | 0.320 | 0.310 |
3.3. Genotype-phenotype analysis of RA patients
The CARD8 (rs2043211) TT genotype was more common in patients with higher DAS-28 (P < 0.0001). Also, DAS-28 was higher in NLRP3 (rs4612666) TT genotypes (P < 0.0001). CARD8 (rs2043211) genotypes distribution in patients showed a significant difference in disease activity (P = 0.033). There are also significant differences in NLRP3 (rs4612666) genotype distribution (P = 0.008).
Significant difference was observed in CARD8 (rs2043211) genotypes between responders and non-responders (P < 0.0001). As well as, NLRP3 genotypes (rs4612666) (P < 0.0001).
Comparison of SNPs genotypes with pro-inflammatory cytokines. A significant difference in the CARD8 (rs2043211) genotypes (P < 0.0001 for TNF-α and IL- 1β) as well as, NLRP3 (rs4612666) genotypes (P < 0.0001 for TNF-α and IL- 1β), Table 7Table 7.
Table 7.
Clinical features and serum cytokines of patients with RA and different genotypes of CARD8 rs2043211 and NLRP3 rs4612666 polymorphisms.
| Parameters | CARD8 rs2043211 Genotypes | NLRP3 rs4612666 Genotypes |
|---|---|---|
| AA | AT | TT |
| DAS-28Mean (SD) | 3.51 (0.90) | 3.92 (1.00) |
| Frequency of Disease activity (n=100) | Remission | 5 |
| Low | 9 | 10 |
| Moderate | 23 | 27 |
| High | 0 | 7 |
| Response after 3 months | Responders | 32 |
| Non-responders | 5 | 14 |
| CytokinesMean (SD) | TNF-α | 5.64 (3.56) |
| IL- 1β | 1.05 (0.34) | 2.25 (0.57) |
| The ANOVA test was performed to determine if the relationship of DAS-28 and SNPs was linked to dominant or recessive models (Table 8Table 8). Patients with CARD8 (rs2043211) A allele bearing genotypes (wild homozygous and heterozygous genotypes) associated with lower DAS- as compared to those with T allele bearing genotypes (Variant homozygous genotypes and heterozygous genotypes. This assume that CARD8 (rs2043211) variant genotypes are associated with lower response to anti-TNF-α treatments in RA patients. Moreover, NLRP3 (rs4612666), C Allele bearing genotypes (wild homozygous and heterozygous genotypes) are associated with lower DAS-28 as compared with T allele bearing genotypes (Variant homozygous and heterozygous genotypes (P < 0.0001 and 0.003 respectively), this supposing that NLRP3 (rs4612666) variant genotypes are extremely associated with higher disease progression and lower response to anti-TNF-α drugs. |
Table 8.
Clinical features and serum cytokines of patients with RA and different genetic models of CARD8 rs2043211 and NLRP3 rs4612666 polymorphisms.
| Parameters | CARD8 rs2043211 Genetic models | NLRP3 rs4612666 Genetic models |
|---|---|---|
| Dominant (AA + AT/TT) | p-value/OR (95% CI) | Recessive (AA/AT + TT) |
| DAS-28 Mean (SD) | 3.74 (0.97)/4.65 (0.65) | 0.001 |
| Disease activity frequency (n=100) | Remission | 8/0 |
| Low | 19/0 | 9/10 |
| Moderate | 50/13 | 23/40 |
| High | 7/3 | 0/10 |
| Response after 3 months | Responders | 19/15 |
| Non-responders | 65/1 | 32/34 |
| CytokinesMean (SD) | TNF-α | 6.62 (4.85)/14.25 (4.67) |
| IL- 1β | 1.72 (0.77)/4.55 (0.64) | <0.0001 |
| Comparison of SNPs genetic models with disease activity, reveal that higher disease activity is associated with patients harboring CARD8 recessive genetic models (P = 0.029), wherein, higher disease activity was associated with heterozygous and variant homozygous genotypes (T allele bearing) of CARD8 SNP rs2043211 as compared with wild (AA) genotype. Additionally, NLRP3 (rs4612666) recessive model is associated with high disease activity (P = 0.002), similarly, higher disease activity was associated with NLRP3 (rs4612666) heterozygous and variant homozygous genotypes (T allele bearing) as compared with wild (CC) genotype. |
Higher response rate associated with dominant models of CARD8 SNP rs2043211 and NLRP3 SNP rs4612666 (P < 0.0001 and 0.001 respectively). While highly non response rate related with recessive models of these two SNPs (P < 0.0001 for both).
ANOVA test was carried out to found out if the association between cytokines serum level and SNPs dominant or recessive model (Table 8Table 8). Comparing SNPs models reveal that lower TNF-α and IL- 1β serum level after 3 months of treatment were associated with dominant models of CARD8 (rs2043211) SNPs (P < 0.0001 for both), while higher cytokines level associated with recessive model (P < 0.0001 for both). Recessive model of NLRP3 (rs4612666) was associated with higher TNF-α and IL- 1β serum level after 3 months of treatment (P = 0.002 and P < 0.0001 respectively), where T allele bearing genotypes (Variant homozygous and heterozygous) were significantly associated with higher cytokines level. In contrast, dominant model was not significantly correlated with TNF-α and IL- 1β serum level (P = 0.764 and 0.187 respectively), Table 8Table 8.
4. Discussion
Tumor necrosis factor-α antagonists have been the most effective tool for controlling patients suffering from a variety of rheumatic diseases over the last two decades. Infliximab and etanercept can induce remission, decrease the disease activity and prevent the progression of both clinical and radiological disease in RA, with a significant improvement in the symptoms, function and quality of life of patients [2121]. Approximately one-third of patients display a lack of response to anti-TNF-α therapies, either due to lack of drug efficacy or following the occurrence of adverse events (AEs). There are variations in their site of action and molecular structure, although the 2 drugs exert their beneficial effects by blockade of TNF-α. These differences may explain the differential response to the 2 agents in individual patients, even though there is no direct evidence to support this [2222]. A total of 10 studies involving 1806 subjects were included in meta-analysis review, which suggested that anti-TNF-α inhibitor antibodies had a significant association with decreased anti-TNF-α response. Anti-TNF-α agents for RA treatment are unsuccessful in some patients [2323]. One causative factor for non-response to anti-TNF-α drugs, such as infliximab and etanercept for RA treatment, is anti-TNF-α inhibitor antibodies produced in patients [2424]. Several studies suggest that the main reasons for different clinical responses could be different bioavailability and diverse expression of anti-TNF-α inhibitor antibodies in RA patients [2525,2626]. The key cause of treatment failure is known to be immunogenicity of the anti-TNF-α agents [2727]. Due to the variety of factors such as route of administration, drug dosage, concomitant medication, comprehensive treatment plan, and immune and nutritional status, the immunogenicity rate of different anti-TNF-α drugs is different [2828]. Extensive studies have investigated the impact on drug efficacy and safety of the immunogenicity of anti-TNF-α agents and have found that antibodies to these agents, such as infliximab, can affect the pharmacokinetics of the drug, resulting in delayed infusion and injection site reactions [2828,2929]. Meanwhile, infliximab-induced anti-chimeric antibodies (ATIs) could enhance the clearance of infliximab and attenuate its function [3030]. This may be a plausible explanation for the essential association of anti-TNF-α inhibitor antibodies with a reduced response rate.
Current study compared the levels of cytokines in infliximab and etanercept groups in patients with RA who received either treatment. The findings showed that IL-1β and TNF-α levels appeared to be identical in both groups, as both drugs seem to have relatively similar anti-inflammatory properties. These two drugs are both monoclonal antibodies and share a relatively similar mechanism to inhibit production of TNF-α by neutralizing the biological activity of TNF-α by binding to the soluble and transmembrane forms of TNF-α with a high affinity and by inhibiting or preventing the successful binding of TNF-α with its receptors [3131]. The only difference is their nature; infliximab is a monoclonal chimeric anti-TNF-α antibody that binds both monomeric and trimeric soluble TNF and transmembrane TNF, with murine variable regions and human IgG1 constant regions. Etanercept is a dimeric fusion protein connected to the Fc domains of human IgG1 consisting of the extracellular portion of TNFRp75. Etanercept binds only trimeric TNF and, compared to infliximab, interacts with transmembrane TNF with reduced avidity [3232].
Analysis has identified variations in cytokine levels between RA patients and control group. Mean serum TNF-α levels were significantly higher in RA patients after 3 months of treatment, and IL-1β levels were also significantly higher in the patients group.
There was a significant relation between serum level of cytokines (TNF-α and IL-1β) and disease activity and response to anti-TNF-α agents after 3 months of treatment, where it was directly proportional with it. Cytokines with different levels of expression have also been found in those patients who responded to anti-TNF-α therapy relative to patients who did not. Cytokines can be useful biomarkers of the tendency of a patient to respond to a particular biological therapy.
The pivotal role played by TNF-α and IL-1β in the development and maintenance of inflammation in non-responder RA patients is supported by decreased cytokines in responding patients receiving anti-TNF-α drugs. Another interesting finding is that patients who did not respond (3 months post-therapy) to anti-TNF-α therapy had significantly higher serum IL-1β concentrations. This finding confirms recently published data that showed elevated expression of the IL-1β gene in synovial biopsies from adalimumab therapy non-responders [3333]. In inflammatory diseases, IL-1β is an emerging target for drug therapy, and anakinra (Recombinant IL-1 receptor antagonist) has been developed to block IL-1β signaling as a biological therapy [3434]. However, indirect associations with adalimumab, etanercept and infliximab have shown a trend towards greater anti-TNF-α drug efficacy [2121].
After an insult, TNF-α (and other cytokines) are developed by the cells of the innate immune system, raising and prolonging the inflammatory response by triggering the release of several cytokines by other cells (i.e., IL-1β). Via decreased FOXP3 expression, TNF-α has been shown to suppress Treg function, an effect that can be reversed by TNF-α blockade [3535]. Therefore, the elevation of IL-1β and TNF-α in a non-responder serum can be a biomarker of the response to anti-TNF-α therapy. Prospective research will explain if it could be possible to use the ratio of these cytokines to predict response to anti-TNF-α medication. Such a study should obviously be structured to account for possible influencing factors in the diagnosis, such as prior and concurrent drug treatment, duration of the disease.
The goal of the study was to explore the impact of genetic factors on the susceptibility of RA. Selected SNP in the study CARD8 rs2043211 (A > T) and NLRP3 rs4612666 (T > C) have identified the significance of their role in RA pathogenesis in several previous studies. Our results indicate that the 2 SNPs were not associated with RA susceptibility.
The influence of CARD8 rs2043211 and NLRP3 rs4612666 polymorphisms was stated after 3 months of RA treatment. T allele bearing genotypes (Variant homozygous genotypes and heterozygous genotypes) for CARD8 rs2043211 NLRP3 rs4612666 polymorphism had significantly higher DAS-28. Consequently, variant genotypes of CARD8 rs2043211 and NLRP3 rs4612666 were related with higher disease activity and lower response to TNF-inhibitors, also higher concentration of TNF-α and IL-1β.
This may be due to the NLRP3 gain-of-function polymorphism, leading to an overactive NLRP3 inflammasome [3535,3636], and possibly to increased activation of IL-1β [3737]. DAS-28 was highly affected by homozygosity for the polymorphic CARD8 rs2043211 T allele. The findings were consistent with the study documenting the effect of CARD8 rs2043211 on the more serious course of long-lasting RA disease [3838].
Truncated CARD8 resulting from CARD8 rs2043211 could decrease its influence over the signaling pathway of NF-κB and thus lead to a more active transcriptional factor and inflammatory process amplification [3838]. For the expression of both inflammatory cytokines and tissue destructive enzymes in RA, NF-κB is essential [3939,4040].
In the gene expression analysis, the contribution of NLRP3 and CARD8 to active RA was shown, in particular in patients with RA, NLRP3 was upregulated and CARD8 was downregulated in contrast to healthy controls. In a well-powered study of UK RA patients, the results verified the association between the NLRP3 gene and the EULAR anti-TNF-α response [1414]. Therefore, good and moderate EULAR response versus no response in two separate cohorts have been correlated with polymorphisms in the NLRP3 gene region in RA patients treated with anti-TNF-α. This is a good predictor of a true relationship between the gene and the response to treatment. The data also showed that polymorphisms of CARD8 rs2043211 were significantly associated with EULAR response to anti-TNF-α therapy. The significance of NLRP3-inflammasome in RA pathogenesis is demonstrated by the findings of increased mRNA NLRP3 in RA synovial tissue relative to osteoarthritis subjects [3939]. In a cell expression analysis, Hitomi et al., 2009, found that rs4612666 variant allele to induce lower mRNA expression by reducing the transcriptional enhancer activity (in intron 7) of the NLRP3 gene [4141]. However, because the association found in this polymorphism remained statistically important this SNP is functionally relevant for the outcome of anti-TNF-α treatment in RA patients [4242].
The caspase-associated recruitment domain (CARD) is a conserved homology domain and a protein-protein interaction module [4343], it is a member of the CARD protein family, has been proposed to be part of the inflammasome family proteins [4444]. The inflammasome is a complex of cytoplasmic proteins that play a crucial role in the maturation and secretion of pro-inflammatory cytokines [4545], such as interleukin (IL)-1β and IL-18 [4646,4747]. These cytokines are known to cause a range of infection-related biological effects, inflammation, and autoimmune processes and they are highly implicated in the pathogenesis of RA by activating the adaptive immune response [4646,4747] CARD8 has been shown to be a negative regulator of activation of NF-κB and caspase-1, suggest its role in suppressing NLRP3 inflammasome activation, this led to the immune response and inflammatory activity to be suppressed [4444]. CARD8 is a new signaling molecule involved in the regulation of activation of caspase-1 and NF-κB [4848] and plays a key role in the development of RA [4747].
Genetic variants of CARD8 are also important in the pathogenesis of a variety of inflammatory diseases [4949]. The gene polymorphisms of CARD8 have been associated with several inflammatory and immune diseases, such as RA [1515,4343], Crohn's disease [5050], gout [5151], ankylosing spondylitis [5252], and atopic dermatitis [5353]. A polymorphism of CARD8 and rs2043211, is associated with the risk of RA [4343].
This study has some limitations. First, the sample size was relatively small because some patients discontinued treatment before 3 months, limiting the study power. Second, because autoimmune diseases are more common in women, we failed to recruit more men. RA patients almost over 40 years old and rarely have no medical issues or chronic diseases. Second, we investigated only two NLRP3 inflammasome polymorphisms, more SNPs should be assessed. Finally, because RA is genetically heterogeneous among ethnicities, our findings only apply to Iraqis.
5. Conclusions
The goal of this case-control study was to find out more about the association between RA and polymorphisms in the inflammasome-related genes (CARD8 and NLRP3) in Iraqi people. Neither etanercept nor infliximab is better than the other for treating RA. The study found an increase in the frequency of RA in older females, indicating that pathogenesis includes genetic and physiological differences. Both males and females had a positive response to anti-TNF-α therapy, but females had a poorer clinical response. No significant difference was found between the risk of RA and CARD8 rs2043211 and NLRP3 rs4612666 polymorphisms. However, we found that variant genotypes of CARD8 rs2043211 and NLRP3 rs4612666 were associated to a more active course of disease after 3 months of treatment, bad outcomes of disease activity, low response to anti-TNF-α therapy, and high levels of serum TNF-α and IL-1β.
Author contribution statement
Ahmed Abdul-Hassan Abbas and Ahmed Sahib Abdulamir: Conceived and designed the experiments.
Abdullah Abbas Awni: Performed the experiments; Analyzed and interpreted the data; Contributed reagents, materials, analysis tools or data; Wrote the paper.
Zainab Oday Hamed: Analyzed and interpreted the data; Contributed reagents, materials, analysis tools or data.
Data availability statement
Data included in article/supplementary material/referenced in article.
Declaration of competing interest
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
Contributor Information
Abdullah Abbas Awni, Email: abdullah.awni@uom.edu.iq.
Zainab Oday Hamed, Email: zainab_uday@bcms.edu.iq.
Ahmed Abdul-Hassan Abbas, Email: ahmedabdulhassan@colmed-alnahrain.edu.iq.
Ahmed Sahib Abdulamir, Email: ahmed.sahib@colmed-alnahrain.edu.iq.
Associated Data
*This section collects any data citations, data availability statements, or supplementary materials included in this article.*This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Data included in article/supplementary material/referenced in article.
Data Availability Statement
Data included in article/supplementary material/referenced in article.
References
Chen W., et al. Role of chemokine receptor 2 in rheumatoid arthritis: a research update. Int. Immunopharm. 2023;116 doi: 10.1016/j.intimp.2023.109755. DOI | PubMed | Google Scholar
Catrina A.I., et al. Mechanisms involved in triggering rheumatoid arthritis. Immunol. Rev. 2016;269(1):162–174. doi: 10.1111/imr.12379. DOI | PubMed | Google Scholar
Navegantes K.C., et al. Immune modulation of some autoimmune diseases: the critical role of macrophages and neutrophils in the innate and adaptive immunity. J. Transl. Med. 2017;15(1):1–21. doi: 10.1186/s12967-017-1141-8. DOI | PMC free article | PubMed | Google Scholar
Ahn J.J., Abu-Rub M., Miller R.H. B cells in neuroinflammation: new perspectives and mechanistic insights. Cells. 2021;10(7):1605. doi: 10.3390/cells10071605. DOI | PMC free article | PubMed | Google Scholar
Ciraci C., et al. Control of innate and adaptive immunity by the inflammasome. Microb. Infect. 2012;14(14):1263–1270. doi: 10.1016/j.micinf.2012.07.007. DOI | PMC free article | PubMed | Google Scholar
Yang Y., et al. Recent advances in the mechanisms of NLRP3 inflammasome activation and its inhibitors. Cell Death Dis. 2019;10(2):128. doi: 10.1038/s41419-019-1413-8. DOI | PMC free article | PubMed | Google Scholar
Zangiabadi S., Abdul-Sater A.A. Regulation of the NLRP3 inflammasome by posttranslational modifications. J. Immunol. 2022;208(2):286–292. doi: 10.4049/jimmunol.2100734. DOI | PubMed | Google Scholar
Addobbati C., et al. Polymorphisms and expression of inflammasome genes are associated with the development and severity of rheumatoid arthritis in Brazilian patients. Inflamm. Res. 2018;67:255–264. doi: 10.1007/s00011-017-1119-2. DOI | PubMed | Google Scholar
Zhang A., et al. The genetic polymorphism and expression profiles of NLRP3 inflammasome in patients with chronic myeloid leukemia. Hum. Immunol. 2018;79(1):57–62. doi: 10.1016/j.humimm.2017.10.013. DOI | PubMed | Google Scholar
Paramel G., Sirsjö A., Fransén K. vol. 2015. Mediators of Inflammation; 2015. Role of Genetic Alterations in the NLRP3 and CARD8 Genes in Health and Disease. DOI | PMC free article | PubMed | Google Scholar
Roberts R., et al. Evidence of interaction of CARD8 rs2043211 with NALP3 rs35829419 in Crohn's disease. Gene Immun. 2010;11(4):351–356. doi: 10.1038/gene.2010.11. DOI | PubMed | Google Scholar
Fontalba A., et al. Deficiency of the NF-κB inhibitor caspase activating and recruitment domain 8 in patients with rheumatoid arthritis is associated with disease severity. J. Immunol. 2007;179(7):4867–4873. doi: 10.4049/jimmunol.179.7.4867. DOI | PubMed | Google Scholar
Wang R., et al. Mangiferin exert protective effects on joints of adjuvant-induced arthritis rats by regulating the MAPKs/NF-κB pathway of fibroblast-like synoviocytes. Int. Immunopharm. 2021;101 doi: 10.1016/j.intimp.2021.108352. DOI | PubMed | Google Scholar
Mathews R.J., et al. Evidence of NLRP3-inflammasome activation in rheumatoid arthritis (RA); genetic variants within the NLRP3-inflammasome complex in relation to susceptibility to RA and response to anti-TNF treatment. Ann. Rheum. Dis. 2014;73(6):1202–1210. doi: 10.1136/annrheumdis-2013-203276. DOI | PubMed | Google Scholar
Kastbom A., et al. CARD8 p. C10X polymorphism is associated with inflammatory activity in early rheumatoid arthritis. Ann. Rheum. Dis. 2010;69(4):723–726. doi: 10.1136/ard.2008.106989. DOI | PubMed | Google Scholar
Lv J., et al. Combined polymorphisms in genes encoding the inflammasome components NLRP3 and CARD8 confer risk of ischemic stroke in men. J. Stroke Cerebrovasc. Dis. 2020;29(8) doi: 10.1016/j.jstrokecerebrovasdis.2020.104874. DOI | PubMed | Google Scholar
Deane K.D., et al. Genetic and environmental risk factors for rheumatoid arthritis. Best Pract. Res. Clin. Rheumatol. 2017;31(1):3–18. doi: 10.1016/j.berh.2017.08.003. DOI | PMC free article | PubMed | Google Scholar
Ceban F., Xu J. The evolution of TNF-α blockade for the treatment of rheumatoid arthritis. J. Undergrad. Life Sci. 2022;16(1) Google Scholar
Burgos P.I., et al. Understanding personalized medicine in rheumatoid arthritis: a clinician's guide to the future. Therap. Adv. Musculoskel. Dis. 2009;1(2):97–105. doi: 10.1177/1759720X09351778. DOI | PMC free article | PubMed | Google Scholar
Lenardo M., Lo B., Lucas C.L. Genomics of immune diseases and new therapies. Annu. Rev. Immunol. 2016;34:121–149. doi: 10.1146/annurev-immunol-041015-055620. DOI | PMC free article | PubMed | Google Scholar
Ozer H.T., Ozbalkan Z. Clinical efficacy of TNF-[alpha] inhibitors: an update. Int. J. Clin. Rheumatol. 2010;5(1):101. Google Scholar
Hyrich K.L., et al. Outcomes after switching from one anti–tumor necrosis factor α agent to a second anti–tumor necrosis factor α agent in patients with rheumatoid arthritis: results from a large UK national cohort study. Arthritis Rheum. 2007;56(1):13–20. doi: 10.1002/art.22331. DOI | PubMed | Google Scholar
Wu C., et al. Effect of anti-TNF antibodies on clinical response in rheumatoid arthritis patients: a meta-analysis. BioMed Res. Int. 2016;2016 doi: 10.1155/2016/7185708. DOI | PMC free article | PubMed | Google Scholar
Huizinga T., et al. The presence or absence of antibodies to infliximab or adalimumab determines the outcome of switching to etanercept: commentary. Int. J. Adv. Rheumatol. 2011;9(2) doi: 10.1136/ard.2010.135111. DOI | PubMed | Google Scholar
Caprioli F., Pallone F., Monteleone G. Cytokine therapies in Crohn's disease: where are we now and where should we go? Inflamm. Allergy - Drug Targets. 2011;10(1):47–53. doi: 10.2174/187152811794352051. DOI | PubMed | Google Scholar
Evangelatos G., et al. The second decade of anti-TNF-a therapy in clinical practice: new lessons and future directions in the COVID-19 era. Rheumatol. Int. 2022;42(9):1493–1511. doi: 10.1007/s00296-022-05136-x. DOI | PMC free article | PubMed | Google Scholar
Bartelds G.M., et al. Development of antidrug antibodies against adalimumab and association with disease activity and treatment failure during long-term follow-up. JAMA. 2011;305(14):1460–1468. doi: 10.1001/jama.2011.406. DOI | PubMed | Google Scholar
Atzeni F., et al. Immunogenicity and autoimmunity during anti-TNF therapy. Autoimmun. Rev. 2013;12(7):703–708. doi: 10.1016/j.autrev.2012.10.021. DOI | PubMed | Google Scholar
Garcês S., Demengeot J., Benito-Garcia E. The immunogenicity of anti-TNF therapy in immune-mediated inflammatory diseases: a systematic review of the literature with a meta-analysis. Ann. Rheum. Dis. 2013;72(12):1947–1955. doi: 10.1136/annrheumdis-2012-202220. DOI | PubMed | Google Scholar
Bendtzen K., et al. Individual medicine in inflammatory bowel disease: monitoring bioavailability, pharmacokinetics and immunogenicity of anti-tumour necrosis factor-alpha antibodies. Scand. J. Gastroenterol. 2009;44(7):774–781. doi: 10.1080/00365520802699278. DOI | PubMed | Google Scholar
Chow V., et al. Pharmacokinetic similarity of ABP 710, a proposed biosimilar to infliximab: results from a randomized, single‐blind, single‐dose, parallel‐group study in healthy subjects. Clin. Pharm. Drug Develop. 2020;9(2):246–255. doi: 10.1002/cpdd.738. DOI | PMC free article | PubMed | Google Scholar
Daub H., et al. The trimer to monomer transition of Tumor Necrosis Factor-Alpha is a dynamic process that is significantly altered by therapeutic antibodies. Sci. Rep. 2020;10(1):9265. doi: 10.1038/s41598-020-66123-5. DOI | PMC free article | PubMed | Google Scholar
Thwaites R.S., et al. Expression of sterile-α and armadillo motif containing protein (SARM) in rheumatoid arthritis monocytes correlates with TLR2-induced IL-1β and disease activity. Rheumatology. 2021;60(12):5843–5853. doi: 10.1093/rheumatology/keab162. DOI | PMC free article | PubMed | Google Scholar
Vecchié A., et al. Advances in pharmacotherapy for acute and recurrent pericarditis. Expet Opin. Pharmacother. 2022;23(6):681–691. doi: 10.1080/14656566.2022.2054327. DOI | PubMed | Google Scholar
Gao X., et al. Toxoplasma gondii promotes microRNA-34a to inhibit Foxp3 expression in adverse outcomes of pregnancy in mice. Int. Immunopharm. 2022;107 doi: 10.1016/j.intimp.2022.108648. DOI | PubMed | Google Scholar
Verma D., et al. The Q705K polymorphism in NLRP3 is a gain-of-function alteration leading to excessive interleukin-1β and IL-18 production. PLoS One. 2012;7(4) doi: 10.1371/journal.pone.0034977. DOI | PMC free article | PubMed | Google Scholar
Vande Walle L., et al. Negative regulation of the NLRP3 inflammasome by A20 protects against arthritis. Nature. 2014;512(7512):69–73. doi: 10.1038/nature13322. DOI | PMC free article | PubMed | Google Scholar
Cross A., Moots R.J., Edwards S.W. The dual effects of TNFα on neutrophil apoptosis are mediated via differential effects on expression of Mcl-1 and Bfl-1. Blood. J. Am. Soci. Hematol. 2008;111(2):878–884. doi: 10.1182/blood-2007-05-087833. DOI | PubMed | Google Scholar
Jenko B., et al. NLRP3 and CARD8 polymorphisms influence higher disease activity in rheumatoid arthritis. J. Med. Biochem. 2016;35(3):319. doi: 10.1515/jomb-2016-0008. DOI | PMC free article | PubMed | Google Scholar
Nejatbakhsh Samimi L., et al. NF-κB signaling in rheumatoid arthritis with focus on fibroblast-like synoviocytes. Autoimmun. Highligh. 2020;11:1–10. Google Scholar
Hitomi Y., et al. Associations of functional NLRP3 polymorphisms with susceptibility to food-induced anaphylaxis and aspirin-induced asthma. J. Allergy Clin. Immunol. 2009;124(4):779–785. e6. doi: 10.1016/j.jaci.2009.07.044. DOI | PubMed | Google Scholar
Sode J., et al. Anti-TNF treatment response in rheumatoid arthritis patients is associated with genetic variation in the NLRP3-inflammasome. PLoS One. 2014;9(6) doi: 10.1371/journal.pone.0100361. DOI | PMC free article | PubMed | Google Scholar
Yu P., et al. A new risk polymorphism rs10403848 of CARD8 significantly associated with psoriasis vulgaris in northeastern China. BioMed Res. Int. 2020:2020. doi: 10.1155/2020/2867505. DOI | PMC free article | PubMed | Google Scholar
Paramel G.V., et al. CARD8 gene encoding a protein of innate immunity is expressed in human atherosclerosis and associated with markers of inflammation. Clin. Sci. 2013;125(8):401–407. doi: 10.1042/CS20120572. DOI | PubMed | Google Scholar
He W., et al. The role of NLRP3 inflammasome in sepsis: a potential therapeutic target. Int. Immunopharm. 2023;115 doi: 10.1016/j.intimp.2023.109697. DOI | PubMed | Google Scholar
Wang H., et al. Association between NLPR1, NLPR3, and P2X7R gene polymorphisms with partial seizures. BioMed Res. Int. 2017;2017 doi: 10.1155/2017/9547902. DOI | PMC free article | PubMed | Google Scholar
Ekman A.K., et al. Genetic variations of NLRP1: susceptibility in psoriasis. Br. J. Dermatol. 2014;171(6):1517–1520. doi: 10.1111/bjd.13178. DOI | PubMed | Google Scholar
Zhou D., et al. The NLRP3 rs10754558 polymorphism is associated with the occurrence and prognosis of coronary artery disease in the Chinese Han population. BioMed Res. Int. 2016;2016 doi: 10.1155/2016/3185397. DOI | PMC free article | PubMed | Google Scholar
Carlström M., et al. Genetic support for the role of the NLRP 3 inflammasome in psoriasis susceptibility. Exp. Dermatol. 2012;21(12):932–937. doi: 10.1111/exd.12049. DOI | PubMed | Google Scholar
Zhang Z.-T., et al. Is the CARD8 rs2043211 polymorphism associated with susceptibility to Crohn's disease? A meta-analysis. Autoimmunity. 2015;48(8):524–531. doi: 10.3109/08916934.2015.1045581. DOI | PubMed | Google Scholar
Chen Y., et al. CARD8 rs2043211 polymorphism is associated with gout in a Chinese male population. Cell. Physiol. Biochem. 2015;35(4):1394–1400. doi: 10.1159/000373960. DOI | PubMed | Google Scholar
Kastbom A., et al. Genetic variants in CARD8 but not in NLRP3 are associated with ankylosing spondylitis. Scand. J. Rheumatol. 2013;42(6):465–468. doi: 10.3109/03009742.2013.779020. DOI | PubMed | Google Scholar
Bivik C., et al. Genetic variation in the inflammasome and atopic dermatitis susceptibility. J. Invest. Dermatol. 2013;133(10):2486–2489. doi: 10.1038/jid.2013.168. DOI | PubMed | Google Scholar