Split (3)

train · 25k rows

text stringlengths 1.55k 332k	label int64 0 8
traditionally the center of gravity in the head of a field hockey stick has been designed so that it is in line with or below the center of gravity of a field hockey ball , when both the head and the ball are resting on the same plane . the circumference of a field hockey ball is typically about 8 . 8125 to 9 . 25 inches , with a radius to its center of about 1 . 40 to 1 . 47 inches . therefore , the head of a traditional field hockey stick typically has a center of gravity within about 1 . 47 inches from the bottom of the head . as used herein , center of gravity refers to the point at which the entire weight of a body may be considered as concentrated so that , if supported at this point , the body would remain in equilibrium in any position . by raising the center of gravity of the head , the present invention changes the moment of impact on a ball and its resultant launch angle . the higher that the center of gravity of the head is above the center of gravity of the ball , the lower the launch angle on the ball will be . embodiments of the present invention raise the center of gravity in a field hockey stick head by one or more of the following methods : 1 ) removing material from a part of the head ; 2 ) adding material to a part of the head ; 3 ) repositioning or redistributing material in the stick , such as in the areas of the head and the throat ; 4 ) using two or more materials with different mass or density properties in the head ; and 5 ) combinations thereof . composite field hockey sticks are traditionally manufactured by a process referred to as bladder molding , which uses an air bladder , a two - part female mold , composite material , and resin . the bladder is inflated , thus creating pressure to force the composite and resin against the mold until it cures . this process results in a hollow hockey stick . according to an embodiment of the present invention , fig2 illustrates an example of how to raise the center of gravity of a composite field hockey stick head by taking advantage of the hollow area inside the head . by strategically placing contours in the molds , the present invention shifts where the composite fills the mold . thus , by not allowing the bottom portion of the head to fill with composite , the mass of the head is disposed higher on the head . to further enhance the reallocation of mass in the head , extra material , such as more resin , can also be added to the head before or after molding . as shown in the example of fig2 , one embodiment of the present invention provides a field hockey stick 200 having a head 206 with one or more depressions 203 in its surface . in this example , head 200 has three depressions 203 , which are generally oval in shape . the outside and inside ovals shown for each depression 203 indicate generally where each depression begins to descend ( outside line ) and then levels out somewhat ( inside line ) to form the base of the depression . fig3 illustrates a side view of field hockey stick 200 , showing the depression 203 nearest the toe 208 . the depressions could , of course , be formed in many different numbers and shapes , for example , having a single rectangular depression with planar sloping walls , instead of rounded walls . the depressions 203 in head 206 minimize the mass of the lower portion of head 200 , and therefore raise the center of gravity of head 206 to above the traditional center of gravity that is in line with the center of gravity of a field hockey ball . line 214 , which is drawn at roughly the center of gravity of a field hockey ball ( e . g ., 1 . 40 to 1 . 47 inches ), represents the line above which the center of gravity of head 206 is disposed , according to an embodiment of the present invention . for example , with depressions 203 , the center of gravity of head 206 could be disposed at about 1 . 5 inches from the extreme end 209 of head 206 . the placement of depressions 203 raises the center of gravity of head 206 , such that the center of gravity of head 206 is higher in relation to a ball struck by head 206 , in comparison to traditional field hockey sticks . this higher center of gravity helps minimize the loft imparted on the ball . in one embodiment , depressions 203 are disposed within about 1 . 47 inches from end 209 . according to a particular implementation of the present invention , the center of gravity of head 206 is above a line drawn halfway between the highest point 210 of toe 208 and the extreme end 209 of head 206 opposite to point 210 , when the distance between end 209 and point 210 is approximately 3 . 94 inches ( which is the maximum distance allowed by widely accepted rules of field hockey ). such a line would be about 1 . 97 inches from end 209 . fig4 illustrates another embodiment of the present invention in which the mass of the throat of a field hockey stick is reduced and shifted toward the upper portion of the head . as shown in this example , a field hockey stick 400 includes a depression 411 in the surface of its throat 404 . depression 411 can be disposed in throat 404 closer to head 406 than to a handle ( not shown ) attached to throat 404 . depression 411 can be disposed either in the flat playing side of throat 404 or , as shown in fig4 , in the round non - playing side of throat 404 . depression 411 could be oval - shaped as shown in the example of fig4 . the outside and inside oval - shaped lines shown for depression 411 indicate generally where depression 411 begins to descend ( outside line ) and then levels out somewhat ( inside line ) to form the base of the depression 411 . fig5 illustrates a side view of field hockey stick 400 , further showing the exemplary shape of depression 411 . depression 411 could , of course , be formed in many different numbers and shapes , for example , having multiple tear - shaped depressions . disposing depression 411 in throat 404 removes mass from throat 404 in the area just above the head 406 , and redistributes this removed mass to the upper portion of the head 406 . line 414 , which is drawn at roughly the center of gravity of a field hockey ball ( e . g ., 1 . 40 to 1 . 47 inches ), represents the line above which the center of gravity of head 406 is disposed , according to an embodiment of the present invention . for example , with depression 411 , the center of gravity of head 406 could be disposed at about 1 . 5 inches from the extreme end 409 of head 406 . adding the mass to the top portion of head 406 raises the center of gravity of head 406 . consequently , head 406 can strike a ball with a higher center of gravity and minimize loft on the ball . according to a particular implementation of the present invention , the center of gravity of head 406 is above a line drawn halfway between the highest point 410 of toe 408 and the extreme end 409 of head 406 opposite to point 410 , when the distance between end 409 and point 410 is approximately 3 . 94 inches ( which is the maximum distance allowed by widely accepted rules of field hockey ). such a line would be about 1 . 97 inches from end 409 . fig6 and 7 illustrate a further embodiment of the present invention in which a field hockey stick 600 has both a depression 611 in its throat 604 and also one or more depressions 603 in its head 606 . as discussed above in reference to fig2 - 5 , depression 611 and depressions 603 redistribute mass of the field hockey stick 600 to the upper portion of its head 606 . having mass redistributed by both depression 611 and depressions 603 accentuates the center of gravity situated in the upper portion of head 606 . fig8 - 9 illustrate alternative embodiments of the present invention having different numbers and shapes of depressions on the head of a field hockey stick . for example , fig8 illustrates a field hockey stick 800 having a head 806 with a single irregularly shaped depression 803 in its extreme end ( opposite to the handle , not shown ). as another example , fig9 illustrates a field hockey stick 900 having a head 906 with five roughly triangular depressions 903 . in a further alternative embodiment , instead of or in addition to removing and redistributing mass of a field hockey stick , mass could be added to the stick . for example , a metal ( e . g ., lead ), thermoplastic elastomer ( tpe ), or other material could be attached to the upper portion of the head of the stick . for example , a plug made of a second material could be embedded ( e . g ., by laying up the plug ) in the upper portion of the head . this additional material would raise the center of gravity of the head . fig1 illustrates an example of this embodiment , in which a field hockey stick 1000 has a head 1006 with a mass 1050 added to the upper portion of the head . line 1014 , which is drawn at roughly the center of gravity of a field hockey ball ( e . g ., 1 . 40 to 1 . 47 inches ), represents the line above which the center of gravity of head 1006 is disposed , according to an embodiment of the present invention . for example , with mass 1050 added , the center of gravity of head 1006 could be disposed at about 1 . 5 inches from the extreme end 1009 of head 1006 . according to a particular implementation of the present invention , the center of gravity of head 1006 is above a line drawn halfway between the highest point 1010 of toe 1008 and the extreme end 1009 of head 1006 opposite to point 1010 , when the distance between end 1009 and point 1010 is approximately 3 . 94 inches ( which is the maximum distance allowed by widely accepted rules of field hockey ). such a line would be about 1 . 97 inches from end 1009 . another alternative embodiment of the present invention provides a field hockey stick with perimeter weighting , while still raising the center of gravity of the head . this perimeter weighting can improve the feel and control of the stick . as an example , fig1 illustrates a field hockey stick head 1106 having a distal member 1102 and a depression 1104 . as described above , depression 1104 enables the redistribution of mass to the upper portion of head 1106 to raise the center of gravity . at the same time , distal member 1102 provides a mass at the end of head 1106 that affords a perimeter weighting for the field hockey stick . although fig1 shows distal member 1102 in one particular form , many different forms of perimeter weight could , of course , be used , such as flanges , ribs , rims , or plugs . plugs could be made , for example , of material heavier than the remaining material of the head . an embodiment of the present invention uses composite materials to construct a field hockey stick having a top weighted head . the composites enable a gradual redistribution of the mass of the field hockey stick , while still providing the requisite degree of strength in the areas from which mass is moved . for example , with the embodiment providing a depression in surface of the round throat back , the mass in the throat can be moved downward to the head with gradual , undulating shapes , leaving a relatively thin area where the mass is removed that is still structurally strong enough to withstand the rigors of the game . the gradual reshaping and redistributing of material also enable the provision of cross sectional dimensions that comply with the traditional two - inch ring test . although discussed primarily in the context of composite field hockey sticks , one of ordinary skill in the art would appreciate that the present invention could apply equally well to field hockey sticks made of other materials , such as wood . in such cases , the throat and head depression ( s ) would be formed as appropriate for the material . for example , depressions could be carved out of a traditional wood field hockey stick . a further embodiment of the present invention achieves a higher center of gravity by varying the material composition of the head . for example , the lower portion of a head could be made of a first material , and the upper portion of the head could made of a second material that is heavier than the first material . in this manner , the center of mass or gravity could be raised on the head without necessarily using depressions ( as in fig2 ) or adding a mass ( as in fig1 ). in the case of a composite stick , for example , lighter fibers could placed in the lower portion of the head , with heavier fibers located in the upper portion of the head . heavier materials could also be laid up within the fibers to provide areas of greater mass in the upper portion of the head . similarly , plugs made of heavier or lighter materials could be strategically positioned in the head to provide a raised center of gravity . thus , the top weighted field hockey sticks of the present invention provide a player with improved comfort , feel , and playability . in particular , the present invention raises the center of gravity of a field hockey stick head to minimize loft and impart an improved feel when striking a ball with the stick . the foregoing disclosure of embodiments of the present invention has been presented for purposes of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise forms disclosed . many variations and modifications of the embodiments described herein will be apparent to one of ordinary skill in the art in light of the above disclosure . the scope of the invention is to be defined only by the claims , and by their equivalents . further , in describing representative embodiments of the present invention , the specification may have presented the method and / or process of the present invention as a particular sequence of steps . however , to the extent that the method or process does not rely on the particular order of steps set forth herein , the method or process should not be limited to the particular sequence of steps described . as one of ordinary skill in the art would appreciate , other sequences of steps may be possible . therefore , the particular order of the steps set forth in the specification should not be construed as limitations on the claims . in addition , the claims directed to the method and / or process of the present invention should not be limited to the performance of their steps in the order written , and one skilled in the art can readily appreciate that the sequences may be varied and still remain within the spirit and scope of the present invention .	0
fig2 illustrates an igniter 12 used in the prior art . an electrical connector ( not shown ) is threaded onto threads 21 , and contains an electrical contact ( not shown ) which mates with the end 24 of electrode 27 . insulator 30 isolates electrode 27 from the shell 33 of the igniter 12 . end e of the igniter 12 is shown in fig3 and 4 . a very simplified explanation of the physics involved in plasma generation will be given . in operation , a high voltage is applied to the electrode 27 , thereby creating a voltage difference , or potential difference , v between points p 1 and p 2 in fig3 . the electric field in that region equals the potential difference v divided by the distance d between the points p 1 and p 2 . for example , if the voltage is 20 , 000 volts and the distance d is 10 millimeters , or 0 . 01 meter , then the electric field equals 20 , 000 / 0 . 01 , or 2 million volts per meter . the electric field is designed to exceed the dielectric breakdown strength of the material , or medium , lying between points p 1 and p 2 . that material is a mixture of air plus fuel . however , the field does not exceed the breakdown strength of insulator 30 , and that strength exceeds that of the air - fuel mixture . when breakdown occurs , the electric field strips electrons away from the atoms in the medium , producing positively charged ions and free electrons . the electric field drives the free electrons in a direction parallel with the electric field . however , during that movement , those temporarily free electrons will collide with other ions . also , thermal motion of the ions and electrons will also bring them together in collisions . in the collisions , the electrons will be captured by the ions , and will drop to a lower energy state , releasing heat and light , in the form of an electric arc which is called a plasma , which is indicated as lightning bolt 40 in fig4 . this process continues as long as the electric field is present . the inventors have observed one result of the operation just described . as indicated in fig5 , the insulator 30 becomes eroded from the phantom shape 50 to the curved shape 53 . in addition , the electrode 27 becomes eroded from the phantom shape 56 to the solid shape 59 . corners 33 a also become eroded . the inventors believe that one or more of the following agencies are responsible for the erosion . one agency is the corrosive nature of the plasma : free electrons are very reactive , and seek to bind to any available atoms or ions which are nearby . also , the generation of free electrons from oxygen , which is present in the air , creates ionized oxygen , which is also highly reactive . a third agency is that the plasma creates a high - temperature environment . a high temperature , by definition , represents agitated atoms and molecules with high velocities . high - velocity atoms and molecules react more readily with stationary objects when they collide with the objects . possibly a fourth agency is the fact that the plasma generates high - frequency photons , in the ultra - violet , uv , and perhaps into the x - ray regions of the spectrum . it is well known that uv and x - radiation can damage numerous types of material . irrespective of the precise causes of the erosion , the erosion illustrated in fig5 eventually causes the igniter 12 to eventually stop functioning . a primary reason is illustrated in fig6 . previously , prior to the erosion , voltage was applied between points p 1 and p 2 in fig6 . however , after the erosion , point p 2 has effectively moved to point p 3 . distance d has now become longer distance d 2 . the electric field , which causes the ionization and thus the plasma , is now weaker . continuing the example given above , if distance d 2 is 20 millimeters , then the electric field becomes 20 , 000 / 0 . 020 , or one million volts per meter , half its original value . eventually , distance d 2 becomes so great that the electric field does not reliably exceed the dielectric breakdown strength of the air - fuel mixture , and ionization ceases to occur . fig7 illustrates one form of the invention . an auxiliary electrode 72 is embedded in the insulator 75 . the tip 78 is covered by the insulator - material in region 81 , as indicated by the insert 84 . auxiliary electrode 72 may be connected to the shell 33 , as at region 90 . initially , current enters electrode 27 as indicated by arrow 84 , jumps to the shell 33 through the plasma 85 , and exits the shell 33 into the engine , through multiple paths , such as through its mounting threads , as indicated by arrow 86 . as erosion occurs , the insulator 75 departs from its initial shape indicated by phantom lines 92 in fig8 . tip 78 of the auxiliary electrode 72 now becomes exposed . now , when a high voltage is applied to the igniter , two paths exist for a plasma to follow . one is the usual path p 5 in fig9 . the other path is indicated as p 6 of fig9 , and runs from the central electrode 27 to the now - exposed auxiliary electrode 72 . restated , two current - return - paths are available to the central electrode 72 . path p 5 runs to the shell 33 , in the usual manner . path p 6 runs to the now - exposed auxiliary electrode 72 . eventually , further erosion will lengthen path p 5 , and cause plasma formation along that path to terminate . that is , path p 5 in fig9 initially can be represented by distance d in fig6 . after sufficient erosion , path p 5 in fig9 will be represented by distance d 2 in fig6 , and , as explained above , no plasma will be generated along path p 5 when distance d 2 becomes sufficiently large . however , auxiliary plasma path p 6 is still available in fig9 at this time . a plasma can still be generated , and the lifetime of the igniter has been increased . the preceding discussion presented the auxiliary electrode 72 in fig7 in the form of a rod . fig1 illustrates such a rod in perspective view , surrounded by insulator 75 . in an alternate embodiment , a cylinder is used . fig1 is a cut - away view of one embodiment . central electrode 27 is surrounded by an insulator 100 , which itself is surrounded by a conductive tube or cylinder 103 , which is then surrounded by another layer of insulator 105 . fig1 illustrates the system in cross - sectional view , with similar numbering . fig1 illustrates the insulator 100 in its initial configuration , after manufacture or just after installation . a tip 110 of central electrode 27 is exposed , and surrounded by the conical surface 113 of the insulator 100 . cylindrical auxiliary electrode 103 is embedded within the insulator 100 , and no tip or edge is exposed , as indicated by distance d 8 in fig1 . the preceding discussion stated that the auxiliary electrode 72 may be connected at region 90 in fig7 . in another embodiment , the auxiliary electrode 72 of fig1 is also connected to ground , but through a detector 150 . detector 150 looks for a current in auxiliary electrode 72 . current detectors are well known . if no current is detected , it is inferred that the auxiliary electrode 72 is still embedded within insulator 75 , as in fig7 , and is electrically isolated from central electrode 27 . in contrast , if a current is detected , it is inferred that the auxiliary electrode has become exposed through erosion , as in fig9 . the detected current is attributed to a plasma following path p 6 . when the current is detected , detector 150 issues a signal , sets a flag , or otherwise indicates the inference that erosion has exposed auxiliary electrode . a human technician at that time , or a prescribed time afterward , replaces the igniter . an alternate mode of detection is to remove the igniter and visually examine the end corresponding to end e in fig2 . if a smooth surface of the insulator 100 is seen , as in fig1 , then it is concluded that the igniter is still functional . however , if the auxiliary electrode 72 is seen , as in fig8 , then it is concluded that replacement may be required . in another embodiment , the auxiliary electrode is designed to become exposed , and then to erode rapidly . fig1 , viewed left - to - right , illustrates first a newly installed igniter 160 . after a period of usage , igniter 165 exposes its auxiliary electrode 72 . now a plasma p 6 extends to the auxiliary electrode 72 . however , as stated above , the auxiliary electrode 72 is designed to erode rapidly . for example , as insert 170 indicates , the auxiliary electrode 72 is fabricated with a pointed end . plasma 6 causes the pointed end to become rapidly eroded , as indicated by the small particles in frame 170 . this operation causes a specific sequence of two events . one is that , when the auxiliary electrode becomes first exposed , a current passes through the it . the current is detected , as by detector 150 in fig1 . next , after the auxiliary electrode fractures or erodes , no current passes through it . one reason for this sequence is illustrated in fig1 . initially , the voltage v spans distance d 9 , creating an electric field equal to v / d 9 . after fracture or erosion , the same voltage v spans distance d 10 . the electric field equals v / d 10 , a smaller value . the latter electric field is insufficient to create a plasma , while the former is . in one embodiment , the occurrence of the two events just described occurs prior to the termination of the lifetime of the igniter . thus , that termination is signalled by the occurrence of a current through the auxiliary electrode 72 , followed by a termination of that current . the onset of the current indicates the approach of the termination of the lifetime , but with time remaining to operate the engine . the subsequent termination of the current indicates that less time remains , and that replacement of the igniter becomes more important . fig1 illustrates one embodiment of the auxiliary electrode 72 . a neck , or groove , 190 is provided , which facilitates the breakage schematically illustrated in the insert 170 in fig1 . the groove 190 is a region of mechanical weakness intentionally built into the auxiliary electrode 72 . prior to the erosion indicated in fig8 , that weakness is not important , because mechanical support to the electrode is supplied by the insulator 75 . the discussion above stated that a high voltage is applied to electrode 27 . it is possible that a low voltage applied to the electrode 27 can accomplish the same function of generating a plasma . numerous substitutions and modifications can be undertaken without departing from the true spirit and scope of the invention . what is desired to be secured by letters patent is the invention as defined in the following claims .	7
the invention provides a device making it possible to indicate to the spectacle wearer that the distance to the close vision working plane is unsuitable . in the remainder of this description , the invention is described in a first application in which the invention discloses prescribing progressive lenses for children suffering from myopia . it also discloses , in this case , in order to ensure a correct close vision distance to the work , the provision of a telemetry device on the frame . as progressive lenses , unlike bifocal lenses , do not have a close vision region that is clearly identifiable by the wearer , the invention allows the spectacle wearer to know if the distance to the close vision working plane is correct , in other words if he is using the close vision region effectively for close vision work . fig1 shows , diagrammatically , a spectacle frame accorded to the invention . frame 1 has at least one progressive lens 2 or 3 , in other words a lens having a power that continuously varies between a power value that is adapted to far vision and a power value that is adapted to close vision . it additionally has telemetry means 5 for measuring the distance to the point the spectacle wearer is looking at , or the distance between the working plane and the lens in the frame . in the embodiment of fig1 the telemetry means comprise infra - red means and , more specifically , an infra - red emitting diode and a sensor sensitive to infra - red ; for the telemetry means one can employ a component such as the one sold by the japanese company sharp under reference gp2d05 . this component has a 2 - level output , supplying a voltage of a different value depending on whether the distance measured is greater or less than a reference value . this reference value can be adjusted by means of a potentiometer . one can also employ other telemetry means apart from the component specified ; the telemetry means can supply a signal that is representative of distance , and not a 2 - level signal ; they can also employ other types of measurement apart from infra - red for measurement in another range of wavelengths , measurement of pupil position , or yet again ultrasound measurement . fig1 additionally shows a housing 7 which is connected to the telemetry means and which , in the embodiment shown in the fig ., contains the power supply for the component used , as well as furnishing the clock signal applied to the imput of the component ; the said clock signal times the measurements done by the telemetry device . a frequency of 2 hz is suitable . the telemetry means can set off an alarm when the wearer is too close to the working plane . this alarm allows optimal use of the progressive lens , by inciting the spectacle wearer to return to a natural position , which is comfortable , for close vision . the alarm is advantageously set off when the distance measured by the telemetry means is less than a predetermined reference distance ; a value of 20 to 50 centimetres for the reference value is suitable . it is also possible to allow this distance to be adjusted , for example allowing adjustment by the optician who supplied the frame , as a function of the spectacle wearer &# 39 ; s age and morphology . the optician could , for example , set the value of the reference distance equal to the so - called harmon distance . this distance corresponds to the distance between the tip of the elbow and the index finger - thumb junction of the spectacle wearer . according to harmon , this distance is ideal for close vision work . in the embodiment of fig1 a potentiometer for adjusting the reference distance is provided in the housing 7 . the alarm can be of any nature , be it visual , audible , tactile or otherwise . in the preferred embodiment , a visual alarm is employed which has the advantage of being able to be used without being a nuisance in public , and for example in the classroom . this alarm can consist of two light - emitting diodes 9 and 10 arranged on the frame , so they can be readily seen by the spectacle wearer . these diodes can flash at the clock frequency , using a control device in the housing 7 . it is further advantageous to provide a time delay to avoid setting off the alarm when an object briefly passes between the frame and the working plane ; such a passage of an object can be detected by the telemetry means , leading to a distance being measured that is less than the reference distance mentioned above . in order to avoid setting off the alarm unnecessarily , it is possible to provide a time delay . in this way , the alarm is only set off when the distance measured remains below the reference value over a predetermined period . a duration of some three seconds is suitable and has proved to be greater than the habitual duration of a brief passage of an object between the frame and the working plane . fig2 is a circuit diagram of one embodiment of the invention . the diagram shows the component gpd05 , identified by reference 12 , having four terminals : the first terminal vin is connected to the output of an oscillator constituted by a logic gate 14 of the trigger or schmidt trigger ( hysteresis comparator ) type , by a capacitor 18 and a resistor 16 . the second terminal of component 12 is for power supply and is connected to the supply voltage vcc . the third terminal is the ground terminal gnd , and is connected to ground . the fourth terminal is the output terminal supplying the output signal . this is connected to the time delay system constituted by a resistor 20 and a capacitor 26 . the mid - point of these components feeds the input to two schmidt triggers acting as buffers , which supply the diodes . the operation of the circuit in fig2 is as follows . when the distance measured by the telemetry means is less than a reference distance , the fourth terminal provides an output signal which oscillates at the frequency of the signal applied to the first terminal , between supply voltage and zero volts . the diodes are not yet powered as the time delay system is operating ( charge on capacitor 26 ) . as long as capacitor 26 is not charged , the residual voltage from filtering does not enable triggering of the schmidt triggers , thereby not activating the diodes . when the capacitor is charged , the flip - flops are triggered , and the diodes flash . if the measured distance is greater than the reference distance , terminal 4 provides a continuous signal of value vcc . the output from the schmidt triggers is consequently a value equal to the ground voltage . in this case , the diodes are not powered . the invention consequently makes it possible , when a distance to the working plane is too small , to indicate , with the aid of the alarm , that the wearer should change position ; thus , when the spectacle wearer starts working in close vision , and comes too close to the working plane — a well - known tendency of myopia sufferers , he or she is alerted and can change position . in this way , in the example of a child who has been prescribed progressive lenses , the child is incited to utilize the close vision region of the progressive lens or progressive lenses . we shall now describe the prescription protocol according to the invention . as indicated above , the invention preferably applies to myopic children , around the age of six to eight , when the signs of acquired myopia start to appear . progressive lenses having a suitable correction are prescribed for the child . the spectacle wearer is supposed to wear the spectacles of the invention for close vision work , and notably for reading and writing . he is told that he should raise his head to utilize the lower portion of the lenses for all close vision work , and that an alarm will warn him when the distance is too short ; if appropriate , the optician will adjust the reference distance as a function of the child &# 39 ; s morphology , and he can for example base this on the harmon distance . the invention applies not only to the example described in detail above for prescribing progressive lenses for a child , but also to all situations in which it is appropriate to warn a spectacle wearer that the distance to the working plane in close vision is incorrect . it can be used with single - focus or bifocal lenses or , as in the above example , with progressive lenses . in all cases , unlike the prior art , the lenses employed in the invention are corrective lenses , the characteristics of which do not vary over the course of time . they can be organic or inorganic lenses . obviously , the present invention is not limited to the examples and embodiments described and illustrated , but may be the subject of numerous variations available to the person skilled in the art . thus , in the preferred embodiment , the telemetry means are fastened onto the frame . one can , more generally , render these means integral with the head of the spectacle wearer without necessarily mounting them on the frame ; thus , one can employ another support , for example an elastic headband or yet again provide releasable mounting means for the telemetry means on the frame . the invention can , in this case , comprise a kit or set of preassembled parts , with a frame , and telemetry means with an alarm . it is also possible to utilize components other than those described above ; all the telemetry , alarm , and electronic means can be integrated into a housing carried by the frame ; the power supply can be arranged on the frame , or alternatively be separate from the frame and electrically connected to the telemetry means .	6
[ 0027 ] fig1 shows a situation in which the invention can be utilized . a mobile telephone 1 is connected to a personal computer 2 , which is shown in the figure as a laptop computer , via a communications link 3 . the actual communication takes place between a transceiver 4 arranged on the mobile telephone 1 and a transceiver 5 arranged on the computer 2 . the type of the communications link 3 can be selected from several different types , such as a wired connection , a short - range radio link or an infrared link . in the following an infrared link implemented according to the well known irda ( infrared data association ) protocol stack will be used as an example , and thus in the example the transceivers 4 and 5 are optical transceivers . [ 0028 ] fig2 shows an example of the hardware configuration of the infrared transceiver 4 and its relating control circuitry 6 . the infrared transceiver 4 includes a transmitter diode 7 , which will typically be an infrared light emitting diode , and a receiver diode 8 , which will typically be a photo diode . the transceiver also contains a pulse encoder and a pulse decoder . the control circuitry 6 is normally implemented in an asic , which could also contain other control circuits for the mobile telephone 1 . one part of the control circuitry 6 is the ir block 9 . this block converts a byte stream into a pulse train for transmission via the pulse encoder and the transmitter diode 7 , and it also converts the pulses received via the receiver diode 8 and the pulse decoder into a byte stream . the data , i . e . the pulse train , from the ir block 9 to the transmitter diode 7 are transferred via the line tx , while data from the receiver diode 8 to the ir block are transferred via the line rx . power to the infrared transceiver 4 is supplied from a battery ( not shown ), and , as shown , power may be supplied separately to the receiver and transmitter parts of the transceiver . in the figure the power to the transmitter part is supplied through the switch 10 that may be controlled from the control circuitry 6 . in portable devices it is important to improve the standby time or operating time between each recharging of the battery , and thus it is also important to reduce the power consumption of the device . one way to do this is to reduce the power consumption of the infrared transceiver 4 , because typically it will be inactive for long periods . two power saving solutions are well known . one is by means of a shutdown ( sd ) signal from the ir block 9 to the infrared transceiver 4 . this signal can put the entire transceiver in a shutdown mode in which both the receiver and transmitter parts are disabled . when sd is active the transceiver is switched off and consumes almost no power . when sd is inactive the transceiver is operational , and it can receive and decode infrared light pulses . the other power saving solution is to switch off the power supply to the transmitter part by means of the switch 10 . in this way the transmitter part is switched off completely , while the receiver part can still be active , provided the sd signal is inactive . this means that the transmitter part only needs to be switched on when data are actually to be transmitted from the transmitter , and since the control circuitry 6 controls the data transmission as well as the power switch 10 , it is easy to switch off the transmitter part of the transceiver 4 as soon as it is not needed for transmission of data . however , this is not possible for the receiver part , because normally the control circuitry 6 does not have any knowledge of when data can be expected from the other transceiver 5 . therefore , the sd signal normally has to be inactive all the time to ensure that the receiver part of the transceiver is ready to receive data at any time , in case such data should arrive . as will be explained later , this is especially important because some types of data are only sent once . the fact that at least the receiver part of the transceiver must be switched on all the time means that the transceiver continuously has a certain power consumption . some typical figures are that virtually no current is drawn when sd is active , i . e . the whole transceiver is shut down , while a current in the range from 300 μa to 1 ma is drawn when the transmitter part as well as the receiver part are switched on . when only the receiver part is switched on , i . e . power to the transmitter switched off while sd is inactive , the current may be reduced by approximately 25 %, but still the remaining consumption is considerable . in the following the word transceiver will be used to describe not only the transceiver hardware described above , but also the software controlling the hardware . as mentioned above , the transceivers 4 and 5 in this example make use of the irda protocol , and the data are transmitted according to the serial infrared procedure irda - sir ( irda serial infrared ) of this protocol . according to this protocol a transceiver can be in a primary mode or in a secondary mode . in the primary mode the transceiver actively searches for other transceivers of the same type , normally because it has information to transmit . in the secondary mode a transceiver only listens for a transceiver in primary mode to contact it . normally , there are long periods with no data transmission , and both transceivers 4 , 5 will thus be in the secondary mode . if , for example , data are now going to be transmitted from the computer 2 to the mobile telephone 1 , the system will enter the irda discovery mode and the transceiver 5 will change to the primary mode , thus becoming a primary transceiver . the primary transceiver will search for a secondary transceiver by transmitting a series of discovery frames having start characters in front of them . in irda discovery mode the primary transceiver will repeat the series of discovery frames with an interval or period which is typically set to 3 seconds although other values are possible as well . in order to ensure that the secondary transceiver is able to detect the discovery frames , the discovery frame must include at least some bits which are different from the situation where no data are sent . normally , a binary “ 1 ” corresponds to “ no light transmitted ”, and a binary “ 0 ” corresponds to “ light transmitted ”, and thus the discovery frame must include at least some “ 0 ” bits . this is achieved in that the discovery frame starts with 10 xbof characters , which will be explained below . the discovery frames are sent with a bit rate of 9600 baud . in irda discovery mode a sequence of e . g . six , eight or 16 discovery frames , each starting with 10 xbof characters , is transmitted from the primary transceiver every period . however , this is not the case in another mode , i . e . the irda ultra mode , which is used for example when sending a so - called vcard ( business card ). this case is important because the information is only sent once , and there is no option for confirmation or retransmission . thus the 10 xbof characters must be detected the first time . otherwise , the frame format is the same as in irda discovery mode . in irda - sir 9600 the xbof character has the value 0xff , but some older devices use the value 0xc0 and to ensure compatibility with these devices this value should also be supported . when using sir the characters are transmitted in an asynchronous serial format with the parameters 1 start bit (“ 0 ”), 8 data bits , no parity bit and 1 stop bit (“ 1 ”), which is a total of 10 bits . the bits in the character are transmitted from the least significant bit ( lsb ) to the most significant bit ( msb ). thus the value 0xff is exchanged as 0 , 1 , 1 , 1 , 1 , 1 , 1 , 1 , 1 , 1 , while the value 0xc0 is exchanged as 0 , 0 , 0 , 0 , 0 , 0 , 0 , 1 , 1 , 1 . note that the 0s result in light pulses while 1s do not . 1s can thus not be differentiated from silence , so the detection relies on the 0s . as mentioned , 10 xbof characters are sent before the actual data packet , and thus the actual bit stream for the xbof character 0xff looks like the sequence below , where it should be noted that the five initial 1s represent the end of the ( probably very long ) silence period before the first character in the discovery frame . the purpose of the start characters is to “ wake up ” the receiver to ensure that it will actually receive the following data packets . there is no information content as such in the start characters . thus according to the invention the receiver — when it is in the secondary mode waiting for another transceiver to send a discovery frame — is continuously switched on and off in order to save power . this means that the receiver is shut down for certain intervals . the receiver just has to be switched on often enough and long enough to be able to detect at least one of the zeros in the ten xbof characters . then if a zero , and thus a start character , is detected , the receiver is maintained on of course as long as data still arrive from the other end . at 9600 baud the duration of every bit is 1 / 9600 = 104 . 2 microseconds . thus an xbof character ( 10 bits ) takes 1 . 042 milliseconds , and at least one of these ten bits is a zero . 10 xbof characters take about 10 . 42 milliseconds to be transmitted . thus , theoretically , it is sufficient if in any period of 10 . 42 milliseconds the receiver is active in a period of 1 . 042 milliseconds . this period is called an eye period . in practice , however , it is more safe to take into account the possibility of enabling the receiver in the middle of a zero bit and thereby missing it . thus the eye period can be extended to 1 . 146 milliseconds ( 11 bits ), and similarly the repetition period can be reduced a little bit . practical tests have shown that a repetition period of 9 milliseconds with an eye period for the receiver of 1 . 4 milliseconds is completely secure , but values closer to the theoretical values mentioned above are probably possible . the principle is illustrated in the graph of fig5 . a illustrates the signal sd in the transceiver 4 when this transceiver is in the secondary mode waiting for the other transceiver 5 to contact it . it will be seen that in each period t p the signal sd is low ( i . e . not active ) only in the eye period t e . b correspondingly shows that the receiver part of the transceiver 4 is switched on , i . e . ready to receive incoming optical signals in the eye periods t e , while it is shut down in the rest of the period . c shows a discovery frame sent from the other transceiver 5 , and finally d shows what is actually received in the transceiver 4 . c and d correspond to fig3 i . e . the xbof character has the value 0xff and the zeros are represented by the black lines . the period t p is selected to be shorter than , but close to , the duration t x of the ten xbof characters , and the eye period t e selected to be longer than , but close to , the duration of one xbof character . at the time t l a discovery frame from the transceiver 5 begins , and in the shown example the first four zeros are not detected because the transceiver is shut down . however , at the time t 2 the sd signal becomes low and the receiver is again ready to receive for an eye period t e , i . e . until the time t 3 . the zero of the fifth xbof character lies in this eye period and is thus detected . although the sd signal was otherwise expected to be activated again at the time t 3 , as is shown with the dashed lines in a , it is now kept low and the receiver is ready to receive the remaining xbof characters and the following data . of course the receiver is now kept in the switched on state as long as data are exchanged between the two transceivers . a certain time after the exchange of data has been concluded , the receiver returns to the state in which it is only switched on in the eye periods . it will be seen that independent of the start time of the discovery frame at least one of the zeros in the ten xbof characters will be detected , and this is sufficient to ensure safe reception of the following data bytes . since the eye period can theoretically be close to one tenth of the repetition period , the power consumption of the receiver part of the transceiver in the discovery mode can also be reduced to close to one tenth of the normal power consumption . although in practice , as mentioned above , the eye period has to be a little bit longer and the repetition period a little bit shorter , the power consumption can still be reduced to maybe 12 or 15 % of the normal power consumption . when an infrared interface without this solution is implemented in a mobile telephone , the transceiver typically consumes about 10 % of the total stand - by current of the phone . therefore , the user will often prefer to switch the interface on and off manually to save power . with the solution implemented this value can be reduced to maybe 1 or 2 %, which means that the transceiver can now be switched on the whole time without affecting the stand - by time of the phone very much . when the transceiver can be switched on all the time , a user interface to switch it on and off is no longer needed , and it can thus be removed from the phone , which gives a simpler design of the phone user interface . it should be noted that the feature activates itself when there is no other transceiver in range , but also when another device has actually been found but does not contact the transceiver in which the solution is implemented . the fact that the transceiver is always on also means that it is always ready to receive an electronic business card that is beamed to the device . this is important because such a business card is only transmitted once . today an ir interface has to be enabled or switched on for some time before a business card can be received . the sd signal can be controlled from either hardware or software , and thus the solution itself can also be implemented in hardware as well as in software , dependent on what is most convenient in a given device . although a preferred embodiment of the present invention has been described and shown , the invention is not restricted to it , but may also be embodied in other ways within the scope of the subject - matter defined in the following claims . thus , the invention has been described above with relation to an infrared interface operated according to the irda protocol . however , it should be emphasized that any other protocol using a number of start characters as the beginning of a transmission can be used as well . further , it is clear that electrical signals on a wired connection or radio signals transmitted through a radio link , e . g . a short - range radio link , can easily be used instead of the optical signals without affecting the idea of the invention .	8
in fig1 reference numerals 10 and 11 identify two adjustable - stroke radial - piston pumps . each pump includes a rotor 12 or 13 and a stroke - establishing cam ring 14 or 15 . by changing the eccentricity of the cam ring 14 or 15 the stroke of the associated pump can be adjusted . provided in the rotors of the pumps are radial pistons which slide along the inner surfaces of the cam rings . the basic construction of adjustable - stroke radial - piston pumps of this type is very well known . each pump 10 or 11 is provided with its own pressure regulator 16 or 17 . the pressure regulators are disclosed in detail in commonly owned u . s . pat . no . 3 , 891 , 354 , the entire disclosure of which is incorporated herein by reference . for the purpose of explaining the present invention , it is sufficient to note that the output line of pump 10 is designated with numeral 27 , and the output line of pump 11 with numeral 28 . pump output conduits 27 , 28 having respective branches 33 , 34 lead into the associated regulators , for furnishing the regulators with information concerning the output pressure of the pumps . if the pressure fed back to regulator 16 via line 33 indicates that the pressure in pump output conduit 27 is greater or less than the preselected value , then the pressure regulator 16 effects a corresponding change in the fluid pressure supplied to hydraulic adjuster 52 , and the hydraulic adjuster will change the eccentricity of the cam ring 14 , and thereby the stroke of pump 10 , until the pump output pressure reassumes the preselected value . the operation of pressure regulator 17 is the same . each pressure regulator 16 , 17 is shown as having a further inlet at its bottom end . normally , pressure is not applied to this further inlet . however , when associated valve 26 or 24 is opened additional pressure is applied . the effect of this additional pressure is to alter the operation of the regulator in a sense causing the regulator to decrease the stroke of the associated pump . this is explained in considerable detail in the aforementioned patent . the purpose of valves 26 , 24 in the present invention will be described below . however , it should be noted here that if the output pressure of one of the pumps suddenly increases , and the associated value 26 or 24 is not open , then the associated pressure regulator 16 or 17 will simply restore the preselected pressure . however , if in addition the associated valve 26 or 24 is opened , the operation of the regulator will be altered in a sense causing the regulator to more quickly change the setting of the respective cam ring towards the minimum - stroke setting . the illustrated hydraulic system includes a pair of first transducers 18 , 21 respectively operative for furnishing via lines 19 and 22 first signals indicative of the eccentricity of respective ones of the cam rings 14 and 15 , and accordingly indicative of the strokes of the respective pumps . lines 19 and 22 feed into an electronic control device 20 , whose operation is described below . the pump rotors 12 and 13 are mounted on a common drive shaft 10 &# 39 ; driven by a common ( non - illustrated ) drive machine . it is clear that the rotary speeds of pump rotors 12 and 13 must always be the same . a rotary speed transducer 54 detects the rotary speed of the common drive shaft 10 &# 39 ; and furnishes a corresponding electrical signal to the electronic control device 20 . the rotary speed transducer 54 serves the purpose of an overload detector for the common drive machine . when the common drive machine , whether an engine or a motor , becomes overloaded , its speed will fall below a certain value , and this will be indicated by the signal from transducer 54 . it will be understood , however , that more sophisticated load - measuring transducers can be utilized , if desired . the electronic control device 20 has two electrical outputs 23 and 25 respectively leading to the control solenoids of valves 26 and 24 . the valves 26 and 24 constitute anti - overload override valves . when opened , they override or alter the normal operation of the associated pressure regulator in a sense causing the regulator to decrease the stroke of the respective pump towards minimum stroke . and they are activated for performing this override function under the control of the control device 20 , in a manner described below , when overloading of the common drive machine for the pumps is about to occur . the output conduits 27 , 28 of the pumps 10 , 11 are connected with each other by a conduit 29 containing a changeover valve 30 . branching away from the outlet of changeover valve 30 are two conduits 31 , 32 leading into the inlets of respective ones of the anti - overload override valves 26 , 24 . the effect of changeover valve 30 is to transmit to one or both of the pressure regulators 16 , 17 , via the valves 26 , 24 , the output pressure from that one of the two pumps having the higher output pressure . the illustrated hydraulic system is used to drive the left and right caterpillar tracks of an excavating shovel vehicle . the left and right caterpillar tracks are directly driven by hydraulic motors 45 and 47 . hydraulic motor 45 receives pressure fluid from pump outlet 28 via a conuit 42 , a slider valve 38 , and a conduit 44 . hydraulic motor 47 receives pressure fluid from pump outlet 27 via a conduit 43 , a slider valve 39 and a conduit 46 . the slider valves 38 , 39 are comprised of respective control slides 48 , 50 whose settings are indicated in the form of second signals generated by respective second transducers 49 , 51 . these second signals are fed to the electronic control device 20 . the settings of the slider valves 38 and 39 are selected by means of sellector handles 40 and 41 . if it is desired that the vehicle travel in a straight line , the two selector levers 40 , 41 will be turned to identical positions , causing the valves 38 , 39 to assume identical settings . during normal operation , i . e ., when the loads applied to the hydraulic drive motors 45 , 47 by the respective caterpillar tracks are substantially identical , the pressure regulators 16 , 17 will cause the cam rings 14 , 15 of the two pumps to assume identical settings , so that the speeds of rotation of the motors 45 , 47 and , accordingly the travel speeds of the left and right caterpillar tracks , will be identical . however , if now the load applied to one of the two motors suddenly increases , the associated pressure regulator will begin to decrease the stroke of the respective pump . accordingly , the eccentricity of the two cam rings 14 , 14 will become different ; more generally expressed , the relative settings of the two cam rings 14 , 15 will no longer correspond to the relative settings of the two control valves 38 , 39 . if not corrected , this action of the pressure regulator would cause the motors 45 and 47 to run at unequal speeds . the electronic control device 20 maintains the relative settings of the cam rings 14 , 15 in correspondence with the relative settings of the control valves 38 , 39 . it detects the relative values of the first signals in lines 19 and 22 , and it detects the relative values of the second signals from transducers 49 , 51 . if the relationship between the values of the first signals does not correspond to the relationship between the values of the second signals , one or the other of valves 26 , 24 is opened , to cause a decrease in the eccentricity of one of the two cam rings 14 , 15 until such time as the relationship between the settings of the cam rings comes again into correspondence with the relationship between the settings of the valves 38 , 39 . control device 20 can have any of many different forms . for example , it may be a ratio regulator operative for maintaining the ratio of the signals in lines 19 and 22 equal to the ratio of the signals from transducers 49 and 50 by automatically opening one or the other of valves 26 , 24 when the ratios become unequal . if the common drive machine for the two pumps 10 , 11 becomes overloaded , an overload signal is fed by transducer 54 to the control device 20 . this causes control device 20 to open one or both of valves 26 , 24 , in an attempt to counteract the overload more quickly than would occur under the normal operation of the pressure regulators . the control device 20 can be designed in any of a variety of ways to provide this quick anti - overload action . for example , in response to detection of drive machine overload it can simply open both the valves 26 and 24 . in the event that opening of both valves 26 , 24 in an overload situation should happen to cause the ratio of the signals in lines 19 , 22 to fall out of correspondence with the ratio of the signals from transducers 49 , 51 , then the control device 20 can be operative for closing one of the valves 26 , 24 , either uninterruptedly or else intermittently , to maintain the desired correspondence between the two ratios . whereas this would somewhat decrease the quickness of the quick anti - overload override action , unexpected sudden swerving of the vehicle will be prevented . in the embodiment of fig2 there is added to the arrangement of fig1 the controls for the excavating shovel of the machine . the control of the excavating shovel is effected by means of two control arrangements 60 , 61 of identical design . the manually activatable control levers 62 , 63 are mounted in a universal joint and are guided in mutually perpendicular guide slots 64 , 65 and 66 , 67 . the settings of the control levers 62 , 63 determine the settings of the control valves 70 , 71 and 72 , 73 . the valves 70 - 73 control the movements of the hydraulic cylinders ( e . e ., 74 ) for the derrick , the shovel stem , the shovel bottom flap and the turning means for the shovel . cooperating with the control lever 62 is a position transducer 75 , whereas the control lever 63 is provided with a position transducer 76 . these transducers furnish position - indicating signals to the control device 20 of fig2 . the output signals of transducers 75 , 76 are compared by the control device 20 against the signals indicative of the settings of the stroke - adjustment members of the pumps 10 and 11 . the control device 20 of fig2 in dependence upon the lack of correspondence between the two sets of signals , controls the solenoid valves 24 , 26 to cause the associated pressure regulators to prevent the pumps 10 , 11 from furnishing the working cylinders pressure fluid in excess of what is actually needed ; i . e ., corresponding to the setting of the control levers 62 , 63 . with this additional control action the output volumes of the pumps can be set in dependence upon the settings of the activated ones of control valves 70 - 73 . in this way , pressure fluid losses and power waste can be avoided . it will be understood that each of the elements described above , or two or more together , may also find a useful application in other types of constructions differing from the types described above . while the invention has been illustrated and described as embodied in an excavating shovel machine having left and right caterpillar tracks driven by separate hydraulic motors and hydraulic drive pumps , it is not intended to be limited to the details shown , since various modifications and structural changes may be made without departing in any way from the spirit of the present invention . without further analysis , the foregoing will so fully reveal the gist of the present invention that others can , by applying current knowledge , readily adapt it for various applications without omitting features that , from the standpoint of prior art , fairly constitute essential charcteristics of the generic or specific aspects of this invention . what is claimed as new and desired to be protected by letters patent is set forth in the appended claims .	5
referring to fig1 - 3 , it will there be seen that the reference numeral 10 denotes an illustrative embodiment of the present invention . ambulator 10 includes a three - sided base 12 that is positioned in relatively closely spaced relation , such as a few inches , to a horizontal support surface 13 . base 12 includes first base rail 14 and second base rail 16 . first base rail 14 is supported by a pair of caster wheels denoted 18 , 20 . first wheel 18 is positioned near leading end 15 of first base rail 14 and second wheel 20 is positioned near trailing end 17 of said first base rail . tab 20 a that projects from rear wheel 20 activates a well - known braking means when stepped upon so that caster wheel 10 cannot roll and hence ambulator 10 cannot move when said braking means is activated . second base rail 16 is parallel to and transversely spaced apart from first base rail 14 . it is supported by a pair of caster wheels denoted 22 , 24 . first wheel 22 is positioned near the leading end of second base rail 16 and second wheel 24 is positioned near the trailing end of said second base rail . first support post 26 is mounted to first base rail 14 in upstanding relation thereto , about mid - length thereof . post 26 includes a lower housing 28 that telescopically receives tubular member 30 . lower housing 28 has a horizontal throughbore 29 formed therein and tubular member 30 has a plurality of vertically spaced apart throughbores formed therein , collectively denoted 31 . lock member 32 has a throughbore - engaging shaft 33 and a handle 34 as depicted and operates in a well - known way to hold tubular member 30 in a preselected position of adjustment relative to lower housing 28 . second support post 36 is mounted to second base rail 16 in upstanding relation thereto , about mid - length thereof . post 36 includes a lower housing 38 that telescopically receives tubular member 40 . lower housing 38 has a throughbore 39 formed therein and tubular member 40 has a plurality of vertically spaced apart throughbores formed therein , collectively denoted 41 . lock member 42 , not shown , has the same structure as lock member 32 , including a throughbore - engaging shaft 43 , not shown , and a handle 44 , not shown and operates in the same way as lock member 32 to hold tubular member 40 in a preselected position of adjustment relative to lower housing 38 . first arm support 46 is disposed in surmounting relation to first support post 26 and in parallel relation to first base rail 14 . second arm support 48 is disposed in surmounting relation to second support post 36 and in parallel relation to second base rail 16 . a first transversely disposed rod 50 is disposed in interconnecting relation between respective leading ends of said first and second arm supports 46 , 48 and defines a forward end of ambulator 10 . a second transversely disposed rod 52 is disposed in interconnecting relation between respective leading ends of the first and second base rails 14 , 16 . rod 52 is disposed in leading relation to first transversely disposed rod 50 so that the feet of an individual using ambulator 10 as a walking aid may travel beyond the forward end of the ambulator without hitting rod 52 . rod 52 includes a straight middle section 53 , a first end section 54 secured to a first end of said straight middle section , and a second end section 55 secured to a second end of straight middle section 53 . the first and second end sections are disposed at a common angle relative to straight middle section 53 . the first end section has a trailing end secured to a leading end of first base rail 14 and the second end section has a trailing end secured to a leading end of second base rail 16 . harness 60 is adapted to be worn by the individual requiring assistance . harness 60 includes a belt - like base 62 of adjustable length adapted to fit snugly around the individual &# 39 ; s waist . a first plurality of loop members 64 are secured to base 62 along its extent and a second plurality of loop members 66 are secured to first and second arm supports 46 , 48 a plurality of straps 68 interconnects harness 60 to ambulator 10 . more particularly , each strap has a first end releasably secured to a preselected loop member of said first plurality of loop members 64 and has a second end releasably secured to a preselected loop member of said second plurality of loop members 66 . each strap of the plurality of straps is adjustable in length and includes a locking and quick release unlocking means 67 . each strap of said plurality of straps is taut when an individual is using ambulator 10 so that movement of the individual simultaneously produces a corresponding movement of the ambulator . leg straps 62 a , 62 b depend from base 62 and include means , not shown , for securing said straps to the legs of the ambulator user . the full details of construction of harness 60 are provided in u . s . pat . no . 5 , 893 , 367 entitled therapeutic gait harness and pelvic support system , to the present inventor and others , which disclosure is hereby incorporated hereinto by reference . padding means 70 , 72 is secured to said arm supports 46 , 48 in overlying relation thereto , respectively , to increase the comfort of the individual using the ambulator . a padding means 74 is likewise secured to first transversely disposed rod 50 in overlying relation thereto to increase the comfort of the user . arm supports 46 , 48 are adjusted in height so that the forearms of the user are supported by padding 70 , 72 when the shoulders of the user are relaxed . a first brace means 80 includes first brace member 81 having a forward end 82 secured to first support post 26 at a preselected location in vertically spaced relation to a lowermost end of said first support post and a rearward end 83 secured to a trailing end of first base rail 14 . first brace means 80 further includes a second brace member 85 having a rearward end 86 secured to first support post 26 at a preselected location in vertically spaced relation to a lowermost end thereof and a forward end 87 secured to housing 89 that is mounted on a leading end of first base rail 14 in upstanding relation thereto . housing 89 receives the uppermost end of a bias means 104 , disclosed hereinafter . a second brace means 90 , not shown , has the same structure as brace means 80 but provides the function of supporting second support post 36 . it includes a first brace member , not shown , having a forward end secured to second support post 36 at a preselected location in vertically spaced relation to a lowermost end of said second support post and a rearward end secured to a trailing end of second base rail 16 . a second brace member , not shown , has a rearward end secured to second support post 36 at a preselected location in vertically spaced relation to a lowermost end of second support post and a forward end secured to a bias mean - receiving housing 99 mounted to the leading end of second base rail 16 in upstanding relation thereto . third transversely disposed rod 100 is disposed in interconnecting , detachable relation between respective trailing ends of the first and second arm supports 46 , 48 . third transversely disposed rod 100 defines a rearward or trailing end of ambulator 10 . padding means 102 is secured to rod 100 in overlying relation thereto to increase the comfort of the user . a first bias means 104 is disposed in biasing relation between the leading end of first base rail 14 and first forward wheel 18 and a second bias means 106 is disposed in biasing relation between the leading end of the second base rail 16 and second forward wheel 22 . the first and second bias means are under compression when the user applies weight to first transversely disposed rod 50 . rigid posts 108 , 110 are secured to middle section 53 of second transversely disposed rod 52 in transversely spaced apart relation to one another and in depending relation to said second transversely disposed rod . the rigid posts have a common preselected length that spaces respective lowermost ends of the rigid posts slightly above support surface 13 when the first and second bias means 104 , 106 , respectively , are in repose . posts 108 , 110 engage the support surface and prevent forward motion of ambulator 10 when first and second bias means 104 , 106 are compressed by the individual applying weight to first transversely disposed rod 50 . it will thus be seen that the objects set forth above , and those made apparent from the foregoing description , are efficiently attained . since certain changes may be made in the above construction without departing from the scope of the invention , it is intended that all matters contained in the foregoing description or shown in the accompanying drawings shall be interpreted as illustrative and not in a limiting sense . it is also to be understood that the following claims are intended to cover all of the generic and specific features of the invention herein described , and all statements of the scope of the invention which , as a matter of language , might be said to fall therebetween .	0
referring now to the sole figure , there is shown a circuit which reduces electromagnetic interference ( emi ) by frequency modulation of power converters . in the instant circuit , the dc - to - dc converter 15 is provided . this converter produces the output signal v out which is , of course , the output signal produced by the power conditioner . a portion of the output signal is also returned to the comparator 16 where it is compared against the reference signal ref . the reference signal is applied to the positive (+) terminal of the comparator 16 from any suitable reference source such as 5 v dc or the like . the output of the comparator 16 , viz ., the comparison of the output signal v out and the reference signal ref is supplied to the pulse width modulator 14 . the signal supplied to the pulse width modulator controls the duty ratio of the pwm 14 to regulate the dc / dc converter 15 output voltage v out . the modulator 14 is connected to receive a signal from the voltage controlled oscillator 13 . the modulator 14 is operative to vary the duty ratio of the signal which is produced by the vco 13 . the output signal from the vco 13 is also fed back to counter 10 which can be any suitable counter of any prescribed length . the output of the counter 10 is connected to the input of eprom 11 which can be any suitable kind of storage device . in the preferred embodiment , the eprom is suggested as a preferred method and apparatus for storing information . however , any suitable kind of rom is believed to be appropriate . the storage mechanism or rom 11 is used to store a pseudo - random ( pr ) code therein . consequently , when counter 10 produces an output signal , it selectively steps the prom ( or rom ) through its addressing routine in order to select the contents of a particular address . the contents of the prom 11 are stored in digital form . these digital signals are supplied to the digital - to - analog converter 12 . the d / a converter 12 supplies an analog signal to the vco 13 . the output of the vco 13 is supplied to the modulator 14 as described above and returned to counter 10 . thus , as the output signal produced by vco 13 varies in frequency , the counter 10 is caused to count at different rates . with counter 10 counting at different rates the eprom 11 is stepped or addressed at different rates . the content of the prom are , a noted , a pseudo random code in digital form . the digital signal from the prom 11 is converted to an analog signal by d / a converter 12 . this analog signal is then applied to vco 13 which produces an oscillating signal which has a frequency which is representative of the amplitude of the analog signal . the vco output signal is supplied to the pulse width modulator 14 which varies the chopping rate of the signal from the vco 13 while maintaining a constant duty ratio . in particular , the modulator 14 operates to provide a fixed duty ratio over a wide range of operating frequencies of the vco 13 . the dc - to - dc converter provides an output which is a function of duty ratio and not frequency . this technique produces independent means of varying the operating frequency in a psuedo random pattern without changing the output voltage and so forth . in the preferred embodiment , the circuit involved uses a chopping power supply with a dc - to - dc converter 15 which chops at a rate of greater than 1 mhz . this circuit then operates as a generator with pseudo random chopping frequency to provide a spread spectrum operation in order to spread the ripple over a relatively large bandwidth from 750 khz to 1 . 5 mhz . as the output signal v out varies , it is mixed with the reference signal ref which alters the operation of the pulsewidth modulator . the signal supplied to the pulsewidth modulator 14 by the vco 13 is also varying on a pseudo random basis , as described above . the pseudo - randon operation of the circuit which supplies the analog signal to the pulsewidth modulator 14 is also described . consequently , a pseudo - random frequency signal with a constant amplitude is supplied to the modulator which then produces a randomly varying ripple signal from the circuit . as a consequence , the output signal has been spread over a very wide spectrum . thus , there has been shown and described a unique power conditioning circuit which uses spread spectrum techniques as well as frequency hopping techniques to reduce ripple , noise and signature from an output signal . this is accomplished by preventing periodic noise from appearing in the output signal . more importantly , this operation is achieved without the addition of extensive filtration circuits at the output of the circuit involved . thus , electromagnetic interference is greatly reduced at the output signal of this system . this operation is especially useful in communication systems and permits smaller , lighter , more efficient power supplies at high frequencies . it is especially useful in areas where advantages are obtained when output filtration is minimized . in addition to communication systems , this type of power supply system can be very useful in many semiconductor applications wherein the semiconductor devices use lower and lower voltage and / or power . that is , by reducing the noise and ripple on the input signals , the operation of such semiconductor devices which have low voltage requirements , ( e . g . 2 . 5 volts ) is highly advantageous . this circuit is highly advantageous in removal of unwanted signals at the output . moreover , there is a decided improvement on the upper limits of the frequencies at which circuits of this type can operate without the unwanted signals at the output . in the preferred embodiment , specific components and arrangements are shown and described . however , those skilled in the art may conceive of different components in the overall circuit scheme or a different arrangement of the components as shown . however , any such modifications to the circuit which fall within the purview of this description are intended to be included therein as well . clearly , the description is not intended to be limitative of the invention but is , rather , illustrative only . the scope of the invention is not limited by this description but is limited only by the claims appended hereto .	7
the following discussion is directed to a graphical user interface system and methods that enable switching between a plurality of online media services from within a host application , such as a pc - based media player application . a user can switch to any one of a number of online services made available in a services menu and thereby make that service the active service . in addition , the currently active online service is given customization opportunities that permit the active service to customize regions of the gui in a host media player application or other application and / or operating system ( e . g ., active service provides a service information file that includes urls to web pages of the active service ). advantages of the described system and methods include providing online media services with an ability to control the way in which customers discover and purchase media from within the feature rich environment of various user applications such as a pc - based media player application . from a user &# 39 ; s perspective , the advantages include an uninterrupted media experience that can involve the entire process of discovering , purchasing and using a wide variety of media content all from within the feature rich environment of a media player application . fig1 illustrates an exemplary system environment 100 suitable for enabling switching between various online media services and allowing an active service to customize portions of an application on a computer 102 . the exemplary environment 100 includes computer 102 operatively coupled to a plurality of online services 104 and a web listing service 106 via a network 108 . network 108 can include both local and remote connections depending on the particular system configuration . thus , network 108 may include , for example , any one or a combination of a modem , a cable modem , a lan ( local area network ), a wan ( wide area network ), an intranet , the internet , or any other suitable communication link . computer 102 is typically implemented as a user &# 39 ; s primary computing device , such as a desktop personal computer ( pc ). computer 102 might also be implemented as other conventional computing devices generally configured to receive and render multi - media content ( e . g ., play back , burn to cd , transfer to portable playback device , etc .) from various online media services . an exemplary implementation of a computer 102 is depicted in fig1 and described in greater detail below in the exemplary computing environment section . online services 104 and web listing service 106 are typically implemented as one or more server computers such as a web server . thus , online services 104 and web listing service 106 may include a variety of general purpose computing devices such as workstation computers , and may be configured in a manner similar to an exemplary implementation of computer 102 such as described below in the exemplary computing environment referring to fig1 . online services 104 and web listing service 106 generally provide storage for electronic documents and information including multi - media content that is accessible to client computers such as computer 102 over network 108 . fig2 illustrates a block diagram representation of an exemplary computer 102 that is suitable for enabling switching between various online media services 104 and allowing an active service to customize portions of an application on a computer 102 . various components on computer 102 facilitate the retrieval and management of media content for the general purpose of rendering the content on computer 102 and / or synchronizing the content with a portable playback device . these components include , for example , an operating system 200 and its sub - components ( e . g ., the operating system &# 39 ; s folder system application , or “ shell ” 202 ), various applications 204 such as , specifically , a media player 206 , a media library 208 ( i . e ., a database that contains digital media files ), and a service switching and customization architecture 210 . although these components are illustrated separately on computer 102 , it is noted that any one or more of these components may be implemented on computer 102 as part of a multimedia software product , the operating system 200 , stand - alone components , and so on . an application 204 may be any of various applications and / or tools configured to perform various computing tasks such as emailing , word processing , financial analysis , and so on . an application 204 may also be an application or tool configured to receive and manipulate media content , such as from an online media service 104 or some other source . for example , application 204 may be an interactive tv service application that facilitates the recording of video ( e . g ., tv programming ) directly off of a cable and / or satellite feed , a video capture component to transfer home video footage from a digital video recorder onto computer 102 , a web browser application that facilitates downloading media over a network 108 , and so on . thus , applications 204 may supply various forms of media content to a media library 208 on computer 102 . media content stored in media library 208 may include , for example , audio files in the form of mp3 and wma files , video files in the form of avi and mov files , and image files in the form of gif and jpeg files , and so on . a specific example of an application 204 that is illustrated in fig2 is a media player application 206 . a media player application 206 is typically a desktop based media player that manages a broad range of multimedia related tasks regarding the discovery , acquisition and use of media content . for example , a media player application 206 may handle streaming audio and video , cd / dvd playback , mp3 and wma support , encoding , cd / dvd burning , transferring media to a portable playback device , internet radio , and the like . like some other applications 204 , a media player application 206 supplies various forms of media content ( e . g ., audio files , video files , image files , etc .) to media library 208 on computer 102 . although the media player application 206 and media library 208 are illustrated in fig2 and discussed herein as separate components on computer 102 , in other embodiments they may just as readily be a part of the operating system 200 itself . a service switching and customization architecture 210 is configured to be operatively interactive with any one or more of the components of computer 102 noted above for the general purpose of enabling switching between various online media services 104 and allowing an active service to customize portions of such components on computer 102 . thus , one or more applications 204 and / or components of computer 102 ( e . g ., operating system 200 , shell 202 ) may “ host ” the service switching and customization architecture 210 . for example , in one embodiment , the service switching and customization architecture 210 may be an integral component of , and / or operatively interactive with , the media player application 206 . accordingly , although the current embodiment of the service switching and customization architecture 210 will be discussed herein with specific reference to the media player application 206 as a host application , various aspects of service switching and customization may be hosted by and / or be generally applicable in similar ways to various components of computer 102 including , for example , the operating system 200 and its sub - components ( e . g ., shell 202 ), and various other applications 204 . the service switching and customization architecture 210 includes an online service manager component 212 , an all - services file 214 , and a number of service information files 216 . the online service manager 212 is generally configured to populate a service menu list within the media player 206 , and to manage switching between online services and to manage customizations made to the player that are provided by a currently active service . each time computer 102 is connected to the network 108 , the online service manager 212 fetches the all - services file 214 from a web service listing 106 . in the current embodiment , the all - services file 214 is an xml ( extended markup language ) file that is kept up - to - date on the web service listing 106 so that the online service manager 212 always has access to the latest list of valid online services 104 . the all - services file 214 includes a list of all valid online services 104 and any other information needed to populate a service menu list within the media player 206 . as discussed in more detail below , the online service manager 212 uses information in the all - services file 214 to determine where to retrieve a service information file 216 for each of the valid services identified in the all - services file 214 . when a valid all - services file 214 is retrieved from web service listing 106 , the service manager 212 populates the service menu list within the media player 206 with the list of valid online services from the file . prior to a new selection being made by a user from the service menu list , the last active service is present in all the customization points within the media player 206 . in general , a ui manager 218 component of the service switching and customization architecture 210 manages the display of a graphical user interface ( gui ) on a computer display device . the ui manager 218 manages the gui in conjunction with online service manager 212 and user input instructions entered through a user interface selection device ( e . g . a mouse ) that controls motions and selections of a pointer displayed on the gui . although the ui manager 218 is illustrated in fig2 as being part of the online service manager 212 , this is for illustrative purposes only and is not intended to be limiting . thus , the ui manager 218 may be configured differently , such as being a stand - alone component or a part of another component on computer 102 . fig3 a - 3 d illustrate examples of such a gui in the form of a command bar user interface . the command bar user interface provides access to functionality for both a host application ( e . g ., a media player application ) and a currently active media service being hosted by the host application . the command bar user interface enables switching between a plurality of online media services from within a host application . users can switch to any one of a number of online services made available by the command bar through a service list menu . a selected online service becomes the currently active service . the currently active online service is given customization opportunities that permit customization of different areas of the user interface within the host application . referring to fig3 a , the command bar user interface illustrates two regions or areas in which function buttons are displayed . a “ host application function area ” includes application function buttons c 1 - c 5 that are intended to illustrate functions of the host application that a user can activate through the user interface . for example , if the host application is a media player application , some of the functions represented by c 1 - c 5 might include a function for burning music onto a cd or a function for synchronizing content with a mobile device . furthermore , any of the buttons c 1 - c 5 could themselves be menus offering additional functionality related to the particular button . the number of application function buttons and the manner in which they are illustrated is shown in fig3 a - 3 d by way of example only , and is not intended to be limiting . thus , certain applications may have a greater or lesser number of application function buttons displayed in the host application function area of the command bar user interface . note that in practice , the application function buttons may not have superscript numbers designating their functions . rather , an application function associated with an application function button will likely be designated with a text description or a graphical representation ( e . g ., an icon or animation ) that indicates the function . another region of the command bar user interface is the “ service function area ”. the service function area includes service function buttons s 1 - 1 - s 1 - 3 that are intended to illustrate functions provided by a currently active online media service and are made accessible to a user through the user interface . the service function area also includes a “ service brand ” icon and a “ service menu ” button . the superscript numbers on the service function buttons indicate that a particular online service is the currently active service and that a number of functions are available for that service . for example , service function button s 1 - 1 is intended to designate a first function for the currently active online media service number 1 , indicated by the “ service 1 brand ” icon . likewise , service function button s 1 - 3 indicates a third function for the currently active online service number 1 . note that in practice , the service function buttons may not have superscript numbers designating their functions and a particular service . rather , service function buttons will likely be designated with a text description that indicates their function , and the currently active service may be identified by the “ service brand ” icon shown in the service function area ( e . g ., “ service 1 brand ”). the “ service menu ” button facilitates access to a list of valid online services as discussed more below with reference to fig3 c . referring still to fig3 a , the command bar user interface illustrates in the “ host application function area ” that a host application function has been activated by a user through the selection of application function button c 2 . when an application function button is active , the command bar user interface typically alters the appearance of the button to indicate its active state as shown in fig3 a . the change in appearance can be implemented in a variety of ways including , for example , by highlighting the application button , changing the color of the application button , adjusting the texture of the application button , and adjusting a background intensity level of the application button . fig3 b illustrates that a user has selected a service function button s 1 - 1 from the “ service function area ”. thus , the user intends to implement the function associated with the s 1 - 1 service button which , as noted above , corresponds to the currently active online service designated by the “ service 1 brand ”. as illustrated in fig3 b , when a service function button is selected by a user , it becomes active . the service button &# 39 ; s active state is indicated by a change in appearance to the button . furthermore , when an online service function is activated , the command bar interface also changes or shifts the appearance of the “ service function area ” to indicate the active state of the online service function to the user . thus , fig3 b illustrates a change in the appearance to both the service function button s 1 - 1 and to the service function area . the change in appearance to a service function button and the service function area can be implemented in a variety of ways including , for example , by highlighting them , changing their colors , adjusting their textures , and adjusting their background intensity levels . fig3 c illustrates use of the “ service menu ” to switch the currently active online service to a different online service . as noted in fig3 c , the service menu has been selected . selection of the service menu can be indicated by a change in appearance to the service menu button , similar to that just discussed above . when the service menu is selected , a list of valid online media services appears in a drop - down menu box . a user then has the opportunity to switch the currently active online service to a different online service based on the available services within the list of valid services . fig3 d illustrates the result of a selection made from the list of valid online media services appearing in the drop - down menu box of fig3 c . the selection the user made was “ service 2 ”, which is indicated by the “ service 2 brand ” icon now appearing in the service function area . in addition , the service function buttons changed to correspond with the newly active online service selected by the user . furthermore , although not illustrated in fig3 d , the appearance of the service function area may also change according to customizations provided by the newly active online service indicated by the “ service 2 brand ” icon . fig4 - 7 illustrate more specific examples of how the command bar user interface described with reference to fig3 a - 3 d might be implemented with respect to the graphical user interface of a media player 206 application . fig4 illustrates an example user interface for media player 206 as it might appear on a display of computer 102 . assuming an all - services file 214 has just been retrieved , customization points such as the menu task pane 400 and the service function button area 402 in the top level command bar are still controlled by the last active service . thus , the current service menu task pane 400 displays the html page associated with the last active service , which in the fig4 example is “ movielink ”, as indicated in the service function area 402 of the command bar by the “ movielink ” brand icon . a selection arrow is shown in fig4 hovering over a service list menu button 404 in the command bar . when a user “ selects ” the service list menu button 404 using a user interface selection device ( e . g ., a mouse ), a drop - down box will open up and reveal the list of valid online services from the all - services file 214 . fig5 illustrates an example of a list of valid online services 500 appearing in the drop - down box 502 after the service list menu button 404 has been “ clicked ” by a user . from the list of valid online services 500 , a user can select an online service to be the currently active service . only one service can be the active service at any one time , and the active service controls all of the customization opportunities within the media player 206 , such as the service menu task pane 400 , which in fig4 and 5 is controlled by the currently active “ movielink ” service . thus , a user is able to switch between the different online services 500 shown in the services drop - down box 502 and thereby change which service controls the customization points in the media player 206 . fig6 illustrates a selection of an online service being made that will switch the active service from the “ movielink ” online service to the “ music box ” online service . switching between these services will shift control of the customization points within media player 206 from the “ movielink ” service to the “ music box ” service . as shown in fig6 , the “ music box ” online service has been highlighted 600 for selection . fig7 illustrates the newly selected “ music box ” service as the active service . accordingly , customization points within the media player 206 have changed according to the new active “ music box ” service and the background under the active service buttons has changed . in fig7 , the apparent customization points that have changed are the text and icon in the service function button area 402 and the html page in the service menu task pane 400 . it is noted that the customization points discussed thus far are only examples of customization points , and that various other customization points also exist , some of which are discussed in greater detail below . for example , the several service function buttons 700 are customization points whose color and text descriptions can be customized by the currently active service . fig8 illustrates an example of an all - services file 214 . as noted above , the all - services file 214 is an xml ( extended markup language ) file that contains a list of valid online services and other information needed to populate a service menu list within the media player 206 . other important information included in the all - services file 214 is a url ( universal resource locator ) link to a service information file 216 for each of the services listed in the all - services file 214 . when a service is selected from the service menu list within the media player 206 , the url for the selected service is accessed and the service information file 216 for that service is retrieved . referring to fig8 , an all - services xml file 214 includes various elements that tell the media player 206 how to populate the initial service menu list and where to retrieve each service information file 216 . these elements include & lt ; services & gt ;, & lt ; default & gt ;, & lt ; browse & gt ;, & lt ; service & gt ;, & lt ; friendlyname & gt ;, and & lt ; image & gt ; elements . the & lt ; services & gt ; element includes an optional version attribute that indicates the version of the xml file . the & lt ; default & gt ; element includes a required key attribute that is used to set the initial default service in the player on the very first use of the player . the & lt ; browse & gt ; element includes a required url attribute that links to a “ browse all services ” page that matches the services that are listed in the all - services file 214 . selecting a “ browse all services . . . ” menu item will open the & lt ; servicetask 1 & gt ; ( discussed below ) and switch to a page that will list and promote partner online services . the & lt ; service & gt ; elements represent each service that is a valid service . each & lt ; service & gt ; element includes a required key attribute that is a service key representing the service , a required xmlurl attribute that is a fully qualified url to the service &# 39 ; s service information file 216 , an optional position attribute that indicates the initial position of the service in the service menu list , and an optional type attribute that represents whether the service can customize all customization points within the media player 206 or just the service panes within the media player 206 . the & lt ; friendlyname & gt ; element includes optional text that represents the name that is shown to the user for the service . if the & lt ; friendlyname & gt ; element is not specified , the & lt ; service & gt ; key attribute is used in the player 206 wherever the & lt ; friendlyname & gt ; element is needed . the & lt ; image & gt ; element includes an optional menuurl attribute that is a fully qualified url to a graphic image to use on the service menu list . as noted above , when a service is selected from the service menu list within the media player 206 , the url for the selected service is accessed and the service information file 216 for that service is retrieved . like the all - services file 214 discussed above , the service information file 216 is preferably an xml file . each valid online service in the all - services file 214 hosts it own service information file 216 and uses this file to manage the customization opportunities within the media player 206 . customization opportunities , or customization points , are places or areas within the media player 206 gui ( e . g ., service area of command bar , task panes , etc .) that the media player gives up control over so that the active service can customize them to its own preference . three main categories of customization can generally be described as music , video ( tv , movie ), and radio . referring to fig7 , these categories are represented by the three service function buttons 700 , whose color and text descriptions can be customized by the currently active service . an active / selected service provides an html page for display in task pane 400 for one or more service function buttons 700 . the html page typically provides access to a purchase experience . for example , an active music service may provide an html page that permits a user to search for a particular song or cd , after which the user can purchase and download the song or cd . a service can choose to include one or all of the three categories depending on the type of service . for example , a video service that offers only video products may only choose to use and customize the video category task tab and forego using the music and radio tabs . in addition to the three main service function buttons 700 , an active service also controls customization points regarding various media player functions ( i . e ., host application functions ), such as those represented by the application function buttons 702 on the left side of the media player command bar shown in fig7 . for example , the “ now playing ” function button displays videos in the task pane 400 when a video is being played on the media player 206 . however , when only audio ( e . g ., music ) is playing on the media player , the “ now playing ” function displays either visualizations ( i . e ., shapes , animations , etc .) or an infocenter view . the infocenter view is an html page provided by the active service that typically includes useful information regarding the music that is being played by the media player at the time , such as track listings , artists , etc . furthermore , the “ now playing ” function includes a “ buy media ” ( e . g ., “ buy cd ”, “ buy video ”) shortcut link to the corresponding service function button 700 that permits a user to directly initiate a purchase experience regarding the currently playing media . typically , the shortcut link will bypass intermediate steps such as searches , and proceed directly to a page that permits purchasing the media currently playing on the media player 206 . in addition to the “ now playing ” function as a customization opportunity for the currently active service , various other functions provide such customization opportunities within media player 206 . fig9 illustrates an example of a service information file 216 which includes examples of the various types of functions providing customization opportunities . each service information file 216 includes various elements that tell the media player 206 how to customize the customization points within the player . these elements include & lt ; serviceinfo & gt ;, & lt ; friendlyname & gt ;, & lt ; image & gt ;, & lt ; color & gt ;, & lt ; servicetask 1 & gt ;, & lt ; servicetask 2 & gt ;, & lt ; servicetask 3 & gt ;, & lt ; infocenter & gt ;, & lt ; albuminfo & gt ;, & lt ; buycd & gt ;, & lt ; install & gt ;, and & lt ; htmlview & gt ; elements . the & lt ; serviceinfo & gt ; element is required , and is the container element for the service information file 216 . the & lt ; serviceinfo & gt ; element includes an optional version attribute that indicates the version of the xml file , and a required key attribute that is used by the media player 206 to uniquely identify the particular service . the & lt ; friendlyname & gt ; element is a required element that includes text that will be used to represent the name of the service on the service menu list in the media player 206 . the & lt ; image & gt ; element is optional and it represents the graphical images that should be used to represent the service . the & lt ; image & gt ; element includes an optional menuurl attribute that is a fully qualified url to a 16 × 16 graphic image to use on the service menu list , an optional servicesmallurl that is a fully qualified url to a 30 × 30 graphic image to use in the chrome , and an optional servicelargeurl that is a fully qualified url to a 30 × 60 graphic image to use in the chrome . the file formats supported include . gif , . jpg , . bmp , and . png . png is the preferred file format as transparency is also supported and recommended . if the menuurl attribute isn &# 39 ; t specified , then no graphic is used on the menu . the servicelargeurl attribute for the chrome service image is used if both servicesmallurl and servicelargeurl are present . if the chrome images are wider than the image area ( 30 or 60 depending on which element ), then the image area is animated over the image area when the user selects the service . the & lt ; color & gt ; element is optional and is used to specify the service area button color and navigation bar color . the & lt ; color & gt ; element includes a required mediaplayer attribute of hex rgb value (# ffddcc ). the & lt ; servicetask 1 & gt ;, & lt ; servicetask 2 & gt ;, and & lt ; servicetask 3 & gt ; elements represent the three service function buttons 700 ( fig7 ) in the service function area of the command bar . the & lt ; servicetask 1 & gt ; element is required , while & lt ; servicetask 2 & gt ; and & lt ; servicetask 3 & gt ; are optional . each of the 3 elements includes a required url attribute that is a fully qualified url to an html page that will be loaded to the respective task pane when the user switches services and selects that pane , a required & lt ; buttontext & gt ; attribute that includes text that will be used as the button text for the task pane , and an optional & lt ; buffontip & gt ; attribute that includes text that will be displayed when the user hovers over the button for the task pane . the & lt ; servicetask 1 & gt ; element is required and is considered the primary commerce pane . the media player will launch into this pane when the user selects “ buy media ” within the player . as noted above , the three main categories of customization for these elements can generally be described as music , video ( tv , movie ), and radio . the & lt ; infocenter & gt ; element is optional and is used to specify a customization of the “ now playing ” infocenter view . the & lt ; infocenter & gt ; element includes a required url attribute that is a fully qualified url that refers to an html page . as noted above , the & lt ; infocenter & gt ; view html page provided by the active service typically includes useful information regarding the music that is currently being played by the media player , such as track listings , artists , etc . the & lt ; albuminfo & gt ; element is an optional element that is used to specify a customization of the album information windows in the burn to cd and media library panes . the & lt ; albuminfo & gt ; element includes a required url that is a fully qualified url that refers to an html page . the url will be loaded into the album information window with parameters as a query . the & lt ; buycd & gt ; element is an optional element that is used to specify a purchase experience from various buy links within the media player 206 . the & lt ; buycd & gt ; element includes a required mediaplayerurl , an optional mediacenterurl , and an optional browserurl that are each fully qualified urls that refer to an html page for buying a cd or dvd in the media player 206 . the “ now playing ” function includes a “ buy cd ” shortcut link to the active service web page that permits purchasing the media currently playing on the media player 206 . the & lt ; install & gt ; element is an optional element that is used by setup to install the default service code ( if any ) when setup is run online . the & lt ; install & gt ; element includes a required eulaurl that is a fully qualified url that points to a . txt file for the code that the service wants installed , and a codeurl that is a fully qualified url that points to a . cab file that will be installed during setup if the service is the default service . the & lt ; htmlview & gt ; element is an optional element that is used to allow radio . asx files to specify a trusted htmlview file so that the page can have access to the external . navigatetaskpane ulr function to link deeply into a service . the & lt ; htmlview & gt ; element includes a required baseurl that is a fully qualified url that points to the base url to use for any new htmlview to allow html access . example methods for enabling switching between various online media services and allowing an active service to customize portions of an application on a computer through a command bar user interface will now be described with primary reference to the flow diagrams of fig1 and 11 . the methods apply to the exemplary embodiments discussed above with respect to fig1 - 9 . while one or more methods are disclosed by means of flow diagrams and text associated with the blocks of the flow diagrams , it is to be understood that the elements of the described methods do not necessarily have to be performed in the order in which they are presented , and that alternative orders may result in similar advantages . furthermore , the methods are not exclusive and can be performed alone or in combination with one another . the elements of the described methods may be performed by any appropriate means including , for example , by hardware logic blocks on an asic or by the execution of processor - readable instructions defined on a processor - readable medium . a “ processor - readable medium ,” as used herein , can be any means that can contain , store , communicate , propagate , or transport instructions for use or execution by a processor . a processor - readable medium can be , without limitation , an electronic , magnetic , optical , electromagnetic , infrared , or semiconductor system , apparatus , device , or propagation medium . more specific examples of a processor - readable medium include , among others , an electrical connection ( electronic ) having one or more wires , a portable computer diskette ( magnetic ), a random access memory ( ram ) ( magnetic ), a read - only memory ( rom ) ( magnetic ), an erasable programmable - read - only memory ( eprom or flash memory ), an optical fiber ( optical ), a rewritable compact disc ( cd - rw ) ( optical ), and a portable compact disc read - only memory ( cdrom ) ( optical ). referring to fig1 , at block 1002 of method 1000 , a list of online services is retrieved . an online service manager 212 related to an application 204 ( e . g ., a media player 206 ) executing on a computer , goes online via a network and accesses a web listing service . the online service manager 212 retrieves an all - services xml file containing a list of valid online services and additional information . one skilled in the art will readily recognize other ways in which a list of valid online services may be retrieved . for example , the list could be hardcoded on the computer by the oem and then retrieved by the online service manager 212 . the list could also be manually constructed by a user registering a media player for a web protocol such that when the user clicks on a special link in the web page of a service provider , the link is received by the player and the service is added to the service list . thus , other sources may be readily available from which the online service manager 212 can access the list of valid online services . at block 1004 , an online service is set as an initial active service based on the last active service previously chosen by the user . if the application has never run before , a default service specified by the all - services file is initially set as the active service . at block 1006 , the online service manager 212 enables the selection of one of the online services as an active service . a service menu within a media player 206 , for example , is populated with the list of online services . each online service is represented in the service menu with a friendly and a graphical image if the name and image have been included by the active service in the retrieved list of online services . selection of one of the online services includes accepting user input that identifies which online service the user desires to make the current active service within the media player . at block 1008 , customization points within the media player 206 ( or other application 204 , operating system 200 , etc .) are customized based on the active service . customization includes retrieving a service information file from the active service and customizing the customization points within the media player 206 ( and / or operating system shell 202 and applications 204 ) by enabling the active service , via the service information file , to control the content within the customization points . the customization points include , for example , task panes and task pane buttons within the media player . customizations within a media player 206 ( and / or operating system shell 202 and applications 204 ) can include a variety of content input and modifications made to parts of the software , including for example , identifying a name for service function button using text provided by the active service , displaying button tip text for the service function button when a selection tool hovers over the service function button , the button tip text being provided by the active service , displaying ( in a task pane ) an html page specified by the active service when a user selects the service function button . customizations can also include displaying an html page from the active service within a now playing function button of the media player , where the html page provides an infocenter view that includes information related to music that is currently being played by the media player . customizations can also include displaying an html page from the active service , where the html page provides album information in a burn - to - cd ( compact disc ) task pane and a media library task pane . customizing can also include displaying a “ buy cd ” link to a web page of the active service within a now playing task pane , where the web page permits purchasing the cd ( compact disc ) or dvd ( digital video disc ) that is currently playing on the media player . at block 1010 , a user input selection is received through the service menu for a different service from the available online services . at block 1012 , the online service manager 212 retrieves a service information file for the different service . at block 1014 , the online service manager 212 switches the active service to the different service based on the input selection made by the user . referring to fig1 , at block 1102 of method 1100 , a user interface is displayed . the user interface includes a command bar that has a host application region to control functions of a host application ( e . g ., a media player application ), and a service region to control functions of a currently active service provider . the application region includes application buttons to control functions of the application and the service region includes service buttons to control functions of the currently active media service . at block 1104 , the user interface provides access to a list of services through a service list menu . user input is received through a user interface selection device ( e . g ., a mouse ) indicating the selection of a service list menu button in the service region . the service list menu provides a drop - down box to display a list of valid services . at block 1106 , the user interface enables a switch from the currently active service to a newly active service . user input is received via the user interface selection device indicating a particular service has been selected from service list menu . in response to the user selection , the active service is switched from the currently active service to the particular / selected service , making it the newly active service . in addition , the appearance of the service region and service buttons within the service region is altered in accordance with customizations provided by the newly active service . for example , the service region branding icon is changed from one identifying the currently active service to one identifying the newly active service . at block 1108 , the appearance of the service region is altered when a service function is made active ( e . g ., by user input selection of the service function button ). alterations in appearance can include , for example , highlighting , changes in color , adjustments in texture , and adjust of background intensity of the service region . at block 1110 , the appearance of a service button is altered when a service button is made active ( e . g ., by user input selection of the service button ). alterations in appearance can include , for example , highlighting , changes in color , adjustments in texture , and adjust of background intensity of the service button . at block 1112 , the appearance of the application region is altered when an application function button is made active ( e . g ., by user input selection of the application function button ). alterations in appearance can include , for example , highlighting , changes in color , adjustments in texture , and adjust of background intensity of the application region . at block 1114 , the appearance of an application button is altered when the application button is made active ( e . g ., by user input selection of the application button ). alterations in appearance can include , for example , highlighting , changes in color , adjustments in texture , and adjust of background intensity of the application button . fig1 illustrates an exemplary computing environment for implementing a computer 102 suitable for enabling switching between various online media services and allowing an active service to customize portions of an application such as a media player as discussed above with reference to fig1 - 9 . although one specific configuration is shown in fig1 , a computer 102 may also be implemented in other computing configurations . the computing environment 1200 includes a general - purpose computing system in the form of a computer 1202 . the components of computer 1202 may include , but are not limited to , one or more processors or processing units 1204 , a system memory 1206 , and a system bus 1208 that couples various system components including the processor 1204 to the system memory 1206 . the system bus 1208 represents one or more of any of several types of bus structures , including a memory bus or memory controller , a peripheral bus , an accelerated graphics port , and a processor or local bus using any of a variety of bus architectures . an example of a system bus 1208 would be a peripheral component interconnects ( pci ) bus , also known as a mezzanine bus . computer 1202 includes a variety of computer - readable media . such media can be any available media that is accessible by computer 1202 and includes both volatile and non - volatile media , removable and non - removable media . the system memory 1206 includes computer readable media in the form of volatile memory , such as random access memory ( ram ) 1210 , and / or non - volatile memory , such as read only memory ( rom ) 1212 . a basic input / output system ( bios ) 1214 , containing the basic routines that help to transfer information between elements within computer 1202 , such as during start - up , is stored in rom 1212 . ram 1210 contains data and / or program modules that are immediately accessible to and / or presently operated on by the processing unit 1204 . computer 1202 may also include other removable / non - removable , volatile / non - volatile computer storage media . by way of example , fig1 illustrates a hard disk drive 1216 for reading from and writing to a non - removable , non - volatile magnetic media ( not shown ), a magnetic disk drive 1218 for reading from and writing to a removable , non - volatile magnetic disk 1220 ( e . g ., a “ floppy disk ”), and an optical disk drive 1222 for reading from and / or writing to a removable , non - volatile optical disk 1224 such as a cd - rom , dvd - rom , or other optical media . the hard disk drive 1216 , magnetic disk drive 1218 , and optical disk drive 1222 are each connected to the system bus 1208 by one or more data media interfaces 1225 . alternatively , the hard disk drive 1216 , magnetic disk drive 1218 , and optical disk drive 1222 may be connected to the system bus 1208 by a scsi interface ( not shown ). the disk drives and their associated computer - readable media provide non - volatile storage of computer readable instructions , data structures , program modules , and other data for computer 1202 . although the example illustrates a hard disk 1216 , a removable magnetic disk 1220 , and a removable optical disk 1224 , it is to be appreciated that other types of computer readable media which can store data that is accessible by a computer , such as magnetic cassettes or other magnetic storage devices , flash memory cards , cd - rom , digital versatile disks ( dvd ) or other optical storage , random access memories ( ram ), read only memories ( rom ), electrically erasable programmable read - only memory ( eeprom ), and the like , can also be utilized to implement the exemplary computing system and environment . any number of program modules can be stored on the hard disk 1216 , magnetic disk 1220 , optical disk 1224 , rom 1212 , and / or ram 1210 , including by way of example , an operating system 1226 , one or more application programs 1228 , other program modules 1230 , and program data 1232 . each of such operating system 1226 , one or more application programs 1228 , other program modules 1230 , and program data 1232 ( or some combination thereof ) may include an embodiment of a caching scheme for user network access information . computer 1202 can include a variety of computer / processor readable media identified as communication media . communication media embodies computer readable instructions , data structures , program modules , or other data in a modulated data signal such as a carrier wave or other transport mechanism and includes any information delivery media . the term “ modulated data signal ” means a signal that has one or more of its characteristics set or changed in such a manner as to encode information in the signal . by way of example , and not limitation , communication media includes wired media such as a wired network or direct - wired connection , and wireless media such as acoustic , rf , infrared , and other wireless media . combinations of any of the above are also included within the scope of computer readable media . a user can enter commands and information into computer system 1202 via input devices such as a keyboard 1234 and a pointing device 1236 ( e . g ., a “ mouse ”). other input devices 1238 ( not shown specifically ) may include a microphone , joystick , game pad , satellite dish , serial port , scanner , and / or the like . these and other input devices are connected to the processing unit 1204 via input / output interfaces 1240 that are coupled to the system bus 1208 , but may be connected by other interface and bus structures , such as a parallel port , game port , or a universal serial bus ( usb ). a monitor 1242 or other type of display device may also be connected to the system bus 1208 via an interface , such as a video adapter 1244 . in addition to the monitor 1242 , other output peripheral devices may include components such as speakers ( not shown ) and a printer 1246 which can be connected to computer 1202 via the input / output interfaces 1240 . computer 1202 may operate in a networked environment using logical connections to one or more remote computers , such as a remote computing device 1248 . by way of example , the remote computing device 1248 can be a personal computer , portable computer , a server , a router , a network computer , a peer device or other common network node , and the like . the remote computing device 1248 is illustrated as a portable computer that may include many or all of the elements and features described herein relative to computer system 1202 . logical connections between computer 1202 and the remote computer 1248 are depicted as a local area network ( lan ) 1250 and a general wide area network ( wan ) 1252 . such networking environments are commonplace in offices , enterprise - wide computer networks , intranets , and the internet . when implemented in a lan networking environment , the computer 1202 is connected to a local network 1250 via a network interface or adapter 1254 . when implemented in a wan networking environment , the computer 1202 includes a modem 1256 or other means for establishing communications over the wide network 1252 . the modem 1256 , which can be internal or external to computer 1202 , can be connected to the system bus 1208 via the input / output interfaces 1240 or other appropriate mechanisms . it is to be appreciated that the illustrated network connections are exemplary and that other means of establishing communication link ( s ) between the computers 1202 and 1248 can be employed . in a networked environment , such as that illustrated with computing environment 1200 , program modules depicted relative to the computer 1202 , or portions thereof , may be stored in a remote memory storage device . by way of example , remote application programs 1258 reside on a memory device of remote computer 1248 . for purposes of illustration , application programs and other executable program components , such as the operating system , are illustrated herein as discrete blocks , although it is recognized that such programs and components reside at various times in different storage components of the computer system 1202 , and are executed by the data processor ( s ) of the computer . although the invention has been described in language specific to structural features and / or methodological acts , it is to be understood that the invention defined in the appended claims is not necessarily limited to the specific features or acts described . rather , the specific features and acts are disclosed as exemplary forms of implementing the claimed invention .	6
fig1 illustrates a channel alignment circuit according to the present invention . as shown therein , the channel alignment circuit according to the present invention includes a cib detector 1 for detecting cib of 51 . 84 mbps of six channels which were descrambled and generating a 12 - bit channel number data , a control signal generator 2 for generating a 3 - bit channel alignment control signal by using a 3 - bit data among the channel number data from the cib detector 1 , and a channel alignment unit 3 for separating the data inputted thereinto six channels in accordance with a control signal from the control signal generator 2 . in the channel alignment circuit according to the present invention , the cib detector 1 detects a cib inputted , and generates a 12 - bit channel number data in accordance with the detected cib . the channel number data from the cib detector 1 are formed as follows : ______________________________________channel 1 ` 0000 0000 0000 ` channel 2 ` 0010 0100 1001 ` channel 3 ` 0100 1001 0010 ` channel 4 ` 1001 0010 0100 ` channel 5 ` 1011 1001 1101 ` channel 6 ` 1111 1111 1111 ` ______________________________________ the 12 - bit channel number data from the cib detector 1 are inputted into the control signal generator 2 . the control signal generator 2 generates a 3 - bit signals , for example , bit 2 ˜ bit 0 , bit 5 ˜ bit 3 , bit 8 ˜ bit 6 or bit 11 ˜ bit 9 , which are capable of separating a channel from the 12 - bit channel number data . the 3 - bit control signal generated by the control signal generator 2 is inputted into the channel alignment unit 3 , and the channel alignment unit 3 separates inputted channel data in accordance with a 3 - bit control signal . fig2 illustrates a control signal generator in the circuit of fig1 according to the present invention . as shown therein , the data b0 of the bit 0 from the cib detector is inputted into the input terminals of an and - gates and1 , and2 and and4 and an exclusive or - gate exor , respectively . the data b1 of the bit 1 is inputted into the input terminals of the smd - gates and3 and and4 , respectively . the data b2 of the bit 2 is inputted into the and - gate and1 and the exclusive or - gate exor , respectively , and the input terminals of the and - gates and2 and and3 through an inverter iv1 , respectively , so that a control signal s0 is outputted from the output terminal of the and - gate and1 . the output terminals of the and - gates and2 and adn3 are connected to the input terminal of an or - gate or1 , respectively , so that a control signal s1 is outputted from the output terminal of the or - gate or1 . the output terminals of the exclusive or - gate exor and an and - gate and4 are connected to the input terminal of the or - gate or2 , so that a control signal s2 is outputted from the output terminal of the or - gate or2 . as shown in fig3 a through 3c , in the control signal generator 2 , when the low level data b0 , b1 , and b2 of the bit 0 , bit 1 , and bit 2 are all inputted at a time t1 , the data b0 of the bit 0 is inputted into the input terminals of the and - gates and1 , and2 and and4 and the exclusive or - gate exor , respectively . in addition , the data b1 of the bit 1 is inputted into the input terminals of the and - gates and3 and and4 , respectively . the data b2 of the bit 2 is inputted into the and - gate and1 and the exclusive or - gate exor , respectively , and is inverted by the inverter iv1 as shown in fig3 d and then is inputted into the input terminals of the and - gates and2 and and3 . therefore , since a low level control signal s0 , as shown in fig3 e , is outputted from the and - gate and1 , and a low level signal is outputted from the and - gates and2 through and4 and the exclusive or - gate exor , the or - gates or1 and or2 output low level control signals s1 and s2 as shown in fig3 f and 3g . in addition , when the low level data b0 and b1 of the bit 0 and bit 1 are inputted at a time t2 , and the high level data b2 of the bit 2 is inputted , the and - gate and1 outputs a high level control signal s0 as shown in fig3 e , and the and - gates and2 through and4 output low level data , and the exclusive or - gate exor outputs a high level data . therefore , the or - gate or1 outputs a low level control signal s1 as shown in fig3 f , and the or - gate or2 outputs a high level control signal s2 . when the low level data b0 and b1 of the bit 0 and bit 2 are inputted at a time t3 , and a high level data b1 of the bit 1 is inputted , the and - gate and1 outputs a low level control signal s0 , and the and - gates and2 and and4 and the exclusive or - gate exor output low level data , and the and - gate and3 outputs a high level data . therefore , the or - gate or1 outputs a high level control signal s1 , and the or - gate or2 outputs a low level control signal s2 . when the high level data b0 of the bit 0 is inputted , and the low level data b1 and b2 of the bit 1 and bit 2 are inputted , respectively , at a time t4 , the and - gate and1 outputs a low level control signal s0 , and the and - gates and2 and and4 output low level data , and the and - gate and3 and the exclusive or - gate exor output high level data . therefore , the or - gates or1 and or2 output a high level control signals s2 , respectively . when the data b0 and b2 of the bit 0 and bit 2 are inputted , and the low level b1 of the bit 1 is inputted , respectively , at a time t5 , the and - gate and1 outputs a high level control signal s0 , and the and - gates and2 through and4 and the exclusive or - gate exor output low level data , so that the or - gates or1 and or2 output low level control signals s1 and s2 . when the high level data b0 through b3 of the bits 0 through 3 are inputted at a time t6 , the and - gate and1 outputs a high level control signal s0 , and the and - gates and2 and and3 and the exclusive or - gate exor output low level data , and the and - gate and4 outputs a high level data , so that the or - gate or1 outputs a low level control signal s1 , and the or - gate or2 outputs a high level control signal s2 . so far , the operations that the control signal generator 2 generated the control signals s0 through s2 in accordance with a low 3 - bit signal , namely , the bits 0 through 2 b0 through b2 , among the 12 - bit channel number data from the cib detector 1 were explained . in the present invention , the configuration of the control signal generator 2 may be changed based on the bits among the 12 - bit channel number data without departing from the scope and spirit of the present invention . fig4 illustrates a channel alignment unit in the circuit of fig1 according to the present invention . as shown therein , channel data signals di1 through di5 are inputted into the input terminals of flip - flop units 31 through 35 . the clock terminals ck of the flip - flop units 31 through 35 receive a clock signal clk , respectively . the output terminal q of the flip - flop unit 31 is connected to the input terminal i16 of a multiplexor 36 , and the output terminal q of the flip - flop unit 32 is connected to the input terminals i15 and i26 of the multiplexors 36 and 37 , respectively . the output terminal q of the flip - flop unit 33 is connected to the input terminals i14 , i25 and i36 of the multiplexors 36 through 38 , respectively . the output terminal q of the flip - flop unit 34 is connected to the input terminals i13 , i24 , i35 and i46 of the multiplexors 36 through 39 , respectively . in addition , the output terminal q of the flip - flop unit 35 is connected to the input terminals i12 , i23 , i34 , i45 and i56 of the multiplexors 36 through 40 . in addition , channel data signals di0 through di5 are inputted into input terminals i10 through i60 of the multiplexors 36 through 41 . the channel data signals di0 through di4 are inputted into input terminals i21 through i61 of multiplexors 37 through 41 . the channel data signals di0 through di3 are inputted into the input terminals i32 through i62 of the multiplexors 38 through 41 . the channel data signals di0 through di2 are inputted into input terminals i43 through i63 of the multiplexors 39 through 41 . in addition , the channel data signals di0 and di1 are inputted into input terminals i54 through i64 of the multiplexors 40 and 41 . the channel data signal di0 is inputted into input terminal i65 of the multiplexor 41 . the multiplexors 36 through 41 outputs channel data signals do0 through do5 in accordance with control signals s0 through s2 . in the channel alignment unit 3 according to the present invention , since the channel data signals di0 through di5 are inputted into the input terminals of the lip - flip units 31 through 35 , and the clock signal clk is inputted into the clock terminals ck of the flip - flop units 31 through 35 through the buffer 42 , the flip - flop units 31 through 35 delay the output signals , namely , the channel data signals di1 through di5 by one cycle in accordance with the clock signal clk . therefore , the data signal from the flip - flop unit 31 is inputted into the input terminal i16 of the multiplexor 36 . the output signal from the flip - flop unit 32 is inputted into the input terminals i15 and i26 , respectively , of the multiplexors 36 and 37 . the output signal from the flip - flop unit 33 is inputted into the input terminals i14 , i25 and i36 , respectively , of the multiplexors 36 through 38 . the output signal from the flip - flop unit 34 is inputted into the input terminals i13 , i24 , i35 and i46 , respectively , of the multiplexors 36 through 39 . the output signal from the flip - flop unit 35 is inputted into the input terminals i12 , i23 , i34 , i45 and i56 , respectively , of the multiplexors 36 through 40 . in addition , the channel data signals di0 through di5 are inputted into the input terminals i10 through i60 through the multiplexors 36 through 41 . the channel data signals di0 through d14 are inputted into the input terminals i21 through i61 of the multiplexors 37 through 41 . the channel data signals di0 through di3 are inputted into the input terminals i32 through i61 of the multiplexors 38 through 41 . the channel data signals di0 through di2 are inputted into the input terminals i43 through i63 of the multiplexors 39 through 41 . the channel data signals di0 and di1 are inputted into the input terminals i54 through i64 of the multiplexors 40 and 41 . the channel data signal di0 is inputted into the input terminal i65 of the multiplexor 41 . in the above - described state , when low level control signals s0 through s2 are all inputted , the multiplexors 36 through 41 select the signals from the input terminals i10 through i60 , and the multiplexors 36 through 41 output the channel data signals di0 through di5 which were not delayed . in addition , when low level control signals s0 and s1 are inputted , and a high level control signal s2 is inputted , the multiplexors 36 through 41 select and output the signals from the input terminals i11 through i61 , and the multiplexors 37 through 41 select and output the channel data signals di0 through di4 which were not delayed , and the multiplexor 36 selects and outputs the channel data signal di5 which was delayed by the flip - flop unit 31 . when low level control signals s0 and s2 are inputted , and a high level control signals s1 is inputted , the multiplexors 36 through 41 select and output the signals from the input terminals i12 through i62 . in addition , the multiplexors 38 through 41 select and output the channel data signals di0 through di3 which were not delayed . in addition , the multiplexors 36 and 37 select and output the channel data signals di4 and di5 delayed by the flip - flip units 31 and 32 . when a low level control signal s0 is inputted , and high level control signals s1 and s2 are inputted , the multiplexors 36 through 41 select and output the signals from the input terminals i13 through i63 . the multiplexors 39 through 41 select and output the channel data signals di0 through di2 which were not delayed . in addition , the multiplexors 36 through 38 select and output the channel data signals di3 through di5 delayed by the flip - flop units 31 through 33 . when a high level control signal s0 is inputted , and low level control signals s1 and s2 are inputted , the multiplexors 36 through 41 select and output the signals from the input terminals i14 through i64 . in addition , the multiplexors 40 and 41 select and output the channel data signals di0 and di1 which were not delayed . in addition , the multiplexors 36 through 39 select and output the channel data signals di2 through di5 delayed by the flip - flop units 31 through 34 . when high level control signals s0 through s2 are inputted , the multiplexors 36 through 41 select and output the signals from the input terminals i15 through i65 . in addition , the multiplexor 41 selects and outputs the channel data signal di0 which was not delayed . in addition , the multiplexors 36 through 40 select and output the channel data signals di1 through di5 delayed by the flip - flop units 31 through 35 . as described above , the channel alignment circuit according to the present invention is directed to separating six channels , so that a user can variously select the channel by using several frames for the identical serial data . although the preferred embodiments of the present invention have been disclosed for illustrative purposes , those skilled in the art will appreciate that various modifications , additions and substitutions are possible , without departing from the scope and spirit of the invention as recited in the accompanying claims .	7
fig1 shows a ripper assembly , generally designated 10 , movably mounted on the rear of a crawler type tractor which is shown to have the rear plates 11 and 12 to which the assembly 10 is movably mounted for up - and - down movement , in the usual manner . the assembly 10 includes the ripper member 13 which has an upstanding shank portion 14 suitably attached to spaced - apart plates 16 which are secured to a hollow tool bar 17 forming a part of the assembly 10 . also , pivotally - mounted links 18 and 19 are included in the assembly 10 , and they are pivotally mounted on the tractor by means of pins 21 and 22 which are secured to the plate 12 , and one skilled in the art will readily understand that there are two plates 12 spaced apart at the rear of the tractor for securing the pins 21 and 22 as shown in fig1 . thus the assembly 10 also has a plate 23 which is suitably secured to the tool bar 17 , such as by welding or the like , and the rearward ends of the links 18 and 19 are pivotally attached to the plate 23 through the pivot pins 24 and 26 . as such , the pivotal mounting for the assembly 10 at the rear of the tractor 11 is in the nature of a parallelogram mounting , and thus the tool bar 17 can be moved up and down relative to the tractor 11 , and the movement is substantially in a vertical direction . a powered cylinder assembly 27 is also pivotally connected between the tractor 11 and the assembly plate 23 , and suitable power controls of a hydraulic nature are preferably connected with the assembly 27 for the usual extension and contraction of the assembly piston rod 28 to thereby induce the up - and - down movement in the ripper assembly 23 . accordingly , fig2 shows that the tool bar 17 is elongated and has the plates 16 and 23 affixed thereto at locations along the length of the tool bar 17 . as such , there would be two links 19 connecting to each pair of plates 23 , as seen in fig2 and of course there would also be two links 18 connected to the two pairs of plates 23 . fig2 further shows that there are pairs of plates 16 located at spaced - apart locations along the length of the tool bar 17 , and each pair of plates 16 receives the shank 14 of the ripper member so that a plurality of ripper members are mounted on the tool bar 17 at spaced - apart locations relative to the length or axis of the tool bar 17 . anyone skilled in the art should readily understand the arrangement of the tractor and the ripper assembly mentioned and described herein , and u . s . pat . no . 3 , 527 , 308 also shows an arrangement of a crawler type tractor and a ripper assembly at the rear thereof and having a horizontally - disposed tool bar and ripper members depending therebelow , and that prior art showing is incorporated in this description . however , it should be noted and fully understood that in the present invention the tool bar 17 is elongated and of a hollow configuration having an endless girth in the direction transverse to the longitudinal axis thereof , as shown in the sectional view in fig4 and that girth is of a general rectangular configuration . also , the ripper shanks 14 are attached to the tool bar 17 to be offset therefrom and fully exteriorly related to the hollow tool bar 17 , rather than passing through the tool bar and obstruct or impede the arrangement of the hollow interior of the tool bar 17 . as such , the ripper mounting plates 16 extend rearwardly of the tool bar 17 , as clearly shown in fig4 . therefore , it will be understood that the ripper shank 14 extends between the spaced - apart mounting plates 16 and to the upper edges 29 of the plates 16 , and the ripper shanks 14 are removable from between the plates 16 and pin openings 31 in each of the plates 16 are arranged to receive a pin which will secure the ripper shank 14 from between the plates 16 , in a desired arrangement . in the actual showings , all of the plates 16 are not identical in configuration so that the plate on each opposite end of the bar 17 is of one configuration , as shown in fig3 and the plate 16 which aligns with the plate 23 is of a somewhat different configuration , as also shown in fig3 and the plates 16 in the center of the tool bar 17 are of still a slightly different configuration , as seen in fig4 . however , for purposes of a succinct description thereof , the plates 16 are considered to be the spaced - apart pairs of plates for the mounting of the ripper shanks 14 , with each pair 16 receiving one shank 14 , and thus the plates are all designated 16 . also , in all instances of the plates 16 , they have forwardly extending portions which are shown to be welded to the tool bar 17 , and the plates 16 have rearwardly extending portions 32 which are offset from the tool bar 17 and which are the portions which actually engage the ripper shanks 14 in that offset arrangement . fig2 shows that there are two plates at the opposite ends of the tool bar 17 and these plates have the portions 32 and extend transverse to the longitudinal axis of the tool bar and completely around and beyond the girth thereof , as seen in fig3 . with the arrangement of the hollow tool bar 17 and the off - set plates 16 for mounting the tool or ripper member 13 , the tool bar 17 is available for receiving counterweights 33 which are of an elongated configuration and which have a transverse cross - section corresponding to the rectangular transverse cross - section of the tool bar 17 , as shown in fig1 and in fig5 and 6 . thus , the counterweight 33 fits snugly into the tool bar 17 for at least the length of the counterweight 33 , and that length would of course be something less than the total length of the tool bar 17 . therefore , there may be several counterweights 33 which can be readily slid into the tool bar 17 , depending upon the desired counterweight effect required and depending upon the particular weight of each counterweight 33 so that the operator can easily lift a counterweight and not find it too large or heavy . fig6 shows that the counterweight can take the configuration shown in that counterweight 34 where there is actually a laminated type of counterweight having weldments 36 , or there may be other means for attaching pieces of counterweight together to form one unitary counterweight 34 in a desired weight and overall size . in all instances , the counterweights 33 and 34 are of a desired and convenient length and they are of a cross - sectional shape to fit snugly within the girth of the tool bar 17 , and the operator can easily slide them into and out of the hollow tool bar 17 , especially when the tool bar 17 is in the lowered position to where it is closest to the ground . finally , the assembly 10 is arranged with a removable cover plate 37 on each end of the tool bar 17 to close off the ends of the tool bar 17 and thus conceal the counterweights and secure them within the tool bar 17 . while only one end and one cover plate 37 is shown , such as in fig1 it will be understood that there is a cover plate 37 on each end of the tool bar 17 , and each cover plate 37 is adjacent the respective end plate 16 which overlaps the cover plate . also , the cover plate 17 can be secured by holes 38 in openings 31 and 39 in end plates 16 so that the cover plates are removably affixed in the assembly 10 . further , each cover plate 37 has an access or inspection opening 39 extending therein , and the perator can therefore see whether or not there is any counterweight within the tool bar 17 , and he can also use a probe rod to either determine the presence of the counterweight within the tool bar or to slide the counterweight along the tool bar 17 either for positioning the counterweight or for removing it from the tool bar 17 and that can be accomplished without removing the utilized cover plates 37 at that time . with the arrangement of the assembly 10 as described in the foregoing , the counterweights of various length and mass can be readily and easily inserted into and removed from the hollow tool bar 17 and they are disposed at the optimum position rearwardly on the tractor assembly for maximum counterbalancing effect , all as desired . further , since the assembly 10 is at the rearmost position of the tractor and attachment arrangement , and since the assembly 10 moves up and down , the complete enclosing of the counterweights 33 and / or 34 within the tool bar 17 assures the effectiveness of the counterbalancing and the security of retaining the weights in the unit and not having them fall out or be repositioned inadvertently . also , when the assembly 10 is in the raised position , the tractor may be used for moving in a reverse direction which is actually toward the assembly 10 , and in that event if the assembly 10 engages an obstacle , the links and particularly the cylinder assembly 27 are retained in the position shown in fig1 and that is the raised position , by virtue of an abutment piece 41 affixed to the rear of the tractor 11 and extending with an abutment surface 42 which engages a matching abutment surface 43 on the link 18 . that is , raising the assembly 10 against the effect of the counterweights within the tool bar is guided to the position shown in fig1 where the abutting surfaces are engaged , and then if the assembly 10 is forced upon by an obstacle , the cylinder 27 is protected from damage by virtue of the abutments and limit stops described . that is , the cylinder 27 will still be under necessary pressure to support the counterweights and the entire assembly 10 , but the cylinder will not be damaged if the assembly 10 inadvertently hits an obstruction since fig1 shows the cylinder assembly 27 in a retracted position and the abutment surfaces 42 and 43 are engaged and thus prevent further cylinder retraction .	4
fig1 depicts an aerial view an aerial fire truck 19 that has just arrived at the scene of the fire . it is up to the driver to position the aerial fire truck so that the truck &# 39 ; s outriggers can be fully extended in order to safely operate the aerial device . left front outrigger 20 c and left rear outrigger 20 d are shown in the extended position . outriggers provide stabilization for the fire truck when the aerial apparatus is in operation , and particularly , when the aerial swings to a side of the fire truck chassis . mounted next to each outrigger are ultrasonic sensors shown as 22 c and 22 d on the left side of the fire truck . there are potential obstructions 24 a and 24 b located near the rear of the aerial fire truck 19 in potential conflict with the outrigger 20 c and 20 d from being extended . in the preferred embodiment , ultrasonic sensors are used . other sensor technologies , such as lasers , tactile sensors , and infrared sensors were also considered , but found to have limitations or unneeded complexity to accomplish the same task as the ultrasonic sensors . fig2 depicts the fire truck from the top . fire truck 19 is shown arriving at the scene of the fire / emergency . outriggers 20 a through 20 c are shown extended to provide support for the fire truck when the aerial is in operation . however , outrigger 20 d cannot be extended due to obstruction 24 b which prevents outrigger 20 d from fully extending . therefore , the fire truck needs to be repositions so that outrigger 20 d can be fully extended and not be obstructed by obstructions 20 a or 20 b . sensors 22 a through 22 d are shown carried by the fire truck and positions in close proximity to outriggers 22 a through 22 d . fig3 shows the top of the fire truck ( aerial apparatus not shown ) with the outriggers in a retracted position . sensor 22 a is able to determine whether there is an obstruction within outrigger zone 28 a . outrigger zone 28 a is an area defined by the space occupied by outrigger 20 a when outrigger 20 a is fully extended . as shown , there are no obstructions within outrigger zone 28 a preventing outrigger 22 a from being fully extended . therefore , sensor 22 a detects no obstructions in outrigger zone 28 a . similarly , sensors 22 b and 22 c are able to detect whether obstructions exist within outrigger zones 28 b and 28 c respectively . as shown , there are no obstructions within outrigger zones 28 b or 28 c . however , obstruction 24 b is contained within outrigger zone 28 d so that sensor 22 d detects that there is an obstruction within outrigger zone 28 d preventing outrigger 22 d from being full extended . it should be known that the sensor beams 18 a through 18 d need not cover the same area as outrigger zones 28 a through 28 d , respectively . rather , the outrigger zone need only be contained within the sensor beam and operatively configured to detect an obstruction within the outrigger zone . for example , ultrasonic sensors output is dependent on the comparison at the time taken for an echo to return . the distance to an object is proportional to the distance to the object . further , an ultrasonic proximity sensor has output whose intensity can be dependent on the distance of an object from the sensor . therefore , an ultrasonic sensor , including a transducer or proximity sensor , can determine whether an object is within a certain distance and therefore within the outrigger zone . referring to fig3 , sensors 22 c through 22 d may have sensing zones shown as 18 a through 18 d , respectively . however , the sensors can be configured to determine if an obstruction is within the outrigger zone , a zone smaller than the area of the sensing zone . fig4 is a schematic of the invention . sensors 22 a through 22 d are shown associated with outrigger zones 28 a through 28 d respectively . the sensors are connected to a power supply 20 and can have a switch 22 . warning panel 24 can have warning indicators 26 a through 26 d which can be connected to the sensors . warning indicators 26 a through 26 d are in communications with sensors 22 s through 22 d respectively so that when an obstruction is detected within the outrigger zone , the associated sensor signal is used to actuate the corresponding warning indicator on the warning panel . further , the warning panel can have a representation of a view of the fire truck approximating the location of the outriggers in relation to the fire truck chassis . the warning indicators can be located on the warning panel so that when actuated , the fire truck driver is provided with an indication of which outrigger zone contains the obstruction and therefore can reposition the fire truck accordingly . after the driver has been warned of the obstruction 24 d by actuated warning indicator 26 d , corrective action can be employed such as pull the aerial fire truck 19 forward until obstruction 24 b is not longer detected within outrigger zone 28 d . clearance of obstruction 24 d is completed when sensor 22 d no longer detects obstruction 24 b . warning indicator 26 d on warning panel 24 is no longer illuminated , providing a “ clear ” state to the driver . switch 22 can be operatively associated with the parking brake of the fire truck so that switch 22 is closed when the parking brake is applied . switch 22 can be operatively associated with the power system of the aerial apparatus so that when power is applied to the aerial apparatus , switch 22 is closed . a relay 30 can be included so that the sensor signals can be transmitted to relay 30 to actuate the corresponding warning indicator when the sensor detects an obstruction in the respective outrigger zone . computer readable instructions embodied in a computer readable medium as well as electrical circuitry can be operatively associated with the sensors so that when the sensor detects an object within its sensing zone , the computer readable instructions determine whether the object is within the outrigger zone and the corresponding warning indicator can be actuated indicating that an obstruction exists within the outrigger zone . fig5 shows a top view of the fire truck when the fire truck has been positions so that there are no obstructions in the outrigger zones 28 a through 28 d . when the warning panel indicates that there is an obstruction within an outrigger zone , the driver of the fire truck can reposition the fire truck until the previously actuated warning indicator no longer is actuated thereby representing that no obstructions re present in the outrigger zones 28 a through 28 d . ultrasonic sensors emit sound pulses through a diaphragm on the front of the sensor . the sound pulses emanate from the sensor in a predetermined pattern known as the sensor beam . when an object passes through the sensor beam , the sound pulses are reflected back to the sensor diaphragm . the sensor &# 39 ; s electronics monitor the pulse reflection to determine an object is obstructing the beam . when an obstruction is detected , the sensor sends a signal output to representing that the sensor has detected an object within the sensor beam . a relay can be used between sensors 22 a , 22 b , 22 c and 22 d and the warning indicators 28 a , 28 b , 28 c and 28 d . the relay is used to convert the low current sensor output to a high current signal output which can be used to actuate the warning indicators . fig6 illustrates a perspective view of an aerial fire truck showing the outriggers in the retracted position . in one embodiment , sensor 22 c is carried by the fire truck in close proximity to an outrigger plate 32 c . outrigger plate 32 c covers the outrigger assembly and is generally flush with the side of the fire truck when the outrigger is in the retracted position . in another embodiment , sensor 22 c is mounted on the outrigger place 32 c . therefore , the sensors can also be mounted in close proximity to the outrigger plate or on the outrigger plate itself . the actual location of outriggers may vary depending on the type and construction of the outrigger assembly employed on the aerial fire truck . further , in one embodiment , there may be only two outrigger assemblies on the aerial fire truck . referring to fig7 a , sensor 22 a can be mounted on a pivotal mount . by mounting the sensors on a pivoting mount , the sensors can be positioned so that the sensors sensing areas overlaps that of the outrigger zone . the sensors can be positioned so that the sensor beam path intersects the outermost point of the space occupied by the outrigger when fully extended . in one embodiment , base bracket 44 can be secured to the faire truck . rotating member 42 can be connected to base bracket 40 a and 40 b ( fig7 b ) so that the rotating member can be secured in place or allowed to rotate based upon tightening or loosening of screws 40 a and 40 b . swivel 46 allows the sensor to swivel and in combination with the movement allowed by the rotating member , the sensor can be positioned in two different planes . in one embodiment , base socket 50 is secured to the fire truck . ball joint 48 is received in the base socket and allows the sensor to be positioned in two different planes . swivel 46 can also be used to mount sensor 22 a to ball joint 48 to allow even further range of positions of the sensor . in one embodiment , the mount consists of a vehicle mounting bracket , sensor mount bracket and two locking nuts . the “ l ” shaped vehicle mounting bracket has curved slots on each face , with a hole on the face that mates to the surface of the fire truck 19 . the “ l ” shaped sensor mounting bracket has a round hole to accept the sensor on one face , with two through holes on the other face to mate to the vehicle mounting bracket . two locking nuts are positioned on the sensor 22 a , 22 b , 22 c and 22 d and on each side of the face with the through hole on the sensor mounting bracket . this configuration allows the sensor 22 a , 22 b , 22 c and 22 d to be positioned in 2 different planes , thereby achieving the ability to point the sensor 22 a , 22 b , 22 c and 22 d along the desired path . in one embodiment , this mount is affixed to the body via hardware , in close proximity to the outrigger assembly , and approximately 2 feet off the ground . the computer readable instructions can receive a signal from the sensors and then actuate the warning indicator . further , a parking brake can send a signal to the computer readable instructions so that the computer readable instructions will only actuate the warning indicator according to the sensor signal if the fire truck parking brake is engaged . the power system of the aerial truck can also be in communication with the computer readable instructions so that the warning indicator will only be actuated when power to the aerial apparatus is applied . further , the outrigger actuator can be in communications with the computer readable instructions so that the outrigger will not be extended if the sensor detects an obstruction in the outrigger zone . in one embodiment , sensors 22 a , 22 b , 22 c and 22 d can be calibrated to send a signal when an object is detected at a known point in space . in other words , the sensing distance can be set by calibrating the sensor . in operation , the fire truck operator maneuvers the aerial fire truck 19 into a setup position . power is applied to the sensors . in one embodiment , sensors , 22 a , 22 b , 22 c and 22 d start emitting sound pulses at each outrigger location . if an object is detected in any of the outrigger zones , the corresponding sensor will send a signal to a relay . the relay will switch to a normally closed position and send an output to the warning indicator 28 a , 28 b , 28 c or 28 d , informing the operator of an unsafe setup position . the vehicle can then be repositioned until no obstructions are detected . in one embodiment , programmable input / output module is used in place of the relay . the programmable i / o module provides power to the ultrasonic sensors 22 a , 22 b , 22 c and 22 d , controls inputs from the sensors , and provides outputs to the warning indicators 28 a , 28 b , 28 c and 28 d . the input / output module has built in circuit protection for each output . user defined parameters are programmed to control the switching logic . in operating , if an object is detected in any of the outrigger zones , the corresponding sensor will send a signal to the programmable input / output module . the programmable input / output module is programmed to send an output to the appropriate warning indicator 28 a , 28 b , 28 c and 28 d informing the operator of an unsafe setup position . while a preferred embodiment of the invention has been described using specific terms , such description is for illustrative purposes only , and it is to be understood that changes and variations may be made without departing from the spirit or scope of the following claims .	1
deuterium ( d or 2 h ) is a stable , non - radioactive isotope of hydrogen and has an atomic weight of 2 . 0144 . hydrogen naturally occurs as a mixture of the isotopes 1 h ( hydrogen or protium ), d ( 2 h or deuterium ), and t ( 3 h or tritium ). the natural abundance of deuterium is 0 . 015 %. one of ordinary skill in the art recognizes that in all chemical compounds with a h atom , the h atom actually represents a mixture of h and d , with about 0 . 015 % being d . thus , compounds with a level of deuterium that has been enriched to be greater than its natural abundance of 0 . 015 %, should be considered unnatural and , as a result , novel over their non - enriched counterparts . all percentages given for the amount of deuterium present are mole percentages . it can be quite difficult in the laboratory to achieve 100 % deuteration at any one site of a lab scale amount of compound ( e . g ., milligram or greater ). when 100 % deuteration is recited or a deuterium atom is specifically shown in a structure , it is assumed that a small percentage of hydrogen may still be present . deuterium - enriched can be achieved by either exchanging protons with deuterium or by synthesizing the molecule with enriched starting materials . the present invention provides deuterium - enriched tirapazamine or a pharmaceutically acceptable salt thereof . there are six hydrogen atoms in the tirapazamine portion of tirapazamine as show by variables r 1 - r 6 in formula i below . the hydrogens present on tirapazamine have different capacities for exchange with deuterium . hydrogen atoms r 1 - r 2 are easily exchangeable under physiological conditions and , if replaced by deuterium atoms , it is expected that they will readily exchange for protons after administration to a patient . the remaining hydrogen atoms are not easily exchangeable for deuterium atoms . however , deuterium atoms at the remaining positions may be incorporated by the use of deuterated starting materials or intermediates during the construction of tirapazamine . the present invention is based on increasing the amount of deuterium present in tirapazamine above its natural abundance . this increasing is called enrichment or deuterium - enrichment . if not specifically noted , the percentage of enrichment refers to the percentage of deuterium present in the compound , mixture of compounds , or composition . examples of the amount of enrichment include from about 0 . 5 , 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 12 , 16 , 21 , 25 , 29 , 33 , 37 , 42 , 46 , 50 , 54 , 58 , 63 , 67 , 71 , 75 , 79 , 84 , 88 , 92 , 96 , to about 100 mol %. since there are 6 hydrogens in tirapazamine , replacement of a single hydrogen atom with deuterium would result in a molecule with about 17 % deuterium enrichment . in order to achieve enrichment less than about 17 %, but above the natural abundance , only partial deuteration of one site is required . thus , less than about 17 % enrichment would still refer to deuterium - enriched tirapazamine . with the natural abundance of deuterium being 0 . 015 %, one would expect that for approximately every 6 , 667 molecules of tirapazamine ( 1 / 0 . 00015 = 6 , 667 ), there is one naturally occurring molecule with one deuterium present . since tirapazamine has 6 positions , one would roughly expect that for approximately every 40 , 002 molecules of tirapazamine ( 6 × 6 , 667 ), all 6 different , naturally occurring , mono - deuterated tirapazamines would be present . this approximation is a rough estimate as it doesn &# 39 ; t take into account the different exchange rates of the hydrogen atoms on tirapazamine . for naturally occurring molecules with more than one deuterium , the numbers become vastly larger . in view of this natural abundance , the present invention , in an embodiment , relates to an amount of an deuterium enriched compound , whereby the enrichment recited will be more than naturally occurring deuterated molecules . in view of the natural abundance of deuterium - enriched tirapazamine , the present invention also relates to isolated or purified deuterium - enriched tirapazamine . the isolated or purified deuterium - enriched tirapazamine is a group of molecules whose deuterium levels are above the naturally occurring levels ( e . g ., 17 %). the isolated or purified deuterium - enriched tirapazamine can be obtained by techniques known to those of skill in the art ( e . g ., see the syntheses described below ). the present invention also relates to compositions comprising deuterium - enriched tirapazamine . the compositions require the presence of deuterium - enriched tirapazamine which is greater than its natural abundance . for example , the compositions of the present invention can comprise ( a ) a μg of a deuterium - enriched tirapazamine ; ( b ) a mg of a deuterium - enriched tirapazamine ; and , ( c ) a gram of a deuterium - enriched tirapazamine . in an embodiment , the present invention provides an amount of a novel deuterium - enriched tirapazamine . examples of amounts include , but are not limited to ( a ) at least 0 . 01 , 0 . 02 , 0 . 03 , 0 . 04 , 0 . 05 , 0 . 1 , 0 . 2 , 0 . 3 , 0 . 4 , 0 . 5 , to 1 mole , ( b ) at least 0 . 1 moles , and ( c ) at least 1 mole of the compound . the present amounts also cover lab - scale ( e . g ., gram scale ), kilo - lab scale ( e . g ., kilogram scale ), and industrial or commercial scale ( e . g ., multi - kilogram or above scale ) quantities as these will be more useful in the actual manufacture of a pharmaceutical . industrial / commercial scale refers to the amount of product that would be produced in a batch that was designed for clinical testing , formulation , sale / distribution to the public , etc . in another embodiment , the present invention provides a novel , deuterium enriched compound of formula i or a pharmaceutically acceptable salt thereof . wherein r 1 - r 6 are independently selected from h and d ; and the abundance of deuterium in r 1 - r 6 is at least 17 %. the abundance can also be ( a ) at least 33 %, ( b ) at least 50 %, ( c ) at least 67 %, ( d ) at least 83 %, and ( e ) 100 %. in another embodiment , the present invention provides a novel , deuterium enriched compound of formula i or a pharmaceutically acceptable salt thereof , wherein the abundance of deuterium in r 1 - r 2 is at least 50 %. the abundance can also be at least 100 %. in another embodiment , the present invention provides a novel , deuterium enriched compound of formula i or a pharmaceutically acceptable salt thereof , wherein the abundance of deuterium in r 3 - r 6 is at least 25 %. the abundance can also be ( a ) at least 50 %, ( b ) at least 75 %, and ( c ) 100 %. in another embodiment , the present invention provides an isolated novel , deuterium enriched compound of formula i or a pharmaceutically acceptable salt thereof . wherein r 1 - r 6 are independently selected from h and d ; and the abundance of deuterium in r 1 - r 6 is at least 17 %. the abundance can also be ( a ) at least 33 %, ( b ) at least 50 %, ( c ) at least 67 %, ( d ) at least 83 %, and ( e ) 100 %. in another embodiment , the present invention provides an isolated novel , deuterium enriched compound of formula i or a pharmaceutically acceptable salt thereof , wherein the abundance of deuterium in r 1 - r 2 is at least 50 %. the abundance can also be at least 100 %. in another embodiment , the present invention provides an isolated novel , deuterium enriched compound of formula i or a pharmaceutically acceptable salt thereof , wherein the abundance of deuterium in r 3 - r 6 is at least 25 %. the abundance can also be ( a ) at least 50 %, ( b ) at least 75 %, and ( c ) 100 %. in another embodiment , the present invention provides novel mixture of deuterium enriched compounds of formula i or a pharmaceutically acceptable salt thereof . wherein r 1 - r 6 are independently selected from h and d ; and the abundance of deuterium in r 1 - r 6 is at least 17 %. the abundance can also be ( a ) at least 33 %, ( b ) at least 50 %, ( c ) at least 67 %, ( d ) at least 83 %, and ( e ) 100 %. in another embodiment , the present invention provides a novel mixture of , deuterium enriched compound of formula i or a pharmaceutically acceptable salt thereof , wherein the abundance of deuterium in r 1 - r 2 is at least 50 %. the abundance can also be at least 100 %. in another embodiment , the present invention provides a novel mixture of , deuterium enriched compound of formula i or a pharmaceutically acceptable salt thereof , wherein the abundance of deuterium in r 3 - r 6 is at least 25 %. the abundance can also be ( a ) at least 50 %, ( b ) at least 75 %, and ( c ) 100 %. in another embodiment , the present invention provides novel pharmaceutical compositions , comprising : a pharmaceutically acceptable carrier and a therapeutically effective amount of a deuterium - enriched compound of the present invention . in another embodiment , the present invention provides a novel method for treating cancer comprising : administering to a patient in need thereof a therapeutically effective amount of a deuterium - enriched compound of the present invention . in another embodiment , the present invention provides an amount of a deuterium - enriched compound of the present invention as described above for use in therapy . in another embodiment , the present invention provides the use of an amount of a deuterium - enriched compound of the present invention for the manufacture of a medicament ( e . g ., for the treatment of cancer ). the present invention may be embodied in other specific forms without departing from the spirit or essential attributes thereof . this invention encompasses all combinations of preferred aspects of the invention noted herein . it is understood that any and all embodiments of the present invention may be taken in conjunction with any other embodiment or embodiments to describe additional more preferred embodiments . it is also to be understood that each individual element of the preferred embodiments is intended to be taken individually as its own independent preferred embodiment . furthermore , any element of an embodiment is meant to be combined with any and all other elements from any embodiment to describe an additional embodiment . the examples provided in the definitions present in this application are non - inclusive unless otherwise stated . they include but are not limited to the recited examples . the compounds of the present invention may have asymmetric centers . compounds of the present invention containing an asymmetrically substituted atom may be isolated in optically active or racemic forms . it is well known in the art how to prepare optically active forms , such as by resolution of racemic forms or by synthesis from optically active starting materials . all processes used to prepare compounds of the present invention and intermediates made therein are considered to be part of the present invention . all tautomers of shown or described compounds are also considered to be part of the present invention . “ host ” preferably refers to a human . it also includes other mammals including the equine , porcine , bovine , feline , and canine families . “ treating ” or “ treatment ” covers the treatment of a disease - state in a mammal , and includes : ( a ) preventing the disease - state from occurring in a mammal , in particular , when such mammal is predisposed to the disease - state but has not yet been diagnosed as having it ; ( b ) inhibiting the disease - state , e . g ., arresting it development ; and / or ( c ) relieving the disease - state , e . g ., causing regression of the disease state until a desired endpoint is reached . treating also includes the amelioration of a symptom of a disease ( e . g ., lessen the pain or discomfort ), wherein such amelioration may or may not be directly affecting the disease ( e . g ., cause , transmission , expression , etc .). “ therapeutically effective amount ” includes an amount of a compound of the present invention that is effective when administered alone or in combination to treat the desired condition or disorder . “ therapeutically effective amount ” includes an amount of the combination of compounds claimed that is effective to treat the desired condition or disorder . the combination of compounds is preferably a synergistic combination . synergy , as described , for example , by chou and talalay , adv . enzyme regul . 1984 , 22 : 27 - 55 , occurs when the effect of the compounds when administered in combination is greater than the additive effect of the compounds when administered alone as a single agent . in general , a synergistic effect is most clearly demonstrated at sub - optimal concentrations of the compounds . synergy can be in terms of lower cytotoxicity , increased antiviral effect , or some other beneficial effect of the combination compared with the individual components . “ pharmaceutically acceptable salts ” refer to derivatives of the disclosed compounds wherein the parent compound is modified by making acid or base salts thereof . examples of pharmaceutically acceptable salts include , but are not limited to , mineral or organic acid salts of the basic residues . the pharmaceutically acceptable salts include the conventional quaternary ammonium salts of the parent compound formed , for example , from non - toxic inorganic or organic acids . for example , such conventional non - toxic salts include , but are not limited to , those derived from inorganic and organic acids selected from 1 , 2 - ethanedisulfonic , 2 - acetoxybenzoic , 2 - hydroxyethanesulfonic , acetic , ascorbic , benzenesulfonic , benzoic , bicarbonic , carbonic , citric , edetic , ethane disulfonic , ethane sulfonic , fumaric , glucoheptonic , gluconic , glutamic , glycolic , glycollyarsanilic , hexylresorcinic , hydrabamic , hydrobromic , hydrochloric , hydroiodide , hydroxymaleic , hydroxynaphthoic , isethionic , lactic , lactobionic , lauryl sulfonic , maleic , malic , mandelic , methanesulfonic , napsylic , nitric , oxalic , pamoic , pantothenic , phenylacetic , phosphoric , polygalacturonic , propionic , salicyclic , stearic , subacetic , succinic , sulfamic , sulfanilic , sulfuric , tannic , tartaric , and toluenesulfonic . table 1 provides compounds that are representative examples of the present invention . when one of r 1 - r 6 is present , it is selected from h or d . table 2 provides compounds that are representative examples of the present invention . where h is shown , it represents naturally abundant hydrogen . numerous modifications and variations of the present invention are possible in light of the above teachings . it is therefore to be understood that within the scope of the appended claims , the invention may be practiced otherwise that as specifically described herein .	2
in fig1 a server data processing apparatus 10 is connected to other server data processing apparatuses 12 and 13 via a network 11 , which could be , for example , the internet . the servers 10 , 12 and 13 interact which each other , in the preferred embodiment , to carry out the processing of transactions ( e . g ., updates to bank accounts ). server 10 has a processor 101 for controlling the operation of the server 10 , a ram volatile memory element 102 for temporarily storing data concerning the transactions that are being carried out , a non - volatile memory 103 for also storing such data so that the transactions can be recovered in case of a server failure , and a network connector 104 for use in interfacing the server 10 with the network 11 so that the server 10 can communicate with the other servers 12 and 13 in the processing of transactions . it should be noted that a network of servers is shown in the preferred embodiment but in other embodiments the server 10 could be operating alone in processing transactions without interacting with other servers . the structure of the transactions log file , stored in the non - volatile storage 103 , is shown in fig2 . the log file 20 is broken up into extent files 21 , 22 , 23 , which are of equal size in the preferred embodiment but which can be of different sizes in other embodiments . taking extent file 21 as an example , log records 21 a , 21 b and 21 c are stored in the extent file 21 as the server 10 processes transactions . should the server 10 experience a failure ( e . g ., a power loss ), upon recovering , the server 10 uses this log file 20 to recreate the transaction processing environment that existed prior to the failure , as was discussed above . the processor 101 , in the preferred embodiment , allocates extent files 21 , 22 to be used in storing log records in the log file 20 . the processor 101 first allocates a first extent file 21 and as the server 10 participates in the processing of transactions , log records 21 a , 21 b , 21 c etc . are stored in the first extent file 21 ( see step 31 of the flowchart of fig3 ). at step 32 , the processor 101 determines whether the presently allocated extent file 21 has been completely written with log records ( that is , is there further room for more log records to be written into the current extent file ). if the current extent file still has more room for further log records to be written , control flows back to step 31 where further log records are stored in extent file 21 . however , if it is determined that the current extent file 21 can not store any further log records , control flows to step 33 where the processor 101 allocates a new extent file 22 to be used in storing log records . then , control flows to step 34 where the processor 101 begins a key - point operation on the log file 20 , and after the key - point operation finishes , control flows back to step 31 where further log records are stored in the extent file 22 . a brief description of the key - pointing operation , in conjunction with the preferred embodiment of the present invention , will now be described with reference to fig4 . fig4 shows the extent file 22 of fig2 during the key - pointing operation which takes place at step 34 of fig3 . importantly , the key - pointing operation is taking place in a newly allocated extent file that is free to have log records written thereto . this should be contrasted with the prior art in which key - pointing took place within an extent file which is also used to hold log records that the key - pointing operation will act upon . in the preferred embodiment of the present invention , at the beginning of the key - pointing operation , a key - point start record 22 a is written as the first log record in the new extent file 22 . then , all of the active log records from extent file 21 are stored in the subsequent log records 22 b , 22 c up to 22 n − 1 . then , a key - point end record 22 n is written . then , control flows back to step 31 where the subsequent log records 22 n + 1 , 22 n + 2 , 22 n + 3 , etc ., are used to store additional data for transactions . once the key - pointing operation has been carried out , the extent file 21 can now be deleted since any active data in this extent file has been rewritten by the key - pointing operation into the new extent file 22 . this presents a considerable savings in log file space , since the entire extent file 21 can now be deleted and thus freed up for further use . also , a considerable savings in processor activity is realized by the present invention because the key - pointing operation occurs quite infrequently if the size of the extent file is large ( thus allowing the processor to spend its processing time on other things besides repetitive maintenance tasks such as key - pointing ). when an extent file becomes redundant as the result of a key - point operation , instead of deleting the extent file , the extent file could be converted into the cushion file in the event that the cushion file has already been used by the log . the key - point operation will now guarantee the removal of at least one extent file . thus , unless the size of da approaches the size of an extent file ( a condition that can be avoided by tuning the size of the extent files prior to server deployment ) it is now possible to continuously run the logger with enough space for only one extent file and one cushion file . clearly , if the size of da did approach the size of an extent file , the key - point operation may require more space than is available in the cushion file , thus causing the log to run out of space . it is assumed , in the preferred embodiment , that the size of the active data ( da ) associated with running transactions is considerably smaller than the size of an extent file . thus , once the key - pointing operation is carried out at step 34 in the new extent file 22 that was allocated at step 33 , there will still be room left for storing more log records when the control flows back to step 31 . however , if this assumption is not true and the key - pointing operation results in the entire new extent file 22 being used up by the rewriting of the active data da , then another extent file would be allocated by the processor 101 prior to control flowing back to step 31 . according to the preferred embodiment of the present invention as described above , the key - pointing operation at step 34 is triggered when a new extent file is allocated . however , in another embodiment , the key - pointing operation could be triggered when a first log record is written into the newly allocated extent file 22 . as a practical matter , however , the key - pointing operation is triggered as soon as possible after one of these two events occurs as the design of the code permits . thus , broadly stated , the key - pointing occurs when no further log records can be written into a current extent file .	6
in the polyamines of the invention , as described in the above structural formula , r 1 - r 6 may be alkyl , e . g ., methyl , ethyl , n - propyl , isopropyl , n - butyl , isobutyl , sec - butyl , tert - butyl ; aryl , e . g ., phenyl , p - tolyl , 2 , 4 , 6 - trimethylphenyl ; aryl alkyl , e . g ., benzyl , α - phenethyl , β - phenethyl ; cycloalkyl , e . g ., cyclohexyl , cyclobutyl , cyclopentyl , cycloheptyl ; any of the foregoing wherein the alkyl chain is interrupted by etheric oxygen , e . g ., — ch 3 o ( ch 2 ) 2 —, ch 3 o ( ch 2 ) 2 o ( ch 2 ) 2 —, ch 3 o ( ch 2 ) 2 o ( ch 2 ) 2 o ( ch 2 ) 2 —; or hydrogen . except where r 1 - r 6 are hydrogen or etheric substituents , each are hydrocarbyl and may have from about 1 to about 12 carbon atoms , it being understood that the size of the substituents will be tailored in each case to ensure that the polyamine is capable of uptake by the target cell and , upon uptake , will competitively bind with the intracellular counter - anions as described above . the bridging groups a , b and c may be the same or different and may be alkylene having 1 - 8 carbon atoms , e . g ., methylene , trimethylene , tetramethylene , pentamethylene ; branched alkylene , e . g ., — ch ( ch 3 ) ch 2 ch 2 —, — ch 2 ch ( ch 3 ) ch 2 —, — ch ( ch 3 ) ch 2 ch 2 —, — ch 2 ch ( ch 3 ) ch 2 ch 2 —; arylalkylene , e . g ., — ch ( ph ) ch 2 ch 2 —, — ch 2 ch ( ph ) ch 2 —, — ch ( ph ) ch 2 ch 2 ch 2 —, — ch 2 ch ( ph ) ch 2 — ch 2 —; cycloalkylene , e . g ., cyclohexylene , cis - and trans - 1 , 3 - cyclohexylene , 1 , 4 - cyclohexylene , 1 , 3 - cyclopentylene ; heterocyclic groups which incorporate within the ring one of the nitrogen atoms of the polyamine [ e . g ., it being understood that the heterocyclic nitrogen group may be located at the terminal end ( s ) or within the interior of the polyamine . those skilled in the art will appreciate that it is only necessary that the bridging groups be selected so as to ensure uptake by the cell and competitive binding to the intracellular counter - anion as described above . particularly preferred polyamines are those set forth in tables 1 and 2 and in the examples , as well as those having the formula : wherein r 1 - r 6 have the meanings ascribed above and a and b may be the same or different and are integers from 2 to 8 . at physiological ph &# 39 ; s , the naturally occurring polyamines and the analogs of the present invention are largely in a protonated state [ bioorg . chem ., supra ]. at a cellular level , these polycations can bind to a collection of single unconnected anions or to anions tethered to a single biomolecule , e . g ., the phosphates on a nucleic acid . if there is any significance to the role of charge interaction in the biological properties of the polyamine analogs , alterations in the polyamine methylene backbone should have significant impact on the compound &# 39 ; s biological properties . in fact , the significance of charge and the length of the methylene bridges separating the cations in the biological properties of the polyamine analogs has been demonstrated . for example , although n 1 , n 12 - diethylspermine ( despm ) is quite active against a variety of tumors in cell culture , when the terminal ethyl groups are replaced by β , β , β - trifluoroethyl groups , the anti - neoplastic activity essentially disappears . the trifluoroethyl group substantially reduces the pk a of the terminal nitrogens and they are no longer protonated [ j . org . chem ., vol . 24 , “ fluorine containing nitrogen compounds — i trifluoroethylamines ,” bissel et al , pages 1256 - 1259 ( 1959 )]. even though the dimensions of bis - β , β , β - trifluoroethylspermine and diethylspermine are essentially the same , what was once a tetracationic spermine analog is now only a dication . on comparing the abilities of several polyamines and polyamine analogs to displace ethidium iodide from calf thymus dna , bis - β , β , β - trifluoroethylspermine ( btfespm ) was found to behave more like putrescine than spermine . the same phenomenon is observed when one acetylates a terminal nitrogen of spermine . the amide nitrogen is not protonated at physiological ph , and the compound has no anti - neoplastic properties and behaves very much like spermidine in displacing ethidium iodide from dna . perhaps the most impressive finding regarding the separation of charge is associated with s - acetyltransferase ( sat ), an enzyme responsible for the n - terminal acetylation of spermine and spermidine . it has been determined that very slight changes in the methylene backbone of the polyamine analogs have pronounced effects on up - regulating the production of this protein , diethylnorspermine ( denspm )& gt ; diethylspermine ( despm )& gt ; diethyl - homospermine ( dehspm ) [ proc . am . assoc . cancer res ., vol . 49 , “ differential induction of spermidine / spermine n 1 - acetyltransferase in human lung cancer cells by the bis ( ethyl ) polyamine analogues ,” casero et al , pages 3829 - 3833 ( 1989 ); proc . am . assoc . cancer res ., vol . 30 , “ potent induction of spermidine / spermine n 1 - acetyltransferase ( ssat ) activity and its relationship to inhibition of cell growth ,” libby et al , page 586 ( 1989 ); biochem . pharma ., vol . 38 , no . 9 , “ structure - function correlations of polyamine analog - induced increases in spermidine / spermine acetyltransferase activity ,” libby et al , pages 1435 - 1442 ( 1989 ); cancer res ., vol . 49 , basu et al , supra ; biochem . j ., vol . 268 , porter et al , supra ; biochem . j ., vol . 267 , pegg et al , supra ; arch . biochem . biophys ., vol . 284 , “ characterization of human spermidine / spermine n 1 - acetyltransferase purified from cultured melanoma cells , libby et al , pages 238 - 244 ( 1991 ); and cancer res ., vol . 51 , “ correlations between polyamine analog - induced increases in spermidine / spermine n 1 - acetyl - transferase activity and growth inhibition in human melanoma cell lines ,” porter et al , pages 3715 - 3720 ( 1991 )]. extracting a single methylene from each of the three methylene bridges of dehspm substantially increases the ability of the analog to stimulate sat up - regulation , dehspm has little impact on sat levels , while despm up - regulates the enzyme by a factor of 200 and denspm by 1 , 200 fold . although each of the tetraamines is a closely related linear tetracation at physiological ph , each provides a different signal to the cell . while dehspm has three 4 - methylene bridges and little sat - stimulating activity , despm which has a single central 4 - methylene bridge and two terminal 3 - methylene bridges is a more active sat - stimulating factor . denspm has three 3 - methylene bridges and is the most active sat stimulator . presumably , the cell then “ reads the charge distribution ” on the polyamines . this suggests that the key issue in the polyamine analogue &# 39 ; s activity is the distance between the charged centers and not the nature of the groups separating these centers , “ the insulators .” however , that this was indeed the case required proof . the total concentration of polyamines in cation equivalents , as well as the ratios of the various polyamines , is very tightly regulated and , when this equilibrium is disturbed , the cell acts quickly to re - adjust . for example , when polyamine analogs are incorporated , these dynamics are disrupted and the cell responds by either excreting polyamines in the free state or by first acetylating them , followed by excretion of the n 1 - acetyl compounds [ j . biol . chem ., vol . 264 , no . 20 , “ effect of n 1 , n 12 - bis ( ethyl ) spermine and related compounds on growth and polyamine acetylation , content and excretion in human colon tumor cell ,” pegg et al , pages 11744 - 11749 ( 1989 ); and cancer res ., vol . 51 , porter et al , supra ]. on analog incorporation , the cell disposes of the appropriate number of polyamine cation equivalents in order to maintain the total polyamine charge balance . the analogs appear to the cell as normal polyamines and provide many of the same regulatory messages that the natural polyamines do . as analog concentration increases in the cell , the following events ensue . polyamine biosynthesis is down - regulated , just as when cells are grown in exogenous polyamines . the levels of ornithine decarboxylase ( odc ) and s - adenosylmethionine decarboxylase ( adometdc ) are drastically reduced just as with the normal negative polyamine feedback control . analogs with aminopropyl groups cause a marked increase in s - acetyl transferase ( sat ). once again , the issues are how the cell reads the charge distribution on the polyamines and how does it translate this information into regulatory events . the answers to both of these questions will allow one to define the structural boundary conditions for the general design of polyamine anti - neoplastics . two fundamental issues needed to be addressed regarding the general structural requirements for anti - neoplastic polyamines : ( 1 ) are the cationic centers really key to the compound &# 39 ; s anti - neoplastic activity or are the nitrogen centers simply enough , and ( 2 ) what are the boundary conditions on the insulators , e . g ., bridging groups separating the nitrogen or cationic centers ? the first question can be answered by comparing two polyamines with essentially the same distance between the nitrogens , but with different pka values on spatially equivalent nitrogens . while the bis - β , β , β - trifluoroethyl analogue of n 1 , n 12 - diethylspermine strongly suggested that charge was significant in polyamine analogue activity , additional examples had to be developed . in particular , examples were utilized in which other than simple methylene insulators were employed . this experiment is typified by the compounds and their activities as set forth in table 1 . the results of table 1 clearly indicate that the nitrogen cationic centers are required for anti - neoplastic activity and not simply a nitrogen center . the pyridine compounds have their nitrogen separated by distances very similar to those in the corresponding piperidine systems . the major difference is , at physiological ph , the pyridine compounds are not substantially protonated at the pyridine nitrogens . this means that the piperidine compounds are tetracations at physiological ph , while the pyridines are dications . the dications , unlike the corresponding reduced and acyclic linear molecules , are not active against l1210 cells . whether the cations can be insulated from each other by other than a methylene bridge , e . g ., a more rigid cyclic backbone , while still maintaining the activity of the compound is a question important not only to an understanding of how cells process information on the polycations , but also to the design of improved therapeutics . if a variety of other aliphatic systems can be substituted for the methylene bridges in the polyamines , it is possible to alter not only the metabolic properties of the polyamine anti - neoplastics , but also their organ distribution and clearance properties . the data set forth in table 2 further indicates that simple linear insulators are not a strict requirement for polyamine analogue anti - neoplastic activity . the results suggest that the polyamine nitrogens can be incorporated into a cyclic backbone . this observation was further investigated to verify that nitrogen insulators could also be cyclic alkyl groups . table 2 clearly indicates that this is true . the cyclohexyl fragment works well in a variety of different arrangements as an insulator . the intention is that the cell should incorporate these compounds via the polyamine &# 39 ; s transport apparatus and that these analogues should find their way to the same subcellular distribution sites that the naturally occurring polyamines do , but once there , because of subtle alterations in the molecules , they should be unable to be further processed . the inability of the polyamines to be further processed is largely related to the fact that the terminal nitrogens in the active compounds are alkylated and unable to be acetylated by sat . previous synthetic methods [ j . org . chem ., vol . 45 , bergeron et al , supra ; synthesis , bergeron et al ( 1981 ), supra ; synthesis , bergeron et al ( 1982 ), supra ; synthesis , bergeron et al ( 1984 ), supra ; j . org . chem ., vol . 49 , bergeron et al , page 2997 ( 1984 ); accts . chem . res ., vol . 19 , bergeron , supra ; bioorg . chem ., vol . 14 , bergeron et al , supra ; j . org . chem ., vol . 53 , bergeron et al , supra ; j . org . chem ., vol . 52 , bergeron et al , supra ; j . org . chem ., vol . 56 , bergeron et al , supra ; and crc handbook on microbial iron chelates , bergeron et al , supra ] were not designed for polyamine bridge expansions , but for the introduction of different alkyl groups at different nitrogens in the triamines or tetraamines . however , it has been recently shown that many of the simple terminally dialkylated polyamine analogs of interest can be accessed via the appropriate tosylamide . for example , to synthesize despm , spermine is first tosylated and then monoalkylated at each terminal tosylamide by treatment with sodium hydride and ethyl iodide . the tosyl groups are then removed under conditions of dissolving metal reduction . the shortcomings of the procedure are three - fold : ( 1 ) the alkylation must be symmetrical , i . e ., the same alkyl group must be fixed to both terminal nitrogens , ( 2 ) the methylene insulators between the nitrogens are regulated by the availability of the starting polyamine , and ( 3 ) removal of the tosyl protecting group proceeds in low yield . a more satisfactory alternative involves formation of the appropriate tetramesitylenesulfonamides , which can be alkylated in high yields and the tetramesitylenesulfonyl ( mes ) protecting groups quantitatively removed by treatment with 30 % hbr in acetic acid and phenol ( fig1 ). this approach eliminates the low yield problem associated with removal of the tosyl protecting group under dissolving metal reduction conditions . the mes methodology has been extended to a symmetrical “ segmented synthesis ” which allows for the facile alteration of the methylene backbone ( fig2 ). the segmented approach to constructing polyamine analogs offers numerous advantages in terms of flexibility and high yields . the procedure begins with mesitylenesulfonation of a primary amine providing ( 1 ), followed by alkylation of ( 1 ) with an excess of the appropriate dihalide ( fig2 ). the resulting halosulfonamide ( 2 ) can then be utilized to alkylate the disulfonamides , e . g ., ( 3 ). the tetrasulfonamide ( 4 ) is treated with hbr / hoac / phoh to remove the mesitylenesulfonamide protecting groups . the resulting bromide is converted to the corresponding hcl salts . thus , the limitations associated with the availability of the starting tetraamine have been eliminated , as well as removal of the tosyl protecting group . in addition , the earlier method was limited to terminal primary alkyl groups because of poor yields when alkylating with secondary and tertiary halides . the above methodology has been successfully applied to the synthesis of , e . g ., trans - 1 , 4 - diaminocyclohexane despm analog ( fig3 ). the cyclic disulfonamide ( 2 ) which is obtained by sulfonation of trans - 1 , 4 - cyclohexanediamine ( 1 ) is alkylated with two equivalents of halosulfonamide ( 3 , n = 3 ). finally , the amine protecting groups of tetrasulfonamide ( 4 ) are easily removed by treatment with phenol and hbr as above to provide cyclic spermine analog ( 5 ). tetraamines in which the terminal nitrogens are incorporated into piperidine rings can also be prepared using mesitylenesulfonyl - protected segments , as shown in fig4 and 5 . 4 -( aminomethyl ) piperidine ( 1 ) was converted into bis - sulfonamide ( 2 ) which was alkylated with 1 , 4 - dibromobutane ( 0 . 5 equivalent )/ nah / dmf to complete the polyamine framework ( 3 ). reductive removal of the sulfonamide protecting groups in ( 3 ) was accomplished with 30 % hbr in hoac / phoh , generating bicyclic dehspm analog ( 4 ) ( fig4 ). the corresponding 5 - 4 - 5 bicyclic polyamine was synthesized from the inside out ( fig5 ). crystalline n , n ′- bis -( mesitylenesulfonyl ) putrescine ( 1 ) was alkylated at both ends with mesitylenesulfonate ( 2 ), a solid derived from 4 - piperidineethanol and mesitylenesulfonyl chloride ( messo 2 cl ) in pyridine . deprotection of sulfonamide ( 3 ) with hbr as usual gave the larger bicyclic spermine homolog ( 4 ). the development of a tri - protected diamine reagent ( fig6 ) permits the efficient synthesis of tetraamines which are unsymmetrical with respect to both their outer methylene chains and terminal alkyl substituents . this methodology eliminates the limitation in earlier routes that the terminal alkyl substituents must be identical . furthermore , terminal monoethyl polyamines ( fig8 ), which are useful as standards in studies of diethyl analog metabolism , can also be generated in a systematic way . n -( tert - butoxycarbonyl )- n - mesitylenesulfonylamide ( bocnhso 2 mes ) ( 1 ), a di - protected ammonia , was alkylated with 4 - chlorobutyronitrile ( nah / dmf ) to give ( 2 ). the cyano group of ( 2 ) was hydrogenated with raney nickel in methanolic ammonia , resulting in primary amine ( 3 ). both the tertbutoxycarbonyl and mesitylenesulfonyl amine protecting groups were stable to these reduction conditions . attachment of a second mesitylenesulfonyl functionality to amine ( 3 ) under bi - phasic conditions generated the reagent , n -( tert - butoxycarbonyl )- n , n ′- bis ( mesitylenesulfonyl ) putrescine ( 4 ). it is noteworthy that this route is flexible , as well , in that an ω - chloroalkanenitrile of any length can be employed in the alkylation of bocnhso 2 mes ( 1 ). applications of the tri - protected diamine reagent to unsymmetrical polyamine preparation are shown in fig7 and 8 . reagent ( 1 ) was deprotonated and alkylated with n -( ethylamino ) tetramethylene unit ( 2 ), providing ( 3 ) ( fig7 ). after removal of the tert - butoxycarbonyl group under mild acidic conditions ( tfa , ch 2 cl 2 ) to produce ( 4 ), the other nitrogen of the putrescine reagent was elaborated with n -( ethylamino ) trimethylene segment ( 5 ). unmasking of the amino groups of ( 6 ) generated tetraamine ( 7 ), in which the outer chains are unequal . n - ethyl trisulfonamide ( 3 ) ( fig8 ) was alkylated with n -( 4 - bromobutyl )- n -( tert - butyl ) mesitylenesulfonamide ( 2 ) to afford masked polyamine ( 4 ). treatment of ( 4 ) with hbr / hoac / phoh cleanly removed the tert - butyl group , as well as the sulfonamides , giving n 1 - ethylhomospermine ( 5 ), a polyamine analog metabolite . only the sulfonamides were cleaved using sodium and liquid ammonia to provide the unsymmetrically dialkylated homospermine derivative ( 6 ). a solution of 2 - mesitylenesulfonyl chloride ( 12 . 15 g , 55 . 0 mmol ) in 100 ml ch 2 cl 2 was slowly dripped into a solution of trans - 1 , 4 - diaminocyclohexane ( 2 . 92 g , 25 . 0 mmol ) in 100 ml 1 n naoh solution , which had been cooled to 0 ° c . the mixture was stirred at 0 ° c . for 30 min . and at room temperature overnight . the solid was filtered out and washed with water and ethanol , to give 10 g ( 2 a ) ( 82 %): mp & gt ; 300 ° c . ; nmr ( dmso - d 6 ) δ 0 . 97 - 1 . 23 ( m , 4h ), 1 . 40 - 1 . 63 ( m , 4h ), 2 . 20 ( s , 6h ), 2 . 50 ( s , 12h ), 2 . 63 - 2 . 83 ( m , 2h ). nah ( 0 . 792 g , 80 %, 26 . 4 mmol ) was added into a solution of n - ethyl -( 2 - mesitylenesulfonylamide ) ( 5 g , 22 . 0 mmol ) in 60 ml dmf , which had been cooled to 0 ° c . the mixture was stirred at 0 ° c . for 30 min ., and 1 , 4 - dibromobutane ( 31 . 5 ml , 261 . 4 mmol ) was added . the solution was warmed to room temperature for 30 min . and then heated to 80 ° c . overnight . the dmf was removed , and the residue was treated with 40 ml water , followed by the extraction with ch 2 cl 2 ( 50 ml × 4 ). the extractions were dried over anhydrous sodium sulfate , and the solvent was rotovapped . the crude oil was purified by silica gel column chromatography with 10 / 1 hexanes / etoac as an eluant , to provide 5 . 85 g ( 3 b ) ( 73 %) as an oil ; nmr ( cdcl 3 ) δ 1 . 07 ( t , j = 12 , 3h ), 1 . 60 - 1 . 83 ( m , 4h ), 2 . 27 ( s , 3h ), 2 . 57 ( s , 6h ), 3 . 07 - 3 . 37 ( m , 6h ), 6 . 90 ( s , 2h ). anal . calcd . for c 15 h 24 brno 2 : c - 49 . 73 ; h - 6 . 68 ; n - 3 . 87 . found : c - 49 . 78 ; h - 6 . 72 ; n - 3 . 88 . nah ( 206 . 6 mg , 80 %, 6 . 89 mmol ) was added into a solution of ( 2 a ) ( 1 . 5 g , 3 . 13 mmol ) in 40 ml dmf , which had been cooled to 0 ° c . the solution was stirred at 0 ° c . for 30 min ., and the solution of ( 3 b ) ( 2 . 5 g , 6 . 89 mmol ) in 20 ml dmf was slowly added at 0 ° c . then the mixture was stirred at 0 ° c . for 20 min ., room temperature for 30 min ., and 70 ° c . overnight , respectively , following the procedure of ( 3 b ) above , the residue of which was purified by column chromatography with 5 % ethanol in chloroform as an eluant , to give 0 . 93 g ( 4 a ) ( 29 %) as an oil ; nmr ( cdcl 3 ) 1 . 00 ( t , j = 12 , 6h ), 1 . 13 - 1 . 43 ( m , 4h ), 1 . 73 - 1 . 93 ( m , 4h ), 2 . 27 ( s , 12h ), 2 . 57 ( s , 24h ), 2 . 83 - 3 . 23 ( m , 12h ), 3 . 35 - 3 . 67 ( m , 2h ), 6 . 90 ( s , 8h ). anal . calcd . for c 52 h 76 n 4 o 8 s 4 : c - 61 . 63 , h - 7 . 56 , n - 5 . 53 . found : c - 61 . 72 , h - 7 . 59 , n - 5 . 56 . phenol ( 2 g , 21 . 3 mmol ) and 20 ml 30 % hbr — hoac were added into a solution of ( 4 a ) ( 720 mg , 0 . 69 mmol ) in 25 ml ch 2 cl 2 , and the solution was stirred at room temperature for 24 hours . the solution was diluted with 60 ml h 2 , and the ch 2 cl 2 layer was separated from the aqueous layer and the aqueous layer was washed by ch 2 cl 2 ( 40 ml × 5 ). the water was removed , and the residue was dissolved in 10 ml h 2 o , basified to ph & gt ; 12 by the naoh solution , extracted by chcl 3 ( 40 ml × 5 ) and dried over sodium sulfate . the salt was filtered out and the solvent was rotovapped . the oil was dissolved in 50 ml etoh , and 1 ml concentrated hcl acid was added . the etoh was removed and 320 mg crude solid was recrystallized from the mixture of h 2 o and etoh to produce 127 mg ( 5 a ) ( 40 %) as nice crystal . nmr ( d 2 o ) 1 . 30 ( t , j = 12 , 6h ), 1 . 50 - 1 . 67 ( m , 4h ), 1 . 67 - 1 . 97 ( m , 8h ), 2 . 07 - 2 . 40 ( m , 4h ), 2 . 90 - 3 . 40 ( m , 14h ). anal . calcd . for c 18 h 44 cl 4 n 4 : c - 47 . 17 , h - 9 . 68 , n - 12 . 22 . found : c - 47 . 01 , h - 9 . 67 , n - 12 . 13 . a solution of 2 - mesitylenesulfonyl chloride ( 19 . 49 g , 89 . 1 mmol ) in ch 2 cl 2 ( 100 ml ) was added to 4 -( aminomethyl )- piperidine ( 1 ) ( 5 . 15 g , 45 . 1 mmol ) in 1 n naoh ( 100 ml ) at 0 ° c . after the addition was complete , the biphasic mixture was stirred for 24 hours ( 0 ° c . to room temperature ). the layers were separated and the aqueous portion was extracted with chcl 3 ( 2 ×). the combined organic phase was washed with 0 . 5 n hcl ( 200 ml ) and h 2 o ( 100 ml ), dried with sodium sulfate and evaporated in vacuo . recrystallization from aqueous ethanol produced 18 . 72 g ( 88 %) of ( 2 ) as plates : mp 158 . 5 - 160 ° c . ; nmr ( cdcl 3 / tms ) δ 0 . 8 - 2 . 0 ( m , 5h ), 2 . 25 ( s , 6h ), 2 . 46 - 2 . 93 ( m + 2s , 16h ), 3 . 37 - 3 . 65 ( m , 2h ), 4 . 67 ( t , 1h , j = 6 ), 6 . 90 ( s , 4h ). anal . calcd . for c 24 h 34 n 2 o 4 s 2 : c - 60 . 22 , h - 7 . 16 , n - 5 . 85 . found : c - 60 . 31 , h - 7 . 19 , n - 5 . 86 . sodium hydride ( 80 % in oil , 1 . 411 g , 47 . 0 mmol ) was added to ( 2 ) ( 18 . 43 g , 38 . 5 mmol ) and nai ( 0 . 146 g , 0 . 97 mmol ) in dmf ( 165 ml ) at 0 ° c . the suspension was stirred for 1¾ hours at room temperature under nitrogen . 1 , 4 - dibromobutane ( 2 . 2 ml , 18 . 4 mmol ) was added by syringe , and the reaction mixture was heated at 84 ° c . for 19 hours . after cooling to 0 ° c ., h 2 o ( 200 ml ) was cautiously added to quench residual nah , followed by extraction with chcl 3 ( 300 ml , 2 × 100 ml ). the combined organic phase was washed with 1 % na 2 so 3 ( 100 ml ) and h 2 o ( 2 × 100 ml ), dried with sodium sulfate and evaporated under high vacuum . recrystallization from etoac / chcl 3 gave 13 . 00 g ( 70 %) of ( 3 ) as an amorphous solid : mp 202 - 203 . 5 ° c . ; nmr ( cdcl 3 / tms ) δ 0 . 75 - 1 . 90 ( m , 14h ), 2 . 25 ( s , 12h ), 2 . 40 - 3 . 18 ( m + 2s , 36h ), 3 . 3 - 3 . 6 ( m , 4h ), 6 . 87 ( s , 8h ). anal . calcd . for c 52 h 74 n 4 o 8 s 4 c - 61 . 75 , h - 7 . 37 , n - 5 . 54 . found : c - 61 . 49 , h - 7 . 39 , n - 5 . 43 . 30 % hbr in acetic acid ( 100 ml ) was added over 10 min . to a solution of ( 3 ) ( 5 . 34 g , 5 . 28 mmol ) and phenol ( 18 . 97 g , 0 . 202 mol ) in ch 2 cl 2 ( 75 ml ) at 0 ° c . the reaction was stirred for 24 hours ( 0 ° c . to room temperature ) and cooled to 0 ° c . distilled h 2 o ( 120 ml ) was added , followed by extraction with ch 2 cl 2 ( 3 × 100 ml ). the aqueous layer was evaporated under high vacuum . the residue was basified with 1 n naoh ( 12 ml ) and 50 % ( w / w ) naoh ( 20 ml ) with ice cooling , followed by extraction with chcl 3 ( 10 × 50 ml ), while adding nacl to salt out the aqueous layer . organic extracts were dried with sodium sulfate and evaporated . the residue was taken up in ethanol ( 200 ml ), acidified with concentrated hcl ( 3 . 5 ml ) and solvents were removed under vacuum . tetrahydrochloride salt was recrystallized with 7 % aqueous etoh to furnish 1 . 318 g ( 58 %) of ( 4 ) as a white solid . nmr ( d 2 o / tsp ) δ 1 . 19 - 2 . 23 ( m , 14h ), 2 . 8 - 3 . 6 ( m , 16h ). anal . calcd . for c 16 h 38 cl 4 n 4 : c - 44 . 87 , h - 8 . 94 , n - 13 . 08 . found : c - 44 . 77 , h - 9 . 00 , n - 13 . 00 . 2 - mesitylenesulfonyl chloride ( 54 . 40 g , 0 . 249 mol ) in ch 2 cl 2 ( 300 ml ) was added to 1 , 4 - diaminobutane ( 11 . 34 g , 0 . 129 mol ) in 1 n naoh ( 300 ml ) at 0 ° c ., and the biphasic mixture was stirred for 24 hours at room temperature . organic solvent was evaporated and 2 . 4 n hcl ( 250 ml ) was added to the combined portions . solid was filtered , washed with water ( 250 ml ) and recrystallized from aqueous ethanol to give 50 . 46 g ( 90 %) of ( 1 ) as needles : mp 156 . 5 - 157 . 5 ° c . ; nmr ( cdcl 3 / tms ) δ 1 . 36 - 1 . 60 ( m , 4h ), 2 . 27 ( s , 6h ), 2 . 57 ( s , 12h ), 2 . 69 - 2 . 96 ( m , 4h ), 4 . 65 ( t , 2h , j = 6 ), 6 . 89 ( s , 4h ). anal . calcd . for c 22 h 32 n 2 o 4 s 2 : c - 58 . 38 , h - 7 . 13 , n - 6 . 19 . found : c - 58 . 31 , h - 7 . 19 , n - 6 . 14 . 2 - mesitylenesulfonyl chloride ( 24 . 78 g , 0 . 113 mol ) in pyridine ( 60 ml ) was added all at once to 4 - piperidine - ethanol ( 5 . 58 g , 43 . 2 mmol ) in pyridine ( 25 ml ) at − 16 ° c . ; the temperature rose to − 11 ° c . the flask was stored in the refrigerator at 5 . 5 ° c . for 44 hours under argon . the reaction mixture was poured into ice ( 1 kg ) and after 3 hours , 16 . 00 g ( 75 %) of ( 2 ) as a yellow solid was filtered off : mp 93 . 5 - 94 ° c . ; nmr ( cdcl 3 / tms ) δ 1 . 4 - 2 . 1 ( m , 7h ), 2 . 27 ( s , 6h ), 2 . 44 - 2 . 96 ( m + s , 14h ), 3 . 37 - 3 . 69 ( m , 2h ), 3 . 97 ( t , 2h , j = 5 ), 6 . 90 and 6 . 93 ( 2s , 4h ). anal . calcd . for c 25 h 35 no 5 s 2 : c - 60 . 82 , h - 7 . 15 , n - 2 . 84 . found : c - 60 . 90 , h - 7 . 13 , n - 2 . 85 . sodium hydride ( 80 % in oil , 0 . 783 g , 26 . 1 mmol ) was added to ( 1 ) ( 5 . 15 g , 11 . 4 mmol ) and nai ( 0 . 376 g , 2 . 5 mmol ) in dmf ( 140 ml ) at 0 ° c . the suspension was stirred for 23 min . at room temperature , followed by the introduction of ( 2 ) ( 15 . 84 g , 32 . 1 mmol ). the reaction mixture was heated at 58 - 67 ° c . for 18 hours and then poured into h 2 o ( 300 ml ), followed by extraction with chcl 3 ( 4 × 100 ml ). the combined extracts were washed with saturated nahco 3 ( 100 ml ), 1 % nahso 3 ( 100 ml ) and h 2 o ( 100 ml ), dried with sodium sulfate and evaporated under high vacuum . column chromatography on silica gel eluting with 1 to 2 % ch 3 oh / chcl 3 furnished 10 . 03 g ( 85 %) of ( 3 ) as an amorphous solid : nmr ( cdc3 / tms ) δ 0 . 8 - 2 . 0 ( m , 18h ), 2 . 08 - 2 . 71 ( m + 3s , 40h ), 2 . 8 - 3 . 5 ( m , 12h ), 6 . 87 ( s , 8h ). anal . calcd . for c 54 h 78 n 4 o 8 s 4 . h 2 o : c - 61 . 33 , h - 7 . 62 , n - 5 . 30 . found : c - 61 . 50 , h - 7 . 44 , n - 5 . 33 . 30 % hbr in acetic acid ( 180 ml ) was added over 30 min . to a solution of ( 3 ) ( 9 . 83 g , 9 . 45 mmol ) and phenol ( 33 . 38 g , 0 . 355 mol ) in ch 2 cl 2 ( 135 ml ) at 0 ° c . the reaction was stirred for 24 hours ( 0 ° c . to room temperature ) and cooled to 0 ° c . distilled h 2 o ( 200 ml ) was added , followed by extraction with ch 2 cl 2 ( 2 × 100 ml ). the aqueous portion was evaporated under high vacuum . the residue was basified with 1 n naoh ( 50 ml ) and then 50 % ( w / w ) naoh ( 10 ml ) ( ice cooling ), followed by extraction with chcl 3 ( 10 ×), while adding nacl to salt out the aqueous layer . organic extracts were dried over sodium sulfate and evaporated . concentrated hcl ( 5 ml ) in ethanol ( 300 ml ) was added to the residue , and solvents were removed under vacuum . tetrahydrochloride salt was recrystallized in 3 % aqueous etoh to give 2 . 91 g ( 68 %) of ( 4 ) as a white solid : nmr ( d 2 o / tsp ) δ 1 . 15 - 2 . 09 ( m , 18h ), 2 . 75 - 3 . 59 ( m , 16h ). anal . calcd . for c 18 h 42 cl 4 n 4 : c - 47 . 37 , h - 9 . 28 , n - 12 . 28 . found : c - 47 . 25 , h - 9 . 35 , n - 12 . 17 .	0
when reference is made to the accompanying drawings , which are only used to illustrate some preferred embodiments of the present invention and shall therefore not be intended as limiting the scope thereof , it can by noticed that the basic peculiarity of the present invention lies essentially in the combination of two distinct measures , the first one of which consists in providing the injection mold 1 , in which the preforms are molded , with a plurality of cavities 2 that must be grouped into a number n of clusters , or sub - groups , namely the clusters of cavities belonging to and identified by the same line a , b . . . n containing preferably an identical number of cavities , as this is shown symbolically in fig1 . so far there would actually be nothing really new with respect to the prior art , since all cavities contained in a single mold can be divided into clusters or sub - groups , e . g . in a number of n , wherein each cluster is arranged to contain a smaller number of cavities , without on the other hand bringing about , by this mere fact , any actual invention and / or advantage of any kind . such a measure is advantageously and innovatorily completed by implementing a cool - down system , along with all related means and devices , inside the mold in such a manner as to enable it to cool down each one of said n clusters of cavities in a differentiated manner , as appropriately selected according to the needs , during the phase in which the molten resin cools down and solidifies in the mold cavities , in such a manner that , when the preforms are removed from their respective cavities of the respective mold , they exhibit a different temperature , as this is clearly induced by the dissimilarity in the cool - down temperature of each respective cavity , said temperature being of course the same for all preforms belonging to a same cluster , but varying from one cluster to the other ones . in both the preceding part and the following one of this description , “ mold ” is generally cited as a singular term , but it will of course be appreciated that any such mold is actually formed by two respective mold halves that must be opened in view of enabling the therein molded preforms to be removed . going now back to the moment in which the preforms are removed from a same mold these preforms are removed from there at the same time and exhibit , as this has already been stressed , a selectively differentiated temperature . the second one of the two aforementioned measures consists in moving the various clusters of the so obtained preforms through an orderly holding and forward conveyance sequence on a cluster - by - cluster basis , as this is described in greater detail below . with reference to fig2 it can be noticed that said clusters a , b . . . n of cavities produce corresponding clusters of preforms a p , b p . . . n p that are shown to be clearly identified by the same reference letters in the cited figure . said clusters of preforms are sent in an orderly sequence , e . g . first the whole cluster a p , then the whole cluster b p , and so on up to the cluster n p , to a common conditioning station 14 and , from here , according to the same initial sequence , to a common blow - molding station 20 . in practice , all preform clusters are removed from the mold at the same time and then queued in a holding phase of the cycle , waiting for being conditioned by successive clusters . it is therefore quite a natural fact that , during the holding time , such preforms are subject to cooling down in a differentiated manner according to the length of actual waiting time , so that the longer such a waiting time , the greater said cool - down effect , wherein it should be noticed in this connection that , during such a holding period , the preforms are exposed to the ambient air at ambient temperature . in view of obtaining the best possible qualitative result with said preforms , the conditioning phase must bring the final temperature of the same preforms to an exactly pre - determined , stable value , regardless of the clusters which each such preform comes from , and since said conditioning phase has constant characteristics , also the temperature of the preforms undergoing such conditioning should be appreciably constant , regardless of the cluster which they come from or the moment in which their conditioning actually starts . in order to obtain such a result , and considering the above remarks about the normally occurring differentiation in the cool - down of the preforms according to the actual length of the holding time , it is necessary for the temperatures of the preforms , as they are just removed from the mold , to be differentiated to such an extent that their subsequent normal cooling down , which depends on the length of the holding time corresponding to the particular cluster of preforms , is capable of bringing the final temperature of said preforms , i . e . the temperature of said preforms at the beginning of the conditioning phase , exactly to the constant value t o c that is required for all preforms of all clusters , regardless of the respective position in the conditioning sequence and , therefore , of the length of the respective holding and , as a result , cool - down time . as a result , the cooling down of the cavities must be aimed at enabling an appropriately differentiated temperature to be reached in the preforms when they are removed from the mold , and such a differentiation depends essentially on both the length of the holding time , during which said natural cool - down takes place , and the final temperature that must coincide with the initial temperature of the conditioning phase . the present invention is therefore based on the condition of such differentiated cool - down of the mold cavities ( and therefore a simultaneous removal of all preforms from the mold ) with said preforms being then sent sequentially , on a cluster - by - cluster basis , to the conditioning phase , wherein said differentiated cool - down of the mold cavities is regulated so as to enable each preform to reach the conditioning phase , at the beginning thereof , at the same temperature , keeping the holding time and the resulting natural cool - down of each preform into due account . to more effectively elucidate this aspect , let us now refer to the diagram illustrated in fig6 where the holding time t of each cluster of preforms between their removal from the mold and the beginning of the conditioning phase is indicated in the abscissa , while the temperature t o of the preform bodies upon their removal from the injection mold is indicated in the ordinate , t o c defines the temperature at which all preform clusters are when entering or beginning the conditioning phase , said conditioning process being of course equal for all preform clusters and equal being also the temperature at which said preform clusters enter the blow - molding stage of the process . the various curves in the above cited diagram shall be intended as representing the temperature pattern in the distinct preform clusters a p , b p , . . . n p , wherein for reason of greater simplicity said curves are identified by the same reference letters . since it is assumed that the temperature of the first preform cluster a p is exactly equal to the temperature t o c at which the same preform are required to be when entering the conditioning station , as this occurs in the traditional technique , then such first cluster a p does not need to go through any holding or waiting phase ; as a result , the related temperature curve is identified by the point a p located in correspondence of the initial time t 0 and the temperature t o c at which the preforms are required to enter the blow - molding station . the subsequent cluster of preforms b p must on the contrary undergo a holding phase for a time t b that is equivalent to the time needed by the cluster a p to go through the conditioning phase ; during such holding time , the related preforms undergo a natural cool - down and must therefore be removed from the injection mold at a higher temperature t b in such a manner that , at the end of the respective holding time t b , their temperature has steadied down at the same above defined level t o c required for the preforms to enter the blow - molding station . the same occurs for the subsequent preform clusters . . . n p , which , owing to their having to undergo holding phases through respectively and progressively longer periods . . . t n , must of course come out of their injection mold at corresponding , progressively increasing temperatures . . . t n , as this can be clearly inferred from the illustration in fig6 . in the course of this description , the term preform cluster or cluster of preforms has been used and defined in the assumption that such clusters actually comprise a plurality of preforms , such assumption being on the other hand a logical one for all operation ( i . e . mold unclamping , handling means , preform ejection / removal , transfer means and the like ) to be duly and completely operated . under the above cited circumstances , owing to the above mentioned facts , it clearly emerges that the conditioning / blow - molding apparatuses carry out two operating cycles in the same time in which the complete preform injection molding / cool - down / removal operation goes through a single cycle , while , owing to the differences in the duration of the cycles preformed by the various apparatuses , the conditioning and blow - molding ones remain particularly still and unused for half of the time . it will appreciated that such an arrangement may therefore be particularly suitable when bottles must be produced at quite low output rates . in such cases , in fact even a relative inefficiency brought about by the above cited downtime problems can be accepted , since it is generally compensated by a considerable simplification in the overall construction of the equipment and a marked saving effect on general costs . however , in order to eliminate such an inefficiency due to downtimes , the configuration illustrated in fig4 is advantageously proposed . such a configuration differs from the one illustrated in fig3 for the addition of a supplementary mold 16 that is fully similar to the afore described mold 1 , including the two clusters of cavities 17 and 18 , respectively , as well as for the addition of also two further holding sectors 17 a and 18 a , respectively , which are again fully similar to the afore described holding sectors 12 a and 13 a . thanks to the explanations given above , those skilled in the art will now be capable of readily appreciating that , in this case , the conditioning and blow - molding apparatuses are in fact fully saturated , since after having processed four successive clusters of preforms produced in a row by the two molds , they are immediately available for processing four further clusters of preforms produced in the meantime by said two molds in a subsequent injection - molding operation . such a configuration appears to be particularly advantageous since it combines a marked improvement in productivity with an unaltered simplicity in the construction of the equipment , considering that the output capability thereof can be practically doubled simply through the addition of said supplementary mold 16 , apart of course from the necessary adjustments and set - up requirements in connection with the related control and drive means . it will also be readily appreciated that the greatest extent to which use can actually be made of the present invention , i . e . the multiplication of the number of clusters per each mold while at the same time making use of several molds , finds its technical and economic limit in the increasing complexity and in the related costs of the quite complex molds required , in the filling and interchangeability thereof , and in the necessary control and drive means . in principle , however , the invention does not find any conceptual limit . as far as all the various control and drive means are concerned which are required to clamp and unclamp the molds , remove the preforms from said molds , convey and position the preforms of a same cluster in a handling means adapted to simultaneously transfer all such preforms to the conditioning and blow - molding stations , these are in all cases means that , although implementable in the most varied forms for operating according to the most varied principles , are fully within the capability of all those skilled in the art . as far as the manners are concerned in which the various zones of a same mold are selectively cooled down in a differentiated way , they do not per sé fall within the actual scope of the present invention , since they can be implemented in a number of ways , the most simple one of which consists in providing , inside the body of the mold , a plurality of conduits , so as to in particular surround each single cavity therewith , wherein a medium is caused to flow through said conduits which is appropriately tempered under thermostatic control in accordance with the actual temperature to which the cavities associated to said conduits must be cooled . in the course of extensive experiments on prototypes , it has however been found that the external variables , such as for instance the room temperature , the type of resin , the temperature at which such resin is injected in its molten state into the mold cavities , the thermal inertia of the mold and so on , can bring about a variation in the temperature of the preforms entering the conditioning station . with reference to fig5 such a drawback is therefore eliminated through a detection of the temperature of the preforms , before conditioning , by means of per sé known means 21 , 22 ; according to such a temperature being detected to fall within or to be outside preset limits , feedback - operated means are adapted to respond accordingly by generally acting on the cooling means that are associated to the cavities of those molds from which the preforms have been removed whose temperature has in such manner been detected to be outside said pre - set limits . in this manner , as soon as a deviation occurs in the temperature of the preforms from the accepted value , said means automatically intervene to modify the respective temperature accordingly . the precision of such a deviation range , i . e . the extent to which the temperature may be allowed to deviate from the pre - set values , can of course be kept within very strict limits and , in any case , within the tolerance range inside which the temperature of the preforms can vary without any risk of it actually affecting the final molding result . in order to improve the responsiveness to a deviation in the temperature of the preforms , as well as to enhance the uniformity in the temperature of the preforms belonging to a same cluster , it is advantageous for said means 21 , 22 provided to detect the temperature of the preforms before the conditioning stage to be so arranged as to be able to detect the temperature of those preforms that are thermally most “ spaced away ” from each other , i . e . of that pair of preforms included in the same cluster , which are supposed to exhibit the greatest difference in temperature as compared to any other pair in the same cluster . it is well within the capabilities of those skilled in the art to identify , even by means of simple measurements , the cavities and , therefore , the pairs of preforms that exhibit such a property . it will be appreciated that the invention can be implemented also with methods and apparatuses that differ from the above described ones , by complying substantially with the features and characteristics recited in the appended claims .	1
the present invention , an auger lock , shown generally as 10 in fig1 includes the following major sections , intake section 11 , auger section 12 , material plug section 14 , and exit section 16 . referring now to fig1 intake section 11 includes a cyclone 28 which also may be a hopper or a storage bin in which material 30 is entrained within a gas . intake section 11 further includes intake flange 27 which communicates with intake 26 which communicates with auger tube 18 . auger section 12 includes a cylindrical housing ; namely , auger tube 18 having mounted therein auger 20 having auger flights 22 . auger 20 which is mounted on drive shaft 24 which is mounted centrally and longitudinal along longitudinal axis 110 within auger tube 18 as shown in fig1 . by way of example only , auger tube 18 may have an outside diameter of five inches , wall thickness of { fraction ( 3 / 16 )} of an inch and houses an auger 20 having auger flights 22 having an outside diameter of four inches . auger flights 22 are preferably half pitch flights , meaning a four inch auger would have two inch pitch auger flights 22 . auger tube 18 has mounted thereon end cap 25 proximate intake section 11 . one end of drive shaft 24 emerges from end cap 25 and has mounted thereon drive pulley 27 . preferably drive pulley 27 is of the sprocket type , however , other drive arrangements known in the art can also be used including belt driven arrangements . not shown in fig1 is a motor and drive system connected to drive pulley 27 for rotating drive shaft 24 . auger flights 22 terminate at material plug section 14 wherein only drive shaft 24 and material 30 continue within auger tube 18 . in other words the auger flights 22 terminate and do not enter material plug section 14 . material 30 within material plug section 14 compacts together forming compacted material 32 within material plug section 14 . exit section 16 , which includes a means for discharging material 30 , includes plunger 34 , rubber seal 36 , agitator pins 38 , deflector cone 40 , two way dogs 44 , spring 46 , shaft bearing 42 , and mounting bracket 48 . fig1 shows plunger 34 in plunger open position 56 wherein two way dogs 44 are in engaged position 54 as shown in fig1 . in addition , seals 50 located between the inner diameter of deflector cone 40 and the outer diameter of drive shaft 24 , provide for a gas - tight seal between deflector cone 40 and drive shaft 24 . preferably seals 50 are of the o - ring type , however , brass bushing type seals and / or any other seals known in the art which allow deflector cone 40 to move slidably , longitudinally along drive shaft 24 are acceptable . plunger 34 has mounted thereon rubber seal 36 on the face which contacts the exit end 70 of auger tube 18 , in plunger closed position 58 shown in fig2 . exit section 16 which includes plunger 34 , rubber seal 36 , agitator pins 38 , deflector cone 40 , and two way dogs 44 move in unison slidably along drive shaft 24 between a plunger open position 56 shown in fig1 and a plunger closed position 58 shown in fig2 . in plunger closed position 58 shown in fig2 two way dogs 44 are in dog disengaged position 52 shown in fig2 . two way dogs 44 are the type known in the art and preferably are three - toothed dogs which cooperate wherein the engaged position 54 , the two way dogs 44 are meshed together thereby rotating plunger 34 , rubber seal 36 , agitator pins 38 , and deflector cone 40 in unison with drive shaft 24 . [ 0066 ] fig4 an alternate embodiment of auger lock 10 , schematically illustrates using engaging pins 114 and co - operating engaging pin holes 116 rather than two way dogs 44 . in addition , spring 112 is located exterior of the engaging mechanism . referring to fig1 through 3 in dogs disengaged position 52 the dog teeth no longer mesh and plunger 34 , rubber seal 36 , agitator pins 38 , and deflector cone 40 no longer rotate in unison with drive shaft 24 , but rather drive shaft 24 rotates freely with plunger 34 left stationary with rubber seal 36 of plunger 34 sealing and mating against exit end 70 of auger tube 18 . spring 46 biases plunger 34 against exit end 70 of auger tube 18 , and maintains plunger 34 in the normally plunger closed position 58 shown in fig2 . shaft bearing 42 supports the exit end of drive shaft 24 onto mounting bracket 48 of the type known in the art . not shown is a frame or other structure to which bracket 48 is mounted . referring now to fig6 and 7 which schematically illustrates an alternate embodiment of the present invention , an auger lock 10 , which has all of the same components as described above except for modification to auger tube 18 which is comprised of two sections ; namely , first auger tube section 130 and second auger tube section 132 , which is coupled together with coupling 134 . first and second auger tube sections 130 and 132 are dimensioned to co - operatively , telescopically slide one over the other in such a manner that the length of the auger tube can be adjusted by slidably urging second auger tube section 132 over first auger tube section 130 , and locking it into a desired position using coupling 134 . in this manner the volume and the length of material plug section 14 containing compacted material 32 can be adjusted by slidably urging second auger tube section 132 telescopically over , first auger tube section 130 . coupling 134 can be any type known in the art and , for example , a lorenze ™ standard coupling , which is described in u . s . pat . no . 4 , 193 , 173 and canadian patent 1 , 025 , 793 can suitably be used . in use auger lock 10 as shown in fig1 operates as will be described hereafter . material 30 , which is contained within cyclone 28 , settles to the bottom of cyclone 28 proximate intake flange 27 . material 30 flows through intake 26 and into auger tube 18 proximate intake section 11 . auger lock 10 will work with almost any type of dry or wet particulate or granular material and / or bulk solids such as plastic particles ( something called rubber regrind ), plastic pellets , grain , saw dust , cement dust , rubber powder , and other similar granular materials . preferably , the material 30 size ranges between 100 mesh and ¾ ″ in diameter in size . material 30 can be almost any type of material which is capable of being moved along through auger 20 mounted within auger tube 18 . the interior of cyclone 28 may be under negative and / or positive pressure , and in practice the unit has been tested to be functional between 80 inches of water column pressure and / or 80 inches of water column vacuum using plastic regrind material through the auger . higher pressures and vacuums are likely achievable . therefore , auger lock 10 can be utilized with either a negative pressure within cyclone 28 and / or a positive pressure within cyclone 28 . as material 30 is transported into auger tube 18 , rotating auger flights 22 of auger 20 move material 30 longitudinally from intake section 11 of auger tube 18 towards exit end 70 of auger tube 18 . typically drive shaft 24 rotates between 25 to 50 rpm as material 30 is moved into material plug section 14 , the auger flights 22 terminate and material 30 begins to accumulate and compact within material plug section 14 . spring 46 biases plunger 34 against exit end 70 of auger tube 18 preventing any material 30 and gas from exiting from exit end 70 of auger tube 18 . preferably , a rubber seal 36 mounted onto plunger 34 mates with and seals off exit end 70 of auger tube 18 , thereby , preventing material 30 and gas or air from flowing past plunger 34 during the start up of auger lock 10 . as auger flights 22 continue to rotate and move more and more material 30 into material plug section 14 , material 30 eventually becomes highly compacted forming compacted material 32 within material plug section 14 . compacted material 32 is also know as a “ material plug ” in the art . compacted material 32 is so highly compacted that it substantially prevents the flow of gases between cyclone 28 and exit end 70 of auger tube 18 . thereby pressure isolating any positive or negative pressures in cyclone 28 from the ambient pressure found at exit end 70 of auger tube 18 . as auger flights 22 continue to rotate , the pressure continually increases increasing the compaction of material 30 within material plug section 14 until the pressure is great enough to overcome the biasing action of spring 46 against plunger 34 . when the pressure of material plug 14 is sufficient to overcome the biasing force of spring 46 , compacted material 32 within material plug section 14 pushes against plunger 34 moving plunger 34 from the plunger closed position 58 to the plunger open position 56 , thereby engaging two way dogs 44 into the engaged position wherein plunger 34 begins rotating in unison with drive shaft 24 . during this entire process drive shaft 24 is being rotated by a motor or other means known in the art , via drive pulley 27 . it will be apparent to those skilled in the art that the power required to continually rotate drive shaft 24 will depend among others upon the size of auger tube 18 , and the type of material 30 transported within the auger lock 10 . with plunger 34 in the plunger open position 56 , rubber seal 36 no longer contacts exit end 70 of auger tube 18 , therefore breaking the seal between plunger 34 and exit end 70 of auger tube 18 . however , because compacted material 32 is so densely compacted it continues to substantially isolate the pressure and / or vacuum found in cyclone 28 from the ambient air pressure found at exit end 70 of auger tube 18 . as two way dogs 44 move into the engaged position 54 , plunger 34 begins to rotate which in turn rotates agitator pins 38 , which are rigidly connected to plunger 34 . agitator pins 38 are mounted longitudinally and parallel with auger tube 18 , and as depicted can be bolts and / or any rigid projections into the interior of auger tube 18 . the length of agitator pins 38 is selected depending upon material 30 consisting and size . by way of example only , finer material 30 requires longer pins , whereas , coarser material 30 requires shorter pins . as compact material 32 begins to move outwardly from exit end 70 it makes contact with rotating agitator pins 38 which breaks up compacted material 32 , allowing material 30 ( which is broken up ) to exit from exit end 70 of auger tube 18 . finally , deflector cone 40 , a cone - shaped deflector mounted on drive shaft 24 , directs material 30 radically outward away from drive shaft 24 , and towards the outer diameter of auger tube 18 and towards agitator pins 38 . in practice it has been found critical to have deflector cone 40 in place in order to provide additional compaction of material 30 as it approaches exit end 70 of auger tube 18 . deflector cone 40 has inclined deflecting surface 118 for deflecting material 30 radially outward . by deflecting and moving material radically outward away from the centre of drive shaft 24 and towards the outer diameter of auger tube 18 , additional compaction of material 30 occurs . this additional compaction as material 30 exits from exit end 70 of auger tube 18 is critical to ensure that a gas seal is maintained in material plug section 14 even though plunger 34 no longer seals with rubber seal 36 against exit end 70 of auger tube 18 . the angle theta 72 is the angle between the longitudinal axis 110 which runs parallel along the longitudinal length of drive shaft 24 , and the inclined deflecting surface 118 of deflector cone 40 . preferably the angle theta 72 is 30 degrees . in practice , angle theta 72 can range between 20 to 60 degrees , however , 30 to 45 degrees is more preferable . referring now to the alternate embodiment shown in fig6 and 7 , the volume and length of material plug section 14 can be adjusted by telescopically urging second auger tube section 132 over first auger tube section 130 , and locking the two auger sections in place with coupling 134 . this is particularly useful when different sized material 30 is fed through auger 20 . by way of example only , finer material 30 being fed through auger 20 requires a smaller material plug section 14 , and therefore , a smaller and shorter material plug . finer materials tend to compact more easily , and therefore , a more effective material plug can be achieved with finer materials . by reducing material plug section 14 the amount of horsepower required by auger lock 10 is reduced , and the efficiency of auger lock 10 is increased . conversely , as the material 30 becomes coarser in nature , a longer material plug section is required in order to provide for an efficient gas tight seal . therefore , the courser the material the longer the material plug section 14 would be , and therefore , second auger tube section 132 is urged outwardly extending the length of the auger tube in order to provide for a longer and larger material plug . in this way the operator can fine tune the operation of auger lock 10 by adjusting the length of material plug section 14 according to the size and the consistency of material 30 being fed through auger 20 . in all other aspects , auger lock 10 , as shown in fig6 and 7 , operates in an elegance fashion as auger lock 10 shown in fig1 through 5 as described here above . in a presently preferred embodiment of the invention , an auger lock shown generally as 210 in fig8 includes the following major sections . intake section 211 , drive section 233 , auger section 212 , material plug section 214 and exit section 216 . referring now to fig1 the intake section 211 includes a cyclone 228 which also may be a hopper or storage bin in which material 230 is entrained with a gas . intake section 211 further includes intake flange 227 which provides for communication between cyclone 228 and auger tube 218 . drive section 233 includes drive unit 235 mounted to auger tube 218 . drive unit 235 is driveably connected to drive end shaft 224 and auger shaft 282 which is connected to auger 220 for rotatably driving drive end shaft 224 and auger shaft 282 . drive unit 235 is a standard type of drive mechanism which can be purchased and is mechanically and / or hydraulically and / or pneumatically connected to drive end shaft 224 through gears , pulleys or belts or other means not shown in fig8 . the purpose of drive unit 235 is to rotate a drive end shaft 224 which is connected to auger shaft 282 which in turn rotates auger 220 with its auger flights 222 . the reader will note that drive end shaft 224 is hollow and houses therein an adjusting rod 272 connected at the shaft end 225 together with an adjusting nut 273 . adjusting rod 272 having at the other end a swivel 274 for connecting to one end of spring 245 . the other end of spring 245 is connected to connecting rod 270 which in turn is attached to exit shaft 280 . the tension on spring 245 can be adjusted by threadably turning adjusting nut 273 of adjusting rod 272 which is threaded . by turning adjusting nut 273 , adjusting rod 272 is urged along longitudinal axis 211 thereby selectively increasing or decreasing the tension on spring 245 . note that drive end shaft 224 is rigidly connected with auger shaft 282 , however , exit shaft 280 which is concentrically housed within auger shaft 282 moves freely and independently of auger shaft 282 and drive end shaft 224 , in the door closed position 292 shown in fig9 . exit shaft 280 also has mounted there through laterally a pin 286 which has portions on each side of the pin projecting beyond the diameter of exit shaft 280 . pin 286 is dimensioned to fit within slot 284 defined in auger shaft 282 for the purpose of driveably connecting auger shaft and drive end shaft with exit shaft 280 . auger lock 210 shown in fig8 is shown in the door open position 290 in which pin 286 has made engagement with slot 284 thereby drive end shaft 224 , auger shaft 282 and exit shaft 280 all rotate in unison due to the coupling of pin 286 with slot 284 . furthermore , seal 236 at the end of auger shaft 282 and near the drive unit 235 seals off material 230 from contaminating the mechanism found within drive end shaft 224 . [ 0096 ] fig9 shows auger lock 210 in the door closed position 292 in which the tension on spring 245 which is transmitted through exit shaft 280 forces exit door 234 closed against exit end 260 of auger tube 218 . in this position lateral pin 286 does not engage with slot 284 and therefore drive end shaft 224 and auger shaft 282 rotate in unison , however exit shaft 280 rigidly connected to exit door 234 does not rotate unless pin 286 engages with slot 284 . therefore , in the door closed position 292 exit door 234 does not rotate and agitator pins 238 do not impart any forces upon material 230 within auger tube 218 . in use , auger lock 210 operates as follows . material 230 drops out of cyclone 228 through intake flange 227 of intake 226 and into auger tube 218 whereby they encounter the rotating auger flights 222 of auger 220 . the spring tension on spring 245 is adjusted by adjusting nut 273 to impart enough force on exit shaft 280 which transfers this force to exit door 234 thereby keeping it closed and in the door closed position 292 against exit end 260 . therefore , initially only drive end shaft 224 and auger shaft 282 rotate leaving exit shaft 280 attached to exit door 234 stationary . auger flights 222 continually transport material 230 towards exit end 260 of auger tube 218 until a material plug of material is formed in material plug section 214 of auger tube 218 . a material plug is a conglomeration of material 230 within auger tube 218 . material 230 is compacted together in this material plug . once the material plug has obtained sufficient size , it begins imparting forces against exit door 234 thereby pushing open exit door 234 against the tension on spring 245 . once exit door 234 has opened a predetermined amount , pin 286 engages with slots 284 thereby beginning rotation of exit shaft 280 with exit door 234 attached . once exit door 234 begins to rotate , agitator pins 238 begin to grind away material 230 from material plug thereby dropping the material into a bin or a hopper below not shown . the size of the material plug and the amount that the exit door opens is depended upon the pretension placed on spring 245 and the tension characteristics of spring 245 as well as the amount the exit door must open prior to the engagement of pin 286 with slot 284 . thereby the characteristics and the size of the material plugs can be adjusted by adjusting the tension on spring 245 as well by selecting the distance between pin 286 and slot 284 in the door closed position 292 . the greater the distance between pin 286 and slot 284 in the door closed position 292 the longer the material plug will form prior to exit door 234 rotating and agitator pin 238 grinding away the material plug . referring now to fig1 , which is schematic representation of auger lock 210 showing fig8 and 9 , highlighting some aspects of auger lock 210 not shown in fig8 and 9 . preferably a linear bearing 320 would be mounted onto the end of exit shaft 280 as shown in fig1 in order to provide for support for exit shaft 280 . in addition , a bushing 322 is preferrably used at the shaft end 225 of drive end shaft 224 as shown in fig1 . preferably also double pitch flighting 324 on auger 220 would be mounted onto auger shaft 282 approximate the exit end of auger flights 222 . in addition to the arrangement shown in fig8 and 10 for auger lock 210 , additionally the auger tube 218 arrangement shown in fig6 and 7 for the previous embodiment apply equally well to the presently preferred embodiment namely auger lock 210 . clarity auger tube 218 could be constructed of two auger tubes sections similar to first auger tube section 130 and second auger tube section 132 shown in fig6 and 7 . a coupling 134 shown in fig7 and fig6 would also be used and this arrangement would enable one to adjust the total length of auger tube 218 , thereby providing very gross and course control of the material plug section 214 . for example by extending second auger tubes section 132 over first auger tube section 130 thereby lengthening the total length of auger tube 218 , one can in effect increase the length of new material plug section 214 thereby increase the length of the material plug which is formed . this is useful for example when very course materials are being fed through auger lock 210 in order to provide for a better gas type seal the material plug section 214 would be made greater . on the other hand should finer materials or materials be used which provide for better gas tightness in the material plug section , then first auger tube section 130 and second auger tube section 132 could be urged over each other thereby shortening material plug section 214 and in this matter increasing the efficiency of the operation of auger lock 210 . it should be apparent to persons skilled in the arts that various modifications and adaptation of this structure described above are possible without departure from the spirit of the invention the scope of which defined in the appended claim .	1
there is shown in fig1 , 2a , 3 , and 3a , a compressible thermal insulating blanket 10 having an inner layer 12 of a flexible and compressible insulating material and an outer layer 14 of a flexible material . the inner layer 12 may be composed of any suitable commercially available insulating material such as fiberglass , rockwool , or glasswool . the important requirements are that the inner layer 12 have a low coefficient of thermal conductivity and be flexible and resiliently compressible so that it may be substantially compressed for long periods of time without affecting its ability to return to its pre - compressed state when released . the outer layer 14 is arranged to completely envelop the inner layer on all sides and thereby retain within the interior any glass fibers or particles that may separate from the inner layer . this is a very important advantage of the present invention in that potentially harmful particles or fibers will not be permitted to enter the living space . the outer layer 14 is constructed from a relatively thin sheet of vinyl , polyurethane , plastic , or similar type of material . the thickness of the layer 14 is approximately 0 . 002 to 0 . 015 inches depending on the desired durability of the finished article . one surface 16 of the inner layer 12 is attached to an inside adjacent surface 18 of the outer layer 14 . this attachment may be effected by adhesive or any suitable bonding means . the entire surface 16 need not be attached . the only requirement is that there be attachment over a sufficient area so that the inner layer 12 will not shift with respect to the outer layer 14 . a series of vent holes 20 are formed through and spaced along portions of the edges 22 of the outer layer 14 as shown in fig1 . the vent holes 20 are of about one quarter inch in diameter , and spaced about eight inches apart . the diameter and spacing of the holes 20 , however , are not critical to the practice of the present invention provided that the vent holes 20 permit sufficient quantities of air to pass through the holes during compression and expansion of the blanket 10 as described below . the outer layer 14 may be constructed in any of several ways as shown in fig2 a , 3 , and 3a . fig2 shows a two piece structure having a bottom portion 30 and a top portion 32 . the bottom portion 30 is folded upwardly on four sides thereby forming the edges 22 and is folded over the top so that a flap 34 overlays the top portion 32 by a small amount . the corners where pairs of the edges 22 meet may be formed into a miter or pleat to minimize build - up of material at these points . the flap 34 may be attached to the overlaid edges of the top portion 32 by pressure sensitive tape , adhesive , or any suitable bonding or fusing means . a second embodiment of the present invention is depicted in fig2 a which shows a structure that is similar to that of fig2 except that a separate strip 36 having top and bottom flaps 37 and 38 respectively is utilized instead of folding the bottom portion 30 upwardly . in this embodiment of the invention the flaps 37 and 38 are attached to the top and bottom portions 32 and 30 respectively in a manner similar to that described for the flap 34 . a third embodiment of the present invention is shown in fig3 wherein the top and bottom portions 32 and 30 respectively form mutually adjacent flaps or flanges 40 which are attached together in a manner similar to that described for the flap 34 . a variation of this structure is shown in fig3 a where a flap of the top portion 32 is attached to an edge 42 that defines the periphery of the bottom portion 30 . as with the structures shown in fig1 , and 2a , a series of vent holes 20 are formed through and suitably spaced along the edges 22 of the embodiments shown in fig3 and 3a . one of the more important advantages of the thermal insulating blanket 10 is that it may be substantially compressed into a compact unit for storage . when preparing the thermal insulating blanket 10 for storage it is first positioned on a flat surface such as a table top or floor as shown in fig4 . one end 50 is then manually compressed and folded over to form the beginning of a tight roll 52 . the roll 52 is held tightly and caused to slowly roll to the right , as viewed in fig4 thereby expelling through the vent holes 20 a substantial quantity of the air contained within the interior of both the inner layer 12 and the outer layer 14 . this tight rolling of the roll 52 continues until the blanket 10 is completely and compactly rolled into a cylinder , the outer diameter of which is schematically represented by the circle a in fig4 . two or more ropes , belts , or suitable ties 56 are then tightly secured around the compact cylinder , as shown in fig5 to maintain the thermal insulating blanket 10 in a compressed and compact state . an alternative to the individual ropes or belts is a single long rope or belt , not shown , which is wrapped tightly around the compact cylinder in a helical pattern and secured in place . in either case , the thermal insulating blanket 10 , when in this compressed and compact state , may be placed into a storage bag , not shown , for convenience in transporting and handling . the thermal insulating blanket 10 , when in this compact state occupies a volume of about one - fourth of the volume occupied when in its uncompressed free state . that is , the diameter of the compactly rolled cylinder , schematically represented by the circle a in fig4 is one - half the diameter of a loosely rolled cylinder which is schematically represented by the circle b in fig4 . this represents the significant savings of about three - quarters of the space required for storing an insulating blanket that cannot be compressed . when it is desired to utilize the blanket 10 after it has been stored in its compressed state for a period of time , it is only necessary to release the ties 56 and unroll the blanket . as the natural resiliency inherent in the inner layer 12 causes the inner layer to expand , air from the room , that is ambient air , will pass through the vent holes 20 and into the interior of the inner layer . this will continue until the inner layer 12 has expanded to substantially its pre - compressed state . another important advantage of the thermal insulating blanket 10 is that it may be completely removed from the attic access openings , stairways , and ceiling openings during the warmer months of the year . this permits warm air that would normally accumulate near the ceiling to pass into the attic through any small openings that would normally be present between the stairway structure or fan housing and the frame of the opening . this significantly enhances the efficiency of airconditioning systems when operating in a room having such a ceiling opening . another important advantage of the thermal insulating blanket 10 is that potentially harmful or irritating particles or fibers which may separate from the fiberglass inner layer 12 are substantially contained within the interior of the blanket 10 . this greatly reduces the risk of such particles or fibers entering the living space during use of the blanket 10 as set forth herein . fig6 through 8 depict several applications in which use of the thermal blanket 10 is particularly advantagous . fig6 shows a partial cross sectional view of a stairway 100 leading to an unheated room or attic area 102 . a door 104 is shown separating the heated and unheatead areas . the thermal insulating blanket 10 is hung across the door opening 106 , as shown in fig6 so that the lower edge 108 of the blanket 10 is in light contact with the floor 110 . a rail 112 having a portion of the blanket 10 sandwiched between it and the wall 116 is fastened to the wall with nails , screws or other suitable fasteners . by this means the blanket 10 is fastened to the wall 116 across the top of the door opening only , leaving the sides and lower porton of the blanket hanging freely but in contact with the sides 118 of the door frame so that the door opening is thermally isolated from the unheated area 102 . in order for a person to pass through the door opening , the door is opened in the normal manner and the thermal insulating blanket 10 merely pushed aside . it will be understood by those skilled in the art that the door 104 and the blanket 10 may be arranged in positions opposite to those shown in fig6 and that such an arrangement is considered equivalent to that shown . further , in certain cases , the use of the blanket 10 obviates the need for the door 104 . a partial cross sectional view of a stairway 120 leading from an unheated area 102 to a heated area 103 that is below grade is shown in fig7 . this is a typical structure for an outside entranceway to a basement wherein a hinged door 122 , or in some cases a pair of mating doors , is arranged to cover the stairway 120 . such doors are highly ineffective in preventing infiltration of cold air into the heated area 103 . in accordance with the present invention a thermal insulating blanket 10 is hung across a passage opening 124 formed in the wall 116 in a manner similar to that for the door opening 106 of fig6 . a rail 112 is used to fasten the blanket 10 to the wall 116 above the passage opening 124 so that the blanket hangs freely and covers the passage opening as shown in fig7 . the blanket 10 may be pushed aside when one desires to pass through . a partial cross sectional view of a typical folding or &# 34 ; pull down &# 34 ; stairway 130 to an attic 139 is shown in fig8 . folding stairways of this type are installed in an opening formed in the ceiling specifically for this purpose . as will be appreciated by those skilled in the art , such folding stairways account for substantial heat loss into the attic area . this is due to many reasons . the ceiling surface area occupied by the folding stairway is relatively large , typically about twelve square feet or more . heat transfer through this large uninsulated surface area can be substantial . further , the folding stairway is arranged so that a specific amount of clearance space exists between the surface of the folding stairway and the sides of the opening . this clearance space is needed to assure proper operaton of the mechanism of the stairway , however , the space permits the flow therethrough of warm air from the heated space into the attic . attempts to seal this clearance space and provide other insulation to reduce the loss of heat into the attic have heretofore met with little success . some of the reasons for this lack of success appear to be inherent in the structure of the folding stairway . that is , a folding stairway necessarily includes a mechanical mechanism which is actuated when raising and lowering the stairs . there is usually a counterbalance mechanism and a hand rail that must retract or extend . the steps themselves are usually arranged in two or three hinged segments which interfold prior to or during retraction of the stairway up into the ceiling . all of these moving parts which must necessarily operate when the stairway is being extended or retracted make it difficult , if not impossible , to effectively place insulation within the stairway structure so that heat transfer from the heated room to the attic is within acceptable limts . these problems , however , are obviated by the present invention wherein the thermal insulating blanket 10 is simply draped across the stairway opening 132 as shown . the blanket 10 is substantially larger than the opening 132 permitting an overlap area 134 of approximately twenty - four inches . this overlap is sufficient so that the blanket 10 should , in most cases , contact at least two joists 136 on two sides of the opening 132 . when the folding stairway 130 is in its closed and fully retracted position , as shown by the phantom lines 140 in fig8 it may project somewhat above the top of the joists 136 . this will cause the thermal insulating blanket 10 to be displaced upwardly a small amount as shown by the phantom lines 142 in fig8 . this small upward displacement , however , will have no adverse affect on the functional performance of the blanket 10 because of the substantial overlap areas 134 . when the stairway 130 is opened to its fully extended position , as shown in fig8 the thermal insulating blanket 10 will sag somewhat within the opening 132 . the blanket 10 , being supported on four sides by the frame around the opening 132 , has sufficient rigidity so that it remains in place without falling through the opening . when one climbs the stairway 130 to enter the attic 139 , one end 144 of the blanket 10 is simply folded back to permit passage . since the thermal insulating blanket 10 is encased in an outer layer 14 , potentially harmful or irritating particles or fibers which may separate from the fiberglass inner layer 12 are substantially contained within the interior of the blanket 10 . another application of the thermal insulating blanket 10 is shown in fig9 . there , an attic fan 150 is disposed in a ceiling 152 in a manner that is well known in the art . the area above the fan 150 is typically an unheated attic 139 . as with the folding stairway 130 , the fan housing 154 may project above the joists 136 an amount as shown in fig9 causing the thermal insulating blanket 10 to be displaced upwardly by that amount directly over the fan . there are , however , substantial overlap areas 134 , of about twenty - four inches , helping to assure that the blanket 10 will contact at least two joists on two sides . as described above in the folding stairway application , potentially harmful particles or fibers which may separate from the fiberglass inner layer 12 are contained within the interior of the blanket 10 thereby reducing the risk of such particles or fibers falling through the fan housing and into the living space below . another application of the thermal insulating blanket 10 , similar to that of the attic fan 150 described above , is insulating the typical ceiling access way to an unheated attic 139 . such an application is depicted in fig1 wherein a hatch 160 is disposed in an opening 162 in a ceiling 152 in a manner that is well known in the art . the hatch 160 is usually a rectangularly shaped piece of wood that is retained within the opening by the molding pieces 164 . the molding pieces 164 are customarily fastened to the ceiling 152 so that they slightly overlap the opening 162 on all sides thereby providing a shoulder 166 upon which the hatch 160 may rest . the thermal insulating blanket 10 , as shown in fig1 , is draped across the opening 162 in a manner similar to that of the stairway opening 132 of fig8 . there are substantial overlap areas 134 , of about twenty - four inches , helping to assure that the blanket 10 will , in most cases , contact at least two joists 136 on two sides . as shown in fig1 , the blanket 10 will sag a small amount within the opening 162 , however , the blanket 10 is supported on four sides by the frame of the opening 162 . when one wishes to enter the attic 139 through the opening 162 , the hatch 160 is simply pushed upwardly , displacing the blanket 10 upwardly a small amount until the hatch clears the top 168 of the frame . the hatch 160 is then laterally displaced so that it completely clears the opening 162 and rests on top of the joists 136 in the usual manner that is well known in the art . as with the folding stairway application described above , one end 144 of the blanket 10 is simply folded back to permit passage . it will be understood that one of the more important advantages of the present invention is the ability of the thermal insulating blanket 10 to be substantially compressed and arranged in a compact unit for storing without adversely affecting its ability to functionally perform at a later time . this is due to its unique structure wherein an inherent resiliency urges it into an expanded state for maximum thermal insulating attributes and vent means which permits conforming the blanket 10 into a compressed state for convenient storage . the above described applications of the thermal insulating blanket 10 indicate its unique usefulness . upon reading the present disclosure additional beneficial uses of the thermal insulating blanket 10 will become apparent to those skilled in the art and such uses are considered to be within the spirit and scope of the following claims .	1
referring now to the figures of the drawings in detail and first , particularly , to fig1 thereof , there is shown a twin clutch 4 which is essentially formed of a clutch housing or clutch case 8 , two clutches 10 , 12 , which are connected to two transmission input shafts 14 , 20 , and an axial bearing 25 which is fastened , via a fastening element 26 , to the inner transmission input shaft 14 . fig1 illustrates schematically a motor vehicle which is only indicated by a dashed line . the motor vehicle has an internal combustion engine 1 having a crankshaft 2 and a crankshaft flange 3 , which represents the connection to the twin clutch 4 . for the sake of simplicity , only half of the twin clutch is illustrated here . a metal clutch drive plate 5 , which is fastened at one end to the crankshaft flange 3 and at the other end to the clutch with the aid of installation screws 6 , forms the connection between the crankshaft flange 3 and the twin clutch 4 . the fastening with the aid of the installation screws 6 takes place after the engine 1 and transmission 7 , which is not shown in detail , have been joined together . the twin clutch 4 includes the housing or cover 8 which connects a fixed pressure plate 9 of the one clutch 10 and a fixed pressure plate 11 of the other clutch 12 to each other and , through the use of the installation screws 6 , to the crankshaft 2 . the one clutch 10 is formed of the driver disc or carrier disc 13 which is connected in an axially displaceable manner on the one transmission input shaft 14 forming the inner transmission input shaft . the one clutch 10 additionally has a movable pressure plate 15 which , for its part , is mounted in an axially displaceable but torsionally fixed manner in the clutch housing 8 . through the use of a lever mechanism 16 , which is likewise mounted within the clutch housing 8 , a force 19 is transferred by an engaging mechanism via a bearing 18 to the movable pressure plate 15 . by closing the air gaps between the carrier disc 13 and the pressure plates 9 and 15 , and by the additional application of a pressure force between these components , a torque is applied between the twin clutch 4 and the transmission input shaft 14 . in the other clutch 12 , the same applies analogously as for the one clutch 10 . the clutch 12 is formed by the pressure plate 11 which is fixedly connected to the clutch housing 8 , by the carrier disc 13 ′ mounted displaceably on the other transmission input shaft 20 , which is configured as a hollow shaft , and by the pressure plate 21 which is mounted in an axially displaceable but rotationally fixed manner with respect to the clutch housing 8 . this movable pressure plate is , for its part , actuated via a further lever mechanism 22 . for this purpose , a disengaging mechanism exerts a force 24 via a bearing 23 on the lever mechanism 22 , as a result of which the clutch 12 is closed and a torque is transmitted by the clutch housing 8 onto the other transmission input shaft 20 . in this case , the disengaging mechanisms are supported on the transmission housing 17 . an additional axial bearing 25 , which is advantageously configured as a grease - lubricated bearing , is provided for preventing that the axial force , which is exerted on the twin clutch 4 by these disengaging mechanisms , is passed on to the crankshaft 2 . this axial bearing 25 is screwed fixedly to the inner transmission input shaft 14 . because of this axial bearing 25 , the forces introduced by the disengaging mechanisms are transferred to the inner transmission input shaft 14 . this shaft 14 , for its part , transmits the forces via an oil - lubricated shaft bearing 27 to the transmission housing 17 . the oil - lubricated shaft bearing 27 is situated within the transmission 7 , more specifically between the transmission input shafts 14 , 20 and the transmission housing 17 . as a result , a closed force flux is produced within the system unit that includes the transmission . however , a requirement for a satisfactory functioning of this support of the axial forces is that although the clutch drive plate 5 is torsion - proof , i . e . torsionally rigid , the clutch drive plate is configured to be elastic in the axial direction . if this clutch drive plate is made too stiff in the axial direction , then because of the tolerances which exist , clamping forces occur between the twin clutch 4 and the crankshaft 2 during the installation of the transmission 7 on the engine 1 . the embodiment illustrated in fig2 has a two - mass flywheel 36 . the flywheel mass is divided into a primary flywheel mass 33 and a secondary flywheel mass 34 . the primary flywheel mass 33 is fastened to the crankshaft 2 . the secondary flywheel mass 34 is provided on the clutch via a plug - in toothing 32 . a torsional damper formed by a bent helical spring 35 is fitted between the flywheel masses . torsional vibrations , which occur between the engine 1 and twin clutch 4 or transmission 7 , are compensated for by the torsional damping of the two - mass flywheel 36 via the spring 35 . the twin clutch 4 is mounted with respect to the transmission housing 17 via the clutch housing 8 having the axial bearing 37 , which is advantageously configured as an axial grooved ball bearing . two disengaging mechanisms 30 , 31 are provided on the transmission input shafts 14 , 20 and , when actuated hydraulically , disengage the clutches 10 , 12 via the diaphragm springs 28 , 29 . the disengaging mechanisms 30 , 31 have the disengaging bearings 38 , 38 ′, 39 , 39 ′. when the clutch is closed , the appropriate disengaging mechanism 30 , 31 rotates together with the transmission input shaft 14 , 20 , with the result that there is no stressing of the respective bearing 38 , 38 ′, 39 , 39 ′ due to speed . this , together with the support by the axial bearing 37 , brings about a significant improvement in the wear characteristic of the twin clutch with respect to wear on the engine and the transmission .	5
fig4 contains a simplified block diagram for an input / output cell 50 according to one embodiment of the invention . logic circuit 52 accepts two input signals s 0 and s 1 , and a mode signal mode . logic circuit 52 provides signals to the gates of four cmos transistor pairs : pair p 1 , n 1 ; pair p 2 , n 2 ; pair p 3 , n 3 ; and pair p 4 , n 4 . the two transistors of each pair are connected at their drains to a drain node — the drain nodes of pairs p 1 , n 1 and p 3 , n 3 connect to a first conductive pad 54 , and the drain nodes of pairs p 2 , n 2 and p 4 , n 4 connect to a second conductive pad 56 . the source of each n - channel transistor ( n 1 , n 2 , n 3 , n 4 ) couples to a reference or ground voltage vss . the source of each p - channel transistor ( p 1 , p 2 , p 3 , p 4 ) couples to a supply voltage vdd . p 1 and p 2 couple to vdd through a common current source 58 , placing pairs p 1 , n 1 and p 2 , n 2 in a differential configuration . although not necessary if the cell will be used only for signal output , cell 50 also includes two additional cmos transistor pairs , p 21 , n 21 and p 22 , n 22 . pair p 21 , n 21 inverts and drives the signal received on conductive pad 54 , producing an input signal c 1 . pair p 22 , n 22 inverts and drives the signal received on conductive pad 56 , producing an input signal c 2 . when mode is set to a first output mode , logic circuit 52 turns off pairs p 3 , n 3 and p 4 , n 4 , e . g ., by supplying vdd to the gates of p 3 and p 4 , and vss to the gates of n 3 and n 4 . s 0 is used in this mode to drive the gates of p 1 , p 2 , n 1 , and n 2 as a differential current - mode driver . for instance , when s 0 is at a logic low level , logic circuit 52 turns on p 1 and n 2 and turns off n 1 and p 2 , such that current i 0 flows out pad 54 and in pad 56 . and when s 0 transitions to a logic high level , logic circuit 52 reverses this on / off pattern , such that current i 0 flows out pad 56 and in pad 54 . s 0 could optionally be an analog output signal instead of a logic signal , in which case logic circuit 52 can create appropriate analog drive signals for pairs p 1 , n 1 and p 2 , n 2 . when mode is set to a second output mode , logic circuit 52 turns off pairs p 1 , n 1 and p 2 , n 2 , e . g ., by supplying vss to the gates of all four transistors and turning off current source 58 . s 0 is used in this mode to drive the gates of p 3 and n 3 as a single - ended voltage driver . in the second mode , logic circuit 52 can drive the gates of p 4 and n 4 as a second single - ended voltage driver . mode can of course have multiple sub - modes in which the mapping of signals s 0 and s 1 onto bonding pads 54 , 56 can be one of the following : s 0 , s 1 ; s 1 , s 0 ; s 0 , none ; s 1 , none ; none , s 0 ; or none , s 1 . note that if one of the pairs p 3 , n 3 and p 4 , n 4 is never used as a voltage driver , the logic circuit need not control the gates of that pair , and that pair can be configured as a conventional esd circuit by connecting the gates of that pair permanently to their respective voltage rails . for the embodiment shown in fig4 , mode can also be set to an input mode that turns off all output drivers , placing all in an esd mode . input signals can then be received on one or both of pads 54 and 56 , and passed to the integrated circuit as c 1 and c 2 . fig5 illustrates , in block diagram form , a specific input / output cell embodiment 100 . cell 100 interfaces on the integrated circuit side with core logic operating at 1 . 8 v . cell 100 itself operates at 3 . 3 v . in one mode , cell 100 outputs signaling compatible with reduced swing differential signaling ( rsds , a trademark of national semiconductor corp ., as described in rsds ™ specification , rev . 0 . 95 , may 2001 ). when driven into a 100 - ohm load placed across pad 0 and pad 1 , the differential voltage across the pads will be roughly 250 mv , with an offset voltage v off of approximately v ref = 1 . 3 v . in a second mode , cell 100 outputs either one or two cmos / ttl ( 3 . 3 v logic ) signals , one on pad 0 and the other on pad 1 . in a third mode , cell 100 receives either one or two cmos / ttl signals , one on pad 0 and the other on pad 1 . cell 100 contains four functional blocks . driver / esd circuit 200 produces output signals in the various output modes , and provides esd protection against spurious transients on pad 0 and pad 1 . driver logic circuit 300 receives 1 . 8 v signals from the circuit core , and converts these signals to control signals for driver / esd circuit 200 . receiver circuit 400 performs the signal input functions for pad 0 and pad 1 , providing corresponding 1 . 8 v signals to the circuit core on c 0 and c 1 . current reference 500 provides a biasing current reference iref for the differential circuitry of driver / esd circuit 200 . an implementation example for each block of cell 100 will now be described with reference to fig6 – 10 . fig6 contains a more detailed version of driver / esd circuit 200 of fig5 . the operation of that circuit will be described first for a differential output mode , then for a single - ended output mode , and finally for a single - ended input mode . in differential output mode , signal diffen is asserted ( and complementary signal diffen # is deasserted ) in order to activate the differential circuitry . signals diff + and diff − form the differential inputs used to control the differential driver transistor pairs p 1 , n 1 and p 2 , n 2 . signal iref provides a reference current i 0 for generating an appropriate rsds current level , and signal vref provides a reference voltage for generating an appropriate rsds bias voltage . the remaining control signals ( seap 0 , sean 0 , seap 1 , sean 1 , sebp 0 , sebn 0 , sebp 1 , and sebn 1 ) each control one of the single - ended output transistors ( respectively p 3 , n 3 , p 5 , n 5 , p 4 , n 4 , p 6 , and n 6 ). in differential mode , each se signal controlling a pmos transistor is driven high , and each se signal controlling an nmos transistor is driven low , placing the se transistors in an esd mode . gated current mirror 210 is off when diffen # is asserted , but otherwise replicates iref , supplying a reference current of magnitude i 0 to current mirrors 212 and 214 ( which use a common mirror transistor ). current mirror 212 in turn supplies a reference current of magnitude i 0 to current mirrors 216 and 218 ( which also use a common mirror transistor ). gated averaging circuit 220 is on when diffen is asserted . when on , averaging circuit 220 supplies a sample voltage vavg , representing the instantaneous average of the voltage on pad 0 and the voltage on pad 1 , to voltage error amplifier 230 . voltage error amplifier 230 compares vref with vavg . error amplifier 230 splits a reference current of magnitude 2 i 0 ( from current mirror 216 ), such that when vref and vavg are equal , a reference current of magnitude i 0 is supplied to current mirror 232 . but when vavg rises above vref , error amplifier 230 increases the reference current supplied to current mirror 232 ( up to a maximum value of 2 i 0 if necessary ). conversely , when vavg dips below vref , error amplifier 230 decreases the reference current supplied to current mirror 232 ( down to a minimum value of zero , if necessary ). current mirror 218 supplies a current of magnitude 26 i 0 to the coupled sources of differential driver transistors p 1 and p 2 when diffen is asserted . likewise , current mirrors 214 and 232 combine to drain a current of magnitude 26 i 0 ( 8 i 0 from mirror 232 and 18 i 0 from mirror 214 ) from the coupled sources of differential driver transistors n 1 and n 2 when diffen is asserted . in differential output mode signaling , one of diff + or diff − will be a logic high , and the other will be a logic low . gate 240 passes diff + to the gates of p 1 and n 1 ; diff − is supplied directly to the gates of p 2 and n 2 . thus when diff + is logic high , a current of magnitude 26 i 0 will flow through p 2 , out pad 1 through the differential load , back in pad 0 , and through n 1 . when diff + is logic low , this current will reverse , flowing through p 1 , out pad 0 and through the differential load in the opposite direction , back in pad 1 , and through n 2 . esd continuity circuits 242 , 244 , and 246 each contain transistors that are biased off , with sources tied to a voltage rail . the drains of the continuity circuit transistors connect to source / drain regions of differential circuit transistors that are not tied directly to a voltage rail and have their other source / drain region connected to a pad ( e . g ., p 1 , p 2 , n 1 , and n 2 ). in single - ended output mode , diffen is deasserted ( and diffen # is asserted ). this turns off gated current mirror 210 , which zeros all of the differential bias currents in driver / esd circuit 200 . rail - gated current mirrors 214 and 218 have their mirror connections opened , and their gates referenced instead to the voltage rail that biases those circuits off . averaging circuit 220 is also turned off . gate 240 disconnects diff + from p 1 and n 1 , instead connecting these transistors to vdd ( leaving p 1 off and n 1 on ). diff − is driven low , such that p 2 is on and n 2 is off . note that although n 1 and p 2 are technically on , each has its source coupled to a high impedance and thus the differential outputs are disabled . optionally , each of p 1 , p 2 , n 1 , and n 2 could be driven by a separate input , such that all four transistors can be turned off in single - ended mode . the se gate signals are potentially active in single - ended output mode . when a single - ended signal is driven on pad 0 , two drive strengths are available . one drive strength drives seap 0 and sebp 0 in synchronism , and sean 0 and sebn 0 in synchronism ( but complementary to seap 0 and sebp 0 ). a lesser drive strength drives only one p 0 and one n 0 transistor , leaving the others biased off . a second single - ended signal can also be driven concurrently on pad 1 using the remaining se gate signals in similar fashion . in single - ended input mode , the differential circuitry signals are set as in single - ended output mode . further , the se signals are set as in differential output mode . this setting places driver circuitry connected to a pad in a high - impedance state . fig7 illustrates further detail for the differential circuitry portions of driver / esd circuit 200 in one embodiment , with the esd continuity circuits and single - ended drivers removed for clarity . gated current mirror 210 comprises matched transistors p 7 and p 8 , with common sources tied to vdd and common gates . p 7 has its gate and drain shorted to a switch transistor p 9 that allows iref to flow through p 7 whenever diffen # is deasserted . thus in single - ended modes , current mirror 210 is off , and in differential mode , p 8 mirrors iref . current mirror 212 comprises matched transistors n 7 and n 8 , with common sources tied to vss and common gates . n 7 has its gate and drain shorted to the drain of p 8 , such that in differential mode , mirror 212 replicates iref at the n 8 drain node . current mirror 214 shares transistor n 7 with current mirror 212 . when diffen is asserted , switch transistor n 10 couples the gate of transistor n 9 to the gate of transistor n 7 . transistor n 9 has 18 parallel channels , each dimensionally identical to the single channel of n 7 , such that n 9 mirrors 18 times iref when on . note that when diffen is deasserted , not only is the gate of n 9 disconnected from the gate of n 7 , but the n 9 gate is biased to vss instead through switch transistor n 11 , which uses diffen # as a gate signal . current mirror 216 comprises transistors p 10 and p 14 , with common sources tied to vdd and common gates . p 10 has its gate and drain shorted to the drain of n 8 , such that in differential mode , mirror 216 is referenced to iref . transistor p 14 has two parallel channels , each dimensionally identical to the single channel of p 10 , such that p 14 mirrors twice iref when on . current mirror 218 shares transistor p 10 with current mirror 216 . when diffen # is deasserted , switch transistor p 12 couples the gate of transistor p 11 to the gate of transistor p 10 . transistor p 11 has 26 parallel channels , each dimensionally identical to the single channel of p 10 , such that p 11 mirrors 26 times iref when on . note that when diffen is deasserted , not only is the gate of p 11 disconnected from the gate of p 10 , but the p 11 gate is biased to vdd instead through switch transistor p 13 , which used diffen as a gate signal . voltage error amplifier 230 receives the 2 iref - magnitude current produced by mirror 216 , and apportions that current between two identical paths to vss . each path comprises a p - channel transistor with its source coupled to the drain of p 14 , and an n - channel transistor with its source coupled to vss , the drain of the p - channel transistor coupled to the drain and gate of the n - channel transistor . in one path , the p - channel transistor p 15 receives a gate signal vref , and in the other path , the p - channel transistor p 16 receives a gate signal vavg . it can be appreciated that when vavg == vref , a current of magnitude iref will flow through each path . when vavg is greater than vref , p 16 will carry less current than p 15 ; when vavg is less than vref , p 15 will carry less current than p 16 . the current that passes through p 15 also passes through n 15 . n 15 and n 24 share common source and gate nodes . transistor n 24 has eight parallel channels , each dimensionally identical to the single channel of n 15 , such that n 24 mirrors eight times the current passing through n 15 . gated averaging circuit 220 comprises the serial combination of transistor n 12 , two resistors of resistance r ( e . g ., r = 2 . 8 k ω ), and transistor n 13 , bridged between pad 0 and pad 1 . transistors n 12 and n 13 are identical switch transistors driven by a common gate signal diffen . n 12 has one source / drain node connected to pad 0 , and n 13 has one source / drain node connected to pad 1 . when diffen is asserted , the two series resistors are effectively connected across pad 0 and pad 1 . the voltage vavg , measured between the two resistors , thus represents a voltage midway between the pad 0 and the pad 1 voltage , no matter which of pad 0 or pad 1 is at a higher voltage . finally , gate 240 contains switch transistors p 17 and n 17 , each driven by a gate signal diffen . when diffen is asserted , n 17 is on , and diff + drives p 1 and n 1 . when diffen is deasserted , p 17 is on , and pulls the gates of p 1 and n 1 high . all p - channel transistors in fig6 and 7 have their n - wells referenced to vdd . fig8 shows one implementation for a driver logic circuit 300 . 1 . 8 v logic signals s 0 , s 1 , oen #, diffsel , and drvsel are inputs to logic circuit 300 . the input inverters identified with a “ c ” are conditioning inverters that accept a 1 . 8 v logic input and provide a 3 . 3 v logic output . the remaining single - ended control logic gates in circuit 300 operate as 3 . 3 v logic gates ( all of the differential control logic operates at 1 . 8 v ). the identifiers within those gates , ending in “ x ”, indicate the relative size of each gate . signal diffsel determines whether the differential driver circuitry will be enabled . diffsel is supplied to the enable ( e ) input of differential gate signal generator 310 . differential gate signal generator 310 accepts s 0 as a 1 . 8 v input signal in , and creates two 1 . 8 v output signals out + and out −. one embodiment for generator 310 uses two serial inverters to create out + from in , and three faster serial inverters to create out − from in with approximately the same timing but opposite phase . when e is deasserted , however , both out + and out − produce logic low signals regardless of the signal present at s 0 . the signals generated at out + and out − are buffered up to a higher drive strength ( but remain 1 . 8 v logic signals ) to form output signals diff + and diff −, respectively . signal oen # is asserted ( low ) whenever any output driver circuitry will be enabled . when asserted at the same time as diffsel , however , diffsel blocks the single - ended logic circuitry from responding to oen #. thus when oen # is logic high or diffsel is logic high , all single - ended outputs will be set to turn off their respective se driver transistors regardless of the state of s 0 and s 1 . when both oen # and diffsel are logic low , at least some of the single - ended outputs will respond to s 0 and s 1 . which single - ended outputs respond to s 0 and s 1 depends in part on the state of drvsel . in single - ended mode , all “ seaxy ” outputs respond to sy . further , when drvsel is set to logic high , all “ sebxy ” outputs respond to sy as well ; otherwise , the “ sebxy ” outputs continue to turn off their respective se driver transistors . note that in this embodiment , signal s 0 provides an input for a drive signal in both single - ended and differential output modes , and s 1 provides an input for a drive signal in single - ended mode . it is straightforward to modify circuit 300 to provide different behavior , e . g ., the ability to output one but not both s 0 and s 1 in a single - ended mode , the ability to use a separate input , even an analog input , for the differential channel , etc . fig9 illustrates one embodiment for receiver circuit 400 of fig5 . pad 0 connects through a resistance r 1 ( e . g ., 622 ω ) to the gates of transistors p 20 and n 20 ( which share a common drain node b 0 ), and to the drain of transistor n 25 ( which has a source connected to vss ). a transistor n 24 , connected between the source of n 20 and vss , determines whether n 20 can pull node b 0 low . when diffen # is low ( indicating differential output mode ), n 24 and n 25 are off , and circuit 400 presents a high impedance to the differential driver . when diffen # is high ( indicating either single - ended input or output mode ), n 24 and n 25 are on , allowing : pair p 20 , n 20 to produce at b 0 an inverted version of the signal present at pad 0 , when pad 0 is driven ; n 25 to pull pad 0 low through r 1 , when pad 0 is not driven . note that n 25 is a weak device , e . g ., a long - channel transistor , such that a drive transistor can easily dominate the signal at pad 0 despite the pulldown effect through n 25 . node b 0 drives the gates of p 22 and n 22 , which are connected in a conventional inverter configuration between vdd 1 and vss 1 ( e . g ., 1 . 8 v logic rails ), with an output at node c 0 . c 0 thus replicates the logical condition present at pad 0 , in 1 . 8 v logic , when pad 0 is not in differential mode . transistors p 21 , n 21 , p 23 , n 23 , n 26 , and n 27 perform a similar function ( for pad 1 ) to that just described for the transistors serving pad 0 . fig1 shows one possible implementation for current reference 500 of fig5 . signal diffsel turns on transistor n 30 when asserted , allowing reference 500 to generate reference current iref . mirror transistors p 31 and p 32 are identical . mirror transistor n 35 contains two parallel channel regions , each identical to the single channel of mirror transistor n 34 , and thus generates twice the current as n 34 . reference 500 is designed to produce a 50 μa current through n 34 ( and thus a 100 μa current iref ) when vdd − vss = 3 . 3 v . fig1 illustrates one application of an i / o cell embodiment in an integrated circuit , e . g ., an image processor circuit that manipulates input video and / or graphics signals ( not shown ) to produce signals appropriate for a display device . programmable timing controller ( tcon ) 620 accepts display data , e . g ., as n - bit - wide data words . microprocessor 610 configures tcon 620 , using bus signaling on bus 612 , in one of several possible output modes . for instance in one mode , tcon 620 could drive all n bits of a data word in parallel — through the n / 2 i / o cells 100 — on display port pads pad 0 through pad ( n − 1 ) in one output clock cycle as cmos / ttl single - ended outputs . in another mode , tcon 620 could drive n / 2 of the n bits in parallel in two consecutive output clock cycles — this time using each i / o cell 100 to drive one bit differentially — across two pads — during each clock cycle . or , in another mode tcon 620 could read an input word from the i / o cells and transmit the word to the microprocessor . in each mode , tcon 620 generates the appropriate drvsel , oen , and diffsel signals to each i / o cell 100 to configure the i / o cell in the appropriate mode . for comparison , a general - purpose i / o ( gpio ) interface 630 is also shown connected to bus 612 . gpio unit 630 connects to port a pads gp 0 to gp ( m − 1 ) through conventional i / o cells 640 . although not shown exactly to scale , the comparison is intended to represent that the multimode i / o cells 100 take up no more room , on a per - pad basis , than the conventional cells 640 . the multimode examples presented above are merely exemplary — for instance , the data word width and number of display port pads need not match , and the timing need not be as expressed . tcon 620 can use any of a variety of multiplexing schemes to drive data on the output pads . the illustrations are intended only to demonstrate the flexibility of such an integrated circuit in interfacing with different external display circuitry . one of ordinary skill in the art will recognize that the concepts taught herein can be tailored to a particular application in many other advantageous ways . for instance , although rsds signaling is shown , another signaling format , such as lvds ( low voltage differential signaling ) could be employed — or configurable voltage and current references could be used to supply signals in multiple programmable differential formats . in general , the voltages , currents , resistance values , transistor ratios and configurations , etc . disclosed herein merely demonstrate a few implementations , and can be readily adapted to other implementations . although a “ pad ” includes bonding pads such as typical in the industry , the exact mechanism used to interface the circuit with external circuitry is not critical to the invention , and thus a “ pad ” could include any such mechanism . such minor modifications are encompassed within the invention , and are intended to fall within the scope of the claims . the preceding embodiments are exemplary . although the specification may refer to “ an ”, “ one ”, “ another ”, or “ some ” embodiment ( s ) in several locations , this does not necessarily mean that each such reference is to the same embodiment ( s ), or that the feature only applies to a single embodiment .	7
a technical solution herein is elaborated below with reference to drawings and embodiments . a transaction system according to an embodiment herein , as shown in fig1 , mainly may include an online mall server , a physical store terminal , and a user terminal , among which information may be delivered through interaction channels . an online mall may include various virtual stores implementing business to business ( b2b ), business to customer ( b2c ), customer to customer ( c2c ), online to offline ( o2o ) buying and selling , and the like . compared with a virtual store , a physical store may be a conventional marketplace , a shopping center , a storefront , or a new experience store established by a virtual store . there may be multiple physical stores , each physical store may include a physical store terminal . the physical store terminal may be configured for maintaining information on the local physical store ( the physical store where the physical store terminal is arranged ). a user terminal may be a personal device for user shopping , and may be a mobile terminal , a pc , a laptop , and the like , or a combination thereof . an interaction channel may be configured for completing system information delivery . a physical bearer of an interaction channel may be a network of any type and / or form . such a bearer network may include any of a point to point network , a broadcast network , a wide area network , a local area network , a remote communication network , a data communication network , a computer network , an asynchronous transfer mode ( atm ) network , a synchronous optical network ( sonet ), a synchronous digital hierarchy ( sdh ) network , a wireless network , and a wired network . an interaction channel 1 may be that between a user terminal and an online mall server , for which a cellular wireless network may be selected as a bearer . through the interaction channel , a terminal user may log in to an online mall , browse and select a list of commodities as needed . the online mall server may acquire , according to the list of commodities , stored information on commodities in physical stores ; look for a proper physical store for the user according to a strategy , and transfer information on the name and location of the physical store and the like to the user terminal through the interaction channel . an interaction channel 2 may be that between a user terminal and a physical store terminal , for which a wifi network may be selected as a bearer . after arriving at the physical store , the user may acquire , through the interaction channel , a specific location of a commodity corresponding to the list of commodities in the physical store , such that the user may select or experience the commodity . the physical store terminal may also transfer other relevant information , such as broadcast information , to the user terminal through the interaction channel . an interaction channel 3 may be that between an online mall server and a physical store terminal , for which a wired network may be selected as a bearer . through the interaction channel , physical store information may be transferred to the online mall server . the physical store information may include information on the name of a physical store , the location of the physical store , a commodity in the physical store , and the like . the physical store information may further include information on the location of a commodity ( in the physical store , such as a floor , a shelf ), and the like . the online mall server may also initiate a requirement to a physical store terminal to report information dynamically as needed . in the transaction system , the online mall server may be configured for : managing physical store information ; receiving login by the user terminal ; searching , according to a selected list of commodities submitted by the user terminal , for information on physical stores having a commodity in the list ; selecting , according to a selecting strategy , a physical store from the physical stores having a commodity in the list ; sending information on a name and a location of the selected physical store to the user terminal . the physical store terminal may be configured for : managing information on a local physical store ; reporting the information on the local physical store to the online mall server ; searching for information on a location of a commodity in the local physical store according to the list of commodities reported by the user terminal , and feeding the found information on the location of the commodity back to the user terminal . the user terminal may be configured for : logging in to the online mall server ; selecting commodities and submitting the selected list of commodities ; receiving the information on the name and the location of the physical store selected by the online mall server for the user terminal ; reporting the list of commodities to a physical store terminal of the physical store selected by the online mall server ; receiving information on a location of a commodity fed back by the physical store terminal of the selected physical store . the user terminal may be further configured for : finding the commodity in the selected physical store according to the received information on the location of the commodity , and paying for the commodity by interacting with the online mall server or the physical store terminal of the selected physical store . the physical store terminal may be further configured for : searching for a tag of the commodity corresponding to the list of commodities reported by the user terminal , and feeding the found tag of the commodity back to the user terminal . the user terminal may be further configured for : scanning the received tag of the commodity in a physical store , and checking the commodity according to a result of the scanning . a tag of a commodity may be one of a near field communication ( nfc ) tag , a wireless radio frequency identification ( rfid ) tag , and a quick response code . with the system , while being logged in to an online mall , a terminal user may browse commodities to be purchased , select and then submit a list of commodities ; an online mall server may acquire stored physical store information according to the list of commodities , select a physical store according to a strategy , and transfer information on the name and the location of the selected physical store to the user terminal . after arriving at the physical store , the user may acquire information on the specific location of the commodities in the physical store , select or experience a commodity ; network payment may be made through the online mall or on - site payment may be made directly at the physical store for a subsequent purchase , thereby greatly increasing means and experience of shopping . fig2 shows a diagram of internal structures of an online mall server , a physical store terminal , and a user terminal in a transaction system according to an embodiment herein . the online mall server may include a physical store managing module , a first terminal interaction module , and a first physical store interaction module . the physical store managing module may be configured for : managing physical store information ; receiving login by a user terminal ; searching , according to a selected list of commodities submitted by the user terminal , for information on physical stores having a commodity in the list ; selecting , according to a selecting strategy , a physical store from the physical stores having a commodity in the list ; sending , through the first terminal interaction module , information on a name and a location of the selected physical store to the user terminal . the first terminal interaction module may be configured for : delivering information between the online mall server and the user terminal . the information delivered between the online mall server and the user terminal may include at least : information delivered during login of the user terminal , the selected list of commodities submitted by the user terminal received by the online mall server , and information delivered during commodity payment between the online mall server and the user terminal . the first physical store interaction module may be configured for : delivering information between the online mall server and a physical store terminal . the information delivered between the online mall server and the physical store terminal may include at least physical store information reported by the physical store terminal received by the online mall server . to increase processing efficiency , the physical store managing module may manage the physical store information by way of a database . the physical store terminal may include a commodity managing module , a second terminal interaction module , and a first network interaction module . the commodity managing module may be configured for : managing information on a local physical store ; searching for information on a location of a commodity corresponding to a list of commodities reported by a user terminal . the second terminal interaction module may be configured for : receiving the list of commodities reported by the user terminal , and feeding the found information on the location of the commodity back to the user terminal . the first network interaction module may be configured for : reporting the information on the local physical store to an online mall server . the second terminal interaction module may be further configured for interacting with the user terminal to complete commodity payment . the user terminal may include a shopping module , a second network interaction module , an information storing module , a second physical store interaction module , and a paying module . the shopping module may be configured for : logging in , through the second network interaction module , to an online mall server , selecting commodities and submitting a selected list of commodities . the second network interaction module may be configured for delivering information between the user terminal and the online mall server . the information storing module may be configured for : receiving and storing information on a name and a location of a physical store selected by the online mall server for the user terminal . the second physical store interaction module may be configured for : reporting the list of commodities to a physical store terminal of the physical store selected by the online mall server , and receiving information on a location of a commodity fed back by the physical store terminal of the selected physical store . the paying module may be configured for : paying for the commodity by interacting with the online mall server or the physical store terminal . the user terminal may further include a displaying module configured for information display and user interface interaction during shopping and paying . the user terminal may further include a navigation module configured for performing global positioning system ( gps ) navigation according to information on the location of a commodity fed back by a physical store terminal as well as information on the location of the user terminal . a transaction method implemented by a transaction system according to an embodiment herein , as shown in fig3 , mainly may include steps as follows . in step 301 , an online mall server manages physical store information ; receives login by a user terminal ; searches , according to a selected list of commodities submitted by the user terminal , for information on physical stores having a commodity in the list ; selects , according to a selecting strategy , a physical store from the physical stores having a commodity in the list ; sends information on a name and a location of the selected physical store to the user terminal . in step 302 , the user terminal reports the list of commodities to a physical store terminal of the selected physical store . in step 303 , the physical store terminal searches for information on a location of a commodity corresponding to the list of commodities reported by the user terminal , and feeds the found information on the location of the commodity back to the user terminal . in step 304 , the user terminal finds the commodity in the physical store according to the received information on the location of the commodity , and pays for the commodity by interacting with the online mall server or the physical store terminal . the physical store terminal may search for a tag of the commodity corresponding to the list of commodities reported by the user terminal , and feed the found tag of the commodity back to the user terminal . the user terminal may scan the received tag of the commodity , and check the commodity according to a result of the scanning . a tag of a commodity may be one of an nfc tag , an rfid tag , and a quick response code . the physical store information may include information on a name of a physical store , a location of the physical store , and a commodity in the physical store . the physical store information may further include information on a location of the commodity in the physical store . the transaction method is further elaborated below with reference to an embodiment . in the embodiment , a terminal user plans to buy 3 commodities a , b , c in an online mall and wishes to experience the commodities and make payment at a nearby physical store . the user terminal supports gps navigation , wifi , and nfc . a physical store terminal regularly reports commodities relevant information to the online mall server . for precise management , each commodity may be provided with an nfc tag for user search and check . the transaction method mainly may include steps as follows . in step a , a terminal user may select a commodity in an online mall and form a selected list of commodities . in step b , a selecting strategy may include that based on nearby experience and that based on experience once for all ; the terminal user may select nearby experience , and input a current geographical location of the terminal user . in step c , an online mall server may traverse all physical stores having the commodity a , b , or c in the selected list of commodities , select a physical store m according to a nearby principle , transfer the address of the physical store m to the user terminal . of course , the online mall server may select multiple physical stores for the user , and it &# 39 ; s up to the user to select the physical store ( s ) where to shop . in step d , the user terminal may start a gps navigation system and arrive at the physical store m . in step e , the user terminal may transfer the list of commodities to a terminal of the physical store m through wifi in the physical store m . the list of commodities may include information on a , b , c . the list of commodities may of course include information on only one or at least one commodity the user desires to experience or purchase . in step f , the terminal of the physical store m may find information on the location of a commodity in the local physical store according to the received list of commodities , return the found information as well as an nfc tag thereof to the user terminal . in step g , the terminal user may find the commodity according to the received information on the location of the commodity . in step h , the user terminal may check the commodity by reading the nfc tag of the commodity . in step i , the terminal user may determine to purchase the commodity and form a payment list . in step j , nfc payment may be made in the physical store m using the user terminal . in step k , the user may pick up the commodity at the physical store m , completing the whole transaction . to sum up , with embodiments herein , online and offline resources of a virtual online mall and a physical store or an experience store can be combined , implementing search and selection among massive commodity information ; complementary advantages of virtual online shopping and of physical store shopping can be combined , greatly increasing user experience in shopping , ensuring shopping quality . what described are merely embodiments of the present disclosure and are not intended to limit the protection scope of the present disclosure .	6
an assembly for injecting a probe into a tire t is indicated generally by the numeral 10 in fig1 . tire t is shown in a mold m with the mold being surrounded by an enclosed steam dome d which forms a cavity that receives steam under pressure to heat the mold m . mold m is recessed to receive a generally cylindrical housing 11 which includes an annular flange 12 . a plurality of fasteners 13 extend through flange 12 and into the mold to hold housing 11 in place , with an o - ring seal 14 being provided between housing 11 and the mold . a portion of an internal diameter of flange 12 is threaded to receive a bearing gland 15 with o - ring 16 providing a seal between housing 11 and gland 15 . a hollow cylindrical - like movable member or piston , indicated generally by the numeral 18 , is slidably received within gland 15 with o - ring 19 providing a seal therebetween . piston 18 is formed with an internally projecting annular hub - like portion 20 which is threaded to receive and carry a probe assembly , indicated generally by the numeral 21 , which is locked in place by nut 22 so that it will move with piston 18 . an o - ring provides a seal between probe assembly 21 and hub 20 . probe assembly 21 includes the temperature sensitive probe 24 , itself , which is preferably a thermistor , but which may be any temperature sensitive device , a body portion 25 , and a conduit 26 extending from the rear of body portion 25 and through steam dome d with appropriate seals , not shown . conduit 26 thus carries the electrical signal out of the steam dome and , as will hereinafter be described , also enables a fluid input to pass into housing 11 for retracting the probe . the electronic signal from probe assembly 21 may thereafter be utilized by an electronic control device , such as that shown in smith u . s . pat . no . 4 , 022 , 555 , to which reference is made for whatever details are necessary to fully understand this invention , and the vulcanization of the tire is thereby controlled based on the temperature data sensed by probe 24 . housing 11 is provided with a bearing gland 28 and embossment 29 through which probe 24 extends with an appropriate o - ring seal 30 . probe 24 also extends through an insulating sleeve 31 in mold m which prevents the probe from picking up extraneous heat from the mold . a cylindrical stroke adjustment screw , indicated generally by the numeral 32 is adjustably threaded into piston 18 so as to be positioned with respect to piston 18 at varying locations . a lock nut 33 threads onto adjusting screw 32 so that once it is properly positioned with respect to piston 18 , lock nut 33 can be tightened to hold screw 32 in place . as shown in fig1 screw 32 is in a position to allow piston 18 to move its full stroke before screw 32 bottoms out against the end wall of housing 11 . adjusting screw 32 is also provided with a plurality of centering lugs 34 through which the body of probe 24 centrally passes . the operation of the device of fig1 should now be evident . usually it is desirable to insert probe 24 into the point of slowest cure of the tire usually located within the thick shoulder portion of the tire t . with that depth being known , adjusting screw 32 is set and locked accordingly by merely removing bearing gland 15 for access to screw 32 . fluid pressure , usually in the form of air from a pneumatic source ( not shown ) is then introduced through conduit 26 . the body portion 25 of probe assembly 21 is provided with an aperture which permits the air pressure to pass into chamber 35 within housing 11 thereby assuring that the tip of probe 24 is fully retracted by acting on the exposed surfaces of piston 18 . the tire is then loaded in the mold and the mold closed . shortly after this time steam is admitted into steam dome d to initiate heating the mold . although the injection of the probe could be essentially simultaneous with the admission of steam to the steam dome , usually after a predetermined small time delay the air is exhausted out of chamber 35 enabling the steam pressure to act on the exposed surfaces of piston 18 to inject probe 24 into tire t to the depth determined by adjusting screw 32 . the probe may now obtain temperature data from the shoulder portion of the tire and transmit the same for cure control purposes . near the end of the curing process the steam is released and thereafter , prior to opening the mold and removing the tire , chamber 35 may again be pressurized to retract the probe . the system would then stand ready for another cure cycle . an alternate assembly for injecting a probe into a tire t is indicated generally by the numeral 50 in fig2 . as in the fig1 embodiment , tire t is somewhat schematically shown in a mold m which is surrounded by a steam dome d . mold m is recessed to receive a housing or guide , indicated generally by the numeral 51 , and including a circular back plate 52 , a cylindrical member 53 bearing against back plate 52 , and an annular flange 54 welded to cylindrical member 53 . housing 51 is fastened to mold m by a plurality of screws 55 extending through flange 54 . o - ring 56 provides a seal between back plate 52 and mold m . prior to affixing housing 51 to mold m , a stationary cylinder head 58 is affixed to back plate 52 , as by screws 59 , with o - ring seal 60 therebetween . a hollow cylindrical - like movable member or piston , indicated generally by the numeral 61 , is slidably received within head 58 . the axially inner portion of piston 61 includes an interrupted flange formed of four segments 62 each extending approximately 45 ° of the circumference . the axially outer portion of head 58 has an interrupted flange of four similar segments 63 so that piston 61 may be inserted in head 58 by misaligning segments 62 with segments 63 . then a 45 ° rotation of piston 61 will cause the segments to interfere . the axially outer end of piston 61 is provided with a keyway to receive a key 64 to affix piston 61 to a movable head 65 . an o - ring 66 is provided between piston 61 and head 65 . key 64 is oriented such that segments 62 and 63 will be maintained interfering when locked in place . a clamp ring 68 is threaded onto movable head 65 and effectively holds all the movable members in place within housing 51 and stationary head 65 . a metallic bellows 69 is attached , as by soldering , to stationary head 58 and movable head 65 provides an effective area upon which the steam dome pressure acts to provide the driving force for probe insertion and effectively seals the operating mechanisms of the present invention to isolate the same from the steam in steam dome d . piston 61 is internally threaded at its axially outer end to receive and carry a probe assembly indicated generally by the numeral 70 and substantially identical to probe assembly 21 of fig1 . probe assembly 70 is locked to piston 61 by nut 71 and includes a temperature sensitive probe 72 , a body portion 73 , and a conduit 74 which extends through steam dome d with appropriate seals , not shown . conduit 74 thus carries the electrical signal out of the steam dome for processing , as previously described with respect to the fig1 embodiment and also provides a fluid input for head 58 and the interior of bellows 69 . an o - ring seal 75 is provided between body portion 73 of probe 71 and piston 61 . a cylindrical stroke adjustment screw 76 is adjustably threaded into the axially inner end of piston 61 so as to be positioned with respect to piston 61 at varying locations . a lock nut 78 also threads onto screw 76 so that once it is properly positioned with respect to piston 61 , lock nut 78 can be tightened to hold screw 76 in place . as shown in fig2 screw 76 is in a position to allow piston 76 to move its full stroke before bottoming out against stationary head 58 . as the piston does move , probe 72 passes through the apertured end 79 of head 58 , through an insulating sleeve 80 in mold m and on into tire t . the operation of the fig2 embodiment is substantially identical to that of fig1 and will be only summarized herein . adjusting screw 76 may be set for proper probe insertion depth by removing clamp ring 68 for access thereto . fluid pressure is introduced through conduit 74 and through an aperture in body portion 73 of probe assembly 70 to pressurize chamber 81 within stationary head 58 and bellows 69 , to fully retract the probe and expand bellows 69 to the position shown . introduction of steam into dome d and exhaustion of the fluid in chamber 81 enables the steam pressure to work essentially on the effective area of the bellows and other external surfaces to inject the probe . it should thus be evident that a probe injection system constructed and operated according to either embodiment disclosed herein will accomplish the objects of the present invention and otherwise substantially improve the cure control art .	1
fig2 shows a circuit which relates to the present invention . as described in prior art the circuit 200 comprises three inputs 202 , 204 and 206 for three signals 208 , 210 and 212 . the signal 208 may be an audio digital signal with a first type of sample rate such as a voice signal . the sample rate of such a signal is usually low . the signal 208 is a narrow band signal . this voice signal 208 relates to a phone call which the user receives on a mobile phone . a voice signal usually comprises a 13 - bits or 14 - bits coded structure . the signals 210 and 212 may be other audio digital signal with a second type of sample rate such as a music signal . the sample rate for this music signal is usually higher than a voice signal . the signals 210 and 212 are wide band signals . the combination of these two signals 210 and 212 represent a stereo music signal . these wide band signals 210 and 212 represent a music signal . a music signal usually comprises a 16 - bits ( or more ) coded structure . this means that 16 bits belong to one signal . a music signal relates for instance to a signal corresponding to an mp3 file already registered on storage means of the mobile phone for instance . the circuit 200 also comprises three corresponding serial parallel interface or interface module 214 for each signal . differing with the prior art , a multiplexing module 216 is located after the interface modules 214 . the multiplexing module 216 receives each signal coming either from interface modules 214 related to the first input 202 or related to the second and third input 204 and 206 or to all entries 202 , 204 and 206 in order to pass them to further digital analog converters 224 and 226 . a spi ( serial parallel interface ) bus register module 220 passes specific information to the multiplexing module 216 . the spi bus register module is a module which may be programmed in advance during the phone operation . this spi bus register module 220 carries out selecting functions and determining functions in order to send specific information to the multiplexing module 216 . this specific information relates to the number of the input signals . the spi bus register module 220 generates a number equal to one if there is only signal 208 as an input signal , a number equal to two if there are both input signals 210 and 212 ; and a number equal to three if there are input signals 208 , 210 and 212 . the spi bus register module 220 also transmits information relating to the type of the input signals i . e . voice type or music type . the spi bus register module 220 detects the sample rate of each input signal 208 , 210 or 212 . thus knowing these both pieces of information concerning the number of the signals and the type of the signals , the multiplexing module 216 is able to pass one or more input signals on one or more corresponding connection lines . then the multiplexing module 216 determines to which digital analog converters 224 and 226 to send the audio digital signals 208 , 210 , 212 using the connection lines 232 , 234 , 236 , 240 . also differing from the prior art , the circuit 200 comprises a combining module 228 . this combining module allows combining both audio digital stereo signals 210 and 212 into an audio digital mono signal 230 . this combining module 228 comprises a first function to add the instantaneous amplitudes of signal 210 and signal 212 and a second function to divide by two the total resulting amplitude in order to avoid an overflow of the component 300 which comprises a digital filter . this overflow relates to a hardware limitation of such a component . the combination of both functions addition and division provides a stereo to mono function . this means that the stereo input signal becomes a mono signal after the combination process . from the multiplexing module 216 to the digital analog converters 224 and 226 , the circuit 200 comprises different connection lines . connection line 232 connects the multiplexing module 216 and the digital analog converter 224 . connection line 232 refers to the conversion line for the voice signal 208 and also for one of the two stereo signals 210 and 212 as signal 210 for instance . connection line 234 connects the multiplexing module 216 and the combining module 228 . connection line 234 refers to the connection line for one of the two stereo signals 210 and 212 as signal 210 for instance . connection line 236 also connects the multiplexing module 216 and the combining module 228 . connection line 236 refers to the conversion line for the other of the two stereo signals 210 and 212 as signal 212 for instance . connection line 238 connects the combining module 228 to the digital to audio converter 226 and refers to the conversion line for the audio combined mono signal 230 . connection line 240 connects the multiplexing module 216 to the digital to audio converter 226 and refers to the other of the two stereo signals 210 and 212 as for instance signal 212 . the use of these different connection lines depends on the number and type of input signals the spi bus register module 220 sends to the multiplexing module 216 . this will now be explained in more detail . three situations may occur in the circuit 200 . as described in fig3 , the circuit 200 only processes a mono voice signal 208 to the multiplexing module 216 . therefore the spi register module 220 sets the number of digital audio input signals register to one referring to signal 208 . in the same way the spi register module 200 sets the type of bandwidth to narrow band as the signal 208 is a voice signal . thus the multiplexing module 216 transmits the signal 208 to the digital analog converter 224 through the connection line 232 . in this situation there is one resulting analog signal 242 representing analog voice signal . as described in fig4 , another situation may occur where the circuit 200 only processes stereo signals 210 and 212 to the multiplexing module 216 . therefore the spi register module 220 sets the number of digital audio input signals to two referring to signal 210 and 212 . in the same way , the spi register module 220 sets the type of bandwidth to wide band as both signals relate to a music signal . as the spi register module 220 does not select any other signal , the multiplexing module 216 determines that the connection line 232 is available . thus the multiplexing module 216 transmits signal 210 i . e . one of the two stereo signals to the digital analog converter 224 through the connection line 232 . the multiplexing module 216 sends the other stereo signal 212 to the digital to audio converter 226 through the connection line 240 . in this situation there are two resulting signals 244 and 246 representing analog stereo music signals . as described in fig5 , another situation may occur where the circuit 200 processes three signals 208 , 210 and 212 to the multiplexing module 216 . therefore the spi register module 220 sets the number of digital audio input signals to three referring to signal 208 , 210 and 212 . in this situation , the spi register module 220 selects different types of bandwidth . the signal 208 has a narrow bandwidth and signals 210 and 212 have a wide bandwidth . in order to convert simultaneously the three different signals , the multiplexing module 216 transmits in a different way all these three signals . the multiplexing module 216 transmits the voice signal 208 to the digital audio converter 224 through connection line 232 . simultaneously the multiplexing module transmits the first stereo signal 210 to the combining module 228 through the connection line 234 and the second stereo signal 212 to the combining module 228 through the connection line 236 . the combining module 228 processes both signals 210 and 212 to provide a mono signal 230 . this mono signal uses connection line 238 to reach digital audio converter 226 . in this situation there are two resulting signals , 242 and 248 . the signal 242 represents the analog mono voice signal and the signal 248 represents the analog mono music signal resulting from the digital stereo - to - mono conversion of the signals 210 and 212 . digital analog converters 224 and 226 comprise the same elements . these elements are detailed on fig6 for dac 224 . the same description is valid for dac 226 . in fig6 , dac 224 comprises a digital filter 300 , a sigma delta modulator 302 , a d - to - a filter 304 and smoothing filter 306 . the components 300 and 302 process a digital transformation of the signal to be converted . the components 304 and 306 process an analog transformation of the signal . according to situations described in fig3 and in fig5 , the different components of the dac 224 have to be adaptive in order to manage and process both voice signal 208 and music signal 210 according to one of the three above mentioned situations that may occur in the whole circuit 200 . in case of a narrow band signal processing , the different components of the dac 224 are adapted in order to minimize the power consumption . in case of a wide band signal processing , the different components of the dac 224 are adapted in order to maximize the audio performances defined as signal - to - noise ratio and total harmonic distortion . the process of the combining module 228 as shown in fig5 will now be described . in the situation described for fig5 , three signals enter the circuit 200 . the multiplexing module 216 receives these threes signals and then as described above in the description it transmits two digital stereo signals having the same sample rate to the combining module 228 . this combining module 228 processes two transforming functions on the two signals 210 and 212 . the first function is to add both instantaneous amplitudes of the two signals to obtain resulting amplitude . the second function is to divide by two the resulting amplitude . so the amplitude of the resulting signal 230 is an average amplitude from the two signals 210 and 212 . the second function is mandatory to avoid an overflow of the digital filters 300 when both signals 210 and 212 have a full scale amplitude . additionally the signal 230 is now a mono digital signal . it will be appreciated the examples described above are just that . other alternatives may exist which fall within the scope of the present invention . in particular it will be appreciated that this invention can be implemented in software . also the invention can be adapted to occur with any number of input signals , with the objective of reducing the number of converters , to be less than the number of input signals .	7
reference will now be made in detail to an illustrative embodiment of the invention , which appears in the accompanying drawings . wherever possible , the same reference numbers will be used throughout the drawings to refer to the same or like parts . in one embodiment of the present invention , as shown in fig7 a , a damaged annulus 42 is repaired by use of surgical sutures 40 . one or more surgical sutures 40 are placed at about equal distances along the sides of a pathologic aperture 44 in the annulus 42 . reapproximation or closure of the aperture 44 is accomplished by tying the sutures 40 so that the sides of the aperture 44 are drawn together . the reapproximation or closure of the aperture 44 enhances the natural healing and subsequent reconstruction by the natural tissue ( e . g ., fibroblasts ) crossing the now surgically narrowed gap in the annulus 42 . preferably , the surgical sutures 40 are biodegradable , but permanent non - biodegradable may be utilized . additionally , to repair a weakened or thinned wall of a disc annulus 42 , a surgical incision is made along the weakened or thinned region of the annulus 42 and one or more surgical sutures 40 can be placed at about equal distances laterally from the incision . reapproximation or closure of the incision is accomplished by tying the sutures 40 so that the sides of the incision are drawn together . the reapproximation or closure of the incision enhances the natural healing and subsequent reconstruction by the natural tissue crossing the now surgically narrowed gap in the annulus 42 . preferably , the surgical sutures 40 are biodegradable , but permanent non - biodegradable materials may be utilized . in an alternative embodiment as depicted in fig7 b , the method can be augmented by the placement of a patch of human muscle fascia or any other autograft , autograft or xenograft in and across the aperture 44 . the patch acts as a bridge in and across the aperture 44 , providing a platform for traverse of fibroblasts or other normal cells of repair existing in and around the various layers of the disc annulus 42 , prior to closure of the aperture 44 . in a further embodiment , as shown in fig8 a – b a biocompatible membrane can be employed as an annulus stent 10 , being placed in and across the aperture 44 . the annulus stent 10 acts as a bridge in and across the aperture 44 , providing a platform for a traverse of fibroblasts or other normal cells of repair existing in and around the various layers of the disc annulus 42 , prior to closure of the aperture 44 . in an illustrative embodiment , as shown in fig1 – 3 , the annulus stent 10 comprises a centralized vertical extension 12 , with an upper section 14 and a lower section 16 . the centralized vertical extension 12 can be trapezoid in shape through the width and may be from about 8 mm – 12 mm in length . additionally , the upper section 14 of the centralized vertical extension 12 may be any number of different shapes , as shown in fig4 a and 4b , with the sides of the upper section 14 being curved or with the upper section 14 being circular in shape . furthermore , the annulus stent 10 may contain a recess between the upper section 14 and the lower section 16 , enabling the annulus stent 10 to form a compatible fit with the edges of the aperture 44 . the upper section 14 of the centralized vertical extension 12 can comprise a slot 18 , where the slot 18 forms an orifice through the upper section 14 . the slot 18 is positioned within the upper section 14 such that it traverses the upper section &# 39 ; s 14 longitudinal axis . the slot 18 is of such a size and shape that sutures , tension bands , staples or any other type of fixation device known in the art may be passed through , to affix the annulus stent 10 to the disc annulus 42 . in an alternative embodiment , the upper section 14 of the centralized vertical extension 12 may be perforated . the perforated upper section 14 contains a plurality of holes that traverse the longitudinal axis of upper section 14 . the perforations are of such a size and shape that sutures , tension bands , staples or any other type of fixation device known the art may be passed through , to affix the annulus stent 10 to the disc annulus 42 . the lower section 16 of the centralized vertical extension 12 can comprise a pair of lateral extensions , a left lateral extension 20 and a right lateral extension 22 . the lateral extensions 20 and 22 comprise an inside edge 24 , an outside edge 26 , an upper surface 28 , and a lower surface 30 . the lateral extensions 20 and 22 can have an essentially constant thickness throughout . the inside edge 24 is attached to and is about the same length as the lower section 16 . the outside edge 26 can be about 8 mm – 16 mm in length . the inside edge 24 and the lower section 16 meet to form a horizontal plane , essentially perpendicular to the centralized vertical extension 12 . the upper surface 28 of the lateral extensions 20 and 22 can form an angle from about 0 °– 60 ° below the horizontal plane . the width of the annulus stent 10 may be from about 3 mm – 5 mm . additionally , the upper surface 28 of the lateral extensions 20 and 22 may be barbed for fixation to the inside surface of the disc annulus 42 and to resist expulsion through the aperture 44 . in an alternative embodiment , as shown in fig4 b , the lateral extensions 20 and 22 have a greater thickness at the inside edge 24 than at the outside edge 26 . in an illustrative embodiment , the annulus stent 10 is a solid unit , formed from one or more of the flexible resilient biocompatible or bioresorbable materials well know in the art . for example , the annulus stent 10 may be made from : a porous matrix or mesh of biocompatible and bioresorbable fibers acting as a scaffold to regenerate disc tissue and replace annulus fibrosus as disclosed in , for example , u . s . pat . no . 5 , 108 , 438 ( stone ) and u . s . pat . no . 5 , 258 , 043 ( stone ), a strong network of inert fibers intermingled with a bioresorbable ( or bioabsorable ) material which attracts tissue ingrowth as disclosed in , for example , u . s . pat . no . 4 , 904 , 260 ( ray et al . ); a biodegradable substrate as disclosed in , for example , u . s . pat . no . 5 , 964 , 807 ( gan at al . ); or an expandable polytetrafluoroethylene ( eptfe ), as used for conventional vascular grafts , such as those sold by w . l . gore and associates , inc . under the trademarks gore - tex and preclude , or by impra , inc . under the trademark impra . furthermore , the annulus stent 10 , may contain hygroscopic material for a controlled limited expansion of the annulus stent 10 to fill the evacuated disc space cavity . additionally , the annulus stent 10 may comprise materials to facilitate regeneration of disc tissue , such as bioactive silica - based materials that assist in regeneration of disc tissue as disclosed in u . s . pat . no . 5 , 849 , 331 ( ducheyne , et al . ), or other tissue growth factors well known in the art . in further embodiments , as shown in fig5 ab – 6 ab , the left and right lateral extensions 20 and 22 join to form a solid pyramid or cone . additionally , the left and right lateral extensions 20 and 22 may form a solid trapezoid , wedge , or bullet shape . the solid formation may be a solid biocompatible or bioresorbable flexible material , allowing the lateral extensions 20 and 22 to be compressed for insertion into aperture 44 , then to expand conforming to the shape of the annulus &# 39 ; 42 inner wall . alternatively , a compressible core may be attached to the lower surface 30 of the lateral extensions 20 and 22 , forming a pyramid , cone , trapezoid , wedge , or bullet shape . the compressible core may be made from one of the biocompatible or bioresorbable resilient foams well known in the art . the core can also comprise a fluid - expandable membrane , e . g ., a balloon . the compressible core allows the lateral extensions 20 and 22 to be compressed for insertion into aperture 44 , then to expand conforming to the shape of the annulus &# 39 ; 42 inner wall and to the cavity created by pathologic extrusion or surgical removal of the disc fragment . in an illustrative method of use , as shown in fig1 a – d , the lateral extensions 20 and 22 are compressed together for insertion into the aperture 44 of the disc annulus 42 . the annulus stent 10 is then inserted into the aperture 44 , where the lateral extensions 20 , 22 expand . in an expanded configuration , the upper surface 28 can substantially conform to the contour of the inside surface of the disc annulus 42 . the upper section 14 is positioned within the aperture 44 so that the annulus stent 10 may be secured to the disc annulus 42 , using means well known in the art . in an alternative method , where the length of the aperture 44 is less than the length of the outside edge 26 of the annulus stent 10 , the annulus stent 10 can be inserted laterally into the aperture 44 . the lateral extensions 20 and 22 are compressed , and the annulus stent 10 can then be laterally inserted into the aperture 44 . the annulus stent 10 can then be rotated inside the disc annulus 42 , such that the upper section 14 can be held back through the aperture 44 . the lateral extensions 20 and 22 are then allowed to expand , with the upper surface 28 contouring to the inside surface of the disc annulus 42 . the upper section 14 can be positioned within , or proximate to , the aperture 44 in the subannular space such that the annulus stent 10 may be secured to the disc annulus , using means well known in the art . in an alternative method of securing the annulus stent 10 in the aperture 44 , as shown in fig9 , a first surgical screw 50 and second surgical screw 52 , with eyeholes 53 located at the top of the screws 50 and 52 , are opposingly inserted into the adjacent vertebrae 54 and 56 below the annulus stent 10 . after insertion of the annulus stent 10 into the aperture 44 , a suture 40 is passed down though the disc annulus 42 , adjacent to the aperture 44 , through the eye hole 53 on the first screw 50 then back up through the disc annulus 42 and through the orifice 18 on the annulus stent 10 . this is repeated for the second screw 52 , after which the suture 40 is secured . one or more surgical sutures 40 are placed at about equal distances along the sides of the aperture 44 in the disc annulus 42 . reapproximation or closure of the aperture 44 is accomplished by tying the sutures 40 in such a fashion that the sides of the aperture 44 are drawn together . the reapproximation or closure of the aperture 44 enhances the natural healing and subsequent reconstruction by the natural tissue crossing the now surgically narrowed gap in the annulus 42 . preferably , the surgical sutures 40 are biodegradable but permanent non - biodegradable forms may be utilized . this method should decrease the strain on the disc annulus 42 adjacent to the aperture 44 , precluding the tearing of the sutures through the disc annulus 42 . it is anticipated that fibroblasts will engage the fibers of the polymer or fabric of the intervertebral disc stent 10 , forming a strong wall duplicating the currently existing condition of healing seen in the normal reparative process . in an additional embodiment , as shown in fig1 a – b , a flexible bladder 60 is attached to the lower surface 30 of the annulus stent 10 . the flexible bladder 60 comprises an internal cavity 62 surrounded by a membrane 64 , where the membrane 64 is made from a thin flexible biocompatible material . the flexible bladder 60 is attached to the lower surface 30 of the annulus stent 10 in an unexpanded condition . the flexible bladder 60 is expanded by injecting a biocompatible fluid or expansive foam , as known in the art , into the internal cavity 62 . the exact size of the flexible bladder 60 can be varied for different individuals . the typical size of an adult nucleus is about 2 cm in the semi - minor axis , 4 cm in the semi - major axis , and 1 . 2 cm in thickness . in an alternative embodiment , the membrane 64 is made of a semi - permeable biocompatible material . in an illustrative embodiment , a hydrogel is injected into the internal cavity 62 of the flexible bladder 60 . a hydrogel is a substance formed when an organic polymer ( natural or synthetic ) is cross - linked via , covalent , ionic , or hydrogen bonds to create a three - dimensional open - lattice structure , which entraps water molecules to form a gel . the hydrogel may be used in either the hydrated or dehydrated form . in a method of use , where the annulus stent 10 has been inserted into the aperture 44 , as has been previously described and shown in fig1 a – b , an injection instrument , as known in the art , such as a syringe , is used to inject the biocompatible fluid or expansive foam into the internal cavity 62 of the flexible bladder 60 . the biocompatible fluid or expansive foam is injected through the annulus stent 10 into the internal cavity 62 of the flexible bladder 60 . sufficient material is injected into the internal cavity 62 to expand the flexible bladder 60 to fill the void in the intervertebral disc cavity . the use of the flexible bladder 60 is particularly useful when it is required to remove all or part of the intervertebral disc nucleus . the surgical repair of an intervertebral disc may require the removal of the entire disc nucleus , being replaced with an implant , or the removal of a portion of the disc nucleus thereby leaving a void in the intervertebral disc cavity . the flexible bladder 60 allows for the removal of only the damaged section of the disc nucleus , with the expanded flexible bladder 60 filling the resultant void in the intervertebral disc cavity . a major advantage of the annulus stent 10 with the flexible bladder 60 is that the incision area in the annulus 42 can be reduced in size , as there is no need for the insertion of an implant into the intervertebral disc cavity . in an alternative method of use , a dehydrated hydrogel is injected into the internal cavity 62 of the flexible bladder 60 . fluid , from the disc nucleus , passes through the semipermeable membrane 64 hydrating the dehydrated hydrogel . as the hydrogel absorbs the fluid the flexible bladder 60 expands , filling the void in the intervertebral disc cavity . all patents referred to or cited herein are incorporated by reference in their entirety to the extent they are not inconsistent with the explicit teachings of this specification , including ; u . s . pat . no . 5 , 108 , 438 ( stone ), u . s . pat . no . 5 , 258 , 043 ( stone ), u . s . pat . no . 4 , 904 , 260 ( ray et al . ), u . s . pat . no . 5 , 964 , 807 ( gan et al . ), u . s . pat . no . 5 , 849 , 331 ( ducheyne et al . ), u . s . pat . no . 5 , 122 , 154 ( rhodes ), u . s . pat . no . 5 , 204 , 106 ( schepers at al . ), u . s . pat . no . 5 , 888 , 220 ( felt et al .) and u . s . pat . no . 5 , 376 , 120 ( sarver et al .). it should be understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and preview of this application and the scope of the appended claims .	8
an installation according to the invention ( fig2 ) distinguishes itself over the state of the art due to the following features . it has an additional lower screen belt 16 . the lower screen belt 16 is located underneath the spreading devices 2a , 2b , 2c arranged immediately one after the other and in the preliminary press 5 on the forming belt 3 , which is returned downstream of the preliminary press 5 . the forming belt 3 can thereby be replaced by a sliding table . the lower screen belt 16 extends all the way through the main press 7 where it is located on the lower steel belt 8 . the preliminary press 5 and the main press 7 are arranged at a distance from each other . downstream of the preliminary press 5 and upstream of the main press 7 , under the screen belt 16 a lower spraying device 18 provided with a dosage device 17 is arranged . above the upper screen belt 6 running through the preliminary press 5 and the main press 7 , opposite to the lower spraying device 18 , there is a vacuum box 20 connected to a blower 19 . downstream thereof , also before the main press 7 , above the upper screen belt 6 , an upper spraying device 22 also provided with a dosage device 21 is arranged . underneath the lower screen belt 16 , opposite the upper spraying device 22 , there is a further vacuum box 24 connected with a blower 23 . by contrast to an installation of the state of the art as in fig1 the installation of the invention has no spraying devices 4a , 4b , 4c between the dispersion devices 2a , 2b , 2c and no additional press 14 . in operation in an installation with a production width of 2 , 500 mm and a belt speed of 15 m / min the following amounts are dosed into the dry mixer : ______________________________________gypsum hemihydrate ( plaster of paris ) 20 , 500 kg / hgypsum dihydrate ( milled ) 100 kg / hpaper fiber ( dry ) 4 , 200 kg . h______________________________________ each of the mixers 1a , 1b are supplied with 50 % of the dry mass of 24 , 800 kg / h . in addition 2 , 580 l / h of water , i . e . 20 . 8 % of the dry mass are supplied to the first mixer 1a , and to the second mixer 1a 2 , 880 l / h water , i . e . 23 . 2 % of the dry mass are introduced , with the proportions of retardants and accelerants adjusted to the gypsum . the mixture is spread on the forming belt 3 in three strata . the dispersed layer has a height of approximately 50 mm and is precompressed in the preliminary press 5 to a height of approximately 12 mm , i . e . to approximately 120 % of the plate thickness . it springs back to approximately 16 mm . after that with the spraying devices 18 , 22 the layer is sprayed first from underneath and subsequently from above each time with 2 , 280 l / h of water , i . e . a total of 18 % of the dry mass . during spraying the supplied water amount is adjusted based on differential measurements of the supplied and discharged water amounts . a total water amount representing approximately 40 % of the dry mass , i . e . approximately three times the stoichiometric water amount , is supplied . during spraying air is evacuated from the layer and from the screen belts 16 , 6 , by the vacuum boxes 20 , 24 [ sic ] arranged opposite to the spraying devices 18 , 22 . in the main press 7 the layer is compressed to a plate thickness of 10 . 3 mm . after setting the raw plate still contains 14 . 2 % residual wetness . after drying a plate is obtained with a density of 1 , 150 kg / m3 and a bending resistance of 8 . 0n / mm . in the installation of example 2 ( fig3 ), the upper screen belt 6 is guided only through the main press 7 . a second upper screen belt 25 extends through the preliminary press 5 , along the vacuum box 20 opposite the lower spraying device 18 and along a further transfer vacuum box 27 connected with a blower 26 . downstream of the transfer vacuum box 27 the upper screen belt 25 reverses its path . the upper spraying device 22 is arranged between the return point of the upper screen belt 25 and the main press 7 . the lower screen belt 16 runs through the preliminary press 5 , along the lower spraying device 18 and over one or more relief nozzles 29 connected with a blower . the relief nozzles 29 are arranged at the end of vacuum box 20 [ sic ]. the lower screen belt 16 projects up to the front edge -- considered in travel direction -- of the transfer vacuum box 27 and is returned from there . a further smooth , lower belt 30 starts at the rear edge of the transfer vacuum box 27 , extends underneath the upper spraying device 22 and is guided through the main press 7 . there is no vacuum box arranged correspondingly opposite the upper spraying device 22 . in operation the layer precompressed in the preliminary press 5 is first wetted on its bottom side by the spraying device 18 . subsequently the layer is detached from the lower screen belt 16 by blowing air through the detaching nozzles 29 and transferred to the smooth lower belt 30 with the assistance of the transfer vacuum box 27 . there the layer is wetted on its top side by the spraying device 22 and compressed to final plate thickness in the main press 7 . thereby the bottom side of the plate is smoothed by the smooth , lower belt 30 . the installation of the example 3 ( fig4 ) differs from that of example 2 in that the lower screen belt 16 , as in example 1 , is guided all the way through the main press 7 . correspondingly a vacuum box 24 with blower 23 is arranged opposite to the upper spraying device 22 located directly upstream of the main press 7 . the installation of example 3 differs from the one in example 2 also in its lower wetting device . the lower wetting device has a tray or trough 32 provided with a dosage device 31 . outer rollers 33 are arranged above each the front and rear edges of the tray 32 considered in travel direction . between the outer guide rollers 33 extends a box divided in two in the direction of travel with venting holes on its bottom side , on whose front half a suction blower 35 and on whose rear half a pressure blower 36 are connected . the bottom side of the box 34 projecting into the tray 32 is designed as a sliding surface , concavely curved in the travel direction . the curvature corresponds approximately to a radius of 5 to 15 m . thereby it is important that the outer guide rollers 33 and the box 34 be arranged so that screen belts 16 , 25 are guided downwards and back again at a small angle . the upper screen belt 25 is returned downstream of tray 32 . at this point the lower screen belt 16 is guided over a further roller 37 . in operation the layer precompressed in the preliminary press 5 is guided through tray 32 so that only the bottom side of the layer is wetted . from the top side next in a first zone air is evacuated from the layer and the screen belts 16 , 25 and subsequently in a second zone an overpressure is applied to the upper side of the layer . the respective pressures are adjustable . in the tray 32 a precisely metered water amount is introduced , which is absorbed by the layer . subsequently the top side of the layer is wetted by spraying devices 22 and finally the layer is compressed in the main press 7 to plate thickness . in the installation of example 4 ( fig5 ) the upper screen belt 6 and the lower screen belt 16 are guided through the preliminary press 5 , wherein the upper spraying device 22 is arranged , the lower wetting device and the main press 7 . thereby upper and lower pressure rollers 38 of the preliminary press 5 are arranged at a distance from each other . between the upper pressure rollers 38 there are nozzles 39 of the upper spraying device 22 . the lower wetting device consists of tray 32 provided with a dosage device 31 as described in example 3 . between the outer guide rollers 33 arranged above the edges of tray 32 , suction / pressure boxes 40 and further guide rollers 41 are alternately arranged in succession . the boxes 40 , four in this example , are connected via ducts 42 with the suction blower 35 and the pressure blower 36 . in the ducts 42 there are valves 43 , so that the blowers 35 , 36 can be connected selectively with the boxes 40 . the air pressure is adjustable . as in example 3 , the guide rollers 41 form a sliding surface concavely curved in the travel direction , along which the upper and the lower screen belts 25 , 16 are guided through the tray 32 . the dipping depth of the lower screen belt 16 is of the order of magnitude of the layer thickness . the extent of tray 32 in the travel direction corresponds approximately to that of the main press 7 , e . g . 3 to 5 m . it is wider than the layer on both sides by approximately 25 cm . its depth is about 10 times the plate thickness . underneath the lower screen belt 16 on the tray 32 , there are guiding devices 44 , 45 extending in the travel direction , with vertical and horizontal guide surfaces as is illustrated in fig7 . the lower screen belt 16 is wider than the upper screen belt 6 ( respectively upper screen belt 25 , ( fig4 ). its lateral edges are sealed with elastic plastic material 46 as is clearly shown in fig8 . the cover projects on both sides by about 5 cm into the area of the precompressed layer as is illustrated in a greater detail in fig8 . besides in the tray 32 the lower screen belt 16 is guided by its edges over rollers 47 . the rollers 47 are arranged so that the edges of the lower screen belt 16 are bent upwards . as is shown in a greater detail in fig6 tray 32 is provided with an inlet 48 at its front end . the inlet 48 is designed in the manner of a diffuser with an overflow ( not shown ), extending over the entire width of the vat . fig6 illustrates the dosage pump 31 generates a flow and 31 is connected to the inlet 48 via a flow meter 49 . in operation the dispersed layer is alternately compressed in the preliminary press 5 by pressure rollers 38 ( fig5 ) and sprayed in the area between the pressure rollers 38 . thereby the spring - back of the layer when it is no longer subjected to the load of the pressure rollers 38 results in an enhanced suction of the water in the layer . subsequently the precompressed layer arranged between the belts 16 seen in fig2 - 5 , 25 is guided through a water bath , namely through the vat 32 supplied with a metered amount of water , so that only the bottom side of the layer is wetted . this is insured by the upturned edges of the lower screen belt 16 which are sealed with the plastic material 46 . the layer is guided into the water bath and then back at a small angle , e . g . of 1 to 10 degrees seen in fig7 which is a front view of the trays illustrated in fig5 and 6 and is particularly well illustrated in fig8 which shows the guide roller 47 in a greater detail . due to the described self - regulating mechanism it absorbs exactly the apportioned amount of water . in this example the layer is alternately loaded and relieved by the guide rollers 38 , 41 ( fig5 and 6 ). the spring - back of the layer between the guide rollers 38 , 41 , enhances the wetting of the layer through aspiration of water as in the upper spraying device 22 of this example . this spring - back of the layer during wetting can also be achieved by guiding the layer in the water bath along a curved surface , whose radius increases constantly . by means of the suction / pressure boxes 40 ( fig5 and 6 ) between the guide rollers 41 the air is evacuated from the layer in a first zone , in order to remove the air from the layer and most of all from the lower screen belt 16 . then in a second zone at the rear box a certain air pressure from above is applied to the layer guided through the water bath . this applied air pressure counters the effect of uneven wetting of areas with variable density of the layer . the boxes 40 can also be operated in such a way that through the boxes 40 alternately in one zone air can be aspired by one box 40 , and by the next one in the following zone air can be applied , whereby in the first box 40 , i . e . in the first zone , air is always aspired . in an installation with a production width of 2 , 500 mm and a belt speed of 15 m / min the following dosed amounts are supplied to each of the mixers 1a and 1b : ______________________________________gypsum hemihydrate ( plaster of paris ; 5 . 9 % h2o ) 10 , 500 kg / hgypsum dihydrate ( milled ) 50 kg / hpaper fibers ( dry weight ) 2 , 000 kg / hwater ( contained in paper fibers ) 2 , 800 kg / h______________________________________ the paper fibers saturated with water are prepared in the paper treatment device 15 . the 30 , 700 kg / h of mixture of gypsum , fiber and water , whereby the water amount represents approximately 22 % of the dry mass , is spread in three strata . the dispersion height is about 45 mm . the layer is precompressed in the preliminary press 5 to a thickness of 11 . 5 mm , i . e . approximately 112 % of the plate thickness . it springs back to 15 mm . during precompression 2 , 400 l / h water are sprayed from above . in the vat the layer absorb from underneath also 2 , 400 l / h water . therefore during wetting a water amount representing 19 % of the dry mass is supplied . this way the total amount of water supplied represents approximately 41 % of the dry mass and approximately three times the stoichiometric water amount . in the main press 7 the layer is compressed to a plate thickness of 10 . 3 mm . after setting the raw plate still contains 14 . 2 % residual wetness . after drying a plate with a density of 1 , 170 kg / m3 and a bending resistance of 9 . 2n / mm is obtained .	1
before entering into a description of the embodiment , a prior art dram will be described with reference to fig1 to 4 . fig2 and 3 are sectional views of the conventional dram of fig1 taken along the lines ii -- ii and iii -- iii . fig4 shows the circuit structure of the device of fig1 . reference numeral 1 denotes a p type silicon substrate ; 2 an element isolation oxide film ; 3 a silicon dioxide ( sio 2 ) dielectric film ; 4 a capacitor electrode of a first polycrystalline silicon layer ; 5 an n + type region as one electrode of the capacitor ; 6 a gate oxide film ; 7 an sio 2 insulating film ; 8 ( 1 ), 8 ( 2 ), 8 ( 3 ), and 8 ( 4 ) address lines ( gate electrodes ) of a second polycrystalline silicon layer , respectively ; 9 an n + type drain region ; 10 a phosphosilicate glass ( psg ) insulating interlayer ; 11 a contact hole ; 12 a contact pad ; and 19 ( 1 ), 19 ( 2 ), 19 ( 3 ), and 19 ( 4 ) data lines of a single aluminum film . the transistor regions t , the capacitance region c , the word lines , and a bit line in fig1 are shown correspondingly in the circuit structure of fig4 . in the prior art dram shown in fig1 to 4 , the parallel data lines 19 ( 1 ) to 19 ( 4 ) are constituted by a single aluminum film . however , in the structure wherein the data lines 19 ( 1 ) to 19 ( 4 ) are constituted by the single wiring material layer , e . g ., the aluminum film in this example , the interval of the data lines 19 ( 1 ) to 19 ( 4 ) is decreased , and the width of each of the data lines 19 ( 1 ) to 19 ( 4 ) must be decreased accordingly upon further micropatterning of the memory cells . in the structure shown in fig1 to 4 , when the wiring pitch is given as 3 . 5 μm and a width of the contact pad 12 is increased to be larger by , for example , 0 . 5 μm than that of the wiring width , the wiring width and the wiring interval are given as 1 . 5 μm . this width has been used in conventional 256 kbit or 1 mbit dram &# 39 ; s . when the dram is highly integrated and the wiring pitch is decreased to about 2 . 0 to 1 . 5 μm , the wiring width and the wiring interval must be decreased to 0 . 75 to 0 . 5 μm when the margin of the contact pad is given as described above . a semiconductor memory device according to an embodiment of the present invention is illustrated in fig5 to 8 . fig5 is a plan view of a dram , and fig6 is a sectional view thereof taken along the line vi -- vi of fig5 . a wiring portion of the prior art dram and that of the dram of fig5 are illustrated in fig9 a and 9b . fig8 shows the circuit structure of the device of fig5 . fig9 shows a modification of the wiring pattern . referring to fig5 to 8 , reference numeral 1 denotes a p type silicon substrate ; 2 an element isolation oxide film ; 3 an sio 2 dielectric film ; 4 a capacitor electrode of a first polycrystalline silicon layer pa ; 5 an n + type region serving as one electrode of the capacitor ; 6 a gate oxide film ; 7 an sio 2 insulating film ; 8 ( 1 ), 8 ( 2 ), 8 ( 3 ), and 8 ( 4 ) gate electrodes serving as address lines made of a second polycrystalline silicon layer pb , respectively ; 9 an n + type drain region ; 10 a first psg insulating interlayer ; 13 a contact hole between a lower wiring layer and the drain region 9 ; 14 a second psg insulating interlayer ; and 15 a contact hole between the upper wiring layer and the drain region 9 . reference numerals 17 ( 2 ) and 17 ( 1 ) are lower data lines made of a lower aluminum film , respectively ; 18 ( 2 ) and 18 ( 1 ) are upper data lines made of an upper aluminum film . each memory cell includes one transistor t and one capacitor c as in the prior art device . in the dram shown in fig5 the plurality of parallel data lines sequentially constituted by a wiring layer of a single wiring material such as aluminum are alternately formed by the upper and lower aluminum films insulated through the second insulating interlayer 14 in an order of 17 ( 2 ), 18 ( 2 ), 17 ( 1 ), and 18 ( 1 ). further , the data lines 18 ( 2 ) and 18 ( 1 ) formed by the upper aluminum film overlap the adjacent data lines of the lower aluminum film , respectively . as shown in fig9 a , a prior art structure has data lines of a single layer . assume that parallel data lines 19 ( 1 ), 19 ( 2 ), . . . 19 ( 7 ) are formed in a wiring region at a wiring width of 1d and a wiring interval of 1d . however , as shown in fig9 b , the data lines 18 ( 1 ), 17 ( 2 ), 18 ( 2 ), 17 ( 3 ), 18 ( 3 ), 17 ( 4 ), and 18 ( 4 ) can be formed in the same wiring area as that of the conventional dram at a wiring width of 3d and a wiring interval of 1d . therefore , the wiring width of the data line of the dram of this embodiment can be increased to three times that of the prior art dram . as shown in fig1 , for example , recesses 16 may be formed in the lower data lines 17 ( 2 ) and 17 ( 3 ) to detour the contact hole 15 formed between the upper data lines 18 ( 2 ) and 18 ( 3 ). in this case , the width of the lower data lines 17 ( 2 ) and 17 ( 3 ) can be larger than that shown in fig5 up to that defined by a maximum interval defined by insulation and connection of the wirings of an identical layer . however , the upper data lines 18 ( 2 ) and 18 ( 3 ) do not have the limits described above , so the wiring interval can be maximized in association with a minimum wiring interval . a preferred circuit diagram applicable to the device according to the present invention in connection with sense amplifiers is shown in fig1 . the circuit arrangement shown in fig1 requires a slight modification of the layout structure of fig5 but has an advantage of a superior symmetrization of electrical characteristic between data line pair associated with a sense amplifier , which is desirable in drams . data lines dl 0 and dl 0 connected with the first sense amplifier are located in the upper layer . data lines dl 1 and dl 1 connected with the second sense amplifier are located in the lower layer . in the circuit arrangement of fig1 , where the data lines are divided into a first group of data lines dl and a second group of data lines dl , the characteristic of symmetry between the data lines is attained satisfactorily . the present invention is exemplified by a dram . however , the present invention can also be applied to other semiconductor memory devices such as static ram &# 39 ; s and static rom &# 39 ; s . the wiring material is not limited to aluminum , but can be extended to any other proper material .	7
fig1 is a block diagram showing a schematic configuration of an nmr instrument using a dds ( direct digital synthesizer ) according to the present invention . a casing 3 which accommodates high - frequency alternating current magnetic field means ( probe ) 4 to transmit an alternating current magnetic field is inserted into static magnetic field generation means 2 which generates a strong static magnetic field . the high - frequency alternating current magnetic field means 4 is connected to an external cable at an end of the casing 3 via a high - frequency adjustment circuit 5 by a high - frequency cable . at the time of measurement , a measurement sample 1 is first placed near the high - frequency alternating current magnetic field means 4 . upon start of measurement , a general controller 6 in the nmr instrument sends pulse sequence data to a pulse generator 7 which uses a dds . a pulse signal output from the pulse generator 7 is amplified by a high - frequency transmitter front end 8 and input to a transmit / receive switching circuit 9 . the high - frequency transmitter front end 8 also has a function of conducting up / down conversion on a frequency as occasion demands and a function of outputting a reference signal for receiving to a high - frequency receiver 10 . the transmit / receive switching circuit 9 has a function of connecting the high - frequency adjustment circuit 5 to the high - frequency transmitter front end 8 or the high - frequency receiver 10 . the connection state of the transmit / receive switching circuit 9 is controlled by control data output from the general controller 6 . first , the high - frequency adjustment circuit 5 is connected to the high - frequency transmitter front end 8 , and a pulse signal output from the high - frequency transmitter front end 8 is transmitted to the measurement sample 1 by the high - frequency alternating current magnetic field means 4 . a response of the sample is detected by the high - frequency alternating current magnetic field means 4 . in order to send a detected response signal to the high - frequency receiver 10 , the transmit / receive switching circuit 9 connects the high - frequency adjustment circuit 5 to the high - frequency receiver 10 . the response signal is subjected to receive processing in the high - frequency receiver 10 and provided to the user by the general controller 6 . fig3 is a block diagram showing a first embodiment of a dds according to the present invention . the dds receives inputs of an n - bit frequency tuning word ( ftw ) and a p - bit phase tuning word ( ptw ) from an upper system . the dds also receives an input of a reference clock signal clk which serves as a period signal for operating a digital circuit from the upper system . a feature of the present dds is present in a phase synthesis unit ( psu ) 20 . the psu 20 includes n pas , i . e ., pa ( 1 ) 21 - 1 to pa ( n ) 21 - n , where n corresponds to the number n of bits of the ftw . the pa ( 1 ) 21 - 1 to pa ( n ) 21 - n operate with fixed phase increment values m ( 1 ) to m ( n ) represented by expression 1 . for example , the pa ( 2 ) 21 - 2 operates with the fixed phase increment m ( 2 )= 2 , and its output p ( 2 ) changes as represented by expression 2 every clk . t is an arbitrary number of time - s of clk . p ( 2 )= 0 , 2 , 4 , . . . , 2 × t , . . . , 2 ×( 2 n - 1 − 2 ), 2 ×( 2 n - 1 − 1 ), 0 , 2 , . . . ( expression 2 ) in general , an output p ( n , t ) of the pa ( n ) 21 - n at the number of times t of clk becomes as represented by expression 3 . p ( n , t )= mod ( m ( n )× t , 2 n ), m ( n )= 2 n - 1 ( expression 3 ) here , mod ( x , a ) is a function which returns a remainder value obtained by dividing x by a . outputs p ( 1 ) to p ( n ) respectively of the pa ( 1 ) 21 - 1 to pa ( n ) 21 - n are input to switches sw ( 1 ) 23 - 1 to sw ( n ) 23 - n , respectively . the switches sw ( 1 ) 23 - 1 to sw ( n ) 23 - n are controlled by control data c ( 1 ) to c ( n ) output from a controller 22 , respectively . for example , the output of the switch sw ( 1 ) 23 - 1 becomes p ( 1 ) if the signal c ( 1 ) is in its high state , whereas it becomes 0 if the signal c ( 1 ) is in its low state . the switches sw ( 2 ) 23 - 2 to sw ( n ) 23 - n also operate in the same way as the switch sw ( 1 ) 23 - 1 . the outputs c ( 1 ) to c ( n ) of the controller 22 are determined by the ftw as hereafter described . first , an n - bit ftw input is retained in n registers included in the controller 22 so as to respectively correspond to the n bits . each of values b ( 1 ) to b ( n ) respectively stored in the n registers has a value of 0 or 1 , and it is a value of each of bits obtained when the ftw is represented by using a binary number . here , it is necessary to make c ( 1 ) to c ( n ) coincide with the values b ( 1 ) to b ( n ), respectively . hereafter , outputs of the switches sw ( 1 ) 23 - 1 to sw ( n ) 23 - n will be described . for example , an output ps ( 2 , t ) of the switch sw ( 2 ) 23 - 2 at the number of times t of clk is determined by the output p ( 2 , t ) of the pa ( 2 ) 21 - 2 and the output c ( 2 ) of the controller 22 as represented by expression 5 . ps ( 2 , t )= b ( 2 ) mod ( 2 1 × t , 2 n ) ( expression 5 ) generalizing expression 5 , the output ps ( n , t ) of the switch sw ( n ) 23 - n becomes as represented by expression 6 . ps ( n , t )= b ( n ) mod ( 2 n - 1 × t , 2 n ) ( expression 6 ) an adder 24 adds up outputs ps ( 1 , t ) to ps ( n , t ) respectively of the switches sw ( 1 ) 23 - 1 to sw ( n ) 23 - n . an output ph ( t ) of the adder 24 becomes as represented by expression 7 . since b ( n ) has only a value of 0 or 1 , expression 7 can be rewritten as represented by expression 8 . the output ph of the adder 24 is an output of the psu 20 . the output of the psu 20 is added to the ptw by a second adder 12 for phase modulation , and a resultant sum is input to a phase - amplitude conversion look up table ( pa - lut ) 13 . the function of the second adder 12 may be integrated into the pa - lut 13 . the output of the second adder 12 is p - bit data , where p ≦ n . only p most significant bits included in the n - bit ph are used , and n - p least significant bits are discarded in order to decrease the quantity of data stored in the pa - lut 13 . a technique for decreasing the quantity of data stored in the pa - lut 13 by utilizing the discarding and symmetry is disclosed in the non - patent document 2 . the pa - lut 13 retains input value − output value pairs , and outputs a - bit amplitude data corresponding to phase information input from the second adder 12 . the a - bit amplitude data is converted to an output signal out by a digital / analog converter ( d / a ) 14 , and the output signal out is output to the outside of the dds . the d / a 14 may be removed from the dds and a separate d / a device may be used . in the case where a separate d / a device is used , the output of the pa - lut 13 becomes the output of the dds . fig4 is a concept diagram of a digital phase wheel for explaining relations between the pa output and the dds output . an example of the pa ( 2 ) with n = 4 is shown . sixteen black points arranged on a circumference as shown in fig4 represent values 0 to 15 which can be output by the pas with n = 4 . since the phase increment of the pa ( 2 ) is m ( 2 )= 2 , the output p ( 2 ) of the pa ( 2 ) advances two points every time of clk . after 14 , p ( 2 ) returns to 0 again . the pa - lut 13 outputs a sine wave amplitude at 0 degree , 22 . 5 degrees , 45 degrees , . . . , 337 . 5 degrees in response to values 0 to 15 which can be output by the pas with n = 4 . in the example shown in fig4 , p ( 2 ) advances in phase by 45 degrees every time of clk . one period corresponds to eight times of clk . since a time period corresponding to one time of clk is dt = 1 / f clk , the digital phase wheel of pa ( 2 ) shown in fig4 generates a frequency of 1 /( 8dt )= f clk / 8 hz . generalizing the number of bits from 4 to n , the period of the output p ( 2 ) of the pa ( 2 ) is 2 n / m ( 2 )= 2 n - 1 clk , and a frequency of m ( 2 )* f clk / 2 n hz is generated . considering the number 8 which represents the output ph of the psu 20 , the output ph of the psu 20 generates a frequency of ftw * f clk / 2 n . this frequency becomes a frequency f out of the output signal out of the dds . what is to be noted is that the output frequency f out of the dds is changed according to the ftw , but the phase increments m ( 1 ) to m ( n ) respectively of the pa ( 1 ) 21 - 1 to pa ( n ) 21 - n shown in fig3 are fixed regardless of the ftw value . even if the ftw is changed , only the outputs c ( 1 ) to c ( n ) of the controller 22 change whereas p ( 1 ) to p ( n ) do not change . while the dds is operating , therefore , the outputs p ( 1 ) to p ( n ) respectively of the pa ( 1 ) 21 - 1 to pa ( n ) 21 - n can always maintain the phase coherency . the dds according to the present embodiment having the configuration shown in fig3 includes n pas , i . e ., pa ( 1 ) 21 - 1 to pa ( n ) 21 - n , one controller 22 , n switches 23 - 1 to 23 - n , and one adder 24 . as a result , frequencies corresponding to all values which can be expressed by the ftw can be output freely while maintaining the phase coherency . operation of the psu 20 in the first embodiment will now be described with reference to a simple example . if the number of bits of the ftw is n = 3 , the psu 20 includes three pas , i . e ., pa ( 1 ) 21 - 1 to pa ( 3 ) 21 - 3 as shown in fig5 . because of the configuration of n = 3 bits , each pa can represent a numerical value in the range of 0 to 7 . as for the phase increments m ( 1 ) to m ( 3 ) of each pa , m ( 1 )= 1 , m ( 2 )= 2 and m ( 3 )= 4 according to expression 1 . the pa ( 1 ) to pa ( 3 ) respectively outputs p ( 1 ) to p ( 3 ) shown in table 1 according to clk . regardless of the ftw tuning word change , p ( 1 ) to p ( 3 ) repetitively output numerical values in the range of 0 to 7 as clk number increases as shown in table 1 . it will now be exhibited by taking an example that phase coherency is maintained in frequency modulation conducted in the configuration in the first embodiment . a 3 - bit ftw tuning word can have a value in the range of 0 to 7 . the case where ftw tuning word = 3 and the case where ftw tuning word = 5 will now be considered as examples . the ftw tuning word = 3 is decomposed into bits { 0 , 1 , 1 } by the controller 22 . the control data c ( 1 ) to c ( 3 ) output to the three switches 23 - 1 to 23 - 3 by the controller 22 become 1 , 1 , and 0 , respectively . the switches 23 - 1 and 23 - 2 output p ( 1 ) and p ( 2 ) according to the control data c ( 1 )= 1 and c ( 2 )= 1 . the switch 23 - 3 outputs 0 . the adder 24 adds up outputs of the switches 23 - 1 to 23 - 3 , and outputs a least significant 3 - bit part of a resultant sum . therefore , the output of the adder 24 becomes as represented by expression 7 ( or expression 8 ). in the clk number , “ d ” represents a fixed delay between pa outputs and the adder output . in the adder output shown in table 2 , the phase increment = 5 and it coincides with the ftw tuning word . the case where the ftw tuning word = 5 will now be considered . the control data c ( 1 ) to c ( 3 ) output by the controller 22 become 1 , 0 , and 1 , respectively . the switches 23 - 1 and 23 - 3 output p ( 1 ) and p ( 3 ), respectively . the switch 23 - 2 outputs 0 . in the adder output , the phase increment = 5 and it also coincides with the ftw tuning word . finally , the case where the ftw tuning word = 3 at the start , the ftw tuning word = 5 at clk = 4 and the ftw tuning word = 3 is restored at clk = 8 will be considered as an example of frequency modulation . it is appreciated from table 4 that the phase increment of the adder output coincides with the changing ftw tuning word . the adder output has a different phase increment as a transition state between clk 3 and clk 4 and between clk 7 and clk 8 during which the ftw tuning word is changed over . since the clk period is typically several tens nanoseconds or less , however , there are no practical problems . it is apparent that the phase coherency is maintained , by comparing the adder output shown in table 4 with the adder outputs shown in table 2 and table 3 . the adder output shown in table 4 coincides with the adder output shown in table 2 during the time period when the ftw tuning word = 3 and coincides with the adder output shown in table 3 during the time period when the ftw tuning word = 5 . heretofore , the operation of the psu 20 in the first embodiment of the present invention has been described with reference to a simple example . the bit length n of the actually used ftw is at least eight . in that case as well , however , the phase coherency at the time of frequency modulation can be maintained by the same operation . fig6 is a block diagram showing a second embodiment of the present invention . in the second embodiment shown in fig6 , the frequency tuning word ftw is divided to a static frequency tuning word sftw which does not change during the transmission of the pulse sequence and a dynamic frequency tuning word dftw which changes during the transmission of the pulse sequence . the frequency which can be output by the dds is in the range of 0 hz to f clk / 2 hz according to expression 8 . since f clk used in the modern dds amounts to several hundreds mhz to several ghz , the output range of the dds becomes hundred mhz order . in many cases , however , the range of frequency used in the nmr pulse sequence is within several mhz . considering this point , the frequency range which needs to be set by the pulse sequence without limiting the degree of freedom of nmr experiments can be made smaller than the frequency range which can be output by the dds . reflecting this point , in the embodiment shown in fig6 , the sftw for setting all frequency tuning bits n of the dds and the dftw for setting l bits which need to be set in the pulse sequence are separated from each other . the sftw is set once before the pulse sequence transmission is started . after the pulse sequence transmission is started , only the dftw is set . the sftw sets pa ( 0 ) 25 which outputs a fixed frequency . an output p ( 0 ) of the pa ( 0 ) 25 always has a phase increment of the sftw . on the other hand , the l - bit dftw is converted to control data c ( 1 ) to c ( l ) by the controller 22 to control switches 23 - 1 to 23 - l in the same way as the ftw in the first embodiment . in the dds according to the second embodiment having the configuration shown in fig6 , the number of frequencies which can be output while maintaining the phase coherency is smaller as compared with the dds according to the first embodiment . however , the dds according to the second embodiment has an advantage that the time required for the frequency modulation becomes short because the number of bits in the dftw is small . furthermore , the dds according to the second embodiment also has an advantage that the circuit scale of the whole dds becomes small and the mounting area and power dissipation are reduced because the number of pas and the number of switches become smaller than those in the first embodiment . fig7 is a block diagram showing a third embodiment of the present invention . in the embodiment shown in fig7 , an output ph_ini of the psu 20 according to the present invention is used as an initial phase of another pa 26 . the ftw is set in both the psu 20 and the pa 26 . ph_cntrl is control data for setting whether to use the output ph_ini of the psu 20 as an initial phase of the pa 26 when the ftw is changed or use a phase possessed by the pa 26 at a clk immediately before the ftw is changed , as the initial phase . in the dds according to the present embodiment having the configuration shown in fig7 , the circuit scale becomes large because the number of pas is increased by one . however , the dds according to the present embodiment has an advantage that the output waveform obtained when the ftw is changed over can be made either of the waveforms b and c shown in fig2 . by the way , in fig7 , the configuration according to the first embodiment is utilized and the ftw and the psu 20 are used . alternatively , the present embodiment can also be applied to the configuration including the sftw , the dftw , the psu 20 ′ and the pa ( 0 ) 25 according to the second embodiment . the apparatus according to the present invention can be applied not only to nuclear magnetic resonance instruments but also to magnetic resonance imaging instruments ( mris ) or the like which change over the frequency at high speed and output signals while maintaining the phase coherency . it should be further understood by those skilled in the art that although the foregoing description has been made on embodiments of the invention , the invention is not limited thereto and various changes and modifications may be made without departing from the spirit of the invention and the scope of the appended claims .	6
referring now to fig1 , in the illustrated practice a preliminary step preferably involves machining gears of ferrous alloy material or the like by operations such as hobbing and shaving so as to form a desired arrangement of protruding gear teeth . following the machining operation , the gears are thereafter subjected to a commercial heat treatment to increase hardness and wear resistance . during the heat treatment the gear may be carburized and / or carob - nitrided and / or subjected to other treatments as may be desired . upon completion of the heat treatment the gear is typically at least partially covered with a tenaciously adhering scale which must be removed prior to the application of any coating that may be desired . in order to efficiently and effectively remove the scale , the gear is preferably subjected to a multi - step cleaning process providing a combination of chemical and mechanical cleaning without damaging the gear substrate . as an initial step in the cleaning process the gear with adhered scale is subjected to an initial or primary chemical cleaning incorporating a galvanic or cathode cleaning as well as an acid etch to partially dissolve and effectively soften the scale . a block diagram setting forth an exemplary primary chemical cleaning procedure is set forth at fig2 . by way of example only , and not limitation , the primary chemical cleaning preferably involves soaking the gear in a standard alkaline soak cleaner for about fifteen minutes followed by rinsing in water . following soaking , the gear thereafter undergoes cathodic cleaning in a standard alkaline cleaning solution or the like for about sixty to ninety seconds . it has been found that an applied voltage in the range of about 4 to 6 volts during the cathodic cleaning provides good results . after the cathodic cleaning , the gear is thereafter rinsed in water and soaked in an acid solution of about sixty percent ( by volume ) hydrochloric acid solution for about 60 to 120 seconds . in one particularly preferred practice the acid solution is 60 % of 37 % reagent grade hydrochloric acid in water . however , other suitable acid solutions may be used if desired . the gear is thereafter rinsed in water and any remaining acid is neutralized by dipping the gear into the alkaline cathodic cleaning solution . the gear is thereafter rinsed and dried . after the initial chemical cleaning the gear with a greatly softened scale surface is subjected to a vapor blasting surface treatment . such a vapor blasting treatment involves accelerating a suspension of microscopic abrasive particles in water or other suitable fluid towards the treatment surface using compressed gas such as air to provide acceleration . during vapor blasting the particles of the suspension are dragged along the surface , removing a substantial portion of the soft residue on the surface . large asperities across the surface may also be knocked down thereby further improving surface finish . vapor blasting preferably should be done with particles that are softer than the softest constituent of the steel used for gear production . moreover , the air pressure used in accelerating the particles is preferably set at levels so as to avoid potential damage to the surface . by way of example only , and not limitation , it has been found that good results are achieved by vapor blasting using a suspension of pumice particles ( about 5 to 20 %) in water wherein the gears are vapor blasted tooth - by - tooth using air pressure of between 20 to 60 psi . it is believed that the combination of vapor blasting preceded by chemical cleaning substantially speeds up the vapor blasting process and improves its effectiveness . this improved effectiveness enables the use of such low hardness particles and low air pressures while still providing excellent scale removal performance . thus , the potential for damaging the substrate material is greatly reduced without sacrificing scale removal performance . the steps of chemical cleaning and vapor blasting can be repeated if desired . following the initial chemical cleaning and vapor blasting , the gear is thereafter preferably subjected to a secondary or final chemical cleaning procedure . during this final chemical cleaning the gear is preferably subjected to cathodic cleaning for about 60 seconds in a standard alkaline cleaning solution to remove any pumice residue . alternatively , after vapor blasting the gears may be immediately cleaned and dehydrated in anhydrous alcohol or a mixture of ethanol , 2 - propanol and methanol in an ultrasound bath . after the conclusion of vapor blasting and chemical cleaning the gear will normally retain only a thin oxide layer corresponding to the nascent oxide layer which forms on a clean metallic surface exposed to air . according to the potentially preferred practice , this oxide layer is removed by use of ion etching procedures under vacuum conditions . as will be appreciated , ion etching is a process in which accelerated ions are directed toward the substrate , strike it and remove small particles of the substrate . the thickness of material removed from the surface is very small and is normally in the order of nano - meters . thus , even a thin oxide layer may be removed effectively without substantial removal of underlying substrate material . by way of example only , according to one contemplated practice ion etching may be done for about 30 minutes in a vacuum chamber filled with argon to a pressure of 10 − 3 torr , in plasma ignited in the chamber . the gears are provided with a negative accelerating voltage of about − 400v with a small amount of cr ions is added to the plasma . following practice of the procedures as outlined above , the oxide layer remaining after vapor blasting was approximately six times thinner than the layer left after chemical etching and eight times thinner than the layer left after heat treatment . the remaining layer was thereafter substantially removed by ion etching . the gear teeth were sufficiently clean to permit the application and adhesion of a wear and fatigue resistant coating such as chromium nitride , titanium nitride or the like by vapor deposition or other suitable techniques . it is to be understood that while the present invention has been illustrated and described in relation to potentially preferred embodiments and procedures , that such embodiments and procedures are illustrative only and that the invention is in no event to be limited thereto . rather , it is contemplated that modifications and variations embodying the principles of the invention will no doubt occur to those of ordinary skill in the art . it is therefore contemplated and intended that the present invention shall extend to all such modifications and variations as may incorporate the broad aspects of the invention within the true spirit and scope thereof .	2
[ 0014 ] fig1 provides a block diagram of a fuel cell inverter circuit 100 , in accordance with the invention . as shown in fig1 a fuel cell 101 is coupled to the remainder of circuit 100 via a switch 110 that operates to disconnect fuel cell 101 from the remainder of circuit 100 . the input of a boost converter 103 is coupled to input filter 102 and it is also coupled to fuel cell 101 via switch 110 . a charge / discharge controller 113 and a battery 104 ( coupled in series to each other ) are coupled to the output of boost converter 103 . battery 104 is sized to produce a voltage greater than or equal to the maximum operating voltage of fuel cell 101 . a dc bus filter 112 and the input to a dc - to - ac inverter 105 are both coupled to the output side of boost converter 103 . the output of boost converter 103 , charge / discharge controller 113 , and the input of dc - to - ac inverter 105 are coupled to a dc bus 108 . dc bus 108 typically is designed to operate at voltages slightly above the voltage level of battery 104 . also , circuit 100 optionally can be coupled to a ground potential 109 . an optional isolation circuit 106 is coupled to the output of dc - to - ac inverter 105 . isolation circuit 106 also is coupled to an ac load 107 . ac load 107 may be any energy - consuming device ( e . g ., motor , lighting ) that can operate with ac current . ac load 107 may be an electrical power transmission grid ( as discussed with reference to fig3 ), or other ac voltage source . fuel cell 101 produces a low dc voltage at a high current . the voltage produced by fuel cell 101 varies with load and operating conditions . also , the requirements of ac load 107 tend to vary over time . the varying power required by ac load 107 tends to create a fluctuating voltage at the output of fuel cell 101 . however , boost converter 103 , charging / discharging controller 113 and battery 104 operate to provide a nearly constant bus voltage to dc bus 108 , despite the fluctuating voltage provided by fuel cell 101 . for example , when a positive load step change occurs ( e . g ., when ac load 107 draws a greater quantity of power ), battery 104 provides power to dc bus 108 ( through charge / discharge controller 113 ) equal to the step change until fuel cell 101 is able to support the entire quantity of load 107 . the amount of power provided by fuel cell 101 to dc bus 108 is determined by boost converter 103 , which allows full control of the power provided by fuel cell 101 . when the available power from fuel cell 101 begins to decrease ( e . g ., because of a lack of fuel supply ), boost converter 103 draws less power from fuel cell 101 and charge / discharge controller 113 draws additional power from battery 104 . boost converter 103 permits the power drawn from fuel cell 101 to be increased gradually as it becomes capable of providing the full power requirements of ac load 107 . when the available fuel cell power exceeds the load power ( plus power consumed by inefficiencies of the inverter ), the boost converter 103 is responsible for maintaining the voltage provided to dc bus 108 . if , however , the available fuel cell power is lower than the required load power , then the voltage on dc bus 108 is regulated by battery 104 and charge / discharge controller 113 . battery 104 operates to provide power both during load transients and during peak loads that exceed the rating of fuel cell 101 . when fuel cell 101 has enough reserve power to both charge battery 104 and to supply the power demanded by ac load 107 , fuel cell 101 provides power to dc bus 108 . in this case , charge / discharge controller 113 operates to stop the flow of current from battery 104 to dc bus 108 , and provide the flow of current from dc bus 108 to battery 104 . as a result , boost converter 103 operates to maintain a nearly constant voltage on dc bus 108 . dc - to - ac inverter 105 converts the dc voltage on dc bus 108 to an ac voltage , suitable for ac load 107 . dc - to - ac inverter 105 is designed to operate with a low voltage input , like that provided by fuel cell 101 . isolation device 106 provides electrical isolation between ac load 107 and dc - to - ac inverter 105 . therefore , fuel cell 101 and the remainder of circuit 100 may be protected from any electrically adverse conditions ( e . g ., power surges ) initiated on the load side of the system . the isolation device 106 also allows for the possibility of connecting battery 104 and fuel cell 101 to an earthed ground ( e . g ., for safety reasons ). [ 0020 ] fig2 provides an example of a component - level block diagram of fuel cell inverter circuit 100 , shown in fig1 . although fig2 provides specific components within the elements shown in fig1 it should be appreciated the components of fig2 are not exclusive , and other similar components may be used . as shown in fig2 input filter 102 includes a capacitor c 1 . charge / discharge controller 113 includes a small mosfet q 2 coupled in anti - parallel with a diode d 2 . it should be appreciated that diode d 2 can be the body diode of mosfet q 2 or a separate diode , like a schottky diode . use of a separate diode allows for battery discharge current to be much greater than battery charging current . mosfet q 2 operates to permit the flow of current from dc bus 108 to battery 104 ( i . e ., charging battery 104 ). diode d 2 operates to permit the flow of current from battery 104 to dc bus 108 ( i . e ., discharging battery 104 ). boost converter 103 includes a mosfet q 1 a diode d 1 , and an inductor l 1 . dc bus filter 112 includes a capacitor c 2 . dc - to - ac inverter 105 includes a combination of components that form an h - bridge inverter , and associated filtering components . in particular , one half of the h - bridge inverter includes mosfets q 3 and q 4 , inductor l 2 , and capacitor c 3 . mosfets q 3 and q 4 form one - half of the h - bridge , and inductor l 2 and capacitor c 3 provide filtering . the other half of the h - bridge inverter includes mosfets q 5 and q 6 , inductor l 3 , and capacitor c 4 . mosfets q 5 and q 6 form one - half of the h - bridge , and inductor l 3 and capacitor c 4 provide filtering . the output of the h - bridge inverter is coupled to isolation device 106 , which may be a transformer t 1 , for example . in this instance , transformer t 1 is coupled on its primary side to the h - bridge inverter , and on its secondary side to ac load 107 . in one embodiment , semiconductor switches q 1 , q 3 , q 4 , q 5 , and q 6 are 100 volt mosfets . as compared to other semiconductor devices that have a nearly constant voltage drop regardless of current flow , for example , insulated gate bipolar transistors ( igbts ), the mosfets are selected so as to reduce losses when the output load is a fraction of the inverter &# 39 ; s full - load rating . in operation , fuel cell 101 provides a low - voltage , high - current power source to the remainder of circuit 100 . the precise value of the available voltage and current from fuel cell 101 may be varied with the number of fuel cells stacked together , based upon the required demand of load 107 . the power generated by fuel cell 101 then passes through a closed switch 110 . capacitor c 1 acts as source of high - frequency current . although capacitor c 1 is shown separate from boost converter 103 , it should be appreciated that capacitor c 1 may be incorporated within boost converter 103 . because fuel cell 101 may not be able to satisfy the demand of ac load 107 at various times throughout the operation of circuit 100 , boost converter 103 operates to regulate power provided by fuel cell 101 . more specifically , diode d 2 operates to detect whether fuel cell 101 can meet the power demanded by ac load 107 . when the average power provided by fuel cell 101 can not meet the average required demand of ac load 107 , the voltage on dc bus 108 drops below the battery voltage and diode d 2 becomes forward biased . the forward biased diode d 2 permits current to flow from battery 104 to dc bus 108 . if , on the other hand , fuel cell 101 provides sufficient power on dc bus 108 to operate ac load 107 , and if battery 104 needs to be charged , mosfet q 2 can be operated in the active region to maintain a constant float voltage across battery 104 . using mosfet q 2 allows a constant current to flow into battery 104 by absorbing and preventing a ripple voltage present on dc bus 108 ( as discussed below with reference to dc - to - ac inverter 105 ) from appearing across battery 104 . notably , the dc bus voltage is nominally higher than the battery voltage , so that the voltage across mosfet q 2 is small ( e . g ., 1 to 5 v ). in effect , therefore , charge / discharge controller 113 operates to conduct the unregulated discharging flow of current from battery 104 to dc bus 108 using d 2 , while properly regulating the flow of charging current to battery 104 using q 2 . boost converter 103 operates to regulate the amount of power provided by fuel cell 101 . as a result , boost converter 103 permits battery 104 and fuel cell 101 to cooperate so as to maintain a substantially constant dc voltage on dc bus 108 . fuel cell 101 is protected from reverse current ( e . g ., current from dc bus 108 back to fuel cell 101 ) by diode d 1 in boost converter 103 . typically , for low voltage sources ( like fuel cell 101 ) that require reverse current protection , a series - connected diode &# 39 ; s voltage drop can introduce a significant loss , especially at partial loads . because of the operation of boost converter 103 , however , diode d 1 provides reverse current protection at a reduced current ( as compared to placing the diode directly in series with fuel cell 101 ), thus increasing the overall efficiency of the circuit . capacitor c 2 filters the high frequency current on the output of boost converter 103 , as well as filtering the ac current required by inverter 105 . inverter 105 uses an h - bridge inverter configuration to convert the voltage from dc provided by dc bus 108 to ac voltage that feeds ac load 107 . therefore , the h - bridge inverter facilitates controlled power flow between dc and ac circuits . the h - bridge inverter includes two half - bridges ( q 3 / q 4 and q 5 / q 6 ) and two corresponding filters ( l 2 / c 3 and l 3 / c 4 , respectively ). inverter 105 typically draws power from dc bus 108 at a frequency that is twice that of the inversion frequency . for example , power drawn from dc bus 108 will have a significant 120 hz ripple component if the inverter produces 60 hz power . dc bus 108 will therefore have a voltage with a 120 hz ripple component . as is well known to those skilled in the art , an inherent feature of the mosfet is that it acts as a diode ( i . e ., a “ body diode ”) for current flowing in the reverse direction . during normal operation , the load current flows through a mosfet in each half - bridge for a period of time , and a mosfet body - diode in each half - bridge for a period of time . notably , the period of time that the current flows through the body - diode will increase if the voltage on dc bus 108 increases above its minimum designed operating level . however , in order to obtain efficient operation during partial load situations , boost converter 103 and battery 104 in conjunction with charge / discharge controller 113 will operate to keep the voltage on dc bus 108 nearly constant ( as discussed above with reference to boost converter 103 ), so to beneficially minimize the duration of current flow through the body diodes . the h - bridge inverter converts the dc voltage from fuel cell 101 to ac voltage for ac load 107 by designing the filters ( l 2 / c 3 and l 3 / c 4 ) to pass the desired frequency of the line voltage ( e . g ., 60 hz or 50 hz ), while removing the high - frequency switching component ( e . g ., 20 khz ) of voltage . the mosfets are pulse width modulated to provide the respective half - bridge filter components with voltages that are 180 ° out of phase with each other , so as to create a sinewave across transformer t 1 . the voltages across c 3 and c 4 are sinewaves that are 180 ° out of phase with each other so that the sinewave applied to the primary of transformer t 1 has twice the amplitude of the sinusoidal voltage across either c 3 or c 4 . the filtering components create fluctuating voltage waves with a small amount of high - frequency ripple created by the pulse wave modulation . because the voltage between either leg of the primary on transformer t 1 and ground 109 has only a very small high - frequency voltage component , the emitted electromagnetic radiation is significantly reduced . transformer t 1 provides isolation between load 107 and circuit 100 . transformer t 1 also may be designed such that the sum total kva rating of its secondary windings is greater than the kva rating of its primary winding . such design accommodates the possibility that either secondary may carry the greater current at any particular time . therefore , transformer t 1 beneficially provides a method to power unbalanced loads without increasing the rating of the semiconductor switches . such capability is especially relevant for stand - alone split - phase loads ( e . g ., residential applications ). it should be noted that the circuit configuration shown in fig2 permits operation in grid - parallel and / or stand - alone mode . fig3 is a block diagram showing the use of circuit 100 coupled to a customer premise 301 ( i . e ., stand - alone mode ) and / or a power transmission network 303 ( i . e ., grid - parallel mode ). power transmission network 303 is a network of high - voltage transmission lines that connect producers of electric power to the end customer ( e . g ., customer premise 301 ). in the united states , there are ten regional networks or “ grids ” ( e . g ., mid - america interconnected network and western system coordinating council ) collectively serving the power needs in the united states . power transmission network 303 may receive power from at least one power generation source 302 , such as a nuclear power plant or hydroelectric power generation plant . when coupled to power transmission network 303 , the network causes a sinusoidal voltage to appear across filter capacitors c 3 and c 4 of dc - to - ac inverter 105 . pulse - width modulation may be used to control the half - bridges of circuit 100 to produce a substantially sinusoidal current through filter inductors l 2 and l 3 . the resulting substantially sinusoidal current may have a frequency substantially similar to the voltage of power transmission network 303 . when coupled to customer premise 301 , the voltage across filter capacitors c 3 and c 4 in circuit 100 may be monitored by a separate device ( not shown ) so as to maintain a sinusoidal voltage at the desired frequency of customer premise 301 ( e . g . 60 hz for residential premises ). furthermore , by monitoring the current entering the residence , it is possible to modify the current produced by inverter 100 to provide overall power factor correction and / or to prevent net power generation by the residence . the scope of protection of the following claims is not limited to the embodiments described above . those skilled in the art will recognize that modifications and variations of the specific embodiments disclosed herein will fall within the true spirit and scope of the invention . while the invention has been particularly shown and described with reference to the embodiments thereof , it will be understood by those skilled in the art that the invention is not limited to the embodiments specifically disclosed herein . for example , although the invention was described using certain electronic components with specific ratings , it should be appreciated that those components may be replace or rearranged without exceeding the scope of the invention . those skilled in the art will appreciate that various changes and adaptations of the invention may be made in the form and details of these embodiments without departing from the true spirit and scope of the invention as defined by the following claims .	7
the present invention is a differential pressure reservoir 10 for use with a hot water system equipped with a bridge conduit 96 across the remote ends of each pair of hot and cold water pipes , as disclosed in u . s . pat . no . 4 , 321 , 943 , incorporated herein by reference . the invention combines the functions of , and replaces , the water heater air pocket and separate pressure reducing means of the prior art system . referring to the figure , the differential pressure reservoir 10 is inserted between the cold water supply inlet 89 of a conventional water heater tank 90 and the cold water supply main 9 . while the differential pressure reservoir 10 is shown in a retrofit embodiment for installation outside of heater tank 90 , it is equally possible to install reservoir 10 without modification as original equipment inside of tank 90 between supply main 9 and inlet 89 . differential pressure reservoir 10 comprises a casing 11 preferably formed from opposing hemispherical shells 12 and 13 which enclose a first cold water chamber 42 and a second hot water chamber 43 , and a cylinder 14 . reservoir 10 preferably has a total water capacity of approximately 1 . 5 gallons . a covering of thermal insulation 19 such as styrofoam around the outside of casing 11 holds whatever heat enters the reservoir from the tank . shells 12 and 13 are preferably mated by fasteners such as bolts 15 , and sealed by an o - ring 16 . shell 12 has a port 22 connected to cold water supply main 9 , and shell 13 has a port 23 connected to heater tank intake 89 . a double - sided piston 31 slides up and down along axis 44 in cylinder 14 . the &# 34 ; effective &# 34 ; area of each side of piston 31 is that area normal to axis 44 and exposed to water . by any one of several arrangements , the piston &# 39 ; s effective area is greater on the side under pressure from water tank 90 than on the side under pressure from cold water main 9 . in the preferred embodiment , piston 31 has a semispherical portion with a first concave face 32 forming a movable wall of first chamber 42 and a second convex face 33 forming an opposing movable wall of second chambers 43 . the first piston face 32 also includes the outer side of the base of a frusto - conical member 34 which extends and converges towards a notched inner rim 35 holding a u - cup seal 36 . a hollow cylindrical sleeve 21 extends from the center of shell 12 part way along axis 44 and forms a sliding fit with u - cup seal 36 . the volume of air trapped inside conical section 34 and sleeve 21 serves as an air spring . in a plane normal to axis 44 , the effective area of first face 32 is less , by the area of the base 48 of sleeve 21 , than the effective area of second face 33 . piston 31 has a notched outer rim 37 holding a u - cup seal 38 to keep water from leaking between cold water chamber 42 and hot water chamber 43 , except when rim 37 is near the end of cylinder 14 adjacent grooves 17 . the grooves 17 serve as a valve means to permit passage of water from inlet 9 across the piston to outlet 23 whenever the second face 33 is urged to a position approaching outlet 23 . reservoir 10 is radially symmetrical around axis 44 of cylinder 14 , with the exception of port 22 being off - center , fasteners 15 , and cylinder wall grooves 17 . the outside walls of the casing may be tapered for convenience in manufacturing with injection molded plastic such as delrin ®, or other suitable material which will not corrode , scale , rust or pit , and which has a service temperature above 212 ° f . the cylinder walls should be non - abrasive to promote long seal life . when the hot water system is in a standby state and no water , or at least no hot water , is flowing , pressures on both sides of piston 31 are equal . in the preferred embodiment , because the effective area of second face 33 is greater than that of first face 32 , the total force on side 33 is greater and moves the piston to expand second chamber 43 until , at the top of the piston stroke , rim 37 abuts shoulder 39 . the shoulder 39 should be in a plane normal to axis 44 so that when the hot water outlet 93 is closed , the upward pressure on piston 31 will be distributed equally around shoulder 39 . when hot water outlet 93 is opened , hot water flows out of pipe 92 from tank 90 , reducing the pressure at tank intake 89 and in second chamber 43 relative to first chamber 42 . when the total force on second face 33 is less than that on first face 32 , hot water flows out , and second chamber 43 contracts . when piston 31 moves down to the level where rim 37 is adjacent cylinder wall grooves 17 , cold water from first chamber 42 flows through the grooves and on into tank 90 . grooves 17 serve as valve means to allow water to flow by without rolling u - cup seal 38 off of piston 31 . when hot water outlet 93 is closed , the slight flow of cold water through cross - over conduit 96 will raise the pressure in hot water pipe 91 to that of cold water pipe 9 . this changes the pressure differential to a force differential in the opposite direction , which pushes away piston 31 and enlarges second chamber 43 , as explained above . bridge conduit 96 contains a one - way flow - check valve 97 which prevents hot water from entering cold water pipe 9 . the bridge conduit 96 is connected between pipes adjacent outlet faucets 93 and 94 with clamp - on - copper - piercing needle valves 92 and 95 which can be adjusted to control the rate of back flow , and thus the rate at which the system functions . details have been disclosed to illustrate the invention in a preferred embodiment of which adaptations and modifications within the spirit and scope of the invention will occur to those skilled in the art . for example , the reservoir according to the invention could be mounted anywhere in the water line near the water heater , including on the outlet side of the water heater , to serve as a hot water recovery and storage mechanism . the scope of the invention is therefore limited only by the following claims .	8
the high sulfur crude oils to be treated in the process of the invention are petroleum crude oils containing from 0 . 5 % to 3 % sulfur , generally about 1 % sulfur . chlorinolysis is conducted at a low temperature below 120 ° c ., generally from 25 ° c . to 85 ° c . for at least 5 minutes and usually for less than 120 minutes . the ratio of water to crude oil should be at least 0 . 05 / l and no more than 0 . 5 / l . the water can be added as steam and separately bubbled through the crude . chlorine gas is introduced at a rate of from 1 to 100 grams of cl 2 / 100 grams oil / hr . a brown emulsion results . the chlorinated crude is then treated with at least an equal volume of water at ambient temperature or slightly heated to a temperature from 20 ° c . to 80 ° c . and the water separated . the crude oil is then washed with at least an equal volume of caustic such as sodium hydroxide having a molarity of from 0 . 1 to 2 . the carbon - sulfur ( sulfide ) and sulfur - sulfur ( disulfide ) bonds of the organic sulfur components of crude oil are highly reactive due to high steric accessibility and electron releasing and demanding nature of the sulfur atom . chlorine treatment in the presence of water brings about the scission of these bonds as follows : ## str1 ## where r and r &# 39 ; represent hydrocarbon groups . the resulting chlorinated organo - sulfur compounds are oxidized and hydrolyzed in the presence of chlorine and water at moderate temperature to produce sulfate compounds as follows : ## equ1 ## most of the sulfate compounds and chlorine compounds are removed by hydrolysis during the water and caustic washing steps . referring now to fig1 the desulfurization system generally includes a chlorinolysis unit 10 , water washing unit 12 and caustic washing unit 14 . water and crude oil are fed to the chlorinolysis unit 10 from lines 16 and 18 respectively in the desired ratio , usually 0 . 3 h 2 o / oil , by volume . the streams are at ambient or can be preheated to the desired temperature . stirrer 20 is started and chlorine is fed to fritted glass bubbler 22 at the bottom of the unit . at the end of the desired reaction period , valve 24 is closed , valve 26 is opened and the brown emulsion is pumped through line 28 by means of pump 30 into unit 12 . an excess amount of water , usually 4 / 1 water to oil is added to the emulsion through line 32 and removed through drain 34 and discarded after the supernatent oil has been transferred through line 35 into unit 14 . an excess amount of dilute caustic , usually 4 / 1 caustic ( 1 molar ) to oil at is then added to unit 14 through line 36 . desulfurized crude is recovered at 40 and spent caustic is discarded through drain 42 . referring now to fig2 the well - site system includes a recovery well 50 , chlorinolysis unit 52 , washing unit 54 , and steam generator 55 . crude oil recovered from the well 50 is delivered to chlorinolysis unit 52 . cl 2 is bubbled into the oil from a perforated ring bubbler 56 and steam is injected into the oil from line 58 . the chlorine treated oil is then delivered to washing unit 54 in which it is successively washed with water and caustic from lines 60 and 62 respectively . a portion of the desulfurized oil is then fed to the combustion section of steam generator 55 along with air and the combustion gases generate steam in tube bank 64 . the generated steam is recycled to chlorinolysis unit 52 and well 50 through lines 58 and 66 . a series of experiments were carried out at temperatures from 25 ° c . to 80 ° c . for periods from 0 to 120 minutes on a crude petroleum oil containing 1 % sulfur obtained from the brea - olinda field of union oil co . chlorine was introduced at a rate of 5 grams of cl 2 / 100 grams of oil / hour . the ratio of water to oil was 0 . 3 . in typical runs , about 230 grams of petroleum was stirred in a glass flask fitted with a stirrer and fritted gas bubbler . either at room temperature , or upon pre - heating to the stated temperature , a vigorous degree of stirring was initiated , and chlorine then introduced to the lowest portion of the flask for up to one hour . a brown emulsion resulted . this product was washed with a four - fold amount of water , and the water then separated . the oily layer showed very little fluidity decrease . thereafter the washed oil was further mixed and washed with a four - fold quantity of sodium hydroxide ( 1 molar ). the final oil was analyzed and fractionally distilled for characterization . significant desulfurization is experienced at treatment periods as little as 15 minutes with optimum treatment appearing to be at 60 minutes . epa requirement of 0 . 3 % sulfur is achieved at room temperature in 60 minutes , though more efficient desulfurization occurs at 50 ° c . the process of the invention provides low cost , efficient desulfurization readily adapted to the on - site generation of process heat or steam for eor from oil wells . it is to be understood that only preferred embodiments of the invention have been described and that numerous substitutions , modifications and alterations are permissible without departing from the spirit and scope of the invention as defined in the following claims .	4
fig1 illustrates an exemplary embodiment of a multiwell mea in an ansi / sbs - compliant format . the multiwell electrode interfaces with electronics to which it is attached to through bottom side contacts . the electronics amplify and process the raw data obtained from cellular cultures in the various wells and the data is reflected in a computer for data analysis and manipulation . fig1 illustrates an exemplary mea system 10 that has been designed to interface with a physical system such as a tissue specimen or a network of cells in a multiwell format , i . e . several wells 12 of electrodes ( 6 , 12 , 24 , 48 , 96 , 384 , and 768 with a total of 768 electrodes ). this physical system is in direct contact with the microelectrodes . the multiwell microelectrodes 20 plug into a signal processing and data management system 14 which collects and analyzes the data that is generated from the cells . the combination of the cells , microelectrodes and entire system connects to a computer 16 via a data cable 18 for real time software analysis and recording . at the top of fig1 is a constructed multiwell mea system 8 . fig2 a - b and 2 c - d illustrate top and side views , respectively , of post - processing on a printed circuit board . fig2 a and 2b illustrate microfabrication of the multiwell mea using a combination of a large area process like pcbs and post processing using microfabrication or mems techniques — top views of a pcb ( obtained from a commercial vendor ) and a single well of electrodes after post processing . fig2 c and 2d illustrate side views for the fabrication strategies for a multiwell mea with a large area process like pcb in combination with microfabrication techniques . fig2 a depicts the components of a planar mea . the active part of a planar mea comprises three components : ( 1 ) the electrodes or the active sites , ( 2 ) the topmost insulating layer , and ( 3 ) the micro - scale metal wiring traces . regardless of the manufacturing strategy , the microfabrication process must account for all these three components . for the development of multiwell mea devices , platinum black can be used for the electrodes , su - 8 or silicon dioxide ( sio 2 ) for the insulation layer , and gold for the wiring traces . the platinum black electrodes can be formed using a closed - loop electroplating process , which will produce robust electrodes with precisely matched electrical properties . the negative tone epoxy su - 8 , which acts as an insulating material , has several attractive properties such as chemical stability , photolithographic definition , thermal stability and coating uniformity . it has been used as an insulation layer in commercially available meas from ayanda biosystems . additionally , su - 8 has the added benefit of planarizing the relatively rough surfaces on pcbs substrates or flex - rigid circuits . su - 8 is an ideal material to act as an insulation layer for a polymer - substrate multiwell meas , which have low temperature processing requirement , though it can be used with glass or silicon substrate materials as well . silicon dioxide is a traditional insulation material that is used in combination with rigid substrates like glass . the advantages of silicon dioxide include well characterized microfabrication techniques , low dielectric constant and pin - hole free coatings even in a nanometer scale . although su - 8 has been used with both polymer and glass substrates for multiwell mea fabrication , sio 2 has been used exclusively with glass substrates ( fig5 and 6 ). with these materials in mind , provided herein are fabrication processes and strategies for a post - processing of pcb that include the minimum number of steps necessary to achieve the desired objectives , such as transparency . fig2 c depicts the side view of this fabrication approach . the mea traces and recording sites can be defined using a relatively thick layer of negative resist ( which will also account for the planarization of the metal on the flex circuit ) and uv lithography . a biocompatible metal stack ( titanium for adhesion and gold for the metal traces ) can be deposited using standard metal deposition techniques and the metal will be lifted off to define the finer metal lines . in order to passivate the mea and define the recording sites ( electrodes ), a thin layer of su - 8 is coated and the material is photo patterned . su - 8 is photopatterned to define the final insulation pattern . no other processing on top of this is necessary to define the insulation layer . this processing step may be followed by electrodeposition of platinum in order to reduce the impedance of the recording sites . the approach listed here has the advantage of a very simple post - processing strategy ( 2 mask process ) to achieve a functional mea . surface planarization ( for microfabrication ) on non - standard substrates may require a slightly modified approach to the process described above . one such modified approach is illustrated in fig2 d . su - 8 is an excellent material for surface planarization . spin coating a layer of su - 8 on relatively rough surface results in the reduction of surface non - uniformities . this may be used as an additional step in the beginning of the above processes to address potential problems in direct processing on pcbs . the rest of the process is same as the fabrication techniques detailed above . the additional complexity ( involving one more mask ) will not add significant time to the process development of multiwell microelectrode arrays . additionally , potential cytocompatibility problems due to insufficient pcb encapsulation are improved by the addition of an extra layer of su - 8 . fig3 depicts a lamination technique for transparent polymer lamination on pcbs that is compatible with standard adhesives used in the industry . acrylic - based adhesives are used to laminate kapton onto a printed circuit board for what are called “ flex - rigid ” or “ rigid - flex ” circuits since the kapton layer adds flexibility to what is a rigid substrate . the most common applications for flex - rigid circuits are in the fields of aerospace , military and biomedical . it offers increased reliability and reduced weight for the former two markets while offering the ability to bend and fold in tight places for biomedical applications like implants . kapton or polyimide is a suitable polymer for these circuits due to its mechanical stiffness , and compatibility with processes for drilling and metallization . polyethylene terephthalate ( pet ) is a transparent polymer ( light transmittance of 93 % for 3 mil thickness ; source dupont teijin films ) that could be utilized as an alternate to kapton utilizing an added step ( such as employing an adhesive or a mechanical operation as known to one skilled in the art ) to render it compatible with standard pcb processing . the temperature of the lamination process is lowered to accommodate the low temperature requirement of pet but the time of the process is increased to ensure the reflow of this thermally set acrylic adhesive . this reflow ensures that the adhesive remains intact for any future processing . this process has been demonstrated successfully on large area substrates ( eg , 12 inches by 18 inches ). several flex rigid circuits with the multiwell format can be fabricated on a single panel pcb making this process batch fabrication compatible . this batch fabrication results in lowering the cost of the pcb process with the primary cost shifting to the post processing , which is low to begin with since there are only two layers to creating the mea . referring now to fig4 a and 4b , design layouts for the pcb , fig4 a , and mems post processing , fig4 b , for a 12 well multiwell mea are illustrated . these designs can be rapidly modified to accommodate different well configurations . the circular configurations on the pcb design define holes in the fr - 4 substrate that allow for bottomside transparency . rapid design changes allow for the modification of the mems post processing masks , so that other well designs with electrodes can be achieved like 24 , 48 and 96 well counts . fig4 a depicts the layout for the pcb ( top side ) and the masks for post processing to create the multiwell meas using the fabrication process described in fig2 a - d . a major advantage is the flexibility of the design and fabrication processes . specifically , design changes can be implemented rather quickly once the fabrication process has been established . a design iteration only requires two different layouts ( pcb layout and mea mask layout for two layer fabrication ), and , by changing these two layouts , a wide variety of electrode counts can be fabricated . additionally the well locations can be made ansi / sbs - compliant by incorporating the well locations from standard documents into the designs . thus , a change from 1 × 768 ( one well with 768 electrodes ) to 96 × 8 ( 96 wells with 8 electrodes each ) or any combination in between can be constructed with little difficulty . the processes also lend to flexibility in terms of changes in electrode densities and geometries with changes only to the mea mask layout . furthermore , since the processes are primarily based on custom pcb / flex circuit fabrication , the integration of heaters , sensors , memory chips , and fluidic valve controls to the multi - well mea itself can be easily accomplished , thus providing additional functionality to the final product . fig5 a and 5b illustrate the concept of a packaging or flip - chip approach to a multiwell mea with side and top views , respectively . the multilayer pcb and the glass die can be fabricated separately using batch fabrication techniques and coupled together to complete the device in an ansi / sbs compliant format . fig5 a depicts a side view of the flip chip approach to multiwell meas . in this schematic , the two components of the multiwell mea are depicted : a recessed three layer printed circuit board ( standard rigid pcb ) 50 ; and a microfabricated glass chip that has metal traces defined and insulation coated 52 . the two components are connected together using a conductive epoxy or solder layer that is screen printed on the glass substrate . the completed device is in an ansi / sbs - compliant culture well format thereby enabling easy design changes from a 1 × 768 electrode format ( single well ) to a 96 × 8 electrode format ( up to 96 wells ). the glass substrate is fabricated in two steps : metal interconnection patterns are defined utilizing a standard metal lift - off process ; an insulation process which may include either an su - 8 layer defined using photolithography or an sio 2 layer defined using a photolithography step followed by an etch process . the rigid pcb is fabricated using a three - layer process with a bottom layer for connecting the electrodes to the multiwell electronics and two layers on top to accommodate the routing of all 768 electrodes . fig5 b depicts a top view of the flip chip approach to multiwell meas . fig6 a and 6b illustrate exemplary design of the pcb and glass substrate with top views of the layout for the pcb and the glass substrate , respectively , used in the flip chip process . these designs can be rapidly modified to accommodate different well configurations . the circular configurations on the pcb design define holes in the fr - 4 substrate that allow for bottomside transparency . rapid design changes allow for the modification of the mems post processing masks , so that other well designs with electrodes can be achieved , such as 24 , 48 and 96 well counts . fig6 a and 6b illustrate a sample routing scheme for 768 electrodes in a 12 - well format ( each well has 64 electrodes ). both the pcb design , fig6 a , and the glass plate design , fig6 b , are shown . the interconnection between the two substrates is achieved using metal pads defined at two of the corners of both the substrates . screen printing of a conductive material like conductive epoxy or solder is carried out utilizing standard stencil printing techniques . the glass substrate and the pcb are brought assembled together using a flip chip bonder and the entire assembly is cured to finish the flip chip process to achieve a multiwell mea in an ansi / sbs compliant format . fig7 a and 7b are optical microscopy images of neuronal cultures grown on the meas at 21 days , fig7 a , and 28 days , fig7 b , in - vitro . fig7 a - b depict optical microscopy images of neuronal cells from e18 cortices of rat brains cultured on a single well of the mea devices . e18 cortices are harvested from rat brains and cells from these cortices are plated on the mea as described in the examples section . these devices were placed in incubators and observed after 24 hours of plating cells , at 7 days , 21 and 28 days in - vitro . the observations were carried out utilizing inverted microscopy techniques . observations were made for neurite outgrowth and general health of the cells . at 28 days in - vitro , a live / dead assay was performed in accordance with the protocols developed by cullen et al . to access the viability of cells in the culture dish . images captured from this assay are also shown in fig7 a - b . in a multiwell embodiment of the same device , such data will be collected from all the wells simultaneously . the multiwell meas will ensure similar experimental conditions for such assays unlike the single well counterparts where these experiments have to be performed one at a time . this will enable a much higher throughput for applications like drug screening . fig8 a - b are graphical illustrations of evoked electrophysiological data recorded from microelectrodes within an individual culture well . in this example , microelectrodes were used to both stimulate and record from neural cortical cultures . in a multiwell format , such data is collected simultaneously in dozens to hundreds of wells , dramatically increasing the throughput of electrophysiological investigations for screening applications . extracellular electrophysiological data from excitable cells and tissues is used to perform a wide range of analyses , ranging from the collection network - level dose response curves and the identification of specific ion - channel behaviors to the quantification of neurotransmitter release . additionally , studies in plasticity , toxicity , learning and memory , and pharmacology are further enabled with the use of meas . an individual microelectrode can be used to perform multiple functions simultaneously , thus it is possible to both stimulate and record from individual microelectrodes . stimulation can be used to evoke electrical activity that would other - wise not occur under normal spontaneous conditions . in fig8 a , ( a ) cultured cortical recordings with ( b ) and without ( a ) the elimination of excess charge that builds up on the microelectrode during stimulation ( known as artifacts ) ( scale bars : 100 μv , 10 ms , stimulus ± 0 . 5v ). in fig8 b , neural recordings on both the stimulating and neighboring electrodes . arrows indicate superimposed evoked responses , and circles indicate secondary artifacts induced by crosstalk inside the recording electronics ( biphasic stimulus ± 0 . 5v ). without being limited by theory , it is believed that the devices provided herein allow for the measurement of characteristics ( eg , chemical , biological , biochemical or electrophysiological ) of certain samples ( eg , chemical or biological ) at sensitivities and / or throughput levels that cannot be achieved with currently available devices . accordingly , provided herein are microelectrode arrays ( meas ) which are compatible with equipment or machinery intended for use with an ansi / sbs - compliant plate , comprising a plate having one or more wells and a substrate comprising a printed circuit board ( pcb ), wherein said substrate further comprises one or more microelectrodes having a diameter of about 1 to about 500 microns , wherein the substrate is transparent in the vicinity of the microelectrodes and has an area of about 3 inches by about 3 inches or greater . currently available multiwell mea plates are restricted to electrodes that are several mm in dimension , precluding the ability to perform electrophysiological measurements , micro - stimulation , or high - resolution impedance analysis . in certain embodiments , the plate is comprised of a transparent material , such as glass or plastic . in certain embodiments , the plate is a multiwell plate . in particular embodiments , the multiwell plate has an area of about 3 inches by about 3 inches or greater . in other embodiments , the multiwell plate has an area of about 3 inches by about 5 inches or greater , about 3 inches by about 6 inches or greater , about 4 inches by about 4 inches or greater , about 4 inches by about 5 inches or greater , about 5 inches by about 5 inches or greater , about 5 inches by about 7 inches or greater or about 6 inches by about 6 inches or greater . in certain embodiments , the microelectrodes are integrated into one or more wells of the multiwell plate . in certain embodiments , the microelectrodes are adhered to or embedded into the substrate . in certain embodiments , the substrate is transparent in the vicinity of the microelectrodes , such that biological specimens can by analyzed using the mea in combination with inverted microscopy , inverted fluorescent microscopy , inverted environmental microscopy or inverted cell counting techniques . in certain embodiment , the entire substrate is transparent . in one embodiment , the wells of the multiwell plate are transparent . in another embodiment , the area of the plate in which the microelectrodes are integrated into or attached to is transparent . in particular embodiments , the substrate or plate is transparent such that it allows for about 90 %, about 92 %, about 94 %, about 96 %, about 98 %, about 99 %, about 99 . 9 % light transmittance through the substrate in one embodiment , one or more microelectrodes is itself transparent . transparency can be measured by methods known to one skilled in the art using a spectrophotometer . in certain embodiments , the microelectrode array comprises a multiwell plate having anywhere from 4 to 1536 wells , 4 to 384 wells or 4 to 96 wells . in specific embodiments , the multiwell microelectrode array comprises a multiwell plate having 4 , 96 , 384 or 1536 wells . in certain embodiments , the multiwell plate is of a size described by ansi / sbs ( ie , is ansi - sbs - compliant ). in certain embodiments , the multiwell plate is compatible with equipment or machinery intended for use with ansi / sbs - compliant plates . because it is possible that plate size could be altered without significantly affecting the utility of a microelectrode array , devices including a plate with a size outside of ansi / sbs standards are intended to be within the scope of the present disclosure . in certain embodiments , the multiwell plate comprises from 1 to 768 or from 1 to 384 electrodes per well . in certain embodiments , the multiwell plate comprises 384 electrodes per well in a 2 well configuration to 1 electrode per well in a 1536 well configuration . in certain embodiments , the multiwell plate has a length of about 127 . 76 mm ± 0 . 25 mm ( 5 . 0299 inches ± 0 . 0098 inches ), a width of about 85 . 48 mm ± 0 . 25 mm ( 3 . 3654 inches ± 0 . 0098 inches ) and a thickness of about 14 . 35 mm ± 0 . 25 mm ( 0 . 5650 inches ± 0 . 0098 inches ). in certain embodiments , the diameter of the microelectrodes is about 1 to about 500 microns , about 1 to about 450 microns , about 1 to about 400 microns , about 1 to about 350 microns , about 1 to about 300 microns , about 10 to about 300 microns , about 50 to about 300 microns or about 100 to about 200 microns . in certain embodiments , the microelectrodes have a length of about 1 to about 500 microns , about 1 to about 450 microns , about 1 to about 400 microns , about 1 to about 350 microns , about 1 to about 300 microns , about 10 to about 300 microns , about 50 to about 300 microns or about 100 to about 200 microns . in certain embodiments , the microelectrodes have a thickness of about 10 nanometers to 1 micron , about 50 nanometers to about 1 micron , about 100 nanometers to about 1 micron , about 200 nanometers to about 1 micron , about 300 nanometers to about 1 micron , about 400 nanometers to about 1 micron , about 500 nanometers to about 1 micron or about 750 nanometers to about 1 micron . in certain embodiments , neighboring microelectrodes have a spacing of about 10 microns to about 1 mm , about 20 microns to about 1 mm , about 50 microns to about 1 mm , about 100 microns to about 1 mm , about 200 microns to about 1 mm , about 300 microns to about 1 mm , about 400 microns to about 1 mm , about 500 microns to about 1 mm or about 750 microns to about 1 mm . in certain embodiments , the are made of titanium , chromium , titanium / gold , chromium / gold , platinum , indium tin oxide , rhodium , silver , palladium , nickel , copper , poly ( 3 , 4 - dioctyloxythiophene ) ( p - dot ) or a combination thereof . in certain embodiments , the pcb is laminated with a transparent polymer membrane . in certain embodiments , the polymer is polyethylene terephthalate ( pet ). in certain embodiments , the polymer membrane has a thickness of about 10 to about 100 microns ). in certain embodiments , the microelectrode arrays allow for the analysis of 4 to 1536 samples / experiment , 4 to 384 samples / experiment or 4 to 96 samples / experiment . in certain embodiments , the microelectrode arrays allow for high - sensitivity and high spatial resolution impedance - based assays . additionally , the use of multiple microelectrodes for impedance analysis provides redundancy , by improving the likelihood that cultures or tissues will adequately cover several electrodes , which may dramatically improve the yield and accuracy of impedance - based assays . in certain embodiments , the microelectrode arrays allow for micro - stimulation , for eliciting controlled , evoked responses from tissues and cultures under investigation . such stimulation can be applied simultaneously during the recording and acquisition of extracellular electrophysiological data . further , micro - stimulation can be used to evoke both field and action potentials as well as to perform a wide - range of threshold - based assays . accordingly , such methods for using the microelectrode arrays disclosed herein are provided herein . in certain embodiments , the microelectrode arrays allow for concurrent access to both single - cell and network - level activity of a sample . in certain embodiments , the microelectrode arrays allow for the detection and / or monitoring of electrically active cellular networks . accordingly , such methods for using the microelectrode arrays disclosed herein are provided herein . in certain embodiments , the total number of microelectrodes in an array is from 1 to 1536 , from 1 to 768 , from 1 to 384 or from 1 to 96 . in other embodiments , the total number of microelectrodes in an array is a multiple of 96 , 384 , 786 or 1536 , such as a multiple of a whole number between 1 and 5000 , between 1 and 4000 , between 1 and 3000 , between 1 and 2000 , between 1 and 1000 , between 1 and 500 , between 1 and 100 , between 1 and 50 or between 1 and 10 . further provided herein are methods for measuring in vitro or in vivo electrophysiological activity , impedance characteristics , extracellular network activity of a biological specimen ( eg , a cell , tissue and / or culture of the following varieties : vertebrate and invertebrate neural , muscle fibers , cardiac , pancreatic islet , osteoblasts , osteoclasts ) using a microelectrode array provided herein . specifically , provided herein are methods for measuring in vitro or in vivo electrophysiological activity , impedance characteristics or extracellular network activity of a cell or tissue , comprising contacting said cell or tissue with a mea provided herein . in certain embodiments , the biological specimen is placed or cultured in one or more wells of an mea provided herein and electrophysiological activity , impedance characteristics or extracellular network activity of the biological sample is detected and / or measured . further provided herein are methods for microscopy and / or cell counting using a microelectrode array provided herein . in particular embodiments , the microelectrode arrays provided herein are compatible with an optical plate reader . further provided herein are methods for in vitro or in vivo micro - stimulation of a biological specimen ( eg , a cell , tissue and / or culture of the following varieties : vertebrate and invertebrate neural , muscle fibers , cardiac , pancreatic islet , osteoblasts , osteoclasts ). in certain embodiments , provided herein are methods for eliciting controlled , evoked responses from a biological specimen . such stimulation can be applied simultaneously during the recording and acquisition of extracellular electrophysiological data . further provided herein are methods for micro - stimulation of a biological specimen and measuring ( including recording and / or acquiring ) a response ( eg , an extracellular electrophysiological response ). further , micro - stimulation can be used to evoke both field and action potentials as well as to perform a wide - range of threshold - based assays . accordingly , such methods for using the microelectrode arrays disclosed herein are provided herein . specifically , provided herein are methods for micro - stimulating a cell or tissue comprising contacting said cell or tissue with a mea provided herein and exposing said cell or tissue to an electrical current originating from said mea . in another embodiment , such methods further comprise recording and / or acquiring extracellular electrophysiological data from said cell or tissue . in certain embodiments , the biological specimen is placed or cultured in one or more wells of an mea provided herein and the biological specimen is micro - stimulated by the mea ( eg , by exposing the biological specimen to an electrical current originating from the mea ). further provided herein are methods for manufacturing a microelectrode array provided herein . provided herein are methods for manufacturing a microelectrode array including the steps of : 1 . providing a pcb and a mask for microelectromechanical systems ( mems ) post processing ( wherein in certain embodiments , the pcb is a flex - rigid pcb , and in other embodiments , the pcb and mask are designed to be compatible with an ansi / sbs - compliant plate ); 2 . laminating the pcb with a transparent polymer membrane ( wherein in certain embodiments , the pcb is a flex - rigid pcb fabricated using a modified process for lamination of pet as described herein ); 3 . defining vias in the polymer membrane ( in certain embodiments , such that it becomes possible to create functional , electrical interconnections between the top - side of the polymer membrane , such as pet , and the underlying pcb ); and 4 . mems processing utilizing the pcb as a substrate to create microelectrodes ( such as in a multiwell fashion ). in certain embodiments , the first layer defines the metal traces on the flex - rigid board and the second layer defines the insulation on top of the defined metal . further provided herein are methods for manufacturing a microelectrode array including the steps of : 1 . defining or modifying a pcb ( such as a standard rigid pcb ) to allow for insertion of a multiwell glass plate ; 2 . providing a photolithography mask for processing a multiwell glass mea ( such as a mask designed to be compatible with an ansi / sbs - compliant multiwell glass plate ); 3 . optionally fabricating the pcb utilizing standard commercial techniques ; 4 . microfabricating the multiwell glass mea to provide at least two layers , wherein the first ( bottom ) layer defines metal traces and the second ( top ) layer defines the insulation ; and 5 . attaching the multiwell glass mea to the pcb utilizing integrated circuit ( ic ) packaging techniques , creating electrical connections between the pcb and glass mea . in exemplary embodiments , the disclosed fabrication techniques , devices and methods of use may comprise at least one of the following elements : i . the device : a multiwell mea device itself , may be any multiwell plate ( more than 4 wells ) with greater than 4 electrodes per well , with electrode sizes of 500 μm or less in diameter , with inter - electrode distances ( center - to - center ) of about 1 mm or less . currently available multiwell mea devices do not have the capability to define electrodes to the size disclosed in this invention . ii . the fabrication process : fabricating micro - scale electrodes on printed circuit board ( pcb ), kapton flex board , hybrid circuit board technology , flip chip techniques , multi - or single - layer glass technology ( i . e . micronit inc ). more specifically , using printed circuit boards ( of any kind ) or multilayer glass technology with vias as a substrate for single - well or multiwell meas . pcb substrate materials may include , but are not limited to , the following : fr - 4 , fr - 2 , kapton , polyimide , and teflon , and polyethylene terephthalate ( pet ). currently available multiwell mea devices in large - area ansi / sbs compliant formats do not utilize microfabrication technologies . iii . transparency : in most cell culture applications it is desirable to evaluate or observe the culture with an inverted microscope . thus , bottom - side transparency , the ability to see through the bottom of the device to observe the underside of the cells , is a desired feature . laminatable , translucent films such as kapton and transparent films such as pet ( among others ) pressed over a hole in the package / pcb substrate to enable inverted microscopy . such thin films can provide superior optical characteristics like a high degree of light transmittance through the substrate . glass substrates provide this advantage as well due to light transmission through the substrate . current multiwell configurations do not disclose this feature . iv . applications : using the multiwell mea as a high throughput instrument for the investigation of electrically active tissue ( including , but not limited to , neural and cardiac cells , cellular networks and tissue , spinal cultures and tissue , and muscle tissue ), which may have specific applications in drug discovery , basic science , epilepsy research , biosensing , high throughput network or tissue analysis . v . connectivity : the use of a pcb or glass substrate as a biochip packaging element and sensor substrate provides an avenue to create bottom side electrical contact pads for ‘ outside - world ’ connections or sockets . bottom side connectivity is made affordable because of via processing readily available in standard pcb and glass - via processes . additionally , bottom - side connector pads significantly reduce the size of the sensor array , as the connector / socket pads are now on a different plane than the electrodes and can lie directly under the sensor array ( outside the transparency region , if applicable ). bottom side metal patterning also creates an opportunity to create a metal heater surface just below the cell culture . a fully microfabricated , packaged and assembled multiwell mea is shown in fig1 ( right hand side ). the components of this system include a microfabricated mea that is constructed utilizing techniques described herein , such as a flip chip package including a glass die with a printed circuit board or a post processed pet - based pcb . this multiwell mea docks into a system that consists of electronics and signal processing units plus data management / software analysis functionalities . biological assays have been conducted using these meas to evaluate neuronal cytocompatibility . the various steps for these experiments are described below . 1 . to remove potential leachants from microfabrication , the devices were sequentially rinsed in sterile ethanol for 5 minutes , followed by rinsing in sterile di water for 5 minutes . the multiwell meas were then soaked in sterile di water for up to 72 hours ( with a change in di water every 24 hours ). the di water was then discarded and the meas were subjected to a rinse with sterile ethanol . this was followed by an 8 hour dehydration bake at 60 ° c . in an oven . this bake completed the steps for removing potential leachants from microfabrication and pcb manufacturing . 2 . before plating cells , the meas were subject to a 1 min oxygen plasma treatment . this process improves the adherence of cells to the meas . this was followed by the coating of 50 μg / ml poly - d - lysine for 2 hrs at 37 ° c . on the mea surfaces . neuronal cells from e18 cortices of rats were cultured on the meas with a density of 3 × 10 5 cells / cm 2 . cells were seeded at the appropriate density in 50 μl of neurobasal media directly on to the center of the mea devices . cells were allowed to attach for 30 min at 37 ° c ., then an additional 950 μl of neurobasal media was added to the device . devices with individual lids were placed inside petri dishes to minimize media evaporation . the devices with cells were studied using optical microscopy at 1 day , 4 days , 7 days and 21 days in - vitro for neurite outgrowth and general health of the culture . images of the cell cultures were captured . at 28 days in - vitro live / dead assays were performed in accordance with the procedures described by cullen et al . fig7 depicts optical and fluorescent microscopy images of cultures of neuronal cells in an individual well at 21 and 28 days in - vitro . the extracellular electrode activity from cultured neuronal cells is indicated in fig8 . this depicts activity from cells after stimulation was performed with and without the elimination of stimulus artifact .	8
a feedback control system is commonly used to control an output variable of a process or plant in the face of some disturbance . linear feedback control systems typically use combinations of proportional feedback control , integral feedback control , and derivative feedback control . feedback that is the sum of proportional plus integral plus derivative feedback is often referred to as pid control . the laplace transform of an output u ( s ) of a pid controller is given by : u  ( s ) = g  ( s )  e  ( s ) = [ k 1 + k 2 s + k 3  s ]  e  ( s ) ( 1 ) in the above equation , g ( s ) is the transfer function of the pid controller , e ( s ) is the controller input , u ( s ) is the controller output , k 1 is the coefficient for proportional feedback , k 2 is the coefficient for integral feedback , and k 3 is the coefficient for derivative feedback . the coefficients k i may be represented by a coefficient vector k , where k =[ k 1 , k 2 , k 3 ]. the vector k is commonly called a coefficient gain schedule ( cgs ). the values of the coefficients k used in the linear pid control system are based on a dynamic model of the plant . when the plant is unstable , nonlinear , and / or time - variant , then the coefficients in k are often controlled by an ai control system . fig1 shows a typical prior art ai control system 100 . an input y ( t ) of the control system 100 is provided to a plus input of an adder 104 and an output x ( t ) of a plant 110 is provided to a minus input of the adder 104 . an output of the adder 104 is provided as an error signal e ( t ) to an error signal input of a pid controller 106 . an output u ( t ) of the pid controller 106 is provided to a first input of an adder 108 and to a first input of a genetic algorithm ( ga ). a disturbance m ( t ) is provided to a second input of the adder 108 . an output u ( t ) of the adder 108 is provided to an input of the plant 110 . the plant 110 has a transfer function h ( s ) and an output x ( t ), where x ( t )⇄ x ( s ) ( where the symbol ⇄ denotes the laplace transform ) and x ( s )= g ( s ) u ( s ). an output of the genetic algorithm 116 is provided to an input of a fuzzy logic neural network ( fnn ) 118 and an output of the fuzzy neural network 118 is provided to a fuzzy controller ( fc ) 120 . an output of the fuzzy controller 120 is a set of coefficients k , which are provided to a coefficient input of the pid controller 106 . the combination of the genetic algorithm 216 and the entropy calculator 214 comprises a simulation system of control quality 215 . the combination of the fuzzy neural network 218 and the fuzzy controller 220 comprises a fuzzy logic classifier system flcs 219 . the combination of the plant 210 and the adder 208 comprises a disturbed plant model 213 . the disturbed plant signal u ( t )= u ( t )+ m ( t ), and the disturbance m ( t ) are typically unobservable . the error signal e ( t ) provided to the pid controller 106 is the difference between the desired plant output value y ( t ) and the actual plant output value x ( t ). the pid controller 106 is designed to minimize the error represented by e ( t ) ( the error being the difference between the desired and actual output signal signals ). the pid controller 106 minimizes the error e ( t ) by generating an output signal u ( t ) which will move the output signal x ( t ) from the plant 110 closer to the desired value . the genetic algorithm 116 , fuzzy neural network 118 , and fuzzy controller 120 monitor the error signal e ( t ) and modify the gain schedule k of the pid controller 106 in order to improve the operation of the pid controller 106 . the pid controller 106 constitutes a reverse model relative to the plant 110 . the genetic algorithm 116 evolves an output signal α based on a performance function ƒ . plural candidates for α are produced and these candidates are paired according to which plural chromosomes ( parents ) are produced . the chromosomes are evaluated and sorted from best to worst by using the performance function ƒ . after the evaluation for all parent chromosomes , good offspring chromosomes are selected from among the plural parent chromosomes , and some offspring chromosomes are randomly selected . the selected chromosomes are crossed so as to produce the parent chromosomes for the next generation . mutation may also be provided . the second - generation parent chromosomes are also evaluated ( sorted ) and go through the same evolutionary process to produce the next - generation ( i . e ., third - generation ) chromosomes . this evolutionary process is continued until it reaches a predetermined generation or the evaluation function ƒ finds a chromosome with a certain value . the outputs of the genetic algorithm are the chromosomes of the last generation . these chromosomes become input information a provided to the fuzzy neural network 118 . in the fuzzy neural network 118 , a fuzzy rule to be used in the fuzzy controller 120 is selected from a set of rules . the selected rule is determined based on the input information α from the genetic algorithm 116 . using the selected rule , the fuzzy controller 120 generates a gain schedule k for the pid controller 106 . the vector coefficient gain schedule k is provided to the pid controller 106 and thus adjusts the operation of the pid controller 106 so that the pid controller 106 is better able to minimize the error signal e ( t ). although the ai controller 100 is advantageous for accurate control in regions near linearized equilibrium points , the accuracy deteriorates in regions away from the linearized equilibrium points . moreover , the ai controller 100 is typically slow or even unable to catch up with changes in the environment surrounding the plant 110 . the pid controller 106 has a linear transfer function g ( s ) and thus is based upon a linearized equation of motion for the plant 110 . since the evaluation function ƒ used in the genetic algorithm 116 is only based on the information related to the input e ( t ) of the linear pid controller 106 , the controller 100 does not solve the problem of poor controllability typically seen in linearization models . furthermore , the output results , both in the gain schedule k and the output x ( t ) often fluctuate greatly , depending on the nature of the performance function ƒ used in the genetic algorithm 116 . the genetic algorithm 116 is a nonlinear optimizer that optimizes the performance function ƒ . as is the case with most optimizers , the success or failure of the optimization often ultimately depends on the selection of the performance function ƒ . the present invention solves these and other problems by providing a new ai control system 200 shown in fig2 . unlike prior ai control systems , the control system 200 is self - organizing and uses a new performance function ƒ which is based on the physical law of minimum entropy . an input y ( t ) of the control system 200 is provided to a plus input of an adder 204 and an output x ( t ) of a plant 210 is provided to a minus input of the adder 204 . an output of the adder 204 is provided as an error signal e ( t ) to an error signal input of a pid controller 206 and to an input of a fuzzy controller 220 . an output u ( t ) of the pid controller 206 is provided to a first input of an adder 208 and to a first input of an entropy calculator ( ec ) 214 . a disturbance m ( t ) is provided to a second input of the adder 208 . an output u ( t ) of the adder 208 is provided to an input of the plant 210 . the plant 210 has a transfer function h ( s ) and an output x ( t ), such that x ( s )= g ( s ) u ( s ), where x ( t )⇄ x ( s ). the output x ( t ) is provided to a second input of the entropy calculator 214 and to the minus input of the adder 204 . an output of the entropy calculator 214 is provided to an input of a genetic algorithm 216 and an output of the genetic algorithm 216 is provided to an input of a fuzzy logic neural network ( fnn ) 218 . an output of the fuzzy neural network 218 is provided to a rules selector input 222 of the fuzzy controller 220 . a coefficient gain schedule ( cgs ) output 212 of the fuzzy controller 222 is provided to a gain schedule input of the pid 206 . the error signal e ( t ) provided to the pid controller 206 is the difference between the desired plant output value y ( t ) and the actual plant output value x ( t ). the pid controller 206 is designed to minimize the error represented by e ( t ). the pid controller 206 minimizes the error e ( t ) by generating an output signal u ( t ) which will move the output signal x ( t ) from the plant 210 closer to the desired value . the fuzzy controller 220 monitors the error signal e ( t ) and modifies the gain schedule k of the pid controller 206 according to a fuzzy control rule selected by the fuzzy neural network 218 . the genetic algorithm 216 provides a teaching signal k t to the fuzzy neural network 218 . the teaching signal k t is a global optimum solution of a coefficient gain schedule k generated by the genetic algorithm 216 . the pid controller 206 constitutes a reverse model relative to the plant 210 . the genetic algorithm 216 evolves an output signal a based on a performance function ƒ . plural candidates for α are produced and these candidates are paired by which plural chromosomes ( parents ) are produced . the chromosomes are evaluated and sorted from best to worst by using the performance function ƒ . after the evaluation for all parent chromosomes , good offspring chromosomes are selected from among the plural parent chromosomes , and some offspring chromosomes are randomly selected . the selected chromosomes are crossed so as to produce the parent chromosomes for the next generation . mutation is also employed . the second - generation parent chromosomes are also evaluated ( sorted ) and go through the same evolutionary process to produce the next - generation ( i . e ., third - generation ) chromosomes . this evolutionary process is continued until it reaches a predetermined generation or the evaluation function ƒ finds a chromosome with a certain value . then , a component from a chromosome of the last generation becomes a last output , i . e ., input information α provided to the fuzzy neural network 218 . in the fuzzy neural network 218 , a fuzzy rule to be used in the fuzzy controller 220 is selected from a set of rules . the selected rule is determined based on the input information α from the genetic algorithm 216 . using the selected rule , the fury controller 220 generates a gain schedule k for the pid controller 206 . this is provided to the pid controller 206 and thus adjusts the operation of the pid controller 206 so that the pid controller 206 is better able to minimize the error signal e ( t ). the fitness function ƒ for the genetic algorithm is given by f = min    s  t ( 2 ) were  s  t = (  s c  t -  s u  t ) ( 3 ) the quantity ds u / dt represents the rate of entropy production in the output x ( t ) of the plant 210 . the quantity ds c / dt represents the rate of entropy production in the output u ( t ) of the pid controller 206 . dynamic stability properties of the plant 210 near an equilibrium point can be determined by use of lyapunov functions . let v ( x ) be a continuously differentiable scalar function defined in a domain d ⊂ r n that contains the origin . the function v ( x ) is said to be positive definite if v ( 0 )= 0 and v ( x )& gt ; 0 for x ≠ 0 . the function v ( x ) is said to be positive semidefinite if v ( x )≧ 0 for all x . a function v ( x ) is said to be negative definite or negative semidefinite if − v ( x ) is positive definite or positive semidefinite , respectively . the derivative of v along the trajectories { dot over ( x )}= ƒ ( x ) is given by : v  ( x ) = ∑ i = 1 n   ∂ v ∂ x i  x . i = ∂ v ∂ x  f  ( x ) ( 4 ) where ∂ v /∂ x is a row vector whose ith component is ∂ v /∂ x i and the components of the n - dimensional vector ƒ ( x ) are locally lipschitz functions of x , defined for all x in the domain d . the lyapunov stability theorem states that the origin is stable if there is a continuously differentiable positive definite function v ( x ) so that v ( x ) is negative definite . a function v ( x ) satisfying the conditions for stability is called a lyapunov function . calculation of the lyapunov dynamic stability and entropy production for a closed nonlinear mechanical system is demonstrated by using the holmes - rand ( duffing - van der pol ) nonlinear oscillator as an example . the holmes - rand oscillator is described by the equation : { umlaut over ( x )}+ ( α + β x 2 ) { dot over ( x )}− γx + x 3 = 0 ( 5 ) where α , β , and γ are constant parameters . a lyapunov function for the holmes - rand oscillator is given by : v = 1 2  x . 2 + u  ( x ) ,  where    u = 1 4  x 4 - 1 2  γ   x 2 ( 6 ) entropy production d i s / dt for the holmes - rand oscillator is given by the equation :  i  s  t = ( α + β   x 2 )  x . 2 ( 7 ) equation 5 can be rewritten as : x ¨ + ( α + β   x 2 )  x . + ∂ u ∂ x = 0 ( 8 ) after multiplying both sides of the above equation by { dot over ( x )}, then dv / dt can be calculated as :  v  t = x ¨  x . + ∂ u ∂ x  x . = - 1 t   i  s  t ( 9 ) an interrelation between a lyapunov function and the entropy production in an open dynamic system can be established by assuming a lyapunov function of the form v = 1 2  ∑ i = 1 6   ( q i 2 + s 2 ) ( 10 ) where s = s u − s c and q i =( α , γ , β , { dot over ( α )},{ dot over ( γ )},{ dot over ( β )}). it is possible to introduce the entropy function s in the lyapunov function v because entropy s is also a scalar function of time . differentiation of v with respect to time gives :  v  t = ∑ i = 1 6   q i  q . i + s  s . ( 11 ) in this case , q i = ψ i ( q i , τ , t ), s = s u − s c , { dot over ( s )}={ dot over ( s )} u −{ dot over ( s )} c and thus :  v  t = ∑ i = 1 6   q i  ϕ i  ( q i , τ , t ) + ( s u - s c )  (  s u  t -  s c  t ) ( 12 ) a special case occurs when β = 0 and the holmes - rand oscillator reduces to a force - free duffing oscillator , wherein :  i  s  t = - α   x . 2   ( duffing   oscillator ) ( 13 ) and the entropy production is given by :  i  s  t = 1 t  ( x 2 - 1 )  x . 2   ( van   der   pol   oscillator ) ( 15 ) for a micro - mobile robot in fluid , a mechanical model is given by : m 1  x ¨ 1 + c d  ρ 2  a 1   x . 1   x . 1 + k 1  ( x 1 - x 0 - l 1  θ 0 ) - k 2  ( x 2 - x 1 - l 2  θ 1 ) = 0 ( 16 ) m 2  x ¨ 2 + c d  ρ 2  a 2   x . 2   x . 2 + k 2  ( x 2 - x 1 - l 2  θ 1 ) - k 3  ( x 3 - x 2 - l 3  θ 2 ) = 0 ( 17 ) m 3  x ¨ 3 + c d  ρ 2  a 3   x . 3   x . 3 + k 3  ( x 3 - x 2 - l 3  θ 2 ) = 0 ( 18 ) where : θ n + 1 = - 1 2  θ n + 3 2  1 l n + 1  ( x n + 1 - x n ) ( 19 ) values for a particular micro - mobile robot are given in table 1 below . entropy production for the micro - mobile robot is given by the equation :  s i  t = ∑ n = 1 3   c d   ρ 2  a n   x . n   x . n 2 ( 20 ) and the lyapunov function is given by : v = ∑ i = 1 3   m i  x . i 2   ρ 2 + ∑ i = 1 3   k i  ( x i - x i - 1 - l i  θ i - 1 ) 2 2 + s 2 2 ( 21 ) where s = s i − s c and s c is the entropy of a controller with torque τ . the necessary and sufficient conditions for lyapunov stability of a plant is given by the relationship : ∑ i     q i  ϕ i  ( q i , τ , t ) & lt ; ( s u - s c )  (  s c  t -  s i  t ) ,  s c  t & gt ;  s i  t  u ( 22 ) according to the above equation , stability of a plant can be achieved with “ negentropy ” s c ( by brillouin &# 39 ; s terminology ) where a change of negentropy ds c / dt in the control system 206 is subtracted from a change of entropy dsi / dt in the motion of the plant 210 . the robust ai control system 200 provides improved control of mechanical systems in stochastic environments ( e . g ., active vibration control ), intelligent robotics and electro - mechanical systems ( e . g ., mobile robot navigation , manipulators , collective mobile robot control ), bio - mechanical systems ( e . g ., power assist systems , control of artificial replaced organs in medical systems as artificial lung ventilation ), micro electromechanical systems ( e . g ., micro robots in fluids ), etc . the genetic algorithm realizes the search of optimal controllers with a simple structure using the principle of minimum entropy production . the fuzzy neural network controller offers a more flexible structure of controllers with a smaller torque , and the learning process produces less entropy . the fuzzy neural network controller gives a more flexible structure to controllers with smaller torque and the learning process produces less entropy than a genetic analyzer alone . thus , an instinct mechanism produces less entropy than an intuition mechanism . however , necessary time for achieving an optimal control with learning process on fuzzy neural network ( instinct ) is larger than with the global search on genetic algorithm ( intuition ). realization of coordinated action between the look - up tables of the fuzzy controller 220 is accomplished by the genetic algorithm and the fuzzy neural network . in particular , the structure 200 provides a multimode fuzzy controller coupled with a linear or nonlinear neural network 218 . the control system 200 is a realization of a self - organizing ai control system with intuition and instinct . in the adaptive controller 200 , the feedback gains of the pid controller 210 are changed according to the quantum fuzzy logic , and approximate reasoning is provided by the use of nonlinear dynamic motion equations . the fuzzy tuning rules for the gains k i are shaped by the learning system in the fuzzy neural network 218 with acceleration of fuzzy rules on the basis of global inputs provided by the genetic algorithm 216 . the control system 200 is thus a hierarchical , two - level control system that is intelligent “ in small .” the lower ( execution ) level is provided by a traditional pid controller 206 , and the upper ( coordination ) level is provided by a kb ( with fuzzy inference module in the form of production rules with different model of fuzzy implication ) and fuzzification and de - fuzzification components , respectively . parallel soft computing for fuzzy control is preferably based on quantum computing . the genetic algorithm 216 simulates an intuition mechanism of choosing the optimal structure of the pid controller 206 by using the fitness function , which is the measure of the entropy production , and the evolution function , which in this case is entropy . one embodiment of the self - organizing control system 200 is advantageously used in the simulation of a robot unicycle 300 shown in fig3 and 4 . the unicycle 300 comprises a motor 304 driving a weighted yoke 302 . the motor 304 and a rate gyro sensor 306 are attached to a frame 318 . a right closing link mechanism 308 is attached between the frame 318 and an axle of a wheel 312 . a left closing link mechanism 316 is attached between the frame 318 and the axle of the wheel 312 . a motor 310 drives the right link mechanism 308 and a motor 314 drives the left link mechanism 316 . a unicycle is an inherently unstable nonlinear system and simultaneous control of both longitudinal and lateral stability is needed to maintain the unicycle &# 39 ; s postural stability . it is an unstable problem in three dimensions . however , a rider can achieve a postural stability on a unicycle , keep the wheel speed constant and change the unicycle &# 39 ; s posture in the yaw direction by using a flexible body , good sensory systems , skill and intelligence . thus , the unicycle is a reasonable testbed for the control system 200 . analysis of the control system 200 is based on a thermodynamic model representation of the dynamic equation of motion for the plant , described as an open dynamic system . accordingly , a mechanical model with dissipative processes for the plant in 210 for a unicycle is given by the equation : [ q ¨ λ ] = [ m  ( q ) - ∂ c ∂ q e  ( q ) 0 ] - 1   [ τ - b  ( q )  [ q . , q . ] - c  ( q )  [ q . 2 ] - d  ( q )  [ q . ] - g  ( q ) - f  ( q , q . ) ] ( 23 ) a thermodynamic description of the production of entropy in the control system 200 used in a unicycle can be expressed as : [  s u  t  sc  t  ] = [ m  ( q ) 0 1 0 ] - 1   [ τ d - b  ( q )  [ q . , q . ] - c  ( q )  [ q . 2 ] - d  ( q )  [ q . ] - g  ( q ) - f  ( q , q . ) ]  [ q . 0 ]  where τ =( τ 105 , 0 , 0 , 0 , 0 , τ θ2 , 0 , τ θ4 , τ n ) and ds c / dt is the rate of entropy production in the pid controller 206 and dsu / dt is the rate of entropy production of the plant 210 ( the unicycle ). e ( q ) is a 4 × 4 coefficient matrix for acceleration . f ( q ,{ dot over ( q )}) is a 4 dimensional vector containing coriolis and centrifugal terms . both e and f are determined from the constraint equations on a closed - link loop acceleration . the matrix ∂ c /∂ q is a 4 × 4 matrix determined by constraint equations of the two closed link loops . the quantity λ is a 4 - dimensional vector of lagrangian multipliers ; m ( q ) is a 9 × 9 matrix of masses ; b ( q ) is a 9 × 36 matrix of coriolis coefficients ; [{ dot over ( q )},{ dot over ( q )}] is a 36 × 1 vector of velocity products given by ({ dot over ( q )}, { dot over ( q )})=[{ dot over ( ψ )},{ dot over ( α )}, { dot over ( ψ )}{ dot over ( γ )}, . . . { dot over ( θ )} 4 { dot over ( η )}] t ; c ( q ) is a 9 × 9 matrix of centrifugal coefficients ; [{ dot over ( q )} 2 ] is a 9 × 1 vector given by ({ dot over ( ψ )} 2 ,{ dot over ( α )} 2 ,{ dot over ( γ )} 2 , { dot over ( β )} 2 ,{ dot over ( θ )} 1 2 ,{ dot over ( θ )} 2 2 ,{ dot over ( θ )} 3 2 ,{ dot over ( θ )} 4 2 , { dot over ( η )} 2 ) t ; d ( q ) is a 9 × 9 matrix of friction coefficients ; [{ dot over ( q )}]=({ dot over ( ψ )},{ dot over ( α )},{ dot over ( γ )}, { dot over ( β )},{ dot over ( θ )} 1 ,{ dot over ( θ )} 2 ,{ dot over ( θ )} 3 ,{ dot over ( θ )} 4 , { dot over ( η )}) t ; and g ( q ) is a 9 × 1 vector of gravity terms . the state vector q is defined as the vector [ q ]=( ψ , α , γ , β , θ 1 , θ 2 , θ 3 , θ 4 , η ) t . the vector τ d describes the dissipative parts of the control torque on the unicycle plant . stability analysis of the unicycle as a nonlinear plant 210 is accomplished , as before , by using asymptotic methods with lyapunov functions and methods of qualitative physics based on correlation between lyapunov and production entropy functions . the new approach for definition of the lyapunov function described above is used . a lyapunov function for the system is given by : v = 1 2  ( ∑ i = 1 n   q i 2 + s 2 ) ( 25 ) where s = s u − s c and q i is a generalized coordinate of the plant model . the input u is a random signal produced by the sum of the control signal u and the disturbance ( noise ) m ( t ). calculation of entropy production performed in the entropy calculator 214 . the output of the entropy calculator is the full entropy production of the dynamic system , ds / dt , and the minimum of this function is used as a fitness function in the genetic algorithm 216 . the output of the genetic algorithm 216 is an optimal gain structure k t for the pid controller 206 . the structure k t is used as the teaching signal for the fuzzy neural network 218 in the flcs 219 . the flcs 219 comprises the fuzzy neural network 218 and the fuzzy controller 220 . the fuzzy neural network 218 generates a knowledge base ( kb ) comprising a look - up table of production rules by using a neural network learning process . the kb output of the fuzzy neural network 218 comprises a look - up table of fuzzy rules ( lptr ) as input for the fuzzy controller 220 . the kb provides for self - organization of the fuzzy controller 220 in the flcs 219 . the flcs 219 provides the adaptation process of an intelligent fuzzy controller 220 structure to the random disturbance m ( t ) in the control signal u *( t ). the output coefficient gain schedule ( cgs ) of the fuzzy controller is provided as an input to the pid - controller to program the coefficient gains k i in accordance . this approach differs from procedural design of fuzzy hybrid pid - type controllers . this design method provides new concepts of a robust structure controller 210 with optimal learning , with minimum entropy production in the control process , and self - organization of the kb structure of the fuzzy controller 220 . the genetic algorithm 216 is preferably a massy genetic algorithm with elite strategy . genetic operators have the following parameters . for the selection , a roulette method ( reduce rate = 5 ) is used . a reproduction operator replaces some chromosome generations . crossover ( with a probability of 0 . 64 ) and mutation ( with a probability of 0 . 08 ) determines , by random numbers , every chromosome &# 39 ; s bit ( i . e ., whether crossover and / or mutation occur ). genes encode each parameter from the interval [ 0 , 10000 ] and the number of used chromosomes is 100 . the fuzzy neural network 218 is preferably a feedforward structure network with four layers . the structure of the fuzzy neural network 218 is preferably similar to the structure of the fuzzy controller 220 . the first layer in the fuzzy neural network 218 is comparable to fuzzification in the fuzzy controller 220 . the second layer in the fuzzy neural network 218 is comparable to an “ if . . . ” part in the inference mechanism of the fuzzy controller 220 . the third layer in the fuzzy neural network is comparable to a “ then . . . ” part in the inference mechanism of the fuzzy controller 220 . finally , the fourth layer in the fuzzy neural network is comparable to a de - fuzzification operator structure in the fuzzy controller 220 . the structure of the fuzzy neural network 218 may use a max - min method for the fuzzy inference and the fuzzy production rules . the membership functions of the fuzzy neural network 218 are preferably optimized by the back - propagation method with minimum information entropy as the criteria of accuracy . in one embodiment used with a unicycle simulation , the fuzzy neural network 218 has 2 inputs , 2 hidden layers ( 14 units in the first layer and 49 units in the second layer ), 1 output , 7 linguistic terms for error and change of error , and 49 rules in the knowledge base . one aspect of the simulation is a comparison of results between the genetic algorithm 216 and the fuzzy neural network 218 for the torque and pid controller gains with minimum entropy production . fig5 is a graph 500 of angle ( in radians ) as a function of time ( in seconds ) for a simulated unicycle with an ai controller 200 . the graph 500 shows a curve 502 showing the angle of the rotor , a curve 504 showing the angle of the wheel , a curve 506 showing yaw of the unicycle , a curve 508 showing roll of the unicycle , and a curve 510 showing pitch of the unicycle . fig6 is a graph 600 of angular velocity ( in radians / second ) as a function of time ( in seconds ). the graph 600 shows a curve 602 showing the angle of the rotor , a curve 604 showing the angle of the wheel , a curve 606 showing yaw of the unicycle , a curve 608 showing roll of the unicycle , and a curve 610 showing pitch of the unicycle . fig7 is a graph showing a phase surface for the roll angle ( in radians ) and angular velocity ( in radians / second ) as a result of the simulation for the posture control performed by the robot unicycle in fig3 . fig8 is a graph showing a phase surface for the pitch angle ( in radians ) and angle speed ( in radians / second ) as a result of the simulation for the posture control performed by the robot unicycle in fig3 . fig9 is a graph 900 showing the time changes in angle ( in radians ) as a function of time ( in seconds ) for each part in the unicycle as a result of the simulation for the posture control using the methods in the prior art . the graph 900 includes a curve 902 showing the angle of the rotor , a curve 904 showing the angle of the wheel , a curve 906 showing yaw of the unicycle , a curve 908 showing roll of the unicycle , and a curve 910 showing pitch of the unicycle . fig1 is a graph showing the time changes in angular velocity ( in radians / second ) versus time ( in seconds ) for each part of the unicycle as a result of the simulation for the posture control in the prior art . the graph 1000 includes a curve 1002 showing the angle of the rotor , a curve 1004 showing the angle of the wheel , a curve 1006 showing yaw of the unicycle , a curve 1008 showing roll of the unicycle , and a curve 1010 showing pitch of the unicycle . fig1 is a graph showing a phase surface for the roll angle and angle speed as a result of the simulation for the posture control in the prior art which is performed by the robot unicycle in fig3 . fig1 is a graph 1200 illustrating a phase surface for the pitch angle and angle speed as a result of a simulation of the robot unicycle in fig3 using the posture control in the prior art . fig1 is a graph 1300 illustrating another example of the simulation for the posture control indicating the effect of the control method in the present invention . the graph 1300 is a plot of angle ( in radians ) versus time ( in seconds ). the graph 1300 includes a curve 1302 showing roll without control , a curve 1304 showing roll with control , a curve 1306 showing pitch without control , and a curve 1308 showing pitch with control . although the foregoing has been a description and illustration of specific embodiments of the invention , various modifications and changes can be made thereto by persons skilled in the art , without departing from the scope and spirit of the invention as defined by the following claims .	6
the method of the present invention may be separated into two general steps , the laminating step illustrated in fig1 and the roll forming step illustrated in fig2 . the laminated strip 10 comprised of a metal strip 11 and fabric strip 12 is shown in fig3 . the final rail product 13 is shown in fig4 . in the laminating step an adhesive material 14 is applied by a flow coating nozzle 15 to the metal strip 11 fed from a roll 16 . the bonding together of the metal strip and the fabric strip is effected by placing an adhesive material on the metal strip and feeding the fabric strip 12 into overlying relation to and between the laminating rollers 17 , 18 . the resulting laminated strip 10 is then temporarily stored on a take - up roll 19 . the rollers 17 , 18 , shown in fig2 are grooved to provide proper location of the fabric strip 12 on the metal strip 11 so that the fabric does not interfere with the subsequent formation of the rail . the groove in the upper laminating roller 17 has a width approximately the same as the width of the fabric strip 12 and a depth sufficient to accomodate the fabric . the fabric strip 12 , as shown in fig3 and various other figures , is located on the metal strip 11 between two reference lines x and y adjacent the location along which the metal strip is to be bent in forming interlocking u - shaped lockseam parts of the lockseam . the location of the fabric is important , as will become apparent in the description of the roll forming step . in the roll forming step , the laminated strip 10 is fed by feeding rollers 23 to a first set of roller dies 24 - 30 which gradually bend the laminated strip 10 into a circular but open tube . the ends of the rollers 23 are knurled and of a diameter to press against the upper and lower surfaces of the metal strip 11 outwardly of the reference lines x and y . the two knurled roller ends produce a knurling or roughening of the metal strip adjacent its right and left longitudinal edges 21 and 22 where the metal extends beyond the fabric strip 12 and is exposed . this roughening assists in producing a tight slip - free lockseam in the final lockseam forming step described below . fig6 - 12 illustrate the progression of the laminated strip 10 as it is roll formed into a circular open tube . in the progressive rolling of the laminated strip 10 , the longitudinally extending and exposed portions 31 and 32 of the metal strip adjacent the edges 21 and 22 are first both bent upwardly to form bends 33 and 34 adjacent the right and left edges 21 and 22 . it will be noticed from fig6 that the bend 34 is spaced at a distance further from the associated longitudinal edge 22 of the metal strip than is the bend 33 from its associated edge 21 . furthermore , the strip outwardly of the bend 34 is folded back along another bend 35 to form a step 36 . with reference to fig7 - 12 , it will be seen that the bend 33 is continued until a first u - shaped lockseam part 37 is formed . also , the opposite longitudinal portion 32 of the metal strip beyond the bend 34 is folded down to form a bend 39 and this bend 39 is continued until a second u - shaped lockseam part 40 is formed . as also noted from these fig7 - 12 , the first u - shaped lockseam part 37 faces inwardly of the rail , whereas the second u - shaped lockseam part 40 faces outwardly of the rail . also , as shown in fig1 , 12 and 13 , the lockseam part 40 is disposed laterally outwardly of the left edge 41 of the fabric with the fabric extending down the step 36 and the edge 41 lying along the bottom of the step . in contrast , the right edge 42 of the fabric extends to the bend 33 of the first lockseam part . as the laminated strip 10 is fed through the roller dies 24 - 30 , a compression of the laminated strip is performed in addition to the roll forming operation . in particular , the fabric 12 is gradually compressed and actually embossed into the metal strip 11 . this is shown in a greatly exagerated state in fig4 . the embossing is necessary to give the finished rail 13 a thickness dimension which will allow it to be used with existing metal rail hardware and processing equipment . in the presently preferred embodiment , the metal strip is approximately 0 . 018 &# 34 ; thick and the fabric approximately 0 . 055 &# 34 ; thick when glued together in the apparatus of fig1 . this forms a total assembly which is 0 . 080 &# 34 ; thick or greater . if this thickness is not subsequently reduced , it would not be able to be cut off or fabricated in standard processing equipment . therefore , the process of the present invention includes the step of thoroughly compressing the fabric so as to partly emboss it into the metal strip . the compressing is sufficient to actually emboss the heavier threads into the metal substrate and generally produce an overall laminate thickness of about 0 . 06 &# 34 ; as it exits from the rollers 24 and a final thickness of about 0 . 04 &# 34 ; or smaller as it exits from the rollers 30 . at the end of the roll forming and compression operations as performed by the first set of roller dies 24 - 30 , the open tube shape of the rail permits feeding of the rail over a mandrel 43 shown in fig1 . this mandrel is mounted at one end on the mandrel support 44 , shown in fig2 and extends inside the rail from just after the last roller die 30 , through a second set of roller dies 45 - 48 and then through a set of lockseam compression roller dies 49 - 52 . the mandrel 43 provides an anvil against which the lockseam roller dies 49 - 52 act to compress the lockseam to close it . in order to counteract friction between the mandrel 43 and the rail , wheels 43 &# 39 ; are provided . these wheels run against the top and bottom inside surfaces of the rail in opposition to the lockseam roller dies 49 - 52 . the lockseam parts are shown in fig1 as they appear just before being closed by the lockseam roller dies 49 - 52 . although , in the preferred embodiment , the edge 42 of the fabric should align at x ( fig3 ) in an area generally beginning at the point of the lockseam bend 33 , it can extend for as much as 45 degrees into the arc of this bend . in this regard , the initial positioning of the fabric strip 12 on the metal strip il is important . if the fabric extends significantly beyond points x then it will extend beyond the bend 33 and prevent a proper lockseam from being formed . if the fabric falls short of this point , particularly x , then metal will be exposed along the lockseam which would detract from the appearance of the rail . similarly , in the case of the edge 41 , it is very critical that it does not extend beyond the point y ( fig3 ). this edge should align with the bottom of the step 36 and be located inwardly of the second lockseam part 40 . this insures that the fabric does not enter the lockseam area at all and yet is positioned relative to the lockseam in a manner such as to minimize the probability of either frayed edges or exposed metal . a lockseam 53 is actually formed by the lockseam compression roller dies 49 - 51 by progressively closing the lockseam parts 37 and 40 as shown in fig1 , 15 and 16 . these views show the lockseam at the first and second of compression roller dies 49 and 50 while fig1 shows the rail at the subsequent tape applicator device 54 . the shape of the rail at the last roller die 52 of the lockseam roller dies is basically the same as at the tape applicator device 54 . in the presently preferred embodiment , the final construction of the lockseam 53 as shown in fig1 will have the edge 41 of the fabric at the bottom of the step 36 and the edge 42 of the fabric abutting the fabric disposed along the step . with this construction , no metal is exposed along the lockseam 53 . furthermore , with this positioning of the edges 41 and 42 of the fabric , the lockseam is formed with roughened metal to metal contact along three surfaces of the u - shaped lockseam parts 37 and 40 , and no fabric extends into the lockseam proper . after a closed tubular rail 55 is formed , adhesive tape 56 is applied and hot melted over the lockseam and to areas of the rail 55 which will be significantly bent in the final forming step . strip heaters 56 are included as part of the tape applicator device 54 to melt the adhesive and capture any fibers which might be frayed along the lockseam or become frayed or otherwise exposed in the final forming step or tend to pull away from the rail surface . more particularly , the adhesive tape 56 applied along the lockseam and the areas which will be subsequently formed into the sharply bent concave areas along the top and bottom of the rail where fabric might become frayed or loose because of the concave bends . this adhesive is , however , not discernible on the finished rail . in the final forming step , crushing roller dies 57 - 59 crush the closed tubular rail 55 into the final form 13 shown in fig4 . as here shown and as shown in fig1 , the final rail structure has convex sides and concave top and bottom with the lockseam located internally of the concave top also , the adhesive tape 56 is located within the concave top and bottom to keep the fabric in place . progressive cross - sections of the rail at roller dies 57 and 59 are shown in fig1 and 18 . after final forming , the rail 13 is cut to desired length by a cut - off machine 60 . in order to protect the appearance of the fabric the entire process must be performed without any external lubrication on the rail . in the absence of such lubrication the inherent slipperiness of the fabric strip 12 provides sufficient lubrication between the forming rollers and the rail . the rail 13 produced by this process has fabric 12 which completely surrounds the metal 11 leaving no seams which would detract from the appearance .	8
because of the intensive competition in the market , every internet service provider ( isp ) is looking for opportunities to enhance its service offerings to stay competitive . this invention discloses a service architecture that allows an isp to deploy enhanced information services for its customers without incurring high deployment cost . in this invention , the functions of an ivr system are split into two parts , i . e ., a front end and a back end . the front end is populated at the pops of an isp and the back end is located at anywhere in the internet . particularly , the invention lets an isp provide the functions of telephony ( e . g ., call handling and touch - tone detection ) and audio ( e . g ., playing audio files , voice recording , and text - to - speech conversion ) at every pop , and puts the software components ( which interact with users ) in the internet . a software component , called an interactive response agent ( ira ) located in the internet interacts with users . an ira has two roles : one is to interact with users who are using touch - tone phones , and the other is to interface with application servers such as e - mail servers , voicemail servers , web servers , database servers etc . on users behalf . if the information retrieved by an ira is in text format , it will be sent to the pop where the user called in , converted into synthesized speech by text - to - speech converters , and played back to users over telephone lines . if the retrieved information is an audio file , as in a phonemail system , the information will be sent to the pop , converted into a form for playing back over a phone line . the present invention not only telephone - enables application servers , it also provides a two - fold advantage to an isp &# 39 ; s corporate customers . on one hand , the corporate customers of an isp can easily enable their end users to access corporate information without buying expensive ivr units . on the other hand , corporations can have full control of iras which retrieve corporate information on behalf of end users . what a corporate customer needs is an ira that interfaces with the isp &# 39 ; s pop . in general , different application servers are accessed by different protocols , e . g . http for web servers .) the application - dependent ira can be provided by an isp , purchased from third party vendors , or developed by corporate i / s staff . for popular information servers such as lotus notes e - mail servers , microsoft exchange servers , and web servers , third party vendors can help to develop the corresponding ira components . for corporate proprietary database applications , the corporate has to develop its own ira which interfaces with isp &# 39 ; s pop . in order to make the components developed by various vendors interoperable , a set of api ( application programming interface ) between pops and iras can be standardized . fig2 shows a system diagram for the present invention which takes a user - oriented approach to distributed ivr systems . in fig2 , like reference numerals represent the same component as in fig1 . fig2 shows a telephone 105 connected to a pstn 110 which connects to a local point - of - presence ( pop ) 220 of an internet service provider ( isp ). the pop 220 includes a front end ( fe ) manager 222 which is a call handling routine , users profile 224 , connection functions 226 , audio functions 126 , and a telephony interface 128 for interfacing with the pstn 110 . the behavior of the fe manager 222 is controlled by a state machine 300 shown in fig3 a . one major component in the present invention is the users profile 224 which contains , among other things , authentication passwords and billing information , a table describing the service items that the user has subscribed to and the networic addresses of the interactive response agents providing those services for each subscriber of the isp . when a subscriber of the isp called a local pop 220 , the phone call will be answered by a front end ( fe ) manager 222 . after the caller is authenticated the caller will be able to specify the desired service item , and the fe manager 222 will establish a session and communicate with the corresponding ira through connection functions 226 over the internet 150 . in the present invention , each subscriber is able to maintain his / her profile and add / delete a pair of a service item and the corresponding network address of the ira handling that service . moreover , when the caller is done with a service , the session between the fe manager 222 and the ira manager 262 will be terminated and the caller will have an opportunity to select another service item in his / her profile . hence the front end at a pop is not statically tied with a particular ira during a phone call , i . e . a dynamically reconfigurable capability . the detailed algorithms of a fe manager and an ira manager to achieve this capability are described in fig3 a - 3c and 4 a - 4 b . the connection functions 226 are a set of api for the fe manager 222 to establish a session and have a two - way communication with ira managers , e . g . ira manager 262 and 272 . the connection functions 226 include api calls to send a session request , send dtmf a digit , send an audio file , receive a text message , receive an audio file , and terminate a session . the fe manager 222 is further interfaced with the internet 150 to which ira 260 , ira 270 , application server 280 and application server 290 are connected . the ira 260 and 270 are agents working between the fe manager and back end application servers such as e - mail servers , financial database servers , web servers , etc . an ira gives the caller the feeling of interacting with an ivr system . an ira can be specialized in interfacing with a specific type of servers . an ira can also implement multiple server interfaces for communicating with different types of application servers . for example , application server 280 can be a lotus notes server ; ira 270 has the api to communicate with it . application 290 can be a computer running web server , pop3 email server and news server ; ira 270 has the set of apis to communicate with multiple application servers . in a preferred embodiment , this ira 270 has a security profile as described in u . s . patent application ser . no . 09 / 239 , 322 to liu entitled “ security profile for web browser ” which is filed on the same day as this disclosure and is herein incorporated by reference in its entirety . in fig2 , ira 260 contains an ira manager 262 , connection functions 264 , and server interface 266 for interfacing with server 280 . the behavior of the ira manager 262 is controlled by a state machine 400 , to be detailed in fig4 a . the fe manager 222 interacts with the ira manager 262 by a set of api as defined in connection functions 226 and 264 over the internet 150 . the connection functions 264 are a set of api calls for the ira manager 262 to establish a session and have a two - way communication with fe manager 222 . the connection functions 264 include api calls to accept a session request , receive a dtmf digit , receive an audio file , send a text message , send an audio file , and send end - of - service request . fig3 a is the state transition diagram 300 of the fe manager 222 . the fe manager 222 has 3 possible states , namely the idle state 310 , the active state 320 , and the pass - through state 350 . initially the fe manager stays in the idle state 310 . when a new phone call is answered , the fe manager 222 moves to the active state 320 which is detailed by the flowchart in fig3 b . the fe manager 222 stays in the active state until either the phone call is hung up , at which point the fe manager goes back to the idle state 310 , or until a session is established with an ira , at which point the fe manager 222 moves to the pass - through state 350 , detailed in fig3 c . the fe manager 222 stays in the pass - through state until either the phone call is hung up , at which point it goes to the idle state 310 , or until the session with the ira is terminated , at which point it goes back to the active state 320 . a session between the fe manager 222 and the ira manager 262 is established after the ira manager 262 sends the fe manager 222 an acknowledgment in response to a request sent by the fe manager 222 . the session is terminated when the ira manager 262 sends an end - of - service request to the fe manager 222 . fig3 b shows a flowchart describing the fe manager 222 in the active state 320 . the fe manager 222 , starting at step 322 and authenticate the caller in step 324 , where the caller is prompted to supply the user id and personal identification number ( pin ) by pressing touch - tone pads on the phone . the user id and pin is checked against the users profile 224 in step 326 . if authentication is successful , the fe manager 222 will in step 328 obtain a service menu from the user &# 39 ; s profile stored in users profile 224 . if the authentication is not successful , the fe manager 222 will in step 329 obtain a service menu from the public profile stored in users profile 224 . the obtained service menu is then presented to the caller in step 330 . the fe manager 222 then obtains the service item chosen by the caller in step 332 , and finds the network address of the ira corresponding to the caller &# 39 ; s selection in step 334 . the fe manager 222 then tries to establish a session with the ira in step 336 and checks the successfulness in step 338 : if the session is successfully established , the fe manager 222 transits to the pass - through state 350 and enters step 352 ( see fig3 c .) if the session is not successfully established , fe manager 222 will report to the caller in step 340 that the chosen ira is not available , and go back to step 330 . it is possible that the fe manager 222 enters the active state 320 from the pass - through state 350 in step 342 . in such a case , the fe manager 222 will in step 344 inform the caller that he / she is back to the main service menu at the front end and go to step 330 . fig3 c shows a flowchart for the fe manager 222 in the pass - through state 350 where a session is already established with an ira . the fe manager 222 starts at step 352 and checks if it receives an end - of - service ( eos ) request from the ira in step 354 . if eos is received , the fe manager 222 will disconnect the session with the ira and goes to step 342 , an entry point to the flowchart of the active state in fig3 b . if no eos is received , the fe manager 222 will check if the telephony interface 128 receives dtmf tones from the caller in step 356 . if any dtmf tone is received , the fe manager 222 will send the dtmf digit , converted from tones by the telephony interface 128 , to the ira in step 358 . then the fe manager 222 will check if any data ( text or audio ) is received from the ira in step 360 . if there is data received from the ira , the fe manager 222 will invoke the appropriate converters , such as text - to - speech converters and audio layers , and present the information to the caller through the telephony interface 128 in step 362 . if no data is received from the ira in step 360 , the fe manager 222 will go back to step 354 . fig4 a is a state transition diagram 400 for an ira manager 262 . an ira manager 262 has 2 possible states , namely the idle state 410 and the active state 420 . initially ira manager 262 stays in the idle state 410 until it receives a request to establish a session from a fe manager , at which point it establishes a session with the requesting fe manager by sending back an acknowledgment and goes to the active state 420 , detailed in fig4 b . ira manager 262 will stay in the active state 420 until the caller wants to end the session , at which point the ira manager 262 will send end - of - service ( eos ) request to the fe manager 222 , terminate the session , and go back to the idle state 410 . fig4 b shows a flowchart describing the ira manager 262 in the active state 420 . the ira manager 262 starts at step 422 and establishes a session with the requesting fe manager 222 using connection functions 264 in step 424 . depending on whether the underlined service is public or personal , the ira manager 262 may authenticate the user in step 426 by prompting the user to supply user &# 39 ; s account number and password . for example , e - mail is a personal service . the ira manager 262 then enters a loop where it interacts with an application server such as the application server 280 to obtain the data that the user needs in step 428 using the application server interface 266 . the ira manager 262 then formats received application data , appends service menu for user &# 39 ; s next selection , and sends data to the fe manager 222 in step 430 . the ira manager 262 receives user &# 39 ; s selection from the fe manager 222 in step 432 and checks if the user &# 39 ; s selection correspond to ending the service in step 434 . if the user &# 39 ; s selection is not to end the service , the ira manager 262 goes back to step 428 to obtain application data . the ira manager 262 exits the loop at step 434 when it finds that the user selects to end the session . in such a case , the ira manager 262 sends an end - of - service ( eos ) request to the fe manager 222 in step 436 , tears down the session at step 438 , and proceeds to the idle state at step 410 . the present invention discloses a service architecture for isps to offer phone - enabled information services such as e - mail , stock quotes , weather information , travel information , personalized traffic information , personalized news services , financial services , sports information , professional services , ticket information , on - line shopping , etc . these many types of services can be provided by different iras supported by different vendors as long as users put the network addresses of the iras they have access to into their user profiles . simply by a local phone call to his local sp , the dynamically reconfigurable capability of the distributed ivr systems disclosed by this invention will allow a caller to visit multiple service providers &# 39 ; iras in the same phone call callers do not have to memorize multiple phone numbers , one for each service provider .	7
while the present invention will be described in the context of producing capillary laminate materials particularly suited for use in disposable absorbent articles , more particularly in the context of sanitary napkins , the present invention is in no way limited to such applications . to the contrary , the present invention may be practiced to great advantage whenever it is desired to produce capillary laminate materials not previously obtainable using prior art web forming processes . fig1 depicts a representative capillary laminate material 40 of the type described in the aforementioned langdon , et al . applications . capillary laminate material 40 is particularly well suited for use as a topsheet or acquisition layer in a sanitary napkin or other absorbent article . capillary laminate material 40 shown in fig1 comprises a first fluid pervious sheet or layer 42 and a second fluid pervious sheet or layer 46 . the fluid pervious nature of the first sheet 42 and the second sheet 46 is provided by apertures 43 and 47 , respectively . while the fluid pervious nature of the first and second sheets 42 and 46 is provided by apertures 43 and 47 , it would be obvious to one of ordinary skill in the art that there are other means of imparting a fluid pervious nature to a sheet , such as microporous materials , porous material , slits , etc . the first and second sheets are spaced apart from one another by a spacer . the spacer shown in fig1 comprises a plurality of generally cylindrical spacers 48 . spacers 48 also serve to connect or secure the first sheet 42 to the second sheet 46 . spacers 48 separate first sheet 42 from second sheet 46 such that a &# 34 ; capillary zone &# 34 ; 50 is created between the first sheet 42 and the second sheet 46 . as used herein , the term &# 34 ; capillary zone &# 34 ; refers to the space between two adjacent sheets not being occupied by a spacer . the material selected for the first sheet 42 and the second sheet 46 is preferably machinable and capable of being formed into a sheet . since the capillary laminate material 40 is to be used in consumer products which contact the human body , the capillary laminate material 40 is preferably soft and safe for epidermal or other human contact . preferred materials for the first sheet 42 and the second sheet 46 are polymeric materials including , but not limited to polyolefins , particularly polyethylenes , polypropylenes and copolymers having at least one olefinic constituent . other polymeric materials such as polyester , nylon , copolymers thereof and combinations of any of the foregoing may also be suitable . while first sheet 42 and second sheet 46 are shown as a film , the sheets may , if desired , be in the form of a nonwoven , microporous membrane , foam , etc . if desired , conventional amounts of agents may also be added to the polymeric matrix of the first sheet 42 and the second sheet 46 . it is often desired to add agents to increase the opacity of the sheets . whiteners , such as titanium dioxide and calcium carbonate may be used to opacity the first and second sheets , 42 and 46 , respectively . it may also be desired to add other agents such as surfactants to impart a hydrophilic nature to either the first sheet 42 or the second sheet 46 . degrees and amounts to which agents including whiteners and surfactants are added to the first sheet 42 and the second sheet 46 may be distinct from one another to provide varying effects such as hydrophilicity gradients and the ability to mask fluids within the absorbent article . the first sheet 42 and the second sheet 46 may themselves be multilayer polymeric films such as those disclosed in commonly assigned u . s . pat . no . 5 , 006 , 394 issued to baird on apr . 9 , 1991 and u . s . pat . no . 5 , 261 , 899 issued to visscher et al . on nov . 16 , 1993 , said patents being incorporated herein by reference . the spacers used to form the capillary laminate can be formed from a material which is added to the sheets or from one of the sheets themselves . examples of materials that can be added include , but are not limited to hot melt adhesives , pressure sensitive adhesives , thermoplastics with a melting point temperature lower than one or more of the sheets , etc . these additional materials can be applied by gravure printing , screen printing or any number of processes which are known to those skilled in the art . accordingly , the spacers 48 may be made from any material suitable for securing the first sheet 42 to the second sheet 46 . for example , spacers 48 may be made from a heat sealable hot melt adhesive such as eastobond a3 , manufactured by eastman chemical , or hl - 1412 , manufactured by fuller adhesive . the spacers 48 may also be made from a polymer material having a lower melting point temperature than the polymeric material used for either the first sheet 42 or the second sheet 46 . the spacers 48 are preferably applied to one of the sheets using a known technique such as gravure printing , screen printing , or transfer printing . when using a pressure sensitive adhesive sufficient pressure must be applied to achieve bonding or securement between the spacers and the respective sheets . when using a hot melt adhesive or a polymeric material having a lower melting point temperature than the materials used for either the first sheet or the second sheet , sufficient heat must be applied to heat the spacers to achieve bonding between the respective sheets . alternatively , the spacers 48 may be formed from one or more of the sheets themselves . this can be achieved by embossing , either hot or cold , casting or other processes known to those skilled in the art . the other sheet is then combined with the embossed or cast sheet to form the laminate material of the present invention . when used as a topsheet on an absorbent article , such as a topsheet on a sanitary napkin , the first sheet 42 becomes the wearer - contacting or body surface of the topsheet . the second sheet 46 becomes the garment facing or pad - contacting surface of the topsheet . accordingly , as fluid impinges capillary laminate material 40 it first contacts the wearer - contacting surface 42a of the first sheet 42 . fluid then proceeds through apertures 43 and into the capillary zone 50 . upon reaching capillary zone 50 fluid then moves within the capillary zone 50 under capillary pressure . the fluid moves throughout the capillary zone 50 in both the lateral and transverse directions . simultaneously , the fluid passes through apertures 47 in second sheet 42 and into the acquisition layer of a sanitary napkin . the dimensions of apertures 43 and 47 in first sheet 42 and second sheet 46 , respectively , may be substantially identical to one another or may be of different dimensions . for example , successively smaller apertures in adjacent sheets can be used to create a capillary driving force through the capillary laminate material in the direction of the smaller apertures . when used as a topsheet or an acquisition layer , it may be desirable to have apertures 43 slightly larger than apertures 47 to provide a capillary gradient within capillary laminate material 40 . it may also be desirable to vary the dimension of the apertures 43 and 47 within their respective sheets . for example , when used as a topsheet it may be desirable to have the apertures 43 in first sheet 42 which are located in the central region of the sanitary napkin , i . e ., the region surrounding the intersection of the longitudinal and transverse centerlines , larger than the apertures adjacent the periphery of the sanitary napkin . the difference in dimension may be easily defined from one region to the next , or may be indiscernible as the dimensions may change gradually from one region to the next region . in addition to varying the size of apertures 43 and 47 it is also possible to vary the frequency of apertures 43 and 47 . for example , when used as a topsheet it may be desirable to have a relatively high frequency of apertures near the central region as compared to the regions near the periphery of the absorbent article . in general , the fewer the apertures and the smaller the apertures the larger the capillary zone defined by the two sheets and the spacers . the dimension of the capillary zone 50 may be also be varied for particular uses . for example , if used as a topsheet on a disposable diaper , the dimension of capillary zone 50 may be smaller than if used as a topsheet on a sanitary napkin , due to the viscosity and density differences of urine and menses and / or blood . therefore , the capillary zone for a diaper topsheet will more than likely be smaller than the capillary zone of a sanitary napkin topsheet . the spacer elements used to both separate and secure the sheets of the capillary laminate material together can be a single spacer or a plurality of spacers having various geometric shapes . the height of the spacers will determine the gap between the sheets or the capillary zone . the capillary zone can be designed to optimally handle different fluids . for example , it has been determined that for blood or menses , the capillary zone should be less than about 0 . 006 inches ( 6 mils ), more preferably about 0 . 003 inches ( 3 mils ). water or urine is best transferred by a smaller capillary zone . the capillary zone may be varied throughout the capillary laminate material . variability of the capillary zone can be used to encourage fluid flow in the direction of decreasing capillary zone . the frequency , cross - sectional area , and height of spacers 48 determine to a substantial degree the dimension of the capillary zone 50 . the cross - sectional area of the spacers 48 is determined by taking the cross - sectional area of the spacers in a plane substantially parallel to the first and second sheets 42 and 46 , respectively , as is indicated by sectional lines a -- a in fig1 . spacers 48 are shown as having a circular cross - sectional shape , however , other cross - sectional shapes such as squares , rectangles , ovals , triangles , arcs , dog bone , etc . may also be used for spacers 48 . the sidewalls 49 of spacers 48 are shown as being substantially straight along their length in fig1 . however , sidewalls 49 may be concave or convex or any other shape such as sloped , curvilinear , etc . as may be desired . the spacers may also be used to divide the capillary zone into capillary channels . capillary channels can be utilized to direct flow within the capillary zone . the capillary channels can be linear , curvilinear or a combination of both . the capillary channels can be uniform in cross - sectional area or they can vary along their length . for example , a decreasing cross - sectional area of a capillary channel can promote fluid flow in the direction of decreasing cross - sectional area . within capillary zone 50 there is at least one and more preferably a multiplicity of capillary channels , generally designated as 60 . referring to fig1 as fluid moves between adjacent spacers 48 the shape of the capillary channel 60 between spacers 48 continually changes . accordingly , the capillary channels 60 have a non uniform shape along their length . the capillary channels within the capillary zone may take on any shape as desired . for example , the capillary channels may be straight along their entire length , straight along only a portion of their length , continuous along their entire length , discontinuous along their entire length , curvilinear , extend in a fan - like array , oval , hourglass , dog bone , asymmetric , etc . fig2 is an enlarged , partially segmented , perspective illustration of another preferred embodiment of the capillary laminate film of fig1 which has been formed into a macroscopically expanded , three - dimensional , fiber - like , apertured web 70 . the overall form / shape of the macroscopically expanded web 70 is generally in accordance with the teachings of commonly assigned u . s . pat . no . 4 , 342 , 314 , issued to radel et al . on aug . 3 , 1982 and hereby incorporated herein by reference . web 70 has been found suitable for use as a topsheet on a sanitary napkin . the term &# 34 ; macroscopically expanded &# 34 ;, when used to describe three - dimensional webs of the present invention , refers to webs , ribbons , and films which have been caused to conform to the surface of a three - dimensional forming structure so that both surfaces thereof exhibit a three - dimensional pattern of surface aberrations corresponding to the macroscopic cross - section of said forming structure . the surface aberrations comprising said pattern being individually discernible to the normal naked eye , i . e ., a normal naked eye having 20 / 20 vision unaided by any instrument that changes the apparent size or distance of an object or otherwise alters the visual powers of the eye , when the perpendicular distance between the viewer &# 39 ; s eye and the plane of the web is about 12 inches . the term &# 34 ; fiber - like &# 34 ; as utilized herein to describe the appearance of webs of the present invention , refers generally to any fine - scale pattern of apertures , random or non - random , reticulated or non - reticulated , which connotes an overall appearance and impression of a woven or non - woven fibrous web when viewed by the human eye . as can be seen in fig2 the webs fiber - like appearance is comprised of a continuum of fiber - like elements , the opposed ends of each of the fiber - like elements are interconnected to at least one other of the fiber - like elements . in the embodiment disclosed in fig2 the interconnected fiber - like elements form a pattern network of pentagonally shaped capillaries 72 . the web 70 , which exhibits a fiber - like appearance , embodies a three - dimensional microstructure extending from the web &# 39 ; s uppermost or wearer - contacting surface 75 in plane 76 to its lowermost or absorbent pad - contacting surface 78 in plane 79 to promote rapid fluid transport from the uppermost surface 75 to the lowermost surface 78 of the web without lateral transmission of fluid between adjacent capillaries 72 . as utilized herein , the term &# 34 ; microstructure &# 34 ; refers to a structure of such fine scale that its precise detail is readily perceived by the human eye only upon magnification by a microscope or other means well - known in the art . apertures 85 are formed by a multiplicity of intersecting fiber - like elements , e . g ., elements 86 , 87 , 88 , 89 and 90 , interconnected to one another in the first surface of the web . each fiber - like element comprises a base portion , e . g ., base portion 92 , located in plane 76 . each base portion has a sidewall portion , e . g ., sidewall portions 93 , attached to each edge thereof . the sidewall portions 93 extend generally in the direction of the second surface 78 of the web . the intersecting sidewall portions of the fiber - like elements are interconnected to one another intermediate the first and the second surfaces of the web and terminate substantially concurrently with one another in the plane 79 of the second surface . in a particularly preferred embodiment , the interconnected sidewall portions terminate substantially concurrently with one another in the plane of the second surface to form apertures in the second surface 78 of the web . the network of capillaries 72 formed by the interconnected sidewall portions allows for free transfer of fluid from the first surface of the web directly to the second surface of the web without lateral transmission of the fluid between the adjacent capillaries . in addition , small amounts of fluid are able to penetrate the apertures 43 in the first layer 42 of the capillary laminate material 40 . the first layer 42 is separated from and secured to the second layer 46 by spacers 48 to provide a capillary zone 50 between the first and second sheets . alter penetrating apertures 43 , fluid will then move through the capillary zone 50 toward the second surface of the web . upon reaching the second surface of the web , fluid will be removed from the capillary zone 50 and transmitted to the underlying layer . fluid may also enter apertures 47 in the second layer 46 . in fig3 there is shown another preferred embodiment of a capillary laminate material 40 of the present invention . capillary laminate material 40 comprises a first sheet 42 and a second sheet 46 secured together and spaced apart by a plurality of spacers 48 . first sheet 42 includes a plurality of apertures 343 . the second sheet 346 is substantially non - apertured , thus preventing fluids from transmitting therethrough . capillary laminate material 40 may be particularly useful as a macroscopically expanded topsheet such as that shown in fig2 where it is not desired or necessary to have fluid penetrate the second sheet 46 . alternatively , the capillary laminate material 40 may also be used as an absorbent core wherein the second sheet 46 is impervious to liquids and therefore may aid the backsheet in the protection against soiling of undergarments and clothing . fig4 is a simplified , schematic flow diagram of a process according to the present invention for producing capillary laminate materials , in particular , three - dimensional , macroscopically expanded capillary laminate materials . a web of substantially planar film 101 comprised of a polymeric material such as polyethylene is fed from supply roll 100 around idler roll 105 and onto the surface of forming drum 110 about which a forming structure 111 continuously rotates at substantially the same speed as the incoming web . the web of film is driven by the forming drum 110 . the web 101 contains at least one spacer , and preferably contains a plurality of spacers , on the side facing away from forming drum 110 and is of the general configuration of sheet 46 as discussed above with regard to fig3 . forming structure 111 comprises a macroapertured surface , such as a patterned network of pentagonally - shaped capillaries , and is preferably constructed generally in accordance with the teachings of u . s . pat . no . 4 , 342 , 314 , issued to radel and thompson on aug . 3 , 1982 , the disclosure of which is hereby incorporated herein by reference . forming structure 111 is comprised of a plurality of individual photoetched lamina . the apertures in forming structure 111 may be of any desired shape or cross - section when the forming structure is fabricated using the laminar construction techniques generally disclosed in the aforementioned patent . a second web of substantially planar film 116 comprised of a polymeric material such as polyethylene is fed from supply roll 115 around idler roll 120 and onto the surface of forming drum 125 about which a forming structure 126 continuously rotates at substantially the same speed as the incoming web . the web of film is driven by the forming drum 125 . forming structure 126 comprises a microapertured surface , such as a woven wire support member , which rotates about a stationary vacuum chamber 135 , generally in accordance with the teachings of u . s . pat . nos . 4 , 629 , 643 and 4 , 609 , 518 , the disclosures of which are hereby incorporated herein by reference . a high pressure liquid jet nozzle 130 is directed at the surface of the web 116 intermediate a pair of baffles ( not shown ) as the web traverses the vacuum chamber 135 . the high pressure , i . e ., preferably at least about 800 psig ., jet of liquid causes the web 116 to assume the general contour of the knuckle pattern of the woven wire support member 126 . in addition , because the interstices formed by the intersecting filaments are unsupported , the fluid jet causes rupture at those portions of web 116 coinciding with the interstices in the woven wire support structure 126 , thereby producing a &# 34 ; microapertured &# 34 ; web . this microapertured web exhibits a multiplicity of fine scale surface aberrations with microapertures coinciding with the point of maximum amplitude of the surface aberrations . the structure and formation of such microapertured webs is described in greater detail in the above - referenced and incorporated u . s . patents . after the microaperturing process is completed , the microapertured web is removed from forming structure 126 about an idler roll 140 , passed about an idler roll 145 , and applied to the outwardly - facing surface ( containing the spacers ) of the web 101 which was previously applied to the forming structure 111 . alternatively , the forming structures 110 and 125 may be positioned in closer proximity to one another , such that the idler rolls 140 and 145 may be omitted . the microapertured web , when produced by the above - described method , is preferably oriented such that the microscopic surface aberrations are oriented so as to face outwardly away from the forming structure 111 . the forming drum 110 preferably includes an internally located vacuum chamber 155 which is preferably stationary relative to the moving forming structure 111 . a pair of stationary baffles ( not shown ) approximately coinciding with the beginning and end of the vacuum chamber 155 are located adjacent the exterior surface of the forming structure . intermediate the stationary baffles there is preferably provided means for applying a fluid pressure differential to the laminate web 175 as it passes over the vacuum chamber . in the illustrated embodiment , the fluid pressure differential applicator means comprises a high - pressure liquid nozzle 150 which discharges a jet of liquid , such as water , substantially uniformly across the entire width of web 101 . examples of methods for the production of formed materials using a high - pressure liquid stream are disclosed in u . s . pat . nos . 4 , 695 , 422 , issued to curro et al . on sep . 22 , 1987 ; 4 , 778 , 644 , issued to curro et al . on oct . 18 , 1988 ; and 4 , 839 , 216 , issued to curro et al . on jun . 13 , 1989 , the disclosures of all of these patents being hereby incorporated herein by reference . the water jet causes the web 101 to conform to the forming structure 111 and apertures the web 101 in the areas coinciding with the capillaries in forming structure 111 . in some situations , it may be preferable to heat the liquid stream to cause thermal bonding between the spacers and the second web 116 to form the laminate web 175 . the pressure of the liquid stream is preferably selected so as to achieve sufficient conformity of the web to the forming structure without collapsing the capillary zone between the webs or sheets , or compromising the integrity of the sheets themselves . as an alternative embodiment , it may be desirable to provide an additional high - pressure liquid nozzle 165 and vacuum chamber 170 analogous to nozzle 150 and chamber 155 , respectively , to cause the incoming web 101 to conform to the surface of the forming structure 111 before the second incoming web 116 is applied . such an arrangement may improve the processability and quality of the finished laminate material by pre - forming the first web and reducing the force required to form the laminate as a whole . following application of the fluid pressure differential to the web , the three - dimensional , macroscopically - expanded , apertured laminate web 175 is removed from the surface of the forming structure 111 about an idler roll 160 in the condition shown in fig2 . the apertured laminate web 175 may be utilized without further processing as a topsheet in an absorbent article . alternatively , the apertured laminate web 175 may be subjected to further processing , such as ring rolling , creping , or surface treatment as may be desired . the resulting laminate web 175 exhibits the general overall configuration of fig2 with the upper sheet being fluid pervious and the lower sheet being fluid - impervious , as depicted in fig3 . if a laminate web with both sheets being fluid pervious is desired , such as depicted in fig1 the lower sheet may be apertured prior to lamination by the method disclosed above with regard to the upper sheet , or by any other suitable method , so as to assume the configuration of sheet 46 of fig1 . fig5 is a simplified schematic diagram of another preferred process according to the present invention for producing capillary laminate webs . a co - wound web of substantially planar film comprised of a polymeric material such as polyethylene , spacer element or elements , and microapertured planar film comprised of a polymeric material such as polyethylene , is fed from supply roll 200 around idler roll 205 and onto the surface of forming drum 210 about which a forming structure 211 continuously rotates at substantially the same speed as the incoming web . it may be desirable to pre - bond the first and second webs or sheets to one another before or during the pre - winding of the supply roll 200 . the web of film is driven by the forming drum 210 . the web 201 is oriented such that the microapertured web faces away from the forming structure 211 , and is of the general configuration of sheet 46 as discussed above with regard to fig3 . the microapertured web may be produced by the method described above with regard to fig4 or any other suitable method , and if produced as described above is preferably oriented with the microscopic surface aberrations facing away from the other film components and away from forming structure 211 . forming structure 211 is generally similar to the forming structure 111 shown in fig4 and comprises a macroapertured surface , such as a patterned network of pentagonally - shaped capillaries . as before , the apertures in forming structure 211 may be of any desired shape or cross - section when the forming structure is fabricated using the laminar construction techniques generally disclosed with regard to fig4 . the forming drum 210 preferably includes an internally located vacuum chamber 220 which is preferably stationary relative to the moving forming structure 211 . the structure and operation of the forming drum 210 is substantially as described above with regard to forming drum 110 depicted in fig4 . in the illustrated embodiment , the fluid pressure differential applicator means comprises a high - pressure liquid nozzle 215 which discharges a jet of liquid , such as water , substantially uniformly across the entire width of web 201 . the water jet causes the web 201 to conform to the forming structure 211 and apertures the laminate web 230 in the areas coinciding with the capillaries in forming structure 211 . in some situations , it may be preferable to heat the liquid stream to cause thermal bonding between the spacers and the second web to form the laminate web 230 . the pressure of the liquid stream is preferably selected so as to achieve sufficient conformity of the web to the forming structure without collapsing the capillary zone between the webs or sheets , or compromising the integrity of the sheets themselves . following application of the fluid pressure differential to the web , the three - dimensional , macroscopically - expanded , apertured laminate web 230 is removed from the surface of the forming structure 211 about an idler roll 225 . the apertured laminate web 230 may be utilized without further processing as a topsheet in an absorbent article . alternatively , the apertured laminate web 230 may be subjected to further processing , such as ring rolling , creping , or surface treatment as may be desired . the resulting laminate web 230 exhibits the general overall configuration of fig2 with the upper sheet being fluid pervious and the lower sheet being fluid - impervious , as depicted in fig3 . if a laminate web with both sheets being fluid pervious is desired , such as depicted in fig1 the lower sheet may be apertured prior to lamination by the method disclosed above with regard to the upper sheet , or by any other suitable method , so as to assume the configuration of sheet 46 of fig1 . fig6 is a simplified schematic diagram of another preferred process according to the present invention for producing capillary laminate webs . a web of substantially planar film comprised of a polymeric material such as polyethylene is fed from supply roll 300 around idler roll 305 and onto the surface of forming drum 310 about which a forming structure 311 continuously rotates at substantially the same speed as the incoming web . the web of film is driven by the forming drum 310 . the web 301 contains at least one spacer , and preferably contains a plurality of spacers , on the side facing away from forming drum 310 and is of the general configuration of sheet 46 as discussed above with regard to fig3 . a second microapertured web of substantially planar film 316 comprised of a polymeric material such as polyethylene is fed from supply roll 315 around idler roll 320 and onto the surface of forming drum 310 . the microapertured web may be produced by the method described above with regard to fig4 or any other suitable method , and if produced as described above is preferably oriented with the microscopic surface aberrations facing away from the other film components and away from forming structure 311 . forming structure 311 is generally similar to the forming structure 111 shown in fig4 and comprises a macroapertured surface , such as a patterned network of pentagonally - shaped capillaries . as before , the apertures in forming structure 311 may be of any desired shape or cross - section when the forming structure is fabricated using the laminar construction techniques generally disclosed with regard to fig4 . the forming drum 310 preferably includes an internally located vacuum chamber 320 which is preferably stationary relative to the moving forming structure 311 . the structure and operation of the forming drum 310 is substantially as described above with regard to forming drum 110 depicted in fig4 . in the illustrated embodiment , the fluid pressure differential applicator means comprises a high - pressure liquid nozzle 315 which discharges a jet of liquid , such as water , substantially uniformly across the entire width of web 350 . the water jet causes the webs 301 and 316 to conform to the forming structure 311 and apertures the laminate web 350 in the areas coinciding with the capillaries in forming structure 311 . in some situations , it may be preferable to heat the liquid stream to cause thermal bonding between the spacers and the second web to form the laminate web 350 . the pressure of the liquid stream is preferably selected so as to achieve sufficient conformity of the web to the forming structure without collapsing the capillary zone between the webs or sheets , or compromising the integrity of the sheets themselves . as an alternative embodiment , it may be desirable to provide an additional high - pressure liquid nozzle 340 and vacuum chamber 345 analogous to nozzle 325 and chamber 330 , respectively , to cause the incoming web 301 to conform to the surface of the forming structure 311 before the second incoming web 316 is applied . such an arrangement may improve the processability and quality of the finished laminate material by pre - forming the first web and reducing the force required to form the laminate as a whole . following application of the fluid pressure differential to the web , the three - dimensional , macroscopically - expanded , apertured laminate web 350 is removed from the surface of the forming structure 311 about an idler roll 335 . the apertured laminate web 350 may be utilized without further processing as a topsheet in an absorbent article . alternatively , the apertured laminate web 350 may be subjected to further processing , such as ring rolling , creping , or surface treatment as may be desired . the resulting laminate web 350 exhibits the general overall configuration of fig2 with the upper sheet being fluid pervious and the lower sheet being fiuid - impervious , as depicted in fig3 . if a laminate web with both sheets being fluid pervious is desired , such as depicted in fig1 the lower sheet may be apertured prior to lamination by the method disclosed above with regard to the upper sheet , or by any other suitable method , so as to assume the configuration of sheet 46 of fig1 . although in the foregoing illustrative process descriptions spacers have been initially provided on the outwardly - facing surface of the web closest to the forming structure , it may be desirable under some circumstances to form or provide the spacers on the inwardly - facing side of the web farthest from the forming structure . it may also be desirable to provide spacers on both webs on their facing surfaces . in addition , the processes described herein may be adapted and expanded to produce capillary laminate materials having more than two sheets of material , in particular 3 or more sheets with a plurality of spacers between adjacent sheets , to form capillary laminate materials of the types generally described in the aforementioned langdon et al . u . s . patent applications . while particular embodiments of the present invention have been illustrated and described , it would be obvious to one skilled in the art that there is other changes and modifications that can be made without departing from the spirit and scope of the present invention . it is therefore intended to cover in the appended claims all such changes and modifications that are within the scope of this invention .	8
the device illustrated in fig1 and 2 consists of an extruder 14 positioned above a tub 8 of water . the extruder 14 has a housing accommodating a screw 7 that rotates on a driveshaft 13 . a blend 2 enters the extruder from a hopper at the left , and the threads around screw 7 force the material constantly to the right . the housing has an inside diameter d2 that decreases to a diameter d1 at the output end in the vicinity of an outlet 9 . the blend 2 of granulated thermoplastic and 20 to 25 % ancillary pieces by weight in the form of slabs 2 . 5 mm thick and 5 to 10 mm long and wide of cotton - reinforced epoxide resin enters from the hopper at the left but can accordingly not travel through extruder 14 unaltered . it is exposed to thorough kneading , resulting in melting of the thermoplastic particles and thorough distribution , bonding , and wetting of the slabs as it travels through the device . the ratio of diameter d2 to diameter d1 is approximately 2 . 5 . the plastic leaving outlet 9 is accordingly in the form of an essentially homogeneous and viscous billet rotating and traveling toward the right with slabs embedded in it paralleling the direction of emergence . downstream and to the right of extruder 14 is a mold 4 in the form of a thin - walled metal cylinder . the mold is forced against the downstream end of the extruder by a pressure - generating device 16 the mold is coaxial with outlet 9 and screw 7 . it is mounted in a device 10 that secures not only mold 4 but other molds 4 . 1 to 4 . 3 as well and rotates around an axis 11 paralleling the axis of extruder 14 . the individual molds accordingly revolve past the outlet 9 from the extruder and can stop in front of it as desired . the molds in rotating device 10 are all columnar shaped and are charged concentrically with the axis from the left end . as long as this latter condition is ensured , they can also have different cross - sections . rotating device 10 is immersed in tub 8 with its axis 11 below the surface of the water . the water can be at room - temperature . above the tub 8 and next to the extruder 14 is a receptacle 15 for finished pieces 1 , which are in the present case expelled from occupied mold 4 . 3 by compressed air injected through a nozzle 17 into the mold &# 39 ; s right end ( in the direction indicated by the arrow 17 . 1 ) a stop 18 accurately positions the expelled pieces in receptacle 15 . the stop can then be pivoted down around its axis ( in the plane of projection ) to allow the intercepted piece to enter an assembling device 19 -- a shipping pallet or something similar . fig3 schematically illustrates how a billet 3 is introduced into a mold 4 . billet 3 arrives through the outlet 9 from extruder 14 rotating around its axis and moving forward toward the center of the downstream end of mold 4 , which is surrounded by a rigid inner surface and positioned in stationary relation to outlet 9 . billet 3 is in an easily deformable state and rests subject to gravity initially below outlet 9 against the inner surface of the mold 4 , where a certain mutual adhesion between it and the mold 4 occurs due to the billet &# 39 ; s adhesive properties . due to the pressure of additional constituents of the billet 3 as they arrive and revolve around its axis , a deposit will continue to occur along the circumference of the mold 4 , resulting in mutual adhesion with inner surface 6 and with the already deposited constituents of the billet 3 . the originally available space between the deposited constituents of the billet 3 and outlet 9 will accordingly become completely occupied , and the already deposited constituents will be displaced into still available spaces , creating the initial subsidiary section of the columnar piece . the embedded slabs will surprisingly now all extend parallel to one another and to the axis of piece 1 . the original adhesion against the inner surface 6 of mold 4 will simultaneously be destroyed , and , although new constituents of piece 1 will continually come into existence at the left , the right end of the piece will become increasingly displaced to the right , in the direction indicated by the outlined arrow inside mold 4 . this process will continue until mold 4 is completely charged and inner surface is continuously and uniformly covered with constituents of the billet 3 . the attainment of this state will be indicated by a sensor 16 that communicates electrically with a switch that , when said state is attained , interrupts the supply of billets and rotates the device 10 around its axis . hot and charged mold 4 enters the water in tub 8 , and charged mold 4 . 1 , which has already been cooled in the water , is positioned for discharging in front of receptacle 15 , while another mold , which has already been discharged , is positioned for charging . the extruder 14 can now be engaged again , and the mold 4 . 3 in the discharging position can be discharged with compressed air from the nozzle 17 , introducing the next cycle . fig4 through 7 illustrate different inner and outer cross - sections of columnar shaped pieces manufactured with the method and device in accordance with the invention . characteristic of all these pieces is that , in addition to an almost non - porous zone around the edge with an essentially constant width , they have almost a foam structure at the core . the slabs at the edge are surprisingly all comprised of the hard material and extend parallel to one another and to the axis of the piece . they have a relatively extensive surface and accordingly adhere satisfactorily to the plastic matrix around them even when the two materials are not ideally matched . the pieces are accordingly provided with a skeletal reinforcement by the slabs , which finally dictates their outstanding mechanical strength and satisfactory chemical resistance . the surface consists entirely of constituents of the plastic matrix . it can have any desired texture , which is a significant aesthetic advantage . it can easily be scored to imitate leather or wood . the cross - section can be rectangular , circular , or stellate . there has thus been shown and described a novel columnar shaped piece and method of manufacturing the same which fulfills all the objects and advantages sought therefor . many changes , modifications , variations and other uses and applications of the subject invention will , however , become apparent to those skilled in the art after considering this specification and the accompanying drawings which disclose the preferred embodiments thereof . all such changes , modifications , variations and other uses and applications which do not depart from the spirit and scope of the invention are deemed to be covered by the invention , which is to be limited only by the claims which follow .	8
the embodiments of the present invention show that when a user of those service providers which cooperate with each other accesses the network , an authentication processing procedure is initiated to the authentication control device of each service provider at the same time based on the identifier information of the access user . accordingly , the user of different service providers which are in cooperation with each other in the network can finish , at one time , the access and authentication processing procedures of different service providers , thus guaranteeing the operating interest of each service provider adequately . in the method of the embodiments of the present invention , each service provider has their respective independent authentication control device , as shown in fig6 , and all the authentication control devices can configure their own aaa servers correspondingly . in the embodiments of the present invention , an authentication control device in the network connected directly to the external network is called master authentication control device , such as the authentication control device of service provider b in fig6 ; an authentication control device in other networks connected to the external network via the network connected directly to the external network is called slave authentication control device , such as the authentication control device of service provider a in fig6 . in the embodiments of the present invention , all authentication information of the users who have gained access to each master or slave authentication control device is stored in the master authentication server to which the master authentication control device corresponds , and the master authentication server is , for example , the aaa ( authentication , authorization , and accounting ) server and the corresponding rdius user authentication server of service provider b in fig6 ; alternatively , the authentication information may be stored in the slave authentication server to which each slave authentication control device corresponds , and the slave authentication server is , for example , the aaa ( authentication , authorization , and accounting ) server and the corresponding rdius user authentication server of service provider a in fig6 . taking the network architecture shown in fig6 as example , the embodiment of the method of the present invention is shown in detail in fig7 , including the following steps : step 71 : a user terminal sends a padi message to an authentication control device ( i . e . pppoe server ) of service provider a to start a pppoe access ; step 72 : after receiving the padi message , the authentication control device sends a pado message to the user terminal ; step 73 : the user terminal sends a padr request to the authentication control device according to the pado message responded by the authentication control device ; step 74 : the authentication control device generates a session id ( session identifier ), and sends it to the user terminal via a pads message ; step 75 : the user terminal and the authentication control device perform a ppp lcp ( link control protocol ) negotiation to establish link layer communication and synchronously negotiate for using the chap authentication mode ; step 76 : the authentication control device sends and provides a challenge of 128 bit to the authentication user terminal via a challenge message ; step 77 : after receiving the challenge message , the user terminal makes an md5 algorithm encryption for a password and the challenge message and then sends the encrypted challenge - password and challenge message in a response message to the authentication control device of service provider a ; the processing procedure for the user access from step 71 to step 76 is completely the same as the corresponding processing procedure in the prior art . step 78 : after receiving the authentication information , the authentication control device of service provider a sends the user identity information ( i . e . the authentication information ) such as a challenge , a challenge - password and the username to the authentication control device of service provider b , i . e . the master authentication control device ; step 79 : the authentication control device of service provider b sends the user identity information to the radius user authentication server of service provider b for authentication ; the radius user authentication server and the corresponding aaa server of service provider b are called master authentication server ; if the user identity information is stored in the aaa server of service provider b , the radius user authentication server of service provider b determines whether the user is legal according to the user identity information , and execute step 712 ; if the user identity information is stored in the aaa server of service provider a , execute step 710 . step 710 : the radius user authentication server of service provider b forwards the user information to the radius user authentication server of service provider a ; step 711 : the radius user authentication server of service provider a determines whether or not the user is legal according to the user information , and then responds with an authentication success / failure message ; if succeeds , carry the negotiation parameter and the user &# 39 ; s relevant service attribute to authorize the user ; step 712 : return the authentication success / failure message to the authentication control device of service provider b ; if skip from step 79 to this step , the radius user authentication server of service provider b determines whether or not the user is legal according to the user information , and then responds with the authentication success / failure message ; if succeeds , carry the negotiation parameter and the use &# 39 ; s relevant service attribute to authorize the user ; if skip from step 711 to this step , the radius user authentication server of service provider b forwards the message sent from the radius user authentication server of service provider a to the authentication control device of service provider b ; if the radius server of service provider b contains the user information , authenticate directly and return the result ; step 713 : after receiving the authentication success / failure message , if the user authorization is obtained successfully , the authentication control device of service provider b performs various control and management on the network of service provider b , and synchronously forwards the message to the authentication control device of service provider a ; for example , if the authentication is successful and the authorization is obtained , the authentication control device of service provider b can manage the user and the traffic which enter the network of service provider b ; however , if the authentication fails , the user can not enter the network of service provider b via the authentication control device of service provider b ; step 714 : after receiving the message , if the user authorization is obtained successfully , the authentication control device of service provider a performs various control and management on the network of service provider a , and synchronously , the authentication control device of service provider a returns the authentication result to the user terminal ; after the user terminal receives the message , if the authentication fails , the flow is ended here , or else continue to execute step 715 . step 715 : the user terminal conducts an ncp ( such as ipcp ) negotiation , and obtains , via the authentication control device of service provider a , the parameters such as the planning ip address etc . step 716 : if the ncp negotiation is successful , the authentication control device of service provider a initiates an accounting - start request to the authentication control device of service provider b , that is , sending the accounting information to the authentication control device ; step 717 : the authentication control device of service provider b forwards the request to the radius user accounting server of service provider b ; if service provider a needs no accounting information , execute step 720 directly , or else execute step 718 ; 95 step 718 : the radius user accounting server of service provider b forwards the request to the radius user accounting server of service provider a ; step 719 : the radius user accounting server of service provider a responds with an accounting - accept message to the radius user accounting server of service provider b ; step 720 : if skip from step 717 to this step , the radius user accounting server of service provider b responds with the accounting - accept message to the authentication control device of service provider b ; and if skip from step 719 to step 720 , forward the received accounting - accept message to the authentication control device of service provider b . step 721 : the authentication control device of service provider b forwards the accounting - accept message to the authentication control device of service provider a ; here , the access user passes the authentication , and obtains the legal access authority of service provider a , service provider b and the external network , and can launch its network service normally . in the embodiments of the present invention , when the user wants to terminate the network service , it can cut off the network connection also via pppoe server ( the authentication control device ), that is , sending the corresponding accounting - stop message according to the message format transmitted from step 716 to step 721 , so as to stop the corresponding accounting procedure . in the accounting procedure , the embodiments of the present invention also can adopt the accounting processing mode that the authentication control device of service provider a does not provide the accounting information and the accounting information is provided only by the authentication control device of service provider b . that is , step 716 and step 721 are omitted in fig7 . if the accounting is performed by only service provider b and service provider a trusts this , the accounting needs to be performed only once ; only in the distrust case , the accounting needs to be performed by both service providers a and b , and then to be checked . the embodiments of the present invention are applicable not only to pppoe , but also to all the other authentication modes . besides the radius , the aaa protocol may include diameter ( a new aaa protocol ) and tacacs ( terminal access controller access control system , an aaa protocol ) etc . because the authentication control device of service provider b is required to synchronize the authentication and accounting information with that of the authentication control device of service provider a , the authentication control device of service provider b must acquire the authentication information of the authentication control device of service provider a . currently , there are mainly two adoptable acquisition modes : one is the mode of detecting the data message which bears the authentication information , and another is the mode of setting the master authentication control device as a proxy server of the slave authentication control device . the following gives the explanation of these two modes : ( 1 ) the mode of detecting the data message : in this mode , it is required that the authentication request message ( such as radius request message ) initiated by the authentication control device of service provider a must be transmitted through the authentication control device of service provider b ; in this way , the authentication control device of service provider b can detect all the data message ; practically , it also can be configured to detect the specified message or the message of the specified aaa server ; generally , the detected message is stored at first , and then forwarded ; on the other hand , it also can be repackaged and then forwarded as required ; ( 2 ) the mode of setting the master authentication control device as a proxy server : the authentication control device of service provider a takes the authentication control device of service provider b as a radius server , and all the messages are sent directly to the radius port of the authentication control device of service provider b ; the authentication control device of service provider b functions as a standard radius proxy to receive , modify , and send the authentication message ; generally the radius proxy needs to repackage the message and then forward the repackaged message , but the radius proxy also can store the received message and forward the stored message directly . because the authentication control device of service provider b and the authentication control device of service provider a have synchronized the authentication and accounting information and all the user authentication and authorization information are stored in all the authentication control devices , the embodiments of the present invention enable the user to obtain the legal network authority of multiple service providers by inputting the username and the password only once . in the practical applications , the embodiments of the present invention can be extended to the interconnections among multiple service providers , so as to realize the synchronous authentication among multiple authentication control devices . the above is just the preferred embodiments of the present invention , and the scope of the present invention is not limited thereto . those skilled in the art shall appreciate that various changes or variations can be made within the scope of the present invention . thus , the scope of the present invention should be defined by the claims .	7
fig8 illustrates an element 1 representing a first and simplest embodiment of the invention . the element 1 comprises an electrically conducting layer 2 formed on a transparent substrate , such as glass or plastic . such a conducting layer 2 may be formed from any suitable conducting material , for example metallic materials such as aluminium or silver , using conventional techniques . the material typically does not cover the whole surface of the substrate i . e . the layer is not continuous but patterned into regions . regions covered in metal will substantially reflect light , whilst regions without will substantially transmit . as such , averaged across the area , the element overall will constitute a partial reflector for light . an expanded view of the layer 2 ( shown in dotted line ) illustrates regions 4 where the conductor is absent and regions 5 where the conductor is present . in this example the absent regions 4 are in the form of rectangles of random distributions with a side length 30 microns . this pattern is useful in avoiding both substantial diffraction effects and any moire interference effects with over regular structures in a display system . however , it should be understood that the invention is not limited to any particular pattern , although the conducting material should be electrically contiguous . such a conducting layer 2 may be formed for example by ; depositing aluminium by vacuum sputtering on the substrate ; overcoating the layer with a photoresist ; uv exposure of the resist through a suitable mask ; development of the resist ; etching of the exposed metal with a suitable acidic etchant ; removal of the remaining resist . such a method , and many other patterning techniques , are well known to those skilled in the art . a further overcoating of protective material ( not shown ) may be useful to limit oxidation which reduces reflectivity . the element 1 further comprises electrical connections 6 at it &# 39 ; s four corners in order to provide for touch sensing . such an element 1 can be combined with known touch capacitance measurement techniques to function as a touch sensor . an example of such measurement techniques is the method known as “ surface capacitance ” as illustrated in fig1 and described below . thus , the optical element 1 has a combined function as touch sensor and partial reflector . the transmittance ( t ) and reflectance ( r ) of the element 1 may be principally determined by the proportion of the surface area of layer 2 that is covered with the reflective conducting material ( regions 5 ). if the proportion of the area covered with the reflective conducting material is x and the reflectivity of the conducting material is r then ( ignoring reflection / absorption losses in the substrate ): reflectivities r of & gt ; 0 . 9 can be achieved for aluminium and & gt ; 0 . 95 for silver . both r and t may typically be in the range 0 . 2 - 0 . 8 for the element 1 , and more preferably in the range 0 . 4 - 0 . 6 . however , for many common applications values close to 0 . 5 are the most useful . fig9 illustrates an element 7 representing a second embodiment of the invention . this embodiment differs from the embodiment in fig8 in that the conducting layer 2 is split into discrete regions ( 9 and 11 for example ) which are electrically isolated from one another on the underlying substrate . each of the discrete regions 9 , 11 , etc . will each have their own electrical connection 13 , 15 , etc ., respectively . sub - patterning within each discrete region ( e . g ., as represented by the expanded view ) may have the random rectangle form of the embodiment of fig8 with regions 4 , 5 or any other form as previously described . such an arrangement of discrete regions 9 , 11 , etc . may be advantageous for use with alternate touch sensing methods such as the “ projected capacitance ” method illustrated in fig1 and described below . such a method may be advantageous as it is sensitive to close proximity rather than requiring relatively close contact for good operation . fig1 illustrates an element 17 representing a third embodiment of the invention . this embodiment differs from the embodiment in fig8 in that an alternative fine patterning is used for the conducting layer 2 . in this case such patterning includes an array of fine conducting lines ( representing reflective regions 19 ) with non - conducting gaps ( representing optically transparent regions 21 ) in between . the conducting material forming the regions 19 should be electrically contiguous , for example using an electrically conductive trace along an edge ( s ) of the element 17 ( e . g ., along the upper and lower edges of the array ). the pitch of such an array of fine conducting lines will typically be less than 1 micron and more typically of the order of 100 nm . such an array will have the property that it will reflect plane polarised light with a polarisation axis parallel to the array , and transmit light polarised orthogonal to it . as such the array constitutes a “ wire - grid ” polariser and may function as a reflective polariser as is known in the art . techniques for forming such a small - scale structure , such as laser interferometry , are also well known in the art . such an element 17 therefore constitutes a combined reflective polariser and touch sensor . it should be understood that such a pattern may equally be implemented with the macroscopic patterning into discrete isolated regions as previously described in the embodiment of fig9 . in this manner , the conducting layer 2 may be made up of an array of electrically isolated mini - grids each having an array of fine conducting lines 19 with non - conducting gaps 21 therebetween . fig1 illustrates a possible configuration of discrete regions within an element 7 , as in an expanded embodiment of fig9 , in order to provide a touch sensor . a number of discrete touch regions ( e . g ., 9 , 11 ) are represented by squares , with attached lines ( e . g ., 13 , 15 , respectively ) showing the electrical connections which lead to the perimeter for connection to measurement equipment . a finger brought near to this array will register the strongest signal on the regions close to it . comparison of signal strength at each of the attached lines may allow interpolation of position to an accuracy finer than the pitch of the array . therefore , such an array may be used to allow location of a touch in x and y directions . this can be useful in use as a 2d touchscreen for display applications . fig1 illustrates a further possible configuration of discrete regions ( e . g ., 25 , 27 , etc .) within an element in order to provide a touch sensor . this differs from the embodiment of fig1 in that discrete regions 25 , 27 , etc . are formed as rows and columns respectively on two separate optically transparent substrates ( or on opposite faces of one substrate ). one set of conductors in the form of regions 25 are for sensing in a y direction are formed on a first substrate , whilst a second set of regions 27 for sensing in an x direction are formed on a second substrate mounted below the first . such an arrangement may have advantages of simplicity of connection tracks compared to that shown in fig1 and therefore may allow a greater density of discrete regions and hence greater positional accuracy . again the regions 25 , 27 , etc . may each comprise a conducting layer 2 with a pattern of regions 4 , 5 as in fig8 and 9 ; regions 19 , 21 as in fig1 ; or any other suitable combination of electrically conductive and optically reflective regions , and optically transparent regions . fig1 illustrates an example of a touch sensor 30 according to the present invention . this example utilizes an optical element 1 of the type shown in fig8 , and a measurement technique commonly referred to “ surface capacitance ”. the optical element 1 including the conducting layer 2 which is electrically contiguous with electrical connections 6 at each corner . only one such connection 6 is shown for clarity . the method employs an ac source 31 which provides a drive signal to each corner . when a finger touches or comes in close contact with the conducting layer 2 it forms a capacitance allowing ac current to flow to ground . the resistance of the path between the finger and each corner of the element 1 will be proportional to the distance from that corner , so in general each resistance values 32 , 34 from respective corners will be different . the current drawn from each corner will be proportional to said resistance and this may be amplified by amplifier 36 and measured by associated controller 38 . the relative value of the four current measurements is used to determine the finger position . such a technique is most suitable when the finger can be in close contact with the conducting layer 2 . fig1 illustrates another example of a touch sensor 40 in accordance with the present invention . this example combines the basic electrical arrangement for a known measurement technique commonly called “ projected capacitance ” and an element 7 of the type shown in fig9 and 11 where the conductor is sub - divided into electrically isolated regions . for clarity just one such region 11 is illustrated , so it should be understood that multiple such regions may exist and each senses touch independently . an ac source 42 is used to charge up reference capacitor 44 . the conductor region 11 functions as a touch pad and forms some capacitance to ground represented by c touch 46 . if charging of the reference capacitor 44 is stopped then the voltage on it may be monitored whilst it discharges through c touch 46 . the value of said capacitance will determine the rate of discharge . the touch capacitor and the reference capacitor act as potential divider and the measured voltage is give by the following equation : v measured = v drive · c ref /( c ref + c touch ) if a finger is brought close to the touchpad , the value of c touch 46 will increase and this may be detected by a reduction in the measured voltage . other methods for measuring the change in capacitance produced by the presence of the finger are known to those skilled in the art . this may include techniques for improving accuracy and sensitivity and for reducing noise . such techniques have the advantage that a finger may be detected when it is in proximity but not touching the sensor , the signal increasing in strength as the finger approaches the sensor . this may be particular useful in systems where the physical arrangement of components restricts the ability to directly touch the sensor for example where the sensor is not located at or very close to the surface of the device . fig1 a and 15 b represent a touch sensor 48 in accordance with a fourth embodiment of the invention . the touch sensor 48 differs from the previously described touch sensor embodiments in that the conductors of the optical element are arranged to provide a resistive touch sensor . the optical element comprises optically transparent substrates 50 , at least the upper one of which is deformable by touch . the patterned conductors 25 and 27 are formed on opposing faces of each substrate 50 . they may typically have a pattern similar to that illustrated in fig1 to give an array of intersecting points in two directions , with sub - patterning to give a partial mirror as described in previous embodiments . the resistance is measured between each conductor on the top substrate and each conductor on the lower substrate . when the upper substrate is deformed by the presence of a finger or other pointing device , the upper conductor at that location is brought closer to the lower conductor and the resistance between them will reduce . if all such resistances are monitored then the position of the finger may be deduced . fig1 illustrates a display system 56 incorporating a touch sensor in accordance with an exemplary embodiment of the present invention . the display system 56 is an example of a known type of multiple image depth display , as illustrated in fig1 , incorporating an optical element as described in any previous embodiments of the invention . the system 56 includes , in order , an absorbing polariser 58 , reflective polariser 60 , quarter - wave plate 62 , partial mirror 64 , quarter - wave plate 66 , electrode 68 , liquid crystal cell 70 , exit polariser 72 , lcd 74 for forming an image , and entrance polariser 76 . the specific operation of the system 56 with the exception of the use of an optical element as described herein is otherwise known and thus will not be described in detail herein for sake of brevity . the system 56 is arranged to provide two different images from the lcd 74 in two different depth planes . typically the reflective polariser 60 may consist of a multiple layer polymer stack known as a dbef as is well known in the art . the partial mirror 64 is commonly a multiple layer thin film coating on glass or plastic . the properties of the film may be adjusted to give the required transmission and reflection properties . however , both these components are relatively expensive . in this embodiment , the reflective polariser 60 is instead formed by the use a patterned conductor layer . this patterning is arranged to be in the form of a “ wire grid ” array as described above in relation to optical element 17 in fig1 , and as such will function as a reflective polariser . the optical element represented in fig1 can be arranged to provide a polarised reflection function and a touch sensing function as described above . it is thus possible to achieve a multiple depth display with integrated touch function at reduced cost and thickness compared to separate components . any of the previously described measurement techniques to determine touch may be used , including surface capacitance , projected capacitance and resistive . fig1 illustrates a display system 80 incorporating an optical element and touch sensor in accordance with another embodiment of the invention . the display system 80 differs from that illustrated in fig1 in that the reflective polariser 60 may be achieved by any typical method such as a dbef . however , in this case an alternative form of the partial mirror 64 is used . in this case a patterned conductor , for example of the form of the optical element 7 in fig9 , is used to provide partial reflection and transmission . thus , the partial mirror 64 may also be used to function as a touch sensor according to any of the previously described methods ( e . g ., as a touch sensor 40 as shown in fig1 ). therefore , the system 80 provides a further method to achieve a multiple depth display with integrated touch function at reduced cost and thickness compared to separate components . because the partial mirror 64 is required to be some distance below the top of the system 80 ( in order to provide the depth effect ) then it may be advantageous to use the “ projected capacitance ” method ( e . g ., as shown in fig1 ) to achieve touch sensing as this does not require very close proximity of the finger . the presence of the ito electrode in the lc cell 70 may also be beneficial in providing shield from noise from the lcd 34 . a seventh embodiment of the invention comprises a variation of the known curved - appearance display illustrated in fig7 . the display system uses a partial mirror and reflective polariser in a manner similar to those described in the previous two embodiments . the reflective polariser may be replaced by a conductor patterned to form a wire grid polariser ( e . g ., an optical element 17 as in fig1 ) in a manner analogous to the embodiment of fig1 . alternatively the partial mirror may be replaced by a patterned conductor to provide partial reflection and transmission ( e . g ., an optical element 7 as in fig9 ) in a manner analogous to the embodiment of fig1 . it is thus possible to achieve a curved - appearance display with integrated touch function at reduced cost and thickness compared to separate components . an eighth embodiment of the invention comprises a variation of the known switchable mirror display illustrated in fig6 . this system uses a reflective polariser , which is typically realised by the use of a dbef . in this embodiment of the present invention , however , the reflective polariser is instead formed by the use a patterned conductor layer ( e . g ., as in fig1 ). this patterning is arranged to be in the form of a “ wire grid ” array as described above , and as such will function as a reflective polariser . the conductor may also be arranged to provide a touch sensing function as described in previous embodiments . it is thus possible to achieve a switchable mirror display with integrated touch function at reduced cost and thickness compared to separate components . fig1 illustrates a display system 90 constituting a ninth embodiment of the invention . it represents a standard lcd comprising substrates 92 , liquid crystal 94 and polarisers 96 and 98 . typically the polarisers would be formed from a stretched polymer containing a dichroic dye such as iodine . in this embodiment either of the polarisers 96 and 98 may be replaced by an element 17 as illustrated in fig1 which will function as a reflective polariser and touch sensor . as such this system 90 constitutes a display with integrated touch sensor . it may be particularly advantageous to arrange for such an element to form the lower polariser 98 . in ambient lighting conditions this system will naturally function as a reflective display with integrated touch sensor , with no further reflector required . in the case of illumination provided from a backlight behind the display , the incorrect polarised would be reflected back to the backlight and recycled , thus improving optical efficiency . thus a display with integrated touch sensor may be provided with reduced cost and thickness compared to an additional touch sensor . fig1 illustrates a display system 100 constituting a ninth embodiment of the invention . this embodiment differs from that in fig1 in that the one or more reflective polarisers 96 and 98 are formed in the inner surface of the substrate . this may be advantageous in simplifying the fabrication process . also , in the case that the lower polariser 98 is formed from such a touch sensor element as in fig1 , then the resulting reflective display may reduce image parallax artefacts . in all of the above embodiments the conducting layer 2 has been spatially patterned to provide partial reflection and partial transmission by virtue of the proportion of area covered by conductor . the thickness of the conducting layer 2 is such as to substantially reflect all of the light . alternatively a very thin conducting layer 2 may be used covering the whole substrate . for example , an aluminium layer of approximately 5 nm in thickness will transmit ˜ 50 % and reflect ˜ 50 %. the conducting layer 2 may be uniform across the underlying substrate as in the embodiments of fig8 and 13 , or divided into electrically isolated regions as in the embodiments of fig9 and 14 , for example . although the invention has been shown and described with respect to certain preferred embodiments , it is obvious that equivalents and modifications will occur to others skilled in the art upon the reading and understanding of the specification . for example , while the optical element as described above includes conductive regions which are reflective and non - conductive regions which are transparent , other embodiments may be used . in another embodiment , conductive regions may be transparent ( e . g ., through the use of indium - tin - oxide ( ito )) and non - conductive regions may be reflective ( e . g ., through the use of non - conducting reflective materials , conducting materials electrically isolated via an isolation layer , etc .) the present invention includes all such equivalents and modifications , and is limited only by the scope of the following claims .	6
fig1 shows a block diagram of part of a control circuit 10 for activating multiple injection in the event of failure of a knock control of a direct injection gasoline engine ( not shown ). control circuit 10 contains an and logic element 12 at whose one input an activation signal kr is applied and at whose other input a fault signal f is applied . activation signal kr and fault signal f are generated by a controller of the firing system . activation signal kr has the switch state logic one when the knock control is to be active . fault signal f has the switch state logic one when there is a disturbance in the knock control . and logic element 12 gates the values of the activation signal and the fault signal according to the logic and function and outputs a request signal hkss whose signal value of logic one causes switching over from single injection to double injection . the letter sequence hkss denotes homogeneous anti - knock safety setpoint . the method steps and components required for switching over the type of injection are not the object of the present invention and therefore will not be explained in greater detail . for example , the position of the throttle valve may be altered in switching over . in addition , the injection nozzles are actuated according to another scheme . if the switching over is performed successfully , the signal value of a control signal hks ( homogeneous anti - knock safety protection ) is switched to logic one . however , if the switching over cannot be performed , the signal value of control signal hks remains at the value of logic zero . for example , this is the case when the fault causing the failure of the knock control also prevents the system from switching over to double injection . fig2 shows the other part of control circuit 10 . control circuit 10 contains another and logic element 20 at whose one input is applied fault signal f and control signal hks at its other input . and logic element 20 gates the signal values applied to its inputs according to the logic and function . the output of and logic element 20 is connected to the input of a not element 22 which outputs at its output a signal value inverted relative to the signal value applied at its input . the output of not element 22 is connected to the switching over input of a switching unit 24 . depending on the signal at the switching input , switching unit 24 switches between two switch states 0 and 1 . control circuit 10 also contains an engine characteristics map unit 26 in which are stored various ignition characteristics maps for the double injection mode of operation . engine characteristics map unit 26 has a plurality of inputs , of which fig2 shows inputs for inputting an rotational speed signal nmot and a load signal rl ( relative air filling ). engine characteristics map unit 26 reads a value for the firing angle out of a memory unit ( not shown ), depending on the signal values of the rotational speed signal nmot and load signal rl , and outputs an engine characteristics map value kfw . engine characteristics map unit 26 may be either an analog or digital unit . then rotational speed signal nmot , load signal rl , and engine characteristics map value kfw are either analog or digital signals accordingly . engine characteristics map value kfw is applied to the one input of switching unit 24 and is output at the output of switching unit 24 in switch state 0 of switching unit 24 ( see output signal 28 ). the other input of switching unit 24 is connected to output signal sv of a knock control unit ( not shown ) for retardation , adjusting the firing angle in a regulating operation . output signal sv goes to the output of switching unit 24 in switch state 1 of switching unit 24 . control circuit 10 contains another switching unit 30 at whose switching input activation signal kr is applied . depending on the signal value of activation signal kr , switching unit 30 operates in two switch states 0 and 1 . signal value of logic zero is constantly applied at the one input of switching unit 30 . if control signal kr has the value logic zero , then in switch state 0 of switching unit 30 , value zero applied at the input is output at the output of the switching unit and is used as input signal dwkrz for a firing angle setpoint unit 32 . the other input of switching unit 30 is connected to the output of switching unit 24 , so that in switch state 1 of switching unit 30 , output signal 28 stipulates the course of input signal dwkrz . firing angle setpoint unit 32 also has an input for a cylinder counting signal zzyl whose signal value indicates the cylinder in whose combustion chamber an ignition is to be executed . firing angle setpoint unit 32 outputs a firing angle signal 34 which specifies the firing angle for all cylinders of the engine in succession . the part of control circuit 10 shown in fig2 operates as follows with fully functional knock control . fault signal f and control signal hks have the signal value of logic zero . a logic signal 36 at the output of and logic element 20 therefore also has the signal value of logic zero . a switching signal 38 at the output of not element 22 has the signal value of logic one because of the inversion of logic signal 36 , so that switching unit 24 is switched to switch state 1 . output signal sv output by anti - knock regulating unit stipulates the course of output signal 28 . if activation signal kr has a value of logic zero , no knocking is detected and no knock control is necessary . in this case switching unit 30 has switch state 0 so that input signal dwkrz has the value of logic zero . firing angle setpoint unit 32 outputs a firing angle signal 34 , which is not corrected with regard to knock control . however , if activation signal kr has the value of logic one in the case of fully functional knock control because knocking is detected , then switching unit 30 operates in switch state 1 . in switch state 1 , output signal 28 of switching unit 24 stipulates the course of input signal dwkrz . firing angle setpoint unit 32 therefore outputs a firing angle signal 34 which is corrected with the help of the firing angle specified by the knock control to counteract engine knocking . if there is a disturbance in the function of the knock control , then fault signal f first has a value of logic one and control signal hks has a value of logic zero . logic signal 36 therefore continues to have a value of logic zero . the operation of control unit 10 corresponds to the operation described above . however , if the signal value of control signal hks is switched to the value one on the basis of the processes illustrated above in fig1 then the value of logic signal 36 changes to the value of logic one . control signal hks has the value of logic one as soon as the system switches to double injection . the signal change in logic signal 36 results in a change in the signal value of switching signal 38 . switching signal 38 then has the value of logic zero so that switching unit 24 is switched to switch state 0 . engine characteristics map value kfw which depends on the current engine rotational speed ( see rotational speed signal nmot ) and on the current engine load ( see load signal rl ) then stipulates the value of output signal 28 . if no knocking of the engine is detected , activation signal kr has the value of logic zero and the firing angle setpoint unit does not perform a correction of the firing angle with regard to knock control . however , if knocking of the engine is detected , the activation signal kr has the value of logic one . switching unit 30 operates in switch state 1 and the course of output signal 28 stipulates the course of input signal dwkrz . firing angle setpoint unit 32 corrects the firing angle so that knocking is counteracted . the engine characteristics map stored in engine characteristics map unit 26 for the double injection is used for correction . if engine knocking no longer occurs , then activation signal kr again has the value of logic zero and switching unit 30 switches back to switch state 0 . fault signal f and control signal hks remain at the value of logic one , however .	8
reference will now be made in detail to the preferred embodiments of the present invention , examples of which are illustrated in the accompanying drawings . fig2 a through 2f illustrate a sequential loading status and processes , fig3 a through 3f illustrates levels of sensing signals sensed according to disk loading operation , and fig4 illustrates levels of sensing signal as a disk is jammed during a disk loading operation . in the method for checking a disk loading status in an optical disk driver in accordance with the present invention , the multi - stage disk loading status is discriminated as shown in fig2 a through 2f and fig3 a through 3f . in case that levels of sensing signals outputted from the first and the second optical sensors s 1 and s 2 and from the loading switch sw are maintained for more than a predetermined time as shown in fig4 , the microcomputer 6 discriminates it as a disk jammed status . that is , after the disk is inserted , if no sensing signal indicating that clamping has been completed is detected from the loading switch for more than a predetermined time , it is discriminated that the disk has been jammed . in detail , as shown in fig3 a , in case that there is no optical disk mounted on the tray 1 , all of the levels of the sensing signals respectively outputted from the first and the second optical sensors s 1 and s 2 and from the loading switching sw become high , while , as shown in fig3 b , in case of initial loading status that the optical disk 1 is mounted on the tray and let in , the levels of the sensing signals respectively outputted from the first and the second optical sensors s 1 and s 2 and from the loading switch sw become low , high and high , respectively . and , as shown in fig3 c through 3e , in case of a loading status that the disk is jammed , the levels of the sensing signals respectively outputted from the first and the second optical sensors s 1 and s 2 and from the loading switch sw become ‘ low , low , high ’, ‘ high , low , high ’ and ‘ low , low high ’, respectively , the status of which is detected for more than a predetermined time as shown in fig4 , whereas , as shown in fig3 f , in case that the led - in disk is completely clamped , the levels of the sensing signals respectively outputted from the first and the second optical sensors s 1 and s 2 and from the loading switch sw become ‘ low , low , low ’ respectively . accordingly , on the basis of the sensing signals respectively outputted from the first and the second optical sensors s 1 and s 2 and from the loading switch sw , the microcomputer 6 segmented the current disk loading status into multiple loading stages to be discriminated . especially , as shown in fig4 , in case that the values of the sensing signals respectively outputted from the first and the second optical sensors s 1 and s 2 and from the loading switch sw are maintained for more than a predetermined time , or in case that no sensing signal indicating completion of clamping is detected from the loading switch for more than a predetermined time after the disk is inserted , it is discriminated that the disk has been jammed and a disk - ejecting operation is performed . the disk - ejecting operation will now be described with reference to accompanying drawings . fig5 is a flow chart of a method for checking a disk loading status in an optical disk driver in accordance with one embodiment of the present invention . first , when the tray is opened to insert the optical disk 1 and closed ( s 20 ), a disk loading operation is performed that the tray on which the optical disk is mounted is inserted into the optical disk driver according to the driving of the loading mechanism . at this time , the microcomputer 6 receives and compares the sensing signals respectively outputted from the first and the second optical sensors s 1 and s 2 and from the loading switch sw ( s 21 ), and discriminates the loading status of the optical disk 1 as shown in fig3 a through 3f by multi - stage ( s 22 ). upon discrimination , the microcomputer 6 generates a corresponding mode sense data as previously defined ( s 23 ) and transmits the generated mode sense data to the host ( a personal computer ) connected through the interface unit 5 to report each disk loading status discriminated during the multiple loading stages of each disk . in this respect , in case that the interface unit 5 uses the typically used atapi bus for interfacing with the personal computer , the microcomputer generates a mode sense data in a 12 byte packet command format as defined by the atapi communication protocol and transmits each disk loading status discriminated by during the multiple loading stages of each disk for reporting . for example , as shown in fig6 , variable values recorded in a recording medium type code among header information of the previously defined mode sense parameter are recorded to be difference to each other according to the disk loading status , to be transmitted and reported to the host . namely , in case that the disk loading status of fig3 a and 3b are maintained for more than a predetermined time , the variable values are recorded in the recording medium type code field by “ h ′ 71 ” and “ h ′ 71 / h ′ f2 ′, respectively , and the current disk status is transmitted to the host . meanwhile , in case that a disk loading status of fig4 is maintained for more than a predetermined time , that is , a disk - jammed status is maintained , the variable value is recorded by “ h ′ f2 ” and the disk - jammed status is transmitted to be reported . thereafter , according to the transmission and report of the mode sense data corresponding to the disk loading status , in case that the microcomputer 6 receives an eject command requesting disk - ejection operation from the host , it drives the loading mechanism to perform the requested disk - ejection operation , so that the disk - jammed status is not maintained for more than a predetermined time . in this manner , in the optical disk driver adopted to the present invention , the disk loading status is discriminated during multiple loading stages and the corresponding mode sense data is transmitted to the host . and then , the disk - ejection operation is performed according to the eject command requested by the host , whereby the disk - ejection operation is automatically performed with the disk - jammed status . fig7 is a flow chart of a method for checking a disk loading status in an optical disk driver in accordance with another embodiment of the present invention . likewise in the former embodiment of the present invention , when the tray is opened to insert the optical disk 1 and closed ( s 30 ), a disk loading operation is performed that the tray on which the optical disk is mounted is inserted into the optical disk driver according to the driving of the loading mechanism . at this time , the microcomputer 6 receives and compares the sensing signals respectively outputted from the first and the second optical sensors s 1 and s 2 and from the loading switch sw ( s 31 ), and discriminates the loading status of the optical disk 1 as shown in fig3 a through 3f during multiple loading stages ( s 32 ). upon discrimination , in case that the disk has been jammed , the microcomputer 6 drives the load mechanism by itself to quickly perform a disk - ejecting operation ( s 33 ), generates a mode sense data for reporting the disk - ejection operation , and transmits it the host such as the personal computer connected through the interface unit 5 ( s 34 ). meanwhile , upon discrimination , in case that the disk is in a state of fig3 a , 3b and 3 f , the microcomputer generates a mode sense data having a corresponding variable value , and transmits it to the host . and then , the microcomputer receives a corresponding command from the host and performs a corresponding operation such as data reading . accordingly , in the optical disk driver adopted to the present invention , the disk loading status is discriminated during multiple loading stages and a corresponding mode sense data is transmitted to the host . in addition , when the disk is discriminated to have been jammed , the loading mechanism is driven by itself , thereby quickly performing the disk - ejection operation . as so far described , according to the method for checking disk loading status in an optical disk driver of the present invention , a loading status of an optical disk is segmented to be discriminated during multiple loading stages , and in case that a disk - jammed status is discriminated , corresponding information is transmitted to a host connected through an interface , so that a disk ejection command is outputted from the host or a disk ejection operation is performed by itself to thereby automatically perform the disk - ejection operation for the disk - jammed status . as the present invention may be embodied in several forms without departing from the spirit or essential characteristics thereof , it should also be understood that the above - described embodiments are not limited by any of the details of the foregoing description , unless otherwise specified , but rather should be construed broadly within its spirit and scope as defined in the appended claims , and therefore all changes and modifications that fall within the meets and bounds of the claims , or equivalence of such meets and bounds are therefore intended to be embraced by the appended claims .	6
note that in the description below , the term “ voltage ” is used to designate analog signals , and the term “ value ” is used to designate digital quantities . note also that in the description and the drawings a symbol without angle brackets is used to denote an analog quantity , and a symbol with angle brackets is used to denote a digital quantity . for example , the analog voltage of a calibration pulse is p , and its digitized equivalent is & lt ; p & gt ;. fig1 is a schematic illustration of a detector signal processing circuit 1 a with sequential calibration pulse injection . circuit 1 a includes a detector 10 which produces a detector response signal s - 10 representative of an energy e of an incident x - ray . in an embodiment herein presented , detector 10 includes a charge - sensitive pre - amplifier ( not shown ) which may be incorporated within the enclosure of detector 10 , and response signal s - 10 consists of a step in output voltage whose height is indicative of energy e . circuit 1 a also includes a pulser 12 which produces a calibration pulse signal s - 12 with a pulse amplitude p , and a switch 20 . optionally , the position of switch 20 is controlled by a calibration mode controller 21 receiving timing information from a clock 19 . calibration mode controller 21 may set switch 20 either to an operating mode in which detector response signal s - 10 is input into an amplifier 18 , or to a calibration mode in which calibration pulse signal s - 12 is input into amplifier 18 . it is to be understood that amplifier 18 may represent one or more signal amplification elements , including one or more pre - amplifiers , amplifiers or other amplification devices . amplifier 18 , having a gain g 1 , produces an amplified voltage s - 18 , which is equal to an amplified response signal voltage g 1 e when switch 20 selects detector response signal s - 10 , and is equal to an amplified pulse voltage g 1 p when switch 20 selects calibration pulse signal s - 12 . in practice , gain g 1 is not constant , but is a variable which may drift depending on the temperature of internal amplifier components , such as resistors . amplified voltage s - 18 is input into a processing analog - to - digital converter ( adc ) 22 , which is a fast adc capable of digitizing at high data rates . ideally the gain of processing adc 22 should be unity , meaning that its output should be the exact digital equivalent of its analog input . in practice , however , the gain of any adc is a variable which may change depending on various factors including the value of the reference voltage and the temperature of the adc components . in particular , a fast adc such as processing adc 22 is typically available only with relatively low resolution , such as 16 bits in an exemplary embodiment . the specification for gain drift for such an adc may be as large as 30 - 50 ppm . therefore , to ensure accuracy and reproducibility of the energy scale derived by circuit 1 a , it is essential that the calibration procedure should take account of any drift in the gain of processing adc 22 . if a gain of processing adc 22 is g 2 , then the digitized output from processing adc 22 is an amplified voltage value s - 22 , whose value depends on the product of the gain g 1 of amplifier 18 and the gain g 2 of processing adc 22 . the value of amplified voltage value s - 22 also depends on the position of switch 20 . when switch 20 selects detector response signal s - 10 , amplified voltage value s - 22 is equal to a response signal voltage value & lt ; g 1 g 2 e & gt ;. when switch 20 selects calibration pulse signal s - 12 , amplified voltage value s - 22 is equal to a pulse voltage value & lt ; g 1 g 2 p & gt ;. the quantity g 1 g 2 is hereinafter referred to as an overall gain g , where g = g 1 g 2 is the overall gain of the electronic system including both the amplification and the digitization components . circuit 1 a further includes a router 23 which is in communication with switch 20 via a signal s - 23 . router 23 is thereby able to route amplified voltage value s - 22 to an amplified calibration voltage value s - 22 a when switch 20 selects calibration pulse signal s - 12 , and to route amplified voltage value s - 22 to an amplified operating voltage value s - 22 b when switch 20 selects detector response signal s - 10 . amplified calibration voltage value s - 22 a is equal to & lt ; gp & gt ;, and amplified operating voltage value s - 22 b is equal to & lt ; ge & gt ;. calibration pulse signal s - 12 is also input into a reference adc 16 which outputs a digital reference pulse value s - 16 . digital reference pulse value s - 16 is equal to & lt ; p & gt ;, which is a digitized value of pulse amplitude p . reference adc 16 does not need to be a fast adc because it needs only to digitize reference pulses at relatively low rate . therefore reference adc 16 is chosen to be a high resolution adc with superior drift specifications . in an embodiment , reference adc 16 has 24 bit resolution and drift specification of less than 2 ppm . it should be noted that the amplitude of the pulses from pulser 12 is preferably chosen so that the pulse amplitude is approximately the same as an average detector response signal s - 10 . the frequency of pulses from pulser 12 is preferably chosen so that the pulse arrival time in calibration mode is approximately the same as the average arrival time of detector response signals s - 10 in operating mode . these conditions of pulse amplitude and frequency are chosen so that the calibration pulses most accurately mimic the gain and linearity performance of the overall electronic system including both the amplification and the digitization components . circuit 1 a also includes a single common reference voltage element 14 , which serves as the voltage reference for pulser 12 via a signal s - 14 a , as well as the reference for processing adc 22 via a signal s - 14 b and for reference adc 16 via a signal s - 14 c . it should be noted that one of the novel aspects of the design of circuit 1 a is that connections s - 14 a , s - 14 b and s - 14 c all share the same signal , which is reference voltage 14 . circuit 1 a further includes a calibration ratio calculator 24 providing a value of a calibration ratio . digital reference pulse value s - 16 and amplified calibration voltage value s - 22 a are used to calculate the calibration ratio , which is equal to amplified calibration voltage value s - 22 a ( equal to & lt ; gp & gt ;) divided by digital reference pulse value s - 16 ( equal to & lt ; p & gt ;). the calibration ratio may be calculated for many pulses during a calibration time , and an average value obtained . the result from calibration ratio calculator 24 is a gain value s - 24 , which is equal to a digital representation & lt ; g & gt ; of overall gain g . it should be noted that an important novel aspect of the present invention is the use of calibration ratio calculator 24 to calculate overall gain g of the entire electronic system including both amplification and digitization components . the calculation is based on comparison of digitized calibration pulses from pulser 12 obtained by two different electronic routes . the first route is by digitization of calibration pulse signal s - 12 using reference adc 16 without any amplification . the second route is when switch 20 selects calibration pulse signal s - 12 , and the calibration pulses are amplified by amplifier 18 and then digitized by processing adc 22 . importantly , processing adc 22 and reference adc 16 use the same reference voltage 14 , so that any drift in the reference voltage causes the same gain drift in both processing adc 22 and reference adc 16 , and the drift cancels out by division done by calibration ratio calculator 24 . moreover , reference adc 16 has much greater accuracy and much lower drift than processing adc 22 , so that its output may be used as a calibration reference for the gain of the overall electronic system . it should also be noted that the calculation done by calibration ratio calculator 24 may be made any time switch 20 is set to select calibration pulse signal s - 12 . calibration time may be any chosen value , which may be as short as 100 msec , and therefore calibration may be performed frequently with minimal interruption of useful operation of the x - ray instrument . during instrument measurement operation , when switch 20 is set to select detector response signal s - 10 , both gain value s - 24 and amplified operating voltage value s - 22 b are used by an energy scale corrector 26 to calculate a corrected energy value s - 26 . corrected energy value s - 26 is equal to amplified operating voltage value s - 22 b ( equal to & lt ; ge & gt ;) divided by gain value s - 24 ( equal to & lt ; g & gt ;). the result of this calculation is corrected energy value s - 26 , which is a corrected digital representation & lt ; e & gt ; of detector response signal s - 10 . corrected energy value s - 26 is calculated for each detector signal , corresponding to each incident x - ray , and is used to construct an energy spectrum , which is a plot of x - ray energy vs number of x - rays incident on the detector with that energy . corrected energy value s - 26 is a calibrated energy value which takes account of substantially all drift in the amplification and digitization electronics , and the calibration may be performed as frequently as desired by programming the operation of switch 20 using calibration mode controller 21 . operation of switch 20 can also be initiated manually by an operator actuating a button or virtual button , ( not shown in fig1 ), whenever a need for calibration is deemed fit . fig2 is a schematic illustration of an alternative detector signal processing circuit 1 b with simultaneous calibration pulse injection . circuit 1 b includes components equivalent to those in circuit 1 a shown in fig1 , with two notable exceptions . the first difference between circuits 1 a and 1 b is that switch 20 is absent in circuit 1 b . the second difference is that router 23 in circuit 1 a is replaced with a pulse discriminator 28 in circuit 1 b . in circuit 1 b , detector response signal s - 10 and calibration pulse signal s - 12 are both injected simultaneously and continuously into amplifier 18 . amplified voltage s - 18 therefore comprises a mixture of both amplified response signal voltage g 1 e and amplified pulse voltage g 1 p . similarly , amplified voltage value s - 22 comprises a mixture of response signal voltage value & lt ; g 1 g 2 e & gt ; and pulse voltage value & lt ; g 1 g 2 p & gt ;. amplified voltage value s - 22 is input into a pulse discriminator 28 whose function is to separate the response signal and pulse voltage values contained within amplified voltage value s - 22 . pulse voltage values are separated to a discriminated calibration value s - 28 a , and detector response signal values are separated to a discriminated response value s - 28 b . the method of operation of pulse discriminator 28 is described below in connection with fig3 . subsequent operation of circuit 1 b is the same as operation of circuit 1 a , namely calibration ratio calculator 24 provides calibration ratio s - 24 used for the calculation of corrected energy value s - 26 . however it should be noted that , in the case of circuit 1 b , calibration occurs continuously throughout every measurement operation , with no interruption or slowdown of the measurement operation . fig3 a , 3b and 3c illustrate the operation of pulse discriminator 28 . fig3 a shows a graph of amplified voltage value s - 22 , which includes a mixture of detector response and calibration values . in general , a detector response causes a rise in the value of amplified voltage value s - 22 , because detector 10 incorporates a charge sensitive pre - amplifier ( not shown ) in which charge from successive responses accumulates to cause rising voltage . on the other hand , calibration pulses originate from pulser 12 in which there is no charge sensitive amplifier , so that each calibration pulse causes an initial rise followed by a fall in the value of amplified voltage value s - 22 . fig3 a illustrates two calibration pulses , 36 and 38 , with initial rising values 36 a and 38 a respectively , flat regions 36 b and 38 b respectively , and falling values 36 c and 38 c respectively . pulse discriminator 28 may distinguish the calibration pulses by their falling values 36 c and 38 c which are not present in detector response values . alternatively , pulse discriminator 28 may distinguish the calibration pulses using timing signals obtained from pulser 12 ( not shown ). using either discrimination method , pulse discriminator 28 identifies calibration pulses 36 and 38 , and removes them to produce discriminated response value s - 28 b as shown in fig3 b . information from the removed calibration pulses is used to produce discriminated calibration value s - 28 a as shown in fig3 c . fig3 b illustrates how the discriminated response value s - 28 b is used to derive an amplified energy signal for each x - ray incident on detector 10 . the response to three incident x - rays can be identified in fig3 b by rising values 31 , 32 , and 33 . the magnitude of rising values 31 , 32 , and 33 corresponds to the quantities & lt ; ge & gt ; 1 , & lt ; ge & gt ; 2 and & lt ; ge & gt ; 3 respectively . these quantities are used by energy scale corrector 26 , together with knowledge of gain value s - 24 obtained from calibration ratio calculator 24 , in order to assign corrected energy value s - 26 to each of the three x - rays . the energy values of all incident x - rays are obtained in this way during the measurement , and counts are accumulated to obtain an energy spectrum . fig3 c illustrates discriminated calibration value s - 28 a , showing calibration pulses 36 and 38 . the amplitudes of pulses 36 and 38 correspond to the quantities & lt ; gp & gt ; 1 and & lt ; gp & gt ; 2 respectively . these quantities are used by calibration ratio calculator 24 together with reference pulse value s - 16 to calculate gain value s - 24 . different values of & lt ; gp & gt ; 1 and & lt ; gp & gt ; 2 may indicate that the overall gain & lt ; g & gt ; of the electronic system has changed , and correction may automatically occur at energy scale corrector 26 . alternatively , rather than applying correction to gain & lt ; g & gt ; at every successive calibration pulse , values of gain & lt ; g & gt ; may be averaged over an averaging time which includes many pulses before applying a correction at energy scale corrector 26 . such averaging may be advantageous to reduce noise in the measurement of gain & lt ; g & gt ; and is within the scope of the present disclosure . fig4 shows a schematic flow diagram of a sequential calibration process 40 according to the present disclosure . process 40 is described below with reference to fig4 and fig1 . process 40 starts at step 402 , and at step 404 an operator selection is made via calibration mode controller 21 as to whether calibration is to be performed after one or more measurements , or after a specified interval of operating time . if calibration after one or more measurements is selected , process 40 moves to step 410 . at step 412 , calibration mode controller 21 sets switch 20 to calibration mode and in step 414 calibration is performed . calibration of step 414 comprises calculation by calibration ratio calculator 24 of the calibration ratio , which may be averaged over many pulses . in a typical embodiment herein presented , the calibration pulse frequency may be 500 khz , and the averaging time in step 414 may be 100 msec . in this embodiment gain value s - 24 at the end of the calibration is an average value of about 50 , 000 pulses . gain value s - 24 is represented by the symbol & lt ; g & gt ;. at step 415 , calibration mode controller 21 sets switch 20 to operating mode and in step 416 the energy scale is corrected using the value of & lt ; g & gt ; derived in step 414 . in step 417 one or more measurements are performed with corrected energy scale , and upon completion of the specified number of measurements the system is ready for a new calibration at step 418 , and the process returns to step 404 . if at step 404 calibration after a specified interval of operating time is selected , process 40 moves to step 420 . at step 421 the operator , via calibration mode controller 21 , selects a time interval t between successive calibrations . at step 422 , calibration mode controller 21 sets switch 20 to calibration mode and in step 423 calibration is performed in the same manner as described above for step 414 . at step 424 , calibration mode controller 21 sets switch 20 to operating mode and in step 425 the energy scale is corrected using the value of & lt ; g & gt ; derived in step 423 . in step 426 the measurement is carried out until either clock 19 indicates that time t has expired or the measurement is complete , whichever occurs first . step 427 tests whether the measurement is complete , and if not the process returns to step 422 for a new calibration . if measurement is complete , the process returns to step 404 . it can be seen that selection of calibration after a specified interval of operating time , as described in steps 420 ˜ 428 allows one or more new calibrations to occur during the course of a single measurement . this may be useful for particularly long measurements . setting of time interval t depends on the degree to which there is a stable environmental temperature — the less stable the environment the shorter time interval t should be set . in a typical embodiment , time interval t might be set to 10 ˜ 100 seconds , and if calibration time is about 100 msec , there is no discernible interruption of instrument operation , even though calibration is occurring with sufficient frequency to avoid any risk of drift of the electronic gain . it can be appreciated that , for both embodiments of calibration by time interval or by measurement operations , calibration switching can be initiated either by an automatic trigger or by manual triggering by the operator . all of such variations of implementation are within the scope of the present disclosure . fig5 shows a schematic flow diagram of a simultaneous calibration process 50 according to the present disclosure . process 50 is described below with reference to fig5 and fig2 . process 50 starts at step 502 , and at step 504 pulser 12 is started in order to perform an initial calibration prior to beginning actual operation of the instrument . the initial calibration is performed for an initial calibration time which is sufficiently large to allow calibration ratio calculator 24 to calculate gain value s - 24 by averaging over a large number of pulses . in an embodiment , the initial calibration time may be 100 msec to 1 second . in step 506 , the measurement is started by activating the x - ray source and directing x - rays at a sample . in step 508 the measurement is continuing , so that both detector response signal s - 10 and calibration pulse signal s - 12 are input into amplifier 18 and subsequently to processing adc 22 and pulse discriminator 28 . in step 510 , pulse discriminator 28 separates calibration pulses and detector response into discriminated calibration value s - 28 a and discriminated response value s - 28 b respectively . in step 512 calibration ratio 24 is calculated and , after the averaging time , an updated gain value s - 24 , denoted by the symbol & lt ; g & gt ;, is provided to energy scale corrector 26 . energy scale corrector 26 updates the energy scale to its most recent updated value in step 514 , using the value of & lt ; g & gt ; derived in step 512 . in step 516 there is a check of whether the measurement is complete . if not , process 50 loops back to step 508 and the measurement continues uninterrupted . it should be noted that the time taken from step 508 to step 516 is almost entirely due to the averaging time which , in an embodiment , is about 100 msec as a result , the energy calibration is updated every 100 msec throughout the measurement . in an embodiment , the pulse frequency of pulser 12 may be 50 khz , which is 10 times lower than the pulse frequency used in process 40 as described in connection with fig4 . the reason for using a lower calibration pulse frequency in process 50 is that , since both calibration pulses and detector signals are processed simultaneously , there is a risk that a calibration pulse and detector signal are so closely coincident in time that neither may be distinguished . the probability of such close coincidence can be reduced by lowering the calibration pulse frequency . nevertheless , at a frequency of 50 khz , 5 , 000 pulses are averaged in 100 msec , which is sufficient to obtain reliable updated gain value s - 24 for use during the next 100 msec measurement interval . if the measurement is complete at step 516 , the instrument is ready for the next measurement at step 518 and the process loops back to the start at step 502 . it should be noted that the simultaneous calibration method of process 50 is particularly useful for measurements with low x - ray count rates . such measurements are lengthy and frequent calibration is essential to ensure that gain drift during the course of the measurement is taken into account . circuits 1 a and 1 b in fig1 and 2 and processes 40 and 50 in fig4 and 5 , as described above , all relate to calibration of the overall gain of the amplification and digitization electronics . however , no account is taken of non - linear effects . referring now to fig6 , and with continued reference to fig1 , there are shown in fig6 graphs illustrating the effect of non - linearity on an exemplary detector response signal 63 , in which an x - ray arrives at detector 10 at a time when the charge - sensitive pre - amplifier voltage is v 1 . the step - function increase in detector response signal s - 10 is representative of the energy e of the x - ray . on a graph of amplified voltage value s - 22 vs detector response signal s - 10 , the voltages of detector response signal s - 10 before and after arrival of the x - ray , v 1 and v 1 + e respectively , are shown by lines 64 and 65 respectively . a line 61 shows the behavior of a perfectly linear amplification and digitization electronic system , wherein the gain g is equal to the slope of the line as shown . however , if the gain is not linear , then the actual gain is represented by the slope of a line 62 , and although the slope of line 61 is the average of the slope of line 62 , the slope at any particular point on line 62 may be different from the slope of line 61 , and therefore the gain may be different . in a graph of gain vs detector response signal s - 10 shown at the top of fig6 , a line 66 is the slope of line 61 and represents the constant gain of a perfectly linear system , and a line 68 is the slope of line 62 and represents the varying gain of a non - linear system . line 66 is the average value of line 68 . the quantity & lt ; δg & gt ; represents the difference between the linear and non - linear gain , and it is to be understood that & lt ; δg & gt ; is a varying function of detector response signal s - 10 . it should be noted that , in order to clearly illustrate the effect of the non - linearity , the deviation of line 62 from linear gain line 61 and of line 68 from line 66 has been greatly exaggerated relative to actual non - linearity of available electronic systems . similarly , the size of step function e has been greatly exaggerated relative to the overall range of detector response signal s - 10 and amplified voltage value s - 22 . lines 64 and 65 , representing the change in detector response signal s - 10 due to detector response signal 63 , intersect line 61 at lines 64 b and 65 b respectively . lines 64 and 65 intersect line 62 at lines 64 a and 65 a respectively . if the electronic system gain is linear , corresponding to line 61 , then the change in amplified voltage value s - 22 is given by the difference between the values of lines 65 b and 64 b , represented by the symbol & lt ; ge & gt ; l . on the other hand , if the electronic system gain is non - linear , corresponding to line 62 , then the change in amplified voltage value s - 22 is given by the difference between the values of lines 65 a and 64 a , represented by the symbol & lt ; ge & gt ; nl . it can be seen that & lt ; ge & gt ; nl is less than & lt ; ge & gt ; l and this is because the slope of line 62 is less than the slope of line 61 in the relevant part of the graph . however , if output voltage v 1 is different , the slopes of lines 61 and 62 may be different , and in some circumstances & lt ; ge & gt ; nl may be greater than & lt ; ge & gt ; l . fig7 is a diagram illustrating a solution by use of calibration pulse signals for calibration of non - linearity effects . in order to calibrate for non - linearity effects , pulses are injected into the amplification and digitization system using a circuit 1 c which is described below in connection with fig8 . in a graph of calibration pulse signal s - 12 vs amplified voltage value s - 22 shown in fig7 , non - linear response line 62 is the same as in the graph of detector response signal s - 10 vs amplified voltage value s - 22 as shown in fig6 . this is because calibration pulses and detector response signals are injected into the same amplification and digitization system , and therefore non - linear gain effects are unchanged . fig7 shows two exemplary calibration pulses , 73 and 73 ′, which are injected into the amplification and digitization system at different times , t and t ′ respectively . pulses 73 and 73 ′ have , respectively , lower pulse voltages v 1 , v 1 ′ and upper pulse voltages v 2 , v 2 ′. pulses 73 and 73 ′ have the same pulse height p , meaning that v 2 − v 1 = v 2 ′− v 1 ′= p . lower voltages v 1 , v 1 ′ and upper voltages v 2 , v 2 ′ are represented , respectively , by lines 74 , 74 ′ and 75 , 75 ′ on the graph of calibration pulse signal s - 12 vs amplified voltage value s - 22 . lines 74 and 75 intersect line 62 at lines 74 a and 75 a respectively , and the change in amplified voltage value s - 22 due to pulse 73 is the difference between the values at lines 74 a and 75 a , represented by the symbol & lt ; gp & gt ;. lines 74 ′ and 75 ′ intersect line 62 at lines 74 a ′ and 75 a ′ respectively , and the change in amplified voltage value s - 22 due to pulse 73 ′ is the difference between the values at lines 74 a ′ and 74 b ′, represented by the symbol & lt ; g ′ p & gt ;. it should be noted that g is the gain of the amplification and digitization system at the voltages v 1 and v 2 of pulse 73 , and g ′ is the gain of the amplification and digitization system at the voltages v 1 ′ and v 2 ′ of pulse 73 ′, and that g and g ′ are different due to non - linearity of the system . note also that , in practice , pulse height p is very small relative to the overall range of detector response signal s - 10 and amplified voltage value s - 22 . it can therefore be assumed that line 62 is linear over such a small range , and therefore there is no change of gain between voltages v 1 and v 2 or between voltages v 1 ′ and v 2 ′. fig8 is a schematic illustration of a circuit 1 c , which is an alternative embodiment of circuit 1 a shown in fig1 , and which is used to perform a one - time calibration of non - linearity during a manufacturing calibration phase . this calibration of non - linearity deals with the intrinsic non - linearity exhibited by both amplifier 18 and adc 22 , and is done only once at the manufacturing level . it should be also noted that the description in fig6 - 10 of calibration for non - linearity is an improved calibration process which is independent of the on - board instrument gain calibration described in relation to fig1 - 5 . the result of the non - linearity calibration is preferably a look - up table ( described below ) which is specific to each instrument , and that can be used by each specific instrument throughout its life . fig8 shows that pulser 12 , which is the same pulser as that shown in fig1 and 2 , comprises a low - level digital - to - analog converter ( dac ) 82 , a high - level dac 84 , and a pulser switch 86 . a pulse voltage controller 87 produces a lower pulse voltage value & lt ; v 1 & gt ; and a higher pulse voltage value & lt ; v 2 & gt ;. lower pulse voltage value & lt ; v 1 & gt ; is input to low - level dac 82 , and , using reference voltage 14 as its reference via signal s - 14 a , dac 82 produces a lower pulse voltage v 1 at signal s - 82 . higher pulse voltage value & lt ; v 2 & gt ; is input to high - level dac 84 , and , using reference voltage 14 as its reference via signal s - 14 a , dac 84 produces a higher pulse voltage v 2 at signal s - 84 . signals s - 82 and s - 84 are input to pulser switch 86 which operates at an operator defined frequency to switch its output between signals s - 82 and s - 84 thereby producing pulses with lower pulse voltage v 1 and higher pulse voltage v 2 at signal s - 12 . signal s - 12 is the same as calibration pulse signal s - 12 which was discussed in relation to circuit 1 a in fig1 and circuit 1 b in fig2 . the remainder of circuit 1 c is operates in the same way as circuits 1 a and 1 b , namely calibration pulse signal s - 12 is input into amplifier 18 and processing adc 22 , and calibration pulse signal s - 12 is also input into reference adc 16 . a calibration ratio is calculated by calibration ratio calculator 24 and after an averaging time , gain value s - 24 is output , represented by symbol & lt ; g & gt ;, which is the gain corresponding to lower pulse voltage v 1 and higher pulse voltage v 2 . gain value s - 24 and the value of v 1 are input to a look - up table generator 88 . as explained below in connection with fig9 , pulse voltage controller 87 then changes the value of lower pulse voltage v 1 , and calibration ratio calculator 24 computes a new gain value s - 24 which may be different from the previous value due to non - linearity of the electronic gain . the new values of v 1 and gain value s - 24 are input to look - up table generator 88 . in this way , by changing values of v 1 and computing corresponding values of gain value s - 24 , look - up table generator 88 may build up a table of gain value s - 24 and corresponding values of v 1 which covers the complete range of amplified voltage value s - 22 and which contains as many calibration points as desired . when data acquisition for the desired calibration points has been completed , look - up table generator 88 computes an average gain value for all the calibration points , and converts the table to be a table of the difference , & lt ; δg & gt ;, between the gain value for each calibration point and the average gain value . therefore , the final product of look - up table generator 88 is a table comprising multiple values of & lt ; δg & gt ; and corresponding values of v 1 . it should be noted that circuit 1 c is equivalent to circuit 1 a with switch 20 set to calibration mode and with addition of pulse voltage controller 87 and look - up table generator 88 . circuit 1 c is also equivalent to circuit 1 b with omission of detector response signal s - 10 and addition of pulse voltage controller 87 and look - up table generator 88 . therefore , by adding pulse voltage controller 87 and look - up table generator 88 , circuit 1 c is available to perform calibration of non - linearity irrespective of whether an x - ray instrument is configured with circuit 1 a or with circuit 1 b . note that detector 10 is present in fig8 , but is not operative during the calibration of non - linearity . fig9 shows an embodiment of calibration pulse signal s - 12 , which is a series of pulse sequences produced by pulse voltage controller 87 and pulser 12 for use in calibration of non - linearity . a pulse sequence 92 comprises pulses continuing for a calibration time t 0 , with lower pulse voltage v 1 , higher pulse voltage v 2 and pulse height p . when pulse sequence 92 is used in circuit 1 c , calibration ratio calculator 24 averages the calibration ratio for time t 0 to produce a gain value s - 24 , representative of & lt ; g & gt ; at lower pulse voltage v 1 . in an embodiment , calibration time to is 100 msec and the pulse frequency is 50 khz , so that pulse sequence 92 comprises 5 , 000 pulses . pulse sequence 92 is followed by a pulse sequence 92 ′ which comprises pulses continuing for a calibration time t 0 , with lower pulse voltage v 1 ′, higher pulse voltage v 2 ′ and pulse height p . when pulse sequence 92 ′ is used in circuit 1 c , calibration ratio calculator 24 averages the calibration ratio for time t 0 to produce a gain value s - 24 , representative of & lt ; g ′& gt ; at lower pulse voltage v 1 ′. pulse sequence 92 ′ is followed by a pulse sequence 92 ″ which comprises pulses continuing for a calibration time t 0 , with lower pulse voltage v 1 ″, higher pulse voltage v 2 ″ and pulse height p . when pulse sequence 92 ″ is used in circuit 1 c , calibration ratio calculator 24 averages the calibration ratio for time t 0 to produce a gain value s - 24 , representative of & lt ; g ″& gt ; at lower pulse voltage v 1 ″. gain values & lt ; g & gt ;, & lt ; g ′& gt ; and & lt ; g ″& gt ; are measurements of gain at different lower pulse voltage v 1 , v 1 ′ and v 1 ″ respectively , and these gain measurements therefore take into account the non - linearity of gain with respect to input voltage . gain values & lt ; g & gt ;, & lt ; g ′& gt ; and & lt ; g ″& gt ; and corresponding lower pulse voltage values & lt ; v 1 & gt ;, & lt ; v 1 ′& gt ; and & lt ; v 1 ″& gt ; are input to look - up table generator 88 as shown in fig8 . only three different lower voltages and corresponding gain values are shown in fig9 , but the number of corresponding lower voltages and gain values which can be obtained according to the invention is unlimited . by continuing to vary the lower pulse voltage in small increments over the full range of expected variation of detector response signal s - 10 , a calibration map is made of the non - linear gain characteristics of the amplification and digitization system . in effect , the calibration reproduces lines 62 and 68 as shown in fig6 and 7 over the full range of the instrument . in subsequent operation of the instrument with input from detector response signal s - 10 , the non - linearity due to differing output levels of the charge - sensitive pre - amplifier is taken into account by energy scale corrector 26 using the table from table generator 88 . referring to fig1 and 2 , it can be seen that gain value s - 24 , represented by symbol & lt ; g & gt ;, is not subject to non - linear variation because the lower pulse voltage of pulses from pulser 12 does not vary . however , the amplified voltage value s - 22 , represented by symbol & lt ; ge & gt ; is subject to non - linear variation depending on the output voltage of the charge sensitive pre - amplifier associated with detector 10 . energy scale corrector therefore corrects the energy & lt ; e & gt ; of an x - ray using the following modification of equation ( 2 ): where δg is derived from the table in table generator 88 according to the voltage v 1 of the charge sensitive preamplifier at the time the x - ray was received . pulse height p is kept constant in pulse sequences 92 , 92 ′ and 92 ″ shown in fig9 . however , as well as depending on the lower pulse voltage , the non - linear gain of the amplification and digitization system may also depend on the pulse height . fig1 shows an alternative embodiment of calibration pulse signal s - 12 , which comprises pulse sequences 96 , 97 and 98 , all with the same lower pulse voltage v 1 , but with differing pulse heights p 1 , p 2 and p 3 respectively . in an embodiment , p 1 may represent a pulse height near the bottom of the voltage range of expected detector response signal s - 10 , p 3 may represent a pulse height near the top of the voltage range of expected detector response signal s - 10 , and p 2 may represent a pulse height at approximately mid - range . pulse sequences 96 , 97 and 98 are followed by pulse sequences 96 ′, 97 ′ and 98 ′, all with the same lower pulse voltage v 1 ′, and with pulse heights p 1 , p 2 and p 3 respectively . in the same way as described in connection with fig9 , by continuing to vary the lower pulse voltage in small increments over the full range of expected variation of detector response signal s - 10 , a calibration map is made of the non - linear gain characteristics of the amplification and digitization system . however , for the pulse sequences of fig1 , for each value of lower pulse voltage there are three values of gain , one for each of low pulse height , mid pulse height and high pulse height . in effect , the calibration produces three version of lines 62 and 68 as shown in fig6 and 7 over the full range of the instrument , and the correct calibration for any pulse height may be determined by extrapolation between the measured calibration data for low -, mid - and high pulse height . in subsequent operation of the instrument with input from detector response signal s - 10 , non - linearity both due to differing output levels of the charge - sensitive pre - amplifier and due to differing x - ray energy are taken into account . it should be noted that because the non - linearity has weak dependence on temperature , only a one - time calibration of the instrument non - linearity is required . this calibration may be conveniently performed in the factory before shipment of the instrument to a customer . on the other hand , the actual gain of the instrument is subject to drift , and it is necessary to apply the gain calibration methods described herein in connection with fig1 ˜ 5 . referring to fig6 , the gain calibration methods of fig1 ˜ 5 are designed to correct the slope of line 61 or the level of line 66 , whereas the non - linearity calibration described in connection with fig6 ˜ 10 is a determination of the deviation of line 62 from line 61 or , equivalently , the deviation & lt ; δg & gt ; of line 68 from line 66 . it can be assumed with good accuracy that the deviation of line 62 from line 61 remains constant even as the slope of line 61 changes . when gain drift occurs during operation , line 62 pivots about the origin of the graph as the gain changes , but its shape does not change . similarly , it can be assumed with good accuracy that the deviation of line 68 from line 66 remains constant even as the level of line 66 changes . when gain drift occurs during operation , line 66 moves up and down the graph as the gain changes , but its shape does not change . the ability to calibrate the non - linearity of an amplification and digitization circuit as described in connection with fig6 ˜ 10 is an important novel aspect of the present invention . a further novel aspect is the combination of non - linearity calibration with automatic calibration of the system gain as described in connection with fig4 and 5 . yet a further novel aspect is use of single common reference voltage 14 as voltage reference for processing adc 22 , for reference adc 16 and for both low - level dac 82 and high - level dac 84 . although the present invention has been described in relation to particular embodiments thereof , it can be appreciated that various designs can be conceived based on the teachings of the present disclosure , and all are within the scope of the present disclosure .	6
the numerous innovative teachings of the present application will be described with particular reference to the presently preferred embodiment ( by way of example , and not of limitation ), in which : fig1 shows a sample electronic citation writing system ( cws ) according to the present invention . the intelligent cws includes a microprocessor ( μp ) or microcontroller ( μc ) 10 based design utilizing peripheral circuitry connected to a system bus 34 for dedicated functionality . peripheral circuitry will be used to control and operate all functional operations such as citation printing 28 , officer keypad / touchscreen input 26 , smart meter communication interface 30 , pc data / reprogramming interface 32 , liquid crystal display ( lcd ) operation 24 , diagnostic circuitry 16 , power supply circuitry 18 , real time clock ( rtc ) circuitry 14 , watchdog ( wdog ) circuitry 16 , data storage memory 20 , flash program memory 22 , and all other miscellaneous circuitry . utilizing the latest flash memory , application specific integrated circuit ( asic ), and field programmable gate array ( fpga ) technology will allow the manufacturer to change and upgrade the cws operation in the future as well as lower service costs . user interface software allows for permanent storage of cws data generated during daily operation . an offsite computer downloads citation data from the cws for use in judicial processing and debt collection . the offsite computer can also upload daily repeat violator data to the cws as well as reprogram the operation of the cws during upgrades . the core processing unit is composed of the main μp or μc 10 along with its associated support chips and components such as crystals , timing circuits , reset circuits , direct memory access ( dma ) support chips , etc . a large variety of processors presently exist from several manufacturers . everything from stand alone embedded μc to 64 bit risc processors are available for any application . the choice of controller often is greatly influenced by intangibles such as readily available and cost effective development tools , speed of operation desired , and compatible interfacing capabilities . all circuitry is preferably implemented using surface mount technology ( smt ). a sample embodiment utilizes a ds5000 . all μc and μp based circuits 10 have logic circuits connected to provide control signals for different system and component operations . these logic signals are often referred to as glue logic 12 since they often tie functional circuits together . these controls can be simple chip select signals , complex address decoding functions , or other registered outputs which are application specific . the choice of the appropriate logic circuit depends on the complexity of the overall design . simple gate arrays or complex fpgas may be required . a rtc 14 and its associated timing circuitry is included with the cws and connected to the μc or μp 10 . its primary purpose will be to provide accurate time stamping of events relating to the citation writing process . advantageously , the rtc can be a single off - the - shelf integrated circuit which also includes nonvolatile memory for long - term storage of system critical information as well as timer functions . furthermore , the possibility of error by the parking enforcement official as to the time of day the citation was issued is eliminated . a watch dog circuit 16 and its associated hold off functions is included in the cws and its operational firmware . the watch dog circuit 16 is a safety function connected to the μp or μc 10 that allows the system to reboot in the event it crashes or locks up for any reason . it is standard procedure to include such a module in any stand alone or embedded system . the μp or μc 10 is connected to a power supply 18 which includes a battery backup system for operation from a portable battery supply . the power supply 18 serves to regulate and supply the appropriate circuit voltages . additional functions of the power supply 18 include power supervision and μc or μp 10 notification during abnormal power conditions . the power supply 18 has an on board temporary power backup for data retention . the system is capable of going into temporary shutdown during inactivity to conserve battery life . the amount of data required per citation will influence the amount and type of memory used . the cws contains enough memory 20 to hold all daily citation log information as well as repeat violator information that will be used to determine whether a citation is issued or a vehicle is secured and towed . for example , each citation log might require the following information : the μc or μp 10 receives this information from either the smart meter or from the enforcement official and stores it in the on board memory 20 . several types of memory are now available . the cws memory 20 is preferably easily accessed with low power consumption to improve battery life . the currently used simm memories used in the latest computer motherboards represent a viable choice , however , the main processor used along with the support circuitry required may have an affect on this choice . the cws includes program memory 22 connected to the μc or μp 10 . although the application can be designed utilizing large eprom or masked rom technology , the recent advancements in flash memory offer an attractive alternative . flash memory now operates at acceptable speeds and provides for in circuit reprogrammability . this is advantageous for the cws since the system requires continuous application updates . the cws includes some type of visual display packaged with the unit . several types of character based and graphical lcds are now available with the associated control and driver circuitry . the lcd 24 preferably contains a built - in backlight for visual accuracy during low light or adverse weather conditions . if a touchscreen is to be used , the lcd 24 will be packaged with the overlaying touchscreen and its associated control circuitry . the local display 24 prompts the enforcement official for the correct information about the parking violation and displays information uploaded from an offsite computer concerning repeat parking violators . the cws provides a user interface for the input of field data from the police / parking enforcement official . a keyboard or a user interface touchscreen 26 can be used for data input . both a keyboard and a touchscreen require dedicated hardware for their control , and the use of a touchscreen requires additional firmware overhead for display and interpretation of input . the enforcement official can enter such information as the type of citation , vehicle make and model , color of the vehicle , license plate number , and the parking meter number . the cws has an on board printer 28 for hardcopies of citations . the printer 28 only needs to be capable of printing simple ascii characters without any graphics . several thermal printer manufacturers currently have printers available for bar code and other applications . these manufacturers include : zebra , nec , tec , intermec , datamax , sato , & amp ; boca systems . the cws also has the capability of interfacing to presently manufactured smart meters utilizing already developed interfaces and protocols . in addition , the cws is easily adaptable for new meter communication interfaces . in a preferred embodiment , the cws has an interchangeable probe that can be easily changed out for different meters and attached to the meter &# 39 ; s communication interface 50 . the most widely required probe utilizes an infrared interface between the smart meter and the cws . the cws design preferably includes all required communication hardware ( duarts , driver chips , etc .) on board the cws with the individual smart meter probe providing the custom hardware interface such as infrared , hard wired , or other wireless media . an example of sample connectors , both optical and contact interfaces , are given in pct application us96 / 06005 , filed apr . 24 , 1996 , which has now been filed in the u . s . as u . s . application ser . no . 08 / 847 , 428 , which is a continuation - in - part of u . s . pat . no . 5 , 614 , 892 , which is hereby incorporated by reference . this reference shows an infrared probe which may be inserted into a payment slot of the meter to provide communications . in an alternate embodiment shown , the probe is docked in a dimple in the meter housing to align it properly for communications with the meter . the μc or μp 10 sends commands to the parking meter through the smart meter communication interface 30 requesting information and / or instructing the meter to perform a diagnostic routine , and to send the results of the routine back to the μc or μp 10 during the citation writing process . the information received by the μc or μp 10 , such as the status of the meter , the last payment received by the meter , the type of payment received , time and date of payment received , and whether the meter returned to zero normally or was reset to zero ( whether manually or automatically by vehicle detector ), is then stored in the on board memory 20 . the cws preferably provides a standard rs232 interface 32 with a 9 or 25 pin d - sub connector and all required driver chips for communication to any offsite computer via a serial port . included in the operational firmware is the capability to download all citation and system related data for permanent storage as well as upload of repeat violator data for field background checks . this interface 32 will also be used to reprogram the on board flash memory 22 to upgrade the operational cws firmware . in addition , cellular links may be incorporated for real - time background checks with a central office . fig2 shows a sample electronic parking meter according to the present invention . the meter includes a microcontroller ( μc ) or microprocessor ( μp ) 40 ( e . g . an 8048 or 8051 ) connected to both a real time clock 42 and a power supply with a battery backup system 44 . a type of payment , such as coins or a debit card , is inserted into the meter through the coin or electronic input trigger 46 by the parking space user , or an automatic logging system ( similar to the systems presently used for &# 34 ; toll tags &# 34 ;) can trigger the purchase of time . the time and amount of the transaction is recorded by the μc or μp 40 in the memory 52 provided in the meter . the meter display 48 informs the user of the amount of time purchased , and whether the meter is functioning properly . when a parking enforcement official issues a citation for a parking violation , the citation writing system sends commands to the meter through the communication interface 50 , where they are received into the μc or μp 40 . the μc or μp 40 accesses the information requested in the memory 52 , and if requested , can also perform a diagnostic routine . this information , including the results of the diagnostic routine , is sent back to the citation writing system through the communication interface 50 in addition to a signal from the clock 42 indicating the time of day the information was sent . fig3 is a flow chart of a sample software routine for the electronic citation writing system . reference numbers have been included to correspond with each step in the process . reference letters show the interconnection between the steps . at the beginning of the day ( step 60 ), the parking enforcement official enters information ( step 62 ) into the citation device to enable the device and to simplify the citation writing process . various entries such as the name and id # of the enforcement official are entered only once at the beginning of the day to minimize errors and eliminate repetitious entries . subsequently , the enforcement official can upload from an offsite computer ( step 64 ) the names and license numbers of repeat parking violators , stolen vehicles , and other related offenses . when an unattended vehicle is parked in a metered parking space for longer than the purchased time , the meter displays an indication that the time has expired allowing the enforcement official to issue a citation for a parking violation . once the official determines that the meter is in violation ( step 66 ), the official can attach the citation device to the meter ( step 68 ), to download various information ( step 70 ), including , but not limited to , the meter id #, the last payment received by the meter , the type of payment received , the time and date of such payment , the status of the meter at the time of payment , the current status of the payment , whether the meter returned to zero normally or was reset , and the results of a diagnostic routine performed by the meter at the request of the citation device . this information can be transmitted to the citation writing system by numerous means including , but not limited to , infrared signal , radio frequency signal , magnetic stripe , or integrated circuit chip read / write method . the enforcement official then enters the citation information ( step 72 ), such as the license plate number , and vehicle information , into the citation device . the citation number can be entered by the official , or preferably , the citation device can be programmed to automatically print the appropriate citation number . the citation device searches the uploaded information ( step 74 ) to determine if the vehicle has previous violations ( step 76 ). if enough previous violations are discovered ( step 78 ), the usual procedure involves seizing and towing or booting the vehicle ( step 80 ). however , the specific enforcement process varies according to the jurisdiction . if the search does not reveal enough previous violation ( step 78 ), the citation device prints an appropriate citation and the enforcement official leaves a hardcopy on the vehicle ( step 82 ). the citation writing system then logs all of the information pertaining to the citation ( step 84 ), and preferably , the device generates a checksum ( step 84 ) to provide verification that the citation information entered and the information obtained from the meter were recorded at the same time . at the end of the day ( step 86 ), the parking enforcement official downloads ( step 88 ) all of the citation information to an offsite computer for permanent storage ( step 90 ). this process streamlines the enforcement process and provides a report which can be used in court to rebut defenses such as the amount of time purchased , the time of the violation , or the inoperability of the parking meter . fig4 is a flowchart which shows a sample embodiment of the entire parking citation issuing and enforcement process . reference numbers have been included to correspond with each step in the process . reference letters show the interconnection between the steps . this process begins ( step 100 ) when a parking citation is issued ( step 102 ) and entered into a citation database ( step 104 ). the owner of the vehicle that has committed the violation receives the hardcopy of the citation left on the vehicle , which instructs the defendant to pay a fine ( step 106 ) or request a hearing ( step 108 ) by a certain date . if the defendant does not respond to the violation within the time allotted ( step 110 ), a reminder letter is sent ( step 112 ) notifying the defendant of the date and time of the violation , the amount owed , and the date such amount is due . once again , the defendant has the option of paying the fine ( step 106 ) or requesting a hearing ( step 108 ), however , if no response is received by the due date ( step 110 ), a notice of hearing and summons will be mailed to the defendant ( step 114 ). at the hearing ( step 116 ), the defendant can assert a defense to the citation . such defenses include disputing the accuracy of the parking meters , or claiming that the meter returned to zero time remaining prematurely , and / or disputing information on the citation , such as the time of day the violation occurred . the court determines the validity of any defenses ( step 120 ) and has the option of upholding the validity of the citation and requiring the defendant to pay the fine ( step 122 ), or finding the citation invalid ( step 134 ). if the defendant does not appear at the hearing ( step 118 ), the citation is upheld ( step 124 ), and the court can issue a warrant for the arrest of the defendant ( step 128 ), considering any previous outstanding violations ( step 126 ). if the defendant commits another parking violation , the parking enforcement official can tow or boot the vehicle ( step 130 ) if a warrant has been issued ( step 128 ), or if several outstanding citations have been issued to the defendant ( step 126 ). however , if the defendant paid the fine ( step 106 ) or had the citation held invalid ( step 134 ), the parking enforcement official will only issue another citation ( step 132 ) that will be entered into the citation database to begin the process again ( step 104 ). fig5 shows a sample embodiment of the hardware utilized to implement the innovative system , including meter 180 , ticket writer 182 , and probe 184 , which together gather , store , and communicate the information necessary for effective enforcement . the innovative parking enforcement system described herein reduces the possibility of the court finding the citation invalid due to any of the defenses listed above by generating a report which contains the citation data entered by the enforcement official and the information obtained from the parking meter at the time the citation was issued . furthermore , this system enables the parking enforcement official to determine whether previous outstanding violations exist . this allows the official to tow or boot repeat offenders to ensure payment of existing citations . other benefits include assuring compliance with parking laws , simplifying the enforcement process , and deterring repeat violators . according to a disclosed class of innovative embodiments , there is provided : a parking enforcement system , comprising : a portable module including at least one microprocessor , said microprocessor being connectable to a data input subsystem , data output circuitry , data storage circuitry , and a communication interface , said communication interface being capable of communicating with an electronic parking meter ; said microprocessor being programmed to send commands to said parking meter , through said communication interface , when entering citation data into said module using said data input subsystem ; said microprocessor being programmed to receive information from said parking meter , to store said information in said data storage circuitry , and to output , using said data output circuitry , a complete citation record , said citation record including said citation data as well as said information received from said parking meter at the time said citation data was entered . according to another disclosed class of innovative embodiments , there is provided : a parking enforcement system , comprising : a portable module including at least one microprocessor , said microprocessor being connectable to a data input subsystem , data output circuitry , data storage circuitry , and a communication interface , said communication interface being capable of communicating with an electronic parking meter ; said microprocessor being programmed to send commands to said parking meter , through said communication interface , to cause said parking meter to initiate a diagnostic routine , when entering citation data into said module using said data input subsystem ; said microprocessor being programmed to receive the results of said diagnostic routine executed by said parking meter , store the results of said diagnostic routine in said data storage circuitry , and to output , using said data output circuitry , a complete citation record , said citation record including said citation data and the results of said diagnostic routine performed on said parking meter at the time said citation data was entered . according to another disclosed class of innovative embodiments , there is provided : a parking enforcement system , comprising : a portable module including at least one microprocessor , said microprocessor being connectable to a data input subsystem , data output circuitry , data storage circuitry , and a communication interface , said communication interface being capable of communicating with an electronic parking meter ; said microprocessor being programmed to send commands to said parking meter , through said communication interface , when entering citation data into said module using said data input subsystem ; said microprocessor being programmed to receive information from said parking meter , to store said information in said data storage circuitry , to generate a checksum , and to output , using said data output circuitry , a complete citation record , said citation record including said citation data , said checksum , and said information received from said parking meter at the time said citation data was entered into said module ; whereby electronic verification that said citation data and the results of said diagnostic routine were recorded at the same time is provided . according to another disclosed class of innovative embodiments , there is provided : a method of issuing and enforcing parking citations , comprising the steps of : ( a .) providing a portable module including at least one microprocessor , said microprocessor being connectable to a data input subsystem , data storage circuitry , data output circuitry , and a communication interface , said communication interface being capable of communicating with an electronic parking meter ; ( b .) sending commands , using said microprocessor , through said communication interface , to said parking meter , when entering citation data into said module using said data input subsystem ; ( c .) receiving information from said parking meter , using said microprocessor , storing said information in said data storage circuitry , and outputting , using said output circuitry , a complete citation record , said citation record including said citation data as well as said information received from said parking meter at the time said citation data was entered . according to another disclosed class of innovative embodiments , there is provided : a method of issuing and enforcing parking citations , comprising the steps of : ( a .) providing a portable module including at least one microprocessor , said microprocessor being connectable to a data input subsystem , data storage circuitry , data output circuitry , and a communication interface , said communication interface being capable of communicating with an electronic parking meter ; ( b .) sending commands , using said microprocessor , through said communication interface , to said parking meter , when entering citation data into said module , using said data input subsystem , to cause said parking meter to initiate a diagnostic routine ; ( c .) receiving the results of said diagnostic routine executed by said parking meter , using said microprocessor , storing the results of said diagnostic routine in said data storage circuitry , and outputting , using said output circuitry , a complete citation record , said citation record including the results of said diagnostic routine performed on said parking meter at the time said citation data was entered . according to another disclosed class of innovative embodiments , there is provided : a method of issuing and enforcing parking citations , comprising the steps of : ( a .) providing a portable module including at least one microprocessor , said microprocessor being connectable to a data input subsystem , data storage circuitry , data output circuitry , and a communication interface , said communication interface being capable of communicating with an electronic parking meter ; ( b .) sending commands , using said microprocessor , through said communication interface , to said parking meter , when entering citation data into said module using said data input subsystem ; ( c .) receiving information from said parking meter , storing said information in said data storage circuitry , and generating a checksum , using said microprocessor ; and ( d .) outputting a complete citation record , using said output circuitry , said citation record including said citation data , said checksum , and said information received from said parking meter at the time said citation data was entered ; whereby electronic verification that said citation data and the results of said diagnostic routine were recorded at the same time is provided . as will be recognized by those skilled in the art , the innovative concepts described in the present application can be modified and varied over a tremendous range of applications , and accordingly the scope of patented subject matter is not limited by any of the specific exemplary teachings given . for example , it should be noted that the disclosed innovative ideas are not limited only to systems based on an ds5000 microprocessor , but can also be implemented in systems using 680 × 0 , risc , or other processor architectures . it should also be noted that the disclosed innovative ideas are not by any means limited to systems using a single - processor cpu , but can also be implemented in a cws using multiprocessor architectures . additional information , not mentioned in the sample embodiments can also be included in the information stored in the cws . one example is useful in conjunction with electronic meters which have vehicle presence detectors , which enable the meter to &# 34 ; know &# 34 ; whether or not a vehicle is present in the parking space , and even to reset the time to zero if the vehicle leaves before the time has expired . information regarding the times vehicles enter or leave a space can be stored in a cws , as well as notations that the meter was reset when a vehicle left . in addition , the nonvolatile memory of the rtc can be eeprom , battery backed sram , or flash .	6
the heart of the present invention is the frequency ratio generator ( frg ). the basic principle of operation of the frg relies on the fact that output frequency ( oscillator fosc ) and input frequency ( reference clock fref ) always have a rational relationship , i . e . the ratio of the two can always be represented as a ratio of two integer numbers , p and q , as shown in equation ( 6 ): alternatively , fosc / fref ratio can be expressed as a combination of two fractions , per eq . ( 6a ): if the ratio p / q can be realized in hardware , such that a frequency equal to fref * p / q is generated , then all what it would take to realize eq . ( 6 ) would be to use a pll and phase lock the oscillator to this frequency . the manner in which the frg accomplishes this goal is described below . it is well known in the science of mathematics that any rational number p / q can be expanded into various equivalent fractions . the equivalent fractions take a form of a series of divided , multiplied , added or subtracted terms , each term being a rational number itself . a simple example of such expansion is 3 / 2 = 1 + ½ . there are numerous possible fraction expansions , but here we are interested in those expansions which are most suitable for implementation in hardware . examining the four arithmetic operations and the feasibility to implement them in hardware , and keeping in mind that the variable which is being operated upon is frequency , the following can be found : addition : addition of two frequencies f 1 + f 2 requires a single side band ( ssb ) mixing , where upper sideband ( usb ) is used . it is well known in the art of frequency conversion that the ssb mixing of two frequencies produces only one dominant frequency , equal to either the sum or the difference of the two frequencies , depending upon which sideband ( upper or lower ) is produced . for ssb mixing , quadrature signals ( 0 ° and 90 ° phase signals ) of both f 1 and f 2 frequencies is required . this requirement poses some constraints , which will be reviewed later in the discussion on implementation details . alternatively , a double sideband ( dsb ) mixing followed by a band pass filter tuned to a desired sideband ( and rejecting the unwanted one ) can be used , however this approach is not suitable for integration in integrated circuits , primarily because of a need for external filters . subtraction : difference of two frequencies f 1 – f 2 can be obtained by ssb mixing , where lower sideband ( lsb ) is used . multiplication : multiplication of one frequency by an integer — there is no easy way to accomplish this in hardware ( a separate pll with dividers in the loop , or a harmonically locked injection - locked oscillator may be needed to accomplish this function ). multiplication by a factor of 2 is somewhat easier to implement directly , but in general , fraction expansions requiring multiplication are not preferred . division : division of a frequency by an integer — well known dividers or counters can be used for this function . it follows that expansions using addition , subtraction and division are preferred , and clearly those having fewer number of terms ( minimum expansion length ) are favored . one preferred type of fraction expansion that meets the above criteria is expressed in equations ( 7 ): where qi , i = 1 , 2 , 3 , . . . , n are also positive integer numbers . further types of preferred expansions include expansion of both fosc and fref frequencies , per eq . 6a , where both p1 / q1 and p2 / q2 are rational fractions , and each can be expanded into fractions like one in eq . ( 7 ) or eq . ( 8 ). a combination of the above equations , where part of the desired signals is synthesized per eq . ( 7 ) and part per eq . ( 8 ) is yet another preferred fraction expansion . the manner in which equations ( 7 ) and ( 8 ) are realized in hardware in the frg of the present invention is illustrated in fig2 . and fig3 . respectively . realization of other equations per above , or the combinations of , can be obtained in a similar fashion . key building blocks in hardware realization are the ssb mixers , for frequency addition / subtraction , and dividers for frequency division . each of the inputs to ssb mixers contains two signals — in phase and quadrature ( not shown in the figures for simplicity ). to obtain the quadrature signals , either a deilay line having a delay equal to 90 ° phase shift at the operating frequency ( which is not inherently broad - band , since a phase shift of a delay line will vary with frequency of the signal ), or a divide - by - two divider circuit can be used , as shown later in one of the embodiments of this invention . this requirement will put a constraint on the coefficients pi or qi in the fraction expansion , namely , the coefficients would need to be even numbers , i . e . divisible by two . the block diagrams in the fig2 and 3 can be directly constructed by following the formulas in eq . ( 7 ) and ( 8 ), respectively , with the addition of a loop filter and an oscillator , to complete a pll circuit . the mechanism for frequency acquisition of the pll is not shown in the figures , since the acquisition is not the focus of this invention . however , should assistance for frequency acquisition be needed , some of the well known techniques in the art , such as a frequency discriminator , which is turned - off upon phase acquisition , or frequency sweeping , or frequency pre - tuning can be used . as an example , frequency pre - tuning , where a separate tuning signal , which is summed together with that of the loop amplifier , can be used to pre - tune the oscillator and bring it &# 39 ; s frequency close enough to the target frequency , i . e . tune it within the lock - in range of the pll , so that the pll can acquire a lock . for any given fraction p / q , there may be multiple solutions for set of coefficients pi and qi ( i = 1 , 2 , 3 , . . . , n ) in eq . ( 7 ) and ( 8 ). multiple solutions provide additional freedom in the design choices . the computation of coefficients pi and qi is iterative in nature , and can be accomplished by various available mathematical and engineering tools . if q is not a prime number , it can be factored into a product of constituent terms , each of which is a prime number raised to an integer exponent . all coefficients pi and qi will contain some combination of products of these factors . the more factors q has , in general , there will be more possible solutions for pi or qi . given fosc and it &# 39 ; s required increment ( fstep ), the choice of fref will directly determine the q ( as shown in eq . ( 10 )). this indicates that for any specific range and step size requirement for the oscillator frequency , an optimum frequency fref can be found , such that a fraction expansion results in an optimum hardware implementation and performance . for each new frequency , corresponding to a new value of p , in general , a computation of new coefficients pi or qi is required . even for increments of p by 1 , the computation may result in completely different values of these coefficients . the ratio p / q , being equal to fosc / fref , represents the minimum possible multiplication ratio , and is therefore equal to the theoretical lower bound of the noise multiplication factor in the loop . for this reason , it can be stated that the frg is approaching theoretical lowest limit regarding noise multiplication factor occurring in the loop . since p is an integer with minimum increment of 1 , the minimum available frequency increment is : the fstep is the lowest frequency existing in the system ( any other frequency in the system is an integer multiple of this frequency ). conversely , 1 / fstep represents the common periodicity of the system , i . e . it is the longest period of any waveform or signal in the system , and therefore the closest distance between any two spectral components of any signal in the system is equal to fstep . for a given reference frequency fref and frequency increment fstep , q can be computed from eq . ( 9 ): individual terms in eq . ( 7 ) have frequencies equal to fref / pi , i = 1 , 2 , 3 , . . . , n . however , because of the digital nature , each of these signals will contain harmonics , and the output spectrum will contain numerous frequencies , as a consequence of spectral convolution of all signals present in the processing . spectral analysis is necessary for each of the synthesized frequencies , to make sure that the spectral purity around the desired output frequency is acceptable . to obtain the spectrum of the output waveform , first a time domain pulse waveform of the signal must be obtained , and fft computed . the time domain waveform can be obtained by computing the waveform over one full cycle equal to system periodicity ( which is equal to 1 / fstep , per eq . ( 9 )) for each of the internal nodes , or only for specific nodes of interest , as the signals are being processed and / or generated in various building blocks of the synthesizer . performing fft will yield the spectral purity information . the minimum frequency spacing between any two spectral lines can not be less than the frequency of fstep and depending on the particular values of coefficients pi or qi , there may or may not be any energy around the desired signal at separation equal to fstep or multiples of it . if the spectral purity is not satisfactory , a new fraction expansion solution should be found , and spectral analysis repeated . if a satisfactory solution can not be found with any fraction expansion , an option to employ external filtering of one or more internal signals can be considered . this would require a signal to exit the ic for external filtering , pass through a filter ( the signal will at this point become an analog signal ) and re - entry into the ic through some type of a comparator which will convert the analog signal back to digital . as an example of such comparator , a single gate , with dc feedback ( through a resistor ) from output back to input can be used . to illustrate the design process in the present invention , an example of fraction expansion and signal synthesis per eq . ( 7 ) is provided : 1 . given fref = 72 mhz , 2 . synthesize fosc = 75 . 63125 mhz 3 . first , find the greatest common factor for the two frequencies ( or alternatively , least common periodicity of the periods of the two signals ). a frequency of 6 . 25 khz is found ( 72 mhz = 11 , 520 * 6 . 25 khz and 75 . 63125 mhz = 12 , 101 * 6 . 25 khz ). note that 12 , 101 is a prime number , whereas 11 , 520 can be factored as 11 , 520 = 2 8 * 3 2 * 5 4 . form a ratio fosc / fref = p / q == 12 , 101 / 11 , 520 5 . expand the ratio per eq . ( 7 ): 12 , 101 / 11 , 520 = 1 + 1 / 20 + 1 / 2304 ( note : 20 = 4 * 5 = 2 2 * 5 and 2304 = 2 8 * 3 2 , i . e . each term is a product of subsets of factors of 11 , 520 ) 6 . implement per fig2 , with the following specific values : p1 division ratio = 20 ( resulting frequency is 72 mhz / 20 = 3 . 6 mhz ) p2 division ratio = 2304 ( resulting frequency is 72 mhz / 2304 = 31 . 25 khz ) first ssb mixer uses usb second ssb mixer uses usb 7 . compute in time domain the output waveform and perform the fft ; examine the spectrum in the vicinity of desired output frequency ( 75 . 63125 mhz ) and , based on the spectral content maximum , determine the loop bandwidth for the required sideband purity of the oscillator signal . while the lowest fractional frequency in item 6 . above is 31 . 25 khz ( which is a 5 th harmonic of 6 . 25 khz ), by spectral analysis of the output waveform it is found that the spectrum contains a 12 . 5 khz term ( 2 nd harmonic of 6 . 25 khz ) offset from the main signal at 75 . 63125 mhz , at a level about 50 db below the main signal . this signal would be converted in a phase detector down to 12 . 5 khz baseband frequency . for instance , for sideband purity of 70 db of the output oscillator , the maximum loop bandwidth of a third order loop could be about 6 khz , since it will provide about 20 db rejection at 12 . 5 khz . 8 . if necessary , obtain a different fraction expansion solution , e . g . : 12 , 101 / 11 , 520 = 1 + ¼ ( 1 / 5 + 1 / 9 )− 1 / 8 1 / 4 *( 1 − 1 / 8 ) and repeat the process . by spectral analysis in this case , it was found that a lowest frequency term of 31 . 25 khz will exist at the output of the phase detector , at about − 40 db . in this case , a third order loop with lbw of about 10 khz can be used , for the same 70 db purity of the output signal . the noise multiplication figure in the loop is only 20 log ( 75 . 63125 / 72 )= 0 . 4 db . for a step size of 6 . 25 khz , the prior art pll of a dual modulus type would have 20 log ( 12 , 101 )= 81 . 6 db of noise gain . this example illustrates a dramatic improvement that can be achieved with the present invention . detailed description of the preferred embodiments of the present invention is presented below . the first preferred embodiment of the present invention is shown in fig4 a . the rational synthesizer in this example has been designed to synthesize a frequency of 969 . 9875 mhz , which is used as a local oscillator in a catv upconverter . the upconverter is of a dual conversion type , where this signal is used as a local oscillator lo 1 in the first upconversion stage . this frequency is offset by 12 . 5 khz from a 970 mhz frequency . the offset of 12 . 5 khz is required by fcc regulation for some channels , as discussed earlier . for some other channels , which require an offset of 25 khz , this synthesizer can be tuned to a frequency of 969 . 975 mhz . for all other channels which do not require offsets , the synthesizer can be tuned to 970 mhz frequency . we &# 39 ; ll focus the discussion to a 12 . 5 khz offset case , i . e . fosc = 969 . 9875 mhz since the fosc frequency exceeds the maximum clock rate of the digital ic ( asic ) selected for this application ( which has about 200 mhz maximum clock rate ), an external divider of a division ratio of 8 had to be used . a system clock frequency of 72 mhz was chosen . the choice of this frequency was based on several considerations , the first being the factorization of this frequency in respect to 12 . 5 khz . other considerations included the design aspects of a crystal oscillator used as a physical source . to utilize the full benefit of the asic &# 39 ; s speed , a 72 mhz clock was doubled - up to a 144 mhz clock , for use as a reference frequency fref . the doubling was accomplished within the same asic ( the doubler is not shown in fig4 a , since a standard technique with gate delays and xor gates , well known in the art was used ). both fosc and fref are integer multiples of 12 . 5 khz . the rational expansion was chosen per the combination of eq . ( 7 ) and ( 8 ): to check the computation in terms of frequencies , substituting 144 mhz for fref in eq . ( 11 ): each of the terms in eq . ( 11 ) represents some physical frequency . the sequence of arithmetic operations in the above formula will affect which physical frequencies are generated ( i . e . by commutating the arithmetic operations , different frequencies will be generated ). the sequence of the arithmetic operations and the actual frequencies in this embodiment can be found in fig4 a . to shift the oscillator frequency to 960 mhz , an rf quadrature modulator circuit ic , operated as an ssb mixer is used . the quadrature modulator is fed , on one side by the output signal of the oscillator , serving as a local oscillator ( lo ) in the quadrature modulator , and on the other side by a signal of frequency fm = 9 . 9875 mhz serving as a modulation signal supplied by the asic . the lo signal is internally in the ic split in quadrature , whereby 0 ° and − 90 ° components provide the lo drive to their respective mixers in the quadrature modulator . the fm signal is also split in quadrature , in the asic . the output of the quadrature modulator will contain only one sideband , either lower sideband ( lsb ) or upper sideband ( usb ), depending upon the phase of the quadrature component of fm . if this component lags by 90 °, an lsb signal will be generated . if this component leads by 90 °, an usb sideband will be generated . the phasing is chosen for lsb , so that output of the quadrature modulator will be at frequency fosc − fm = 960 mhz . this signal is presented to the divide - by - 8 prescaler / divider , which produces the frequency of 120 mhz at it &# 39 ; s output . this frequency is compared in a phase detector with another 120 mhz signal , generated from 144 mhz reference clock signal with the frg inside the asic . this frequency is generated by dividing 144 mhz by 6 , where 24 mhz quadrature signals are produced , and mixing this signal in an lsb mixer ( such as one in fig6 b ) with 144 mhz ( the 144 mhz quadrature signal is obtained with a precise delay through several gates ), to produce 120 mhz . the output of the phase detector is supplied to a loop filter , which drives the tuning line of the oscillator and closes the pll circuit , so that a phase lock of the oscillator is established . returning back to considerations regarding spectral purity implications as a result of practical limitations in the performance of the quadrature modulator , it is not difficult to find that in addition to the desired sideband , the output spectrum will contain other , undesired terms , caused by imbalances in the in - phase and quadrature signal paths . in addition to a desired fosc − fm term , there will also be undesired terms , which will at minimum include the lo leakage at fosc frequency , the other sideband at fosc + fm frequency , as well as the direct leakage of the modulation signal at fm frequency . in addition , it is likely that numerous other sidebands caused by harmonics of modulation frequency fm will exist . all these terms must be regarded as spurious components , and each of those can potentially degrade the spectral purity , if it falls within or close to the lbw after being processed in the synthesizer . the relative power of these terms at the output of the quadrature modulator will depend upon the amount of imbalance and amount of direct leakage around the circuit . with the typical quadrature modulator ic in a reasonably well designed application circuit , the level of undesired signals of no less than − 30 dbc could be expected . since the fm signal in the first preferred embodiment of the invention is a digital signal , it will contain harmonics of the fundamental frequency fm , where the level of specific harmonics will depend upon the duty cycle , as well as on the rise time of the pulses . if the duty cycle is close to 50 %, predominantly odd order harmonics of fm will be present ( 3 fm , 5 fm , etc . ), and with fast rise time of the pulses , the third harmonic could reach as high as − 10 dbc levels . a spectrum of such digital signal is displayed in fig9 a , normalized to a frequency of 1 hz , for clarity . when such a complex spectrum is presented to the input of a prescler or divider , the first effect that will occur is the limiting of the signal on the strongest tone . the limiting will convert any am that may be present into pm , which will result in a bi - level signal ( i . e . the limiting will effectively convert an analog signal into digital ). next , a so called capture effect similar to the one known in fm systems will occur , where the divider will lock on and divide the frequency of the strongest tone ( which is the fosc − fm in this case ), while other terms will appear as pm modulation on this tone . the pm modulation terms will produce sidebands that are spread around the fosc − fm signal at the distance equal to the integer multiples of fm . in the division process , only the frequency of fosc − fm will be divided down , while the pm terms , being the modulation sidebands will remain at the same distance from the main tone after division , only the levels of those terms will be reduced by a division factor , which is consistent with the pm or fm modulation index scaling phenomena associated with a process of division , where only the sideband level , not the frequency distance , gets reduced by a factor equal to the division ratio . however , reduced spur levels through the division process will offer no relief to the spectral purity conditions , since all the terms appearing in the vicinity of the lbw at the output of phase - frequency detector will be multiplied back by the pll loop by the ( exact same amount equal to the division ratio . after the entire division process in this example , the spectral content of the signal presented to the phase - frequency detector will include the main tone at 120 mhz , surrounded by other terms at 9 . 9875 mhz spacing . the negative frequencies ( if any , depending on the division ratio ) will fold back around dc to positive ones . a 120 mhz signal applied to the other side of the phase detector contains it &# 39 ; s own sidebands . the phase - frequency detector will perform the operation of multiplication of the two signals ( in time domain , which is equivalent to the operation of mixing in the frequency domain ), which will produce the spectrum equal to the convolution of the spectrums of the two signals . in the mixing process , all spectral components present around 120 mhz and it &# 39 ; s harmonics will translate to spectral components around dc at the output of the phase detector . the distance of these components from dc will be equal to the distance of the original components from the main signal . in real implementation in a digital asic , there may be a case of adverse ( undesired ) coupling of the signals through internal structures of the ic ( such as substrate , bond wires , etc .) that in general can degrade spectral purity and produce spectral components which are not expected per the results of computations or simulations . to minimize such effects , it is beneficial to use differential ( complementary ) signals wherever possible , in order to utilize well known benefits of reduced coupling and cross - talk of such signals , as well as to optimize internal layout of the ic . the frequency fm = 9 . 9875 mhz in eq . ( 12 ), is generated by a circuit shown in fig4 b . note : in this , and other figures , a letter φ is used to indicates that division produces quadrature components , i . e . that it has two outputs − 0 ° and 90 °. the manner in which this signal is generated follows directly from eq . ( 11 ). first , 144 mhz reference signal is split in two signals , one divided by 2 in quadrature ( using a circuit of fig8 ) and another divided by 45 , also in qudrature . the dividers used for division by 45 are similar in nature to that of fig8 , except that the quadrature signals are not exactly 90 ° apart ( 88 ° in this example , as indicated in fig4 b .). in general , division by non - binary numbers can not produce exact quadrature , however with a proper choice of division sequence , choice of triggering ( either on the raising edge or on the falling edge ) and choice of signal polarity , the quadrature conditions can be approached close enough , so that degradation of the ssb signal ( i . e . reduced rejection of the unwanted sideband or signal feed - through ) is acceptable . the two signals are next applied to an usb mixer , such as one shown in fig6 a ., to produce a 75 . 2 mhz signal , which is further divided by two , to a 37 . 6 mhz frequency , which is in turn mixed in another usb mixer with it &# 39 ; s version divided by 8 , to finally produce a signal at 9 . 9875 mhz . to illustrate spectral conditions at the output of a digital ssb mixer ( with normalized frequencies down to a few hz for clarity ), in fig9 c a spectrum of a digital signal with dominant energy at 8 hz , as a result of usb mixing of the signals in fig9 a and 9 b , using the circuit of fig6 a is shown . as another illustration of a spectrum at the output of a digital ssb mixer , in fig9 d a spectrum of a digital signal with dominant energy at 6 hz , as a result of lsb mixing of the signals in fig9 a and 9 b , using the circuit of fig6 b is shown . to illustrate the spectral conditions at the output of a digital divider when dividing an ssb signal , in fig1 a a spectrum of a digital signal as a result of a divide - by - 4 of the usb digital signal of fig9 c , with dominant energy at 8 / 4 = 2 hz is shown . as another illustration of the spectrum at a digital divider when dividing an ssb signal , in fig1 b a spectrum of a digital signal as a result of a divide - by - 4 of the lsb digital signal of fig9 d with dominant energy at 6 / 4 = 1 . 5 hz is shown . the spectral plots in the figures above were obtained by computing time domain waveforms and applying fft transform . a block diagram of a wide range tunable synthesizer , operating in 1 ghz to 2 ghz frequency range , with 1 mhz step resolution is shown in fig5 a . the application of this synthesizer is in the same catv upconverter , except this signal is used as a local oscillator l 02 in the second upconversion stage . the circuit uses an external digital divide - by - two circuit followed by an analog ( rf ) quadrature modulator ic operated in ssb mode to provide a translation of the local oscillator frequency , further followed by a fixed digital divide - by - 8 ic in order to scale the frequency down to about 130 mhz and below , which is within the operating range of a chosen digital asic ( or fpga ). the fraction expansion can be performed in a similar manner as in the previous example . as a result of such expansion , various frequencies internally needed in the frg , in order to synthesize all required oscillator frequencies can be computed . the embodiment of the fraction expansion and the generation of all required frequencies is shown in fig5 b and fig5 c . all frequencies shown in these figures are derived from 144 mhz reference signal , in a similar manner as in the first example , using similar circuits for the division and ssb mixing process . an embodiment of an improved phase detector over the prior art is shown in fig1 . this phase detector employs ssb mixing of the two compared frequencies , where each frequency has quadrature signals ( i = 0 ° in phase and q = 90 ′ quadrature signal ). the circuit in fig1 is similar to a quadrature modulator circuit , except the phasing is somewhat different . the mixers are of analog type . compared with a detector of the prior art , this phase detector has a higher gain by a factor of two , since full converted power is contributing to the detection of phase , and a 3 db better noise figure . the prior art phase detector uses one mixer only , where half the power ( the power in the upper sideband ) is not used to contribute to the detection of phase difference of two signals . an embodiment of the ssb phase comparator with digital circuits is possible , where analog mixers are replaced with xor gates , and the i and q signals at the output of the xor gates are summed together by a resistive network . an embodiment of a digital phase - shift circuit , which provides phase control capability is shown in the block diagram in fig1 . an example of 45 . 75 mhz signal is shown , where full 360 degrees phase control with 1 . 25 ° step resolution is available . this signal ( or a signal of different frequency constructed in a similar way ), can be added / subtracted to another signal by ssb mixing and so obtaining a phase controlled signal at any desired frequency . through ssb mixing , the phase control range and step size will remain unchanged , since the ssb mixing is an additive process , both for frequency and phase .	7
the general arrangement of the elements is shown most clearly in fig1 . this shows a towable power plant 100 including a frame 102 with a drawbar 104 and a hitch 106 . a pair of wheels 108 is coupled to the frame 102 either with or without suspension . an enclosure 110 houses an engine 202 . the engine 202 may be fixedly secured to the frame 102 . a light tower 300 may be coupled to the drawbar 104 . the light tower 300 may be coupled to the drawbar 104 with mechanical fasteners , by welding or any other process . a portion of the light tower 300 is moveable between a towable position and a working position . in the towable position , the moveable portion of the light tower may be secured to a coupling 144 secured to the enclosure 110 . in the working position the light tower is preferably coupled only to the frame 102 and does not contact the housing 110 . as shown in fig2 the engine 202 is coupled to a starter 204 , an alternator 206 , and an air compressor 208 . alternatively , the engine 202 may drive an electric generator , a water pump , or a hydraulic pump . the engine 202 may use any fuel including , but not limited to , gasoline , diesel , and natural gas . the compressor 208 may be coupled to a storage tank 210 in known fashion . the output of the compressor 208 or the tank 210 may be used to drive pneumatic tools such as a jackhammer . the alternator 206 may be used to recharge an energy storage device , for example a battery 212 . the battery 212 may be coupled to the starter 204 through a series of switches or actuators and a relay coil 220 that may be arranged in a variety of different ways . an ignition switch 214 may be manually operable with a key or any other means to make or break electrical connection with the battery 212 . the ignition switch is preferably a momentary switch . an optional air pressure switch 216 may also be used to make or break electrical connection with the battery 212 . the air switch may break connection with the battery if the air pressure in the tank 210 exceeds a predetermined value . a manually operable switch , for example a toggle switch 218 may also be used to make or break electrical connection with the battery 212 . the toggle switch is preferably a maintained switch . a socket 230 may also be electrically coupled to the battery 212 through a fuse 234 and a relay contact 232 . the relay contact may be used to control the on / off status of the lamp 320 and may have an actuator that extends through an opening in the enclosure 110 . the socket may be mechanically coupled to the housing 110 of the towable power plant 100 . fig3 shows the light tower assembly 300 . the light tower assembly includes a first support member 302 rotatably coupled to a second support member 304 about a pivot pin 306 . the first member 302 is moveable between a towable position ( as shown in fig3 ) and a working position ( as shown in fig1 ). the second member 304 is coupleable to a draw bar 104 of a towable trailer with mechanical fasteners 308 and clamps 310 . alternative fastening methods including welding shall be considered part of the present invention . the first member 302 may be mechanically secured to the second member 304 in the working position with a pin 332 . a lamp 320 , for example a 100 - watt incandescent lamp , may be coupled to a light - mounting bracket 322 that is couple to a light - rotating shaft 324 . preferably , a plurality of lamp may be coupled to the light - mounting bracket 322 . the light - rotating shaft 324 is capable of being manually rotated about the longitudinal axis of the first member 302 with a handle 326 . the light - rotating shaft 324 may extend through a series of aligned opening in plates extending from the first member 302 . knob 340 may be used to resist rotational motion of the shaft 324 . a retainer 342 and collar 344 may be used to prevent removal of the shaft 324 along the longitudinal axis of support member 302 . a winch 326 with a handle 348 is coupled to the second member 304 with suitable fasteners or by welding . a first end of a cable 350 may be connected to the winch 326 and then extends around a guide or pulley 328 and the second end is coupled to the first member 302 near an end opposite the lamp 320 . the pulley 328 may be secured to the second member 304 with a bracket 330 . a lanyard 334 may be used to secure locking pin 30 and a leaf spring 336 may be used to aid in lowering upper support 302 from vertical position . a wire clip 338 may be used to secure cable assembly to upper support 302 . fig4 shows a wiring assembly 400 with a plug 402 coupled at a first end of a length of cable 404 and at least one lamp electrically coupled to a second end . connectors 406 may be used to allow for removal of the lamp . the connector 406 may be coupled to lamp 320 . a portion of the wiring assembly 400 may be secured to the outside of the first member 302 or alternatively it has to be housed inside of the first member . the plug 402 is matable with the socket 230 . alternatively a wiring assembly 400 may have alligator style clips secured at the first end in place of the plug 402 to allow for connection to the positive terminal of battery 212 and the negative terminal of the battery or a convenient grounding point . the cable 404 may enter the enclosure through an existing opening or through one of the enclosure doors . it should be understood that , while the present invention has been described in detail herein , the invention can be embodied otherwise without departing from the principles thereof , and such other embodiments are meant to come within the scope of the present invention as defined in the following claims :	1
those of ordinary skill in the art will realize that the following description of the present invention is illustrative only and not in any way limiting . other embodiments of the invention will readily suggest themselves to such skilled persons having the benefit of this disclosure . in accordance with a presently preferred embodiment of the present invention , the components , process steps , and / or data structures may be implemented using various types of operating systems , computing platforms , computer programs , and / or general purpose machines . in addition , those of ordinary skill in the art will readily recognize that devices of a less general purpose nature , such as hardwired devices , or the like , may also be used without departing from the scope and spirit of the inventive concepts disclosed herein . the present invention relates to a method to determine the constellation type for modulation of a received signal . the method may be used in a receiver of a communications system employing different types of modulations . examples of such systems include , but are not limited to , multiple data rate systems , adaptive data rate systems and multi - resolution modulation systems . these can be found in satellite , microwave , terrestrial and cable communication systems along with broadcast channels , digital subscriber loops and various size networks . the method may also be used in universal types of receivers designed to operate for multiple applications . such receivers may be reconfigured according to the modulation system employed . examples of such universal receiver systems are those used in television set - top boxes that can receive vsb , m - qam and m - psk depending on the transmission medium and communication standard used . the method may be used in conjunction with any form of timing and carrier synchronization . it may also be used with equalization used in channel receivers . the inventive method may ascertain the modulation without the need for recovery of carrier identification . the channel intersymbol interference may be treated as additive white gaussian noise , irrespective of the channel noise level . the symbol timing is assumed to be recovered and the data available at the symbol rate . the waveform series s m ( nt ) for m = 1 , 2 , . . . , m may be characterized by an average voltage s . the series of these signal waveform may be expressed as an expected value function of its average e (\| s \|) representing an aggregate absolute voltage of the received signals . the function e may also signify the equivalent low pass filtering operation of the waveforms . the power of the signal may be expressed as a second order moment of the waveform . for the power , the expected value function e ( s 2 ) may be taken for the series of the square of the waveform . the variance of signal power may be expressed as a fourth order moment of the waveform . for the signal power variance , the expected value function e ( s 4 ) may be taken for the series of the fourth power of the waveform . by dividing the variance function by the power function , a moment ratio r may be expressed by the following relation : r = e  ( s  ( nt ) 4 ) e  ( s  ( nt ) 2 ) signals arranged in an m - psk constellation have a constant envelope , i . e ., identical distance or moment d of the constellation points from the signal space origin . since the waveform average s may be replaced the combined or average absolute distance \| d \|, the resulting expected value function e (\| d \|) may be treated as proportional to a constant d c . consequently , m - psk signals have the same second and fourth order moments irrespective of the number of constellation points m . this allows a psk moment ratio to be reduced to r = d c 4 / d c 2 = d c 2 . signals such as qam , pam and vsb may exhibit different second and fourth order moment characteristics for increasing numbers of constellation points . as m increases , points may disperse on the signal grid . for example , points for 8 - qam may be located at ± 1 ± j and ± 3 ± j . due to the differing distances from the origin , the points in these constellations have non - uniform second order moments , and by extension non - uniform fourth order moments . power and variance functions may vary from one point to another within a constellation . consequently , as the number of points m within a constellation expands , the e functions monotonically increase for these modulated signals . the moment ratio r may thus be treated as a unique value for each m - qam and m - pam constellation , and distinguished from the psk values of r . a comparison of expected value functions and the moment ratio for selected modulations is shown in table 1 . each constellation type includes the number of constellation points m and modulation technique . the constellation type is described by point distances from the origin , the expected value function of that distance , the function with respect to the square of the distance , the function with respect to the fourth power of the distance , and the moment ratio . calculation of the moment ratio r may distinguish between modulation by constellation types . the moment ratio may also distinguish m levels within a constellation type ( except psk ). an algorithm may include comparing the moment ratio to a threshold for distinguishing between two types of constellations . alternatively , the thresholding operation may be generalized by comparing the moment ratio to a series of threshold values to identify the constellation type and / or its level among several candidates . fig4 shows a block diagram for the algorithm to determine the constellation type according to a first specific embodiment of the present invention . the algorithm 30 receives an incoming signal 32 into an amplifier 34 . the amplified signal may be digitized in an analog - digital converter ( adc ) 36 . the digital signal may be separately input into a second order power ( or squaring ) function 38 and a fourth order power function 40 . the second and fourth order power functions 38 and 40 may be considered equivalent to a first low pass filter ( lpf ) to perform the expected value function . the squared value from the function 38 may be input to a ratio - inverter 42 ( taken to the − 1 power ). the smoothed fourth order and inverted squared values may then be input to a multiplier 44 to produce a moment ratio r in a ratio store 46 . a threshold value t may be provided in a threshold store 48 . the moment ratio r and threshold t may be input to a logical comparer 50 . if the moment ratio r is lower than the threshold t , the comparer 50 may indicate a first constellation condition 52 . by contrast , if r is higher than t , the comparer 50 may indicate a second constellation condition 54 . a concatenated series of threshold values may be compared with the moment ratio in order to distinguish between several constellation types . the procedure of determining the constellation type may be further simplified in a second embodiment of the present invention . by employing an automatic gain control , the power level ( represented by the expected value function of the square of the point distance or moment ) may be normalized to the highest power value among the expected modulation techniques . from the constellation list in table 1 , the highest power level is 170 , corresponding to 256 - qam . the point distance d for each constellation type may be multiplied by a coefficient a in order to normalize each power function e ( d 2 ) to a value of 170 . this normalizing operation may be performed by automatic gain control ( agc ). the agc system for a multi - constellation type receiver may adjust the incoming signal power and adc input range irrespective of signal modulation type . thus , the incoming signal power may be uniform regardless of the input constellation . a comparison of expected value functions and the moment ratio for selected modulations is shown in table 2 . each constellation type includes the number of constellation points m and modulation technique . the constellation type is described by coefficient a , the expected value function of the coefficient and distance product , the function with respect to the square of the product , the unction with respect to the fourth power of the product , and the moment ratio . the multiplication of power normalizing coefficient a by the distance d may produce a factored moment . the incorporation of the factored moment in the expected value function may eliminate the division of the fourth order function by the second order function , since the latter may be normalized as a constant value . a comparison to a threshold may be made either to the fourth order function , or to a moment ratio composed of the fourth order function divided by a constant power value . consequently , the complexity of the algorithm for determining the constellation type in the second specific embodiment may be reduced from the first specific embodiment . fig5 shows a block diagram for the algorithm to determine the constellation type according to the second specific embodiment of the present invention . the algorithm 60 receives an incoming signal 62 into a normalizing amplifier 64 . the amplified signal may be digitized in an adc 66 . the digital signal may be input into a fourth order power function 68 ( such as an lpf ) to produce a value 70 that may be termed a moment ratio . a threshold value t may be provided in a threshold store 72 . the moment ratio r and threshold t may be input to a logical comparer 74 . if the value 70 is lower than the threshold t , the comparer 74 will indicate a first constellation condition 76 . by contrast , if the value 70 is higher than t , the comparer 74 may indicate a second constellation condition 78 . a concatenated series of threshold values 72 may be used to compare with the value 70 in order to distinguish between several constellation types . the normalized moment ratio may be readily segregated by constellation type . the moment ratio for m - psk in table 2 is 170 . the moment ratio for m - qam in table 2 lies between 220 and 240 . the moment ratio for m - pam in table 2 lies between 270 and 310 . the moment ratio may be compared to a threshold to distinguish between two types of constellations . for example , a first threshold value of 200 ± 20 may be employed for deciding between psk and qam constellations , with values below the first threshold corresponding to psk and values above being either qam or pam . alternatively , a second threshold value of 260 ± 10 may be considered to distinguish qam and pam constellations , with values above the second threshold corresponding to pam . the thresholding operation may be generalized by comparing the moment ratio to a series of threshold values to identify the constellation type among several modulation candidates . the m number of points may be determined by further thresholding for narrower differences between threshold values . while embodiments and applications of this invention have been shown and described , it would be apparent to those skilled in the art having the benefit of this application that many more modifications than mentioned above are possible without departing from the inventive concepts herein . the invention , therefore , is not to be restricted except in the spirit of the appended claims .	7
below , the invention will be described in more detail on the basis of the figures , with only the features required for understanding the invention being depicted . the following reference signs are used in the figures : 1 : tof camera ; 2 : x - ray tube ; 2 . 1 : telescope and articulation system ; 3 : x - ray detector / flat - panel detector ; 3 . 1 : telescope and articulation system ; 4 : rail system ; 6 : housing ; 7 : c - arm ; 8 : patient couch ; 9 : computer unit ; g : wire model ; o : organ system ; p : patient ; s : skeleton / bony skeleton ; v : venous and arterial system ; prg 1 - prgn : software / programs . referring now to the figures of the drawings in detail and first , particularly to fig1 thereof , there is shown an exemplary radiography system according to the invention , by which projective x - ray recordings of patients can be generated . such a radiography system contains a patient positioning system , in this case in the form of a patient couch or table 8 , which is embodied in a manner adjustable both in terms of the height thereof and in terms of at least one horizontal direction . if the patient is born on the patient couch , it is possible to set both an x - ray tube 2 and a digital flat - panel detector 3 to have any spatial locations and any alignments with the aid of a telescope and articulation systems 2 . 1 and 3 . 1 thereof . in the present example , both telescope and articulation systems 2 . 1 and 3 . 1 are connected in a horizontally displaceable manner to a ceiling of the room by way of a rail system 4 . what should be observed in each case for an x - ray recording is that a coordinated alignment between the x - ray tube 2 and the flat - panel detector 3 is brought about in such a way that , first , in respect of the desired active recording region thereof , the detector 3 is covered by the x - ray radiation and , second , the x - ray radiation should where possible not extend beyond the recording region such that there is no unnecessary exposure of the patient to radiation . moreover , the alignment of the x - ray radiation and the recording region of the detector 3 must be set in such a way that as few perspective distortions as possible are created . this already is not a trivial problem for the operating staff , particularly in the case of x - ray tubes and detectors that are freely movable relative to one another . finally , in order to avoid unnecessary exposure to radiation , it is also necessary to set the x - ray radiation as exactly as possible onto the recording region on the patient that is required for making findings , for example for recording a specific region of the skeleton , a predetermined organ or an organ system containing a plurality of organs . to this end , the operating staff requires well - founded anatomical knowledge . however , despite intensive training , there are repeated occurrences where the undertaken settings are insufficient and hence regions that are too large are irradiated unnecessarily or it is necessary to carry out correction recordings as the first recording did not completely cover the desired region . therefore , according to the invention , use is made of a time - of - flight camera 1 and the patient p is scanned in respect of his contours using the tof camera 1 , which in this case is assembled on the x - ray tube 2 . from knowledge about the contour of the patient , it is then possible to calculate a wire model of the skeleton with typical joint locations . corresponding computer programs for generating such a wire model — registered / adapted to the contour of the patient — are well known and also made freely available by the manufacturers of the tof cameras as software development kit ( sdk ). if the wire model with its typical joint locations and distances between the joint locations is available , it is possible to register a previously established general model of anatomical structures on the established wire model such that a display of anatomical structures adapted to the proportions of the patient is made possible and the structures in turn can be projected directly onto the patient with the aid of a projector , or it is possible to superpose onto an image recording of the patient the established virtual anatomical structure on a monitor . in the present example , such an image projector should be integrated directly into the housing of the tof camera 1 . the above - described establishment of the wire model and also the adaptation of the virtual anatomical structures can take place on the computer system 9 with the aid of the programs prg 1 - prgn that are stored therein and executed during operation . instead of projecting the organic structures onto the patient , it is possible to display a superposition of the virtual structures and an optical recording of the patient on the monitor of the computer system . if the operating staff now has the anatomical structure of the patient to be examined optically in view relative to said patient , it is possible to control the alignment of x - ray tube 2 and detector 3 substantially more exactly than previously . additionally , reference is made to the fact that the way that the patient is borne shown here is merely intended to be exemplary . by way of example , the bearing aids according to the invention can also be used for instances of patient positioning in which the patient is imaged in a standing position for a recording of the lungs or in which the patient is examined in a seated position . the embodiment of an x - ray system according to the invention can also be brought about in conjunction with a c - arm system , as shown in fig2 in an exemplary manner . this c - arm system typically likewise contains an x - ray tube 2 and a digital flat - panel detector 3 , wherein , however , these two units are securely connected and aligned relative to one another by way of a swivelable and rotatable c - arm 7 . the c - arm 7 is moved by an appropriate mechanism , which is situated in the housing 6 and the control of which is carried out by the computer system 9 with the aid of appropriate programs prg 1 - prgn . in the shown embodiment , the tof camera 1 is once again fastened to the x - ray tube 2 . in order to elucidate the invention , a wire model g is also shown on the patient p , which wire model is created according to the invention with the aid of the tof camera 1 and appropriate software in the computer system 9 and which wire model is adapted to the proportions of the patient currently situated on the patient couch 8 . fig3 to 7 once again elucidate the procedure according to the invention for assisting a correct alignment of x - ray recordings in the case of a projective x - ray system . fig3 shows the contours of a patient p on a patient couch , as are recorded by a tof camera . by applying appropriate , currently freely available sdks , it is possible to create a wire model g of the patient p , as depicted in fig4 , from this contour and with optionally the movements of the patient being taken into account . such a wire model g has nodes — depicted by the plotted solid black circles — at which the wire model is movable . the distances between the wire points in this case are embodied in a manner specific to the patient , i . e . adapted or registered or scaled to the proportions visible in the contour of the patient . by means of appropriate statistical examinations of subjects with the aid of ct and / or mri recordings , it is possible to determine mean or typical anatomical structures registered to the wire model . in this case , it is particularly advantageous if , additionally , standardizations or subdivisions according to sex , height , weight , etc . are also undertaken . on the basis of the statistical material obtained thus , it is now possible to align and register the desired anatomical structure s , v or o on the basis of the wire model g . in fig5 to 7 , an adapted skeleton s , an adapted venous and arterial system v and an adapted organ system o are depicted as anatomical structures in an exemplary manner . according to the invention , the respective virtual anatomical structure s , v and o obtained thus is projected onto the patient situated on the patient couch , or it is shown on a monitor with the patient , for aligning x - ray tube and detector . as a result , the correct alignment of the recording system becomes substantially easier and it becomes permanently more precise . thus , overall , this invention shows an x - ray recording system , in which the contour of a patient is established with the aid of a tof camera and , in a manner scaled to the contour , a wire model is generated in the form of a much - simplified skeleton with the essential joint and endpoints and the connections thereof . representations of anatomical structures are then scaled to this wire model and depicted visually together with the patient . thereupon , the operating staff is able to set the desired recording region for the x - ray recording in a very precise and accurate manner , supported by the visual representation of the anatomical structure together with the patient . even though the invention was illustrated more closely and described in detail by the preferred exemplary embodiment , the invention is not restricted by the disclosed examples and other variations can be derived herefrom by a person skilled in the art , without departing from the scope of protection of the invention . the following is a summary list of reference numerals and the corresponding structure used in the above description of the invention : 1 tof camera 2 x - ray tube 2 . 1 telescope and articulation system 3 x - ray detector / flat - panel detector 3 . 1 telescope and articulation system 4 rail system 6 housing 7 c - arm 8 patient couch 9 computer unit g wire model o organ system p patient s skeleton / bony skeleton v venous and arterial system prg 1 - prgn software / programs	0
referring to the drawing , a playing board 11 is provided which may be made of any suitable material and may be foldable in two or more sections . a square central area 12 is defined by coordinate boundary lines 13 . the central area 12 is surrounded by spaced coordinately extending lines 14 , 15 defining contiguous squares 16 which are located in columns surrounding the central area 12 . randomly arranged ones , i . e . 17 , of the squares 16 are progressively numbered around the board in a clockwise direction from &# 34 ; 1 &# 34 ; to &# 34 ; 21 &# 34 ;, and each is marked by heavy lines 18 to form a cell which is open at one side as indicated at 20 . such openings 20 also extend in different randomly arranged directions . a starting row 21 of squares 16 is located at the lower left hand corner of the board and such squares are differently colored to receive similar differently colored playing pieces 22 . the squares of the starting row 21 are located in the columns of squares passing along the left hand side of the central area 12 , and the right hand end of the starting row 21 is defined by a heavy finish line 19 which extends to the central area 12 and forms the left hand wall of the highest numbered cell , i . e . &# 34 ; 21 &# 34 ;. a register device 23 is provided comprising a block of wood or similar material having a row of holes 24 formed therein equal in number to the number of cells on the board 11 . such holes are identified by indicia 25 , identifying each hole with a corresponding numbered cell . a marker in the form of a pin , pencil or the like may be inserted into any one of the holes 24 to indicate the highest numbered cell to which any player has advanced as will appear presently . fig3 illustrates a conventional die cube 26 having different numbers of spots 27 on its various sides , ranging in number from one to six . such die forms a selection device for randomly selecting the number of squares each playing piece is to be advanced . however , other well known types of random selection devices may be used wherein a value from &# 34 ; 1 &# 34 ; to &# 34 ; 6 &# 34 ; may be obtained by chance . in playing the game , the players select respective playing pieces 22 and locate them on the correspondingly colored starting squares 21 . the die 26 is then rolled to indicate the number of squares the player having the first or leftmost playing piece 22 is to advance his piece . the object of each player is to land his playing piece 22 in a cell 17 which can only be entered through its opening 20 . the piece 22 can be stepped in any direction , except diagonally , but cannot step on the same square 16 more than once during each advance . the die 26 is then rolled to indicate the number of squares the next player can advance , etc ., until one of the players scores by landing his piece exactly in a cell 17 . a marker such as a pin , pencil , etc ., is then placed in the hole 24 corresponding in number to the numbered cell , i . e . &# 34 ; 1 &# 34 ;, on which the player has landed and the player also receives a chip 28 or the like to represent his score . this procedure is repeated around the board by the players advancing to successively higher numbered cells until one of the players has accumulated a prescribed number of chips , for example 10 , which determines that he has won the game . however , when one player has scored on a particular cell 17 , no other player can score on that cell or on any lower numbered cell but must advance to another higher numbered cell in order to score . in the event that no player has accumulated the required number of chips to win the game by the time one player has scored by entering the highest numbered cell 17 , i . e . &# 34 ; 21 &# 34 ;, the game continues and as one of the players passes across the finish line 19 , he continues to again step through the originally traversed columns of squares , aiming toward the cell number &# 34 ; 1 &# 34 ; or a higher numbered cell . at this point , the marker is removed from the block 23 and is subsequently placed in the hole corresponding to that cell reached by one of the players . the playing process continues as noted hereinabove until one of the players accumulates the required number of chips 28 . many other rules may be imposed on the game . for example , a player must go around a cell 17 unless he wishes to enter it . he must also go around any square which is already occupied by the playing piece of a player . also , when a player &# 39 ; s piece is in a cell waiting for a next advance and is blocked by another player &# 39 ; s piece lying directly in front of the opening , the first player loses his turn . further , if a player &# 39 ; s piece 22 is in a cell and a second player enters his piece in the same cell , the first player must give up a chip to the second player . it will be obvious to those skilled in the art that many variations may be made in the exact construction shown without departing from the spirit of this invention .	0
fig1 shows a gas turbine power generator system 1 embodying the present invention , and this power generator system 1 comprises a gas turbine engine 2 , a fuel supply valve 3 for supplying fuel to the gas turbine engine 2 , an alternator 4 ( power generator ) driven by the gas turbine engine 2 , a battery system 5 for storing the electric power generated by the alternator 4 , a power control unit 7 for controlling the alternator 4 and battery system 5 according to the state of a user system 6 and an engine control unit 8 for controlling the mode of operation of the gas turbine engine 2 . the gas turbine engine 2 is provided with an air temperature sensor 9 for detecting the air temperature t 0 at the inlet end of the combustion chamber , an atmospheric pressure sensor 10 for detecting the atmospheric pressure p 0 , an inlet temperature sensor 11 a for detecting an inlet temperature tit of the turbine of the engine and an outlet temperature sensor 11 b for detecting the outlet temperature tet of the turbine , and the outputs of these sensors 9 to 11 are forwarded to the engine control unit 8 . the alternator 4 is provided with a rotational speed sensor 12 for detecting the rotational speed of the alternator 4 and hence the rotational speed of the gas turbine engine 2 , and the output of this rotational speed sensor 14 is also forwarded to the engine control unit 8 along with the output og of the alternator 4 . the illustrated gas turbine engine generator system 1 is also provided with a warning device 13 for providing an audible and / or visible alarm to an operator according to a command from the engine control unit 8 . the power control unit 7 is designed to control the output of the alternator 4 , and comprises a converter unit for converting the ac output of the alternator 4 into dc power and an inverter unit for converting this dc power and / or the dc power stored in the battery system 5 into commercial ac power . the engine control unit 8 comprises a microcomputer , rom , ram , peripheral circuits , input / output interfaces and various driver circuits , and is configured to control the fuel supply valve 3 and the power control unit 7 according to various control programs stored in the rom . during the operation of the gas turbine power generator system 1 , the power control unit 7 and the engine control unit 8 carry out the following control process . first of all , in step s 1 , the engine control unit 8 corrects an engine operation map by using a degradation correction coefficient which is described hereinafter . the engine operation map shown in fig4 gives an engine operation curve ( or a relationship between the rotational speed ne and the output of the engine or the output og of the alternator 4 ) which enables the engine to operate in such a manner that at least one of the internal temperatures ( turbine inlet temperature tit and turbine outlet temperature tet ) is equal to the corresponding limit temperature . as the degradation of the engine 2 progresses in time , the rotational speed ne for producing a given output rises , and the engine operation curve shifts rightward in fig4 . as shown in fig4 , the engine operation curve is determined by the turbine outlet temperature tet in a low to intermediate output region , and by the turbine inlet temperature tit in a high output region . in fig4 , the engine operation curve when the engine is new ( nominal engine operation curve ) is indicated by 0 % and that when the degradation has reached a limit ( maintenance warning ) is indicated by 100 %. the engine control unit 8 then determines , in step s 2 , a target rotational speed net of the gas turbine engine 2 according to the inlet state of the gas turbine engine 2 ( atmospheric temperature and atmospheric pressure detected by the atmospheric temperature sensor 9 and atmospheric pressure sensor 10 ) and the target output ogt by using the engine operation map which was corrected in step s 1 . the engine control unit 8 generates a rotational speed command cne which corresponds to the target rotational speed net , and forwards it to the fuel control unit in step s 3 . the engine control unit 8 further controls the supply of fuel via the fuel control valve 3 such that the rotational speed ne comes to match the rotational speed command cne , and forwards a corresponding fuel command cgf to the fuel supply valve 3 in step s 4 . thereby , the gas turbine engine 2 operates at a prescribed rotational speed net , and the alternator 4 generates electric power by an amount corresponding to the alternator target output ogt . the engine control unit 8 determines if the gas turbine engine 2 is operating under a steady state condition or not according to the changes in the turbine inlet temperature tit , turbine outlet temperature tet , rotational speed ne and alternator output ogt in step s 5 . if not , the engine control unit 8 returns to the starting point of the control process , and repeats the above described control process because the engine is in a transient state which is not suitable for estimating the degradation level of the gas turbine engine 2 . when the gas turbine engine has continued to be in a steady state operation for more than a prescribed period of time ( a few minutes , for instance ) or the determination result of step s 5 is yes , the engine control unit 8 determines a degradation level by using a degradation level determining unit in steps s 6 and s 7 . in other words , the engine control unit 8 conducts a feedback control in step s 6 so that the turbine outlet temperature tet detected by the outlet temperature sensor 11 b may be kept constant , and estimates the current advance in the degradation level δld of the gas turbine engine 2 according to a deviation of the target temperature obtained from the current rotational speed ne and alternator output og from the actual turbine outlet temperature tet . the engine control unit 8 determines the current degradation level by adding the current advance in the degradation level δld to the previous degradation level ld . the engine control unit stores the current degradation level ld in non - volatile memory such as eeprom so that the determination of the degradation level can be continued even when the gas turbine engine generator system 1 is shut down and restarted from time to time . the engine control unit 8 then determines if the current degradation level ld has reached a prescribed maintenance warning level ldmax in step s 8 , and if this determination result is yes , forwards a warning command to the warning device 13 in step s 9 . irrespective of issuing a warning or not , when the degradation level is determined , the engine control unit 8 updates the degradation correction coefficient kd corresponding to the current degradation level ld by using the correction coefficient determining unit in step s 110 . thereby , the correction of the engine operation map can be conducted at a high precision , and the efficiency of the gas turbine engine 2 can be improved . the engine control unit 8 stores the current degradation correction coefficient cd in non - volatile memory such as eeprom so that the engine operation map may be properly corrected even when the gas turbine engine generator system 1 is shut down and restarted from time to time . in the foregoing embodiment , only the turbine outlet temperature tet was monitored if it has reached a limit temperature or not because the engine operation map is substantially dictated by the turbine outlet temperature tet . however , it is also possible and more preferable to monitor the turbine inlet temperature tit as well , and define the engine operation map such that both the turbine outlet temperature tet and the turbine inlet temperature tit remain below the corresponding limit values . fig5 is a diagram showing how one of the turbine inlet temperature tit and turbine outlet temperature tet may be selected over the other when determining the engine operation map . a first target rotational speed is looked up from the engine operation map based on the limit temperature of the turbine outlet temperature tet , and a second first target rotational speed is looked up from the engine operation map based on the limit temperature of the turbine inlet temperature tit . of the first and second target rotational speeds , the higher one is selected and incorporated into the rotational speed command cne . thereby , both the turbine inlet temperature tit and turbine outlet temperature tet are kept within the limit temperatures , and the engine operation curve can be selected in an optimum fashion at all times . although the present invention has been described in terms of preferred embodiments thereof , it is obvious to a person skilled in the art that various alterations and modifications are possible without departing from the scope of the present invention which is set forth in the appended claims . for instance , although the gas turbine engine was used to power an electric generator in the foregoing embodiment , the present invention can also be applied to gas turbine engines for other purposes as well . the contents of the original japanese patent application on which the paris convention priority claim is made for the present application are incorporated in this application by reference .	5
fig1 illustrates the logical blocks of the implementation of the method of the prior art . this method is for controlling job execution in a target external system ( 120 ), such as a sap system , where these jobs have been scheduled from another external source system ( 110 ). the method may be implemented as a control program ( 100 ) such as a computer program or other data processing system that interfaces with the target system through a standard external system programming interfaces ( 130 ) such as xbp 2 . 0 with sap . a person skilled in the art can adapt this solution to the use by the control program of different user interfaces according to the ability of the target external system . these interfaces may be remote ( programming interfaces , web user interface ) or local ( command lines , graphical user interface ). this is why the control program may be executed on a remote server or on the same server than the external source or target systems . as explained in more detail in relation with fig2 , the control program suspends and releases jobs waiting for execution in the target system . through the interface , the control program collects the following information : query list of jobs running on target external system ; query list of jobs which can be suspended or released in the target external system ; read the number of batch processes in the target external system ; read total number of running jobs on the target system ; read any required resource on target system that is needed to run a job ; release / resume an enqueued job in the target system ; and track the status of running jobs ( running , complete ) on the target executing system . fig2 illustrates the control program logical blocks and system environment according to the method of the prior art . in this method , the control program ( 100 ) takes control of jobs ( job 1 , job 2 . . . job 8 ) which have been concurrently scheduled by the source system ( 110 ) for execution in the target system . the control program takes control of the jobs once they have been queued in the waiting queue ( 140 ) of the target system before execution . a single job scheduled can create spawned jobs in the target system . for example , job 1 and job 4 have generated respectively 2 jobs and 3 jobs for execution in the target system . using the api of the target system , the control program intercepts the job in the waiting queue , suspends the job and enqueues it in a local queue ( 150 ). to intercept jobs in sap , for example , the sap xbp2 . 0 api is used . according to customizable policies , spawned jobs can be suspended until an external program such as the control program resumes it . the control program uses different policies to resume suspended jobs such as : resume as many jobs as the total number of batch processes in the sap system ; and resume as many jobs as the number of free batch processes in the sap system ; these policies can be associated to criteria needed to prioritize suspended jobs : jobs with higher priority must be resumed first ; and jobs spawned by the same parent job must be resumed first . it is possible to extend and customize these policies to adapt the control program to the needs of the workload systems . fig3 illustrates the control program logical blocks and system environment according to the method of the preferred embodiment . in order to optimize the resources available in the target system , the algorithm of prior art can adapt the number of jobs to be released in the target system to the number of free batch processes in the target system . for example , the control program can release as many jobs as the number of free batch processes in the target system . however , in the preferred embodiment a solution is provided which goes over the best choice of policy to release jobs in the target system . the method is to add a control on the source system . using the interface capabilities of the source system , it is possible to add a second level throttling mechanism in order take the best advantage of the resources in the target system to execute jobs . a new component is added in the control program for making a computation of the maximum of jobs to be concurrently scheduled from the source system to take the best advantage of the resources available in the target system . in the example of fig3 , a maximum of 4 jobs can be scheduled by the source system . this limit is computed by the control program and imposed through the available api of the source system . the control of the maximum of jobs concurrently scheduled by the source system is done using available interfaces of the source system . in the preferred embodiment an application programming interface ( 300 ) is used . this limit adaptation ( decrease or increase ) can thus be done by a program automatically at given points in the general algorithm describing the control program as illustrated in the flowchart of fig4 . as with the interface of the target system , any other interface available in the source system and supported by the operating system of the server on which the control program is running can be used . as detailed in reference to fig5 , the computation of the limit of number of jobs to be scheduled depends on the resource available in the target system to executed batch jobs at a given t time and on the value of parameters . the parameter values can be read by the control program from a configuration file ( 310 ) if they are user defined or can be automatically evaluated by a statistical analysis system , which monitors job execution throughput and adjusts the configuration to get the best performance . it is noted that the computed limit at a given t time is based on the number of resources available for batch job execution at this given time . for example , the number free batch processes b ( t ) in sap target systems at this given time as explained in more detail in reference to fig5 . fig4 is the general flowchart of the method of the preferred embodiment . in the initialization step ( 400 ) of fig4 , the program controlling both the jobs to be executed in the target executing system and the jobs scheduled from the source scheduling system is started . the controlling program communicates with the external systems using the available interfaces so that the program is dependent on the type of external systems it communicates with . the person skilled in the art can imagine extending the capability of the program to many types of external systems and even to more than one interface when they are available on a same target system . for simplification of the description , the detailed description of the preferred embodiment is focusing on one originating source external system which schedules job into one target execution external system . a first part of the flowchart ( 410 , 415 , 425 , 430 , 435 , 440 ), corresponds to the control existing in prior art on jobs scheduled in the target system performed by an external control program . with this first control , jobs scheduled in the target system are enqueued in a queue local to the control program and released when the program determines that the resources in the target system are available . three new steps ( 420 , 445 , 450 ) of the preferred embodiment are added . they bring a second control by the control program which applies to the jobs scheduled by the source scheduling system . periodically , with a time period , the program checks ( 410 ) if new jobs have been submitted in the target system . this is done by reading the queue of submitted jobs in the target system . for example , while using the sap xbp2 . 0 api , the interface macros bapi_xbp_job_select and bapi_xbp_confirm_job are used to look into the sap job queue and find new submitted jobs . by getting sap job details , it is possible to find out whether the job has been spawned by one other job or not . new jobs ( answer yes to test 410 ) are candidate to be controlled by the program if they can be suspended ( 415 ). in sap , this checking is done using the macro bapi_xbp_get_intercepted_jobs . however , some jobs cannot be suspended . those jobs are submitted from external schedulers or those jobs not are matching the interception criteria stated in sap table tbcicpt1 . if jobs in the scheduling queue of the target system can be suspended ( answer yes to test 415 ), the program dequeues the jobs from the scheduling queue of the target external system and enqueues them in a queue local to the control program . if no job can be suspended among the new jobs scheduled in the target external system ( answer no to test 415 ), then the program cannot delay the scheduling for execution of this job , but performs a second level of control at the level of the source scheduling system . the control program changes in the target system the system parameter limiting ( 420 ) the number of jobs scheduled in the target system . this step comprises a computation of the best limit to put in place according to the number of jobs currently executing and the resources available in the target system ( number of ‘ free processes ’ in the example of sap ). the computation is described in fig5 . the program tests if the local queue has jobs to release ( 430 ). this step is also performed if there is no new jobs ( answer no to test 410 ) which have been submitted in the target system . if there are jobs to be released from the local queue of the control program ( answer yes to test 430 ), the program checks if there are resources available in the target system ( 435 ). this is done , for example , by using customizable policies such as provided with the sap xbp2 . 0 api . spawned jobs can be suspended until an external program ( like the control program described here ) resumes them . as described in relation with description of fig2 , different policies to resume suspended jobs can be used . if there is enough resource ( answer yes to test 435 ) then the jobs are released ( 440 ) or otherwise transmitted from the local queue and re - included in the waiting queue of the target system . in sap , this is possible using the macro bapi_xbp_job_start_asap . when there are no more jobs to control in the target external system ( 445 ) ( end of step 440 , answer no to test 435 and answer no to test 430 ) the program changes , in the target system , the system parameter adapting ( 450 ) the number of jobs to be scheduled in the target system . as in step 420 , this step comprises a computation of the best limit representing the maximum of jobs to be submitted by the source system in the target system . this computation is done knowing the resources available for batch job execution in the target system . in sap , the maximum number of concurrent jobs is equal to the number of “ sap background processes ”. in this second execution of computation of limit in the flowchart of the method of the preferred embodiment , as there are resources available , the limit will be increased compared to the result of step 220 which reduces the limit . the computation is described in detail in relation with fig5 . if the program is not stopped ( answer yes to test 455 ) the process goes on by checking ( 410 ) if new jobs have been scheduled by the originating external system in the target system . if not ( answer no to test 455 ) the program ends . in sap only jobs that have been internally submitted or any spawned jobs can be intercepted by an external control program . externally submitted jobs cannot be intercepted . so , when sap is the target system , the control program intercepts internally submitted jobs and spawned jobs and enqueues them in the local queue . but this is not the general case and the solution of the preferred embodiment considers the case where any job waiting for execution in the target system can be intercepted and enqueued in the local queue of the control program . fig5 is a detailed flowchart of the method of the preferred embodiment . the steps of this detailed flowchart are executed when the number of jobs to be scheduled in the target system is set to a certain limit . these steps are executed when a new job to be executed in the target system cannot be suspended by the control system ( 420 ) and the limit must be decreased to avoid overloading of the target system . these steps are also executed when a job is released by the control program for execution in the target system ( 450 ) and the limit must be increased to have a better use in the target system of all available resources to execute jobs . the first step ( 500 ) is performed by the control program to check how many free batch processes b ( t ) are available in the target system at this t time . then , the control program reads ( 515 ) in a configuration file ( 310 ) parameters for preparing computation ( 520 ) of a formula to provide or otherwise transmit ( 525 ) the maximum number of jobs to be scheduled , prior to returning ( 530 ) processing to steps 420 or 455 , knowing the value of these parameters at this t time and the number of free batch processes b ( t ) which are available in the target system . the number of concurrent jobs that can be submitted into the sap system at time t is given by limit ( t ) α is a positive or negative constant representing the minimum limit level ( if positive ) or a fixed negative bias ( if negative ), β is the multiplying factor that translates the number of concurrent sap jobs into concurrent external jobs , γ is a positive or negative constant representing a reserved number of batch processes that must be left always free ( if negative ) or an additional bias to overload batch ( if positive ), and b ( t ) is the number of sap free batch process available at time t , and f ( x ) is a function such as : given configuration parameters α , β , γ and using the simple moving average of length ν , the computed limit value at time t will be : parameters α , β , γ and ν can be defined in a configuration setting or , optionally , they can evaluated by collecting statistical data on job execution . if there are many jobs starting and finishing very quickly , then a slow update of the limit could be better to follow the actual average of the running jobs by ignoring unuseful fluctuations . on the opposite , if there are few slow jobs , then it could be better to change the limit with the same rate as the background processes . regardless the adopted tuning parameters , the solution of the preferred embodiment is able to synchronize the scheduling among source and target systems and is also able to avoid that the target system could get overloaded . if the configuration parameter values are the best ones , then the solution is used at its best capability . for α = 0 , β = 1 , γ = 0 , ν = 1 , the limit will be equal to the number of free batch processes : for α = 0 , β = 2 , γ = 0 , ν = 1 , the limit will be twice to the number of free batch processes : for α = 1 , β = 1 , γ = 0 , ν = 1 , the limit will be equal to the number of free batch processes plus one so , even if the number of free batch process is zero , the limit is for α = 0 , β = 1 , γ =− 1 , ν = 1 , a batch process is always left free and the limit will be equal to the number of free batch processes less one : even if the solution of the preferred embodiment has been described has been described when one source system schedules batch jobs for execution in one target system , the person skilled in the art can easily adapt the control program to control in the same way one source system scheduling batch jobs for execution in more than one target system . for example , one adaptation could be managing one local queue per each couple ( source system , target system ). the preferred embodiment implements a double level of synchronization because the external system is updated for any change in the target execution system and will not submit an overloading number jobs , and the target execution system will have an execution queue that does not exceed the maximum number of executable jobs . the preferred embodiment allows optimizing resource utilization and throughput of job execution in external systems such as application container systems . the preferred embodiment is based on a double level mechanism that allows a fine grained optimization by manual customization or automatic adaptive tuning . the double level job throttling mechanism of the preferred embodiment includes a first level to control children jobs spawned by other running jobs and a second level . the preferred embodiment is “ resource ” based . it measures the number of background processes available at a given time instant . the principle is one independent entity polling schedulers of the external systems without staying in between mediating data . this entity acts tuning the two schedulers &# 39 ; behaviors by limiting job scheduling on the target execution system and controlling release of jobs sent for execution on the target execution system . the preferred embodiment provides the following advantages . first , it does not require changes in the two schedulers only the standard apis provided by the external systems are used . second , it does not require any change of the connection between the originating external system and the target execution system . third , it is stateless as it does not need historical data or statistics , but it can benefit from statistics data for an automatic tuning . the preferred embodiment starts from an existing control program which can define an interception rule that can suspend batch jobs scheduled by a source system before their actual execution in a target system at fixed time intervals . the preferred embodiment retrieves the list of suspended jobs and , accordingly to user - defined policies , resumes them . the preferred embodiment is enhanced by adding a second level throttling system to optimize use of resources for batch execution in the target system . at a fixed time interval , the preferred embodiment checks the number of free batch processes in the target system . this value is used to calculate the maximum number (“ limit ”) of jobs that can be concurrently submitted into the target system . since batch jobs can spawn children jobs during their execution , the combination of the above three actions ( to limit concurrent job submission , to define suspension rules , to resume suspended jobs ) can be tuned to optimize job execution throughput . all the configuration parameters used in this preferred embodiment can be manually defined or can be automatically evaluated by a statistical analysis system , which monitors job execution throughput and adjusts the configuration to get the best performance .	6
fig3 is a block diagram of the fsk demodulator of the invention . where the parts function in a similar manner to those of fig1 the same numerals are used . the mark filter 11 and space filter 12 are conventional except that each has an extra output . in this case there are quadruature - related sine and cosine outputs for each filter . each of the four filter outputs is full wave rectified in rectifiers 19 - 22 . the sine and cosine rectified outputs from filter 11 are combined in summer 23 which drives low pass filter 15 . similarly , the outputs of sine rectifier 21 and cosine rectifier 22 are combined in summer 24 which drives low pass filter 16 . fig4 is a graph showing the outputs of summers 23 and 24 . the signal has been normalized at unity by dividing it by 1 . 414 . comparison of the waveforms of fig2 and 4 indicates that in the prior art circuit the first harmonic which must be removed is one octave above the fundamental frequency of the carrier . in the circuit of the invention the first harmonic which must be removed is two octaves above the fundamental . this doubling of frequency of this noise component results in more attenuation of this noise component than would be achieved with the prior art circuit . this reduction complements the previously mentioned harmonic signal reduction of the invention . the following description shows a cmos form of circuit construction of the invention . since the various elements are well known in the art their details will not be enlarged upon . it is to be understood that other forms of ic construction could be employed . fig5 is a filter circuit for performing the mark filter 11 and space filter 12 functions . input terminals 25 and 26 represent the noninverting and inverting filter inputs respectively . the filter is designed using a well known &# 34 ; biquadratic &# 34 ; topology . output terminal 27 provides a sine output while output terminal 28 provides a cosine output . the switched filter circuit uses input transmission gate switches 29 and 30 which are alternately clocked by θ1 and θ2 respectively to drive a capacitor t network 31 . op amp 32 is converted to an integrator by capacitor 33 and in conjunction with clocked transmission gates 34 - 37 develops a sine output at terminal 27 . capacitor t 38 has its input coupled to the output of capacitor t 31 and drives node 39 which is the junction of transmission gates 36 and 37 . capacitors 41 and 42 respectively couple the outputs of capacitor t 31 and capacitor t 38 to nodes 40 and 41 . op amp 43 is converted to an integrator by capacitor 44 . transmission gates 45 - 48 operate with op amp 43 to produce a cosine wave signal output at terminal 28 . fig6 is a graph showing the waveforms of θ1 and θ2 as employed in the circuit of fig5 . the pulses are made non - overlapping by the t 1 time increment . the clock pulses have a period of t 2 . θ1 and θ2 alternatively switch the n channel transistors on while θ1 and θ2 alternately switch the p channel transistors on . the pulse period t 2 is made small with respect to the period of the fsk or data signals . fig7 is a schematic diagram of a rectifier circuit suitable for performing the function of blocks 19 - 33 of fig3 . input terminal 50 receives a signal from one of the mark or space filters ( 11 or 12 ). comparator 51 senses whether the input is above or below ground . switches 52 and 53 will be in the positions shown ( up ) when the input voltage is above ground . when the input goes below ground , comparator 51 will drive switches 52 and 53 to their lower positions . transmission gates 54 and 55 are operated sequentially by θ1 and θ2 and their drive sense is controlled by the polarity of the input signal . capacitor 56 couples the node between transmission gates 54 and 55 to the node between transmission gates 57 and 58 which are operated sequentially by θ1 and θ2 . thus , for positive input cycles , transmission gats 54 and 57 ( and also 55 and 58 ) are operated in synchronism . however , for negative input half cycles the operating phases of transmission gates 54 and 55 is reversed so the negative half cycle inputs appear at terminal 59 inverted . thus , the output at terminal 59 is the full wave rectified input signal from the related mark or space filter output . two of the fig7 circuits will have their output terminals coupled to input terminal 60 of fig8 which therefore acts as a summer . the circuit shown further includes a low pass filter of the well known &# 34 ; sallen key &# 34 ; topology . transmission gates 61 and 62 are operated conventionally by the θ1 and θ2 clock signals and their common node is coupled via capacitor 65 to the common node of transmission gates 63 and 64 . output capacitor 69 is made relatively large so that its charge can only vary slowly . in effect , a relatively large number of incremental charges from capacitor 65 will be needed to vary the charge on capacitor 69 . capacitor 66 provides positive feedback coupling isolated by unity gain buffer 67 . the summed and filtered inputs appear at output terminal 68 . the outputs of the two low pass filters are coupled to a conventional comparator ( 17 of fig3 ). this comparator will produce a digital output , logic one or zero , depending upon which of the mark or space signals dominates . the circuit of fig3 was constructed using the schematic diagrams of fig5 and 8 . conventional cmos ic construction was employed . the following capacitors in 1 / 2 pf values were employed . ______________________________________capacitor mark filter 11 space filter 12______________________________________31a 1 131b 1 131c 4 . 3 4 . 938a 1 138b 1 138c 2 . 2 2 . 641 2 242 2 233 17 . 6 1644 17 . 6 16______________________________________capacitor rectifier and low pass filter______________________________________56 0 . 565 0 . 566 5559 12 . 5______________________________________ four rectifier circuits of the fig7 variety were employed , two each for mark filter 11 and space filter 12 . two fig8 summer and low pass filter circuits were used to combine and filter the rectified signals . the rectifier and low pass filter circuits were operated at a clock frequency that was 1 / 4 of the clock frequency of the filters . the clock frequencies were 28 khz and 112 khz respectively which provides a low pass filter corner frequency of 240 hz . the low pass filter outputs were coupled to a comparator , the output of which indicated whether a mark or space signal was present . the circuit performed in accordance with the above - mentioned &# 34 ; bell 103 &# 34 ; standard . it was useful in detecting a 300 baud data signal and had a 14 db greater signal to noise ratio compared with the prior art circuit . the total area of capacitors 66 and 69 ( two of each ) which dominate the topology , was about 675 mils 2 ( 0 . 435 mm 2 ). using the approach of the prior art , the equivalent chip area would have been about 1000 mils 2 ( 0 . 645 mm 2 ). the invention has been described and a working example given . when a person skilled in the art reads the foregoing description , alternatives and equivalents , within the spirit and intent of the invention , will be apparent . accordingly , it is intended that the scope of the invention be limited only by the claims that follow .	7
referring to fig1 showing an automatic chopper blade operating timing regulator in a preferred embodiment according to the present invention in combination with a portion of a chopper - type folding device pertinent to the present invention , a driven gear 51 interlocked with a chopper blade 41 is in engagement with one of the helical gears 52a and 52b , i . e ., the helical gear 52a in fig1 of a double helical gear 52 supported for rotation and axial movement . a driving gear 53 is in engagement with the other helical gear 52b of the double helical gear 52 . the chopper blade 41 is operated by the driving gear 53 through the double helical gear 52 and the driven gear 51 . the double helical gear 52 is moved axially to change the phase of the driven gear 51 relative to the driving gear 53 to change the timing of operation of the chopper blade 41 . a threaded portion 54 formed in the shaft of the double helical gear 52 is in engagement with an internally threaded member 55 journaled on a frame 56 so that the internally threaded member 55 is unable to move axially . a gear 55a is formed integrally with the internally threaded member 55 . the gear 55a is in engagement with a pinion 58 mounted on the output shaft of a stepping motor 57 . the stepping motor 57 rotates the internally threaded member 55 through the pinion 58 and the gear 55a to move the double helical gear 52 axially by the screw jack action of the internally threaded member 55 and the threaded portion 54 of the shaft of the double helical gear 52 . a slit disk 57a is mounted on the output shaft of the stepping motor 57 , and a pulse generator 59 is associated with the slit disk 57a to detect the phase of the slit disk 57a . a timing regulating mechanism comprises , as principal components , the driven gear 51 , the double helical gear 52 having the threaded portion 54 , the internally threaded member 55 integrally provided with the gear 55a , the pinion 58 and the stepping motor 57 . a piezoelectric acceleration sensor 60 , i . e ., impulsive force detecting means , is provided on a locating plate 34 to detect an impulsive force applied by a signature to the locating plate 34 . detection signals provided by the acceleration sensor 60 are applied to a charge amplifier 61 , the charge amplifier 61 provides an acceleration signal stream . a signal processing unit 62 receives the acceleration signal stream , averages the acceleration signal stream to obtain an average acceleration signal and gives the average acceleration signal to a comparator 63 . a desired acceleration setting unit 64 , i . e ., desired impulsive force setting means , for setting an optimum acceleration according to the condition of the signature gives a signal to the comparator 63 . the desired acceleration setting unit 64 is provided with a set acceleration calculating circuit 67 which sets a desired acceleration on the basis of data given thereto from an impulsive force setting device 65 and a signature mass calculating circuit 66 for calculating the mass of a signature , and gives a signal representing the desired acceleration to the comparator 63 . the impulsive force setting device 65 gives a signal representing an optimum impulsive force f to the set acceleration calculating circuit 67 . a sheet width w ( mm ), a basis weight s ( g / mm 2 ) and a web number n , i . e ., the number of webs to be used , are given to the signature mass calculating circuit 66 respectively from a sheet width setting device 68 , a signature mass setting device 68 and a web number setting device 70 . then , the sheet weight calculating circuit 66 calculates the mass m of the signature by operating those data given thereto by using : the set acceleration calculating circuit 67 receives the mass m of the signature and the desired impulsive force f , and gives a desired acceleration a ( a = f / m ) to the comparator 63 . the comparator 63 compares the acceleration signal received from the signal processing unit 62 and the desired acceleration a received from the set acceleration calculating circuit 67 , and gives a signal representing the deviation of the acceleration signal from the desired acceleration a through an amplifier 71 to a control unit 72 . then , the control unit 72 gives a driving signal through a pulse oscillator 73 and a driver 74 to the stepping motor 57 . the pulse oscillator 73 provides a clockwise driving pulse signal cw for driving the stepping motor 57 for rotation in a clockwise direction or a counterclockwise driving pulse signal ccw for driving the stepping motor 57 for rotation in a counterclockwise direction . when the deviation determined by the comparator 63 is a positive value , namely , when the actual acceleration of the signature is lower than a reference acceleration , the stepping motor 57 is driven so as to delay the timing of operation of the chopper blade 41 . when the deviation is a negative value , namely , when the actual acceleration of the signature is higher than the reference acceleration , the stepping motor 57 is driven so as to advance the timing of operation of the chopper blade 41 . the location of the double helical gear 52 at a zero - position is detected by a zero - position switch 75 , an upper limit switch 76 gives a signal to the control unit 72 at the upper limit of travel of the double helical gear 52 , and a lower limit switch 77 gives a signal to the control unit 72 at the lower limit of travel of the double helical gear 52 . the signal generated by the pulse generator 59 is applied also to the control unit 72 . a chopper blade operating timing regulating method to be carried out by the automatic chopper blade operating timing regulator will be described hereinafter . the chopper blade 41 is driven through the double helical gear 52 and the driven gear 51 by the driving gear 53 . the acceleration sensor 60 detects an impulsive force ( acceleration ) applied by a signature to the locating plate 34 . an acceleration signal representing the impulsive force , provided by the acceleration sensor 60 is transferred through the charge amplifier 61 and the signal processing unit 62 to the comparator 63 . the desired acceleration setting device 64 sets the desired acceleration a on the basis of data provided by the impulsive force setting device 65 and the signature mass calculating circuit 66 . the comparator 63 compares the acceleration signal and the desired acceleration a , and then the comparator 63 gives a deviation signal representing the deviation of the acceleration signal from the desired acceleration a through the amplifier 71 to the control unit 72 . the control unit 72 gives a drive command signal corresponding to the deviation to the driver 74 , and then driver 74 applies a drive signal to the stepping motor 57 to drive the stepping motor 57 . then , the stepping motor 57 rotates the internally threaded member 55 through the driving gear 58 and the gear 55a to shift the double helical gear 52 axially according to the drive command signal so that the phase of the driven gear 51 relative to the driving gear 53 is changed accordingly to change the operating timing of the chopper blade 41 is changed accordingly . if the deviation determined by the comparator 63 is a positive value , namely , when the actual acceleration of the signature is lower than the reference acceleration , the operating timing of the chopper blade 41 must be delayed to reduce the deviation to zero . therefore , a drive command signal to delay the operating timing of the chopper blade 41 is given to the driver 74 so that the stepping motor 57 rotates the driven gear 51 in a direction for delaying the operating timing of the chopper blade 41 . if the deviation determined by the comparator 63 is a negative value , namely , when the actual acceleration of the signature is higher than the reference acceleration , the operating timing of the chopper blade 41 must be advanced to reduce the deviation to zero . therefore , a drive command signal to advance the operating timing of the chopper blade 41 is give to the driver 74 so that the stepping motor 57 rotates the driven gear 51 in a direction for advancing the operating timing of the chopper blade 41 . thus , the operating timing of the chopper blade 41 is regulated automatically so that the acceleration of the signature at the impact of the same on the locating plate 34 is constant regardless of the signature conveying speed corresponding to the printing speed . the automatic chopper blade operating timing regulator is capable of automatically regulating the chopper blade operating timing so that the impact of the signature on the locating plate 34 is constant regardless of the printing speed and , consequently , the signature can satisfactorily be folded by the chopper blade 41 in an accurate quarto sheet in an accurate squareness . since the operator is required only to enter data of the signature , the quality of the folded sheet is not dependent on the degree of skill of the operator . although the invention has been described in its preferred form with a certain degree of particularity , obviously many changes and variations are possible therein . it is therefore to be understood that the present invention may be practiced otherwise than as specifically described herein without departing from the scope and spirit thereof .	1
while the specification concludes with claims which particularly point out and distinctly claim the invention , it is believed the present invention will be better understood from the following description . all weights , measurements and concentrations herein are measured at 25 ° c . on the composition in its entirety , unless otherwise specified . unless otherwise indicated , all percentages of compositions referred to herein are weight percentages of the total composition ( i . e . the sum of all components present ) and all ratios are weight ratios . unless otherwise indicated , the content of all literature sources referred to within this text are incorporated herein in full by reference . except where specific examples of actual measured values are presented , numerical values referred to herein should be considered to be qualified by the word “ about ”. as has been discussed , a limitation of traditional aerosol spray head configurations is that they may produce an uneven distribution of product on the target site . in addition , the viscosity of the product to be sprayed may be practically constrained to remain below a certain level . by introducing instability into the fluid flow at an early stage it is possible to atomize products with greater viscosities and , at the same time , improve the product distribution on the target site . the replacement of a single spray outlet by multiple outlets may assist in introducing that instability , because , for a given volume flow of product , the size of the shear interface ( i . e . the total outlet perimeter size ) is greater for multiple outlets than for a single outlet . without wishing to be bound by theory , it is believed that this measure may prevent the formation of a smooth film structure just outside the outlet where the product commences its trajectory to the target site . the disadvantage of a smooth film structure is that it may propagate a relatively coarse atomization in the final stage before the product reaches the target site , with the drops at the center of the spray being larger than those near the periphery . it is in the final stage of the spray formation where an instability in the system may help disintegrate the product into ligaments and then further into drops to form a highly atomised spray and an improved drop distribution . in addition , in a multi - outlet system , it is observed that , following the split in the flow to channel fluid to the separate orifices , changes to the separate flows may occur such that there may be differences , for example , in viscosity or other parameters , between what is sprayed from one outlet and what is sprayed from the other or others . if there are differences between the individual sprays immediately after they leave their respective spray outlets , then that may translate into differences in product distribution at the target site . without wishing to be bound by theory , it is believed that these changes may be brought about by manufacturing limitations . in other words , it is very difficult to ensure that the ducts along which the separate flows travel are identical . to counter this , it has been found to be beneficial to locate the point at which the flow splits to travel to the two or more separate spray outlets close to the spray outlets such that most of the flow within the spray head occurs prior to the split . to be more specific and as set out above , it has been found that it is beneficial to design the spray head ( 1 ) such that the ratio , l 1 / l 2 , for each spray outlet ( 3 ), of the distance ( l 1 ) between the conduit outlet means and the spray outlet ( 3 ) to the distance between the inlet means ( 5 ) and the spray outlet ( 3 ) is from 0 . 01 to 0 . 6 , preferably from 0 . 015 to 0 . 4 and more preferably from 0 . 02 to 0 . 4 . in the event that the conduit and / or ducts leading to the spray outlets have a non - constant cross - sectional area such that either or both of l 1 and l 2 may vary depending on the line of measurement , then the measurements must be made along the centre line connecting the centres of the inlet means ( 5 ), the conduit outlet means and the respective spray outlet ( 3 ). in one preferred embodiment , at least one of the spray outlets has a ratio l 1 / l 2 which is different from the other or others . in another preferred embodiment , all the spray outlets have the same ratio l 1 / l 2 . advantageously , at least one of the spray outlets and preferably all of the spray outlets are non - circular . employing non - circular spray outlets may additionally assist in introducing early instability into the flow , thereby improving distribution at the target site . as used herein , the term “ circle ” means a closed plane curve every point of which is equidistant from a fixed point within the curve and the word “ circular ” shall be interpreted accordingly . with reference to fig3 , the spray outlets ( 3 ) may have any non - circular shape , but advantageously have a cross - sectional shape selected from the group consisting of polygonal , semi - circular , crescent , stellate and mixtures thereof . if polygonal , then each polygonal cross - sectional shape may advantageously be selected from the group consisting of polygons having from three to ten sides . preferably , the polygons are selected from the group consisting of triangular , rectangular , pentagonal , hexagonal and mixtures thereof . the spray head ( 1 ) according to the invention may have any number of spray outlets ( 3 ) above two , but preferably has from 2 to 36 and more preferably from 3 to 12 spray outlets ( 3 ). according to a second aspect of the invention , an aerosol spray unit ( 10 ) is provided comprising a pressurised product to be dispensed and having a spray head ( 1 ) according to the first aspect of the invention . as used herein , the term “ spray unit ” means a pressurised aerosol canister , comprising a valve , the valve stem of which extends from the canister , typically at the top . such canisters typically have a volume up to 1000 ml , though more typically below 200 ml and are typically pressurised at 103 kpa to 552 kpa ( 15 to 80 psi ), more typically less than 414 kpa ( 60 psi ). as used herein , the term “ product ” means all components of the composition or mixture contained within the spray unit , including all active agents , all carrier materials and all propellant . preferably , the product to be dispensed is a cosmetic product , more preferably it is selected from the group consisting of antiperspirants , deodorants and mixtures thereof . if the product to be dispensed is an antiperspirant , then it may comprise antiperspirant active particulates and a carrier such that the antiperspirant active particulates are not soluble in the carrier . alternatively , the antiperspirant active may be solubilised in the carrier . according to a third aspect of the invention , a portable aerosol spray unit ( 10 ) is provided comprising a pressurised product to be dispensed and a spray head ( 1 ) according to the first aspect of the invention . as used herein , the term “ portable ” used in relation to an aerosol spray unit means that it may readily be transported in one hand by a single adult person of ordinary strength . according to a fourth aspect of the invention , a process for spraying a pressurised product is provided comprising the steps of spraying said product through a spray head having at least two separate spray outlets ( 3 ), wherein at least one of the spray outlets ( 3 ) has a non - circular cross - section , such that the product has a reynolds number of at least 3000 as it leaves said spray outlets ( 3 ). all documents cited in the detailed description of the invention are , in relevant part , incorporated herein by reference ; the citation of any document is not to be construed as an admission that it is prior art with respect to the present invention . to the extent that any meaning or definition of a term in this written document conflicts with any meaning or definition of the term in a document incorporated by reference , the meaning or definition assigned to the term in this written document shall govern . while particular embodiments of the present invention have been illustrated and described , it would be obvious to those skilled in the art that various other changes and modifications can be made without departing from the spirit and scope of the invention . it is therefore intended to cover in the appended claims all such changes and modifications that are within the scope of this invention .	2
with reference to fig1 one embodiment of the pre - cast concrete traffic barrier element 10 according to the present invention includes an elongated block of pre - cast concrete having a top surface 12 , a bottom surface 14 and two sides 16 and 18 . one side 18 preferably has a cross - sectional new jersey profile for deflecting or redirecting a moving vehicle back towards the traffic surface 90 . the new jersey profile includes an upper inclined surface 20 extending from the top surface 12 and sloping downwardly at a first acute angle with respect to a vertical plane . an intermediate inclined surface 22 extends from the upper inclined surface 20 and slopes downwardly at a second acute angle which is greater than the first angle . a lower inclined surface 24 extends between the intermediate inclined surface 22 and the bottom surface 14 . the lower inclined surface 24 slopes downwardly at a third acute angle which is less than the second angle and more than the first angle . this profile is well reported in the literature . a relatively unprofiled side 16 , opposite from the profiled side 18 , provides an ornamental aspect to the traffic barrier . the relatively unprofiled side has an upper vertical surface 26 extending from the top surface 20 and sloping downward at a vertical angle . an intermediate inclined surface 28 extends from the upper vertical surface 26 and slopes downwardly at an acute angle with respect to a vertical plane . an intermediate vertical surface 30 extends from the intermediate inclined surface 28 to a horizontal surface 32 . the horizontal surface 32 extends from the intermediate vertical surface 30 to the lower vertical surface 34 . a lower vertical surface 34 extends from the horizontal surface 32 to the chamfer surface 35 . the chamfer surface 35 extends between the lower vertical surface 34 and the bottom surface 14 . the bottom surface 14 of the pre - cast traffic barrier has a longitudinally extending channel 36 therein . the channel 36 has a significant depth d of approximately 15 inches but can vary from 4 inches to 48 inches depending on the specific requirements . preferably , the channel 36 has a trapezoidal configuration with an internal face 46 which is parallel to the bottom surface 14 . two sidewalls 42 , 44 of the channel 36 extend from the internal face 46 to the bottom surface 14 . preferably , the outer sidewall 42 diverges downwardly in a direction away from the profiled side 18 and the inner sidewall 44 diverges downwardly in an opposite direction away from the unprofiled side 16 . as shown , the channel 36 is broader at the bottom for easy engagement . the channel 36 divides the lower section of the concrete pre - cast traffic barrier into two lips 38 and 40 . the outer lip 38 is defined by the concrete between the lower vertical surface 34 of the unprofiled side 16 and the outer sidewall 42 of the channel 36 . the inner lip 40 is defined by the concrete between the lower inclined surface 24 of the profiled side 18 and the inner sidewall 44 of the channel 36 . the two lips flank the channel 36 for the full length of the barrier . embedded throughout the pre - cast traffic barrier 10 is reinforcing welded wire fabric 52 to resist directly applied stresses to the pre - cast concrete traffic barrier . the welded wire fabric 52 has an outer vertical section 54 embedded within the concrete adjacent to the unprofiled side 16 and an inner section 56 embedded within the concrete adjacent to the profiled side 18 . the inner section 56 follows the slopes of the profiled side 18 at the upper inclined surface 20 , intermediate inclined surface 22 , and also the lower inclined surface 24 . also embedded in the concrete barrier 10 are u - shaped reinforcing anchoring rods 58 to resist applied stresses at the channel 36 . the u - shape opens upwardly . an upper u - shaped anchoring rod 58 has an inner inclined section 60 embedded within the concrete adjacent to the profiled side 18 and an outer vertical section 62 embedded within the concrete adjacent to the unprofiled side 16 . the upper u - shaped anchoring rod 58 extends into the channel 36 to form an eyelet cooperative with a similar eyelet 64 with a lower u - shaped anchoring rod 66 . the lower u - shaped anchoring rods 66 are embedded in the retaining wall 88 . this u - shape opens downwardly . preferably , there are a plurality of upper u - shaped anchoring rods 58 and a matching plurality of lower u - shaped anchoring rods 66 spaced evenly throughout the length of the barrier . thus , the open channel encloses alternating eyelets ; fig1 shows the eyelets inscribing a large area for a lock to be described . viewing the channel 36 prior to filling with grout , an elongate rebar lock member is inserted from the end ; that is , several rebars 70 form a lock equal to the barrier in length . the rebars 70 are formed into a beam by plural , spaced u - shaped cross bars 73 . the beam is inserted into the channel 36 , passes through every eyelet and fastens the barrier 10 to the supporting wall 88 . inlet fill holes 72 extend from the intermediate inclined surface 22 of the profiled side 18 to the empty channel 36 . the inlet fill holes 72 are used to pump cast - in - place concrete , grout , mortar or similar material into the channel 36 to fill the channel along this length of the barrier 10 . separately installed sealing material at 48 and 50 prevent the pumped in cast - in - place concrete , grout , mortar or similar material from escaping from the channel 36 during the pumping process . the sealing material 48 and 50 ideally is impregnated asphalt board , however alternative materials , including but not limited to elastiomeric material , precompressed foam sealant or foam backup rods , may be used . the sealing material keeps the traffic barrier 10 from directly contacting the retaining wall 88 . in assembly , the traffic barrier 10 is aligned over the retaining wall 88 with reinforcing rods 58 , 66 forming alternating eyelets 64 and 68 in the longitudinal channel 36 . sealing material 48 and 50 is put in place . the traffic barrier 10 is then lowered onto the sealing material 48 and 50 to form a seal between the traffic barrier 10 and the retaining wall 88 . a locking beam is then inserted through the loops . the traffic barrier 10 is thus locked to the retaining wall 88 . then , a cast - in - place concrete , grout , mortar or similar material mixture is pumped through the inlet holes 72 into the channel 36 . the openings at either end of the channel 36 allow the expulsion of air from the channel 36 while the cast - in - place concrete , grout , mortar or similar material mixture is pumped into the channel 36 allowing the channel to be completely filled with the mixture . it should be noted that once the concrete hardens , the strength of the joint formed by the anchoring eyelets is increased . after the concrete hardens the roadway surface 90 is built up in the conventional fashion . with reference to fig2 a plurality of pre - cast traffic barrier elements 10 are supported on a retaining wall 88 to form a traffic barrier 92 . each traffic barrier element 10 has a length of 10 feet but can vary from 4 feet to 40 feet depending on the specific requirements of the roadway 90 and retaining wall 88 . a roadway 90 is supported by frictionally stabilized earth 94 . the outer surface 16 of the traffic barrier 10 is for ornamental purposes and could be left plain or decorated with different architectural designs . the pre - cast traffic barrier 92 restrains a moving vehicle on an elevated traffic surface 90 from travelling over the edge of the wall face of the earth 94 . with reference to fig3 another embodiment of the pre - cast traffic barrier 10 is cast with a longitudinal slot 150 and end sections 152 . embedded in the pre - cast traffic barrier 10 is reinforcing welded wire fabric 52 to resist directly applied stresses to the pre - cast concrete traffic barrier 10 . the welded wire fabric 52 has an outer vertical section 54 embedded within the concrete adjacent to the unprofiled side 16 and an inner section 56 embedded within the concrete adjacent to the profiled side 18 . the inner section 56 follows the slopes of the profiled side &# 39 ; s 18 upper inclined surface 20 , intermediate inclined surface 22 , and part of the lower inclined surface 24 . with reference to fig4 a plurality of pre - cast traffic barrier elements 10 are supported on a retaining wall 88 to form a traffic barrier 92 . the roadway surface 90 is shown partially removed 96 to reveal the longitudinal slot 150 . the slot 150 allows the cast - in - place concrete , grout , mortar or similar material to be pumped directly to the channel 36 encasing the interlocking anchor rods 58 , 66 and locking welded wire fabric 68 of fig3 . the end sections 152 contain the cast - in - place concrete , grout , mortar or similar material in the channel 36 during pumping operations . the end sections 152 also balance the traffic barrier 10 during construction , keeping the traffic barrier 10 from tipping over towards the roadway surface 90 . in operation , the traffic barrier 10 is aligned over the retaining wall 88 with reinforcing rods 58 , 66 forming a closed oval 64 in the longitudinal channel 36 . sealing material 48 , 50 is placed over the retaining wall 88 . the traffic barrier 10 is then lowered onto the sealing material 48 , 50 forming a seal between the traffic barrier 10 and the retaining wall 88 . a locking u - shaped welded wire fabric 68 is then inserted through the closed loop 64 . the traffic barrier 10 is thus locked to the retaining wall 88 by the u - shaped welded wire fabric 68 . a cast - in - place concrete , grout , mortar or similar material mixture is pumped through the longitudinal slot 150 into the channel 36 . the openings at either end of the channel 36 allow the expulsion of air from the channel 36 while the cast - in - place concrete , grout , mortar or similar material mixture is pumped into the channel 36 allowing the channel to be completely filled with the mixture . it should be noted that once the cast - in - place concrete , grout , mortar or similar material mixture hardens the strength of the joint formed by the anchoring bars 58 , 66 and locking welded wire fabric 68 is increased . after the cast - in - place concrete , grout , mortar or similar material mixture hardens the roadway surface 90 is built up to a point at the top of the lower inclined surface 24 . with reference to fig5 another embodiment of the pre - cast traffic barrier 10 is cast with the chamfer surface 35 extending between the lower vertical surface 34 and the bottom surface 14 . the bottom surface 14 extends from the chamfer surface 35 to an inner vertical surface 37 . the inner vertical surface 37 slopes upwardly at a vertical angle to an inner horizontal surface 39 . the inner vertical surface 37 extends for a length e of 3 inches , but this length e may vary from 1 inch to 24 inches . the greater the length e , the greater camming effect is created which counteracts any force applied which tends to tip the traffic barrier 10 over the retaining wall 88 . also , the greater the length e , the more adjustment is possible when aligning each barrier element 10 with the adjacent barrier elements . the inner horizontal surface 39 slopes at a horizontal angle to the sidewall 42 of the longitudinal channel 36 . the sidewall 42 slopes upwardly to an internal face 46 . the internal face 46 slopes upwardly at an angle of approximately 10 degrees but can vary from 0 degrees to 70 degrees . the internal face 46 extends from sidewall 42 to sidewall 44 . the sidewall 44 slopes downwardly from the internal face 46 to the bottom surface 14 . the length of sidewall 44 from the inner face 46 to the bottom surface 14 is less than the length of sidewall 42 from the inner face 46 to the bottom surface 14 . sidewall 44 is shown being 4 inches longer than sidewall 42 , but sidewall 44 can be cast to be from 1 inch to 36 inches longer than sidewall 42 . the longitudinal channel 36 of the pre - cast traffic barrier 10 has an upper u - shaped reinforcing anchoring rod 58 extending into the longitudinal channel 36 to form a closed oval 64 with a lower u - shaped reinforcing anchoring rod 66 . reinforcing rods 69 for interlocking the upper u - shaped anchoring rod 58 with the lower u - shaped anchoring rod 66 are inserted through the oval 64 the length of the longitudinal channel 36 to transfer stresses from the pre - cast concrete traffic barrier 10 to the retaining wall 88 . the reinforcing rods 69 use 4 separate rods , one at each corner stress point of the oval 64 , to transfer the stress , but can vary from 1 rod to 12 rods . the sealing material 48 , 50 supports the traffic barrier 10 and keeps the traffic barrier 10 from directly contacting the retaining wall 88 . sealing material 48 also prevents the pumped in cast - in - place concrete , grout , mortar or similar material from escaping from the longitudinal channel 36 down the retaining wall 88 . the sealing material 48 , 50 may also be used to shim a traffic barrier element 10 into alignment with adjacent traffic barrier elements . with reference to fig6 a plurality of pre - cast traffic barrier elements 10 are supported on a retaining wall 88 to form a traffic barrier 92 . the roadway surface 90 is shown partially removed 96 to reveal the end sections 174 . the end sections 174 , 175 are cast a distance of 2 feet 33 / 4 inches from the ends 176 , 177 of the traffic barrier 10 , but this distance can vary from 0 inches to 4 feet . this inset distance lessens the possibility that the end sections 174 , 175 will be damaged in storage or transportation to the construction site . the end sections 174 , 175 also balance the traffic barrier 10 , keeping the traffic barrier from tipping over towards the graded roadway surface 91 . an inner longitudinal slot 170 extends from end section 174 to end section 175 . outer longitudinal slots 172 extend from end 176 to end section 174 and from end 177 to end section 177 . the longitudinal slots 170 , 172 allow cast - in - place concrete , grout , mortar or similar material to be poured into the longitudinal channel 36 . in operation , the traffic barrier 10 is aligned over the retaining wall 88 with reinforcing rods 58 , 66 forming a closed oval 64 in the longitudinal channel 36 . sealing material 48 , 50 is placed on the retaining wall 88 and the graded roadway surface 91 at a level flush with the top of the retaining wall 88 . the traffic barrier 10 is then lowered onto the sealing material 48 , 50 forming a tight seal between the traffic barrier 10 and the retaining wall 88 and graded roadway surface 91 . if the plurality of traffic barriers 10 are not level with respect to each other , shims may be inserted in place of or with the sealing material 48 , 50 to ensure a level alignment between the traffic barriers . locking reinforcing rods 69 are then inserted through the closed loop 64 . the traffic barrier 10 is thus locked to the retaining wall 88 by the locking reinforcing rods 69 . a cast - in - place concrete , grout , mortar or similar material mixture is pumped through the longitudinal slots 170 , 172 into the channel 36 . the inclined internal face 46 of the channel 36 allows the expulsion of air from the channel 36 while the cast - in - place concrete , grout , mortar or similar material mixture is pumped into the channel 36 , thereby allowing the channel to be completely filled with the mixture . it should be noted that once the cast - in - place concrete , grout , mortar or similar material mixture hardens the strength of the joint formed by the anchoring bars 58 , 66 and locking reinforcing rods 69 is increased . after the cast - in - place concrete , grout , mortar or similar material mixture hardens the graded roadway surface 91 is built up to a point at the top of the lower inclined surface 24 . when a vehicle driving along the roadway 90 strikes the barrier 10 , the profiled inner face 18 will direct the vehicle &# 39 ; s wheel upward so as to prevent damage to the vehicle &# 39 ; s body . this will also slow the movement of a vehicle down so that the driver will be able to regain control of his vehicle and steer it back onto the roadway 90 . the force applied by the vehicle &# 39 ; s impact would otherwise tend to tip the barrier 10 over the retaining wall 88 , but this tipping force is overcome by the unique camming , interlocking eyelet arrangement , and the cemented channel features of this invention . the camming effect of the inner vertical surface 37 takes part of the tipping force and redirects it against the retaining wall 88 . the interlocking bar arrangement ; the upper u - shaped rods 64 , the lower u - shaped rods 66 , and locking bars 69 , cemented in place throughout the longitudinal channel 36 , takes the rest of the tipping force and absorbs it and redirects it into the retaining wall 88 . this cemented locking bar arrangement and camming effect will thus allow the construction of a traffic barrier on top of a retaining wall without the need for concrete and steel anchors under the roadway surface or other external structural support . this in turn reduces the cost and time required to build a retaining wall . the tongue and groove construction avoids lateral shifting of the barricade . although the invention has been described with reference to specific embodiments , this description is not meant to be construed in a limiting sense . various modifications of the disclosed embodiments , as well as alternative embodiments of the invention , will become apparent to persons skilled in the art upon reference to the description of the invention . it is therefore contemplated that the appended claims will cover such modifications that fall within the true scope of the invention .	4
the preferred embodiment herein described is not intended to be exhaustive or to limit the invention to the precise form disclosed . it is chosen and described in order to explain the principles of the invention and its application and practical use to enable others skilled in the art to utilize the invention . as is illustrated in the figures , air diffuser 10 , which in the preferred embodiment is formed from sheet metal , includes a wall or ceiling mounting ring 12 having a plurality of spaced mounting holes 14 to accommodate screws or similar fasteners . diffuser 10 further includes annular air diffuser rings 16 and 18 which in the preferred embodiment are coaxially displaced relative to mounting ring 12 , with the outer circumference of ring 18 being smaller than ring 16 . an outermost diffuser ring 20 having a centrally located hole 24 is positioned coaxially spaced from rings 16 , 18 . part 20 has a smaller circumference then ring 18 . the mounting ring 12 and each of the diffuser rings 16 , 18 , 20 have substantially uninterrupted outer edges . as illustrated in the figures , rings 16 , 18 and 20 are maintained in a spaced relationship by a plurality of radial inwordly offset links 26 which extend integrally between the rings at an acute angle relative to the diffuser rings in the direction of decresing size of the diffuser rings . each link includes an innermost and an outermost end , the outermost end of each link being connected to the next adjacent outer diffuser ring , the innermost end being solely connected to a slotted intermediate portion of the next adjacent inner diffuser ring or mounting member as the case maybe . although the figures illustrate three links extending between adjacent diffuser rings , it should be understood that any number of links may be used . air diffuser 10 is formed from a single piece of metal by a series of progressive stamping operations . it should be understood that although an annular air diffuser is illustrated in the drawings , the concept of a one piece air diffuser is equally as applicable to a multitude of shapes and dimensions , such as with square diffuser sections , and of various numbers of diffuser sections . it is further to be understood that the invention herein described is not to be limited by the details given above , but may be modified within the scope of the appended claims .	5
although it is previously known that certain lipophilic drugs may benefit from administering the drug in connection with food intake , the strength of the effect of food intake upon the ospemifene bioavailability obtained in the present investigations was very surprising . particularly compared to the behaviour of other serms , the food effect on ospemifene is remarkable . it was found ( anttila m ., 1997 ) that the intake of food did not have any positive effect on the bioavailability of toremifene , which like ospemifene also has a low aqueous solubility . it was observed that food intake in fact retarded the absorption of toremifene . it has also been reported that the administration of raloxifene , another serm , together with a standardized high - fat meal increases the absorption of raloxifene slightly , but that it does not lead to clinically meaningful changes in systemic exposure . while food intake causes only a 20 % increase of raloxifene absorption , the effect on ospemifene absorption is a 2 - 3 fold increase . the term “ food ” shall be understood to cover any edible foodstuff having a nutritional value as an energy supplier . thus the food can be solid , semisolid or liquid substance comprising one or more of the basic ingredients carbohydrates , fats and proteins . surprisingly , a high percentage of fats or a high energy value in the food intake is not crucial for obtaining a high bioavailability for ospemifene . neither is the amount of food intake crucial for the beneficial effect . it is believed that the secretion of bile acids may play an important role in the improved bioavailability , and therefore any foodstuff being capable of causing secretion of bile acids is expected to work . the drug is considered to be administered in connection with the intake of food if the drug is administered at a time point shortly before the start of the food intake , during the food intake or in a relatively short time after the food intake is completed . a preferable time range is defined to begin 1 hour before starting the food intake and to end 2 hours after starting the food intake . more preferably , the drug is administered at a time point which is in the range defined to begin at a time point during the food intake and to end 1 hour after the food intake was started . most preferably , the drug is administered during the food intake or at a time point which is no later than 0 . 5 hour after starting the food intake . the method of enhancing the bioavailability of ospemifene and related compounds according to this invention is particularly useful when treating women during or after the menopause . however , the method according to this invention is not restricted to women in this age group . the term “ metabolite ” shall be understood to cover any ospemifene or ( deaminohydroxy ) toremifene metabolite already discovered or to be discovered . as examples of such metabolites can be mentioned the oxidation metabolites mentioned in kangas ( 1990 ) on page 9 ( tore vi , tore vii , tore xviii , tore viii , tore xiii ), especially tore vi and tore xviii , and other metabolites of the compound . the most important metabolite of ospemifene 4 - hydroxyospemifene , which has the formula the use of mixtures of isomers of compound ( i ) shall also be included in this invention . the method of enhancing bioavailability is useful in any application of ospemifene , especially when the compound is used for treatment or prevention of osteoporosis or for treatment or prevention of symptoms related to skin atrophy , or to epithelial or mucosal atrophy . a particular form of atrophy which can be inhibited by administering of ospemifene is urogenital atrophy . symptoms related to urogenital atrophy can be divided in two subgroups : urinary symptoms and vaginal symptoms . as examples of urinary symptoms can be mentioned micturation disorders , dysuria , hematuria , urinary frequency , sensation of urgency , urinary tract infections , urinary tract inflammation , nocturia , urinary incontinence , urge incontinence and involuntary urinary leakage . as examples of vaginal symptoms can be mentioned irritation , itching , burning , maladorous discharge , infection , leukorrhea , vulvar pruritus , feeling of pressure and postcoital bleeding . according to previous data , the optimal clinical dose of ospemifene is expected to be higher than 25 mg daily and lower than 100 mg daily . a particularly preferable daily dose has been suggested in the range 30 to 90 mg . at the higher doses ( 100 and 200 mg daily ), ospemifene shows properties more similar to those of tamoxifen and toremifene . due to the enhanced bioavailability according to the method of this invention , it can be predicted that the same therapeutical effect can be achieved with doses lower those recommended earlier . the invention will be disclosed more in detail in the following non - restrictive experimental section . two clinical studies were carried out in order to assess the bioavailability of ospemifene in healthy male subjects after intake of high caloric content ( 860 kcal ) and high - fat breakfast compared to bioavailability of ospemifene administered in fasted condition ( study a ). in a separate study ( study b ), the bioavailability of ospemifene after intake of low caloric content ( 300 kcal ), low - fat breakfast was assessed and the results were compared to those obtained in study a ( i . e . ospemifene bioavailability after intake of high caloric , high - fat breakfast or after ospemifene administering in fasted condition ). in study a , 24 healthy male volunteers ( mean age 23 . 8 years , mean bmi 22 . 8 kg / m 2 ) received single oral doses of 60 mg ospemifene , once under fed condition after consuming a standardised high - fat , high caloric breakfast , and once after an overnight fast . blood samples for pharmacokinetic assessments were drawn during 72 hours at each study period . a washout period between the two treatments was at least 2 weeks . the breakfast consisted of the following ingredients : two eggs fried in butter ( 50 g ), two strips of bacon ( 34 g ), two slices of toast with butter ( 50 g ), 60 g hash brown potatoes and 240 ml of whole milk ( pecentage of fat = 3 . 5 %). the meal provided approximately 150 , 170 and 540 kcal from protein , carbohydrate and fat , respectively . following an overnight fast of at least 10 hours at the study site , the subjects were given the test meal described above 30 minutes before ospemifene dosing ( 60 mg tablet ). the meal had to be consumed over the 30 minutes , immediately followed by administration of ospemifene . following an overnight fast of at least 10 hours at the study site , the subjects were given one ospemifene tablet ( 60 mg ) with 240 ml of water . no food was allowed for at least 4 hours after the ospemifene dose . a substantial effect of food intake was observed on the bioavailability of ospemifene and its main metabolite 4 - hydroxy - ospemifene . fig1 shows the mean serum concentration of ospemifene versus time following the administration of 60 mg ospemifene tablet in fasted condition ( open circles ) and after a high caloric , high - fat meal ( filled circles ). the results of this study showed clearly that the ospemifene bioavailability was enhanced by concomitant ingestion of ospemifene and a meal . due to the surprising and promising results of this study it was decided to carry out a second study ( study b below ) to find out the effect of a low caloric , low - fat meal on the bioavailability of ospemifene . in study b , 12 healthy male volunteers ( mean age 23 . 8 years , mean bmi 22 . 3 kg / m 2 ) of the 24 subjects in study a were subjected to ospemifene administering in combination with the intake of a low caloric , low - fat meal . the results were compared to those obtained in study a for the same individuals . the composition of the light breakfast ( approximately 300 kcal ) was as follows : two slices of toast with margarine ( 5 g , fat content 60 %), 6 slices ( 30 g ) of cucumber , 240 ml skimmed ( non - fat ) milk and 100 ml orange juice . the test meal provided approximately 50 , 180 and 70 kcal from protein , carbohydrate and fat , respectively . following an overnight fast of at least 10 hours at the study site , the subjects were given the test meal described above 30 minutes before ospemifene dosing ( 60 mg tablet ). the meal had to be consumed over the 30 minutes , immediately followed by administration of ospemifene . fig2 shows the mean serum concentration of ospemifene versus time following the administration of 60 mg ospemifene tablet in fasted condition ( open circles ; data obtained from study a ); after a high caloric , high - fat meal ( filled circles ; data obtained from study a ) and after a low caloric , low - fat meal ( stars ). fig3 shows the mean serum concentration of the ospemifene metabolite 4 - hydroxy - ospemifene versus time following the administration of 60 mg ospemifene tablet in fasted condition ( open triangles ; data obtained from study a ); after a high caloric , high - fat meal ( filled triangles ; data obtained from study a ) and after a low caloric , low - fat meal ( crosses ). the results of this study showed clearly that the bioavailability of ospemifene was also enhanced by concomitant ingestion of ospemifene and a low caloric , low - fat meal . although the fat content of the low - fat meal was much lower than that of the high - fat meal , the bioavailabity of ospemifene was only slightly lower for the low - fat meal . therefore it can be concluded that the effect of food on the ospemifene bioavailability is not dependent on the fat content of the meal ingested . instead , stimulation of bile flow due to meal ingestion may enhance the solubilisation of ospemifene . it will be appreciated that the methods of the present invention can be incorporated in the form of a variety of embodiments , only a few of which are disclosed herein . it will be apparent for the expert skilled in the field that other embodiments exist and do not depart from the spirit of the invention . thus , the described embodiments are illustrative and should not be construed as restrictive . anttila m . effect of food on the pharmacokinetics of toremifene . eur j cancer , 1997 ; 33 , suppl 8 : 1144 , 1997 . kangas l . biochemical and pharmacological effects of toremifene metabolites . cancer chemother pharmacol 27 : 8 - 12 , 1990 . kauffman r f , bryant h u . selective estrogen receptor modulators . drug news perspect 8 : 531 - 539 , 1995 .	0
an embodiment of the present disclosure will be described hereinafter with reference to the drawings . in the drawings , reference numerals having the same last two digits designate the same or similar elements . fig1 is a block diagram illustrating an example configuration of a stream processor according to an embodiment of the present disclosure . a stream processor 100 illustrated in fig1 includes stream processing sections 12 , 14 , 16 , and 18 and an access controller 30 . the processing sections 12 , 14 , 16 , and 18 include priority information calculators 22 , 24 , 26 , and 28 , respectively . the access controller 30 includes an access arbiter 32 . the stream processing sections 12 , 14 , 16 , and 18 receive streams st 1 , st 2 , st 3 , and st 4 , respectively . the stream processing sections 12 , 14 , 16 , and 18 perform menu decoding a , subtitle decoding b , menu decoding c , and subtitle decoding d , respectively . the priority information calculator 22 extracts time stamp information on a menu to be displayed , from the stream st 1 . examples of the time stamp include a presentation time stamp ( pts ) and a decoding time stamp ( dts ). the priority information calculator 22 calculates the difference between the extracted time stamp and a reference time rt , and outputs the obtained difference to a main memory 42 as an access priority . in this calculation , the priority information calculator 22 subtracts the reference time rt from the extracted time stamp , for example . the reference time rt is , for example , a system time clock ( stc ), and input from a cpu ( not shown ). the stream processing section 12 adds the priority obtained by the priority information calculator 22 to an access request to the main memory 42 , and outputs the resulting access request to the access controller 30 . similarly , the priority information calculators 24 and 28 acquire time stamps of subtitles to be displayed , from the streams st 2 and st 4 , respectively . the priority information calculator 26 acquires a time stamp of a menu to be displayed , from the stream st 3 . each of the priority information calculators 24 , 26 , and 28 calculates the difference between the acquired time stamp and the reference time rt , and outputs the obtained difference as priority information of access to the main memory 42 . the priority increases as the value of the priority information decreases . each of the stream processing sections 14 , 16 , and 18 adds the priority information obtained by an associated one of the priority information calculators 24 , 26 , and 28 to the access request to the main memory 42 , and outputs the resulting priority information to the access controller 30 . the access arbiter 32 determines which one of the stream processing sections 12 , 14 , 16 , and 18 is to receive access permission , based on the priority information from the stream processing sections 12 , 14 , 16 , and 18 . specifically , for example , the access arbiter 32 determines that access permission should be granted to the stream processing section 12 having the highest priority ( i . e ., having the smallest value of priority information ), and grants access permission to the stream processing section 12 . the stream processing section 12 that has received the access permission accesses the main memory 42 . then , after the processing of the stream processing section 12 that received the access permission has terminated , the access arbiter 32 grants access permission to a stream processing section ( e . g ., the stream processing section 14 ) having the next highest priority ( the second smallest value of priority information ) after the stream processing section 12 that has finished its processing . the stream processing section 14 that has received the access permission accesses the main memory 42 . subsequently , after the processing of the stream processing section that received the access permission has terminated , the access arbiter 32 grants access permission to a stream processing section having the next highest priority after the stream processing section that has finished its processing , and this process is repeatedly performed . in this manner , the access arbiter 32 makes determination based on the priority order , and thereby , a plurality of streams can be processed with dynamic determination of streams to be processed by priority . fig2 is a timing chart showing an example of transfer to a main memory by using a conventional stream processor . fig3 is a timing chart showing an example of transfer to the main memory by using the stream processor 100 illustrated in fig1 . in fig2 and 3 , the vertical broken lines indicate timings when the main memory 42 is accessed by the whole stream processor . the distance between the broken lines corresponds to the main memory bandwidth ( the transfer bandwidth to the main memory 42 ) allocated to the whole stream processor . the timing charts show that the time stamp ( ts ) of the menu decoding a should be performed as soon as possible . in this case , the time stamp is considered to coincide with , for example , the reference time rt . the time stamps of the subtitle decoding b , the menu decoding c , and the subtitle decoding d are also shown in the timing charts . in the menu decoding a , the subtitle decoding b , the menu decoding c , and the subtitle decoding d , transfer to the main memory 42 needs to be performed three times , twice , three times , and four times , respectively . the same holds for the timing charts that will be referred to later . the process of fig2 employs a round robin scheduling as an arbitration technique . in this case , transfer for the menu decoding a that needs to be finished earliest is completed after transfer for the subtitle decoding b . that is , in typical arbitration in direct memory access ( dma ) such as a round robin , the relationship between a completion required time indicated by a time stamp and an actual completion time is not necessarily rational . on the other hand , in the case of fig3 , the transfer for the menu decoding a is finished earliest , and thus , the relationship between the completion required time and the actual completion time is rational . accordingly , the stream processor 100 illustrated in fig1 can achieve predetermined performance even with a small available main memory bandwidth . fig4 is a block diagram illustrating a variation of the configuration of the stream processor 100 illustrated in fig1 . a stream processor 200 illustrated in fig4 has the same configuration as that of the stream processor 100 except for including an access controller 230 instead of the access controller 30 . the access controller 230 includes an access arbiter 232 and a rate setup section 234 . the rate setup section 234 receives , from , e . g ., a cpu , a bandwidth bw of the main memory 42 with respect to each of the stream processing sections 12 , 14 , 16 , and 18 . the bandwidth bw is a bandwidth necessary for processing streams to be input to each of the stream processing sections 12 , 14 , 16 , and 18 . the rate setup section 234 outputs the received bandwidth bw to the access arbiter 232 . the access arbiter 232 grants access permission based on the bandwidth from the rate setup section 234 in addition to priority information from the stream processing sections 12 , 14 , 16 , and 18 . fig5 is a timing chart showing an example of transfer to the main memory by using the stream processor 200 illustrated in fig4 . specifically , the access arbiter 232 reduces uneven temporal distribution of access in a case where the bandwidth from the rate setup section 234 is satisfied without transfer at every broken line in fig5 . the access arbiter 232 grants access permission to the stream processing section 18 once for every second or third broken line in fig5 , as in the case of subtitle decoding d in fig5 . in fig3 , access to the main memory is continuously performed until completion of transfer for the subtitle decoding d in a case where a plurality of stream processings conflict with one another . on the other hand , in fig5 , while conditions of the completion time required for each stream processing are satisfied , access to the main memory is not issued at some times . in this manner , in the stream processor 200 , at times when the stream processing sections 12 , 14 , 16 , and 18 do not perform transfer , the main memory 42 can be accessed by another circuit such as a cpu , thereby enhancing performance of the entire system . fig6 is a block diagram illustrating another variation of the configuration of the stream processor 100 illustrated in fig1 . a stream processor 300 illustrated in fig6 has the same configuration as that of the stream processor 100 except for including an access controller 330 instead of the access controller 30 . the access controller 330 includes an access arbiter 332 and an offset setup section 334 . the offset setup section 334 receives , from , e . g ., a cpu , an offset fs for the priority of each of the stream processing sections 12 , 14 , 16 , and 18 . the offset setup section 334 outputs the received offset fs to the access arbiter 332 . the access arbiter 332 grants access permission based on the offset from the offset setup section 334 in addition to the priority information from the stream processing sections 12 , 14 , 16 , and 18 . at this time , the access arbiter 332 uses priority information that has been changed based on the offset fs input to the offset setup section 334 . specifically , for example , the access arbiter 332 adds the offset fs to the priority information of the stream processing section 12 , 14 , 16 or 18 , and uses the resulting information . the stream processor 300 enables adjustment of the priority for each stream depending on operating characteristics of , for example , a cpu or a drawing engine at a subsequent stage . fig7 is a block diagram illustrating still another variation of the configuration of the stream processor 100 illustrated in fig1 . a stream processor 400 illustrated in fig7 has the same configuration as that of the stream processor 100 except for including stream processing sections 412 , 414 , 416 , and 418 instead of the stream processing sections 12 , 14 , 16 , and 18 , and including an access controller 430 instead of the access controller 30 . the access controller 430 includes an access arbiter 432 and a clock controller 434 . the stream processing sections 412 , 414 , 416 , and 418 perform clock gating control therein based on received clock control signals cc 1 , cc 2 , cc 3 , and cc 4 . the other part of the configuration is similar to that of the stream processing sections 12 , 14 , 16 , and 18 of fig1 . the access arbiter 432 notifies the clock controller 434 of which one of the stream processing sections 412 , 414 , 416 , and 418 access permission is granted to . the other part of the configuration of the access arbiter 432 is similar to that of the access arbiter 32 of fig1 . the clock controller 434 outputs the clock control signal cc 1 , cc 2 , cc 3 , or cc 4 instructing each one of the stream processing sections 412 , 414 , 416 , and 418 to which no access permission is granted to stop a clock while no access permission is being granted . the stream processing section 412 , 414 , 416 , or 418 that has been instructed to stop a clock based on the clock control signal cc 1 , cc 2 , cc 3 , or cc 4 stops at least one of the clocks that are being used in the stream processing section 412 , 414 , 416 , or 418 . in this manner , dynamic clock gating control is performed on the stream processing section that does not receive access permission , thereby reducing power consumption . the stream processor 200 or 300 illustrated in fig4 or 6 may include the clock controller 434 to control clocks in the same manner . fig8 is a timing chart showing an example of clock control by the stream processor 400 illustrated in fig7 . each of the stream processing sections is supplied with clocks from when decoding is started in response to access permission to when transfer is finished . the timing chart of fig8 shows that a period in which clocks are supplied is shorter and power consumption is reduced more greatly in the case of fig8 than in the case of fig2 . this is because until transfer for one processing is finished , a clock of the stream processing section that is in charge of this processing cannot be stopped . in the foregoing embodiment , the stream processor includes four stream processing sections . alternatively , the number of stream processing sections is not limited to the above example . each of the stream processing sections may process video streams and / or audio streams . instead of the main memory , access to another memory may be controlled in a manner similar to that described above . each functional block herein can be typically implemented as hardware . for example , each functional block may be implemented on a semiconductor substrate as a part of an integrated circuit ( ic ). here , an ic includes a large - scale integrated circuit ( lsi ), an application - specific integrated circuit ( asic ), a gate array , a field programmable gate array ( fpga ), etc . alternatively , a part or the entire part of each functional block may be implemented as software . for example , such a functional block may be implemented by a processor and a program that can be executed on the processor . in other words , each functional block herein may be implemented as hardware , software , or any combination of hardware and software . the many features and advantages of the present disclosure are apparent from the detailed specification and , thus , it is intended by the appended claims to cover all such features and advantages of the present disclosure which fall within the true spirit and scope of the invention . further , since numerous modifications and changes will readily occur to those skilled in the art , it is not desired to limit the present disclosure to the exact construction and operation illustrated and described , and accordingly all suitable modifications and equivalents may be resorted to , falling within the scope of the invention . as described above , according to the present disclosure , a memory bandwidth can be used efficiently in processing a plurality of streams , and thus , the present disclosure is useful for , for example , stream processors .	8
detailed embodiments of the present invention are disclosed herein ; however , it is to be understood that the disclosed embodiments are merely illustrative of the invention that may be embodied in various forms . in addition , each of the examples given in connection with the various embodiments of the invention are intended to be illustrative , and not restrictive . further , the figures are not necessarily to scale , some features may be exaggerated to show details of particular components . in addition , any measurements , specifications and the like shown in the figures are intended to be illustrative , and not restrictive . therefore , specific structural and functional details disclosed herein are not to be interpreted as limiting , but merely as a representative basis for teaching one skilled in the art to variously employ the present invention . the term “ purpose - built medical inhalation device ” means : a device designed and manufactured for medical use as a method of administering therapeutic doses of cannabis in the form of an inhaled vapor . the term “ medical cannabis ” means : a form of the plant genus cannabis , in the form of ground plant material comprising bud , leaf , and stem materials of the cannabis genus , or any combination thereof . the term “ authorized ” means : an individual or use that is approved for a medical cannabis therapy by a recommending physician or other legally or administratively authorized provider . the term “ measured ” means : marked by due proportion or precise weights and measures . the term “ sterile ” means : treated with any of a number of recognized sterilization methods that leave the sample free from living organisms and especially microorganisms . the term “ sanitary ” means : free from living , esp pathogenic , microorganisms , and detrius associated therewith , for example insect parts , spores , etc . the term “ sterilizable ” means : capable of being rendered sterile multiple times . the term “ tamper - evident ” means : a form of packaging or presentation that renders improper and unauthorized use obvious to inspection ( for example , visual , machine , or electronic inspection ). the term “ dosage form ” means : a formulation that presents or administers a medicine or therapy in a single , measured , clinically - appropriate unit . the term “ verifying ” means : to confirm proper or authorized use or identification . the term “ patient ” means : an individual awaiting or under medical care and treatment . the term “ single dose cycle ” means : the time and steps required to administer one dose of medicine . the term “ delivering ” means : to bring or transport to the proper place or recipient ; to distribute or administer . the term “ recording ” means : the act or process of making a record ; a record . the term “ wherein the patient is identified with a prescription ” means : pertaining to a patient who has received a prescription or recommendation from a qualified physician . the term “ biometrically identified ” means : the verification of identity via physical characteristics , such as fingerprints , dna , or retinal patterns . the term “ prescription ” means : a written order , especially by a physician , for the preparation and administration of a medicine or other treatment ; a recommendation of a medicine or other treatment from a physician . the term “ without combustion ” means : with no burning ; the absence of fire , smoke and the byproducts of burning . with respect to medical cannabis , “ without combustion ” means heating cannabis to a cannabis material temperature of between 180 and 200 c , thereby vaporizing the cannabinoids that reside on the trichomes on the surface of cannabis flowers and leaves , while avoiding combustion ( which occurs at 230 c and above ) and attendant smoke toxins . the term “ locking out ” means : denying access ; disabling a mechanism or feature ; prohibiting an activity . the term “ frequency of use of the machine ” means : the number of times the device is used ; the intensity of usage . the term “ exceeds a given set point ” means : anything that surpasses a predetermined limit or benchmark . the term “ has been tampered with ” means : has been subject to improper or unauthorized use ; evidencing damage to the form of packaging or presentation . the term “ the delivery temperature of the dose of medical cannabis ” means : the temperature at which a single unit of cannabis - based therapy is administered to a patient . the term “ the dosage form is not accessible until biometric authorization is obtained ” means : the single unit of therapy is not available for administration without physical verification of identity or authorization . the term “ selective acceptance of the dosage form into the medical inhalation device ” means : accommodating insertion of a unit of therapy only in a pre - determined manner . the term “ disposable ” means : designed to be replaced and discarded after use . the term “ heat of combustion ” means : the heat at which combustion occurs for a given substance — for example , approximately 230 c and above for medical cannabis . the term “ availability of the dose is confirmed ” means that a database or other verifying means confirms that a particular purpose - built machine / person is authorized to utilize a dose . the term “ one - way sanitary vapor valve ” means : a valve that only allows the flow of vapor in a single direction . the term “ consumption data ” means data related to the location , use , frequency of use , identity of user , and identity of product used with respect to a purpose - built vaporizer / dose combination “ legally qualified for use ” means that a given purpose - built vaporizer / dosage form / individual is authorized for use or using a given medical cannabis dose . fig1 depicts an embodiment of a medical cannabis vaporizer and recording system . removable vaporizer tube 1 is in communication with outflow vapor source 14 which receives vapor from the stabilizing chamber 15 . vapor flow is in the direction of the arrows indicated . exhaust temperature and data sensors 2 , 16 , measure the temperature and other physical / chemical characteristics of the vapor . this data is optionally transmitted to exhaust sensor data connections 3 , 17 . the vapor itself is generated from heated air originating from intake ports 23 , heated by a heating element 12 , and passing through a medical dose 4 of a vaporizable substance ( in one embodiment , cannabis ) held in place and surrounded by a dose suspension screen 5 itself contained within a medical dose cartridge 6 . vapor collects in the dose vaporizing chamber 24 . data recognition means ( in one embodiment , an infrared - scannable barcode 7 ) may be located on the medical dose cartridge 6 so as to tracking and / or verifying use and user of the medical dose 4 through a dose - recognition switch 18 , and may , in one embodiment , be readable by medical dose / data connections 8 , 19 . separate intake temperature sensor data recorders 9 and data connections 10 may also be utilized . an insulation heat sink 11 absorbs excess heat and keeps the starting temperature of the heated air utilized to generate the vapor fairly constant . an intake temperature sensor and data recorder 20 associated with an intake temperature measuring device monitors the temperature of the heated air utilized to generate the vapor . in one embodiment , the air may itself be heated by a heat element 22 and driven through the machine by an air flow fan 13 . fig1 a depicts an embodiment of a dose vaporizer similar to that shown in fig1 , with the added differences of a hot air flow restriction baffle 13 , and air flow carburetor holes 12 . in another embodiment , the dose vaporizing chamber 6 is removable and / or separately packaged and salable , and can be attached and used with any other commercially available vaporizer and / or heat source by use of an adapter . fig2 depicts an embodiment of the invention with a dose cartridge inserted . in one embodiment , the dose cartridge 108 includes a medical dose of a material between two metal screens that has not been previously vaporized or subject to other extraction or processing steps . dose cartridge data 105 may , in one embodiment , be imprinted on the dose cartridge 108 . the dose cartridge slot 104 holds a dosage cartridge 108 so that its wire mesh section is held within the dosage cartridge vaporizing chamber 106 . temperature regulated airflow 113 flows through the dosage , and its presence is measured utilizing a vapor temperature sensor 122 . vapor flows in the direction of the arrows shown 123 . vapor temperature sensor , data recording , and data connection means 102 , 103 , 120 , 121 measure vapor temperature and chemical characteristics , while — upstream of the medical dose — temperature sensor , data recording and data connection means 111 , 112 , 114 , 115 measure the temperature and / or other characteristics of the incoming air stream . the medical dose recognition switch 117 optionally allows operation of the machine only when an authorized dose / dose size is placed in the apparatus , and an optional data connection 116 allows connection to an outside computer and / or outside entity . similar structures are provided at 109 , 110 . fig3 is a side view of an embodiment of the dose cartridge , dose cartridge slot and dose vaporization chamber of the instant invention . the medical dose cartridge 201 includes a finger grip 202 for easy insertion and removal . the vaporization chamber slot 203 may be optionally designed so as only to accept a medical dose cartridge 204 of a particular configuration — thus “ locking out ” use of the apparatus to any potential user not utilizing a particularly configured medical dose cartridge . the cartridge is comprised of micro screens 205 , 206 which hold a dose within the dose vaporization chamber 207 . cartridge and medical dose recognition and data connection means 209 - 210 and 212 - 213 optionally provide a mechanism to ensure that only a pre - approved , pre - measured particular dose of a medical herb or other substance is administered by matching the dose and cartridge identifying information . fig4 is a top view of an embodiment of the dose cartridge , dose cartridge slot and dose vaporization chamber of the instant invention . the medical dose 301 is placed between microscreen layers 302 , 306 . the vaporization chamber slot 303 may be optionally designed so as only to accept a medical dose cartridge of a particular configuration — thus “ locking out ” use of the apparatus to any potential user not utilizing a particularly configured medical dose cartridge . the dose is positioned within a temperature regulated air flow 308 passing through an air flow hole 307 so as to ensure optimum efficiency in vaporization of the medical dose . fig5 a and 5b depicts an embodiment of the medical dose vaporization cartridge itself . the dose cartridge 401 includes a finger grip 402 and may optionally include a means for storing / transmitting product and / or cartridge specific data 403 . an optional bar code 404 provides an additional means for identification / tracking . the dose housing 405 , in one embodiment , wholly encapsulates a medical 407 dose between two screens 406 in a manner that allows for placement of a dose that is small enough to essentially prevent combustion ; and thin and / or well - distributed enough to ensure consistent vaporization of relevant dose components throughout the vaporization process . a recognition switch 408 individually identifies the dose . fig6 a , 6 b , and 6 c depict an embodiment of consumer packaging utilized for the medical dose vaporization cartridges of the instant invention . in one embodiment , a plurality of cartridges are stored in a sterile airtight box . in another embodiment , the plurality of cartridges within the sterile airtight box are individually wrapped so as to ensure sterility when the box is repeatedly opened for dose access . in another embodiment , the consumer packaging is equipped with monitoring means so as , for example , to monitor the rate at which individual dose cartridges are removed from the box ; the total number of cartridges removed from the box ; and whether any dose cartridges removed and / or replaced within the box maintain sterility and / or are in a pre - vaporization state . in one embodiment , both the box and the individual cartridges may have individual monitoring and / or tracking means , including but not limited to computer chip , barcode and / or radiofrequency identification ( rfid ) tracking / monitoring / data transmission means . fig7 depicts an embodiment of a cannabis dose cartridge assembly process . in one embodiment , this assembly process is carried out by the commercial provider of the medical dose . in another embodiment , this assembly process is carried out by a licensed physician / nurse / pharmacist or other authorized third party . in one embodiment , a screen is forged 501 , so as to create a depression in the screen . the medical dose is placed 502 in the screen depression , and optionally tamped down 503 . the medical dose is then encapsulated between screens 504 . once the dose is encapsulated between screens , the encapsulated dose may then be cut out 505 and inserted into a dose cartridge for commercial use 506 . fig8 a and 8b depict an embodiment of a maintenance and sterilization kit for use with the dose vaporizer of the instant invention . a heat shield sterilization safety cap 601 may be placed over the openings of the vaporization chamber 602 to prevent contamination between uses . means for flushing the system are also provided 604 . fig9 depicts an embodiment of a dose vaporizer of the instant invention . an on / off switch 711 governs provision of power to the unit . visual and digital data may be displayed , and a maintenance control 712 is also provided for optional control of vaporization parameters . a dose cartridge slot 704 is configured to only accept a particularly configured ( physically and / or electronically or informationally ) dose cartridge , and is further configured so as to place the medical dose contained within the dose cartridge in optimal contact with the heated air coming from the heat source so as to create a vapor stream . a dose location 703 is configured so as to maximize efficiency and efficacy of dose vaporization . a control data collection system 709 and usb data port ( s ) 708 permit recordation and / or monitoring of dose vaporizer utilization . fig1 is a variant of the dose vaporizer of fig9 , wherein the flexible tube 814 and mouthpiece 815 are differently configured . in one embodiment , the flexible tube and mouthpiece of fig1 have an internal diameter substantially similar to that of the dose vaporization chamber . fig1 depicts an alternative embodiment of a dose vaporizer . removable vaporizer tube consists of disposable mouthpiece 901 ; disposable flexible hose 902 ; disposable expandable vapor reservoir 903 ; disposable one - way sanitary vapor valve 904 : a dose 905 housed within a cartridge vaporization chamber 906 . the cartridge may contain an rfid chip or other notification means ( for example radio transmitter ) and may also contain a means for detecting tampering with the cartridge 908 . a heat source 909 heats up and vaporizes the dose 905 contained within the dose cartridge 908 . insulation 910 may optionally be used to isolate the heat source 909 from surrounding structures . an air pump 911 pushes air in the direction of the arrows indicated . exhaust temperature and data sensors 912 measure the temperature and other physical / chemical characteristics of the vapor . the vapor itself is generated from heated air passing through a medical dose 905 of a vaporizable substance ( in one embodiment , cannabis ) held in place and surrounded by a dose suspension screen itself contained within a medical dose cartridge . data recognition means ( in one embodiment , an infrared - scannable barcode ) may be located on the medical dose cartridge 906 so as to tracking and / or verifying use and user of the medical dose , and may , in one embodiment , be readable by medical dose / data connections . separate intake temperature sensor data recorders and data connections may also be utilized , as well as a processor circuit board 914 ; led display 915 ; data display keys 916 ; usb data port 917 ; and for warm - up switch 918 . an insulation heat sink absorbs excess heat and keeps the starting temperature of the heated air utilized to generate the vapor fairly constant . in one embodiment , the air may itself be heated by a heat element and driven through the machine by an air flow fan . fig1 depicts an alternative embodiment of a comprehensive medical solution comprised of purpose - built subsystems . the three subsystems may include a dose cartridge vaporizing system ; a disposable safety / sterility system ; and a clinical monitoring system . physicians may gather information from a variety of sources ( including the patient themselves ) to determine whether the patient would benefit from a particular dosage of a product .) 1001 . subsequent to a physician determination , data related to the patient &# 39 ; s individually identifiable information , condition , and prescribed use of a substance ( in one example , cannabis ) may be provided 1002 to any of a hospital database , pharmacy database , hospice database , research database , law enforcement database , etc . separately , dose cartridges containing a dose of a substance ( in one embodiment , cannabis ) may be produced 1003 and “ tagged ” with any of a number of differing types of data , including identity of the dose ; prescribed individual corresponding to the dose ; batch and lot number of the dose ; expiration date of the dose ; usage of the dose ; etc . doses may be prescribed and / or distributed to a patient , and data related to machine usage ; dose usage ; patient usage , etc . may be stored in a database or provided in varying forms to any matter of healthcare provision , regulatory oversight , tax collection and / or law enforcement entities . 1004 . in another embodiment , any portion of the instant invention — including , but not limited to , the flexible tube , dose cartridge and / or mouthpiece — may be made disposable , individually sterilizable , separable from the main apparatus of the invention and / or reusable and / or returnable . in one embodiment , the dose vaporizer provides a mild , non - noxious , and non - irritating vapor so as to facilitate administration of medical dose ( in one embodiment , cannabis ) vapors with a reduced incidence and / or risk of concomitant administration of carcinogens . in another embodiment , the dose vaporizer provides a vapor dose that utilizes substantially all of the active ingredients within a particular medical ( in one example , cannabis ) sample , thus increasing efficiency of delivery of cannabis active ingredients . in another embodiment , the instant dose vaporizer permits physicians to record and control frequency , time and date of use while enabling treatment to the dose - response curve of individual patients ( a critical healthcare benefit ). doctors can deliver improved care due to patient ability to self - administer consistent doses with maximum efficiency ( little waste ) and efficacy ( greater absorption of active ingredients ). tamper - resistant packaging and digital record - keeping offer states and law enforcement authorities new tools to help ensure accountability , control and transparency throughout the medical cannabis supply chain . in another embodiment , the amount of material vaporized is not alterable by the end user . in another embodiment , the flexible tube / mouthpiece may be removed while in operation , resulting in use of the dose vaporizer in a manner that provides the vaporizer stream into a given physical space , for example , a room of a house . in another embodiment , the instant invention is designed exclusively for use by legally approved patients . in another embodiment , the instant invention is designed for home use bedside or on any or all flat table top like surfaces that are suitable for such a device and able to withstand the level of heat that may be generated by sustained use . in another the instant invention is designed for portable use , for example , as a backpack unit ; a wheeled unit ; a battery or liquid - fuel - powered unit . in another embodiment , the instant invention is designed to be set at the specific temperature by the factory or the legally approved provider and or doctor or caregiver that is required to vaporize medical cannabis or a single specific temperature that is required to vaporize any and all other medications that have been legally prescribed . in another embodiment , the instant invention is designed to be set to deliver any of a number of vaporizable medicines / alternative compounds , including but not limited to aromatherapy compounds and / or substrates . in another embodiment , the instant invention is designed to have one and only one temperature setting activatable by the user . in another embodiment , the instant invention is not designed to be used with more than one medical product . in another embodiment , the temperature , time and air velocity settings of the instant invention are not variable . in another embodiment , the instant invention is designed to have a baffle that will block the heat source and prevent the combustion of the material to be vaporized . in another embodiment , the baffle system is designed to be set at a single temperature by the factory . in another embodiment , the baffle system is designed to be activated by a time period set by the factory or controlled by the doctor . in another embodiment , the baffle system is designed to be activated by a temperature set by the factory or controlled by the doctor . in another embodiment , the heating element is designed to be activated by a time period set by the factory or controlled by the doctor . in another embodiment , the heating element is designed to be activated by a temperature set by the factory or controlled by the doctor . in another embodiment , the baffle is designed to be activated by a time or temperature set by the factory or controlled by the doctor so as to optimize heating and / or inhalation periods ( for example in order to optimize extraction of the vapors from the sample ) and / or for the purpose of avoiding combustion and / or control total amount of vapor / active ingredient taken in by the patient . in one embodiment , the baffle system is designed and intended to provide a vaporizing heat stream at a temperature approximately 10 degrees below the combustion point of medical cannabis . in another embodiment , the vaporizer is designed to deliver vapor to the lungs of legally approved patients via oral inhalation through a simple tube made from easily cleaned and sterilized materials such as plastic , glass , ceramics or low heat conducting metal . in another embodiment , the instant invention &# 39 ; s vaporizer carbureting holes are designed to allow cool air to rush into the delivery tube , behind the heated vapor at the time the baffles block off the heat source . in another embodiment , the carbureting holes are designed to use cool air to push the heat created vapors deep into the patients &# 39 ; lungs for more effective absorption of the intended compounds of the vaporized material . in another embodiment , the carbureting holes are designed to insure that the vapors cannot reach the patients body / lungs at temperatures that would create discomfort . in another embodiment , the instant invention vaporizer is designed to only accept medical cannabis and any legally prescribed material that is packaged by a licensed provider in proprietary dose cartridges . in another embodiment , use of standardized , optimized dose cartridges may facilitate consistent dosing amounts and efficacy by minimizing human error in the preparation and use of doses prepared by the user from “ loose ” or unprocessed vaporizable substances . in another embodiment , the vaporizer is designed to record proper use and illegal misuse or abuse with a data storage system . in another embodiment , the vaporizer is designed to be used by one and only one legally approved patient at a time . in another embodiment , the vaporizer is designed to be very simple to use by patients that have limiting or debilitating conditions . in another embodiment , the vaporizer is designed to be impossible to use incorrectly with automatic “ lockout ” cutoff if misuse , dangerous temperature levels , illegal use and any or all unintended use is detected . in one embodiment , a lockout is tied to use of a purpose - built machine in the wrong location , which may be ascertained , for example , by use of gps geolocation . in another embodiment , a lockout is tied to use of the machine at an improper temperature . in another embodiment , a lockout is tied to use of the machine at an improper frequency of use . in another embodiment , a lockout is tied to use of the machine utilizing an improper dose . in another embodiment , a lockout is tied to use of the machine by an improper person . in another embodiment , a lockout is tied to use of the machine with an improper material . in another embodiment , the vaporizer is designed to eliminate the need for a legally approved patient to handle , come on contact with or otherwise contaminate , subdivide or transfer the material to be vaporized . in another embodiment , the vaporizer is designed to electronically alert law enforcement , care givers , insurance providers and any or all legally authorized interested parties of both proper use and illegal misuse via the internet , wi - fi , blue tooth , cellular phone , land line telephone , telegraph and or other means . in another embodiment , the vaporizer is designed to fully extract the intended compounds of the material to be vaporized by proper and exact temp settings and controlling the volume of heated air that is allowed to pass through the material to be vaporized . in another embodiment , the vaporizer is designed to “ present ” the proprietary dose cartridge to the heat source in the optimal way to insure complete vaporization of the material . in another embodiment , the vaporizer is designed to completely vaporize each dose cartridge in a single patient use and record each used dose in a simple data collection system . in another embodiment , the vaporizer is designed to detect the identity of the legally authorized user through methods that can include fingerprint sensors , retinal scanning , proprietary passwords and electric confirmation from the recommending physician , legally authorized care giver in another embodiment , the vaporizer is designed to work only with single - use dose cartridges , and will not accept a cartridge more than once even if the sample contained within is not fully vaporized . in another embodiment , the instant invention is designed to avoid unintentional combustion through use of any or all of a smaller sample ; limited temperature ; limited airflow ; and / or limited air intake . in another embodiment , the heat source is programmed to maintain a precise temperature below the maximum temperature . in the event of a malfunction temp . sensors between the heat source and the dose cartridge electronically trigger a baffle that blocks heat from substance before it exceeds the minimum temp necessary for the combustion of cannabis . in another embodiment , the medical inhalation device includes a disposable vaporizer tube . in another embodiment , the medical inhalation device includes a sterilizable vaporizer tube . in another embodiment , the medical inhalation device includes a sterile vaporizer tube . in another embodiment , the medical inhalation device further includes a one - way sanitary vapor valve . in one embodiment , the dose vaporizer cartridge is a new device that delivers a single dose of medicine ( in one embodiment , cannabis ) that has been produced for medicinal uses . in another embodiment , the dose is encapsulated between two heat - resistant screens . in another embodiment , the dose may be encapsulated between / wrapped within any available substrate , such as paper , plastic , mesh , metal , etc . in another embodiment , the two heat - resistant screens are designed so as to assist in delivering equivalent heat to the entirety of the encapsulated sample when exposed to heated air and / or convection processes . in another embodiment , the dose vaporizer cartridge is adapted and sized so as to be precisely fit into a dose vaporizer so as to provide for optimal vaporization of medical product encapsulated within the heat resistant screens . in one embodiment , the dose vaporizer cartridges are refillable . in another embodiment , the dose vaporizer cartridges are reusable . in another embodiment , the dose vaporizer cartridges are tamper - resistant , and will not work when refilled by the end user . in another embodiment , the dose vaporizer cartridges are tamper - resistant , and will work only when refilled by an authorized dispenser , who may , without limitation , be a health - care provider . in another embodiment , the dose cartridge allows physicians and / or third parties to create specific and / or customizable measured doses of medical cannabis that may be supplied within the dose cartridges . in one embodiment , such specific , controlled , measured doses of medical cannabis may include specific measured blends of multiple strains of cannabis that are combined for the treatment of specific conditions and / or the packaging of measured amounts of a single strain of medical cannabis . in one embodiment , the dose cartridge is designed to deliver a specific amount of the chemicals in medical cannabis to the patient . in one embodiment , the dose cartridge encapsulates cannabis or any and all other substances to be delivered through vaporization between two screens , pieces of mesh or otherwise suitable material . in another embodiment , the dose cartridge is tamper evident and designed to clearly record and / or visually indicate misuse or attempted misuse . in another embodiment , the cartridge is also labeled for easy identification by pharmacists , doctors patients and all caregivers . the cartridge is designed to be easily handled by patients and caregivers . in another embodiment , the cartridge is designed to only be used in a proprietary vaporizing delivery system . in another embodiment , the dose cartridges are designed to be compatible with and / or usable with a variety of brands and models of vaporizers that are available and / or may become available in the marketplace . in another embodiment , the cartridge is designed to be packaged in sterile easily identifiable boxes that can be distributed by pharmacies , doctors and any and all properly licensed caregivers or dispensaries whether traditional or automated . in another embodiment , the cartridge facilitates use of a medical product ( in one instance , cannabis ) without requiring expensive and time - consuming pretreatment of the medical product by , for example , solubilizing , heating or otherwise transforming the medical product . in another embodiment , the dose consists of sterilized cannabis or other material , for example through use of heat , ultraviolet , or gamma - ray sterilization . in one embodiment , the instant invention is designed to track and control medical cannabis and other controlled substances or drugs that can be vaporized from their growth or production through packaging and until final consumption by the legally intended patient . in one embodiment , such tracking can be facilitated by use of any of a number of available technologies , such as rfid ; internet access ; wireless access ; usb device monitoring ; smartphone application ; internet connection ; social media ; etc . in another embodiment , the instant invention is designed to collect , organize , analyze and provide accurate and precise information about the use of medical cannabis by legally authorized patients to legally authorized interested parties including , without limitation , doctors , medical researchers , patient advocates , politicians , patients , insurance providers , state governments , and government agencies . in another embodiment , the instant invention is designed to detect any or all illegal use , abuse , subdivision , and unauthorized redistribution of the materials packaged in proprietary dose cartridges for use in a proprietary vaporizer . the instant invention is designed to create and utilize a single dose / single use package for medical cannabis . in another embodiment , the instant invention is designed to record the precise time and location that a legally authorized patient ingests medical cannabis utilizing simple data recording software and / or a gps location device ; and cross - verifying barcode / rfid using an available database or other reporting / recording methods described above . in another embodiment , the instant invention is designed to rapidly and efficiently deliver the beneficial effects of medical cannabis to legally authorized patients . in another embodiment , the instant invention is designed to completely utilize and eliminate the waste of the materials including medical cannabis that is packaged in a proprietary dose cartridge and vaporized with a proprietary vaporizer . in another embodiment , the instant invention is designed to eliminate direct contact by legally authorized patients with the material packaged in proprietary dose cartridges . in another embodiment , the instant invention is designed to track a plurality of individually - packaged doses , including tracking the identity of the person utilizing the dose ; receiving the dose ; purchasing the dose ; ascertaining whether the dose was completely administered ; and ascertaining whether the dose cartridge was tampered with and / or refilled . in another embodiment , the instant invention is usable for tracking individual acquisition and use of doses , regardless of whether the individuals are located within a healthcare facility . in another embodiment , the instant invention is capable of tracking dispensation and use of a product through its full life cycle ; e . g . assessing when the relevant active ingredients have been substantially vaporized and delivered from the dose cartridge . in another embodiment , the instant invention assesses use of a dose through non - visual means . in another embodiment , such non - visible means are , for example , through use of test strips and / or chemical assays . in another embodiment , such non - visible means are indirect measurements , for example , the measurement of heat setpoint obtained and duration of heat setpoint obtained at the mouthpiece ( downstream of vaporization ) as a method of indirectly measuring extent of vaporization and incidence of combustion of the medical sample . while a number of embodiments of the present invention have been described , it is understood that these embodiments are illustrative only , and not restrictive , and that many modifications and / or alternative embodiments may become apparent to those of ordinary skill in the art . for example , any steps may be performed in any desired order ( and any desired steps may be added and / or any desired steps may be deleted ). therefore , it will be understood that the appended claims are intended to cover all such modifications and embodiments that come within the spirit and scope of the present invention .	0
fig1 is a sectional view schematically illustrating the construction of a semiconductor device according to one embodiment of the present invention . the semiconductor device is of a so - called fcbga ( flip chip ball grid array ) structure , and includes a thin wiring board 1 such as of a ceramic , a polyimide resin or a glass epoxy resin . the wiring board 1 has a wiring pattern ( not shown ) such as formed by copper plating . a thin semiconductor chip 2 , for example , having a thickness of not greater than 200 μm is bonded to a surface 11 of the wiring board 1 with its face down . more specifically , the thin semiconductor chip 2 is bonded to the board 1 and electrically connected to the wiring pattern formed on the board 1 via bumps 3 formed of an electrically conductive material such as gold so that an active surface 21 thereof including an active surface region formed with devices such as a transistor is opposed to the board surface 11 . a plurality of solder balls 4 are provided as terminals for external connection on a rear surface 12 of the wiring board 1 opposite from the surface 11 to which the semiconductor chip 2 is bonded . a frame - like stiffener 5 of a synthetic resin material such as an epoxy resin is provided around the semiconductor chip 2 . the stiffener 5 serves to strengthen the periphery of the thin wiring board 1 and to keep the planarity of the wiring board 1 . a surface 51 of the stiffener 5 opposite from the wiring board 1 is generally flush with a non - active surface 22 of the semiconductor chip 2 opposite from the active surface 21 . as required , a heatsink plate 6 for dissipating heat from the semiconductor chip 2 is provided on the semiconductor chip 2 and the stiffener 5 as indicated by a phantom line in fig1 . if there was a height difference between the non - active surface 22 of the semiconductor chip 2 and the surface 51 of the stiffener 5 in this case , it would be difficult to attach the heatsink plate 6 in contact with both the non - active surface 22 of the semiconductor chip 2 and the surface 51 of the stiffener 5 . in this embodiment , however , the non - active surface 22 of the semiconductor chip 2 is generally flush with the surface 51 of the stiffener 5 , so that the heatsink plate 6 can easily be provided in contact with both the non - active surface 22 of the semiconductor chip 2 and the surface 51 of the stiffener 5 . further , a production serial number and the like can be inscribed across the non - active surface 22 of the semiconductor chip 2 and the surface 51 of the stiffener 5 , since the non - active surface 22 of the semiconductor chip 2 is generally flush with the surface 51 of the stiffener 5 . even if the semiconductor chip 2 has a small size as viewed in plan , a sufficient space can be provided for the inscription . a space d is provided between the semiconductor chip 2 and the stiffener 5 . even if the semiconductor device is exposed to a high temperature , a difference in thermal expansion between the semiconductor chip 2 and the stiffener 5 can be accommodated by the space d . therefore , the warp of the semiconductor device can be prevented which may otherwise occur due to the thermal expansion . a low elasticity filler 7 such as of a synthetic resin material ( e . g ., a polyimide resin ) having a lower elasticity than the stiffener 5 is filled in a space defined between the surface 11 of the wiring board 1 and the active surface 21 of the semiconductor chip 2 . thus , the active surface 21 of the semiconductor chip 2 can be protected , and stresses exerted on the bumps 3 can be alleviated . the non - active surface 22 of the semiconductor chip 2 and the surface 51 of the stiffener 5 are preferably mirror surfaces finished by a chemical polishing process . when the semiconductor device is mounted on a mounting board under monitoring with a camera , for example , the camera can recognize the semiconductor device with an improved accuracy because diffused light reflection on the non - active surface 22 of the semiconductor chip 2 and the surface 51 of the stiffener 5 is suppressed . therefore , the semiconductor device can accurately be positioned at a desired mounting position on the mounting board . the mirror - finished non - active surface 22 and surface 51 each have an increased surface strength , so that the warp of the semiconductor device can more effectively be prevented which may otherwise occur due to the thermal expansion . fig2 ( a ) to 2 ( d ) are sectional views illustrating a process sequence for fabrication of the semiconductor device shown in fig1 . fig2 ( a ) illustrates a chip bonding step . in the chip bonding step , a semiconductor chip 2 is face - down bonded to a surface 11 of a wiring board 1 formed with a wiring pattern with an active surface 21 thereof being opposed to the surface 11 . at this time , the semiconductor chip 2 bonded to the wiring board 1 has a relatively great thickness , for example , on the order of 300 μm to 650 μm . thereafter , a material for a low elasticity filler 7 is injected into a space defined between the surface 11 of the wiring board 1 and the active surface 21 of the semiconductor chip 2 , whereby the space between the surface 11 and the active surface 21 is sealed with the low elasticity filler 7 . fig2 ( b ) illustrates a resin providing step to be performed after the chip bonding step . in the resin providing step , a liquid thermo - setting resin as a material for a stiffener 5 is applied on the surface 11 of the wiring board 1 mounted with the semiconductor chip 2 to surround the periphery of the semiconductor chip 2 . then , the resulting board is subjected to a heat treatment , whereby the thermo - setting resin provided around the semiconductor chip 2 is hardened for formation of the stiffener 5 . after the hardening of the thermo - setting resin , a planarization step ( polishing step ) is performed as shown in fig2 ( c ). in the planarization step , the semiconductor chip 2 and the stiffener 5 are simultaneously ground by means of a grinder . at this time , the simultaneous grinding of the semiconductor chip 2 and the stiffener 5 can alleviate a stress exerted on the semiconductor chip 2 during the grinding . thus , the warp and chipping of the semiconductor chip 2 can be prevented . the simultaneous grinding of the semiconductor chip 2 and the stiffener 5 is carried out until the thickness of the semiconductor chip 2 and the stiffener 5 reaches a target thickness level t as indicated by a two - dot - and - dash line in fig2 ( b ). the target thickness level t is set , for example , so that the thickness of the semiconductor chip after the polishing is not greater than 200 μm . where a non - active surface 22 of the semiconductor chip 2 and a surface 51 of the stiffener 5 are to be mirror - finished , a chemical polishing process with the use of a chemical agent or a cmp ( chemical mechanical polishing ) process is performed after the planarization step . as required , a heatsink plate 6 ( see fig1 ) is attached onto the semiconductor chip 2 and the stiffener 5 . then , a plurality of solder balls 4 are provided on a rear surface 12 of the wiring board 1 as shown in fig2 ( d ). thus , the semiconductor device having the aforesaid construction is fabricated . the step of injecting the material for the low elasticity filler 7 into the space between the surface 11 of the wiring board 1 and the active surface 21 of the semiconductor chip 2 may be performed after the resin provision step or after the planarization step . while the embodiment of the present invention has thus been described , the invention may be embodied in any other ways . the planarization for making the non - active surface 22 of the semiconductor chip 2 and the surface 51 of the stiffener 5 generally flush with each other is achieved by the grinding with the use of the grinder in the embodiment described above , but may be achieved by a chemical polishing process or a cmp process . further , the stiffener 5 is formed of the synthetic resin material in the embodiment described above , but may be formed of a metal material . in this case , a metal stiffener 5 is provided on the surface 11 of the wiring board 1 , and then the semiconductor chip 2 and the metal stiffener 5 are simultaneously planarized . although the aforesaid embodiment is directed to the semiconductor device of the fcbga structure having the ball - shaped terminals for external connection , the present invention may be applied to semiconductor devices of a flip chip bonding structure which have pin - shaped or land - shaped lead terminals . further , the invention may be applied not only to the semiconductor devices of the flip chip bonding structure but also to semiconductor devices of a chip - on - chip structure in which semiconductor chips are bonded to each other with active surfaces thereof being opposed to each other . while the present invention has been described in detail by way of the embodiment thereof , it should be understood that the foregoing disclosure is merely illustrative of the technical principles of the present invention but not limitative of the same . the spirit and scope of the present invention are to be limited only by the appended claims . this application corresponds to japanese patent application no . 2000 - 322814 filed to the japanese patent office on oct . 23 , 2000 , the disclosure thereof being incorporated herein by reference .	7
the polymers used in the preferred embodiments of the present invention are prepared by the polycondensation of dimethyl terephthalate , dimer acid , or preferably its diisopropyl ester and a polymethylene diol ( n = 4 to 8 , and preferably 4 ). ## str7 ## the preferred parent dimer acid of the diisopropyl ester utilized in the polymerizations is derived from high purity oleic acid and is formed by a clay catalyzed high pressure dimerization of the oleic acid in the presence of water . the mechanism of formation of the dimer acid is probably free radical in nature and the product is believed to consist of a mixture of acyclic unsaturated c 36 acids . the unsaturated materials are then hydrogenated and the dimer ester used in the present polymerizations possesses a slight degree of unsaturation as evidenced by an iodine number of 5 . in addition to the c 36 acids that make up the dimer acid there is present some monofunctional acid ( iso - stearic ) and a certain quantity of trifunctionality in terms of a &# 34 ; trimer ( c 54 ) acid .&# 34 ; the former may act as a chain terminator and the latter as crosslinking agent . detailed structures of the c 36 components of the dimer acid have not been elucidated as yet and the diacid is sometimes represented graphically as shown below ( with four almost equal branches ). ## str8 ## the reaction may be run in the absence or preferably in the presence of stabilizers taken from the types of hindered phenols or secondary aromatic amines . an example of the former is irganox 1098 sold by ciba - geigy [ n , n &# 39 ;- hexamethylene bis ( 3 , 5 - ditert - butyl - 4 - hydroxy hydrocinnamide )] and an example of the latter is naugard 445 sold by uniroyal [ 4 , 4 &# 39 ;- bis ( α , α - dimethylbenzyl ) diphenyl amine )]. oxides and alkoxides of numerous polyvalent metals may be employed as catalysts . a preferred catalyst for the polymerization is a mixture of 0 . 1 % tetrabutyl orthotitanate and 0 . 005 % magnesium acetate ( percentages based on total charge weight ). if a dyed end product is desired a compatible dye such as , for instance , d & amp ; c green # 6 can be added in suitable concentrations based on expected polymer yield . the polymerization is run in two stages . in the first stage , run under nitrogen at temperatures ranging from 160 ° to 250 ° c ., polycondensation via transesterification and esterification occurs resulting in oligomeric chains . these are converted to materials having a high degree of polymerization in the subsequent step run at 240 ° to 255 ° c ., at pressures of less than 1 mm of mercury . the resulting polymers exhibit inherent viscosities ( measured in hexafluoroisopropyl alcohol ) of 0 . 6 to 1 . 3 . the tm of the polymers , depending on composition , varies from 190 ° to 210 ° c . apparent viscosities at suitable extrusion temperatures vary from 2 × 10 3 to 9 × 10 3 poise . a summary of polymer properties is given in table i . the polymers may readily be extruded in a ram type extruder , such as , an instron capillary rheometer , at temperatures usually exceeding the polymer tm by 10 ° to 50 ° c . the resulting extrudate may be drawn , usually in a two - stage process using either two consecutive heated glycerine baths or a hot shoe followed by a subsequent glycerine bath . the draw ratio may vary from about 400 to 700 %. the oriented fibers exhibit properties that are quite unexpected . size 3 / 0 strands possess knot tensiles in the 35 - 40 × 10 3 psi range , straight tensiles in the 60 - 80 × 10 3 psi range and a young &# 39 ; s modulus of less than 150 × 10 3 psi . elongations range from 35 to 50 %. in summary , the polymers described lend themselves to ready extrusion and drawing to strong and supple fibers which are useful as flexible monofilament sutures . both stabilized and unstabilized fibers , upon co 60 sterilization ( 2 . 5 megarads ) suffer practically no losses in physical properties as judged by a comparison of inherent viscosities and tensile strength before and after sterilization . the unexpected retention of physical properties revealed by the unstabilized fibers presents a distinct advantage of the present invention over prior art . the desired amounts of dimethyl terephthalate , diisopropyl dimerate ( obtained from emery industries as emerest 2349 ), a 1 . 3 to 2 . 0 molar excess of a polymethylene diol and a given stabilizer are placed under nitrogen into a dry reactor fitted with an efficient mechanical stirrer , a gas inlet tube and a takeoff head for distillation . the system is heated under nitrogen to 160 ° and stirring is begun . to the homogeneous stirred solution the required amount of catalyst is added . the mixture is stirred and heated under nitrogen for given time periods at 190 ° c . ( 2 - 4 hours ) and 220 ° c . ( 1 - 3 hours ). the temperature is subsequently raised to 250 ° to 255 ° c . and over a period of 0 . 4 - 0 . 7 hours , the pressure is reduced in the system to below 1 mm / hg ( preferably in the range of 0 . 05 mm to 0 . 1 mm ). stirring and heating under the above conditions is continued to the completion of the polymerization . the endpoint is determined by either ( a ) estimating visually the attainment of maximum melt viscosity , ( b ) measuring inherent viscosity or melt indices of samples removed from the reaction vessel at intermediate time periods , and ( c ) using a calibrated torquemeter immersed into the mixture . in practice , depending on the terephthalate / dimerate ratio , in vacuo reaction times vary from 2 to 13 hours . at the end of the polymerization cycle the hot mixture is equilibrated with nitrogen and allowed to cool slowly . the reaction product is isolated , chilled in liquid nitrogen and ground . the ground chips are dried at 80 ° to 110 ° c . for 8 to 16 hours under vacuum of 1 mm or less and subsequently submitted for extrusion . extrusion through the instron rheometer is geared towards producing an extrudate which upon drawing ( 5 × to 7 × ratio ) yields a fiber in the 8 - 10 mil diameter range ( size 3 / 0 suture ). the polymers are packed at 110 ° to 130 ° c . in the extrusion chamber and extruded after a dwell time of 9 to 15 minutes through a 40 mil die . the ram speed is 2 cm / minute . extrusion temperatures depends both on the polymer tm and on the melt viscosity of the material at a given temperature ; usually extrusion proceeds at temperatures of 10 ° to 50 ° c . above the tm . die swells of up to 40 % are experienced by usually are much smaller ( 5 - 20 %); the extrudate is taken up at a speed of 18 feet per minute . the extrudate ( diameter range , 19 - 22 mm ) is passed through rollers at an input speed of four feet per minute onto a hot shoe or into a draw bath varied from 50 ° to 100 ° c . draw ratio in this first stage of operation vary from 5 × to 6 ×. the drawn fibers are placed over another set of rollers into a glycerine annealing bath ( second stage ) kept at temperatures ranging from 70 ° to 95 ° c . draw ratios for the second stage operation vary from 1 . 1 × to 1 . 25 ×. finally , the fiber is passed through a water wash bath and taken up on a spool . in the following examples inherent viscosity ( ninh ) is obtained for polymer solutions in hexafluoro - 2 - propanol ( hfip ) ( 1 g ./ 1 ). the infrared spectra are obtained for polymer films cast from chcl 3 or hfip . the nmr spectra are recorded for polymer samples in solution in 60 / 40 hexafluoroacetone sesquideuterium oxide . the glass transition ( tg ), crystallization ( tc ) and melting ( tm ) temperatures of the polymers in nitrogen are recorded , using a d . s . c . ( differential scanning calorimetry ) apparatus . the percent crystallinity is determined by x - ray . a hot - stage microscope is used to determine the melting behaviour of the polymers . fiber tensile properties are measured on an instron , model no . 1122 . steel faced jaws are used throughout . for the measurement of the young &# 39 ; s modulus , line contact jaws are applied . for straight tensile and moduli measurements a speed of 100 mm / min ., a chart speed of 200 mm / min . and a gauge length of 12 cm is employed . for knot tensiles the above parameters are 100 mm / min ., 100 mm / min . and 5 cm , respectively . the following materials are placed in a nitrogen glove box into a flamed , vacuum dried two - necked round bottom flask fitted with a stainless steel paddle shaped stirrer : the open neck is fitted with a rubber septum , the flask and stirrer assembly is removed from the glove box , attached to an efficient mechanical stirrer and placed into an oil bath heated at 160 ° c . after several minutes , the reaction mixture liquifies and mechanical stirring is started . the catalyst ( 1 . 0 ml ) consisting of 0 . 1 % tetrabutyl orthotitanate and 0 . 005 % magnesium acetate ( percentages based on total charge weight ) dissolved in a mixture of methanol and butanol is added through the septum to the reaction via a syringe . the septum is replaced by a short distilling head fitted with a receiver and a nitrogen inlet nozzle . the reaction mixture is heated under nitrogen at 190 ° c . for 3 hours and at 220 ° c . for 2 hours . as the methanol distillation ceases , the reaction temperature is increased to 250 ° c ., the receiver containing the distillate is replaced by an empty flask and gradually , over a period of 30 minutes , the pressure in the reaction setup is reduced to 0 . 08 mm . the mixture is heated at this pressure and at 250 ° c . for 4 hours . the hot viscous mass is equilibrated with nitrogen and allowed to cool to room temperature . the polymer is isolated , chilled and then ground . the polymer chips are dried for 8 hours under a good vacuum and a temperature of 80 ° c . properties of the polymer and of others prepared by similar reaction schemes are shown in table i ( see sample # 6 for above - described polymer ). the procedure of example i is followed , in all respects with the one exception that a like quantity of dimethyl isophthalate is substituted in place of the dimethyl terephthalate used in the initial reaction mixture . the final product is a poly ( tetramethylene dimerate coisophthalate ) polymer . the procedure of example i is followed in all respects , with the one exception that 52 . 4 g . of dimethyl cyclohexane - 1 , 4 - dicarboxylate is substituted in place of the 50 . 8 g . of the dimethyl terephthalate used in the initial reaction mixture . the final product is a poly ( tetramethylene dimerate co - cyclohexane - 1 , 4 - dicarboxylate ) polymer . ten grams of the copolymer described in example i are packed at 150 ° c . into the extrusion chamber of an instron rheometer and after 15 minutes of dwell time the sample is extruded at a ram speed of 2 cm / min ., a shear rate of 212 . 6 sec - 1 and a temperature of 250 ° c . the resulting melt viscosity is found to be 6178 poise . the takeup speed of the extrudate is 18 ft / min . and the extrudate is quenched in ice water . the diameter of extrudate is 21 . 0 mils . the extrudate is drawn at 5 × over a hot shoe held at a temperature of 99 ° c . and at 1 . 2 × through a glycerine bath kept at 95 ° c . the fiber is pulled through a water bath ( room temperature ) to remove the glycerine and taken up on a spool . the draw tension for both the first drawing stage is 420 g . and for the second stage 380 g . ; the total draw ratio is 6 . 0 ×. tensile data for fibers obtained in this and other runs are shown in table ii . fibers prepared from polymer # 9 ( table i ) are strung under a tension of 50 g . on an adjustable annealing rack . the adjustable bar is lowered about 10 % to allow the fibers to relax freely . after 16 hours the adjustable bar is raised to a height which is sufficient to straighten the fibers without imparting any tension ( 0 % relaxation ). the fibers are subjected to one hour of heating at 110 ° c . and then cut off the annealing rack . fibers annealed in this manner , upon exposure to free shrinkage ( 60 ° c ./ 2 . 5 hours ) shrink 2 . 3 % as opposed to 15 . 6 % for unannealed strands . copolymer x , which is the poly ( tetramethylene dimerate - co - terephthalate ) of example i of the hoeschele u . s . pat . no . 3 , 954 , 689 was prepared , the molar monomer ratio [ dimerate / terephthalate ] being 15 : 725 / 84 : 275 and the poly . ninh at 25 ° c . in hfip being 1 . 32 . in addition , homopolymer y , which comprises poly ( tetramethylene terephthalate ) [ pbt ] was prepared , the polyninh at 25 ° c . in hfip being 1 . 52 . polymers x and y were subjected to extrusion in the same manner as indicated in example iv , but the extrusion and orientation conditions were as follows : a 40 mil . die was used and the shear rate was 212 . 6 sec - 1 ______________________________________ copolymer x homopolymer y______________________________________1 . extrusion conditions temperature 240 ° c . 250 ° c . αapp ., sec . sup .- 1 212 . 6 212 . 6 ηapp ., poise 10 , 207 8 , 2732 . draw ratio 4 × at 72 ° c . 4 × at 71 ° c . 1 . 2 × at 90 ° c . 1 . 25 at 90 ° c . 3 . tensile properties tensile strength 71 , 657 psi 70 , 011 psi knot strength 28 , 427 psi 64 , 958 psi elongation 62 % 32 % young &# 39 ; s modulus 36 , 266 psi 398 , 953 psi______________________________________ table i__________________________________________________________________________synthesisand properties of poly ( tetramethylene dimerate co terephthalate ) polymers polymerizationmonomer % d & amp ; c reaction scheme poly . ηinhsample ratio * stabilizer green # 6 temp . pressure time at 25 ° c . m . p . ° c . no . d / t type ** ( by wt .) ° c . mm hg hours in hfip ( microscopy ) tm ° c . __________________________________________________________________________1 13 / 87 naugard 445 0 160 atm . n . sub . 2 0 . 2 0 . 90 not not ( 1 %) 190 &# 34 ; 3 . 0 available available 220 &# 34 ; 2 . 5 250 &# 34 ; 1 . 5 250 0 . 05 5 . 02 13 / 87 naugard 445 0 160 atm . n . sub . 2 0 . 2 0 . 98 195 - 197 196 ( 1 %) 190 &# 34 ; 3 . 0 220 &# 34 ; 2 . 5 250 &# 34 ; 1 . 5 250 0 . 05 2 . 03 13 / 87 naugard 445 0 160 atm . n . sub . 2 0 . 2 0 . 90 195 - 196 195 ( 1 %) 190 &# 34 ; 3 . 0 220 &# 34 ; 2 . 5 250 &# 34 ; 1 . 5 250 0 . 05 2 . 04 13 / 87 naugard 445 0 . 3 160 atm . n . sub . 2 0 . 2 1 . 17 197 - 199 194 ( 1 %) 190 &# 34 ; 3 . 0 220 &# 34 ; 2 . 5 250 &# 34 ; 1 . 5 250 0 . 05 4 . 05 12 / 88 naugard 445 0 . 3 160 atm . n . sub . 2 0 . 2 0 . 96 197 - 198 199 ( 1 %) 190 &# 34 ; 3 . 0 220 &# 34 ; 2 . 0 250 0 . 05 13 . 06 12 / 88 naugard 445 0 . 3 160 atm . n . sub . 2 0 . 2 1 . 21 197 - 198 199 ( 1 %) 190 &# 34 ; 3 . 0 220 &# 34 ; 2 . 0 250 0 . 05 4 . 07 12 / 88 naugard 445 0 160 atm . n . sub . 2 0 . 2 1 . 00 198 - 200 203 ( 1 %) 190 &# 34 ; 2 . 5 220 &# 34 ; 3 . 0 250 0 . 05 8 . 08 11 / 89 naugard 445 0 160 atm . n . sub . 2 0 . 2 0 . 63 203 - 208 204 ( 1 %) 190 &# 34 ; 3 . 5 220 &# 34 ; 1 . 8 250 &# 34 ; 1 . 5 250 0 . 05 5 . 39 10 / 90 naugard 445 0 160 atm . n . sub . 2 0 . 2 1 . 15 not not ( 1 %) 190 &# 34 ; 3 . 0 available available 220 &# 34 ; 2 . 0 250 0 . 05 7 . 510 10 / 90 naugard 445 0 . 3 160 atm . n . sub . 2 0 . 2 1 . 06 202 203 ( 1 %) 190 &# 34 ; 3 . 0 200 &# 34 ; 2 . 0 250 0 . 05 5 . 011 10 / 90 none 0 . 3 160 atm . n . sub . 2 0 . 2 1 . 08 202 - 203 202 190 &# 34 ; 3 . 0 220 &# 34 ; 2 . 0 250 0 . 08 4 . 012 10 / 90 irganox 1098 0 . 3 conditions same as in 1 . 24 202 - 203 205 ( 0 . 25 %) sample 11 . __________________________________________________________________________ * d = dimerate moiety ; t = terephthalate moiety . ** naugard 445 : 4 , 4 &# 39 ; bis ( α , dimethylbenzyl ) diphenyl amine irganox 1098 n , n &# 39 ;-- hexamethylene bis ( 3 , 5ditert - butyl - 4 - hydroxyhydrocinnamide ) table ii__________________________________________________________________________extrusion and drawing conditions andultimate tensile properties for fiber derived from dimerate co terephthalate ) polymersextrusion drawing conditions tensile propertiesconditions ratio t ° c . knot straight % y . m . sample ηapp 1st 2nd 1st 2nd dia . ( psi × ( psi × elong - ( psi × no . t ° c . ( poise ) stage stage stage stage ( mil ) 10 . sup .- 3 ) 10 . sup .- 3 ) ation 10 . sup .- 3 ) __________________________________________________________________________1 215 5587 5 × 1 . 3 × 52 75 9 . 2 35 . 1 69 . 8 49 79 . 62 210 5050 6 × 1 . 08 × 85 92 8 . 6 32 . 5 74 . 0 47 79 . 23 210 5050 6 × 1 . 08 × 85 92 8 . 6 35 . 3 67 . 0 42 82 . 34 230 7682 5 × 1 . 1 × 96 95 9 . 5 36 . 3 75 . 8 43 108 . 55 225 6124 5 × 1 . 2 × 99 95 9 . 7 35 . 5 71 . 2 55 60 . 06 250 6178 5 × 1 . 2 × 99 95 9 . 0 40 . 6 81 . 4 41 117 . 27 215 7198 5 × 1 . 15 × 85 92 9 . 1 41 . 2 70 . 9 40 134 . 28 215 1128 6 × 1 . 17 × 52 72 8 . 2 37 . 3 66 . 7 35 141 . 29 220 9616 5 × 1 . 2 × 85 90 9 . 1 38 . 7 82 . 1 42 147 . 710 215 6285 5 × 1 . 25 × 79 79 9 . 2 43 . 8 70 . 3 40 162 . 211 210 7735 5 × 1 . 25 × 82 79 9 . 4 39 . 9 57 . 3 37 125 . 812 235 8541 5 × -- 91 -- 9 . 8 41 . 1 62 . 6 48 138 . 9__________________________________________________________________________ the poly ( polymethylene terephthalate , isophthalate or cyclohexane - 1 , 4 - dicarboxylate - co - dimerate ) used in accordance with the present invention may be spun as multifilament yarn and woven or knitted to form sponges or gauze , ( or nonwoven sheets may be prepared ) or used in conjunction with other compressive structures as prosthetic devices within the body of a human or animal where it is desirable that the structure have high tensile strength and desirable levels of compliance and / or ductility . useful embodiments include tubes , including branched tubes , for artery , vein or intestinal repair , nerve splicing , tendon splicing , sheets for tying up and supporting damaged kidney , liver and other abdominal organs , protecting damaged surface areas such as abrasions , particularly major abrasions , or areas where the skin and underlying tissues are damaged or surgically removed . in more detail , the surgical and medical uses of the filaments of the present invention include , but are not necessarily limited to :	0
the present invention is based on the discovery that adeno - associated virus - derived vectors efficiently transduce primate pluripotent hemopoietic stem cells . adeno - associated virus has not been reported to transduce pluripotent hemopoietic stem cells of primates and aav - derived vectors have not been shown to transduce hemopoietic cells with in vivo repopulating ability , in addition , it is surprising that the vector integrates with high efficiency into p - phsc , even though most of the p - phsc are not actively dividing at the time of infection . this is surprising , since it has been established that raav integration in dividing cells occurs 200 times more efficiently in dividing , as opposed to nondividing cells [ 38 ]. also , it was reported that primary cells are much less efficiently transduced by raav than immortalized cell lines [ 47 ]. in addition , it was reported that orf 6 from adenovirus e4 - region stimulates transduction by recombinant aav [ 48 ]. in a gene therapy setting , it is undesirable to have functionally active adenovirus present due to toxicity problems caused by the virus directly or the immune system of the patient . at the keystone symposium on molecular and cellular siology , taos , n . mex . feb . 4 - 10 , 1996 , prof . a . nienhuis presented a paper stating that they transduced rhesus monkey cd34 + cells and , subsequently , autologously transplanted the infected cells [ 49 ]. analysis of the peripheral blood cells circulating in blood with a polymerase chain reaction specific for the raav revealed that cells carrying the raav were only detected up until 7 days post transplantation [ 49 ], i . e . p - phsc were not transduced by raav in their experiment . nonetheless , the present invention demonstrates that an adeno - associated virus - derived vector may be used to deliver exogenous dna efficiently to cells of the hemopoietic system with long term repopulating ability . the current perception of aav - integration into the cellular host chromosome is that the pre - integration complex is stable in cells . although integration occurs more efficiently in dividing cells , the pre - integration complex is stable in non - dividing cells and integrates when the cell is triggered to undergo cell cycling [ 38 , 60 ]. the primate - derived hemopoietic stem cells and committed progenitor cells upon autologous transplantation into an irradiated recipient are triggered into cycle to repopulate the destroyed hemopoietic system . for this reason , it is generally believed that the hemopoietic cells need not be triggered in vitro . for this reason , protocols to transduce hemopoietic progenitor cells with raav do not involve culturing the cells in the presence of hemopoietic growth factors . although this reasoning is very plausible with the current information , we devised experiments to investigate the effect of in vitro culture of hemopoietic stem cells and the in vitro stimulation with hemopoietic growth factors . as used herein , the term “ recombinant aav vector ” means a dna sequence flanked at each end by an aav - itr or functional equivalent or part thereof . the recombinant aav vector can be used directly or be packaged into a complex before use , as used herein , the term “ complex ” is defined as a combination of two or more components physically linked to each other through hydrophobic , hydrophilic or electrostatic interactions or covalent bonds , whereby one component of the complex at least is a recombinant aav molecule . other components of the complex can comprise , but are not limited to , one or a combination of liposomes , calcium phosphate precipitate , polylysine , adenovirus , adenovirus proteins , rep78 , rep68 , aav capsids or the aav capsid proteins vp1 , vp2 or vp3 . in a preferred embodiment the complex consists of the recombinant aav vector and the aav capsid proteins . this complex can be , but is not limited to , the form of an intact virion or particle where the recombinant aav vector is packaged inside an aav capsid or functional analogs thereof . as used herein , the term “ functional analogs ” refers to the same activity in kind , but not in amount or degree , i . e . not quantitatively . when the recombinant aav is packaged into aav particles , the size of the dna sequence will be limited by the size constraints for packaging into aav particles which , with the current state of the technology , is about 5 kb . the dna fragment preferably does not contain sequences functionally analogous to the terminal resolution site in the aav - itr as this might interfere with the stability of the recombinant vector . the dna sequence can be any sequence with therapeutic properties when introduced into hemopoietic stem cells , but the dna sequence preferably encodes one or more proteins or rna with therapeutic properties when expressed in hemopoietic cells . non - limiting examples of such sequences are the human β - globin gene operably linked to cis - acting sequences for erythroid specific physiological expression , the human lysosomal glucocerebrosidase gene ( e . c3 . 2 . 1 . 45 ), the α1 - antitrypsin gene , a dna sequence encoding an rna or protein with anti - viral activity or the multidrug resistance gene i ( mdri ). aav - itr sequences may be obtained from aav serotypes 1 , 2 , 3 , 4 or 5 . alternatively , mutant or recombinant itr sequences can be used , which retain the essential properties of the aav - itr prototype , examples of which are described in lefebvre et al , [ 50 ]. packaging of raav into aav - virions can be achieved using a variety of different methods . all methods are based on bringing the necessary proteins and raav - containing dna in an environment that supports the replication and packaging of raav , one method relies on the transfection of adenovirus 5 infected human cells with a plasmid carrying the raav - dna together with a plasmid containing expression cassettes for the aav - genes rep and cap . upon continued culture of the manipulated cells , raav is replicated and packaged . after three days , the cells are harvested and the accumulated recombinant virions are released from the cells [ 15 - 19 ]. a variation on the packaging system described above is the use of packaging cells that carry all or part of the relevant sequences stably integrated in their genome ( i . e . the recombinant aav vector , the rep - gene , the cap - gene , and the relevant protein coding domains of the helper virus ). when only partial packaging cells are used , the missing packaging functions have to be supplied externally via transtections of plasmids carrying the functions or virus infection . the helper virus functions are required for efficient packaging of recombinant aav . for most applications , the helper virus is inactivated or separated physically from the recombinant aav virions before using the recombinant aav virions for the transduction of cells [ 15 - 19 ]. recombinant aav vectors can be packaged by adding the recombinant aav - dna to protein extracts or mixtures of protein extracts of cells that expressed all or part of the relevant proteins for the replication and packaging of recombinant aav . when protein extracts are used from cells expressing only some of the relevant proteins for packaging of recombinant aav , the missing proteins can be supplied externally in purified form . the rep - gene can be derived from aav serotypes 1 - 5 or functional analogues thereof either obtained through non - essential mutations in the rep - genes or through the isolation of genes with similar capabilities such as the human herpesvirus 6 aav - 2 rep gene homologue [ 58 ]. the cap - gene can be derived from aav serotypes 1 - 5 or functional analogues thereof obtained through non - essential mutations in the cap - genes . alternatively , the cap - gene sequences can be altered through the replacement or addition of sequences rendering the produced virion new or altered target cell specificities . recombinant aav virions produced by the methods described above can be purified and concentrated using biological , physical or chemical separation techniques such as , but not limited to , antibody affinity purification , density gradient centrifugation or ion exchange chromatography . alternatively , the virions produced can be used in an unpurified form . as used herein , pluripotent hemopoietic stem cells from primates ( p - phsc ) are functionally defined as cells from primates with the capability to form and maintain an entire hemopoietic system , ranging from mature t - cells , b - cells , macrophages or erythrocytes to new p - phsc . p - phsc display this capability in unmanipulated primates or upon their autologous transplantation . sources of p - phsc are the bone marrow , the peripheral blood or cord blood . p - phsc can be collected from unmanipulated primates or from primates treated with compounds such as , but not limited to , cytostatic drugs or hemopoiatic growth factors to activate , recruit or otherwise potentiate the p - phsc . transduction of p - phsc is preferably performed ex vivo , following harvesting of the p - phsc from a suitable source , and after the transduction the transduced cells are autologously transplanted . in a preferred embodiment of the invention , the p - phsc are cultured during their ex vivo transduction , where it is most preferred that during this culture the p - phsc are stimulated with at least one hemopoietic growth factor , such as , e . g ., interleukin - 3 . alternatively , p - phsc transduction is performed in vivo when suitable methods have been developed to target the recombinant aav vector in vivo to p - phsc . table 1 key properties of adeno - associated virus vectors and amphotropic retrovirus vectors . table 2 characterization of recombinant aav preparations useful for the transduction of primate phsc . fig1 a recombinant aav - vectors useful for the transduction of primate phsc . lcr = core sequences from hypersensitive sites 4 , 3 and 2 from the β - globin locus control region . − 103 = human β - globin gene promoter fragment extending − 103 upstream of the transcription start site . − 265 = human β - globin gene promoter fragment extending − 265 upstream of the transcription start site . β - globin = human β - globin gene with modified intron 2 ( see text and 21 ). tkprom = herpes simplex virus thymidine kinase gene promoter ( approx . 500 bp nari - bgiii fragment ) pa = polyadenylation signal from herpes simplex virus thymidine kinase gene λapprox . 500 bp smai - nari fragment ). β - globin = human β - globin gene with in the 5 ′ untranslated region three point mutations that generate two restriction enzyme sites ( see fig1 b ). δmo + pyf101 a moloney murine leukemia virus long terminal repeat fragment in which the moloney enhancer is replaced by an enhancer from a mutant polyoma virus that was selected to grow on embryonal carcinoma cells [ 2 , 51 , 52 , 53 ]. fig1 b nucleotide sequence of the 5 ′ untranslated region ( utr ) of the normal ( β ) and the marked ( β ) human β - globin gene . fig2 detection of recombinant aav in rhesus monkey peripheral blood cells . blood cells were collected as described in the text . peripheral blood mononuclear cells ( wbc ) were separated from the granulocytes ( gran ) and a neospecific nested pcr was performed on the dna of both cell types . dna from the nested pcr was analyzed on agarose gels and compared to positive and negative control samples . the sensitivity of the nested pcr was such that approximately one raav - vector could be detected in a background of 10 5 negative cells . (+) indicates the presence of a neo - specific band and (−) the absence of a neo - specific band in the agarose gel . fig3 a - 3b graphic representation of direct and nested neo - specitic pcr data from monkeys bb94 and a94 ( fig3 a ) and monkeys 9128 en 9170 ( fig3 b ). the data on the latter two monkeys shown in fig2 are included in fig3 as well . for clarity , negative pcr - results were not included in the graphs . closed circles ( pbmc ) and closed squares ( granulocytes ) indicate the time - points after transplantation at which the vector was detected . arrows in fig3 b indicate the time - points at which docetaxel ( taxotere ) was administered . fig4 detection of neo - specific sequences in hemopoietic cells from rh bb94 at 16 months post transplantation . bm ( bone marrow ) , pbmc ( peripheral blood mononuclear cells ), gran ( granulocytes ). fig5 detection of vector specific globin sequences in rhesus monkey peripheral blood cells ( samples from 2 months ( a94 ) and 6 months ( bb94 ) post - transplantation ) with this pcr , the two vectors ig - cft and ig - cft * are discriminated since the size of the ig - cft * fragment is approximately 150 pb . longer than the fragment specific for ig - cft . ligation of recombinant aav vectors containing the human β - globin gene and / or the neo r gene in order to determine whether recombinant aav could transduce p - phsc , it was necessary to generate appropriate vectors . we generated three different recombinant aav - vectors , which are schematically represented in fig1 a . the ligation of the vector ig - cft containing a human β - globin gene together with sequences from the β - globin locus control region and the neo r - gene is described in [ 21 ], ig - cft * differs from ig - cft in the size of the human β - globin promoter and in the presence of three point mutations in the 5 ′ untranslated region ( utr ) of the human β - globin gene , in ig - cft , the promoter driving β - globin expression extends 265 bp upstream of the transcription start site instead of the 103 bp in ig - cft . in ig - cft , three point mutations in the 5 ′ utr of the human β - globin gene created two new restriction sites , one for xbai and one for hindiii , see also fig1 b . ig - δmoneo ( depicted in fig1 a ) contains the raav - backbone ( xbai - fragment ) from psub201 [ 51 ], the nhei - smai promoter - fragment from the δmo + pyf101 ltr [ 53 ], the bglii - smai fragment from the tn5 - derived neo r - gene followed by the smai - nari poly - adenylation signal from herpes simplex virus ( hsv ) thymidine kinase ( tk ) gene [ 54 ]. the elements were linked together using the polylinker from pbluescript sk + ( stratagene ). the 293 cell line [ 55 ], which is a human embryonic kidney cell line transformed with ads dna , the a549 cell line , which is a human bronchial carcinoma cell line , and the c88 cell line [ 56 ], which is a murine erythroleukemia ( mel ) cell line , were maintained in dmem ( gibco - brl ) containing 10 % fetal calf serum ( fcs ), 100 μg / ml streptomycin and 100 u / ml penicillin . recombinant aav was produced by transfecting a raav packaging plasmid and a vector plasmid into approx . 90 % confluent permissive 293 cells . the cells were made permissive for aav - replication by transfecting them with a plasmid capable of expressing all the relevant early genes from adenovirus but not the late genes or by infecting them with adenovirus ts149 with a multiplicity of infection of 20 . the packaging plasmid was either paav / ad [ 15 ] or pim45 , which contains sequences 146 to 4493 from wtaav2 in the polylinker of pbluescript , the ratio of vector plasmid dna to packaging plasmid dna was 1 : 10 to accommodate the fact that the recombinant aav vector upon expression from the packaging plasmid replicates , whereas the packaging plasmid does not replicate . for crude virus stocks , the cells were harvested in their own culture medium after two to three days and subjected to three freeze / thaw cycles . the latter was performed by intermittent freezing and thawing in liquid nitrogen and a 37 ° c . water bath . cell debri was subsequently pelleted . ( 10 min , 200 g ) and the supernatant was incubated at 56 ° c . for 1 hour to inactivate residual adenovirus . concentrated high titer recombinant aav stocks were prepared by harvesting the cells in there own culture medium , and washing in pbs ( max . 10 7 cells / ml ). the virus was released from the cells by 3 freeze / thaw cycles and / or 30 sonication pulses of 1 second on ice to prevent warming . cell debri was spun down and the supernatant was made a density of 1 . 4 by adding solid cscl . after o / n centrifugation ( 50 . 000 r . p . m ., 20 ° c ., using a vti ti65 . 1 rotor in a beckman ultracentrifuge ), fractions were collected and raav was determined . fractions containing raav were pooled and further concentrated in a centricon concentrator ( amicon ) according to manufacturer &# 39 ; s specifications . after concentration , the medium containing the virus was changed by two successive washes in the centricon concentrator , using optimem culture medium ( gibco - brl ). to determine the effect of the different methods of virus preparation and the different processing steps on the quality of the various raav - batches , we characterized them for 5 parameters : 1 ) the capacity to deliver the desired dna to the nucleus of the target cell by means of a replication center assay ( rca ) described below , 2 ) the capacity to stably transduce cells and express the neo r - gene by means of a limiting dilution on mel cells followed by g418 selection , 3 ) the wild - type aav titer in the batches by a rca without added wtaav , 4 ) the amount of replication proficient adenovirus in each preparation , and 5 ) the concentration of cscl in the raav preparations that were purified using cscl radients ( see table 2 ). the replication center assay ( rca ) takes advantage of the fact that in a lytic infection of aav up to 10 6 aav , genomes are produced inside a cell . this amount of dna is sufficient for the radioactive detection of infected cells . to accomplish this , 293 cells were seeded in a flat bottom 96 wells plate such that they reached near confluence the following day . for a titration of recombinant aav , the cells were infected with dilutions of recombinant virus stock , adenovirus ts149 ( m . o . i . 20 ) and wtaav - 2 ( m . o . i . 2 ). for a titration of the wild type aav , the cells were infected with dilutions of recombinant virus stock and adenovirus ts149 ( m . o . i . 20 ). the cells were subsequently incubated at 39 ° c . the next day , after 24 hours , the medium was replaced by ice - cold pbs containing 5 mm edta . after 5 to 20 min . on ice , a single cell suspension was made by rigorous pipetting . the cells were diluted in 5 ml pbs and sucked onto hybond n + filter circles ( pore size 0 . 22 μm ) of 3 . 6 cm diameter . filters were incubated for 5 min in denaturation solution ( 0 . 4 m naoh ; 0 . 6 m nacl ) and 5 min in renaturation buffer ( 1 , 5 m nacl ; 1 m tris - hcl , ph 7 ). filters were washed and stored in 5xsspe until hybridization . filters were hybridized with a recombinant aav specific probe for the determination of the recombinant aav titer and hybridized with a wild type aav specific probe for the determination of the wild - type aav titer . 1 . 5 × 10 5 mel cells were seeded in 2 ml culture medium per well ( 24 wells plate , falcon ) and the appropriate dilution of raav virus was added . the cells were collected the next day and reseeded in 30 ml culture medium in a 75 cm 2 flask ( falcon ) . after three days , the medium was replaced by selection medium by spinning down the cells ( 200 g , rt ) and resuspending the cells in fresh medium containing 1 mg / ml ( dry weight ) g418 ( gibco ). medium was replaced every three to four days . after fourteen days , the cultures were scored . when the cells had grown to confluency , the cultures were scored positive since the specific virus dilution contained raav capable of stably transducing mel cells . specific virus dilutions were scored negative when , after fourteen days , confluency had not been reached . adenovirus was determined by serial dilutions of the aav virus stock on a549 ( human bronchial carcinoma ) cells . dilutions were scored positive when cytopathic effect was visible after 6 days . wild - type adenovirus 5 stocks with a known titer were used as positive controls . cscl concentrations in the aav preparations were determined by flame photometry . a summary of the characterization is given in table 2 . the infectious particle ( ip ) concentration , i , e . the capacity - to deliver raav - dna to the nucleus of target cells determined in the pca varied considerably among the different batches . also the transducing particle ( tp ) concentration and the amount of wild - type aav contamination varied considerably . three batches had a ip to tp ratio of 10 4 , the 248 crude batch had a much lower ratio of 200 . the animals used for transplantation were 3 - 5 kg rhesus monkeys ( macaca mulatta ), bred at the biomedical primate research centre ( bprc ), rijswijk , the netherlands . three weeks before transplantation , the animals were transferred to a laminar flow unit and selectively decontaminated in the digestive tract by treatment with metronidazole ( 40 mg / kg / day ), during 5 days , followed by daily oral administration of ciprofloxacin ( 6 . 5 mg / kg / day ), polymixin b ( 10 mg / kg / day ) and nystatin ( 40 ku / monkey / day ). a94 and bb94 received one administration of ivermectine 200 μg / kg anti - worm treatment approximately two weeks prior to transplantation . the monkeys were kept under barrier nursing and antimicrobial treatment until leukocyte counts exceeded a value of 1 × 10 9 / liter . the day before transplantation , the monkeys received 5 gy total - body x - ray irradiation . for this purpose , the animals were placed in a cylindrical polycarbonate cage which rotated 6 rpm around its vertical axis during irradiation from two opposing beams ( physical parameters : 300 kv , 7 ma , 0 . 26 gy / min dose rate , 0 . 80 m average focus - to - skin distance ). bone - marrow grafts were infused into a peripheral vein in a volume of 7 . 5 ml 0 . 9 % nacl . supportive care after transplantation included blood transfusions of 15 gray - irradiated thrombocytes when thrombocyte counts were below 40 × 10 9 / liter , subcutaneous fluid upon indicationl , and red blood cell transfusions when hematocrit levels dropped below 0 . 2 l / l . monkey 9128 was administered daily baytrill s . c . for 2 weeks , 9 months after transplantation , as treatment of a salmionella infection . monkeys bb94 and a94 were treated for streptococci septis and received cefamandolnafaat 50 mg / kg / day and tobramycine 3 mg / kg / day . a94 was additionally treated for streptococci sepsis with amoxiline 9 mg / kg / day , clavulanic acid 2 . 5 mg / kg / day and ceftriaxone 50 mg / kg / day and with amphotericin b 8 mg / kg / day for a yeast infection . selective decontamination was stopped a few days after hemopoietic repopulation of the monkeys . sepsis treatment was stopped 4 days after the body temperature had returned to normal and serum cultures were found to be sterile . docetaxel ( taxotere ®) treatment was given to monkeys rh9128 and rh9170 at indicated times ( fig3 ) at a dose of 50 mg / m 2 . in monkey rh9128 , around 14 months post transplantation 4 docetaxel doses were given of 10 mg / m 2 . the appropriate amount of docetaxel was diluted in 50 ml pbs - glucose ( nppi , the netherlands ) and was administered by iv injection at a rate of 1 ml / min . 40 ml of bone marrow aspirate was obtained by puncturing both femoral shafts under total anesthesia . bone marrow cells were collected in hanks &# 39 ; basic salt solution containing heparin at 100 units per ml and deoxyribonuclease - i and subjected to ficoll - hypaque ( sigma ) cenitrifugation . cd34 + selection was performed using a smallscale ceprate lc column ( cellpro , bothell , wash .). from 5 × 10 4 to 50 × 10 4 cells were incubated at 4 ° c . for 30 min in 0 . 1 ml pbs and 1 % bovine serum albumin ( bsa ) with 5 ml of a phycoerythrin - conjugated anti - cd34 antibody ( 563 . f ) or unconjugated anti - cd34 antibody ( 566 ). cells incubated with the antibody 566 were washed ( pbs , 0 . 1 * bsa ) and further incubated with percp conjugated rabbit anti - mouse igg1 ( becton - dickinson , cat no . 340272 ). after washing , cells were acquired on a facsort ( becton - dickinson ) flow cytometer . cells were analyzed with the lysis ii software program . the percentage of cd34 + cells was calculated as the ratio of cd34 + cells to total number of cells and multiplied by 100 . for rhesus monkeys 9128 and 9170 , the enriched cd34 + cells were immediately processed for transduction . for rhesus monkeys a94 and bb94 the enriched cd34 + cells were split into two equal fractions and stored in liquid nitrogen . transduction of cd34 + cells was done as described below . a summary of the experimental conditions is given in table 3 . rhesus monkey 9129 and 9170 : four days prior to transplantation the cds34 + enriched cells were split in two equal fractions and cultured at a density of 10 6 cells per ml in low density bmc culture medium supplemented with recombinant rhesus monkey interleukin - 3 ( rhil - 3 ; burger et al ., 1990 ) as described in [ 57 ], on day 2 and day 3 , one fraction of cultured cd34 + cells was exposed to the crude raav preparation of ig - cft and the other fraction was exposed to a crude raav - preparation of ig - δmoneo by adding an equal volume of virus preparation to the medium of the cultured cd34 + cells . after three to five hours , the cells were collected by centrifugation ( 7 min , 200 g ) and resuspended into fresh rhil - 3 supplemented low density bmc culture medium in the same volume as the culture was started in . on day four , the cells were collected by centrifugation ( 7 min , 200 g ) and resuspended in an equal volume of 0 . 9 % nacl and separately transplanted into autologous rhesus monkeys by iv injection . rhesus monkey a94 and bb94 : four days prior to transplantation , one fraction of the frozen cd34 + enriched cells was thawed and subsequently washed with hanks balanced salt solution . live cells were collected by ficoll - hypaque ( sigma ) centrifugation and cultured at a density of 10 6 cells per ml in iscove &# 39 ; s modified eagles medium ( imdm , gibco - brl ) supplemented with fetal calf &# 39 ; s serum ( fcs , 10 %) and recombinant rhesus monkey interleukin - 3 ( rhil - 3 ; burger et al ., 1990 ). on day 2 and day 3 , cells were collected by centrifugation ( 7 min , 200 g ) and resuspended in 10 to 200 μl of imdm + 10 % fcs and rhil - 3 and subsequently exposed to a purified raav preparation of ig - cft ( monkey a94 ) or ig - cft * ( monkey b994 ). after two hours , the cells were washed with imdm + 10 % fcs and reseeded in imdm + 10 % fcs and rh - il - 3 . at day four , the cells were collected by centrifugation and suspended in 0 . 9 % nacl . also , on day four , the other fraction of cd34 + cells was thawed and washed with hanks balanced salt solution . live cells were collected by ficoll - hypaque ( sigma ) centrifugation , resuspended in 10 to 200 μl of imdm + 10 % fcs and rhil - 3 and subsequently exposed to a purified raav - preparation of ig - cft ( monkey bb94 ) or ig - cft * ( monkey a94 ). after two hours , the cells were collected by centrifugation and suspended in 0 . 9 % nacl . after collection in nacl ( 0 . 9 %), the cells were separately transplanted into autologous irradiated rhesus monkeys by iv injection . daily observation of clinical signs . weekly complete physical examination and determination of body weight . blood chemistry analysis was performed before and after x - ray irradiation . hematology was performed weekly . bone marrow samples were punctured from the femoral shafts under total anesthesia . heparine blood samples were taken weekly for pcr analysis . pbmc and granulocytes were isolated from peripheral blood samples , as described previously by ficoll hypaque centrifugation ( van seusechem et al ., 1992 ). circulating t - and b - cells were purified from pbmc by sorting cd2 and cd20 positive cells , respectively . fitc labeled cd2 ( clone s 5 . 2 ; becton - dickinson , california ) or cd20 ( clone l27 ; becton - dickinson , california ) antibodies were incubated with pbmc according to the manufacturers protocols . labeled cells were separated using the macs ® column and anti - fitc beads ( miltenyi , germany ) according to the manufacturers protocol . re - analyses of the sorted cells on facs ® ( becton - dickinson , usa ) showed that the sorted cells were more then 95 % pure populations . rh912b and rh9170 hemopoietic cells were plated in duplicate at 5 × 10 3 / ml ( cd34 + selected ) or 1 × 10 5 / ml ( post - ficoll ) in 1 ml methylcellulose medium , as described in [ 57 ], supplemented with 30 ng / ml rhil - 3 and 25 ng / ml gm - csf . rh a94 and bb94 hemopoietic cells were seeded for colony formation in methylcellulose medium containing 50 ng / ml scf , 10 ng / ml gm - csf , 10 ng / ml il - 3 and 3 u / ml epo ( methocult gf h4434 , stemcell technologies inc , vancouver , canada ). for cell lysis , pellets were incubated ( 10 7 cells / ml ) in nonionic detergent lysis buffer ( 0 . 5 % np40 , 0 . 5 % tween 20 , 10 mm tris ph 8 . 3 , 50 mm kcl , 0 . 01 % gelatin , 2 . 5 mm mgcl 2 ) containing proteinase k ( 60 mg / ml ) at 56 ° c . for 1 hour , lysates were then heated at 95 ° c . for 10 min to inactivate the proteinase k . two different pcr detections were performed . one was a nested neo r - specific pcr and one was a β - globin specific pcr . the protocol for the neo r - specific pcr will be described first . the first amplification was performed on 10 μl lysates in a total volume of 50 μl with 2 u of supertaq polymerase ( ht biotechnology , cambridge , england ) in a reaction mix ( final concentration : 200 mm each of 2 ′- deoxyadenosine - 5 ′- triphosphate , 2 ′- deoxycytidine - 5 ′- triphosphate , 2 ′- deoxyguanosine - 5 ′- triphosphate , 2 ′- deoxythymidine - 5 ′- triphosphate ( pharmacia , roosendaal , the netherlands ), 0 . 2 μm each of 5 ′ neo - 1 and the antisense primer 3 ′ neo - 2 and the reaction buffer supplied by the manufacturer ( ht biotechnology , cambridge , england ). the nested amplification was performed on 5 μl of the first reaction in a total volume of 50 μl with 2 u of supertaq polymerase ( ht biotechnology , cambridge , england ) in a reaction mix ( final concentration ; 200 mm each of 2 ′- deoxyadenosine - 5 ′- triphosphate , 2 ′- deoxycytidine - 5 ′- triphosphate , 2 ′- deoxyguanosine - 5 ′- triphosphate , 2 ′- deoxythymidine - 5 ′- triphosphate ( pharmacia , roosendaal , the netherlands ), 0 . 2 μm each of 5 ′ neo - 2 and the antisense primer 3 ′ neo - 1 and the reaction buffer supplied by the manufacturer ( ht biotechnology , cambridge , england ). primers were chosen to selectively amplify the neo r gene . amplification conditions were the same for the first and the nested amplification and were performed in a trio thermocycler ( biometra , göttingen , germany ) temperature cycling apparatus , the conditions chosen were : 95 ° c . for 5 minutes , then 30 cycles of 94 ° c . for 30 seconds , 55 ° c . for 30 seconds , 72 ° c . for 1 minute , followed by extension at 72 ° c . for 10 minutes . five to ten microliters of the nested reaction were separated on 2 % agarose gel ( pronarose , hispanagar , burgos , spain ). each assay included titrations of a murine erythroid leukemia cell line c88 - c1 , containing a single provirus integration of ig - cft [ 21 ] and / or a titration of a pool of g418 selected mel cells infected with ig - cft . for practical reasons , we developed an alternative pcr method to detect the neo - cassette in the raav - vectors ig - cft , ig - cft and ig - δmo + neo . the sequences of the primers were as follows ; neo - 1s : 5 ′- tagcgttggctacccgtgat - 3 ′ ( seq id no5 ), and neo - 4as : 5 ′- tgccgtcatagcgcgggtt - 3 ′ ( seq id no . 6 ). reaction mixtures were prepared as described above and the reaction temperature was 95 ° c . for 3 minutes followed by 30 cycles of 95 ° c . for 30 seconds , 65 ° c . for 30 seconds and 72 ° c . for 1 minute . the completion of the 30 cycles was followed by an extension of 5 minutes at 72 ° c . five to ten microliter of the pcr - reaction was run on a 2 % agarose gel , blotted and hybridized to a 157 bp . specific probe isolated from a bstbi - smai digest of ig - cft . the β - globin specific pcr was carried out in essentially the same way as the first reaction of the neo r - specific pcr . but instead of the neo r - primers , the primers listed below , specific . for the 3 ′ part of the hs - 2 fragment and β - globin intron i , were added . the sequences of the primers are : the temperatures for the cycling were : 95 ° c . for 3 minutes and then 30 cycles of 95 ° c . for 30 seconds , 55 ° c . for 30 seconds , 72 ° c . for 30 seconds . following the 30 cycles , an extension at 72 ° c . for 5 minutes was performed . samples were run on 2 % agarose gels , which were blotted and hybridized to a ncoi - clai β - globin promoter specific probe using standard techniques . the survival and the selection of the purification and transduction procedure of cd34 + rhesus monkey bone marrow cells was controlled by determining the number of cfu - c present at different stages in the procedure . the cd34 selection for rh9128 and rh9170resulted in a 13 - 19 fold enrichment of cfu - c resp . for a94 and bb94 , the enrichment for cfu - c was 37 - 92 fold resp . ( table 4 ). the number of cfu - c did not vary by more then a factor of 2 during culture or upon transduction , with the exception of monkey bb94 where the decrease in the number of cfu - c was considerable upon culture and infection with ig - cft . this was due to a direct toxicity of the cscl purified ig - cft batch , as determined by a titration of the batch on human cord blood post ficoll bone marrow which resulted in a dilution factor dependent toxicity on cfu - c ( not shown ). since it is known that cscl is a very toxic substance , we determined the cscl concentration in the two cscl purified raav preparations . both contained considerable amounts of cscl , enough to account for the observed toxicity ( table 2 ). due to the observed toxicity on cfu - c in this experiment the two grafts that rh - bb94 received were very different in size . whereas the cultured graft wasostill considerable , the graft - size for the short transduction protocol was very small ( table 4 ). however , since stem cells are not measured in a cfu - c assay and are indeed more resistant to a large variety of drugs and agents , it is possible that many of them survived the high concentration of cscl . to determine whether the engrafted cells had been transduced by the recombinant aav vectors , approx . 3 ml of blood was collected each week from every monkey . granulocytes and mononuclear cells were purified , as described in ( 57 ), and the dna was released and analyzed by pcr for the presence of raav - sequences . two different pcr reactions - were performed . on the samples from all four monkeys , pcr reactions specific for the neo r - gene were performed . the neo r - gene is present in all the vectors , so this pcr detects all recombinant aav - genomes present in the cells . on the samples from monkeys rh - a94 and rh - bb94 , also a β - globin specific pcr was performed . this pcr utilizes the size difference in the β - globin promoter in vectors ig - cft and ig - cft . these vectors were used to transduce the p - phsc via two different protocols , the effect of the two different protocols can thus be read out by the prevalence of one of the two vectors in the peripheral blood cells of the monkeys . the results of the neo - pcr are depicted in fig2 and 3 . all monkeys were negative for raav before transplantation and became positive for raav after transplantation . the presence of the vector varied from week to week . some samples were positive for the vector , others were negative , indicating that the frequency of transduced cells averaged around the detection limit of the pcr - reaction which was determined to be at 1 copy in 10 5 nucleated cells for the neo - specific pcr . monkey bb94 was positive in all samples immediately after transplantation and regeneration of the hemopoietic system , indicating a more efficient transduction of early progenitors during the ex vivo handling of the cells . in monkeys bb94 and 9128 , vector containing cells could be detected for at least more then one year after transplantation . bone marrow samples taken from these animals at 2 and 6 months ( 9128 ) or 14 months ( bb94 ) post transplantation also contained vector transduced cells . in bb94 , the vector was detected in pbmc , granulocytes , bone marrow and purified populations of b - and t - cells ( fig4 ). this result demonstrated the transduction of stem cells which had repopulated both the myeloid lineage ( granulocytes ) and the lymphoid lineage ( t - and b - cells ). the granulocytes , t cells , and b cells were still pcr positive more than 15 months post - transplantation , indicating the transduction of cells with extensive self - renewal capacity , the transduction of primate cells with ( 1 ) an extremely long - term in vivo stability after transplantation , and ( 2 ) the capability of multiple - lineage repopulation long after transplantation , provides strong evidence for transduction of p - phsc . rhesus monkey 9128 received treatments with taxotere , a cytostatic drug , to ablate the mature cells in the circulation , inducing periodic regrowth from immature hemopoietic cells residing in the bone marrow . recombinant aav transduced cells were detected in circulating cells fter a series of treatments with taxotere , over a period of 14 months post transplantation . the persistence of transduced cells in peripheral blood cells and the resistance to taxotere treatment provides convincing evidence of the transduction of p - phsc . the experiment with monkeys bb94 and a94 was designed to quantify the success of two different transduction protocols . for each monkey , the transplant was split in two equal fractions and each fraction was transduced in a different way . to be able to discriminate which protocol resulted in a better transduction , we used a different vector for each transduction . we compared the efficiency of transduction of cultured p - phsc versus that of non - cultured p - phsc . for the transduction of p - phsc from monkey bb94 , we used the purified virus ig - gft for the non - cultured p - phsc and the purified virus ig - cft for the cultured p - phsc . to exclude a possible role of quality differences between the virus batches , we switched the two virus batches for the transduction protocols for monkey a94 ; we used ig - gft for its cultured p - phsc and ig - gft * for its non - cultured p - phsc . following transplantation and repopulation of the . hemopoietic system of the monkeys , we performed the β - globin specific pcr to determine which transduction procedure resulted in the highest frequency of gene modified circulating cells . for both monkeys , we were able to detect only the virus used to transduce the cultured p - phsc , i . e ., ig - gft * for monkey bb94 and ig - gft for monkey a94 ( fig5 ). thus , in vitro stimulation of p - phsc results in a more efficient transduction with recombinant aav vectors . this result was not expected . it is generally accepted that culture of p - phsc promotes progressive loss of the grafting potential of the p - phsc , presumably due to differentiation . hence , if both procedures resulted in similar p - phsc transduction efficiencies , we would expect the progeny of the non - cultured p - phsc co prevail among the circulating blood cells due to grafting advantages . since we observed the opposite , the stable transduction efficiency of the cultured p - phsc must be significantly higher than that of the noncultured p - phsc . it is known that aav - vectors integrate with higher efficiency in cycling cells then in non - cycling cells ( 38 ) however , in non - cycling cells the vector remains in the nucleus and retains its ability to integrate when the cell is triggered into cycle ( 60 ). once transplanted , the p - phsc start to divide and repopulate the ablated hemopoietic system . considering the enormous amount of cells that need to be produced in a short time , it is presumed that the p - phsc start to divide within a couple of days once inside the body . therefore , a difference in transducibility of cultured versus non - cultured cells is not expected when only replication of the target cells is the enhancing factor . we infer that culture and exposure to hemopoietic growth factors such as il - 3 could in other ways potentiate the transduction with recombinant aav . one possible explanation is the up - regulation or activation of receptors for the virus on the surface of the p - phsc . another is the induction of proteins inside the p - phsc that enhance for instance nuclear transport and / or other rate limiting steps for stable transduction . 1 . einerhand m p w , valerio d : gene transfer into hematopoietic stem cells : prospects for human gene therapy , in muller - sieberg c , visser j w m , torock - storb b , storb r ( eds ): stem cells in hematopoiesis : animal models and human transplantation . curr . top . in microbiol . and immunol ., berlin - heidelberg , springer - verlag gmbh & amp ; co kg , 1992 , p . 217 - 235 2 . einerhand m p w , bakx t a , kukler a , valerio d : factors affecting the transduction of pluripotent hemopoietic stem cells : long term expression of a human adenosine deaminase gene in mice . blood 81 : 254 - 263 , 1993 3 . van beusachem v , valerio d : gene transfer into hematopoietic stem cells of non human primates . hum . gene ther . 7 : in press , 1996 4 . dunbar c , cottler - fox m , o &# 39 ; shaughnessy j , doren s , carter c , berenson r , brown s , moen r , greenblatt j , stewart f , leitman s , wilson w , cowan k , young n , nienhuis a : retrovirally marked cd34 - enriched peripheral blood and bone marrow cells contribute to long - term engraftment after autologous transplantation . blood 85 : 3048 - 3057 , 1995 5 . deisseroth a , zu z , claxton d , hanania e , fu s , ellerson d : genetic marking shows that ph + cells present in autologous transplants of chronic myelogenous leukemia ( cml ) contribute to relapse after autologous bone marrow in cml . blood 83 : 3068 - 3076 , 1994 6 . brenner m k , rill d r , holladay m s , heslop h e , moen r c , buschle m , krance r a , santana v m , anderson w f , ihle j n : gene marking to determine whether autologous marrow infusion restores long - term haemopoiesis in cancer patients . lancet 342 : 1134 - 1137 , 1993 7 . cornetta k , srour e , moore a , davidson a , broun e , hromas a , r c m , morgan r , rubin l , anderson w . hoffman r , tricot g : retroviral gene transfer in autologous bone marrow transplantation for adult acute leukemia . hum . gene ther . 7 ; 1323 - 1329 , 1996 8 . fritsch e , temin h : inhibition of viral dna synthesis in stationary chicken embryo fibroblasts infected with avian retroviruses . j . virol . 24 : 461 - 469 , 1977 9 . harel j , rassart e , jolicoeur p ; cell cycle dependence 5 of synthesis of unintegrated dna in mouse cells newly infected with murine leukemia virus . virology 110 : 202 - 207 , 1981 10 . miller d g , adam m a , miller a d : gene transfer by retrovirus vectors occurs only in cells that are actively replicating at the time of infection . mol cell biol 10 : 4239 - 4242 , 1990 11 . springett g , moen r , anderson s , blaese r , anderson w : infection efficiency of t lymphocytes with amphotropic retroviral vectors is cell cycle dependent . j . virol . 63 : 3865 - 3869 , 1989 12 . berns k i , rose j a : evidence for a single - stranded adeno - associated virus genome ; isolation and separation of complementary single strands . j . virol . 5 ; 693 - 699 , 1970 13 . berns k i , adler s : separation of two types of adeno - associated virus particles containing complementary polynucleotide chains . virology 9 : 394 - 396 , 1972 14 . lusby e , fife k h , berns k i : nucleotide sequence of the inverted terminal repetition in adeno - associated virus dna . j . virol . 34 : 402 - 409 , 1980 15 . samulski r j , chang l , shenk t : helper - free stocks of recombinant adeno - associated viruses : normal integration does not require viral gene expression . j . virol . 63 : 3822 - 3828 , 1969 16 . tratschin j d , miller i l , smith m g , carter b j : adeno - associated virus vector for high - frequency integration , expression , and rescue of genes in mammalian cells . mol . cell . biol . 5 ; 3251 - 3260 , 1985 17 . hermonat p l , muzyczka n . use of adeno - associated virus as a mammalian dna cloning vector : transduction of neomycin resistance into mammalian tissue culture cells , proc . natl . acad . sci , usa 81 ; 6466 - 6470 , 1984 18 . mclaughlin s k , collis p . hermonat p l , muzyczka n : adeno - associated virus general transduction vectors : analysis of proviral structures . j . virol . 62 : 1963 - 1973 , 1988 19 . lebkowski j s , mcnally m m , okarma t b , lerch l b : adeno - associated virus ; a vector system for efficient introduction and integration of dna into a variety of mammalian cell types . mol . cell . biol . 8 : 3988 - 3996 , 1988 20 . walsh c e , liu j m , xiao x , young n s , nienhuis a w , samulski r j : regulated high level expression of a human γ - globin gene introduced into erythroid cells by an adeno - associated virus vector . proc . natl . acad . sci . usa 89 : 7257 - 7261 , 1992 21 . einerhand m , antoniou m , zolotukhin s , muzyczka n , berns k , grosveld f , valerio d : regulated high - level β - globin gene expression in erythroid cells following recombinant adeno - associated virus - mediated gene transfer . gene ther . 2 : 336 - 343 , 1995 22 . collis p , antoniou m , grosveld f : definition of the minimal requirements within the human β - globin gene and the dominant control region for high level expression . embo j . 9 : 233 - 240 , 1990 23 . mclvor r s , johnson m j , miller a d , pitts s , williams s r , valerio d , martin jr . d w , verma i m : human purine nucleoside phosphorylase and adenosine deaminase : gene transfer into cultured cells and murine hematopoietic stem cells by using recombinant amphotropic retroviruses . mol . cell . biol . 7 : 839 - 846 , 1987 24 . berns k i : parvovirus replication . microbiol . rev . 54 : 316 - 329 , 1990 25 . kotin r m , siniscalco m , samulski r j , zhu x , hunter l , laughlin s , muzyczka n , rocchi m , berns k i : site - specific integration by adeno - associated virus . proc . natl . acad . sci . usa 87 : 2211 - 2215 , 1990 26 . samulski r j , zhu x , xiao x , brook j d , housman d e , epstein n . hunter l a : targeted integration of adeno - associated virus ( aav ) into human chromosotne 19 . embo j . 10 : 3941 - 3950 , 1991 27 . chiorini j a , weitzman m d , owens r a , urcelay e , safer b , kotin r m : biologically active rep proteins of adeno - associated virus type 2 produced as fusion proteins in escherichia coli . j . virol . 68 : 797 - 804 , 1994 28 . berns k i : parvoviridae and their replication , in chanock r m , hirsch m s , melnick j l , monath t p , roizman b ( eds ): virology , new york , raven press , 1990 , p . 1743 - 1763 29 . flotte t r , solow r , owens r a , afione s , zeitlin p l , carter e j : gene expression from adeno - associated virus vectors in airway epithelial cells . am . j . respir . cell mol . biol . 7 : 349 - 356 , 1992 30 . flotte t r , afione s a , conrad c , mcgrath s a , solow r , oka h , zeitlin p l , gugginoa w b , carter b j : stable in vivo expression of the cystic fibrosis transmembrane conductance regulator with an adeno - associated virus vector . proc . natl . acad . sci . usa 90 : 10613 - 1 - 617 , 1993 31 . egan m , flotte t , afione s . solow r , zeitlin p l , carter b j , guggino w b : defective regulation of outwardly rectifying cl - channels by protein kinase a corrected by insertion of cftr . nature 358 : 581 - 584 , 1992 32 . lapace d , hermonat p , wakeland e , peck a : gene transfer into hemopoietic progenitor cells mediated by an adeno - associated virus vector . virol . 162 : 483 - 486 , 1988 33 . zhou s z , broxmeyer h e , cooper s , harrington m a , srivastava a : adeno - associated virus 2 - mediated gene transfer into murine hematopoietic progenitor cells . exp hematol . 21 : 928 - 933 , 1993 34 . zhou s z , cooper s . kang l y , ruggierri l , heimfeld s , srivastava a , broxineyer h e : adeno - associated virus 2 - mediated high efficiency gene transfer into immiature and mature subsets of hematopoietic progenitor cells in human ukmbilical cord blood . j . exp . med . 179 : 1867 - 1875 , 1994 35 goodman s , xiao x , donahue r e , moulton a , miller j , walsh c , young n s , samulski r j , nienhuis a w : recombinant adeno - associated virus - mediated gene transfer into hematopoietic progenitor cells . blood b4 : 1492 - 1500 , 1994 36 . chatteryee s , johnson p r , wong k k : dual - target inhibition of hiv - 1 in vitro by means of an adeno - associated virus antisense vector . science 258 : 1485 - 1488 , 1992 37 . luhovy m , mccune s , dong j y , prchal j f , townes t m , prchal j t : stable transduction of recombinant adeno - associated virus into hematopoietic stem cells from normal and sickle cell patients . biol . of blood and marrow transpl . 2 ; 24 - 30 , 1996 38 . russell d w , miller a d , alexander i e ; adeno - associated virus vectors preferentially transduce cells in s phase . proc . natl . acad . sci . usa 91 ; 8915 - 8919 , 1994 39 . wintrobe m m , lee g r , boggs d r , bithell t c , foerster j , athens j w , lukens j n : glinical hematology : 869 - 903 , 1981 40 . rodgers g p , dover g j , noguchi c t , schlechter a n : hematologic responses of patients with sickle cell disease to treatment with hydroxyurea . n . engl . j . med . 322 ; 1037 - 1045 , 1990 41 . anderson w f : prospects for human gene therapy . science 226 : 401 - 409 , 1984 42 . evans t , felsenfeld g , reitman m : control of globin gene transcription . ann . rev . cell biol . 6 : 95 - 124 , 1990 43 . grosveld f . blom van assendelft g , greaves d r , kollias g : position - independent , high - level expression of the human β - globin gene in transgenic mice . cell 51 : 975 - 985 , 1987 44 , talbot d , collis p , antoniou m , vidal m , grosveld f , greaves d r : a dominant control region from the human β - globin locus conferring integration site independent gene expression . nature 338 : 352 - 355 , 1989 45 . miller j l , walsh c e , ney p a , samulski r j , nienhuis a w : single - copy transduction and expression of human γ - globin in k562 erythroleukemia cells using recombinant adeno - associated virus vectors : the effect of mutations in nf - e2 and gata - 1 binding motifs within the hypersensitivity site 2 enhancer , blood 82 : 1900 - 1906 , 1993 46 . einerhand m p w , valerio d : viral vector systetns tor bone marrow gene therapy , in levitt , mertelsmann ( eds ): hematopoietic stem cells ; biology and therapeutic applications , new york , marcel dekker , inc , 1995 , p 275 - 295 47 . halbert c l , alexander i e , wolgamot g m , miller a d : adeno - associated virus vectors transduce primary cells much less efficient than immortalized cells . j . virol . 69 : 1473 - 1479 , 1995 48 . ferrari f k , samulski t , shenk t , samulski r j : second strand synthesis is a rate limiting step for efficient transduction by recombinant adeno - associated virus vectors . j . virol . 70 : 3227 - 3234 , 1996 49 . nienhuis a : gene therapy for hematopoietic stem cells in genetic disease and cancer . keystone symposia on molecular and cellular biology , taos , n . mex . peb . 4 - 10 , 1996 50 , lefebvre r b , riva s , berns k i : conformation takes precedence over sequence in adeno - associated virus dna replication , mol . cell biol . 4 : 1416 - 1419 , 1984 51 . van beusechem v w , kukler a , einerhand m p w , bakx t a , van der eb a j , van bekkum d w , valerio d : expression of human adenosine deaminase in mice transplanted with hemopoietic stem cells infected with amphotropic retroviruses . j . exp . med . 172 : 729 - 736 , 1990 52 . valerio d , einerhand m p w , wamsley p m , bakx t a , li c l , verma i m : retrovirus - mediated gene transfer into eibryonal carcinoma cells and hemopoietic stem cells : expression from a hybrid long terminal repeat . gene 84 : 419 - 427 , 1989 53 . linney e , davis b , overhauser j , chao e , fan h : non - function of a moloney murine leukemia virus regulatory sequence in f9 embryonal carcinoma cells . nature 308 ; 470 - 472 , 1984 54 . mcknight s : the nuceotide sequence and transcript map of the herpes simplex thymidine kinase gene . nucl . acids res . 8 : 5949 - 5964 , 1980 55 . graham f l , smiley j , russell w c , naiva r : characteristics of a human cell line transformed by dna from aderiovirus type 5 . j . gen . virol . 36 : 59 - 72 , 1977 56 . deisseroth a , hendrick d : human β - globin gene expression following chromosomal dependent gene transfer into mouse erythroleukemia cells . cell 15 : 55 - 63 , 1978 57 . van beusechem v w , kukler a , heidt p j , valerio d : long - term expression of human adenosine deaminase in rhesus monkeys transplanted with retrovirus - infected bone - marrow cells . proc . natl , acad . sci . usa 89 : 7640 - 7644 , 1992 58 . thomson b j , weindler f w , gray d , schwaab v , heilbronn : human herpesvirus 6 ( hhv - 6 ) is a helpervirus for adeno - associated virus type 2 ( aav - 2 ) and the aav - 2 rep gene homologue in hhv - 6 can mediate aav - 2 dna replication and regulate gene expression . virol . 204 : 304 - 411 , 1994 59 . fischer - adams g , wong jr k k , podsakoff g , forman s j , chatterjee s : integration of adeno - associated virus vectors in cd34 + human hemopoietic progenitor cells after transduction . blood 88 : 492 - 504 , 1996 60 . podsakoff g , wong jr k k , chatterjee s : efficient gene transfer into nondividing cells by adeno - associated virus - based vectors . j virol 68 : 5656 - 5666 , 1994 properties of adeno - associated virus and amphotropic retrovirus vectors . * calculated number per replication cycle . aav is replicated via cellular dna - polymerases which have proof reading activity . the error frequency of these polymerases is 10 − 6 implying 1 point mutation per 200 recombinant aav genomes . retroviruses are replicated via rna - polymerase ii and reverse transcriptase ( rt ). the known error frequency of rt is 10 − 4 . not # much is known about the mutation rate of rna - polymerase ii . based on the error frequency of rt one can expect one point mutation per retroviral genome of 10 kb . a [ srivastava , 1993 ]; b [ joyner , 1983 ]; c [ einerhand , 1992 # 109 ]; d [ chatteryee , 1992 ]; e [ nolta , 1992 ]; f [ brenner , 1993 ]; g [ walsh , 1992 ]; h [ miller , 1992 ]; i [ flotte , 1993 ];	0
referring to fig1 there is shown in perspective view a boat hull frame , partially planked , comprised of fiber - reinforced plastic . the frame is constructed of a longitudinal or keel member 10 and a plurality of transverse or rib members 12 . they are attached either by allowing the members to cure in contact to form a plastic or self bond or by preventing such contact during the curing process and later bonding the cured members with an adhesive such as epoxy . in the embodiment illustrated , the rib members overlap the keel member , but the positions may be reversed . in either case , precise positioning for bonding after curing is assured by the interlocking nature of the design and optionally , alignment indicators such as marks , small holes , or impressions which may be added during the molding process . other structural members may be added according to the stress demands which will be placed on the frame . the include additional stringers or longitudinal supports , seat supports , and in general all structural elements common to boat hull design . the frame , when assembled , can be planked with any suitable material , preferrably thin strips of wood 14 which bend easily to the configuration of the hull . the wood may be attached by adhesives , such as epoxy , eliminating the need for nails or screws which deteriorate through electrolysis . fig3 is a cross - sectional representation of an alternative shape for rib members . the fiber - reinforced plastic 16 is molded in a step configuration to produce a finished hull of lap - strake construction when planks 18 are layed over and affixed to the ribs in the manner described above . step molding provides the additional advantage of acting as a fix or locator for each plank simplifying the overall construction . referring next to fig2 mold apparatus used in the method of constructing the above described frame is illustrated . the hull to be reproduced may be a complete boat hull , for example a classic shape such as a cat boat or friendship sloop available as a complete boat in drydock , or a design which is built up for the purpose . the model or original hull , not shown , becomes the plug over which a support mold 20 is formed , typically of a fiberglass material . the interior 22 of the support mold thus exactly reproduces the shape of the exterior of the original hull to be reproduced . however , the interior of the support mold need not be finely finished as is the case when producing molds for conventional fiberglass shell boat hulls . channels 24 for the specific structural members are attached to the interior of the support mold by adhesives or counter - sunk nuts and bolts or other means as would be appropriate . the channels are placed wherever a longitudinal or transverse structural member is desired and are constructed of any suitable material , preferrably a flexible plastic which will conform and bend to the shape of the support mold , one which is not degraded by polyester or plastic resins , nor one to which these resins will bind . plastics appropriate for the purpose include polyethylene , polypropylene , and polyvinyl chloride . these ae commonly available in standard extuded profiles and can be used with little or no modification . the number , size and spacing of the channels may be varied at will to provide structural reinforcement wherever desired . once the support mold and frame member channel molds are combined into an assembly , strips of uncured fiber - reinforced plastic are layed in the channels and allowed to cure . where a self bond is desired , the uncured members are allowed to contact one another . where no bond is desired and it is intended that the members be attached after removal from the mold , a thin membrane of plastic abhorent material such as polyethylene or polyvinyl alcohol is inserted between the strips . such a practice allows the frame to be shipped in kit form to be assembled at the destination . as mentioned , the channels themselves are plastic abhorent or are covered with such a material . a number of plastics or more precisely resin - catalyst promoter systems may be used in combination with glass , nylon , carbon or polypropylene fibers to mold the frames . these include polyester and epoxy resins . for normal gel times of approximately an hour , cobalt promoted methyl ethyl ketone peroxide catalyzed resins may be used . where a short gel time is desired for quick - setting structural fillers , benzoyl peroxide catalyst may be used . for long gel times , an unpromoted resin catalyst system can be employed , requiring in addition the application of heat to produce curing . other combinations of material fitting into the fiber - reinfoced plastic category may be employed , as would be obvious to those skilled in the art . in constructing any particular hull frame configuration , care must be taken not to mold the frames such that the cured assembly locks up in the support mold . this is accomplished , when necessitated by the frame design , by making some or all of the frame members removable from the frame after molding ; that is , by preventing self of plastic bonds by inserting contact preventing membranes as described above . also a multipiece or sectional support mold duplicating separate portions of the hull can be used , assembling such sections to form a complete mold and disassembling them to free the frame . an additional technique which may be used to add structural members and prevent lock up is illustrated by the apparatus of fig4 , and 6 . shown in perspective view is a demountable support assembly which may be used to add additional structure to the frame , a seat or deck support for example . support mold 20 , employing like members from previous figures for clarity , serves to shape and contain mold channel 24 . removable support block 26 is held up against removable spacer blocks 28 by bolts 30 and wing nuts 32 . blocks 26 and 28 are comprised of or covered with a plastic abhorent material in the manner previously described . a strip of uncured fiber - reinforced plastic 34 may now be placed along block 26 in contact with an additional transverse strip in channel 24 to form the desired component . after curing , the blocks are removed to free the frame components from the mold . as before , depending upon the hull design , additional structural members may be cured together in contact or prevented from contact and later bonded by adhesives . as will be obvious , the concept of the invention encompasses an extensive range of frame configurations and fiber - reinforced plastic materials to produce a unitized frame of the type described above . accordingly , the scope of the invention is defined by the following claims .	1
referring initially to fig1 a , 1b , 2 and 6 of the drawings , in a preferred embodiment a typical moveable saw carriage of this invention is illustrated by reference numeral 20 and a fixed carriage by numeral 20a ; in a typical installation , multiple moveable saw carriages 20 , and a single fixed saw carriage 20 a as illustrated in fig1 a and 1b , are aligned adjacent to respective stem loaders 45 of selected design and typically having loading arms 46 to receive the stems 100 in sequence from stem loaders 45 and load them on the moveable saw carriages 20 and the fixed saw carriage 20a . a loading conveyor 85 typically transfers the stems 100 from a stem conveyor 82 , where the stems are initially scanned by a scanner 102 and diverted from the stem conveyor 82 to the loading conveyor 85 , mounted on a loading frame 47 , by means of a stem diverter 87 , typically as described in my u . s . pat . no . 5 , 579 , 671 and as illustrated in fig1 a and 1b . each of the movable saw carriages 20 is characterized by a carriage frame 21 , and with the exception of the single , end - located fixed saw carriage 20a , as described in my patent and as further illustrated in fig1 b , the movable saw carriages 20 are fitted with a pair of flanged wheels 23 that roll on corresponding rails 22 , mounted on a supporting surface 50 . the flanged wheels 23 are designed to engage and traverse the rails 22 in a linearly - controlled manner , as further illustrated in fig2 . a wheel shaft 24 connects the respective pairs of flanged wheels 23 to facilitate traversal of the carriage frame 21 of the movable saw carriages 20 in both directions , parallel to the stem loaders 45 , as further hereinafter described . a horizontal cutting platform 25 is located on each of the carriage frames 21 and receives a pair of shaped cutting rollers 26 , each mounted on a rotatable roller shaft 26a , and designed to receive each stem 100 from the stem loaders 45 , as further hereinafter described . each of the roller shafts 26a is provided with a roll drive 39 , operated by a solenoid valve 13 , electrically linked to the programmable logic controller 104 by suitable wiring ( not illustrated ) wired into the junction boxes 15 and connected to the programmable logic controller 104 by additional electric wiring 14 . the roll drives 39 automatically drive the respective cutting rollers 26 and shift each incoming stem 100 against a butt plate 49 , mounted on the butt plate positioning cylinder piston 49b of a butt plate positioning cylinder 49a , as illustrated in fig1 b . the butt plate positioning cylinder 49a is typically mounted on the carriage frame 21 of the fixed saw carriage 20a by means of a cylinder mount plate 16 . each of the cutting rollers 26 is fitted with multiple , radially - shaped roller plates 27 for seating each stem 100 in sequence on the cutting rollers 26 , as illustrated in fig1 . a sawdust chute 28 is mounted on the carriage frame 21 beneath the cutting platform 25 to receive and channel sawdust from the cut logs , poles and other segments and divert the sawdust to a sawdust conveyor or other apparatus ( not illustrated ). as illustrated in fig1 and 6 of the drawings , a pair of segment ejectors 93 is provided in each one of the movable saw carriages 20 and the fixed saw carriage 20a , and each segment ejector 93 includes an ejection cylinder 94 , attached to the carriage frame 21 of each of the movable saw carriages 20 and the fixed saw carriage 20a . each ejection cylinder 94 receives an ejection cylinder piston 95 , designed for extension and retraction inside the ejection cylinder 94 . a segment - engaging head 96 is secured to the extending end of each ejection cylinder piston 95 , for engaging each of the cut segments ( not illustrated ) from the stem 100 at the proper time determined by the programmable logic controller 104 , and ejecting the segments in concert from the cutting rollers 26 and cutting platform 25 of each of the carriage frames 21 , typically to a segment conveyor 75 of suitable design , illustrated in fig1 a , for removing the cut segments of the stems 100 from the cutting rollers 26 . referring again to fig1 and 6 of the drawings , a pair of stem clamps 66 is provided on the carriage frame 21 of each of the movable saw carriages 20 and the fixed saw carriage 20a above the respective cutting platforms 25 and are each characterized by a clamp arm 67 , pivotally secured to a vertical support member of the carriage frame 21 by means of a clamp arm pivot pin 69 . each clamp arm 67 is fitted with arm teeth 68 and is pivotally raised and lowered on the clamp arm pivot pin 69 by means of a clamp arm positioning cylinder 70 , pivotally connected by means of a cylinder pivot pin 54a to a cylinder mount plate 16 , fixed to the carriage frame 21 . a clamp arm positioning cylinder piston 71 is attached to a piston mount plate 19 , welded to the clamp arm 67 and is extendible and retractable in each clamp arm positioning cylinder 70 . accordingly , the respective clamp arm positioning cylinders 70 can be operated in concert by the programmable logic controller 104 as hereinafter described , to timely extend and retract the corresponding clamp arm positioning cylinder pistons 71 , initially raise the clamp arms 67 to the position illustrated in fig1 to receive a stem 100 and then pivot the clamp arms 67 in a downward direction at the proper time to clamp and stabilize the stem 100 in position on the cutting rollers 26 above the cutting platform 25 of each of the carriage frames 21 . referring again to fig1 , 3 , 4 and 6 of the drawings , in a most preferred embodiment of the invention an encoder assembly 40 is mounted on the carriage frame 21 above the flanged wheels 23 and rails 22 of each movable saw carriage 20 and is operably connected to the programmable logic controller 104 ( illustrated in fig2 and 6 ) by suitable electrical wiring ( not illustrated ) extending to the junction boxes 15 , illustrated in fig2 . each encoder assembly 40 includes a carriage location encoder 41 , which is fitted with an encoder sprocket 42 , connected to a driven spur gear shaft 31a by means of a driven spur gear shaft sprocket 31b and an encoder drive chain 43 , for measuring the travel of the saw carriages 20 on the rails 22 . a horizontal gear rack 29 , fitted with rack teeth 29a , is fixed to the supporting surface 50 between and parallel to the rails 22 and extends throughout the length of travel of the respective movable saw carriages 20 on the corresponding rails 22 . as further illustrated in fig3 and 4 , a module drive assembly 10 includes a drive spur gear 30 , mounted on a drive spur gear shaft 30a , extending from a gear reducer 11 , which mounts a hydraulic motor 8 , wherein the gear reducer 11 is mounted on the carriage frame 21 . a driven spur gear 31 is positioned on a driven spur gear shaft 31a , extending from a spur gear bearing 33 and the driven spur gear 31 is positioned in vertical alignment with the drive spur gear 30 , such that the respective spur gear teeth 32 of the drive spur gear 30 and driven spur gear 31 mesh . operation of the hydraulic motor 8 thus effects rotation of the drive spur gear 30 and driven spur gear 31 at a speed determined by the gear reducer 11 , for linearly adjusting each movable saw carriage 20 on the rails 22 . as described above and illustrated in fig3 and 4 , the driven spur gear shaft 31a is connected to the encoder shaft 44 of the carriage location encoder 41 . moreover , as illustrated in fig2 and as further heretofore described , the programmable logic controller 104 is connected to the junction boxes 15 by electric wiring 14 . accordingly , operation of the respective hydraulic motors 8 on the corresponding gear reducers 11 and the corresponding carriage location encoders 41 in the various movable saw carriages 20 responsive to the commands of the programmable logic controller 104 ( in semi - automatic or automatic mode ), causes each of the movable saw carriages 20 to linearly traverse the rails 22 in increments monitored by the carriage location encoders 41 and determined by the programmable logic controller 104 . the programmable logic controller 104 receives pulse signals from the respective carriage location encoders 41 to locate the corresponding movable saw carriages 20 in a precise position with respect to the fixed saw carriage 20a , for cutting each stem 100 into segments of optimum length , responsive to information determined from the scanner 102 and evaluated by the computer 103 , as hereinafter further described . referring again to fig1 and 2 of the drawings , a blade assembly 52 is provided in each of the movable saw carriages 20 and the fixed saw carriage 20a ; which blade assembly 52 includes an elongated blade ladder 53 , pivotally attached to the carriage frame 21 by means of a ladder pivot shaft 63 . each of the blade ladders 53 further includes a saw positioning cylinder 54 and one end of the saw positioning cylinder 54 is pivotally secured to a cylinder mount plate 16 on the carriage frame 21 of each of the saw carriages 20 and the fixed saw carriage 20a , by means of a cylinder pivot pin 54a . the opposite end of the saw positioning cylinder 54 extensibly and retractably receives a saw positioning cylinder piston 55 , the extending end of which is pivotally attached to a piston mount plate 19 , welded to the blade ladder 53 , as illustrated . a circular saw blade 56 is rotatably secured to the lower end of the blade ladder 53 by means of a blade arbor 56a , on a blade shaft 57 , rotatably secured in the blade ladder 53 . each saw blade 56 is driven by operation of a blade pulley 61 , mounted in the blade end of the blade ladder 53 on a rotatable blade shaft 57 and fitted in driven relationship with a middle shaft pulley 65 , mounted on a middle shaft 64 , journalled for rotation in the blade ladder 53 . a blade belt 61a connects the blade pulley 61 and the middle shaft pulley 65 . a motor pulley 60 , attached to the motor shaft 60a of a blade drive motor 58 , is attached to a middle shaft drive pulley 65a , on the middle shaft 64 , by means of a drive belt 62 . the blade drive motor 58 is electrically coupled by suitable wiring not illustrated to the junction boxes 15 and from there by means of electric wiring 14 to the programmable logic controller 104 for automatic operation and is attached to a motor mount bracket 59 , mounted on the carriage frame 21 near the top end of the blade ladder 53 . accordingly , it will be appreciated that the blade ladder 53 and thus , the blade in each of the movable saw carriages 20 and the fixed saw carriage 20a , can be pivoted on each of the ladder pivot shafts 63 in concert by simultaneous operation of each of the saw positioning cylinders 54 , to extend the corresponding saw positioning cylinder pistons 55 , position the saw blades 56 in concert and simultaneously cut the stem 100 into multiple segments of optimum length , as further hereinafter described . as illustrated in fig1 and 5 of the drawings , in a most preferred embodiment of the invention each of the operating elements on the linearly - adjustable moveable saw carriage 20a and the fixed saw carriages 20 are hydraulically operated by means of the pump motor 12 , hydraulic fluid pump 5 and other components of the hydraulic system 3 . hydraulic fluid is pumped from the hydraulic fluid reservoir 9 or the accumulator 4 to the hydraulic fluid manifold 37 , where it is selectively dispensed and returned by operation of the programmable logic controller 104 through respective solenoid valves 13 , the fixed hydraulic fluid lines 1 , mounted on the carriage frame 21 , and the corresponding flexible hydraulic fluid hoses 7 , to the respective roll drives 39 , clamp arm positioning cylinders 70 and ejection cylinders 94 . the solenoid valves 13 are electrically connected to the programmable logic controller 104 for orchestration of the roll drives 39 , clamp arm positioning cylinders 70 and the ejection cylinders 94 , as hereinafter described . similarly , a set of servo valves 6 is mounted on the fluid manifold 37 and are hydraulically connected by means of the fixed hydraulic lines 1 and flexible hydraulic fluid hoses 7 to the butt plate positioning cylinder 49a , the saw positioning cylinder 54 and the hydraulic motor 8 , respectively , for supplying hydraulic fluid to these elements . the servo valves 6 are also electrically connected to the programmable logic controller 104 for orchestration of the butt plate positioning cylinder 49a , saw positioning cylinder 54 and hydraulic motor 8 , as further heretofore described . in automatic operation , the moveable saw carriages 20 and the fixed saw carriage 20a sequentially cut segments of optimum length from incoming stems 100 , as follows . the stems 100 are typically delivered in linear sequence to the saw carriage area on a stem conveyor 82 , as illustrated in fig1 a , where they are initially scanned by the scanner 102 and the physical characteristics of each of the stems 100 are transferred by the scanner 102 to the computer 103 and the desired cutting pattern from the computer 103 to the programmable logic controller 104 , as illustrated in fig6 . for purposes of this application , the term &# 34 ; physical characteristics &# 34 ; shall mean and include , but not be limited to , the location of limbs , the location of rotten spots , the degree of linearity or straightness , length , cuts , gashes , and other observable characteristics well known to those of ordinary skill in the art . the carriage location encoders 41 continually update the programmable logic controller 104 on the relative positions of the movable saw carriages 20 on the fixed rails 22 . accordingly , when the physical characteristics of each stem 100 are assimilated by the computer 103 and the desired cutting pattern transferred from the computer 103 to the programmable logic controller 104 , the system operates as follows : the module drive assembly 10 , including the drive spur gear 30 and driven spur gear 31 , operate to precisely position the respective movable saw carriages 20 and thus , the saw blades 56 in each of the movable saw carriages 20 , responsive to an electric signal from the programmable logic controller 104 and opening of the servo valve 6 which controls the hydraulic motor 8 . while selected ones or all of the movable saw carriages 20 are in the process of independent linear adjustment by traversal of the rails 22 responsive to operation of the hydraulic module drive assembly 10 , including the drive spur gear 30 and driven spur gear 31 , another stem 100 passes in sequence by the scanner 102 and is then typically diverted in sequence by the stem diverters 87 from the stem conveyor 82 to the loading conveyor 85 and then to the fixed stem loaders 45 . this diversion is typically accomplished under command of the programmable logic controller 104 . loading of each stem 100 from the stem loaders 46 to the now - still and pre - prepositioned movable saw carriages 20 also occurs by command of the programmable logic controller 104 . the loading arms 46 roll the stems 100 in sequence onto the respective cutting rollers 26 located above the corresponding cutting platforms 25 of each of the moveable saw carriages 20 and the fixed saw carriage 20a ; with the butt end of the stem 100 resting against or near the butt plate 49 , as further illustrated in fig1 b . if the butt end of the stem 100 is not resting against the butt plate 49 when the stem 100 is loaded on the cutting rollers 26 , the respective roll drives 39 are automatically operated by the programmable logic controller 104 and the respective connecting solenoid valves 13 to supply hydraulic fluid to the roll drives 39 , rotate the corresponding roller shafts 26a and cutting rollers 26 , shift the stem 100 laterally and seat the butt end of the stem 100 against the butt plate 49 . each butt plate 49 is initially positioned to receive the butt end of the stem 100 by extension of the corresponding butt plate positioning cylinder piston 49b from the butt plate positioning cylinder 49a by operation of a corresponding servo valve 6 upon demand by the programmable logic controller 104 . the several movable saw , and carriage 20 single fixed saw carriages 20a are now positioned such that the respective saw blades 56 are nearly ready to cut the stem 100 into segments of optimum length . when each stem 100 is seated on the cutting rollers 26 and adjusted to engage the butt plate 49 , the respective solenoid valves 13 on the corresponding manifolds 37 which hydraulically connect to the clamp arm positioning cylinders 70 are opened by operation of the programmable logic controller 104 . this action extends the respective clamp arm cylinder positioning pistons 71 from the corresponding clamp arm positioning cylinders 70 and pivots the corresponding clamp arms 67 on the clamp arm pivot pin 69 , such that the arm teeth 68 securely engaged the stem 100 and stabilize the stem 100 for cutting , as illustrated in fig1 . when the stem 100 is securely clamped in place on the cutting rollers 26 , the butt plate positioning cylinder piston 49b is retracted into the butt plate positioning cylinder 49a by operation of the corresponding servo valve 6 and the programmable logic controller 104 , to disengage the butt plate 49 from the butt end of the stem 100 . the respective blade drive motors 58 are continuously operated and the saw positioning cylinders 54 are activated by electrical actuation of the corresponding servo valves 6 , hydraulically connected to the positioning cylinders 54 , responsive to command from the programmable logic controller 104 , to extend the saw positioning cylinder pistons 55 in concert and cause the blade ladders 53 and the corresponding rotating saw blades 56 to pivot forwardly , such that each blade 56 engages and cuts the stem 100 in concert with the remaining saw blades 56 , at the precise locations previously determined by the computer 103 and marked by the respective carriage location encoders 41 , as heretofore described . when the stem 100 has been cut into multiple segments , the saw positioning cylinders 54 are reversed in concert by retraction of the saw positioning cylinder pistons 55 responsive to operation of the connecting servo valves 6 and the programmable logic controller 104 , and the saw blades 56 are reoriented together into the &# 34 ; ready &# 34 ; position . the clamp arm positioning cylinders 70 are likewise operated to pivot the clamp arms 67 on the clamp arm pivot pin 69 back into the stem loading configuration . the two ejection cylinders 94 in each of the respective moveable saw carriages 20 and the fixed saw carriage 20a are then activated by operation of the corresponding hydraulically - connected solenoid valves 13 responsive to command from the programmable logic controller 104 , to extend the corresponding ejection cylinder pistons 95 and the segment - engaging heads 96 , contact the respective segments and force the segments from the cutting platform 25 , where they typically drop onto a segment conveyor 75 , for transport to other areas of the mill for further processing . the segment - engaging heads are retracted by reversing the procedure outlined above and the respective movable saw carriages 20 are now in configuration for repositioning by the respective drive spur gear 30 and driven spur gear 31 in the corresponding module drive assembly 10 , according to signals from the programmable logic controller 104 , to process the next successive stem 100 , which was scanned by the scanner 102 while the first stem 100 was being cut into segments . the process is thus repeated , with the entire stem scanning , loading , adjusting , clamping , cutting and log - ejecting steps repeated in sequence . referring again to the drawings , as heretofore described , each of the carriage location encoders 41 in the movable saw carriages 20 is designed to signal the programmable logic controller 104 and facilitate independent location of selected ones or all of the respective movable saw carriages 20 throughout the travel of the movable saw carriages 20 on the rails 22 as the respective driven spur gears 31 traverse the corresponding gear racks 29 . it will be appreciated that the movable saw carriages 20 can be moved in either direction on the rails 22 , since the carriage encoders 41 and the hydraulic motors 8 which operate the respective drive spur gears 30 are reversible , to reverse the corresponding operation of the driven spur gears 31 , depending upon the precisely desired location of each of the respective saw blades 56 with respect to the stem 100 to be cut . furthermore , the movable saw carriages 20 are designed to overlap in travel , such that each movable saw carriage 20 may move partially into the adjacent movable saw carriage 20 position if the latter is incapacited or is not needed for the cutting pattern selected . the computer 103 may be instructed to eliminate any cutting sequence requiring operation of a disabled movable saw carriage 20 and the programmable logic controller 104 executes these instructions in orchestrating operation of the remaining moveable saw carriages 20 . it is understood that the respective butt plate positioning cylinders 49a , clamp arm positioning cylinders 70 , ejection cylinders 94 , saw positioning cylinders 54 , roll drives 39 , hydraulic motors 8 and blade drive motors 58 may be operated by hydraulic , electric or pneumatic equipment , using conventional hoses , couplings , fittings , valves , motors , accessories and the like ( not illustrated ), according to the knowledge of those skilled in the art . however , in a most preferred embodiment of the invention , these components , with the exception of the blade drive motors 58 , are hydraulically operated , as illustrated in the drawings and described herein . moreover , it is further understood that the hydraulic fluid pumps 5 and pump motors 12 can be located off the respective moveable saw carriages 20 and the fixed saw carriage 20a and one or more hydraulic fluid pumps 5 and pump motors 12 may be fitted with inlet and outlet hydraulic fluid hoses 7 that connect to the respective hydraulic fluid reservoirs 9 and accumulators 4 on the moveable saw carriages 20 , and the fixed saw carriage 20a to circulate hydraulic fluid and enable the movable saw carriage 20 operating functions described above . it will be appreciated by those skilled in the art that the saw carriages 20 and the fixed saw carriage 20a of this invention are characterized by versatility in the number of modules that can be used , as well as the module spacing and range of movement , to customize the system for a specific job . furthermore , the moveable saw carriages 20 and the fixed saw carriage 20a considerably speed the processing and cutting of incoming stems 100 by minimizing the movement of the stems during the cutting process , to optimize cutting of the stems into logs , poles and other segments of optimum length , using a computerized scanning system . accordingly , substantially any number of rail - mounted movable saw carriages 20 can be used , depending upon the size and character of the operation envisioned , with each of the movable saw carriages 20 having a carriage location encoder 41 that signals the programmable logic controller 104 , electronically connected to the computer 103 . in a typical installation multiple moveable saw carriages 20 , and one fixed saw carriage 20a , are aligned as illustrated in fig1 a and 1b and any number or all of these saw carriages can be implemented in any desired cutting sequence . for example , if only a butt cut is required , only the blade assembly 52 on the fixed saw carriage 20a is activated to effect this cut . furthermore , if a stem 100 is to be cut into 3 segments of selected length , the butt cut may be made , if necessary , by the fixed saw carriage 20a in combination with activation of two of the remaining five moveable saw carriages 20 to effect the necessary dual cuts in the stem 100 . furthermore , the scanner 102 , or the laser camera , electronic or alternative optical scanning device , the computer 103 , programmable logic controller 104 and carriage location encoders 41 , as well as the servo valves 6 and solenoid valves 13 attached to the hydraulic fluid manifold 37 and hydraulically connected to the respective butt plate positioning cylinders 49a , hydraulic motors 8 , saw positioning cylinders 54 , roll drives 39 , clamp arm positioning cylinders 70 and ejection cylinders 94 , respectively , may be of any desired design , according to the knowledge of those skilled in the art and operate in conventional fashion to achieve the intended result . moreover , a control console or remote control of selected design may be used to initiate manual , semiautomatic and automatic operation of the moveable saw carriages 20 and the fixed saw carriage 20a , according to the knowledge of those skilled in the art . referring again to fig1 b and 2 of the drawings , it will be further understood as described above that the saw blade 56 mounted in the fixed saw carriage 20a located on one end of the carriage line is known as the &# 34 ; butt - cut saw &# 34 ; and is fixed and designed to precisely remove that portion of the butt end of the stem 100 resting against the butt plate 49 , which cut is necessary to insure that the remaining segments are of optimum length and size . accordingly , this fixed saw carriage 20a includes only one cutting roller 26 , stem clamp 66 and segment ejector 93 . the remaining saw blades 56 serve to cut the stem 100 into the respective segments which are transferred , typically by means of a segment conveyor 75 , to a debarking or other processing area of the mill , as described in my copending patent application and mentioned above . as described above , it will also be appreciated by those skilled in the art that the moveable saw carriages 20 and the fixed saw carriage 20a can be manually operated by use of a control panel or remote control device as described above , by eliminating the functions of the scanner 102 , computer 103 , programmable logic controller 104 and carriage location encoders 41 , as desired . the stems 100 can thus be visually evaluated , the movable saw carriages 20 linearly - adjusted on the rails 22 by an appropriate control system and the stems cut as evaluated . alternatively , any desired function of the moveable saw carriages 20 and the fixed saw carriage 20a can be performed semiautomatically , using the scanner 102 and the programmable controller 104 , or bypassing the scanner 102 and utilizing pre - programmed cutting sequences in the programmable controller 104 , as desired . while the preferred embodiments of the invention have been described above , it will be recognized and understood that various modifications may be made in the invention and the appended claims are intended to cover all such modifications which may fall within the spirit and scope of the invention .	8
the magnetic field generated by the current in the exciter coil 1 has an axial course 2 in the coil itself , as shown in fig1 . at the end face 3 , 3 a of the coil , the field then transitions into a radial course 4 , 4 a , and is partitioned on the outside onto the claw poles 5 , 5 a , and is again guided into these claw poles in the axial direction 6 , from where it overflows radially 7 into the magnet gap 8 . it passes through the stator 9 to the adjacent rotor claw pole 5 a of opposite polarity , and from there , analogously , back to the core 10 of the exciter coil 1 via the leg 3 a . because of this multiple axial - radial field diversion , the field - guiding iron parts of the magnet wheel , that is , the coil core 10 , face plates 3 , 3 a and claw poles 5 , 5 a , are produced from solid iron . this is not a problem for the exciter field , which , at most , changes slowly over time . this field is , however , rapidly modulated on the claw - pole jacket surfaces 11 through the use of the stator , so eddy losses occur in the solid claw poles . to limit these losses , the magnet gap 8 between the magnet wheel and the stator must be larger than would be desirable from the standpoint of capacity . in accordance with the invention , the iron losses dictated by the field pulsation in the magnet gap can be significantly reduced in the solid claw poles if only the interior of the claw poles is solid , i . e ., the cores , and the poles are equipped in the outer region with metal sheets . fig2 and 3 show a detailed longitudinal section and cross - section , respectively , of this measure in a claw pole 5 . the claw pole is solid in the cross - hatched region , and its jacket and side surfaces are encompassed by approximately u - shaped sheets 12 , which , as stamped sheets , can be combined into a stack as a pole end prior to being secured to the claw pole . the claw poles have a uniform width over their axial length . the magnet gap 8 separates the stator 9 , with the stator working winding 21 , from the sheet 12 and the claw pole 5 . the sheets extend claw - like around the solid claw - pole core , so the sheets cannot follow the centrifugal forces . they can also be welded to the claw - pole core by their ends 13 . in addition , the sheets are later glued to each other and the claw - pole core through dripping or saturation . one or more recesses 14 can be stamped into the sheet segment extending along the circumference . this allows a better adaptation of the inside sheet contour to the claw poles , but most importantly , it permits a prevention of the armature field . it is possible to reduce the magnet gap by about half with the reduction in eddy losses attained with the sheet arrangement in the outer claw - pole region . the parallel - flank arrangement of the claw poles , which otherwise usually mesh in a roughly sinusoidally - pointed manner , assures a reduction in the iron losses in the stator 9 , because the magnetic axial flux in the stator that occurs with axially “ pointed ” poles is avoided . the resulting non - sinusoidal course over time of the induced voltage in the stator winding is a further functional advantage with an open circuit of the winding and subsequent rectification . because of this , and because of the reduced magnet gap , the magnet - gap field itself and the counter - inductances , and therefore the desired generator current , are increased . efficiently increases significantly . of course , the stamping tool can also shape the outside jacket contour of the sheet stack to produce a “ sinus pole ,” that is , an expansion of the magnet gap to the tangential pole sides , effecting a sinusoidal voltage . fig4 shows the combination of the aforementioned features with a supportive permanent - magnet excitation by means of tangentially - acting permanent magnets 15 between the parallel - flank claw poles . the permanent magnets are inserted between the side flanks of the u - sheets 12 . they are secured through adhesion ( for example , along with the gluing of the sheets ). the permanent magnets are secured in the radial direction by the catches 16 . the permanent magnets prevent the side ends of the u - sheets from bending laterally due to the centrifugal force . if the desired pole - gap width no longer matches the ( tangential ) magnet thickness , the outside sheet contour must be appropriately adapted . a shoulder is preferably provided in the contour . a “ sinus - pole ” embodiment is also possible . similarly to the standard claw - pole embodiment , an embodiment that has no slip ring and includes idle exciter coils is possible . in this case , however , both claw - pole - finger systems must be supplied with their magnetic field via an idle , annular - cylinder - type conductor piece and two additional magnet gaps . support by permanent magnets of the aforementioned type is especially worthwhile here . because , as mentioned at the outset , the magnetically axially - acting exciting coil encompasses the entire exciter useful flux and the scatter flux of all p rotor poles of a claw side at higher powers , the exciter yoke passing axially through the exciter coil must have a minimum diameter , as stipulated by the magnetic saturation , which severely narrows the radial space for the exciter coil if a transition is not made to a larger rotor diameter . a larger diameter necessitates a higher number of pole pairs . at a given rpm , this leads to an increased remagnetization frequency and greater losses . in a further embodiment of the invention , this problem can be circumvented by exciting the claw poles in a different manner . to this end , two similar claw - pole - finger systems ( one delivers p north poles , the other p south poles ) are no longer allowed to mesh with the pole fingers , alternatingly forming north and south poles in the circumferential direction within the bore of the stator - sheet stack ; instead , a claw - pole toothed wheel 5 having p pole teeth is disposed axially in the plane of the stator - sheet stack 9 , with a claw - pole - finger system 3 , 3 a that has { fraction ( p / 2 + l )} fingers alternatingly extending into the gaps axially from both sides . the corresponding arrangement is shown in fig5 . exciter coils 1 , 1 a are provided on the axial end faces of the { fraction ( p / 2 + l )} claw - pole toothed wheel ; the exciter yoke 18 , 18 a of these coils only has to guide the flux from the { fraction ( p / 2 + l )} poles of the adjacent , adjoining claw - pole - finger system . consequently , the sheet - stack length of the stator can be increased considerably with a predetermined diameter , with advantageous effects for the radial space required for a desirable power and the remagnetization losses . the magnetic excitations of the coils counteract one another , so the claw - pole toothed wheel lying in the center has p north poles , and the two claw - pole - finger systems together deliver p south poles in the gaps of the claw - pole toothed wheel 5 . it is critical that the magnetic resistances in the outer yokes of the claw poles 3 , 3 a not differ too greatly from those in the claw - pole toothed wheel 5 . this principle of axial flux partitioning can be expanded beyond two adjacent units seated on the same shaft . the claw - pole wheel runs in bearings 17 , 17 a , with the end shields 19 , 19 a supporting the stator - sheet stack 9 . the conventional slip rings 20 are provided for current supply .	7
nomenclature of protected and unprotected natural and unnatural amino acids according to the definition in the novabiochem catalogue 2000 under “ useful information , nomenclature , abbreviation ”, page x et seq . and pages a3 - a13 . tks tachykinins sp substance p , neuropeptide of the sequence h - arg - pro - lys - pro - gln - gln - phe - phe - gly - leu - met - nh 2 . nka neurokinin a cgrp calcitonin gene - related peptide bzl benzyl bn benzyl bip biphenyl alanine fmoc - bip - oh cas #: [ 199110 - 64 - 0 ] bpa benzophenone alanine collidine 2 , 4 , 6 - trimethyl pyridine dipea diisopropyl ethyl amine dppa diphenyl phosphoryl acid equiv equivalents esi electron spray ionisation hatu [ o -( 7 - azabenzotriazol - 1 - yl )- 1 , 1 , 3 , 3 - tetramethyluronium hexafluorophosphate ] hoat 1 - hydroxy - 7 - azabenzotriazol ivdde 1 -( 4 , 4 - dimethyl - 2 , 6 - dioxo - cyclohexylidene ) 3 - methyl butyl mtt 3 -( 4 , 5 - dimethyl - 2 - thiazolyl )- 2 , 5 - diphenyltetrazolium bromide nmp n - methyl pyrrolidone odmab 4 { n -[ 1 -( 4 , 4 - dimethyl - 2 , 6 - dioxo - cyclohexylidene )- 3 - methyl butyl ]- amino } benzyloxy tcp - resin : tritylchloropolystyrene resin tlc : thin layer chromatography trt trityl gaba 4 - aminobutyric acid tempo 2 , 2 , 6 , 6 - tetramethylpiperidine - 1 - oxyl hfip hexafluoroisopropanol dcm dichloromethane hplc high performance liquid chromatography xtt ( 2 , 3 - bis -( 2 - methoxy - 4 - nitro - 5 - sulfophenyl )- 2h - tetrazolium - 5 - carboxanilide , disodium salt ) nle norleucine β - z 3 - amino - 3 - deoxy - n - 9 - fluorenylmethoxycarbonyl - 1 , 2 - isopropylidene - α - d - ribofuranose acid γ - z 3 - amino - 3 - deoxy - n - 9 - fluorenylmethoxycarbonyl - 1 , 2 - isopropylidene - α - d - allofuranose acid tentagel trichlorotrityl resin fmoc 9 - fluorenyloxy carbonyl boc t - butyloxycarbonyl lys lysine trp tryptophan tyr tyrosine tyr ( me ) tyrosine methyl ether tyr ( bzl ) tyrosine benzyl ether thr threonine thr ( bzl ) threonine benzyl ether bta l - 3 - benzothienyl alanine ( l - form : cas #: 72120 - 71 - 9 ) bip l - biphenyl alanine ( l - form : cas #: 155760 - 02 - 4 ) dip l - diphenyl alanine ( l - form : cas #: 1495997 - 92 - 2 ) bpa 1 - benzophenone alanine 1 - nal 1 - naphthyl alanine 2 - nal 2 - naphthyl alanine o - fluoro - phe o - fluorophenyl alanine m - fluoro - phe m - fluorophenyl alanine p - fluoro - phe p - fluorophenyl alanine 2 , 3 - difluoro - phe 2 , 3 - difluorophenyl alanine 2 , 4 - difluoro - phe 2 , 4 - difluorophenyl alanine 2 , 5 - difluoro - phe 2 , 5 - difluorophenyl alanine phe ( f 5 ) pentafluorophenyl alanine o - chloro - phe o - chlorophenyl alanine m - chloro - phe m - chlorophenyl alanine p - chloro - phe p - chlorophenyl alanine 2 , 3 - dichloro - phe 2 , 3 - dichlorophenyl alanine 2 , 4 - dichloro - phe 2 , 4 - dichlorophenyl alanine 2 , 5 - dichloro - phe 2 , 5 - dichlorophenyl alanine phe ( cl 5 ) pentachlorophenyl alanine 3 - pal 3 - pyridinyl alanine 4 - pal 4 - pyridinyl alanine phg phenyl glycine thr ( ar ) aryl ether or arylalkyl ether of threonine hphe homo - phenyl alanine ( l - form : cas #: 943 - 73 - 7 ) htyr homo - tyrosine igl indanyl glycine phe ( 4 - no 2 ) 4 - nitrophenyl alanine phe ( 4 - nh - 2clz ) 4 -(( 2 - chlorobenzyl ) oxycarbonyl - amino )- phenyl alanine phe ( 4 - nhz ) 4 -( benzyloxycarbonyl - amino ) phenyl alanine pra propargyl glycine dmf n , n - dimethyl formamide esi - ms electron spray ionisation mass spectroscopy mb methylene blue mtt 3 -( 4 , 5 - dimethyl - 2 - thiazolyl )- 2 , 5 - diphenyltetrazolium bromide xtt ( 2 , 3 - bis -( 2 - methoxy - 4 - nitro - 5 - sulfophenyl )- 2h - tetrazolium - 5 - carboxanilide , disodium salt ) bpa 4 - benzophenyl alanine fmoc - bpa - oh cas # 11766696 - 3 fmoc - d - 1 - nal - oh [ 138774 - 93 - 3 ] fmoc - 1 - nal - oh fmoc - 1 - naphthyl alanine [ 96402 - 49 - 2 ] fmoc - 2 - nal - oh fmoc - 2 - naphthyl alanine [ 136774 - 94 - 4 ] acoet ethyl acetate fc flash chromatography , chromatography at increased pressure edta ethylenediiaminetetraacetic acid dfo desferrioxamine - b dads diamidedithiol alkyl within the meaning of the present invention is a branched , unbranched or cyclic alkyl group . lower alkyl groups having 1 to 10 carbon atoms are preferred ; those having 1 to 6 carbon atoms are particularly preferred . special mention may be made of the radicals methyl , ethyl , propyl , iso - propyl , n - butyl , sec - butyl , tert - butyl , n - pentyl , neo - pentyl , 1 - methyl butyl , 2 - methyl butyl , 3 - methyl butyl , cyclo - pentyl , n - hexyl , 1 - methyl pentyl , 2 - methyl pentyl , 3 - methyl pentyl , 4 - methyl pentyl , 1 - ethyl butyl , 2 - ethyl butyl , 3 - ethyl butyl and cyclo - hexyl . alkenyl within the meaning of the present invention is a branched , unbranched or cyclic hydrocarbon group comprising one or more unsaturated carbon - carbon bonds . these unsaturated carbon - carbon bonds do not form an aromatic system . alkenyl groups having 2 to 10 carbon atoms are preferred ; those having 2 to 6 carbon atoms are especially preferred . the unsaturated bond may be present at any position within the alkenyl group . special mention may be made of the radicals ethenyl , 1 - propenyl , 2 - propenyl , 1 - butenyl , 2 - butenyl , 3 - butenyl , 1 - pentenyl , 2 - pentenyl , 3 - pentenyl , 4 - pentenyl , 1 - hexenyl , 2 - hexenyl , 3 - hexenyl , 4 - hexenyl , 5 - hexenyl , 1 - methyl ethenyl , 1 - methyl - 1 - propenyl , 1 - methyl - 2 - propenyl , 1 - methyl - 1 - butenyl , 1 - methyl - 2 - butenyl , 1 - methyl - 3 - butenyl , 2 - methyl - 1 - butenyl , 2 - methyl - 2 - butenyl , 2 - methyl - 3 - butenyl , 3 - methyl - 2 - butenyl , 1 - methyl - 1 - pentenyl , 1 - methyl - 2 - pentenyl , 1 - methyl - 3 - pentenyl , 1 - methyl - 4 - pentenyl , 2 - methyl - 1 - pentenyl , 2 - methyl - 2 - pentenyl , 2 - methyl - 3 - pentenyl , 2 - methyl - 4 - pentenyl , 3 - methyl - 1 - pentenyl , 3 - methyl - 2 - pentenyl , 3 - methyl - 3 - pentenyl , 3 - methyl - 4 - pentenyl , 4 - methyl - 1 - pentenyl , 4 - methyl - 2 - pentenyl , 4 - methyl - 3 - pentenyl , 4 - methyl - 4 - pentenyl . alkinyl within the meaning of this invention is a branched , unbranched or cyclic hydrocarbon group having one or more di - unsaturated carbon - carbon bonds . alkinyl groups having 2 to 10 carbon atoms are preferred ; those having 2 to 6 carbon atoms are especially preferred . the di - unsaturated bond may be present at any position within the alkinyl group . special mention may be made of the radicals ethinyl , 1 - propinyl , 2 - propinyl , 1 - butinyl , 2 - butinyl , 3 - butinyl , 1 - pentinyl , 2 - pentinyl , 3 - pentinyl , 4 - pentinyl , 1 - hexinyl , 2 - hexinyl , 3 - hexinyl , 4 - hexinyl , 5 - hexinyl , 1 - methyl - 2 - propinyl , 1 - methyl - 2 - butinyl , 1 - methyl - 3 - butinyl , 2 - methyl - 3 - butinyl , 3 - methyl - 1 - butinyl , 1 - methyl - 2 - pentinyl , 1 - methyl - 3 - pentinyl , 1 - methyl - 4 - pentinyl , 2 - methyl - 3 - pentinyl , 2 - methyl - 4 - pentinyl , 3 - methyl - 4 - pentinyl , 3 - methyl - 1 - pentinyl , 4 - methyl - 1 - pentinyl und 4 - methyl - 2 - pentinyl . aryl within the meaning of this invention is a cyclic aromatic group . the aryl group optionally contains one or more heteroatoms selected from the group consisting of n , s , o so that heteroaryl groups also fall under the term “ aryl group ” within the meaning of this invention . aryl groups having 4 to 16 carbon atoms are preferred ; benzyl , naphthyl , anthracyl , fluorenyl , pyridyl , pyrazinyl , pyrrolyl , imidazolyl , furanyl , thienyl and indolyl groups are especially preferred . arylalkyl within the meaning of the present invention is an aryl group linked to the remainder of the molecule by an alkyl group . the preferred groups listed for this group are also preferred in the present case . alkylaryl within the meaning of the present invention is an alkyl group linked to the remainder of the molecule by an aryl group . the preferred groups listed for this group are also preferred in the present case . alkoxy within the meaning of the present invention is an alkyl group linked to the remainder of the molecule by an oxygen atom . the preferred groups listed for this group are also preferred in the present case . alkenyloxy within the meaning of the present invention is an alkenyl group linked to the remainder of the molecule by an oxygen atom . the preferred groups listed for this group are also preferred in the present case . aryloxy within the meaning of the present invention is an aryl group linked to the remainder of the molecule by an oxygen atom . the preferred groups listed for this group are also preferred in the present case . arylalkoxy within the meaning of the present invention is an arylalkyl group linked to the remainder of the molecule by an oxygen atom . the preferred groups listed for this group are also preferred in the present case . alkylaryloxy within the meaning of the present invention is an alkylaryl group linked to the remainder of the molecule by an oxygen atom . the preferred groups listed for this group are also preferred in the present case . thioalkyl within the meaning of the present invention is an alkyl group linked to the remainder of the molecule by a sulfur atom . the preferred groups listed for this group are also preferred in the present case . thioalkenyl within the meaning of the present invention is an alkenyl group linked to the remainder of the molecule by a sulfur atom . the preferred groups listed for this group are also preferred in the present case . thioaryl within the meaning of the present invention is an aryl group linked to the remainder of the molecule by a sulfur atom . the preferred groups listed for this group are also preferred in the present case . selenoalkyl within the meaning of the present invention is an alkyl group linked to the remainder of the molecule by a selenium atom . the preferred groups listed for this group are also preferred in the present case . selenoaryl within the meaning of the present invention is an aryl group linked to the remainder of the molecule by a selenium atom . the preferred groups listed for this group are also preferred in the present case . alkanoyl within the meaning of the present invention is an alkyl group linked to the remainder of the molecule by a — c ( o ) group . the preferred groups listed for this group are also preferred in the present case . alkenoyl within the meaning of the present invention is an alkenyl group linked to the remainder of the molecule by a — c ( o ) group . the preferred groups listed for this group are also preferred in the present case . alkinoyl within the meaning of the present invention is an alkinyl group linked to the remainder of the molecule by a c ( o ) group . the preferred groups listed for this group are also preferred in the present case . aroyl within the meaning of the present invention is an aryl group linked to the remainder of the molecule by a — c ( o ) group . the preferred groups listed for this group are also preferred in the present case . arylalkanoyl within the meaning of the present invention is an arylalkyl group linked to the remainder of the molecule by a — c ( o ) group . the preferred groups listed for this group are also preferred in the present case . alkylaroyl within the meaning of the present invention is an alkylaryl group linked to the remainder of the molecule by a — c ( o ) group . the preferred groups listed for this group are also preferred in the present case . amidoalkyl within the meaning of the present invention is an alkyl group linked to the remainder of the molecule by an amide linkage . the preferred groups listed for this group are also preferred in the present case . amidoalkenyl within the meaning of the present invention is an alkenyl group linked to the remainder of the molecule by an amide linkage . the preferred groups listed for this group are also preferred in the present case . amidoalkinyl within the meaning of the present invention is an alkinyl group linked to the remainder of the molecule by an amide group . the preferred groups listed for this group are also preferred in the present case . arylalkanoyloxy within the meaning of the present invention is an arylalkyl group linked to the remainder of the molecule by an ester group . the preferred groups listed for this group are also preferred in the present case . alkylaroyloxy within the meaning of the present invention is an alkylaryl group linked to the remainder of the molecule by an ester group . the preferred groups listed for this group are also preferred in the present case . aminocarboxylic acid within the meaning of the present invention is an α -, β -, or γ - aminocarboxylic acid . alpha - aminocarboxylic acids occurring in nature are preferred . unless explicitly defined , all stereo isomers of optically active aminocarboxylic acids are included , especially the d - and l - forms of α - aminocarboxylic acids occurring in nature . aliphatic side chains within the meaning of the present invention mean a side chain of an aminocarboxylic acid which is an alkyl group . the side chains of the amino carboxylic acids alanine , valine , leucine , norleucine and isoleucine are preferred . optionally , the side chain may bear one or more substituents selected from the group consisting of f , cl , br , i , alkoxy , alkylthio , alkylseleno . an aromatic side chain within the meaning of the present invention is a side chain of an aminocarboxylic acid comprising at least one aromatic ring . this ring may be a pure carbocycle or include one or more heteroatoms selected from the group consisting of n , s and o . the aromatic ring may be substituted . it may be linked to the peptide backbone directly or by an alkylene group . preferred aromatic side chains are the side chains of phenyl alanine , 1 - and 2 - naphthyl alanine , tyrosine , tryptophan , biphenyl alanine , mono -, di -, tri -, tetra -, and pentahalogenated phenyl alanine , substituted and unsubstituted , especially mono -, di -, tri -, tetra -, and pentahalogenated homophenyl alanine , methylphenyl alanine , nitrophenyl alanine , alkyl tyrosine , phosphotyrosine , mono -, di -, tri -, and tetrahalogenated tyrosyl , substituted and unsubstituted , especially mono -, di -, tri -, and tetrahalogenated and alkylated homotyrosyl , substituted and unsubstituted , especially halogenated 4 - biphenyl alanine , diphenyl glycine , 2 - indanyl glycine , diphenyl alanine , 4 - benzoyl phenyl alanine , 3 - benzothienyl alanine . an amino group within the meaning of the present invention is a group selected from nh 2 , nhr ′ and nr ′ r ″ wherein the r ′ and r ″ groups are selected independently from alkyl , alkenyl , and aryl , preferably c 1 - c 4 alkyl , c 2 - c 6 alkenyl and c 6 - c 14 aryl . nh 2 , dimethyl amine and diethyl amine are especially preferred . acid groups in the side chain within the meaning of the present invention are groups of which at least 5 % are present in a deprotonated state in an aqueous solution at a ph value of 7 . basic groups in the side chain within the meaning of the present invention are groups of which at least 5 % are present in a protonated state in an aqueous solution at a ph value of 7 . a side chain is a basic side chain if at least one basic group is contained . polyfunctional side chains are defined as basic side chains within the meaning of the present invention if they bear more basic groups than acidic groups . the peptides of the present invention are represented by the general formulae 1 to 6 . the groups a , b , c , d , and z are radicals derived from aminocarboxylic acids linked to each other by a peptide linkage . n and m represent 0 or 1 and n + m represents 1 or 2 . accordingly , the formulae 1 to 6 represent tetra - or pentapeptides . the linear peptides of the formulae 1 to 5 may be derived from the cyclic peptide of the formula 6 by cleaving any binding site among the peptide linkages and by saturating the free valences with the terminal groups y 1 and y 2 . wherein the substituents q 1 , q 2 , q 3 , q 4 , q 5 , q 6 , q 7 , q 1 , r 3 , r 4 , r 5 , r 6 , r 7 , r 8 and x have the following meaning : x is selected from o , s , se , nr 9 , pr 8 and cr 9 r 10 , preferably o and nh , wherein r 9 , r 10 are independently selected from h , oh , sh , f , cl , br , i , alkyl , alkenyl , alkinyl , aryl , alkylaryl , arylalkyl , alkoxy , alkenyloxy , aryloxy , thioalkyl , thioaryl , selenoalkyl , selenoaryl which may optionally be substituted with one or more of the substituents selected from f , oh , sh , seh , an amino group , an oxo group and a carboxy group . h , alkyl , aryl and oh are preferred . q 1 and q 2 are independently selected from a single bond , ch 2 , ch ( oh ), ch ( or 1 ), chr 1 and cr 1 r 2 , wherein r 1 and r 2 are independently selected from alkyl , alkenyl , aryl , arylalkyl , alkylaryl , which may optionally be substituted with f , oh , an amino group or a carboxy group . preferred groups q 1 and q 2 are a single bond , ch ( oh ) and ch ( o benzyl ), especially mono -, di -, tri -, tetra - and pentahalogenated benzyl ether , fluorinated benzyl ether , alkylated benzyl ether , arylbenzyl ether , hydroxy benzyl ether and alkoxy benzyl ether . q 3 bis q 8 are independently selected from a single bond , o , s , se , n 2 , nr 9 , po 3 . r 3 bis r 8 are independently selected from the group consisting of h , oh , sh , n 3 , cn , nc , scn , f , cl , br , i , so 3 , no 2 , pr 11 r 12 , coor 11 , alkyl , alkenyl , alkinyl , aryl , alkylaryl , arylalkyl , alkanoyl , alkenoyl , alkinoyl , aroyl , arylalkanoyl , alkylaroyl , which may optionally be substituted with one or more substituents selected from f , oh , sh , seh , an amino group , an oxo group or a carboxy group . r 11 and r 12 are independently selected from h , oh , sh , f , cl , br , i , cn , nc , scn , alkyl , alkenyl , alkinyl , aryl , alkylaryl , arylalkyl , alkoxy , alkenyloxy , aryloxy , thioalkyl , thioalkenyl , thioaryl , selenoalkyl , selenoalkenyl , selenoaryl , amidoalkyl , amidoalkenyl , amidoalkinyl , arylalkanoyloxy , alkylaroyloxy , arylalkoxy , alkylaryloxy , which may optionally be substituted with one or more of the substituents selected from f , oh , sh , seh , an amino group , an oxo group or a carboxy group . optionally , two substituents r i and r j , with i , j = 3 to 8 , are linked , forming a 5 - or 6 - membered ring , wherein optionally one or more of the ring atoms are independently substituted with one or more groups , independently selected from alkyl , alkenyl and aryl . typical representatives of this group are spiro compounds , aryl ketals , alkylaryl ketals , alkyl acetals , aryl acetals , arylthio ketals , alkylarylthio ketals , alkylthio acetals , arylthio acetals , aryl aminals , alkylaryl aminals , alkyl aminals and aryl aminals each of which may be substituted or unsubstituted , branched or unbranched . alkyl ketals , aryl ketals , alkylaryl ketals , alkyl acetals or aryl acetals are preferred . the ketal of acetone and the ketal of substituted or unsubstituted benzophenone are especially preferred . preferred substituents - q i - r i and - q j - r j , with i , j = 3 to 8 , are h , alkyl , alkenyl , aryl , arylalkyl , alkylaryl , alkoxy , aryloxy , aroyloxy and alkanoyloxy . especially preferred are h , methoxy , benzyloxy , allyloxy and — o — c ( ch 3 ) 2 — o —. it is also especially preferred to select the substituents - q i - r i with i 3 to 8 , in such a manner that each of the ring atoms in formula ( 7 ) except x bears a hydrogen atom and a substituent other than hydrogen . this criterion is met by most of the monosaccharides occurring in nature . the use of such molecules as starting materials provides the advantage that the groups z with a defined stereochemistry may be obtained at low cost . preferred regioisomers of group z are characterised in that the groups - q 1 - nh — and - q 2 - c ( o )— are linked to adjacent carbon atoms of the ring in formula ( 7 ). z groups wherein the groups - q 1 - nh — and - q 2 - c ( o )— are linked to the two carbon atoms of the ring in formula ( 7 ) which are adjacent to x are also preferrred . the structural formulae for preferred representatives of group z are shown in the following . in each case , the free amino carboxylic acids are shown . in the peptide of the invention , peptide linkages are present at the positions of the amino group and of the carboxyl group . the substituents r , r ′ and r ″ shown in the following structural images have the same meaning as the substituents - q i - r i , wherein i = 3 to 8 , defined above and in the claims . group a is an α -, β - or γ - amino carboxylic acid radical having an aromatic side chain or an aliphatic side chain . c 6 - c 14 aryl groups , which may optionally be substituted with oh or i and wherein a carbon atom may be isosterically replaced by nitrogen or sulfur , and c 1 - c 10 alkyl groups are preferred . it is also preferred if the side chain of the amino carboxylic radical a is a c 1 - c 4 alkyl - c 6 - c 14 aryl group wherein the aryl group is optionally substituted with oh or i and wherein a carbon atom may optionally be replaced isosterically by nitrogen or sulfur . the amino carboxylic acid radicals of valine , tyrosine , the methyl ether of tyrosine and of phenyl alanine are particularly preferred . also preferred is d - asp incorporated as a β - amino acid wherein the side chain is amidically linked to benzyl amine or 1 - naphthyl amine via an amide linkage . also preferred are β - phe , β - tyr and β - val wherein the side - chain may be located in the 2 - or 3 - position . with regard to the nomenclature and synthesis of β - amino carboxylic acids reference is made to the works of d . seebach : helv . chim . acta 1998 , 81 , 2141 ; angewandte chemie 1999 , 111 , 1302 ; helv . chim . acta 2000 , 83 , 16 ; helv . chim . acta 1998 , 81 , 187 ; helv . chim . acta 1998 , 81 , 983 ; helv . chim . acta 1998 , 81 , 2093 ; helv . chim . acta 1999 , 82 , 1150 ; liebigs ann . chem . 1995 , 1217 ; helv . chim . acta 2000 , 83 , 3139 ; helv . chim . acta 1996 , 79 , 913 ; helv . chim . acta 1996 , 79 , 2043 ; helv . chim . acta 1997 , 80 , 2033 ; helv . chim . acta 1998 ; 81 ; 2218 ; chimia 1998 , 52 , 734 . b is an α -, β - or γ - amino carboxylic acid radical having an aromatic side chain . side chains having a c 6 - c 14 aryl group or a c 1 - c 4 alkyl - c 6 - c 14 aryl group which may optionally be substituted with oh or i and wherein a carbon atom may optionally be replaced isosterically by nitrogen or sulfur are preferred . especially preferred are the amino carboxylic acid radicals of 1 - naphthyl alanine , 2 - naphthyl alanine , bta and tryptophan . in each of these cases , the d - and l - forms of the radicals are preferred . c is an α -, β - or γ - amino carboxylic acid radical having a basic side chain or an aliphatic side chain . preferably , the side chain is a c 1 - c 10 alkyl group which may be substituted with one or more groups selected from amino , acetyl , trifluoroacetyl and alkyl amide groups . especially preferred are side chains having a c 3 - c 5 alkyl group or a c 3 - c 5 amino alkyl group . especially preferred representatives of group c are the radicals of the amino carboxylic acids lysine , acetal protected lysine and norleucine . d is an α -, β - or γ - amino carboxylic acid radical which does not have acidic groups or basic groups in the side chain . side chains having a c 6 - c 14 aryl group or a c 1 - c 4 alkyl - c 6 - c 14 aryl group which may optionally be substituted with oh or i and wherein a carbon atom may optionally be replaced isosterically by nitrogen or sulfur are preferred . also preferred are radicals wherein the side chain is a c 1 - c 6 alkyl group which may optionally be substituted with one or more groups selected from oh , c 1 - c 10 alkoxy , c 6 - c 20 aryl - c 1 - c 4 alkoxy , and c 6 - c 20 aryloxy . preferred representatives of this group are the radicals of the amino carboxylic acids bip , bpa , dip , 1 - nal , 2 - nal and threonine . especially preferred are the radicals of the threonine ethers and tyrosine ethers where the ether is formed from threonine or tyrosine and an aromatic group or an arylalkyl group . preferred representatives of this group are trityl ether , benzyl ether and the phe ( f 5 ) ether of threonine and the trityl ether , benzyl ether and the phe ( f 5 ) ether of tyrosine . also preferred are side chains where an aryl group or an aralkyl group is linked to the backbone of the peptide by an amide linkage . preferred representatives are d - and l - asp incorporated as a β - or α - amino acid which is peptidically linked to aminopyrene , 1 - naphthyl amine , benzyl amine , anthraquinone amine via the second acidic group . in addition , the linear peptides comprise the end groups y 1 and y 2 . y 1 is linked to the amino group of the corresponding amino carboxylic acid and is selected from h , ch 3 ( ch 2 ) r co , with r = 0 to 6 , butoxy carbonyl and 9 - fluorenyl methoxy carbonyl . preferred groups are acetyl and trifluoro acetyl . y 2 is linked to the carboxy group of the corresponding amino carboxylic acid and is selected from h , nh 2 , alkoxy , aryloxy , alkyl , aryl , alkenyl , alkinyl , f , cl , br , i , cn , nc , scn , thioalkyl , thioaryl . preferred groups are nh 2 , methoxy , ethoxy and benzyloxy . each of n and m represent the integers 0 or 1 , such that m + n is 1 or 2 : cyclo [- phe - trp - lys - z -], cyclo [- phe - d - trp - lys - z -], cyclo [- phe - trp - nle - z -], cyclo [- phe - d - trp - nle - z -], cyclo [- tyr - trp - lys - z -], cyclo [- tyr - d - trp - lys - z -], cyclo [- tyr - trp - nle - z -], cyclo [- tyr - d - trp - nle - z -], cyclo [- phe - bta - lys - z -], cyclo [- phe - d - bta - lys - z -], cyclo [- phe - bta - nle - z -], cyclo [- phe - d - bta - nle - z -], cyclo [- tyr - bta - lys - z -], cyclo [- tyr - d - bta - lys - z -], cyclo [- tyr - bta - nle - z -], cyclo [- tyr - d - bta - nle - z -], cyclo [- phe - 1 - nal - lys - z -], cyclo [- phe - d - 1 - nal - lys - z -], cyclo [- phe - 1 - nal - nle - z -], cyclo [- phe - d - 1 - nal - nle - z -], cyclo [- tyr - 1 - nal - lys - z -], cyclo [- tyr - d - 1 - nal - lys - z -], cyclo [- tyr - 1 - nal - nle - z -], cyclo [- tyr - d - 1 - nal - nle - z -], cyclo [- phe - 2 - nal - lys - z -], cyclo [- phe - d - 2 - nal - lys - z -], cyclo [- phe - 2 - nal - nle - z -], cyclo [- phe - d - 2 - nal - nle - z -], cyclo [- tyr - 2 - nal - lys - z -], cyclo [- tyr - d - 2 - nal - lys - z -], cyclo [- tyr - 2 - nal - nle - z -], cyclo [- tyr - d - 2 - nal - nle - z -], cyclo [- tyr ( bzl )- bta - lys - z -], cyclo [- tyr ( bzl )- d - bta - lys - z -], cyclo [- tyr ( bzl )- bta - nle - z -], cyclo [- tyr ( bzl )- d - bta - nle - z -], cyclo [- tyr ( bzl )- 1 - nal - lys - z -], cyclo [- tyr ( bzl )- d - 1 - nal - lys - z -], cyclo [- tyr ( bzl )- 1 - nal - nle - z -], cyclo [- tyr ( bzl )- d - 1 - nal - nle - z -], cyclo [- tyr ( bzl )- 2 - nal - lys - z -], cyclo [- tyr ( bzl )- d - 2 - nal - lys - z -], cyclo [- tyr ( bzl )- 2 - nal - nle - z -], cyclo [- tyr ( bzl )- d - 2 - nal - nle - z -], cyclo [- phe - trp - lys - phe - z -], cyclo [- phe - d - trp - lys - phe - z -], cyclo [- tyr - trp - lys - phe - z -], cyclo [- tyr - d - trp - lys - phe - z -], cyclo [- tyr ( me )- trp - lys - phe - z -], cyclo [- tyr ( me )- d - trp - lys - phe - z -], cyclo [- phe - trp - lys - thr - z -], cyclo [- phe - d - trp - lys - thr - z -], cyclo [- phe - trp - lys - tyr ( bzl )- z -], cyclo [- phe - d - trp - lys - tyr ( bzl )- z -], cyclo [- phe - trp - lys - bip - z -], cyclo [- phe - d - trp - lys - bip - z -], cyclo [- phe - trp - lys - dip - z -], cyclo [- phe - d - trp - lys - dip - z -], cyclo [- phe - trp - lys - bpa - z -], cyclo [- phe - d - trp - lys - bpa - z -], cyclo [- phe - trp - lys - 1 - nal - z -], cyclo [- phe - d - trp - lys - 1 - nal - z -], cyclo [- phe - t r - lys - 2 - nal - z -], cyclo [- phe - d - trp - lys - 2 - nal - z -], cyclo [- phe - trp - lys - p - fluoro - phe - z -], cyclo [- phe - d - trp - lys - p - fluoro - phe - z -], cyclo [- phe - trp - lys - phe ( f5 )- z -], cyclo [- phe - d - trp - lys - phe ( f5 )- z -], cyclo [- phe - trp - lys - o - fluoro - phe - z -], cyclo [- phe - d - trp - lys - o - fluoro - phe - z -], cyclo [- phe - trp - lys - m - fluoro - phe - z -], cyclo [- phe - d - trp - lys - m - fluoro - phe - z -], cyclo [- phe - trp - lys - thr ( ar )- z -], cyclo [- phe - d - trp - lys - thr ( ar )- z -], cyclo [- phe - trp - lys - thr ( bn )- z -], cyclo [- phe - d - trp - lys - thr ( bn )- z -], cyclo [- phe - trp - lys - 2 , 4 - difluoro - phe - z -], cyclo [- phe - d - trp - lys - 2 , 4 - difluoro - phe - z -], cyclo [- phe - trp - lys - 2 , 3 - difluoro - phe - z -], cyclo [- phe - d - trp - lys - 2 , 3 - difluoro - phe - z -], cyclo [- phe - trp - lys - 2 , 5 - difluoro - phe - z -], cyclo [- phe - d - trp - lys - 2 , 5 - difluoro - phe - z -], cyclo [- phe - trp - lys - p - chloro - phe - z -], cyclo [- phe - d - trp - lys - p - chloro - phe - z -], cyclo [- phe - trp - lys - phe ( c15 )- z -], cyclo [- phe - d - trp - lys - phe ( c15 )- z -], cyclo [- phe - trp - lys - o - chloro - phe - z -], cyclo [- phe - d - trp - lys - o - chloro - phe - z -], cyclo [- phe - trp - lys - m - chloro - phe - z -], cyclo [- phe - d - trp - lys - m - chloro - phe - z -], cyclo [- phe - trp - lys - thr ( ar )- z -], cyclo [- phe - trp - lys - 2 , 4 - dichloro - phe - z -], cyclo [- phe - d - trp - lys - 2 , 4 - dichloro - phe - z -], cyclo [- phe - trp - lys - 2 , 3 - dichloro - phe - z -], cyclo [- phe - d - trp - lys - 2 , 3 - dichloro - phe - z -], cyclo [- phe - trp - lys - 2 , 5 - dichloro - phe - z -], cyclo [- phe - d - trp - lys - 2 , 5 - dichloro - phe - z -], cyclo [- phe - trp - lys - 3 , 5 - dichloro - phe - z -], cyclo [- phe - d - trp - lys - 3 , 4 - dichloro - phe - z -], cyclo [- phe - trp - lys - 3 , 4 - dichloro - phe - z -], cyclo [- phe - d - trp - lys - 3 , 5 - dichloro - phe - z -], cyclo [ phe - trp - nle - phe - z ], cyclo [- phe - d - trp - nle - phe - z -], cyclo [- tyr - trp - nle - phe - z -], cyclo [- tyr - d - trp - nle - phe - z -], cyclo [- tyr ( me )- trp - nle - phe - z -], cyclo [- tyr ( me )- d - trp - nle - phe - z -], cyclo [- phe - trp - nle - thr - z -], cyclo [- phe - d - trp - nle - thr - z -], cyclo [- phe - trp - nle - bip - z -], cyclo [- phe - d - trp - nle - bip - z -], cyclo [- phe - trp - nle - dip - z -], cyclo [- phe - d - trp - nle - dip - z -], cyclo [- phe - trp - nle - bpa - z -], cyclo [- phe - d - trp - nle - bpa - z -], cyclo [- phe - trp - nle - 1 - nal - z -], cyclo [- phe - d - trp - nle - 1 - nal - z -], cyclo [- phe - trp - nle - 2 - nal - z -], cyclo [- phe - d - trp - nle - 2 - nal - z -], cyclo [- phe - trp - nle - p - fluoro - phe - z -], cyclo [- phe - d - trp - nle - p - fluoro - phe - z -], cyclo [- phe - trp - nle - phe ( f5 )- z -], cyclo [- phe - d - trp - nle - phe ( f5 )- z -], cyclo [- phe - trp - nle - o - fluoro - phe - z -], cyclo [- phe - d - trp - nle - o - fluoro - phe - z -], cyclo [- phe - trp - nle - m - fluoro - phe - z -], cyclo [- phe - d - trp - nle - m - fluoro - phe - z -], cyclo [- phe - trp - nle - thr ( ar )- z -], cyclo [- phe - d - trp - nle - thr ( ar )- z -], cyclo [- phe - trp - nle - thr ( bn )- z -], cyclo [- phe - d - trp nle - thr ( bn )- z -], cyclo [- phe - trp - nle - 2 , 4 - difluoro - phe - z -], cyclo [- phe - d - trp - nle - 2 , 4 - difluoro - phe - z ], cyclo [- phe - trp - nle - 2 , 3 - difluoro - phe - z -], cyclo [- phe - d - trp - nle - 2 , 3 - difluoro - phe - z -], cyclo [- phe - trp - nle 2 , 5 - difluoro - phe - z -], cyclo [- phe - d - trp - nle - 2 , 5 - difluoro - phe - z -], cyclo [- phe - trp - nle - p - chloro - phe - z -], cyclo [- phe - d - trp - nle - p - chloro - phe - z -], cyclo [- phe - trp - nle - phe ( c15 )- z -], cyclo [- phe - d - trp - nle - phe ( c15 )- z -], cyclo [- phe - trp - nle - o - chloro - phe - z -], cyclo [- phe - d - trp - nle - o - chloro - phe - z -], cyclo [- phe - trp - nle - m - chloro - phe - z -], cyclo [- phe - d - trp - nle - m - chloro - phe - z -], cyclo [- phe - trp - nle - thr ( ar )- z -], cyclo [- phe - trp - nle - 2 , 4 - dichloro - phe - z -], cyclo [- phe - d - trp - nle - 2 , 4 - dichloro - phe - z -], cyclo [- phe - trp - nle - 2 , 3 - dichloro - phe - z -], cyclo [- phe - d - trp - nle - 2 , 3 - dichloro - phe - z -], cyclo [- phe - trp - nle - 2 , 5 - dichloro - phe - z -], cyclo [- phe - d - trp - nle - 2 , 5 - dichloro - phe - z -], cyclo [- phe - trp - nle - 3 , 5 - dichloro - phe - z -], cyclo [- phe - d - trp - nle - 3 , 4 - dichloro - phe - z -], cyclo [- phe - trp - nle - 3 , 4 - dichloro - phe - z -], cyclo [- phe - d - trp nle - 3 , 5 - dichloro - phe - z -], cyclo [- phe - trp - nle - nle ( 6 - obzl )- z -], cyclo [- phe - d - trp nle - nle ( 6 - obzl )- z -], cyclo [- tyr - trp - nle - nle ( 6 - obzl )- z -], cyclo [- tyr - d - trp - nle - nle ( 6 - obzl )- z -], cyclo [- tyr ( me )- trp - nle - nle ( 6 - obzl )- z -], cyclo [- phe - trp - nle - 3 - pal - z -], cyclo [- phe - d - trp - nle - 3 - pal - z -], cyclo [- tyr - trp - nle - 3 - pal - z -], cyclo [- tyr - d - trp - nle - 3 - pal - z -], cyclo [- tyr ( me )- trp - nle - 3 - pal - z -], cyclo [- tyr ( me )- d - trp - nle - 3 - pal - z -], cyclo [- phe - trp - nle - 4 - pal - z -], cyclo [- phe - d - trp - nle - 4 - pal - z -], cyclo [- tyr - trp - nle - 4 - pal - z -], cyclo [- tyr - d - trp - nle - 4 - pal - z -], cyclo [- tyr ( me )- trp - nle - 4 - pal - z -], cyclo [- phe - trp - nle - 3 , 4 - dichloro - phe - z -], cyclo [- phe - d - trp - nle - 3 , 4 - dichloro - phe - z -], cyclo [- phe - trp - nle - 3 , 4 - difluoro - phe - z -], cyclo [- phe - d - trp - nle - 3 , 4 - difluoro - phe - z -], cyclo [- phe - trp - nle - phg - z -], cyclo [- phe - d - trp - nle - phg - z -], cyclo [- tyr - trp - nle - phg - z -], cyclo [- tyr - d - trp - nle - phg - z -], cyclo [- tyr ( me )- trp - nle - phg - z -], cyclo [- phe - trp - nle - phe - z -], cyclo [- phe - d - trp - nle - hphe - z -], cyclo [- tyr - trp - nle - hphe - z -], cyclo [- tyr - d - trp - nle - hphe - z -], cyclo [- tyr ( me )- trp - nle - hphe - z -], cyclo [- phe - trp - nle - igl - z -], cyclo [- phe - d - trp - nle - igl - z -], cyclo [- tyr - trp - nle - igl - z -], cyclo [- tyr - d - trp - nle - igl - z -], cyclo [- tyr ( me )- trp - nle - igl - z -], cyclo [- phe - trp - nle - phe ( 4 - no2 )- z -], cyclo [- phe - d - trp - nle - phe ( 4 - no2 )& gt ; z -], cyclo [- tyr - trp - nle - phe ( 4 - no2 )- z -], cyclo [- tyr - d - trp - nle - phe ( 4 - no2 )- z -], cyclo [- tyr ( me )- trp - nle - phe ( 4 - no2 )- z -], cyclo [- phe - trp - nle - phe ( 4 - nhz )- z -], cyclo [- phe - d - trp - nle - phe ( 4 - nhz )- z -], cyclo [- tyr - trp - nle - phe ( 4 - nhz )- z -], cyclo [- tyr - d - trp - nle - phe ( 4 - nhz )- z -], cyclo [- tyr ( me )- trp - nle - phe ( 4 - nhz )- z -], cyclo [- phe - trp - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- phe - d - trp - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr - trp - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr - d - trp - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr ( me )- trp - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- phe - trp - nle - htyr - z -], cyclo [- phe - d - trp - nle - htyr - z -], cyclo [- tyr - trp - nle - htyr - z -], cyclo [- tyr - d - trp - nle - htyr - z -], cyclo [- tyr ( me )- trp - nle - htyr - z -], cyclo [- phe - trp - nle - pra - z -], cyclo [- phe - d - trp - nle - pra - z -], cyclo [- tyr - trp - nle - pra - z -], cyclo [- tyr - d - trp - nle - pra - z -], cyclo [- tyr ( me )- trp - nle - pra - z -], cyclo [- phe - 1 - nal - nle - phe - z -], cyclo [- phe - d - 1 - nal - nle - phe - z -], cyclo [- tyr - 1 - nal - nle - phe - z -], cyclo [- tyr - d - 1 - nal - nle - phe - z -], cyclo [- tyr ( me )- 1 - nal - nle - phe - z -], cyclo [- tyr ( me )- d - 1 - nal - nle - phe - z -], cyclo [- phe - 1 - nal - nle - thr - z -], cyclo [- phe - d - 1 - nal - nle - thr - z -], cyclo [- phe - 1 - nal - nle - tyr ( bzl )- z -], cyclo [- phe - d - 1 - nal - nle - tyr ( bzl )- z -], cyclo [- phe - 1 - nal - nle - bip - z -], cyclo [- phe - d - 1 - nal - nle - bip - z -], cyclo [- phe - 1 - nal - nile - dip - z -], cyclo [ phe - d - 1 nal - nle - dip - z -], cyclo [- phe - 1 - nal - nle - bpa - z -], cyclo [- phe - d - 1 - nal - nle - bpa - z -], cyclo [- phe - 1 - nal - nle - 1 - nal - z -], cyclo [- phe - d - 1 - nal - nle - 1 - nal - z -], cyclo [- phe - 1 - nal - nle - 2 - nal - z -], cyclo [- phe - d - 1 - nal - nle - 2 - nal - z -], cyclo [- phe - 1 - nal - nle - p - fluoro - phe - z -], cyclo [- phe - d - 1 - nal - nle - p - fluoro - phe - z -], cyclo [- phe - 1 - nal - nle - phe ( f5 )- z -], cyclo [- phe - d - 1 - nal - nle - phe ( f5 )- z -], cyclo [- phe - 1 - nal - nle - o - fluoro - phe - z -], cyclo [- phe - d - 1 - nal - nle - o - fluoro - phe - z -], cyclo [- phe - 1 - nal - nle - m - fluoro - phe - z -], cyclo [- phe - d - 1 - nal - nle - m - fluoro - phe - z -], cyclo [- phe - 1 - nal - nle - thr ( ar )- z -], cyclo [- phe - d - 1 - nal - nle - thr ( ar )- z -], cyclo [- phe - 1 - nal - nle - thr ( bn )- z -], cyclo [- phe - d - 1 - nal - nle - thr ( bn )- z -], cyclo [- phe - 1 - nal - nle - 2 , 4 - difluoro - phe - z -], cyclo [- phe - d - 1 - nal - nle - 2 , 4 - difluoro - phe - z -], cyclo [- phe - 1 - nal - nle - 2 , 3 - difluoro - phe - z -], cyclo [- phe - d - 1 - nal - nle - 2 , 3 - difluoro - phe - z -], cyclo [- phe - 1 - nal - nle - 2 , 5 - difluoro - phe - z -], cyclo [- phe - d - 1 - nal - nle - 2 , 5 - difluoro - phe - z -], cyclo [- phe - 1 - nal - nle - p - chloro - phe - z -], cyclo [- phe - d - 1 - nal - nle - p - chloro - phe - z -], cyclo [- phe - 1 - nal - nle - phe ( c15 )- z -], cyclo [- phe - d - 1 - nal - nle - phe ( c15 )- z -], cyclo [- phe - 1 - nal - nle - o - chloro - phe - z -], cyclo [- phe - d - 1 - nal - nle - o - chloro - phe - z -], cyclo [- phe - 1 - nal - nle - m - chloro - phe - z -], cyclo [- phe - d - 1 - nal - nle - m - chloro - phe - z -], cyclo [- phe - 1 - nal - nle - thr ( ar )- z -], cyclo [- phe - 1 - nal - nle - 2 , 4 - dichloro - phe - z -], cyclo [- phe - d - 1 - nal - nle - 2 , 4 - dichloro - phe - z -], cyclo [- phe - 1 - nal - nle - 2 , 3 - dichloro - phe - z -], cyclo [- phe - d - 1 - nal - nle - 2 , 3 - dichloro - phe - z -], cyclo [- phe - 1 - nal - nle - 2 , 5 - dichloro - phe - z -], cyclo [- phe - d - 1 - nal - nle - 2 , 5 - dichloro - phe - z -], cyclo [- phe - 1 - nal - nle - 2 , 5 - dichloro - phe - z -], cyclo [- phe - d - 1 - nal - nle - 2 , 5 - dichloro - phe - z -], cyclo [- phe - 1 - nal - nle - 3 , 5 - dichloro - phe - z -], cyclo [- phe - d - 1 - nal - nle - 3 , 5 - dichloro - phe - z -], cyclo [- phe - 1 - nal - nle - 3 , 5 - difluoro - phe - z -], cyclo [- phe - d - 1 - nal - nle - 3 , 5 - difluoro - phe - z -], cyclo [- phe - 1 - nal - nle - nle ( 6 - obzl )- z -], cyclo [- phe - d - 1 - nal - nle - nle ( 6 - obzl )- z -], cyclo [- tyr - 1 - nal - nle - nle ( 6 - obzl )- z -], cyclo [- tyr - d - 1 - nal - nle - nle ( 6 - obzl )- z -], cyclo [- tyr ( me )- 1 - nal - nle - nle ( 6 - obzl )- z -], cyclo [- tyr ( me )- d - 1 - nal - nle - nle ( 6 - obzl )- z -], cyclo [- phe - 1 - nal - nle - 3 , 4 - dichloro - phe - z -], cyclo [- phe - d - 1 - nal - nle - 3 , 4 - dichloro - phe - z -], cyclo [- phe - 1 - nal - nle - 3 , 4 - difluoro - phe - z -], cyclo [- phe - d - 1 - nal - nle - 3 , 4 - difluoro - phe - z -], cyclo [- phe - 1 - nal - nle - 3 - pal - z -], cyclo [- phe - d - 1 - nal - nle - 3 - pal - z -], cyclo [- tyr - 1 - nal - nle - 3 - pal - z -], cyclo [- tyr - d - 1 - nal - nle - 3 - pal - z -], cyclo [- tyr ( me )- 1 - nal - nle - 3 - pal - z -], cyclo [- tyr ( me )- d - 1 - nal - nle - 3 - pal - z -], cyclo [- phe - 1 - nal - nle - 4 - pal - z -], cyclo [- phe - d - 1 - nal - nle - 4 - pal - z -], cyclo [- tyr - 1 - nal - nle - 4 - pal - z -], cyclo [- tyr - d - 1 - nal - nle - 4 - pal - z -], cyclo [- tyr ( me )- 1 - nal - nle - 4 - pal - z -], cyclo [- phe - 1 - nal - nle - 3 , 4 - dichloro - phe - z -], cyclo [- phe - d - 1 - nal - nle - 3 , 4 - dichloro - phe - z -], cyclo [- phe - 1 - nal - nle - 3 , 4 - difluoro - phe - z -], cyclo [- phe - d - 1 - nal - nle - 3 , 4 - difluoro - phe - z -], cyclo [- phe - 1 - nal - nle - phg - z -], cyclo [- phe - d - 1 - nal - nle - phg - z -], cyclo [ tyr - 1 - nal - nle - phg - z -], cyclo [- tyr - d - 1 - nal - nle - phg - z -], cyclo [- tyr ( me )- 1 - nal - nle - phg - z -], cyclo [- phe - 1 - nal - nle - hphe - z -], cyclo [- phe - d - 1 - nal - nle - hphe - z -], cyclo [- tyr - 1 - nal - nle - hphe - z -], cyclo [- tyr - d - 1 - nal - nle - hphe - z -], cyclo [- tyr ( me )- 1 - nal - nle - hphe - z -], cyclo [- phe - 1 - nal - nle - igl - z -], cyclo [- phe - d - 1 - nal - nle - igl - z -], cyclo [- tyr - 1 - nal - nle - igl - z -], cyclo [- tyr - d - 1 - nal - nle - igl - z -], cyclo [- tyr ( me )- 1 - nal - nle - igl - z -], cyclo [- phe - 1 - nal - nle - phe ( 4 - no2 )- z -], cyclo [- phe - d - 1 - nal - nle - phe ( 4 - no2 )- z -], cyclo [- tyr - 1 - nal - nle - phe ( 4 - no2 )- z -], cyclo [- tyr - d - 1 - nal - nle - phe ( 4 - no2 )- z -], cyclo [- tyr ( me )- 1 - nal - nle - phe ( 4 - no2 )- z -], cyclo [- phe - 1 - nal - nle - phe ( 4 - nhz )- z -], cyclo [- phe - d - 1 - nal - nle - phe ( 4 - nhz )- z -], cyclo [- tyr - 1 - nal - nle - phe ( 4 - nhz )- z -], cyclo [- tyr - d - 1 - nal - nle - phe ( 4 - nhz )- z -], cyclo [- tyr ( me )- 1 - nal - nle - phe ( 4 - nhz )- z -], cyclo [- phe - 1 - nal - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- phe - d - 1 - nal - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr - 1 - nal - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr - d - 1 - nal - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr ( me )- 1 - nal - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- phe - 1 - nal - nle - htyr - z -], cyclo [- phe - d - 1 - nal - nle - htyr - z -], cyclo [- tyr - 1 - nal - nle - htyr - z -], cyclo [- tyr - d - 1 - nal - nle - htyr - z -], cyclo [- tyr ( me )- 1 - nal - nle - htyr - z -], cyclo [- phe - 1 - nal - nle - pra - z -], cyclo [- phe - d - 1 - nal - nle - pra - z -], cyclo [- tyr - 1 - nal - nle - pra - z -], cyclo [- tyr - d - 1 - nal - nle - pra - z -], cyclo [- tyr ( me )- 1 - nal - nle - pra - z -] cyclo [- phe - 2 - nal - nle - phe - z -], cyclo [- phe - d - 2 - nal - nle - phe - z -], cyclo [- tyr - 2 - nal - nle - phe - z -], cyclo [- tyr - d - 2 - nal - nle - phe - z -], cyclo [- tyr ( me )- 2 - nal - nle - phe - z -], cyclo [- tyr ( me )- d - 2 - nal - nle - phe - z -], cyclo [- phe - 2 - nal - nle - thr - z -], cyclo [- phe - d - 2 - nal - nle - thr - z -], cyclo [- phe - 2 - nal - nle - tyr ( bzl )- z -], cyclo [- phe - d - 2 - nal - nle - tyr ( bzl )- z -], cyclo [- phe - 2 - nal - nle - bip - z -], cyclo [- phe - d - 2 - nal - nle - bip - z -], cyclo [- phe - 2 - nal - nle - dip - z -], cyclo [- phe - d - 2 - nal - nle - dip - z -], cyclo [- phe - 2 - nal - nle - bpa - z -], cyclo [- phe - d - 2 - nal - nle - bpa - z -], cyclo [- phe - 2 - nal - nle - 2 - nal - z -], cyclo [- phe - d - 2 - nal - nle - 2 - nal - z -], cyclo [- phe - 2 - nal - nle - 1 - nal - z -], cyclo [- phe - d - 2 - nal - nle - 1 - nal - z -], cyclo [- phe - 2 - nal - nle - p - fluoro - phe - z -], cyclo [- phe - d - 2 - nal - nle - p - fluoro - phe - z -], cyclo [- phe - 2 - nal - nle - phe ( f5 )- z -], cyclo [- phe - d - 2 - nal - nle - phe ( f5 )- z -], cyclo [- phe - 2 - nal - nle - o - fluoro - phe - z -], cyclo [- phe - d - 2 - nal - nle - o - fluoro - phe - z -], cyclo [- phe - 2 - nal - nle - m - fluoro - phe - z -], cyclo [- phe - d - 2 - nal - nle - m - fluoro - phe - z -], cyclo [- phe - 2 - nal - nle - thr ( ar )- z -], cyclo [- phe - d - 2 - nal - nle - thr ( ar )- z -], cyclo [- phe - 2 - nal - nle - thr ( bn )- z -], cyclo [- phe - d - 2 - nal - nle - thr ( bn )- z -], cyclo [- phe - 2 - nal - nle - 2 , 4 - difluoro - phe - z -], cyclo [- phe - d - 2 - nal - nle - 2 , 4 - difluoro - phe - z -], cyclo [- phe - 2 - nal - nle - 2 , 3 - difluoro - phe - z -], cyclo [- phe - d - 2 - nal - nle - 2 , 3 - difluoro - phe - z -], cyclo [- phe - 2 - nal - nle - 2 , 5 - difluoro - phe - z -], cyclo [- phe - d - 2 - nal - nle - 2 , 5 - difluoro - phe - z -], cyclo [- phe - 2 - nal - nle - p - chloro - phe - z -], cyclo [- phe - d - 2 - nal - nle - p - chloro - phe - z -], cyclo [- phe - 2 - nal - nle - phe ( c15 )- z -], cyclo [- phe - d - 2 - nal - nle - phe ( c15 )- z -], cyclo [- phe - 2 - nal - nle - o - chloro - phe - z -], cyclo [- phe - d - 2 - nal - nle - chloro - phe - z -], cyclo [- phe - 2 - nal - nle - m - chloro - phe - z -], cyclo [- phe - d - 2 - nal - nle - m - chloro - phe - z -], cyclo [- phe - 2 - nal - nle - thr ( ar )- z -], cyclo [- phe - 2 - nal - nle - 2 , 4 - dichloro - phe - z -], cyclo [- phe - d - 2 - nal - nle - 2 , 4 - dichloro - phe - z -], cyclo [- phe - 2 - nal - nle - 2 , 3 - dichloro - phe - z -], cyclo [- phe - d - 2 - nal - nle - 2 , 3 - dichloro - phe - z -], cyclo [- phe - 2 - nal - nle - 2 , 5 - dichloro - phe - z -], cyclo [- phe - d - 2 - nal - nle - 2 , 5 - dichloro - phe - z -], cyclo [- phe - 2 - nal - nle - 2 , 5 - dichloro - phe - z -], cyclo [- phe - d - 2 - nal - nle - 2 , 5 - dichloro - phe - z -], cyclo [- phe - 2 - nal - nle - 3 , 5 - dichloro - phe - z -], cyclo [- phe - d - 2 - nal - nle - 3 , 5 - dichloro - phe - z -], cyclo [- phe - 2 - nal - nle - 3 , 5 - difluoro - phe - z -], cyclo [- phe - d - 2 - nal - nle - 3 , 5 - difluoro - phe - z -], cyclo [- phe - 2 - nal - nle - nle ( 6 - obzl )- z -], cyclo [- phe - d - 2 - nal - nle - nle ( 6 - obzl )- z -], cyclo [- tyr - 2 - nal - nle - nle ( 6 - obzl )- z -], cyclo [- tyr - d - 2 - nal - nle - nle ( 6 - obzl )- z -], cyclo [- tyr ( me )- 2 - nal - nle - nle ( 6 - obzl )- z -], cyclo [- tyr ( me )- d - 2 - nal - nle - nle ( 6 - obzl )- z -], cyclo [- phe - 2 - nal - nle - 3 , 4 - dichloro - phe - z -], cyclo [- phe - d - 2 - nal - nle - 3 , 4 - dichloro - phe - z -], cyclo [- phe - 2 - nal - nle - 3 , 4 - difluoro - phe - z -], cyclo [- phe - d - 2 - nal - nle - 3 , 4 - difluoro - phe - z -], cyclo [- phe - 2 - nal - nle - 3 - pal - z -], cyclo [- phe - d - 2 - nal - nle - 3 - pal - z -], cyclo [- tyr - 2 - nal - nle - 3 - pal - z -], cyclo [ tyr - d - 2 - nal - nle - 3 - pal - z -], cyclo [- tyr ( me )- 2 - nal - nle - 3 - pal - z -], cyclo [- tyr ( me )- d - 2 - nal - nle - 3 - pal - z -], cyclo [- phe - 2 - nal - nle - 4 - pal - z -], cyclo [- phe - d - 2 - nal - nle - 4 - pal - z -], cyclo [- tyr - 2 - nal - nle - 4 - pal - z -], cyclo [- tyr - d - 2 - nal - nle - 4 - pal - z -], cyclo [- tyr ( me )- 2 - nal - nle - 4 - pal - z -], cyclo [- phe - 2 - nal - nle - 3 , 4 - dichloro - phe - z -], cyclo [- phe - d - 2 - nal - nle - 3 , 4 - dichloro - phe - z -], cyclo [- phe - 2 - nal - nle - 3 , 4 - difluoro - phe - z -], cyclo [- phe - d - 2 - nal - nle - 3 , 4 - difluoro - phe - z -], cyclo [- phe - 2 - nal - nle - phg - z -], cyclo [- phe - d - 2 - nal - nle - phg - z -], cyclo [- tyr - 2 - nal - nle - phg - z -], cyclo [ tyr - d - 2 - nal - nle - phg - z -], cyclo [- tyr ( me )- 2 - nal - nle - phg - z -], cyclo [- phe - 2 - nal - nle - hphe - z -], cyclo [- phe - d - 2 - nal - nle - hphe - z -], cyclo [- tyr - 2 - nal - nle - hphe - z -], cyclo [- tyr - d - 2 - nal - nle - hphe - z -], cyclo [- tyr ( me )- 2 - nal - nle - hphe - z -], cyclo [- phe - 2 - nal - nle - igl - z -], cyclo [- phe - d - 2 - nal - nle - igl - z -], cyclo [- tyr - 2 - nal - nle - igl - z -], cyclo [- tyr - d - 2 - nal - nle - igl - z -], cyclo [- tyr ( me )- 2 - nal - nle - igl - z -], cyclo [- phe - 2 - nal - nle - phe ( 4 - no2 )- z -], cyclo [- phe - d - 2 - nal - nle - phe ( 4 - no2 )- z -], cyclo [- tyr - 2 - nal - nle - phe ( 4 - no2 )- z -], cyclo [ tyr - d - 2 - nal - nle - phe ( 4 - no2 )- z -], cyclo [ tyr ( me )- 2 - nal - nle - phe ( 4 - no2 )- z -], cyclo [- phe - 2 - nal - nle - phe ( 4 - nhz )- z -], cyclo [- phe - d - 2 - nal - nle - phe ( 4 - nhz )- z -], cyclo [- tyr - 2 - nal - nle - phe ( 4 - nhz )- z -], cyclo [- tyr - d - 2 - nal - nle - phe ( 4 - nhz )- z -], cyclo [- tyr ( me )- 2 - nal - nle - phe ( 4 - nhz )- z -], cyclo [- phe - 2 - nal - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- phe - d - 2 - nal - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr - 2 - nal - nle - phe ( 4 - nh - 2clz )- z -], cyclo [ tyr - d - 2 - nal - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr ( me )- 2 - nal - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- phe - 2 - nal - nle - htyr - z -], cyclo [- phe - d - 2 - nal - nle - htyr - z -], cyclo [- tyr - 2 - nal - nle - htyr - z -], cyclo [- tyr - d - 2 - nal - nle - htyr - z -], cyclo [- tyr ( me )- 2 - nal - nle - htyr - z -], cyclo [- phe - 2 - nal - nle - pra - z -], cyclo [- phe - d - 2 - nal - nle - pra - z -], cyclo [- tyr - 2 - nal - nle - pra - z -], cyclo [- tyr - d - 2 - nal - nle - pra - z -], cyclo [- tyr ( me )- 2 - nal - nle - pra - z -], cyclo [- phe - bta - nle - phe - z -], cyclo [- phe - d - bta - nle - phe - z -], cyclo [- tyr - bta - nle - phe - z -], cyclo [- tyr - d - bta - nle - phe - z -], cyclo [- tyr ( me )- bta - nle - phe - z -], cyclo [- tyr ( me )- d - bta - nle - phe - z -], cyclo [- phe - bta - nle - thr - z -], cyclo [- phe - d - bta - nle - thr - z -], cyclo [- phe - bta - nle - tyr ( bzl )- z -], cyclo [- phe - d - bta - nle - tyr ( bzl )- z -], cyclo [- phe - bta - nle - bip - z -], cyclo [- phe - d - bta - nle - bip - z -], cyclo [- phe - bta - nle - dip - z -], cyclo [- phe - d - bta - nle - dip - z -], cyclo [- phe - bta - nle - bpa - z -], cyclo [- phe - d - bta - nle - bpa - z -], cyclo [- phe - bta - nle - b - nal - z -], cyclo [- phe - d - bta - nle - 1 - nal - z -], cyclo [- phe - bta - nle - 2 - nal - z -], cyclo [- phe - d - bta - nle - 2 - nal - z -], cyclo [- phe - bta - nle - p - fluoro - phe - z -], cyclo [- phe - d - bta - nle - p - fluoro - phe - z -], cyclo [- phe - bta - nle - phe ( f5 )- z -], cyclo [- phe - d - bta - nle - phe ( f5 )- z -], cyclo [- phe - bta - nle - o - fluoro - phe - z ], cyclo [- phe - d - bta - nle - o - fluoro - phe - z -], cyclo [- phe - bta - nle - m - fluoro - phe - z -], cyclo [- phe - d - bta - nle - m - fluoro - phe - z -], cyclo [- phe - bta - nle - thr ( ar )- z -], cyclo [- phe - d - bta - nle - thr ( ar )- z -], cyclo [- phe - bta - nle - thr ( bn )- z -], cyclo [- phe - d - bta - nle - thr ( bn )- z -], cyclo [- phe - bta - nle - 2 , 4 - difluoro - phe - z -], cyclo [- phe - d - bta - nle - 2 , 4 - difluoro - phe - z -], cyclo [- phe - bta - nle - 2 , 3 - difluoro - phe - z -], cyclo [- phe - d - bta - nle - 2 , 3 - difluoro - phe - z -], cyclo [- phe - bta - nle - 2 , 5 - difluoro - phe - z -], cyclo [- phe - d - bta - nle - 2 , 5 - difluoro - phe - z -], cyclo [- phe - bta - nle - p - chloro - phe - z -], cyclo [- phe - d - bta - nle - p - chloro - phe - z -], cyclo [- phe - bta - nle - phe ( c15 )- z -], cyclo [- phe - d - bta - nle - phe ( c15 )- z -], cyclo [- phe - bta - nle - o - chloro - phe - z -], cyclo [- phe - d - bta - nle - o - chloro - phe - z -], cyclo [- phe - bta - nle - m - chloro - phe - z -], cyclo [- phe - d - bta - nle - m - chloro - phe - z -], cyclo [- phe - bta - nle - thr ( ar )- z -], cyclo [- phe - bta - nle - 2 , 4 - dichloro - phe - z -], cyclo [- phe - d - bta - nle - 2 , 4 - dichloro - phe - z -], cyclo [- phe - bta - nle - 2 , 3 - dichloro - phe - z -], cyclo [- phe - d - bta - nle - 2 , 3 - dichloro - phe - z -], cyclo [- phe - bta - nle - 2 , 5 - dichloro - phe - z -], cyclo [- phe - d - bta - nle - 2 , 5 - dichloro - phe - z -], cyclo [- phe - bta - nle - 2 , 5 - dichloro - phe - z -], cyclo [- phe - d - bta - nle - 2 , 5 - dichloro - phe - z -], cyclo [- phe - bta - nle - 3 , 5 - dichloro - phe - z -], cyclo [- phe - d - bta - nle - 3 , 5 - dichloro - phe - z -], cyclo [- phe - bta - nle - 3 , 5 - difluoro - phe - z -], cyclo [- phe - d - bta - nle - 3 , 5 - difluoro - phe - z -], cyclo [- phe - bta - nle - 3 , 4 - dichloro - phe - z -], cyclo [- phe - d - bta - nle - 3 , 4 - dichloro - phe - z -], cyclo [- phe - bta - nle - 3 , 4 - difluoro - phe - z -], cyclo [- phe - d - bta - nle - 3 , 4 - difluoro - phe - z -], cyclo [- phe - bta - nle - nle ( 6 - obzl )- z -], cyclo [- phe - d - bta - nle - nle ( 6 - obzl )- z -], cyclo [- tyr - bta - nle - nle ( 6 - obzl )- z -], cyclo [- tyr - d - bta - nle - nle ( 6 - obzl )- z -], cyclo [- tyr ( me )- bta - nle - nle ( 6 - obzl )- z -], cyclo [- tyr ( me )- d - bta - nle - nle ( 6 - obzl )- z -], cyclo [- phe - bta - nle - 3 - pal - z -], cyclo [- phe - d - bta - nle - 3 - pal - z -], cyclo [- tyr - bta - nle - 3 - pal - z -], cyclo [- tyr - d - bta - nle - 3 - pal - z -], cyclo [- tyr ( me )- bta - nle - 3 - pal - z -], cyclo [- tyr ( me )- d - bta - nle - 3 - pal - z -], cyclo [- phe - bta - nle - 4 - pal - z -], cyclo [- phe - d - bta - nle - 4 - pal - z -], cyclo [- tyr - bta - nle - 4 - pal - z -], cyclo [- tyr - d - bta - nle - 4 - pal - z -], cyclo [- tyr ( me )- bta - nle - 4 - pal - z -], cyclo [- phe - bta - nle - 3 , 4 - dichloro - phe - z -], cyclo [- phe - d - bta - nle - 3 , 4 - dichloro - phe - z -], cyclo [- phe - bta - nle - 3 , 4 - difluoro - phe - z -], cyclo [- phe - d - bta - nle - 3 , 4 - difluoro - phe - z -], cyclo [- phe - bta - nle - phg - z -], cyclo [- phe - d - bta - nle - phg - z -], cyclo [- tyr - bta - nle - phg - z -], cyclo [- tyr - d - bta - nle - phg - z -], cyclo [- tyr ( me )- bta - nle - phg - z -], cyclo [- phe - bta - nle - hphe - z -], cyclo [- phe - d - bta - nle - hphe - z -], cyclo [- tyr - bta - nle - hphe - z -], cyclo [- tyr - d - bta - nle - hphe - z -], cyclo [- tyr ( me )- bta - nle - hphe - z -], cyclo [- phe - bta - nle - igl - z -], cyclo [- phe - d - bta - nle - igl - z -], cyclo [- tyr - bta - nle - igl - z -], cyclo [- tyr - d - bta - nle - igl - z -], cyclo [- tyr ( me )- bta - nle - igl - z -], cyclo [- phe - bta - nle - phe ( 4 - no2 )- z -], cyclo [- phe - d - bta - nle - phe ( 4 - no2 )- z -], cyclo [- tyr - bta - nle - phe ( 4 - no2 )- z -], cyclo [- tyr - d - bta - nle - phe ( 4 - no2 )- z -], cyclo [- tyr ( me )- bta - nle - phe ( 4 - no2 )- z -], cyclo [- phe - bta - nle - phe ( 4 - nhz )- z -], cyclo [- phe - d - bta - nle - phe ( 4 - nhz )- z -], cyclo [- tyr - bta - nle - phe ( 4 - nhz )- z -], cyclo [- tyr - d - bta - nle - phe ( 4 - nhz )- z -], cyclo [- tyr ( me )- bta - nle - phe ( 4 - nhz )- z -], cyclo [- phe - bta - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- phe - d - bta - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr - bta - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr - d - bta - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr ( me )- bta - nle - phe ( 4 - nh - 2clz )- z -], cyclo [- phe - bta - nle - htyr - z -], cyclo [- phe - d - bta - nle - htyr - z -], cyclo [- tyr - bta - nle - htyr - z -], cyclo [- tyr - d - bta - nle - htyr - z -], cyclo [- tyr ( me )- bta - nle - htyr - z -], cyclo [- phe - bta - nle - pra - z -], cyclo [- phe - d - bta - nle - pra - z -], cyclo [- tyr - bta - nle - pra - z -], cyclo [- tyr - d - bta - nle - pra - z ], cyclo [- phe - trp - lys - nle ( 6 - obzl )- z -], cyclo [- phe - d - trp - lys - nle ( 6 - obzl )- z -], cyclo [- tyr - trp - lys - nle ( 6 - obzl )- z -], cyclo [- tyr - d - trp lys - nle ( 6 - obzl )- z -], cyclo [- tyr ( me )- trp - lys - nle ( 6 - obzl )- z -], cyclo [- phe - trp - lys - 3 - pal - z -], cyclo [- phe - d - trp - lys - 3 - pal - z -], cyclo [- tyr - trp - lys - 3 - pal - z -], cyclo [- tyr - d - trp - lys - 3 - pal - z -], cyclo [- tyr ( me )- trp - lys - 3 - pal - z -], cyclo [- tyr ( me )- d - trp - lys - 3 - pal - z -], cyclo [- phe - trp - lys - 4 - pal - z -], cyclo [- phe - d - trp - lys - 4 - pal - z -], cyclo [- tyr - trp - lys - 4 - pal - z -], cyclo [- tyr - d - trp - lys - 4 - pal - z -], cyclo [- tyr ( me )- trp - lys - 4 - pal - z -], cyclo [- phe - trp - lys - 3 , 4 - dichloro - phe - z -], cyclo [- phe - d - trp - lys - 3 , 4 - dichloro - phe - z -], cyclo [- phe - trp - lys - 3 , 4 - difluoro - phe - z -], cyclo [- phe - d - trp - lys - 3 , 4 - difluoro - phe - z -], cyclo [- phe - trp - lys - phg - z -], cyclo [- phe - d - trp - lys - phg - z -], cyclo [- tyr - trp - lys - phg - z -], cyclo [- tyr - d - trp - lys - phg - z -], cyclo [- tyr ( me )- trp - lys - phg - z -], cyclo [- phe - trp - lys - hphe - z -], cyclo [- phe - d - trp - lys - hphe - z -], cyclo [- tyr - trp - lys - hphe - z -], cyclo [- tyr - d - trp - lys - hphe - z -], cyclo [- tyr ( me )- trp ,- lys - hphe - z -], cyclo [- phe - trp - lys - igl - z -], cyclo [- phe - d - trp - lys - igl - z -], cyclo [- tyr - trp - lys - igl - z -], cyclo [- tyr - d - trp - lys - igl - z -], cyclo [- tyr ( me )- trp - lys - igl - z -], cyclo [- phe - trp - lys - phe ( 4 - no2 )- z -], cyclo [- phe - d - trp - lys - phe ( 4 - no2 )- z -], cyclo [- tyr - trp - lys - phe ( 4 - no2 )- z -], cyclo [- tyr - d - trp - lys - phe ( 4 - no2 )- z -], cyclo [- tyr ( me )- trp - lys - phe ( 4 - no2 )- z -], cyclo [- phe - trp - lys - phe ( 4 - nhz )- z -], cyclo [- phe - d - trp - lys - phe ( 4 - nhz )- z -], cyclo [- tyr - trp - lys - phe ( 4 - nhz )- z -], cyclo [- tyr - d - trp - lys - phe ( 4 - nhz )- z -], cyclo [- tyr ( me )- trp - lys - phe ( 4 - nhz )- z -], cyclo [- phe - trp - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- phe - d - trp - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr - trp - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr - d - trp - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr ( me )- trp - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- phe - trp - lys - htyr - z -], cyclo [- phe - d - trp - lys - htyr - z -], cyclo [- tyr - trp - lys - htyr - z -], cyclo [- tyr - d - trp - lys - htyr - z -], cyclo [- tyr ( me )- trp - lys - htyr - z -], cyclo [- phe - trp - lys - pra - z -], cyclo [- phe - d - trp - lys - pra - z -], cyclo [- tyr - trp - lys - pra - z -], cyclo [- tyr - d - trp - lys - pra - z -], cyclo [- tyr ( me )- trp - lys - pra - z -], cyclo [- phe - 1 - nal - lys - phe - z -], cyclo [- phe - d - 1 - nal - lys - phe - z -], cyclo [- tyr - 1 - nal - lys - phe - z -], cyclo [- tyr - d - 1 - nal - lys - phe - z -], cyclo [- tyr ( me )- 1 - nal - lys - phe - z -], cyclo [- tyr ( me )- d - 1 - nal - lys - phe - z -], cyclo [- phe - 1 - nal - lys - thr - z -], cyclo [- phe - d - 1 - nal - lys - thr - z -], cyclo [- phe - 1 - nal - lys - tyr ( bzl )- z -], cyclo [- phe - d - 1 - nal - lys - tyr ( bzl )- z -], cyclo [- phe - 1 - nal - lys - bip - z -], cyclo [- phe - d - 1 - nal - lys - bip - z -], cyclo [- phe - 1 - nal - lys - dip - z -], cyclo [- phe - d - 1 - nal - lys - dip - z -], cyclo [- phe - 1 - nal - lys - bpa - z -], cyclo [- phe - d - 1 - nal - lys - bpa - z -], cyclo [- phe - 1 - nal - lys - 1 - nal - z -], cyclo [- phe - d - 1 - nal - lys - 1 - nal - z -], cyclo [- phe - 1 - nal - lys - 2 - nal - z -], cyclo [- phe - d - 1 - nal - lys - 2 - nal - z -], cyclo [- phe - 1 - nal - lys - p - fluoro - phe - z -], cyclo [- phe - d - 1 - nal - lys - p - fluoro - phe - z -], cyclo [- phe - 1 - nal - lys - phe ( f5 )- z -], cyclo [- phe - d - 1 - nal - lys - phe ( f5 )- z -], cyclo [- phe - 1 - nal - lys - o - fluoro - phe - z -], cyclo [- phe - d - 1 - nal - lys - o - fluoro - phe - z -], cyclo [- phe - 1 - nal - lys - m - fluoro - phe - z -], cyclo [- phe - d - 1 - nal - lys - m - fluoro - phe - z -], cyclo [- phe - 1 - nal - lys - thr ( ar )- z -], cyclo [- phe - d - 1 - nal - lys - thr ( ar )- z -], cyclo [- phe - 1 - nal - lys - thr ( bn )- z -], cyclo [- phe - d - 1 - nal - lys - thr ( bn )- z -], cyclo [- phe - 1 - nal - lys - 2 , 4 - difluoro - phe - z -], cyclo [- phe - d - 1 - nal - lys - 2 , 4 - difluoro - phe - z -], cyclo [- phe - 1 - nal - lys - 2 , 3 - difluoro - phe - z -], cyclo [- phe - d - 1 - nal - lys - 2 , 3 - difluoro - phe - z -], cyclo [- phe - 1 - nal - lys - 2 , 5 - difluoro - phe - z -], cyclo [- phe - d - 1 - nal - lys - 2 , 5 - difluoro - phe - z -], cyclo [- phe - 1 - nal - lys - p - chloro - phe - z -], cyclo [- phe - d - 1 - nal - lys - p - chloro - phe - z -], cyclo [- phe - 1 - nal - lys - phe ( c15 )- z -], cyclo [- phe - d - 1 - nal - lys - phe ( c15 )- z -], cyclo [- phe - 1 - nal - lys - o - chloro - phe - z -], cyclo [- phe - d - 1 - nal - lys - o - chloro - phe - z -], cyclo [- phe - 1 - nal - lys - m - chloro - phe - z -], cyclo [- phe - d - 1 - nal - lys - m - chloro - phe - z -], cyclo [- phe - 1 - nal - lys - thr ( ar )- z -], cyclo [- phe - 1 - nal - lys - 2 , 4 - dichloro - phe - z -], cyclo [- phe - d - 1 - na - lys - 2 , 4 - dichloro - phe - z -], cyclo [- phe - 1 - nal - lys - 2 , 3 - dichloro - phe - z -], cyclo [- phe - d - 1 - nal - lys - 2 , 3 - dichloro - phe - z -], cyclo [- phe - 1 - nal - lys - 2 , 5 - dichloro - phe - z -], cyclo [ phe - d - 1 - nal - lys - 2 , 5 - dichloro - phe - z -], cyclo [- phe - 1 - nal - lys - 2 , 5 - dichloro - phe - z -], cyclo [- phe - d - 1 - nal - lys - 2 , 5 - dichloro - phe - z -], cyclo [- phe - 1 - nal - lys - 3 , 5 - dichloro - phe - z -], cyclo [- phe - d - 1 - nal - lys - 3 , 5 - dichloro - phe - z -], cyclo [- phe - 1 - nal - lys - 3 , 5 - difluoro - phe - z -], cyclo [- phe - d - 1 - nal - lys - 3 , 5 - difluoro - phe - z -], cyclo [- phe - 1 - nal - lys - nle ( 6 - obzl )- z -], cyclo [- phe - d - 1 - nal - lys - nle ( 6 - obzl )- z -], cyclo [- tyr - 1 - nal - lys - nle ( 6 - obzl )- z -], cyclo [- tyr - d - 1 - nal - lys - nle ( 6 - obzl )- z -], cyclo [- tyr ( me )- 1 - nal - lys - nle ( 6 - obzl )- z -], cyclo [- tyr ( me )- d - 1 - nal - lys - nle ( 6 - obzl )- z -], cyclo [- phe - 1 - nal - lys - 3 , 4 - dichloro - phe - z -], cyclo [- phe - d - 1 - nal - lys - 3 , 4 - dichloro - phe - z -], cyclo [- phe - 1 - nal - lys - 3 , 4 - difluoro - phe - z -], cyclo [- phe - d - 1 - nal - lys - 3 , 4 - difluoro - phe - z -], cyclo [- phe - 1 - nal - lys - 3 - pal - z -], cyclo [- phe - d - 1 - nal - lys - 3 - pal - z -], cyclo [- tyr - 1 - nal - lys - 3 - pal - z -], cyclo [- tyr - d - 1 - nal - lys - 3 - pal - z -], cyclo [- tyr ( me )- 1 - nal - lys - 3 - pal - z -], cyclo [- tyr ( me )- d - 1 - nal - lys - 3 - pal - z -], cyclo [- phe - 1 - nal - lys - 4 - pal - z -], cyclo [- phe - d - 1 - nal - lys - 4 - pal - z -], cyclo [- tyr - 1 - nal - lys - 4 - pal - z -], cyclo [- tyr - d - 1 - nal - lys - 4 - pal - z -], cyclo [- tyr ( me )- 1 - nal - lys - 4 - pal - z -], cyclo [- phe - 1 - nal - lys - 3 , 4 - dichloro - phe - z -], cyclo [- phe - d - 1 - nal - lys - 3 , 4 - dichloro - phe - z -], cyclo [- phe - 1 - nal - lys - 3 , 4 - difluoro - phe - z -], cyclo [- phe - d - 1 - nal - lys - 3 , 4 - difluoro - phe - z -], cyclo [- phe - 1 - nal - lys - phg - z -], cyclo [- phe - d - 1 - nal - lys - phg - z -], cyclo [- tyr - 1 - nal - lys - phg - z -], cyclo [- tyr - d - 1 - nal - lys - phg - z -], cyclo [- tyr ( me )- 1 - nal - lys - phg - z -], cyclo [- phe - 1 - nal - lys - hphe - z -], cyclo [- phe - d - 1 - nal - lys - hphe - z -], cyclo [- tyr - 1 - nal - lys - hphe - z -], cyclo [- tyr - d - 1 - nal - lys - hphe - z -], cyclo [- tyr ( me )- 1 - nal - lys - hphe - z -], cyclo [- phe - 1 - nal - lys - igl - z -], cyclo [- phe - d - 1 - nal - lys - igl - z -], cyclo [- tyr - 1 - nal - lys - igl - z -], cyclo [- tyr - d - 1 - nal - lys - igl - z -], cyclo [- tyr ( me )- 1 - nal - lys - igl - z ], cyclo [- phe - 1 - nal - lys - phe ( 4 - no2 )- z -], cyclo [- phe - d - 1 - nal - lys - phe ( 4 - no2 )- z -], cyclo [- tyr - 1 - nal - lys - phe ( 4 - no2 )- z -], cyclo [- tyr - d - 1 - nal - lys - phe ( 4 - no2 )- z -], cyclo [- tyr ( me ) 1 - nal - lys - phe ( 4 - no2 )- z -], cyclo [- phe - 1 - nal - lys - phe ( 4 - nhz )- z -], cyclo [- phe - d - 1 - nal - lys - phe ( 4 - nhz )- z -], cyclo [- tyr - 1 - nal - lys - phe ( 4 - nhz )- z -], cyclo [- tyr - d - 1 - nal - lys - phe ( 4 - nhz )- z -], cyclo [- tyr ( me )- 1 - nal - lys - phe ( 4 - nhz )- z -], cyclo [- phe - 1 - nal - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- phe - d - 1 - nal - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr - 1 - nal - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr - d - 1 - nal - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr ( me )- 1 - nal - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- phe - 1 - nal - lys - htyr - z -], cyclo [- phe - d - 1 - nal - lys - htyr - z -], cyclo [- tyr - 1 - nal - lys - htyr - z -], cyclo [- tyr - d - 1 - nal - lys - htyr - z -], cyclo [- tyr ( me )- 1 - nal - lys - htyr - z -], cyclo [- phe - 1 - nal - lys - pra - z -], cyclo [- phe - d - 1 - nal - lys - pra - z -], cyclo [- tyr - 1 - nal - lys - pra - z -], cyclo [- tyr - d - 1 - nal - lys - pra - z -], cyclo [- tyr ( me )- 1 - nal - lys - pra - z -] cyclo [- phe - 2 - nal - lys - phe - z -], cyclo [- phe - d - 2 - nal - lys - phe - z -], cyclo [- tyr - 2 - nal - lys - phe - z -], cyclo [- tyr - d - 2 - nal - lys - phe - z -], cyclo [- tyr ( me )- 2 - nal - lys - phe - z -], cyclo [- tyr ( me )- d - 2 - nal - lys - phe - z -], cyclo [- phe - 2 - nal - lys - thr - z -], cyclo [- phe - d - 2 - nal - lys - thr - z -], cyclo [- phe - 2 - nal - lys - tyr ( bzl )- z -], cyclo [- phe - d - 2 - nal - lys - tyr ( bzl )- z -], cyclo [- phe - 2 - nal - lys - bip - z -], cyclo [- phe - d - 2 - nal - lys - bip - z -], cyclo [- phe - 2 - nal - lys - dip - z -], cyclo [- phe - d - 2 - nal - lys - dip - z -], cyclo [- phe - 2 - nal - lys - bpa - z -], cyclo [- phe - d - 2 - nal - lys - bpa - z -], cyclo [- phe - 2 - nal - lys - 2 - nal - z -], cyclo [- phe - d - 2 - nal - lys - 2 - nal - z -], cyclo [- phe - 2 - nal - lys - 1 - nal - z -], cyclo [ phe - d - 2 - nal - lys - 1 - nal - z -], cyclo [- phe - 2 - nal - lys - p - fluoro - phe - z -], cyclo [- phe - d - 2 - nal - lys - p - fluoro - phe - z -], cyclo [- phe - 2 - nal - lys - phe ( f5 )- z -], cyclo [- phe - d - 2 - nal - lys - phe ( f5 )- z -], cyclo [- phe - 2 - nal - lys - o - fluoro - phe - z -], cyclo [- phe - d - 2 - nal - lys - o - fluoro - phe - z -], cyclo [- phe - 2 - nal - lys - m - fluoro - phe - z -], cyclo [- phe - d - 2 - nal - lys - m - fluoro - phe - z -], cyclo [- phe - 2 - nal - lys - thr ( ar )- z -], cyclo [- phe - d - 2 - nal - lys - thr ( ar )- z -], cyclo [- phe - 2 - nal - lys - thr ( bn )- z -], cyclo [- phe - d - 2 - nal - lys - thr ( bn )- z -], cyclo [- phe - 2 - nal - lys - 2 , 4 - difluoro - phe - z -], cyclo [- phe - d - 2 - nal - lys - 2 , 4 - difluoro - phe - z -], cyclo [- phe - 2 - nal - lys - 2 , 3 - difluoro - phe - z -], cyclo [- phe - d - 2 - nal - lys - 2 , 3 - difluoro - phe - z -], cyclo [- phe - 2 - nal - lys - 2 , 5 - difluoro - phe - z -], cyclo [- phe - d - 2 - nal - lys - 2 , 5 - difluoro - phe - z -], cyclo [- phe - 2 - nal - lys - p - chloro - phe - z -], cyclo [- phe - d - 2 - nal - lys - p - chloro - phe - z -], cyclo [- phe - 2 - nal - lys - phe ( c15 )- z -], cyclo [- phe - d - 2 - nal - lys - phe ( c15 )- z -], cyclo [- phe - 2 - nal - lys - o - chloro - phe - z -], cyclo [- phe - d - 2 - nal - lys - o - chloro - phe - z -], cyclo [- phe - 2 - nal - lys - m - chloro - phe - z -], cyclo [- phe - d - 2 - nal - lys - m - chloro - phe - z -], cyclo [- phe - 2 - nal - lys - thr ( ar )- z -], cyclo [- phe - 2 - nal - lys - 2 , 4 - dichloro - phe - z -], cyclo [- phe - d - 2 - nal - lys - 2 , 4 - dichloro - phe - z -], cyclo [- phe - 2 - nal - lys - 2 , 3 - dichloro - phe - z -], cyclo [- phe - d - 2 - nal - lys - 2 , 3 - dichloro - phe - z -], cyclo [- phe - 2 - nal - lys - 2 , 5 - dichloro - phe - z -], cyclo [- phe - d - 2 - nal - lys - 2 , 5 - dichloro - phe - z -], cyclo [- phe - 2 - nal - lys - 2 , 5 - dichloro - phe - z -], cyclo [- phe - d - 2 - nal - lys - 2 , 5 - dichloro - phe - z -], cyclo [- phe - 2 - nal - lys - 3 , 5 - dichloro - phe - z -], cyclo [- phe - d - 2 - nal - lys - 3 , 5 - dichloro - phe - z -], cyclo [- phe - 2 - nal - lys - 3 , 5 - difluoro - phe - z -], cyclo [- phe - d - 2 - nal - lys - 3 , 5 - difluoro - phe - z -], cyclo [- phe - 2 - nal - lys - nle ( 6 - obzl )- z -], cyclo [- phe - d - 2 - nal - lys - nle ( 6 - obzl )- z -], cyclo [- tyr - 2 - nal - lys - nle ( 6 - obzl )- z -], cyclo [- tyr - d - 2 - nal - lys - nle ( 6 - obzl )- z -], cyclo [- tyr ( me )- 2 - nal - lys - nle ( 6 - obzl )- z -], cyclo [- tyr ( me )- d - 2 - nal - lys - nle ( 6 - obzl )- z -], cyclo [- phe - 2 - nal - lys - 3 , 4 - dichloro - phe - z -], cyclo [- phe - d - 2 - nal - lys - 3 , 4 - dichloro - phe - z -], cyclo [- phe - 2 - nal - lys - 3 , 4 - difluoro - phe - z -], cyclo [- phe - d - 2 - nal - lys - 3 , 4 - difluoro - phe - z -], cyclo [- phe - 2 - nal - lys - 3 - pal - z -], cyclo [- phe - d - 2 - nal - lys - 3 - pal - z -], cyclo [- tyr - 2 - nal - lys - 3 - pal - z -], cyclo [- tyr - d - 2 - nal - lys - 3 - pal - z -], cyclo [- tyr ( me )- 2 - nal - lys - 3 - pal - z -], cyclo [- tyr ( me )- d - 2 - nal - lys - 3 - pal - z -], cyclo [- phe - 2 - nal - lys - 4 - pal - z -], cyclo [- phe - d - 2 - nal - lys - 4 - pal - z -], cyclo [- tyr - 2 - nal - lys - 4 - pal - z -], cyclo [- tyr - d - 2 - nal - lys - 4 - pal - z -], cyclo [- tyr ( me )- 2 - nal - lys - 4 - pal - z -], cyclo [- phe - 2 - nal - lys - 3 , 4 - dichloro - phe - z -], cyclo [- phe - d - 2 - nal - lys - 3 , 4 - dichloro - phe - z -], cyclo [- phe - 2 - nal - lys - 3 , 4 - difluoro - phe - z -], cyclo [- phe - d - 2 - nal - lys - 3 , 4 - difluoro - phe - z -], cyclo [- phe - 2 - nal - lys - phg - z -], cyclo [- phe - d - 2 - nal - lys - phg - z -], cyclo [- tyr - 2 - nal - lys - phg - z -], cyclo [- tyr - d - 2 - nal - lys - phg - z -], cyclo [- tyr ( me )- 2 - nal - lys - phg - z -], cyclo [- phe - 2 - nal - lys - hphe - z -], cyclo [- phe - d - 2 - nal - lys - hphe - z -], cyclo [- tyr - 2 - nal - lys - hphe - z -], cyclo [- tyr - d - 2 - nal - lys - hphe - z -], cyclo [- tyr ( me )- 2 - nal - lys - hphe - z -], cyclo [- phe - 2 - nal - lys - igl - z -], cyclo [- phe - d - 2 - nal - lys - igl - z -], cyclo [- tyr - 2 - nal - lys - igl - z -], cyclo [- tyr - d - 2 - nal - lys - igl - z -], cyclo [- tyr ( me )- 2 - nal - lys - igl - z -], cyclo [- phe - 2 - nal - lys - phe ( 4 - no2 )- z -], cyclo [- phe - d - 2 - nal - lys - phe ( 4 - no2 )- z -], cyclo [- tyr - 2 - nal - lys - phe ( 4 - no2 )- z -], cyclo [- tyr - d - 2 - nal - lys - phe ( 4 - no2 )- z -], cyclo [- tyr ( me )- 2 - nal - lys - phe ( 4 - no2 )- z -], cyclo [- phe - 2 - nal - lys - phe ( 4 - nhz )- z -], cyclo [- phe - d - 2 - nal - lys - phe ( 4 - nhz )- z -], cyclo [- tyr - 2 - nal - lys - phe ( 4 - nhz )- z -], cyclo [- tyr - d - 2 - nal - lys - phe ( 4 - nhz )- z -], cyclo [- tyr ( me )- 2 - nal - lys - phe ( 4 - nhz )- z -], cyclo [- phe - 2 - nal - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- phe - d - 2 - nal - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr - 2 - nal - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr - d - 2 - nal - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr ( me )- 2 - nal - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- phe - 2 - nal - lys - htyr - z -], cyclo [- phe - d - 2 - nal - lys - htyr - z -], cyclo [- tyr - 2 - nal - lys - htyr - z -], cyclo [- tyr - d - 2 - nal - lys - htyr - z -], cyclo [- tyr ( me )- 2 - nal - lys - htyr - z -], cyclo [- phe - 2 - nal - lys - pra - z -], cyclo [- phe - d - 2 - nal - lys - pra - z -], cyclo [- tyr - 2 - nal - lys - pra - z -], cyclo [- tyr - d - 2 - nal - lys - pra - z -], cyclo [- tyr ( me )- 2 - nal - lys - pra - z -], cyclo [- phe - bta - lys - phe - z -], cyclo [- phe - d - bta - lys - phe - z -], cyclo [ tyr - bta - lys - phe - z -], cyclo [- tyr - d - bta - lys - phe - z -], cyclo [- tyr ( me )- bta - lys - phe - z -], cyclo [- tyr ( me )- d - bta - lys - phe - z -], cyclo [- phe - bta - lys - thr - z -], cyclo [- phe - d - bta - lys - thr - z -], cyclo [- phe - bta - lys - tyr ( bzl )- z -], cyclo [- phe - d - bta - lys - tyr ( bzl )- z -], cyclo [ phe - bta - lys - bip - z -], cyclo [- phe - d - bta - lys - bip - z -], cyclo [- phe - bta - lys - dip - z -], cyclo [- phe - d - bta - lys - dip - z -], cyclo [- phe - bta - lys - bpa - z -], cyclo [- phe - d - bta - lys - bpa - z -], cyclo [- phe - bta - lys - 1 - nal - z -], cyclo [- phe - d - bta - lys - 1 - nal - z -], cyclo [- phe - bta - lys - 2 - nal - z -], cyclo [- phe - d - bta - lys - 2 - nal - z -], cyclo [- phe - bta - lys - p - fluoro - phe - z -], cyclo [- phe - d - bta - lys - p - fluoro - phe - z -], cyclo [- phe - bta - lys - phe ( f5 )- z -], cyclo [- phe - d - bta - lys - phe ( f5 )- z -], cyclo [- phe - bta - lys - o - fluoro - phe - z -], cyclo [- phe - d - bta - lys - o - fluoro - phe - z -], cyclo [- phe - bta - lys - m - fluoro - phe - z -], cyclo [- phe - d - bta - lys - m - fluoro - phe - z -], cyclo [- phe - bta - lys - thr ( ar )- z -], cyclo [- phe - d - bta - lys - thr ( ar )- z -], cyclo [- phe - bta - lys - thr ( bn )- z -], cyclo [- phe - d - bta - lys - thr ( bn )- z -], cyclo [- phe - bta - lys - 2 , 4 - difluoro - phe - z -], cyclo [- phe - d - bta - lys - 2 , 4 - difluoro - phe - z -], cyclo [- phe - bta - lys - 2 , 3 - difluoro - phe - z -], cyclo [- phe - d - bta - lys - 2 , 3 - difluoro - phe - z -], cyclo [- phe - bta - lys - 2 , 5 - difluoro - phe - z -], cyclo [- phe - d - bta - lys - 2 , 5 - difluoro - phe - z -], cyclo [- phe - bta - lys - p - chloro - phe - z -], cyclo [- phe - d - bta - lys - p - chloro - phe - z -], cyclo [- phe - bta - lys - phe ( c15 )- z -], cyclo [- phe - d - bta - lys - phe ( c15 )- z -], cyclo [- phe - bta - lys - o - chloro - phe - z -], cyclo [- phe - d - bta - lys - o - chloro - phe - z -], cyclo [- phe - bta - lys - m - chloro - phe - z -], cyclo [- phe - d - bta - lys - m - chloro - phe - z -], cyclo [- phe - bta - lys - thr ( ar )- z -], cyclo [- phe - bta - lys - 2 , 4 - dichloro - phe - z -], cyclo [- phe - d - bta - lys - 2 , 4 - dichloro - phe - z -], cyclo [- phe - bta - lys - 2 , 3 - dichloro - phe - z -], cyclo [- phe - d - bta - lys - 2 , 3 - dichloro - phe - z -], cyclo [- phe - bta - lys - 2 , 5 - dichloro - phe - z -], cyclo [- phe - d - bta - lys - 2 , 5 - dichloro - phe - z -], cyclo [- phe - bta - lys - 2 , 5 - dichloro - phe - z -], cyclo [- phe - d - bta - lys - 2 , 5 - dichloro - phe - z -], cyclo [- phe - bta - lys - 3 , 5 - dichloro - phe - z -], cyclo [- phe - d - bta - lys - 3 , 5 - dichloro - phe - z -], cyclo [- phe - bta - lys - 3 , 5 - difluoro - phe - z -], cyclo [- phe - d - bta - lys - 3 , 5 - difluoro - phe - z -], cyclo [- phe - bta - lys - 3 , 4 - dichloro - phe - z -], cyclo [- phe - d - bta - lys - 3 , 4 - dichloro - phe - z -], cyclo [- phe - bta - lys - 3 , 4 - difluoro - phe - z -], cyclo [- phe - d - bta - lys - 3 , 4 - difluoro - phe - z -], cyclo [- phe - bta - lys - nle ( 6 - obzl )- z -], cyclo [- phe - d - bta - lys - nle ( 6 - obzl )- z -], cyclo [- tyr - bta - lys - nle ( 6 - obzl )- z -], cyclo [- tyr - d - bta - lys - nle ( 6 - obzl )- z -], cyclo [- tyr ( me )- bta - lys - nle ( 6 - obzl )- z -], cyclo [- tyr ( me )- d - bta - lys - nle ( 6 - obzl )- z -], cyclo [- phe - bta - lys - 3 - pal - z -], cyclo [- phe - d - bta - lys - 3 - pal - z -], cyclo [- tyr - bta - lys - 3 - pal - z -], cyclo [- tyr - d - bta - lys - 3 - pal - z ], cyclo [- tyr ( me )- bta - lys - 3 - pal - z -], cyclo [- tyr ( me )- d - bta - lys - 3 - pal - z -], cyclo [- phe - bta - lys - 4 - pal - z -], cyclo [- phe - d - bta - lys - 4 - pal - z -], cyclo [- tyr - bta - lys - 4 - pal - z -], cyclo [- tyr - d - bta - lys - 4 - pal - z -], cyclo [- tyr ( me )- bta - lys - 4 - pal - z -], cyclo [- phe - bta - lys - 3 , 4 - dichloro - phe - z -], cyclo [- phe - d - bta - lys - 3 , 4 - dichloro - phe - z -], cyclo [- phe - bta - lys - 3 , 4 - difluoro - phe - z -], cyclo [- phe - d - bta - lys - 3 , 4 - difluoro - phe - z -], cyclo [- phe - bta - lys - phg - z -], cyclo [- phe - d - bta - lys - phg - z -], cyclo [- tyr - bta - lys - phg - z -], cyclo [- tyr - d - bta - lys - phg - z -], cyclo [- tyr ( me )- bta - lys - phg - z -], cyclo [- phe - bta - lys - hphe - z -], cyclo [- phe - d - bta - lys - hphe - z -], cyclo [- tyr - bta - lys - hphe - z -], cyclo [- tyr - d - bta - lys - hphe - z -], cyclo [- tyr ( me )- bta - lys - hphe - z -], cyclo [- phe - bta - lys - igl - z -], cyclo [- phe - d - bta - lys - igl - z -], cyclo [- tyr - bta - lys - igl - z -], cyclo [- tyr - d - bta - lys - igl - z -], cyclo [- tyr ( me )- bta - lys - igl - z -], cyclo [- phe - bta - lys - phe ( 4 - no2 )- z -], cyclo [- phe - d - bta - lys - phe ( 4 - no2 )- z -], cyclo [- tyr - bta - lys - phe ( 4 - no2 )- z -], cyclo [- tyr - d - bta - lys - phe ( 4 - no2 )- z -], cyclo [- tyr ( me )- bta - lys - phe ( 4 - no2 )- z -], cyclo [- phe - bta - lys - phe ( 4 - nhz )- z -], cyclo [- phe - d - bta - lys - phe ( 4 - nhz )- z -], cyclo [- tyr - bta - lys - phe ( 4 - nhz )- z -], cyclo [- tyr - d - bta - lys - phe ( 4 - nhz )- z -], cyclo [- tyr ( me )- bta - lys - phe ( 4 - nhz )- z -], cyclo [- phe - bta - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- phe - d - bta - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr - bta - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr - d - bta - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- tyr ( me )- bta - lys - phe ( 4 - nh - 2clz )- z -], cyclo [- phe - bta - lys - htyr - z -], cyclo [- phe - d - bta - lys - htyr - z -], cyclo [- tyr - bta - lys - htyr - z -], cyclo [- tyr - d - bta - lys - htyr - z -], cyclo [- tyr ( me )- bta - lys - htyr - z -], cyclo [- phe - bta - lys - pra - z -], cyclo [- phe - d - bta - lys - pra - z -], cyclo [- tyr - bta - lys - pra - z -], cyclo [- tyr - d - bta - lys - pra - z ], cyclo [- phe - d - trp - nle - tyr ( bzl )- z -], cyclo [- phe - trp - nle - tyr ( bzl )- z -], cyclo [- tyr - d - trp - nle - tyr ( bzl )- z -], cyclo [- tyr - trp - nle - tyr ( bzl )- z -], cyclo [- phe - d - bta - nle - tyr ( bzl )- z -], cyclo [- phe - bta - nle - tyr ( bzl )- z -], cyclo [- tyr - d - bta - nle - tyr ( bzl )- z -], cyclo [- tyr - btqa - nle - tyr ( bzl )- z -], and cyclo [- tyr ( me )- bta - lys - pra - z -]. also preferred are all the linear peptides which may be derived by replacing a peptide linkage in the above - mentioned sequences with the terminal groups y 1 and y 2 . a few representatives of the peptides of the invention are graphically shown in the following : the general synthesis of the z groups and of the peptide of the invention are described below . a ) tf 2 o , py , − 10 ° c ., ch 2 cl 2 ; b ) nan 3 , bu 4 ncl ( cat ), 50 ° c ., dmf ; c ) 77 % hoac , 3 h , 65 ° c . ; d ) naio 4 , 5 h , 10 ° c ., meoh ; e ) kmno 4 , 50 % hoac , rt ; f ) h 2 , pd / c , meoh , fmoccl , nahco 3 , ph 8 - 9 , thf , meoh , rt , 90 %; g ) naocl , tempo ( cat ), kbr , ch 2 cl 2 , sat . aq nahco 3 , bu 4 ncl , 62 %. scheme 1 shows the synthesis of two fmoc - protected z groups ( 1 and 2 ). both are synthesised using the azides 6 and 7 . the decisive step is acidolysis of diacetone glucose activated over triflate ester . the use of nan 3 and of catalytic amounts of tetrabutylammonium chloride ( bu 4 ncl ) is preferred . the azide 6 may be obtained after 3 to 5 hours by reacting triflyl - activated diacetone glucose with 1 . 8 to 2 . 5 , preferably 1 . 8 to 2 . 2 equivalents of nan 3 in dmf at 30 to 90 ° c ., preferably 40 to 60 ° c . the use of two equivalents at 50 ° c . yields optimum results . catalytic amounts of bu 4 ncl are used to suppress the elimination reaction and to increase the solubiltiy of nan 3 . this affords yields of about 70 %. azidolysis is followed by deprotection of the exocyclic hydroxyl groups . this may be carried out at quantitative yields by means of acetic acid at a temperature of 20 to 120 ° c ., preferably 70 to 115 ° c . (( l . n . kulinkovich , v . a . timoshchuk , zh . obshch . khim . ( ru ); 53 ; 9 , 1983 ; 2126 - 2131 1983 , 53 , 1917 ). in order to obtain the fmoc - protected compound 1 , the diol 7 is cleaved oxidatively with naio 4 and then kmno 4 . these reagents are used in a relative amount of 1 . 1 to 2 . 5 , preferably 1 . 5 to 2 . 2 . suitable reaction temperatures are in the range of 10 to 30 ° c ., preferably 20 to 25 ° c . in a one - pot reaction , the - azide 8 is simultaneously reduced with a yield of 70 % and fmoc - protected to obtain 1 . with stirring , a solution of the azide in meoh / h 2 o ( 2 : 1 , 0 , 15 mol / l ) is adjusted to a ph of 8 with saturated nahco 3 . for this purpose , a solution of fmoc - cl ( 1 . 0 bis 1 . 5 equiv ., preferably 1 . 1 equiv .) in thf ( 0 . 1 bis 0 . 2 mol / l , preferably 0 . 16 mol / l ) is added , followed by the addition of the catalyst ( pd / c , 10 wt .-%, wet 49 . 7 wt -.% h 2 o , eg . degussa e 101 ; 1 g of catalyst per 1 g of azide ). the suspension is washed with h 2 several times . in general , the reaction is completed in 18 to 24 hrs . ( control via thin - layer chromatography ). the solvents are removed at reduced pressure . the residue is suspended in water and adjusted to a ph of 8 to 9 with saturated nahco 3 and the aqueous phase extracted three times with ethyl acetate . the combined organic phases are washed three times with aqueous nahco 3 solution . the aqueous phase is adjusted to a ph of 1 with mol / l hcl and then extracted three times with ethyl acetate . the combined organic phases are washed with a saturated aqueous nacl solution dried over mgso 4 and concentrated under reduced pressure . in order to prepare 2 , the azide 7 is reduced in a one - pot reaction under similar conditions as for 8 and fmoc - protected . after that , the primary alcohol of the product 9 is selectively oxidised with 2 , 2 , 6 , 6 - tetramethylpiperidine - 1 - oxyl ( tempo ), sodium hypochlorite und kbr to yield 2 . for this purpose , relative amounts of 0 . 005 to 0 . 2 parts of tempo , 1 to 5 parts of sodium hypochlorite and 0 . 5 to 5 kbr , in each case based on 100 mol equivalents of compound 9 , are suitable . in order to avoid decarboxylation during oxidation , it is essential to maintain the ph between 8 . 5 and 9 . 5 and the temperature below 0 ° c . preferred reaction temperatures are in the range of − 10 to 0 ° c . other z groups may be prepared by the following methods described in literature : t . k . chakraborty , s . gosh , s . jayaprakash , j . a . r . p . sharma , v . ravikanth , p . v . diwan , r . nagaraj , a . c . kunwar , j . org . chem . 2000 , 65 ; m . d . smith , d . d . long , a . martin , d . g . marquess , t . d . e . claridge , g . w . j . fleet , tetrahedron lett . 1999 , 40 , 2191 ; t . d . w . claridge , d . d . long , n . l . hungerford , r . t . aplin , m . d . smith , d . g . marquess , g . w . j . fleet , tetrahedron lett . 1999 , 40 , 2199 ; m . shiozaki , n . ishida , s . sato , bull . chem . soc . jpn . 1989 , 62 , 3950 . in addition , suitable z groups may also be prepared according to wo 95 / 07022 a , ep 0 538 691 a , ep 0 538 692 a , yaoxue xuebao 1985 , 20 ( 3 ), 214 - 218 ; j . nat . sci . math . 1983 , 23 ( 1 ), 107 - 112 ; russ . j . bioorg . chem . 2000 , 26 ( 11 ), 774 - 783 ; phytochemistry 2000 , 53 ( 2 ), 231 - 237 ; left . pept . sci . 1995 , 2 ( 3 / 4 ), 253 - 258 ; jp 46025379 b ; seikagaku 1968 , 40 ( 11 ), 823 - 837 ; liver res ., trans . int . symp . 3rd , tokyo , kyoto 1967 , meeting date 1966 , 321 - 330 ; j . chem . 1967 , 20 ( 12 ), 2701 - 2713 ; aust . j . chem . 1967 , 20 ( 7 ), 1493 - 1509 ; nippon yakuzaishikai zasshi 1966 , 62 , 297 - 306 ; hsueh pao [ acta pharmaceutica sinica ] 1985 , 20 ( 3 ), 214 - 218 . peptide synthesis is carried out according to standard procedures on the solid phase or in solution . reference is made to g . b . fields , r . l . nobel , int . j . pept . protein res . 1990 , 35 , 161 - 214 and to the following general operating instructions “ beladung von tcp - harz ” ( loading of tcp resin ) and “ abspaltbedingungen für peptide von tcp - harz ” ( cleaving conditions for peptides of tcp resins ), form sheets by pepchem , goldhammer & amp ; clausen , im winkelrain 73 , d - 72076 tübingen , germany ; fax ++ 49 70 71 600 393 ; tel . : ++ 49 - 7071 - 600384 ; novabiochem catalog 2000 : “ useful information , nomenclature , abbreviations ” pages x - xi . and “ synthesis notes ” edited by b . dörner & amp ; p . white ; pages i - ii , i1 - i16 , s1 - s54 , p1 - p34 , b1 - b16 , r1 - r16 , al - 16 calbiochem - novabiochem gmbh , p . o box 1167 , 65796 bad soden ; tel . : 0800 - 6931000 or 06196 - 63955 ; fax : ++ 49 - 6196 - 62361 . reference is also made to solid - phase synth . 2000 , 377 - 418 and to r . knorr , a . trzeciak , w . bannwarth , d . gillessen , tetrahedron lett . 1989 , 30 , 1927 - 1930 . the use of the reagents hatu / hoat is described in l . a . carpino , a . el - faham , f . albericio , tetrahedron lett . 1994 , 35 , 2279 - 2282 and in l . a . carpino , a . el - faham , c . a . minor , f . albericio , j . chem . soc . chem . commun . 1994 , 2 , 201 - 203 . the cleavage with hfip is disclosed in r . bollhagen , m . schmiedberger , k . barlos , e . grell , j . chem . soc ., chem . commun . 1994 , 22 , 2559 - 2560 and the use of the ivdde - protecting group is described in s . r . chhabra , b . hothi , d . j . evans , p . d . white , b . w . bycroft , w . c . chan , tetrahedron lett . 1998 , 39 , 1603 - 1606 . the cyclization with dppa is described in t . shioiri , k . ninomiya , s . yamada , j . am . chem . soc . 1972 , 94 , 6203 - 6205 and in s . f . brady , w . j . paleveda , b . h . arison , r . m . freidinger , r . f . nutt , d . f . veber , in 8th am . pept . symp . ( eds . : v . j . hruby , d . h . rich ), pierce chem . co ., rockford , ill ., usa , tuscon , ariz ., usa , 1983 , pp . 127 - 130 . the application of the peptides of the invention as anti - tumour agents is made in accordance with standard methods known to skilled practitioners from the prior art . among others , such applications include the use of the peptide of the invention together with the usual , pharmaceutically acceptable excipients and / or the usual pharmaceutically acceptable carriers for preparing a pharmaceutical composition . such pharmaceutical compositions may be used for the therapy of tumours . as a rule , all tumours bearing somatostatin receptors may be treated . among others , these are tumours of the pituitary gland , mamma carcinomas , glucagonomas , renal carcinomas , prostate carcinomas , meningiomas , gliomas , pancreas tumours , insulinomas and liver tumours . the treatment of the tumours is also carried out in accordance with standard procedures . 5 . the use of the somatostatin derivatives as diagnostic agents for tumours methods for tumour diagnosis by means of positron - emission tomography ( pet ) and radioscintigraphie as well as other radiodiagnostic methods are known to skilled practitioners from the prior art . this also applies for the radionuclides to be used for this purpose and their suitable complexing agents and bifuntional chelators [ chemical reviews thematic issue : medicinal inorganic chemistry ; september 1999 volume 99 , no . 9 ; guest editors : chris orvig , university of british columbia ; michael j . abrams , anormed , inc .]. by way of example , reference is made to the following four publications describing the use of the 18 f isotope for tumour diagnosis ( r . haubner , h .- j . wester , w . weber , c . mang , s . ziegler , r . senekowitsch - schmidtke , h . kessler , m . schwaiger , cancer research 2000 , 61 , 1781 ), and of the 125 i - isotope ( r . haubner , h .- j . wester , u . reuning , r . senekowitsch - schmidtke , b . diefenbach , h . kessler , g . stöcklin , m . schwaiger , j . nucl . med . 1999 , 40 , 1061 ), and of that of metallic radioisotopes such as 111 in and 99m tc and suitable bifunctional chelators . chemical reviews thematic issue : medicinal inorganic chemistry ; september 1999 volume 99 , no . 9 radiometal - labeled agents ( non - technetium ) for diagnostic imaging carolyn j . anderson and michael j . welch pp 2219 - 2234 and 99 mtc - labeled small peptides as diagnostic radiopharmaceuticals shuang liu and d . scott edwardspp 2235 - 2268 . thus , the present invention also relates to compounds which are derived from the peptides according to claims 1 to 31 , and which contain a radionuclide that is linked to the peptide . neither the radionuclide to be incorporated into the peptide of the invention nor the method of binding it and its position within the peptide is limited , provided the binding to the somatostatin receptor is not adversely affected and / or the peptide is internalised by tumour cells , so that a signal may be observed with appropriate measurement techniques , that may be used to discriminate the enrichment in tumour tissue from healthy tissue , thereby permitting the diagnosis of tumours . incorporation of 125 i and 131 i into the side chain of tyrosine in the radicals a and d is preferred . the incorporation of 99m tc and 111 in , 6768 ga , 90 / 86 y , 64 cu via complexing agents and bifuntional chelators such as dota , dtpa ( diethylenetriaminepentaacetic acid ), edta ( ethylenediiaminetetraacetic acid ), dfo ( desferrioxamine - b ) or short peptides such as cys - gly - cys , lys - gly - cys or diamidedithiol ( dads ) linked to the z residue are also preferred . the incorporation of 125 i adjacent to the oh group of tyrosine is particularly preferred . 6 . the use of the tetra - and pentapeptides of the present invention as anti - inflammatory or analgetic agents this aspect of the present invention is based on the recognition that the development of neurogenic and non - neurogenic inflammations can be prevented and an alleviation of pain can be accomplished by using the compounds of the present invention . although , as indicated above , somatostatin prevents the experimentally induced neurogenic inflammation , it cannot therapeutically be taken into consideration because of its broad spectrum of activities and its short half life in the human body . thus the invention relates to the use of tetra - or pentapeptides as described in the claims 1 - 31 as well as the salts of these compounds for the preparation of pharmaceutical compositions possessing neurogenic or non - neurogenic anti - inflammatory as well as analgetic effects . a common characteristic of the pharmaceutical compostitions prepared by the process of invention is that they inhibit the substance p release ( and thus inflammation processes ) to a greater extent than natural somatostatin does and in the same range as tt232 does , but they are more stable under the conditions of use . according to the invention , pharmaceutical compositions useful for the inhibition of neurogenic and non - neurogenic inflammations and for pain alleviation can be prepared by mixing the compounds of claims 1 - 31 , the salts or metal complexes thereof with carriers and / or auxiliaries commonly used in the pharmaceutical industry , thereby transforming them into pharmaceutical compositions . the pharmaceutical composition for the therapeutic use may contain any solvent suitable for pharmaceutical use ( e . g . water , aqueous solution containing thioalcohol and / or polyalcohol such as polyethylene glycol and / or glycerol etc . ); salts ( e . g . sodium chloride for adjustment of the physiological osmotic pressure ; iron cobalt , zinc or copper chlorides and the like for supplementing trace elements ); fillers and carriers ( e . g . lactose , potato starch , talc , magnesium carbonate , calcium carbonate , waxes , vegetable oils , polyalcohols etc . ); auxiliaries promoting dissolution ( such as certain polar solvents , in the case of water usually ethanol , polyalcohols , most frequently polyethylene glycol or glycerol and / or complex forming agents , e . g . cyclodextrins , crown ethers , natural proteins , saponins and the like ); tablet - disintegrating agents ( artificial or natural polymers strongly swelling in water , e . g . carboxymethylcellulose ); complex - forming agents usually employed in retard compositions ( such as water - insolble or slightly soluble cyclodextrin derivatives , artificial and natural polymers , crown ethers and the like ); ph - adjusting compounds such as mineral or organic buffers ; taste - improving agents ( cyclodextrins and / or crown ethers ); and flavouring agents ( beet sugar , fruit sugar or grape sugar , saccharin , invert sugar etc . ); antioxidants ( e . g . vitamin c ) as well as substances promoting the effectiveness of the action of compounds of claims 1 - 31 . the compounds of claims 1 - 31 are useful also in aerosol compositions aimed at the absorption through the skin surface or lungs . for the preparation of tablets , dragées or hard gelatine capsules e . g . lactose , maize , wheat or potato starches , talc , magnesium carbonate , stearic acid and its salts etc . can be used as carriers . for the preparation of soft gelatine capsules e . g . vegetable oils , fats , waxes , or polyalcohols with an appropriate density can be used as carriers . for the preparation of solutions and syrups e . g . water , polyalcohols such as polyethylene glycol and glycerol , beet sugar , grape sugar , etc . can be employed as carriers . parenteral compositions may contain water , alcohol , polyalcohols or vegetable oils as carriers . suppositories may contain e . g . oils , waxes , fats or polyalcohols of appropriate density as carriers . suitable doses of the active ingredients can be determined in accordance with standard procedures that are known to the person skilled in the art . typical doses may be in the range of 0 . 5 to 5000 μg / kg of body weight . however , higher or lower doses may also be appropriate , depending on the individual case and on the active ingredient that is used . it allows to diminish inflammations of both neurogenic and non - neurogenic orignin with simultaneous exertion of an analgetic effect . the somatostatin analogues used in the invention are more slowly decomposed under in vivo conditions than the natural compound ; therefore their action is more durable . all solvents for moisture sensitive reactions were distilled and dried in accordance with standard procedures . the pd / c used is a donation from degussa , frankfurt / main , germany . column chromatographies at increased pressure were carried out with the solvents specified on silica gel 60 , 230 - 400 mesh ( merck kgaa , darmstadt ). tritylchloropolystyrene resin by pepchem goldammer & amp ; clausen and hatu by perseptive biosystems were used for solid phase syntheses . all reactions in a solution were monitored by means of thin - layer chromatography ( 0 . 25 mm precoated silica gel 60 f 254 aluminium plates ; merck kgaa , darmstadt ). melting points were measued with a bütchi - tottoli apparatus and reported in uncorrected form . analytical and semi - preparative reverse - phase - hplc was carried out with the aid of waters equipment ( high pressure pump 510 , multi - wavelength detector 490e , chromatography workstation maxima 820 ), an apparatus from beckman ( high pressure pump 110b , gradient mixer , controller 420 , uv detector uvicord by knauer ) or a device by amersham pharmacia biotech ( äkta basic 10 / 100 , autosampler a - 900 ). the preparative reverse - phase - hplc was carried out on a beckman system gold ( high pressure pump module 126 , uv detector 166 ). c 18 columns ( by - ymc ) were used for the chromatographies . the solvents used were a : h 2 o + 0 . 1 % cf 3 cooh and b : ch 3 cn + 0 . 1 % cf 3 cooh . detection was carried out at 220 and 254 nm . [ 0131 ] 1 h and 13 c nmr spectra of the compounds were taken on apparatuses by bruker , karlsruhe ( bruker — ac 250 , bruker dmx - 500 or bruker dmx - 600 ). references for the chemical shift of the proton resonances were chcl 3 ( δ = 7 . 24 ) and dmso ( δ = 2 . 49 ), respectively . multiplets were noted as s ( singlet ), d ( doublet ), t ( triplet ), q ( quartet ), m ( multiplet ), and br ( broad ). the chemical shift for 13 c resonances is reported in relation to cdcl 3 ( δ = 77 . 0 ) and [ d 6 ] dmso ( δ = 39 . 5 ), respectively . die nmr data were processed on a bruker x32 work station using uxnmr software . the allocation of the proton and carbon signals was carried out by means of hmqc , cosy , tocsy and hmbc experiments . where possible , coupling constants were determined from the corresponding 1d - spectra as well as cosy dqf and cosype spectra . hplc - esi mass spectra were prepared on a finnigan device ( ncq - esi with hplc conjunction lcq ; hplc system hewlett packard hp 1100 ; nucleosil 100 5c 18 ). high - resolution mass spectra were recorded on a finnigan mat 95q with fab ( cs + ions and m - nitrobenzyl alcohol as matrix ). in the following experiments , every step is taken at room temperature ( 18 to 25 ° c .) unless explicitly specified otherwise . preparation of the furanoid z group from diacetone glucose which is available commercially and inexpensively both groups z1 und z2 are prepared in accordance with the above scheme 1 . 1 , 2 : 5 , 6 - di - o - isopropylidene - 3 - o - triflyl - α - d - glucofuranose : triflic anhydride ( 54 . 2 g , 0 . 19209 mol ) was slowly added with stirring to a solution of diacetone glucose ( 25 g , 0 . 96 mol ) and pyridine ( 30 . 39 g , 0 . 384 mol ) in ch 2 cl 2 ( 1 l ) in a 3 - neck flask at − 10 ° c . ( acetone - ice cooling bath ) ( l . d . hall , d . c . miller , carbohydr . res . 1976 , 47 , 299 ; r . w . binkley , m . g . ambrose , d . g . hehemann , j . org . chem . 1980 , 45 , 4387 ). the pyridinium triflate salt precipitated and the solution turned brown . the reaction was completed after 1 . 5 hrs . ( tlc control : acoet / hexane 2 : 1 ). the reaction mixture was added to 1 l of ice water . the aqueous phase was extracted with ch 2 cl 2 ( 4 ×). the organic phase was dried with mgso 4 and distilled several times on a rotatory evaporator while repeatedly adding toluene in order to remove the pyridine from the mixture . the brown residue was extracted with hexane ( 3 ×). after removal of the hexane , the desired product was obtained in the form of white crystals ( 36 . 88 g , 98 %). r f = 0 . 61 ( acoet / hexane 2 : 1 ). both the melting point and 1 h nmr were congruent with the values given in literature ( l . d . hall , d . c . miller , carbohydr . res . 1976 , 47 , 299 ). a solution of the trifyl sugar described above ( 37 . 1 g , 0 . 0945 mol ) dissolved in dmf ( 200 ml ), was slowly added to a solution of nan 3 ( 12 . 3 g , 0 . 189 mol ), bu 4 ncl catalytic , ˜ 0 . 1 g ) in dmf ( 1 . 5 l ) at 50 ° c . after 5 hrs . of stirring at 50 ° c ., the reaction was completed ( tlc control : acoet / hexane 2 : 1 ). the dmf was removed on the rotary evaporator at reduced pressure and the residue dissolved in acoet . the organic phase was washed with water ( 2 ×). the aqueous phase was re - extracted with acoet until no product 6 was detectable by tlc . the combined organic phases were dried over mgso 4 and the solvent removed . a syrup of 6 and the elimination byproduct was obtained . ( 1 h nmr showed that the ratio between product and byproduct was 7 : 3 ). the crude product 6 was purified by fc ( acoet / hexane 1 . 3 ) and 6 obtained as a colourless liquid ( 18 . 2 g , 70 %), r f = 0 . 55 ( acoet / hexane 1 : 3 ). the 1 h nmr von 6 was congruent with the values given in literature ( h . h . baer , y . gan , carbohydr . res . 1991 , 210 , 233 ). for the oxidation step ( 4 ), 6 ( 16 g , 0 . 056 mol ) was dissolved in acoh ( 77 %, 38 ml ) and stirred at reflux for 3 hrs . after removal of the solvent the crude product 7 was purified by fc ( acoet / hexane 2 : 1 ). white crystals of 7 were obtained ( 10 . 98 g , 80 %). naio 4 ( 8 . 4 g , 0 . 036 mmol ) was successively added dropwise to a cooled solution ( 10 ° c .) of 7 ( 8 g , 0 . 0327 mol ) in meoh ( 60 ml ) and h 2 o ( 100 ml ) ( l . n . kulinkovich , v . a . timoshchuk , zh . obshch . khim . ( ru ); 53 ; 9 ; 1983 ; 2126 - 2131 1983 , 53 , 1917 ). the mixture was stirred for 5 hrs . inorganic salts precipitated after meoh ( 150 ml ) was added . they were filtered off and washed repeatedly with meoh . the combined organic phases were concentrated under vacuum on a rotary evaporator until a slightly yellow syrup remained . the aldehyde obtained was used in the oxidation step to obtain 8 without further purifaction . [ 0147 ] 1 h nmr ( 250 mhz , cdcl 3 / meod , 298 k ): δ = 1 . 35 ( s , ch 3 ), 1 . 55 ( s , ch 3 ), 3 . 65 ( dd , j 3 , 4 = 4 . 72 , j 2 , 3 = 4 . 37 hz , h 3 ), 4 . 1 ( d , j = 4 . 7 hz , h 4 ), 4 . 7 ( dd , j 1 , 2 = 3 . 7 , j 2 , 3 = 4 . 5 hz , h 2 ), 5 . 9 ( d , j 1 , 2 = 3 . 8 hz , hl ), 9 . 7 ( br . s , h 5 ). with stirring , kmno 4 ( 6 . 7 g , 42 mmol ) was slowly added to a solution of the aldehyde in hoac ( 50 %, 150 ml ) ( l . n . kulinkovich , v . a . timoshchuk , zh . obshch . khim . ( ru ); 53 ; 9 ; 1983 ; 2126 - 2131 1983 , 53 , 1917 ), which resulted in a purple solution . after 12 hours , the reaction was completed . the solution was adjusted to a ph of 1 with conc . hcl and excess kmno 4 removed with na 2 so 3 . the solution was extracted with chcl 3 ( 3 ×). the organic phase was dried with mgso 4 and the solvent removed under vacuum . recrystallisation in acoet / hexane yielded crystals of 8 ( 4 . 29 g , 1 . 87 mmol , 89 % for both steps together ). general procedure for the simultaneous reduction and protection of the azides with fmoc ( gp ) with stirring , the solution of the azide in meoh / h 2 o ( 2 : 1 , 0 . 15 mol / l ) is adjusted to a ph of 8 with saturated nahco 3 . a solution of fmoc - cl ( 1 . 1 equiv .) in thf ( 0 . 16 mol / l ) is added , followed by the addition of the catalyst ( pd / c , 10 wt .-%, ( wet ) 49 . 7 wt .-% h 2 o , degussa e 101 , 1 g of catalyst per 1 g of azide ). the suspension is gassed with h 2 repeatedly . in general , the reaction is completed in 18 to 24 hrs ( contol by means of thin - layer chromatography ). the solvents are removed under reduced pressure . the solvent is suspended in water and adjusted to a ph of 8 - 9 with saturated nahco 3 and the aqueous phase extracted three times with ethyl acetate . the combined organic phases are washed with aqueous nahco 3 solution . the aqueous phase is adjusted to a ph of 1 with 1 mol / l hcl and extracted three times with ethyl acetate . the combined organic phases are washed with a saturated aqueous nacl solution , dried over mgso 4 and concentrated under reduced pressure . as described in gp , the azide 8 ( 1 g , 4 . 36 mmol ) was reduced to the amine and protected with fmoc at the same time . 1 ( 1 . 4 g , 3 . 29 mmol , 76 %) was obtained as a colourless syrup . [ 0154 ] 1 h nmr ( 500 mhz , [ d6 ] dmso , 300 k ): δ = 1 . 26 ( s , 3h , ch 3 ), 1 . 46 ( s , 3h , ch 3 ), 4 . 07 ( m , h 3 ), 4 . 22 ( m , 1h , fmoc - ch ), 4 . 25 ( m , 1h , h 4 ), 4 . 30 ( m , 2h , ch 2 fmoc ), 4 . 60 ( t , j = 4 . 0 , 1h , h 2 ), 5 . 84 ( d , j = 3 . 4 , 1h , h 1 ), 7 . 32 ( m , arom h ), 7 . 40 ( m , arom h ), 7 . 63 ( m , h n ), 7 . 72 ( m , arom h ), 7 . 87 ( d , j = 7 . 3 hz , 2h , arom h ); 13 c nmr ( 125 mhz , [ d 6 ] dmso , 300 k ): δ = 26 . 06 ( ch 3 ), 26 . 29 ( ch 3 ), 46 . 30 ( ch fmoc ), 56 . 25 ( c 3 ), 65 . 61 ( ch 2 fmoc ), 75 . 36 ( c 4 ), 78 . 01 ( c 2 ), 104 . 17 ( c 1 ), 111 . 63 ( c isoprop . ), 119 . 75 ( c arom ), 124 . 89 ( c arom ), 127 . 17 ( c arom ), 143 . 32 ( c 5 ); fab - hrms calc . c 23 h 23 no 7 na [ m + na ] + 448 . 1372 , found : 448 . 1366 . as described in gp , the azide 7 ( 2 g , 8 . 31 mmol ) was reduced to the amine and protected with fmoc at the same time . fc ( acoet / hexane 1 : 1 ) resulted in a white powder of 9 ( 3 . 3 g , 7 . 48 mmol , 92 %). [ 0157 ] 1 h nmr ( 500 mhz , cdcl 3 , 300 k ): δ = 1 . 35 ( s , 3h , ch 3 ), 1 . 55 ( s , 3h , ch 3 ), 2 . 12 ( s , 0 . 8h , oh ), 3 . 60 - 4 . 65 ( m , 13h , h 2 , h 3 , h 4 , h 5 , h 6 , h 6 ′ , ch 2 fmoc , ch fmoc , h 2 o ), 5 . 47 ( br . s , 1h , h n ), 5 , 80 ( br . s , 1h , h 1 ), 7 . 32 ( m , 2h , h arom ), 7 . 40 ( m , 2h , h arom ), 7 . 57 ( m , 2h , h arom ), 7 . 76 ( d , j = 6 . 7 hz , 2h , h arom ); 13 c nmr ( 125 mhz , cdcl 3 , 300 k ): δ = 26 . 46 ( ch 3 ), 26 . 61 ( ch 3 ), 47 . 12 ( ch fmoc ), 55 . 74 ( c 3 ), 63 . 73 ( c 4 ), 67 . 47 ( c 5 ), 79 . 25 ( c 2 ), 80 . 41 ( ch 2 fmoc ) 103 . 77 ( c 1 ), 112 . 85 ( c isoprop ), 120 . 05 ( c arom ), 124 . 90 ( c arom ), 127 . 80 ( c arom ), 141 . 32 , 143 . 53 , 143 . 57 ( c arom , c 6 ); esi - ms : calc . c 24 h 27 no 7 na 464 . 1685 , found : 464 . 1 ; t r = 14 . 41 ( hplc - ms , 30 - 90 % b in 20 min ). the diol 9 and tempo ( 1 mg , 0 . 064 mmol , 0 . 011 eq ) were suspended in ch 2 cl 2 ( 1 . 8 ml ) at 0 ° c . a solution of kbr ( 14 . 5 mg , 0 . 064 mmol , 0 . 11 eq ) and tbu 4 ncl ( 8 . 9 mg ) in saturated aq nahco 3 was slowly added to the reaction mixture . a mixture of naocl ( 13 %, 1 . 5 ml ), saturated nacl solution ( 1 . 32 ml ) and saturated nahco 3 solution ( 0 . 7 ml ) was added dropwise to the reaction mixture over 30 min . the reaction mixture was stirred over night and then diluted with acoet ( 2 ml ). the organic phase was extracted twice with saturated nacl solution . the aqueous phase was adjusted to a ph of 2 with 1 n hcl and extracted with acoet extrahiert . the solvent was distilled off at reduced pressure , leaving behind a colourless syrup of 2 ( 0 . 17 g , 62 %). [ 0160 ] 1 h nmr ( 500 mhz , [ d 6 ] dmso , 300 k ): δ = 1 . 25 ( s , 3h , ch 3 ), 1 . 47 ( s , 3h , ch 3 ), 4 . 05 - 4 . 30 ( m , 6h , h 3 , h 4 , h 5 , ch 2 fmoc , ch fmoc ), 4 . 55 ( br . s , 1h , h 2 ), 5 . 73 ( br . s , 1h , h 1 ), 7 . 30 - 7 . 90 ( m , 9h , h arom , h n ); 13 c nmr ( 125 mhz , [ d 6 ] dmso , 300 k ): δ = 23 . 97 ( ch 3 ), 24 . 39 ( ch 3 ), 45 . 19 ( ch fmoc ), 51 . 88 ( c 3 ), 63 . 70 ( c 4 ), 67 . 18 ( c 5 ), 75 . 30 ( c 2 ), 76 . 98 ( ch 2 fmoc ) 101 . 73 ( c 1 ), 111 . 35 ( c isoprop . ), 117 . 20 ( c arom ), 122 . 39 ( c arom ), 124 . 14 ( c arom ), 124 . 51 ( c arom ), 143 . 80 ( c 6 ); fab - hrms calc for c 24 h 25 no 8 na [ m + na ] + 478 . 1478 , found : 478 . 14167 ; t r = 15 . 71 ( hplc - ms , 10 - 90 % b in 20 min ). according to standard methods , tcp resin ( 1 . 3 g ) was loaded with 629 mg of fmoc - tyr - oh , 2 . 77 ml of collidine in 10 ml of dcm in a 20 ml syringe . the loading was determined to be 0 . 477 mmol / g resin by gravimetry . 165 mg of the resin loaded with fmoc - tyr - oh as above were allowed to swell for 2 hrs . in a 5 ml syringe with frit in nmp . fmoc - deprotection : with agitation , the resin is treated with 20 % piperidine in nmp ( 3 × 10 min .) and then washed with nmp ( 5 × 2 min .) with agitation . the fmoc - protected sugar amino acid 1 ( 50 , 5 mg , 1 . 5 equiv ) is dissolved in 2 ml of nmp together with hoat ( 16 mg , 1 . 5 equiv ), hatu ( 45 mg , 1 . 5 equiv ) and collidine ( 156 μl , 15 equiv ). this solution is charged into the syringe containing the tyr - resin and allowed to react with agitation for 3 - 4 hours , followed by washing with nmp under agitation ( 5 × 1 min .) a few resin beads were taken from the syringe and treated with a few drops of a 20 vol .-% hfip in dmc solution in an eppendorf - cap for 30 minutes . the dipeptide fmoc - z1 - tyr - oh thus separated from the resin was characterised through esi mass spectrum : esi - ms : 1237 . 6 [ 2m − h + na + k ] + ; 1221 . 4 [ 2m − h + 2na ] + ; 1215 . 4 [ 2m + k ] + ; 1199 . 2 [ 2m + na ] + ; 633 . 4 [ m − h + 2na ] + ; 627 . 4 [ m + k ] + ; 611 . 4 [ m + na ] + ; 589 . 3 [ m + h ] + . after fmoc - deprotection and washing with nmp as described above , coupling was carried out for 2 - 3 hours with fmoc - thr ( otrt )- oh ( 115 mg , 2 . 5 equiv ), hatu ( 75 mg , 2 . 5 equiv ), hoat ( 27 mg , 2 . 5 equiv ) and 260 μl collidine in 2 ml of nmp with agitation , followed by washing with nmp ( 5 × 1 min ) with agitation . after fmoc - deprotection and washing with nmp as described above , coupling was carried out for 2 - 3 hrs . with fmoc - lys ( ivdde )- oh ( 112 . 9 mg , 2 . 5 equiv ), hatu ( 74 . 7 mg , 2 . 5 equiv ), hoat ( 27 mg , 2 . 5 equiv ) and 260 μl of collidine in 2 ml of nmp with agitation , followed by washing with nmp ( 5 × 1 min ) with agitation . after washing with nmp , the resin is washed twice for dcm ( 1 min ) and twice with meoh ( 1 min .) and dried in vacuum over night . after that it is divided in equal parts and charged into 2 syringes ( one for g and one for h ) at 122 mg resin each . from this point onwards , synthesis of tg and th is carried out separately . after fmoc - deprotection and washing with nmp as described above , coupling was carried out with fmoc - trp - oh ( 50 mg , 3 equiv ), hatu ( 45 mg , 3 equiv ), hoat ( 16 mg , 3 equiv ) and 156 μl of collidine in 1 ml of nmp with agitation for 2 - 3 hrs ., followed by washing with nmp ( 5 × 1 min .) with agitation . after fmoc - deprotection and washing with nmp as described above , coupling was carried out with fmoc - d - trp - oh ( 50 mg , 3 equiv ), hatu ( 45 mg , 3 equiv ), hoat ( 16 mg , 3 equiv ) and 156 μl of collidine in 1 ml of nmp with agitation for 2 - 3 hrs ., followed by washing with nmp ( 5 × 1 min .) with agitation . cleavage of the protected linear peptides fmoc - trp - lys ( ivdde )- thr ( otrt )- z1 - tyr - oh and fmoc - d - trp - lys ( ivdde )- thr ( otrt )- z1 - tyr - oh from the resin : after the fmoc - deprotection and washing with nmp as described above , both peptides are washed with dcm ( 3 × 1 min .) with agitation and then separated from the resin with 20 vol -% hfip in dcm ( 3 × 20 min .) with agitation . the dcm is removed under reduced pressure . in each case characterisation is carried out through hplc - ms : h - trp - lys ( ivdde )- thr ( otrt )- z1 - tyr - oh : esi - ms : 1306 . 4 [ m − h + 2k ] + ; 1290 . 5 [ m − h + na + k ] + ; 1274 . 6 [ m − h + 2na ] + ; 1268 . 6 [ m + k ] + ; 1252 . 6 [ m + na ] + ; 1230 . 4 [ m + h ] + ; 988 . 5 [ m - trt + h ] + ; 930 . 5 [ m − trt - acetone + h ] + ; 243 [ trt ] + ; t r = 12 . 90 min ( hplc - ms , 40 - 90 % b in 15 min ). h - d - trp - lys ( ivdde )- thr ( otrt )- z1 - tyr - oh : esi - ms : 1306 . 4 [ m − h + 2k ] + ; 1290 . 5 [ m − h + na + k ] + ; 1274 . 6 [ m − h + 2na ] + ; 1268 . 6 [ m + k ] + ; 1252 . 6 [ m + na ] + ; 1230 . 4 [ m + h ] + ; 988 . 5 [ m − trt + h ] + ; 930 . 5 [ m − trt - acetone + h ] + ; 243 [ trt ] + ; t r = 12 . 97 min ( hplc - ms , 40 - 90 % b in 15 min ). the peptides h - trp - lys ( ivdde )- thr ( otrt )- z1 - tyr - oh and h - d - trp - lys ( ivdde )- thr ( otrt )- z1 - tyr - oh were dissolved in 12 ml of dmf each . 37 . 9 μl of dppa and 25 mg of nahco 3 were added with stirring . after 12 hrs ., the reaction was completed . c [- trp - lys ( ivdde )- thr ( otrt )- z1 - tyr -]: esi - ms : 1256 . 7 [ m − h + 2na ] + ; 1250 . 7 [ m + k ] + ; 1234 . 7 [ m + na ] + ; 1219 . 0 [ m + li ] + ; 970 . 5 [ m − trt + h ] + ; 912 . 6 [ m − trt - acetone + h ] + ; 243 [ trt ] + ; t r = 22 . 13 min ( hplc - ms , 30 - 70 % b in 15 min ). c [- d - trp - lys ( ivdde )- thr ( otrt )- z1 - tyr -]: esi - ms : 1256 . 7 [ m − h + 2na ] + ; 1250 . 7 [ m + k ] + ; 1234 . 8 [ m + na ] + ; 1218 . 8 [ m + li ] + ; 970 . 6 [ m − trt + h ] + ; 912 . 7 [ m − trt - acetone + h ] + ; 243 [ trt ] + ; t r = 22 . 28 min ( hplc - ms , 30 - 70 % b in 15 min ). the protected cyclopeptides are dissolved 3 × in 3 % hydrazine in dmf solution , reacted with stirring for 10 min . and the solvent removed under reduced pressure . the residue was solubilised with a few drops of dmf and these and the peptide precipitated with diethyl ether . purification in each case was carried out by semi - preparative hplc . after lyophilisation both peptides were present as an amorphous white powder . c [- trp - lys - thr ( otrt )- z1 - tyr -] ( tg ): semi - preparative hplc purification : gradient : 40 - 65 % b in 30 min ; ( b = 90 % acetonitrile , 10 % water , + 0 . 1 % tfa ) esi - ms : 1044 . 5 [ m + k ] + ; 1028 . 5 [ m + na ] + ; 1006 . 2 [ m + h ] + ; 764 . 4 [ m − trt + h ] + ; 706 . 4 [ m − trt - acetone + h ] + ; 243 . 2 [ trt ] + ; t r = 13 . 94 min ( hplc - ms , 30 - 70 % b in 15 min ; b = acetonnitrile + 0 . 1 % tfa ). c [- d - trp - lys - thr ( otrt )- z1 - tyr -] ( th ): semi - preparative hplc purification : gradient : 50 - 65 % b in 30 min ; ( b = 90 % acetonitrile , 10 % water , + 0 . 1 % tfa ) esi - ms : 1044 . 5 [ m + k ] + ; 1028 . 6 [ m + na ] + ; 1012 . 6 [ m + li ] + ; 764 . 4 [ m − trt + h ] + ; 706 . 4 [ m − trt - acetone + h ] + ; 243 [ trt ] + ; t r = 14 . 35 min ( hplc - ms , 30 - 70 % b in 15 min ; b = acetonitrile + 0 . 1 % tfa ). tcp - resin ( 2 g ) was loaded with 933 mg ( 1 . 2 equiv ) of fmoc - phe - oh , dipea ( 2 . 5 equiv , 1 . 05 ml ) in 16 ml of dcm in a 20 ml syringe according to standard methods . by gravimetry , the loading was determined to be 0 . 677 mmol / g resin . 52 . 4 mg of the fmoc - phe - oh loaded resin were allowed to swell with frit in a 2 ml syringe in nmp for two hrs . fmoc - deprotection : with agitation the resin is treated with 20 % piperidine in nmp ( 3 × 10 min .) and then washed with nmp ( 5 × 2 min .) with agitation . the fmoc - protected sugar amino acid 2 ( 24 . 3 mg , 1 . 5 equiv ) is dissolved in 194 μl of dmf together with hoat ( 7 . 3 mg , 1 . 5 equiv ), hatu ( 20 . 25 mg , 1 . 5 equiv ) and collidine ( 70 . 7 μl , 15 equiv ). this solution is charged into the syringe containing the phe - resin and allowed to react with agitation for 3 - 4 hours , followed by washing with nmp under agitation ( 5 × 1 min .) a few resin beads were taken from the syringe and treated with a few drops of a 20 vol .-% hfip in dcm solution in an eppendorf - cap for 30 minutes . the dipeptide fmoc - z1 - tyr - oh thus separated from the resin was characterised through an esi mass spectrum : esi - ms : 1249 . 3 [ 2m − h + 2na ] + ; 1227 . 2 [ 2m + na ] + ; 1204 . 9 [ 2m + h ] + ; 663 . 4 [ m − h + na + k ] + ; 647 . 4 [ m − h + 2na ] + ; 641 . 3 [ m + k ] + ; 625 . 4 [ m + na ] + ; 603 . 2 [ m + h ] + . after fmoc - deprotection and washing with nmp as described above , coupling was carried out for 2 - 3 hours with fmoc - thr ( otrt )- oh ( 42 mg , 2 equiv ), hatu ( 27 mg , 2 equiv ), hoat ( 9 . 5 mg , 2 . 5 equiv ) and 95 pi of collidine ( 20 equiv ) in nmp ( 250 μl ) with agitation , followed by washing with nmp ( 5 × 1 min ) with agitation . after fmoc - deprotection and washing with nmp as described above , coupling was carried out for 2 - 3 hrs . with fmoc - lys ( ivdde )- oh ( 41 mg , 2 equiv ), hatu ( 27 mg , 2 equiv ), hoat ( 9 . 5 mg , 2 equiv ) and 95 μl of collidine ( 20 equiv ) in 250 μl of nmp with agitation , followed by washing with nmp ( 5 × 1 min ) with agitation . after fmoc - deprotection and washing with nmp as described above , coupling was carried out with fmoc - trp - oh ( 30 . 2 mg , 2 equiv ), hatu ( 25 , 7 mg , 2 equiv ), hoat ( 9 . 7 mg , 2 equiv ) and 94 μl of collidine in nmp with agitation for 2 - 3 hrs ., followed by washing with nmp ( 5 × 1 min .) with agitation . cleavage of the protected linear peptide fmoc - d - trp - lys ( ivdde )- thr ( otrt )- z2 - phe - oh from the resin after fmoc - deprotection and washing with nmp as described above , the peptide was washed with dcm with agitation ( 3 × 1 min .) and then separated from the resin with 20 vol -% of hfip in dcm ( 3 × 20 min ) with agitation . the dcm is removed under reduced pressure . the peptide h - d - trp - lys ( ivdde )- thr ( otrt )- z2 - phe - oh was dissolved in 7 . 1 ml of dmf and 23 al of dppa and 4 . 9 mg nahco 3 added with agitation . after 12 hrs ., the reaction was completed ( no linear peptide visible in the esi mass spectrum ). the protected cyclopeptide was dissolved 3 × in 3 % hydrazine in dmf solution , reacted with stirring for 10 min . and the solvent removed under reduced pressure . the residue was solubilised with a few drops of dmf and added dropwise to diethyl ether to precipitate the peptide . purification in each case was carried out by semi - preparative hplc . after lyophilisation the peptide was present as an amorphous white powder . c [- d - trp - lys - thr ( otrt )- z2 - phe -] ( sgnc 18 ): semi - preparative hplc purification : gradient : 50 - 65 % b in 30 min ; ( b = 90 % acetonitrile , 10 % water , + 0 , 1 % tfa ) parallel synthesis of sgnc 12 : c [- d - trp - lys - phe ( f 5 )- z1 - phe -]; sgnc 13 : c [- d - trp - lys - bip - z1 - phe -]; sgnc 14 : c [- d - trp - lys - bpa - z1 - phe -]; sgnc 15 : c [- d - trp - lys - 1 - nal - z1 - phe -]; sgnc 16 : c [- d - trp - lys - 2 - nal - z1 - phe -]: tcp - resin ( 2 g ) was loaded with 933 mg ( 1 . 2 equiv ) of fmoc - phe - oh , dipea ( 2 . 5 equiv , 1 . 05 ml ) in 16 ml of dcm in a 20 ml syringe according to standard methods . by gravimetry , the loading was determined to be 0 . 677 mmol / g resin . 52 . 4 mg of the fmoc - phe - oh loaded resin each were weighed and charged into a 2 ml syringe and allowed to swell in nmp for two hrs . fmoc - deprotection : with agitation the resin in each of the 5 syringes is treated with 20 % piperidine in nmp ( 3 × 10 min .) and then washed with nmp ( 5 × 2 min .) with agitation . the fmoc - protected sugar amino acid 1 ( 113 . 5 mg , 1 . 5 equiv ) is dissolved in 1 ml of dmf together with hoat ( 36 . 3 mg , 1 . 5 equiv ), hatu ( 101 . 3 mg , 1 . 5 equiv ) and collidine ( 353 μl , 15 equiv ). this solution is charged in equal parts , i . e . 270 . 7 ill each , into 5 syringes containing the phe - resin and allowed to react with agitation for 3 - 4 hours , followed by washing with nmp under agitation ( 5 × 1 min .) by way of an example , a few resin beads were taken from the syringe to synthetise sgnc 13 and treated with a few drops of a 20 vol .-% hfip in dcm solution in an eppendorf - cap for 30 minutes . the dipeptide fmoc - z1 - phe - oh thus separated from the resin was characterised through an esi mass spectrum : esi - ms : 1738 . 7 [ 3m + na ] + ; 1716 . 8 [ 3m + h ] + ; 1205 . 4 [ 2m − h + na + k ] + ; 1167 . 1 [ 2m + na ] + ; 1144 . 9 [ 2m + h ] + ; 611 . 3 [ m + k ] + ; 595 . 3 [ m + na ] + ; 573 . 2 [ m + h ] + . after fmoc - deprotection and washing with nmp as described above , coupling with agitation was carried out for 2 - 3 hrs . each to synthesise sgnc 12 : with 33 . 9 mg of fmoc - phe ( f 5 )- oh , 27 mg of hatu , 10 mg of hoat and 94 μl of collidine in 300 μl nmp ; to synthesise sgnc 13 : with 33 . 0 mg of fmoc - bip - oh , 27 mg of hatu , 10 mg of hoat and 94 μl of collidine in 300 μl nmp ; to synthesise sgnc 14 : with 35 mg of fmoc - bpa - oh , 27 mg of hatu , 10 mg of hoat and 94 μl of collidine in 300 μl of nmp ; to synthesise sgnc 15 : with 31 mg of fmoc - 1 - nal - oh , 27 mg of hatu , 10 mg of hoat and 94 μl of collidine in 300 μl of nmp ; to synthesise sgnc 16 : with 31 mg of fmoc - 2 - nal - oh , 27 mg of hatu , 10 mg o hoat and 94 μl collidine in 300 μl of nmp ; after fmoc - deprotection and washing with nmp as described above , coupling was carried out for 2 to 3 hrs . as follows : to synthesise sgnc 12 - 14 and sgnc 16 : fmoc - lys ( ivdde )- oh ( 163 mg , 2 equiv ), hatu ( 108 mg , 2 equiv ), hoat ( 38 mg , 2 equiv ) and 377 μl of collidine ( 20 equiv ) are dissolved in 1 . 3 ml of nmp . this solution is charged into the pertinent syringe in equal parts , i . e . 419 μl each , and subjected to coupling with agitation . to synthesise sgnc 15 : fmoc - lys ( ivdde )- oh ( 40 . 75 mg , 2 equiv ), hatu ( 27 mg , 2 equiv ), hoat ( 9 mg , 2 equiv ) and 94 μl of collidine ( 20 equiv ) is dissolved in 300 μl of nmp gelöst , charged into the syringe and subjected to coupling with agitation . after that , washing with nmp was carried out with agitation ( 5 × 1 min .). after fmoc - deprotection and washing with nmp as described above , coupling was carried out for 2 to 3 hrs . as follows : to synthesise sgnc 12 - 14 und sgnc 16 : fmoc - d - trp - oh ( 121 mg , 2 equiv ), hatu ( 108 mg , 2 equiv ), hoat ( 38 mg , 2 equiv ) and 377 μl of collidine ( 20 equiv ) are dissolved in 1 . 3 ml nmp . this solution is drawn into the pertinent syringe in equal parts , i . e . 419 μl and subjected to coupling with agitation . to synthesise sgnc 15 : fmoc - d - trp - oh ( 30 . 2 mg , 2 equiv ), hatu ( 27 mg , 2 equiv ), hoat ( 9 mg , 2 equiv ) and 94 μl of collidine ( 20 equiv ) are dissolved in 300 μl of nmp , drawn into the syringe and subjected to coupling with agitation . after that , washing with nmp was carried out with agitation ( 5 × 1 min .) after fmoc - deprotection and washing with nmp as described above , the peptides were washed dcm with agitation ( 3 × 1 min .) and then separated from the resin with 20 vol -% each of hfip in dcm ( 3 × 20 min ) with agitation . the dcm is removed under reduced pressure . the protected linear peptides were dissolved in 7 . 1 ml of dmf each and 23 μl of dppa and 4 . 9 mg of nahco 3 each added with agitation . after 12 hrs ., the reaction was completed ( no linear peptide visible in the esi mass spectrum ). exemplary characterisation of the ivdde - protected sgnc 12 : c [- d - trp - lys ( ivdde )- phe ( f 5 )- z1 - phe -] by esi - ms : 1134 . 6 [ m − h + 2na ] + ; 1128 . 6 [ m + k ] + ; 1112 . 7 [ m + na ] + ; 1090 . 6 [ m + h ] + ; 1032 . 6 [ m - acetone + h ] + . the cyclopeptides ivdde - protected in the lysine side chain were dissolved 3 × in 3 % hydrazine in dmf solution , reacted with stirring for 10 min . and the solvent removed under reduced pressure . the residue was solubilised with a few drops of dmf each and the peptide precipitated with diethyl ether . purification in each case was carried out by semi - preparative hplc . after lyophilisation all of the peptides were present as an amorphous white powder . c [- d - trp - lys - phe ( f 5 )- z1 - phe -] ( sgnc 12 ): semi - preparative hplc purification : gradient : 30 - 70 % b in 30 min ; ( 13 = 90 % acetonitrile , 10 % water , + 0 . 1 % tfa ) t r = 24 . 35 esi - ms : 1806 . 4 [ 2m ( 1 * 13 c )+ k ] + ; 1805 . 4 [ 2m + k ] + ; 1790 . 3 [ 2m ( 1 * 13 c )+ na ] + ; 1789 . 3 [ 2m + na ] + ; 1768 . 2 [ 2m ( 1 * 13 c )+ h ] + ; 1767 . 2 [ 2m + h ] + ; 922 . 3 [ m + k ] + ; 906 . 4 [ m + na ] + ; 884 . 3 [ m + h ] + ; 826 . 4 [ m - acetone + h ] + ; t r = 11 . 65 min ( hplc - ms , 30 - 70 % b in 15 min ; b = acetonitrile + 0 . 1 % tfa ). c [- d - trp - lys - bip - z1 - phe -] ( sgnc 13 ): semi - preparative hplc purification : gradient : 45 - 63 % b in 30 min ; ( b = 90 % acetonitrile , 10 % water , + 0 . 1 % tfa ) esi - ms : 1028 . 2 [ m + tfa − h + 2na ] + ; 1022 . 4 [ m + tfa + k ] + ; 1006 . 5 [ m + tfa + na ] + ; 908 . 4 [ m + k ] + ; 892 . 6 [ m + na ] + ; 870 . 4 [ m + h ] + ; 812 . 5 [ m - acetone + h ] + ; t r = 13 . 05 min ( hplc - ms , 30 - 70 % b in 15 min ; b = acetonitrile + 0 . 1 % tfa ). c [- d - trp - lys - bpa - z1 - phe -] ( sgnc 14 ): semi - preparative hplc purification : gradient : 45 - 65 % b in 30 min ; ( b = 90 % acetonitrile , 10 % water + 0 . 1 % tfa ); t r = 17 . 5 min ; esi - ms : 1056 . 1 [ m + tfa − h + 2na ] + ; 1050 . 3 [ m + tfa + k ] + ; 1034 . 4 [ m + tfa + na ] + ; 936 . 5 [ m + k ] + ; 920 . 6 [ m + na ] + ; 898 . 4 [ m + h ] + ; 840 . 5 [ m - acetone + h ] + . sgnc 15 : esi - ms : 1840 . 7 [ 2m ( 1 * 13 c )+ tfa + k ] + ; 1710 . 6 [ 2m ( 1 * 13 c )+ na ] + ; 1687 . 5 [ 2m + h ] + ; 1002 . 1 [ n + tfa − h + 2na ] + ; 996 . 4 [ m + tfa + k ] + ; 980 . 3 [ m + tfa + na ] + ; 882 . 5 [ m + k ] + ; 866 . 6 [ m + na ] + ; 844 . 4 [ m + h ] + ; 786 . 5 [ m - acetone + h ] + . t r = 3 . 75 min ( hplc - ms , 30 - 70 % b in 15 min ; b = mecn + 0 . 1 % tfa ). c [- d - trp - lys - 2 - nal - z1 - phe -] ( sgnc 16 ): semi - preparative hplc purification : gradient : 45 - 65 % b in 30 min ; ( b = 90 % acetonitrile , 10 % water , + 0 . 1 % tfa ) esi - ms : 1839 . 6 [ 2m + tfa + k ] + ; 1709 . 6 [ 2m + na ] + ; 1687 . 6 [ 2m + h ] + ; 1002 . 1 [ m + tfa − h + 2na ] + ; 996 . 4 [ m + tfa + k ] + ; 980 . 4 [ m + tfa + na ] + ; 882 . 5 [ m + k ] + ; 866 . 6 [ m + na ] + ; 844 . 4 [ m + h ] + ; 786 . 5 [ m - acetone + h ] + . general procedure for anchoring of the first fmoc - protected amino acid on tcp resin ( gp 2 ): the unloaded dry tcp resin in a syringe ( exact weight known ), completed with a frit , was swelled in nmp ( 30 min ). the resin was filtered off , before a solution (˜ 0 . 125 m ) of 1 . 2 equiv of fmoc - protected amino acid ( with respect of the theoretical capacity of the tcp resin ) and 2 . 5 equiv dipea ( with respect to the quantity of fmoc - protected amino acid used ) in dcm ( abs .) was added . after shaking for 1 h at rt the capping solution ( 20 % dipea in meoh ) is added . after 15 min the resin is filtered off , and the resin is washed with dcm ( 3 × 3 min ), dmf ( 3 × 3 min ), and meoh ( 3 × 3 min ), and dried overnight under vacuo . subsequently the exact weight of the dried resin was determined , and the loading of the resin was calculated : c [ mol / g ]=( m total − m resin )/{ mg xaa − 36 . 461 )× m total mg xaa molar weight of the fmoc - protected amino acid ( xaa ) the preloaded resin was swelled for 30 min in nmp . the fmoc - protecting group of the amino acid attached to the resin is removed by treating the resin with a 20 % piperidine solution in dmf ( 3 × 10 min ). the resin is filtered off and washed with nmp ( 5 × 3 min ), before a solution of the next fmoc - protected amino acid ( 3 equiv ), or fmoc - z - oh ( that is in the following examples either fmoc - z1 - oh or fmoc - z2 - oh ) ( 1 . 5 equiv ), hatu and hoat ( l . a . carpino , a . el - faham , f . albericio , tetrahedron lett . 1994 , 35 , 2279 - 2282 ; l . a . carpino , a . el - faham , c . a . minor , f . albericio , j . chem . soc . chem . commun . 1994 , 2 , 201 - 203 ) ( 1 . 5 equiv each for saa coupling , 3 equiv each for other amino acids ), and 2 , 4 , 6 - collidine ( 15 equiv / 30 equiv ) in nmp ( for coupling with fmoc - protected z1 dmf , was used as solvent ) is added . after 2 - 3 h reaction is complete ( monitoring by esi - hplc - ms ). the resin is washed with nmp ( 5 × 3 min ), prior to the subsequent fmoc - deprotection and coupling steps . after coupling of the last amino acid , and subsequent fmoc - deprotection , the resin is washed with nmp ( 3 × 3 min ), ch 2 cl 2 ( 1 × 3 min ), and dried overnight in vacuo . the compounds are cleaved from the dry resin using 20 % hfip solution in ch 2 cl 2 ( 3 × 10 min )( r . bollhagen , m . schmiedberger , k . barlos , e . grell , j . chem . soc ., chem . commun . 1994 , 22 , 2559 - 2560 ). the crude peptides were purified via rp - hplc . in all cases peptide ( hplc ) purity was & gt ; 99 %. the fmoc - deprotected linear peptide is dissolved in dmf ( 0 . 1 mm ), and dppa ( 3 equiv ) and nahco 3 ( 11 equiv ) are added ( t . shioiri , k . ninomiya , s . yamada , j . am . chem . soc . 1972 , 94 , 6203 - 6205 ; s . f . brady , w . j . paleveda , b . h . arison , r . m . freidinger , r . f . nutt , d . f . veber , in 8 th am . pept . symp . ( eds . : v . j . hruby , d . h . rich ), pierce chem . co ., rockford , ill ., usa , tuscon , ariz ., usa , 1983 , pp . 127 - 130 ). after 12 h reaction is usually complete . after side chain deprotection ( c . f . gp 5 ) the cyclic peptides were precipitated with et 2 o and purified via rp - hplc , and finally lyophilized from water or dioxane . the peptide is dissolved in 3 % hydrazine / dmf solution , stirred for 10 - 15 min , and the solvent is evaporated . this procedure is repeated 3 times . synthesis of the first library of somatostatin analogues sga , sgb , sge , sgf according to gp 2 , tcp resin ( 2 . 008 g ) was loaded with fmoc - phe - oh ( 933 . 6 mg , 2 . 4098 mmol ) and dipea ( 1 . 05 ml , 6 . 025 mmol ) in 16 ml dcm . the loading was c = 0 . 677 mol / g resin . similar to gp 2 ( instead of dipea 2 , 4 , 6 - collidine was used as base ), tcp resin ( 1 . 300 g ) was loaded with fmoc - tyr - oh ( 629 mg , 1 . 56 mmol ) and 2 , 4 , 6 - collidine ( 2 . 77 ml ) in 10 ml dcm . the loading was c = 0 . 477 mmol / g resin . synthesis of sga and sgb : according to gp 3 , sga and sgb were synthesized parallel in the same syringe (( 2 ml ), 137 mg of the fmoc - phe - oh loaded tcp resin ). coupling was verified by a sample cleavage of the dipeptide fmoc - z1 - phe - oh : esi - ms : 1205 . 6 [ 2m - h + na + k ] + ; 1167 . 2 [ 2m + na ] + ; 1144 . 9 [ 2m + h ] + ; 611 . 4 [ m + k ] + ; 595 . 4 [ m + na ] + ; 573 . 3 [ m + h ] + ; t r = 25 . 04 min ( anal . hplc , 20 - 80 % b in 30 min ). the first coupling was done with fmoc - protected z1 ( 60 . 8 mg ), hoat ( 18 . 9 mg ), hatu ( 53 mg ) and 2 , 4 , 6 - collidine ( 184 μl ). subsequentely fmoc - lys ( ivdde )- oh ( 133 mg ) ( hoat ( 31 . 6 mg ), hatu ( 88 . 2 mg ), 2 , 4 , 6 - collidine ( 307 μl )) was coupled . the resin was split into two equal parts — one for the synthesis of sga , one for the synthesis of sgb . coupling with fmoc - l - trp - oh , or fmoc - d - trp - oh ( 59 . 4 mg of l -, or d - trp respectively ) ( hoat ( 18 . 9 mg ), hatu ( 52 . 9 mg ), 2 , 4 , 6 - collidine ( 184 μl )) respectively , and subsequent washing fmoc - deprotection and cleavage steps ( gp 3 ) yielded the linear , ivdde - protected precursors of compounds sga and sgb , characterized by hplc - ms : h 2 n - trp - lys ( ivdde )- z1 - phe - oh ( precursor to sga ): 909 . 5 [ m + k ] + ; 893 . 5 [ m + na ] + ; 871 . 5 [ m + h ] + . 813 . 5 ; [ m - acetone + h ] + ; t r = 11 . 41 min ( hplc - ms , 30 - 90 % b in 15 min ), t r = 14 . 41 min ( anal . hplc , 30 - 90 % 1b in 15 min ). h 2 n - d trp - lys ( ivdde )- z1 - phe - oh ( precursor to sgb ): 915 . 5 [ m − h + 2na ] + ; 909 . 5 [ m + k ] + ; 893 . 5 [ m + na ] + ; 871 . 5 [ m + h ] + . 813 . 5 ; [ m - acetone + h ] + ; t r = 11 . 31 min ( hplc - ms , 30 - 90 % b in 15 min ). the precursors to sga and sgb were cyclizied according to gp 4 ( dppa ( 37 . 9 μl ), nahco 3 ( 25 mg ), dmf ( 12 ml )) to yield the protected cyclic precursors : cyclo [- trp - lys ( ivdde )- z1 - phe -] ( precursor of sga ): esi - ms : 1729 . 0 [ 2m + na ] + ; 890 . 6 [ m + k ] + ; 875 . 7 [ m + na ] + ; 853 . 6 [ m + h ] + ; 795 . 6 [ m - acetone + h ] + ; t r = 19 . 19 min ( anal . hplc , 30 - 90 % b ). cyclo [- d - trp - lys ( ivdde )- z1 - phe -] ( precursor of sgb ): esi - ms : 1743 . 1 [ 2m + k ] + ; 1729 . 0 [ 2m + na ] + ; 1705 . 6 [ 2m + h ] + ; 897 . 6 [ m − h + 2na ] + ; 891 . 7 [ m + k ] + ; 875 . 7 [ m + na ] + ; 853 . 6 [ m + h ] + ; 795 . 6 [ m - acetone + h ] + ; t r = 21 . 32 min ( anal . hplc , 10 - 60 % b ). ivdde - deprotection according to gp 5 , purification via rp - hplc ( semipreparative ; gradient : 35 - 55 % b in 30 min ( sga ), and 20 - 60 % b in 30 min ( sgb ), respectively ; ( b = 90 % mecn , 10 % h 2 o , + 0 . 1 % tfa )), and subsequently lyophilization yielded the compounds sga ( 10 mg , 33 %) and sgb ( 10 . 7 mg , 36 %) as white , fluffy powder . sga : esi - ms : 1445 . 1 [ 2m + tfa + k ] + ; 1331 . 3 [ 2m + k ] + ; 1315 . 2 [ 2m + na ] + ; 1293 . 2 [ 2m + h ] + ; 799 . 1 [ m + tfa + k ] + ; 783 . 1 [+ tfa + na ] + ; 685 . 2 [ m + k ] + ; 669 . 4 [ m + na ] + ; 647 . 2 [ m + h ] + ; 589 . 2 [ m - acetone + h ] + ; t r = 4 . 78 min ( hplc - ms , 30 - 70 % b in 15 min ; b = mecn + 0 . 1 % tfa ). sgb : esi - ms : 1445 . 2 [ 2m + tfa + k ] + ; 1331 . 4 [ 2m + k ] + ; 1315 . 3 [ 2m + na ] + ; 1293 . 3 [ 2m + h ] + ; 799 . 1 [ m + tfa + k ] + ; 669 . 3 [ m + na ] + ; 647 . 2 [ m + h ] + ; 589 . 3 [ m - acetone + h ] + ; t r = 5 . 74 min ( hplc - ms , 30 - 70 % b in 15 min ; b = mecn + 0 . 1 % tfa ). synthesis of sge and sgf : according to gp 3 , sge and sgf were synthesized parallel in the same syringe ( 2 ml ), 190 mg of the fmoc - tyr - oh loaded tcp resin ). the first coupling was done with fmoc - protected z1 ( 58 mg ), hoat ( 18 . 5 mg ), hatu ( 52 mg ) and 2 , 4 , 6 - collidine ( 180 μl ). coupling was verified by a sample cleavage : some beads were fished out , and the dipeptide fmoc - z1 - tyr - oh cleaved from those beads in an eppendorf cap according to gp 3 . characterization : esi - ms : 1237 . 6 [ 2m − h + na + k ] + ; 1221 . 4 [ 2m − h + 2na ] + ; 1215 . 4 [ 2m + k ] + ; 1199 . 2 [ 2m + na ] + ; 921 . 6 [( 3m + 2k )/ 2 ] 2 + ; 913 . 7 [( 3m + na + k )/ 2 ] 2 + ; 633 . 4 [ m − h + 2na ] + ; 627 . 4 [ m + k ] + ; 611 . 4 [ m + na ] + ; 589 . 3 [ m + h ] + ; t r = 21 . 68 min ( anal . hplc , 20 - 80 % b in 30 min ). according to gp 3 fmoc - lys ( ivdde )- oh ( 130 mg ) ( hoat ( 31 mg ), hatu ( 86 mg ), 2 , 4 , 6 - collidine ( 300 μl )) was coupled . the resin was split into two equal parts — one for the synthesis of sge , one for the synthesis of sgf . coupling with fmoc - l - trp - oh , or fmoc - d - trp - oh ( 58 mg of l -, or d - trp respectively ) ( hoat ( 18 . 5 mg ), hatu ( 52 mg ), 2 , 4 , 6 - collidine ( 180 μl )) respectively , and subsequent washing fmoc - deprotection and cleavage steps ( gp 3 ) yielded the linear , ivdde - protected precursors of compounds sge and sgf . the precursors to sge and sgf were cyclizied according to gp 4 ( dppa ( 38 μl ), nahco 3 ( 25 mg ), dmf ( 12 ml )) to yield the protected cyclic precursors : cyclo [- trp - lys ( ivdde )- z1 - tyr -] ( precursor of sge ): esi - ms : 1759 . 9 [ 2m + na ] + ; 906 . 7 [ m + k ] + ; 891 . 6 [ m + na ] + ; 869 . 6 [ m + h ] + ; 811 . 6 [ m - acetone + h ] + ; t r = 11 . 89 min ( anal . hplc , 30 - 90 % b , 30 min ). cyclo [- d - trp - lys ( ivdde )- z1 - tyr -] ( precursor of sgf ): esi - ms : 906 . 7 [ m + k ] + ; 891 . 6 [ m + na ] + ; 869 . 6 [ m + h ] + ; 811 . 6 [ m - acetone + h ] + ; t r = 11 . 74 min ( anal . hplc , 30 - 90 % b , 30 min ). ivdde - deprotection according to gp 5 , purification via rp - hplc ( semipreparative ; gradient : 20 - 60 % b in 30 min ( sge ), and 25 - 60 % b in 30 min ( sgf ), respectively ; ( b = 90 % mecn , 10 % h2o , + 0 . 1 % tfa )), and subsequently lyophilization yielded the compounds sge and sgf as white , fluffy powder . sge : esi - ms : 799 . 2 [ m + tfa + na ] + ; 685 . 4 [ m + na ] + ; 663 . 2 [ m + h ] + ; 605 . 3 [ m - acetone + h ] + ; t r = 15 . 46 min ( anal . hplc , 20 - 60 % b in 15 min ; b = mecn + 0 . 1 % tfa ). sgf : esi - ms : 1363 . 3 [ 2m + k ] + ; 1347 . 1 [ 2m + na ] + ; 1325 . 2 [ 2m + h ] + ; 685 . 4 [ m + na ] + ; 663 . 3 [ m + h ] + ; 605 . 3 [ m - acetone + h ] + ; t r = 20 . 19 min ( anal . hplc , 10 - 60 % b in 15 min ; b = mecn + 0 . 1 % tfa ). sgnc 7 was synthesized according to gp 3 ( 2 ml , 66 . 8 mg of the fmoc - tyr - oh loaded tcp resin ). coupling of the fmoc - protected z1 was verified by a sample cleavage : some beads were fished out , and the dipeptide fmoc - z1 - tyr - oh cleaved from those beads in an eppendorf cap according to gp 3 . esi - ms of that sample cleavage : 1803 . 0 [ 3m + k ] + ; 1786 . 9 [ 3m + na ] + ; 1237 . 3 [ 2m − h + na + k ] + ; 1221 . 4 [ 2m − h + 2na ] + ; 1215 . 3 [ 2m + k ] + ; 1199 . 1 [ 2m + na ] + ; 633 . 4 [ m − h + 2na ] + ; 627 . 4 [ m + k ] + ; 611 . 3 [ m + na ] + ; 589 . 1 [ m + h ] + . coupling of the fmoc - thr ( otrt )- oh , was verified by a sample cleavage : some beads were fished out , and the tripeptide fmoc - thr ( otrt )- z1 - tyr - oh cleaved from those beads in an eppendorf cap according to gp 3 . esi - ms of that sample cleavage : 1885 . 3 [ 2 m + na ] + ; 1863 . 0 [ 2m + h ] + ; 976 . 4 [ m − h + 2na ] + ; 970 . 4 [ m + k ] + ; 954 . 4 [ m + na ] + ; 932 . 4 [ m + h ] + ; 243 . 2 [ trt ]+. according to gp 3 fmoc - nle - oh , and fmoc - d - trp - oh were coupled consecutively . subsequent cleavage from the resin ( gp 3 ), cyclization according to gp 4 , and purification via rp - hplc ( semipreparative ; gradient : 50 - 100 % b in 30 min ), yielded the sgnc 7 as a white fluffy powder : esi - ms : 1998 . 7 [ 2m + li ] + ; 1143 . 4 [ m − h + tfa + k ] + ; 1127 . 5 [ m − h + tfa + na ] + ; 1029 . 5 [ m + k ] + ; 1013 . 5 [ m + na ] + ; 997 . 7 [ m + li ] + ; 990 . 6 [ m + h ] + ; 771 . 7 [ m − trt + na ] + ; 749 . 4 [ m − trt + h ] + ; 691 . 4 [ m − trt - acetone + h ] + ; 243 . 2 [ trt ] + . t r = 21 . 05 min ( hplc - ms , 30 - 70 % b in 15 min ). sgnc 18 was synthesized according to gp 3 ( 2 ml , 52 . 4 mg of the fmoc - phe - oh loaded tcp resin ). coupling of the fmoc - protected z2 was verified by a sample cleavage : some beads were fished out , and the dipeptide fmoc - z2 - phe - oh cleaved from those beads in an eppendorf cap according to gp 3 . esi - ms of that sample cleavage : 1829 . 8 [ 3m + na ] + ; 1227 . 2 [ 2m + na ] + ; 1205 . 0 [ 2m + h ] + ; 663 . 4 [ m − h + na + k ] + ; 647 . 4 [ m − h + 2na ] + ; 641 . 3 [ m + k ] + ; 625 . 4 [ m + na ] + ; 603 . 2 [ m + h ] + ; 551 . 3 [ m - acetone + li ] + ; 545 . 1 [ m - acetone + h ] + . according to gp 3 fmoc - thr ( otrt )- oh , fmoc - lys ( ivdde )- oh , and fmoc - d - trp - oh were coupled consecutively . subsequent cleavage from the resin ( gp 3 ), cyclization according to gp 4 , the ivdde cyclic precursor cyclo [- d - trp - lys ( ivdde )- thr ( otrt )- z2 - phe -]: esi - ms : 1264 . 8 [ m + k ] + ; 1248 . 9 [ m + na ] + ; 1226 . 5 [ m + h ] + ; 1006 . 8 [ m − trt + na ] + ; 984 . 6 [ m − trt + h ] + ; 926 . 7 [ m − trt - acetone + h ] + ; 243 . 2 [ trt ] + . subsequent ivdde deprotection according to gp 5 , and purification via rp - hplc ( semipreparative ; gradient : 50 - 65 % b in 30 min ), yielded the sgnc 18 as a white fluffy powder : esi - ms : 1058 . 3 [ m + k ] + ; 1042 . 5 [ m + na ] + ; 1020 . 2 [ m + h ] + ; 800 . 6 [ m − trt + na ] + ; 778 . 4 [ m − trt + h ] + ; 720 . 4 [ m − trt - acetone + h ] + ; 243 . 2 [ trt ] + . t r = 15 . 18 min ( hplc - ms , 30 - 70 % b in 15 min ). sgnc 20 was synthesized according to gp 3 ( 2 ml , 52 . 4 mg of the fmoc - phe - oh loaded tcp resin ). coupling of the fmoc - protected z2 was verified by a sample cleavage : some beads were fished out , and the dipeptide fmoc - z2 - phe - oh cleaved from those beads in an eppendorf cap according to gp 3 . esi - ms of that sample cleavage : 1829 . 8 [ 3m + na ] + ; 1227 . 2 [ 2m + na ] + ; 1205 . 0 [ 2m + h ] + ; 663 . 4 [ m − h + na + k ] + ; 647 . 4 [ m − h + 2na ] + ; 641 . 3 [ m + k ] + ; 625 . 4 [ m + na ] + ; 603 . 2 [ m + h ] + ; 551 . 3 [ m - acetone + li ] + ; 545 . 1 [ m - acetone + h ] + . according to gp 3 fmoc - bip - oh , fmoc - lys ( ivdde )- oh , and fmoc - d - trp - oh were coupled consecutively . subsequent cleavage from the resin ( gp 3 ), cyclization according to gp 4 , ivdde - deprotection and purification via rp - hplc ( semipreparative ; gradient : 50 - 65 % b in 30 min ), yielded sgnc 20 as a white fluffy powder : esi - ms : 938 . 9 [ m + k ] + ; 922 . 9 [ m + na ] + ; 900 . 7 [ m + h ] + ; 842 . 7 [ m - acetone + h ] + . t r = 13 . 10 min ( hplc - ms , 30 - 70 % b in 15 min ). sgnc 38 was synthesized ( 2 ml , 66 . 8 mg of the fmoc - tyr - oh loaded tcp resin ), according to gp 3 . coupling of the fmoc - protected z1 was verified by a sample cleavage : some beads were fished out , and the dipeptide fmoc - z1 - tyr - oh cleaved from those beads in an eppendorf cap according to gp 3 . esi - ms of that sample cleavage : 1803 . 0 [ 3m + k ] + ; 1786 . 9 [ 3m + na ] + ; 1237 . 3 [ 2m − h + na + k ] + ; 1221 . 4 [ 2m − h + 2na ] + ; 1215 . 3 [ 2m + k ] + ; 1199 . 1 [ 2m + na ] + ; 633 . 4 [ m − h + 2na ] + ; 627 . 4 [ m + k ] + ; 611 . 3 [ m + na ] + ; 589 . 1 [ m + h ] + . according to gp 3 fmoc - thr ( obzl )- oh , fmoc - lys ( ivdde )- oh , and fmoc - d - trp - oh were coupled consecutively . subsequent cleavage from the resin ( gp 3 ), cyclization according to gp 4 , ivdde deprotection according to gp 5 , and purification via rp - hplc ( semipreparative ; gradient : 35 - 50 % b in 30 min ), yielded the sgnc 38 as a white fluffy powder : esi - ms : 892 . 2 [ m + k ] + ; 876 . 5 [ m + na ] + ; 860 . 9 [ m + li ] + ; 854 . 4 [ m + h ] + ; 796 . 3 [ m - acetone + h ] + ; t r = 8 . 82 min ( hplc - ms , 30 - 90 % b in 15 min ). sgnc 51 was synthesized ( 2 ml , 66 . 8 mg of the fmoc - tyr - oh loaded tcp resin ), according to gp 3 . coupling of the fmoc - protected z1 was verified by a sample cleavage : some beads were fished out , and the dipeptide fmoc - z1 - tyr - oh cleaved from those beads in an eppendorf cap according to gp 3 . esi - ms of that sample cleavage : 1803 . 0 [ 3m + k ] + ; 1786 . 9 [ 3m + na ] + ; 1237 . 3 [ 2m − h + na + k ] + ; 1221 . 4 [ 2m − h + 2na ] + ; 1215 . 3 [ 2m + k ] + ; 1199 . 1 [ 2m + na ] + ; 633 . 4 [ m − h + 2na ] + ; 627 . 4 [ m + k ] + ; 611 . 3 [ m + na ] + ; 589 . 1 [ m + h ] + . subsequent coupling of fmoc - tyr ( obzl )- oh ( gp 3 ) was verified by a sample cleavage esi - ms : 1742 . 9 [ 2m − h + na + k ] + ; 1727 . 3 [ 2m − h + 2na ] + ; 1722 . 2 [ 2m ( 1 * 13 c )+ k ] + ; 1706 . 3 [ 2m ( 1 * 13 c )+ na ] + ; 1705 . 3 [ 2m + na ] + ; 1683 . 2 [ 2m + h ] + ; 902 . 4 [ m − h + na + k ] + ; 886 . 4 [ m − h + 2na ] + ; 880 . 4 [ m + k ] + ; 864 . 5 [ m + na ] + ; 842 . 3 [ m + h ] + ; 784 . 4 [ m - acetone + h ] + . according to gp 3 fmoc - lys ( ivdde )- oh , and fmoc - d - trp - oh were coupled consecutively . subsequent cleavage from the resin ( gp 3 ), and cyclization according to gp 4 , yielded the cyclic precursor cyclo [- d - trp - lys ( ivdde )- tyr ( obzl )- z1 - tyr -]: esi - ms : 1177 . 8 [ m + k ] + ; 1161 . 7 [ m + na ] + ; 1139 . 7 [ m + h ] + ; 1081 . 7 [ m - acetone + h ] + . ivdde deprotection according to gp 5 , and purification via rp - hplc ( semipreparative ; gradient : 40 - 65 % b in 30 min ), yielded the sgnc 51 as a white fluffy powder : esi - ms : 1926 . 5 [ 2m ( 1 * 13 c )− h + na + k ] + ; 1903 . 9 [ 2m + k ] + ; 1888 . 9 [ 2m ( 1 * 13 c )+ na ] + ; 1866 . 9 [ 2m ( 1 * 13 c )+ h ] + ; 971 . 8 [ m + k ] + ; 955 . 7 [ m + na ] + ; 933 . 6 [ m + h ] + ; 883 . 7 [ m - acetone + li ] + ; 875 . 7 [ m - acetone + h ] + . t r = 11 . 43 min ( hplc - ms , 30 - 90 % b in 15 min ). sgnc 50 was synthesized ( 2 ml , 66 . 8 mg of the fmoc - tyr - oh loaded tcp resin ), according to gp 3 . coupling of the fmoc - protected z1 was verified by a sample cleavage : some beads were fished out , and the dipeptide fmoc - z1 - tyr - oh cleaved from those beads in an eppendorf cap according to gp 3 . esi - ms of that sample cleavage : 1803 . 0 [ 3m + k ] + ; 1786 . 9 [ 3m + na ] + ; 1237 . 3 [ 2m − h + na + k ] + ; 1221 . 4 [ 2m − h + 2na ] + ; 1215 . 3 [ 2m + k ] + ; 1199 . 1 [ 2m + na ] + ; 633 . 4 [ m − h + 2na ] + ; 627 . 4 [ m + k ] + ; 611 . 3 [ m + na ] + ; 589 . 1 [ m + h ] + . subsequent coupling of fmoc - thr ( otrt )- oh ( gp 3 ) was verified by a sample cleavage esi - ms : 1885 . 3 [ 2m + k ] + ; 992 . 6 [ m − h + na + k ] + ; 976 . 4 [ m − h + 2na ] + ; 970 . 4 [ m + k ] + ; 954 . 4 [ m + na ] + ; 932 . 6 [ m + h ] + ; 734 . 3 [ m − trt − h + 2na ] + ; 726 . 0 [ m − trt + k ] + ; 712 . 4 [ m − trt + na ] + ; 690 . 3 [ m − trt + h ] + ; 678 . 7 [ m − trt - acetone + k ] + ; 663 . 5 [ m − trt - acetone + na ] + ; 632 . 3 [ m − trt - acetone + h ] + ; 243 . 2 [ trt ] + . according to gp 3 fmoc - lys ( ivdde )- oh , and fmoc - d - bta - oh were coupled consecutively . subsequent cleavage from the resin ( gp 3 ), and cyclization according to gp 4 , yielded the cyclic precursor cyclo [- d - bta - lys ( ivdde )- thr ( otrt )- z1 - tyr -]: esi - ms : 1269 . 0 [ m ( 1 * 13 c )+ k ] + ; 1251 . 8 [ m + na ] + ; 1230 . 6 [ m ( 1 * 13 c )+ h ] + ; 1009 . 8 [ m − trt + na ] + ; 987 . 6 [ m − trt + h ] + ; 243 . 2 [ trt ] + . ivdde deprotection according to gp 5 , and purification via rp - hplc ( semipreparative ; gradient : 40 - 65 % b in 30 min ), yielded the sgnc 50 as a white fluffy powder : esi - ms : 1061 . 6 [ m + k ] + ; 1045 . 6 [ m + na ] + ; 1029 . 8 [ m + li ] + ; 1023 . 5 [ m + h ] + ; 842 . 6 [ m − trt − h + na + k ] + ; 828 . 5 [ m − trt − h + 2na ] + ; 781 . 5 [ m − trt + h ] + ; 723 . 5 [ m − trt - acetone + h ] + , 243 . 2 [ trt ] + . t r = 12 . 29 min ( hplc - ms , 30 - 90 % b in 15 min ). sgnc 8 was synthesized ( 2 ml , 66 . 8 mg of the fmoc - tyr - oh loaded tcp resin ), according to gp 3 . coupling of the fmoc - protected z1 was verified by a sample cleavage : some beads were fished out , and the dipeptide fmoc - z1 - tyr - oh cleaved from those beads in an eppendorf cap according to gp 3 . esi - ms of that sample cleavage : 1803 . 0 [ 3m + k ] + ; 1786 . 9 [ 3m + na ] + ; 1237 . 3 [ 2m − h + na + k ] + ; 1221 . 4 [ 2m − h + 2na ] + ; 1215 . 3 [ 2m + k ] + ; 1199 . 1 [ 2m + na ] + ; 633 . 4 [ m − h + 2na ] + ; 627 . 4 [ m + k ] + ; 611 . 3 [ m + na ] + ; 589 . 1 [ m + h ] + . subsequent coupling of fmoc - thr ( otrt )- oh ( gp 3 ) was verified by a sample cleavage esi - ms : 1885 . 3 [ 2m + k ] + ; 992 . 6 [ m − h + na + k ] + ; 976 . 4 [ m − h + 2na ] + ; 970 . 4 [ m + k ] + ; 954 . 4 [ m + na ] + ; 932 . 6 [ m + h ] + ; 734 . 3 [ m − trt − h + 2na ] + ; 726 . 0 [ m − trt + k ] + ; 712 . 4 [ m − trt + na ] + ; 690 . 3 [ m − trt + h ] + ; 678 . 7 [ m − trt - acetone + k ] + ; 663 . 5 [ m − trt - acetone + na ] + ; 632 . 3 [ m − trt - acetone + h ] + ; 243 . 2 [ trt ] + . according to gp 3 fmoc - lys ( ivdde )- oh , and fmoc - l - bta - oh were coupled consecutively . subsequent cleavage from the resin ( gp 3 ), and cyclization according to gp 4 , yielded the cyclic precursor cyclo [- bta - lys ( ivdde )- thr ( otrt )- z1 - tyr -]: esi - ms : 1267 . 8 [ m + k ] + ; 1251 . 8 [ m + na ] + ; 1229 . 3 [ m + h ] + ; 1009 . 7 [ m - trt + na ] + ; 987 . 6 [ m − trt + h ] + ; 929 . 7 [ m − trt - acetone + h ] + ; 243 . 2 [ trt ] + . ivdde deprotection according to gp 5 , and purification via rp - hplc ( semipreparative ; gradient : 40 - 65 % b in 30 min ), yielded the sgnc 8 as a white fluffy , powder : esi - ms : 1061 . 6 [ m + k ] + ; 1053 . 6 [ m − h + li + na ] + ; 1045 . 6 [ m + na ] + ; 1029 . 5 [ m + li ] + ; 1023 . 5 [ m + h ] + ; 842 . 6 [ m − trt − h + na + k ] + ; 826 . 4 [ m − trt − h + 2na ] + ; 781 . 4 [ m − trt + h ] + ; 723 . 4 [ m − trt - acetone + h ] + ; 243 . 2 [ trt ] + . t r = 12 . 29 min ( hplc - ms , 30 - 90 % b in 15 min ). sgnc 10 was synthesized ( 2 ml , 66 . 8 mg of the fmoc - tyr - oh loaded tcp resin ), according to gp 3 . coupling of the fmoc - protected z1 was verified by a sample cleavage : some beads were fished out , and the dipeptide fmoc - z1 - tyr - oh cleaved from those beads in an eppendorf cap according to gp 3 . esi - ms of that sample cleavage : 1803 . 0 [ 3m + k ] + ; 1786 . 9 [ 3m + na ] + ; 1237 . 3 [ 2m − h + na + k ] + ; 1221 . 4 [ 2m − h + 2na ] + ; 1215 . 3 [ 2m + k ] + ; 1199 . 1 [ 2m + na ] + ; 633 . 4 [ m − h + 2na ] + ; 627 . 4 [ m + k ] + ; 611 . 3 [ m + na ] + ; 589 . 1 [ m + h ] + . subsequent coupling of fmoc - thr ( otrt )- oh ( gp 3 ) was verified by a sample cleavage esi - ms : 1885 . 3 [ 2m + k ] + ; 992 . 6 [ m − h + na + k ] + ; 976 . 4 [ m − h + 2na ] + ; 970 . 4 [ m + k ] + ; 954 . 4 [ m + na ] + ; 932 . 6 [ m + h ] + ; 734 . 3 [ m − trt − h + 2na ] + ; 726 . 0 [ m − trt + k ] + ; 712 . 4 [ m − trt + na ] + ; 690 . 3 [ m − trt + h ] + ; 678 . 7 [ m − trt - acetone + k ] + ; 663 . 5 [ m − trt - acetone + na ] + ; 632 . 3 [ m − trt - acetone + h ] + ; 243 . 2 [ trt ] + . according to gp 3 fmoc - lys ( ivdde )- oh , and fmoc - 2 - nal - oh were coupled consecutively . subsequent cleavage from the resin ( gp 3 ), and cyclization according to gp 4 , yielded the cyclic precursor cyclo [- 2 - nal - lys ( ivdde )- thr ( otrt )- z1 - tyr -]: esi - ms : 1261 . 7 [ m + k ] + ; 1245 . 6 [ m + na ] + ; 1230 . 6 [ m ( 1 * 13 c )+ li ] + ; 1224 . 1 [ m ( 1 * 13 c )+ h ] + ; 1026 . 6 [ m − trt − h + 2na ] + ; 1018 . 7 [ m − trt + k ] + ; 1003 . 6 [ m − trt + na ] + ; 981 . 5 [ m − trt + h ] + ; 923 . 5 [ m − trt - acetone + h ] + ; 243 . 2 [ trt ]+. ivdde deprotection according to gp 5 , and purification via rp - hplc ( semipreparative ; gradient : 40 - 63 % b in 30 min ), yielded the sgnc 10 as a white fluffy powder : esi - ms : 1175 . 3 [ m + tfa − h + 2na ] + ; 1169 . 4 [ m + tfa + k ] + ; 1153 . 3 [ m + tfa + na ] + ; 1056 . 6 [ m ( 1 * 13 c )+ k ] + ; 1039 . 6 [ m + na ] + ; 1017 . 3 [ m + h ] + ; 775 . 5 [ m − trt + h ] + ; 717 . 4 [ m − trt - acetone + h ] + ; 243 . 2 [ trt ] + . t r = 14 . 46 min ( hplc - ms , 30 - 70 % b in 15 min ). 80 mg of a tcp resin loaded with fmoc - d - asp - odmab ( i . e . fmoc - d - asp bound to the resin through the acid group of the side chain ) wherein the loading corresponds to 0 . 037 mmol / g resin were weighed into a syringe . before the 1 st coupling , the acid function was deprotected 3 times with 3 % hydrazine in nmp solution followed by washing with 5 % dipea in nmp ( 2 ×) and nmp ( 5 ×). with agitation , the acid was preactivated with a solution consisting of 0 . 6 equiv . each of hatu , hoat and 30 equiv . of collidine in 300 μl of nmp for 30 min . with agitation before adding 3 equiv . of 1 -( aminomethyl ) naphthaline . after 2 hrs ., the coupling solution was discarded , the resin washed with nmp ( 3 ×) and preactivated once more with 0 . 6 equiv . of hatu , hoat and 30 equiv . of collidine in 300 μl of nmp for 30 minutes before adding 3 equiv . of the 1 -( aminomethyl ) naphthalene . after 2 hours , the coupling solution was discarded and the resin washed 5 × with nmp . after that , synthesis was carried out analogously to the synthesis of the above cyclopeptides described in examples 2 to 4 . a few resin beads were taken and treated with a few drops of a 20 vol .-% hfip in dcm solution in an eppendorf - cap for 30 minutes . the amino acid thus separated from the resin : was characterised through an esi mass spectrum : esi - ms : 1010 . 8 [ 2m + na ] + ; 989 . 5 [ 2m + h ] + ; 517 . 2 [ m + na ] + ; 495 . 4 [ m + h ] + . biological evaluation : apoptosis - inducing effect both in multi - resistant and non - resistant hepatoma cancer cell lines rat hepatoma cells were cultivated in a f 12 medium ( gibcobrl ), to which 5 % of foetal calf serum had been added , in a atmosphere saturated with humidity (& gt ; 95 %) and having a co 2 content of 8 % in air . the cell line named “ klon 2 ” was isolated by venetianer et al . ( cytogentc . cell . genet 28 : 280 - 283 , 1980 ). the cell line 2 ( 10 × 80 ) t1 is a sub - clone of klon 2 having a moderate multi - drug resistance 8 ( pirity , hever - szabo and venetianer , cytotechnology 19 : 207 - 214 , 1996 ). the degree of resistance of cell line 2 ( 10 × 80 ) was determined by a niagara blue exclusion test , the cells being exposed to different concentrations of the following cytostatic agents for 72 hrs . the following ic 50 values were determined for the cell line : 5 . 2 for vinblastine , 9 . 4 for doxorubicine , 11 . 4 for puromycin , 7 . 7 for actinomycin d and for colchicine ( pririty et al ., cytotechnology 19 : 207 - 214 , 1996 ). the xtt / pms assay ( scuderio et al ., cancer res . 48 : 4827 - 4833 , 1988 ; roehm et al ., j . immun . methods 142 : 257 - 265 , 1991 ) was utilised to determine the cytotoxicity of the compounds . for this purpose , the viability of the sensitive cell line klon 2 was tested in comparison with that of the multi - drug resistant cell line klon 2 ( 10 × 80 ). an identical number of cells was applied to a 96 cell culture plate . after one day , the cells were incubated with different concentrations of the compounds to be tested , compound tt - 232 serving as internal control . the cell viability was determined by triple determination for each concentration by means of the xtt / pms dye test ( scuderio et al ., cancer res . 48 : 4827 - 4833 , 1988 ; roehm et al ., j . immun . methods 142 : 257 - 265 , 1991 ). after an incubation time of 72 hrs . the absorption of treated cells at 450 nm in relation to cells not treated with dye was used as a viability standard . the concentrations of the test compound having 50 % viability ( ic 50 ) was determined by double determination in two independent experiments . multidrug resistant drug sensitive activity [ μm ] cells cells c [- tyr - d - trp - lys - thr ( otrt )- z1 -] 25 31 ( th of example 2 ) c [- tyr - trp - lys - thr - z1 -] 47 75 these results demonstrate that high activities can be achieved with the compounds according to the invention in cells with multiple drug resistance as well as in cells that do not exhibit such a resistance . the compounds shown below were tested on two cell - lines , a431 ( a . t . c . c . reference no . crl - 1555 , c . f . american type culture collection , http :// phage . atcc . org / cgi - bin / searchengine / longview . cgi ? view = ce , 663682 , crl - 1555 & amp ; text = a - 431 , 2001 , pp . http :// phage . atcc . org / cgi - bin / searchengine / longview . cgi ? view - ce , 663682 , crl - 661555 & amp ; text = a - 663431 ; http :// phage . atcc . org / cgi - bin / searchengine / longview . cgi ? view = ce , 663682 , crl - 661555 & amp ; text = a - 663431 ) ( an epidermoid cancer ) and panc - 1 ( a . t . c . c . reference no . crl - 1469 , c . f . american type culture collection , http :// phage . atcc . org / cgi - bin / searchengine / longview . egi ? view = ce , 609764 , crl - 1469 & amp ; text = panc - 1 ) ( a well differentiated pancreatic adenocarcinoma ), both of human origin , using the mtt ( carmichael j et al . cancer res . 47 ( 4 ): pp . 936 - 42 , 1987 .) and mb ( oliver m h , harrison n k , bishop j e , cole p j , laurent g j ; j cell sci 1989 march ; 92 ( pt 3 ): 513 - 8 ) assays . each compound was tested under 4 conditions : 6 h ( to exclude necrosis ) and 48 h to see inhibition of proliferation and apoptosis . high ratio between 48 / 6 h inhibition shows little necrotic , but pronounced apoptotic activity of the tested compound . the results are summarized in table 1 . neurogenic inflammation participates in all inflammatory responeses where nociception or pain sensation occurs . the principal mediator of this type of inflammation is substance p . classical anti - inflammatory agents as the cyclooxygenase ( cox ) inhibitors do not inhibit neurogenic inflammation . stable peptide analogues of somatostatin are potent broad spectrum anti - inflammatory agents which inhibit both the release of substance p from sensory nerve terminals and also the development of neurogenic inflammation ( helyes , zs ., pintér , e ., németh , j ., kéri , gy ., thán , m ., oroszi , g ., horváth , a . and szolcsányi , j . : anti - inflammatory effect of synthetic somatostatin analogues in the rat . br . j . pharmacol . 134 , 1571 - 1579 , 2001 , pintér , e ., helyes , zs , németh , j ., pórszász , r ., peth { acute over ({ acute over ( o )})}, g ., thán , m ., kéri gy ., horváth a ., jakab b ., szolcsányi , j . : pharmacological characterization of the somatostatin analogue tt - 232 : effects on neurogenic and non - neurogenic inflammation and neuropathic hyperalgesia . naunyn - schmiedeberg &# 39 ; s arch . pharmacol . ( 2002 , in press )). effect of tg , sga , tr , and tt - 232 on the release of substance p in vitro methods : after exsanguination the tracheae of 2 - 2 female wistar rats were removed and perfused ( 1 ml min − 1 ) in an organ bath ( 1 . 8 ml ) at 37 ° c . for 60 min with oxygenated ( 95 % o 2 and 5 % co 2 ) krebs solution of the following composition ( in mm ): nacl 119 , nahco 3 25 , kh 2 po 4 1 . 2 , mgso 4 1 . 5 , kcl 4 . 7 , cacl 2 2 . 5 , glucose 11 . after stopping the flow the solution was changed 3 times for 8 min ( prestimulated — stimulated — poststimulated ). electrical field stimulation ( 40 v , 0 . 1 ms , 10 hz , 120 s ) was performed to induce release of sensory neuropeptides from the tissue pieces in the presence or absence of sgtg , sga , sgth , or tt - 232 ( 500 - 500 nm ). the fractions were collected in ice - cold tubes and the wet weight of the tracheae were measured . concentration of sp was determined by specific radioimmunoassay ( ria ) methods developed in our laboratory ( németh , j ., oroszi , g ., thán , m ., helyes , zs ., pintér , e ., farkas , b . and szolcsányi , j . : substance p radioimmunoassay for quantitative characterization of sensory neurotransmitter release . neurobiology , 7 , 437 - 444 , 1999 ) and was expressed as the released amount of peptide per tissue weight . the results which are summarized in table 2 below and depicted in fig2 show that substance p release evoked by electrical stimulation of sensory nerve terminals is inhibited by sgtg , sga and sgth to a similar extent as elicited by tt - 232 .	2
referring to the drawings , fig1 illustrates an example facing system 100 of the present invention , for use on a shelf or other display surface . the facing system includes an interior portion in which plurality of products can be positioned for alignment and face up positioning of the products on the support surface . in use , if the products at the front of the shelf have been removed , the facing system may be lifted at its front end and used to move the remaining containers from a retracted position on the support surface to the front of the support surface . the facing system is then pushed back to the retracted configuration leaving the products positioned at the front of the support surface . the facing system 100 is formed of a plurality of frame members including at least two side members 110 and at least one front member 120 and at least one back member 130 . the side frame members 110 attach to the front frame member 120 and back frame member 130 in any suitable manner , and may be fixed into engagement , or assembled into the desired configuration . in this example , connecting members 140 are used to assemble the side frame members 110 to the front frame member 120 and back frame member 130 . the facing system 100 is moved from a retracted position on the support surface and enables products to be moved toward the front of shelves or the like , simply by lifting the front frame member 120 and moving the system 100 outwardly along with any retracted product positioned therein . as shown in fig1 , each side member 110 is located on opposing sides and extends vertically at approximately a 90 degree angle from a support surface . the front frame member 120 and rear frame member 130 also extend vertically at approximately a 90 degree angle from a surface . the height of the frame members 110 , 120 and 130 may be any suitable height to facilitate retaining products therein , and to allow for the facing procedure , but as shown , may be low profile so as not to obscure or detract from proper visibility of products on the support surface . as shown in fig1 , the two side members 110 and front and back members 120 and 130 are connected to form an integrated unit . particularly , both ends of the side members 110 are connected to the ends of front member 120 and rear member 130 . any type of connecting techniques may be used to join the side members 110 to the front and rear frame members 120 and 130 . each side member 110 preferably functions as a divider between products in longitudinal rows , with multiple systems 100 adjacent one another to accommodate multiple rows of products on the shelf or other support surface . the systems 100 separate adjacent rows of products from one another , and allows any individual row of a product to be faced to the front of the shelf or support surface , while not interfering with any adjacent row of a product . in the example of fig1 , the system 100 is width adjustable by adjustment systems 135 . the system 135 includes first and second sections 131 and 132 that together make up the front frame member 120 and rear frame member 130 , and are adjustably arranged with respect to one another . the section 131 includes a transverse opening 133 with a stepped configuration having an outer diameter which is less than the diameter of the inner portion of the opening 133 . a button 134 is slidably received in the transverse opening 133 and is dimensioned to be substantially commensurate with the dimensions of transverse opening 133 , excepting that the outer end of the button is projectable beyond opening 133 . the transverse opening 133 comprises a stepped configuration as indicated , and the button 134 includes an inner portion which extends through the opening 133 and is connected to the section 132 . the button 134 may be pushed to slide into the inner portion of transverse opening 133 . the button 134 is spring biased outwardly and configured to only be partially received in the inner portion of opening 133 . the button 134 may be pushed to slide into transverse opening 133 by depressing the projecting portion of button . the button 134 may be mounted to bias against the walls of the outer portion of transverse opening 133 to thereby act to releasably retain the button in position in one of the steps of the stepped configuration of opening 133 . the locking mechanism provided by button 134 and transverse opening 133 may be released by merely depressing the button 134 so that it can then be slid to adjust the width of the frame members 120 and 130 , and the relationship between the sections 131 and 132 . upon release of the button the sections 131 and 132 are locked into the relative adjusted position . the mechanism 135 may be similar to mechanisms that allow extension and retraction of blades in some utility knives . in this way , the system 100 is width adjustable to allow different sized products to be arranged therein , aligned and to allow the facing procedure therewith . any other suitable adjustment mechanism 135 may be used and is contemplated in the invention . as also shown in fig1 , the frame members 110 , 120 and 130 may also be formed to have reinforcing ribs 106 to increase the strength thereof , and if the frame members include an adjustment mechanism 135 , the sections of the frame members may have the reinforcing ribs 106 engage in sliding relationship with one another to allow them to be slidably retained together . in this example , the front frame member 120 may also include a header portion 123 forming a space for positioning product information or other graphic or informational material . for example , the header portion 123 may include a clear cover that is slid into engagement with the header portion 123 to provide the space for a sheet of paper or other material having product information , price or any other desired information or graphics . fig2 illustrates another example of the facing system 100 providing for adjusting both the width and / or length of the system 100 . in this example , the side frame members 110 also include an adjustable mechanism 135 similar to that shown in the example of fig1 . this provides the significant advantage of not only allowing adjustment to accommodate different sized products by allowing width adjustment , but also allows for accommodating different sized shelving or other support surfaces , without replacing a whole facing system . the side frame members 110 may include first and second sections 111 and 112 that are adjustably engaged by an adjustment mechanism 135 , to slidably engage sections 111 and 112 together . the adjustment mechanism 135 allows each side frame member to have its length increased or decreased to a desired length . the length of each side frame member can be adjusted by pushing and holding the button 134 until the desired length is achieved , and the button is released to lock the sections 111 and 112 together . as shown in fig2 , the front and rear frame members 120 and 130 may also comprise the adjustment mechanism 135 as described with reference to the example of fig1 , or these may provide a fixed width while the length is adjustable via the mechanisms 135 associated with the side frame members 110 . again , any other suitable adjustment mechanism 135 may be used and is contemplated in the invention . referring to fig3 , there is shown a further example of the facing system in accordance with the invention , which allows the system 100 to be folded flat for packaging , shipping , handling and storage . this has the significant advantage because the size of the facing system can be reduced significantly , for example by up to seventy five percent . in this example , the facing system 100 comprises the two side frame members 110 and front and back frame members 120 and 130 , which are engaged with one another by hinges 150 . the hinges 150 allow connection between the frame members in a manner that allow each of the frame members to be folded against an adjacent frame member as shown in fig3 . any number of commonly available connecting methods can be used to provide rotatable connection including , but not limited to , hinges or bearings . referring to fig4 , there are shown side wall extensions 201 attachable to the facing system 100 . the bottom of the side wall extension 201 is applied with a magnetic strip 210 so that the side wall extension can be attached to one side of the side frame member 110 . any number of commonly available attaching methods including , but not limited to , a magnetic or velcro ™ strip can be used to attach the side wall extensions to the side members , or the side members 110 may include structure to engage the side wall extensions 201 . further , referring to fig4 , an end wall extension 202 can be assembled with two side wall extensions 201 , and / or the rear frame member 130 . for example , the end wall extension 202 may have protrusions 204 on its edges . the protrusions 204 can be inserted into the holes 205 located on the side wall extensions 201 . as shown in fig5 , when assembled , the side wall extensions 201 and back wall extension 202 allow support for products positioned in the facing system 100 , such as stacked products like cans or the like , both when positioned on the shelf or support surface , and during a facing procedure . referring to fig6 , another example of the facing system 100 may include one or more magnetic members 106 on the front frame section 120 , which allows the facing system 100 to be retained in its retracted position until a facing procedure is to be performed . this allows the facing system to be securely , but releasably attached on a shelf to ensure the products are properly aligned , and to prevent unwanted movement of system 100 . as many display shelves or other display systems are formed of metal , the magnetic member 106 will be magnetically attached to the shelf or the like when the front frame section 120 is laid flat on the shelf . if the support surface is not metal , a front lip member ( not shown ) may be separately attached to the front of the shelf or other support surface , to which the magnetic member 106 will be attracted to and retained with . such a front lip member may be adhesively attached to the shelf or other support surface , or in other suitable ways . another magnetic or metal member may be attached to the shelf or support surface at a position to mate with the magnetic member 106 on the frame member 120 . alternatively , or in conjunction with a magnetic member on the front frame member 120 , the side frame members 110 may include a magnetic member or strip 106 as shown in fig6 . if desired as an alternative , the tops of the frame members 120 and / or 110 may include a magnetic member or strip to engage another facing system 100 , to allow multiple facing systems 100 to be stacked and retained together . any other suitable retaining mechanism to allow simple and effective retention on a shelf or support surface may be used and is contemplated in the invention , such as a velcro ™ strip or the like to be used to securely attach the facing system to shelves . fig7 illustrates another example of a facing system 100 according to the invention , providing for adjustment of the width of the system 100 . in this example , the front and rear frame members 120 and 130 may comprise a mating c - channel configuration 136 , which allows width adjustment of the front and rear frame members 120 and 130 , and maintains a set width by frictional engagement of the c - channel members . the adjustment mechanism 136 is created by forming a c - channel slot in which the mating c - channel is insertable and frictionally engaged . width adjustment is performed simply by sliding the c - channels relative to one another to a desired width . though not shown in this example , the side frame members 110 could also include an adjustable mechanism 135 similar to that shown in the example of fig2 , or can be of fixed lengths . in this example , the system 110 again provides the ability to accommodate different sized products by allowing width adjustment . again , other suitable length or width adjustment mechanisms 135 or 136 may be used and are contemplated in the invention . as shown in fig8 , the systems 100 may allow for use with an array of products with varying widths , and on shelving of different depths by suitably sizing the systems 100 . fig9 illustrates another example of side wall extensions 201 attachable to the facing system 100 . the bottom of the side wall extension 201 is applied by using side panel slots 211 which can be inserted into the facing system 100 for support . while the invention has been illustrated and described in detail in the foregoing drawings and description , the same is to be considered as illustrative and not restrictive in character , it being understood that only illustrative embodiments thereof have been shown and described and that all changes and modifications that come within the spirit of the invention are desired to be protected . additional features of the invention will become apparent to those skilled in the art upon consideration of the description . modifications may be made without departing from the spirit and scope of the invention .	0
referring now to fig1 the apparatus comprises an electro - magnet winding defined by coils 1 to 6 , which are serially connected to carry a magnetising current . the coils 1 to 6 are symmetrically disposed about a central vertical axis 7 and a longitudinal axis 8 which is common to the coils 1 to 6 . in order to provide shielding from the magnetic field produced when the coils 1 to 6 are energised , shielding coils 9 and 10 are provided which are serially connected with the coils 1 to 6 and arranged to produce a field which substantially cancels the magnetic field produced by the coils 1 to 6 outside the assembly . electrical connection to the coils just before described , is effected in a known manner via a service turret 11 , which is arranged to communicate with the interior of a helium vessel 12 having an outer wall 13 . the helium vessel 12 is filled with liquid helium via the service turret 11 , whereby the coils 1 to 6 and 9 , 10 contained therein are maintained at a temperature of about 4 ° k . necessary to produce superconductivity . in order to reduce heat gain by the liquid helium , the vessel 12 is contained in a vacuum chamber 14 having an outer wall 15 . between the outer wall 15 of the vacuum chamber and the wall 13 of the helium vessel , two heat shields 16 and 17 are provided may be fabricated from aluminium and which serve to reduce heat gain by radiation . a cylindrical space 18 is provided within the apparatus , within which space 18 a patient 19 is positioned so that a portion of the patient to be examined lies within a spherical imaging volume 20 , wherein the magnetic field is highly homogeneous . in order to provide for magnetic resonance imaging , gradient coils 21 and rf coils 22 are provided . operation of the gradient coils and rf coils is well understood by those skilled in the art and so details of the imaging process , which is not central to the present invention , will not herein be described . as hereinbefore explained , one of the problems with mri apparatus is that in order to produce a desirable degree of magnetic field linearity within the imaging volume 20 , magnets having a relatively long longitudinal axial length are required which tend to produce claustrophobia in patients , due to the degree of enclosure . in the present arrangement , in order to reduce the possibility of claustrophobia , the coils 3 and 6 which constitute end coils , are shaped to provide chamfers 23 and those portions 24 , 25 , 26 and 27 of the vessel 13 , the shields 16 and 17 and the vacuum chamber outer wall 15 respectively , which are adjacent the chamfer 23 , are chamfered correspondingly to provide flaring at each end of the space 18 . the provision of this flaring affords to the patient 19 a feeling of reduced enclosure and accordingly provides for a reduced tendency to claustrophobia . various modifications may be made to the arrangement shown and for example , in alternative arrangements different chamfer angles and shapes may be provided . in order to fabricate the coils 3 and 6 , they may be wound on a suitably shaped mandrel , thereby to form the chamfers 23 , and thereafter impregnated with an epoxy resin impregnant which is cured so that it solidifies prior to the coil being removed from the mandrel . as shown in fig2 wherein parts corresponding to fig1 bear the same numerical designations , the coil 3 may be provided with an outer layer 28 , of impregnated glass beads or glass fibre , in which a step 29 is formed , which serves to facilitate fixing by means of ` l - shaped ` clamps 30 ( only one of which is shown ), which are held in place by means of screw threaded bolts 31 . in order securely to clamp the coils , a single clamp may be used or several clamps may be used , as in this embodiment , spaced equi - angularly around the outer cylindrical surface of the coil and engaging the step . the bolts 31 are arranged to pass through an aluminium support structure 32 on which the coils 1 to 6 and 9 , 10 are mounted . by providing this kind of fixing , the need for a clamp which embraces an end portion 33 of the coil 3 so as to extend its axial length , is obviated . this is particularly advantageous because it facilitates a reduction in the overall axial magnet length which in turn facilitates the provision of apparatus wherein the tendency to produce claustrophobia in patients is reduced .	8
the process of the invention relies upon the rapid heating of nickel - coated polymer substrates to facilitate carbon removal . rapid heating of these nickel - coated structures quickly converts the polymer to gaseous decomposition products . these gases form a relatively large internal pressure within the nickel structure that bursts the outer nickel layer to provide gas escape holes . these newly formed holes allow efficient oxidation and removal of the polymers . furthermore , these holes reduce the shrinkage of the nickel foam during annealing . increasing the rate of heating the polymer trapped within the nickel coating increases the number of holes blown through the nickel skeleton . this results in less decomposition products exiting per hole and therefore leaves a thinner carbonaceous deposit on the outer surface of each hole piercing the nickel skeleton . in addition , increasing the polymer heating rate increases the fraction of gases in the decomposition products , further decreasing the amount of tar - like carbonaceous deposits . this rapid temperature increase is critical to effectively removing the carbon and reducing shrinkage . quickly exposing the nickel - coated polymer substrate from a condition where the outer nickel layer contains no holes to a temperature of at least about 600 ° c . creates sufficient internal pressure to form several holes . this quick temperature increase must occur in less than about twenty - five seconds to prevent the slow release of gases through a small number of holes . similarly , if the nickel coating contains burst openings prior to heating , the rapid heat - up process generates fewer holes and loses effectiveness . advantageously , exposing the nickel - coated substrate to a temperature of at least 700 ° c . in less than fifteen seconds further promotes polymer removal and reduces shrinkage . most advantageously , exposing the nickel - coated polymer substrate to a temperature of at least 800 ° c . in less than about ten seconds bursts a sufficient number of holes to quickly discharge the gases . exposing the nickel foam from temperatures below the decomposition temperature of the foam to increased temperatures in quicker times further increases effectiveness of the process of the invention . for example , exposing the nickel - coated polymer substrate from a temperature less than 200 ° c . to a temperature of at least 900 ° c . temperature in less than five , two or even one second further improves polymer removal , reduces the amount of tar - like deposits on the outer surface of the nickel skeleton and reduces shrinkage of the nickel foam . 1 ) using a physical barrier to shield the nickel - coated polymer from radiative heat and hot furnace gases ( convective heat ) at the furnace entrance ; 2 ) increasing foam speed to minimize exposure of the foam to intermediate temperatures that thermally decompose foam ; 3 ) increasing furnace temperature to increase the rate of radiative heat transfer to the nickel - coated polymer ; and 4 ) increasing furnace - gas - flow rate or changing furnace - gas composition to increase rate of convective heat transfer to the nickel - coated polymer . the upper limit of the furnace temperature is a temperature slightly below the melting temperature of nickel . most advantageously , the furnace exposes the nickel foam to a temperature sufficient to anneal the nickel structure in a single pass . for example , setting the furnace at a temperature between about 800 ° c . and about 1200 ° c . allows a belt furnace to sinter nickel foam in one pass . alternatively , using a rapid heat - up followed by a separate annealing process provides an acceptable , but more costly , procedure for forming nickel foam . the polymer structure may consist of a reticulated foam structure , closed cell structure , felt or any combination thereof . acceptable polymer substrates include : polyester , polyurethane , polystyrene , polyvinylchloride , polyethylene , polyisocyanurates , polyphenols and polypropylene . these polymers all thermally decompose on rapid heating to leave high purity nickel foam with minimal shrinkage . referring to fig1 a continuous belt furnace 5 most advantageously provides the means for heating the nickel - coated structure . the divider 12 separates the hot zone of furnace 10 from the cooling zone within water - cooled jacket 14 . during operation , nickel - coated polymer 16 continuously travels about 1 m through the hot zone of furnace 10 to the cooling zone . cooling insert 18 protects foam from gradual heating and premature burning before entry into the hot zone of furnace 10 . specifically , cooling gases 20 purge the atmosphere within the cooling insert 18 to maintain the polymer substrate below its decomposition temperature . most advantageously , an inert or reducing gas continuously purges cooling insert 18 . after the foam passes the cooling insert 18 , the furnace 10 rapidly heats the foam 16 to a temperature well above the decomposition temperature of the polymer . the hot zone of furnace 10 advantageously contains a gaseous mixture of hydrogen and water vapor 22 that is oxidizing to carbon and reducing to nickel . optionally , this gas may be diluted with an inert gas such as nitrogen or substituted for with an atmosphere of equivalent oxygen partial pressure such as that obtained by partially combusting natural gas . after removing the polymer substrate and annealing the resulting nickel structure within the hot zone , the nickel structure passes about 1 m through water - cooled jacket 14 . the water - cooled jacket 14 cools the nickel structure to a temperature where nickel is stable in an air atmosphere . introducing inert or reducing gases 24 into the cooling zone of cooling jacket 14 prevents oxidation of the nickel structure during cooling . most advantageously , nitrogen gases purge the cooling zone of any oxidizing gases . the following examples demonstrate the effectiveness of rapid heat - up for removing carbon , minimizing shrinkage and minimizing total processing time . all samples were processed in the furnace illustrated by fig1 using a nitrogen purge in the cooling zone , unless specifically stated otherwise . example 1 demonstrates the effect of rapid heat - up on carbon removal and shrinkage . the samples consisted of four 28 cm by 40 cm rectangular pieces cut from a roll of nickel - plated polyurethane foam . total densities of these samples varied from 597 g / m 2 to 615 g / m 2 . the polyurethane foam substrate accounted for approximately 58 g / m 2 of the nickel - plated foam , with the nickel accounting for the balance . the two - zone controlled atmosphere belt furnace of fig1 heated all samples . but the cooling insert was not present for the testing of example 1 . the starting polyurethane foam was approximately 2 . 2 mm thick and contained about 80 pores per inch ( ppi ) or 31 pores per centimeter ( ppcm ). the hot zone of the furnace exposed sample 1 to an atmosphere maintained at 800 ° c . the atmosphere in the furnace hot zone and the cooling zone consisted of flowing nitrogen . quickly sliding sample 1 into the middle of the furnace hot zone on a slider plate effected rapid heat - up . after 200 seconds , quickly sliding sample 1 to the cooling zone of the furnace effected cooling in a protective atmosphere . for the testing of sample 2 , the furnace belt speed was 30 cm / min , providing a hot zone residence time of approximately 200 seconds . thus , this test exposed sample 1 and sample 2 to essentially the equivalent atmosphere and temperature for the same length of time . the only significant parameter change was heat - up rate . the test parameters of samples 3 and 4 were identical to samples 1 and 2 , except for increasing the furnace hot zone temperature to 1000 ° c . analyses included dimensional changes , carbon assays , oxygen assays and visual observations . table 1 below provides data obtained from testing samples 1 to 4 . table 1__________________________________________________________________________ total density total density ( g / m . sup . 2 ) ( g / m . sup . 2 ) δ δsample temp . time as - an - length width c ono . (° c .) ( sec ) plated nealed (%) (%) ( ppm ) ( ppm ) __________________________________________________________________________1 800 200 615 545 0 . 50 0 . 18 2510 4902 800 200 * 601 563 - 2 . 11 - 2 . 32 5050 9803 1000 200 610 550 0 . 00 - 1 . 07 1950 2304 1000 200 * 597 553 - 2 . 11 - 1 . 79 4020 590__________________________________________________________________________ * furnace belt rate of 30 cm / min . as seen in table 1 , the rapid heating of samples 1 and 3 significantly reduces residual carbon for a specific time at temperature . in addition , increasing hot zone temperature to 1000 ° c . further decreased residual carbon . visual observations indicate that rapid heat - up leads to an increase in the number of holes blown through the nickel skeleton . numerous small spots covered sample 1 . these small spots consisted of carbon residue surrounding eruption sites . in contrast , sample 2 had a noticeably lower spot density , but the spots were of larger diameter and darker , indicating a thicker tar - like carbonaceous deposit at each eruption site . sample 3 was similar to sample 1 , except that there was a higher carbon spot density and the carbon spots were of smaller diameter and lighter . sample 4 had a lower density of large , dark carbon spots than sample 2 , but was still much worse than sample 1 . example 2 provides a direct comparison between the subject sintering method , two stage sintering and single stage sintering processes that use uncontrolled heat - up rates . samples 5 to 7 consisted of 28 cm by 40 cm rectangular pieces cut from a roll of nickel - plated polyurethane foam . these samples all had fine edge cracks introduced by the cutting process . total densities of these samples varied from 252 g / m 2 to 260 g / m 2 . the polyurethane foam substrate accounted for approximately 58 g / m 2 of the nickel - plated foam , with the nickel accounting for the balance . the starting polyurethane was approximately 1 . 7 mm thick and contained 90 ppi ( 35 ppcm ). the controlled atmosphere belt furnace of fig1 lacked the cooling insert for samples 5 and 6 . sample 5 was processed using conditions simulating traditional two - stage sintering methods . pre - burning was simulated by quickly sliding sample 5 into the furnace hot zone with an atmosphere of free flowing air and a temperature of 700 ° c . the polymer of sample 5 ignited in approximately 2 seconds and a flame persisted on the foam surface for approximately 19 seconds . sample 5 remained in the furnace hot zone for a total of 120 seconds . sample 5 grew 2 . 8 % in length and 2 . 9 % in width during pre - burning . after pre - burning , sample 5 was black , brittle and had some edge cracks . the pre - burned sample 5 assayed 400 ppm c and 6 . 96 % o . this level of oxygen represents oxidizing approximately 27 . 5 % of the nickel . the annealing portion of the two - stage processing of sample 5 was conducted in the belt furnace at a speed of 8 cm / min and a hot zone temperature of 1000 ° c . the atmosphere contained counter - currently flowing gas consisting of 15 % h 2 , 30 % h 2 o and balance n 2 . flow rates of 16 . 7 l / min h 2 , 25 ml / min h 2 o ( water ) and 61 l / min n 2 produced this atmosphere . on sintering , sample 5 shrank 4 . 3 % in length and 4 . 9 % in width , giving overall dimensional changes of - 1 . 5 % in length and - 2 . 1 % in width . sintered c and o assays were 360 ppm and 300 ppm respectively . final nickel density was 216 g / m 2 . no carbon residue was visible at polyurethane eruption sites . but fine edge cracks , present after pre - burning , extended on sintering , presumably due to the stresses associated with the dimensional changes . test conditions simulating single - stage polymer removal and annealing with slow initial heat - up treated sample 6 . for testing sample 6 , the furnace maintained a hot zone temperature of 1000 ° c . the furnace atmosphere was counter - currently flowing 15 % h 2 , 30 % h 2 o and balance n 2 . the belt was 4 cm / min for 9 minutes , then the belt speed was increased to 32 cm / min . this gave the same approximate hot zone residence time as setting the continuous belt speed at 8 cm / min . the muffle extended from the front of the furnace a sufficient distance to ensure that the foam was under the sintering atmosphere for heat - up . shrinkage of sample 6 on sintering was 8 . 2 % in length and 3 . 2 % in width . sintered carbon and oxygen assays of sample 6 were 360 ppm and 400 ppm respectively . final nickel density of sample 6 was 220 g / m 2 . no carbon residue was visible at polyurethane eruption sites . but fine edge cracks , present in the as - plated material , extended on sintering . single stage sintering with rapid heat - up conditions were used for sample 7 . the cooling insert of fig1 rapidly exposed the polymer to severe pyrolyzing conditions and prevented nickel foam from being gradually heated in the belt furnace . the insert diverted hot furnace gasses away from the foam surface and prevented premature exposure of the foam to radiative heat . furthermore , room temperature nitrogen was purged through the cooling insert to maintain the foam below temperatures of thermal decomposition and prevent inward flow of hot furnace gases . for testing sample 7 , the furnace temperature was 1000 ° c ., the sintering atmosphere was counter - currently flowing 15 % h 2 , 30 % h 2 o and balance n 2 , and the belt speed was 20 cm / min . the cooling insert maintained the temperature inside the insert below 150 ° c ., while immediately beyond the insert the furnace temperature was 1000 ° c . the transition zone was approximately 1 . 5 cm long , corresponding to approximately 4 . 5 seconds of belt travel time . dimensional changes on sintering were less than 0 . 1 % in both length and width . sintered c and o assays were 430 ppm and 460 ppm respectively . no residue was visible at eruption sites . importantly , none of the fine edge cracks present in sample 7 propagated . table 2 below provides dimensional changes and chemical assays for the three samples : table 2__________________________________________________________________________comparison of two - stage sintering , single - stage sintering andsingle - stage sintering with rapid heat - up . nickel density nickel density ( g / m . sup . 2 ) ( g / m . sup . 2 ) c osample sintering process as - plated annealed δ length (%) δ width (%) ( ppm ) ( ppm ) __________________________________________________________________________5 two - stage 202 216 - 1 . 5 - 2 . 1 360 3006 single - stage 198 220 - 8 . 2 - 3 . 2 360 4007 single - stage w rapid heat - up 194 196 0 . 0 0 . 0 430 460__________________________________________________________________________ example 3 demonstrates continuous sintering of low density nickel foam using rapid heat - up technology . the test sample consisted of a 20 m length of nickel - plated polyurethane foam . the polyurethane foam was approximately 1 . 8 mm thick and contained about 100 ppi ( 39 ppcm ). nickel density was approximately 300 g / m 2 for about the first 18 m and approximately 200 g / m 2 for the remaining 2 m . the furnace atmosphere consisted of 50 % h 2 , 25 % h 2 o and 25 % n 2 maintained at 1000 ° c . foam feed speed and belt speed were identical at 20 cm / min . trimming the foam to a uniform 28 cm width prior to removing the polymer allowed monitoring of any dimensional change . the single - step process of example 3 rapidly removed the polymer and annealed the nickel foam without cracking or leaving carbon spots . a 28 cm × 92 cm piece cut from the same roll of as plated polyurethane foam ( approximately 310 g / m 2 ni ) provided a comparative test sample . single stage sintering without rapid heat - up was conducted using the furnace described in fig1 with the cooling insert removed . the furnace atmosphere was 10 % h 2 , 20 % h 2 o and balance n 2 . furnace temperature was 1000 ° c . and the belt speed was 10 cm / min . despite the higher oxygen partial pressure and the longer residence time at temperature , the sample exited the furnace lightly spotted . furthermore , the sample shrunk approximately 5 . 5 % in length and 7 . 8 % in width . the above clearly demonstrates the advantage of rapid heat - up for improving carbon removal and reducing shrinkage . for all of the samples in the above three examples the changes in thickness were approximately the same as the corresponding changes in length and width . the new rapid heat - up process provides several advantages over the conventional two - step burn and anneal processes of the prior art . the rapid heat - up process improves the speed and effectiveness of carbon removal from nickel structures . in addition , the process of the invention provides a continuous one - step polymer removal and annealing process for producing ductile nickel structures from nickel - coated structures . finally , the rapid heating of nickel - coated foam reduces shrinkage of the nickel foam to maximize foam production . the reduced shrinkage maintains the high porosity of nickel foams . these high porosity foams increase battery capacity by allowing the loading of increased quantities of &# 34 ; active mass &# 34 ; to batteries for a specific volume . while in accordance with the provisions of the statute , this specification illustrates and describes specific embodiments of the invention . those skilled in the art will understand that the claims cover changes in the form of the invention and that certain features of the invention provide advantages without the use of other features .	8
a tacan transmitter 1 generates , in a manner known per se , the signals to be fed to the tacan antenna . the transmitter can be of the kind described by m . kayton and w . r . fried in the book &# 34 ; avionics navigation systems &# 34 ;, john wiley & amp ; sons , inc ., new york , 1969 , pages 187 to 192 . it contains a control facility which causes the necessary pulse pairs and pulse groups to be transmitted . two signals e and f applied to the transmitter 1 cause the latter to transmit the main reference pulses and the auxiliary reference pulses at the correct instants . the control facility generates a trigger pulse about 6 μs prior to the delivery of each pulse pair or pulse group . this trigger pulse is applied to a synchronizing facility 4 . a power divider 2 divides the output signal of the tacan transmitter 1 into four signals which are applied to a first switch 28 , a first controllable phase shifter 25 , a second controllable phase shifter 26 , and a third controllable phase shifter 27 , respectively . the output of the first phase shifter is applied to the second switch 29 , and the outputs of the second and third phase shifters are applied to a third switch 30 . the first switch 28 and the second switch 29 are arranged to apply the signals fed to them to a first (+ 4 ) or a second (- 4 ) input , or to a third (+ 3 ) or a fourth (- 3 ) input , respectively , of a butler maxtrix 31 . the third switch 30 is arranged to apply one of the signals fed to it to a fifth input (+ 5 ) and the other of such signals to a sixth input (- 5 ) of the butler matrix 31 in its first position . in its other position , it applies the signals fed to it to the respective other inputs (- 5 and + 5 ) of the butler matrix 31 . the butler matrix 31 of the embodiment shown has six inputs and sixteen outputs , i . e ., the conventional butler matrix , in which the number of inputs is equal to the number of outputs , has been modified accordingly . each output is connected to a different radiating element 32 . the radiating elements 32 are equally spaced on a circle . the signal applied to an input of the matrix 31 is evenly distributed to the sixteen outputs , but the output signals differ in phase . the butler matrix 31 is presented with four signals at a time ; consequently , four signals are present at each of the sixteen outputs of the butler matrix 31 , which are superposed on each other vectorially . the butler matrix is designed to produce the desired phase shifts ( phase modes ) and power distributions . a clock generator 5 generates a 6 . 048 - mhz clock signal . this signal is fed to the synchronizing circuit 4 and to a divider 6 , whose output provides a 2 , 160 - hz signal . in the synchronizing circuit 4 , the trigger pulse from the tacan transmitter 1 is synchronized with the clock signal from the clock generator 5 . the frequency of the clock generator 5 is chosen to be so high that the synchronization causes only a short delay of the trigger pulse , so that between the actuation of the switches 28 to 30 and phase shifters 25 to 27 yet to be discussed by the synchronized trigger pulse and the delivery of the radio - frequency pulses , sufficient time (≦ 6 μs ) remains for completing the switching of the switches 28 to 30 and phase shifters 25 to 27 . thus , the instant of switching remains in a space beween pulse pairs or pulse groups and cannot overlap a pulse pair or pulse group . the output of the divider 6 is applied to a counter 7 , which is reset to zero after reaching a count of m = 143 . to accomplish this , the beacon includes a memory 9 , in which the number m = 143 is stored , and a comparator 8 , which resets the counter 7 . the beacon further contains read - only memories 10 to 14 , whose addreses are selected by means of the counts of the counter 7 . the trigger pulse causes the data present in the read - only memories 11 to 14 at the instant of its occurrence to be transferred into registers 15 to 18 . since the trigger pulse is synchronized with the clock pulse , it is insured that the data at the outputs of the read - only memories 11 to 14 are not changed at the very moment when the registers 15 to 18 are being set by the trigger pulse . at given counts of the counter 7 , a read - only memory prom 10 provides at its outputs e and f pulses which pass through driver stages 101 and 102 , respectively , and trigger the generation of the main reference - pulse group and the auxiliary reference - pulse group , respectively , in the tacan transmitter 1 . the outputs e and f are connected to the inputs e and f of the tacan transmitter 1 . the registers 15 to 17 that are respectively arranged behind the read - only memories ( proms ) 14 to 12 are followed by driver stages 24 to 22 , each of which controls a respective controllable phase shifter 25 , 26 or 27 . the phase shifters 25 , 26 and 27 are 4 - bit digital phase shifters . they are controlled via the proms 12 to 14 , registers 15 to 17 , and driver stages 26 to 24 in such a way as to alternately generate an upper sideband and a lower sideband of the carrier applied to them . the output of the first controllable phase shifter 25 is applied to the second switch 29 , and the outputs of the phase shifters 26 and 27 are fed to the third switch 30 . the output of the register 18 , which follows the fourth prom 11 , is applied to three driver stages 19 , 20 and 21 , whose output signals switch the switches 28 , 29 , and 30 . as mentioned , the signals at the outputs of the butler matrix 31 differ in phase at a sufficiently low amplitude . these phase shifts can also be produced by means of individual controllable phase shifters . such a solution is equivalent to the butler matrix , because in both cases signals differing in phase by different amounts are obtained at several outputs . the operation of the novel tacan beacon is as follows . to generate the 15 - hz coarse bearing signal and the 135 - hz fine bearing signal , the signal generated by the tacan transmitter 1 must be amplitude - modulated at 15 - hz and 135 - hz , with the phase depending on the azimuth . in the tacan beacon disclosed in the book cited above , this is accomplished by mechanical pattern rotation . in the novel tacan beacon of the present invention , the upper and lower 15 - hz sidebands are generated simultaneously by means of the controllable phase shifters 25 , 26 , and the upper and lower 135 - hz sidebands are generated successively by means of the controllable phase shifter 27 . in addition , different radio - frequency phase - rotation fields are generated during two states , which are described in the following . the first switch 28 applies the carrier signal to the first input of the butler matrix 31 . a radio - frequency phase - rotation field with the ordinal number + 4 is generated . the controllable phase shifter 25 is controlled to provide the upper 15 - hz sideband at its output . this side - band is applied to the third input of the butler matrix 31 . a radio - frequency phase - rotation field with the ordinal number + 3 is generated . the controllable phase shifter 26 is controlled to provide the lower 15 - hz sideband , which is applied to the fifth input of the butler matrix 31 . a radio - frequency phase - rotation field with the ordinal number + 5 is generated . the controllable phase shifter 27 is controlled to provide the upper 135 - hz sideband , which is applied to the sixth input of the butler matrix 31 . a radio - frequency phase - rotation field with the ordinal number - 5 is generated . the first switch 28 applies the carrier signal to the second input of the butler matrix 31 . a radio - frequency phase - rotation field with the ordinal number - 4 is generated . the controllable phase shifter 25 is controlled to provide the lower 15 - hz sideband , which is applied to the fourth input of the butler matrix 31 . a radio - frequency phase - rotation field with the ordinal number - 3 is generated . the controllable phase shifter 26 is controlled to provide the upper 15 - hz sideband , which is applied to the sixth input of the butler matrix 31 . a radio - frequency phase - rotation field with the ordinal number - 5 is generated . the controllable phase shifter 27 is controlled to provide the lower 135 - hz sideband , which is applied to the fifth input of the butler matrix 31 . a radio - frequency phase - rotation field with the ordinal number + 5 is generated . in the presence of a radio - frequency phase - rotation field with the ordinal number (±) 3 , the phase difference between the first output and the υth output of the butler matrix is (±) ( υ - 1 )· 67 . 5 degrees ; at the ordinal numbers (±) 4 and (±) 5 , the values are (±) ( υ - 1 )· 90 degrees and (±) ( υ - 1 )· 112 . 5 degrees , respectively . the switches 28 to 30 and thus the distribution of the output signals of the controllable phase shifters 25 to 27 controlled by the output signals of the driver stages 19 to 21 , as mentioned above . switching from one state to another takes place periodically at 540 hz . the switching rate must be so high as to permit averaging in the tacan - signal receiver . the necessary switch and phase - shifter positions are determined by the counter 7 , which counts from 0 to 143 in 1 / 15 s , and the proms 11 to 14 . each count (= address ) corresponds to a specified switch and phase - shifter position stored in the proms . if 4 - bit digital phase shifters are used , the information at the outputs of the proms 13 and 14 changes after every 9th address change of the counter 7 in accordance with the 15 - hz modulation of the carrier , and that at the output of the prom 12 changes after every address change in accordance with the 135 - hz modulation of the carrier . to generate the sidebands , the direction of rotation of each of the phase shifters 25 to 27 , which determines the phase gradient , must be controlled to obtain a conventional levorotatory tacan pattern . the changes in the directions of rotation of the phase shifters 25 to 27 for the two states i and ii are controlled by the contents of the proms 12 to 14 . with the single phase shifter 27 , both an upper sideband and a lower sideband are generated , as mentioned above . the direction of rotation of the phase shifter 27 is chosen depending on whether the upper sideband or the lower sideband is to be generated . the address changes of the counter 7 are also used to control the rf switches 28 to 30 . a switching frequency of 540 hz is achieved , for example , by changing the output of the prom 11 after every 4th address change . however , the necessary switch and phase - shifter positions are passed on to the switches 28 to 30 and phase shifters 25 to 27 only if the registers 15 to 18 are set by the clock - synchronized trigger pulse immediately before transmitter pulses . each of the proms 12 to 14 contains a number of addresses equal to the number of states required to control the controllable phase shifters 25 , 26 , and 27 in such a way that the desired sidebands are generated . the generation of sidebands by means of controllable phase shifters is known per se and , therefore , will not be explained here in greater detail . the sideband generation described results in an azimuthal rotation of the aperture current distribution produced in the radiating elements 32 by vectorial superposition of the phase modes . the rotating current distribution causes a far - field pattern rotating at the same speed . while we have described above the principles of our invention in connection with specific apparatus , it is to be clearly understood that this description is made only by way of example and not as a limitation to the scope of our invention as set forth in the objects thereof and in the accompanying claims .	7
the present disclosure is directed to a system and method for applying a fluid material to an article using a fluid distribution or rotary atomizing device , and to an apparatus that includes the device , and to a method of using the device and apparatus . the rotary atomizing device allows fluids of varying viscosities to be applied to a surface . regardless of the viscosity of the fluid , the rotary atomizing device is also useful for applying fluids that may include relatively large amounts of particulate material . the device has particular utility for applying batter to foods , especially relatively viscous batter , up to at least about 50 percent solids content . in a preferred embodiment , the device and method may be used to dispense a batter onto food products to coat the food products . the device and method allow an unexpectedly wide range of batter viscosities to be applied to the food products , as well as batters that include relatively large particles , without clogging the apparatus and minimizing contamination of the batter . one embodiment of a rotary atomizing device 10 according to the present disclosure is illustrated with reference to fig1 - 5 . fig1 illustrates device 10 in a perspective view including two spaced apart opposed discs 12 a , b . as shown in fig2 and 3 , spaced apart opposed discs 12 a , b are substantially symmetrical about plane “ p 1 ,” and each includes an inner surface 14 a , b , an outer surface 16 a , b , and a perimeter 18 a , b . in the present embodiment , the spacing s 1 between discs 12 a , b is preferably about 2 inches , and each disc 12 a , b preferably has a diameter d 1 of about 7 inches . a centrally disposed hub 20 having an outer surface 22 connects inner surfaces 14 a , b of discs 12 a , b . an axial bore 24 extends through hub 20 in coaxial alignment with axis “ a ,” which is substantially perpendicular to plane p 1 . preferably , bore 24 includes steps 24 a and 24 b , for engagement with bushing 26 and drive shaft 30 , as shown in fig3 the purpose of which will be explained in greater detail below . bushing 26 is preferably a quick - mount keyless bushing or transtorque bushing . a plurality of apertures 32 preferably may be disposed radially about bore 24 of central hub 20 to allow engagement of central hub 20 to each disc 12 a , b by fasteners 34 , which are illustrated herein as screws . as shown in fig2 - 4 taken together , outer surface 22 of central hub 20 includes two surfaces 22 a , b that intersect at plane p 1 . outer surfaces 22 a , b are substantially symmetrical with respect to plane p 1 , and extend from plane p 1 toward perimeter 18 a , b , respectively , to define an angle θ 1 , which is preferably less than about 90 degrees , more preferably in the range of about 30 degrees to about 60 degrees . thus , outer surfaces 22 a , b provide central hub 22 with a substantially vee - shaped , or hourglass - shaped outer surface 22 . the angle θ 1 of outer surface 22 of hub 20 may be important for maximizing the amount of fluid that may be distributed from device 10 , as will be explained in greater detail below . as shown in fig5 in the present embodiment , central hub 22 preferably has a diameter d 2 of about 2 . 5 inches . referring back to fig2 and 3 , flanges 36 a , b extend substantially perpendicularly from each inner surface 14 a , b along perimeter 18 a , b . flanges 36 a , b may have a width w 1 ranging from about ¼ inch to about 2 inch , more preferably about ½ inch to about 1½ inch . in the present embodiment , width w 1 is about ½ inch . for ease of machining , the intersection of inner surface of each disc 12 a , b with flanges 36 a , b preferably has a radius of about ¼ inch . it is thought that the radius enhances the movement of fluid towards the end of the flange , where it becomes atomized . however , a perpendicular intersection of inner surface of each disc 12 a , b with flanges 36 a , b is also possible . in some embodiments , inner surface 14 a , b of each disc 12 a , b may include a recess 38 a , b into which shoulder 39 a , b of central hub 20 may be received . preferably , recess 38 a , b may have a diameter sufficient to allow friction fitment of central hub 20 therein . discs 12 a , b and central hub 22 may be unitary or integral , depending on the material of construction and the method of constructing the discs . preferably , when used in the food industry , device 10 is machined or molded from a food - grade material including plastics such as delrin or ultra - high molecular weight polyethylene ( umhw - pe ) and metal such as 304 / 316 grade stainless steel . those of skill in the art will recognize that the dimensions of device 10 may vary as needed depending on the particular application in which it is used . all surfaces of device 10 , in the present embodiment , are substantially smooth and flat . those of skill in the art will also recognize that it is possible for any or all of the surfaces of device 10 to include patterns or grooves machined therein , as is known in the art of rotary atomizing , if it will improve the performance of the devices . another embodiment of a rotary atomizing device 100 according to the present disclosure will now be described with reference to fig6 - 10 . device 100 includes a plurality of sequentially arranged discs 102 . in preferred embodiment , capping discs 104 may be positioned at opposing ends of the sequence of discs 102 . the structure of discs 102 allow them to be coupled together in sequential arrangement , which increases the amount of fluid that may be applied to a surface or allows the application of fluid to a larger surface area than may be possible with device 10 . a single disc 102 will be described now with reference to fig7 - 8 . as shown , disc 102 is substantially symmetrical in construction about plane “ p 2 .”. each disc 102 includes opposing side surfaces 106 a , b having a perimeter 108 . a centrally disposed frustum 108 a , b may be disposed on each side surface 106 a , b . frustums 108 a , b each have a top surface 110 a , b and an outer surface 112 a , b . an axial bore 114 extends through frustums 108 a , b in coaxial alignment with axis “ a 2 ,” which is substantially perpendicular to plane p 2 . flanges 116 a , b extend substantially perpendicularly from each side surface 106 a , b along perimeter 108 . preferably , a plurality of apertures 118 are formed in top surfaces 110 a , b of each frustum 108 a , b for receiving pins 120 , as explained in greater detail below . a single capping disc 104 will now be illustrated with reference to fig9 - 10 . as shown , disc 104 includes a perimeter 108 and two opposing sides 120 a , b . side 120 a is substantially similar in construction to side surface 106 a of disc 102 , whereas side 120 b is substantially planar . thus , side 120 a includes centrally disposed frustum 108 a having atop surface 110 a and an outer surface 112 a . an axial bore 114 extends through frustum 108 a in coaxial alignment with axis “ a 3 ,” which is substantially perpendicular to plane p 3 . bore 114 includes a step 122 for receiving a transtorque bushing . flange 116 a extends substantially perpendicularly from side surface 120 a along perimeter 108 . preferably , a plurality of apertures 118 are formed in top surface 110 a of frustum 108 a for receiving pins 120 . as in the previous embodiment , the dimensions of discs 102 and capping discs 104 may vary depending on the particular application in which they are used . in the present embodiment , each disc 102 and 104 has an outer diameter d 1 of about 7 inches . the diameter d 2 of the central hub is preferably about 2 . 5 inches , and the spacing s 1 between each sequential disc 102 and between disc 102 and capping disc 104 and is preferably about 2 inches . as in the previous embodiment , discs 102 and 104 may have a unitary or integral construction , depending on the material of construction and the method of constructing the discs . preferably , when used in the food industry , device 100 is machined or molded from a food - grade material including plastics such as delrin or ultra - high molecular weight polyethylene ( umhw - pe ) and metal such as 304 / 316 grade stainless steel . those of skill in the art will recognize that the dimensions of device 100 may vary as needed depending on the particular application in which it is used . all surfaces of device 100 , in the present embodiment , are substantially smooth and flat . those of skill in the art will also recognize that it is possible for any or all of the surfaces of device 10 to include patterns or grooves machined therein , as is known in the art of rotary atomizing , if it will improve the performance of the devices . fig1 - 14 illustrate another aspect of the present disclosure , which is an apparatus 150 for coating articles with a fluid material , preferably for coating articles of food with batter . an exemplary apparatus 150 is shown in perspective view in fig1 and 12 . as shown , apparatus 150 includes a frame 152 supporting a chamber 154 having an inlet end 156 and an outlet end 158 . chamber 154 includes a base 160 connected to a cover 162 . base 160 preferably has downwardly sloping sides 160 a , b that intersect at the lower end 162 of base 160 above a fluid reservoir 164 . cover 162 may be hingedly connected to base 160 in preferred embodiments . a control panel 166 may be suitably disposed on cover 162 to enable an operator to operate various controls . power to apparatus 150 may be supplied by any suitable means . a plurality of the previously described rotary atomizing devices 10 are disposed within cover 162 and base 160 . although illustrated herein with several rotary atomizing devices , those of skill in the art will recognize that only one may be necessary , depending on the particular application . similarly , any number of devices 10 may be included in an apparatus , if needed or desired . as shown best in fig1 , two devices 10 a , b are disposed in cover 162 . each device 10 a , b is supported on drive shafts 168 a , b that extend through cover 162 to connect to motor 170 a , b which drives shafts 168 a , b . base 160 includes a support member 172 for supporting several of the foregoing rotary atomizing devices . as best shown in fig1 and 14 when taken together , support member 172 has a drawer - like construction which allows it to be slidably removed from base 160 using , for example , handle 174 . two devices 10 a and two devices 10 b are disposed on opposites of drawer 172 . each of the four devices 10 a , b are supported on drive shafts 176 a , b extending through the wall of drawer 172 to connect to motors 178 a , b , which rotatably drive shafts 176 a , b . a fluid dispensing tube 180 ( not illustrated in each drawing ) may be disposed within each device 10 a , b proximate the outer surface of the central hub . dispensing tube 180 may have a diameter ranging from about ⅛ inch to about 1 inch , more preferably about ¼ inch to about ¾ inch . in the present embodiment , the diameter of dispensing tube 180 is about ½ inch . one exemplary arrangement of a fluid dispensing tube 180 between discs 12 a , b is illustrated in fig1 . fluid dispensing tube 180 may distribute a fluid drawn from fluid reservoir 164 containing a source of fluid to be dispensed by a variety of suitably connected fluid dispensing lines . as illustrated in fig1 - 13 , two motor driven pumps 182 , 184 are supported on frame 152 . pump 182 draws fluid from reservoir 164 through line 186 and dispenses the fluid through lines 188 which extends through the face of drawer 172 to fluidly connect to devices 10 a , b , as shown best in fig1 . similarly , pump 184 draws fluid from reservoir 164 through line 190 ( see fig1 ) and dispenses the fluid through lines 192 a , b which are fluidly connected to devices 10 a , b within cover 162 . the foregoing dispensing lines may have a diameter ranging from about ½ inch to about 2 inch , more preferably about ¾ inch to about 1½ inch . in the present embodiment , the diameter of the dispensing lines is about ½ inch . a conveyancing assembly indicated generally at 194 includes a motor 196 for rotatably driving a plurality of rollers 198 disposed at various locations within base 160 and about which a conveyor member 199 , which is illustrated herein as a belt . belt 199 is operably disposed for transverse movement within base 160 from inlet end 156 to outlet end 158 . such conveyancing assemblies are well known in the art and will not be described in detail herein . preferably , rollers 198 are disposed such that conveyor member 199 substantially conforms to the sides 160 a , b of base 160 . preferably , when used in the food industry , the components of apparatus 150 that come into contact with food may be constructed from a food - grade material including plastics such as delrin or ultra - high molecular weight polyethylene ( umhw - pe ) and metal such as 304 / 316 grade stainless steel . those of skill in the art will recognize that the dimensions of apparatus 150 may vary as needed depending on the particular application in which it is used . in operation , power to the system is provided , and articles to be coated , preferably food articles , are placed on the conveyor belt . the rotary atomizing devices 10 a , b may be set to rotate at a rate of about 1500 rpm to about 2000 rpm , with about 1725 rpm being optimal . generally , at slower rates of rotation , large droplets are dispensed from the discs instead of a fine mist of batter . moreover , the direction in which the batter is dispensed is narrower , resulting in build - up of thicker , more uneven coating on the food product . also generally , at high rates of rotation , the dwell time of the batter in the device is insufficient to allow it to acquire sufficient momentum to be atomized and thereby dispensed as a fine mist . batter may then be drawn from the reservoir and distributed to each rotating rotary atomizing device in both the cover and the base , while the conveyor belt begins moving . typical line speeds in the food industry range from about 50 rpm to about 100 fpm . the present methods provide expanded lines speed capability ranging from about 5 fpm up to about 200 fpm or more , in some instances . the increased line speeds that are possible with the present method are due in part to the increased capacity of the present rotary atomizing devices and systems , as well as the increased dwell time of the batter in the rotary atomizing devices . those of skill in the art will recognize that modifications may be required to operate at such line speed . for example , it may be necessary to use a different conveyor belts , or to change the rotation rate of the atomizers , to changing the number and position of the rotary atomizing devices , to change the spacing between the rotary atomizing devices and the conveyor belt . such modifications will be apparent to those of ordinary skill in the art and may be achieved using routine experimentation . batter from the food distribution tubes in both the cover and the base is sprayed onto the central hub of each rotary atomizing device . when the batter comes into contact with the outer surface of the central hub , the batter is deflected such that it impacts the flanges of discs . the flanges increase the dwell time of the batter in the disc , allowing the batter to gain the momentum necessary to be atomized as the batter leaves the disc . thus , the inclusion of the flange in the disc design allows more viscous batters to be dispensed . the increased momentum provide the necessary energy for the batter to be atomized into a fine mist , resulting in a uniform coating on the articles to be coated . the flanges prevent batter from being dispensed too rapidly from the disc which would result in , for example , large droplets of batter , drips of batter , and non - uniform coating generally . typically , fluids having a viscosity of up to about 12 - 14 seconds in a # 3 stein cup ( available from stein / dsi , which is a subsidiary of fmc food tech , located in sandusky ohio ), and / or a solids content of about 50 percent may be dispensed using the present devices and methods . thus , using the present method , articles of food may be coated substantially uniformly on all sides , with a relatively viscous fluid or batter , at a relatively high rate that is compatible with most food production lines . the design of the rotary atomizing device allows relatively viscous fluids , or batters to be atomized . the design of the rotary atomizing device also accommodates a relatively high volume of fluid or batter without dripping onto the food . fig1 - 19 illustrate another exemplary embodiment of a coating apparatus . as seen in the figures , apparatus 250 differs from apparatus 150 in size and shape , but otherwise includes substantially the same components , with the exception of the inclusion of rotary atomizing devices 100 rather than devices 10 . where possible , reference numerals indicating the same or similar components as in the previous embodiment have been changed by replacing the number “ 1 ” with the number “ 2 .” thus , 152 becomes 252 , and so on . utilization of rotary atomizing devices 100 in apparatus 250 provides increased fluid distribution capacity , allowing the coating of relatively large amounts of articles or alternatively , coating at faster speed . as shown in fig1 - 20 when taken together , cover 262 of apparatus 250 includes a plurality of devices 100 mounted for rotation on drive shafts 268 which are rotatably driven by motor 270 . devices 100 may be spaced apart from one another within cover 262 ( best seen in fig1 ), and staggered with respect to one another within cover 262 so as not to interfere with the fluid distributed by adjacent devices 100 ( best seen in fig1 ). similarly , base 260 of apparatus 250 also includes a plurality of sequentially arranged rotary atomizing devices 100 which are mounted for rotation on drive shaft 276 driven by motor 278 . as in the previous apparatus , the components of apparatus 250 that come into contact with food may be constructed from a food - grade material including plastics such as delrin or ultra - high molecular weight polyethylene ( umhw - pe ), and metal such as 304 / 316 grade stainless steel . those of skill in the art will recognize that the dimensions of apparatus 250 may vary as needed depending on the particular application in which it is used . fig2 - 25 illustrate another aspect of the present disclosure which is directed to an accessory 300 for use in cooperation with either of devices 10 , 100 and thus with apparatus 150 , 250 . as shown in fig2 , accessory 300 may include a substantially ring shaped portion 302 . as shown in isometric view in fig2 , ring shaped portion 302 includes two sections 306 , 308 connected by fasteners 310 which are inserted into apertures 308 . section 308 includes and aperture 312 into which the fluid distribution tube 180 may be fixedly attached . as shown in fig2 - 23 , section 306 , 308 each have a substantially flat inner surface 314 a , b from which sloped surfaces 316 a , b and 318 a , b extend outwardly . section 306 preferably has a substantially curved outer surface 320 , whereas section 308 has a substantially flat outer surface 322 . fig2 - 25 illustrate one exemplary arrangement using ring - shaped portion 302 in cooperation with disc 102 and capping disc 104 . as shown , discs 102 , 104 may be mounted on a rotatable hollow drive shaft 324 , which may be coupled to , for example , a fluid distribution manifold to receive fluid or batter in the hollow drive shaft 324 . discs 102 , 104 are connected by pins inserted into the apertures on each opposing side of discs 102 , 104 . before the pins are inserted , the ring - shaped portion 302 must be mounted about the frustoconical portion . of course , although not illustrated herein , accessory 300 may also be disposed between discs 12 a , b of device 10 . during operation of an apparatus , fluid is distributed directly from hollow drive shaft 324 to ring - shaped portion 302 , which acts as a gutter to collect and distribute fluid to the interior surfaces of the rotating discs of devices 10 , 100 . thus , any fluid that is distributed from the hollow drive shaft 324 and which is not immediately flung onto the cone or inner surfaces of the discs is collected . this prevents fluid that does not yet have the required momentum to be atomized from dripping onto the articles to be coated . thus , accessory 302 effectively increases the dwell time within devices 10 , 100 , of fluid dispensed from fluid distribution tubes 180 . while there is shown and described herein certain specific structure embodying the invention , it will be manifest to those skilled in the art that various modifications and rearrangements of the parts may be made without departing from the spirit and scope of the underlying inventive concept and that the same is not limited to the particular forms herein shown and described except insofar as indicated by the scope of the appended claims .	0
the method and apparatus of the present invention convert a still panorama into a conventional rectangular panorama record suitable for use in selective display on a video display device . such a conventional rectangular panorama record is known , as exemplified by u . s . pat . no . 4 , 125 , 862 . such an arrangement has a user control which allows the user to select what portion of the rectangular panorama record that he wishes to have displayed on the video display device and for simulating moving within the panorama by adjusting the controls . the first step 2 of the method illustrated in fig1 requires recording of the panorama in a distorted form preferably as a ring or portion thereof on a film record , resulting in a circular mapping . this recording is accomplished , for example , by using a p - lens 3 and a conventional camera arrangement 5 to produce a record 50 as generally shown at the bottom of fig4 . each one of the ring shaped images 50 would represent the panorama at a single point in time or correspond to a still panorama . each record 50 provides a distorted recording of the panorama and is generally difficult to directly use by individuals or effectively use by means of a video display device . what is normally done with this type of recording is to project the image as set out in the second step 4 of fig1 which requires projecting the film record 50 in a manner to produce an undistorted projected image of the panorama suitable for viewing on a cylindrical screen . the projection of the film record 50 is illustrated in fig5 and , in this case , is shown for projecting of a series of film records 48 which would be used in conversion of a real time panorama . in the case of a still panorama , the film record 50 is merely projected generally using a similar optical system , as used in the recording , to remove the distortion and allow reproduction of the panorama on a cylindrical screen , labelled 26 in fig5 . panoramic lenses 3 , as shown in fig3 cause the image to be compressed at the narrow portion 52 and expanded at the wider portion 54 , illustrated in record 50 of fig4 . this compression of the image makes it important to have a high resolution capability in the initial recording . the use of p - lenses 3 and high resolution film photography is particularly suitable , although the invention is not limited by this combination . the high resolution is required to provide the accuracy in the projecting step 4 and determines to a large extent the accuracy of the recording step 6 of the projected image in the second stage of the method . the film records 50 , in the form of a circular map shown at the bottom of fig4 represent the entire panorama , with the innermost circular portion 52 representing the lower portion of the panorama scanned , and portion 54 representing the upper panorama scanned . the resolution required for recording of the lower portion of the panorama is higher due to the compression thereof . the degree of distortion and manner of distortion will vary with the type of panoramic lens 3 used or fish - eye lens . the next step 6 in the method requires recording of the undistorted projected image in a manner to record the panorama as a rectangular panorama 70 shown in fig6 . this step 6 is shown in fig5 where a camera 29 is rotated about the panoramic lens 25 for recording of the projected panoramic image . this then results in the panorama being converted to a rectangular panorama record which can use conventional techniques 8 , as shown in fig1 for viewing thereof . in a preferred embodiment , as illustrated in fig1 it is possible to further process the rectangular panorama record , or the subsequent display of that record , to adjust the rectangular panorama , as illustrated in step 10 , to artificially introduce two version of the image for separate eyes of a viewer to introduce a synthetic parallax effect . this step increases the realism of the produced image and uses the video glasses 99 generally shown in fig7 . these video glasses have separate screens 100 and 102 associated with each lens of the glasses and thus the image reproduced on each screen by step 12 would be slightly different to introduce this desired effect . the method , as generally set out in the first three steps of fig1 allows for the accurate recording of the panorama , albeit in a distorted form , followed by the projection of this initial record to remove the distortion whereafter the projected image is then used for recording in a conventional rectangular panorama record . the first step 2 is considered a first stage of the method , whereas the second and third steps 4 and 6 are considered a second stage of the method . the accuracy of the recording in the first step can be reproduced in the conventional rectangular panorama record . the time requirement for the first step is very short , whereas the time requirement for the second recording is much longer . by recording in this manner , the accuracy of the first recording flows through to the resulting rectangular panorama record . the initial recording occurs quickly due to known technology and the subsequent recording of the projected image to produce the conventional rectangular panorama record is time independent with respect to the recording of the actual panorama . the benefits of the method , generally set out in fig1 can further be realized for the various steps set out in the real time recording of a panorama exemplified in fig2 . the flow chart of fig2 still requires the recording 14 of the panorama in a distorted form , but in this case , a series of distorted records 48 are produced having a known timing interval . the second step 16 requires projection of each of these distorted records in a manner to remove the introduced distortion to produce an undistorted representation of the panorama . this undistorted representation of the panorama is then used for recording 18 of the representation of the panorama in a rectangular panorama record . the initial recording occurs in real time , whereas the projection and subsequent recording does not occur in real time . thus , a very accurate , but distorted record is first obtained , followed by the projection of the record to remove the distortion and the subsequent recording of the representation in a rectangular panorama record . to complete the method , it is necessary to introduce the required timing information by step 20 to result in the series of rectangular panorama records producing the desired representation of the real time panorama . as can be appreciated , there is timing information associated with the initial recording and this can be introduced into the sequencing of the series of rectangular panorama records once they have been recorded . fig3 illustrates various types of panoramic lenses 3 referred to as p - lenses , type a and type b . both types of p - lenses operate satisfactorily and are preferrably used in the initial recording of the actual panorama . fig4 shows the recording of a panorama using a p - lens and a conventional camera . this will produce the ring shaped image 50 stored on film . this is a distorted record of the actual panorama and would be difficult for an individual to effectively use . each record 50 of the series of records 48 of fig4 are used in the apparatus as generally shown in fig5 for projecting of the record by means of the p - lens 25 to reproduce , in this case , the panorama on the cylindrical screen 26 . each record 50 of the series of records 48 is brought into registration with the projecting arrangement 56 comprising a light source 58 and a focusing lens 60 . in this case , the series of records 48 is unwound from reel 62 and collected on reel 64 . camera 29 moves about track 31 a fixed radial distance from the panoramic lens 25 . in this case , a film record 33 of a vertical segment of the panorama is produced which , in combination with the other records produced as the camera 29 sequentially moves about the panoramic lens , results in a rectangular record of the panorama . as can be appreciated , whatever time is required to effect the accurate recording of the projected image is possible , as this step is not time dependent as the original record remains unchanging . timing of the changing panorama image is introduced once all conversion of the original distorted records to the rectangular panorama record has been completed . the method of recording the projected image need not use a cylindrical screen , as the recording can be made direct using a camera arrangement moved about the panoramic lens 25 or a ccd arrangement or other solid state recording device sequentially moved around the panoramic lens . if a solid state device is used , each recording position can be vertically scanned in a sequence of steps which collectively represent the vertical scanned portion . thus , the actual record format for recording of the projected image or for recording of the initial image can vary as long as the desired accuracy of the final recording is satisfactory . high resolution film for the initial recording is the most desirable today , although improvements in solid state recording may make it preferred in the future . direct recording of the projected image rather than recording from a screen may also improve accuracy . fig6 shows a preferred form of the rectangular panorama record 70 produced by the apparatus of fig5 . in this case , the first 0 ° to 180 ° 72 of the panorama are stored in an upper part of the record and portion 180 ° to 360 ° 74 are recorded in the lower part of the record resulting in the equal segments being stacked one atop the other in the buffer . this results in an approximate overall 3 : 5 image ratio ( when the vertical scan is about 55 °) which is easily stored using existing storage devices and existing buffers suitable for high definition television . such buffers or storage devices have sufficient capacity to permit only portions of the image to be displayed with good resolution . this is necessary , as typically only a portion of the panoramic record is being scanned at any point in time . this type of ratio is preferred , but other arrangements are possible for dividing the recorded panorama suitable for storage in common buffers having an overall image ratio of 3 : 5 . the exact storage arrangement will vary depending upon the number of degrees in the vertical direction scanned . different buffer arrangements can be designed based on particulars of the panorama recorded and the requirements of the overall system . fig7 shows the second stage of the method which is essentially time independent . it includes the projection 80 of the film record to produce an actual projection representation of the recorded panorama , which could be viewed on a cylindrical screen , and this projected representation is then rerecorded using a rotating optical slit scanner for producing a film record ( step 82 ) or a rotating optical slit scanner in combination with a ccd device ( step 84 ). after the rectangular records have been produced and the necessary timing information reintroduced into the resulting series , the record can be accessed using conventional technology such as a high density t . v ., vcr 86 , or optical disc player , depending upon the type of format used , in combination with a frame buffer 90 and various control arrangements for selecting which portion of the actual record the viewer wishes to consider . such variation can be imparted to the system by the joystick control 92 or the use of the video glasses 99 which are responsive to the head movement of the user , as but two examples . the selected portion of the panorama is displayed on video display device 106 . the recording of the projected representation has been described on the basis that the projected representation is stationary and the recording arrangement moves . it is possible to sequentially rotate the projected representation and have the recording arrangement stationary . an enhancement to the viewing of the series of rectangular panoramic records , either by this method or any other method , can be accomplished by processing the signal to produce a synthetic parallax effect similar to the parallax effect used by human eyes . as shown in fig8 the video glasses 99 have two screens 100 and 102 for viewing of a particular portion of the record . human eyes , as shown in fig9 have an overlapped field of view indicated by the crosshatching 91 of fig9 . to reproduce this effect , a portion 104 of the overall panoramic record 106 being sampled is used for each of the viewing screens 100 and 102 . one of the viewing screens would only look at a limited portion of 104 , indicated by the bracketed area 108 . the opposite viewing screen would receive the signal resulting from the bracketed portion 110 . this results in an overlapped area of the portion 104 of the record , indicated by 112 , and thus , synthetically produces an effect similar to the overlap illustrated in fig9 . in order to produce this , computer software merely selects the appropriate portion of the record to be displayed with respect to each of the video screens 100 and 102 , in accordance with the principles set out above . a further enhancement of the viewing of these types of records is illustrated in fig1 and 11 . fig1 illustrates a particular field of view 120 of the user 122 provided with the video glasses 99 . as long as the user does not tilt his head from side to side , the horizon in each of the viewing screens will remain horizontal fig1 b . however , if he tilts his head from side to side , this will result in an artificial tilt of the horizon which is an effect which would not be experienced if the user merely tilted his head in actual life . to overcome this deficiency , the video glasses 99 can include separate means 125 for maintaining the represented horizons of the image horizontal , as illustrated in embodiments of fig1 a , b and c . the glasses can be provided with their own motorized arrangement 125 for effecting this sympathetic movement of the screens to correspond with actual reality , or computer software can be used and the angle of the glasses sensed with the resulting view to be displayed merely shifted according to this sensed angle . in the mechanical arrangement of fig1 a , 10b and 10c , the viewing screens are mounted for rotation in a circle mount 126 having drives 125 provided at either side of the glasses . a further enhancement is shown in fig1 . in this case , as the user 122 tilts his head back to view the higher part of the image 128 , a reduced field of view is seen and the portion of the screen 130 outside of this image viewing area is blacked out , as illustrated in fig1 a . fig1 b illustrates when the viewer &# 39 ; s head is horizontal . fig1 c shows a view 132 of the lower part of the field . the portion of the viewing screen which is not in use is blacked out to increase the realistic effect . although various preferred embodiments of the present invention have been described herein in detail , it will be appreciated by those skilled in the art , that variations may be made thereto without departing from the spirit of the invention or the scope of the appended claims .	7
we will describe here below the general principles of the method for the waterproofing of joints and / or cracks according to the invention , by means of a waterproofing membrane , referring as an example to a roller compacted concrete dam , without intending this example in a restrictive way , since the waterproofing method described can be applied to any concrete and / or masonry structure ; for the aims of this invention , “ waterproofing membrane ” means a strip of prefixed width , obtained from a synthetic , waterproofing and elastically yieldable material , such as pvc , pp , pe and similar synthetic material . fig1 shows a front view of the upstream face 10 of an rcc dam consisting of superimposed layers of roller compacted concrete ; during the construction of the layers , contraction joints 11 are formed , which extend vertically , parallel to the slope of the upstream face , for the whole height of the dam body . as shown in fig2 the contraction joint 11 prolongs inside the concrete body of the single layers 10 , so as to constitute a preferential line for cracking . as shown in the two above - mentioned figures , the method for the waterproofing of joint 11 foresees the use of a strip of waterproofing membrane 13 , of suitable width , obtained from a sheet of flexible and elastically yieldable material , with a low permeability , which is installed on the whole vertical development of joint 11 so that it entirely covers it , if needed prolonging it in correspondence with the dam heel in order to allow the connection with the waterproofing system of a curb or a foundation beam , as it will be further explained . strip 13 of waterproofing material is installed external to the upstream face 10 in order not to interfere with the construction of the dam . in order to adequately support the waterproofing membrane 13 and to avoid the membrane to be damaged by puncturing or intrusion in the crack , according to this invention it is foreseen to previously install a suitable support element for supporting the membrane 13 which prevents the intrusion of the same membrane 13 into the joint 11 under the thrust of the hydraulic load of the water impounded in the upstream reservoir , or due to any movement of the dam body . the support element for supporting the waterproofing membrane must be executed in such a way as to be able to follow the maximum allowed opening movements of the contraction joint 11 under the maximum foreseen hydraulic load , and the subsequent closing movements , without interfering with the strip of the waterproofing membrane . the support element can consist of one or more rigid plates in steel or another kind of material , connected to the concrete body of the upstream face , and placed across joint 11 so as to allow relevant movements . more precisely , in the example shown in fig1 and 2 , the support element consists of two plates 14 and 15 , partially overlapped ; each plate is fastened at spaced apart points , along only one lateral edge , by means of anchoring rods , respectively 16 and 17 , so as to allow free sliding of the two plates one over the other during the opening and closing movements of joint 11 , while allowing support of membrane 13 . the two supporting plates 14 and 15 consist of one or more shaped portions , axially aligned , which extend for the whole length of joint 11 . in order to prevent the waterproofing membrane 13 from any failures or puncturing actions caused by the supporting plates 14 and 15 , and in order to grant the independence of movement between the support plates and the same membrane , one or more protection and sliding substrates are interposed , between the supporting plates and the waterproofing membrane 13 , said substrates being fastened to the concrete body of the upstream face 10 , on both side of the supporting plates 14 , 15 . more precisely , as shown in fig1 and 2 , immediately over the supporting plates 14 and 15 , a transition substrate 13 of considerable thickness is provided , for examples having a weight from 0 . 5 to 3 kg / m 2 , comprising a synthetic sheet material , preferably a geotextile with great mass per unit area ; over the transition substrate 16 a second sliding substrate 19 is overlapped , in geosynthetic material , for example constituted by a strip of the same material used for the membrane 13 waterproofing the joint , in order to grant a free sliding movement of the same membrane in respect to the joint . both the protection substrate 18 and the sliding substrate 19 are fastened at spaced apart points to the concrete existing surface 10 by means of anchoring rods 20 . therefore the two substrates 18 and 19 have a double function , namely : the protection layer or layers 18 , in geotextile or other suitable material , avoid that the mutual sliding of the two supporting plates 14 and 15 interferes with the waterproofing strip 13 , damaging it for example because of the puncturing action of the edges of the plates themselves , while the sliding substrate 19 , besides constituting a further mechanical support and additional protection for strip 13 of the waterproofing membrane , allows also a free sliding of the membrane over substrates 18 and 19 and over the supporting plates 14 and 15 during the dilatation and contraction movements of joint 11 . as shown in the enlarged section of fig2 strip 13 of the waterproofing membrane is watertight fastened against the concrete existing surface of the facing , along its lateral edges , in a way totally independent from the substrates 18 and 19 and the supporting plates 14 and 15 . for this purpose , metal profiles 21 have been applied along the lateral edges of membrane 13 ; these profiles tightly press the edges 13 ′ of the membrane against the surface of the upstream face 10 , also foreseeing the interposition of a suitable watertight gasket 22 . the face or surface on which the watertight fastening is constructed is previously regularised by the application of proper material 22 ′, such as epoxy resins and similar . the metal profiles 21 are fastened by means of threaded rods 23 anchored in the concrete , on which the blocking nuts 24 are screwed with interposition of suitable washers . in this way a continuous watertight line is constructed along the two edges of the waterproofing membrane 13 . as previously described , the waterproofing method employs , as a waterproofing element , a flexible synthetic , elastically yieldable , in form of a strip comprising one or more sections suitably welded one to the other , which extends for the whole length of the contraction joint 11 ; the waterproofing membrane 13 is preferably composed by a geocomposite consisting of a low permeability synthetic geomembrane coupled to a geosynthetic material having different properties . therefore only the waterproofing geomembrane is exposed to the action of the reservoir , while the coupled geocomposite is suitably protected and constitutes a further antipuncturing and supporting layer which increases the dimensional stability of the geomembrane itself . the flexibility and the elasticity of the synthetic geomembrane and of the system by which it is fastened to the dam concrete face , over joint 11 to be protected , are such as to allow the membrane to elastically deform along its entire extension , following the opening and closing movements of joint 11 under the maximum foreseen hydraulic load , or due to other causes . as shown in fig2 over the waterproofing membrane 13 , slightly detached from it , it is possible to add an additional protection which substantially consists of a shield 25 which extends for the entire length of the waterproofing membrane and beyond its lateral edges , for example a steel slab separately and independently fastened to the upstream face by means of anchoring rods 26 , slab 25 being supported by means of spacers 27 and bolts 28 that can be screwed on the threaded end of the rods . in order to allow the protection shield 25 a sliding movement independent from the movement of the protection membrane , on one side of shield 25 the anchoring rods 26 are placed through holes 29 , which are oval - shaped or have larger dimensions , to allow a relative movement in transverse and / or longitudinal direction in respect to the protection shield 25 as seen in fig3 . as previously described , the membrane 13 for the waterproofing of the joint can be extended in correspondence of the dam heel so as to allow the connection with the waterproofing system of a curb or a foundation beam , as schematically represented in the example of fig5 and 6 of the attached drawings . the connection is executed by extending and positioning membrane 13 over the foundation beam 30 to which it is fastened by means of proper mechanical anchoring profiles . the flat 13 ″ of the membrane is extended on the beam 30 for a brief stretch of 30 - 40 cm , in any case so long as to be sufficient to overlap on area 31 where the waterproofing of a joint in the foundation beam may have been executed , for example by injection into a proper sump of epoxy resins or similar , or by waterstops in pvc or similar . as shown in fig5 and 6 , flap 13 ″ of the membrane is watertight anchored along its three edges by means of metal profiles 32 which are fastened by means of anchoring rods 33 . a ballast 34 can be placed on the folded part 13 ″ of the waterproofing membrane , upon previous interposition of further protection synthetic material 35 , in order to allow a close contact between the waterproofing membrane and the grout curtain . the flap 13 ″ of the membrane can be physically connected to material 31 waterproofing the beam joints , for example by means of an adhesive 36 or by welding , according to the material employed . with this configuration , the waterproofing of the joint is connected with the beam at the dam heel , achieving a continuity between the waterproofing of the joint on the upstream face , the waterproofing of the foundation beam , and the grout curtain that is generally provided in the foundation beam towards the underlying ground . the upper fastening of membrane 13 is similar to the lateral ones which have already been described . the waterproofing method for joints , previously described , beside being suitable for waterproof the contraction joints in rcc dams , can also be employed for restoring waterproofing in correspondence of deteriorated construction joints of concrete dams , or of cracks which should occur over time , for different causes , in the faces of concrete dams , or in the concrete face of embankment dams , or in the faces of other concrete or masonry structures . the waterproofing method results substantially identical to the previously described one and can be applied both at the end of construction of the dam , and as a rehabilitation intervention to waterproof joints of existing hydraulic structures , as well as cracks produced by the deterioration of concrete . should the waterproofing not be extended over the foundation beam , the perimeter fastening of the membrane at bottom is similar to the one adopted for watertight fastening the lateral edges . fig7 and 8 of the attached drawings show the perimeter anchorage 37 at the bottom of a waterproofing membrane 13 should this membrane not reach the foundation beam 30 or the heel of the hydraulic structure . in this case it is possible to connect the waterproofing obtained with membrane 13 in the above - mentioned way , to a pre - existing joint 39 which has deteriorated , or to a crack , by means of injecting a sealing material 38 into a hole which has been put in contact with the crack or the defective joint 39 . from what has been said and shown in the attached drawings , it will therefore be evident that we have provided a method for the waterproofing of joints for roller compacted concrete dams , concrete dams , or embankment dams with a concrete upstream face , and for the waterproofing of deteriorated joints and / or cracks in concrete and / or masonry structures . hence , what has been said and shown with reference to the attached drawings has been given as a mere example of the general principles of the invention and of some of its preferential constructive configurations ; other modifications or variants can be made without departing from what claimed .	4
referring now to fig1 therein is shown a detailed block diagram of a circuit for generating video signals which , when applied to a raster scan display , will display alpha - numeric or other symbols on the screen of the display . the timing functions of the video signal generator shown in fig1 are generated by crystal oscillator 10 and a binary counter made up of dot counter 11 , character counter 12 , scan line counter 13 , character line counter 14 , and block blank counter 15 . these counters are used to divide the display screen of a raster scan display into a multiplicity of rows of character blocks in each of which a symbol may be displayed . in addition , each character block is subdivided into rows and columns of elemental spaces which are selectively illuminated to display a symbol . gate matrix 16 , read only memory ( rom ) 17 , rom 18 , rom 19 , are responsive to the contents of counters 11 , 12 , 13 , and 14 to which they are connected to decode the count and provide the timing signals required to generate a standard composite video signal comprising character display information and vertical and horizontal blanking and synchronization signals . i also provide a character generator for generating video signals of the alpha - numeric information and symbols to be displayed on the display area of a raster scan display . this character generator is made up of memory mapping decoder 26 , memory 27 , line buffer 28 , character generator 29 , and video shift register 30 all of which cooperative in a manner well known in the art but are described in greater detail hereinafter . i also provide filter 21 , zero crossing detector 22 , mono - pulser 23 , and flip - flop 25 which , in accordance with the teaching of my invention are used to control counters 12 , 13 and 14 once per cycle of the alternating current ( a . c ) public utility power line or other source providing power to my raster scan display in order to operate my raster scan display in synchronization with the power line and thereby eliminate line frequency beating . crystal oscillator 10 in the video signal generator of fig1 is the one signal source from which all timing functions of the video generators are derived . oscillator 10 drives the binary counter made up of counters 11 , 12 , 13 , 14 and 15 . counter 11 is the lowest order stage at the binary counter and provides an output on lead 48 when subdivides a character block into columns of elemental spaces . gate matrix 16 is responsive to the output from counter 11 on lead 48 to provide a pulse train output on lead 34 . these pulses are referred to in the art as dot pulses and there is one dot pulses generated for each elemental space scanned by the scanning beam of the display device . output lead 34 from matrix 16 applies the dot pulses to video shift register 30 of the character generator . the dot pulses applied to video shift register 30 cause a video signal to be generated in direct synchronization with the scanning beam of the display device as will be discussed in greater detail further in this specification . dot counter 11 also provides an output which is connected via lead 49 to the lowest order counting stage of character counter 12 . the binary count in character counter 12 indicates which character block in a row of character blocks is presently being scanned on the display device . as the scanning beam of the display device finishes scanning one scan of a row of character blocks there is a pulse output from counter 12 on lead 51 . the binary count in character counter 12 is also output on lead 50 to rom 17 which is programmed to provide outputs on its output leads 35 , 36 , 37 , 38 and 39 which are described now and further in the specification . the output from rom 17 on lead 35 is input to memory mapping decoder 26 of the character generator and indicates when the scanning of the display device has finished scanning the last character block on one scan line . when the binary count in counter 12 indicates completion of each scan line on the display screen there is an output from rom 17 on lead 36 used to initiate generation of horizontal blanking and synchronization signals by rom 20 as described further in the specification . the output from rom 17 on lead 37 , an input to line buffer 28 indicates to buffer 28 which character blocks in a row of character blocks are bing scanned to allow characters shifting by the character generator . th output from rom 17 on lead 38 is applied to one of the three inputs of nand gate 24 and indicates completion of each scan line on the display screen . the output from rom 17 on output lead 39 is said to rest input r of character counter 12 and causes character counter 12 to be reset to a starting state concurrent with the initiation of each horizontal synchronization signal . character counter 12 then recounts keeping track of which character of a row of characters is being scanned on the next succeeding scan of the raster . as mentioned previously , the output from character counter 12 on lead 51 indicates when the scanning beam of the display device has completed one horizontal scan and causes scan line counter 13 to be incremented thereby indicating that the next scan line of the display device is being traced by the scanning beam of the display device . the outputs from scan line counter 13 on leads 52 are input to rom 18 which decodes the contents of counter 13 and provides outputs on leads 40 , 41 and 42 also used in timing circuit functions in the video signal generator shown in fig1 . there is a signal applied to output leads 40 by rom 18 indicating which scan line of a row of characters is being displayed . the signal on leads 40 is input to character generator 29 which cooperates with video shift register 30 , as detailed further in the specification , to generate the video signal for the particular scan line of a character presently being scanned by the scanning beam of the display device . there is a signal applied to lead 41 by rom 18 upon completion of scanning of all scan lines for a row of character blocks . the signal on lead 41 is input to rom 20 and is used to initiate the generation of a vertical blanking and synchronization signal at the proper time . rom 18 also applies a signal to lead 42 that is input to nand gate 24 indicating the end of scanning of each character line . the function of nand gate 24 is described further in the specification . rom 18 also applies a signal to lead 43 which is applied to the reset input r of scan line counter 13 after the last scan line of a row of character blocks has been scanned . this signal applied to input r of counter 13 resets scan line counter 13 to an initial count so that counter 13 may count the scan lines for the next row of character blocks to be displayed on the display device . there is an output from the highest order stage of scan line counter 13 on lead 53 which also indicates when the last scan line of a row of character blocks has been scanned . the pulse on lead 53 is input to character line counter 14 to increment counter 14 so that the binary count therein is indicative of the next row of character blocks on the display device to be scanned by the scanning beam . the binary counter stages of counter 14 are connected via leads 54 to r0m 19 which decodes the contents of counter 14 and provides a timing output signal on leads 44 , 45 , 46 and 47 . when the last row of character blocks on the display device has been completely scanned and character line counter 14 is again incremented by counter 13 , rom 19 applies a signal to lead 44 that is input to memory mapping decoder 26 which causes the next row of character blocks to be displayed as described further in the specification . rom 19 applies a signal to lead 45 following completion of scanning of the last row of character blocks displayed on the display device . the signal is input to rom 20 to initiate the generation of the vertical blanking and synchronization signals . rom 19 also applies a signal to lead 46 that is input to nand gate 24 indicating that the last scan line on the screen of display device has been scaned and , as will be described in greater detail further in the specification , causes scan line counter 13 and character line counter 14 to cease counting . finally , rom 19 applies a signal to lead 47 which is applied to reset input r of character line counter 14 to reset counter 14 to an initial count . this prepares a counter 14 to count the character blocks scanned on the next succeeding vertical trace of the display device screen . when the count in line counter 14 indicates that the last scan line has been scanned during one vertical trace an output signal is applied to lead 55 which is input to field counter 15 . field counter 15 is a single stage counter whose binary content changes between its 0 and 1 state on odd and even interlaced scan fields respectively . the generation of interlaced fields is well known in the art and is not described here . accordingly , no output is shown from field counter 15 . in summary , crystal oscillator 10 and counters 11 , 12 , 13 , 14 and 15 cooperate to provide binary signal outputs used to control all functions of the video signal generator shown in fig1 . binary count in the counter comprising counters 11 , 12 , 13 , 14 and is are decoded by gate matrix 16 and rom &# 39 ; s 17 , 18 and 19 provide the exact control signals required by the video signal generator . in accordance with the teaching of my invention , i do not try to synchronize the frequency of crystal oscillator 10 with the frequency of the public power . instead , oscillator 10 causes a predetermined binary count of character line counter 14 to indicate that all character lines displayed on the display device have been completely scanned by one vertical scan of the scanning beam of the display device in a time period that is less than the period of any possible frequency of public utility power with which the display device may be powered . the predetermined binary count is sensed by rom 19 which provides an output via lead 46 to one of the three inputs of nand gate 24 . in addition , when the binary count in scan line counter 13 indicates that the last scan line of the last character line has been scanned , its associated rom 18 provides an output via lead 42 to the second input of nand gate 24 . finally , when the binary count in character counter 12 indicates that the last character of a line has been scanned by its associated rom 17 provides an output via lead 38 to the third input of nand gate 24 . thus , all three inputs of nand gate 24 are energized when the scanning beam has finished a complete scan of the display device . at that time there is an output from nand gate 24 which energizes set input s of flip flop 25 causing the flip flop to be placed in its 1 state . with flip flop 25 being in its 1 state there is a signal output therefrom via lead 71 which is applied to the enable input e of both scan line counter 13 and character line counter 14 causing these counters to cease counting . counters 11 and 12 , however , are allowed to continue counting . as will now be described , flip flop 25 is returned to its zero state to reenable scan line counter 13 and character line counter 14 in direct synchronization with a frequency of the public utility power line from which the display device is powered . counters 13 and 14 then cause generation of a vertical blanking and synchronization signal . in this embodiment of my invention my video signal generator is powered by 110 volts a . c . 60 hz source 58 . however , in accordance with the teaching of my invention , the frequency of the public utility power line may just as well be 50 hz which is found in many countries of the world . the public utility power line source 58 is applied to filter 21 , which is advantageously a low voltage winding of a power transformer in a power supply ( not shown ) powering my video signal generator . the output of filter 21 is a low voltage a . c . signal of the same frequency as the public utility power line which is input to zero crossing detector 22 . as is well known in the art , a zero crossing detector 22 provides an output signal once per cycle of the public utility power line . monopulser 23 is responsive to each output signal from detector 22 to generate a shaped pulse which is applied to reset input r of flip flop 25 . in accordance with the teaching of my invention monopulser 23 applies a pulse to reset input r of flip flop 25 several microseconds after flip flop 25 has been placed in its one state causing counters 13 and 14 to cease counting . the time difference between flip - flop 25 being placed in its one state and being reset to its zero state is longer when the public utility power line has a frequency of 50 hz than when power line frequency is 60 hz as is recognizable to one skilled in the art . when flip flop 25 is returned to its zero state , once per cycle of the power line , counters 13 and 14 are reenable to count from the last binary count . when character counter 12 indicates the scanning beam has finished a horizontal sweep it applies a signal via lead 51 which increments the count is scan line counter 13 which then causes character line counter 14 to be incremented . the higher binary count in counters 12 , 13 and 14 is sensed by rom &# 39 ; s 17 , 18 and 19 , respectively . r0m 17 applies a signal via lead 39 to reset input r of counter 12 returning it to a start count state . rom 18 applies a signal via lead 43 to reset input r of counter 13 resetting it to a start count state . rom 19 applies a signal via lead 19 to reset input r of character line counter 14 returning it to its start count state . in this manner , scan line counter 13 and character line counter 14 are effectively synchronized with the frequency of the public utility power line powering the display device and line frequency beating seen on the display device is eliminated . before describing the generation of video signals for the display of alpha - numeric information or symbols on the display device i first describe the generation of horizontal and vertical synchronization signals . as previously described , rom 17 is responsive to the count in counter 12 to provide a signal on lead 36 indicating when the last possible character space in a character line on the display device has been scanned by a single scan line . at this time the scanning beam is deflected off - screen and does not commence another horizontal scan until horizontal blanking and sync signals are generated . the aforementioned signals output on lead 36 from rom 17 causes rom 20 to generate the horizontal blanking and sync signals on its output lead 56 to be amplified by amplifier 31 and mixed with the remainder of the video signal by network 33 as is described in greater detail further in the specification . more particularly , the binary count of character counter 12 is incremented several more counts in direct correspondence with the scanning beam sweeping from the last displayed character in a line of characters to an off - screen position . this higher binary count of counter 12 is sensed by rom 17 which then applies the signals to lead 36 to be input to rom 20 . upon being incremented to a still higher count than that to initiate generation of the horizontal blanking and sync signals rom 17 applies a signal via lead 39 to reset input r of counter 12 causing it to be reset to its start count . character counter 12 then recounts in synchronization with the next horizontal scan of the display device . generation of vertical blanking synchronization signals is controlled by the binary count in scan line counter 13 and character line counter 14 . it is well known in the art to provide a buffer space at the bottom of the screen of the display device below the last line of characters displayed on the screen . following the last counter line of characters displayed on the screen , scan line counter 13 and character line counter 14 continue to count until character line counter 14 is incremented a few more counts indicative of the scanning beam of the display device having finished scanning vertically to an off screen position . at this time , the binary counts in character counter 12 , scan line counter 13 and character line counter 14 indicate that the scanning beam is at the lower right hand corner of the screen in an off screen position . output leads 38 , 42 and 46 of rom &# 39 ; s 17 , 18 and 19 respectively are all energized resulting in an output from nand gate 24 thereby causing flip flop 25 to be placed in its one state as described previously . also , as previously described , flip flop 25 being in its one state causes a signal to be applied via lead 71 to enable input e of counters 13 and 14 resulting in these counters being disabled from counting until flip flop 25 is reset to its zero state . upon flip flop 25 being reset to its zero state as described previously , scan line counter 13 and character line counter 14 commence counting from their last binary count . both counters 13 and 14 are incremented after being reenabled and the incremented counts therein are detected respectively by rom &# 39 ; s 18 and 19 . at this time rom 18 applies a signal via lead 41 to rom 20 and rom 19 applies a signal via lead 45 to rom 20 . there is also an input to r0m 20 directly from scan line counter 13 via lead 72 which also has a signal thereupon . with these signals present on leads 41 , 45 and 72 and input to rom 20 , the rom is programmed to output a vertical blanking and synchronization signal on lead 56 which is amplified to an appropriate level by amplifier 31 . the amplified blanking and synchronization signal is then input to summing networks 33 where it is mixed with the video display signal to create a composite video signal that is output from network 33 to drive a raster scan display ( fig . 2 ) which is described further in the specification . turning now to describe the generation of video signals for the display of alpha - numeric or other symbols . the video signal generator apparatus comprises memory mapping decoder 26 , memory 27 , line buffer 28 , character generator 29 , video shift register 30 , and amplifier 32 . elements 26 , 27 , 28 , 29 , 30 and 32 cooperate in a way that is well known in the art to generate video signals for the display of alpha - numeric information on a display device , so video signal generator is not described in great detail herein . the video signal generator apparatus is under control of the counters and associated decoding rom &# 39 ; s described heretofore to display information at the proper positions on the screen of the display device . memory mapping decoder 26 has two inputs thereto . the first input is from rom 17 via lead 35 which indicates the end of scanning of each scan line . the second input is provided by rom 19 via lead 44 and indicates when each line of characters has been completely scanned during either an odd or even interlaced field . at the end of scanning of the last scan line of a complete line of characters on the display device the signals on these two inputs via leads 35 and 44 to memory mapping decoder 26 causing coded information to be read out from membory 27 indicating the next succeeding line of characters to be displayed on the display device . this coded information is stored in line buffer 28 prior to commencement of scanning of the particular line of characters . line buffer 28 has a second input thereto from rom 17 via lead 37 indicating which character is presently being scanned by the scanning beam of the display device . the signal on lead 37 causes an ascii coded signal representing the character to be scanned to be input to character generator 29 . as is well known in the art , character generator 29 may comprise a commercially available integrated circuit which is preprogrammed for the alpha - numeric or other symbols to be displayed . character generator 29 has another input via lead 40 from rom 18 indicating which scan line is being scanned for a row of characters . in response to these inputs via leads 37 and 40 , character generator 29 provides an output in parallel format to video shift register 30 at the beginning of each scan line of each character . the output from generator 29 indicates which elemental spaces along the particular scan line are to be illuminated in order to properly display a character . video shift register 30 has an input thereto via lead 34 from gate matrix 16 . this signal on lead 34 is a stream of pulses synchronous with the scanning beam scanning each elemental space or dot on the face of the display device . these dot pulses cause the contents of register to be shifted out in serial formate to make up the video signal . the video signal output from video shift register 30 is amplified by amplifier 32 and input to summing network 33 where it is mixed with vertical and horizontal blanking and synchronization signals in a manner well known in the art to create a composite video signal . turning now to fig2 therein is shown a block diagram of a crt display used to display alpha - numeric or other symbol information in response to the composite video signal generated by the video signal generator of fig1 applied to input 59 of the display . the video signal at input 59 is amplified by video amplifier 60 and , in a well known manner , vertical sync separator 62 separates vertical sync pulses from the video signal and horizontal sync separator 64 separates horizontal sync pulses from the video signal . the video signal is further amplified by video amplifier 61 and applied to control grid 69 of cathode ray tube 66 to modulate the scanning beam of tube 66 . in accordance with the teaching of my invention , vertical and horizontal sweep oscillators and phase lock loop circuitry are not provided . instead , vertical sweep generator 63 and horizontal sweep generator 65 are one - shot ramp generators and are used to provide ramp deflections signals . horizontal ramp deflection signals generated by generator 65 are applied to magnetic deflection coils 68a and 68b around the neck of cathode ray tube 66 and vertical ramp deflection signals generated by generators 63 are applied to deflection coils 67a and 67b . horizontal sweep generator 65 generates one ramp signal at a time and each ramp signal causes the scanning beam to sweep across the face of crt 66 and remain off screen at full deflection until another horizontal sync pulse is detected by sync separator 64 . in response to a subsequent horizontal sync pulse , sync separator 64 generates a signal causing horizontal sweep generator 65 to generate another ramp deflection signal . vertical sync separator 62 and vertical sweep generator 63 operate in the same manner as previously described for horizontal sync separator 64 and horizontal sweep generator 65 . the ramp deflection signal generated by vertical sweep generator 63 causes the scanning beam of crt 66 to vertically sweep the display area of crt 66 in a time period less than the period of any possible frequency of public utility power that may be used to power the display . typically , the frequency of the public utility power will only be either 50 hz or 60 hz . the period of 50 hz power is 20 milliseconds while the period of 60 hz power is approximately 17 milliseconds and the slope of the vertical deflection signal generated by sweep generator 63 causes the scanning beam of crt 66 to scan the face thereof in 15 milliseconds . after a complete vertical scan the beam remains off screen until another vertical sync pulse is detected by sync separator 62 which then triggers sweep generator 63 to generate another vertical ramp deflection signal . as the sync pulses are generated in response to the public utility power the scanning beam of crt 66 operates in synchronization with the public utility power providing power to the display device and line frequency beating is eliminated without the use of synchronization circuits such as phase lock loop circuits . it is apparent that various modifications may be made to my invention without departing from the spirit and scope of the invention .	7
a fast , low - power automated test system is provided through the use of an improved formatter . the formatter may be implemented in cmos , or any other suitable technology , which allows the formatter to draw low power and to be integrated into the same semiconductor devices used to implement timing generators or other portions of a test system . the inventors have appreciated that fast test and low power operation may be achieved with simple and low power formatter circuitry that can combine multiple edge signals to generate a formatted output signal . in some embodiments of the invention , the formatter has multiple signal paths , each path providing a timed edge signal in the form of a narrow pulse . each pulse signal may be selectively coupled to either the set or reset port of an sr latch based on format data . the sr latch is set at times corresponding to the logical oring of the narrow pulse signals that have been selected for coupling to the set port . similarly , the sr latch is reset at times corresponding to the logical oring of the narrow pulse signals that have been selected for coupling to the reset port . by using simple circuitry to combine edge signals in this way , the formatted output signal may have multiple state transitions per cycle , allowing the tester to generate signal for testing high - speed devices yet the simple circuitry consumes low power . fig2 shows a portion of an ate system according to an embodiment of the invention . specifically , the portion shown is part of a channel 110 comprising timing generator 130 and driver 160 which may be as in a known test system . here formatter 150 ′ differs from a known formatter design . as in a known tester , timing generator 130 provides edge signals at programmed times . formatter 150 ′ combines edge signals into a signal of a desired format . driver 160 is connected to a test point of the dut associated with channel 110 . however , the output of formatter 150 ′ may be used to drive a comparator or used in any other suitable way . in the example of fig2 , channel 110 has a total of n signal paths , 10 - 1 to 10 - n . in the embodiment illustrated , the signal paths 10 - 1 to 10 - n are the same . however , the specific construction of each signal path is not critical to the invention and any suitable construction may be used for the signal paths . each signal path 10 - 1 . . . 10 - n has an input 21 - 1 . . . 21 - n connected to edge signal generator 70 , which is part of timing generator 130 . in the embodiment illustrated , each signal path 10 - 1 . . . 10 - n may receive and process an edge signal . these edge signals are combined , according to format data 43 - 1 . . . 43 - n and form inputs to sr latch 50 . outputs 42 - 1 . . . 42 - n from signal path 10 - 1 to 10 - n are connected to the set port 42 of sr latch 50 , and outputs 44 - 1 . . . 44 - n are connected to reset port 44 . in some embodiments , the connection of the plurality of outputs 42 - 1 to 42 - n to the set port 42 of sr latch 50 forms a wired or . a wired or connection allows outputs of signal paths 10 - 1 . . . 10 - n to be connected directly to input ports 42 and 44 of sr latch 50 without intervening buffers or logic gates . such a connection is possible even though the circuitry of fig2 may be implemented on a cmos integrated circuit because of the design of the output stage of signal paths 10 - 1 . . . 10 - n and the input stage of sr latch 50 . in the embodiment illustrated , the output stage of each signal path is implemented as a current steering element that may either sink current or present a high impedance , depending on the state of the signal in the signal path to be “ ored ” with outputs of other signal paths . also , the inputs to sr latch 50 , even though sr latch 50 may be implemented in cmos , are coupled to pull - up components . an example embodiment of cmos circuitry that can form a wired or connection is provided below in fig4 . similarly , in some embodiments , the connection of the plurality of outputs 44 - 1 to 44 - n to the reset port 44 of sr latch 50 forms a wired or . taking signal path , such as signal path 10 - i as representative , each signal path , may comprise circuit components that generate a set or reset control input to sr latch 50 . in the example illustrated , signal path 10 - i includes interpolator 20 - i , pulse shrinker 30 - i , and current steering circuit 40 - i . interpolator 20 - i may be an interpolator as is known in the art . an example implementation of pulse shrinker 30 - i and current steering circuit 40 - i is provided in conjunction with fig4 below . in other embodiments , different or additional components may be connected in the signal path or components may be connected in a different order . for example , the interpolator may follow the pulse shrinker . as another example , the interpolator may not be present in some signal paths . accordingly , the specific circuit components in each signal path are not critical to the invention and any suitable components may be used . in signal path 10 - i , the timing of an edge pulse is controlled by edge signal generator 70 and an interpolator 20 - i . each of these components may be cmos components as is known in the art , though any suitable components may be used . interpolator 20 - i selectively delays an edge signal received via signal path input 21 - i from edge signal generator 70 according to delay information received via delay input 23 - i . the delay information may be written to delay input 23 - i by pattern generator 120 ( fig1 ) or any other suitable source . in the embodiment illustrated , interpolator 20 - i outputs an edge signal in the form of a pulse . the rising edge of the pulse signal represents the timing edge and occurs at a time specified by information written to delay input 23 - i in conjunction with other timing data that may be applied to timing generator 130 . accordingly , the output of interpolator 20 - i may be regarded as a delayed edge signal , with the amount of delay being used to control the time at which the edge signal is input to formatter 150 ′. within formatter 150 ′, the delayed edge signal output by interpolator 20 - i may be coupled to pulse shrinker input 31 - i . pulse shrinker 30 - i outputs a short pulse in response to the delayed edge signal received via pulse shrinker input 31 - i . in some embodiments pulse shrinker 30 - i may be a monostable multivibrator as is known in the art . such a circuit has a stable output state . in response to an input , the output state may change from its stable state . however , once the output state changes , its state is no longer stable and the output state will quickly revert to the stable state . consequently , the output state pulses in response to an input . the duration of the pulse output by pulse shrinker 30 - i depends on the characteristics of pulse shrinker circuit 30 - i , allowing pulse shrinker circuit 30 - i to output a relatively narrow pulse , regardless of the duration of a pulse or other signal format output by interpolator 20 - i . the timing of the output of pulse shrinker 30 - i is driven by the timing of a signal input to pulse shrinker 30 - i . the width of the output pulse may be controlled by the design of pulse shrinker 30 - i . in some embodiments , the duration of the pulse will be long enough to ensure that a pulse , after propagation through current steering circuit 40 - i , is long enough to activate sr latch 50 . otherwise , the pulse may be as short as practical . however , pulse shrinker 30 - i may be implemented in any suitable way . in the embodiment illustrated , a “ pulse shrinker ” circuit is used because the output of interpolator 20 - i may be a pulse . however , a monostable multivibrator may respond to inputs of other types . the pulse shrinker may output a short pulse in response to a signal containing any suitable feature of the delayed edge signal . the feature may be a rising edge , a falling edge , the crossing of a threshold , or any other feature of the delayed edge signal . in some embodiments , the input delayed edge signal and output short pulse may have associated pulse widths . in some such embodiments , the pulse width of the short pulse is shorter than the pulse width of the delayed edge signal . the pulse shrinker output may be coupled to current steering circuit input 41 - i . current steering circuit 40 - i receives a short pulse from pulse shrinker 30 - i and may for a short time sink current at an output 42 - i or 44 - i , selectively depending on control inputs provided to current steering circuit 40 - i . the length of time that current steering circuit 40 - i sinks current may depend on the duration of the pulse output by pulse shrinker 30 - i . which output 42 - i or 44 - i sinks current may depend on the format data received via format input 43 - i . the format data specifies the effect on the output of formatter 150 ′ of an edge output by interpolator 20 - i . in the embodiment illustrated , the format data may indicate whether , at a time dictated by the edge output by interpolator 20 - i , the output of sr latch 50 should be set in a high output state or reset to a low output state . in the embodiment illustrated in fig2 , when format data 43 - i indicates that the edge produced by interpolator 20 - i should cause the output of formatter 150 ′ to transition to a high state , current steering circuit 40 - i briefly sinks a current pulse at its output 42 - i , causing a state at input port 42 that sets sr latch 50 . conversely , when format data 43 - i indicates that an edge output by interpolator 20 - i should cause the output of formatter 150 ′ to transition to a low state , current steering circuit 40 - i produces a current pulse at output 44 - i that places input port 44 into a state that resets sr latch 50 . when current steering circuit 40 - i produces a current pulse at its output 42 - i when sr latch 50 is already in a set state , the state of sr latch 50 does not change . sr latch 50 may be in a set state , either because of a prior pulse at output 42 - i or a prior output pulse at any of the corresponding outputs 42 - 1 . . . 42 - n in any of the signal paths 10 - 1 . . . 10 - n , all of which are similarly coupled to input port 42 through a “ wired or ” connection . conversely , if sr latch 50 is already in a reset state when current steering circuit 40 - i produces a current pulse at output 44 - i , sr latch 50 retains its reset state . sr latch 50 may be in a reset state because of a prior current pulse on output 44 - i or a corresponding output 44 - 1 . . . 44 - n in any of the signal paths 10 - 1 . . . 10 - n , all of which are similarly coupled to input port 44 through a “ wired or ” connection . in the embodiment illustrated , edge signal generator 70 and interpolator 20 - 1 . . . 20 - n may be programmed so that signals applied at set input port 42 and reset input port 44 of sr latch 50 are not simultaneously asserted . reducing the width of pulses produced by pulse shrinker circuits 30 - 1 . . . 30 - n decreases the likelihood that a pulse may simultaneously be applied to set input port 42 and reset input port 44 . however , in embodiments in which sr latch 50 exhibits a suitable behavior in response to signals asserted at both set input port 42 and reset input port 44 , it may not be necessary to program edge signal generator 70 and interpolators 23 - 1 . . . 23 - n to avoid overlapping pulses at set input port 42 and reset input port 44 . the format data received by current steering circuit 40 - i via format input 43 - i may be generated by pattern generator 120 or any other suitable source . format data may be encoded or transmitted in any suitable form . for example , in some embodiments format data may be transmitted serially as a binary code . in other embodiments , the information may be transmitted in parallel . in some embodiments the format data is transmitted as a differential signal . in yet other embodiments an analog signal may be used . regardless of the programming used in each signal path 10 - 1 . . . 10 - n , the set or reset state of sr latch 50 may be used to control the value output by channel 110 ′ at any given time . the output , q 52 , of sr latch 50 adopts the state associated with the asserted port , taking on a high state if set port 42 is asserted or a low state if reset port 44 is asserted . in the embodiment illustrated , the output of formatter 150 ′ controls a drive signal . the outputs q 52 and not q 54 of sr latch 50 are connected to driver 160 , which generates a drive signal corresponding to the state of the sr latch outputs . sr latch outputs driver output z_p 62 and z_n 64 , here shown as a differential signal , may be coupled to a dut or other test point . in the embodiment illustrated , driver 160 has a differential output . in some embodiments , a single ended driver may be used and only one of z_p 62 and z_n 64 may be connect to a dut test point . in some embodiments , only one of z_p 62 and z_n 64 may be generated . in the embodiment illustrated in fig2 , formatter 150 ′ provides an output that controls a signal driven to a device under test . in other embodiments , formatter 150 ′ may alternatively or additionally be coupled to a comparator . the comparator may measure a signal received from a device under test in a window defined by the output of formatter 150 ′. accordingly , the specific function controlled by the output of formatter 150 ′ is not a limitation of the invention . having provided an overview of the operation of the part of formatter 150 ′, an embodiment having four signal channels is used to illustrate an example of operation . fig3 is a timing diagram illustrating input signals , internal signals , and output signals of signal paths 10 - 1 . . . 10 - 4 during the operation of channel 110 ′. the signals are grouped into input signals s 31 , format signals s 43 , set signals ss 42 , reset signals ss 44 , and latch signals s 40 . the signals shown in fig3 may be observed on the inputs and outputs of similar reference designation of the signal channels in fig2 . for example input signal s 31 - 1 may be observed on input 31 - 1 of signal path 10 - 1 . each signal in fig3 may take an asserted “ high ” state , or an unasserted “ low ” state . the high state is indicated by a thick line raised above the thin guide line , while the low state is indicated by a thick line imposed over the guide line . such a representation may correspond to relative voltage levels . in the example circuit of fig2 , some signals are represented as differential signals . accordingly , a high signal may correspond to relative voltage levels on two conductors rather than an absolute voltage level . these signaling methods are exemplary , however , and any suitable signaling method may be used in embodiments of the invention , including , for example , using a lower voltage to represent a “ high ” state . in this example , input signals s 31 - 1 , s 31 - 2 , s 31 - 3 , and s 31 - 4 are generated by interpolators , such as interpolators 20 - 1 . . . 20 - n ( fig2 ) from signals produced by edge signal generator 70 . each input signal may contain multiple edge signals . in the embodiment of this example , the input signals contain relatively wide pulses , with the leading edge of each pulse , i . e ., the transition from the low state to high state , acting as a triggering edge . in the embodiment of fig2 , the output of pulse shrinker circuits 30 - 1 . . . 30 - n may similarly be in the format of a pulsed signal , but having a narrower width than the pulses indicated in signals s 31 - 1 . . . s 31 - 4 . for simplicity , output signals produced by pulse shrinker circuits 30 - 1 . . . 30 - n are not expressly shown . however , set signals s 42 - 1 . . . s 42 - 4 and reset signals s 44 - 1 . . . s 44 - 4 are shown with a narrower pulse width than input signals s 31 - 1 . . . s 31 - 4 , reflecting the operation of pulse shrinker circuits 30 - 1 . . . 30 - n . this type of edge signal is exemplary , and any other suitable edge signal or trigger signal formats may be used in embodiments of the invention . four edges are illustrated in input signal s 31 - 1 during the time period shown . similarly , three edges are illustrated in each of inputs s 31 - 2 , and s 31 - 3 . two edges are illustrated on input s 31 - 4 . format signals s 43 are shown as signals s 43 - 1 , s 43 - 2 , s 43 - 3 , and s 43 - 4 . pulses received at a current steering circuit 40 - i while the format signal is in a high state are “ steered ” within corresponding current steering circuits 40 - i to cause current to flow into the set output 42 - i . in contrast , pulses received while the format signal is in a low state are “ steered ” to the reset output 44 - i ( fig2 ). in the example , format signal s 43 - 1 transitions from high to low during the time period shown . edge signals received prior to the transition are steered to the set port 42 of latch 50 , while edge signals received after the transition are steered to the reset port 44 of latch 50 ( fig2 ). format signal s 43 - 4 transitions from low to high during the time period shown . edges received prior to the transition are steered to the reset port 44 of latch 50 , while edges received after the transition are steered to the set port 42 of latch 50 . format signals s 43 - 2 and s 43 - 3 do not charge during the time illustrated and are in the low state and high state , respectively , during the time period of this example . latch signals s 40 illustrates the signals received at the set ( 42 ) and reset ( 44 ) ports of the latch 50 ( fig2 ), labeled s 42 and s 44 , respectively . latch signals s 40 also include an output signal on latch output q 52 , labeled q s 52 . q s 52 may be regarded as a single - ended representation of the signal on outputs z_p 62 and z_n 64 ( fig2 ). each of the latch input signals s 42 and s 44 may represent the combination of set and reset signals , respectively , produced in the separate signal paths 10 - 1 . . . 10 - 4 . as illustrated , set signal s 42 includes a pulse 306 corresponding to pulse 302 . a similar correspondence exists between pulses in set signal s 42 and pulse 304 in set signal s 42 - 1 . additionally , set signal s 42 includes pulses corresponding to pulses in the other set signals . as illustrated , set signal s 42 contains a pulse corresponding to each of the pulses in set signal s 42 - 3 and s 42 - 4 . in this way , set signal s 42 is the combination of the set signals output in each of the signal paths 10 - 1 . . . 10 - 4 . in the example of fig3 , the pulses in the set signals s 42 - 1 . . . s 42 - 4 are combined through a logical or operation . reset signal s 44 is similarly a logical or of the reset signals output by each of the signal paths . for example , reset signal s 44 includes a pulse 312 that corresponds to a pulse in reset signal s 44 - 2 . reset signal s 44 includes other pulses , each corresponding to a pulse in a reset signal s 44 - 1 . . . s 44 - 4 . signal q s 52 indicates the output of the sr latch 50 ( fig2 ). the initial state of the sr latch may be established in any suitable way . in this example it is established as low . at the leading edge of each pulse on set s 42 , the output q s 52 rises to the high state , while at the leading edge of each pulse on reset s 44 , the output q s 52 returns to the low state . the signal q s 52 retains its state until another signal changes it . in the example illustrated , a first edge signal appears on input signal s 31 - 1 , with a triggering edge occurring at marker 300 . because format signal s 43 - 1 is high , current steering circuit 40 - 1 “ steers ” a pulse to the set port of sr latch 50 via output 42 - 1 . the steered pulse is observed on set signal s 42 - 1 as pulse 302 . in this example , pulse 302 is illustrated to be shorter than the input edge signal on s 21 - 1 beginning at marker 300 because of the operation of a pulse shrinking circuit . pulse 302 in turn appears as pulse 306 on signal set s 42 . the pulse 306 causes the output signal q s 52 of the sr latch 50 to switch states from low to high as indicated by marker 308 . notice that q s 52 maintains the high state even after pulse 306 has ended . the process continues with the next edge appearing in any of input signals s 31 , which in this example is on signal s 31 - 2 . the edge occurs at marker 310 while the corresponding format signal , s 43 - 2 , is in the low state ( steer to reset port ). in response to this edge , pulse 312 is created on the reset port signal s 44 , which causes output q s 52 to return low as indicated by marker 314 . in some embodiments where the simultaneous excitation of the set and reset ports of the sr latch is a restricted , the time between state changes of output q s 52 may be limited by the pulse width of the applied edges . the use of pulse shrinkers may provide narrower pulses than if input signals s 31 were used to trigger the sr latch directly and thus faster refire time for formatter 150 ′. having provided a description of aspects of channel 110 ′ and an illustration of a signaling method used to produce a channel output , an example implementation of the formatter 150 ′ is presented in fig4 . formatter 150 ′ comprises a pulse shrinker 30 , current steering circuit 40 , and sr latch 50 . driver 160 is also shown . for simplicity , only one signal path 10 is shown . in embodiments of the type shown in fig2 , multiple signal paths 10 - 1 to 10 - n in the form of signal path 10 would each be connected to the sr latch 50 at set port 42 and reset port 44 . the circuitry illustrated in fig4 may be implemented using cmos technology as is known in the art . however , any suitable implementation is possible . the components illustrated in fig4 may be implemented on a single cmos integrated circuit chip . in such an embodiment , other signal paths , such as 10 - 1 . . . 10 - n illustrated in fig2 forming a portion of formatter 150 ′ may similarly be implemented on the same integrated circuit chip . timing generator 130 ( fig2 ) may also be implemented in cmos technology and may be combined on the same integrated circuit chip with formatter 150 ′. because of the relatively simple design provided by formatter 150 ′, in some embodiments , timing generators and formatters for multiple channels may be integrated onto the same cmos integrated circuit chip . in some embodiments , driver 160 may be implemented in a separate integrated circuit chip from a chip containing the formatter and timing generators . however , in embodiments in which a driver is implemented using cmos technology , the driver may likewise be integrated onto the same integrated circuit chip . fig4 illustrates pulse shrinker 30 schematically as a block . any suitable circuitry may be used to implement pulse shrinker 30 . in some embodiments pulse shrinker 30 may be implemented as a monostable multivibrator . the current steering circuit 40 comprises buffer 49 . buffer 49 may be a buffer amplifier as is known in the art . buffer 49 serves to insure that signals at format data input 43 are applied with the appropriate levels to other components within current steering circuit 40 . in the embodiment illustrated , current steering circuit 40 is constructed from multiple transistors nm 1 . . . nm 7 . transistor nm 1 acts as a current source . voltage v mux is provided to the central input of transistor nm 1 to provide a suitable sinking current , i 1 . voltage v mux may depend on the exact circuit configuration and may be adjustable for different circuit and signaling conditions . for example , voltage v mux may be generated with a variable value by a circuit that tracks temperature variations and sets the voltage level to adapt for changes in signal delays caused by temperature variations . temperature compensated cmos circuitry is known in the art , and voltage v mux may be generated using techniques as known in the art . transistors nm 2 through nm 7 will each be “ on ” or “ off ” at different times during operation of current steering circuit 40 , depending on the signals applied to inputs 41 or 43 . depending on the values at those inputs , current steering circuit 40 will sink an amount of current i 1 through either set port 42 , reset port 44 or will draw current i 1 from the voltage rail v dd such that no current flows into current steering circuit 40 from either set port 42 or reset port 44 . when current is drawn through set port 42 or reset port 44 , the state of latch 50 may be set , with a current entering current steering circuit 40 through set port 42 causing latch 50 to enter or remain in a set state . similarly , a current flow into current steering circuit 40 through reset port 44 may cause latch 50 to enter or remain in a reset state . the switching transistor states of “ on ” and “ off ” refer to a substantially conducting state and a high impedance state , respectively . practical transistors may not form perfect open circuits and short circuits when in the off or on state . tolerances may exist for all components , which permit a leakage current and small voltage drop across a transistor in the off and on states , respectively . sr latch 50 comprises pull - up 58 , pull - up 59 , and transistors nm 8 through nm 10 . transistor mn 8 may act as a current source . voltage v j2 is provided to a central input of transistor nm 8 and may have a value that provides a suitable bias current , i 2 . voltage v j2 may depend on the exact circuit configuration and may be adapted for different circuit and signaling conditions , and , like voltage v mux , may be generated by a temperature compensation circuit . as illustrated in fig4 , transistors nm 9 and nm 10 are cross - coupled to create a bi - stable memory cell . in the stable states of that cell , one of transistors nm 9 or nm 10 will be in a conducting state conducting the current i 2 . which of the transistors nm 9 or nm 10 dictates the relative difference in voltage at output ports q 52 and not q 54 . accordingly , the state of latch 50 is determined based on which of the transistors nm 9 or nm 10 is conducting . as described below , this state may be altered when current flows into current steering circuit 40 through either set port 42 or reset port 44 . otherwise , the state is maintained by the voltages applied to transistors nm 9 and nm 10 through pull - ups 58 and 59 . here , pull - ups 58 and 59 may be implemented using transistors , resistors or other circuit components connected using known design techniques . voltages v dd and v ss provide a difference in electrical potential needed to drive formatter 150 ′. in operation , format data to control operation of current steering circuit 40 is received via format input 43 of the current steering circuit 40 and is buffered by buffer 49 . input 43 is represented as a differential signal with a pol input and npol input . if the differential signal on format input 43 is asserted ( pol having a greater voltage than npol ) set port 42 is selected to sink current in response to a pulse at input 41 . when the format input 43 is asserted , transistor nm 2 is turned on , and the bias current established by transistor nm 1 passes primarily to the differential pair of transistors nm 4 and nm 5 . conversely , transistor nm 3 is off and substantially no current flows through either of transistors nm 6 or nm 7 . if the differential signal on format input 43 is not asserted ( npol having a greater voltage than pol ) the reset port 44 is selected . in this state , transistor nm 3 is on and transistor nm 2 is off . accordingly , the bias current i 1 flows through differential pair of transistors nm 6 and nm 7 and substantially no current flows through either transistor nm 4 or nm 5 . thus , depending on the state of the format signal at input port 43 , either differential pair nm 4 and nm 5 or differential pair nm 6 and nm 7 will be active . the operation of the active pair will depend on the value of the signal at input port 41 . when no signal is asserted at input port 41 , either transistor nm 5 or nm 7 will be on , depending on which of the differential pairs is active based on the format data input . if differential pair nm 4 and nm 5 is active , transistor nm 5 will be active . as a result , transistor nm 5 will pass from v dd a current i 1 . substantially no current will flow through transistor nm 4 . accordingly , no current flows into current steering circuit 40 through reset port 44 . because differential pair nm 6 and nm 7 is inactive , no current flows into current steering circuit 40 through set port 42 . in this state , current steering circuit 40 does not change the state of sr latch 50 . if the format input data is in the opposite state such that transistor pair nm 6 and nm 7 is active , the effect of current steering circuit 40 on the state of latch 50 is the same when the signal at input port 41 is not asserted . namely , differential pair nm 4 and nm 5 is inactive . within the active differential pair of transistors nm 6 and nm 7 , transistor nm 7 will be on . the bias current i 1 will therefore flow through transistor nm 7 and substantially no current will flow into set port 42 because transistor nm 6 will be off . when pulse shrinker 30 outputs a pulse such that a signal is asserted at input port 41 , current steering circuit 40 will sink current through either set port 42 or reset port 44 , depending on the state of the format data input at port 43 . when the format data is such that differential pair nm 4 and nm 5 is active , a pulse at input port 41 causes transistor nm 4 to conduct . accordingly , current flows into current steering circuit 40 through reset port 44 . conversely , when format data at input port 43 causes differential pair nm 6 and nm 7 to be active , an input signal at port 41 causes transistor nm 6 to sink current through set port 42 . in the case the format data indicates the set port is selected , transistors nm 2 and nm 4 are on during a pulse asserted at input port 41 . transistors nm 3 , nm 5 , nm 6 and nm 7 are off . a low resistance path is created between v ss and reset output 44 . the voltage drop is primarily across pull - up 58 such that the voltage associated with reset output 44 is closer to v ss than v dd . because the central input of transistor nm 9 is connected to reset port 44 , transistor nm 9 is forced off . current is restricted through pull - up 59 since all drain paths ( 42 , nm 9 , and 52 ) exhibit a high impedance . thus the voltage associated with set output 42 is closer to v dd than v ss . in this state , transistor nm 10 is forced on . with transistor nm 10 on and nm 9 off , latch 50 is in one of its two stable states . even after transistor nm 4 stops drawing current , latch 50 may remain in this state . thus , the sr latch 50 has been “ set .” in the case the format data indicates the reset port is selected , transistors nm 3 and nm 6 are on during a pulse is asserted at input port 41 . transistors nm 2 , nm 5 , nm 4 and nm 7 are off . a low resistance path is created between v ss and set output 42 . the voltage drop is primarily across pull - up 59 such that the voltage associated with set output 42 is closer to v ss than v dd . transistor nm 10 is forced off . current is restricted through pull - up 58 since all drain paths ( 44 , nm 10 , and 54 ) exhibit a high impedance . thus the voltage associated with reset output 44 is closer to v dd than v ss . in this state , transistor nm 9 is forced on . in this state , with nm 9 on and nm 10 off , latch 50 is in a second of its stable states and will remain in this state even after current flow through transistor nm 6 stops . thus , the sr latch 50 has been “ reset .” fig5 illustrates a method of operating the test system of fig2 . in step 502 , a pulse signal is generated . the pulse signal has a series of pulses . the spacing between pulses may be programmed according to the desired timing of edge signals during a test of a semiconductor device . similarly , in step 504 a second pulse signal is generated . each of the first and second pulse signals may be generated in a signal path . the signals on inputs 21 - 1 . . . 21 - n ( fig2 ) may serve as examples of the pulse signals generated in steps 502 and 504 . in step 506 , the pulse signals generated in step 502 are selectively delayed . in some embodiments , the delay is determined by delay information as may be received by the delay input of an interpolator ( see delay input 23 - i of interpolator 20 - i in fig2 for example ). as shown pictorially in step 506 , each pulse in the pulse signal ( dashed ) may be uniquely delayed . in step 508 , the delayed pulse signals are each reduced in width . in some embodiments a pulse shrinker such as pulse shrinker 30 - i in fig2 produces the reduced pulse width signal . in some embodiments , pulse shrinking may be performed prior to the selective delay of pulses . in step 510 , it is determined which of the delayed and reduced width pulses in the first pulse signal are to be directed to the set port of the sr latch via the set output of the signal path . in some embodiments , pulses not directed to the set port are directed to the reset port . in other embodiments pulses may be directed to neither port . equivalently , it may be determined which of the delayed and reduced width pulses in the first pulse signal are to be directed to the reset port of the sr latch via the reset output of the signal path . pictorially , the second of the three pulses is indicated as being selected in step 510 . however , any or all pulses in the pulse signal may be selected and applied to set or reset an output . in some embodiments the selection is specified by format data . in step 512 , the outputs of the first and second signal paths are combined at the set ( or reset ) port . in some embodiments the combination is of the form of a wired or . in step 514 , the selected pulses from the first pulse signal are received at the set ( reset ) port of the latch . in step 516 , the latch output is set ( reset ) in response to receiving the pulse . having thus described at least one illustrative embodiment of the invention , various alterations , modifications , and improvements will readily occur to those skilled in the art . such alterations , modifications , and improvements are intended to be within the scope of the invention . for example , a cmos embodiment of the invention may provide a low power consumption , highly integrated ate construction . however , other technologies may be used . method and apparatus as described above may be applied in any suitable way . for example , in the manufacture of semiconductor devices , it is desirable to generate test signals applied to devices under test and measure responses produced by those devices to verify that the devices are operating properly . the circuitry and methods described may be used to test semiconductor devices . information obtained through testing can be used to identify and discard devices that fail to exhibit the expected performance . test results may alternatively or additionally be used to alter the steps in the process used to make the devices . for example , the devices may be calibrated or modified in subsequent process steps so that they do exhibit expected performance or the devices might be packaged for sale as parts that meet relaxed performance specifications . alternatively , the results of tests might also be used in a yield enhancement system to change parameters of processing equipment . accordingly , the foregoing description is by way of example only and is not intended as limiting . the invention is limited only as defined in the following claims and the equivalents thereto .	7
the cascading concept has been applied in rssi circuits of mobile radios , where the transmitted power is controlled to the level that is needed so as to save battery lifetime . as already mentioned before , these rssi circuits may seem unsuitable for use in a field strength sensor , because they have a too high noise level for extreme low amplitude field strength . however , the applicant had the opportunity to measure that amplitude fields are medium in case of measuring rapid changing fields or measuring transfer functions . thus , unexpectedly , the use of rssi circuits in a field strength sensor may be adapted to these cases . the fig1 illustrates an exemplary series of n detectors referenced d 1 to dn . they are in connection with a cascade of n − 1 wide - band amplifier cells referenced a 1 to an - 1 , all the cells having a fixed gain , 8 decibels for example . the series of detectors are used to convert an rf - in signal to baseband . the outputs of the cells are summed together to generate a piecewise - linear approximation to a logarithmic function dc - out = l ( rf - in ) with a large dynamic range . the output is a dc voltage , whose amplitude is a measure of the rf - in voltage amplitude as illustrated by fig1 . several integrated circuits of this logarithmic detector are available on the market at a relatively low cost due to their widespread use in mobile phones . frequency ranges of some hundreds of kilohertz ( khz ) up to several gigahertz ( ghz ) are already available . the dynamic range is in theory unlimited , but due to crosstalk it will decrease at high frequencies , e . g . above 3 ghz , but we estimate that 90 decibels ( db ) can be reasonably achieved . recently , a comparable cascaded detector integrated circuit became available for measuring the root - mean , a measure for energy density , such a detector being hereinafter referred to as a rms module . according to an advantageous specificity of the current invention , such a rms module can be applied in parallel to the peak logarithmic detector , so that both peak and rms quantities can be measured ( root mean square ). using a logarithmic amplifier for the peak detection and a similar , but electronically different , logarhithmic amplifier for rms detection , these detections being realized simultaneously in all directions , allows measuring peak , rms , crest factor . an apparatus according to the current invention may further comprise means for averaging the dc output of the peak detector . by averaging the dc output of the peak detector , the average level of the rf signal is measured as well . the response time of these detector circuits is extremely short and a rapid changing field with changes in the order of 100 picoseconds shall be detected . thus , the peak levels of modern digital signals can be measured easily . thus an apparatus according to the current invention can be operational over wide - frequency ranges , and thus also capable to measure pulsed signals , such as those used in ultra wide band or high power microwave applications , and also capable of performing electromagnetic interference ( emi ) measurements . the antenna should be wide - band . a basic dipole is wideband , but has very high output impedance . this characteristic can be used advantageously in two different embodiments of the present invention . in a first embodiment illustrated by fig2 , a very wide band and still a large dynamic range field strength sensor comprises a high - input impedance field effect transistor ( fet ), the fet being used as an impedance transformer . in another embodiment illustrated by fig3 , a biological effect sensor uses the high output impedance for icnirp correction . the fig2 schematically illustrates an exemplary embodiment of a field strength sensor according to the invention . it is worth noting that the rssi circuits available on the market , which have not been developed for use in a sensor , do not comprise an antenna . the sensor comprises a 3 - directionnal antenna system including three antennas referenced 21 , 22 and 23 arranged orthogonally with respect to an x axis , a y axis and a z axis respectively . antennas 21 , 22 and 23 are wide - band antennas . they may be either short monopoles or patches or even inverted bowties . the sensor may also comprises three fets referenced 24 , 25 and 26 connected to the outputs of the antennas 21 , 22 and 23 respectively . the fets 24 , 25 and 26 are used as impedance transformers . the sensor also comprises three logarithmic detectors referenced 27 , 28 and 29 connected to the outputs of the fets 24 , 25 and 26 respectively . the logarithmic detectors 27 , 28 and 29 are capable of peak measurement . as described hereinbelow , the logarithmic detectors 27 , 28 , 29 can be put in parallel with logarithmic amplifiers allowing rms detection , nota shown on the figure . then both peak and rms measurements can be realized simultaneously . the electronics of the peak and rms detectors can advantageously be packaged in one single module . the sensor comprises also a plurality of analog readouts 30 a , 30 b and 30 c connected to the outputs of the three logarithmic detectors 27 , 28 and 29 respectively . logarithmic detectors 27 , 28 and 29 are core elements , which are being used in many mobile communication systems . as a result of this widespread use , the cost of a complete sensor according to the invention , including the antennas 21 , 22 and 23 , can be very low . this makes it possible to perform em field mapping measurements for all kind of applications . moreover , the output level is direct current and any rf interference coupled into the interference can be filtered out in a simple manner , which makes these sensors a very low cost solution for field strength measurements . thus , the present invention may be implemented as a professional 3 - directional electric and / or magnetic field sensor for measuring fast changing fields in a test environment . the present invention may also be implemented as a small 3 - directional sensor for measuring transfer function and evaluating shielding effectiveness or coupling of fields through windows or doors or feedthrough panels . the present invention may also be implemented as a small low - cost 3 - directional sensor for measuring field distribution inside a cavity . the fig3 schematically illustrates an exemplary embodiment of a biological effect sensor according to the invention . the sensor comprises a 3 - directionnal antenna system including three antennas referenced 31 , 32 and 33 arranged orthogonally with respect to an x axis , a y axis and a z axis respectively . antennas 31 , 32 and 33 are wide - band antennas . they may be either short monopoles or patches or even inverted bowties . the sensor may also comprise three icnirp converters referenced 34 , 35 and 36 connected to the outputs of the antennas 31 , 32 and 33 respectively . the icnirp converters 34 , 35 and 36 form a passive bio - compensation network to compensate for an icnirp curve c illustrated by fig4 . the protection levels for exposure to time - varying electric , magnetic and electromagnetic fields are published by icnirp , as illustrated by fig4 . the curve c shown in fig4 may be embedded in the passive bio - compensation network after said curve has been inverted , such that the output of the sensor gives a value relative to the curve c . indeed , the icnirp levels are frequency dependant but the sensor does not know which frequency it is measuring : the sensor converts any rf level to a corresponding dc level . for instance , the icnirp level may be 100 volts per metre ( v / m ) in some frequency range , while it may be 27 v / m in another range . the present invention proposes that the bio - compensation network corrects the rf level as a function of the frequency . the effect is that when an rf signal of 50 v / m is measured in the part of icnirp where the limit is 100 v / m , then the readout is 50 % ( actually − 6 db ). if an rf signal of 50 v / m is measured in the range where the icnirp curve is 27 v / m , then the readout is + 5 . 4 db ( i . e . 20 log ( 50 / 27 )). the sensor also comprises three logarithmic detectors referenced 37 , 38 and 39 connected to the outputs of the icnirp converters 34 , 35 and 36 respectively . the logarithmic detectors 37 , 38 and 39 are capable of peak measurement . as described hereinbelow , the logarithmic detectors 37 , 38 , 39 can be put in parallel with logarithmic amplifiers allowing rms detection , nota shown on the figure . then both peak and rms measurements can be realized simultaneously . the electronics of the peak and rms detectors can advantageously be packaged in one single module . the sensor comprises also an analog - to - digital converter referenced 40 ( adc ) connected to the outputs of the three logarithmic detectors referenced 37 , 38 and 39 . the sensor may also comprise a multichannel logging memory referenced 41 , allowing the dc level to be stored in a logging memory . in another embodiment , the multichannel logging memory 41 may be replaced by a network interface to transmit data to a computer , allowing the dc level to be transmitted via a network to a central computer . in addition of providing a broadband , fast , tri - axial , high - dynamic range and low - cost em field strength sensor , a further advantage of the present invention is that it can also be used as a biological effect sensor . embodied as a body - worn device the size of a usb stick , the resulting biological effect sensor may then be provided with a correction curve integrated within the antenna system , so as to measure levels with respect to the international limits . when provided with a digital logging memory for storing data or when connected to a network , the resulting biological effect sensor can make a readout periodically , so as to enable the creation of an em exposure map of the environment . distributed over a network , for instance inside a hospital or around primary schools , such biological effect sensor may also monitor the field strength .	6
in the following description , several specific details are presented to provide a thorough understanding of embodiments of the invention . one skilled in the relevant art will recognize , however , that the invention can be practiced without one or more of the specific details , or in combination with other components , etc . in other instances , well - known implementations or operations are not shown or described in detail to avoid obscuring aspects of various embodiments , of the invention . fig1 depicts an example of a system 100 for validating a client at a server . in the example of fig1 , the system 100 includes a server 102 , a network 104 , and a client 106 . the server 102 includes a certificate request module 110 , a certificate verification module 112 , a cert database 114 , a pseudo - random number ( prn ) generator 116 , and an interface 118 . the client 106 includes a certificate generation module 120 , non - volatile ( nv ) memory 122 , and an interface 124 . the server 102 may be any applicable known or convenient computer . the network 104 may be any communications network including , by way of example but not limitation , the internet . the client 106 may be any applicable known or convenient computer that has secure storage . the nv memory 122 may include a secure key store and , in an embodiment , the nv memory 122 is on - chip memory . in the example of fig1 , in operation , a protocol for registration or activation is initiated by the server 102 . ( the client 106 may , in an alternative , initiate the registration or activation .) in an embodiment , the protocol serves to register a device identity and certificate into the cert database 114 . to do so , the prn generator 116 generates a prn , r , and the certificate request module 110 of the server 102 generates a request for a device certificate . r and the request for a device certificate are sent via the interface 118 to the network 104 . r and the request for a device certificate are received at the interface 124 of the client 106 . the certificate generation module 120 of the client 106 generates a certificate cert . an example of the algorithm used to generate cert is described with reference to fig7 , below . the certificate generation module 120 computes a signature sig , over random number r , using a device private key . operands are stored in the nv memory 122 , which may reside in , for example , a secure kernel ( see e . g ., fig5 ). in an alternative , the computation could include a device id , serial number , region code , or some other value . the interface 124 of the client 106 returns r , any optional data , cert , and sig to the network 104 . the interface 118 receives at the server 102 r , any optional data , cert , and sig . the certificate verification module 112 at the server 102 validates cert using a trusted certificate chain , validates sig using cert , and verifies that r is the same as the value , r , that was originally sent by the server 102 to the client 106 . if successfully validated and verified , the server 102 imports cert into the cert database 116 . at this point , the client 106 is presumably authorized to obtain from the server 102 — or some other location that can use the certificate to authorize the client 106 — digital licenses for rights managed content , and other operations . in another embodiment , the device could generate a new key pair { pvt 1 , pub 1 } using a rng , and a certificate could be created for the new public key pub 1 , using the device programmed private key as signer . this new key pvt 1 could be used to sign the message having the random r . it should be noted that secure networking protocols such as ssl and other services that require ephemeral secret keys typically make use of a source of a string of random numbers . a secure manufacturing process , such as is described by way of example but not limitation with reference to fig6 , below , can be used to seed a secret random number s in a device . a prn generating algorithm using cryptographic primitives such as the functions in aes or sha can be used to generate prns . the sequence should not repeat after power - cycle of the device . using a state - saving mechanism involving the chip non - volatile memory ensures a high level of security . the device uses a part of re - writeable non - volatile memory to store a sequence number . fig2 depicts a flowchart 200 of an example of a method for power up and power down of a device appropriate for use in the system 100 . in the example of fig2 , the flowchart 200 starts at module 202 where a device is powered on . in the example of fig2 , the flowchart 200 continues to module 204 where runtime state is initialized to 1 . since the runtime state is incremented over time , the runtime state should be stored in writable memory , such as on - chip writable memory . in the example of fig2 , the flowchart 200 continues to module 206 where the device increments the sequence number and computes key = fn ( s , sequence number ), where s = a programmed secret seed random number . since s is programmed , it can be stored in on - chip nv read - only memory ( rom ). at this point , the device is presumed to be “ up and running .” in the example of fig2 , the flowchart 200 continues to module 208 where , in response to a request for a random number , the device generates random = fn ( key , state ) and increments state : state ++. in the example of fig2 , the flowchart 200 continues to decision point 210 where it is determined whether another random number request is received . if it is determined that another random number request has been received ( 210 - y ), then the flowchart 200 returns to module 208 . in this way , module 208 may be repeated multiple times for multiple random number requests . when it is determined there are no other random number requests ( 210 - n ), the flowchart 200 continues to module 212 where the device is powered off , and the state is lost . thus , the flowchart 200 illustrates the state of the device from power on to power off . if the device is powered on again , a new key must be computed , and state initialized again . fig3 depicts a flowchart 300 of an example of a method for generating a device certificate only once . in the example of fig3 , the flowchart 300 starts at module 302 where a device certificate is generated at a secure device . the flowchart 300 continues to module 304 where the device certificate is stored in system external storage . this variation is notable because the device is secure , but the device certificate is public . accordingly , the certificate is still secure , even though it is not regenerated each time . fig4 depicts a computer system 400 suitable for implementation of the techniques described above with reference to fig1 - 3 . the computer system 400 includes a computer 402 , i / o devices 404 , and a display device 406 . the computer 402 includes a processor 408 , a communications interface 410 , memory 412 , display controller 414 , non - volatile storage 416 , and i / o controller 418 . the computer 402 may be coupled to or include the i / o devices 404 and display device 406 . the computer 402 interfaces to external systems through the communications interface 410 , which may include a modem or network interface . the communications interface 410 can be considered to be part of the computer system 400 or a part of the computer 402 . the communications interface 410 can be an analog modem , isdn modem , cable modem , token ring interface , satellite transmission interface ( e . g . “ direct pc ”), or other interfaces for coupling a computer system to other computer systems . although conventional computers typically include a communications interface of some type , it is possible to create a computer that does not include one , thereby making the communications interface 410 optional in the strictest sense of the word . the processor 408 may include , by way of example but not limitation , a conventional microprocessor such as an intel pentium microprocessor or motorola power pc microprocessor . while the processor 408 is a critical component of all conventional computers , any applicable known or convenient processor could be used for the purposes of implementing the techniques described herein . the memory 412 is coupled to the processor 408 by a bus 420 . the memory 412 , which may be referred to as “ primary memory ,” can include dynamic random access memory ( dram ) and can also include static ram ( sram ). the bus 220 couples the processor 408 to the memory 412 , and also to the non - volatile storage 416 , to the display controller 414 , and to the i / o controller 418 . the i / o devices 404 can include a keyboard , disk drives , printers , a scanner , and other input and output devices , including a mouse or other pointing device . for illustrative purposes , at least one of the i / o devices is assumed to be a block - based media device , such as a dvd player . the display controller 414 may control , in a known or convenient manner , a display on the display device 406 , which can be , for example , a cathode ray tube ( crt ) or liquid crystal display ( lcd ). the display controller 414 and i / o controller 418 may include device drivers . a device driver is a specific type of computer software developed to allow interaction with hardware devices . typically this constitutes an interface for communicating with the device , through a bus or communications subsystem that the hardware is connected to , providing commands to and / or receiving data from the device , and on the other end , the requisite interfaces to the os and software applications . the device driver may include a hardware - dependent computer program that is also os - specific . the computer program enables another program , typically an os or applications software package or computer program running under the os kernel , to interact transparently with a hardware device , and usually provides the requisite interrupt handling necessary for any necessary asynchronous time - dependent hardware interfacing needs . the non - volatile storage 416 , which may be referred to as “ secondary memory ,” is often a magnetic hard disk , an optical disk , or another form of storage for large amounts of data . some of this data is often written , by a direct memory access process , into memory 412 during execution of software in the computer 402 . the non - volatile storage 416 may include a block - based media device . the terms “ machine - readable medium ” or “ computer - readable medium ” include any known or convenient storage device that is accessible by the processor 408 and also encompasses a carrier wave that encodes a data signal . the computer system 400 is one example of many possible computer systems which have different architectures . for example , personal computers based on an intel microprocessor often have multiple buses , one of which can be an i / o bus for the peripherals and one that directly connects the processor 408 and the memory 412 ( often referred to as a memory bus ). the buses are connected together through bridge components that perform any necessary translation due to differing bus protocols . network computers are another type of computer system that can be used in conjunction with the teachings provided herein . network computers do not usually include a hard disk or other mass storage , and the executable programs are loaded from a network connection into the memory 412 for execution by the processor 408 . a web tv system , which is known in the art , is also considered to be a computer system , but it may lack some of the features shown in fig4 , such as certain input or output devices . a typical computer system will usually include at least a processor , memory , and a bus coupling the memory to the processor . the computer system 400 may be controlled by an operating system ( os ). an os is a software program — used on most , but not all , computer systems — that manages the hardware and software resources of a computer . typically , the os performs basic tasks such as controlling and allocating memory , prioritizing system requests , controlling input and output devices , facilitating networking , and managing files . examples of operating systems for personal computers include microsoft windows ®, linux , and mac os ®. delineating between the os and application software is sometimes rather difficult . fortunately , delineation is not necessary to understand the techniques described herein , since any reasonable delineation should suffice . the lowest level of an os may be its kernel . the kernel is typically the first layer of software loaded into memory when a system boots or starts up . the kernel provides access to various common core services to other system and application programs . as used herein , algorithmic descriptions and symbolic representations of operations on data bits within a computer memory are believed to most effectively convey the techniques to others skilled in the art . an algorithm is here , and generally , conceived to be a self - consistent sequence of operations leading to a desired result . the operations are those requiring physical manipulations of physical quantities . usually , though not necessarily , these quantities take the form of electrical or magnetic signals capable of being stored , transferred , combined , compared , and otherwise manipulated . it has proven convenient at times , principally for reasons of common usage , to refer to these signals as bits , values , elements , symbols , characters , terms , numbers , or the like . it should be borne in mind , however , that all of these and similar terms are to be associated with the appropriate physical quantities and are merely convenient labels applied to these quantities . unless specifically stated otherwise as apparent from the following discussion , it is appreciated that throughout the description , discussions utilizing terms such as “ processing ” or “ computing ” or “ calculating ” or “ determining ” or “ displaying ” or the like , refer to the action and processes of a computer that manipulates and transforms data represented as physical ( electronic ) quantities within the computer system &# 39 ; s registers and memories into other data similarly represented as physical quantities within the computer system memories or registers or other such information storage , transmission or display devices . an apparatus for performing techniques described herein may be specially constructed for the required purposes , or it may comprise a general purpose computer selectively activated or reconfigured by a computer program stored in the computer . such a computer program may be stored in a computer readable storage medium , such as , by way of example but not limitation , read - only memories ( roms ), rams , eproms , eeproms , magnetic or optical cards , any type of disk including floppy disks , optical disks , cd - roms , dvds , and magnetic - optical disks , or any known or convenient type of media suitable for storing electronic instructions . the algorithms and displays presented herein are not inherently related to any particular computer architecture . the techniques may be implemented using any known or convenient programming language , whether high level ( e . g ., c / c ++) or low level ( e . g ., assembly language ), and whether interpreted ( e . g ., perl ), compiled ( e . g ., c / c ++), or just - in - time ( jit ) compiled from bytecode ( e . g ., java ). any known or convenient computer , regardless of architecture , should be capable of executing machine code compiled or otherwise assembled from any language into machine code that is compatible with the computer &# 39 ; s architecture . fig5 depicts an example of a secure system 500 suitable for implementation of the techniques described above with reference to fig1 - 3 . a typical secure system 500 may include a game console , media player , an embedded secure device , a “ conventional ” pc with a secure processor , or some other computer system that includes a secure processor . in the example of fig5 , the secure system 500 includes a secure processor 502 , an os 504 , ticket services 506 , a calling application 508 , and protected memory 510 . in the example of fig5 , the os 504 includes a security kernel 514 , which in turn includes a key store 516 , an encryption / decryption engine 517 , and a security api 518 . it should be noted that one or more of the described components , or portions thereof , may reside in the protected memory 510 , or in unprotected memory ( not shown ). it should further be noted that the security kernel 514 is depicted as residing inside the os 504 by convention only . it may or may not actually be part of the os 504 , and could exist outside of an os or on a system that does not include an os . for the purposes of illustrative simplicity , it is assumed that the os 504 is capable of authentication . in an embodiment , the ticket services 506 may also be part of the os 504 . this may be desirable because loading the ticket services 506 with authentication can improve security . thus , in such an embodiment , the os 504 is loaded with authentication and includes the ticket services 506 . for illustrative simplicity , protected memory is represented as a single memory . however protected memory may include protected primary memory , protected secondary memory , and / or secret memory . it is assumed that known or convenient mechanisms are in place to ensure that memory is protected . the interplay between primary and secondary memory and / or volatile and non - volatile storage is known so a distinction between the various types of memory and storage is not drawn with reference to fig5 . the ticket services 506 may be thought of as , for example , “ digital license validation services ” and , in a non - limiting embodiment , may include known or convenient procedures associated with license validation . for example , the ticket services 506 may include procedures for validating digital licenses , pki validation procedures , etc . in the example of fig5 , the ticket services 506 can validate a ticket from the calling application 508 . in operation , the ticket services 506 obtains the ticket from the calling application 508 , which proceeds to validate the ticket . it is possible that the ticket is personalized . in that case , it could be decrypted using the device private key ( programmed as discussed before ) to compute a secret shared encryption key . the ticket may or may not be obtained using an internet download mechanism and stored on re - writable flash memory . in an embodiment , the security kernel 514 may be loaded at start - up . in another embodiment , a portion of the security kernel may be loaded at start - up , and the remainder loaded later . an example of this technique is described in application ser . no . 10 / 360 , 827 entitled “ secure and backward - compatible processor and secure software execution thereon ,” which was filed on feb . 7 , 2003 , by srinivasan et al ., and which is incorporated by reference . any known or convenient technique may be used to load the security kernel 514 in a secure manner . the key store 516 is a set of storage locations for keys . the key store 516 may be thought of as an array of keys , though the data structure used to store the keys is not critical . any applicable known or convenient structure may be used to store the keys . in a non - limiting embodiment , the key store 516 is initialized with static keys , but variable keys are not initialized ( or are initialized to a value that is not secure ). for example , some of the key store locations are pre - filled with trusted values ( e . g ., a trusted root key ) as part of the authenticated loading of the security kernel 514 . the private key in the non - volatile memory could be retrieved and stored in the keystore for future use . the encryption / decryption engine 517 is , in an embodiment , capable of both encryption and decryption . for example , in operation , an application may request of the security api 518 a key handle that the application can use for encryption . the encryption / decryption engine 517 may be used to encrypt data using the key handle . advantageously , although the security api 518 provides the key handle in the clear , the key itself never leaves the security kernel 514 . the security api 518 is capable of performing operations using the keys in the key store 516 without bringing the keys out into the clear ( i . e ., the keys do not leave the security kernel 514 or the keys leave the security kernel 514 only when encrypted ). the security api 518 may include services to create , populate and use keys ( and potentially other security material ) in the key store 516 . in an embodiment , the security api 518 also provides access to internal secrets and non - volatile data , including secret keys and device private key . for example , the device private key might be stored in the keystore and used by the security api . one api call could be used to return a device certificate ( using an algorithm discussed herein to generate the certificate ). another api call can be constructed to use the private key to compute a shared key for decryption , or use the private key to sign a message or certificate . depending upon the implementation , the security api 518 may support aes and sha operations using hardware acceleration . in the example of fig5 , the ticket services 506 and the security api 518 may execute in a separate execution space for system security . in order to validate data blocks , the ticket services 506 may validate the ticket using data in the header . the ticket may include an encrypted key . the ticket services 506 decrypts the key using services in the security kernel 514 ( e . g ., the encryption / decryption engine 517 ). in an embodiment , the encryption / decryption engine 517 uses secret common keys from the key store 518 to perform this decryption . in another embodiment , the ticket services 506 could use a device personalized ticket obtained from flash or network ( not shown ), validate some rights to content , and then return the key . in any case , this process returns the key . the personalized ticket could be encrypted by a key that is a function of the device private key , programmed in the non - volatile memory . an example of data flow in the system 500 is provided for illustrative purposes as arrows 520 - 528 . receiving the certificate request at the ticket services 506 is represented by a certificate request arrow 520 from the calling application 508 to the ticket services 506 . forwarding the certificate request from the ticket services 506 to the security api 516 is represented by a certificate request arrow 522 . within the security kernel 514 , the public key / device certificate construction engine 517 accesses keys / signature data from the key / signature store 518 . the access is represented by the private key / signature access arrow 524 . the security api 516 returns a device certificate to the ticket services 506 , as represented by the device certificate arrow 526 , which is forwarded to the calling application 508 , as represented by the device certificate arrow 528 . fig6 depicts a flowchart 600 of an example of a method for manufacturing a secure device . this method and other methods are depicted as serially arranged modules . however , modules of the methods may be reordered , or arranged for parallel execution as appropriate . in the example of fig6 , the flowchart 600 begins at module 602 where a device id is obtained . the device id may be a serial number or some other unique identifier for the device . in the example of fig6 , the flowchart 600 continues to module 604 where a pseudo - random number is provided for use as a small - signature private key for the device . to date , truly random numbers are not generable on a computer ; of course , a pseudo - random number generator or an external secured hardware true random number generator could work for the intended purpose . a small - signature private key may be , by way of example but not limitation , an elliptic curve private key , or some other private key with a relatively small footprint . in the example of fig6 , the flowchart 600 continues to module 606 where a public key is computed from the private key using common parameters . for example , a multiple of a base point may be computed , where a scalar multiple is the private key . in the example of fig6 , the flowchart 600 continues to module 608 where a fixed certificate structure is used to construct a certificate . the certificate is signed using a small signature algorithm such as elliptic curve dsa . in an embodiment , the fixed certificate structure may include at least the device id , issuer name , and device public key . a small - signature algorithm is used to minimize the size of the signature . by way of example but not limitation , an elliptic curve signature algorithm may be used . in the example of fig6 , the flowchart 600 continues to module 610 where { device id , private key , issuer id , signature } is programmed into the non - volatile memory of the device . this set includes these four items because the items provide sufficient security for most purposes , and the set has a relatively small footprint due to the relatively small size of the private key and signature . ( the device id and issuer id also , presumably , have relatively small footprints .) in an embodiment , any other data that is needed to construct the device certificate such as the public key may be generated programmatically on demand . however , more items could be programmed into the non - volatile memory , or fewer , as appropriate for a given embodiment or implementation . in the example of fig6 , the flowchart 600 continues to module 612 where a secret random number is programmed into the rom of the device . the secret random number may be pseudo - randomly generated or arbitrarily assigned . this secret random number can be used to support secure pseudo - random number generation . in an alternative , the rom may be replaced with some other known or convenient nv storage . fig7 depicts a flowchart 700 of an example of a method for construction of a secure certificate . advantageously , the method enables the device having the non - volatile programmed key and required software to construct a full device certificate that can be used to validate the device . in the example of fig7 , the flowchart 700 starts at module 702 where a request for a device certificate is received from a calling application . in the example of fig7 , the flowchart 700 continues to module 704 where { device id , private key , issuer id , signature } is read from non - volatile memory . in an embodiment , a security kernel module accesses and reads the non - volatile memory . an example of a security kernel module that is appropriate for this purpose is described in u . s . patent application ser . no . 10 / 360 , 827 entitled “ secure and backward - compatible processor and secure software execution thereon ,” which was filed on feb . 7 , 2003 , by srinivasan et al ., and / or in u . s . patent application ser . no . 11 / 586 , 446 entitled “ secure device authentication system and method ,” which was filed on oct . 24 , 2006 , by srinivasan et al ., both of which are incorporated by reference . however , any applicable known or convenient security kernel module could be used . in the example of fig7 , the flowchart 700 continues to module 706 where the public key is computed from the private key and common parameters , if any . in an embodiment , the computation makes use of the same algorithm that was used in a manufacturing process , such as the method described with reference to fig6 , above . the public key may be computed in a security kernel . in the example of fig7 , the flowchart 700 continues to module 708 where a device certificate is constructed from device id , issuer id , public key , signature , and common parameters . in an embodiment , a security kernel module is aware of the structure of the device certificate , as is used in a manufacturing process , such as the method described with reference to fig6 , above . advantageously , the device certificate can be constructed on demand . in the example of fig7 , the flowchart 700 continues to module 710 where the device certificate is provided to the calling application . the flowchart 700 ends when the device certificate is provided to the calling application . the method could be started again by another calling application ( or by the same calling application if , for some reason , the device certificate was needed again .) as used herein , the term “ content ” is intended to broadly include any data that can be stored in memory . as used herein , the term “ embodiment ” means an embodiment that serves to illustrate by way of example but not limitation . it will be appreciated to those skilled in the art that the preceding examples and embodiments are exemplary and not limiting to the scope of the present invention . it is intended that all permutations , enhancements , equivalents , and improvements thereto that are apparent to those skilled in the art upon a reading of the specification and a study of the drawings are included within the true spirit and scope of the present invention . it is therefore intended that the following appended claims include all such modifications , permutations and equivalents as fall within the true spirit and scope of the present invention .	7
the present invention will be further described by means of the following preferred embodiments without restricting the scope of the invention . 0 . 90 kg of 2 , 6 - diacetylpyridine ( 99 %), 2 . 56 kg of phosphorus pentoxide ( p 2 o 5 ), and a solution of 2 . 14 kg of 2 , 4 - dichloro - 6 - methylaniline ( 100 %) were solubilized in 20 l of tetrahydrofuran . the mixture was stirred for 15 min and then heated under reflux for 18 hours at 70 ° c . after completion of the reaction , the obtained suspension was cooled to 20 ° c ., stirred for 30 min and then filtered and washed with 6 l of tetrahydrofuran . the filtrate , having a volume of 26 l , was concentrated under vacuum ( 250 mm hg , 55 ° c .). the volume was reduced by rotary evaporation up to a final concentrate of 3 . 5 l . 20 l of methanol were added so as to obtain crystallization . the resulting suspension ( 23 . 5 l ) was filtered and washed with 6 l of methanol , thus resulting in a volume of 27 l . the humid product ( 1 . 38 kg ) resulting from the filtration was set under drying condition in free air for one night . this gave a first fraction of 1 . 36 kg of 2 , 6 - bis [ 1 -( 2 , 4 , 6 - trimethylphenylimino ) ethyl ] pyridine in 51 % yield . the filtrate ( 27 l ) was concentrated as described above up to a final concentrate of 2 . 5 kg . 4 l of methanol were added . the resulting suspension was agitated for 1 hour at room temperature and washed with 0 . 4 l of methanol . a second fraction of 50 g was in this way obtained . thus , a total of 1400 g of 2 , 6 - bis [ 1 -( 2 , 4 , 6 - trimethylphenylimino ) ethyl ] pyridine in 53 % yield were obtained . a reaction with iron ( ii ) dichloride was carried out as described by qian et al ., organometallics 2003 , 22 , 4312 - 4321 . 140 kg sylopol 2107 , a spray - dried silica gel from grace , was calcinated at 600 ° c . for 6 hours . a mixture of 509 g ( 0 . 84 mol ) of 2 , 6 - bis [ 1 -( 2 , 4 - dichloro - 6 - methylphenylimino ) ethyl ] pyridine iron ( ii ) dichloride , prepared according to the above - mentioned procedure under a ), 4131 g ( 8 . 4 mol ) of bis ( n - butylcyclopentadienyl ) hafnium dichloride , commercially available from crompton , and 195 l of mao ( 4 . 75 m in toluene , 926 mol ) was stirred at 20 ° c . for 2 h and after cooling to 0 ° c . subsequently added while stirring to 140 kg of the pretreated support material b ). the solution was added with a flow rate lower than 100 kg / h . the obtained product was stirred for further 30 minutes and heated to 40 ° c . the solid was dried under reduced pressure until it was free - flowing . after sieving , 320 kg of catalyst were obtained ( residual solvent : 41 %). the polymerization was carried out in a fluidized - bed reactor having a diameter of 3 . 7 m in the presence of the mixed catalyst described above . the reaction temperature was 105 ° c ., the pressure in the reactor was 25 bar , the reaction gas had the following composition : 49 vol % ethylene , 5 . 1 vol % hexane , 0 . 6 vol % hexene , 45 vol % nitrogen , 1 . 5 kg / h trihexylaluminum ( 2 wt % in hexane ). the output was 5 . 5 t / h . the mdpe polyethylene so obtained had a density of 0 . 939 g / cm 3 and a mfr ( 190 / 21 . 6 ) of 28 g / 10 min . the mdpe , conveniently added with 700 ppm of a conventional processing additive , namely polybatch ® amf 705 ( available from a . schulman ) was used as a first polyethylene component , whose main properties are shown in table 1 below , while lupolen 3220 f , which is a ldpe commercially available from basell polyolefine gmbh having a density of 0 . 930 g / cm 3 , and a mfr ( 190 / 2 . 16 ) of 0 . 9 g / 10 min , was used as a second polyethylene component in an amount of 11 % by weight . in examples 2 - 4 a first and a second polyethylene components as those described in example 1 were used , except for the amount of ldpe , which was set to 20 %, 30 % and , respectively , 40 % by weight . density is the polymer density mfr ( 190 / 21 . 6 ) is the melt flow rate according to standard iso 1133 , condition g eta ( vis ) is the intrinsic viscosity as determined according to iso 1628 - 1 and eta ( gpc ) is the viscosity as determined by gpc according to din 55672 , with 1 , 2 , 4 - trichlorobenzene , at 140 ° c . m w is the weight average molar mass ; m n is the number average molar mass m z is the z - average molar mass gpc % at molar mass 1 mio is the % by weight according to gel permeation chromatography below a molar mass of 1 mio g / mol . — hc ═ ch 2 is the amount of vinyl groups total - ch 3 is the amount of ch 3 - groups per 1000 c including end groups . innovex ll6910aa , which is a conventional lldpe prepared by the use of a ziegler - natta catalyst commercially available from bp ( density equal to 0 . 936 g / cm 3 , mfr ( 190 / 2 . 16 ) of 1 . 0 g / 10 min ), conveniently added with 700 ppm polybatch ® amf 705 , was used as a first polyethylene component , whose properties are shown in table 2 , while lupolen 3220 f was used as a second polyethylene component in an amount of 11 %, 20 %, 30 % and , respectively , 40 % by weight . lupolen 3721 c , which is a mdpe prepared by the use of a chromium catalyst commercially available from basell ( density equal to 0 . 937 g / cm 3 , mfr ( 190 / 21 . 6 ) of 12 . 5 g / 10 min ), was used as a first polyethylene component , whose properties are shown in table 3 , while lupolen 3220 f was used as a second polyethylene component . the polyethylene compositions of example 1 - 12 were homogenized and granulated on a zsk 30 ( werner pfleiderer ) with screw combination 8a . the processing temperature was 220 ° c ., the screw speed 250 / min , the output of 20 kg / h . each polyethylene composition of the examples above was extruded into films by blown film extrusion on a weber film extruder equipped with a collapsing device with wooden flatted boards . the diameter of the ring die was 50 mm , the gap width was 2 / 50 and the angle along which the cooling air is blown onto the extruded film was 45 °. no filters were used . the 25d extruder with a screw diameter of 30 mm and a screw speed of 50 turns per min gave an output of 5 . 1 kg / h . the blow - up ratio was 1 : 2 and the haul - off speed 4 . 9 m / 10 min . the height of the frost line was 160 mm . films with a thickness in the order of 50 μm were obtained . the specific thickness of each film , as well as the processing properties and optical and mechanical properties of the different films , are summarized in tables 4 and 5 . nmr samples were placed in tubes under inert gas and , if appropriate , melted . the solvent signals served as internal standard in the 1 h - and 13 c - nmr spectra and their chemical shift was converted into the values relative to tms . the degree of branching in the individual polymer fractions was determined by the method of holtrup ( w . holtrup , makromol . chem . 178 , 2335 ( 1977 )) coupled with 13 c - nmr . the density [ g / cm 3 ] was determined in accordance with iso1183 . the determination of the values m n , m w , m z and of the molar mass distribution m w / m n derived therefrom was carried out by means of high - temperature gel permeation chromatography on a waters 150 c using a method based on din 55672 and the following columns connected in series : 3x shodex at 806 ms , 1x shodex ut 807 and 1x shodex at - g under the following conditions : solvent : 1 , 2 , 4 - trichlorobenzene ( stabilized with 0 . 025 % by weight of 2 , 6 - di - tert - butyl - 4 - methylphenol ), flow : 1 ml / min , 500 μl injection volume , temperature : 140 ° c . the columns were calibrated with polyethylene standards with molar masses of from 100 bis 10 7 g / mol . the evaluation was carried out by using the win - gpc software of fa . hs - entwicklungsgesellschaft für wissenschaftliche hard - and software mbh , ober - hilbersheim . for the purposes of the present invention , the expression mfr ( 190 / 21 . 6 ), known also as “ high load melt flow rate ”, has been determined at 190 ° c . under a load of 21 . 6 kg in accordance with iso 1133 , condition g . for the purposes of the present invention , the expression mfr ( 190 / 2 . 16 ) has been determined at 190 ° c . under a load of 2 . 16 kg in accordance with iso 1133 , condition d . in order to determine the reflection properties of the films , gloss measurements were carried out according to iso 2813 on a reflectometer at impingement angles of 20 ° and 60 °, on at least 5 pieces of film with a thickness of 50 μm . the haze was determined by astm d 1003 - 00 on a byk gardener haze guard plus device on at least 5 pieces of film 10 × 10 cm with a thickness of 50 μm . the clarity was determined by astm d 1746 - 03 on a byk gardener haze guard plus device , calibrated with calibration cell 77 . 5 , on at least 5 pieces of film 10 × 10 cm with a thickness of 50 μm . in order to determine the puncture resistance of films under shock loading , the dart drop was determined by astm d 1709 , method a on 10 film samples having a thickness of 50 μm . in order to determine the strength of the films under dynamic loading , dynamic tests were carried out according to din 53373 , so as to obtain the fracture energy w s up to the first tear and the total fracture energy w tot for the penetration . the tensile strength test was performed according to iso 527 both in machine direction ( md ) and at right angle to the machine direction , known as transverse direction ( td ) the tear propagation test , otherwise known as elmendorf method , was performed according to iso 6383 / 2 .	2
referring to the drawing in particular , the invention embodied therein comprises a circuit for a low power , high efficiency switching power supply which has been found to have an efficiency of 87 to 92 %. this results in additional functions and increased operating speed ( response time ) for microprocessor based smart ( the transmitter is monitored by a microprocessor while still on line ) transmitters which are used with a 4 - 20 ma current loop system . the circuit of the figure includes an input circuit assembly 10 which receives a primary voltage of between 12 and 42 volts d . c . the input circuit assembly 10 may be connected to the current loop of a known 4 - 20 ma process control system . the function of the input circuit assembly 10 is to provide a constant current and voltage to an isolating circuit assembly 12 . the isolating circuit assembly 12 receives the constant voltage and current signal from the input circuit assembly 10 and electromagnetically couples this signal to an output circuit assembly 14 . this provides electrical isolation between the input circuit assembly 10 and the output circuit assembly 14 . the output circuit assembly 14 consists of two ± 5 v dc power supplies connected to two known rc filtering circuits that filter the ± 5 v dc power outputs to establish an output signal that is filtered and isolated from the input circuit assembly 10 . the input circuit 10 receives the 12 - 42 volt d . c . signal from the proportional 4 - 20 ma process control loop on lines 16 and 18 . a resistor 20 is connected in parallel to line 16 and a feedback line 22 . an emitter 24 of a transistor 26 is connected in parallel to the feedback 22 and in series to the resistor 20 . a collector 28 of transistor 26 is connected in parallel to line 18 and to a base 30 of the same transistor 26 . the base 30 is connected to a driving circuit such as a microprocessor ( not shown ). a constant current source 32 is connected in parallel to resistor 20 and emitter 24 and in series to a zener diode 36 along a line 34 . the zener diode 36 is then connected in parallel to input line 18 . the isolation circuit 12 is connected to the input circuit 10 along line 38 which is connected in parallel from line 34 to a center tap 40 of a primary winding 41 of a low loss switching transformer 42 . opposite ends of the primary winding 41 are connected to sources 44 and 46 of a pair of mosfet &# 39 ; s 48 and 50 respectively . drains 52 and 54 of the respective mosfet &# 39 ; s 48 and 50 are connected into input line 18 . gates 56 and 58 of the respective mosfet &# 39 ; s 48 and 50 are connected to a low power oscillator 60 . a pair of secondary windings 62 and 64 are provided through a core 66 of transformer 42 . a pair of center taps 68 and 70 are connected to reference voltage points 72 , 73 chosen by the user . either side of the secondary windings 62 and 64 are connected to a pair of known schottky diode bridge rectifier circuits 74 and 76 respectively . a pair of known rc networks 106 and 108 are connected to the rectifier circuits 74 and 76 by lines 78 , 80 and 82 , 84 respectively . a pair of resistors 86 and 88 form the known resistor - capacitor filtering networks 106 and 108 with capacitors 90 , 92 and 94 , 96 respectively . the output circuit 14 provides two pairs of output lines 98 , 100 and 102 , 104 that are connected in parallel to their respective filtering circuits 106 and 108 respectively . in operation , input lines 16 and 18 of input circuit 10 are connected to a process control loop which provides a 4 - 20 ma signal proportional to a process variable . the input 4 - 20 ma current creates a voltage across the resistor 20 . since this current is proportional to the process variable the voltage created on resistor 20 is also proportional to the process variable and may be used to obtain a reading of the process variable . a known driving circuit ( not shown ) such as a microprocessor produces a signal which drives base 30 of the transistor 26 . this allows current to flow through emitter 24 to collector 28 of transistor 26 . this driving signal is also proportional to the process variable . as the base 30 of transistor 26 is being driven by the driving circuit a signal which is also proportional to the process variable flows back through feedback line 22 . the known constant current source 32 , which is a group of transistors and resistors that provide a current of constant magnitude regardless of load in a known manner , supplies the isolating circuit 12 with a nonvarying current along lines 34 and 38 . the zener diode 36 regulates the voltage across isolating circuit 12 and prevents any ac power from circuit 12 from going back through lines 38 and 34 into line 18 and hence back into the 4 - 20 ma current loop . the isolating circuit 12 receives the constant current from the constant current source 32 of the input circuit 10 along lines 34 and 38 at the center tap 40 of the switching transformer 42 . the transformer 42 has a core 66 which is preferably toroid coil to reduce primary to secondary leakage losses by improving winding distribution . the transformer 42 is specially designed in that it operates at low flux densities ( 100 - 500 gauss ) also to reduce core losses . the low power oscillator 60 alternately puts a signal on gates 56 and 58 of respective mosfet &# 39 ; s 48 and 50 . the signals turn on gates 56 and 58 alternately , allowing current to flow alternately from the center tap 40 , through the primary coil 41 , through the sources 44 and 46 to the respective drains 52 and 54 of the respective mosfet &# 39 ; s 48 and 50 . the low power oscillator 60 in most previously designed power supplies of this type would alternately drive a pair of regular transistors instead of mosfet &# 39 ; s 48 and 50 . by utilizing mosfet &# 39 ; s which have low power gate drive characteristics and fast switching characteristics instead of regular transistors , switching losses are greatly minimized . the oscillator should have a frequency of 10k hz or less to further reduce overall switching losses in the mosfet &# 39 ; s , the transformers , etc . this alternating current flowing through the primary coil 41 steps down to the two secondary windings 62 and 64 of the transformer 42 . each of the secondary windings 62 and 64 have center taps 68 and 70 respectively . these center taps are the common points for the two ± 5 v supply outputs of output circuit 14 . either end of both secondary windings 62 and 64 supply the input side of of known bridge rectifier circuits 74 and 76 respectively . schottky diodes are used in bridges 74 and 76 to minimize switching losses . these known bridge rectifier circuits 74 and 76 change the acv from the secondaries 62 and 64 to dcv in a known manner . the outputs of these bridge circuits 74 and 76 supply unfiltered dc volts to the output circuit 14 . the output circuit 14 has of two known rc filter networks 106 and 108 that filter the rough dcv from isolating circuit 12 into steady ± 5 v dc sources . the output lines 98 and 102 supply a dc signal 5 v below the chosen reference points 72 and 73 respectively , and lines 100 and 104 supply a dc signal 5 v above the chosen reference points 72 and 73 respectively . thus it is seen that the present supply provides an output supply signal along lines 98 , 100 and 102 , 104 that is a low power and high efficiency supply with an efficiency of 87 to 92 %. this results in increased response time for transmitters used in a 4 - 20 ma current loop . while a specific embodiment of the invention has been shown and described in detail to illustrate the application of the principles of the invention , it will be understood that the invention may be embodied otherwise without departing from such principles .	7
research in automatic image annotation can be roughly categorized into two different ‘ schools of thought ’: ( 1 ) words and visual features are jointly modeled to yield compound predictors describing an image or its constituent regions . the words and image representations used could be disparate or single vectored representations of text and visual features . ( 2 ) automatic annotation is treated as a two - step process consisting of supervised image categorization , followed by word selection based on the categorization results . while the former approaches can potentially label individual image regions , ideal region annotation would require precise image segmentation , an open problem in computer vision . although the latter techniques cannot label regions , they are typically more scalable to large image collections . the term meta - learning has historically been used to describe the learning of meta - knowledge about learned knowledge . research in meta - learning covers a wide spectrum of approaches and applications , as has been reviewed in . here , we briefly discuss the approaches most pertinent to this work . one of the most popular meta - learning approaches , boosting is widely used in supervised classification . boosting involves iteratively adjusting weights assigned to data points during training , to adaptively reduce misclassification . in stacked generalization , weighted combinations of responses from multiple learners are taken to improve overall performance . the goal here is to learn optimal weights using validation data , in the hope of generalization to unseen data . a research area under the meta - learning umbrella that is closest to our work is inductive transfer / transfer learning . research in inductive transfer is grounded on the belief that knowledge assimilated about certain tasks can potentially facilitate the learning of certain other tasks . incrementally learning support vectors as and when training data is encountered has been explored as a scalable supervised learning procedure . in our work , we draw inspiration from inductive transfer and incremental / decremental learning to develop the meta - learner and the overall t / t framework . given an image annotation system or algorithm , we treat it as a ‘ black - box ’ and build a lightweight meta - learner that attempts to understand the performance of the system on each word in its vocabulary , taking into consideration all available information , which includes : here , we discuss the nature of each one , and formulate a probabilistic framework to harness all of them . we consider a black - box system that takes an image as input and guesses one or more words as its annotation . we do not concern ourselves directly with the methodology or philosophy the black - box employs , but care about their output . a ranked ordering of the guesses is not necessary for our framework , but can be useful for empirical comparison . assume that either there is ground - truth readily available for a subset of the images , or , in an online setting , images are being uploaded and collaboratively / individually tagged from time to time , which means that ground - truth is made available as and when users tag them . for example , consider that an image is uploaded but not tagged . at this time , the black - box can make guesses at its annotation . at a later time , user provide tags to it , at which point it becomes clear how good the black - box &# 39 ; s guesses were . this is where the meta - learner fits in , in an online scenario . the images are also available to the meta - learner for visual content analysis . furthermore , knowledge bases ( e . g ., wordnet ) can be potentially useful , since semantics recognition is the desiderata of annotation . let the black - box annotation system be known to have a word vocabulary denoted by v bbox . let us denote the ground - truth vocabulary by v gtruth . the meta - learner works on the union of these vocabularies , namely v =( v bbox ∪ v gtruth )={ w 1 , . . . , w k }, where k =\| v \|, the size of this overall vocabulary . given an image i , the black - box predicts a set of words to be its correct annotation . to denote these guesses , we introduce indicator variables g w ε { 0 , 1 }, wεv , where a value of 1 or 0 indicates whether word w i is predicted by the black - box for 1 or not . we introduce similar indicator variables a w ε { 0 , 1 }, wεv to denote the ground - truth tagging , where a value of 1 or 0 indicates whether w is a correct annotation for 1 or not . strictly speaking , we can conceive the black - box as a multi - valued function ƒ bbox mapping an image i to indicator variables g w i : ƒ bbox ( i )=( g w 1 , . . . , g w k ) similarly , the ground - truth labels can be thought of as a function ƒ gtruth mapping the image to its true labels using the indicator variables : ƒ gtruth ( i )=( a w 1 , . . . , a w k ). regardless of the abstraction of visual content that the black - box uses for annotation , the pixel - level image representation may be still available to the meta - learner . if some visual features extracted from the images represent a different abstraction than what the black - box uses , they can be thought of as a different viewpoint and thus be potentially useful for semantics recognition . such a visual feature representation , that is also simple enough not to add significant computational overhead , can be thought of as a function defined as : ƒ vis ( i )=( h 1 , . . . , h d ). here , we specify a d - dimensional image feature vector representation as an example . instead , other non - vector representations ( e . g ., variable - length region - based features ) can also be used as long as they are efficient to compute and process , so as to keep the meta - learner lightweight . finally , the meta - learner also has at its disposal an external knowledge base , namely the semantic lexicon wordnet , which is essentially a semantic lexicon for the english language that has in the past been found useful for image annotation . the invention is not limited in this regard , however , insofar as other and yet to be developed lexicons may be used . in particular , wordnet - based semantic relatedness measures have benefited annotation tasks . wordnet , however , does not include most proper nouns and colloquial words that are often prevalent in human tag vocabularies . such non - wordnet words must therefore be ignored or eliminated from the vocabulary v in order to use wordnet on the entire vocabulary . the meta - leamer attempts to assimilate useful knowledge from this lexicon for performance gain . it can be argued that this semantic knowledge base may help discover the connection between the true semantics of images , the guesses made by the black - box model for that image , and the semantic relatedness among the guesses . once again , the inductive transfer idea comes into play , whereby we conjecture that the black - box , with its ability to recognize semantics of some image classes , may help recognize the semantics of entirely different classes of images . let us denote the side - information extracted ( externally ) from the knowledge base and the black - box guesses for an image by a numerical abstraction , namely ƒ kbase ( i )=( ρ 1 , . . . , ρ k ), where ρ i εr , with the knowledge base and the black - box guesses implicitly conditioned . we are now ready to postulate a probabilistic formulation for the meta - learner . in essence , this meta - learner , trained on available data with feedback ( see fig2 ), acts a function which takes in all available information pertaining to an image i , including the black - box &# 39 ; s annotation , and produces a new set of guesses as its annotation . in our meta - learner , this function is realized by taking decisions on each word independently . in order to do so , we compute the following odds in favor of each word w j to be an actual ground - truth tag , given all pertinent information , as follows : note that here ƒbbox ( i ) ( and similarly , the other terms ) denotes a realization of the corresponding random variables given the image i . using bayes &# 39 ; rule , we can re - write : in ƒ bbox ( i ), if the realization of variable g w i for each word w i is denoted by g i ε { 0 , 1 } given i , then without loss of generality , for each j , we can split ƒ bbox ( i ) as follows : we now evaluate the joint probability in the numerator and denominator of l w j separately , using eq . 3 . for a realization a j ε { 0 , 1 } of the random variable a w i , we can factor the joint probability ( using the chain rule of probability ) into a prior and a series of conditional probabilities , as follows : the odds in eq . 1 can now be factored using eq . 2 and 4 : is a sanity check on the black - box for each word . for g w j = 1 , it can be paraphrased as “ given that word w j is guessed by the black - box for i , what are the odds of it being correct ?”. naturally , a higher odds indicates that the black - box has greater precision in guesses ( i . e ., when w j is guessed , it is usually correct ). a similar paraphrasing can be done for g w i = 0 , where higher odds implies lower word - specific recall in the black - box guesses . a good annotation system should be able to achieve independently ( word - specific ) and collectively ( overall ) good precision and recall . these probability ratios therefore give the meta - learner indications about the black - box model &# 39 ; s performance for each word in the vocabulary . in eq . 5 relates each correctly / wrongly guessed word w j to how every other word w i , i ≠ j is guessed by the black - box . this component has strong ties with the concept of co - occurrence popular in the language modeling community , the difference being that here it models the word co - occurrence of the black - box &# 39 ; s outputs with respect to ground - truth . similarly , for g j = 0 , it models how certain words do not co - occur in the black - box &# 39 ; s guesses , given the ground - truth . since the meta - leamer makes decisions about each word independently , it is intuitive to separate them out in this ratio as well . that is , the question of whether word w i is guessed or not , given that another word w j is correctly / wrongly guessed , is treated independently . furthermore , efficiency and robustness become major issues in modeling joint probability over a large number of random variables , given limited data . considering these factors , we assume the guessing of each word w i conditionally independent of each other , given a correctly / wrongly guessed word w j , leading to the following approximation : the problem of conditional multi - word co - occurrence modeling has been effectively transformed into that of pairwise co - occurrences , which is attractive in terms of modeling , representation , and efficiency . while co - occurrence really happens when g i = g j = 1 , the other combinations of values can also be useful , e . g ., how the frequency of certain word pairs not being both guessed differs according to the correctness of these guesses . the usefulness of component ratios of this product to meta - learning , namely can again be justified based on ideas of inductive transfer . the following examples illustrate this : some visually coherent objects do not often co - occur in the same natural scene . if the black - box strongly associates orange color with the setting sun , it may often be making the mistake of labeling orange ( fruit ) as the sun , or vice - versa , but both occurring in the same scene may be unlikely . in this case , with w i =‘ oranges ’ and w j =‘ sun ’ ( or vice - versa ), w i and w j will frequently co - occur in the black - box &# 39 ; s guesses , but in most such instances , one guess will be wrong . this will imply low values of the above ratio for this word pair , which in turn models the fact that the black - box mistakenly confuses one word for another , for visual coherence or otherwise . some objects that are visually coherent also frequently co - occur in natural scenes . for example , in images depicting beaches , ‘ water ’, and ‘ sky ’ often co - occur as correct tags . since both are blue , the black - box may mistake one for the other . however , such mistakes are acceptable if both are actually correct tags for the image . in such cases , the above ratio is likely to have high values for this word pair , modeling the fact that evidence about one word reinforces belief in another , for visual coherence coupled with co - occurrence ( see fig3 , box a ). highlighted in fig3 are cases interesting from the meta - learner &# 39 ; s viewpoint . for example , box a is read as “ when ‘ water ’ is a correct guess , ‘ sky ’ is also guessed .” for some word w j , the black - box may not have effectively learned anything . this may happen due to lack of good training images , inability to capture apt visual properties , or simply the absence of the word in v bbox . for example , users may be providing the word w j =‘ feline ’ as ground - truth for images containing w i =‘ cat ’, while only the latter may be in the black - box &# 39 ; s vocabulary . in this case , g w j = 0 , and the ratio will be high . this is a direct case of inductive transfer , where the training on one word induces guesses at another word in the vocabulary ( see fig3 , box c ). other such scenarios where this ratio provides useful information can be conceived ( see fig3 , box b , d ). for the term in eq . 5 , since we deal with each word separately , the numerical abstractions ƒ kbase ( i ) relating wordnet to the model &# 39 ; s guesses / ground - truth can be separated out for each word ( conditionally independent of other words ). therefore , we can write in eq . 5 can be simplified , since ƒ vis ( i ) is the meta - learner &# 39 ; s own visual representation ƒ vis ( i ), unrelated to the black - box &# 39 ; s visual abstraction used for making guesses , and hence also the semantic relationship ƒ kbase ( 1 ) therefore , we re - write which is essentially the ratio of conditional probabilities of the visual features extracted by the meta - learner , given w j is correct / incorrect . a strong support for the independence assumptions made in this formulation comes from the superior experimental results . putting everything together , and taking logarithm ( monotonically increasing ) to get around issues of machine precision , we can re - write eq . 5 as a logit : this logit is used by our meta - learner for annotation , where a higher value for a word indicates a higher odds in its support , given all pertinent information . what words to eventually use as annotation for an image i can then be decided in at least two different ways , as found in the literature : top r : after ordering all words w j εv in the increasing magnitude of log l w j ( i ) to obtain a rank ordering , we annotate i using the top r ranked words . threshold r %: we can annotate i by thresholding at the top r percentile of the range of log l w i ( i ) values for the given image over all the words . the formulation at this point is fairly generic , particularly with respect to harnessing of wordnet ( ƒ kbase ( i )) and the visual representation ( ƒ vis ( i )) we now go into specifics of a particular form of these functions that we use in experiments . furthermore we consider robustness issues that the meta - learner runs into , which is further discussed below . the crux of the meta - learner is eq . 10 , which takes in an image i and the black - box guesses for it , and subsequently computes odds for each word . the probabilities involving a w j must all be estimated from any training data that may be available to the meta - learner . in a temporal setting , there will be seed training data to start with , and the estimates will be refined as and when more data / feedback becomes available . let us consider the estimation of each term separately , given a training set of size l , consisting of images { i ( 1 ) , . . . , i ( l ) }, the corresponding word guesses made by the black - box , { ƒ bbox ( i ( 1 ) ), . . . , ƒ bbox ( i ( l ) )}, and the actual ground - truth / feedback , { ƒ gtruth ( i ( 1 ) ), . . . , ƒ gtruth ( i ( l ) )}. to make estimation lightweight , and thus scalable , each component of the estimation is based on empirical frequencies , and is a fully deterministic process . moreover , this property of our model estimation makes it adaptable to incremental or decremental learning . the probability pr ( a w j =\| g w j = g j ) in eq . 10 can be estimated from the size l training data as follows : here , i (•) is the indicator function . a natural issue of robustness arises when the training set contains too few or no samples for g w j ( n ) = 1 , where estimation will be poor or impossible . therefore , we perform a standard interpolation - based smoothing of probabilities . for this we require a prior estimate , which we compute as where gε { 0 , 1 }. for g = 1 ( or 0 ), it is the estimated probability that a word that is guessed ( or not guessed ) is correct . the word - specific estimates are interpolated with the prior to get the final estimates as follows : where m = σ n = 1 l i { g w j ( n ) = g j }, the number of instances out of l where w j is guessed ( or not guessed , depending upon g j ). the probability pr ( g w i = g i \| a w j = 1 , g w j = g j ) in eq . 10 can be estimated from the training data as follows : here , we have a more serious robustness issue , since many word pairs may not appear in the black - box &# 39 ; s guesses . a popular smoothing technique for word pair co - occurrence modeling is similarity - based smoothing , which is appropriate in this case , since semantic similarity based propagation of information is meaningful here . given a wordnet - based semantic similarity measure w ( w i , w j ) between word pairs w i and w j , the smoothed estimates are given by : where z is a normalization factor . when { circumflex over ( p )}{ circumflex over ( r )}(•\|•,•) cannot be estimated due to lack of samples , a prior probability estimate , computed as in the previous case , is used in its place . the leacock and chodorow ( lch ) word similarity measure , used as w (•,•) here , generates scores between 0 . 37 and 3 . 58 , higher meaning more semantically related . thus , this procedure weighs the probability estimates for words semantically closer to w j more than others . the estimation of pr ( ρ j \| a w j = a , ∪ i ≠ j ( g w i = g i ), g w j = g j ), aε { 0 , 1 } in eq . 10 will first require a suitable definition for ρj . as mentioned , it can be thought of as a numerical abstraction relating the knowledge base to the black - box &# 39 ; s guesses . the hope here is that the distribution over this numerical abstraction will be different when certain word guesses are correct , and when they are not . one such formulation is as follows . suppose the black - box makes q word guesses for an image i that has word w j as a correct ( or wrong ) tag , for a = 1 ( or a = 0 ). we model the number of these guesses , out of q , that are semantically related to w j , using the binomial distribution , which is apt for modeling counts within a bounded domain . semantic relatedness here is determined by thresholding the lch relatedness score w (•,•) between pairs of words ( a score of 1 . 7 , ˜ 50 percentile of the range , was arbitrarily chosen as threshold ). of the two binomial parameters ( n , p ), n is set to the number of word guesses q made by the black - box , if it always makes a fixed number of guesses , or the maximum possible number of guesses , whichever appropriate . the parameter p is calculated from the training data as the expected value of ρ j for word w j , normalized by n , to obtain estimates { circumflex over ( p )} j , 1 ( and { circumflex over ( p )} j , 0 ) for a w j being 1 ( and 0 ). this follows from the fact that the expected value over a binomial pmf is n · p . since robustness may be an issue here again , interpolation - based smoothing , using a prior estimate on p , is performed . thus , the ratio of the binomial pmfs can be written as follows : finally , we discuss pr ( h 1 , . . . , h d \| a w j = a ), aε { 0 , 1 }, the visual representation component in eq . 10 . the idea is that the probabilistic model for a simple visual representation may differ when a certain word is correct , versus when it is not . while various feature representations are possible , we employ one that can be efficiently computed and is also suited to efficient incremental / decremental learning . each image is divided into 16 equal partitions , by cutting along each axis into four equal parts . for each block , the rgb color values are transformed into the luv space , and the triplet of average l , u , and v values represent that block . thus , each image is represented by a 48 - dimensional vector consisting of these triplets , concatenated in raster order of the blocks from top - left , to obtain ( h 1 , . . . , h 48 ). for estimation from training , each of the 48 components is fitted with a univariate gaussian , which involves calculating the estimated mean { circumflex over ( μ )} j , d , a and std . dev . { circumflex over ( σ )} j , d , a . smoothing is performed by interpolation with estimated priors { circumflex over ( μ )} and { circumflex over ( σ )}. the joint probability is computed by treating each component as conditionally independent given a word w j : here , n (.) is the gaussian pdf . so far , we have discussed the static case , where a batch of images are trained on . if ground - truth for some images is available , it can be used to train the meta - learner , to annotate the remaining ones . we experiment with this setting in sec . 4 , to see if a meta - learner built atop the black - box is advantageous or not . we now look at image annotation in online settings . the meta - learning framework discussed earlier has the property that the learning components involve summation of instances , followed by simple o ( 1 ) parameter estimation . inference steps are also lightweight in nature . this makes online re - training of the meta - learner convenient via incremental / decremental learning . imagine the online settings presented in the background of the invention ( see fig1 ). here , images are annotated as they are uploaded , and whenever the users choose to provide feedback by pointing out wrong guesses , adding tags , etc . for example , in flickr , images are publicly uploaded , and independently or collaboratively tagged , not necessarily at the time of uploading . in alipr , feedback is solicited immediately upon uploading . in both these cases , ground - truth arrives into the system sequentially , giving an opportunity to learn from it to annotate future pictures better . note that when we say of tagging ‘ over time ’, we mean tagging in sequence , temporally ordered . at its inception , an annotation system may not have collected any ground - truth for training the meta - learner . hence , over a certain initial period , the meta - learner stays inactive , collecting an l seed number of seed user feedback . at this point , the meta - learner is trained quickly ( being lightweight ), and starts annotation on incoming images . after an l inter number of new images has been received , the meta - learner is re - trained ( fig4 provides an overview ). the primary challenge here is to make use of the models already learned , so as not to redundantly train on the same data . re - training can be of two types depending on the underlying ‘ memory model ’: persistent memory : here , the meta - learner accumulates new data into the current model , so that at steps of l inter , it learns from all data since the very beginning , inclusive of the seed data . technically , this only involves incremental learning . transient memory : here , while the model learns from new data , it also ‘ forgets ’ an equivalent amount of the earliest memory it has . technically , this involves incremental and decremental learning , whereby at every l inter jump , the meta - learner is updated by ( a ) assimilating new data , and ( b ) ‘ forgetting ’ old data . our meta - learner formulation makes incremental and decremental learning efficient . let us denote ranges of image sequence indices , ordered by time , using the superscript [ start : end ], and let the index of the current image be l cu . we first discuss incremental learning , required for the case of persistent memory . here , probabilities are re - estimated over all available data up to the current time , i . e ., over [ 1 : l cu ]. this is done by maintaining summations computed in the most recent re - training at l pr ( say ), over a range [ 1 : l pr ] where l pr & lt ; l cu . for the first term in eq . 10 , suppressing the irrelevant variables , we can write therefore , updating and maintaining the summation values s ( g w i ) and s ( g w j & amp ; a w j ) suffices to re - train the meta - learner without using time / space on past data . the priors are also computed using these summation values in a similar manner , for smoothing . since the meta - learner is re - trained at fixed intervals of l inter , i . e ., l inter = l cu − l pr only a fixed amount of time / space is required every time for getting the probability estimates , regardless of the value of l cu . the second term in eq . 10 can also be estimated in a similar manner , by maintaining the summations , taking their quotient , and smoothing with re - estimated priors . for the third term related to wordnet , the estimation is similar , except that the summations of ρ j for a w j = 0 and 1 , are maintained instead of counts , to obtain estimates { circumflex over ( p )} j , 0 and { circumflex over ( p )} j , 1 respectively . for the fourth term related to visual representation , the estimated mean { circumflex over ( μ )} j , d , a and std . dev . { circumflex over ( σ )} j , d , a can also be updated with values of ( h 1 , . . . , h 48 ) for the new images by only storing summation values , as follows : owing to the fact that σ 2 ( x )= e ( x 2 )−( e ( x )) 2 . here , s ( h d 2 ) [ 1 : l pr ] is the sum - of - squares of the past values of feature h d , to be maintained , and e (.) denotes expectation . this justifies our simple visual representation , since it conveniently allows incremental learning by only maintaining aggregates . overall , this process continues to re - train the meta - learner , using the past summation values , and updating them at the end , as depicted in fig4 . in the transient memory model , estimates need to be made over a fixed number of recent data instances , not necessarily from the beginning . we show how this can be performed efficiently , avoiding redundancy , by a combination of incremental / decremental learning . since every estimation process involves summation , we can again maintain summation values , but here we need to subtract the portion that is to be removed from consideration . suppose the memory span is decided to be l ms , meaning that at the current time l cu , the re - estimation must only involve data over the range [ l cu − l ms : l cu ] let l old = l cu − l ms . here , we show the re - estimation of { circumflex over ( μ )} j , d , a . here , along with summation s ( h d ) [ 1 : l pr ] , we also require s ( h d ) [ 1 : l old - 1 ] . therefore , since l ms , and l inter are decided a priori , it is straightforward to know the values of l old for which s ( h d ) [ 1 : l old - 1 ] will be required , and we store them along the way . other terms in eq . 10 can be estimated similarly . putting things together , a high - level version of our t / t approach is presented in algorithm 1 , below . it starts with an initial training of the meta - learner using seed data of size l seed . this could be accumulated online using the annotation system itself , or from an external source of images with ground - truth ( e . g ., corel images ). the process then takes one image at a time , annotates it , and solicits feedback . any feedback received is stored for future meta - learning . after gaps of l inter the model is re - trained based on the chosen strategy . if (( l cu − l seed ) modulo l inter ) = 0 then re - train meta - learner on dat ( l cu − l ms : l cu ) we perform experiments for the two scenarios shown in fig1 ; ( 1 ) static tagging , where a batch of images are tagged at once , and ( 2 ) tagging over time ( online setting ) where images arrive in temporal order , for tagging . in the former , our meta - learning framework simple acts as a new annotation system based on an underlying black - box system . we explore whether the meta - learning layer improves performance over the black - box or not . in the latter , we have a realistic scenario that is particularly suited to online systems ( flickr , alipr ). here , we see how the seed meta - learner fares against the black - box , and whether its performance improves with newly accumulated feedback or not . we also explore how the two meta - learning memory models , persistent and transient , fare against each other . experiments are performed on standard datasets and real - world data . first , we use the corel stock photos , to compare our meta - learning approach with the state - of - the - art . this collection of images is tagged with a 417 word vocabulary . second , we obtain two real - world , temporally ordered traces from the alipr system , each 10 , 000 in length , taken over different periods of time . each trace consists of publicly uploaded images , the annotations provided by alipr , and the user - feedback received on these annotations . the alipr system provides the user with 15 guessed words ( ordered by likelihoods ), and the user can opt to select the correct guesses and / or add new ones . this is the feedback for our meta - learner . here , ignoring the non - wordnet words in either vocabulary ( to be able to use the wordnet similarity measure uniformly , and to reduce noise in the feedback ), we have a consolidated vocabulary of 329 unique words . two different black - box annotation systems , which use different approaches to image tagging , are used in our experiments . a good meta - learner should fare well for different underlying black - box systems , which is what we set out to explore here . the first is alipr , which is a real - time , online system , and the second is a recently proposed approach that was shown to outperform earlier systems . for both models , we are provided guessed tags given an image , ordered by decreasing likelihoods . annotation performance is gauged using three standard measures , namely precision , recall and f 1 - score that have been used in the past . specifically , for each image , ( harmonic mean of precision and recall ). results reported in each case are averages over all images tested on . the ‘ lightweight ’ nature of our meta - learner is validated by the fact that the re - training of each visual category in [ 2 ] and [ 1 ] are reported as 109 sec . and 106 sec . respectively . therefore , at best , re - training will take these times when the models are built ally in parallel . in contrast , our meta - learner re - trains on 10 , 000 images in ˜ 6 . 5 sec . on a single machine . furthermore , the additional computation due to the meta - learner during annotation is negligible . in [ 1 ], it was reported that 24 , 000 corel images , drawn from 600 image categories were used for training , and 10 , 000 test images were used to assess performance . we use this system as black - box by obtaining the word guesses made by it , along with the corresponding ground - truth , for each image . our meta - learner uses an additional l seed = 2 , 000 images ( randomly chosen ) from the corel dataset as the seed data . therefore , effectively , ( black - box + meta - learner ) uses 26 , 000 instead of 24 , 000 images for training . we present results on this static case in table i . results for our meta - learner approach are shown for both top r ( r = 5 ) and threshold r % ( r = 60 ), as described elsewhere herein . the baseline results are those reported in [ 1 ]. note the significant jump in performance with our meta - learner in both cases . effectively , this improvement comes at the cost of only 2 , 000 extra images and marginal addition to computation time . next , we experiment with real - world data obtained from alipr , which we use as the black - box , and the data is treated as a batch here , to emulate a static scenario . we use both data traces consisting of 10 , 000 images each , the tags guessed by alipr for them , and the user feedback on them , as described before . it turns out that most people provided feedback by selection , and a much smaller fraction typed in new tags . as a result , the recall is by default very high for the black - box system , but it also yields poor precision . for each trace , our meta - leaner is trained on l seed = 2 , 000 seed images , and tested on the remaining 8 , 000 images . in table ii , averaged - out results for our meta - learner approach for both top r ( r = 5 ) and threshold r % ( r = 75 ), as described earlier , are presented alongside the baseline performance on the same data ( all 15 and top 5 guesses ). again we observe significant performance improvements over the baseline in both cases . as is intuitive , a lower percentile cut - off for threshold , or a higher number r of top words both lead to higher recall , at the cost of lower precision . therefore , either number can be adjusted according to the specific needs of the application . we now look at the t / t case . because the alipr data was generated online in a real - world setting , it makes an apt test data for our t / t approach . again , the black - box here is the alipr system , from which we obtain the guessed tags and user feedback . the annotation performance of this system acts as a baseline for all experiments that follow . first , we experiment with the two data traces separately . for each trace , a seed data consisting of the first l seed = 1 , 000 images ( in temporal order ) is used to initially train the meta - learner . re - training is performed in intervals of l inter = 200 . we test on the remaining 9 , 000 images of the trace for ( a ) static case , where the meta - learner is not further re - trained , and ( b ) t / t case , where meta - learner is re - trained over time , using ( a ) top r ( r = 5 ), and ( b ) threshold r % ( r = 75 ) for each case . for these experiments , the persistent memory model is used . comparison is made using i and f 1 - score , with the baseline performance being that of alipr , the black - box . here a comparison of recall is not interesting because it is generally high for the baseline ( as explained before ), and it is anyway dependent on the other two measures . these results are shown in fig5 a to 5d . the scores shown are moving averages over 500 images ( or less , for the initial 500 images ). next , we explore how the persistent and transient memory models fare against each other . the main motivation for transient learning is to ‘ forget ’ earlier training data that is irrelevant , due to a shift in trend in the nature of images and / or feedback . because we observed such a shift between alipr traces # 1 and # 2 ( being taken over distinct time - periods ), we merged them together to obtain a new 20 , 000 image trace to emulate a scenario of shifting trend . performing a seed learning over images 4 , 001 to 5 , 000 ( part of trace # 1 ), we test on the trace from 5 , 001 to 15 , 000 . the results for the two memory models for t / t , along with the static and baseline cases , are presented in fig6 a and 6b . note the performance dynamics around the 10 , 000 mark where the two traces merge . while the persistent and transient models follow each other closely till around this mark , the latter performs better after it ( by up to 10 %, in precision ), verifying our hypothesis that under significant changes , ‘ forgetting ’ helps to produce a better - adapted meta - learner . a strategic question to ask , on implementation , is ‘ how often should we re - train the meta - learner , and at what cost ?’. to analyze this , we experimented with the 10 , 000 images in alipr trace # 1 , varying the interval l inter , between retraining while keeping everything else identical , and measuring the f 1 - score . in each case , the computation time is noted ( ignoring the latency incurred due to user waits , treated as constant here ). these durations are normalized by the maximum time incurred , i . e ., at l inter = 100 . these results are presented in fig7 a and 7b . note that with increasing gaps in re - training , f 1 - score decreases to a certain extent , while computation time saturates quickly , to the amount needed exclusively for tagging . there is a clear trade - off between computational overhead and the f 1 - score achieved . a graph of this nature can therefore help decide on this trade - off for a given application . finally , in fig8 , we show an image sampling from a large number of cases where we found the annotation performance to improve meaningfully with re - training over time . specifically , against time 0 is shown the top 5 tags given to the image by alipr , along with the meta - learner guesses after training over l 1 = 1000 and l 2 = 3000 images over time . clearly , more correct tags are pushed up by the meta - learning process , which improves with more re - training data . in this specification , we have disclosed a principled lightweight meta - learning framework for image annotation , and through extensive experiments on two different state - of - the - art black - box annotation systems have shown that a meta - learning layer can vastly improve their performance . we have additionally disclosed a new annotation scenario which has considerable potential for real - world implementation . taking advantage of the lightweight design of our meta - learner , we have set of a ‘ tagging over time ’ algorithm for efficient re - training of the meta - learner over time , as new user - feedback become available . experimental results on standard and real - world datasets show dramatic improvements in performance . we have experimentally contrasted two memory models for meta - learner re - training . the meat - learner approach to annotation appears to have a number of attractive properties , and it seems worthwhile to implement it atop other existing systems to strengthen this conviction . r . datta , w . ge , j . li j . wang ; “ toward briding the annotation - retrieval gap in image search by a generative modeling approach .” in proc . acm multimedia , 2006 . [ 2 ] j . li and j . wang ; “ real - time computerized annotation of pictures .” in proc . acm multimedia 2006 .	6
the following description is merely exemplary in nature and is in no way intended to limit the disclosure , its application , or uses . for purposes of clarity , the same reference numbers will be used in the drawings to identify similar elements . as used herein , the phrase at least one of a , b , and c should be construed to mean a logical ( a or b or c ), using a non - exclusive logical “ or .” it should be understood that steps within a method may be executed in different order without altering the principles of the present disclosure . embodiments of the invention will now be described with reference to the figures , wherein like numerals reflect like elements throughout . embodiments of the invention may include several novel features , no single one of which is solely responsible for its desirable attributes or which is essential to practicing the invention described herein . the words proximal and distal are applied herein to denote specific ends of components of the instrument described herein . for example only , a proximal end refers to the end of an instrument nearer to an operator of the instrument when the instrument is being used . a distal end refers to the end of a component further from the operator and extending towards the surgical area of a patient and / or the implant . similarly , the words left and right , top and bottom , and upper and lower may denote opposite sides of a component . referring now to fig1 - 6 , an exemplary stand alone interbody fixation system 100 for spinal surgeries includes a cage 102 and an attachment member 104 . the cage 102 may include a substantially annular shape formed by an anterior wall 106 , lateral walls 108 and 110 , and a posterior wall 112 that form a substantially hollow interior 114 . a plurality of grooves 115 on upper and lower surfaces of the cage 102 may improve attachment of the cage 102 to the vertebrae . the attachment member 104 may include one or more fixation blades 116 a - b ( collectively blades 116 ) coupled to a shaft 118 at a hub 119 . the shaft 118 may extend through into at least one of the walls 106 - 112 . for example , in the present example , the shaft 118 extends through the anterior wall 106 , a portion of the hollow interior 114 , and into the posterior wall 112 . one or more of the blades 116 may be positioned exterior to the walls 106 - 112 . the blades 116 may rotate about the shaft 118 to engage vertebrae above and below the cage 102 . other typical stand alone interbody fixation systems may include interior blades within the hollow interior of a cage . because these interior blades must fit within the hollow interior of the cage , the dimensions must be limited to the dimensions of the interior sides of the various walls comprising the cage . further , because the interior blades fill a portion of the hollow interior , less volume is available for packing of bone graft material . the exterior blades 116 provide a larger radius of travel or arc length than prior stand alone interbody spacer systems having blades that deploy from the hollow interior 114 . for example , in the cervical region of the spine , vertebrae and intervertebral disc space are substantially smaller than in lower regions of the spine . therefore , spacers with internal blades are substantially limited in terms of arc length and engagement with the adjacent vertebrae . by positioning the blades external to the spacer / cage , the blades may include radial lengths greater than internal blades . although the exterior blades 116 of the present example are substantially formed in right angles , other blade configurations may include curved blades , helical blades , and additional toothed and spiked blades . fig6 illustrates an exploded perspective view of the system 100 showing additional features for coupling the cage 102 and the attachment member 104 . the anterior wall 106 of the cage 102 may include an anterior aperture 120 . the anterior aperture 120 may also include a keyed portion 122 that engages portions of the shaft 118 to lock the system 100 in one or more configurations . for example , the hub 119 may include posterior projections 123 configured to snap into the keyed portion 122 . the posterior wall 112 of the cage may include a posterior aperture 124 . the posterior aperture 124 may include a slot 126 for guiding the shaft 118 through the posterior wall 112 . the attachment member 104 may be rotated from a non - deployed first configuration to a deployed second configuration by rotating the shaft 118 as illustrated in fig7 a - 7c and 8 a - 8 c . for example , a deployment instrument ( not shown ) may engage a driving feature 127 of the hub 119 . the cage 102 may include nesting features for receiving the attachment member 104 within portions of the walls 106 - 112 in the first configuration . for example , in fig6 , the side walls 108 and 110 include recessed portions 128 and 130 configured to partially engage the attachment member 104 . the blades 116 of the attachment member 104 may comprise an anterior member 132 extending substantially parallel with the anterior wall 106 and including the hub 119 . a first arm 134 may extend posteriorly from the anterior member 132 and proximate to the first side wall 108 to form the first blade 116 a . a second arm 136 may extend posteriorly from the anterior member 132 and proximate to the second side wall 110 to form the second blade 116 b . first recessed portion 128 may permit nesting of the first arm 134 such that the outer surfaces of the first arm 134 and the side wall 108 are substantially flush with one another . likewise , second recessed portion 130 may permit nesting of the second arm 136 such that the outer surfaces of the second arm 136 and the side wall 110 are flush with one another . thus , the attachment member 104 may form a substantially unitary , u - shaped construction that surrounds the cage 102 . posterior ends of the blades 116 may include piercing members 138 such as spikes , claws , and the like for piercing the endplates of the vertebrae . referring now to fig7 a - 7c and 8 a - 8 c , the system 100 may be deployed by rotating the shaft 118 within the cage 102 . in fig7 a and 8a , the system 100 is in a first non - deployed configuration with the first and second arms 134 and 136 nesting within the first and second recessed portions 128 and 130 respectively . the system 100 includes a slim profile for insertion into the intervertebral space . the deployment instrument ( not shown ) may engage the recess 127 of the hub 119 and apply a torque to rotate the attachment member 104 and deploy the system 100 . as the shaft 118 rotates within the apertures 120 and 124 in fig7 b and 8b , the first arm 134 may disengage the first recessed portion 128 and the second arm 136 may disengage the second recessed portion 130 . rotation of the arms 134 and 136 positions the piercing members 138 closer to the endplates and begins engage the piercing members 138 with the endplates of the vertebrae . in fig7 c and 8 c , the system 100 is in a fully deployed configuration with the first and second arms 134 and 136 fully rotated and disposed at right angles relative to the cage 102 . the piercing members 138 may fully engage the endplates of the vertebrae . the exterior fixation blades 116 may include a radius r 1 of extension away from the shaft 118 that is greater than a radius r 2 of typical interior blades of the prior art . the larger radius r 1 provides greater encroachment and engagement within the endplates of the vertebrae . exterior blades also provide increased volume within the hollow interior 114 of the cage 102 . including blades that are exterior to the cage may present additional concerns regarding safety of the surgeon while handling the system 100 . the system 100 may further comprise sterile packaging conducive to both transport and loading into the insertion / deployment tools . the tools themselves may include a protective sheath , sleeve , or outer members that surround the system 100 to prevent contact with the exterior blades 116 . example embodiments of the methods and systems of the present invention have been described herein . as noted elsewhere , these example embodiments have been described for illustrative purposes only , and are not limiting . other embodiments are possible and are covered by the invention . such embodiments will be apparent to persons skilled in the relevant art ( s ) based on the teachings contained herein . thus , the breadth and scope of the present invention should not be limited by any of the above - described exemplary embodiments but should be defined only in accordance with the following claims and their equivalents . the broad teachings of the disclosure can be implemented in a variety of forms . therefore , while this disclosure includes particular examples , the true scope of the disclosure should not be so limited since other modifications will become apparent to the skilled practitioner upon a study of the drawings , the specification , and the following claims .	0
the block copolymers used herein are recognized as linear a - b - a triblock copolymers or radial - block copolymers , or as a - b - a - b - a - b multi - block copolymers where the a block is styrene and the b block is butadiene and wherein the copolymer contains 38 to 55 parts styrene per 100 parts copolymer . these copolymers may be prepared using methods taught , for example , in u . s . pat . nos . 3 , 239 , 478 ; 3 , 427 , 269 ; 3 , 700 , 633 ; 3 , 753 , 936 ; and 3 , 932 , 327 . alternatively , they may be obtained from firestone under the tradenames stereon 840 a and stereon 845 , from shell under the tradename dx1150 and from enichem ( italy ) under the tradename sol t162 . the tackifying resins useful in these adhesive compositions can be hydrocarbon resins , synthetic polyterpenes , hydrogenated rosin esters , and the like . more particularly , the useful tackifying resins include any compatible resins or mixtures thereof such as ( 1 ) glycerol and pentaerythritol esters of modified hydrogenated rosins , such , for example as the glycerol ester of hydrogenated rosin , ( 2 ) copolymers and terpolymers of natural terpenes , e . g . styrene / terpene and alpha methyl styrene / terpene ; ( 3 ) polyterpene resins having a softening point , as determined by astm method e28 - 58t , of from about 80 to 150 ° c . ; the latter polyterpene resins generally resulting from the polymerization of terpene hydrocarbons , such as the bicyclic monoterpene known as pinene , in the presence of friedel - crafts catalysts at moderately low temperatures ; also included are ( 4 ) the hydrogenated polyterpene resins ; and ( 5 ) copolymers of aliphatic and aromatic monomers such as wingtack 86 available from goodyear tire and rubber company . while other known tackifying resins are not useful as the sole tackifier in the composition , it is possible to obtain satisfactory results utilizing a blend of tackifiers where a substantial portion of the blend is comprised of one of the tackifiers represented above . the selection of the particular tackifying agent is , in large part , dependent upon the specific block copolymers employed . generally the tackifier is present in the hot melt adhesive in an amount of 30 - 70 %, preferably 50 to 60 %, by weight . various plasticizing or extending oils are also present in the composition in amounts of 10 % to about 30 %, preferably 15 to 20 %, by weight in order to provide wetting action and / or viscosity control it is desirable that the amount of oil present in the adhesive not exceed the amount of the block polymer . the usual plasticizing oils such as paraffinic and naphthenic oils are preferred ; however , the invention also contemplates the use of the olefin oligomers and low molecular weight polymers as well as vegetable and animal oil and their derivatives . the petroleum derived oils which may be employed are relatively high boiling materials containing only a minor proportion of aromatic hydrocarbons ( preferably less than 30 % and , more particularly , less than 15 % by weight of the oil ). alternatively , the oil may be totally non - aromatic . the oligomers may be polypropylenes , polybutenes , hydrogenated polyisoprene , hydrogenated polybutadiene , or the like having average molecular weights between about 350 and about 10 , 000 . vegetable and animal oils include glyceryl esters of the usual fatty acids and polymerization products thereof . additionally , some or all of theoil or some portion of the tackifying resin may be replaced by a liquid tackifying resins such as wingtack 10 ( a low molecular weight liquid aliphatic synethetic polyterpene plasticizing resin ). various petroleum derived waxes may also be used in amounts less than about 15 % by weight of the composition in order to impart fluidity in the molten condition of the adhesive and flexibility to the set adhesive , and to serve as a wetting agent . the term &# 34 ; petroleum derived wax &# 34 ; includes both paraffin and microcrystalline waxes having melting points within the range of 54 - 110 ° c . as well as synthetic waxes such as low molecular weight polyethylene or fisher - tropsch waxes . among the applicable stabilizers or antioxidants utilized herein are included high molecular weight hindered phenols and multifunctional phenols such as suflur and phosphorous - containing phenols . hindered phenols are well known to those skilled in the art and may be characterized as phenolic compounds which also contain sterically bulky radicals in close proximity to the phenolic hydroxyl group hereof . in particular , tertiary butyl groups generally substituted onto the benzene ring in at least one of the ortho positions relative to the phenolic hydroxy group . the presence of these sterically bulky substituted radicals in the vicinity of the hydroxyl group serves to retard its stretching frequency and , correspondingly , its reactivity ; this steric hindrance thus providing the phenolic compound with its stabilizing properties . representative hindered phenols include : 1 , 3 , 5 - trimethyl 2 , 4 , 6 - tris ( 3 , 5 - di - tert - butyl - 4 - hydroxybenzyl ) benzene ; pentaerythrityl tetrakis - 3 ( 3 , 5 - di - tert - butyl - 4 - hydroxyphenyl ) propionate ; n - octadecyl - 3 ( 3 , 5 - di - tert - butyl - 4 - hydroxyphenyl )- propionate ; 4 , 4 &# 39 ; methylenebis ( 2 , 6 - tert - butylphenol ); 4 , 4 &# 39 ;- thiobis ( 6 - tert - butyl - o - cresol ); 2 , 6 - ditertbutylphenol ; 6 -( 4 - hydroxyphenoxy )- 2 , 4 - bis -( n - octyl - thio )- 1 , 3 , 5 - triazine ; di - n - octadecyl 3 , 5 - di - tert - butyl - 4 - hydroxy - benzylphosphonate ; 2 -( n - octylthio ) ethyl 3 , 5 - di - tert - butyl -- 4 - hydroxy - benzoate ; and sorbitol hexa [ 3 -( 3 - di - tert - butyl - 4 - hydroxyphenyl )- propionate ]; zinc di - n - butyl dithiocarbamate and zinc diethyl dithiocarbamate . the performance of these antioxidants may be further enhanced by utilizing , in conjunction therewith known synergists such , for example , as thiodipropionate esters and phosphites , particularly useful is distearylthiodipropionate . these stabilizers are generally present in amounts of about 0 . 1 to 2 weight percent , preferably 0 . 25 to 1 . 0 %. in formulating the hot melt adhesives of the present invention , the styrene - butadiene copolymer is used in an amount of 20 - 40 % by weight , preferably 25 to 35 %; with 30 - 70 %, preferably 50 - 60 %, of a tackifier ; 10 - 30 %, preferably 15 - 20 %, of a plasticizing oil and a small effective amount of an antioxidant . other additives such as plasticizers , pigments , dystuffs conventionally added to hot melt adhesives for the various end uses contemplated may also be incorporated in minor amounts into the formulations of the present invention . the adhesive compositions are prepared by blending the components in the melt at a temperature of about 130 - 200 ° c . until a homogeneous blend is obtained , approximately 2 hours . various methods of blending are known to the art and any method that produces a homogeneous blend is satisfactory . an exemplary procedure involves placing the block copolymer , antioxidants and a portion of the oil in a jacketed mixing kettle , for example in a jacketed heavy duty mixer of the baker - perkins type , which is equipped with rotors and thereupon raising the temperature to a range of from about 120 ° to 180 ° c . when the mixture has been masticated to a uniform consistency , the tackifying resin and the remainder of the oil are gradually added in order to avoid the formation of lumps . mixing and heating are continued until a smooth , homogeneous mass is obtained whereupon the remainder of the tackifying resin and the oil are thoroughly and uniformly admixed therewith . the resultant hot melt adhesives are generally produced in bulk form and packaged in release coated containers . the resulting hot - melt pressure sensitive adhesive , once it is heated to a temperature where it will flow readily , can be applied directly to the outer covering layer of the absorbent structure or article or it may be reverse ( transfer ) coated onto release paper using any of the techniques known in the art , including flow coating , roller coating , knife coating , or the like . the adhesive can also be extruded into place by using a hot - melt extruder or die face . in the following illustrative examples , all parts are by weight and all temperatures in degrees celsius unless otherwise specified . a series of adhesive formulations were prepared based on stereon 845 , a multi - block copolymer available from shell containing approximately 50 % styrene , varying the tackifying agent used . ______________________________________ formulation ( weight %) ingredient 1 2 3 4 5 6______________________________________stereon 845 27 . 5 27 . 5 27 . 5 27 . 5 27 . 5 27 . 5naphthenic oil 7 . 5 7 . 5 7 . 5 7 . 5 7 . 5 7 . 5wingtack 10 ( 1 ) 10 10 10 10 10 10arkon m 100 ( 2 ) 55 -- -- -- -- -- permalyn 85 ( 3 ) -- 55 -- -- -- -- zonatac lite 105 ( 4 ) -- -- 55 -- -- -- escorez 5300 ( 5 ) -- -- -- 55 -- -- foral 105 ( 6 ) -- -- -- -- 55 -- wingtack 86 ( 7 ) -- -- -- -- -- 55irganox 1010 ( 8 ) 0 . 25 0 . 25 0 . 25 0 . 25 0 . 25 0 . 25irgaphos 168 ( 8 ) 0 . 25 0 . 25 0 . 25 0 . 25 0 . 25 0 . 25______________________________________ ( 1 ) wingtack 10 is a liquid tackifying resin available fromgoodyear tire and rubber company . ( 2 ) arkon m100 is a hydrogenated aromatic tackifying resinavailable from arakawa k . k . ( japan ). ( 3 ) permalyn 85 is a glycerol ester of resin available fromhercules chemical . ( 4 ) zonatac lite 105 is a aromatic modified terpene resinavailable from arizona chemical . ( 5 ) escorez 5300 is a hydrogenated dicyclopentadiene resinavailable from exxon corpration . ( 6 ) foral 105 is a hydrogenated rosin ester available fromhercules chemical . ( 7 ) wingtack 86 is an aliphatic - aromatic copolymer availablefrom goodyear tire and rubber company . ( 8 ) antioxidant system . another series of adhesive formulations was preparedvarying the block copolymers employed . formulation ( weight %) ingredient % styrene 7 8 9 10wingtack 86 -- 55 55 55 55kraton 1102 ( 9 ) 28 % 27 . 5 -- -- -- stereon 840a 40 % -- 27 . 5 -- -- dx 1150 ( 10 ) 38 % -- -- 27 . 5 -- sol t162 ( 11 ) 40 % -- -- -- 27 . 5naphthenic oil -- 7 . 5 7 . 5 7 . 5 7 . 5wingtack 10 -- 10 10 10 10irganox 1010 -- 0 . 25 0 . 25 0 . 25 0 . 25irgaphos 168 -- 0 . 25 0 . 25 0 . 25 0 . 25 ( 9 ) a block copolymer available from shell chemicalcontaining 28 % styrene . ( 10 ) a block polymer available from shell chemicalcontaining 38 % styrene . ( 11 ) a block copolymer available from enichem ( italy ). as a comparison , a formulation was prepared from 15 . 75 parts kraton g1650 ( styrene = 28 - 30 %), 25 parts oil , 59 - 25 parts wingtack 95 and an antioxidant according to the teachings of u . s . pat . no . 4 , 136 , 699 . samples were prepared for testing by coating a 1 . 75 - 2 . 25 mil thickness of the adhesive on a mylar substrate ( trademark of dow chemical corp .). after conditioning overnight , 1 inch by 3 inch ( 2 . 54 by 7 . 82 cm .) strips were cut in the x - machine direction . all tests were performed on samples as initially prepared and then repeated after subjecting the adhesives to heat aging at 175 ° c . for 24 hours . the coated samples were laminated to cotton knit fabric ( placed on glass ) using two passes with a 4 . 5 lb . ( 2 kg ) roller . immediately after lamination , the coated sample was pulled from the cotton knit using the shear mode on an instron tester at a crosshead speed of 20 inches ( 50 cm ) per minute . values shown are for an average of at least three samples and are expressed in grams per linear inch . the coated samples was laminated to cotton knit fabric by placing the knit on glass plates in an oven equilibrated to 40 ° c . and placing the sample on top of the knit with a load of 150 grams per square inch for a period of 60 minutes . the sample was then peeled away from the cotton knit in a 180 ° direction using an instron tester at crosshead speed of 20 inches ( 50 cm ) per minute . values shown are for an average of at least three samples and are expressed in grams per linear inch . the coated sample was laminated to cotton knit as for the dynamic shear test . then using a crosshead speed of 20 inches ( 50 cm ) per minute , the coated samples were pulled away from the cotton knit immediately and after 30 minutes conditioning at room temperature . values are shown in grams per linear inch for an average of at least three samples at each time interval . the coated sample was laminated to cotton knit fabric by placing the knit on glass plates in an oven equilibrated to 49 ° c . and laminating with a 800 gram per square inch load for 24 hours . the sample was then peeled away from the cotton knit in 180 ° direction on an instron tester at crosshead speed of 20 inches ( 50 cm ) per minute . values shown are for an average of at least three samples and are expressed in grams per linear inch . the adhesive residue left on the cotton knit is noted qualitatively . two hundred grams of the adhesive were placed in a clean glass jar , tightly covered with aluminum foil and placed in an oven equilibrated to 176 ° for 24 hours . the adhesive was then examined visually for stains , char , separation , gel , edge rim and color . the viscosity was measured and compared with the initial viscosity . test results for formulations 1 - 10 as well as the control are presented in table i . table i__________________________________________________________________________test formulation 1 2 3 4 5 6 7 8 9 10 control__________________________________________________________________________cotton peel ( initial ) 170 468 213 43 240 255 400 317 125 132 225 ( after aging ) 155 600 218 45 295 268 415 270 107 125 257peel retention ( initial ) 297 699 245 8 666 932 1035 1041 518 890 932 ( after aging ) 327 611 218 21 690 950 1078 1171 690 775 869peel retention * ( initial ) 294 630 224 14 763 893 920 950 521 751 893 ( after aging ) 288 593 248 29 702 787 781 1111 490 572 412dynamic cotton shear ( initial ) 1233 2783 1000 83 2417 3567 4367 4083 2550 3567 3567 ( after aging ) 1100 2850 1233 67 1867 3367 4450 4050 3500 2967 3133transfer ( initial ) 1060 2467 2133 483 2125 1275 2583 2225 4313 867 1275 ( after aging ) 1067 2517 1342 433 1700 1050 2900 2217 1083 617 983qualitative transfer ( initial ) none moderate none none none none heavy none none none none ( after aging ) none moderate none none none none heavy none none none noneheat stability good good good good good good good good good good good__________________________________________________________________________ * test procedure repeated after conditioning at room temperature for 1 / 2 hour . the results presented above show that only when adhesives are formulated using the high styrene content block copolyer with the specific classes of tackifying agents described herein are compositions obtained characterized by a high degree of adhesion and low transfer as desired for commercial positioning adhesive applications . thus , formulations 1 , 3 , 5 , 6 , 8 , 9 and 10 prepared with block copolymers containing at least 38 % styrene and with tackifiers from the specified classes provided adhesive compositions which would be satisfactory for commercial application and in some cases , gave adhesive strength values greater than or equivalent to those achieved with the present commercially utilized product with little or no increase in transfer . in contrast , use of the high styrene polymers with other tackifiers in formulations 2 , 4 , and 7 exhibited substantially poorer adhesive strength values or undesirable transfer .	0
fig1 is a perspective view displaying a multimodal resonant cavity for heating and polymerizing cylindrical rods . fig2 is a top view of an installation comprising a multimodal resonant cavity with a measuring system for controlling certain adjustments . fig3 is a polymerization line for cylindrical rods using three multimodal resonant cavities . fig1 illustrates a cell according to the invention , constructed of an aluminum sheet 1 . 5 mm thick , for operation at a frequency f = 2450 mhz . it is illustrated in the form of a parallelepipedal enclosure , the dimensions of which , perpendicular to the respective sides a , b , and c are determined according to the relationship length l =( 2k + 1 )× λ / 4 and are as follows : microwave energy is introduced through a rectangular opening 43 × 86 mm in one of the walls , for example wall b , of the enclosure . the microwave energy is conducted by means of a suitable wave guide 2 , for example a type rg 112 wave guide , affixed to the enclosure 1 by a flange 3 . the wall a and the opposed wall of the enclosure parallel to wall a , have a series of aligned orifices 4 . each orifice 4 carries a metallic tube 5 which permits the material 6 to traverse the cell while assuring effective shielding of microwave radiation from the enclosure . ducts 5 &# 39 ;, closely sized to the material 6 and formed of a suitable dielectric material such as polytetrafluoroethylene , extend between the tubes 5 and are provided to protect the interior of the enclosure from solvent vapors or the like that may escape out of the material 6 . in the interior of the enclosure , and parallel to the side opposite to that which supports the wave guide 2 , i . e ., facing the direction of incident energy , is a movable metallic plate 7 that may be formed of aluminum . the dimensions of the plate are length a - 20 mm ( i . e ., 438 mm ) and length c - 20 mm , that is 194 mm . this plate is mounted on posts 10 and is biased toward the interior of the enclosure by springs 11 . a threaded control spindle 9 is fixed to the center of the plate 7 . a rotatable threaded member 8 on the exterior of the enclosure coacts with the spindle 9 to provide for displacement of the plate 7 a distance on the order of 2 cm . a graduated knob 8 &# 39 ; engaging the threaded member 8 , marks the position of the plate . movement of the plate 7 provides for rough adjustment of the tuning of the enclosure to minimize reflected energy . on the wall c of the enclosure , is mounted a rotatable spindle 12 aligned with the axis of the wave guide 2 and disposed at a right angle thereto . the spindle 12 carries a planar member or plate 13 , the dimensions of which are 55 × 55 mm . the lower edge of the plate is approximately 70 mm from the wall c and is above the ducts 5 &# 39 ;. the spindle 12 is provided with a graduated knob 12 &# 39 ; for indicating the orientation of the plate 13 with respect to the axis of the wave guide 2 . referring to fig2 the wave guide 2 has mounted thereon a bi - directional connector of known type that provides for detection of incident and reflected energy passing through the wave guide . the incident and reflected energies are measured by milliwattmeters 16 and 16 &# 39 ; provided with standard bolometers . incident power is read from the meter 16 and reflected power is read from the meter 16 &# 39 ;. by observing the respective meter readings , the control knobs 8 &# 39 ; and 12 &# 39 ;, that allow for the displacement of plate 7 and the rotation of planar member 13 respectively , can be adjusted to minimize the reflected power with the stationary wave length ( tos ) near 1 . 1 , thereby providing optimum conditions for production . a differential measuring element 17 may be used to detect the differences between the readings of meters 16 and 16 &# 39 ; and generate a suitable control signal for changing the position of the plate 13 by appropriate means such as a servomotor with appropriate feedback circuitry . this provides for automatic regulation of optimum conditions . referring to fig3 there is shown a complete polymerization section for cylindrical rods . a microwave generator 18 supplies energy through wave guides 20 and power dividers 19a , 19b and fitting 21 to enclosures 1a , 1b , 1c respectively . the first cell 1a receives half the power from generator 18 by means of divider 19a . the other half of the power is supplied to divider 19b which in turn supplies a quarter of the total power to cell 1b and a quarter of the total power to cell 1c . this distribution permits the cell 1a to heat the treated material to the ideal polymerization temperature and the other cells merely need to supply sufficient heat to assure continuance of the reaction temperature . measuring systems 15a , 15b and 15c of the type previously discussed in connection with fig2 each having milliwattmeters 16 , 16 &# 39 ;, are utilized to assure the optimum conditions for each cell . between the cells 1a , 1b and 1c , are forming components , such as a carrier plate 22 with short metallic dies , as well as thermal insulation sleeves 23 that reduce heat loss between the heating cells . conventional components for forming and conveying the formed structure are placed upstream and downstream from the apparatus shown in fig3 and no further explanation of these components is believed necessary . by way of example , utilizing the apparatus illustrated in fig3 the simultaneous polymerization of four rods of polyester resin 20 mm in diameter , reinforced with glass fiber , was accomplished at a speed of 1 m / mn , using a 5 kw generator , supplying electromagnetic energy at a frequency of 2450 mhz .	7
the medical bipolar coagulation instrument , as shown especially in fig1 and 2 , consists essentially of a hollow shaft 1 configured as a suction / flushing channel , a handle 2 mounted on the proximal end of the shaft 1 , and two electrode tips 3 and 4 that extend beyond the hollow shaft 1 on the distal end . as can be seen in particular from fig2 , the hollow shaft 1 is configured in several layers consisting of an inner tube 5 , an electrically insulating layer 6 that coaxially surrounds the inner tube 5 , an outer tube 7 that coaxially surrounds the inner tube 5 as well as the insulating layer 6 , and an electrically insulating layer 8 that coaxially surrounds the outer tube 7 . in the illustrated embodiment the insulating layers 6 and 8 , which on the one hand electrically insulate the tubes 5 and 7 with respect to one another and on the other hand electrically insulate the shaft 1 from the outside , are configured as shrink hoses that surround the tubes 5 and 7 in form - locked manner . it is also possible of course to obtain the electrical insulation of the tubes 5 and 7 with respect to one another and from the environment also by means of other electrically insulating layers , such as by coating the tubes 5 and 7 with electrically insulating layers made of plastic or ceramic material . the tubes 5 and 7 , in turn , are at least partly electrically conductive in configuration , so that the tubes 5 and 7 simultaneously constitute the electrodes of the bipolar coagulation instrument . to configure the actual electrode tips 3 and 4 , on the distal ends of the inner tube 5 and of the outer tube 7 , tubular sections are configured , protruding in finger - like manner , which extend beyond the distal end of the shaft 1 , as shown in fig1 and 3 . these finger - like protruding electrode tips 3 and 4 are positioned opposite one another on the distal end of the shaft 1 . the multi - layered structure of the hollow shaft 1 can be seen both from the explosion drawing in fig2 and in particular from fig3 and 4 , which show the distal end of the shaft 1 that includes the electrode tips 3 and 4 . the external insulating layer 8 has been omitted from fig3 to allow a clearer view of the configuration of the electrode tips 3 and 4 as a distal extension of the tubes 5 and 7 . it can also be seen from fig3 and 4 how the tubes 5 and 7 are geometrically configured in the area of the transition to the electrode tips 3 and 4 . to ensure a form - locked positioning and gapless insulation of the insulating layers 6 and 8 on the tubes 5 and 7 in the area of the distal free ends of the tubes 5 and 7 , beveled surfaces 5 a and 7 a , inclined diagonally inward , are configured on the free ends of the tubes 5 and 7 . the configuration of the tubes 5 and 7 , which constitute the hollow shaft 1 , as electrodes of the bipolar coagulation instrument has the advantage that the entire free cross - section of the hollow shaft 1 is available as a suction and / or flushing channel and no cabling is required inside the shaft 1 . to configure the hollow shaft 1 as a suction and / or flushing channel , the handle 2 comprises on its proximal end a suction and / or flushing connection 9 for coupling to an external suction and / or flushing line . the handle 2 in addition comprises a current connection 10 by which the tubes 5 and 7 configured as electrodes can be charged with current . to make it possible for the operator to be able easily and quickly to regulate the suction capacity via the hollow shaft 1 configured as a suction and / or flushing channel , the hollow shaft 1 in the area of the handle 2 comprises a throttle opening 11 that connects the interior of the suction and / or flushing channel with the ambient air . in the illustrated embodiment the throttle opening 11 is configured as a borehole running essentially radially . different - shaped throttle openings 11 , such as oval , rectilinear , or similarly configured openings , are also possible of course . as can be seen in particular from fig5 and 6 , the throttle opening 11 is configured and placed on the handle in such a way that the operator can open and close the throttle 11 again with one finger , for instance with a finger of the hand that is also being used for holding the handle 2 to guide the instrument . the throttle opening 11 here is advantageously of such dimensions that with the throttle opening 11 completely opened , the suction capacity essentially comes to a stop , because so much ambient air is drawn in by the opened throttle opening 11 that the suction capacity does not extend as far as the distal end of the shaft 1 . the farther the operator closes the throttle opening 11 with a finger , the stronger becomes the suction capacity inside the hollow shaft and thereby the suction capacity from the operating area by way of the distal end of the shaft 1 . to prevent the eventuality in the area of the throttle opening 11 of a short - circuit between the tubes 5 and 7 , which are constructed as electrodes , as a result of liquid or of shunting by the operator &# 39 ; s finger , in the area of the throttle opening 11 , in the outer tube 7 , a recess 12 is configured surrounding the throttle opening 11 at a distance on all sides , for instance in the form of a clearance milling , as can be seen from fig6 , in which the outer insulating layer 8 has been omitted to allow better visibility . as can be seen from fig2 , the outer insulating layer 8 in the area of the throttle opening 11 also comprises a recess 13 that surrounds the throttle opening 11 at a distance on all sides , in order to ensure complete closing of the throttle opening 11 by means of one of the operator &# 39 ; s fingers . a bipolar coagulation instrument as described above is differentiated in particular in that , on the one hand , it is composed in simple manner using only a few components and thus is configured so that it can be installed at reasonable price and , on the other hand , because of the configuration of the tubes 5 and 7 , which constitute the hollow shaft 1 , as electrodes of the bipolar coagulation instrument , the entire free cross - section of the hollow shaft 1 is available as a suction and / or flushing channel . in addition , the configuration of the throttle opening 11 allows for easy , rapid , and effective regulation of the suction capacity in the interior of the hollow shaft 1 , which is configured as a suction and / or flushing channel .	0
fig2 is a block diagram of an embodiment of the present invention . elements which correspond to elements in fig1 are indicated by the same symbols and their descriptions are omitted . according to the present invention , an analog test system is designed so that it can calibrate both dc and ac levels . an analog switching device 27 is coupled between a precision power source 26 and an analog signal measuring unit 21 as a component of the ac level calibration circuit of the analog test system 10 &# 39 ; of the present invention . the analog switching device 27 is controlled by a digital signal generator 14 during ac level calibration , so that an ac level calibration signal is supplied to a waveform digitizer 23 in the analog signal measuring unit 21 . an output from the precision power source 26 is supplied to the digitizer 23 through a dc level calibration switch s 1 , and is also supplied to the analog switching device 27 , from which it passes through an ac level calibration switch s 2 to the digitizer 23 . further , an output from an analog signal generator 13 is supplied to the digitizer 23 through a signal generator calibration switch s 3 . all of these switches ( s 1 - s 3 ), and a test switch s 4 between an analog signal output terminal 18a in a dut 19 and the digitizer 23 , are controlled by the signal from the digital signal generator 14 . for testing the dut 19 , all the test switches must be open except the test switch s 4 , so that the analog signal outputs from the dut 19 pass directly to the digitizer 23 . in contrast , for dc level calibration , all the test switches except the dc calibration switch s 1 are open so that dc voltage v 1 of the precision power source 26 is supplied to the digitizer 23 . in addition , by closing the signal generator calibration switch s 3 , the signals from the analog signal generator 13 are directed to the digitizer 23 , which has completed its dc level calibration . since the waveform digitizer 23 has finished its calibration , a dc level calibration of the analog signal generator 13 will then be performed . according to the present invention , an ac level calibration is completed by closing only the ac calibration switch s 2 and controlling the analog switching device 27 , so that ac level calibration signals are directed to the waveform digitizer 23 . fig3 is a more detailed block diagram of the analog switching device 27 and its connection through the ac level calibration switch s 2 to the digitizer 23 of the present invention . a high quality direct current power source is utilized for the precision power source 26 , and its output voltage v 1 is supplied to an input terminal 31 in the digitizer 23 through a first analog switch 27a and a coaxial cable 29 via the ac level calibration switch s 2 . the signal supplied to the input terminal 31 then passes through a resistor 34 which is connected to an analog test system &# 39 ; s ground . the coaxial cable 29 is also connected to a second analog switch 27b which is controlled inversely from the first analog switch 27a and which is connected to ground . therefore , with this second analog switch 27b , the input terminal 31 can be connected to ground via the coaxial cable 29 . an outer conductor 38 of the coaxial cable 29 is also connected to ground and the input terminal 31 . both the first analog switch 27a and the second analog switch 27b are controlled by a control signal from the digital signal generator 14 , which alternately outputs signals &# 34 ; 0 &# 34 ; and &# 34 ; 1 &# 34 ; during the ac level calibration process . fig4 illustrates a waveform of the control signal . the digital signal generator 4 , for example , outputs a signal &# 34 ; 1 &# 34 ; for a time period t o and outputs a &# 34 ; 0 &# 34 ; for the next time period t o . consequently , this control signal repeatedly outputs &# 34 ; 1 &# 34 ; then &# 34 ; 0 &# 34 ; ( fig4 a ). therefore , the digital signal generator 14 outputs a rectangular wave signal with a duty ratio of 50 percent . this control signal is provided to drive a switch circuit 39 , where first and second on / off signals ( fig4 b and 4c ) are generated . the first and second on / off signals , whose polarities are opposite to each other , are supplied to the first and second switches 27a and 27b , respectively . in this example , first and second analog switches 27a and 27b are open when their respective on / off signals are at h - level , and closed when their respective signals are at l - level ; that is , they are controlled oppositely to each other . for example , when first analog switch 27a is closed and second analog switch 27b is open for a time period t 0 , dc voltage v 1 is supplied to the input terminal 31 of the digitizer 23 . during the next time period to , both analog switches are oppositely controlled ; the first analog switch 27a is open and the second analog switch 27b is closed , so that a ground potential is supplied to the input terminal 31 of the digitizer 23 . then , dc voltage v 1 is supplied during the next time period t o . therefore in this embodiment , as an ac level calibration signal , a precise rectangular waveform is supplied to the digitizer 23 . in fig3 a capacitor c is set to exclude spikes from the first analog switch 27a . according to the present invention , the output from an a / d converter which forms the digitizer 23 is first fourier transformed in a digital signal processor 24 , using either a discrete fourier transform ( dft ), or a fast fourier transform ( fft ). then a fundamental wave level included in the ac level calibration signal measured . finally , the system is ac calibrated based on this fundamental wave level . the rectangular wave shown in fig5 is fourier transformed to produce : as shown in equation ( 1 ), the rectangular waveform is represented by the sum of the fundamental frequency component and the harmonic frequency components . therefore , if there is no ac level error in the digitizer 23 , the amplitude of the fundamental frequency component obtained by signal processor 24 should be 4v 1 / π . fig6 is a spectral map corresponding to the rectangular waveform of fig5 after fourier transformation . the amplitude of the fundamental component 4v 1 / π , in fig6 can be predetermined correctly from the dc voltage v 1 , and the duty ratio of the rectangular waveform in fig5 . thus , by comparing the predetermined value with the fourier transformed value , the ac level error is obtained , and the ac level error is stored in a calibration data file 41 . this data , together previously collected data for dc level error , is used for calibrating the digitizer 23 by adding or subtracting the appropriate error from the appropriate test data . in operation , the complete procedure for ac level calibration in the analog test system of the present invention is as follows : 1 . the dc offset voltage and dc voltage gain in the digitizer 23 is calibrated while a dc reference voltage from the precision power source 26 is supplied . the calibration data is stored in the calibration data file 41 . 2 . an ac level calibration signal is generated by switching back and forth between the reference voltage v 1 from the precision power source 26 and ground . this signal is provided to the digitizer 23 . the output signal from the digitizer 23 is then supplied to the digital signal processor 24 , where a fourier transform is performed on the signal . finally , the waveform digitizer 23 is ac level calibrated by compensating for the difference between the measured fundamental component level and the calculated fundamental component level . this data is also stored in the calibration data file 41 . 3 . the signal which tests the dut 19 is generated by the analog signal generator 13 and is supplied to the digitizer 23 which has completed calibrating steps 1 and 2 above . all the data collected through above steps 1 and 2 are used for calibrating test data , so that test data are compensated for any improper calibration in the analog test system . according to the above embodiment , dc level calibration and ac level calibration are performed using separate components , namely by passing their calibrating signals through a calibration switch s 1 and a calibration switch s 2 respectively . however , in an alternate embodiment , instead of controlling a dc level calibration switch s 1 for dc level calibration in step 1 above , the first analog switch 27a can be closed so that a voltage v 1 from the precision power source 26 is directed to the digitizer 23 before the on / off switching of the first and second analog switches 27a , 27b begins for the ac level calibration . also in the above embodiment , a rectangular waveform having a 50 percent duty ratio is used in ac level calibration as a calibration signal . however , the particular duty ratio of 50 % and the rectangular signal form are not essential for the calibration , i . e ., other duty ratios and waveforms may be employed . in the preferred embodiment , the precision power source 26 is a part of the system itself , but supplying power may be performed by an element outside the analog test system as well . also the driving circuit 39 which controls the first and second analog switches 27a , 27b can be placed outside the analog test system . finally , analog signal measuring unit 21 may be composed of a frequency selection level meter ( a band pass filter and rms meter ) as well as composed of the digitizer 23 and the digital processor 24 . a high precision analog switch control signal is easily generated with a precision power source and a digital signal generator driven by an accurate standard clock . this precision power source is an accurate input signal supply for a dc level calibration of an analog test system . therefore , highly accurate ac level calibration is available by simple modification of conventional analog test systems . the present invention has been described referring to one main embodiment , however , the present invention permits various modifications within the scope of the subject matter of the present invention . since numerous modifications and changes will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and applications shown and described and accordingly , all suitable modifications and equivalents may be resorted to , falling within the scope of the appended claims and their equivalents .	6
a preferred embodiment of the present invention will now be described , with reference to the figures , beginning at fig3 . fig3 shows two appliances ( 104 ), ( 120 ) which present virtual storage volumes ( 102 ) and ( 108 ) to hosts ( 100 ) and ( 116 ), respectively , in order to manage i / o for physical storage ( 112 ), ( 114 ), ( 128 ), ( 130 ). the presentation of storage to hosts ( 102 ), ( 116 ) is achieved using volume mappings , shown as vol ( 102 ) mapping ( 110 ) and vol ( 118 ) mapping ( 126 ) to map the physical storage ( 112 ), ( 114 ) and ( 128 ), ( 130 ), respectively . i / o between host ( 100 ) and storage appliance ( 104 ) is directed through host - scsi interface layer ( 106 ), and i / o between host ( 116 ) and storage appliance ( 120 ) is directed through host - scsi interface layer ( 122 ). i / o between storage appliance ( 104 ) and physical storage ( 112 ), ( 114 ) is directed through storage - scsi interface layer ( 108 ), and i / o between storage appliance ( 120 ) and physical storage ( 128 ), ( 130 ) is directed through storage - scsi interface layer ( 124 ). the storage administrator wishes to merge appliance ( 104 ) into appliance ( 120 ) in the sense that appliance ( 120 ) will present both volumes ( 102 ) and ( 108 ) without impacting access for hosts ( 100 ) and ( 116 ). it will be clear to one of ordinary skill in the art that , though the description of the preferred embodiment is cast in terms of the small computer system interface or scsi protocols , any other set of system interface protocols may be substituted . the preferred embodiment of the present invention makes use of a spanning host scsi interface layer ( 132 ), as shown in fig4 . this interface layer ( 132 ) is created so as to facilitate linkage between the two appliances ( 104 ), ( 120 ) and to forward i / o either to storage managed by appliance ( 104 ) or appliance ( 120 ) as appropriate . in one embodiment , the spanning host interface layer receives and redirects i / o requests from a first storage appliance to a second storage application during a merge of the first and second storage appliance . similarly , in one embodiment , the spanning host interface layer receives and redirects i / o requests from the first and the second storage appliance to a third storage appliance during the merge of the first and second storage appliance in the third storage appliance . advantageously , no extra storage is required and the management action ( in this exemplary case , a merge ) is transparent to the host applications . the two appliances ( 104 ) and ( 120 ) are merged using the following sequence of operations , with reference to fig4 : 1 . extract the metadata for volume ( 102 ) from appliance ( 104 ). 2 . map physical storage ( 112 ), ( 114 ) of appliance ( 102 ) to appliance ( 120 ). 3 . using the metadata for volume ( 102 ) create a volume on appliance ( 120 ) that maps to the appropriate regions on the physical storage ( 112 ), ( 114 ) from appliance ( 104 ). 4 . start the spanning host scsi layer for volume ( 102 ) between the two appliances . this layer will forward all i / o received for volume ( 102 ) on appliance ( 120 ) to appliance ( 104 ). 5 . map the new volume from appliance ( 104 ) to host ( 100 ). host ( 100 ) will see the new volume as another path available to volume ( 102 ). the spanning layer is required because it is not sufficient to just allow both appliance ( 102 ) and appliance ( 120 ) to access the same physical storage at the same time . physical storage is usually managed by a redundant raid controller . many of these raid controllers require all i / o requests to a particular physical volume to be directed to the same half of the controller to avoid lun thrashing . therefore if two appliances need to share the same storage they would need to jointly decide which half of the controller to use for each physical volume . turning now to fig5 , the following sequence of steps is performed : 1 . flush any cached data in appliance ( 104 ) for volume ( 102 ). 2 . offline the path from appliance ( 104 ) to host ( 100 ). this causes host ( 100 ) to start using the paths to volume ( 104 ) through appliance ( 120 ). 3 . fail any outstanding i / o in appliance ( 104 ). 4 . quiesce i / o in appliance ( 120 ) for volume ( 102 ), instruct the spanning layer to stop forwarding i / o and start performing i / o for the physical storage ( 112 ), ( 114 ) through appliance ( 120 ) instead of appliance ( 104 ). the configuration of volume ( 102 ) in appliance ( 104 ) ( i . e . virtual mapping , host mapping , etc .) can now be removed as shown in fig6 , wherein all i / o for all the physical storage and for both mapped volumes ( 102 ) and ( 118 ) is performed using appliance ( 120 ). as will be clear to one of ordinary skill in the art , the sequence of steps to implement the method described above can be initiated by issuing a single command on either cluster instructing it to merge virtual storage onto one of the appliances . it will also be clear to one of ordinary skill in the art that other methods of initiating the merge are possible ; such as by execution of a script , execution of a trigger event , or the like . the process of the preferred embodiment can be repeated for any number of volumes on any number of clusters . the process is independent for each volume and so can be done in parallel . an exemplary apparatus or arrangement of apparatus according to the preferred embodiment will now be described , with reference to the schematic diagram of fig7 . fig7 shows a storage appliance ( 700 ) having , in addition to the normal host and storage scsi interface layers ( not shown in this figure for ease of reading ), a spanning host scsi interface layer ( 702 ). the i / o handler ( 708 ) is adapted to send and receive i / os between the host and the storage and to present one or more volumes to the host using local volume mapper ( 704 ) in the conventional fashion , but is also adapted to present one or more volumes to the host using remote volume mapper ( 706 ). the apparatus or arrangement of apparatus in accordance with fig7 is thus adapted to perform the process as described above . the preferred embodiment of the present invention in the form of an apparatus or arrangement of apparatus thus advantageously addresses the problem of providing a technical means for managing storage systems having storage virtualization appliances . an exemplary method or logic arrangement according to the preferred embodiment will now be described , with reference to the schematic diagram of fig8 . the process of the preferred embodiment shown in fig8 starts at start step ( 800 ). at step ( 802 ), volume metadata is extracted and at step ( 804 ), the physical storage for the volume that is to be migrated from ( 104 ) is mapped to a new volume map at the new location . at step ( 806 ), the spanning host scsi layer ( 132 ) is started and the new volume map is presented to host ( 100 ). at step ( 808 ), the cached data at the appliance to be migrated from ( 104 ) is flushed and the path from the host ( 100 ) to the appliance to be migrated from ( 104 ) is offlined . outstanding i / o at the appliance to be migrated from ( 104 ) is failed at step ( 810 ). at step ( 812 ), i / o at the device to be migrated to ( 120 ) is quiesced and the spanning layer ( 132 ) is inhibited from forwarding i / o through the appliance to be migrated from ( 104 ). i / o is now performed via the appliance to be migrated to ( 120 ). at step ( 814 ), the appliance to be migrated from ( 104 ) is released from service and can be decommissioned , and at end step ( 816 ) the process completes . the preferred embodiment of the present invention in the form of a method or logic arrangement thus advantageously addresses the problem of providing a technology for managing storage systems having storage virtualization appliances . it will be clear to one of ordinary skill in the art that all or part of the method of the preferred embodiments of the present invention may suitably and usefully be embodied in a logic apparatus , or a plurality of logic apparatus , comprising logic elements arranged to perform the steps of the method and that such logic elements may comprise hardware components , firmware components or a combination thereof . it will be equally clear to one of skill in the art that all or part of a logic arrangement according to the preferred embodiments of the present invention may suitably be embodied in a logic apparatus comprising logic elements to perform the steps of the method , and that such logic elements may comprise components such as logic gates in , for example a programmable logic array or application - specific integrated circuit . such a logic arrangement may further be embodied in enabling elements for temporarily or permanently establishing logic structures in such an array or circuit using , for example , a virtual hardware descriptor language , which may be stored and transmitted using fixed or transmittable carrier media . it will be appreciated that the method and arrangement described above may also suitably be carried out fully or partially in software running on one or more processors ( not shown in the figures ), and that the software may be provided in the form of one or more computer program elements carried on any suitable data - carrier ( also not shown in the figures ) such as a magnetic or optical disk or the like . channels for the transmission of data may likewise comprise storage media of all descriptions as well as signal - carrying media , such as wired or wireless signal - carrying media . the present invention may further suitably be embodied as a computer program product for use with a computer system . such an implementation may comprise a series of computer - readable instructions either fixed on a tangible medium , such as a computer readable medium , for example , diskette , cd - rom , rom , or hard disk , or transmittable to a computer system , via a modem or other interface device , over either a tangible medium , including but not limited to optical or analogue communications lines , or intangibly using wireless techniques , including but not limited to microwave , infrared or other transmission techniques . the series of computer readable instructions embodies all or part of the functionality previously described herein . those skilled in the art will appreciate that such computer readable instructions can be written in a number of programming languages for use with many computer architectures or operating systems . further , such instructions may be stored using any memory technology , present or future , including but not limited to , semiconductor , magnetic , or optical , or transmitted using any communications technology , present or future , including but not limited to optical , infrared , or microwave . it is contemplated that such a computer program product may be distributed as a removable medium with accompanying printed or electronic documentation , for example , shrink - wrapped software , pre - loaded with a computer system , for example , on a system rom or fixed disk , or distributed from a server or electronic bulletin board over a network , for example , the internet or world wide web . in an alternative , the preferred embodiment of the present invention may be realized in the form of a computer implemented method of deploying a service comprising steps of deploying computer program code operable to , when deployed into a computer infrastructure and executed thereon , cause the computer infrastructure to perform all the steps of the method . in a further alternative , the preferred embodiment of the present invention may be realized in the form of a data carrier having functional data thereon , the functional data comprising functional computer data structures to , when loaded into a computer system and operated upon thereby , enable the computer system to perform all the steps of the method . it will be clear to one skilled in the art that many improvements and modifications can be made to the foregoing exemplary embodiment without departing from the scope of the present invention .	6
the following detailed description is merely exemplary in nature and is not intended to limit the disclosed embodiments or the application and uses thereof . furthermore , there is no intention to be bound by any theory presented in the preceding background detailed description . fig1 a presents a system 2 for the metered dispensing of a fragrance in a toilet , in particular in a lavatory of an airplane . the system 2 comprises a fragrance container 4 , an odor measuring device 6 and a controller 8 , wherein a dispensing device is not shown on fig1 a in order to simplify the illustration . the fragrance container 4 is joined by the dispensing device ( not shown ) with a flushing pipe 10 , which leads to a spraying ring 12 installed in the bowl of a toilet 14 . the flushing pipe 10 is coupled upstream with a flushing valve 16 , which is connected by an actuator 18 with the controller 8 . another check valve 20 situated further upstream prevents liquids from flowing back to a reservoir ( not shown ), a supply line or the like . a discharge valve 22 is in in turn connected with a discharge 24 of the toilet 14 , and also comprises an actuator 26 joined with the control unit 8 . when flushing , the user presses a button , and a command from the control unit 8 correspondingly actuates the flushing valve 16 , guiding a flushing liquid into the spray ring 12 via the flushing pipe 10 . subsequently , at the same time and / or thereafter , a vacuum is applied to the inside of the toilet 14 by actuating the discharge valve 22 . all liquids or solids in the toilet 14 are conveyed out of the toilet 14 through the discharge 24 . odors arising in the toilet 14 may be masked by admixing a fragrance located in the fragrance container 4 , which in particular is a liquid fragrance comprising a scented oil or the like . establishing a connection with the flushing pipe 10 causes the fragrance to be dispensed only as needed , which limits the required supply of fragrance , and prevents both an excessive metering and too high a fragrance concentration . fragrance metering may further be adjusted based upon an odor detected by the odor measuring device 6 . as a result , more or less fragrance may be dispensed in the flushing process , as needed . stronger odors in the lavatory in which the toilet is located may in this way be better masked or balanced out . dispensing preferably takes place toward the end of the flushing process , in order to at least partially prevent the siphoning of liquid fragrance . fig1 b to ld show various dispensing devices . fig1 b depicts a fragrance container 4 with a fragrance situated therein , which is designed as a liquid fragrance 28 , which may be dispensed by a height difference through exposure to a gravitational force via a port 30 lying underneath the fragrance container 4 into the flushing pipe 10 . reference number 32 is used to label this dispensing device without active components , and points to the entire arrangement of the fragrance container 4 and port 30 . fig1 c shows a dispensing device 36 . the system 2 is modified in such a way that the fragrance container 4 holding the fragrance designed as a liquid fragrance 28 incorporates a piston 34 , which limits the expansion of the fragrance 28 in the fragrance container 4 at one surface via the overlying piston 34 . by applying a pressurized fluid , for example compressed air , to the side of the piston 34 lying opposite the fragrance 28 , the liquid fragrance 28 itself may be pressurized , so that it may thereby be dispensed . alternatively or additionally , an actuator or pre - loaded spring 35 may exert a force on the piston 34 , so that the liquid fragrance 28 is conveyed to the port 30 . the dispensing unit 38 shown on fig1 d is an injector in the form of a venturi nozzle , which is connected with the port 30 at a constricted location 39 . in particular a fragrance designed as a liquid fragrance 28 is siphoned out of the fragrance container 4 with flushing water as it flows through the venturi nozzle 38 , and admixed directly to the flushing water stream . all embodiments of the dispensing device may have allocated to them a valve 40 shown on fig1 e , which may be coupled with the control unit 8 via an actuator 42 , and only dispenses the flushing water as needed . fig2 depicts an exemplary function 42 for metering the fragrance . the concentration of the fragrance 28 may be selected depending on the strength of the determined odor . the vertical ( y ) axis shows a concentration of the fragrance 28 , while the horizontal ( x ) axis presents the chronological progression of fragrance dispensing . the lower curve includes the surface 44 , and represents the determined odor inside the lavatory . as the odor intensifies , the fragrance dosage may be increased , as represented by the upper curve , wherein the distance from the lower curve represents the dosage of the fragrance 28 . this area includes the surface 46 , which is preferably proportional to the consumed quantity of fragrance 28 . fig3 exemplarily depicts a lavatory 52 of a vehicle with a toilet 14 installed therein , along with a system 2 according to the embodiment . a fragrance container 4 is here exemplarily installed in a service module 50 , which is situated laterally inside the lavatory 52 . an odor measuring device 6 may be secured to a wall 48 of the lavatory 52 , and be connected with a control unit 8 not illustrated in this depiction . in addition , let it be noted that “ comprise ” does not preclude any other elements or steps , and that “ a ” or “ an ” do not rule out a plurality . let it further be noted that features described with reference to one of the above exemplary embodiments may also be used in combination with other features from other exemplary embodiments described above . reference numbers in the claims are not to be regarded as a limitation . while at least one exemplary embodiment has been presented in the foregoing detailed description , it should be appreciated that a vast number of variations exist . it should also be appreciated that the exemplary embodiment or exemplary embodiments are only examples , and are not intended to limit the scope , applicability , or configuration of the embodiment in any way . rather , the foregoing detailed description will provide those skilled in the art with a convenient road map for implementing an exemplary embodiment , it being understood that various changes may be made in the function and arrangement of elements described in an exemplary embodiment without departing from the scope of the embodiment as set forth in the appended claims and their legal equivalents .	0
reference is now made to fig1 of the drawing wherein there is schematically illustrated digital microcomputer 11 , of the type employed in modern multifunction electronic sport watches . microcomputer 11 includes a microprocessor , a read only memory ( rom ) for storing program and display instructions and a random access memory ( ram ) for storing at designated addresses data signals supplied to the microcomputer and values computed by the computer . the microprocessor in microcomputer 11 includes the usual elements , i . e ., an input / output buffer , a central processing unit and clock circuitry including an oscillator responsive to quartz crystal 12 . microcomputer 11 and the remaining circuitry illustrated in fig1 are powered by battery 13 of the type usually employed in electronic watches . the frequency of the oscillator in microcomputer 11 is controlled by crystal 12 , as well as by the capacitance of variable capacitor 14 , connected to the microcomputer . microcomputer 11 includes a multibit output bus 15 for supplying alpha - numeric representing digital signals to liquid crystal display 16 . liquid crystal display 16 is fabricated in the normal manner , but includes alpha and numeric indications associated with the age , weight , sex , and stride length of the subject , as well as indications of the number of steps taken by the subject during a walking , jogging or running exercise routine , the average speed of the subject during the exercise routine , the peak speed , instantaneous speed and calories consumed by the subject during the exercise routine . in addition , liquid crystal display 16 includes the usual displays associated with a sport watch , i . e ., time of day , day and month , stop watch functions , lap timer , and countdown functions . microcomputer 11 also supplies signals to beeper piezoelectric beeper crystal 17 by way of driver 18 . crystal 17 provides an aural signal to the subject every other time the subject takes a stride while the watch is in the stop watch operating mode . in addition , computer 11 can periodically supply a pacing signal to crystal 17 , i . e ., to provide the subject with a aural signal each time he should take a stride to maintain a particular speed or cadence in walking , jogging or running . microcomputer 11 also supplies signals to beeper crystal 17 for the usual alarm and countdown functions of an electronic sports watch . to enter data into microcomputer 11 , switches 21 - 23 are provided . switches 21 - 23 are normally spring biased to an open state , and are selectively closed by the subject pressing them in the usual manner of operating a sports watch . one contact of each switches 21 - 23 is connected in parallel to the positive electrode of battery 13 , while the remaining contacts of the switches are connected to separate input terminals of microcomputer 11 . the electronic watch of the present invention includes a fourth normally open spring biased switch 24 , connected between lamp 25 and the electrodes of battery 13 . lamp 25 is mounted in proximity to liquid crystal display 16 , to illuminate the display in response to switch 24 being closed by the user . switches 21 - 24 are located in the four corners of the watch , in the usual manner . the nomenclature for switches 21 - 24 are respectively &# 34 ; time &# 34 ;, &# 34 ; lap / reset &# 34 ;, &# 34 ; record data &# 34 ; and &# 34 ; light &# 34 ;. in response to switches 21 - 23 being closed different command signals are supplied to microcomputer 11 . the read only memory of the microcomputer responds to depression of the buttons in the usual manner to derive control signals for liquid crystal display 16 . however , the program is different from those usually included in microcomputer sports wrist watches to enale calculation of the various functions associated with calculation of calories and subject speed . basically , switch 21 is closed to enable the subject to select the type of data to be entered into the random access memory of microcomputer 11 . closure of switch 23 causes numeric values to be entered into the random access memory at addresses controlled by the read only memory . in general , a numeric value is incremented by a count of one each time switch 23 is closed . however , if switch 23 is closed for in excess of a predetermined time interval , such as one or two seconds and remains so depressed , the numeric indication and liquid crystal display 13 are incremented at high speed in response to pulses from the oscillator responding to crystal 12 until switch 23 is open . to provide the pedometer function , mercury switch 26 is mounted in the watch case . mercury switch 26 includes a dielectric , preferably glass , envelope 27 , a mercury globule 28 inside of envelope 27 , and a pair of contact leads 29 extending through the bottom of envelope 27 into the interior of the envelope , to be wetted and bridged by globule 28 . mercury switch 26 is positioned in the watch casing so that in response to each swing of the left arm of a subject maintaining the arm parallel to the ground , the globule moves from a position , at the bottom of envelope 27 , where it short circuits leads 29 , to a position adjacent the top of the envelope , where the globule does not wet the contact leads , whereby the leads are open circuited . mercury globule 28 functions as an inertia member to provide bounceless closure of leads 29 each time the arm of the subject moves through one cycle . since the arm is moved through a cycle each time the subject takes two steps , the number of times contacts 29 are opened is directly proportional to the number of steps taken by the subject . bounceless closure of leads 29 is provided by mercury globule 28 because mercury has very high internal cohesive forces , such that the mercury remains in globular form and does not separate into droplets . contact leads 29 of mercury switch 26 are connected to circuitry in microcomputer 11 which generates a pulse each time the contacts are opened by mercury globule 28 moving away from them . thereby , the circuitry within microcomputer 11 derives a pulse each time the left arm of the subject completes one movement cycle . the pulses derived in the microcomputer in response to contact leads 29 being open circuited from mercury globule 28 are counted during each cycle time of the computer . a signal indicative of the number of counted pulses during each computer cycle time is stored in a designated ram address . the stored count indicative of number of counted pulses is combined with preset signals stored in the computer indicative of subject stride length to provide the pedometer function , and with the computer computation cycle time to derive the aforementioned speed parameters . the pulses generated by the circuitry responsive to opening of contacts 29 are also combined with the subject stride length indications , the subject weight indications , the subject sex indication and the subject weight indication to derive an indication of calories consumed . reference is now made to fig2 of the drawing , a plane view of the exterior of a watch in accordance with a preferred embodiment of the invention . as illustrated in fig2 the watch includes a plastic , dielectric relatively thin case 31 having a generally square outline . secured to opposite edges of case 31 is strap 32 for enabling the watch to be placed around the wrist of a subject , in the normal fashion . in the four corners of case 31 are spring biased push buttons 33 - 36 which , when pushed inwardly , respectively , close switches 21 - 24 . push buttons 33 - 36 are of the type normally employed on conventional electronic sports watches . legends assigned to push buttons 33 - 36 are respectively &# 34 ; time &# 34 ;, &# 34 ; lap / reset &# 34 ;, &# 34 ; record data &# 34 ;, and &# 34 ; light &# 34 ;, respectively color coded with dots 37 as orange , blue , amber and white . extending across the top of the watch face is liquid crystal display 16 . below display 16 are s tripes 38 - 40 containing abbreviations for instructions associated with buttons 33 - 35 , and color coded in the same manner as the buttons . stripe 38 is color coded orange , to correspond with button 32 , and bears the nomenclature &# 34 ; stw timer pace maker entry &# 34 ;; stripe 39 is color coded amber to correspond with push button 33 , and bears the nomenclature &# 34 ; date alarm sta / stp advance &# 34 ;; and stripe 40 is color coded blue , to correspond with button 34 , and bears the nomenclature &# 34 ; cal dist speed step &# 34 ;. reference is now made to fig3 and 4 of the drawing wherein there are respectively illustrated front and back faces of dielectric printed circuit board 41 , mounted in watch case 31 so that the planar surfaces of the printed circuit board are parallel to the plane of the watch face containing liquid crystal display 16 . as illustrated in fig4 microcomputer 11 is surface mounted on the back face of printed circuit board 41 , i . e ., the face of the board adjacent liquid crystal display 16 . surface mounted microcomputer 11 is covered with protective , insulative coating 42 . leads 43 , coated or plated on the back face of board 41 , extend from microcomputer 11 to terminal pads 44 , engaged by pins ( not shown ) connected to liquid crystal display 16 . on opposite faces of printed circuit board 41 are coated or plated leads 45 for supplying to microcomputer 11 power from battery 13 and signals from crystal 12 , capacitor 14 , switches 21 - 23 , and mercury switch contacts 29 . leads 45 , on opposite sides of printed circuit board 41 , are connected to each other by plated through holes 46 in the printed circuit board . leads 43 and 45 and plated through holes 46 are covered with a dielectric coating ( not shown ), as is conventional in the art . however , terminals 44 and portions of conductive lands forming switches 21 - 24 are not covered by the dielectric coating , so that pads 44 and the conductive lands can engage metal contacts to provide electric connections . in fig3 watch case 31 is illustrated as it is mounted on the left wrist or lower forearm of a subject while walking , jogging or running with the left forearm parallel to the ground . the face of circuit board 41 illustrated in fig3 is adjacent the watch backing . in fig4 the face of circuit board 41 is illustrated in the position where case 31 is mounted on the left wrist of a person walking , jogging or running with the forearm parallel to the ground ; the circuit board face illustrated in fig4 is adjacent the watch face . as illustrated in fig3 and 4 , longitudinal axis 46 of elongated envelope 27 of mercury switch 26 is disposed at an angle of 30 ° from the horizontal when the watch is worn on the left wrist with the left forearm parallel to the ground . to provide this result , longitudinal axis 46 is displaced 60 ° from the axis of wrist watch strap 32 . envelope 27 is mounted in watch case 31 so leads 29 , at one end of the envelope , are below the end of the envelope where no leads are located when the watch is worn on the left wrist or forearm and the forearm is parallel to the ground . thereby , when the left forearm is in a stationary position , parallel to the ground , mercury globule 28 wets and bridges contacts 29 to short circuit the contacts together . globule 28 wets and bridges contacts 29 while the arm is cyclically moved , with the forearm remaining parallel to the ground , except immediately after the left arm has reversed direction immediately after being extended farthest in front of the body of the subject . the inertia of mercury globule 28 is such that at the time of arm reversal the globule moves forward relative to the rest of envelope 27 , toward the top end of the envelope 27 . at this time globule 28 is approximately at the position indicated by dotted lines 28 &# 39 ; where the globule no longer wets and bridges contacts 29 so the contacts are not connected to each other . at all other times during the cyclic movement of the left forearm during a walk , jogging or running exercise routine , the inertia of globule 28 is such that the globule wets and bridges contacts 29 . in response to globule 28 moving off of contacts 29 once during each arm movement cycle , a pulse is supplied by mercury switch 26 to microcomputer 11 , whereby the number of pulses supplied to the microcomputer is equal to one half the number of steps taken by the subject . hence , each time a pulse is derived by mercury switch 26 , which in essence forms a pedometer sensor , the subject has taken two steps ; thereby the number of steps and pulses are directly proportional to each other . while 60 ° has been found to be an optimal angle between the longitudinal axes of envelope 27 and watch strap 32 , this angle can vary considerably , by up to and even in excess of plus or minus 15 °. it is important for the longitudinal axis of envelope 27 not to be located in the vertical or horizontal plane while the pedometer including switch 26 is worn by the subject because globule 28 will not serve as an inertia member in these positions . therefore , the longitudinal axes of envelope 27 and strap 31 should not be in line with or at right angles to each other . for component mounting convenience , metal can 47 , containing crystal 12 , is positioned immediately adjacent envelope 27 , and the can and envelope longitudinal axes are parallel . envelope 27 and can 47 are mounted on parallel or planar edges 48 and 49 of printed circuit board 41 . battery 13 is mounted on printed circuit board 41 in a cavity having arcuate side walls 51 . the upper face of battery 13 , constituting one electrode of the battery , engages metal , spring - like tab 52 , while the lower battery face , which constitutes another electrode of the battery , abuts against metal tab 50 , connected to the plated metal land 53 on a face of board 41 . land 53 is connected by metal plated through - hole 54 to leads on the opposite sides of printed circuit board 41 , as illustrated in fig3 . metal tab 52 is pivotally mounted by rivet 55 on metal strap 56 that extends in a direction at right angles to the longitudinal axis of strap 32 between opposite edges of printed circuit board 41 ; strap 56 is on the face of circuit board 41 illustrated in fig3 . tab 52 and strap 56 are connected to metal arms 57 and 58 that extend parallel to the longitudinal axis of watch strap 32 along opposite edges of printed circuit board 41 . arms 57 and 58 are integral with strap 56 , being constructed as spring biased contacts having fingers 61 - 64 extending toward printed circuit board 41 . each of lands 65 - 68 is coated on both faces of printed circuit board 41 and includes a conducting plating along the edge of the circuit board opposite from fingers 61 - 64 . fingers 61 - 64 respectively engage the portions of lands 65 - 68 on the edges of circuit board 41 in response to buttons 33 - 36 being pushed inwardly . buttons 33 - 36 respectively include extensions 71 - 74 arranged so that extension 71 bears against a corner at the intersection of arm 57 and finger 61 , extension 72 engages a corner at the intersection of arm 58 and finger 64 , extension 73 engages a corner at the intersection of arm 58 and finger 63 , and extension 74 engages a corner at the intersection of arm 57 and finger 64 . in response to buttons 33 - 36 being pressed inwardly , switches 21 - 24 are closed by virtue of the contact between finger 61 and land 65 , between finger 62 and land 66 , between finger 63 and land 67 , and between finger 64 and land 68 . in response to buttons 33 - 36 being released , the spring bias of arms 57 and 58 opens contacts 21 - 24 and pushes buttons 33 - 36 outwardly . in response to buttons 33 - 35 being depressed , current respectively flows from one electrode of battery 13 through tab 32 and strap 56 to fingers 61 - 63 , thence to lands 65 - 67 and plated leads 45 on printed circuit board 41 to input terminals of computer 11 . in response to button 36 being pushed , current flows from battery 13 through tab 52 and strap 56 to finger 64 , thence to land 68 and bulb 25 to illuminate liquid crystal display 16 . to provide fine tuning for the oscillator in microcomputer 11 , including quartz crystal 12 and variable capacitor 14 , the value of the capacitor is adjusted by turning screw 81 , which controls the value of the dielectric between electrodes of capacitor 14 in a manner well known to those skilled in the art . at the time of initial installation , the assembler turns screw 81 until the quartz crystal oscillator is at the correct , predetermined frequency for time - keeping purposes . piezo - electric crystal 17 is formed as a coating on stainless steel watch backing 82 , fig5 and 6 . crystal 17 includes piezo - electric slab 83 that is deposited on aluminum coating 84 , in turn deposited on backing 82 . aluminum coating 85 is applied to the face of slab 83 opposite from coating 84 , whereby coatings 84 and 85 form electrodes on opposite faces of slab 83 for crystal 17 . electrical and mechanical contact is made between electrodes 84 and 85 and leads on printed circuit board 41 through metal compression springs 86 and 87 that respectively bear against coatings 84 and 85 and are connected to leads on printed circuit board 41 . the rom and ram in microcomputer 11 activate liquid crystal display 16 in the conventional manner in response to closure of switches 21 - 23 for the usual sport watch functions , namely display and adjustment of time , date , countdown timer , alarm timer and stopwatch . in response to pulses from the pedometer comprising mercury switch 26 and timing signals from the oscillator including quartz crystal 12 and input signals from switches 21 - 23 , the rom and ram of microcomputer 11 are arranged to derive digital signals which are supplied to liquid crystal display 16 to indicate the instantaneous speeds of the subject during an exercise period , the average speed of the subject during the exercise period , the total distance traveled by the subject during the exercise period , the number of steps taken by the subject during the exercise period and the number of calories burned by the subject during the exercise period . all of these functions are performed while microcomputer 11 is operating in the stopwatch mode . prior to calculating instantaneous , peak and average speeds , total distance traveled and calories , push button 35 is pressed until the indicia &# 34 ; data &# 34 ; appear in the upper right - hand corner of the liquid crystal display . in the normal , clock mode , the indicia &# 34 ; inavpk speed step dist and data &# 34 ; appear on the upper line of the liquid crystal display . in response to button 33 being pressed in sequence four times , causing switch contacts 21 to close four times , display 16 is activated by the rom so the bottom line of the liquid crystal display reads ( 1 ) &# 34 ; stw &# 34 ; ( for stopwatch ), ( 2 ) tmr ( for countdown timer ), ( 3 ) nothing i . e ., there are no alpha numeric characters on the bottom line of the liquid crystal display , and ( 4 ) nothing . in response to the fourth activation of button 33 , &# 34 ; data &# 34 ; appears in the upper right - hand corner of the display . when the &# 34 ; data &# 34 ; indicia appear on the upper line , the program in the rom addresses the ram to read out rom signals to the buffer so the center line of the liquid crystal display is activated to read either &# 34 ; 0 &# 34 ; or &# 34 ; 1 &# 34 ; ( stored in a designated ram address ) followed by the letters &# 34 ; ut &# 34 ; ( signals for &# 34 ; ut &# 34 ; are stored in a designated rom address ). the numeric values 0 and 1 followed by the letters &# 34 ; ut &# 34 ; signify whether distance , weight and speed data entries via button 34 and numeric values on display 16 are to be in metric or english units ; 0 = metric and 1 = english . to change from english to metric units and vice versa , button 35 , associated with contact 22 , is pressed . in response to button 35 being pressed with the read only memory causing display 16 to be in state ( 4 ) a designated ram address changes state from one to zero and vice versa . the sex of the subject may then be changed by pressing button 34 , closing switch contact 23 . this causes the program in the rom to access designated addresses in the ram and rom to cause a &# 34 ; 0 &# 34 ; or &# 34 ; 1 &# 34 ; value to appear on the middle line of the liquid crystal display followed by the letters &# 34 ; se &# 34 ;; 0 = female and 1 = male . to change the sex from male to female , button 35 is pressed , causing the designated ram address to change state . in response to the designated ram address indicating that the subject is a female , designated rom addresses for female coefficients are read out to the arithmetic logic unit ( alu ) of the computer during a computation interval for the subject calorie factor ; other designated rom addresses are read in response to the sex designated rom address having a value associated with a male subject . button 34 is then pressed to set the age of the subject , so that the program in the rom reads out designated ram and rom addresses to cause the display center line to display a numeric value followed by &# 34 ; ae &# 34 ;. to change the age of the subject stored in the ram designated address , button 35 is pressed . to increment age by a count of one , button 35 is pressed instantaneously and released . if , however , it is desired to change the age value significantly , button 35 is pressed for in excess of two seconds and remains pressed until a value slightly less than the age of the subject is displayed on display 16 , at which time button 35 is released . button 35 is then depressed and released for short intervals until the desired subject age numeric value is reached value in the center line of liquid crystal display 16 . in the preferred embodiment , the age sequences through a range from 5 through 99 years . after the age of the subject has been set , button 34 is again pressed , causing the program in the rom to address the ram and rom so the center line of display 16 displays a numerical value followed by the letters &# 34 ; wt &# 34 ; for weight change entries . the display numerical value is then incremented by pressing button 34 , for either step by step or high speed changes , as described in connection with the age display . the weight values can be set anywhere from 50 through 500 pounds , or 22 through 227 kilograms , depending upon whether a display 16 has been set to 1 or 0 while &# 34 ; ut &# 34 ; appeared in the center line . next , button 35 is pressed , causing the program in rom to address the ram and rom so the center line of display 16 has a numerical value , followed by the letters &# 34 ; sl &# 34 ;, enabling stride length of the subject to be entered . the stride length is entered by depressing button 34 , as described for the age setting . the stride length in the preferred embodiment , can be set anywhere from 30 to 200 centimeters , or 13 to 84 inches . after stride length has been entered , button 33 is pressed , causing time of day to be displayed again on the display center line . each time button 35 is depressed while the &# 34 ; ae &# 34 ;, &# 34 ; wt &# 34 ;, and &# 34 ; sl &# 34 ; indicia are displayed on the center line of the liquid crystal display while &# 34 ; data &# 34 ; is displayed in the upper right - hand corner of the display , a pulse is supplied by the oscillator including crystal 16 to the input of microcomputer 11 . each pulse increments by a count of one , count values stored in three different addresses in the microcomputer ram respectively associated with age , weight and stride length ; the appropriate ram address is accessed by the rom being at the address associated with display of data and one of age , weight or stride length . in response to button 35 being pressed for in excess of two seconds while the program in the rom is at an address causing data and ae , wt or sl to be displayed , a gate in microcomputer 11 responsive to pulses from the oscillator is opened to increment continuously the counts in the designated ram addresses associated with age , weight and stride length . the center line of the liquid crystal display 16 responds , through an input / output buffer of microcomputer 11 , to the ram accessed address to display the numerical values for age , weight and stride length , in a manner known to those of ordinary skill in the art . also , the designated ram addresses are incremental in an accumulator register of microcomputer 11 in a manner well known to those of ordinary skill . microcomputer 11 responds to the sex , units , age , weight and stride length signals to compute periodically , preferably once every six seconds , signals having numeric values indicative of subject distance traveled during the period , subject speed during the period , peak subject speed since the stop watch mode was entered , average subject speed since the stop watch mode was entered and calories consumed since the stop watch mode was entered ; the six second period is the computer cycle period . the distance traveled during the period is computed by microcomputer 11 counting the number of pulses derived as a result of globule 28 moving from and open circuiting contacts 29 during the period and multiplying the number of pulses by twice the subject stride length . to this end , microcomputer 11 derives a pulse each time globule 28 moves from contacts 29 and derives a digital signal indicative of the number of pulses during each computer cycle period . the digital signal is derived in a manner known to those skilled in the art , as disclosed , e . g ., in the aforementioned patent the digital signal indicative of the number of pulses is multiplied by two in the alu and stored in a designated ram address . at the end of the six second period , designated ram addresses where stride length and the number of pulses are stored are addressed and supplied to the alu . the microcomputer is programmed to multiply the number of steps by twice the subject stride length to derive an indication of distance traveled during the six second period . the stored indication of distance traveled is supplied to a designed ram address to enable &# 34 ; instantaneous &# 34 ; speed to be calculated during the six second interval , to update average and peak speeds since the beginning of the exercise period ( when the stop watch mode was entered ) and to compute calories consumed during the six second interval . &# 34 ; instantaneous &# 34 ; speed during the six second period is the distance traveled during the period divided by the length of the time interval of the period . the computed value of instantaneous speed is supplied by the alu to a ram designated address under the control of the program stored in rom . the designated address for instantaneous speed is updated after each six second interval . the instantaneous speed signal is combined with the previous accumulated value of average speed , as stored at a designated ram address . the previously accumulated value of average speed is combined in the alu under the control of a sub - routine program stored in the microcomputer rom in accordance with a known algorithm to compute average speed , as updated by the measurements taken during the previous six second interval . the thus computed average speed is returned to the ram designated address under the control of the program stored in the rom . the instantaneous speed during the six second interval is compared in the alu with the peak value signal stored in a designated ram address . if the instantaneous speed during the just completed six second interval is greater than the peak value previously stored in the designated ram address , the instantaneous value is returned to the designated address as a new peak value . if , however , the peak value previously stored in the designated ram address exceeds the value during the previous six second interval , the stored value is returned to the designated ram address . calories consumed during the previous six second interval are calculated by multiplying a previously determined factor r for the subject by the number of pulses generated during the six second calculation interval . for male subjects 26 years of age or older the value of r is calculated from equation 3 as : where x is the weight of the subject in kilograms , q is the subject stride length in centimeters , and z is the age of a male subject 26 years of age or older and the age of a female subject 21 years of age or older . the value of r is , in this instance , based upon equations 1 - 6 . the value of r is computed by microcomputer 11 in response to the values of units , subject age , weight , sex , and stride length initially entered into the microcomputer memory in response to activation of buttons , 33 - 35 . the entered values of age ( numeric ) and sex ( 0 or 1 ) are logically combined in the alu , to determine which expression for r , as stored in the rom , is to be used . the subroutine associated with calculating r is entered in response to button 33 being pressed . the entered value of units ( 0 or 1 ) determines whether appropriate coefficient changes will be made in the alu for the entered and read out values of distance , weight and speed . the initially calculated value of r for the particular subject is stored in a designated ram address and is read out into the alu once during each computation cycle interval time . the value of r supplied by the ram to the alu is combined with a stored value for the number of steps taken by the subject ( determined by counting the number of pulses generated in response to globule 38 opening contacts 29 ) during each cycle period to determine the number of calories consumed by the subject during the computer period . the calculated number of calories for the period is combined in the alu accumulator register with a previous indication of number of total consumed calories computed during the exercise regime , as stored in a designated ram address . the signal in the accumulator register is returned to the designated ram address for total calories computed . to read out the stored signals indicative of the number of steps taken during the exercise routine , peak speed during the exercise routine , distance traveled during the exercise routine , speed during the last computer period of the exercise routine , average speed during the exercise routine , and number of calories consumed during the exercise routine , button 35 is pressed after the routine has been completed . pressing button 35 terminates the stopwatch operation . button 33 is then pressed , causing the contents of the ram address where time of day is stored to be displayed . then , button 34 is pressed in sequence six times to provide sequential read out of the six aforementioned quantities . in response to the first depression of button 34 the program stored in the rom reads out the ram address where number of steps is stored through the microcomputer input / output buffer to liquid crystal display 16 ; a maximum of 999 , 999 steps can be displayed . in response to the second depression of button 34 , the contents of the ram address where instantaneous speed is stored , which corresponds to the subject speed during the last six second calculation period , are supplied to display 16 via the microcomputer input / output buffer . in response to the next four depressions of button 34 , the peak speed , average speed , distance and calorie indications stored in the designated random access memory addresses are sequentially supplied to display 16 . continued depressions of button 34 repeatedly sequence display 16 through the indications for number of steps , actual or instantaneous speed , peak speed , average speed , distance and calories consumed . the microcomputer rom stores signals to indicate what parameters are being displayed . thereby , in response to the first depression of button 34 the program stored in the rom addresses a designated rom address to read out signals to display 16 , causing the upper display line to read &# 34 ; step &# 34 ;, in response to the second depression of button 34 . the upper display line 16 responds to an address in the random access memory to provide indicia &# 34 ; in speed &# 34 ;, and the right side of the display middle line reads , either &# 34 ; m h &# 34 ; or &# 34 ; k h &# 34 ;, depending upon whether a 1 or 0 was displayed while the display middle line read &# 34 ; ut &# 34 ;. in response to the next two depressions of button 34 , the display top line responds to designated rom addresses to display indica &# 34 ; pk speed &# 34 ;, and &# 34 ; av speed &# 34 ;, while the rom address causes the display middle line to read &# 34 ; mh &# 34 ; or &# 34 ; kh &# 34 ;. in response to the fifth depression of button 34 , the top display line responds to a designated rom address to display &# 34 ; dist &# 34 ;, while the middle line of the display reads , on the right side , either &# 34 ; ml &# 34 ; or &# 34 ; km &# 34 ;. in response to the sixth depression of button 34 , display 16 responds to a designated rom address that causes the letters &# 34 ; ca &# 34 ; to be displayed on the center display line . as an auxiliary subroutine , instantaneous speed and number of steps can be determined while the subject is performing an exercise routine , while the stop watch mode is entered . to these ends , the rom is programmed so that in response to the computer being in the stopwatch mode , sequential depressions of buttons 35 , 33 and 34 cause the upper display line to respond to a designated rom address to display &# 34 ; step &# 34 ; while the display center line responds to a designated ram address to indicate the number of steps taken prior to depression of button 35 ; depression of button 35 activates the computer into the &# 34 ; lap timer &# 34 ; mode . the next depression of button 34 causes the top display line to respond to a rom memory address that causes : the top line to read &# 34 ; in speed &# 34 ;, the center display line to read either &# 34 ; kh &# 34 ; or &# 34 ; mh &# 34 ;, and the center display line to respond the ram designated address where subject speed during the previous six second calculation interval is stored . the pacer function involves providing the subject with a predetermined number of aural pulses ; the number of pulses per minute is settable from 5 to 160 in 5 pulses per minute increments . to set the desired number of aural pulses or beeps per minute for pacing purposes , button 33 is activated three times from the time display , whereby the center display line is supplied with a number indicating signal from the ram , followed by the letters &# 34 ; pm &# 34 ;, as supplied to the display from a designated rom address . the digital display is incremented in units of five each time button 34 is pressed for less than two seconds . in response to button 34 being pressed for more than two seconds the digital indicia on the display center line is incremented rapidly . pressing button 34 sets a count down factor in a count down register of the microcomputer alu . the count down register is responsive to pulses from the oscillator including crystal 12 , to control the frequency of pulses supplied by the oscillator to beeper piezoelectric crystal 17 by way of amplifier 18 . the countdown register setting is controlled by a designated ram address loaded with pulses from the oscillator in response to pressing key 34 being pressed . after the designated pacer pulse rate has been set and displayed on liquid crystal display 16 , the pacer function is instigated by pressing button 33 while the watch is in the pacer mode . the rom is programmed to respond to pressing of button 35 at this time by opening a gate in the microcomputer to supply pulses to amplifier 18 and crystal 17 , causing aural pulses to be derived from the piezoelectric crystal at the designated pacer rate . after the pacer rate has been set , button 33 is pressed , to return display 16 to the time of day indication . the pacer beep function is activated by pressing button 34 and then pressing button 35 . each time button 3 is thereafter pressed causes the pacer beep to be either turned on or turned off . when the pacer beep is on the rom activates display 16 so that in the lower right hand corner thereof a special pictorial representation appears . crystal 17 responds to pulses from microcomputer 11 to provide an aural beep in response to many different functions performed by the microcomputer ; amongst these functions are : ( a ) sensing open circuiting of contacts 19 , each time each of buttons 33 - 35 is pressed , responding to a count of zero being reached in the clock countdown mode , and responding to the time set for the alarm to go off being reached , provided that the alarm setting has been set . while there has been described and illustrated one specific embodiment of the invention , it will be clear that variations in the details of the embodiment specifically illustrated and described may be made without departing from the true spirit and scope of the invention as defined in the appended claims .	0
referring now to fig1 there is shown generally at 10 an elevation , cross - sectional view of a cooling tower provided with the water treatment system in accordance with the present invention . although a cooling tower is shown on fig1 the present invention could be utilized with any type of evaporative cooling equipment such as evaporative condensers , closed - circuit fluid coolers , direct evaporative coolers , as well as others . also , cooling tower 10 is shown as a forced draft counterflow cooling tower , though the present invention could be utilized with other types of cooling towers such as induced draft counterflow , cross - flow , natural draft hyperbolic , among other types . cooling tower 10 comprises outside casing 12 and collection basin 14 . attached to casing 12 is fan 20 , which could be a centrifugal or squirrel cage fan , as shown , or an axial fan . cooling tower 10 also comprises drift particle eliminators 18 , which typically consist of a plurality of thin plastic or metal sheets arranged to prevent entrained moisture particles from passing through eliminators 18 and outside of cooling tower 10 . recirculated water spray header 32 passes through casing 12 into cooling tower 10 . spray header 32 typically is constructed of galvanized or polyvinyl chloride ( pvc ) piping . orifice nozzles 34 are attached to spray header 32 and are typically manufactured of a plastic material such as polypropylene , though other similar plastic materials are often utilized . positioned below spray header 32 is heat transfer media 16 . heat transfer media 16 generally comprises a plurality of thin plastic sheets over which the recirculated water passes . heat transfer media 16 is generally designed to maximize the heat transfer surface area between the air and recirculated water while minimizing the pressure drop of the air flow through cooling tower 10 . suction screen 40 is located in basin 14 . suction screen 40 is connected to circulating pump 28 via line 29 . suction screen 40 typically comprises a metallic screen , such as galvanized or stainless steel , and is intended to prevent debris from leaving basin 14 . circulating pump 28 is connected to line 30 which transports the recirculating water back to the process requiring cooling . blow down line 46 extends from basin 14 of cooling tower 10 to a drain not shown in the figure . the purpose of blow down line 46 is to provide a means for removing a portion of the recirculated water to control the level of dissolved solids within the system . valve 48 is positioned in blow down line 46 to control the amount of recirculated water that is bled from basin 14 . typically valve 48 is connected to conductivity meter 50 which measures the conductivity of the recirculated water via conductivity probe 52 which usually is located within line 30 . when the dissolved solids in the recirculated water increase , the electrical conductivity of the water also increases . when the conductivity of the recirculated water reaches a pre - set level , conductivity meter 50 typically transmits a signal to valve 48 to open and allow a portion of the recirculated water to escape from basin 14 . although it is preferred that an automatic blow - down system as that described above be utilized with the present invention , manual blow - down methods may also be utilized to control the dissolved solids &# 39 ; level in the recirculated water . as a result of the need to add additional water to the evaporative cooling system to replace the water lost from the system due to evaporation and blow down , a make - up water control apparatus is typically utilized . the make - up water control system in fig1 is shown as float ball 36 and mechanical valve 38 , although alternative make - up control devices , such as electronic level controllers and valves , could be utilized . float ball 36 is connected to mechanical valve 38 which , in turn , is connected to make - up water supply line 44 . located within the make - up supply line is canister 42 , in accordance with the present invention , which is filled with solid biocide chemicals . a close - up view of canister 42 is shown in fig2 . typically , canister 42 comprises a top housing 60 and a bottom container 62 . bottom container 62 and top housing 60 are usually connectable via screw type threads 70 , though other types of connection methods could be utilized . canister 42 is typically molded of polypropylene , though other similar plastic materials could be utilized . referring now to fig3 bottom container 62 is typically provided with top restraining screen 68 and bottom restraining screen 69 which are used to contain a solid form biocide chemical , shown generally as 72 . top restraining screen 68 and bottom restraining screen 69 are typically thin , perforated plastic or metallic sheets which are designed to allow water to flow through the screen while restraining biocide 72 within the confines of container 62 . initially , bottom container 62 is completely filled with biocide chemical 72 . as water flows through bottom container 62 , biocide chemical 72 is depleted and the level of biocide chemical will be reduced , as shown in the figure . in the preferred embodiment , biocide chemical 72 is in the form of round spheres , or particles , although other solid form shapes could also be utilized . the mesh size of top restraining screen 68 is critical to the proper operation of the present invention . in general , the mesh size must be small enough to confine biocide chemical 72 within container 62 . conversely , the mesh size must be large enough to allow water to pass through with minimal restriction . in addition , it is desired that the mesh size be large enough to pass the very small biocide chemical beads which become fluidized during operation of the device and would otherwise block the passageways of top restraining screen 68 if not passed through . in the preferred embodiment of the present invention , biocide or treatment chemical 72 has a density significantly greater than that of water . accordingly , as the water flows up through biocide chemical 72 bed , the majority of biocide chemical 72 remains in the bottom of the container 62 . however , as biocide chemical 72 dissolves , the chemical beads become smaller in size until a point is reached where the drag on some of the biocide chemical particles created by flow of water through the bed is greater than the gravitational force on the particle . when this point is reached , the biocide chemical particle will become fluidized and will be carried to the top of container 72 . the mesh of top restraining screen 68 is preferably large enough to pass such particles through top restraining screen 68 and into the main stream of make - up water . in its preferred embodiment top restraining screen 68 will have a mesh with openings of about 0 . 020 inches . tube 74 is also included in bottom container 62 . tube 74 extends from a top side of bottom container 62 down through the center of bottom container 62 and through bottom restraining screen 69 . the purpose of tube 74 is to transport a flow of fluid from top housing 60 down to the bottom of bottom container 62 . when bottom container 62 and top housing 60 are connected , gasket 84 engages top housing 60 to provide a water tight seal . gasket 84 is preferably made of ethylene propylene dimonomer rubber or silicone rubber , though other similar rubber materials could be utilized . in fig2 it can be seen that the purpose of gasket 84 is to prevent the make - up water from bypassing the chemical bed and leaking from opening 78 directly into chamber 82 . referring now to fig4 top housing 60 is provided with inlet 64 for receiving incoming make - up water flow and with outlet 66 for passing the make - up flow out of top housing 60 and back into the make - up supply line . venturi 76 is positioned in the water flow path in top housing 60 between inlet 64 and outlet 66 . the purpose of venturi 76 is to accelerate the water flow through the top housing in order to create a side - stream flow of make - up which will be brought in contact with biocide chemical 72 contained within bottom container 62 . typically , venturi 76 will have a smooth , generally circular entrance and exit as is shown on the figure . this arrangement is preferred in order to minimize the turbulence of the flow through venturi 76 . however , a similar effect could be obtained if , instead of using smooth venturi 76 , an orifice plate or some other restriction to flow was utilized . referring back to fig2 the creation of the side stream flow of make - up water will be explained . the sidestream flow of water is created by positioning side stream inlet 78 in top housing 60 just prior to venturi 76 . in addition , side stream outlet 80 is positioned within venturi 76 . as the make - up water flows through top housing 60 , the majority of the flow passes through venturi 76 and outlet 66 . however , as the make - up water flows through top housing 60 , an area of low static pressure is created within and downstream of venturi 76 . accordingly , the static pressure of the water at side stream outlet 80 is less than the static pressure of the water at side stream inlet 78 . as a result of this difference in static pressures , a small portion of the make - up flow is split apart from the major flow stream and is forced through side stream inlet 78 . once the side stream has passed through side stream inlet 78 , the side stream is forced down through tube 74 , back up through biocide chemical 72 , through chamber 82 and side stream outlet 80 . as the side stream flows through side stream outlet 80 , it rejoins , and is mixed back into , the main make - up flow . in the preferred embodiment of the invention , the biocide chemical used in bottom container 62 is prilled elemental iodine . prilled elemental iodine is preferred for several reasons . first , elemental iodine has a relatively low solubility in cool water of approximately 300 mg / l . this low solubility coupled with the relatively long contact time of the side stream flow with biocide 72 allows the side stream flow to reach a constant , elemental iodine saturation concentration . preferably , the iodine concentration within the recirculating water should be held between 0 . 1 ppm and 0 . 5 ppm . it has been found that if the make - up water added to the recirculating water has an iodine concentration of about 3 . 0 ppm iodine , the level of iodine within the recirculating water will be within the 0 . 1 to 0 . 5 ppm range . accordingly , in order to achieve a 3 . 0 ppm iodine concentration in the make - up water stream , it is necessary that the side stream flow constitute about 1 % of the total make - up water flow through device 42 . when this side stream , having a constant 300 ppm iodine concentration , is re - mixed into the main make - up water flow stream , the resulting mixture will have a constant iodine concentration of about 3 mg / l . it is recognized , however , that differing iodine concentrations could be obtained , and may be preferred in certain instances , by varying the volume of the side stream flow . the low solubility of iodine also prevents excessive iodine from being dissolved and wasted during times when the addition of make - up water is not required . during such periods , the side stream will remain in contact with biocide chemical 72 within bottom container 62 . however , due to the low solubility of elemental iodine , the only iodine that will dissolve into the side stream is the amount which is necessary to saturate the side stream . once this saturation level is reached , no additional iodine will dissolve . this feature allows the supply of iodine in bottom container 62 to last for extended periods of time . in fact , it is possible to calculate an amount of iodine which , if placed within bottom container 62 , will last for an entire operating season . although prilled elemental iodine is preferred , the present invention could also be utilized with other oxidizing biocides such as chlorine or bromine compounds and other organic or inorganic biocides which are slightly soluble in water . however , the degree of solubility of alternative biocides will have to be considered if all the anticipated features of the present invention are to be realized . it is anticipated that the present invention will find most use in systems utilizing evaporative cooling equipment in the small to mid - size range , that is with equipment of up to about 350 to 400 tons . when used with equipment of this size , it is possible to provide sufficient iodine to last for an entire operating season within a canister of a reasonable size . in addition , systems in the small to mid - size range often are left untreated , or are treated using the slug - feed method , due to the high cost of installing automatic chemical feed equipment . as a result , the present invention will provide a much improved means for cost - effectively treating such systems . in typical applications , it is estimated that approximately 0 . 1 pound of iodine per ton of cooling will be required to supply iodine to an evaporative cooling system for an entire season . this amount of iodine is based upon the assumption that the evaporative cooling equipment will operate at about five cycles of concentration . of course , if the evaporative cooling equipment is operated at other than 5 cycles of concentrations , or if the operating season is longer or shorter than that assumed in this estimate , the amount of iodine that will be required to last an entire season may change . usually , the canisters used in accordance with the present invention will be approximately 3 to 8 inches in diameter and about 6 to 36 inches in length . with canisters of this size , passageway 75 will usually be about 0 . 63 to 1 . 0 inches in diameter . in order to create a side stream flow equal to about 1 % of the total flow in the preferred embodiment of the present invention , the cross - sectional flow area of venturi 76 will generally need to be equal to about 50 % of the cross - sectional flow area of passageway 75 . generally , side stream inlet 78 is oversized and provides minimal restriction to the side stream flow . however , the size of side stream outlet 80 must be controlled and matched with the size of venturi 76 so that a sufficient restriction to flow will be provided in order to prevent excessive side stream flow . for example , if a venturi having a diameter of 0 . 59 inches is utilized , side stream outlet 80 will need to be about 0 . 09 inches in diameter . however , other combinations of venturi size and side stream outlet sizes could also be used . an important feature of the present invention is that the biocide chemical is added to the evaporative cooling equipment in proportion to the need for biological control within the system . as shown by fig1 this is accomplished by adding the biocide chemical contained in canister 42 via the make - up water supply 44 . it is known in the art that the growth rate of microbiological organisms in evaporative cooling equipment typically increases as the recirculating water temperature increases . in most evaporative cooling systems , the recirculating water temperature increases as the load on the equipment , or the amount of heat that must be rejected from the equipment , increases . it is also known in the art that as the load on evaporative cooling equipment increases , the amount of water that is evaporated from the equipment must necessarily increase to provide the required cooling . in addition , it is also necessary to increase the blow down rate from the tower as the evaporation rate increases in order to maintain the level of dissolved solids at a relatively constant level . due to the increase in the loss of water from the system from increased evaporation and increased blow down rate at high loads , it is necessary to correspondingly increase the amount of make - up water flow to the equipment in order to maintain sufficient water within the system . since the amount of make - up water added to the system is approximately proportional to the load on the evaporative cooling equipment , and since the load on the system is approximately proportional to the rate of microbiological growth within the evaporative cooling equipment , it logically follows that the rate of make - up water added to an evaporative cooling system is approximately proportional to the rate of microbiological growth within the system . the present invention utilizes this relationship to provide a method of biocidal water treatment that automatically , without expensive automatic chemical feed equipment and daily operator attention , adds biocide chemical in proportion to the need for microbial control within evaporative cooling systems . this minimizes the chemical waste which is present with most systems and is a significant advantage over prior art systems which typically add biocide chemical on a timed basis . for example , typical evaporative cooling equipment used on comfort cooling , or air conditioning , systems operate at their maximum capacity for less than 10 % of the time the equipment is in operation . accordingly , if , in a prior art time based , automatic biocide feed system , the rate of biocide addition is set based upon the maximum biological growth rate , the prior art system would overfeed biocide chemical approximately 90 % of the time . on the other hand , if the timed rate of biocide addition in such a prior art system were based on the average biological growth rate , the prior art system would overfeed and waste biocide chemical at times when the load on the equipment was small and the recirculating water temperature was low . similarly , such prior art system would underfeed biocide chemical at times of high load when the recirculated water temperature was high . if harmful pathogens are present within the system , this underfeed situation could allow the concentration of harmful pathogens in the system to increase to potentially dangerous levels . although the method and apparatus of the present invention has been described for the preferred embodiment , it is apparent that various modifications and alternatives can be made thereto without departing from the scope and spirit of the invention , which is defined in the following claims .	1
according to the present invention , applicant presents a process for preparing n , n &# 39 ;- difluorinated diazoniabicyclo - alkane derivatives of the following formula i : ## str4 ## wherein n represents 0 , 1 or 2 ; each r 1 , r 2 , r 3 , r 4 and r 5 independently represents hydrogen , c 1 - c 6 alkyl , aryl , c 1 - c 6 alkyl - substituted aryl or aryl - substituted c 1 - c 6 alkyl ; and each x - represents a counterion or 2x - represents a single divalent counterion . the process for preparing the derivatives according to formula i comprises fluorinating the corresponding 1 - hydro - 4 - aza - 1 - azoniabicycloalkane salts of the following formula ii : ## str5 ## wherein n , r 1 , r 2 , r 3 , r 4 , r 5 , and x - are as defined above , in the presence of an alkali metal salt m + x - , wherein x - is as defined above and m + is an alkali metal cation . when any of r 1 to r 5 is other than hydrogen , it is preferably benzyl , phenyl or , especially , c 1 - c 4 alkyl , particularly methyl . however , due to steric considerations it may not be possible to obtain compounds with all possible combinations of r 1 to r 5 values . usually no more than one r 1 at the 2 and 3 ring positions and no more than one r 1 at the 5 and 6 ring positions will be other than hydrogen . it is preferred that all r 1 are hydrogen . usually no more than one of r 2 , r 3 , r 4 and r 5 is other than hydrogen . it is preferred that all of r 2 to r 5 are hydrogen . it is especially preferred that n is 0 , and each r 1 is hydrogen ( i . e . that the compounds of formula ii are derivatives of 1 , 4 - diazabicyclo [ 2 . 2 . 2 ] octane . thus , according to a preferred embodiment , the 1 - hydro - 4 - aza - 1 - azoniabicycloalkane salts of formula ii are of the following formula iii the counterion represented by x - in formulae i to iii can be any anion which can be a counterion to the quaternizing fluorine . usually , but not necessarily , the counterion will be weakly nucleophilic . suitable anions include halides , especially fluoride ( f - ); fluorosulfate ( so 3 f - ); alkanesulfonates , especially methanesulfonate ( ch 3 so 3 - ); alkyl sulfates , especially methyl sulphate ( ch 3 so 4 - ); perfluoroalkanesulfonates , preferably triflate ( cf 3 so 3 - ) and nonaflate ( c 4 f 9 so 3 - ); arenesulfonates , especially tosylate ( i . e . p - toluene - sulfonate ; ch 3 c 6 h 4 so 3 - ); alkanecarboxylates ; perfluoroalkanecarboxylates ; tetrafluoroborate ( bf 4 - ); tetraphenylborate ( ph 4 b - ); hexafluorophosphate ( pf 6 - ); hexafluoroantimonate ( sbf 6 - ); chlorate ( cio 3 - ); and sulfate ( so 4 - = 2x - ). the preferred anions are fluoride , triflate , tosylate and , especially , tetrafluoroborate . the fluorinations usually are carried out using a stirred - tank batch reactor into which the fluorine is admitted either as a single charge of the gas at sub - atmospheric pressure or as a continuous flow of fluorine blended with nitrogen or other inert diluent at about atmospheric pressure . in the first of said fluorination methods , fluorine , usually diluted with nitrogen , is passed into a stirred low temperature solution or suspension of the 1 - hydro - 4 - aza - 1 - azoniabicycloalkane salts of formula ii in a suitable organic solvent , for example trichlorofluoromethane or especially acetonitrile . usually , the temperature is in the range - 35 ° c . to - 78 ° c . and the fluorine pressure is below 20 mmhg ( 2 . 7 kpa ). in the second fluorination method , fluorine heavily diluted with an inert gas , usually nitrogen , is passed through said solution at about ambient pressure ( see u . s . pat . nos . 4 , 479 , 901 and 5 , 086 , 178 ). the fluorination is conducted in the presence of an alkali metal salt m + x - , wherein x - is as defined above and m + is an alkali metal cation , usually lithium . preferably , both the heterocyclic and alkali metal salts are triflates ( i . e . trifluoromethane - sulfonates ) and the reaction is conducted in acetonitrile under nitrogen . the 1 - hydro - 4 - aza - 1 - azoniabicycloalkane salts of formula ii can readily be prepared by treating in a suitable organic solvent the corresponding 1 , 4 - diazabicyclo [ 2 . 2 . 2 ] alkane of the following formula iv ## str6 ## wherein n , r 1 , r 2 , r 3 , r 4 , r 5 , and x - are as defined above , with the corresponding acid h + x - , wherein x is as defined above . usually , the 1 , 4 - diazabicyclo [ 2 . 2 . 2 ] alkane is stoichiometrically titrated with acid in the solvent to be used for the subsequent fluorination and the 1 - hydro - 4 - aza - 1 - azoniabicycloalkane salts fluorinated in situ . the 1 , 4 - diazabicyclo [ 2 . 2 . 2 ] alkanes of formula iv are known per se or can be prepared by analogous methods to those known per se . in particular , those compounds of formula iv in which n is 0 can be obtained by acid - catalyzed ring closure of the corresponding n -( hydroxyethyl ) piperazine . the n -( hydroxyethyl ) piperazines can be obtained by reaction of the corresponding piperazine with ethylene oxide or an appropriately substituted ethylene oxide . substituted piperazine reactants can be obtained by reaction of an ethanolamine , an ethylene oxide and ammonia with the ethanolamine and / or ethylene oxide being appropriately substituted . the diazabicyclononane derivatives in which n is 1 or 2 can be obtained by treatment of the corresponding piperazine or homopiperazine with an appropriate alkyldihalide . the fluorinating agents of formula i are used in manner know per se as electrophilic fluorinating agents ( see , for example , r . e . banks et al j . chem . soc . perkin trans . i , 1988 , 2805 ). they appear to be unstable in the presence of moisture and hence should be protected from atmospheric moisture by , for example , storage under dry nitrogen in polyalkene or similar containers resistant to hydrogen fluoride . 1 , 4 - diazabicyclo [ 2 . 2 . 2 ] octane was stoichiometrically titrated in acetonitrile solution with neat trifluoro - methanesulfonic acid . the stoichiometric endpoint ( at ph = 5 . 851 ) was monitored by potentiometric methods . analysis of the resulting acetonitrile solution by 1 h and 19 f nmr spectroscopy was consistent with 1 - hydro - 4 - aza - 1 - azonia - bicycloalkane [ 2 . 2 . 2 ] octane triflate ( concentration 0 . 505 mmol cm - 3 ). all operations were performed under an atmosphere of dry nitrogen . an aliquot ( 50 cm 3 ) of the solution prepared in step a ( containing 25 . 25 mmol of 1 - hydro - 4 - aza - 1 - azonia - bicycloalkane [ 2 . 2 . 2 ] octane triflate ) was diluted to 550 cm 3 with anhydrous acetonitrile ( final concentration 0 . 046m ) in a jacketed glass reactor . to this solution was added 8 . 51 g ( 54 . 6 mmol ) of lithium triflate and the mixture was cooled to - 45 ° c . while being stirred . fluorine diluted with nitrogen ( ca . 6 % by volume of f 2 in n 2 ) was then introduced through a sparging dip - tube at the rate of 200 cm 3 per minute until a total of 70 . 4 mmol of f 2 had passed into the mixture ( ca . 2 . 5 hours ). the reactor was then purged with nitrogen for a period of 10 minutes , and the reaction solution allowed to stand to allow solid matter to settle . the clear supernatant liquid was then decanted into a polyethylene container , which was subsequently tightly sealed and cooled to - 78 ° c . the mixture was kept at this temperature for the duration of analysis and evaluation . the product in solution was characterized by iodometric analysis and low - temperature multinuclear magnetic resonance ( 1 h , 13 c , 19 f ) spectroscopy . the 1 h , 19 f and 13 c nmr spectra were recorded at - 42 ° c . and were fully consistent with 1 , 4 - difluoro - 1 , 4 - diazoniabicyclo [ 2 . 2 . 2 ] octane bistriflate . thus the 1 h spectrum comprised a broadened 12h multiplet at 4 . 93 p . p . m . [ six equivalent ch 2 groups , each magnetically coupled ( partially resolved ) to two equivalent n + -- f groups ], and a singlet at 3 . 52 p . p . m . due to unreacted starting material . with cfcl 3 as reference , the 19 f spectrum showed two singlets of relative intensities 2 : 3 at 36 . 62 p . p . m . ( two equivalent n + -- f groups ) and - 79 . 12 p . p . m . ( cf 3 so 3 - ). the 13 c spectrum comprised a doublet - of - doublets , at 60 . 52 p . p . m . corresponding to the six ch 2 groups of the difluoro compound , a triflate quartet at 121 . 21 p . p . m ., and a singlet at 44 . 20 p . p . m . caused by the presence of some unreacted starting material .	2
in an embodiment , the soft magnetic component may comprise an amorphous or a nano - crystalline material . in an embodiment , the soft magnetic component may comprise particles which are individually insulated with a surface layer . in an embodiment , the particle size can be less than 2 mm . in an embodiment , the particle thickness can be less than 0 . 5 mm . in an embodiment , the surface of the particles can be oxidized or plastic coated . in an embodiment , the plastic component may comprise thermoplastic or duroplastic which can be processed with a casting resin technology . in an embodiment , the antenna formed by the magnet core and winding may have a quality more than 50 in the frequency range from 20 khz to 150 khz . in an embodiment , the magnet core can be loaded with a magnetic flow of at least 20 μwb . in an embodiment , the antenna may comprise several windings on the same magnet core , wherein the longitudinal axes of the windings are arranged at an angle greater than 0 ° to one another . in an embodiment , the antenna may comprise several magnet cores that carry windings , wherein the radiation properties of the individual magnet cores are shaped and / or aligned differently . in an embodiment , at least one of the magnet cores may have a recess for accommodating electronic components . yet another embodiment is directed to a method of using an antenna for inductive power transmission , wherein the antenna comprises a magnet core and a winding for use in the inductive power transmission , wherein the magnet core contains a soft magnetic component made of finely divided particles and a plastic component as the composite material and wherein the magnet core has an effective initial permeability ranging from 20 to 200 as well as a saturation induction higher than 0 . 6 t . in an embodiment , the method may be used for inductive power transmission between a stationary device and a mobile device fitted with an inductive receiver . in an embodiment , the method may be used for charging the power stores in the mobile devices . in an embodiment , the method may be used for inductive power transmission from a mobile device to a stationary device . yet another embodiment is directed to a method for operating an antenna comprising a plurality of magnet cores each carrying at least one winding , wherein the radiation properties of the individual magnet cores are shaped and / or aligned differently , wherein each magnet core contains a soft magnetic component made of finely divided particles and a plastic component as the composite material and wherein each magnet core has an effective initial permeability ranging from 20 to 200 as well as a saturation induction higher than 0 . 6 t , wherein the method may comprise the step of controlling different windings in a simultaneously phased manner or in an alternating manner . yet another embodiment is directed to a method for operating an antenna comprising a magnet core having a plurality of winding for use in the inductive power transmission , wherein longitudinal axes of the windings are arranged at an angle greater than 0 ° to one another , and wherein the magnet core contains a soft magnetic component made of finely divided particles and a plastic component as the composite material and wherein the magnet core has an effective initial permeability ranging from 20 to 200 as well as a saturation induction higher than 0 . 6 t , wherein the method comprises the step of controlling different windings in a simultaneously phased manner or in an alternating manner . according to the invention , the magnet core contains a soft magnetic component made from finely distributed particles and a plastic component as the composite material ; the magnet core has an initial permeability between 20 and 200 and a saturation induction of & gt ; 0 . 6 t . an advantage is that , the soft magnetic component is made up of the flakes of a nano - crystalline material as mentioned above . this component has a saturation magnetization of approx . 1 to 1 . 6 t and permeability & gt ; 30 , 000 . by mixing a plastic component , the magnetic circuit is broken because of the microscopic gaps between the flakes and a lower effective permeability of 30 to 100 is achieved at a high quality and constancy of temperature . however , a high flow density is achieved , higher than 0 . 6 t , typically also higher than 0 . 9 t . a favorable property of the soft magnetic component of the magnet core is that the particles are electrically insulated with a surface layer . this can be , for example , a plastic layer or the result of surface oxidation . the particle size can be less than 2 mm , whereby the particle thickness can be less than 0 . 5 mm . because of this form of the particles , there are very little magnetic losses and thus , a very high quality of antennae is achieved . the mechanical properties — fracture toughness , flexibility and temperature dependability — can be adapted according to the type and proportion of plastic used . thermoplastics or duroplastics such as polyamide , polyacrylate , polyacetate , polyimide or epoxy resin processed with the casting resin technology can be used as the plastic component , depending upon the required mechanical and thermal properties . in the simplest design , the antenna arrangement has a bar or a plate with a winding as the magnet core . definite core cross - sections are necessary so that the arrangement can be used for an effective power transmission . if an average flow of at least 20 μwb is attained in the core , an induction of 400 mt is achieved for a cross - section of 0 . 5 cm 2 . this corresponds to approximately half of the cross - section required for the use of a soft ferrite . in this case , the coil length should be greater than the diameter of the winding so that the magnet core can be effectively used for increasing the flow . an important property of the material used as per this invention is the mechanical immunity to impacts and vibrations and flexibility in shaping during the production and / or subsequent flexibility . because of its magnetic properties , the material used as per this invention has a small size and can thus , be used in several areas of application due to cost , space and design reasons . for achieving the desired radiation properties and / or flow of the antenna arrangement , it can be advantageous if several windings are arranged on the same magnet core , whereby the longitudinal axes of the windings are at an angle of & gt ; 0 °, e . g . 90 ° to one another . the windings can be controlled simultaneously , in a phased manner or in an alternating manner , so that inductive power transmission to the receiver can take place in different positions . thus , power transmission becomes more reliable and immune as regards the relative positioning of the transmitter and receiver . this invention is based on different operating methods of the antenna arrangement with intermittent functioning of the different windings and / or the aforementioned dephased simultaneous control of the different windings . to achieve a high acceptance as regards the positioning of the transmitters and receivers , it is possible to have several windings on different magnet cores of the given type , whereby the radiation property of the individual magnet cores is shaped or adjusted differently . also , this helps in increasing the optimum positioning range of a receiver , to which the power is transmitted . since the antenna arrangement as per this invention can be space - saving , it might also be logical to provide for a recess within a magnet core , in which electronic components , e . g . the control circuit of the antenna arrangement , can be accommodated . the flow within the magnet core will hardly be influenced by such recesses , provided they are not too large . besides , the antenna arrangement can be pre - fabricated with the control circuit and easily incorporated as an integral unit in the device . fig1 shows a two - dimensional magnet core 1 with a winding 2 , whereby the dimensions of the magnet core can be , e . g . 20 × 10 × 0 . 2 cm . preferably , the area of the core is as big as the target place ( to be covered ) of the receiver . because of the design of the winding , e . g . a compaction / compression towards the ends , a strong homogenous flow density is generated as far as possible . for specially designing the flow orientation and the radiation properties , fig2 shows a combination of two perpendicular windings 3 , 4 on a magnet core 5 , which is almost designed as a quadratic plate . both the windings can be controlled alternately or in a simultaneously dephased manner . if the correct plastic component is selected , the entire arrangement can be flexible , as shown in fig1 or 2 . in any case , this component is more immune to fracture than e . g . an arrangement with ferrite core or a core made from any other material that is usually used . the arrangement with a bar - shaped magnet core as shown in fig3 is particularly suitable for the transmission of power to a mobile receiver , whereby the direction of movement as well as the antenna of the receiver is parallel to the longitudinal axis of the winding 7 . fig6 shows two different magnet cores 8 , 9 ; each has a separate winding and their longitudinal axes are perpendicular so as to allow different flow densities and radiation properties . this is an alternative to the design shown in fig2 , which has several windings on a single magnet core . fig4 shows an arrangement , in which the winding 10 is integrated in a magnetic body 11 , as if it is passing through the magnet core itself 11 and the lower part of the magnet core 11 shown in fig4 forms a yoke , which shorts the magnetic flow on the lower side . this along with the pole shoes 12 , 13 gives a screening effect in one direction ( downward ) as well as a good radiation in the upward direction . the casting method described in wo 0191141 a1 is particularly suitable for making such an arrangement , whereby the winding can also be cast while preparing the magnet core . fig5 shows a recess 15 in the magnet core 14 , where components of an electronic circuit , e . g . for controlling the winding 16 , can be accommodated . fig6 shows an example of application of the antenna arrangement with a mobile communication terminal unit as per this invention — such as a mobile phone or a cordless phone 17 , which has a receiver for inductive coupling with the antenna arrangement 18 ( not described in detail ). the antenna arrangement 18 has a housing 19 , which accommodates both the magnet cores 8 , 9 ; each of these magnet cores has a winding and enable inductive power transmission to the receiver in the terminal unit 17 . in addition to the receiver , a capacitor or accumulator is also integrated in the terminal unit 17 for storing the transmitted power . although the described antenna arrangement is specially meant for power transmission , the same arrangement can also be used for transmitting back information and / or a signal , which is possibly either transmitted in an inductive manner ( whereby a changeover must take place between transmission and reception ) or by evaluating the power drawn by the receiver . the invention can also be used for power transmission from a mobile device to a stationary device , e . g . in the track system for transmitting signals and / or power from a device fixed on a vehicle to a stationary sensor in a control room / signal cabin for monitoring the traffic .	7
as a general comparison between barium titanate - based and strontium titanate - based ceramics , a sufficiently large dielectric constant is readily obtained with the former type of ceramics though with a relatively large dielectric loss whereas the strontium titanate - based ceramics have rather smaller dielectric constant than the barium titanate - based ceramics but a much smaller dielectric lass factor of 0 . 5 % or smaller or , in particular , 0 . 06 % or smaller than in the barium titanate - based ones is readily obtained with the strontium titanate - based ceramics depending on the composition . the key factor for the improvement of the high frequency performance and extended durability of a ceramic capacitor is the small dielectric loss whereas the requirement for the dielectric constant has been found to be so high that a value of 1000 or larger is sufficient in strontium titanate - based ceramic capacitors for the dielectric constant in most applications . since strontium titanate - based ceramics having a dielectric constant of at least 1500 or at least 1800 are readily available in the present status of the art , the dielectric constant is no longer the critical parameter limiting the performance and durability of the ceramic capacitor or the electric power source units built by use of the ceramic capacitors . the present invention is characteristic in the high - performance electric power source unit with a high - speed pulse - forming circuit or a high - frequency rectifying circuit in which the dielectric loss is minimized by the use of capacitors made of a strontium titanate - based ceramic . as a benefit accompanying the reduced dielectric loss , the temperature rising of the ceramic capacitor during application of a voltage is decreased so that the serviceable life of the capacitor is extended with retardation of the aging phenomenon of the capacitor . on the other hand , the impedance of a circuit is inversely proportional to the product of the frequency and the capacitance so that the impedance can be decreased at a higher frequency and the capacitance can be reduced at a higher frequency . the strontium titanate - based ceramic capacitors are advantageous also in this respect . on the contrary , conventional barium titanate - based ceramic capacitors exhibit particularly large dielectric loss at a frequency higher than 1 mhz resulting in large temperature rising with considerable disadvantages in comparison with the strontium titanate - based ceramic capacitors . further , the oil - impregnation type polymer film and paper capacitors are satisfactorily usable at low frequencies owing to their large capacitance but quite unsuitable for high frequency uses due to the large inductance . when the proportionality between the applied voltage and the power output of the source unit is desired to be maintained over a range as wide as possible , it is a requirement that the voltage dependency and the temperature characteristic of the capacitance should be minimized . strontium titanate - based ceramic capacitors are advantageous also in this respect since the voltage dependency of them can be as small as 10 % or smaller per 1 kv / mm thickness of the dielectric material and the temperature characteristic of the capacitance can be such that the decrease of the capacitance at 85 ° c . from the value at 20 ° c . is 40 % or smaller . accordingly , the electric power source unit of the present invention with the highest performance is manufactured by use of the capacitors of strontium titanate - based ceramics having a dielectric constant of at least 1000 , dielectric loss factor of 0 . 5 % or smaller , voltage dependency of the capacitance of 10 % or smaller at 1 kv / mm thickness of the dielectric material and decrease of the capacitance at 85 ° c . is 40 % smaller from the value at 20 ° c . strontium titanate - based ceramic materials satisfying the above requirements can be prepared with the formulations , for example , given below in four classes ( 1 ) to ( 4 ). ( 1 ) a ceramic composed of 20 to 51 % by weight of strontium titanate , 5 to 30 % by weight of a bismuth titanate having a molar ratio of bi 2 o 3 : tio 2 of 2 : 3 to 1 : 5 , and 15 to 70 % by weight of barium titanate with addition of a small amount of at least one additive ingredient selected from the group consisting of oxides of manganese , niobium , chromium , nickel , cobalt and iron , clay materials and oxides of rare earth elements . ( 2 ) a ceramic composed of 60 to 75 % by weight of strontium titanate , 5 to 25 % by weight of bismuth oxide , 5 to 30 % by weight of a titanium oxide and up to 5 % by weight of magnesium oxide with addition of a small amount of at least one additive ingredient selected from the group consisting of oxides of manganese , niobium , chromium , nickel , cobalt and iron , clay materials and oxides of rare earth elements . ( 3 ) a ceramic composed of 40 to 80 % by weight of strontium titanate , 15 to 40 % by weight of a bismuth titanate having a molar ratio of bi 2 o 3 : tio 2 of 2 : 3 to 1 : 5 , and 3 to 20 % by weight of lead titanate with addition of a small amount of at least one additive ingredient selected from the group consisting of oxides of manganese , niobium , chromium , nickel , cobalt and iron , clay materials and oxides of rare earth elements . ( 4 ) a ceramic composed of 30 to 60 % by weight of strontium titanate , 0 . 5 to 30 % by weight of calcium titanate , 5 to 35 % by weight of lead titanate and 5 to 30 % by weight of a bismuth titanate having a molar ratio of bi 2 o 3 : tio 2 of 2 : 3 to 1 : 5 with addition of a small amount of at least one additive ingredient selected from the group consisting of oxides of manganese , niobium , chromium , nickel , cobalt and iron , clay materials and oxides of rare earth elements . in each of the above four classes of the ceramic formulations , the rare earth oxide is added in order to further decrease the dielectric loss . suitable rare earth oxides , for example , are ceric oxide , lanthanum oxide and the like used usually in an amount of 0 . 01 to 10 % by weight . the oxides of manganese , niobium , chromium , nickel , cobalt and iron as well as the clay materials serve as a mineralizing agent to give a sintered body with further densified structure . the amount of their addition is usually in the range from 0 . 1 to 0 . 5 % by weight . among the above given four classes of the ceramic materials , those belonging to the first class are characterized by their relatively large dielectric constant for a strontium titanate - based ceramic . those belonging to the second class of the ceramic materials are characterized by the small voltage dependency of the capacitance . thus , it is a matter of option to select and use any one or more of the additive ingredients according to the particular object of the use of the ceramic capacitors . a typical example of the ceramic capacitors used in the inventive electric power source unit is illustrated by the cross section in fig1 . in this figure , the sintered ceramic body 1 is provided with electrodes 3 , 3 &# 39 ; on the opposite surfaces , to which the terminals 2 , 2 &# 39 ; are bonded by soldering or other suitable means . the body of the capacitor is as a whole encapsulated in a synthetic resin 5 such as an epoxy resin with the end surfaces of the terminals 2 , 2 &# 39 ; being exposed and a connector 4 being bonded thereto . the inventive electric power source unit is assembled and constructed with the above described ceramic capacitor or capacitors as a component or components of a high - speed pulse - forming circuits or a high - frequency voltage - multipler rectifying circuit . the pulse - forming circuit may be a marx circuit as illustrated in fig2 a capacitor bank circuit as illustrated in fig3 a l - c inversion circuit as illustrated in fig4 or a pfn circuit as illustrated in fig5 . further , an example of the circuit diagram of the high - frequency voltage - rectifying circuit is illustrated in fig6 . in these figures , c 1 to c 5 each denote a ceramic capacitor , g 1 to g 4 each denote a spark gap and d 1 to d 5 each denote a diode . in the next place , the unique characteristics of the strontium titanate - based ceramic capacitors used in the inventive electric power source unit are well illustrated in comparison with conventional barium titanate - based ceramic capacitors with reference to fig7 in which curves a and a &# 39 ; are for an inventive strontium titanate - based ceramic capacitor and curves b and b &# 39 ; are for a conventional barium titantate - based ceramic capacitor . the figure is a graphic showing of the relationship between the applied voltage per unit thickness of the ceramic body in kv / mm and the output of the power source in kv . the chain line indicates the ideal proportionality between the parameters . curves a and b are for the ambient temperature of 20 ° c . and curves a &# 39 ; and b &# 39 ; are for 85 ° c . as is clear from the figure , the curves for the conventional ceramic capacitor level off irrespective of the ambient temperature as the applied voltage increases and the leveling - off temperature is lower at 85 ° c . than at 20 ° c . on the contrary , the strontium titanate - based ceramic capacitors used in the inventive power source unit are free from the phenomenon of leveling off and exhibit almost satisfactory proportionality at both 20 ° c . and 85 ° c . by further increasing the voltage applied to the capacitors , the strontium titanate - based ceramic capacitor exhibited a much higher , say about 1 . 5 times higher , break - down voltage than the conventional barium titanate - based ceramic capacitor . in this regard , the inventive power source unit is advantageous in the wide versatility in its use . further , fig8 illustrates the temperature characteristic of the capacitance of the strontium titanate - based ceramic capacitor ( curve a ) and the barium titanate - based ceramic capacitor ( curve b ) by plotting the relative changes in the values at varied temperatures taking the values at 20 ° c . as the base . as is clear from the figure , the capacitance of the barium titanate - based one decreases about 55 % at 85 ° c . while the decrease in the strontium titanate - based ceramic capacitor is only about 15 % at 85 ° c . further illustration of the characteristic difference between the strontium titanate - and barium titanate - based ceramic capacitors is given by fig9 in which the relative changes in the capacitance with aging are plotted as a function of the lapsed time in a logarithmic scale . as is clear from this figure , the strontium titanate - based ceramic capacitor ( curve a ) exhibited only a few % of decrease in the capacitance even after 10 5 hours when the barium titanate - based one exhibited a decrease of 25 % or more . fig1 is a graph showing the voltage dependency of the capacitance with the relative changes in the value of the capacitance in % taken as the ordinate plotted as a function of the applied voltage in kv divided by the thickness d in mm of the dielectric ceramic body . as is clear from this figure , the strontium titanate - based ceramic capacitor ( curve a ) has very small voltage dependency in comparison with the barium titanate - based ceramic capacitor ( curve b ), the decrease at v / d = 1 being only a few % for the former and about 20 % for the latter . as is readily understood from the above given comparison of the characteristics of the capacitors , the electric power source unit of the invention constructed with a strontium titanate - based ceramic capacitor is capable of producing a higher power output as a power source than with a similar unit with the barium titanate - based ceramic capacitor , and the stability of the power output is greatly improved over a long period of continued use . in summarizing , the electric power source unit of the present invention has advantages , by virtue of the use , as a component of the circuit , of one or more of the strontium titanate - based ceramic capacitors with much smaller , say , a half , of tolerance than in the conventional ceramic capacitors as a result of the use of stable materials and much higher working voltage and dielectric strength than in the conventional ceramic capacitors , that a well - controlled power output is obtained as calculated and designed , that the number of stages in a multi - stage circuit can be reduced permitting a more compact design of the power source unit and the stability of the power output is improved and that a power source unit of a large power output can readily be designed . in the following , the present invention is further described in detail by way of examples . in the examples , the characterization of various parameters of the capacitors were undertaken as below . ( a ) the values of the dielectric constant and tan δ are those obtained at 20 ° c . at a frequency of 1 mhz . ( b ) the temperature characteristic is expressed in the relative decrease in % of the capacitance of the capacitor at 85 ° c . in comparison with the value at 20 ° c . ( c ) the voltage dependency is expressed by the relative decrease in % of the capacitance at an electric field of 1 kv / mm of the thickness of the dielectric ceramic body . strontium titanate , a bismuth titanate , barium titanate in proportions indicated in table 1 and other necessary additive ingredients were uniformly blended with admixture of a suitable amount of a binder and the mixture was shaped by compression molding into a disc of a 16 . 5 mm diameter and 1 mm thickness , which was sintered at about 1200 ° c . for 2 hours into a ceramic body . these sintered bodies were each provided with electrodes to be a ceramic capacitor of the form as illustrated in fig1 . the characteristics of these capacitors are shown in table 1 . table 1______________________________________ sample no . 1 2 3______________________________________compo - srtio . sub . 3 50 . 9 36 . 4 29 . 1sition , 2bi . sub . 2 o . sub . 3 . 3tio . sub . 2 19 . 1 % by bi . sub . 2 o . sub . 3 . 3tio . sub . 2 13 . 6 10 . 9weight batio . sub . 3 30 50 60______________________________________pro - dielectric constant 1200 1780 2580perties temperature charac - teristic , % - 20 . 5 - 30 - 36 tan δ , % 0 . 4 0 . 1 0 . 1 voltage dependency , % - 2 - 2 . 5 - 4 . 8______________________________________ as is shown in the table , all of the ceramic capacitors prepared in this example had a dielectric constant of at least 1200 , temperature characteristic of the capacitance of 36 % or smaller , dielectric loss of 0 . 4 % or smaller and voltage dependency of the capacitance at an electric field of 1 kv / mm thickness of the dielectric ceramic body of 5 % or smaller . the ceramic capacitors prepared in the same formulation as in sample no . 2 above were used for building an electric power source unit having a marx circuit as shown in fig2 . the relationship between the voltage applied to each of the capacitors and the output of the power source unit is plotted in fig7 to give the curves a and a &# 39 ; for the ambient temperatures of 20 ° c . and 85 ° c ., respectively . three kinds of ceramic capacitors were prepared in the same manner as in example 1 each with the formulation composed of strontium titanate , bismuth oxide , titanium oxide and magnesium oxide in the proportion as indicated in table 2 below as well as other necessary additive ingredients . the characteristics of these ceramic capacitors are also given in table 2 . table 2______________________________________ sample no . 4 5 6______________________________________compo - srtio . sub . 3 72 . 3 63 . 3 62 . 4sition , bi . sub . 2 o . sub . 3 7 . 1 11 . 9 11 . 7 % by tio . sub . 2 20 . 6 23 . 9 23 . 5weight mgo 0 0 . 9 2 . 4______________________________________pro - dielectric constant 1050 1310 1215perties temperature charac - teristic , % - 19 - 12 . 3 - 8 . 5 tan δ , % 0 . 3 0 . 1 0 . 1 voltage dependency , % - 0 . 9 - 0 . 8 - 1 . 0______________________________________ as is shown in the table , all of the ceramic capacitors prepared in this example had a dielectric constant of at least 1000 , temperature characteristics of the capacitance of 20 % or smaller , dielectric loss of 0 . 3 % or smaller and voltage dependency of the capacitance of 1 . 0 % or smaller . three kinds of ceramic capacitors were prepared in the same manner as in example 1 each with the formulation composed of strontium titanate , either one of 2 kinds of bismuth titanates and lead titanate in the proportion as indicated in table 3 below as well as other necessary additive ingredients . the characteristics of these ceramic capacitors are also given in table 3 . table 3______________________________________ sample no . 7 8 9______________________________________compo - srtio . sub . 3 69 . 4 65 . 9 61 . 6sition , bi . sub . 2 o . sub . 3 . 2tio . sub . 2 20 . 0 % by bi . sub . 2 o . sub . 3 . 3tio . sub . 2 25 . 9 23 . 2weight pbtio . sub . 3 4 . 7 14 . 1 15 . 2______________________________________pro - dielectric constant 1060 1380 1880perties temperature charac - teristic , % - 15 - 26 . 2 - 20 . 5 tan δ , % 0 . 06 0 . 5 0 . 1 voltage dependency , % - 0 . 8 - 9 . 0 - 5 . 4______________________________________ as is shown in the table , all of the ceramic capacitors prepared in this example had a dielectric constant of at least 1000 , temperature characteristic of the capacitance of 27 % or smaller , dielectric loss of 0 . 5 % or smaller and voltage dependency of the capacitance at an electric field of 1 kv / mm thickness of the dielectric ceramic body of 10 % or smaller . three kinds of ceramic capacitors were prepared in the same manner as in example 1 each with the formulation composed of strontium titanate , either one of 2 kinds of bismuth titanates , calcium titanate and lead titanate in the proportion as indicated in table 4 below as well as other necessary additive ingredients . the characteristics of these ceramic capacitors are also given in table 4 . table 4______________________________________ sample no . 10 11 12______________________________________compo - srtio . sub . 3 31 . 0 40 . 4 36 . 4sition , bi . sub . 2 o . sub . 3 . 2tio . sub . 2 26 % by bi . sub . 2 o . sub . 3 . 3tio . sub . 2 28 . 6 30weight catio . sub . 3 15 . 9 13 . 6 18 . 6 pbtio . sub . 3 24 . 5 20 15______________________________________pro - dielectric constant 1250 1800 1170perties temperature charac - teristic , % - 2 . 0 + 20 . 0 - 10 . 0 tan δ , % 0 . 1 0 . 2 0 . 1 voltage dependency , % - 1 . 8 - 4 . 4 - 0 . 8______________________________________ as is shown in the table , all of the ceramic capacitors prepared in this example had a dielectric constant of at least 1100 , temperature characteristic of the capacitance of 20 % or smaller , dielectric loss of 0 . 2 % or smaller and voltage dependency of the capacitance at an electric field of 1 kv / mm thickness of the dielectric ceramic body of 5 % or smaller .	2
in the accompanying drawing which forms a part of the specification and are to be read in conjunction therewith and in which like reference numerals are used to indicate like parts in the various views : fig1 is a side elevational view of a typical reciprocating chain drive mechanism in which the chain of the present invention is employed , the broken away portions indicating continuous chain length ; fig2 is a fragmentary side elevational view on an enlarged scale illustrating one of the disengaging links of the chain having reached one of the sprocket teeth ; fig3 is a fragmentary elevational view , partially in cross section , taken generally along line 3 -- 3 of fig2 in the direction of the arrows ; and fig4 is a perspective view on a still larger scale illustrating one of the disengaging links included in the chain . referring now to the drawing in detail , fig1 illustrates a typical reciprocating chain drive mechanism in which an endless chain 10 constructed according to the invention is employed . the chain drive mechanism includes a pair of sprockets 11 and 12 around which chain 10 is tightly trained . sprockets 11 and 12 are mounted on shafts 13 and 14 , respectively , and one of the shafts is normally rotatively driven by a motor or other means ( not shown ) in order to advance the chain . in the chain drive illustrated , shaft 14 is the driven shaft while shaft 13 and sprocket 11 are idlers . of course both shafts 13 and 14 could be driven shafts . in reciprocating chain drives , reversal controls , ( not shown ) are provided which operate conventionally to reverse the direction of rotation of shaft 14 periodically in order to reciprocate chain 10 back and forth . stop controls ( not shown ) are also provided to stop the movement of the chain completely . ordinarily , a second chain ( not shown ) parallel to chain 10 will be mounted on a second pair of sprockets ( also not shown ) which are mounted on shafts 13 and 14 at locations spaced to the side of sprockets 11 and 12 . reciprocating equipment ( not shown ) of any type such as a trolley , carriage , scraper , or the like is mounted to the two parallel chains , usually extending between the upper runs of the chains . this equipment will be driven back and forth in reciprocating motion between sprockets 11 and 12 as the reversal controls periodically reverse the direction of rotation of shaft 14 . each sprocket 11 and 12 is constructed conventionally with thin peripheral teeth 16 extending outwardly from the sprocket body . the teeth 16 act to engage the links of chain 10 in order to advance the chain as the sprockets rotate . referring now more particularly to the construction of chain 10 , a plurality of drive links 18 and connector bars 19 are connected end to end in alternative fashion , with a bar 19 between each pair of links 18 . as best illustrated in fig3 each link 18 comprises a pair of flat side plates 20 which are spaced apart in parallel relationship by a pair of pins 21 which extend between each pair of plates 20 near the opposite ends thereof . the spacing between plates 20 is slightly greater than the thickness of sprocket teeth 16 so that the teeth will fit between the side plates . each connector bar 19 is a flat plate member of lesser thickness than the distance between side plates 20 . each bar 19 is pivoted near its ends to the pins 21 of successive links 18 . the pivotal connection between links 18 and bars 19 permits chain 10 to flex as required about each pin 21 . the ends of each bar 19 fit between side plates 20 , and the sprocket teeth 16 act against the end portions of the bars 19 in order to advance the chain as sprockets 11 and 12 rotate . chain 10 further includes a pair of disengaging links which are designated by numeral 22 . as best shown in fig1 the links 22 are connected between selected pairs of connector bars 19 in place of the links 18 that would normally be at these locations in an ordinary chain construction . links 22 act to disengage the chain from sprockets 11 and 12 if they should reach the sprocket teeth , and the two links 22 are therefore spaced apart from one another half the entire length of the chain . the link 22 on the lower run of chain 10 is illustrated in detail in fig4 . a flat plate 23 forms one side of each link 22 . a channel shaped member 24 having flanges 25 on its ends is secured to plate 23 by a pair of the pins 21 . pins 21 extend between each flange 25 and the corresponding end of plate 23 to space the plate 23 from flanges 25 . the spacing between plate 23 and flanges 25 is equal to the spacing between the side plates 20 of the links 18 so that identical pins 21 may be used throughout the chain . the central portion of each member 24 is offset or recessed inwardly of flanges 25 . integral legs 26 extend toward plate 23 at right angles from the ends of flanges 25 , and a flat central web 27 extends along the surface of plate 23 between the ends of legs 26 . the web 27 of each member 24 is thus recessed inwardly of flanges 25 . a flat plate 28 is welded in the recess area of each member 24 at an inclined angle . in the link 22 shown in fig4 which is the link on the lower run of chain 10 , plate 28 is welded to legs 26 at its side edges and to the upper edge of web 27 at its upper edge . as plate 28 extends downwardly , it also extends outwardly or away from web 27 at an inclined angle . the angle of inclination of plate 28 relative to web 27 is preferably in the range of from 20 ° to 40 ° for the most effective and reliable results . the link 22 on the upper run of chain 10 is constructed identically to the lower link 22 but is inverted from the orientation shown in fig4 for the lower link . in other words , the plate 28 on the upper link 22 extends outwardly or away from web 27 as it extends upwardly , as best shown in fig3 . one end of each pin 21 is preferably threaded , and a nut 29 ( fig4 ) is threaded onto this end of the pin to secure the components of each link 18 and 22 together and to attach the connector bars 19 to the links . the pins 21 of links 22 pivotally connect to the ends of bars 19 , with one end of the connector bar located between plate 23 and flange 25 . the central portion of each pin 21 is preferably reduced in diameter in a smooth manner as shown at 21a in fig4 in order to facilitate the pivoting of bar 19 . in use , chain 10 drives the reciprocating equipment ( not shown ) back and forth in response to the periodic reversal of the rotational direction of sprockets 11 and 12 . in fig1 the directional arrow indicates the direction of rotation of sprocket 12 , and it is noted that the two disengaging links 22 have not reached sprockets 11 and 12 . when the chain reaches the approximate position shown in fig1 the direction of rotation of sprocket 12 will ordinarily be reversed from that indicated by the directional arrow so that the upper run of chain 10 will begin moving to the right and the lower run of the chain will begin moving to the left . when the chain has moved in this direction to a position where the upper link 22 is near sprocket 12 and the lower link 22 is near sprocket 11 , the direction of rotation of sprocket 12 will again be reversed before either link 22 reaches either sprocket . in this manner , the equipment carried on chain 10 will reciprocate back and forth without either link 22 engaging a sprocket in normal operation . however , if the reversal or stop controls should malfunction and fail to reverse or stop the rotation of sprocket 12 as intended , the respective links 22 will come into engagement with the teeth 16 on sprockets 11 and 12 shortly after the ordinary extreme position of the chain has been passed . this is shown in fig2 where the upper run of the chain has moved excessively to the left due to failure of the reversal or stop controls . when this occurs , one of the sprocket teeth 16 initially engages the inclined plate 28 at a location approximately midway of the height of the plate . due to the inclined angle of plate 28 and the tension of chain 10 , the plate slides off of the tooth 16 in a camming manner until it has been diverted completely off to the side of the tooth , as best shown in fig3 . this has the effect of disengaging the entire chain from sprocket 11 since the following drive links 18 will follow the path of link 22 and pass to the side of the sproket teeth . as a result , chain 10 will not advance further , and the chain drive and the reciprocating equipment will not be subjected to damage despite the failure of the controls and the continued rotation of the sprocket . at the same time , the camming action of plate 28 on the lower link 22 against one of the teeth of sprocket 12 diverts the lower link 22 to the side of sprocket 12 and disengages the chain from this sprocket in the manner described above . accordingly , the chain will be stopped even if both sprockets continue to rotate . of course , if chain 10 should move excessively in the opposite direction , the upper link 22 will effect disengagement of the chain from sprocket 12 , and the lower link will disengage the chain from sprocket 11 . while the chain has been illustrated and described as having two disengaging links 22 , it is contemplated that in some cases only one link 22 will be included in the chain since this single link would eventually reach either sprocket 11 and 12 to disengage the chain therefrom in the event of a control malfunction . in addition , in cases where the sprockets are of different construction or size than the sprockets illustrated and have teeth that are spaced more closely together , it may be necessary or desirable to provide two or more of the disengaging links 22 as adjacent links of the chain so that the adjacent disengaging links 22 will be able to disengage the chain from adjacent sprocket teeth simultaneously . drive chains are commonly employed in various configurations such as being trained around a large number of sprockets or rollers that are mounted at various offset locations . this allows a single long chain to be used to drive equipment such as two or more scrapers in different work areas . the present invention contemplates this and is intended to include within its scope drive chains that are trained around any number of sprockets and / or rollers in any configuration . of course , the location and number of the disengaging links 22 that will be included in the chain will depend on the configuration of the chain and the number and location of the sprockets from which the chain is to be disengaged . from the foregoing , it will be seen that this invention is one well adapted to attain all the ends and objects hereinabove set forth together with other advantages which are obvious and which are inherent to the structure . it will be understood that certain features and subcombinations are of utility and may be employed without reference to other features and subcombinations . this is contemplated by and is within the scope of the claims . since many possible embodiments may be made of the invention without departing from the scope thereof , it is to be understood that all matter herein set forth or shown in the accompanying drawing is to be interpreted as illustrative and not in a limiting sense .	8
to a stirred solution of 514 mg . ( 1 . 0 mmole ) of the cephem benzhydryl ester 3 in 30 ml . of methanolmethylene chloride ( 1 : 1 ) was added 147 mg . ( 1 . 1 mmole ) of n - chlorosuccinimide ( ncs ) and the solution was stirred for 3 hours at room temperature . the reaction was diluted with 30 ml . of methylene chloride , washed with 5 % bicarbonate and two portions of 100 ml . of water . the organic layer was dried over magnesium sulfate , filtered and evaporated to dryness affording 546 mg . ( 100 %) of 4 as yellow foam , which was pure enough for further reactions . an analytical specimen was obtained , by recrystallizing from methylene chloride and n - pentane , as white prisms , m . p . 132 °- 133 ° c . anal . calc &# 39 ; d for c 30 h 28 n 2 o 6 s : c , 66 . 25 ; h , 5 . 15 ; n , 5 . 15 . found : c , 66 . 60 ; h , 5 . 30 ; n , 5 . 46 . nmr ( cdcl 3 ) δ2 . 1 ( s . 3h ), 3 . 45 ( s . 3h ), 4 . 56 ( s . 2h ), 5 . 15 ( d . j = 5 . 0 hz 1h ), 5 . 90 ( q , j = 5 . 0 , 12 hz , 1h ), 6 . 8 - 7 . 8 ( m . 16h ). to a cooled (- 20 ° c .) solution of 5 . 40 g . ( 10 . 0 mmole ) of the 2 - methoxycephem 4 in 80 ml . of dry methylene chloride was added dropwise a solution of 1 . 57 g . ( 22 . 0 mmole ) of chlorine in 15 ml . of carbon tetrachloride over a 10 minute period and the slightly yellow solution was allowed to stir at - 20 ° c . for 60 minutes under nitrogen . the reaction was poured into 120 ml . of ethyl acetate and shaken vigorously with 100 ml . of ice - cold water for 10 minutes . the organic layer was washed with brine , dried over magnesium sulfate , filtered and evaporated to dryness affording 5 . 9 g . ( quantitative yield ) of yellow oil which was a mixture of cis 5b and trans 5a ( α - chloro / β - chloro = 1 / 9 ). this oily material was chromatographed over 200 g . of silica gel and elution with 10 % ethyl acetate in methylene chloride giving 4 . 3 g . ( 75 %) of a pure mixture of 5a and 5b as a white foam . anal . calc &# 39 ; d for c 29 h 25 n 2 o 6 cl · h 2 o : c , 63 . 30 ; h , 4 . 92 ; n , 5 . 10 ; cl , 6 . 45 . found : c , 63 . 84 ; h , 4 . 64 ; n , 5 . 31 ; cl , 6 . 04 . nmr ( cdcl 3 ) of 5b δ2 . 2 ( s , 3h ), 4 . 62 ( s , 2h ), 5 . 70 ( q , j = 4 . 2 , 11 . 5 hz , 1h ), 6 . 3 ( d , j = 4 . 2 hz , 1h ), 6 . 8 - 7 . 5 ( m ) 10 . 0 ( s , 1h ). nmr ( cdcl 3 ) of 5a δ2 . 15 ( s , 3h ), 4 . 56 ( s , 2h ), 5 . 10 ( q , j = 1 . 2 , 10 hz , 1h ), 6 . 20 ( d , j = 1 . 2 hz , 1h ), 6 . 8 - 7 . 5 ( m ) 9 . 95 ( s , 1h ). to a cooled ( 0 ° c .) solution of 1 . 13 g ( 2 . 0 mmole ) of 5b and 5a ( 9 : 1 ) in 15 ml . of dry methylene chloride was added at once 487 mg . ( 2 . 5 mmole ) of silver fluoroborate and 800 mg . ( 2 . 5 mmole ) of silver oxide and stirred vigorously at 0 ° c . for 60 minutes under nitrogen . the reaction was filtered and the filtrate was treated with 10 ml . of brine . the mixture was filtered again through &# 34 ; celite &# 34 ; under suction . the organic layer was dried over magnesium sulfate , filtered and condensed to 5 ml . of volume which was then poured into 150 ml . of n - pentane to give 895 mg . ( 85 %) of 8 as a white powder . anal . calc &# 39 ; d for c 29 h 24 n 2 o 6 : c , 70 . 15 ; h , 4 . 87 ; n , 5 . 31 . found : c , 69 . 29 ; h , 5 . 09 ; n , 5 . 75 . nmr ( cdcl 3 ) δ2 . 15 ( s , 3h ), 4 . 75 ( s , 2h ), 5 . 40 ( d , j = 4 . 5hz , 1h ), 6 . 3 ( d , j = 4 . 5 hz , 1h ), 6 . 8 - 7 . 5 ( m , 15h ), 9 . 85 ( s , 1h ). to a cooled ( 0 ° c .) solution of 2 . 11 g . ( 4 . 0 mmole ) of 8 in 50 ml . of dry methylene chloride was bubbled hcl gas slowly for 2 minutes . no starting material was detected by tlc . the reaction was washed with ice - cold 5 % bicarbonate and dried over magnesium sulfate . the dried solvent was evaporated to dryness affording 2 . 2 g . ( almost quantitative yield ) of 5a as a slightly yellow foam . nmr of this material was identical with the minor component in the ring opening products of 2 - methoxycephem 4 by chlorine . to a cooled ( 0 ° c .) solution of 564 mg . ( 1 . 0 mmole ) of 5b and 5a ( 9 : 1 ) in 9 ml . of thf and 1 ml . of acetic acid was added 100 mg . ( 1 . 6 mmole ) of sodium cyanoborhydride ( nacnbh 3 ) and the mixture was stirred at 0 ° c . for 30 minutes under nitrogen . the reaction was poured into ice cold 50 ml . of ethyl acetate - 30 ml . of 5 % bicarbonate solution . the organic layer was then washed with brine , dried over magnesium sulfate and filtered . the filtrate was evaporated to a colorless oil which gave 510 mg . ( 91 %) of 9b and 9a ( ca 9 : 1 ) as amorphous solids upon trituration with n - pentane - ether ( 5 : 1 ). anal . calc &# 39 ; d for c 29 h 27 n 2 o 6 cl : c , 65 . 01 ; h , 5 . 05 ; n , 5 . 23 . found : c , 64 . 67 ; h , 4 . 69 ; n , 5 . 69 . ir ( kbr ) 3400 ( broad ), 1785 , 1730 , 1690 and 1530 cm - 1 . nmr ( cdcl 3 ) of 9b δ2 . 35 ( s , 3h ), 4 . 2 ( d , j = 12hz , 1h ), 4 . 4 ( d , j = 12hz , 1h ), 4 . 51 ( s , 2h ), 5 . 6 ( q , j = 3 . 9 , 9 . 5 hz , 1h ), 5 . 9 ( d , j = 3 . 9hz , 1h ), 6 . 7 - 7 . 5 ( m , 15h ). nmr ( cdcl 3 ) of 9a ( only following peaks could be observed in the spectrum of 9b and 9a mixture . δ2 . 34 ( s ), 5 . 0 ( q , j = 1 . 5 , 10hz ), 5 . 8 ( d , j = 1 . 5hz ).	8
the polymer backed non - slip products , of the present invention , may be prepared by girt coating preferably a polyvinyl chloride backer material with an inorganic mineral particles . the preferred polyvinyl chloride material may be any commercially available polyvinyl chloride , but preferably is sheeting or film , and should be preferably of a thickness which will enable sufficient structural integrity for handling , but which is also sufficiently flexible and pliable to be continuously fed through radiation curing equipment , e . g ., electron beam curing equipment , adapted to produce non - slip sheet products . the preferred polyvinyl chloride backing material , preferably sheet or film , is preferably about 10 mils or less in thickness , more preferably about 6 mils or less in thickness , although the present invention is not limited to applications wherein the polyvinyl chloride backing , or other backing material , is 10 mils or less in thickness . a variety of mineral particles may be employed which will provide adequate frictional contact in use to prevent , or aid in the prevention of , slippage or skidding . examples of suitable mineral particles are aluminum oxide and silicon carbide fumed silica and silica gel ; other mineral materials which are adaptable to radiation curing , in particular electron beam curing , may also be utilized . a maker and size coating comprising at least one resin system which is radiation curable , preferably electron beam curable , and provides a durable size coating for the intended use of the product is utilized . a maker coat is the resin coat onto which the particles are deposited . a size coat is the coat which is placed over the particles to aid in holding them onto the substrate during flexing and wear applications , usually in combination with some form of pressure or other applied physical force . a second size coat , sometimes referred to as an &# 34 ; over &# 34 ; or &# 34 ; super size &# 34 ; coat , may also be applied , if desired , although in many cases this is not necessary . the amount of the maker and size coats applied are whatever is sufficient to adequately hold and secure the to the polyvinyl chloride substrate , of the present invention , in subsequent use , i . e ., as a stand - alone product or by bonding and / or lamination to some other substrate , and in final application , e . g ., a floor or a floor mat surface , a hand tool grip or other non - slip applications , as are well known to those skilled in the art . the methods of applying the coatings of the present invention may be selected from those which are conventionally used with the electron beam curing methods of forming coated abrasive products . among typical methods , for examples , are knife coating , roll pressure coating , transfer roll coating and doctor blade coating . the preferred method of coating used for the present invention is pressure roll coating . the resin system is chosen to match , in its preferred electron beam cured form , certain physical properties of the preferred polyvinyl chloride backer . the properties of the systems which are deemed to be significant are those described above , i . e ., such as flexibility , stretchability , yield , tensile , elongation , deformability , rate of softening , melt point , corrosion resistance , durability , capability of securely bonding to both the mineral particles and the preferred polyvinyl chloride backer of the present invention and , of course , the capability of being readily radiation cured , preferably electron beam cured , as applied to a preferred polyvinyl chloride backer . it is quite important to ensure that the physical properties of the preferred electron beam cured resin system ( s ), bonded to both the preferred polyvinyl chloride backer and to the mineral particles , is ( are ) capable of being deformed and bonded and / or laminated , in unison with the preferred polyvinyl chloride backer of the present invention , to substrates , either of polyvinyl chloride material or otherwise . to ensure this , it is important that the flexibility of the resin system ( s ) is ( are ) generally complimentary to that of the backer material being used . a resin system ( or systems ) which is ( or are ) deemed complimentary , within the scope of the present invention , is one ( or more ) which produces a linear tensile strength , in the product of the present invention , which is at least as great as that of the backer used , and which reduces ( or reduce ) the elongation potential of the product of the present invention to no less than 25 % of that of the backer material , as such , which is being used , but in no case produces an elongation capability of less than 125 % of the original dimension of that product , in any given direction , on stretching , before tearing . in particular , in the preferred embodiment of the present invention , it is important that the resin system ( s ), in its ( their ) preferred electron beam cured form , is ( are ) capable of a bonding strength , in respect to both the preferred polyvinyl chloride backer and the mineral particles of the present invention , which is at least as great as the bonding and / of lamination strength between the preferred polyvinyl chloride backer of the present invention and the substrates to which that polyvinyl chloride substrate is to be bonded , as the case may be . the preferred resin system or systems to be used is ( are ) a unique combination of resin components , made from commercially available resins , with diluents and other components , which re notable for their ability to be blended together . more specifically , the resin system ( s ) preferably comprise a blend of two or more grades of urethane oligomers , both of which are polyester urethane acrylates , and these are further blended with a combination of ethoxyethoxyethyl acrylate and stabilized n - vinyl - 2 - pyrrolidone monomers , this latter combination being radiation curable and comprising a diluent . in addition , one or more surfactants , preferably containing fluorocarbon material , may be added as wetting agents . diluents are added to adjust the viscosity of the coating mixture , adjusting that viscosity , and the sag resistance of the resin system ( s ), to best suit the application method thereof , such as , e . g ., knife coating , roll pressure coating , transfer roll coating or doctor blade coating , techniques which are well known to those skilled in the art of making coated abrasive products . further , the diluents may be used to modify the radiation curing properties of the resin system ( s ) and the flexibility of both the radiation , e . g ., electron beam , cured resin system ( s ) and of the products of the present invention . among suitable diluents for the electron beam curable resins are the vinyl pyrrolidones and the multifunctional and mono - functional acrylates , including , but not limited to , n - vinyl - 2 - pyrrolidone ; 1 , 6 hexanediol diacrylate ; tetraethylene glycol diacrylate ; and trimethylolpropane triacrylate . the preferred diluent material is n - vinyl - 2 - pyrrolidone monomer , in a stabilized form . these materials , in addition to adjusting viscosity , tend to modify flexibility and reduce the energy level of the preferred electron beam radiation energy required for curing . the preferred product of the present invention , in the form of an electron beam cured coated abrasive with mineral particles on a polyvinyl chloride backer , may be readily co - extruded with a polyvinyl chloride compound , as normally used to form floor mating material , as that compound is being formed into floor matting ; the standard floor mating then acts as a substrate , having the same composition as the grit coated polyvinyl chloride backer . alternatively , the application of sufficient heat and pressure can be utilized to laminate the two together . once in a formed state the mineral particles should remain thoroughly secured in and to the stretched film . furthermore , the product is tough and flexible enough to offer good slip - resistance , skid - resistance and durability , in the form of wear - resistance , to heavy pedestrian traffic normally encountered in restaurants , kitchens , service stations , checkout counters and the like . the following example illustrates the preferred embodiment and best presently known mode of the present invention and is in no way intended to be limiting . it is understood that many other embodiments may be readily devised , by those skilled in the art , without departing from the spirit and scope of the present invention . two different grades of polyester urethane acrylate resin were used in forming the preferred resin system of the present invention , the first being uvithane ® uv - 782 nd the second being uvithane ® uv - 783 , both as supplied by morton thiokol , inc ., morton chemical division of moss point , miss ., u . s . a . the uv - 782 resin grade , having cas number 64060 - 30 - 6 . the uv - 783 resin grade , having cas number 64060 - 31 - 7 . both of these resin grades , in their respective shipping containers , were placed into and oven at 160 ° f . and held at that temperature for 24 hours to preheat them . concurrent with the latter period of the preheating of the two grades of polyester urethane acrylate resin , a mixing and blending kettle was preheated with hot water to 90 ° f ., in a manner , and using equipment , common to the coated abrasive manufacturing industry . initially added to the kettle , at 90 ° f ., was 192 lbs . of stabilized n - vinyl - 2 - pyrrolidone monomer , specifically v - pyrol ®/ rc as supplied by gaf corporation of new york , n . y ., u . s . a ., having cas number 88 - 12 - 0 , and containing at least 98 . 5 weight percent of c 6 h 16 o 4 . while holding the stabilized n - vinyl - 2 - pyrrolidone monomer in the kettle at 90 ° f ., 192 lbs . of ethoxyethoxyethyl acrylate was added , mixed , and blended into that n - vinyl - 2 - pyrrolidone monomer . specifically rc - 20 ethoxyethoxyethyl acrylate was used , being supplied by the same source as the uv 782 and uv 783 . the rc - 20 bears cas number 7328 - 17 - 8 and with essentially the formula c 6 h 16 o 4 . care was taken in adding the rc - 20 material to the v - pyrol ®/ rc in the kettle to ensure that the mix temperature did not drift below 85 ° f . after the rc - 20 and the v - pyrol ®/ rc were thoroughly mixed and blended together , and the temperature was stabilized at 90 ° f ., 450 lbs . of uv - 782 , at a temperature of 160 ° f ., were added , being mixed in and blended in such a manner that the kettle contents temperature did not exceed 95 ° f . then , likewise , 450 lbs . of uv - 783 , also at a temperature of 160 ° f ., were added , being mixed in and blended in such a manner that the kettle contents temperature did not exceed 95 ° f . finally . 3 lbs . of fluorocarbon surfactant , namely fc - 171 , were added in , mixed and blended , and the temperature of the batch in the kettle was stabilized at 90 ° f . the mixing and blending were accomplished using a variation of mixer speeds , as is quite common in the art , and the batch mixture was circulated into and out of the kettle to further assure fully mixed and blended uniformity and a stabilized uniform batch temperature , also as is quite common in the art . thus , the preferred resin system was formulated and prepared . in the example described herein , the preferred resin system was applied to the dull side of 6 mil thickness polyvinyl chloride film , 40 inches wide , weighing the equivalent of 13 . 7 lbs ./ ream , and processed through the electron beam curing equipment , in accord with the equipment and procedures specified in the above published references which have been specifically incorporated herein by reference , using a radiation energy range of 1 to 10 mrad , preferably 3 mrad ( used for the present example ), within a range of 250 to 325 kv , preferably at 285 kv ( used for the present example ), in an inerting atmosphere of nitrogen , having an oxygen content of less than 2000 ppm . the polyvinyl chloride film used in the present example was product no . 39 - 44 - 0001 - 00 - 4 , vinyl film , as supplied by rjf international corporation ( formerly the b . f . goodrich company , engineered products group ), akron , ohio ., u . s . a . the application of the resin , in the example , to the 6 mil thickness polyvinyl chloride film was accomplished by use of a standard transfer roll coating system for both the make and the size coats ; the make coat and size coat were both identical , being of the preferred resin system as described above . the weight of the electron beam cured end product of the example was the equivalent of 43 . 5 lbs ./ ream , ± 4 . 0 lbs ./ ream . the mineral particles used were standard aluminum oxide grits , having a standard grit size of 100 . the applied grit may be within the weight range of about 10 to 25 lbs ./ ream , and in the present example , comprised the overall preferred equivalent weight of 20 . 0 lbs ./ ream , ± 2 . 0 lbs ./ ream , while the overall weight of electron beam cured resin in the final product may be within the range of about 4 to 5 lbs ./ ream , and in the present example comprised the preferred equivalent of 10 . 5 lbs ./ ream , ± 1 . 0 lbs ./ ream . the amount applied is described above in terms of &# 34 ; lbs / ream &# 34 ; and this term is understood to refer to the pounds applied per ream of surface area . the &# 34 ; ream &# 34 ; used in the content of coated abrasives is understood to be a &# 34 ; sandpaper - markers reams &# 34 ;. it corresponds to the surface area of 480 9 × 11 inch sheets . the finished non - slip sheet product was bonded to an otherwise standard ribbed polyvinyl chloride floor mat material , as produced by rjf international corporation of akron , ohio , u . s . a . under the keroseal ® trademark , by co - extrusion during the otherwise normal production of that floor mat material . the bonded floor mat material exhibited excellent bonding between the coated abrasive product of the present invention and the floor mat material , without use of any separate bonding agents or adhesives . the finished product of the instant example was tested for tensile strength and elongation by an instron ® tensile tester , using a sample size of 1 &# 34 ;× 8 &# 34 ; with a 6 &# 34 ; gauge length , a cross - head speed of 1 &# 34 ; per minute and a chart speed of 1 / 2 &# 34 ; per minute ( full chart scale = 20 lbs .). the results of those substantially all of the abrasive particles remained firmly bonded to the test pieces after being subjected to the foregoing tensile and elongation tests . as a general proposition for the products of the present invention , the tensile strength , in lbs ./ linear inch , should be at least as great as that exhibited by the particular backer material used , as measured in its uncoated state . also , as a general proposition for the non - slip product of the present invention , the elongation , in inches , should not be less than 25 % of that which is exhibited by the particular backer material used , as measured in its uncoated state , however , at the same time , the product of the present invention should be capable of being linearly stretched ( elongated ), in any given direction , to a dimension which is at least 110 % of the original unstretched ( unelongated ) dimension , in that same direction , before tearing occurs . observation has indicated that the limitations of the foregoing general propositions are necessary to ensure the desired physical properties , in particular , flexibility , as discussed above , of the non - slip sheet product of the present invention . because the sheet material of the invention is thermoformable , the thermal softening and decomposition temperatures of the backing and the radiation curable urethane polymer used to bond the abrasive particles to the backing should be such as to permit thermoforming of the finished sheet product and lamination to a desired substrate . the preferred embodiment of the product of the present invention has been carefully examined in comparison to the virgin 6 mil thick polyvinyl chloride sheet on which it is preferably formed , and both were noted to exhibit the desired physical properties as set forth and discussed above . in use , the preferred embodiment of the coated abrasive product of the present invention , as bonded to a standard ribbed polyvinyl chloride floor mat material , appears to exhibit good wear characteristics as well as providing relatively outstanding resistance to slipping and skidding . while the invention has been described with specific embodiments , there are modifications that may be made without departing from the spirit of the invention . the scope of the invention is not to be limited by specific illustrations or by the preferred embodiment and best mode , but is defined by the claims .	8
the present invention consists of a sanding wheel 21 which utilizes a removable and replaceable contoured abrasive strip 31 positioned thereon to facilitate use with workpieces requiring different contours . fig1 is a perspective view showing the sanding wheel 21 in position on a processing machine 10 . the processing machine 10 includes a set of rollers 12 designed to hold a workpiece 11 in proper orientation as it moves along the path indicated by arrow f . the sanding wheel 21 is mounted on motor 20 so that sanding wheel 21 turns when motor 20 is operated . during operation , a movable support 17 upon which motor 20 is positioned pivots on hinge 15 and is adjusted by adjustment means 18 , which in this embodiment consists of a screw or other adjustment means . with proper use of adjustment means 18 , the angular position of sanding wheel 21 with respect to workpiece 11 may be adjusted as indicated by arrow b to precisely orient sanding wheel 21 to workpiece 11 as desired . sanding wheel 21 is raised and lowered by adjustment of slidable support 16 , to which movable support 17 is attached , up and down on track 14 as indicated by arrow a . lateral movement of sanding wheel 21 is achieved by means of a slide arrangement which allows motor 20 to slide laterally along movable support 17 as indicated by arrow c . fig1 a and 1b of the drawings show the structure of the tracks utilized in raising and lowering and laterally moving sanding wheel 21 . fig1 a , which is taken along line 1a of fig1 shows the structure utilized in raising and lowering sanding wheel 21 . specifically , track 14 has a slot 38 provided therein and a slidable support 16 which includes an extension 39 of substantially the same shape as slot 38 so that slidable support 16 is held in substantially rigid orientation with respect to track 14 . when slidable support 16 is set to the desired vertical position , a locking device such as screw 46 extending through threaded hole 50 in track 14 as shown and butting against extension 39 of slidable support 16 is tightened to hold slidable support 16 in position . fig1 b of the drawings shows the track arrangement utilized to allow lateral movement of sanding wheel 21 in the direction indicated by arrow c . movable support 17 includes a slot 44 positioned therein defining a track very similar to that shown in fig1 a . the motor 20 is mounted to a sliding block 43 by means of fastening means 41 and 42 . fastening means 41 and 42 consist of screws in this embodiment , but any other acceptable and reliable fastening means could be employed . sliding block 43 includes an extension 45 the shape of which is substantially the same as the shape of slot 44 in movable support 17 . as a result , motor 20 is held in a substantially rigid orientation with respect to movable support 17 . a locking device such as screw 47 extending through threaded hole 49 in movable support 17 and butting against extension 45 of sliding block 43 is provided to lock the lateral position of sanding wheel 21 once the desired position is achieved . fig2 of the drawings is a perspective view of sanding wheel 21 . the basic structure of sanding wheel 21 consists of a substantially cylindrically shaped body 48 having a top surface , a bottom surface and a cylindrical surface . a hole 22 is provided substantially concentrically positioned in body 48 to facilitate attachment to an armature or shaft . two substantially circumferential rings 23 and 24 are attached to body 48 at the top and bottom surfaces by fasteners such as screws 100 and 101 as shown . the circumferential rings 23 and 24 each have a small section removed to form slots 25 and 26 and shown . a slot 28 and plate 27 are provided in body 48 . the operation of slot 28 and plate 27 is disclosed more fully in fig3 of the drawings . during preparation of sanding wheel 21 for operation , a contoured abrasive strip 31 as shown in fig4 is slid through slots 25 and 26 into a slot formed between circumferential rings 23 and 24 and the cylindrical surface of body 48 along the path shown by arrow d . as the contoured abrasive strip 31 is pushed around the cylindrical surface of body 48 to approach plate 27 , it butts against plate 27 and is held in position by plate 27 during sanding operations . the operator can remove contoured abrasive strip 31 by depressing plate 27 and removing as indicated by arrow e . fig3 is a cross - sectional view of the sanding wheel 21 taken along lines 3 -- 3 of fig2 . a slot 28 is cut into the outer surface of body 48 to provide for the positioning of plate 27 therein . further , a hole 29 is provided within which a coil or other type of spring 30 is positioned so that force is exerted therefrom upon plate 27 to keep plate 27 in position to stop movement of contoured abrasive strip 31 with respect to body 48 during operation . plate 27 and spring 30 are shown with plate 27 pushed toward the center of body 48 as far as possible . with plate 27 released , it assumes the position shown as 27 &# 39 ;, but is prevented from moving farther by circumferential rings 23 and 24 . circumferential rings 23 and 24 are formed so that they provide a lip extending circumferentially about body 48 , thereby providing the slot into which contoured abrasive strip 31 is slid . fig4 of the drawings shows the structure of the contored abrasive strip 31 in greater detail . contoured abrasive strip 31 consists of a flat piece 32 with raised sections 33 extending outward therefrom and leaving slots 38 between raised sections 33 . slots 38 between raised sections 33 are important because , without them , sawdust , chips and other abrasive dust will build up during sanding of a workpiece . slots 38 prevent loading of the surface of contoured abrasive strip 31 by creating air turbulence and providing an avenue of escape for the abrasive dust so that sanding wheel 21 is self - cleaning , with less wear as a result . when wear does occur , contoured abrasive strip 31 is simply removed from sanding wheel 21 and replaced with a new strip . fig5 is a cross - sectional view of contoured abrasive strip 31 taken along lines 5 -- 5 of fig4 . contoured abrasive strip 31 is constructed of a single sheet of plastic or other formable material , together with abrasive material such as sandpaper . when the sheet of plastic from which contoured abrasive strip 31 is constructed is formed , it results in a base 32 with raised sections 33 as shown . the top surface 34 may be shaped to any desired contour to match the contour of a piece of molding or other material to be sanded . abrasive material 36 is cut to match the size and shape of the top surface area 34 of raised sections 33 and is attached thereto by adhesive 35 . the resulting contoured surface of abrasive material 36 matches the contoured surface of workpiece 11 . fig6 is a cross - sectional view of contoured abrasive strip 31 of fig4 taken along lines 5 -- 5 of fig4 and showing an alternative contoured surface which may be utilized . the top surface of raised section 33 is designated 37 , but all other numbers remain as in fig5 . the contoured abrasive strip 31 may be vacuum - formed and , whether the contour of the surface of abrasive material 36 is concave , as shown in fig5 or convex , as shown in fig6 the contoured abrasive strip 31 works equally well . the key to the operation of contoured abrasive strip 31 and its usefulness is that contoured abrasive strip 31 may be produced inexpensively with extreme accuracy , and may be removed and replaced as desired , depending upon the needs of an operator of sanding wheel 21 . because plastic and / or other formable and somewhat flexible material is utilized in constructing the contoured abrasive strip 31 , a certain degree of flexibility is inherent in the strip ; this results in less likelihood of damage to the sanding wheel 21 , contoured abrasive strip 31 and the workpiece 11 being sanded . while the foregoing description of the invention has shown a preferred embodiment using specific terms , such description is presented for illustrative purposes only . it is applicant &# 39 ; s intention that changes and variations may be made without departure from the spirit or scope of the following claims , and this disclosure is not intended to limit applicant &# 39 ; s protection in any way .	1
fig1 illustrates an embodiment of the tire inflation system 10 for a trailer axle on a trailer 13 . the rotary air chamber 28 of a tire inflation system 10 is shown affixed to a hub cap 24 of a tire 11 . two pressure gauges 32 indicate the current pressure for both the outermost tire 11 and the tire behind it . the tire inflation system 10 maintains the tire 11 pressure between adjustable predetermined values . typically , the operating air pressure for tires 11 on a trailer 13 is maintained between 100 and 110 psi . for situations where the trailer 13 load requires different air pressures in the tires 11 , the lower and upper values of the desired tire 11 air pressure range can be adjusted . an embodiment of the tire inflation system 10 is shown in fig2 . a rotary air chamber 28 is fastened to a bracket 26 . the bracket 26 is fastened to a hub cap 24 . the hub cap 24 is fastened to the rim or wheel ( not shown ). an air shaft 40 extends from the axle 20 through the hub cap 24 , the bracket 26 and into the rotary air chamber 28 . high speed bearings 38 are affixed between the air shaft 40 and the hub cap 24 . the air shaft 40 is inserted into the axle 20 via an axle plug 22 , so that the air shaft 40 remains stationary , thus allowing air to flow through the passage while the wheel and the hub cap 24 rotate . as discussed further below , the rotary air chamber 28 also contains high speed bearings between the rotary chamber 28 and the air shaft 40 . two pressure gauges 32 allow visual inspection of the operating air pressure in the tires . fittings 42 on either end of the rotary air chamber 28 allow for connection to tires 11 ( see fig1 ) through air hoses 44 . two pressure relief valves 30 will release air pressure from the respective tire 11 when the tire 11 air pressure exceeds a preset upper limit . as a non - limiting example , the tire 11 air pressure could exceed the preset upper limit during hot weather . this preset upper limit may be adjusted to accommodate changing load and temperature conditions . air pressure flows to the tire 11 from a pressurized air tank 12 through an air line 18 . a shut off valve 14 and an air pressure regulator 16 are inserted into the air line 18 between the air tank 12 and the axle 20 . the pressurized air tank 12 is typically available to service air brakes and other similar equipment on the tractor and / or trailer . the air pressure regulator 16 sets the desired pressure for the tire inflation system 10 independently of other air pressure systems that may be present . as a non - limiting example , if it is desired to operate the tires 11 at 100 psi , then the air pressure regulator 16 is set for 100 psi . air pressure will then flow through the air line 18 at 100 psi . the air line 18 extends through the axle 20 and continues to the air shaft 40 . the air shaft 40 extends through the hub cap 24 and the bracket 26 and into the rotary air chamber 28 . of course , the air line 18 may extend in both directions to air shafts 40 at both ends of the axle 20 . it should be noted that the shut off valve 14 and the air pressure regulator 16 could be operated manually or remotely . additionally , the shut off valve 14 and the air pressure regulator 16 could be operated automatically or could even be computer controlled . the air flow for the tire inflation system 10 operates on a positive pressure if small leaks occur in a tire 11 as , in a non - limiting example , when a bolt or nail becomes stuck in the tire 11 . the tire inflation system 10 will increase flow rate to maintain the predetermined tire pressure . again , the predetermined air pressure may be changed by adjusting the air pressure regulator 16 . an alternative embodiment of the tire inflation system 10 would allow for adding a coolant such as nitrogen to the pressurized air . a coolant could be added to the pressurized air by , for example but not limited to , providing a fixed bleed into the air line 18 . further details of the tire inflation system 10 are illustrated in fig3 . as noted above , the air line 18 extends through the axle 20 and continues to the air shaft 40 . the air shaft 40 extends through the hub cap 24 , the bracket 26 and into the rotary air chamber 28 . high speed bearings 38 are affixed between the air shaft 40 and the hub cap 24 . additionally , the rotary air chamber 28 has high speed bearings 34 affixed between the inside of the rotary air chamber 28 and the air shaft 40 . thus , the air shaft 40 remains stationary while the hub cap 24 , the bracket 26 and the rotary air chamber 28 rotate with the wheel and tire 11 . air flows through the air line 18 into an air chamber 35 inside the rotary air chamber 28 . a high pressure air seal 36 is affixed between the air line 18 and the air chamber 35 . pressure relief valves 30 operate to release air pressure from the tires 11 when the tire 11 air pressure exceeds an adjustable predetermined value . the predetermined value may be set for an appropriate maximum tire 11 air pressure dependent upon weather and / or load conditions . check valves 41 operate to cause air to flow into the tires 11 when the tire 11 air pressure drops below the desired pressure as set by the air pressure regulator 16 . additionally , the check valves 41 operate to prevent loss of pressure in one tire 11 in the event of a catastrophic failure of the other tire , as in for example a blow - out . if the check valve 41 detects an increased air flow rate , it will close off air flow through the check valve 41 . the check valve 41 will prevent air from flowing back into the air chamber 35 from the still operable tire 11 in an attempt to equalize the pressure with the failed tire . the rotary air chamber 28 prevents trailer tires from loosing air pressure due to “ non air back flow technology .” the rotary air chamber 28 causes air transfer to each tire 11 as needed . as the tire 11 air pressure increases to unsafe levels , air is released via the relief valves 30 . a pressure gauge 32 corresponds to each tire and the rotary air chamber 28 is equipped with a non flow - back check valve 41 , which also prevents air flow from one tire to another due to catastrophic failure of a tire . the rotary air chamber 28 also includes auxiliary inlet air fill valves ( not shown ) through which nitrogen or other coolants can be introduced if desired . arrows representing air flow 15 in fig4 illustrate the passage of air through the tire inflation system 10 . air flows from the air tank 12 through the air line 18 . typically a shut off valve 14 and an air pressure regulator 16 are present in the air line 18 between the air tank 12 and the axle 20 . air flow 15 continues through the air line 18 to the end of the axle 20 , and then continues through the air shaft 40 and into the rotary air chamber 28 . air hoses 44 are connected to the fittings 42 on either end of the rotary air chamber and air flow 15 continues through the air hoses 44 to the tires 11 . an alternative embodiment of the tire inflation system 15 allows the rotary air chamber 28 to be secured directly to the hub cap 24 as shown in fig5 . the intervening bracket is not used in this embodiment . aside from the bracket not being present the tire inflation system 15 operates as in previous embodiments . as noted above , the air line 18 extends through the axle 20 and continues to the air shaft 40 . the air shaft 40 extends through the hub cap 24 and into the rotary air chamber 28 . the high speed bearings 34 ( not shown in fig4 , see fig3 ) are affixed between the inside of rotary air chamber 28 and the air shaft 40 , such that the air shaft 40 , which is secured to the axle 20 via an axle plug 22 , remains stationary while the hub cap 24 and the rotary air chamber 28 rotate with the wheel and tire 11 . pressure relief valves 30 operate to release air pressure from the tires 11 when the tire 11 air pressure exceeds an adjustable predetermined value . the predetermined value may be set for an appropriate maximum tire 11 air pressure dependent upon weather and / or load conditions . check valves 41 ( not shown , see fig3 ) operate to cause air to flow into the tires 11 when the tire 11 air pressure drops below the desired pressure as set by the air pressure regulator 16 . as above , the check valves 41 operate to prevent loss of pressure in one tire 11 in the event of a catastrophic failure of the other tire , as in for example a blow - out . the check valve 41 and air seal 36 prevent air from flowing back into the air chamber 35 ( not shown , see fig3 ) of the rotary air chamber 28 from the still operable tire 11 in an attempt to equalize the pressure with the failed tire . it should be noted that the pressure gauges 32 , as shown in fig2 , fig3 , fig4 and fig5 could include sensors and / or transmitters equipped to indicate the air pressure in tire 11 . the transmitter could send tire 11 air pressure to a monitoring system in a vehicle or to other wireless connection points and could thus provide air pressure measurements to the monitoring system . in this way the driver could monitor the tire 11 air pressure from inside the vehicle . fig6 shows a flowchart 50 illustrating the operation of the tire inflation system 10 . step 54 shows that the air flows through an air line , through the axle , and into a rotary air chamber secured to a hub cap . the tire inflation system continuously monitors the tire air pressure as in step 56 . if the air pressure is below a predetermined minimum value , air is injected into the tire in step 58 . the tire inflation system also continuously monitors the tire air pressure as in step 60 . if the air pressure is above a predetermined maximum value , air is released from the tires in step 62 . the nature of steps 56 and 60 is such that the order of the steps may be switched or occur simultaneously . it should be emphasized that the above - described embodiments are merely examples of the disclosed system and method . many variations and modifications may be made to the above - described embodiments . all such modifications and variations are intended to be included herein within the scope of this disclosure .	1
fig1 illustrates the hardware configuration for one 62 user system hardware set , e . g ., basic single base station system configuration . each hardware set is comprised of one base station 10 and up to 62 handsets 11 - 1 , 11 - 2 . . . 11 - n with cradle . the system defines a star network configuration with the base station as the center of the star . the base station 10 contains one transceiver 12 for each individual user handset in the operating system . polarization diversity is provided in the system by using dual cross polarized antennas 11a1 and 11a2 in each handset . a single antenna 13 is used in the base station 10 . only one antenna is required because the communication channel is symmetrical with respect to direction , to and from the base station , so that dual cross - polarized antennas at the handset are sufficient to provide diversity in the system . transceivers 12 are coupled by up / down converter and distribution amplifiers 14 to antenna 13 and served by a common reference oscillator 15 clock , logic 16 and telephone system ( telco ) interface 17 . the handset hardware configuration is shown in fig2 . the handset cradle 18 serves two purposes . it provides a place to physically store the handset 19 when not in use , and it provides a charging capability to replenish the charge on the handset batteries as required . red and green alarm lights 20 are provided on the handset 19 . these lights 20 serve to indicate the adequacy of the physical location of the cradle . if the received signal strength is adequate , a green light will illuminate . if the received signal strength is not adequate a red light will illuminate and the handset 19 can be moved a few inches . since the handset contains polarization diversity , the need to relocate the cradle location will almost never occur . the primary purpose of the system in this embodiment is to provide voice traffic capability to the potentially mobile user community . in order to provide this capability , a telephone system ( telco ) support and interface capability is provided . this telco support functions consists of 1 ) call establishment operations support , 2 ) user information data base support and update , 3 ) multicall programming operations capability , and 4 ) peripheral support functions . this comprises interfacing with the telco , providing and interpreting all signaling operations required to establish both incoming and outgoing calls . this includes such things as dialing , a busy signal , and a phone ringing operation . all these functions are handled by the order wire ( ow ) channel and described in later herein . a typical multiple base station system configuration is illustrated in fig3 . a system of n base stations bs # 1 . . . bs # n each with 62 voice traffic channel capability is shown . also shown is that each base station may be required to support up to 128 ( not all in use at once ) users ( hs # 1 . . . hs # 128 ) part time . for these assumed conditions the telco ( this telco unit is sometimes referred to as a mobile telecommunications switching office ( mtso ) base station system must have the capability to recognize and properly route calls to 128n different phone numbers ( different users ). this establishes that there are a minimum of four pieces of data required for each user as follows : 1 ) a serial number unique to a particular handset . this is a fixed , manufacturer assigned number and identifies the handset as an authorized system user . 2 ) an identification number identifies a handset as one of the 128 members of a particular user community associated with a base station . this is a number arbitrarily assigned by the base station when a handset becomes a member of its user community . 3 ) a channel number identifies one of the 62 voice traffic channels which are assigned for use arbitrarily each time a call is established . 4 ) the set of phone numbers are the phone numbers assigned uniquely by the telco to the set of system users . a number of operations such as &# 34 ; three - way calling &# 34 ; and &# 34 ; call waiting &# 34 ; require the processing of multiple calls simultaneously while a call is in process . this demands the existence of a two - way control channel within the voice traffic channel . such a control channel is provided and is described later . there are also a number of support , or convenience , functions which may be provided . these are functions which are not critical to the basic system but which make the telephone more convenient to the user . this includes such things as &# 34 ; speed calling &# 34 ; or speed dialing , which permits the dialing of frequently called numbers by pushing only two buttons on the handset . so long as users are confined to operate through only one particular base station , operations are well defined and the equipment need concern itself only with maintaining signal timing and appropriate transmitter power level . if the system is defined to consist of many base stations over an extended geographical area , or covering multiple floors in a multi - floor building , the user must be able to roam , or execute a handover operation from one base station to another . thus , in a multiple base station system it is assumed that any user can roam from the cell area serviced by his original base station to the cell area covered by any other compatible base station . the importance of a cell pattern is threefold : 1 ) it defines a minimum range between two cells sharing the same frequency thereby defining co - channel interference effects , 2 ) it can define the exclusive neighbors of any given cell thereby reducing the search time for a new cell when attempting a roaming / handover operation , and 3 ) it defines whether a multifloor building can be serviced without suffering significant interference between like cells on adjacent floors . a twelve pattern is very desirable for all these reasons . a hexagonal 12 cell pattern has six uniquely defined neighbors per cell and provides a 6 cell radii separation between like cells . for multifloor operation , this provides 3 cell radii separation plus the attenuation between floors . for indoor operation it is likely that a square pattern may be used since a square , or rectangular , pattern may lend itself better for use within a building . as a user roams about his cell , he will at times reach the boundary of good coverage . as the handset realizes it is reaching the limits of its operating range , it will identify the cell area he is about to enter . the handset will constantly search for signals from other adjacent user groups which are members of the total system but outside his present cell . this will be done by searching for other ow signals than the ow of his own cell group . in order to minimize the search time and minimize the likelihood of losing the presently in use voice channel before he can establish a new one with the next base station , a handset maintains a data base defining relative timing between all adjacent base stations . the details of this operation are presented later . once the ow of the &# 34 ; next &# 34 ; cell is contacted , the handset must now require admission to the cell as a new user . if admitted , the handset is assigned an identification number as an authorized user of the group . at this time all pertinent data on the handset , i . e ., handset serial number , identification number , and telephone number must be relayed to and stored in the base station database . the local telco data base must also be updated so that it knows where , i . e ., to which base station , to direct calls intended for that particular telephone number . if a call is in progress , handover now involves the local telco intimately . the local telco must now not only have its data base updated , it must re - route a call in progress from one base station to another in real time . the system is limited by fcc rule to operating with no more than 1 watt ( 30 dbm ) transmitted power from either the handout or the base station . based on this , the base station is clearly the limiting factor . however , according to the invention , a very viable system can be set up while satisfying the 1 watt total maximum power limitation . in general when servicing a densely populated user community high capacity base stations capable of servicing a large number of users can be employed and will operate over a relatively short range . alternately , when servicing a sparsely populated user community , lower capacity base stations capable of servicing a smaller number of users can be utilized operating over a greater communication range . each base station incorporates a fixed reference signal level against which all estimates of received handset signal levels are compared . on the basis of these comparisons , the transmit power bias term in each handset is adjusted as described later . the power control system can maintain the power received at the base station from each handset to within an accuracy of about 1 db without the need for agc circuitry in the base station . the base station transmit power level is held fixed at the maximum power setting . as a handset is transported throughout the cell , its received signal level will vary over a maximum dynamic range of about 90 db . in order to maintain the input voltage to the main signal path analog - to - digital converter in the user unit at nominally half of full scale , and thereby avoid clipping and loss - of - resolution problems , an agc function is implemented prior to the analog - to - digital . the system rf frequency plan for the disclosed embodiment is illustrated in fig4 . the fcc rule 15 . 247 band intended for this type of application extends from 902 mhz to 928 mhz , providing a 26 mhz total system bandwidth . each subgroup signal is allocated a 1 . 0833 mhz bandwidth such that a total of 24 subgroups can be accommodated . the frequency spacing between adjacent subgroup carrier frequencies is set to 1 . 0833 mhz . the 3 db bandwidth of each subgroup signal is set to approximately 1 mhz , or about 80 % of the signal spectrum central lobe bandwidth . in order to minimize adjacent channel interference , two adjacent subgroup channels will not be assigned to any given base station . only alternate subgroups will be assigned for operation within a given base station . fig4 b shows a typical subgroup assignment for a four subgroup system . the advantage of using only alternate subgroup bands within a given system , or cell , is that it permits realization of a significant excess attenuation on possible adjacent channel and co - channel interference signals . the system provides the feature that different pn sequences may be used in different cells . the use of different pn sequences in like cells minimizes co - channel interference . different pn sequences would be used in like cells when a given cell configuration forces like cells to be placed closer to each other than desired . antenna polarization diversity at the user handset is selected , in the preferred embodiment , as the most effective method to reduce multipath fading . implementation of polarization diversity at the handset requires two antennas at the handset and a single switch to select between them . channel sounding is performed in order to select the best antenna , in each 10 ms time subframe . studies conducted indicate that polarization diversity provides an improvement in signal reception capability as good as or better than any other diversity technique . the use of polarization diversity does not impact system capacity as some techniques do and , the additional hardware complexity required to add polarization diversity is minimal . the system implements the use of dual cross polarized antennas at the handset . a typical handset antenna configuration is illustrated in fig5 . the antenna configurations shown in fig5 makes use of a whip 11a1 and an alford loop 11a2 . separation of whip 11a1 and loop 11a2 may compromise polarization diversity performance but will then provide spatial diversity . in the preferred embodiment , the loop should be approximately 3 inches square to have the same sensitivity as whip antenna 11a1 . the base station antenna pattern should be appropriate to the area to be served . if the base station is located in the center of the service area its pattern should be omnidirectional in the horizontal plane . in most cases , the user will be distributed over a narrow vertical span and the base station antenna can have a narrow vertical pattern . such patterns are ordinarily obtained by the use of vertical linear arrays . a convenient element for such an array is the lindenblad radiator invented in 1936 for use at 120 mhz . it is an assembly of four dipoles spaced around a center support post ; tilted at 45 degrees , and fed in phase . this antenna provides a circular polarized wave . an array of these elements can easily be assembled to narrow the vertical pattern , with a practical limit imposed by the space available for mounting . this assembly has been used commercially . the advantage of the lindenblad design is that it is simple and very tolerant of implementation variations . it has been used in many applications up to frequencies in x - band . in constructing the array due attention must be given to the mutual impedance between array elements . the practical limit for array gain is somewhere around 10 db where the 3 db beam width becomes about 20 degrees . in the event the user distribution is wide in the vertical direction -- as for several floors in a tall building , a less directive antenna would be desired . then a single element or short array would be preferred . when two handsets operating in two mutually adjacent cells ( served by different base stations ) find themselves near each other and at the cell boundary , an adjacent channel interference ( aci ) ratio of i / s = 80 db or more can result . if the two cell systems are not synchronized , and if one handset is transmitting while the other is receiving , operations at both handsets will be disrupted . this can be avoided by making adjacent base stations mutually synchronous to an accuracy of ± 8 μs . this is so because there is a 16 . 6 μs minimum gap time between successive receive / transmit time intervals in each subframe . the preferred timing approach in this disclosed embodiment is to provide input from a precision timing source to a central site ( one of the base stations ( fig3 ) is designated to be master base station ). this timing signal can then be distributed to a constellation of base stations along with the other telco interface lines . this approach applies to both indoor and outdoor base station systems . in an indoor system there would be one master base station or central site . in an outdoor system there could be many depending on the extent of the system and its configuration . synchronization for a limited system , for example , a system intended to service one building , is not a problem . one base station can be designated as the master station and it would distribute timing to all other base stations . the timing signal can be distributed along with the telco interface wiring . alternatively , the gps , local telephone company central office time source , etc . can be used . in this embodiment of the invention , the signal structure for the system is predicated on two underlying objectives : ( 1 ) to operate synchronously with 20 - msec frames of a 16 kbps voice encoder / decoder , and accordingly , the preferred signal structure is a sequence of 10 - msec subframes , as shown in fig6 each consisting of four distinct periods , two for inbound and two for outbound signalling , and each being one of 64 subframes composing a 640 - msec frame as shown in fig7 . the inbound signals are spread with a different pn code than the outbound signals but with the same code length and chipping rate . the voice channel data consists of 16 kbps bidirectional digital voice , plus a 400 bps bidirectional control link . the data modulation is differentially encoded qpsk , transmitted at a burst rate of 20 . 72 kps . the data signal is bi - phase modulated with a spreading code at 32 times the burst symbol rate ( 663 khz ). the spreading code is the modulo - 2 sum of a length - 255 pn sequence and a length - 32 rademacher - walsh ( r - w ) function . the all - ones r - w function is used as an order - wire channel within each 32 - channel subgroup ; the remaining 31 functions are each associated with a different voice channel in that subgroup . from the perspective of a handset already associated with a particular base station , the four time periods within each subframe may be viewed as follows : throughout this discussion , the term &# 34 ; symbol &# 34 ; is used to mean &# 34 ; voice channel symbol duration &# 34 ;, i . e ., 32 chip times , even when the activity is on the order wire channel . the term &# 34 ; voice channel &# 34 ; means one frequency channel and non - unity rademacher - walsh code combination . ( 1 ) ( sound ) the base station transmits a 121 / 4 symbol allones sounding pattern ( i . e ., no data transitions ) on each order wire channel , at a level 15 db higher than for individual bs → hs voice channels ; each handset receives the first six symbols on one antenna a1 , switches to the other antenna a2 during the next 1 / 8 symbol , receives the next six symbols on a2 , compares the power between a1 and a2 , chooses the antenna with the higher power , and switches to that antenna during the next 1 / 8 symbol . the power level from the chosen antenna is used by the handset to determine transmit power during the following hs sync and hs → bs portions of the signal , and also as a code sync error measure to be input to its delay lock code tracking loop . ( 2 ) ( bs → hs ) on each active voice channel , the base station transmits a voice data burst of 91 qpsk symbols , followed by a guard time of 11 chips . the handset receives this data on the antenna selected during the sounding period . the voice channel data is constructed as follows : ( 3 ) ( hs sync ) on an automatic cyclic time division multiple access ( tdma ) basis , one member handset in each 64 member subcommunity ( i . e ., one per order wire channel ) transmits a continuous all - ones ranging signal ( i . e ., no data transitions but pn chip transitions ) to the base station on its associated order wire channel for a duration of 121 / 8 symbols , followed by a 1 / 8 - symbol guard time . the base station order wire channel performs a delay lock loop error measurement on this signal , and prepares and queues a timing correction command , if required , to be sent to that handset at the next opportunity . each transmitting handset transmits using the antenna it selected during the sounding period , at a power level determined from the power ( 4 ) ( hs → bs ) on each active voice channel , the handset transmits a voice data burst of 91 symbols , followed by a guard time of 11 chips , on the antenna selected during the sounding period . this inbound burst is of the same format as the bs → hs burst of period ( 2 ). thus the time - division duplex signal is symmetrical , with respect to format and content , its inbound and outbound portions being essentially identical to each other , of the total time available , 77 . 2 % is used for voice data , 10 . 6 % for related overhead and spare capacity , 5 . 8 % for channel sounding , 5 . 8 % for handset timing synchronization , and 0 . 6 % for various switching and guard times . 1 ) one dedicated bidirectional order wire channel ( for link control ) for each 31 voice channels . 2 ) no voice channel activity during sounding burst ( at 15 db higher than individual voice channels , allows very accurate measurements of received power , time offset , and frequency offset . 3 ) dedicated handset sync per channel allows accurate measurement of handset power and time offset with no interference due to timing errors in other channels . 4 ) bidirectional 400 bps control link incorporated into each voice channel ( for handset power and timing control , as well as link control ). the order wire channel signal structure is shown in fig8 . four periods of the overall time - division duplex structure are superimposed on an order wire signal structure consisting of ( in each direction ) two ow symbol periods followed by ten actual ow symbols plus a 7 voice channel symbol frame sync / parity check signal and a 31 - chip guard time . each half subframe is exactly 13 ow symbol periods in duration . the order wire signal structure has been designed so as to maximize signal search effectiveness , i . e ., to minimize expected search times . each ow symbol period = 255 pn chips = one pn code sequence length , thus by taking energy measurements over one ow symbol period , we are integrating over one pn code sequence length and taking full advantage of the pn code &# 39 ; s autocorrelation properties . also , the choice of an exact integer number of pn sequence lengths per half subframe both 1 ) greatly simplifies the pn coder design and the search algorithm , and 2 ) is critical to avoiding code phase ambiguities which would increase typical and worst - case initial search times by more than ten fold . during the two sounding periods , the switching times allotted at the end of each , and the reference phase period ( i . e . for a total of ( 192 + 4 ) * 2 + 118 = 510 chips = 2 ow symbol periods ), the base station is transmitting a continuous ( spread ) tone corresponding to an all - ones data modulation ( i . e . no , data transitions ). the next 10 ow symbols contain order wire data , as described below . the outbound order wire channel frame sync field contains 7 voice channel symbols ( 14 bits ) organized as 6 bits parity check on the 20 ow bits , 6 bits subframe number within frame ( 0 - 63 ), and 2 bits parity check on the subframe number . thus 12 / 13 = 92 . 3 % of the base station order wire channel transmit lime ( i . e ., 46 . 1 % of the total time ) is available to handsets for signal acquisition purposes . the inbound order wire signal format consists of two segments . during the first , on a cyclic basis , one handset out of each community of 64 transmits a continuous ( spread ) tone corresponding to an all - ones data modulation ( i . e . no data transitions ), for a duration of 388 chips , for the purpose of allowing the base station to measure that handset &# 39 ; s transmit code synchronization , power , and quality during a period wherein there is guaranteed to be no interference from other handsets on the same channel . four chips guard time later , if the current order wire time slot is assigned , the handset assigned to this slot transmits first a 118 - chip phase reference symbol , then 10 ow symbols , and finally a 7 - voice - channel - symbol ( 14 - bit ) field containing a parity check of the 20 order wire bits ; the last 31 chips of the inbound order wire signal segment are merely guard time . if the current order wire time slot is not assigned , it may be accessed by roaming handsets seeking membership in a new base station community , or by handsets which have just been switched from standby to active mode and are seeking a voice channel assignment . the signal structure for such accesses is identical to that for assigned accesses . each outbound order wire burst contains a 10 - symbol ( 20 - bit ) order wire command , formatted as shown in fig9 . the 5 - bit function field specifies which of the various command or broadcast functions is being invoked . for most command functions , a 7 - bit handset id field is also included to specify to which of up to 128 handsets in the local base station community the command is directed . the remaining 8 bit ; ( or in some cases , all remaining 15 bits ) are defined as required by the specific command or broadcast function . the response to any outbound ( i . e ., to a handset ) command or inbound request which requires a response will be provided in the third half subframe following that command or request . failure to receive a valid response at that time shall be considered an error and shall cause recovery measures to be taken . thus , each third half sub - frame following a base station command requiring a response is defined as being assigned , and is not available for use by handsets attempting to initiate communication . a handset &# 39 ; s response to a base station command requiring - one is to echo the received command &# 39 ; s function and handset id fields , and follow with whatever additional meaningful information is required for that command . thus a handset response generally constitutes a specific acknowledgement of the received command , plus an implied request for the next step in the dialog leading to the end objective . similarly , a base station &# 39 ; s response to a handset request both acknowledges the request and provides the next step in the dialog toward the desired objective . the example diagrammed in fig1 and described below serves to illustrate this : ( 1 ) a base station detects that an incoming call from the telco interface is directed to a handset with the corresponding telephone number . it then schedules a ring alert command to be sent to the handset , addressed to it via its 7 - bit handset id . ( 2 ) on recognizing its id , the handset responds by echoing the ring alert command and enabling a local &# 34 ; ring &# 34 ; function . ( 3 ) when the user picks up the handset and switches it from standby to active mode , the handset disables the local ring function and attempts to reestablish the dialog by issuing an allocate channel request in the next available csma slot . ( 4 ) assuming for the moment that the csma allocate channel request is received properly at the base station ( recovery from collisions and other errors is discussed in sections later herein ), the base station echoes the allocate channel request to the requesting handset , ( 5 ) which then resubmits it in the now implicitly assigned ( i . e ., &# 34 ; guaranteed &# 34 ; collision - free tdma slot 15 msec later . ( 6 ) having thus confirmed the allocate channel request , the base station then allocates a voice channel and issues a channel assignment command to the handset , ( 8 ) having thus confirmed that the handset has correctly received the channel assignment information , the base station connects the corresponding telco line to the allocated voice channel and issues a make link command to the handset , for calls originating at the handset , essentially the same procedure would be followed , except for steps ( 1 ) and ( 2 ), which of course would be eliminated . at the end of any call , the user would switch the handset from active back to standby mode , and the handset would signal a deallocate channel request to the base station via its in - band order wire ( or channel control ) path ( see section 3 . 6 ). this request would be acknowledge by the base station , via the same path , prior to releasing the channel on either end . approximately 15 specific order wire channel commands are necessary or very useful . some are &# 34 ; broadcast &# 34 ; by the base station on the order wire channel to indicate network status . others are involved in initiating communication with a handset , terminating communication , and adjusting timing . these include : 6 ) base station memberships available broadcast . the 8 - bit data field of the broadcast contains the number of memberships currently available in this base station community . this broadcast will occur at least once every 200 msec on each order wire channel . 7 ) membership enrollment request . submitted on a csma basis by roaming handsets seeking membership in a new community . 8 ) enrollment interview commands . eight different commands , actually : three to get the 24 - bit handset serial number , three to get the 24 - bit handset telephone number , one to identify the previous membership cell , if any , and one to assign a 7 - bit id number to the handset , thereby completing its acceptance into the new cell community . 9 ) adjacent cell map broadcast . the 12 lease significant bits of this broadcast indicate , for each of 12 possible frequency cells , whether that cell is ( 1 ) adjacent to the current cell or ( 0 ) not adjacent to the current cell . 10 ) adjacent cell time offset report . three different reports , actually : one to indicate pn code phase offset , one to indicate symbol offset within a subframe , and one to indicate subframe offset within a frame . the 8 - bit data field of these reports indicates the particular offset , relative to the current cell , of the adjacent cell base station identified in the handset id field . these reports are submitted , initially on a csma basis , by any scouting or roaming handset , and are then confirmed on an assigned tdma basis . 11 ) adjacent cell time offset broadcast . three different broadcasts , actually : one to indicate pn code phase offset , one to indicate symbol offset within a subframe , and one to indicate subframe offset within a frame . the 8 - bit data field of these broadcasts indicates the particular offset , relative to the current cell , of the adjacent cell base station identified in the handset id field . 12 ) voice channels available broadcast . the 8 - bit data field of this broadcast contains the number of currently unassigned voice channels within this base station . this broadcast will occur nominally once each second . 13 ) csma statistics broadcast . the 15 least significant bits of this broadcast contain csma slot capacity , loading , and collision statistics for the previous 1 - second period . 14 ) adjust transmit code phase command . the 8 - bit data field of this command is a two &# 39 ; s complement number indicating the handset transmit code phase adjustment , in sixteenths of a chip to be advanced ; thus a value of - 3 would indicate to retard the transmit phase of the handset identified in the handset id field by 3 / 16 of a chip . data values outside the range of - 4 to + 4 are ignored . 15 ) adjust transmit power level command . the 8 - bit data field of this command is a two &# 39 ; s complement number indicating the handset transmit power adjustment , in units of db gain ; this value is essentially added to the transmit power control bias term ( see section 4 . 3 ) of the handset identified in the handset id field . data values outside the range of - 4 to + 4 are ignored . handsets seeking entry to a cell ( i . e ., a base station ) are unknown entities to the base station , thus the invention provides for the handset to access the base station . also , in order to accommodate other asynchronous events ( e . g ., handset transition from standby to active mode and requesting allocation of a voice channel ) and avoid the delays inherent in a purely cyclical or polling approach , again , some other means is desirable . a carrier sense multiple access ( csma ) approach seems well suited to supporting these relatively infrequent demands , but it brings with it the requirement to manage the csma resources intelligently . several design features have been incorporated in this regard . first , the fraction of slots available for csma use will be arranged to provide a suitable probability of no collision on the first access attempt . second , the base station will maintain statistics of the use of available csma slots and will broadcast these statistics to the handsets for use in making intelligent choices of initial access and backoff strategies . third , the powerful parity check code included in inbound order wire transmissions minimizes the possibility that when collisions do occur they would not be recognized as such , thus the likelihood of the base station erroneously interpreting the demodulated results of collided transmissions is extremely low . any csma access attempt which is not acknowledge within 35 msec will be considered to have failed , the appropriate backoff strategy will be selected , and a retry will be scheduled accordingly . each voice channel burst contains a 2 - symbol field allocated for channel control , i . e ., inband order wire functions such as handset transmit power control , handset transmit code phase control , and other functions to be identified . this provides a capacity of : 400 bits / sec = 256 bits / frame in each direction , inbound and outbound , for these purposes , so that handsets with calls in progress still have access to full order wire functionality as described earlier . outbound channel control data is organized into 16 - bit commands and acknowledgements formatted as shown in fig1 and frame synchronized to provide 16 such commands per frame ( 25 per second ) per voice channel . each command is composed of a 6 - bit function field and a 10 - bit data field . unlike the order wire channel , no handset id field is required since the handset being addressed is implicit in he voice channel assignment . inbound channel control data is organized into 16 - bit requests and acknowledgements formatted identically to outbound commands and synchronized with them but offset by half a subframe . inbound responses to outbound commands commence three half - subframes after the command transmission is complete , and outbound responses to inbound requests commence in the burst following completion of the request . the following describes the signal processing operations and sequences utilized by the system to acquire and track the signal , maximize its quality , demodulate data from it , determine when to transfer to an adjacent cell , and accomplish such transfers . when a handset is first powered on , it is assumed to have a priori knowledge of its &# 34 ; home &# 34 ; base station pn code and frequency channel , but to have no knowledge of its time offset from that base station , and to know to within only 9 khz its frequency offset from nominal for that channel . ( the frequency offset from nominal at the base station is assumed to be less than 100 hertz .) the initial search resolves these time and frequency uncertainties by seeking to acquire the base station order wire signal at each of 255 * 2 = 510 pn code phase uncertainty states and 19 frequency bins spaced 1 khz apart . each of the resulting 19 * 510 = 9690 composite uncertainty states is examined for 398 . 44 μsec (= one 255 - chip pn sequence length ), and since there are 3 correlators per receiver , a total of 9690 * 398 . 44 μsec / 3 = 1 . 29 sec would be required to complete the search if the signal were constantly present . since the base station order wire signal is present only half the time , however , ( the inbound signal being spread with a different pn code ), each uncertainty state must be searched at least twice , once at time t and again t +( 2n + 1 )* 5 msec , so the total time required to acquire pn chip sync ( to within 0 . 25 chip or so ) and resolve frequency offset ( to within 500 hz or so ) is at least twice this , or 2 . 6 seconds . if the peak power measure of all the uncertainty states is not at least tbd db greater than the average of all the non - peak states , then it is assumed that the first attempt failed due to an antenna null , and the search process is repeated on the other antenna , for a worst case total of 5 . 2 seconds . note again that subsequent acquisitions will in general be essentially instantaneous , because the initial acquisition and carrier pull - in will have removed all frequency uncertainty , and adjacent cell time offset broadcasts will have eliminated most code phase and other time uncertainties . note too that acquiring pn code phase sync automatically also achieves ow symbol sync , but an additional several frames will be required to achieve frame sync and carrier pull - in prior to being able to demodulate data . these processes are described in the sections following . 1 ) return the coder and the carrier frequency to the code phase and frequency corresponding to the initial acquisition energy peak ( with the order wire signal still selected ). 2 ) observe 3 subframes of ( i , q ) measures from the correlator , each integrated over one ow symbol ; in particulars , observe the power profile of the data ( modulo 26 ow symbol times per subframe ), determine the peak power measure , and verify that it is at least 9 db above the average of the others . this corresponds to the onset of the outbound sounding burst at the start of each subframe . this observation is accomplished by constructing a 26 - element histogram , clearing all elements to zero , then adding to each the power measure of the corresponding ( i , q ) sample ( that is , sample number i mod 26 , for i = 0 to 77 ), where the measure of power is defined as i 2 + q 2 . represents the delay , in ow - symbol increments , of the actual frame start relative to the postulated frame start ( i = 0 ). if no such index j exists , then repeat steps ( 2 ) and ( 3 ) using the other antenna . 4 ) set ow symbol count =( 26j ) mod 26 . ( ow symbol count will be incremented by 1 ( modulo 26 ) on each subsequent ow symbol ). this completes the frame sync process , so it may be disabled and the carrier and code tracking functions enabled . during each of the two sounding bursts at the start of each subframe ( one burst received on each antenna ), a power measurement is made and projected to the midpoint of the inbound signalling period . the antenna corresponding to the larger projected power measure is selected to be used during the remainder of the subframe ( both outbound and inbound portions ). the larger projected power measure itself , plus a bias correction term determined by the base station over a longer time frame , is used to set the power level for the inbound transmission ( if any ). reference is made to the elements shown in fig1 . the power is measured for each sounding burst as follows : ( i , q ) samples are input from the correlator and integrated in integrators coherently over 6 voice symbols ; total power is then computed from these burst - coherent ( ij , qj ) measures as the antenna selected algorithm is the same independent of whether a call is in progress on the handset . the transmit power pxmit for this subframe is then computed as this bias correction term for each handset is determined at the base station once each 64 frames as follows : prcv = pp from base station code phase tracking function ( see section 4 . 5 . 2 ). = ip 2 + qp 2 , ip and qp integrated coherently over a 121 / 8 symbol handset sync period pref = reference receive power level and k1d is chosen to provide a loop bandwidth of 0 . 10 hz . the transmit power control algorithm is the same independent of whether a call is in progress on the handset . carrier pull - in and tracking are achieved using the afc function described in the following , which is enabled on the first ow symbol count of 0 following subframe sync . fig1 exemplifies the frequency discriminator and afc carrier tracking loop subsystem used in the invention . base on the power measurements taken during the sounding bursts , if pwr1 & gt ; pwr2 , then let k = 1 ( else k = 2 ) and compute the discriminator dafc as and the subscripts 1 and 2 denote samples taken during the first and second halves of each sounding burst , respectively . and output df + nominal , scaled appropriately , to the carrier nco . the loop is iterated at the subframe rate , i . e . 100 hz and k1a is chosen to provide a loop bandwidth of 6 hz . the discriminator operates only on outbound order wire sounding bursts and has a range of ± 3450 hz . carrier pull - in will be essentially complete within three loop time constants , or about 0 . 15 sec , so at that time the data demodulation function is enabled . the carrier tracking function is the same , independent of whether a call is in progress on the handset . code phase tracking is performed both at the handsets and at the base stations , but it is done differently in either place . this following describes the code phase tracking algorithms both for handsets and for base stations . code phase tracking is accomplished at the handsets using the delay lock loop function described following , which is enabled on the first ow symbol count of 0 following subframe sync . base on the power measurements taken during the sounding bursts , if pwr1 & gt ; pwr2 then let k = 1 ( else k = 2 ), and compute the discriminator dco as and the subscripts e , l , and p denote measures taken with the reference code displaced 1 / 2 chip early and 1 / 2 chip late relative to nominal , and at nominal , respectively , and the subscripts 1 and 2 denote samples taken during the first and second halves of each sounding burst , respectively . dco is then input to a first order delay lock loop and the loop output dp is used to adjust the code phase in units of 1 / 16 of a chip . the loop is iterated at the subframe rate , i . e . at 100 hz , and k1b is chosen to provide a loop bandwidth of 6 hz . note that the code phase tracking function is the same at each handset , independent of whether a call is in progress on that handset . in order to maximize the synchronicity of the inbound signals at each base station , the code phase at arrival is measured for each handset in each community at the base station associated with that community . this process , illustrated in fig1 , is implement as follows : each handset has an associated 7 - bit id number which it receives from the base station at the time it joins that base station community . handsets with id numbers from 0 to 63 are implicitly associated with order wire subgroup 0 of that base station ; those with id numbers from 64 to 127 are implicitly associated with order wire subgroup 1 . each order wire channel must thus support up to 64 handsets . during the handset sync portion of each inbound half subframe , the handset whose id number modulo 64 equals the number of the current subframe within the frame transmits a 121 / 8 symbol all - ones sync burst . the base station receives this burst and computes the discriminator dco2 as and the subscripts e , l , and p denote measures taken with the reference code displaced 1 / 2 chip early and 1 / 2 chip late relative to nominal , and at nominal , respectively , and each of the i and q inputs have been coherently integrated over the full 121 / 8 symbol ( 388 - chip ) measurement period . dco2 is then input to a first order delay lock loop and the loop output dp is used to adjust the handset transmit code phase in units of 1 / 16 of a chip . this function is iterated at the subframe rate , i . e . at 100 hz , so for each handset , it &# 39 ; s at the frame rate ( 640 msec , or 1 . 56 hz ), and klc is chosen to provide a loop bandwidth of 0 . 02 hz . the loops are actually closed via communication with each handset , using the order wire channel for handsets with no call in progress or using the voice channel control field for handsets with calls in progress . other than this difference , the code phase tracking function at the base station is the same for each handset , independent of whether a call is in progress on the handset . once its afc loop has settled , a handset may begin to demodulate order wire data and engage in order wire dialogs with the base station in order to subscribe to and participate ill the cell community as described earlier . once it has subscribed to a particular community or cell , it may then receive and originate calls , initially via the order wire channel but predominantly via a voice channel , which of course requires voice channel data demodulation as well . the algorithm used to demodulate this data is a combination of block phase estimation , which adjusts the phase of the received symbols for optimum detection in the presence of phase and frequency offsets , and differential data decoding of the receive symbols . this algorithm is applied straightforwardly to the voice channel and with minor modifications to the order wire channel . for the voice channel , the algorithm operates as shown in fig4 . 6 . 1 and described as follows : for each of the 91 symbols ( ij , qj ) following the sounding bursts ( in the handset ) or the handset sync burst ( in the base station ), compute the equivalent symbols ( 14j , q4j ) ( with the date removed ) as for the next 75 symbols ( ij , qj ), j = 8 , 82 , update the block integrators and phase estimate and rotate the symbol accordingly : where ntrack = 0 , 1 , 2 or 3 such that abs ( phi - phio ) is a minimum , i . e ., so as to produce minimum rotation relative to the previous rotation . next , rotate the final 8 symbols ( ij , qj ), j = 83 , 90 , by the final value of phi : finally , quantize the rotated symbols to 00 , 01 , 10 , or 11 according to the sign of ij and qj and input the result to the differential decoder as shown in fig1 . symbols 1 through 90 of the decoder output are the demodulated data for this burst . ( date to be transmitted are first differentially encoded as shown in fig1 . for the order wire channel , the algorithm is essentially the same except that the block length is 2 ow symbols rather than 16 voice channel symbols , and the phase reference symbol is shorter than the other ow symbols . also , the frame sync portion of each order wire burst is handled differently , namely as 7 voice channel symbols . thus the algorithm becomes : for each of the 11 symbols ( ij , qj ) following the sounding bursts ( in the handset ) or the handset sync burst ( in the base station ), compute the equivalent symbols ( i4j , q4j ) with the data removed , as for tile next 10 symbols ( ij , qj ), j - 1 , 10 , update the block integrators and phase estimate and rotate the symbol accordingly : ntrack = 0 , 1 , 2 , or 3 such that abs ( phi - phi0 ) is a minimum , i . e . so as to produce minimum rotation relative to the previous rotation . next , rotate the 7 frame sync symbols ( ij , qj ), j = 11 , 17 , by the final value of phi : finally , quantize the rotated symbols to 00 , 01 , 10 , or 11 according to the sign of ij and qj and input the result to the differential decoder . symbols 1 through 10 of the decoder output are the demodulated ow data for this burst . symbols 11 through 17 of the decoder output are the demodulated frame sync data for this burst . ( ow data to be transmitted are also first differentially encoded .) the system implements certain features to support rapid cell transfer . one of these is the maintenance and broadcast of a database of the relative time offsets of adjacent cell base stations . the information in the database is supplied by handsets which acquire adjacent cell order wire signals on a scouting or roaming basis . again , scouting activity is essentially roaming activity , but with the intent of gathering data about the surrounding environment , rather than of actually transferring cell membership . scouting handsets relay time offset information regarding adjacent cells back to the base station of their currently assigned cell ; roaming handsets which transfer to an adjacent cell impart this information regarding previous cell timing to the base station of the new cell . the information so gathered is verified and broadcast by each base station via the order wire channel and via the channel control portion of each active voice channel . scouting and roaming searches differ from initial searches primarily in that they are more focussed , that is , they search at only a single frequency , namely the handset &# 39 ; s current carrier tracking frequency within the current cell , and , at least initially , they search only a few chips of pn code phase uncertainty ( proportional to data staleness ). the other main difference is that carrier frequency , pn code phase , and power level tracking operations are maintained on the original signal during scouting and roaming searches . for scouting , if the more focussed search fails on both antennas , it is then broadened to include all 255 pn chips code phase uncertainty . if even this broader search fails on both antennas , the current scouting effort is terminated and normal operation within the current cell is resumed , without a scouting report ( adjacent cell time offset report ) being submitted to the base station . if any of the searches succeed , however , subframe and frame synchronization are also performed and a scouting report submitted . received power is measured once each subframe . a filtered average of this measure is also maintained so as to provide a 2 - second time constant . whenever this filtered average falls below a threshold defined by the signal level at which transfer to another cell becomes desirable , a roaming search is initiated , which searches first for the adjacent cell order wire signal most recently acquired . if this focussed search fails on both antennas , a similar search is conducted on both antennas for the next most likely adjacent signal to be acquired , and so on , until all adjacent signals have been searched . for each adjacent signal acquired , if the measured power level on that signal is greater than on the current signal , then the handset listens for a base station memberships available broadcast . if memberships are available ( and , if a call is in progress on the handset , if voice channels are also available ), then the handset issues a membership enrollment request . on verification of the enrollment request , the base station conducts an enrollment interview with the handset , and the transfer of the handset membership , to the adjacent cell base station is completed , along with any call in progress on the handset . in order to detect those situations in which a handset signal can reasonably be assumed to be lost , especially if it is currently assigned a voice channel and voice channels are currently in high demand , a filtered average of the received power from each of the handset sync periods is maintained as : prcv ( j )= ip 2 + qp 2 , ip and qp integrated coherently over 121 / 8 symbols , and where klf is chosen to provide a time constant of 2 seconds . whenever the fp value for any handset j falls below a specified lower threshold , the handset is noted as being off - line : whenever its fp value returns above an upper threshold , it is noted as being on - line . any call in progress on a handset determined to be off - line is terminated . incoming calls whose destination handset is off - line are given a busy signal . in order to minimize the dynamic range requirements ( and thus the power and cost ) of the signal - path a - to - d converter used in handsets , some form of automatic gain control ( agc ) of the a - to - d input signal is required . fig1 depicts the agc approach selected for this system . the concept is as follows : during each sounding burst , the analog input signal is correlated with the reference pn waveform and coherently integrated over 6 symbols , then dumped to square - law devices sld whose outputs are summed and log - amplified , then converted to digital . this digital log - domain power measure is read by software at the end of each sounding burst . at the end of the second burst , the larger of the two power measures ( pmax ) is selected by software to get the signal - path attenuation for the remainder of the current subframe and the sounding period of the following subframe . the attenuation is determined as : where kpow is a function of the log amplifier gain and attenuator gain . the attenuator setting is also used in the determination of the handset transmit power setting for the current subframe . for signal acquisition , the attenuator is set ( separately for each antenna and for each new code phase and carrier frequency uncertainty range scan ) so that the rms noise level p0 is 18 db below the maximum a - to - d converter input level , thus : an embedded microcontroller or microprocessor can be used to control not only the operational sequences involved in command handling , but there are decided advantages to incorporating not only the sequence control functions but much of the signal processing as well into a programmable device such as a digital signal processor . these advantages include : increased flexibility to modify or fine - tune algorithms once the system is already built and in test . while a preferred embodiment of the invention has been shown and described , it will be appreciated that various modifications and adaptations of the invention will be obvious to those skilled in the art and still be within the spirit and scope of the invention as set forth in the claims appended hereto .	7
fig1 shows an example situation in which a remote control acts as a reader of a passive device . a credit card with an nfc communication interface is illustrated , but it should be appreciated that any portable device can be used . according to an embodiment , an nfc component is integrated into an electronic wallet and used in this context . another application is responsible for transferring access rights to the receiver . these rights are loaded on to the nfc device . other example passive devices can be e . g ., tags , books , tickets , etc . thus , according to disclosed principles , a movie or airplane ticket can be provided with a passive nfc component , and the embodiment disclosed herein will be able to access additional services of the movie theater / airline via a connected television receiver . for example , the remote control reads the code from the airplane ticket and sends it to the receiver . this code contains at least one address and identification information . the receiver may e . g ., transmit the identification information to an address contained in the code , this identification information allows the identification of the details of the ticket . the user can thus e . g ., access his / her mileage account , take part in a competition or state his / her opinion on the service to earn additional miles , etc . fig2 shows an example situation in which the remote control communicates with another active device . each device creates an electromagnetic field that enables a data exchange at a higher speed and at a longer communication distance . as discussed above , it should be noted that even though the nfc device has its own energy source it does not mean that the device must operates in the active mode . for example , a smartphone can operate in the passive mode when used with the remote control . in order to limit power consumption , a button for activating the nfc function is provided on the remote control . by pressing the button , the electromagnetic field emitter is activated and a response from an nfc device is expected . once the nfc device is detected , the code is read by the remote control and the emitter is disabled . if no device is detected during a predefined time , the emitter will be disabled . once the code is received by the remote control , it is transmitted to the receiver according to several possible methods . according to a first embodiment , the code is simply transmitted via the infrared emitter . a message comprising a header and the code is composed . a marking information is added to inform the receiver , upon reception of the message , that it has to re - route the received code to the application that is waiting for the arrival of the identification information ( also referred to herein as information data ). according to a particular embodiment , the information data received by the nfc device is encrypted by a key . this key is loaded into the receiver and into the remote control during initialization . the encrypted information data will then be transmitted to the receiver via the infrared channel . the receiver will use the same key to decrypt the information data . according to a second embodiment , a bidirectional channel is created between the receiver and the remote control . preferably , a radio emitter / receiver will be used for the remote control such as , for example , a bluetooth emitter / receiver . the information data can also be encrypted according to the above described technique . alternatively , it is possible to generate a session key by using a protocol such as diffie - hellmann for encrypting the information data . the receiver then decrypts the information data and transmits it to the application that can use this data . as mentioned above , this application can be an on - line trading site , a secured voting platform ( i . e ., one single person can vote , as identified by the code of the portable device ), or a generic application that will react to an address contained in the code and connect the receiver to the identified distant application . in the voting example , a voting application can be loaded into the smartphone and be identified by the voting site in a particular way , which means that the user has registered with this site and has received such an identifier . during a program allowing television viewers to cast a vote , the viewers will be prompted to use a smartphone to cast a vote and thus , identifier will be transmitted to the remote control and to the receiver . as the receiver is connected to the internet , it can transmit the voter &# 39 ; s identifier along with an identifier of the current program . another application is used for the other side of the transaction ( i . e ., in the opposite direction of e . g ., the vote ). during the vote , the receiver extracts , from the metadata of the program , a code identifying the current program . this code is unique for each program and not predictable ( for example , a random number ). this code is transmitted to the remote control via the bidirectional channel and to the smartphone via the nfc communication . the vote application loaded in the smartphone can then add the user &# 39 ; s identifier , the result of the user &# 39 ; s choice and send a message to the voting site containing the identifier of the program , the user &# 39 ; s identifier , and the choice . this prevents someone who has not followed the program from voting and also prevents third parties from voting without having initially registered . according to one embodiment the receiver includes an nfc reader that contains the parameters enabling the remote control to communicate with the receiver . in fact , an in particular with radio frequency remote controls , a programming step is necessary to pair the remote control with the receiver . a setup parameter is transferred from the receiver to the remote control due to the nfc connection . this parameter will serve to identify the remote control while sending commands via a radio frequency channel and will thus allow the receiver to filter the instructions that are addressed to it . this parameter can be the frequency or frequencies to be used , or an identification code placed in the header of the transmitted data . an alternative to this embodiment loads the setup parameters into a passive nfc device provided with the receiver . it is sufficient to use this nfc card to set the remote control and thus , enable communications with the receiver . this mechanism prevents one device from interfering with another one . the devices to be paired , for example , the receiver and the remote control , are placed next to each other . when the devices detect each other , pairing may be initiated , i . e ., the receiver detects the remote control and determines if an identifier of the remote control is already stored in a setup memory of the receiver or not . if not , a message may be displayed to the user to initiate the pairing by pressing e . g ., an “ ok ” button or “ exit ” button if pairing is not desired . when the user approves the pairing , a pairing request message containing an identifier of the remote control is sent to the receiver , which returns an acknowledgement message containing parameters of the receiver that are necessary for pairing . the pairing data of the receiver and remote control are stored in both devices so that the receiver recognizes the remote control to which it is paired to when communicating via the radio frequency channel . the pairing may further comprise , in addition to identifiers , a cryptographic key or pairing key that is exchanged by the devices . the pairing key is then used to encrypt data transmitted by the remote control and the receiver . the devices can further be authenticated with a key pertaining to the user or to a home network . the pairing can be permanent , but , according to a desired embodiment , the pairing is temporary . this means that , for example , a remote control paired with a specific television set can be paired with another television set , simply by placing the remote control next to another television set within the range of an nfc data transmission . in this case , the former pairing data ( e . g ., identifier , key , parameters ) are deleted and replaced by new pairing data . this embodiment thus provides a very flexible pairing process . according to a further embodiment , a remote control may be paired with several devices in a multi - pairing mode . in this case , when a device is placed next to another device in order to be paired , the former pairing data is not erased ; instead , the prior pairing data is kept . this embodiment may be used e . g ., for forming a home network . the pairing could be applied to a remote control and television set as mentioned above , but may also be applied to any similar device having nfc capabilities ( e . g ., set - top - boxes , hi - fi installations , doors or gates , heating or air conditioner , or any device that can be controlled by a remote control ). a remote control may be e . g ., a smartphone , tablet , personal digital assistant , or any similar portable device . the same pairing principle could also be applied to a wireless mouse or keyboard paired with a personal computer or a tablet .	7
while the invention is susceptible to embodiments in many different forms , there are shown in the drawings and will described herein , in detail , the preferred embodiments of the present invention . it should be understood , however , that the present disclosure is to be considered an exemplification of the principles of the invention and is not intended to limit the spirit or scope of the invention and / or the claims and embodiments illustrated . referring now to fig1 , in accordance to a first embodiment , there is illustrated an interactive gaming device 10 that includes an external housing 15 and a plurality of response units 30 that further include a plurality of button mechanisms 25 . the button mechanisms 25 are preferably made up of a light emitting diode ( led ), a lens and a switch positioned at the base of the response units 30 . these leds may have any number of different colors , or , as in the first embodiment , include a white led with a colored lens . the external housing 15 may take on several different three - dimensional geometric shapes , such as a cube , sphere , or pyramid . virtually any three - dimensional shape may be used . an aspect of the external housing 15 is that the faces defined by the three - dimensional shape each include a plurality of tiles 17 that may surround the response units 30 . referring now to fig2 , the exploded view of fig1 is shown . as illustrated , the housing 15 , which may also be viewed as a polyhedron housing , has a number of external faces 16 . each face includes the plurality of tiles 17 and includes one or more openings 19 that are surrounded by two or more tiles depending upon its location . by placing the opening 19 in between tiles 17 , the location of the button mechanism that needs to be pressed during game play is not visible from all lines of sight and increases the challenging aspects of the game . referring also to fig3 a - 3 d , distributed throughout each opening 19 is the response unit 30 . in one embodiment , each response unit 30 includes a recessed chamber 20 and a button mechanism 25 . the button mechanism includes a lens 35 , a switch 40 , and an led 45 . the switch 40 and the led 45 may be mounted to a switch plate 50 . the response units 30 are further mounted to a mount plate 55 positioned within the housing 15 . the response unites 30 are separately positioned in the openings 19 such that an edge 21 of the recessed chamber 20 is substantially flush with a surface plane of the surrounding tiles 17 . thus , when the button mechanisms 25 are positioned at the base of the recessed chambers , the button mechanisms 25 and the leds 45 are not visible from all lines of sight , which increases the level of difficulty of the game . the button mechanisms 25 , which are located at the base of the recessed chambers 20 , are in communication with an integrated circuit ( ic ) 60 ( described below ) by an electrical connection that permits the transfer of power and information . the lens 35 would be positioned at the base of the recessed chamber 20 above the switch and led , such that when the lens 35 is pressed by a user , the switch 40 is triggered . the processor ( described below ) accesses game content ( such as preprogrammed signals or audio content ) stored on a memory internal or external to the ic 60 . further , the ic 60 , amplifier ( described below ), switches 40 and led drivers ( described below ) are in communication with a power source such as a battery pack . in the first embodiment , the interactive gaming device 10 includes a means to trigger game play and responses . an example of the triggered game play and responses is included in a “ play pattern ” example and game play examples below . further , in accordance to the first embodiment , to play with the gaming device a user manually rotates and maneuvers the interactive gaming device to locate button mechanisms 25 , which appear illuminated by activated leds 45 in accordance to gaming content . the gaming content is considered interactive or evolving with a play pattern designed in the programming . the gaming content may include audio information and / or data or led activation . the audio information may be generated or converted into any type of signal or format needed for playing or transferring the gaming content , such as but not limited to digital , analog , wav , etc . as such , when a switch is triggered , the interactive gaming device responds based on the programming contained within the gaming content enabling a user to interact with the interactive gaming device in a variety of different capacities . referring now to fig4 , there is shown a block diagram provided for an embodiment of the interactive gaming device 10 . the ic 60 communicates with a plurality of led drivers 65 via an electrical connection 70 . utilizing the electrical connection 70 , data ( such as preprogrammed audio content , preprogrammed responses and / or randomly generated signals , etc .) can travel between the ic 60 and the plurality of led drivers 65 . the plurality of led drivers 65 also receives an appropriate amount of power from the power source via an electrical connection 70 . utilizing control signals ( such as randomly generated or preprogrammed ) the ic 60 then directs the led driver 65 to transfer the appropriate amount of power to the plurality of leds 45 to activate a desired state . examples of a desired state include a “ light on ,” a “ light off ,” or a varying level of illumination for an led 45 . the power is obtained from a power source 75 while the data is obtained from a processor ( s ) 80 . the processor ( s ) 80 is designed to run the program ( s ) stored on a memory 85 . when one of the plurality of switches 40 is triggered in response to a user &# 39 ; s input , a signal is sent via an electrical connection 70 to the ic 60 . the ic 60 contains the processor ( s ) 80 and may include a memory 85 . the ic 60 receives signals from the plurality of switches 40 . the ic 60 further includes programming and electronic components to facilitate and direct audio content , control signals , and data within the interactive gaming device 10 . the ic 60 is also in communication with the power source 75 and an amplifier 90 . the memory 85 contains gaming content . the processor ( s ) 80 in the ic 60 accesses the gaming content based on a program and / or in accordance to the generated control signals received from the plurality of switches 40 . the processor ( s ) 80 then generates a response that includes signals and may be in the form of audio or control signals . while the interactive gaming device 10 is preprogrammed to respond , the selection of the type of response may be randomly selected . from the processor ( s ) 80 , audio signals are transferred to the speaker 95 while control signals are transferred to the plurality of led drivers 65 via an electrical connection 70 . the led drivers 65 then direct the plurality of leds 45 to change to a desired state , based on a program and / or in accordance to a user &# 39 ; s input or preprogrammed response . one illustrative example can be described in the following “ play pattern ” as show in fig5 a - 5 c . power switch 100 is turned on to activate the interactive gaming device 10 . once a game is selected , the processor 80 begins to change one or more of the plurality of leds 45 to a “ light on ” state , prompting the user to press one or more of the corresponding button mechanisms 25 illuminated by a the lit led 45 . activating or trigging one of the switches 40 sends a signal to the processor 80 . the processor 80 then accesses the gaming content to retrieve audio data to transfer to the speaker 95 and signals to control the state of the leds 45 . for example and as illustrated in 5 a , an led 45 on the c - side will receive a control signal from the ic 60 , directing the led 45 on the c - side to change to the “ light on ” state , thus illuminating the button mechanism 25 . when a user is looking at the interactive gaming device 10 from the a - side , they will not be able to see the button mechanism 25 illuminated on the c - side . a rotation of the interactive gaming device 10 in the direction of the arrow in 5 a will also not place the led 45 on the c - side in view as illustrated in 5 b . however , another rotation of the interactive gaming device 10 in the direction of the arrow in 5 b will take the user to the view in 5 c . at this point , the user will be able to see the button mechanism 25 illuminated on the c - side . the user then presses the corresponding button mechanism 25 on the c - side , sending a response signal to the ic 60 . the ic 60 receives this response signal and changes the state of a different , or the same led 45 . since the leds 45 may be positioned at the bottom of the recessed chambers 20 , a user must manually rotate and maneuver the interactive gaming device 10 to permit a user &# 39 ; s line of sight to view the led 45 in the “ light on ” position . this creates a challenging interactive element because the leds 45 are not at the surface of the external housing 15 , where they are easily visible and do not require additional user rotation of the external housing 15 . the ic 60 will continue to receive input signals from the switches 40 , and direct output signals to the speaker 95 and the leds 45 . the resulting play pattern will direct a user to continuously rotate and manipulate the interactive gaming device to follow the ic &# 39 ; s 60 direction , preferably with a time pattern variation to increase the difficulty of play as a user progresses through the play pattern . numerous games may be played with the interactive gaming device 10 . these games are selected by a user pressing the appropriate button mechanisms 25 . several games are described below , however , the ic ( described below ) may be programmed to play any number of games . in a first example of game play , the object of the game is for a user to fully illuminate all of the leds 45 by pressing the button mechanisms 25 as the light begins to fade out . at the start of game play , each of the six leds 45 are in a lights out state . the processor 80 accesses the gaming content to retrieve audio data to transfer to the speaker 95 to emit a sound notifying a user of the start of game play . the processor 80 sends control signals to one or more of the led drivers 65 which direct the corresponding led 45 to illuminate . the processor 80 then directs the led driver 65 to gradually decrease the level of illumination ( essentially , a fade out ). the user then presses the illuminated button mechanism 25 which appears to fade to increase the level of illumination back to the maximum level . the corresponding switch sends a control signal to the processor 80 . the processor 80 sends audio data to the speaker 95 to emit a corresponding audio sound . as the user presses the first button mechanisms 25 to illuminate , the other leds 45 subsequently switch to the light on position and begin to fade as described above . if an led 45 fades to the light out state , game play ends . if the user is able to get all six leds 45 to their full light on state , game play ends . the processor 80 may be programmed to generate a “ game over ” or “ winner ” audio signal when the user reaches either scenario . also , the processor 80 may be programmed to increase the speed of the fading effect to make the game play more challenging . further , the processor 80 may be programmed to time out or end game play after a predetermined length of time has expired . after the conclusion of game play , the user has the option to start a new game by pressing the corresponding button mechanisms 25 or selecting one of the other games included in the interactive gaming device . in a second example of game play , the object is to press a button mechanism 25 illuminated by an led 45 in the light on state before the led 45 switches to a light out phase . the processor 80 may be programmed to flash the leds 45 between a light on or light out phase , prompting a user to respond in accordance to the game play . the processor 80 includes programming to provide multiple levels of game play , preferably increasing in the difficulty of play as a user advances in the game play . the processor 80 is programmed to time out game play after a predetermined length of time has elapsed for each level of game play . for example , when the first led 45 is switched to the light on state , a timer begins a countdown scheduled to last thirty seconds during which time the user needs to press as many button mechanisms 25 illuminated by the leds 45 as possible before the programming directs the led 45 to switch to the light off position in accordance with game play . once the countdown time is reached , the processor 80 determines a performance rating of the user , such as a percentage of button mechanisms 25 correctly pressed versus corresponding leds 45 lit . if the user achieves the required percentage of hits , the user advances to the next level . as the user advances in levels , the speed in which the leds 45 flash between the light on state and light off state increases . the programming may also include audio commands to emit through the speaker 95 , signaling completion of a level and the advance to the next level . in a third example of game play involving multiple users , the object of the game is similar to the game known as “ hot potato .” at the start of game play , the processor 80 directs an audio command to emit from the speaker 95 , requesting one of the users to input the desired number of players . a user responds by pressing a button mechanism 25 corresponding to the number of players . an led 45 switches to the light on phase to signal the start of play . simultaneously , the processor 80 tracks time while directing audio signals to emit from the speaker 95 , such as a simulated clock ticking sound . since the button mechanisms 25 are at the base of the recessed chambers 20 , players do not have a direct line of sight to the button mechanism 25 now illuminated . the first player maneuvers the interactive gaming device 10 to locate the corresponding illuminated button mechanism 25 and presses the button mechanism 25 before passing the interactive gaming device 10 to the next user . pressing the illuminated button mechanism 25 with an led 45 in the light on state triggers the associated switch 40 and sends a signal to the processor 80 . the processor 80 responds by randomly triggering another led 45 to switch to the light on state . the next user then maneuvers the interactive gaming device 10 to locate the next illuminated button mechanism 25 . upon locating and pressing the illuminated button mechanisms 25 , the user passes the interactive gaming device 10 as above , prompting the processor 80 as above . these steps are repeated as the interactive gaming device 10 is passed to subsequent players until the processor 80 determines that the time of play has expired . scoring may be recorded according to gaming content , or a user may simply be eliminated . this interaction and game play may continue until a winner is determined . in a fourth example of game play , the object of the games is to determine a randomly generated led 45 illumination sequence to fully illuminate all the leds 45 by pressing the corresponding button mechanisms 25 with the fewest number of attempts . at the start of game play , all of the leds 45 are in the lights off state . the processor 80 directs an audio signal to the speaker 95 to emit an audio sound to notify the users to start play . a user presses one of the button mechanisms 25 in an attempt to find the first correct button mechanism 25 in the randomly generated sequence . once the button mechanism 25 is pressed by the user , a signal is sent to the processor 80 . the processor 80 determines if it is the correct signal ( corresponding to the button mechanisms 25 ) according to the randomly generated sequence . if the button mechanism 25 selected is not the first in the sequence , no leds 45 will switch to the light on state and the processor will send an audio signal to the speaker 95 to notify the user that the selection was incorrect . if the button mechanism 25 selected is the first button mechanism 25 in the sequence , the processor 80 will direct the corresponding led 45 to illuminate and send an audio signal to the speaker 95 to notify the user that the selection is correct . the user then selects another button mechanism 25 in an attempt to find the subsequent button mechanism 25 in the sequence . if the second button mechanism 25 selected is incorrect , the processor 80 sends an audio signal to the speaker 95 to notify the user that the selection was incorrect . simultaneously , the processor 80 will reset the game play to the initial button mechanism 25 in the sequence . game play proceeds accordingly until the user selects all six button mechanism 25 according to the randomly generated sequence . once the user is able to press the button mechanisms 25 in the correct sequence , the leds 45 will all be in the light on state and the processor 80 will send an audio signal to the speaker 95 indicating completion of the game play . further , the processor 80 may record the correct and incorrect presses to provide an accuracy and timing rating . in a fifth example of game play , the object is to locate leds 45 subsequently switched to the light on state and press the corresponding button mechanisms 25 before a predetermined time expires . the leds 45 may be subsequently switched to the light on state in a randomly generated sequence . to start game play , the processor 80 sends a signal to one of the leds 45 to switch to the light on state . the user maneuvers the interactive gaming device 10 to locate the corresponding button mechanism 25 . since the button mechanism 25 and leds 45 in this embodiment are located at the base of the recessed chambers 20 , a user will typically not have a direct line of sight to the button mechanism 25 when illuminated by the leds 45 , creating a challenging scenario requiring a user to maneuver the interactive gaming device 10 quickly to locate the illuminated button mechanism 25 before time expires . game play continues while the user continues to locate and press the correct button mechanism 25 corresponding to the led 45 in the light on state in the randomly generated sequence within the allocated time . to increase the difficulty , the time allotted to locate each button mechanism 25 will decrease with each correct selection . the processor 80 sends an audio signal to the speaker 95 indicating a correct selection and further sends an audio signal to the speaker 95 when there is an incorrect selection signaling the end of the game play and indicating a user &# 39 ; s score . at the conclusion of game play , the user has the option to start a new game by pressing the corresponding button mechanism 25 or selecting one of the other games included in the interactive gaming device 10 . in a sixth example of game play , the object is to follow a randomly generated color pattern according to audio signals . to start play , the processor 80 sends an audio signal to the speaker 95 as a voice command and the user presses the corresponding button mechanism 25 . for example , the speaker 95 will emit the word “ red ” as a voice command . if the user presses the button mechanism 25 on the red side , the processor 80 sends an audio signal to the speaker 95 to continue the sequence , such that the voice will then say “ red , yellow .” the user must select and press the correct button mechanisms 25 according to the color sequence to repeat the pattern . with each correct selection , the processor 80 will direct the sequence to repeat and add one or more colors to the sequence for the subsequent rounds . the processor 80 may be programmed to increase in difficulty as a user advances in game play . for example , when a user correctly presses a five button sequence , the processor 80 resets the round and randomly generates a color sequence requiring the user to follow a six button sequence . an incorrect selection will prompt the processor 80 to send an audio signal indicating the end of game play . after the conclusion of game play , the user has the option to start a new game or select one of the other games included in the interactive gaming device 10 by pressing the corresponding button mechanisms 25 . there is a virtually unlimited amount of play patterns that can be included in the gaming content . the examples above are meant to be but a few of the many and are not meant to limit the invention in any manner . from the foregoing and as mentioned above , it will be observed that numerous variations and modifications may be effected without departing from the spirit and scope of the novel concept of the invention . it is to be understood that no limitation with respect to the specific methods and apparatus illustrated herein is intended or should be inferred .	0
hereinafter , the present invention will be described in greater detail with reference to the accompanying drawings . [ 0032 ] fig2 is a view showing a basic structure of an image projection apparatus according to the preferred embodiment of the present invention . referring to fig2 an image projection apparatus 200 according to the present invention comprises a light source 210 , a first light transmit unit 220 , a light switch unit 230 , a second light transmit unit 230 , a quadrangular beam generating unit 250 , a single panel ( or one panel ) 260 and a projection lens unit 270 . in the present embodiment , the image projection apparatus 200 has the light switches arranged in the matrix structure of ( 3 × 3 ). light paths of respective r . g . b . laser beams in the light switch unit 230 are respectively illustrated . for example , a light path of the r laser beam , which is deflected from a predetermined light switch 230 a and inputted into a first output port 232 a , is indicated by a dotted line . the light source 210 emits a plurality of monochromatic color beams having different wave - lengths . the light source 210 uses a laser beam , an arc lamp , a metal halide lamp , a halogen lamp or a xenon lamp , or any such light source suitable for performing as required for the present invention . the present invention uses the laser beam by way of an example . the plurality of monochromatic color beams ( hereinbelow , called “ laser beams ”) are , for example , red ( r ), green ( g ), and blue ( b ) laser beams . the first light transmit unit 220 has a plurality of first optical fibers 222 a , 222 b , 222 c and a plurality of first collimating lenses 224 a , 224 b , and 224 c . the first optical fibers 222 a , 222 b , and 222 c allow the respective r . g . b . laser beams to pass therethrough , and the first collimating lenses 224 a , 224 b , and 224 c concentrate the laser beams transmitted through the optical fibers 222 a , 222 b , 222 c . the first collimating lenses 224 a , 224 b , and 224 c are disposed at output ends of the first optical fibers 222 a , 222 b , and 222 c . the laser beams concentrated at the first collimating lenses 224 a , 224 b , and 224 c are transmitted to the light switch unit 230 . the light switch unit 230 comprises a plurality of light switches for deflecting the respective r . g . b . laser beams at a predetermined angle or allowing the r . g . b . laser beams to pass therethrough . the light switch unit 230 has a matrix structure of ( n × n ), wherein n is a positive number . in other words , the light switch unit 230 has the light switches 230 a through 230 i as many as ( n × n ). in this embodiment , the light switch unit 230 has nine ( 9 ) light switches 230 a through 230 i arranged in the square matrix of ( 3 × 3 ). the light switches 230 a through 230 i use high reflective mirror embodied by utilizing micro electro mechanical system ( mems ) technology . the light switches 230 a through 230 i output the r . g . b . laser beams directly as the light signal without the process of converting an input light signal into an electric signal . accordingly , the switching speed is faster than in the conventional method which requires the process of converting the light signal into the electric signal . each of the light switches 230 a through 230 i has a deflection mirror a and a drive unit b ( fig3 ). the deflection mirror a has a deflection surface formed on a side thereof , for deflecting the laser beams , and is fabricated by utilizing the mems technology . the position of the deflection mirror a is varied from a first position ( on - position ) to a second position ( off - position ) by the drive unit b . the first position ( on - position ) allows a laser beam ( among the r . g . b . laser beams ) to be deflected from the deflection mirror a to any one portion of upper , mid , and lower portions of the dmd panel 260 , while the second position ( off - position ) allows the r . g . b . laser beams to go straight and not be directed toward the panel 260 . that is , the first position ( on - position ) is the state where the light switches 230 a through 230 i are inclined to deflect the laser beams to desired output ports 232 a , 232 b , and 232 c . the second position ( off - position ) is the state where the light switches 230 a through 230 i are in parallel relation to the direction of the laser beams passing through the light switches 230 a through 230 i . also the light switch unit 230 is operated such that only one light switch in a row and a column is positioned at the first position . the light switch unit 230 is operated such that the three light switches are simultaneously positioned at the first position or the ( 3 × 3 ) light switches 230 a through 230 i are positioned at the first position by a predetermined order . for example , if a light switch 230 a is positioned at the first position ( on - position ), the other light switches 230 b , 230 c , 230 d , and 230 g disposed in the same row and column as the light switch 230 a are positioned at the second position ( off - position ). at this time , if another light switch 230 e is positioned at the first position , the light switch unit 230 sets another light switch 230 i to be positioned at the first position . one image is realized when each of the ( 3 × 3 ) light switches 230 a through 230 i is positioned at the first position at least one time . at the output terminal of the light switch unit 230 are provided a plurality of output ports 232 a , 232 b , and 232 c . the output ports 232 a , 232 b , and 232 c output the laser beams deflected from the light switches 230 a through 230 i of the light switch unit 230 into the second light transmit unit 240 . the second light transmit unit 240 has a plurality of second collimating lenses 242 a , 242 b , and 242 c and a plurality of second optical fibers 244 a , 244 b , 244 c . the second collimating lenses 242 a , 242 b , and 242 c concentrate the respective r . g . b . laser beams received through the output ports 232 a , 232 b , and 232 c to the respective second optical fibers 244 a , 244 b , and 244 c . the second optical fibers 244 a , 244 b , and 244 c transmit the concentrated r . g . b . laser beams to the quadrangular beam generating unit 250 . the quadrangular beam - generating unit 250 has a plurality of first lenses 252 a , 252 b , and 252 c , a plurality of light tubes 254 a , 254 b , and 254 c , and a second lens 256 . the quadrangular beam generating unit 250 is disposed at output ends of the second optical fibers 244 a , 244 b , and 244 c , for converting the respective laser beams to a quadrangular beam . the first lenses 252 a , 252 b , 252 c disperse the respective r . g . b . laser beams such that the respective r . g . b . laser beams can be incident on the light tubes 254 a , 254 b , and 254 c corresponding to the first lenses 252 a , 252 b , and 252 c . the light tubes 254 a , 254 b , and 254 c are shaped as a hexahedron and have passage holes formed therein . the respective light tubes 254 a , 254 b , and 254 c consist of four surfaces made of mirrors . when the laser beams dispersed from the first lenses 252 a , 252 b , and 252 c are incident in the passage hole defined in the light tube 254 a , 254 b , and 254 c , the laser beams are converted to quadrangular beams that have a predetermined ratio of width to height . the second lens 256 disperses the quadrangular beams such that the beams are incident on the single panel 260 . the single panel 260 consists of one digital micromirror device ( dmd ) panel or one liquid crystal display ( lcd ) panel . hereinafter , the present invention using the dmd panel will be described . the dmd panel 260 receives the monochromatic color beams i . e . the respective r . g . b . laser beams converted into the quadrangular beams to form the r . g . b . color bars on the upper , mid and lower portion thereof as shown in fig2 . as shown in fig2 r color bar is illustrated in an oblique line , g color bar in a vertical line , and b color bar in a reverse oblique line . the dmd panel 260 has a plurality of drive mirrors . the drive mirrors digitalize the respective r . g . b . color bars formed on the dmd panel 260 and deflect them at a predetermined angle . the image deflected from the dmd panel 260 is projected onto a screen through the projection lens unit 270 . the projection lens unit 270 is disposed opposite the dmd panel 260 . according to another embodiment of the present invention , the lcd panel can be used instead of the dmd panel . while dmd panel is a deflection type panel , the lcd panel is a projection type panel . when the lcd panel is used , the position of the projection lens and the screen can vary . [ 0051 ] fig4 a through 4c are views showing a process of realizing one image by a certain order of manipulation according to the preferred embodiment of the present invention . one image is realized by performing a series of processes as illustrated in fig4 a through 4c . these processes can be changed without departing from the spirit of the invention . referring to fig4 a and 4c , the r laser beam transmitted through the first light transmit unit 220 is incident on any one of the light switches 230 a through 230 c arranged in the first column , the g laser beam on any one of the light switches 230 d through 230 f arranged in the second column , and the b laser beam on any one of the light switches 230 g through 230 i arranged in the third column . also , the laser beams deflected from the light switches 230 a , 230 d , 230 g of the first row form a color bar on the upper portion of the dmd panel 260 through the first output port 232 a , the laser beams deflected from the light switches 230 b , 230 e , and 230 h of the second row form a color bar on the mid portion of the dmd panel 260 through the second output port 232 a , and the laser beams deflected from the light switches 230 c , 230 f , and 230 i of the third row form a color bar on the lower portion of the dmd panel 260 . these three monochromatic color bars are formed on the upper , mid , and lower portions of the dmd panel 260 by manipulating the light switch unit 230 . when the nine ( 9 ) light switches 230 a through 230 i of the light switch unit 230 are operated according to the following table 1 , the color bars are formed on the dmd panel 260 as shown in fig4 a . in the table 1 , ‘ on ’ corresponds to the first position that allows the laser beams to be deflected , and ‘ off ’ corresponds to the second position that allows the laser beams to pass through the light switches . reference numerals 230 a through 230 i indicate the light switches . if the light switch unit 230 manipulates the light switches 230 a through 230 i according to table 1 , the color bars are formed on the dmd panel 260 as shown in fig4 a . that is , the r color bar is formed at the upper portion , the g color bar at the middle portion , and the b color bar at the lower portion . also , when the nine light switches 230 a through 230 i of the light switch unit 230 are operated according to the following table 2 , the color bars are formed on the dmd panel 260 as shown in fig4 b in the table 2 , ‘ on ’ corresponds to the first position that allows the laser beams to be deflected , and ‘ off ’ corresponds to the second position that allows the laser beam to pass through the light switches . reference numerals 230 a to 230 i indicate the light switches . if the light switch unit 230 is operated according to the table 2 , the color bars are formed on the dmd panel 260 as shown in fig4 b . that is , the b color bar is formed at the upper portion , r color bar at the mid portion , and g color bar at the lower portion . also , when the nine light switches 230 a through 230 i of the light switch unit 230 are operated according to the following table 3 , the color bars are formed on the dmd panel 260 as shown in fig4 c . in the table 3 , ‘ on ’ corresponds to the first position that allows the laser beams to be deflected , and ‘ off ’ corresponds to the second position that allows the laser beam to pass through the light switches . reference numerals 230 a through 230 i indicate the light switches . if the light switch unit 230 is operated according to the table 3 , the color bars are formed on the dmd panel 260 as shown in fig4 c . that is , the g color bar is formed at the upper portion , b color bar at the mid portion , and r color bar at the lower portion . according to the image projection apparatus , by forming monochromatic color bars on the panel sequentially using the light switches that utilize the mems technology , the use of light on the panel can be improved . that is , the light switches make it possible to achieve the efficient use of light of the three panels . accordingly , the brightness of the formed image can be improved . also , since the light switches output the light signal directly without the process of converting the light signal into the electric signal , the on / off switching speed increases . the foregoing embodiments and advantages are merely exemplary and are not to be construed as limiting the present invention . the present teaching can be readily applied to other types of apparatuses . the description of the present invention is intended to be illustrative , and not to limit the scope of the claims . many alternatives , modifications , and variations will be apparent to those skilled in the art . in the claims , means - plus - function clauses are intended to cover the structures described herein as performing the recited function and not only structural equivalents but also equivalent structures .	6
set forth below is a description of what are believed to be the preferred embodiments and / or best examples of the invention claimed . future and present alternatives and modifications to this preferred embodiment are contemplated . any alternatives or modifications which make insubstantial changes in function , in purpose , in structure , or in result are intended to be covered by the claims of this patent . referring now to fig6 - 9 , the subject of the present invention is the “ undulating ” brush 24 . undulating brush 24 may be effectively used in a device such as shown in fig1 - 2 . in contrast to known prior art rotating brushes , undulating brush 24 includes a repeating pattern of a “ peak ” portion 24 a , and a “ valley ” portion 24 b , in which the peak and valley portions preferably have dimensional ranges as specified here for cleaning the ( automobile and small truck ) tire sizes addressed here . ( in order to clean larger tire sizes than those mentioned here , this will of course require undulating brushes with larger dimensions .) using an “ undulating ” rotating brush as described here , it was surprisingly discovered that superior cleaning characteristics were obtained , as opposed to prior known rotating brushes as described above . ( it is noted that satisfactory cleaning also requires the use of an appropriate chemical formulation that is properly applied to the entire outside surface of the outside tire portion and wheel surfaces to be cleaned .) it was found that the use of an undulating rotating brush with a curvilinear intermediate edge between the peak and valley portions works particularly well . it appears that rotating brushes with squared - off intermediate portions do not clean as well . it was also found that the density of the cleaning elements of the undulating rotating brush , as well as the pressure they apply on the surfaces to be cleaned , also facilitate superior cleaning , as described below . referring to fig1 a - 10e , typical tire od / ids ( in inches ) are shown , of : 24 / 16 ( fig1 a ); 25 / 20 ( fig1 b ); 16 / 8 ( fig1 c ); 28 . 5 / 16 . 5 ( fig1 d ); and 32 / 19 ( fig1 e ). for wheels in this size range , it was found that the following diameter ranges for a brush diameter measured at the peak and valley portions of the undulating brush 24 of the present invention are preferred : for tire sizes for automobiles and small trucks in the tire outside diameter range of 24 - 32 inches , preferred diameter ranges for diameter dp ( see fig7 ) measured at peak portion 24 a are about 14 - 18 inches , while preferred diameter ranges for diameter dv ( see fig7 ) measured at valley portion 24 b are about 9 - 14 inches . ( if dp is 14 , dv is preferably about 9 ; if dp is 18 , dv is preferably about 14 ; other corresponding dp and dv numbers may be proportionally derived .) the undulating brush of the present invention may take various shapes and sizes , such as sinusoidal ( fig7 ) or modified sinusoidal waves , flattened sine waves ( fig8 ), sawtooth waves ( fig9 ), etc ., provided that there is an “ undulating ” characteristic to the brush length ( i . e ., peak portions followed by valley portions ). the common characteristic of these undulating brush shapes is that the cleaning element peak and valley diameters and lengths should be sufficient to provide desirable cleaning . the cleaning surface of the rotating brush may be made of filaments , cloth , or closed cell foam . if filaments are used , they may be “ x - shaped ” in cross - section , have a thickness in the range of about 15 - 50 thousandths of an inch , and are made of low density polyethylene . ( polypropylene or nylon could be used , but these are harder materials which may scratch the vehicle exterior and nylon may not be economical to use .) the shaft carrying the rotating brush preferably has a smaller diameter conventional such shafts ( about 1½ - 1⅞ inches , for example , instead of 2¼ - 2½ inches ). ( as the shaft diameter decreases , longer filaments may be used for the same outside brush diameter .) the present invention is currently believed to preferably use a filament density of about one - half pound / linear inch of length measured at the core / shaft , whereas prior art brushes are believed to employ lower filament densities of roughly about one - half or three - quarters of this preferred density . in other words , for an 8 - foot long brush , the undulating brush of the present invention may have about 48 pounds of polyethylene filament . this density may vary depending upon the type of material and the length of cleaning elements ( e . g ., filaments ) selected . sufficient force must also be exerted on surfaces to be cleaned by the rotating brush to provide sufficient penetration into the surfaces of the tire and wheel to be cleaned . this force is a function of the distances of the shaft from the wheel / tire to be cleaned , as well as the shaft rpm . a faster shaft rpm actually results in less brush penetration into the surfaces to be cleaned . a preferred range is currently believed to be about 100 - 175 rpms , with about 15 - 40 pounds of force exerted over the ( e . g .) 8 - foot rotating brush length . shaft rotational speed and overall brush diameter can substantially influence the distance between the brush cleaning element ends and the surfaces to be cleaned . ( the higher the rpm or the larger the overall brush diameter , the greater the force needed , i . e ., the brush can be “ tuned ” by varying the shaft distance and / or the rpms for best cleaning results .) referring to fig7 , in a particularly preferred embodiment , it was found that satisfactory cleaning was achieved when using about 15 - 50 thousandths of an inch , x - shaped polyethylene filaments with a peak wave diameter dp at peak 24 a of about 18 inches and a valley height diameter dv at valley 24 b of about 14 inches , that exerted about 15 - 35 pounds of force exerted on the 96 - inch long brush as measured by a grainger push - pull gauge scale . based on visual observation , assuming adequate cleaning chemical coverage , satisfactory cleaning was achieved over roughly 90 - 99 percent of the exterior surfaces of the tire and wheel , as compared to about 70 percent for a comparable uniform - width brush and about 80 percent for a comparable poodle brush . referring to fig8 , in a particularly preferred embodiment , the length of the peak portion lp is preferably longer than the length of the valley portion lv , such as in about a 1 - 2 : 1 ratio . in alternative , less - preferred embodiments , lv may be about equal to or less than lp . while the preferred embodiment of the invention has been discussed above with regard to undulating , rotating brush elements made of filaments , those of ordinary skill in the art will appreciate that the foregoing inventive principles may be applied with brush elements made of cloth or closed cell foam , as is well known in the art to be used . it will also be understood that the undulating , rotating brush of the present invention may include parallel strips , or a spiral wound strip , and may include individually drawn brush elements or tufts , or stapled brush elements . the above description is not intended to limit the meaning of the words used in the following claims that define the invention . persons of ordinary skill in the art will understand that a variety of other designs still falling within the scope of the following claims may be envisioned and used . it is contemplated that future modifications in structure , function , or result will exist that are not substantial changes and that all such insubstantial changes in what is claimed are intended to be covered by the claims .	1

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.