text
stringlengths 1.55k
332k
| label
int64 0
8
|
|---|---|
although exemplary performances which are produced according to methods of the present invention may include actual sexually explicit conduct , such that production of visual images of the performance may be subject to statutory regulations as discussed above , the present invention is by no means limited to the production of such performances or to the generation of records pertaining to such performances . as used herein , the term “ custodian ” denotes any person who is in possession of at least one record of a performance that is subject to a record - keeping regulation . such a person can be , for example , a producer as defined in 28 c . f . r . part 75 , or an individual employed by an organization that is itself a producer . fig1 illustrates a method according to the present invention in a general aspect . information pertaining to a performance is first provided , more specifically in accordance with a record - keeping requirement such as the requirements established at 18 u . s . c . § 2257 and 28 c . f . r . part 75 . the information can be provided , in certain embodiments , by one or more performers of a performance which is subject to the record - keeping requirement , and very specifically by every performer who engages in regulated conduct , such as actual sexually explicit conduct , at any time during the course of the performance . in other particular embodiments , the information can be provided by a producer or other individual in possession of the required information . the performance for which the information is provided can be a live performance or a pre - recorded performance ( the recording being a book , magazine or other periodical , film , videotape , etc .). in specific embodiments , the information is provided prior to a request by a viewer over a network for a transmission of the performance to the viewer over the network . for example , in certain particular embodiments , a performer accesses a site on a network over which a live performance is to be transmitted to a viewer , and then provides the required information . in other specific embodiments , the information is provided subsequent to , e . g ., in response to , a request by the viewer for a transmission of the performance . the information can be provided , in particular embodiments , as direct input by the performer by means of a scanner or other electronic device . in other particular embodiments , the performer logs onto a site and then provides a code , an id number , a credit card account number or the like to the site . entry of the code enables the performer to access a database including a file that contains the required information pertaining to the performer , for example by activating a hyperlink to such a database . the information pertaining to the performance can include an identification of a performer , for example a picture identification card ; a maiden name , alias , nickname , stage name or professional name used by the performer ; other information pertaining to a performer , such as an address , social security number , telephone number , etc . ; an identification of the performance , such as a title or identification number ; a date of the performance , e . g ., the date on which the performance is transmitted over a network or the date on which the performance was first recorded ; etc . additional information can be provided in more specific embodiments , depending on the record - keeping requirements that pertain to the performance . thus , for example , if a performer has previously appeared in one or more other performances in which visual depictions of actual sexually explicit conduct were produced , such additional information might include the titles or identification numbers of such performances , the dates of the performances , and the legal and other names used by the performer at the times the performances were produced . provision of an accurate identification of the performer is of particular importance . thus , in more specific embodiments , the performer initially submits an identification , such a scanned picture identification card or other documentation . next , the identification so submitted is verified , for example by submitting or redirecting the identification to a verification site such as a database of verified identification documents . once the performer &# 39 ; s identification is verified , the performer provides additional information as described herein . in other more specific embodiments , the performer provides a verified identification , for example , a code associated with a file in a database of scanned images of verified picture identification cards . the information is provided , in particular embodiments , to a central site such as a database , or to a site maintained by a producer of the performance . once the information has been provided to the database or other site , the information is associated with the performance . thus , for example , the legal name and picture identification of a performer , together with other information such as the performer &# 39 ; s aliases or other names other than the performer &# 39 ; s legal name , are associated with the title or identification number , and the date , of the performance , for example by storage together in a file in a database . once the information has been associated with the performance , the associated information is then provided to a custodian . this can be accomplished , for example , by forwarding the associated information to the custodian via e - mail ; by providing the custodian with a hyperlink to a site at which the information can be accessed ; by providing the custodian with a hard copy of the information , including a print - out of the performer &# 39 ; s personal information and a copy of the performer &# 39 ; s scanned picture identification card ; or by other means . after the associated information is provided to the custodian , transmission of the performance to the viewer is enabled . transmission can commence promptly upon provision of the information to the custodian . in alternative embodiments , the viewer is provided with a statement prior to the transmission of the performance , for example by providing the viewer with a screen including a button which can be activated to access the statement ( see fig3 b ), the button can activate a link to a site maintained by the custodian in specific embodiments , or to a database maintained by another site . the contents of the statement can vary according to the record - keeping requirements to which the performance is subject . for example , the statement can include some or all of the associated information , such as the performer &# 39 ; s name ( s ) and the title and date of the performance , together with a location ( e . g ., a business street address ) of the custodian . once the viewer accesses the statement , transmission of the performance is authorized and commences . in still other embodiments , the statement is automatically provided to the viewer prior to transmission of the performance to the viewer . it may be desirable in certain communities to limit access to performances provided according to the present application . accordingly , in particular embodiments , the physical location of the user is ascertained , for example by gps means , and access to the performance via the network is controlled on the basis of the user &# 39 ; s location . such access control can be accomplished , for example , according to the methods disclosed in u . s . pat . no . 6 , 154 , 172 , to piccionelli et al ., the entire contents of which are incorporated herein by reference . in other particular embodiments , the viewer verifies that viewing the performance in the viewer &# 39 ; s physical location is legally permissible , for example by means of a button provided on a screen that provides a statement to this effect to a site controlling transmission of the performance over the network to the viewer . revenue - generating specific embodiments of the inventive method include the additional step of providing a viewer &# 39 ; s credit card account number to a site that controls transmission of the performance . in such embodiments , the viewer is charged a premium in order to view the performance , for example prior to transmission of the performance . fig2 illustrates a more specific method according to the invention . as described herein , the method is implemented by a performer of a live or previously recorded performance ; however , the method can also be implemented by other parties , such as producers , or by the performer together with one or more other persons . a performer initially provides an identification , such as a scan of a picture identification card , to a central site controlling transmission of a live performance over a network . the identification can be verified by the central site or by another site , or can be a pre - verified identification . next , the performer provides all names other than the performer &# 39 ; s legal name , if the performer has used such additional names . the performer also provides an identification of the performance , such as a title or identification number , and also a date of the performance , for example , the date on which the performance is to take place ( which can be the date of submission of the information , in particular embodiments ). the performer &# 39 ; s identification and name ( s ) are then associated with the identification and date of the performance , for example by storage together in a file in a database . the associated information is next provided to a custodian , for example by transmission via a network or by other means as previously mentioned . once the associated information has been provided to the custodian , the performance is then transmitted over a network to a viewer . in specific embodiments of the method illustrated in fig2 , the viewer is provided with a statement including the identification and date of the performance and the location of the custodian . according to very specific embodiments , the viewer is further enabled to download a copy of the performance . in such embodiments , the statement described above is incorporated in the download of the performance . a system useful in implementing methods according to the invention is illustrated in fig3 a - b . in fig3 a , a computer 10 is in communication with a video camera 12 and a scanner 14 . a performer employs scanner 14 to provide a scanned copy of a picture identification card to a central site 16 , and provides additional information such as the performer &# 39 ; s legal name , other names such as aliases , stage names , etc ., previously used by the performer , a title of a performance in which the performer is to appear , the date of the performance ( e . g ., the present date ), and , in particular embodiments , the titles and dates of other performances in which the performer has appeared together with a listing of aliases , stage names , etc ., used by the performer at the time of the prior performances . all of the foregoing information is provided to central site 16 , where it is associated , for example by storage in a file . the associated information is then provided to a site 18 maintained by a custodian . once the information is provided to the custodian , the performer commences the performance , which is transmitted over a network by means of camera 12 to a viewer . fig3 b illustrates an exemplary screen 20 including a box 22 presenting a disclaimer such as that described above , together with a button 24 which can be activated by a viewer in order to access a statement as described above . window 26 allows the viewer to view a performance as discussed above .
| 6 |
a laser guided parking assistance device and method of operation is disclosed . an example laser guided parking assistance device deploys an eye safe laser for assisting vehicle operators to park a vehicle at the desired position . in art example , the laser guided parking assistance device can be installed at a more accessible place than a ceiling of the garage ( e . g ., on the garage door itself ), making installation and maintenance or removal easy and convenient . for example , the laser guided parking assistance device can be mounted by an attachment ( e . g ., screws ) to attach the laser guided parking assistance device to a strut on a top panel of the garage door . in an example , the attachment can be implemented without needing tools ( e . g ., as a clamp or double - sided tape ). an example laser guided parking assistance device reduces electrical power consumption when the device is not in use , even down to zero power consumption . the lower power consumption also enables operation by battery power . in an example , the laser guided parking assistance device includes a tilt switch , a battery , and an electronic circuit . when the garage door is closed , the laser guided parking assistance device is in a vertical position . when the garage door is open , the laser guided parking assistance device is in a horizontal position near the garage ceiling . the tilt switch inside the device is arranged in the way that when the garage door is in the vertical position the tilt switch is opened and when the garage door is in the horizontal position the tilt switch is closed . when the tilt switch is open , the switch cuts off battery power to all of the electronics of the laser guided parking assistance device so that the device does not consumes electrical power . when the tilt switch is closed , the switch connects electrical power to the electronics of the device which turns on the laser for guiding vehicle parking . the tilt switch also enables a sensing function that is free of environmental and external interference , thereby increasing reliability of the laser guided parking assistance device . in addition , the laser is not activated by movement of pets or people , improving safety . when the laser is tuned on by the garage door having reached the horizontal position near the garage ceiling , the laser shines a light beam down to the garage floor . as a vehicle moves into the garage , the laser beam shines onto the hood of the vehicle and casts a laser light dot onto the hood . as the vehicle continues to travel into the garage , the laser beam shines onto the windshield of the vehicle . in an example , the laser guided parking assistance device is mounted at a position on the garage door such that the laser beam is shining onto the windshield slightly at an angle behind the windshield when the vehicle is reaching the desired position . this configuration causes the laser beam to be split into two laser beams by the glass of the windshield . one laser beam shines through the windshield and casts a laser light dot onto the dashboard of the vehicle . the other laser beam is deflected off of the windshield glass and casts a laser light dot onto a wall in front of the vehicle . when the vehicle is traveling to different positions , both laser light dots move to different locations . the driver can monitor either or both of the laser light dots as position references to park the vehicle at a desired position . in an example , the laser can also be turned off by a time delay circuit when the garage door is kept in an open position . the quiescent electronic current in this state is the leaking current of the electronic components in the circuit , which is typically no more than a few micro amps for most commercial electronic components . normal household batteries can hold power at this low level leaking current for years . the time delay circuit is reset when the garage door is closed . before continuing , it is noted that as used herein , the terms “ includes ” and “ including ” mean , but is not limited to , “ includes ” or “ including ” and “ includes at least ” or “ including at least .” the term “ based on ” means “ based on ” and “ based at least in part on .” fig1 illustrates a garage 1 with a closed garage door 2 ( in a vertical position ) with an example laser guided parking assistance device 10 mounted at the top of the garage door 2 . the garage door 2 can move along the tracks 3 and 4 . in an example , the laser guided parking assistance device 10 includes an orientation switch , such as a tilt switch . the tilt switch may be gravity actuated . that is , the tilt switch operates based on its orientation as determined by gravitational pull . the tilt switch may be arranged such that it is open ( no electrical current flow ) when the garage door 2 is in a vertical position , and the tilt switch is closed ( electrical current flow ) when the garage door 2 is in a horizontal position . in fig1 , the garage door 2 is shown closed and as such the tilt switch is in the vertical position and the tilt switch is open . power is turned off , and as such the laser is turned off . fig2 illustrates the garage 1 with an open garage door 2 ( in a horizontal position near the garage ceiling ) with the example laser guided parking assistance device 10 mounted on or near the top of the garage door . with the garage door 2 in the horizontal position , the tilt switch is closed and the electronic circuit of the laser guided parking assistance device 10 is powered on . in an example , the laser guided parking assistance device 10 is powered by a battery . the battery is sized sufficient to actuate a laser diode which generates a laser beam 20 . the laser beam 20 emits downward in the direction of the garage floor 5 . in an example , the laser guided parking assistance device 10 is mounted in a position on the garage door 2 such that the laser beam 20 is emitted at an angle selected to be a behind the windshield 6 of the vehicle 7 when the vehicle 7 is moving close to the desired parking position , it is understood that this angle can be adjusted for a generic vehicle and / or determined based on the specific configuration of the vehicle being operated ( e . g ., including vehicle height and angle of the windshield ). when the laser beam 20 hits the windshield 6 of the vehicle 7 , the laser beam 20 is split by the glass of the windshield 6 , and forms two beams 21 a and 22 a . light beam 21 a transmits through the windshield 6 and casts a laser light dot 21 b onto the dashboard 8 of the vehicle 7 . the laser beam 22 a is deflected off of the windshield 6 and casts a laser light dot 22 b onto the wall 9 in front of the vehicle 7 . accordingly , the driver ( or passenger ) can visually observe the position of the vehicle 7 relative to a desired parking area within the garage 1 . fig3 illustrates the vehicle 7 moving through different positions in the garage 1 and reflecting a laser light dot from the example laser guided parking assistance device 10 onto the all 9 in front of the vehicle 7 . in the example shown in fig3 , the vehicle 7 is shown moving from a position 30 to a position 31 . for the position 30 of the vehicle 7 , the deflected laser beam is illustrated by line 22 a and the laser light dot is shown at 22 b . for the position 31 of the vehicle 7 , the deflected laser beam is illustrated by line 22 c and the laser light dot is shown at 22 d . at the same time that the user sees dots moving on the wall from 22 b to 22 d , the laser light dot 21 b on the dashboard 8 of the vehicle also moves ( not shown ) to a new position on the dashboard 8 . in an example , marking can be provided by the manufacturer of the laser guided parking assistance device 10 to affix to the wall 9 and / or the dashboard 8 of the vehicle 7 . in another example , the driver may provide his or her own markings and / or simply remember the relative position of the dots with respect to the desired parking alignment . before continuing , it should be noted that the examples described above are provided for purposes of illustration , and are not intended to be limiting . other devices and / or device configurations may be utilized to carry out the operations described herein . by way of non - limiting example , the orientation of the switch may be reversed and the circuit wired accordingly . in another example , multiple lights may be provided and / or the position of the lights may vary . likewise , the light source is not limited to a laser and can be any suitable light source ( e . g ., led lighting ). these and other variations will be readily understood by those having ordinary skill in the art after becoming familiar with the teachings herein . fig4 is a diagram of an example circuit 100 to implement the laser guided parking assistance device . in an example , the circuit has only four components , simplifying the circuit , minimizing cost , and improving reliability . however , the circuit is not limited to any particular number of components . in an example , the circuit 100 includes a battery 110 to provide electrical power . the circuit 100 also includes a tilt switch 120 to turn power on and off in the circuit the tilt switch 110 may be opened or closed based on orientation of the switch . the circuit 100 also includes a laser diode 130 to generate and emit a laser beam . the circuit may also include a resistor 140 to set the electrical current flowing through the laser diode 130 and determines the output or brightness of the laser beam . fig6 is a diagram of another example circuit 200 to implement the laser guided parking assistance device , in an example , the circuit 200 includes a battery 210 to provide electrical power . the circuit 200 also includes a tilt switch 220 to turn power on and off in the circuit . the tilt switch 220 may be opened or closed based on orientation of the switch . the circuit 200 also includes a laser diode 230 to generate and emit a laser beam . the circuit may also include a resistor 240 to set the electrical current flowing through the laser diode 230 and determines the output or brightness of the laser beam . in addition , the example circuit 200 shown in fig5 implements a voltage regulator 250 to provide a regulated voltage to drive the laser diode 230 . as such , the brightness of the laser light is not affected by the battery voltage change over the time due to discharge , as long as the battery is still capable of providing an operating power for the laser diode 230 . in addition , the example circuit 200 shown in fig5 includes a time delay circuit to turn off the laser if the garage door is left in an open position . the time delay circuit may be implemented as an r - c time delay circuit including resistor 260 and capacitor 270 . if the garage door is left open , the capacitor 270 is charged through resistor 260 . when the voltage on capacitor 270 reaches a predetermined level , it turns off the mosfet switch 280 and therefore turns off the laser diode 230 . when the mosfet switch 280 is turned off , the quiescent current of the circuit is the leaking currents of the mosfet switch 280 and the capacitor 270 . these are typically only a few micro amps for most available commercial products . discharging at this rate , a standard aa battery can last for years . in addition , the example circuit 200 shown in fig5 may include a second tilt switch 290 . tilt switch 290 provides a quick discharge path for capacitor 270 when the garage door is closed . as such , the circuit 200 is ready to turn on the laser diode 230 again without delay after the garage door has been closed . in an example , the second tilt switch 290 is physically arranged in a perpendicular orientation relative to the tilt switch 220 . as such , the tilt switch 220 is closed when the garage door is closed , and the tilt switch 220 is open when the garage door is open . it is noted that the physical orientation of the switches 220 and 290 is not illustrated by the circuit diagram . fig6 is a diagram of another example circuit 300 to implement the laser guided parking assistance device . in an example , the circuit 300 includes a battery 310 to provide electrical power . the circuit 300 also includes a tilt switch 320 to turn power on and off in the circuit . the tilt switch 310 may be opened or closed based on orientation of the switch . the circuit 300 also includes a laser diode 330 to generate and emit a laser beam . the circuit may also include a resistor 340 to set the electrical current flowing through the laser diode 330 and determines the output or brightness of the laser beam . in addition , the example circuit 300 shown in fig6 implements a voltage regulator 350 to provide a regulated voltage to drive the laser diode 330 . as such , the brightness of the laser light is not affected by the battery voltage change over the time due to discharge , as long as the battery is still capable of providing an operating power for the laser diode 330 . in addition , the example circuit 300 shown in fig6 includes a time delay circuit to turn off the laser if the garage door is left in an open position . the time delay circuit may be implemented as an r - c time delay circuit including resistor 360 and capacitor 370 . if the garage door is left open , the capacitor 370 is charged through resistor 360 . when the voltage on capacitor 370 reaches a predetermined level , it turns off the mosfet switch 380 and therefore turns off the laser diode 330 . when the mosfet switch 380 is turned off , the quiescent current of the circuit is the leaking currents of the mosfet switch 380 and the capacitor 370 . these are typically only a few micro amps for most available commercial products . discharging at this rate , a standard aa battery can last for years . in addition , the example circuit 300 shown in fig6 may include a second tilt switch 390 . tilt switch 390 provides a quick discharge path for capacitor 370 when the garage door is closed as such , the circuit 300 is ready to turn on the laser diode 330 again without delay after the garage door has been closed . in an example , the second tilt switch 390 is physically arranged in a perpendicular orientation relative to the tilt switch 320 . as such , the tilt switch 390 is dosed when the garage door is dosed , and the tilt switch 390 is open when the garage door is open . it is noted that the physical orientation of the switches 320 and 390 is not illustrated by the circuit diagram . in fig6 , the circuit 300 is also shown including a solar battery 390 to provide electrical power . in an example , the solar battery 390 can be mounted on the window of the garage door , or the solar battery can be mounted on the outer side of the garage door . for example , if the garage door does not have glass windows , the solar battery can be installed on the outer side of the garage door . the solar battery 390 can be implemented in parallel with a standard battery 310 , or by itself . when implemented as shown in the circuit diagram of fig6 , diodes 391 and 392 may also be provided . the example circuits 100 , 200 , and 300 shown and described herein are provided only for purposes of illustration and are not intended to be limiting . other circuits ( simple or more sophisticated ) may be implemented , as will be readily understood by those having ordinary skill in the art after becoming familiar with the teaching herein . it is noted that the examples shown and described are provided for purposes of illustration and are not intended to be limiting . still other examples are also contemplated .
| 1 |
referring to the simplified diagram shown in fig1 which shows the main components forming a locating system according to the invention , the light - radiating object 1 is assumed to be situated in the reception field and to be radiating light waves in this field either directly or by reflection . these waves , or that fraction of the waves which is received by the optical receiver , form the useful radiation to be detected . the optical receiver consists of an optical focussing device represented by the objective 2 . the detecting device 3 is positioned parallel and close to the corresponding focal plane so that the image of the object is formed on it as a spot of predetermined diameter . in accordance with the invention , the detector 3 consists of a single photosensitive element . this element is connected to pre - amplifier and amplifier circuits indicated at 4 . the expected useful radiation , or at least the wave band in which it lies , is generally known . consequently , a selection operation is performed on the received radiation so as to eliminate ambient interference radiation , or at least the major proportion thereof ; this selection operation usually being performed by optical filtering using a filter device 5 inserted in the optical path . the detector 3 is preceded by a mask device 6 controlled by an arrangement 7 . the combination of 6 and 7 is so calculated as to cause sequentially at the detector 3 , a law of discontinuous illumination determined from the four measurement quadrants . the receiver circuits downstream of the amplifier 4 being arranged accordingly , the principle of operation of elements 3 and 6 will first be explained . fig2 shows the image of the object in the detection plane at c , the photosensitive area of the detector 3 defining the image of the observed field . this area may be circular as shown or may be of some other shape , such as rectangular for example . point o represents the location of the optical axis z of the system and ox and oy represent the reference axes for measurement . the co - ordinates es and eg of the centre of the spot c represent the amounts of aiming error in elevation and bearing respectively . the mask 6 is designed to produce one of the configurations 6a , 6b and 6c shown in fig3 and 5 . to simplify the explanation , it will be assumed that the configuration 6a of fig3 is produced which has a transparent zone corresponding to one measurement quadrant and an opaque zone corresponding to the three remaining quadrants . mask 6a is operated sequentially by the control circuit 7 so as to assume four successive operating states which are distinguished from one another by a rotation of π / 2 around the optical axis . these states are shown in fig6 at the successive times to , to + t , to + 2t , to + 3t , the initial state being repeated at time to + 4t and so on . if the corresponding amounts of detected light energy are called e1 , e2 , e3 , e4 respectively , the divergences es and eg are given by : es = ( e1 + e4 ) - ( e2 + e3 ), and eg = ( e1 + e2 ) - ( e3 + e4 ), assuming that the useful radiation received does not vary , i . e . the sum et = e1 + e2 + e3 + e4 remains substantially constant . consequently , the receiver circuits are arranged to produce four reception channels and to allow the aforementioned measurements es and eg to be made . they include a switching device 8 which is supplied with the detected signal after it has been amplified in circuit 4 , and which has four outputs . the switch 8 is operated by the control circuit 7 in synchronisation with the mask 6 so as to switch the detected signals s1 , s2 , s3 and s4 , corresponding to the above values e1 , e2 , e3 and e4 onto successive ones of the four output channels . these signals are applied , via high - speed memory circuits 9 to 12 which may consist of circuits of the sample - and - hold kind controlled by the circuit 7 , to a circuit 13 termed a divergence measuring circuit to measure the divergences , which circuit produces signals representing the aiming error in elevation es and in bearing eg . block 14 represents the ancillary user unit which may consist of a display device or of tracking means to slave the sighting axis z to the direction in which the object lies . also shown are an automatic gain control circuit at 15 to control a variable gain amplifier at 4 from signals representing the total amount of detected energy et , and a remotely situated emitter at 16 which illuminates the object 1 when the latter does not have a source to emit useful radiation to be detected . it will readily be appreciated that the configurations 6b ( fig4 ) and 6c ( fig5 ) allow divergence measurements es and eg to be made in the same way . in comparison with configuration 6a , twice as much energy is received in the case of 6b and three times as much as in the case of 6c in the course of a given sequence 4t . configuration 6c is thus the most advantageous of the three . it will be clear from what has just been said and from the sequential mode of operation of the mask 6 that when , in addition , the useful radiation is emitted in a pulsed fashion with a period of t , the system is particularly beneficial if reception is synchronised with the incident light pulses . the mask 6 is produced in the form of a static device produced by means of ceramics which exhibit transparent or birefringent properties when subjected to an electrical field . such ceramics cause the plane of polarization of incident light to be rotated by an angle which is a function of the locally established electrical field . the electrical fields are obtained by applying predetermined voltages to a circuit deposited on the surface of the ceramic . ceramics known by the abbreviation plzt have these properties . if a ceramic 20 of this nature , in the form of a plzt strip for example , is assumed to be arranged between two polarizers 21 and 22 which intersect at π / 2 , the resulting operation is that briefly described below with reference to fig7 and 8 . in the case of fig7 there is no applied electrical field and the incoherent incident light 23 is polarized by element 21 , the resulting polarized light 24 is not affected by the plzt strip and is stopped by polarizer 22 . by applying an electrical field e of predetermined magnitude as in fig8 the plane of polarization of the light 24 is rotated by π / 2 and the light then passes through the second polarizer 22 . such an arrangement is described inter alia in the journal &# 34 ; applied optics &# 34 ; volume 14 , no . 18 of august 1975 , on pages 1866 to 1873 on which appears an article &# 34 ; plzt electro - optic shutters application &# 34 ; by j . thomas cutchin , james o . harris and george r . laguna . to enable the four measurement quadrants to be selected in space , the circuit deposited on the plzt strip may be produced in the form shown in fig9 by means of electrodes forming interlocking arrays . the electrical field in the quadrant or quadrants concerned is produced by a dc source 30 and a combination of gate circuits 31 to 34 controlled by a circuit 35 . the connections shown correspond to operation with the configuration shown in fig3 . a simple permutation of the inputs to gates 31 to 34 would produce the preferred mask configuration of fig5 . the four states shown in fig6 are produced by operating the gate circuits 31 to 34 in succession by means of circuit 35 at times to , to + t , etc . the combination 30 to 35 corresponds to the control circuit 7 in fig1 . the switching circuit 8 may be produced in a similar fashion by means of four gate circuits 41 to 44 which are operated in succession by circuit 35 . the control outputs are shown separately from those intended for gate circuits 31 to 34 to indicate that there are delays due to the upstream circuits 6 , 3 and 4 . the gate circuits may for example be produced from field effect transistors . an embodiment of the control circuit 35 is shown in fig1 and fig1 relates to the operating waveforms . emission is assumed to be of the pulsed type . synchronization between the actuation of the mask 6 and the reception of the useful signal at emission period t is achieved by applying the detected signal s5 , after suitable amplification , to the control circuit 7 ( the connection shown as a broken line in fig1 ). in circuit 35 , the signal s5 ( fig1 a ) is compared with a predetermined positive threshold vs1 in particular to allow for the noise level . the comparison takes place in a comparator 45 of the logic - output kind which emits a signal s6 ( fig1 b ). in addition , the signal s5 is applied to a differentiating circuit 46 whose output signal s7 ( fig1 c ) is compared with a negative threshold - vs2 in a second logic - output comparator 47 . the comparison outputs s6 and s8 ( fig1 d ) are applied to an and circuit 48 whose output signal s9 ( fig1 c ) is applied to a first delay circuit 49 . the latter is calculated to produce a delay t1 equal to the emission period t less the response lag t2 resulting from the combination of the immobile mask 6 , the detector 3 and the amplifier 4 , the lag t2 being mainly due to the mask device 6 . the value of t2 is also adjusted in such a way that the resultant signal s10 ( fig1 f ) is approximately central to the useful signal s5 subsequently obtained . a matching circuit , such as a monostable device , may be provided to adjust the length of this signal to that ti of the emitted pulse . the signal s10 is applied to a logic circuit 50 which counts up to four , followed by a four - output decoding circuit 51 to identify the four successive values of count . the outputs of the decoder 51 control respective ones of the gate circuits 31 to 34 ( fig9 ). the signal s10 is also applied to a second delay circuit 52 where it is subjected to a delay equal to the aforementioned lag t2 . the resulting signal s15 ( fig1 g ) is processed in the same way by means of a count - up - to - four circuit 53 followed by a decoding circuit 54 to produce the outputs for controlling the gate circuits 41 to 44 ( fig9 ) and the sample - and - hold circuits 9 to 12 ( fig1 ). in fact , additional delay circuits which are not shown may be inserted in the control connections to circuits 9 to 12 to allow for the delay due to gate circuits 41 to 44 and to ensure that the sample - and - hold circuits select the peak value of the useful signal s5 . the form taken by the circuits 9 to 12 of fig1 depends upon whether the mode of emission is continuous or discontinuous . the function of these circuits is to store the value of the detected signal until the next operating sequence , each sequence lasting for a period of 4t during which the mask assumes its four successive operating states . fig1 is a diagram of an embodiment of the measuring circuit 13 of fig1 which , from the signals s11 to s14 representing the respective detected levels in the four operating states , produces signals representing the co - ordinates for the bearing divergence eg and elevation divergence es of the object 1 . these signals are produced by calculating the ratios : ## equ1 ## when the optical configuration of the mask is that shown either in fig3 or fig5 . these ratios are calculated by means of elements which , as shown , consist of differential amplifying circuits 70 , 71 and 72 , adding circuits 73 and 74 , and dividing circuits 75 and 76 . elements 70 to 76 may easily be formed by means of integrated circuits . in fact the values of the aforementioned ratios when obtained , have been multiplied by a coefficient which corresponds to the gain of the systems represented by 70 , 71 , 73 and 75 in the case of bearing . when the configuration of the mask is that of fig4 the divergence signals are given by simpler formulae , the numerators becoming s11 - s13 for the bearing divergence and s14 - s12 for the elevation divergence , and circuit 13 is simplified to the extent that elements 72 and 73 are not needed under these circumstances . the signal s16 which is intended for the agc circuit 15 ( fig1 ) to allow the receiver gain to be controlled may be formed by the sum output . the agc circuit is produced by known techniques and operates by threshold comparison for example to produce a signal for controlling the gain of amplifier 4 . the outputs es and eg may be applied to slaving circuits 77 , 78 to produce a desired technical effect , for example automatic tracking by adjusting the line of sight z in directions x and y . in the application to a homing head which is envisaged , the slaving circuits 77 , 78 control members such as ailerons 79 , 80 to control the direction of the missile . this control will be exercised in particular as determined by the type of operation selected , such as proportional navigation or tracking navigation . the static mask arrangement has further advantages . the range of control provided by the applied voltages allows one or more quadrants to be rendered opaque or transparent ; all the quadrants may thus be rendered opaque or transparent . this property is useful in the case where the application is to a homing head since the whole of the mask device may thus be made transparent to produce an initial locking - on or acquisition phase . by way of example , fig1 shows an embodiment of a locking - on arrangement . a sample - and - hold circuit 60 receives the detected and amplified signal s5 and is controlled by the output s6 of the previously mentioned comparator 45 . the output signal s20 from the sample - and - hold circuit is compared with a positive threshold vs3 in a logic - output comparator circuit 61 . threshold vs3 is made lower than the threshold vs1 for comparator 45 . comparator 61 is followed by an inverter circuit 62 whose output is applied simultaneously to first inputs of four or circuits 63 to 66 . these or circuits have second inputs which are supplied by respective outputs of decoder circuit 51 ( fig2 ). operation is as follows : if signal s5 is lower than the detection threshold vs1 , sample - and - hold circuit 60 is not actuated . if it is assumed that the signal s5 also fails to reach the threshold vs3 , the or circuits then receive a &# 34 ; 1 &# 34 ; signal at their first inputs . the result is that gates 31 to 34 are all actuated simultaneously and terminals 26 and 29 of the mask ( fig9 ) all receive a supply , the mask being made completely transparent . as soon as the level of s5 exceeds vs1 , circuit 60 is actuated and the or circuits are then operated in succession by the corresponding &# 34 ; 1 &# 34 ; outputs from the decoder to cause the mask to operate normally . in the event of the lock - on being lost , that is to say when the useful signal drops below vs1 for a number of cycles t , circuit 60 is no longer actuated and signal s20 gradually declines in a discharge process . as soon as the level of s20 becomes lower than vs3 , all the gate circuits 31 to 34 are again operated by the outputs of or circuits 63 to 66 . this general actuation ceases when lock - on again takes place . the arrangement is made such that a loss of lock - on is recognized after a delay of at least four periods t . it may in fact be that , in the case of a mask as shown in fig3 the image spot forms in only one quadrant and there is no useful signal during three successive periods . the locking - on arrangement is prevented from operating at the wrong time by fixing the following parameters : the emission period t , the threshold vs3 and the selection of the sample and hold circuit 60 . for applications to automatic target tracking , the emitter may be mechanically attached to the receiver and may move conjointly therewith . another possibility is a separate emitter which is trained on the target independently by suitable means . likewise , applications may be envisaged in which the emitter is on board the target and emits in a virtually omnidirectional or low - directivity pattern . in other applications , the emitter may be positioned in isolation from the receiver near to or remotely therefrom , the receiver being on board a moving vehicle which is to be steered toward a predetermined target . in conclusion , the respective positions of the emitter section and the receiver section depend mainly on the application envisaged and may take various forms among which are those described and those mentioned above . in certain of these embodiments , the system may possibly include means for generating a range - finding window so that the target is only detected within a restricted range band as far as the receiver is concerned . the term light - radiating object should not be considered as a restriction to the visible spectrum and it also covers , in particular , the infra - red range . the choice ceramic material for use in producing the static mask depends in particular on the spectral waveband intended for operation . the plzt ceramics which were taken as an example allow operation in the visible and near infra - red spectrum up to 2 to 3 microns . it is also understood that the embodiment described is not to be considered as exhaustive and that it is capable of modifications conforming to the features of the invention and which also form part of the invention .
| 6 |
an apparatus and a system according to the present invention are suitable as a display using an flcd ( ferroelectric liquid crystal ) imparted with a memory function and can allow use of both a partial writing method of realizing moving display such as a mouse or a cursor and a total - refresh scanning driving method . a partial writing method used in the present invention is basically performed as follows . 1 when a drawing request requires partial writing , total refresh is interrupted , and a partial write area on a screen is scanned in a non - interlace manner . an actual operation is not so simple as described above but requires the following recognitions : this recognition will be described below by taking fig2 as an example . fig2 illustrates four events , i . e ., three independent windows and a moving mouse font . a window 1 displays a clock , a window 2 displays a rotationally moving line , and a window 3 displays vertical scrolling of characters . the respective windows have different display speeds and display asynchronous with each other ( independent events ). since a one - line access time of an flcd remains unchanged , provided that a temperature is constant , a time ( scanning time ) required to perform each window display by partial writing is proportional to the size of a partial write area . if partial writing is generated in one window while partial writing is executed in another , one of the windows partial writing of which is executed prior to the other must be determined . for this reason , a priority order for partial writing operations must be predetermined when an event occurs so that the priority order is recognized to perform processing by predetermined procedures each time partial write request is generated . for example , the priority order is determined such that partial writing during scroll display is interrupted , clock display partial writing is performed , and then the interrupted partial writing is restarted , and procedures between the respective partial writing operations are determined accordingly . the concept of priority order is unsatisfactory in a multitask system such as a unix / x - window . in such a system , several requests simultaneously access partial writing and are stored in host queues ( fig1 ). thereafter , these requests are transferred from the respective host queues to a queue buffer of a server either via a network or internally . in this case , however , the requests are set in the buffer of the server while their drawing order to a vram is held . therefore , the priority order does not work well because the requests are processed in accordance with the drawing order . for example , although &# 34 ; mouse &# 34 ; has the highest priority , if a large number of image drawing requests to the vram are present before the mouse request , the mouse request is not executed until the foregoing requests are finished . that is , the mouse request cannot have the highest priority order in this multitask system ( fig2 ). to solve the above problem , a graphic scheduler is introduced . this scheduler functions to give a proper priority order for partial writing to a request from a queue of a host ( fig2 ). the basic concepts of the flcd h / w interface of the present invention are as follows . 1 the start , the end , and the number of a group of continuous lines accessed to a vram are calculated , and the data is stored in a &# 34 ; stack &# 34 ;. 2 several groups are simultaneously detected for each period ( different from the s / w case ). 3 in the &# 34 ; stack &# 34 ;, a margin for a certain time can include the above several groups . fig1 is a block diagram showing an apparatus of the present invention , in which a register for catching access information to a vram is illustrated . this information is transferred to an external circuit to count the number of partial writing operations or is transferred to another memory . fig2 shows a multistack for obtaining a priority order in the present invention . a stack 1 stores a partial write area for every t ( interval of time ) which is measured from a monitoring starting time n . on the other hand , a stack 2 basically stores a partial write area for every 2δt in order to obtain a priority order . as indicated in fig7 for example , letters a , b , c , d , e , and f correspond to scanning lines . further , &# 34 ; clock 1 &# 34 ; in fig2 corresponds to &# 34 ; stack 1 &# 34 ;, with the vertical lines indicating time signals n , n + δt , etc . at which address data is stored into stack 1 , as shown . similarly , &# 34 ; clock 2 &# 34 ; corresponds to &# 34 ; stack 2 &# 34 ; and address data is stored into stack 2 in sync with the vertical lines of clock 2 . in this case , the depth level of each stack is not determined . fig3 shows switching timings between partial writing and refresh in the present invention . a value b represents the number of switching times at which a screen must be refreshed . if a , which corresponds to a cumulative number of accessed lines , exceeds b , all of partial writing operations must be interrupted to maintain a screen image by refresh . in a current flcd , however , it is difficult to set a fixed b . fig4 shows two signals par and ref for performing switching between partial writing and refresh in the present invention . referring to fig3 a new gsp is controlling switching between partial writing and refresh . in a gsp ( tradename : available from texas instruments ), the value &# 34 ; b &# 34 ; for an flcd cannot be recognized , and the end of refresh in continuous partial write requests cannot be determined . therefore , this partial write h / w supplies the signal par to a new flcd controller , and the flcd controller supplies the signal ref to the h / w to perform refresh , independently of each other . fig5 a schematic diagram for the purpose of conceptual explanation , shows several pieces of hardware of the present invention . double buffers are preferably used in a sampling register and a memory register . each register is constituted by a large number of f . f . s ( flip - flops ) or a static memory . when f . f . s are used , a read register is serially reset ( fig5 ). when a static memory is used ( fig6 ), however , another hardware must be used to serially read data , and data &# 34 ; 0 &# 34 ; must be overwritten at all addresses by still another hardware upon resetting . fig6 shows a static memory used in the present invention . an accessed line address is assigned to an address of the static memory . data &# 34 ; 1 &# 34 ; is set at a memory address assigned to an accessed line address . when a gate is turned off , control is performed such that an address is automatically assigned to an auto - address generator . upon resetting , an auto - data generator overwrites data &# 34 ; 0 &# 34 ; at all addresses of the memory while assigning addresses . a case 1 shown in fig7 shows a practical multi - register arrangement . in this case , only one request is generated , and processing is performed at the highest speed . a case 2 shown in fig8 shows another arrangement at a middle speed . a case 3 shown in fig9 shows an arrangement at high and middle speeds . a case 4 shown in fig1 shows an arrangement at a plurality of speeds . this arrangement has two windows which scroll at different speeds . this condition is strict for partial writing . a case 5 shown in fig1 is similar to the case 4 except that the sizes and positions of two windows on a screen are different from each other . this condition is also strict for partial writing . a case 6 shown in fig1 is similar to the case 3 except that the scroll speed of the case 6 is different from that in the case 3 . this condition is also strict for partial writing . a case 7 shown in fig1 is still another arrangement of the case 3 , in which an improved method of obtaining a priority order is used . a case 8 shown in fig1 is still another arrangement of the case 4 . this arrangement has two windows which scroll at different speeds . also in this case , an improved method of obtaining a priority order for partial writing is used . a case 9 shown in fig1 shows another arrangement of the case 5 , in which an improved method of obtaining a priority order is used . this case is no longer hard as compared with the foregoing partial writings . a case 10 shown in fig1 shows another arrangement of the case 6 , in which partial writing is no longer hard as compared with the foregoing cases . also in this case , a timing chart shown in fig1 is used . fig1 shows a sequence and switching of actual partial writing and refresh in the present invention according to the arrangement shown in fig1 . sampling timings and request timings with respect to stacks will be described below . referring to fig1 , actual sampling timings of stacks 1 and 2 are shifted from each other . access requests such as a - b , c - d , e - f , and g - h accompanying movement of a circle are detected in the sampling time of the stack 1 , and scroll requests are detected in the sampling time of the stack 2 . since long partial writing has a priority to short one , the final result as partial write information is obtained as shown in fig1 . 2 partial writing is executed for moving circles a - b and c - d . 3 since the end timing of the a - b and c - d partial writing is before an examination timing of the next partial writing , the stack 1 is in a data indefinite state , and the stack 2 is sampling . therefore , refresh is executed . 4 when partial write data are determined , the respective stack data are compared with each other , and partial writing of sampling data of the stack 2 , a - h , and a scroll request is executed . fig1 shows a practical example for explaining an actual sampling h / w in an flcd interface according to the timing chart shown fig1 . referring to fig1 , a scrolling image and a moving circle are present on a screen . a vram is constituted by 1 m × 8 bits . the size of the circle is 100 × 100 bits , and the scroll size is 1 k × 1 k bits . therefore , times required for the moving circle and the scrolling window are 0 . 125 msec . and 12 . 5 msec ., respectively . the circle moves every 25 msec ., and scrolling is performed every 100 msec . types of access to the vram are actually read access and write access . strictly speaking , the write access is actually required in terms of partial write control . fig2 shows an example of copying one window to the other . in this case , a copy source window is accessed to the vram in a read cycle , and a copy destination window is accessed in a write cycle . actually , partial writing is started at only the copy destination and need not be performed at the copy source . partial writing is always performed after the access to the vram in the write cycle and need not be performed in the read cycle . if both the read and write cycles are used to detect access to the vram , time consumption for partial writing is doubled . as described above , the flcd requires a scheduler under the multitask . in a hardware interface , long partial writing has a priority , or partial write data latched at the start timing of partial writing has a priority . in addition , until one partial writing cycle is finished , another partial writing cycle is not accepted . therefore , an order of actually generated partial write requests is uniformed during the sampling period , and partial writing operations are simultaneously executed thereafter . for this reason , a priority order of each event is determined based on a size relationship between physical partial write areas by the hardware of item 1 ! above , and simultaneous partial writing operations are superposed within a certain period . therefore , scheduling of the partial write request order at this timing is assumed to be completed . as described above , the flcd partial writing mainly requires two items , and these two items must have the same function in the hardware interface . the item 1 ! is related to a priority order , and the item 2 ! is related to a scheduler . ( the scheduler of item 2 ! above has no clear arrangement but is included in the hardware of item 1 ! and has a function different therefrom .) as shown in fig1 , 3 , and 5 and the basic concept , allocation of priority orders can be obtained by an h / w using the following procedures . 2 with respect to the scan direction , y line accessed to the vram is detected by the registers during the respective sampling periods ( by using the double buffer technique as shown in fig5 ). the sampling period is , e . g ., a maximum of 25 msec . 3 obtained data are serially transferred to an external circuit . a transfer clock is , e . g ., 10 mhz ( fig2 ). 4 the external circuit checks whether the accessed y lines are only one line or a block having start and end addresses , and calculates the number of accessed lines / blocks or the total number of accessed lines . that is , the serial data is converted into parallel data , and the accessed continuous block in the registers is obtained in an external memory called stacks . 5 these detected data for partial writing are stored in the respective stacks at different sampling periods , e . g ., 25 msec . and 50 msec . a stack having two or more sampling periods can be made ( fig3 and 4 ). 6 if an image is to be held on a screen while partial writing is continued for a long time period or permanently , the total number of accessed lines must be monitored . however , it is difficult to set b fixed through hardware for the following two reasons . b is a limiting value with respect to the total number of accessed lines to be monitored . b is probably smaller than the total number of scan lines because if b exceeds the total number , an access time for this partial writing exceeds a frame period . in other words , non - interlace is caused by partial writing over the frame period . for this reason , flicker is easily caused . in addition , since the frame period changes due to a temperature dependency of the flcd , b changes in accordance with temperatures . therefore , no fixed value b can be set . the other reason , which is important , is that a refresh stop timing must be known during partial writing . this stop timing is also variable due to the temperature dependency of the flcd . to solve these problems , two control signals par and ref are used in the flcd h / w interface . there are two ideas of allocating priority orders . the cases 1 to 6 show several examples using an invention that the fastest partial writing has the first priority order . in this description , assume that the pixel size of the flcd is 1 , 024 ( vertical )× 1 , 280 ( horizontal ) and the frame frequency ( refresh rate ) at an ordinary use temperature is 20 hz . the plurality of registers described above are designed to distinguish priority orders . however , a care must be paid to the cases 3 to 6 for allocating priority orders well . the cases 3 to 6 suggest that very strict limitations are necessary . a register 1 detects the fastest movement of , e . g ., every 25 msec . (= 40 hz ). a register 2 detects the second fastest movement of , e . g ., every 50 msec . (= 20 hz ). a register 3 , if present , detects the third fastest movement of , e . g ., every 100 msec . (= 10 hz ). although it is assumed that a register 4 detects a movement of every 200 msec . or more , the register 4 is meaningless because refresh of the flcd is performed at 20 hz or less ( 50 msec . or more ). the register 3 is unnecessary for the same reason . thereafter , the data move to the respective stacks as shown in fig2 . in the cases 1 and 2 , the respective movements are detected and displayed well because there is only one movement in each case . however , care must be exercised when different movements are simultaneously present as in each of the cases 3 to 6 . if the fastest register for partial writing has the highest priority order as described in each drawing operation , it is understood that a very strict limitation is present to complete a plurality of partial writing operations . that is , the frame frequency of the flcd must be higher than the highest sampling frequency , i . e ., 25 msec . (= 40 hz ), and this is impossible in this flcd . an opposite assumption with respect to priority order allocation must be made ( cases 7 to 10 ). that is : the priority order is &# 34 ; stack 2 & gt ; stack 1 &# 34 ;. in other words , until the longest partial writing with respect to an flcd panel is finished , the stack 1 does not affect the partial writing . this will be described in more detail below . ( the cases 1 and 2 are not affected by this new assumption because only one request is present in each case ). in the case 7 , on the basis of the new partial writing priority order allocation assumption , the fastest moving object is not continuously displayed but sometimes displayed or skipped and displayed . in the case 8 , the movement of the stack 1 is skipped as in the case 7 . in the case 9 , the same result as in the case 8 is obtained . in the case 10 , the same result as in the case 7 is obtained . the operation is performed well in all cases ( cases 7 to 10 ) regardless of the speed of the flcd because until the longest partial writing is finished , another partial writing is interlaced . therefore , the conventional problem cannot arise . the last invention about priority order allocation is an actual execution manner . in the above description , it is assumed that partial write data is instantaneously detected by the register and stored during the sampling period . in actual processing , however , a certain period must be consumed in sampling . in addition , the flcd must have a scheduler for requests simultaneously generated especially under the multitask . therefore , the h / w flcd interface operates , for example , as shown in fig1 . referring to fig1 , an actual sampling time of the stack 1 is 12 . 5 msec ., and that of the stack 2 is 25 msec ., i . e ., twice that of the stack 1 . during these periods , it is assumed that the gates to the detectors ( registers ) are &# 34 ; on &# 34 ;. each register detects and stores an accessed line address . the sampling interval of the stack 1 is 25 msec ., and that of the stack 2 is 50 msec . as parameters in fig1 , fig1 and the case 10 described above are used . two images are present on a screen : one is an image of a circle moving at a high speed ; and the other , a scrolling window . the circle moves every 25 msec . (= 40 hz ), and the scroll speed is every 100 msec . (= 10 hz ). the access time of a vram per bit is 100 nsec / bit ( this speed is considerably higher than other speeds ). in this case , eight bits can be simultaneously accessed . therefore , one - screen access of the window can be completely detected within the sampling time of 25 msec . of the stack 2 . in addition , since the scroll speed is 100 msec . while the sampling interval is 50 msec ., partial writing of one scroll screen can be started after the detection . on the other hand , since two accesses of delete and write are performed as a unit for the circle to display one movement thereof : ## equ1 ## therefore , one moving display access cycle can be completely detected within the sampling time of 12 . 5 msec . of the stack 1 . in addition , since the sampling interval is 25 msec ., at least one moving display partial writing cycle can be started for a circle having a moving speed of 25 msec . a case in which scrolling and a circle are simultaneously present will be described below . this case corresponds to the case 10 . in the description of fig1 , when partial writing of the stack 2 for larger partial writing is to be started , a scrolling window includes image information of a circle present on the screen . partial writing of the circle moving during scrolling is displayed in accordance with information from the stack 1 . if the end of partial writing comes before comparison between the stacks and both the stacks have indefinite sampling data or are executing sampling , refresh is performed until the next comparison time (= 3 ). when the next partial write time comes , partial writing is started by interrupting the refresh . if no partial write data is present , the refresh is , of course , continued until the next partial writing is detected . according to the present invention , compatibility with respect to a crt display system is improved by simultaneously displaying partial scrolling and a mouse movement .
| 6 |
while this invention may be embodied in many different forms , there are described in detail herein a specific preferred embodiment of the invention . this description is an exemplification of the principles of the invention and is not intended to limit the invention to the particular embodiment illustrated fig1 shows a first profile element 10 that possesses a flat basic section 12 as well as two laterally angled side sections 14 . at the transition between the basic section 12 and side section 14 , there are provided two bars 16 which extend continuously in the longitudinal direction of the profile element . the free end of the side area 14 is approximately at the height of the free end of the bar 16 so that the outer edge of the side area and free end of the bars lie in a plane . the luminous layer 18 is poured into the seat of the first profile element 10 formed by the basic section 12 and bars 16 . the luminous layer 18 is continuously poured into the profile element in a liquid state and cures therein . with the curing of the luminous layer in the profile element , the materials form a connection that holds the luminous layer in the profile element with a connecting force . this connecting force is derived from an integral bond . by surface treating the recess , the silicone material cross - links with the material of the profiled strip when it cures . preferably , only one layer of the silicone material is introduced into the profiled strip . it is not necessary to use several layers of silicone material since the pigments can be prevented from disadvantageously settling on the bottom of the luminous layer by adjusting , according to the invention , the viscosity and particle size of pigments ; instead , they are distributed substantially evenly in the silicone in advantageous manner . the profiled strip is preferably made of a polycarbonate ( pc ) material . the first profile element 10 with the cured luminous layer 18 is connected to the second profile element 20 . the second profile element 20 has a recess 22 that is delimited by side sections 24 . the line of the contour of the side sections 24 corresponds in its shape to the curved side sections 14 so that the surface of the first profile element 10 lies against the second profile elements 20 . the second profile element 20 has a smooth bottom side and can be additionally equipped with means for connecting to the base . a pc plastic can also be provided as the material for the second profile element 20 . in contrast to the first profile element 10 , it is unnecessary for the second profile element 20 to be designed transparent or translucent . the recess 22 in the second profile element 20 is dimensioned such that a frictional connection arises between the bars 16 and the insides of the side sections 24 . in addition to the frictional connection , the side sections 16 can be integrally connected , i . e ., adhered or welded , to the side sections 24 of the other profile element . in fig2 , the side section 14 is additionally provided with a bar 26 . the side section 24 of the second profile element 20 also has a recess 28 in which the bar 26 is arranged . as is the case with the connection described with reference to fig1 , additional bars and 16 can be seated clamped in the recess 28 . these can also be adhered . fig3 shows an embodiment in which a first profile element 30 is fastened to the second profile element 36 by means of a snap connection . as is the case with the versions shown in fig1 and fig2 , the first profile element 30 is equipped with a recess delimited by bars 16 that is filled with a luminous layer 18 . the side area of the first profile element 30 has a projection 32 that grips behind a catch 34 of the second profile element 36 . fig4 shows another embodiment in which a first profile element 38 has bars 40 that delimit the side of the recess for accommodating the luminous layer 42 . on their side facing the side sections 43 , the bars 40 possess a beveled sidewall 44 . the second profile element 46 possesses a second recess in which the bars 40 with the luminous layer 42 are inserted . the second recess is delimited on the side by a side section 48 that has a beveled sidewall 50 . between the sidewalls 44 and 50 there is an air gap 52 that also extends below the free end of the bar 40 . the air gap allows the bar elements 38 and 46 to be connected with a sufficient production tolerance . in addition , the air gap 52 gives the bar element 38 sufficient play when it is loaded from above . between the luminous layer 42 and the second profile element 46 is a reflective layer 54 that for example is designed with a white color , and reflects the light from the luminous layer back into it . such a reflective layer can also be seen in the embodiments in fig1 to 3 . the side sections 48 and 43 are integrally connected by adhesion and / or welding to each other . a double - sided adhesive tape , for example , can also be provided for adhesion . the production procedure in fig5 will be further explained below . the first profile element 60 is shown on the left side in fig5 , and it is continuously unwound off a drum 62 . the first profile element 60 that is designed as an upper shell can be processed as a continuous profile element in the production procedure shown in fig5 . in a following step 64 , the profile element 60 is irradiated with laser light . a labeling laser with a relatively low output can be used to do this which serves to apply a part number or another identification . in a following step 66 , the seat for the silicone material provided for the first profile element is exposed to flame . the flame prepares the first profile element for subsequently accommodating the silicone mixture . in a procedural steps 68 , the silicone mixture is introduced into the first profile element 60 . the silicone mixture is introduced in a substantially liquid form , and the pigments are kept from falling or settling too much by adjusting the viscosity of the silicone mixture . in a subsequent step 70 , the silicone mixture introduced into the first profile element undergoes infrared irradiation . this achieves a good preliminary cross - linking of the silicone material in the first profile element 60 , whereby the dimensional stability of the luminous layer increases . as in fig5 , the silicone mixture can be subjected directly to infrared radiation . alternately or in addition , it is also possible to expose the silicone mixture introduced in step 68 to infrared radiation through the transparent first profile element . in a following procedural step , the second profile element 72 is wound off of a drum 74 . the second profile element 72 is applied on the first profile element 60 and seals it . if an additional reflector layer is to be introduced between the luminous strip and seconds profile element , this additional reflector layer can be introduced between steps 70 and 72 . in a subsequent step 76 , the two profile elements 60 and 72 are welded . a stationary laser can be used for the welding 76 of the profile elements that continuously welds the profile elements to each other along their edge . in a subsequent procedural step 78 , a continuous adhesive strip 80 is applied to the top side of the second profile element 72 . the adhesive strip 80 can for example be designed in the form of a double - sided adhesive strip by means of which , after a protective film is removed from the adhesive surface , the finished escape route marking can be adhered to the base . an automatic quality check occurs in a subsequent step 82 . the automatic quality check 82 is continuous and ongoing during production . the quality check 82 can for example optically inspect the weld seams between the first and second profile element , the thickness of the introduced silicone material , or the arrangement of the adhesive strip 80 . in a following procedural step 84 , the continuously produced escape path markings can be cut into a predetermined length so that they can then be transported by a cart 86 . the above - described procedure in which the profile elements are joined by a static laser past which the workpiece continuously moves allows continuous , endless production of an escape route marking . the resulting advantage is that the escape route markings can be created in different lengths during production to thereby provide the desired length of escape route marking for later installation . this completes the description of the preferred and alternate embodiments of the invention . those skilled in the art may recognize other equivalents to the specific embodiment described herein which equivalents are intended to be encompassed by the claims attached hereto .
| 8 |
compositions suited for practicing this invention are the 3 - nitrobenzotrifluorides and 4 - halo - 3 - nitrobenzotrifluorides . with respect to the halobenzotrifluorides , the halo groups can be any of the halogen atoms but preferably chlorine is the preferred halogen atom for herbicidal synthesis . it has been found that both the 3 - nitrobenzotrifluoride and 4 - halo - 3 - nitrobenzotrifluoride composition and particularly 4 - chloro - 3 - nitrobenzotrifluoride is stable to hydrolysis under nitration conditions when the sulfuric acid is present in a concentration below about 65 mole percent . when the concentration of sulfuric acid exceeds about 65 mole percent , the rate of hydrolysis of the nitrobenzotrifluoride increases rapidly . in other words , the rate of nitration is much faster than the rate of hydrolysis at nitration conditions when the sulfuric acid is present in less than 65 mole percent . thus if the concentration of sulfuric acid exceeds about 65 mole percent in the nitration reaction , e . g ., 70 percent , the rate of the competing hydrolysis reaction increases substantially and thereby reduces the amount of product . on the other hand , if the nitration is carried out with mixture containing less than 65 mole percent and preferably from 50 to 60 mole percent sulfuric acid , the rate of hydrolysis of the nitrobenzotrifluoride is negligible compared to the rate of dinitration . the dinitration reaction should be carried out at a temperature of from about 40 ° to 150 ° c . preferably the temperature for dinitration is from 90 ° to 110 ° c . as the 3 - nitrobenzotrifluoride and 4 - halo - 3 - nitrobenzotrifluoride compositions are quite stable to hydrolysis at this temperature . for example , the half life of 4 - chloro - 3 - nitrobenzotrifluoride at 100 ° c . in a mixture containing 60 mole percent sulfuric acid is about 5 hours . the corresponding dinitrochlorobenzotrifluoride has a half life greater than 24 hours . thus , at these temperatures it is possible to achieve a rate of nitration sufficient for generating the more stable dinitrobenzotrifluoride and dinitrohalobenzotrifluoride in good yield . nitration of the 3 - nitro - 4 - benzotrifluoride and 4 - halo - 3 - nitrobenzotrifluorides is carried out by contacting the nitrobenzotrifluorides with a material capable of generating nitronium ions . generally , most nitration reations are carried out by employing nitric acid as the nitrating agent . however , it is known that nitric acid can be generated in situ to minimize the amount of water present in a nitration medium by employing an alkali - metal nitrate and converting this nitrate to nitric acid by contacting it with an acid e . g ., sulfuric . the following examples are provided to illustrate preferred embodiments of the invention and are not intended to restrict the scope thereof . the preparation of 4 - chloro - 3 , 5 - dinitrobenzotrifluoride is effected by first forming a mixture containing 3 . 04 moles nitric acid , 6 . 55 moles sulfuric acid and 1 . 18 moles water . the mixture is prepared by mixing white fuming nitric acid ( approximately 90 percent nitric acid ) with 100 percent sulfuric acid . this mixture is charged to a 1 liter morton flask containing 1 . 01 moles of 3 - nitro - 4 - chlorobenzotrifluoride . the reaction is carried out by agitating with a turbine type stirrer rotated at 1 , 000 rpm and at a temperature of about 110 ° c . for 14 hours . at the end of a 14 hour period , the reaction medium is cooled to about 60 ° and the acid and organic phases separated . the organic phase is washed with water to remove any water soluble salts and acids therein . a small amount of 4 - chloro - 3 , 5 - dinitrobenzotrifluoride is recovered from the spent acid by extracting with chloroform . thin layer chromotography shows that about 3 to 4 percent of 4 - chloro - 3 , 5 - dinitrobenzoic acid is present in the product . these results show that very little hydrolysis of the product occurrs during the nitration reaction thus showing the stability of the nitrobenzotrifluoride in a nitrating mixture containing approximately 60 hole percent sulfuric acid . the yield of the desired dinitrobenzenetrifluoride product is about 88 percent of the theoretical based on the 4 - chloro - 3 - nitrobenzotrifluoride charged . a 4 - chloro - 3 , 5 - dinitrobenzotrifluoride product is prepared by adding 1 mole of 4 - chloro - 3 - nitrobenzotrifluoride to a nitrating mixture containing 3 . 04 moles nitric acid , 10 . 13 moles sulfuric acid , ( 59 . 9 mole percent sulfuric acid ) and 3 . 72 moles water based on the mixture formed by mixing 94 percent ( by weight ) sulfuric acid in water obtained from a reconcentration process for sulfuric acid with 98 percent ( by weight ) nitric acid . the nitration reaction is carried out at about 110 ° c . with vigorous agitation . the 4 - chloro - 3 - nitrobenzotrifluoride is added to the mixture over a period of about 2 hours and the reaction is permitted to continue for 12 hours with additional heating . at the end of a 12 hour period , the mixture is cooled and the organic layer containing the desired 4 - chloro - 3 , 5 - dinitrobenzotrifluoride is separated and washed with water . the yield of product , based on the organic material charged is good and there is very little dinitrobenzoic acid present in the mixture showing that hydrolysis is kept to a very low level . the nitration of 4 - chloro - 3 - nitrobenzotrifluoride is carried out by first forming a mixture containing 1 . 01 moles 4 - chloro - 3 - nitrobenzotrifluoride , 6 . 55 moles sulfuric acid , and 1 . 96 moles water . the sulfuric acid present in this mixture is about 77 mole percent . the mixture is heated , and at a temperature of about 100 ° c . rapid evolution of gas is noticed . during this period the organic layer completely dissolves in the acid layer and gas evolution continues for about 11 / 2 hours at which time effervescence subsides . nitric acid is added to the mixture in an amount sufficient to bring the sulfuric acid content to about 60 mole percent and the mixture is heated for an additional hour . on cooling 4 - chloro - 3 , 5 - dinitrobenzoic acid is obtained . this example shows that substantial hydrolysis of the mononitrobenzotrifluoride composition occurs with the sulfuric acid concentration is about 77 mole percent . on the other hand , the previous example shows that excellent yields in terms of dinitrated product can be obtained , with minimum hydrolysis when the sulfuric acid concentration does not exceed about 65 percent .
| 2 |
an embodiment of this invention will be described below based on the drawings . unless otherwise stated , the same reference numerals refer to the same subjects throughout the drawings . it should be understood that , since illustrative embodiments of the present invention are described below , there is no intention to limit the invention to content described through these embodiments . referring to fig1 , there is shown a block diagram of computer hardware used for realizing a system configuration and processing according to the one embodiment of the present invention . in fig1 , a cpu 104 , a main memory ( ram ) 106 , a hard disk drive ( hdd ) 108 , a keyboard 110 , a mouse 112 and a display 114 are connected to a system path 102 . the cpu 104 is preferably based on a 32 - bit or 64 - bit architecture , and any one of pentium ™ 4 , core ™ 2 duo ™ and xeon ™ of intel corporation ™, athlon ™ of amd ™, and the like may be used as the cpu 104 . the main memory 106 preferably has a capacity of at least 2 gigabytes . it is desirable that the hard disk drive 108 has a capacity of , for example , at least 320 gigabytes so as to store therein a large amount of graph data . although not individually illustrated , an operating system is previously stored on the hard disk drive 108 . the operating system may be any one , such as linux ™, windows xp ™ or windows ™ 2000 of microsoft corporation ™, or mac os ™ of apple inc .™, that is compatible with the cpu 104 . moreover , the hard disk drive 108 also stores therein a programming language processor for c , c ++, c #, java ™ or the like . this programming language processor is used for generating and retaining later - described modules or tools used for graph data processing . the hard disk drive 108 may further include : a text editor for writing source code to be compiled by the programming language processor ; and a development environment such as eclipse ™. the keyboard 110 and the mouse 112 are used for initiating the operating system or a program ( not shown ) that is loaded into the main memory 106 from the hard disk drive 108 and then displayed on the display 114 for typing characters . the display 114 is preferably a liquid crystal display , and , for example , one having an arbitrary resolution , such as xga ( 1024 - by - 768 resolution ) or uxga ( 1600 - by - 1200 resolution ). although not illustrated , the display 114 is used for displaying graph data that should be processed and a degree of similarity between graphs . fig2 is a functional block diagram of processing modules according to the present invention . these modules are written in any one of existing programming languages such as c , c ++, c # and java ™ and then stored in the hard disk drive 108 in an executable binary form . then , in response to an operation of the keyboard 110 or the mouse 112 , the operating system ( not shown ) causes these modules to be invoked in the main memory 106 and then executed . a graph data producing module 202 converts a given graph into a computer - readable data structure . in the conversion , for example , the following data structures are used for a graph g with the number of nodes and the average number of adjacent nodes being denoted as n and d , respectively . g . nodelist : a list denoting a list of the nodes and having a length of n , g . labellist : a list denoting a list of node labels and having a length of n , g . labellistx : a list having the same data structure as g . labellist , being used as a buffer into which labels are written , and having a length of n , and g . adjacencymatrix : an adjacent matrix of the graph , the adjacent matrix having an element ( i , j ) thereof set to 1 if there is a link between nodes i and j , and set to 0 otherwise , and having a size of n × n although the size can be reduced to n × d by use of a data structure named a sparse array in which elements being 0 are omitted . here , with the number of different kinds of labels of nodes being denoted as p , each of the labels is set to m - bit data by selecting m satisfying a condition such as p & lt ;& lt ; 2 m . the reason for taking 2 m , which is sufficiently larger than p , is that a possibility of hash collision among the labels should be reduced . with the above premises , a prime number p1 satisfying , for example , 2 m - 1 & lt ; p1 & lt ; 2 m , and a prime number p2 sufficiently larger than p1 are prepared , and the i - th label value is denoted as lh i . then , to the respective labels l i ( i = 1 , . . . , p ), different label values each having a size of m bits can be given by the following expression : for ( i = 1 ; i & lt ;= p ; i ++){ lhi =( p 2 * i )% p 1 ;}, where % denotes an operator used for calculating a reminder of division . otherwise , another arbitrary routine for random number generation may be used . the graph data producing module 202 forms graph data while giving the determined label values lh i to the respective nodes of the graph in accordance with the respective values l i . that is , with respect to graphs shown in fig4 a , the graph data producing module 202 traces each of the graphs , for example , in depth - first order , g . nodelist is sequentially produced , and at the same time , while recording label values lh i in g . nodelist , records adjacency relations in g . adjacencymatrix . as a result , as shown in fig4 b , bit strings are given as the label values to the respective labels . in the example in of fig4 b , a =# 1000 , b =# 0101 and c =# 1100 . it goes without saying that the label values given to the labels are common between the two graphs . here , an expression such as # 0101 represents a binary number . each of the label values is preferably configured as a fixed - length number of bits . although being described later in detail , the reason for the use of the above configuration is the convenience in calculations such as bit rotation , xor and radix sort . the formed graph data is loaded onto the main memory 106 , or stored in the hard disk drive 108 . otherwise , when the graph data is very large , the graph data may be firstly placed on the hard disk drive 108 and then a part of the graph data may be loaded onto the main memory 106 , the part being needed for the calculation . a graph searching module 206 performs a graph search sequentially and visits all of the nodes of one graph . the graph searching module 206 then refers to nodes adjacent to each node to , while invoking a hash calculation module 208 in relation to the adjacent nodes , perform processing of updating a label value of each node . fig3 is a flowchart showing processing performed by the graph searching module 206 . in fig3 , in step 302 , the graph searching module 206 determines whether or not it has finished visiting all of the nodes of the graph . this judgment is made based on whether or not the graph searching module 206 has reached the end of g . nodelist . if it is determined in step 302 that the graph searching module 206 has not yet finished visiting all of the nodes of the graph , the graph searching module 206 visits a subsequent node in accordance with g . nodelist in step 304 . in the first stage of the graph search , the graph searching module 206 comes to visit a beginning node . in step 306 , the graph searching module 206 calculates a label value through a hash calculation by using information on nodes adjacent to a relevant node currently visited thereby , the information being obtained by invoking the module 208 . here , the adjacent nodes are nodes directly connected to the relevant node through edges . such adjacency relations can be checked with reference to values recorded in g . adjacencymatrix . for this calculation , a label value of the relevant node and label values of the adjacent nodes are used . these label values are acquired by referring to g . labellist . the calculation of a label value will be described later in more detail with reference to flowcharts in fig5 , 6 and 7 . in step 308 , the graph searching module 206 updates the label value of the relevant node to the calculated label value . here , although g . labellist may be directly overwritten , it is more preferable that an updated label be written not into g . labellist but into g . labellistx . this is because , if g . labellist is directly overwritten , different results are obtained in cases where different sequences are taken in the same node search . subsequently , the processing returns to a judgment in step 302 , and steps 304 , 306 and 308 are executed until the graph searching module 206 finishes visiting all of the nodes . when the graph searching module 206 finishes visiting all of the nodes , g . labellistx finishes being rewritten for all of the nodes . then , g . labellist is replaced by g . labellistx . such rewrite of label values by visiting a graph is performed for each of the two graphs to be compared to each other . a manner of the conversion is schematically shown in fig4 ( c ). processing of such rewrite of label values by visiting a graph is preferably performed plural times as shown in fig4 ( d ) and the like . generally , this increases a degree of accuracy of the graph comparison . however , an increase in the number of times the processing is performed does not always lead to an increase in the accuracy , and there naturally exists the optimal number of the times . returning to fig2 , a graph similarity calculation module 210 calculates a degree of similarity between the two graphs on the basis of the rewritten label values . the simplest calculation method for the degree of similarity is to calculate an agreement rate of the rewritten values between the two graphs . later , a slightly more complicated calculation will be also described . fig5 is a rough flowchart that illustrates , in more detail , processing of the hash calculation module 208 in relation to adjacent nodes . assuming that the currently visited node in the flowchart in fig3 is referred to as a relevant node , a label 502 of the relevant node is a label value corresponding to the currently visited node , and is acquired from g . labellist . the label 502 will be expressed as thisnodelabel for the sake of convenience . on the other hand , a set 504 of labels of nodes adjacent to the currently visited node is acquired from g . labellist by referring to values recorded in g . adjacencymatrix . the labels can exist in plurality in general , and therefore will be expressed as neighboringnodelabels [ ]. additionally , if a hush function and a new label 508 are denoted as hash ( ) and newlabel , respectively , a calculation is made by : g . labellistx is overwritten by setting a thus calculated value of newlabel as the label value of the currently visited node . fig6 is a diagram showing one example of the processing of fig5 . specifically , in processing of fig6 , in order to produce a new label 608 from a label 605 of the relevant node and a set 604 of labels of the adjacent nodes , a hashing block 606 includes : a block 610 that rotates the label 602 of the relevant node by 1 bit ; a block 612 that xors the label set 604 of the adjacent nodes ; and a block 614 that xors an output from the block 610 and an output from the block 612 to obtain the new label 608 . fig8 shows a specific calculation example of the processing of fig6 . in fig8 , suppose a label of the relevant node is # 1000 , labels of the adjacent nodes are # 1110 and # 1100 , respectively . then , while an output from the block 612 becomes # 0010 through xor of # 1110 and # 1100 , an output from the block 610 becomes # 0001 through 1 - bit rotation of # 1000 . then , an output from the block 614 that xors those outputs becomes # 0011 , which turns out to be the new label of the relevant node . fig7 is a diagram showing another example of the processing of fig5 . specifically , in processing of fig7 , in order to produce a new label 708 from a label 702 of the relevant node and a set 704 of labels of the adjacent nodes , a hashing block 706 includes : a block 710 that rotates the label 702 of the relevant node by 1 bit ; a block 712 that sorts the label set 704 of the adjacent nodes ; a block 714 that counts duplications among the sorted outputs ; a block 716 that adds the counted values ; a block 718 performs bit - rotation by the numbers of bits corresponding to the counted values ; a block 720 that xors outputs obtained by the bit - rotation ; and a block 722 that xors an output from the block 710 and an output from the block 720 to obtain the new label 708 . note that , since labels are bit strings of a fixed length in the preferable examples , it is convenient that radix sort be used in the sorting performed by the block 712 . fig9 shows a specific calculation example of the processing of fig7 . in fig9 , suppose a label of the relevant node is # 1000 , labels of the adjacent nodes are # 0101 , # 1100 and # 0101 , respectively . then , the sorted output from the block 712 becomes # 0101 , # 0101 and # 1100 . then , the counted outputs from the block 714 become 2 for # 0101 and 1 for # 1100 since # 0101 consecutively appears twice . next , the block 716 adds the counted outputs to original values of the labels . while # 0101 becomes # 0111 with 2 being added thereto , # 1100 becomes # 1101 with 1 being added thereto . next , the block 718 performs bit - rotation thereon by the numbers of bits corresponding to the counted outputs . while # 0111 becomes # 1101 with 2 - bit rotation performed thereon , # 1101 becomes # 1011 with 1 - bit rotation performed thereon . next , the block 720 xors # 1101 and # 1011 , which are values obtained through the bit rotation , and then outputs # 0110 . on the other hand , the block 710 outputs # 0001 obtained by rotating # 1000 , which is the label of the relevant node , by 1 bit . then , the block 722 xors # 0110 outputted from the block 710 and # 0001 outputted from the block 720 , and # 0111 obtained as a result thereof becomes the new label of the relevant node . note that an algorithm used for calculating a label value of a relevant node by hashing is not limited to the algorithm shown in fig6 or 7 , and any hashing algorithm requiring a reasonable calculation amount and unlikely to cause hash collision can be used . that is , if a set of labels of nodes adjacent to a relevant node and a label of the relevant node are denoted as neighboringnodelabels [ ] and thisnodelabel , respectively , such a hashing algorithm is a function that takes arguments as follows : consequently , a method can be employed in which : elements of neighboringnodelabels [ ] are sorted and then lined up ; a result thereof is taken as one number ; and a remainder of division of this number by an appropriate prime number p1 is taken as newlabel . in the case of the example in fig9 , neighboringnodelabels [ ] consists of # 0101 , # 1100 and # 0101 , and # 010101011100 is obtained by having these elements sorted and lined up . therefore , a calculation is performed as : next , with reference to flowcharts in fig1 and 11 , processing of simultaneously comparing degrees of similarity between two or more plural graphs will be described . modules used for executing this processing are included in the graph similarity calculation module 210 . in fig1 , in step 1002 , h graphs of γ ={ g 1 0 , . . . , g h 0 } to be compared to each other in similarity are prepared , and data for these graphs are stored in the main memory 106 or the hard disk drive 108 . at this point , binary label values of a predetermined number of bits are previously provided to nodes of the graphs by the already - described method . h =| γ |, that is , h denotes the number of graphs . r max is the number of times that the hash calculation is repeated . although it depends on the case , some number from 3 to 5 is selected as r max . in step 1004 , r is set as r = 1 , and a loop in terms of r until r max is reached is started . in step 1006 , whether or not r & lt ;= r max is determined , and , if r & lt ;= r max , k r is set as k r = i in step 1008 , where i is an h - by - h unit matrix . in step 1010 , i is set as i = 1 , and a loop in terms of i is started from this point . in step 1012 , whether or not i & lt ;= h is determined , and , if i & lt ;= h , the following equation is executed in step 1014 : where g i r does not denote g i to the power of r but denotes a graph having label values obtained as the r - th result of the hush calculation . additionally , nh ( ) denotes a function or a subroutine that executes the processing of the flowchart in fig3 . an algorithm used for the hash calculation in relation to adjacent nodes in this case is assumed to be , for example , the one shown in fig7 , although it is not limited to that algorithm . in next step 1016 , v i r is a node list of g i r . in step 1016 , components of v i r are stored in v i sort while being lined up in a sequence obtained by radix - sorting the components on the basis of the label values . in step 1018 , i is incremented only by 1 , and the processing returns to step 1012 . that is , until i reaches h , steps 1014 , 1016 and 1018 are repeated . if it is determined in step 1012 that i exceeds h , the processing goes to step 1020 , where g r - 1 is removed . here , g r - 1 is a code that collectively denotes g 1 r - 1 , . . . , g h r - 1 , and , in short , processing of releasing a region in the main memory is executed , the region having g 1 r - 1 , . . . , g h r - 1 retained therein . subsequently , in step 1022 , i is set to 1 , which implies that a loop in terms of i starts . in step 1024 , whether or not i & lt ;= h is determined , and , if i & lt ;= h , j is set to 1 in step 1026 , which implies that a loop in terms of j starts . in step 1028 , whether or not j & lt ;= h is determined . if j & lt ;= h , whether or not j & lt ; i is determined in step 1030 . because step 1032 is symmetric with respect to i and j , this judgment is performed so that duplicative processing may be avoided . if it is determined in step 1030 that j & lt ; i , the processing goes to step 1032 , where a calculation expressed as k ij r = k ji r = compare_labels ( g i r , g j r ) is performed . compare_labels ( ) is a function that compares labels of two graphs specified by arguments thereof , and then returns a result of the comparison in the form of a real number . detailed processing contents of the function will be described later with reference to a flowchart in fig1 . additionally , v i sort and v j sort calculated in step 1016 are used in specific calculations . in step 1034 , j is incremented only by 1 , and the processing returns to step 1028 , that is , steps 1030 , 1032 and 1034 are repeated until j reaches h . thus , if it is determined in step 1028 that j exceeds h , i is incremented only by 1 in step in 1036 , and then the processing goes to step 1024 . if it is determined in step 1024 that i exceeds h , r is incremented only by 1 in step 1038 , and the processing returns to step 1006 . if it is determined in step 1006 that r exceeds r max , a similarity matrix k is calculated with the following equation , and then the processing ends . an ij component of the similarity matrix k represents a degree of similarity between the graphs g i 0 and g j 0 . next , with reference to the flowchart in fig1 , processing contents of the function , compare_labels ( ) used in step 1032 will be described . in step 1102 , v a sort and v b sort are set as sorted node lists of two graphs , and the orders of v a sort and v b sort are set as n a and n b , respectively . in step 1104 , variables c , i and j used in the following steps are set as c = 1 , i = 1 and j = 1 . in step 1106 , whether or not i & lt ;= n a at the same time as j & lt ;= n b is determined , and , if i & lt ;= n a at the same time as j & lt ;= n b , v i and v j are set as v i = v a sort [ i ] and v j = v a sort [ j ], respectively , in step 1108 . in step 1110 , whether or not l a ( v i )= l b ( v j ) is determined , where l a ( v i ) denotes , for example , a label value of a node that is the i - th component of vi a sort . if it is determined that l a ( v i )= l b ( v j ), c , i and j are incremented so as to be c + 1 , i + 1 and j + 1 , respectively , and the processing returns to step 1106 . if it is determined that l a ( v i )≠ l b ( v j ), the processing goes to step 1114 , where whether or not l a ( v i )& lt ; l b ( v j ) is determined . if l a ( v i )& lt ; l b ( v j ), i is incremented only by 1 in step 1116 . otherwise , j is incremented only by 1 in step 1118 . in any case , the processing then returns to step 1106 . if it is determined in step 1106 that i & gt ; n a or that j & gt ; n b , the processing goes to step 1120 , where a degree k of similarity is calculated by use of the following equation : in step 1122 , a value of k thus calculated is returned . in practice , this value is used in step 1032 which is a part that invokes compare_labels ( ). while the present invention has been described by means of illustrative embodiments , various changes or modifications can be added to the abovementioned embodiments , and it will be apparent to those who skilled in the art that embodiments to which such changes or modifications are added can also be included in the technical scope of the present invention . for example , while the specific processing shown in any one of fig6 and 7 has been presented as the hash calculation of a label value that is shown in fig5 , these are nothing more than examples , and any hash function requiring a reasonable calculation amount can be used . additionally , the processing shown in fig1 as an algorithm used for a similarity calculation is also simply one example , and those who skilled in the art should be able to conceive various modification examples on the basis of the number of matching label values of two graphs . in addition , a degree of similarity between two nodes can be calculated by the present invention in the following manner . that is , suppose subject nodes are denoted as a and b . by extracting two partial graphs including the respective nodes and applying the present invention to the partial graphs , an agreement rate between an updated label of a and an updated label of b can be found and set as the degree of similarity between a and b . 202 . . . graph data producing module , 204 . . . graph data , 206 graph searching module , 208 . . . hash calculation module in relation to adjacent nodes
| 6 |
according to preferred embodiments of the present invention , devices and methods are provided for operating internal circuits of drams while entering , exiting and during a power save operation mode . according to aspects of the invention , leakage current during power save mode is reduced or eliminated , the amount of current surge during circuit turn on when exiting power save mode is reduced , and false triggering of internal circuits is eliminated . preferred embodiments of the present invention act to reduce the current surge when the input buffers and internal power voltage generators are turned on when the semiconductor device enters or exits dpd mode . according to preferred methods of the present invention , a current surge is reduced by , for example , varying the setup times of the turn on of the internal power voltage generators , varying the drive capabilities of the different internal power voltage generators or buffers , delaying the turn on of the different voltage generators or buffers , or varying the slew rate of the voltage generators and input buffers . although the present invention is described with the deep power down ( dpd ) entry and exit modes and the memory device described is a dram , it is to be appreciated that the present invention is applicable to any type of semiconductor memory devices operating in any of standby or power save modes . [ 0038 ] fig2 is a block diagram of a device for controlling a dram in deep power down mode according to a preferred embodiment of the present invention . input buffers 51 , 52 , 53 , 54 and 55 receive external input signals such as / cs , / ras , / cas , / we , etc . and output them to dpd detect and controller 150 . a plurality of internal power voltage generators 210 , 220 , 230 and 240 provide various bias and reference voltages such as plate voltage , internal array power voltage , substrate bias voltage , internal peripheral voltage ( vintp ), and boost voltage , etc . to internal circuit 400 of the memory device . vintp has characteristics which are common to other internal power voltages of the dram . for purposes of illustration of the operations of the embodiments of the present invention , it is understood that when vintp is used in an explanation , such explanation is applicable to other internal power voltages of the dram . briefly , when dpd detect and controller 150 detects a pre - assigned combination of signals from input buffers 51 to 55 that signals a dpd entry mode and exit mode ( see for example , fig1 b and 1c ), a dpd command signal ( pdpde ) is generated to turn off the various input buffers 51 to 55 and internal power voltage generators 210 to 240 . according to the present embodiment , the outputs of internal power voltage generators 210 to 240 are pulled to vss or ground . this feature is further described below . with the input buffers and voltage generators turned off , a very small amount of current flow and power is conserved . auxiliary input buffer 50 separately receives an external power down command signal such as cke for signaling dpd entry and exit . according to a preferred embodiment of the invention , cke will transition from low to high to signal dpd exit and high to low for dpd entry . upon sensing the power down exit command , dpd detect and controller 150 signals a transition at pdpde , for example , from high to low , and turns on the input buffers 51 to 55 and internal power voltage generators 210 to 240 , providing passage of external data through the input buffers and application of bias and reference voltages to internal circuit 400 . with the internal power voltage generators 210 to 240 turned off during dpd mode , the circuits of internal circuit 400 are unbiased and many nodes of the circuits may float at some unspecified voltage level . when these circuits are turned on , the unspecified voltage levels may falsely trigger latches or other voltage level sensitive devices . if a voltage pulse is applied to the floating nodes prior to turn on , false triggering is eliminated . an auto pulse generator 300 detects the dpd exit command from auxiliary input buffer 50 and generates a pulse ap . the ap pulse is sent to internal circuit 400 to initialize the turning on of internal circuits . the auto pulse ap is applied to nodes of latch circuits within internal circuit 400 of the memory device . fig3 shows an exemplary auto pulse generator . as shown in fig3 the cke signal buffered by auxiliary buffer 50 ( ckeb ) is applied directly to one of a two - input nor gate 310 . the same ckeb signal is passed through a series of inverters 320 , 325 , and 330 to invert and delay the ckeb signal to generate pulse ap at the output of nor gate 310 . this auto pulse generator generates a positive going pulse having a pulse width equal to the delay of inverters 320 , 325 , and 330 . it can be appreciated by one skilled in the art that a low - going pulse can be generated by a circuit having an equivalent configuration as shown in fig3 and a nand gate is used . the ap plus can also be generated from the dpd command signal pdpde in lieu of the ckeb signal . [ 0041 ] fig4 shows a block diagram of a device for controlling internal voltage generators and buffers of a dram during entering or exiting power down mode according to another embodiment of the present invention . this embodiment employs circuitry to prevent false entry or exit to or from dpd by ‘ locking - out ’ the external power down signal cke if internal power voltage generators 210 , 220 , 230 or 240 are detected to be at an unspecified voltage level . according to the present embodiment , an internal power voltage detector 200 and an interlock circuit 100 are used to detect the voltage outputs of internal power voltage generators 210 to 240 and prevent the turn on of the voltage generators from a floating or unspecified voltage level when a dpd exit command is received . an embodiment of the internal power voltage detector 200 is shown in fig5 and an embodiment of interlock circuit 100 is shown in fig6 . referring to fig4 , and 6 , the dpd detect and controller 150 outputs control signal pdpde , which is connected to input buffers 51 and 55 and internal voltage generators 210 to 240 , to transition during entry and exit to and from dpd mode , e . g ., with a low to high transition of pdpde signaling for dpd entry mode and high to low transition of pdpde for signaling a dpd exit mode . the pdpde signal is connected to transistors mp 2 , mp 3 and mn 2 of the circuit in fig5 to turn on the internal power voltage detector when the circuit has entered dpd mode ( pdpde transitioned from low to high ). with pdpde at high , transistors mp 2 and mn 2 are turned on , providing bias voltage through the transistor 85 to transistor 84 and through transistor mn 2 to vss . transistor mp 3 remains in an off state with pdpde at high , thus floating node 1 at the output of transistor 84 . the output of a representative internal power voltage generator , e . g ., 210 , at vintp is connected to the input of transistor 84 , which turn on when vintp goes low . in such configuration , when the output of internal power voltage generator at vintp is low and the pdpde is at high during dpd mode , node 1 is pulled down to vss or ground , and the output of internal power voltage detector 200 at pdpdhb is low . when vintp is high and pdpde is high , the voltage level at node 1 , the output of transistor 84 is unspecified depending upon the state of transistor 84 , which in turn depends on the voltage level of vintp . if the circuit has exited dpd mode , the pdpde signal is low , transistor mp 2 and mn 2 are turned off and transistor 84 is not biased . transistor mp 3 is turned on to pull node 1 to high , the voltage of the external bias voltage vcc . thus , when the circuit is in active mode , the internal voltage detector 200 is disabled and pdpdhb is high . referring to fig6 an interlock circuit is used to prevent a false dpd exit condition . the output of the internal power voltage detector 200 at pdpdhb is applied to nand gate 72 , which is cross - coupled to nand gate 71 , which in turn receives at its input ckeb , the signal output from auxiliary buffer 50 ( fig4 ), which is a buffered signal of cke used to signal dpd entry or exit . the ckeb signal is at a low level during dpd mode . the output of gate 71 at node 2 is forced to high , and the cross - coupled output of gate 72 is high , enabling gate 72 . with pdpdhb at high , both inputs of gate 72 are high , node 3 is low , which is applied to input of nand gate 71 , and disabling nand gate 71 , with its output node 2 at high regardless of the level of ckeb . thus , blocking an inadvertent ckeb signal from triggering a dpd exit . the ckeb signal is passed through when pdpdhb goes low . in other words , after the pdpdhb signal goes low , the ckeb signal at either low or high level , can be transferred to node 2 . low ckeb signal is from dpd exit command . the output of the interlock circuit 100 at pdpd_exit is connected to dpd detect and controller 150 to disable the generation of the pdpde signal until the ckeb signal is passed through by interlock circuit 100 . when a circuit exits from dpd mode , the internal buffers and voltage generators turn on to apply bias and reference voltages to the internal circuit of the dram . in some instances , unintended dc paths may exist when the bias and reference voltages are applied and excessive current may flow . for example , referring to the prior art circuit of fig1 a , when power down command pbpub goes from low to high , transistor mp 0 is turning off while transistor mn 0 is turning on . for a brief moment , both transistors mp 0 and mn 0 are conducting . if mp 1 is on during this time , a current path exists from vcc through mp 0 , mp 1 and mn 0 to ground . excess current can flow until mp 0 is completely turned off . likewise , when entering power down mode , pbpub goes from high to low and transistor mp 0 may turn on before transistor mn 0 is completely off , and current may flow from vcc to vss through mp 1 . [ 0045 ] fig7 shows circuitry applicable to internal power voltage generators for turning on and off the voltage generators when entering and exiting dpd modes without excessive current flow or false triggering . [ 0046 ] fig8 shows circuitry for splitting the dpd command signal pdpde into signals pdpde 0 and pdpde 1 for applying to the circuit of fig7 . the operation of fig7 and 8 ensures that transistors mp 4 and mn 4 do not turn on at the same time . fig9 shows a timing diagram of the generation of pdpde 0 and pdpde 1 signals from pdpde by the circuit of fig8 . referring to fig8 and 9 , the pdpde command signal is applied to a two input nor gate 103 and a two input nand gate 104 through delays 101 and 102 , respectively . upon occurrence of a low to high pulse of pdpde , the output of nor gate 103 immediately goes from high to low and a low to high pulse of pdpde 0 through inverter 105 will be generated . since both inputs of nand gate 104 must be high for its output to be low , the low to high transition of pdpde 1 ( through inverter 106 ) does not occur until the low to high transition arrives at the second input of nand gate 104 through delay 102 . thus , the transition of pdpde 1 from low to high occurs later than pdpde 0 , at least by the amount of time of delay 102 . conversely , when pdpde goes from high to low , the output of nand gate 104 goes from low to high and pdpde 1 goes from high to low through inverter 106 . pdpde 0 goes from high to low only when both inputs of nor gate 103 are low . the high to low transition of pdpde 0 occurs later than pdpde 1 , at least by an amount of time of delay 101 . referring now to fig7 with pdpde 0 applied to transistor mp 4 and pdpde 1 applied to transistor mn 4 , during the deep power down enter mode ( pdpde goes from low to high level ), the internal power voltage generator is turned off through pmos transistor mp 4 to turn off the internal power voltage generator and with pdpde 1 going high after the pdpde 0 going high , nmos transistor mn 4 will be turned on only after mp 4 is turned off , cutting off vcc . the internal power voltage will be pulled down to vss and no current can flow through mp 4 to vss through mn 4 . during the deep power down exit mode , pdpde goes from high to low and pdpde 1 goes low before pdpde 0 goes low ( see fig9 ). transistor mn 4 is thus turned off by pdpde 1 before transistor mp 4 is turned on to provide bias voltage to the circuit and allowing internal power voltage mode to operate normally . it can be seen that the circuits of fig7 and 8 prevent any transient dc path and thus current flow between vcc and vss in the circuit of fig7 during both dpd entry and exit operations . another consideration of a circuit operating to enter and exit deep power down mode is current surge . when a circuit is powered down or in dpd mode , input buffers and internal power voltage generators are turned off , a minimal amount of current flows through the circuit . when a circuit exits from the dpd mode , the input buffers and internal power voltage generators that were kept off during dpd mode are now turned on at substantially the same time , causing a large current surge , which severely strains the battery and may render inoperative the internal circuits of a semiconductor memory device . preferred embodiments of the present invention act to reduce the current surge when the input buffers and internal power voltage generators are turned on when the semiconductor device enters or exits dpd mode . according to preferred methods of the present invention , a current surge is reduced by , for example , varying the setup times of the turn on of the internal power voltage generators , varying the drive capabilities of the different internal power voltage generators or buffers , delaying the turn on of the different voltage generators or buffers , or varying the slew rate of the voltage generators and input buffers . [ 0049 ] fig1 depicts one embodiment for varying the drive set up of the internal power voltage generators . referring to fig1 , when the device is in dpd mode , dpd command signal pdpde is high and its derivative signals pdpde 0 and pdpde 1 are also high . transistor 115 is turned on to pull down the internal power voltage vintp to vss . transistor 117 is turned on to pull vcc to the gates of transistors 113 and 114 to keep them off . when a dpd exit command is detected , ( pdpde 0 and pdpde 1 goes from high to low ), transistor 117 is turned off and transistor 115 is turned off . the internal reference power voltages from the internal power voltage generators are provided to turn on transistors tx 10 , tx 11 and tx 12 to pull node n 10 toward vss . transistor 114 ( driver 1 ) begins to turn on to drive the internal power voltage vintp towards vcc . transistor 112 receives as gate input a delayed version of pdpde 0 for turning on transistor 112 after the turn on of the transistor 114 . upon turn on of transistor 112 , transistor 113 is biased to turn on for providing further driving capability at vintp . it can be seen that the turn on rate of internal power voltage vintp provided to internal circuit 400 of the semiconductor device can be varied by varying the size of transistor 114 and by adding transistor 113 . thus , if different size drivers ( e . g ., transistor 114 ) are in different internal power voltage generators , the internal power voltages provided to different portions of internal circuit 400 of the semiconductor device can be turned on at different rates . advantageously , the different rates of biasing the internal circuit 400 according to the illustrative embodiment of the present invention act to reduce current surge when dpd exits . another method for varying the turn on of internal power voltages is by varying the turn on of the internal power voltage generators . according to an embodiment of the present invention , the dpd command signal pdpde is delayed so that the command arrives at the different internal power voltage generators at different times , thereby causing turn on of the internal power voltage generators at different times . fig1 and 12 show illustrative embodiments for varying the time of arrival of dpd command signal pdpde . referring to fig1 , the dpd command signal pdpde is sent to the internal power voltage generators 210 , 220 , 230 and 240 through inverters / amplifiers such as 121 . the speed of the signals applied to the internal voltage generators ( s 1 , s 2 . . . sn ) can be individually adjusted by varying the size of resistors r 1 , r 2 , . . . rn and capacitors c 1 , c 2 , . . . cn . the different rc time constants applied to inverters / amplifiers will vary the time of arrival of pdpde at s 1 , s 2 . . . sn , thus turning on / off the internal power voltage generators at different times . referring to fig1 , the dpd command signal pdpde is fed through a series of buffers 126 , 127 , 128 , 129 , each of the buffers 126 to 129 having an intrinsic delay . the s 1 , s 2 , s 3 . . . sn signals apply to respective power voltage generators 210 , 220 . . . 240 . by selecting different outputs of buffers 126 , 127 . . . 129 to apply to the internal power voltage generators , the internal power voltage generators are caused to turn on at different times . according to still another aspect of the present invention , when a semiconductor device such as a dram is put in a deep power down mode , the voltages output from internal power voltage generators applied to internal circuit 400 of the semiconductor device are generally pulled down to ground or vss so that only minimal current flows through internal circuit 400 . in certain instances , it may be advantageous to maintain certain portions of internal circuit 400 at a predetermined voltage level other than vss even during dpd mode . for example , it may be advantageous to maintain a predetermined voltage level to peripheral or boost circuits at all times , even during power down mode , so that the affected circuits need not be turned on from ground or can turn on at a much quicker rate . fig1 and 14 show embodiments of the present invention for providing voltages to internal circuit 400 at vintp . referring to fig1 , a circuit for maintaining predetermined voltage level at vintp according to an embodiment of the present invention , dpd command signal pdpde is applied through inverter 131 to transistor 132 . the inverter 131 and transistor 132 are biased by an external power voltage vcc . during power down mode , pdpde is high , transistor 132 is turned on , pulling vcc to the gate of transistor 134 , turning it on . the voltage at internal power voltage vintp is pulled up towards vcc at the predetermined level . such level is maintained during dpd mode . the predetermined voltage level at vintp is the voltage level of vcc minus the threshold voltage drop of transistor 134 operating as a diode and the voltage drop across transistor 132 when it is turned on . transistor 133 is connected to provide a further voltage drop in the amount equivalent to the threshold voltage of a diode . when needed , the fuse connected across the transistor 133 is cut . metal line connections can be selectively used in place of the fuses to vary the voltage level at vintp . when the device exits from dpd mode , dpd command signal pdpde goes from high to low , turning off transistor 132 and transistor 134 . internal power voltage at vintp is then floated and a voltage applied from an internal power voltage generator from any of 210 , 220 , . . . 240 is applied to vintp to operate at normal operating level . referring to fig1 , a circuit for providing a predetermined boost voltage during dpd mode according to a preferred embodiment of the present invention is provided . similar to the circuit of fig1 , when pdpde is high during dpd mode , transistor 136 is turned on . the internal boost voltage vpp applied to a boost circuit within internal circuit 400 is pulled toward external power voltage vcc through transistor 138 , which is connected in a configuration of a diode . transistor 138 is preferably an nmos transistor . transistor 137 provides a further voltage adjustment to the level of boost voltage vpp . if needed , the fuse connected across transistor 137 is cut to provide another voltage drop equivalent to the threshold voltage of transistor 137 . again , it is apparent to one skilled in the art that metal lines can be optionally used in place of the fuses . when the semiconductor device exits from dpd mode , pdpde goes low , transistors 136 and 138 turn off and boost voltage vpp is floated and driven by the voltage generated by one of the internal power voltage generators to provide vpp at a normal operating level . thus , the internal power voltage generators can be selectively made to maintain at predetermined levels while other internal power voltage generators are turned off and voltages are pulled down to vss during power down mode . in the drawings and specification , there have been disclosed illustrative preferred embodiments of the invention and , although specific terms and types of devices are employed , they are used in a generic and descriptive sense only and not for purposes of limitation . for example , although specific logic circuit gates or electronic components described to implement preferred functions of the invention , one skilled in the art can implement the functions with equivalent logic or electronic components . thus , numerous modifications and variations of the present invention are possible in light of the above teachings . it is therefore to be understood that , within the scope of the appended claims , the present invention can be practiced in a manner other than as specifically described herein .
| 6 |
before explaining at least one embodiment of the invention in detail , it is to be understood that the invention is not limited in its application to the details of construction and to the arrangements of the components set forth in the following description or illustrated in the drawings . the invention is capable of other embodiments and of being practiced and carried out in various ways . also , it is to be understood that the phraseology and terminology employed herein are for the purpose of description and should not be regarded as limiting . disclosed is a static bilge pump for watercraft requiring no moving parts . the static bilge pump may be attached to the hull over the drain hole commonly found at the back of the boat adjacent to the lowest point of the bilge . the static bilge pump may remove water from the bilge of a boat . when the boat is not submerged , the boat &# 39 ; s original drain may still be utilized . in the following description , the term “ distal ” generally refers to a direction away from a boat to which the static bilge pump is attached , and the term “ proximal ” generally refers to a direction toward the boat . thus , “ distal ” could optionally be considered “ back ” or “ rear ” and “ proximal ” could optionally be considered “ forward ” or “ front .” referring to fig1 - 6 , the static bilge pump 10 may include an inlet tube 12 , a body 14 and one or more eductors 17 . the inlet tube 12 may house a drainage conduit 40 and a pump conduit 34 , as shown in fig3 , that are not in fluid communication with each other . the drainage conduit 40 may extend from the drain aperture 26 to the drainage outlet 28 . drainage outlet 28 may be located on the distal end of the body 14 as shown in fig1 , or may optionally be located on the side of the body 14 . drainage outlet 28 may be sealed by inserting a drain plug 18 . fluid communication between the drain aperture 26 and the drainage outlet 28 may allow a boat to be drained while out of the water , in the same manner used in the absence of an attached static bilge pump . when a boat is in the water , it may be preferable to have the drain plug inserted into the drainage outlet . an attachment mechanism may be used to affix the static bilge pump 10 to a boat &# 39 ; s hull . in the embodiment shown in fig1 - 6 , the attachment mechanism comprises a bolt 20 and bolt holes 32 . other attachment mechanisms suitable for attaching devices to the exterior of a boat hull may be used . for example , the inlet tube 12 may include an annular sleeve that may be inserted about the portion of the inlet tube that extends into the interior of the boat hull . in this embodiment , the body 14 includes an interior frame 22 to provide strength and rigidity to the body 14 . the body 14 may optionally be formed as a solid block . the body 14 may house an internal conduit 38 in fluid communication with the pump conduit 34 and the eductor inlets 46 . in this embodiment , a conduit plug 24 may provide access to the internal conduit 38 which may be desirable for inspection , repair and / or manufacturing . other plugs , for example inlet plugs 26 may also provide access to the internal conduit 38 and facilitate inspection , repair , cleaning and / or manufacturing . in fig2 conduit 38 , bolt holes 32 , suction duct 34 and nozzle access ports 36 may be seen . drain aperture 26 may be located within a recess 27 on the side of the inlet tube 12 . the opening to suction duct 34 may be located on the proximal end of inlet tube 12 and may be designed to accommodate removable fluid connection with a hose , pipe , tube or other device for moving fluids . fig3 shows a lateral cross - section of the inlet tube 12 of the static bilge pump 10 . within inlet tube 12 , a drainage conduit 40 extends from the drainage aperture 26 to the drain 28 , which may be sealed using drain plug 18 . suction conduit 34 extends the length of inlet tube 12 from the proximal end 36 to the internal conduit 38 . thus , pump conduit 34 provides fluid communication from the proximal end 36 of the inlet tube 12 to the internal conduit 38 . the pump conduit 34 and the drainage conduit 40 may not be in fluid communication with each other . however , in some alternative embodiments , it may be desirable to optionally provide fluid communication between these or other conduits or valves for adjusting fluid communication between the various conduits . fig4 shows a transverse cross - section of the body 14 of the static bilge pump 10 . the body 14 includes the internal conduit 38 housed inside the body . the conduit plug 24 seals the end of the internal conduit 38 and also allows access to the conduit 38 from the exterior of the body 14 . bolt holes 32 may extend through body 14 . as shown in fig3 , conduit 38 is in fluid communication with the suction duct 34 . conduit 38 is also in fluid communication with eductor inlets 46 . referring now to fig5 , a lateral cross - section of the static bilge pump 10 shows the interior of an eductor 17 and the body 14 . internal conduit 38 is in fluid communication with the eductor inlet 46 . plug 28 may be removed from the body 14 to access the interior of eductor inlet 46 . the eductor 17 may include several components . in this embodiment , the eductors include a cylindrical body housing the components of the eductor 17 . the eductor inlet 46 may be in fluid communication with an annular vacuum chamber 58 by means of eduction port 55 . eduction inlet 46 may be integral to buttress 50 . buttress 50 extends from the body 14 to provide additional rigidity and support to the static bilge pump 10 and may be optional . the annular vacuum chamber 58 may surround a cylindrical motive nozzle 56 , which may in fluid communication with intake aperture 30 . when a boat is in motion , water may enter intake aperture 30 and enter eduction chamber 54 through intake nozzle 56 . water introduced into eduction chamber 54 through nozzle 56 creates a vacuum , courtesy of bernoulli &# 39 ; s principle , within annular vacuum chamber 58 . this creates suction at induction port 55 . the suction , or negative pressure , applied to induction port 55 provides suction through eductor inlet 46 , conduit 38 and pump conduit 34 . water and other items in eduction chamber 54 exit through exhaust port 56 . fig6 shows the static bilge pump 10 with a siphon tube 60 . the static bilge pump 10 may be placed on the exterior of a boat such that inlet tube 12 extends through a boats drain hole . alternatively , a separate hole may be made in the hull of a boat through which the inlet tube may be extended . body 14 may then be affixed to the exterior of the hull such that the front apertures of the eductors 16 are exposed to oncoming water when the boat is in motion . the inlet to 12 may then be attached to siphon 60 . when in use , when a boat is traveling , the eductors 16 create vacuum suction which travels through the eductor inlets , the conduits and the inlet duct through siphon 60 . the end 62 of siphon to 60 may be placed at or near the bottom of the bilge . alternatively , siphon 60 may be flexible such that the end 62 of siphon 60 may be used as a vacuum hose such that a person in the boat may move the end 62 about to suck up and remove bilge water wherever it is located . the arched , “ upside - down u ” characteristic shape of the siphon 60 may prevent water from entering a bilge while the boat is at rest or in reverse . fig7 shows a perspective view of the static bilge pump 10 . the static bilge pump 10 may be attached to the stern of a boat but may also be attached to other objects . for example , a static bilge pump in accordance with the principles of the invention may include fins or other devices to facilitate proper orientation when dragged through water . such an embodiment may be attached to the end of a hose and dragged by a boat . the motion through the water will generate suction and may provide an emergency back up alternative bilge pump for boats . the exhaust ports 56 of the eductors 17 may be swept back or swept together for hydrodynamic and / or aesthetic purposes . fig8 shows a static bilge pump attached to the stern of a boat . in this figure , the static pump is retrofit to a boat through its drain hole . the pump may have a very low profile , not significantly increasing drag . static bilge pump 10 may include two eductors 17 housed in cylindrical eductor bodies 16 . it may be desirable to optionally utilize one eductor or 3 or more eductors , each having its own housing , which may be cylindrical or optionally parallelepiped or other shape . as shown in the figures , the forward end of the inductors 17 are angled . this swept back design may minimize drag created by the eductor &# 39 ; s and may also minimize the possibility of flotsam and jetsam lodging in and obstructing the apertures 30 . the eductor &# 39 ; s 17 may be made larger or smaller and may have a front end that is not swept back . it may also be desirable to provide simpler eductors having a smaller body or having no housing at all . optionally , the inlet apertures of the eductors may include a grate or screen to prevent debris from entering the eductor housings . buttresses 50 extending between the body and the eductor housings 16 may provide additional stability to the static bilge pump 10 . they also may house the induction inlets . it may be desirable to include additional buttresses or to use none at all . the inlet tube 12 of the invention incorporates both atypical drain as well as and inlet duct for the static bilge pump 10 . it may be desirable to not include the simple drain aspects of the inlet tube 12 . fig9 and 10 show components of an alternative embodiment of the invention . fig9 shows an eductor assembly 80 in accordance with the principles of the invention . an eductor inlet 86 may be in fluid communication with annular vacuum chamber 88 by means of eduction port 85 . as with the embodiment of the invention shown in fig1 - 9 , the eductor inlet 86 may be integral to a buttress 90 . an annular vacuum chamber 58 may surround a cylindrical motive nozzle 92 , which may be in fluid communication with aperture 94 . when a boat is in motion , water may enter aperture 94 and may be ejected out of nozzle 92 and into eduction chamber 84 . the movement of water through nozzle 92 and into eduction chamber 84 creates a vacuum within annular vacuum chamber 88 . this in turn results in suction applied to eduction port 55 and through eductor inlet 86 . water and any other items in eduction chamber 84 may exit through exhaust port 98 . eductor assembly includes an integration block 100 . integration block 100 may include a conduit 102 . a bolt hole 99 may be located just above integration block 110 . in fig1 is shows an alternative embodiment of a body 110 in accordance with the principles of the invention . body 110 includes an integration socket 112 . integration block 100 is sized to fit snugly with in integration socket well . body 10 also includes bolt holes 114 for attaching the body 110 to a boat hull . in this embodiment , body 110 also includes bolt holes 116 . bolt holes 116 may correspond to bolt holes 99 of the eductor assembly 80 . because bolt holes 116 may be located both above and below socket 112 , and because the integration block 100 and socket 112 are bilaterally symmetric , and eductor assembly 80 may be integrated with a body 110 . so that may be positioned either to the left or to the right of a boat hull &# 39 ; s drain plug . it is not uncommon for various devices , such as trim tabs , sonar devices or other objects , to be installed close to a drain plug . if one or more devices are located adjacent to and left of a drain plug of a hole , it may not be possible to attach an eductor as shown in fig1 - 8 to the hull . the embodiment shown in fig9 and 10 allow for reversing and creating a mirror of the device as shown in fig9 . making an eductor of the present invention ambidextrous , or capable of being flipped over to either side of a drain plug , facilitates an easier integration of the device into a boat hull . fig1 shows a graph of the amount of suction produced by the static bilge pump as a function of the speed of the boat to which it is attached . as may be seen , the static bilge pump , requiring no external power and having no moving parts , is capable of pumping 15 gallons per minute when a boat is traveling at only 20 miles per hour . whereas , the present invention has been described in relation to the drawings attached hereto , it should be understood that other and further modifications , apart from those shown or suggested herein , may be made within the spirit and scope of this invention . descriptions of the embodiments shown in the drawings should not be construed as limiting or defining the ordinary and plain meanings of the terms of the claims unless such is explicitly indicated . as such , those skilled in the art will appreciate that the conception , upon which this disclosure is based , may readily be utilized as a basis for the designing of other structures , methods and systems for carrying out the several purposes of the present invention . it is important , therefore , that the claims be regarded as including such equivalent constructions insofar as they do not depart from the spirit and scope of the present invention .
| 5 |
a first embodiment of the invention will be described in terms of a printed instant ticket with a scratch - off material covering play indicia . fig1 is a simplified representation of a conventional instant lottery ticket 10 that includes a printed identification 12 of the ticket 10 , a printed instruction 14 on how to play the ticket and a scratch - off material 16 covering a set of play indicia 18 . also , printed on the lottery ticket 10 is a set of validation data 20 that can be in alphanumeric or bar code form or both . the validation data 20 can be printed on the back of the lottery ticket 10 as well . in the representation of fig1 , the lottery ticket 10 is shown with most of the scratch - off material 16 removed which , in this case , reveals the play indicia 18 that indicates to the player that the prize value of the lottery ticket 10 is $ 100 , 000 . 00 . in conventional instant lottery games , the tickets 10 are all printed with play indicia 18 that indicate the prize value of the lottery ticket 10 . fig2 is a simplified representation of an instant lottery ticket 22 according to one aspect of the invention . the principal difference between the lottery ticket 22 and the conventional lottery ticket 10 is that a set of play indicia 24 printed beneath the scratch - off material 16 on the lottery ticket 22 represents a variable prize value as indicated on the lottery ticket 22 by a coined term such as “ mystery prize ” as shown in fig2 or “ bonus prize ”. here , the play indicia 24 also includes a message to the effect that the player should read instructions ( not shown ) on the back of the lottery ticket 22 that will provide guidance on how to redeem a prize for the lottery ticket 22 . in the preferred embodiment of the invention , most of the lottery tickets in the game will be printed with play indicia representing the actual value of prize as shown at 18 on the ticket 10 in fig1 . additionally , and evenly dispersed throughout the game , will be a set of the lottery tickets 22 having the printed play indicia 24 indicating a variable prize value . these tickets 22 will be dispersed evenly throughout the game and , preferably , in such volume to greatly increase the likelihood that at least one of the “ mystery ” prize winning tickets 22 remains in the game at all times . in this embodiment of the invention , it is desirable that the odds are extremely high that at least one of the “ mystery ” prize ticket 22 remain in the game after the last static top prize is sold . if the last static top prize as shown at 18 on the ticket 10 is redeemed for cashing before all tickets in the game have been redeemed , at least one of the remaining ‘ mystery ’ prize tickets 22 would be eligible to be ‘ promoted ’ to the top prize . this “ mystery ” top prize would be distributed during the end of game draw procedure . in this manner , it would always be possible to win one of the top prizes as advertised by the lottery administration in its general promotional literature , and thus render moot any complaint that the top prize no longer remains in the game . it is common practice that drawings of this type are conducted by a manual process whereby players mail in to the lottery a stub or some portion of the ticket . in the preferred embodiment , this manual system is replaced by an electronic system reducing the workload on the lottery and reducing the chance for fraud or error . with reference to fig3 , operation of the preferred embodiment of the instant lottery game will be described . to illustrate a representative environment for the invention , fig3 provides a block diagram of the basic hardware structure of a typical state administered lottery system 26 for selling and redeeming instant lottery tickets such as lottery tickets 10 and 22 . included in the system 10 is a lottery ticket redemption mechanism which in this embodiment can include a number of validation or agent terminals 28 a – c that are connected , as represented by a set of lines 30 a – c , to a lottery host computer 32 . the agent terminals 28 a – c usually include bar code readers , keyboards , displays and printers that a lottery agent can use for selling , validating and redeeming instant lottery tickets . the connections 30 a – c to the host computer 32 can be dedicated or dial - up telephone lines or other methods of communication such as satellite communications systems . included in the host computer 32 is a validation file 34 that contains validation information for lottery tickets usually stored in the form of records each having a ticket identification and a prize code as represented generally at 35 as shown in fig4 . the prize code can be a code or the actual prize or redemption value of the lottery ticket 10 or 22 . usually there is one record 35 for winning lottery tickets that requires validation through the host computer 32 . however in some cases , the validation file 34 contains records 35 for only the winning lottery tickets in a game or contains records 35 for all of the tickets in the game . connected to the host computer 32 is a lottery administration terminal 36 that usually contains or is connected to a data input device 38 such as a compact disk ( cd ) reader along with a printer 40 for printing out reports to the lottery administration . also in some state lotteries , the lottery administration provides information to the public via an access system regarding the status of a game by , for example , a toll free telephone number as represented by a block 42 and , or in some cases , by internet access represented by a block 44 it is typical practice in the united states lottery industry for a ticket vendor to provide a state lottery administration with one or more sets of tickets where each set is defined as a game . each game will normally have a prize structure with a predetermined number of winning tickets and a predetermined number of losing tickets . very often the winning tickets are divided between high tier winners , which have a high winning prize value and low tier winners that have relatively low winning values . it is also industry practice for the vendor to supply the validation file 34 for each game , which is generally structured to contain one record 35 having the prize code for each winning ticket in the game . in conventional game structures , the prize value represented by the prize code in each record 35 provided by the vendor is fixed or static . for some games , the validation file 34 will contain a record 35 for each winning ticket or in some cases , the validation file 34 will contain a record 35 for each lottery ticket in the game . this vendor supplied validation file is then loaded into the host computer validation file 18 using the data input device 38 . in many state lotteries the practice is to require that high tier lottery tickets that are presented by a player to a lottery agent for redemption be validated by having the lottery agent transmit ticket identification information or the validation data 20 from the agent terminal 28 a to the host computer 32 . this information is then used to access the record 35 in the validation file 34 that contains the prize code or redemption value for the lottery ticket 10 and this value is then transmitted back to the agent terminal 28 a . the usual practice is to have the lottery agent compare this value from the host computer 32 with the winning value 18 printed on the lottery ticket 10 and if they are the same , the agent will pay the player this amount or provide the player with a form that he can use to redeem the ticket from the lottery administration . referring to fig4 , in one embodiment of the invention , an instant lottery game structure is provided where a subset of the lottery tickets , such as the lottery ticket 22 , is printed with the play indicia 24 which indicates to a player that the prize can have a variable value . the rest of the lottery tickets in the game , such as lottery ticket 10 , are printed with play indicia 18 that have a static prize value and for a large number of the lottery tickets 10 the play indica 18 will indicate that the lottery ticket 22 has no redemption value . in the validation file 34 , the first set of records 35 corresponds to the lottery tickets 10 that have static prize values and a second set or a sub file of records 45 corresponds to the lottery tickets 22 that have variable prize values . other methods that identify the variable prizes within the ticket population in a game can be used as well , such as a special prize code unique to variable prize tickets . in the preferred embodiment , the initial prize values represented by the prize codes in each of the records 45 in the sub file will have the same relatively low value , for example $ 50 . 00 , at the beginning of the game . for other embodiments , each initial prize code can have a different value or even a null value . here , the $ 50 . 00 value represents the prize value that the lottery tickets 22 in the sub file 45 can be redeemed for , at least at one point , during the time period that the game is being marketed to the public . in addition , the host computer 32 can automatically at periodic intervals change the prize values in the records 45 in the validation sub file . these changes can be random within a certain predetermined range or alternatively , the changes in the prize values can be made by the host computer 32 in response to inputs from the lottery administration via the terminal 36 . for example , the lottery administration can , by using this system , alter the redemption value of the variable tickets 22 to increase ticket sales or as a part of its marketing plan as it relates to a specific dynamic prize structure for the game . the host computer 32 will mark as paid the records 45 in the sub file that represent lottery tickets 22 that are redeemed during the game period . then , preferably at a publicly announced date after the termination of the game period , the host computer 32 would perform an electronic draw based on all or a subset of the records 45 in the sub file to determine the winner of the final top prize in the game . alternatively , the system could be used to distribute all remaining , unredeemed prizes in the game among those players who hold a ‘ mystery ’ prize winning ticket 22 . if , for example , there were one thousand records 45 in the mystery prize sub file and the lottery administration wished to distribute one hundred high tier prizes that remained in the game , the electronic draw program in the host computer 32 would randomly distribute those remaining prizes into the one thousand records 45 in the sub file . normally , the lottery administration would establish the total prize payout before the beginning of a game . one of the primary advantages of the system described above is that , the lottery administration will know what the total payout for a game is while at the same time because a portion of the prizes are dynamic , it will have the ability to control the amount and timing of certain of the redemption values for the lottery tickets 22 . because security is an important factor in lotteries , it is desirable that the systems such as 26 shown in fig3 , and the file structures such as the validation files 36 and the sub file 45 shown in fig4 along with administrative procedures utilize the latest security technology . preferably , only authorized lottery administrative personnel should be able to dynamically modify the value of the lottery tickets 22 . one approach is to use the audit techniques described in u . s . patent application ser . no . 10 / 317 , 577 , assigned to the assignee of this application and which is hereby incorporated by reference . for example , the approach described in this patent application of using a read only memory to check the total prize value of a game can be used to test the integrity of the records 45 in the sub file . the following is an example of how the game structure described above might operate . after purchasing the lottery ticket 22 , the player scratches off the scratch - off material 16 . if the play indicia 24 indicates that the lottery ticket 22 has a variable redemption value , e . g ., the “ mystery prize ”, the player , depending on the rules of the particular game , will have the option to : ( 1 ) redeem the lottery ticket 22 for its current value and / or ( 2 ) be included in the end of the game prize drawing . in one embodiment of the invention , these two options are mutually exclusive ; in another embodiment , the mystery prize winner is automatically entered in the end of game draw , regardless of whether he has redeemed his ticket . the redemption value of the prize during the game period can be , for example , $ 50 during week 1 of the game , $ 100 during week 2 , back to $ 50 during week 3 etc . . . . as described above . in this example , the players can learn the redemption value of the lottery tickets 22 during the game by utilizing the internet 44 or the 1 – 800 number 42 . the players who opt to remain in the final draw held at the end of the game can likewise learn the value of their lottery tickets 22 via the public access system such as the internet 44 or the 1 - 800 number 42 . at any time until the game is closed , a player can redeem his mystery ticket for the current posted value . in one embodiment , if he chooses to remain ‘ in the draw ’, his mystery prize ticket 22 is guaranteed to be of some minimal value . if he opts for the draw , he might win the top prize or some other high - valued prizes such as a car or a trip . alternatively , the player might win some sort of relatively low value promotional item such as a t - shirt promoting the lottery . in another embodiment , the player can both redeem his mystery prize for its current value and expect to be included in the end of game draw . yet another embodiment of the invention will be described in terms of an electronic ticket with a simulated scratch - off material covering play indicia . in particular , a set of dashed lines 46 in fig1 and 2 represent a display of a video lottery terminal or a personal computer that can be connected to the host computer 32 to play an electronic version of an instant lottery game . here , the lottery tickets 10 and 22 are electronic visual simulations of instant lottery tickets where the scratch - off coatings 16 can be removed by the player by operation of a mouse or some other control device connected to the terminal . again , fig3 depicts in block diagram form the basic hardware structure of the typical state administered lottery system 26 that can be used for selling and redeeming electronic lottery tickets such as lottery tickets 10 and 22 . included in the system 10 are a number of video lottery terminals 48 a – c that can be for example video terminals in a gaming establishment or player owned personal computers . the video lottery terminals 48 a – c can be connected , as represented by a set of lines 50 a – c , to the lottery host compute 32 by a variety of mechanisms such as the internet or a lottery site controller 52 which in turn is connected to the host computer 32 . the video lottery terminals 48 a – c , as represented by the terminal 45 a in fig3 , can include the graphical capabilities such as the display 46 for a lottery player to the play the electronic tickets 10 and 22 and a reader 52 for receiving credit cards or coupons to permit the player to play the game . also , a printer 54 can be included or connected to the terminals 48 a – c for printing out a payment voucher such as an eticket 56 having for example a bar code 58 that can be used by a player to redeem a winning ticket at one of the agent terminals 28 a – c . it should be noted that a variety of redemption mechanisms can be used including various internet secure payment systems . to enable a player to remove the simulated scratch - off coating 16 , a control device 59 such as a keyboard or a mouse can be used with the video lottery terminals 48 a – c . this system permits a player to pay for and play electronic tickets as well as ‘ cash out ’ when finished . the connections 50 a – c to the host computer 32 can be dedicated lines , dial - up telephone lines or other methods of communication such as satellite or internet - based communications systems such as shown at 44 . as with the printed instant lottery games discussed above , it is typical practice in the united states lottery industry for a ticket vendor to provide a state lottery administration with one or more sets of “ electronic ” tickets such as lottery tickets 10 and 22 where each set is defined as a game . each game will normally have a structure with a predetermined number of winning tickets and a predetermined number of losing tickets . very often the winning tickets are divided between high tier winners which have a high winning prize value and low tier winners which have relatively low winning values . it is also industry practice for the vendor to supply the validation file 34 for each game , which is generally structured to contain one record having the redemption or prize value for each high tier winning ticket . in conventional game structures , the prize value in each record provided by the vendor is fixed or static . for some games , the validation file 34 will contain a record for each winning ticket or in some cases ; the validation file 34 will contain a record for each lottery ticket in the game . this vendor supplied validation file is then loaded into the host computer validation file 18 using the data input device 38 . in many state lotteries the practice is to require that the high tier lottery electronic ticket vouchers that are presented by a player to a lottery agent or a lottery validation system for redemption be validated by having the lottery agent or system transmit ticket identification information or the validation data 20 from the agent terminal 28 a to the host computer 32 . this information is then used to access a record in the validation file 34 which contains the redemption value for the lottery ticket 10 and this value is then transmitted back to the agent or validation terminal 28 a . referring again to fig4 , in one embodiment of the invention , an instant lottery game structure is provided where an electronic lottery tickets , such as the lottery ticket 22 , is displayed on the display 46 with the play indicia 24 which indicates to a player that the prize can have a variable value . the system 26 then functions essentially the same way the printed instant lottery system functions as described above . the following is an example of how the electronic instant lottery game structure described above might operate in one embodiment of the invention . after selecting and purchasing the electronic lottery ticket 22 at the video lottery terminal 48 a , the player receives a graphical representation of his selected ‘ pull ’ or ticket 10 or 22 . if the play indicia 24 indicates that the lottery ticket 22 has a variable redemption value , e . g ., the “ mystery prize ”, the player will have the option to : ( 1 ) redeem the lottery ticket 22 for its current value or ( 2 ) opt to be included in the end of the game prize drawing . the redemption value of the prize during the game period can be , for example , $ 50 during week 1 of the game , $ 100 during week 2 , back to $ 50 during week 3 , etc . . . . as described above . in this example , the players can learn the redemption value or any other value or non - value of the lottery administration &# 39 ; s choosing of the lottery tickets 22 during the game by utilizing an information access system such as the internet 44 , the 1 - 800 number 42 or , in this case , the video lottery terminals 48 a – c . the players who opt to remain in the final draw held at the end of the game can also learn the value of their lottery tickets 22 via the internet 44 , the 1 - 800 number 42 or the video lottery terminals 48 a – c . at any time until the game is closed , a player can redeem his mystery ticket for the current posted value . if he chooses to remain ‘ in the draw ’, his mystery prize ticket 22 is guaranteed to be of some minimal value . if he opts for the draw , he might win the top prize or some other high - valued prizes such as a car or a trip . alternatively , the player might win some sort of relatively low value promotional item such as a t - shirt promoting the lottery or nothing . in another embodiment of the invention , the player can both redeem his electronic mystery prize for its current value and expect to be included in the end of game draw . the existence of mystery prizes tickets 22 within an instant ( or an electronic game ) and the mystery prize validation sub file 45 delivered to the lottery administration can form the basis for the electronic end of game ( or end of sales ) draw . the validation numbers 20 of the mystery prize winning tickets 22 are separately stored in the validation sub file 45 ( or in another embodiment , a special prize code identifies the mystery prize winners in the traditional validation file 34 .) in either case , the electronic draw is based on these validation numbers 20 which uniquely identify the population of all mystery prize winning tickets within the game . valid or redeemed mystery prize winners within a game can be further identified by a voucher that is produced at the agent terminal 28 a upon redemption of the mystery prize winning ticket 22 . at this point , player information can be recorded in a database . alternatively , the internet 44 or a 1 - 800 number 42 can be used to identify validated mystery prize winners . there can be other methods of identifying those lottery players who have indeed won a mystery prize . the result of the identification is to populate or mark the validation sub file 45 with valid mystery prize winners who are eligible for the electronic drawing . by the methods described above , once the lottery has satisfactorily populated the validation sub file 45 with valid mystery prize winners , the lottery can choose one of the records 45 from this file . typically , this would occur at some predetermined point in the lifecycle of the game , for example the end of retail sales for the game . the selection of this single record 45 can be accomplished using several common methods , but the most common is the use a specialized random number generator by the host computer 32 . this random number generator would identify one of the mystery prize winners as the grand prize winner — and thus distribute the remaining top prize in the game to this individual mystery prize winner . since mystery prize tickets 22 are available throughout the sales of the game , all lottery players will have the opportunity to play for the top prize until the game sales have been halted by the lottery administration . it will be understood that the dynamic game structure concepts described above can also be applied to non - gambling games . as an example , this type of structure can be used with supermarket type sweepstakes where sweepstake coupons are not sold .
| 0 |
the embodiments has been developed to solve the above - mentioned problems , and aims at providing a system controller and a cache control method capable of a large information processing device configured by a multiprocessor enhancing the accessibility to a cache device of a related cache device by reducing the number of state modify requests to a data block of a cache device of another system . the embodiments are described below with reference to the attached drawings . fig1 is an explanatory view of the outline of a multiprocessor system . in fig1 , a multiprocessor system 1 includes a plurality of system boards 2 - 1 and 2 - 2 . each of the system boards 2 - 1 and 2 - 2 includes a system controller 13 - 1 or 13 - 2 , a plurality of processor modules 10 - 1 , . . . , 10 - n , a plurality of i / o devices 11 - 1 , . . . , 11 - n , and a plurality of memory units ( mem ) 16 - 1 , . . . , 16 - n . the system boards 2 - 1 and 2 - 2 are connected to be able to communicate with each other , and control a read and a write to and from the memory units 16 - 1 , . . . , 16 - n at an instruction from the processor modules 10 - 1 , . . . , 10 - n or the i / o devices 11 - 1 , . . . , 11 - n . fig2 is an explanatory view of the outline of a large multiprocessor system . in fig2 , a multiprocessor systems 3 is larger than the multiprocessor system 1 shown in fig1 , and is provided with more system boards 2 - 1 , 2 - 2 , 2 - 3 , 2 - 4 , 2 - 5 , 2 - 6 , 2 - 7 , and 2 - 8 , and the system boards 2 - 1 , . . . , 2 - 8 are interconnected to one another through a cross bar switch 4 . as with the system board 2 - 1 of the multiprocessor system 1 shown in fig1 , these system boards 2 - 1 , . . . , 2 - 8 include one system controllers 13 - 1 , . . . , 13 - 5 , . . . , a plurality of processor modules 10 - 1 , . . . , 10 - n , a plurality of i / o devices 11 - 1 , . . . , 11 - n , and a plurality of memory units ( mem ) 16 - 1 , . . . , 16 - n . the embodiments can be applied to the multiprocessor system as shown in fig1 and 2 . fig3 is a block diagram showing the configuration of the hardware of a multiprocessor system . in fig3 , the multiprocessor system 1 is provided with a plurality of processor modules 10 - 1 , 10 - 2 , . . . , 10 - n . each of the processor modules 10 - 1 to 10 - n is provided with cpus ( processors ) 12 - 1 to 12 - n and cache devices 14 - 1 to 14 - n . each of the processor modules 10 - 1 , . . . , 10 - n is interconnected to each other by connecting the cache devices 14 - 1 to 14 - n to a system bus 15 . for example , a snoop bus can be the system bus 15 for connecting the cache devices 14 - 1 to 14 - n . a snoop bus refers to a bus capable of immediately acquiring the state of the data block held in a cache line corresponding to the process requests when any of the cache devices 14 - 1 to 14 - n issues a request to fetch or store data from the cpus 12 - 1 to 12 - n according to the state signal of the snoop control line . fig4 is a block diagram showing the function of a cache device . in fig4 , the cache device 14 - 1 is provided with a cache controller 18 and cache memory 20 . the cache memory 20 holds data for each of a plurality of cache line 22 , and each cache line 22 includes a tag 24 and a data block 30 . the tag 24 is provided with a state tag 26 and an address tag 28 . the state tag 26 of the cache memory 20 has the state of a data block by six representations , that is , the invalid state i , the shared state s , the exclusive state e , the modified state m , the shared modified state o , and the writable modified state w , thereby managing the cache memory 20 . the cache controller 18 is provided with a cache control management unit 32 , a state management unit 34 , a processor interface ( if ) 36 , and a bus interface ( if ) 38 . the state management unit 34 is provided with a fetch protocol process unit 40 and a store protocol process unit 42 . upon receipt of a fetch request from the cpu 12 - 1 , the cache control management unit 32 refers to the tag 24 of the cache memory 20 , and retrieves the cache line 22 having the address tag 28 matching the address value of the requested address . if there is no cache line 22 matching in address , a cache mishit occurs , the cache control management unit 32 acquires a data block from the main storage or any other cache devices 14 - 2 to 14 - n , and provides it for the cpu 12 - 1 . when there is the cache line 22 having an address matching the requested address , the cache control management unit 32 performs a process depending on any of the invalid state i , the shared state s , the exclusive state e , the modified state m , the shared modified state o , and the writable modified state w by the state tag 26 of the corresponding cache line 22 on the cache memory 20 . in response to the store request from the cpu 12 - 1 , the cache control management unit 32 performs a storing process of updating a data block of the corresponding cache line 22 on the cache memory 20 if a cache hit occurs , and reserves a new cache line 22 on the cache memory 20 and performs a storing process by writing data if a mishit occurs . if there is a data block corresponding to any of other cache devices 14 - 2 to 14 - n , the latest data block is acquired from any of the cache devices 14 - 2 to 14 - n , and a storing process is performed by writing data . in response to the process request from the cpu 12 - 1 and any of other cache devices 14 - 2 to 14 - n through the system bus 15 by the cache control management unit 32 , the state management unit 34 controls the state transition of the state tag 26 on the corresponding cache line 22 after the execution of the process request . as the state transition control for cache coherence by the state management unit 34 , the cache protocol of the six states of the invalid state i , the shared state s , the exclusive state e , the modified state m , the shared modified state o , and the writable modified state w is applied . other cache devices 14 - 2 to 14 - n have functions similar to those of the cache device 14 - 1 . fig5 is a block diagram showing the function of the system controller . in fig5 , each of the system controllers 13 - 1 and 13 - 2 is provided with a memory access request reception unit 51 , a broadcast transmission / reception unit 52 , a snoop control unit 53 , an ms access issue unit 54 , and a cpu request issue unit 55 . the memory access request reception unit 51 receives an access request to the memory units 16 - 1 , . . . , 16 - 2 from the processor modules 10 - 1 , . . . , 10 - n or the i / o devices 11 - 1 , . . . , 11 - n . the broadcast transmission / reception unit 52 transmits and receives an access request to and from the broadcast transmission / reception unit 52 in another system controller 13 - 1 or 13 - 2 when the access request received by the memory access request reception unit 51 of the system controller 13 - 1 or 13 - 2 is an access request to the memory units 16 - 1 , . . . , 16 - 2 of the other system controller 13 - 1 or 13 - 2 . the snoop control unit 53 performs a snooping process for detecting the contents stored in the memory units 16 - 1 , . . . , 16 - 2 based on the access request from the processor modules 10 - 1 , . . . , 10 - n of the i / o devices 11 - 1 , . . . , 11 - n through the broadcast transmission / reception unit 52 . the snoop control unit 53 sets locking for the address of an object data block from the point when the snooping process is completed to the point when a reply to data transfer is received according to the information stored in a lock register 531 . the ms access issue unit 54 issues an access instruction to the memory units 16 - 1 , . . . , 16 - 2 based on an instruction from the snoop control unit 53 , and the cpu request issue unit 55 issues an access instruction to the processor modules 10 - 1 , . . . , 10 - n based on an instruction from the snoop control unit 53 . described next is the cache control process performed in the multiprocessor system with the above - mentioned configuration . fig6 shows address locking in updating a tag2 . fig7 through 9 show state transitions . fig7 shows the state transition of a hit case in the exclusive state e . fig8 shows the state transition of a hit case in the writable modified state w . fig9 shows the state transition of a hit case in the modified state m . in the embodiments , when the next state of an object data block is not determined at the completion of the snooping process , a cache protocol is configured to report the next state of the related device in the six states , that is , the invalid state i , the shared state s , the exclusive state e , the modified state m , the shared modified state o , and the writable modified state w , from the hit cache device that transmits a data block as a new state on the cache device to which data is transferred . when a tag2 is updated on the system controller , the address lock control is performed on an object data block after receiving a data transfer reply at the completion of the snooping process until the next state is determined , and the lock control is performed to inhibit access to the same subsequent data block . that is , relating to the above - mentioned cache protocol , when data is to be transferred by a fetch request between cache devices , a hit cache device ( source of data transfer ) notifies a system controller of a new state together with a data transfer reply depending on the entry state of an object data block . the cpu as a fetch requester makes a new entry in the cache device in the “ requester ” state of the information in a reply packet of the data transfer . the cpu of the data transfer source changes the entry state of the object data block into the “ transfer source ” state when the data is transferred . relating to the lock control relating to the update of the tag2 , when the fetch request makes a hit in the exclusive state e , the modified state m , or the writable modified state w in the cache device of another cpu ( the state is all exclusive state e for the tag2 of the system controller ), a data transfer is requested to the hit cache device , and from the point when the snoop is completed to the point when the data transfer reply is received , a lock is set for the address of the object data block . then , until the update of the tag2 of the system controller is completed by the data transfer , another access to the same data block cannot be performed . thus , the control of the 6 - state cache protocol to enhance the accessibility to a cache device by reducing the number of state modify requests to a data block on another cache device can be requested address in the conventional snooping system . the embodiments are described above with reference to the attached drawings , but the above - mentioned embodiments can be realized by hardware as a function of a system controller , firmware by a dsp board and a cpu board , or software . it is obvious that the system controller according to the embodiments is not limited to the above - mentioned embodiments so far as the function can be realized , that is , it can be a single device , a system or an integrated device including a plurality of devices , or a system for performing a process over a network such as a lan , a wan , etc . it also can be realized by a system configured by a cpu , memory such as rom and ram , an input device , an output device , an external storage device , a medium drive device , and a network connection device interconnected via a bus . that is , the memory such as rom and ram , the external storage device , and the portable recording medium recording a program code of the software for realizing the system according to the embodiments described above can be supplied to a system controller , and the computer of the system controller can read the program code , thereby realizing the embodiments . in this case , the program code itself read from the portable recording medium etc . realizes the new function of the embodiments , and the portable recording medium etc . recording the program code configures the embodiments . the portable recording medium for supplying the program code can be , for example , a flexible disk , a hard disk , an optical disk , a magneto optical disk , cd - rom , cd - r , dvd - rom , dvd - ram , a magnetic tape , a non - volatile memory card , a rom card , various recording media recording data through a network connection device ( that is , a communication line ) for e - mail , a personal computer communication , etc . by the computer ( information processing device ) executing the program code read to the memory , the functions of the above - mentioned embodiments are realized , and the os etc . operating on a computer performs all or a part of the actual process according to an instruction of the program code , thereby realizing the function of the above - mentioned embodiments . the functions of the above - mentioned embodiments can also be realized by performing the process of writing a program code read from a portable recording medium and a program ( data ) provided by a program ( data ) provider to memory of a feature expansion board inserted into the computer or a feature expansion unit connected to the computer , and then performing all or a part of the actual process by the cpu of the feature expansion board or the feature expansion unit based on the instruction of the program code . that is , the embodiments is not limited to the above - mentioned embodiments , but can be of various configurations or shapes within the scope of the gist of the embodiments .
| 6 |
with reference to fig1 , 1 is a urine test sheet according to the present disclosure . in the present embodiment , the shape of the urine test sheet 1 is that , on one end side in a longitudinal direction of a support , that is , a rectangular support sheet 11 , four detection members , that is , detection pads 12 are arranged in series , but the embodiment shall not be restricted to the form . in order to test a plurality of subjects to be tested through the use of the single urine test sheet 1 , the detection pad 12 is arranged in a plural number , but , in order to measure a single subject to be tested , only one detection pad 12 may be provided . examples of the above - mentioned subjects to be tested include urobilinogen , occult blood , bilirubin , ketone body , glucose , protein , ph , specific gravity , nitrite , white blood cell , ascorbic acid etc . a urine test is performed , usually , by causing a subject to collect an appropriate amount of urine through the use of a paper cup or the like , and immersing the part of the detection pad 12 of the urine test sheet 1 in the urine specimen in the paper cup and then taking out the same . accordingly , it becomes necessary to align the detection pad 12 in a range of being immersed in the collected urine , and the above - mentioned form is commonly used . the urine test sheet 1 according to the present embodiment is also , in appearance , basically made to have approximately the same form as the form of conventional urine test sheet . the material of the support sheet 11 is , although not restricted to a specific one , generally , made of plastic or water - resistant paper . after the urine test sheet being immersed in a urine specimen and then taken out promptly , the detection pad 12 shows , after a prescribed period of time , specific color corresponding to a material or a component amount contained in the urine specimen . this is because a prescribed reaction reagent is contained in the detection pad 12 . the principle of the urine test sheet is that , while utilizing the nature of the reaction reagent , the above - mentioned prescribed period of time is set as a required time for the determination in urine tests . the component of the reaction reagent differs according to each of subjects to be tested , and there is performed each of the specifications such as 4 - methoxybenzenediazonium tetrafluoroborate for detecting urobilinogen , and tetrabromophenol blue ( tbpb ) for detecting protein . in the present disclosure , in addition to the above - mentioned reaction reagent , a reaction - terminating agent for terminating the reaction of these reaction reagents is contained in the detection pad 12 . it is configured such that the reaction - terminating agent is covered with a water - soluble material so that the reaction - terminating agent does not act prior to a urine test , and such that , by the immersion of the urine test sheet into a urine specimen , the water - soluble material begins to dissolve by moisture in the urine to cause the reaction - terminating agent to act . the reaction - terminating agent differs corresponding to every reaction reagent , and , for example , may be magnesium chloride , sodium hydroxide , sodium nitrite , phosphate or the like . the amount of the above - mentioned water - soluble material may be set so as to cause the reaction - terminating agent to act after a prescribed period of time specified for each of subjects to be tested and to terminate the reaction of the reaction reagent . the setting can be performed , for example , according to the fick &# 39 ; s law . that is , from the nature that a diffusion flux ( flux ) of the above - mentioned water - soluble material per unit area and per unit time is proportional to the concentration gradient , the amount of the water - soluble material can be calculated using the period of time until the lapse of the prescribed period of time . meanwhile , since the concentration distribution of the water - soluble material is considered to vary with the period of time , specifically , the amount of the water - soluble material may be calculated using the fick &# 39 ; s second law . incidentally , the prescribed period of time differs depending on each of subjects to be tested . even in the case of the identical subject to be tested , the prescribed period of time differs depending on the kind , amount or the like of the reaction reagent , and , for example , the period of time differs for every subject to be tested such that around 30 seconds for urobilinogen , around 30 seconds to 60 seconds for occult blood , around 120 seconds for white blood cell , and around 10 seconds for ascorbic acid . the difference in the prescribed periods of time is , as described above , generally a difference in unit of second . therefore , in the case where a large amount of urine specimens are treated , for example , in group examinations , the above - mentioned prescribed period of time is to be measured for urine test sheets brought in one after another for every subject to be tested , which is a very troublesome work . in addition , when detection pads corresponding to different subjects to be tested ( that is , different prescribed periods of time ) are formed on a single urine test sheet , furthermore , the measurement of the period of time is extremely difficult , resulting in a state where a precise determination is practically impossible . in the present disclosure , even when a precise prescribed period of time is not measured for an individual detection pad , the progress of the reaction can be blocked by the above - mentioned reaction - terminating agent after the prescribed period of time . accordingly , for example , it is sufficient to perform sequentially the determination for one for which the longest period of time ( in the case of the above - mentioned example , 120 seconds ) among the above - mentioned prescribed periods of time has elapsed . alternatively , in order to determine whether the reaction is terminated or not , it may also be possible to use a known color tone table to be compared with the detection pad 12 and to perform sequentially the determination from one that shows the same coloring as the color tone table . meanwhile , the urine test sheet 1 according to the present disclosure can be used by subjects by themselves at home . conventionally , when a subject uses a test sheet by oneself at home or the like , the subject has to measure on the spot the prescribed period of time specified according to the subject to be tested . in the urine test sheet 1 according to the present disclosure , however , since the reaction terminates after the prescribed period of time , the measurement of the prescribed period of time becomes unnecessary . accordingly , the subject can carry the urine test sheet 1 after measurement in health check or send it previously by mail to entrust the determination to an expert , and in addition , a necessary period of time for health check may be shortened . further , in order to obtain an accurate determination result , subjects has to be in a state of being appropriate to the determination ( for example , in a fasting state ), but , when the urine test sheet 1 according to the present disclosure is used , since restriction on eating in accordance with the time of a group examination is unnecessary and the sheet may be used in home at an arbitrary time before eating , a load on subjects can be reduced . meanwhile , in the present disclosure , subjects include animals , in addition to mankind . fig2 is a side cross - sectional view showing the enlarged configuration of the detection pad 12 in a first embodiment of the urine test sheet 1 according to the present disclosure . the detection pad 12 is formed of a reaction reagent 121 and a reaction - terminating agent 122 covered with a water - soluble material 123 , which is interposed between the reaction reagent 121 and the support sheet 11 . that is , the reaction reagent 121 and the reaction - terminating agent 122 covered with the water - soluble material 123 are arranged in a layered form on the support sheet 11 . fig3 ( a ) is a side cross - sectional view showing the enlarged configuration of the detection pad 12 in a second embodiment of the urine test sheet 1 according to the present disclosure . as shown in fig3 ( b ), a reaction - terminating agent 125 a is formed in the shape of an approximate spherical body and the whole outer surface thereof is covered with a water - soluble material 125 b to form a granular body 125 . the detection pad 12 in the present embodiment is formed by containing the granular body 125 on the reaction reagent 124 in a scattered state . fig4 is a side cross - sectional view showing the enlarged configuration of the detection pad 12 in a third embodiment of the urine test sheet 1 according to the present disclosure . when detection pads 12 different in the prescribed periods of time are arranged in a plural number in series on the support sheet 11 , if a reaction - terminating agent contained in an adjacent detection pad 12 oozes and acts , there may be generated an disadvantage that the amount of the reaction - terminating agent is substantially increased to accelerate the action of terminating the reaction . therefore , in the present embodiment , in order to block the ooze of the reaction - terminating agent contained in the adjacent detection pad 12 , an encircling part 126 is provided around each of the detection pads 12 . meanwhile , in order to block more reliably the ooze of the reaction - terminating agent , a material that neutralizes the reaction of the reaction - terminating agent may be contained in the outer surface of the encircling part 126 ( not shown ). meanwhile , in fig4 , the detection pad 12 is shown by one containing the granular body 125 described in the second embodiment , but the detection pad to be provided with the encircling part 126 shall not be limited to this , and one obtained by encircling the detection pads 12 described in the first embodiment is also acceptable . fig5 ( a ) and 5 ( b ) show a urine test sheet which shows the reaction result by a mark for a prescribed subject to be tested . in order to perform the determination from the change in the coloring of the detection pad 12 caused by the reaction of the reaction reagent , in a stepwise manner indices are required depending on the degree of shading of the coloring . so far , there has been present a color tone table that shows determination indices of substantially about 3 to 9 depending on the degree of shading of the coloring for each of subjects to be tested . as in the case of group examinations , however , to determine enormous numbers of urine test sheets while comparing them with the color tone table is a troublesome work and the period of time necessary for the determination per one sheet becomes longer . even if liberation from the complication of measurement at the prescribed period of time is achieved , when a long period of time is required for the determination treatment , the throughput of the whole test is not enhanced and the temporal load on those performing the test is not dissolved . accordingly , the change in the above - mentioned coloring is set in a stepwise manner by the shading , and detection pads 127 a to 127 d corresponding to the set number of steps are formed on the support sheet 11 . in fig5 ( a ), one with 4 steps of from 127 a to 127 d is shown , but as described above , the number of steps is to be determined in accordance with the subject to be tested . on the support sheet 11 , so as to be readable from on each of detection pads 127 a to 127 d before the reaction , marks 13 a to 13 d that show each of steps are indicated . in the present embodiment , 4 steps of −, +, ++ and +++ are indicated , but the indication shall not be limited to this if it shows the step . for example , an indication only by numerals such as 1 to 4 , an indication showing the number of “+” by a numeral such as + 1 , + 2 , etc . are also usable . each of the marks is colored by the same color as the coloring in each of steps . that is , along with the movement from − to +++, each of the marks is colored so that the density of coloring of the mark also becomes higher . fig5 ( b ) shows a state where the urine test sheet 1 was immersed in a urine specimen and then taken out , and after that , the prescribed period of time has elapsed . the detection pads 127 a to 127 d uniformly show a prescribed coloring , in which , as the result of change into this coloring , marks colored in the same color as the coloring and marks colored paler than the coloring are unreadable due to the coloring of the detection pad 12 . that is , in fig5 ( b ), marks of 13 a (−) and 13 b (+) can not be read from on the detection pads 127 a and 127 b . among unreadable marks , the step shown by the most deeply colored mark gives the determination result . that is , in fig5 ( b ), such determination result as 13 b (+) is drawn . as described above , in the present disclosure , for the urine test sheet 1 for which the above - mentioned prescribed period of time has elapsed , the determination result can be grasped intuitively , and thus work load on those performing the test can be reduced remarkably . in particular , in the case where a large amount of urine specimens are treated as in the case of group examinations , this effect exerts an extremely large effect . fig6 ( a ) is a drawing showing a mask 14 for observation use only and the urine test sheet 1 according to the present disclosure . for detection pads 131 a , 131 b , 131 c and 131 d coated on the support sheet 11 , no mark showing the step is indicated in particular , in the same way as those shown in examples 1 to 4 , unlike from example 4 and examples 6 and 7 to be described later . in the mask 14 , window portions 14 a , 14 b , 14 c and 14 d are opened so that the detection pads 131 a , 131 b , 131 c and 131 d are observable , and to each of windows , while the change in the coloring of the detection pads 131 a , 131 b , 131 c and 131 d is set in a stepwise manner by shading , films having the same color as the steps are stuck , respectively . in the vicinity on the lower side of the window portions 14 a , 14 b , 14 c and 14 d , marks 141 a , 141 b , 141 c and 141 d corresponding to each of the steps are indicated . in the present example , (−) for 141 a , (+) for 141 b , (++) for 141 c , and (+++) for 141 d are indicated . fig6 ( b ) is a drawing showing a state where the mask 14 is overlapped upon the urine test sheet 1 . at this time , the urine test sheet 1 is in a state where the sheet was immersed in a urine specimen and then taken out , and after that , the prescribed period of time has been elapsed . the detection pads 131 a to 131 d uniformly show prescribed coloring , and as the result of the change into this coloring , from a window portion to which a film of color paler than the coloring among the window portions 14 a , 14 b , 14 c and 14 d of the mask 14 , observation is performed as color that is the same as the coloring . in the present example , since colors shown by each of the detection pads show the coloring that is the same as the color of the film stuck to the window portion 14 b , in the window portion 14 a , the observation is performed as the color that is the same as that in the window portion 14 b . accordingly , a mark 141 b (+) indicated on the lower side of the window portion 14 b is the determination result . fig7 ( a ) and 7 ( b ) show a urine test sheet in which the reaction result is shown by a mark for a prescribed subject to be tested , as is the case for the embodiment shown in fig5 ( a ) and 5 ( b ). also in fig7 ( a ) and 7 ( b ), as in fig5 ( a ) and 5 ( b ), the change in the above - mentioned coloring is set in a stepwise manner by shading , and detection pads 127 e to 127 h corresponding to the set number of steps are formed on the support sheet 11 . the embodiment in fig7 ( a ) is , however , different from that in fig5 ( a ) and 5 ( b ) in that the mark is formed by the reaction reagent on the detection pads 127 e to 127 h . that is , marks 13 e (−), 13 f (+), 13 g (++) and 13 h (+++) themselves are indicated by a reaction reagent that changes coloring by a urine specimen . in the present embodiment , in order to read marks 13 e to 13 h in which the coloring has changed , a mask 14 for exclusive use is employed . in the mask 14 , so that each of the marks 13 e , 13 f , 13 g and 13 h are readable , window portions 14 a , 14 b , 14 c and 14 d are opened , and for each of the window portions , films colored in the same color as the coloring in each of steps are provided , respectively . that is , the reading of each of the marks 13 e , 13 f , 13 g and 13 h is performed via films on each of window portions 14 a to 14 d of the mask 14 after overlapping the mask 14 upon the urine test sheet 1 . fig7 ( b ) shows a state where the urine test sheet 1 was immersed in a urine specimen and then taken out , and after that , the prescribed period of time has been elapsed . the marks 13 e to 13 h on the detection pads 127 e to 127 h uniformly show a prescribed coloring , and as the result of the change into this coloring , it is configured such that reading of the mark is impossible through films colored in the same color as or deeper than the coloring . that is , in fig7 ( b ), the marks 13 g (+) and 13 h (+++) can not be read via films on the window portion 14 d of the mask 14 . in this case , the step shown by the palest mark among unreadable marks is the determination result for the subject to be tested . that is , in fig5 ( b ), such determination result as 13 g (++) is drawn . fig8 ( a ) and 8 ( b ) are modified examples of the urine test sheet 1 shown in fig7 ( a ) and 7 ( b ). in the present embodiment , in place of the window portions 14 a to 14 d of the mask 14 described in fig7 ( a ) and 7 ( b ), a window portion 15 is provided directly on the support sheet 11 . that is , as shown in fig8 ( a ), in the face of the support sheet 11 on which the detection pad 12 is formed , in the same way as in fig7 ( a ) and 7 ( b ), marks 13 e to 13 h are formed by the reaction reagent on each of detection pads 127 i to 127 l . each of marks are formed , however , in the same thickness as that of the detection pad 12 ( not shown ) so that marks can be observed also from the backside of each of the detection pads 127 i to 127 l . fig8 ( b ) shows a state of observing the urine test sheet 1 through the window portion 15 , the urine test sheet 1 being in a state where it was immersed in a urine specimen and then taken out , and after that , a prescribed period of time has elapsed . after the immersion in a urine specimen and then the elapse of a prescribed period of time , the marks 13 e to 13 h formed of the reaction reagent show the change in coloring . at this time , the urine specimen permeates into the reaction reagent and the change in the above - mentioned coloring can be observed also from the backside . consequently , it is sufficient to open window portions 15 a to 15 d in positions where the marks 13 e to 13 h are observable from the face opposite to the face of the support sheet 11 on which the detection pad 12 is formed , and to provide films colored in the same color as the coloring of each of steps for each of the window portions 15 a to 15 d , respectively . in the present embodiment , as is the case for the fifth embodiment , such a determination result as the mark 13 g (++) shown in the position corresponding to the window portion through which the mark is unreadable , that is , the window portion 15 c is obtained . fig9 shows one in which information relating to the urine test sheet 1 is shown on the support sheet 11 by an optically readable code . in urine tests , a work for transcribing determination results to a diagnosis table or the like is generated , and there may be such a risk that , in the case where a large amount of tests are treated in a certain period of time as is the case for group examinations , in addition to the existence of a plurality of determination steps as described above , a transcription error is generated . consequently , in order to generate no transcription error , a code is indicated so that results can be read with an optical reader . by the indication of the code , for example , it is sufficient that , in the above - mentioned transcription work , each of information is read with a known optical reader and the read information is transferred to an apparatus or the like in which check tables of respective subjects are stored and is transcribed automatically . as to relevant information , at least information for identify a subject , information for specifying a subject to be tested ( hereinafter , collectively referred to as “ id information ”), and information for showing each of marks shown in the above - mentioned fourth to sixth embodiments may be included . id information 16 a may be indicated on a holding part of the support sheet 11 by which the sheet is held with a hand upon being taken in and out of a paper cup containing a urine specimen , that is , on the end part opposite to the end part in which the detection pad is formed in the longitudinal direction of the support sheet . information 16 b to 16 e showing each of marks are shown , in the present embodiment , on the backside of the support sheet 11 in the sixth embodiment , that is , on the lower side of the window portions 15 a to 15 d while corresponding to each other , and for example , in the fourth and fifth embodiments , the information 16 b to 16 e may be indicated on the surface of the support sheet 11 ( not shown ). that is , the information 16 b to 16 e may be indicated in positions corresponding to the marks after the reaction . in the embodiment , the cord is exemplified by a bar code , but it shall not be restricted to a bar code and , for example , a matrix type two dimensional code etc . are also usable . in the fourth embodiment to eighth embodiment , for a single subject to be tested , the detection pads 12 for showing a plurality of steps ( 4 steps in the present embodiment ) are arranged in series . when a plurality of subjects to be tested are to be measured in one test , it is necessary to arrange one , in which the detection pads 12 are arranged in series in number corresponding to the number of steps , in a plurality of rows . in this case , a plurality of urine test sheets 1 may be immersed in a paper cup for collecting a urine specimen , but each becomes individual and , in the case where a large amount of specimens are treated as is the case for group examinations , a sheet may coexist with a sheet of another specimen or may become dispersed and lost . consequently , as shown in fig1 , in order to make measurement possible in a collection amount of a urine specimen that is required for a single subject to be tested , and to make collective measurement possible for every subject , each of the detection pads 12 for every plural and different subject to be tested is arranged in parallel on the support 11 . in the present embodiment , the urine test sheet 1 is formed in a hollow polygonal column of an approximately regular hexagon , and , as to the state before measurement , each of the detection pads 12 is arranged in parallel on a flat sheet and , when it is inserted into a paper cup containing a collected urine specimen , so as to make the insertion easy , while setting a support sheet part , in which the detection pad 12 for a single subject to be tested is arranged , to be a fold line , it may be formed into the polygonal column shape . meanwhile , in the present embodiment , one provided with the window portion on the backside as is described in fig8 ( a ) and 8 ( b ) are arranged in parallel , but the embodiment shall not be restricted to this , and the one described in fig5 ( a ), 5 ( b ), 6 ( a ), 6 ( b ), 7 ( a ), 7 ( b ) or 9 is may also be arranged .
| 6 |
the present invention contemplates the provision of a novel apparatus for cleaning and sanitizing brushes , particularly hair brushes 10 and , in general , includes a carrier 11 which releasably supports a brush to be cleaned and presents the bristles 12 of the brush in a unique and effective manner to one or more cleaning devices . more specifically , the carrier moves along a predetermined path through a plurality of stations each having a cleaning device . a cam 13 extends along the path and co - acts with a follower 14 ( fig7 ) on the carrier to turn the latter arcuately about the line of travel and the cam is shaped to present the bristles of the brush 10 to the cleaning device at each of the stations . in addition , the cam also arcuately oscillates the carrier and hence the brush at least at one of the stations , and preferably at all of the stations , to effectively clean all the bristles of the brush . in the form shown in the drawings , the carrier 11 and the cleaning devices are disposed within an elongated rectangular sheet metal box 15 which includes opposed front and rear end walls 16 and 17 and which is horizontally mounted in an upright cabinet 18 with the front and rear walls of the box being generally flush respectively with the front and rear walls 19 and 20 of the cabinet . the path of the carrier 11 is straight and extends from a position adjacent the front wall 16 to a position near the rear wall 17 and back . the cleaning devices include at least one nozzle which sprays a liquid on the bristles 12 of the brush 10 , at least one power - rotated member with generally radially projecting fingers which engage the bristles , and another nozzle which subsequently sprays the bristles again . herein , there are six aligned stations 21 , 22 , 23 , 24 , 25 and 26 ( fig4 and 5 ) with nozzles 27 and 28 located at the first two stations 21 and 22 , rotating members 29 and 30 at the next two stations 23 and 24 and nozzles 31 and 32 at the last two stations 25 and 26 . drive mechanism is provided to move the carrier 11 back and forth between the front and rear end walls 16 and 17 of the box 15 . herein , this mechanism includes a horizontal screw 33 extending between the end walls and a nut 34 which is threaded on the screw and which is part of the carrier . as will be explained more in detail , the cam 13 and the follower 14 generally hold the nut from turning and , accordingly , the nut travels along the screw as the latter is rotated . the screw is formed with a forward thread 35 which drives the nut from the front end wall 16 to the rear end wall 17 and a return thread 36 which drives the nut in the reverse direction . as shown in fig8 the screw 33 and the nut 34 are a conventional ball screw and nut assembly with balls 37 ( fig8 ) which are captured within the nut and roll along either the thread 35 or the thread 36 which are in the form of grooves . the screw is fast on a shaft 38 with the forward end portion 39 of the shaft reduced and journaled in a bearing 40 . the latter is mounted in a cylindrical plug 41 which is fastened to the front end wall 16 by the screws 42 . at its rear end , the shaft 38 is reduced in cross section as indicated at 44 and is journaled in another bearing 43 mounted in a second cylindrical plug 45 which is fastened to the rear end wall 17 by screws 46 . the end portion 44 projects through holes 47 and 48 in the plug 45 and the rear end wall where the shaft is driven by a motor 49 ( fig4 ) through a drive train 50 . to complete the carrier 11 , a stub shaft 51 ( fig7 and 8 ) received in a radial bore 52 in the periphery of the nut 34 projects radially outwardly from the nut and is pinned to the latter as indicated at 53 . an end portion 54 of an elongated spring finger 55 abuts the underside of the stub shaft with the finger projecting horizontally toward the front end wall 16 of the box 15 . a washer 56 abuts the underside of the finger end portion 54 and the end portion of a flat bar 57 is received in a recess 58 in the washing with the bar being disposed beneath and generally paralleling the spring finger . this assembly is held together by a screw 59 which projects through the bar , the washer and the spring end portion 54 and is threaded into the end of the stub shaft 51 . in accordance with the invention , each brush includes means which permit easy cooperating engagement between the brush and carrier so as to permit the brush to be reliably supported and transported by the carrier through the operating stations of the cleaning apparatus . to this end , a block 60 is rigidly provided on the back 61 on the brush . the block 60 may either be integrally formed on the back , as shown in fig2 or may be a separate part secured to the back by an adhesive 62 , as illustrated in fig3 . the block 60 , as clearly depicted in fig2 and 3 , has a length substantially less than the length of the back and is formed with a longitudinal aperture 63 which is of a size and shape generally complemental to the cross section of the bar 57 so that the block may be received on the bar which thereby supports the brush on the nut 34 . as the block is slid onto the bar , the upper side of the block engages a downwardly projecting hook 64 on the free end of the spring finger 55 and resiliently cams the finger upwardly . when the down behind the block as shown in fig8 to releasably hold the brush on the carrier . to permit the brush to be placed on and removed from the carrier when the latter is adjacent the front end wall 16 , this wall is formed with a rectangular opening 65 ( fig1 and 5 ) through which the brush may be moved into and out of the box 15 . flexible strips 66 may be attached to the wall 16 to hand down over the opening and prevent liquid from the cleaning nozzles from spraying out of the box while permitting the brush to pass through the opening , the box also having a removable cover 92 . in the present instance , the cam 13 is a slot formed longitudinally in a sleeve 67 which encircles the screw 33 and the nut 34 . the sleeve spans the end walls 16 and 17 of the box 15 and its ends are telescoped over the plugs 41 and 45 which support the sleeve . screws 68 project through the end portions of the sleeve and are threaded into the plugs 41 , 45 to prevent the sleeve from turning . as shown in fig7 and 8 , the stub shaft 51 projects through the cam slot 13 and the cam follower 14 is a plastic sleeve which encircles the stub shaft and engages the sides of the slot . thus , except for the limited turning of the nut 34 as permitted by the shape of the cam slot , the follower and the slot hold the nut against turning so that the nut travels along the screw 33 as the latter is rotated . in the form of the invention illustrated in the drawings , the brush 10 initially is supported on the carrier 11 with the bristles 12 pointed down . the nozzles 27 , 28 , 31 and 32 and the cleaning members 29 and 30 , however , are aligned horizontally along one side of the screw 33 . accordingly , the initial portion 69 of the cam slot is stright and opens downwardly . at the point where the brush approaches the first station 21 , the follower 14 engages a ramp 70 ( fig6 ) in the cam slot and this turns the carrier . because of the non - circular cross sections of the bar 57 and the hole 63 , the brush turns through approximately 90 degrees so that the bristles face sidewise toward the nozzles and the cleaning members . thereafter , the cam slot is formed with zigzag portions 71 which extend above and below the centerline of the screw 33 so that the carrier and the brush are oscillated up and down between an upper position as shown in solid lines in fig9 and a lower position as illustrated in broken lines . these portions 71 of the slot are arranged so that there is at least one complete oscillation of the brush as it passes through each cleaning station . thus , all of the bristles are presented to each nozzle and to each cleaning member even though the bristles may be supported by an arcuate underside 72 of the brush . as shown in fig4 and 5 , the rotating cleaning members 29 and 30 include hubs 73 and 74 respectively which are keyed to a horizontal shaft 75 . this shaft parallels the screw 33 in the same general horizontal plane as the screw and is journaled in the box 15 by means of a bearing 76 in the rear end wall 17 and a bracket 77 secured to a side wall 78 of the box . the shaft 75 projects through the rear end wall so that it , like the screw , may be driven by the motor 49 through the drive train 50 . thus , the drive includes a gear belt 79 trained about a toothed pulley 80 on the motor shaft 81 and a second toothed pully 82 fast on the outer end of the shaft 75 so that the motor drives the shaft through the pulleys and the belt . the shaft 75 and the screw 33 are driven in synchronization but with the screw turning at a slower speed by an endless chain 83 which extends around a sprocket 84 on the shaft 75 and a larger sprocket 85 on the screw shaft 38 . the fingers of the rotary cleaning member 29 herein are comparatively stiff wire bristles 86 projecting radially from the hub 73 and arranged in six groups equally spaced around the hub . as illustrated in fig9 the bristles 86 are sufficiently long to project through the entire length of the bristles 12 of the brush 10 and to flex against the brush bottom 72 . thus , the wire bristles remove hair entrained in the brush bristles or at least bring the hair to the outer ends of the brush bristles . in order that the matting of the hair as it is removed does not impede the effectiveness of the wire bristles , the cleaning member 29 also includes a plurality of knife blades 87 which are mounted on the hub 73 and cut the matted hair . herein , there are three such blades equally spaced around the hub and anchored in the latter with the blades projecting radially from the hub and extending longitudinally of the shaft 75 . in the present instance , the fingers of the second rotary cleaning member 30 are intended primarily to remove hair left on the ends of the bristles 12 of the brush 10 by the cleaning member 29 and , to this end , the fingers on the member 30 are flat strips 88 of a flexible material such as rubber or the like . the strips are arranged in three groups equally spaced angularly around the hub 74 of the member 30 with the inner ends of the strips anchored in the hub . the strips are long enough that their free end portions flap against the ends of the brush bristles 12 to remove lossened hair therefrom . if desired , the member 30 may include knife blades 89 similar to the blades 87 to cut up matted hair being removed by the strips . the four nozzles 27 , 28 , 31 and 32 are mounted on and communicate with the interior of a horizontal manifold pipe 90 ( fig4 and 5 ) which is disposed behind and slightly above the shaft 75 and parallels the latter . an inlet pipe 91 projecting through and mounted on the side wall 78 of the box 15 is connected by a t - joint 93 to the manifold pipe to support the latter and to supply liquid to the nozzles through the manifold pipe . hot water is drawn from a suitable source ( not shown ) through a pipe 94 by a pump 95 , which is driven by the motor 49 , and the water is delivered to the inlet pipe 91 from the pump through a pipe 96 which is controlled by a solenoid - operated valve 97 , the temperature of the water being visually shown by an indicator 98 which communicates with the pipe 96 and is mounted on the front wall 19 of the cabinet 18 ( see fig1 ). in order to sanitize the brushes , the temperature of the water should be at least 180 ° fahrenheit , and preferrably suitable controls are provided to prevent cycling of the machine when the water temperature is below such temperature . liquid soap from a suitable source ( not shown ) also is delivered to the inlet pipe 91 and hence to the nozzles through a pipe 99 which is connected to the inlet pipe and is controlled by a second solenoid - operated valve 100 . in the present instance , the soap is concentrated and includes a disinfectant and the soap is mixed with water from the pipe 96 with the water drawing the soap into the pipe 91 by a jet pumping action , the ratio of water to soap concentrate being on the order of twenty to one . in other words , water is delivered to the nozzles when the valve 97 is open and the valve 100 is closed and soap is delivered to the nozzles when both valves are open . thus , by selectively controlling the valves 97 and 100 , soap or hot rinse water may be sprayed through the nozzles . as shown in fig4 and 5 , the nozzles 27 and 32 are shaped to spray liquid in a generally horizontal plane and the nozzles 28 and 31 are shaped to spray in a generally vertical plane so that a brush 10 being cleaned is sprayed vertically and horizontally both before and after it is engaged by the rotary cleaning members 29 and 30 . after being sprayed on the brush , the liquid from the nozzles , together with hair removed from the brush 10 , drains through a hole 101 in the bottom wall 102 ( fig5 ) of the box 15 and a rigid tube 103 secured to the bottom wall . a flexible tube 104 ( fig1 ) is attached to the tube 103 and leads to the filter bag 105 removably supported in a drum 106 so that the hair is collected in the bag while the liquid filters through the bag to the bottom of the drum , the drum being mounted in the cabinet 18 beneath the box 15 . a pump 107 mounted in the bottom of the cabinet and driven by a motor 108 draws the filtered liquid out of the drum through a hose 109 and delivers the liquid to a drain through a hole 110 . the drive motor 49 and the solenoids of the valves 97 and 100 are operated by means of any suitable control circuit through a cycle in which the brush 10 moves from the position adjacent the front end wall 16 of the box 15 as shown in fig5 to the rear end wall 17 and back to the starting position , each cycle being initiated by manually pressing a button 111 ( fig1 ) or the front wall 19 of the cabinet . in a typical cycle , the brush 10 is turned through 90 degrees during the beginning of its forward travel and then is sprayed with a solution of liquid soap and water at a temperature of 180 ° f . by the nozzles 27 and 28 , the valves 97 and 100 being open . next , the bristles 12 of the brush are engaged successively by the bristles 86 of the rotary member 29 and by the strips 88 of the rotary member 30 and then the brush bristles are sprayed again with soap solution by the nozzles 31 and 32 . it will be appreciated that any long or matter hair which is removed from a passing brush by the bristles 86 and strips 88 and which tends to wrap around the rotating members upon which the bristles and blades are mounted will be severed by the respective blades 87 and 89 . as the brush begins its return travel , the valve 100 is closed and the valve 97 remains open so that the nozzles 31 and 32 rinse the bristles 12 with hot water . the brush bristles next are engaged again by the rotary members 29 and 30 and then are given a final rinse of hot water by the nozzles 27 and 28 . in the final portion of the return travel of the brush 10 , the latter is oscillated rather vigorously to shake excess water from the bristles 12 and , preferably , this is done with the bristles facing downwardly . the cam slot 13 and follower 14 are used to effect this action and , for this purpose , the portion of the slot between the initial straight portion 69 and the ramp 70 has one side 112 straight ( fig6 , 11 and 12 ) and the other side is formed with a plurality of notches 113 , herein two in number . means is provided to hold the follower against the straight side 112 on the forward travel of the brush and to cause the follower to enter the notches 113 on the return travel whereby the notches produce the shaking action . herein , this means comprises a torsion spring 114 which is mounted on the sleeve 67 and engages the projecting end portion 115 &# 39 ; of a screw 115 ( fig7 and 14 ) threaded into the nut 34 diametrically opposite the stub shaft 51 . more specifically , the torsion spring 114 is wound around a pin 116 ( fig8 ) which parallels the screw 33 and is clamped by a nut 117 to an ear 118 struck up from the upper side of the cam sleeve 67 , the pin projecting from the ear in the direction of the forward movement of the nut 34 . one end 119 of the spring is anchored in the ear and the other or free end portion 120 of the spring extends down through an opening 121 in the sleeve and projects along the screw toward the rear end wall 17 of the box 15 . during the forward travel of the nut , the free end portion 120 of the spring is in its relaxed position as shown in full lines in fig1 and the screw 115 passes to the right of this end portion as viewed in fig7 as the follower 14 passes the notches 113 so that the spring resiliently prevents the nut from turning in a direction which would cause the follower to enter the notches . once the follower has passed the notches , the screw 115 engages the curved end 122 of the spring and moves the spring to one side as shown in broken lines in fig1 so that the pin passes the spring end portion 120 with the nut 34 travelling in a straight line . as soon as the screw 115 passes the curved spring end 122 , the free end portion 120 of the spring 114 returns to its relaxed position . as a result , on the return travel of the nut 34 the screw 115 engages the curved end and causes the spring to flex so that the screw passes along the other or left side of the end portion 120 as viewed in fig1 ( see also fig1 ). this urges the nut to turn in the direction in which the follower 14 bears against the notched edge of the cam slot 13 . as a result , the follower is successively moved into each of the notches 113 and , as the follower enters and leaves each notch , the brush 10 is swung to the side as shown by full lines in fig1 ( see also fig1 ) and then returned to its downwardly facing position illustrated in broken lines . the entering edge 123 of each notch is generally circumferential of the sleeve 67 with the result that the follower enters each notch abruptly resulting in a vigorous shaking of the brush . to avoid the possibility of jamming , the leading edges 124 of the notches are inclined so that the follower is gradually cammed out of each notch . the cabinet 18 includes a chamber 124 ( fig1 ) above the box 15 for drying cleaned brushes 10 and access to this chamber is obtained by opening a door 126 on the front of the cabinet , the door being horizintally hinged along its lower edge to the cabinet as indicated at 127 and being provided with a suitable handle 128 . a plurality of horizontal rods 129 project forwardly from the rear of the cabinet and receive the holes 63 in the blocks 60 on the backs of the brushes to support the latter . an ultraviolet lamp 130 for further sanitizing the brushes extends across the top of the chamber and the air within the chamber is heated by electric heating elements 131 in the back of the chamber and circulated by an electric fan 132 , the lamp , the heating elements and the fan being controlled through a suitable circuit ( not shown ) by a push button 133 on the front of the cabinet . the cabinet also provided with a storage chamber 134 below the box 15 and access to this chamber is achieved by opening a second door 135 which is supported on the cabinet along one side edge by a vertical hinge 136 and is provided with a handle 137 . the brushes 10 are supported on racks 138 in the chamber 134 with the bristles 12 facing up and the bristles are subjected to the rays of a second sanitizing ultraviolet lamp 139 extending across the top of this chamber , this lamp being turned on and off by a switch button 140 on the front of the cabinet . the brushes stored in such compartment are maintained in a sanitized condition until reuse . with the apparatus described above , a brush 10 is inserted through the opening 65 and slipped onto the rod 64 of the carrier 11 where it is held by the spring finger 55 . a cleaning cycle is initiated by pressing the button 111 which energizes the various components of the apparatus . this turns the screw 33 to cause the nut 34 and hence the brush 10 to travel toward the rear end wall 17 of the box 15 and back to the starting position . at the same time , the shaft 75 is driven to turn the rotary cleaning member 29 and 30 and the valves 97 and 100 are sequentially oiperated to selectively spray either a soap and hot water solution or hot water through the nozzles 27 , 28 , 31 and 32 . as the brush approaches the nozzle 27 , the cam 13 turns the carrier so that the bristles 12 of the brush face the nozzles and the cleaning members and , thereafter , the cam oscillates the brush as it passes the nozzles and the cleaning members on both the forward and return travel of the carrier so that the brush bristler are thoroughly cleaned of loose hair and other foreign matter . near the final portion of the return travel of the nut 34 , the follower 14 enters the notches 113 in the cam slot 13 to vigorously oscillate the brush and shake excess water from the bristles . the cycle is complete when the carrier comes to rest at its original position at which time the cleaned brush is removed from the box 15 through the opening 65 . it has been found that an effective cleaning cycle requires less than 15 seconds and , obviously , very little time is used in loading and unloading the brushes . cleaned and sanitized brushes are hung on the rods 129 in the chamber 125 to dry and , thereafter , they are removed from the chamber 125 and stored on the racks 138 in the chamber 134 .
| 0 |
the invention relates to anamorphic objective lenses , and in particular to a range of different focal length anamorphic objective lenses covering at least a focal length range from 25 mm to 135 mm and providing low residual chromatic aberration , a traditional oval bokeh shape and different depths of field in the vertical and horizontal azimuth directions of the field . the term “ lens group ” as used in connection with the anamorphic objective lens disclosed herein means one or more individual lens elements . also , the terms “ optical stop ” and “ stop ” are equivalent terms that can be used interchangeably . a “ field stop ” as the term is used herein is a stop where the chief rays do not go through the center of the stop at the optical axis and the general purpose of a field stop is to vignette the edges of the radiation beams . in the example provided herein , the front lens group is negatively powered and the rear lens group is positively powered and they have been paired with an anamorphic lens group to work in unison and match the preferred optical interface characteristics of sensors , where near telecentric radiation beams approach the sensor . the example embodiment discussed below is a medium fast full aperture moderately wide angle field of view anamorphic objective lens of the fixed focal length ( prime ) type . in the example embodiment , all of the lens elements are made from glasses . the lens element optical surface shapes in the spherical first lens group and the spherical third lens groups are all rotationally symmetrical about the optical axis such as spherical and in the anamorphic second lens group at least one lens element surface shape is non - rotationally symmetrical about the optical axis such as cylindrical . the aforementioned optical example , although providing these kinds of features and others like low breathing and telecentric radiation output at the sensor , are capable of achieving suitable levels of various performance including image quality resolution and contrast , high relative illumination for low shading and efficient optical throughput at the sensor via near telecentric radiation output at the sensor , which telecentric radiation output is less than about 10 degrees . the novel configuration of having a negatively powered spherical first lens group , an anamorphic second lens group followed by a positively powered spherical third lens group containing an optical stop may produce some residual distortion , astigmatism and field curvature aberrations but those aberrations to a tolerable extent contribute to the anamorphic look as desired by many cinematographers . in addition , a balanced blend of the afore - described lens characteristics may aid in cost reduction of manufacture . with the advent and adoption of digital cameras employing electronic sensors a large back focal length which was once required for film cameras having a reflex mirror may be less necessary but is still provided for in the novel anamorphic objective lens . the example embodiment disclosed operates at an aperture of f / 2 . 4 and over a waveband of 455 - 656 nm and this waveband is what was used in the transverse ray aberration ( tra ) figures ( see bottom right of tra figures ) and in the mtf figures ( see top right of mtf figures ). a faster or slower aperture may be required and an extended waveband may be required . the aperture may be increased or reduced and the waveband expanded and the optical designs re - optimized to maximize image quality over such apertures and wavebands without departing from the invention . also , during such re - optimization alternate glass types may be used without departing from the spirit and scope of the disclosure . furthermore , more complex optical surface shapes such as aspherical and free - form surfaces may be introduced for expanded performance but at the likely effect of increased manufacturing cost . fig1 - 16 relate to an example embodiment in which the focal length in the y and x directions are 42 . 47 mm and 21 . 47 mm , the overall length is 245 mm from the first refractive surface vertex of the lens to the image vertex , the front diameter clear aperture is 89 . 61 mm , the back focal length from the rear refractive surface vertex to the image vertex is 36 . 07 mm and the close focus distance from the object to the image is 985 . 00 mm . the focal lengths of the spherical first lens group , anamorphic second lens group and spherical third lens group are 130 . 62 mm , − 132 . 23 mm and 133 . 86 mm for the far , intermediate and close focus distances , 1032 . 81 mm in the y direction and − 140 . 60 mm in the x direction and 66 . 75 mm . the focal lengths of the five lens elements of the anamorphic second lens group containing at least one cylindrical surface are in order from an object space to an image space − 81 . 27 mm ( in x direction ), − 64 . 50 mm ( in x direction ), 1379 . 50 mm ( in y direction ), 90 . 87 mm ( in x direction ) and 6151 . 28 mm ( in y direction . it is to be understood that the focal lengths of the five lens elements of the anamorphic second lens group in the other x and y directions are substantially large and hence have little optical power . the nominal image size is 8 . 91 mm vertical half height and 10 . 65 mm horizontal half width . the lens system comprises a total of fourteen lens elements with twelve singlets and one doublet . the spherical first group contains two lens elements with one element axially movable for focusing at different distances , the anamorphic second lens group contains five cylindrically surfaced lens elements with four y cylinders , three x cylinders and 3 plano surface shapes and the spherical third lens group contains seven lens elements . the optical stop lies within the spherical third lens group . in this example embodiment the telecentric radiation output is about 7 . 8 degrees at all three focus positions . optical prescription table 1 is set forth below in the appendix and describes a select example of the embodiment of the anamorphic objective lens disclosed herein . table 2 contains focal length , anamorphic squeeze and illumination data . in table 2 it is shown that the relative illumination is above 40 %, which is sufficiently high for low shading across the field of view when an anamorphic objective lens is used in combination with an electronic sensor at the image plane , such as when the anamorphic objective lens constitutes part of a digital camera . in fig4 - 9 , the transverse ray aberration performance for the example embodiment is shown with minimized residual astigmatic and longitudinal and lateral chromatic aberrations on curved image surfaces to approximately emulate curved object surfaces . fig4 and 5 show transverse ray aberration plots at a far focus distance , 6 and 7 show transverse ray aberration plots at an intermediate focus distance and fig8 and 9 show transverse ray aberration plots at a close focus distance . in fig1 - 15 , the polychromatic mtf performance at a spatial frequency of 20 cycles / mm is shown for the example embodiment to be greater than 70 % at all field positions at the far and close focus distances and greater than 75 % for all axial field positions at an intermediate focus distance . fig1 and 11 show mtf at a far focus distance , fig1 and 13 show mtf at an intermediate focus distance and fig1 and 15 show mtf at a close focus distance . in fig1 , the periphery of the field of view at far , intermediate and close focus distances is shown on a plane in object space located at substantially 3 . 66 m from the image surface . the variation in the field of view size is mainly dependent on variations through focus in the anamorphic squeeze ratio , distortion in x and y directions and focus breathing caused by change in the x and y focal lengths . field stops may be employed in additional locations to those given in table 1 for the example embodiment . they may be located anywhere within the lens system . their purpose is to vignette the radiation and may be circular or rectangular or even rectangular with radius corners . the five lens elements in the anamorphic second lens group with the cylindrical surfaces of the example embodiment additionally may each have two refractive surfaces which may be formed by x and y cylindrical surfaces or y and x cylindrical surfaces with the x and y surfaces substantially perpendicular to one another . this arrangement may improve the imaging characteristics but likely at the effect of additional manufacturing cost . although the present invention has been fully described in connection with an embodiment thereof with reference to the accompanying drawings and data listing , it is to be noted that various changes and modifications including smaller and larger focal lengths , smaller and larger anamorphic squeeze ratios , smaller and larger full aperture f / numbers , smaller and larger image sizes , smaller and larger wavebands , etc . ( e . g ., 435 nm to 656 nm ) may be made as will be apparent to those skilled in the art . such changes and modifications are to be understood as being included within the scope of the present invention as defined by the appended claims .
| 6 |
applicants have discovered that using an anion electrode that is thicker than a cation electrode , but substantially similar in effective capacitance ( such that the effective capacitance of neither electrode is more than two times the capacitance of the other ), provides a cdi cell with greater performance characteristics . surprisingly , and contrary to conventional wisdom as expressed in the &# 39 ; 639 patent mentioned above , the phenomenon is not observed in reverse ; that is , if the anion electrode is much thicker than the cation electrode . this concept is illustrated with reference to the attached figures . an exploded view of the inside of a cdi cell according to an exemplary embodiment of the present invention is illustrated schematically in fig1 . the cell consists of a stack of discs , consisting in order , of an anion electrode , 12 , an anion selective membrane , 13 , a woven spacer , 14 , that serves as a fluid flow path , a cation selective membrane , 15 , and a cation electrode , 16 . the stack of materials is compressed between two conductive graphite carbon blocks ( poco graphite , inc . ), 11 and 17 , which serve as electrical contacts to the electrodes . during the charging , or purification cycle , the anion electrode contacting graphite carbon block , 11 , is electrically connected to the positive terminal of the power supply . the cation electrode contacting graphite carbon block , 17 is connected to the negative terminal of the power supply . a plurality of such cells may be used , in series or in parallel , in alternative embodiments of the invention . the anion and cation electrodes , ( 12 ) and ( 16 ) are cut from sheets , composed of activated carbon , conductive carbon black and a ptfe binder . electrodes of this type are widely used in electric double layer capacitors . in these tests , electrodes of varying thickness were obtained from japan gore - tex , inc ., okayama , japan . the dimensions of the electrodes in the cell of this embodiment are 3 ″ in diameter , and have a 0 . 5 ″ diameter hole ( 18 ) in the center to allow the treated water to pass out of the cell . the anion membrane ( 13 ) is cut from sheets of neosepta am1 ( amerida / astom ). the dimensions are 3 ″ od with a 0 . 5 ″ id . the cation membrane ( 15 ) is cut from sheets of neosepta cm1 ( amerida / astom ). the spacer , 14 , is a 3 . 25 ″ od × 0 . 5 ″ id disc cut from a 0 . 004 ″ woven polyester screen . the flow of water into the cell is radial , with water entering the cell from the outside edge of the spacer , ( 14 ), and flowing out the center exit tube , ( 30 ). holes ( 31 ) are positioned in the center exit tube to enable water to flow from the spacer into the tube . a cross section of exemplary cell components as assembled in an exemplary cylindrical cell housing , ( 39 ), are shown in fig2 a . the housing consists of a top half ( 40 ) and a bottom half ( 41 ), joined by means of 4 bolts ( 46 ). the cation contacting graphite carbon block , ( 17 ) is mounted to a pneumatically actuated air cylinder ( 47 ). the cell components , 12 - 16 are stacked on top of the carbon block ( 17 ), and around the exit tube ( 30 ). the anion contacting carbon block ( 11 ), is rigidly mounted to the top half to the housing ( 40 ). electrical leads 44 and 45 connect the anion contacting carbon block ( 11 ) and the cation contacting carbon block ( 17 ) to the power supply . water is brought into the cell through the water inlet ( 43 ) and fills the circular cavity ( 51 ) surrounding the cell components ( 12 - 16 ). the water flows radially through the spacer ( 14 ) and exits the cell via holes ( 31 ) in the exit tube ( 30 ) and the cell water outlet ( 42 ). the pneumatic cylinder is mounted to a base ( 49 ), which is attached to the bottom half of the housing ( 41 ) by means of bolts ( 50 ). the air cylinder piston ( 48 ) is mounted to the cation contacting carbon block 17 . when the air cylinder is activated the air cylinder piston is extended from the air cylinder , raising ( 17 ) and compressing the cell assembly as shown in fig2 b . in operation of this exemplary embodiment , as shown in fig3 , water is pumped from a reservoir , ( 61 ), via a peristaltic pump ( 62 ) into the cell ( 39 ). treated water is analyzed with a conductivity probe ( 63 ). the output of the conductivity probe is converted to total dissolved solids ( tds ), based on a nacl calibration . power is applied to the cell by means of an programmable battery cycle tester ( 64 ) ( arbin bt2000 ). potential , current and conductivity are recorded as a function of time on a computer ( 65 ). the inlet pressure to the cell is monitored by an inlet pressure transducer ( 66 ), whose output can optionally be included in the arbin ( 64 ). the cell tds can be utilized as a set point by the battery cycle tester in the controlling charge and discharge cycles . inlet water tds is nominally 480 ppm . at the beginning of the charge cycle , the tds rapidly declines to some minimum value ( see fig4 ). after reaching the minimum value , tds increases slowly . typically charge cycles are conducted until the product tds reaches 320 ppm , at which point the polarity of the potential is reversed , causing the cell to discharge . there is a rapid increase in current and tds on discharge . after reaching a peak , the tds decreases and the discharge is typically allowed to proceed until the product tds falls to 580 ppm . in some experiments it was considered useful to employ a ag / agcl reference electrode ( see fig5 ) ( 70 ) to determine how the potential split between the two electrodes . the position of the reference electrode is shown in fig5 . positioned in the circular cavity ( 51 ) surrounding the cell components , the solution potential should be constant . the chloride activity of the test water was estimated to be 0 . 00356 m using debye - huckle approximations for the activity coefficient . from this activity , the potential of the reference electrode was determined to be 0 . 367v vs . the standard hydrogen electrode . protocols could be programmed that enabled a short open circuit condition , or a so called current interrupt . this protocol enabled in - situ determination of the potential of each electrode , free of cell ir . activated carbon electrodes in thicknesses of 250 micron , 600 micron , 800 micron and 1000 micron , were obtained from japan gore - tex . these electrodes are marketed commercially for electrolytic double layer capacitor , and particularly for coin cell applications . cation membrane was either neosepta cm1 , obtained from astom or gore select ( gs018950 - 44us ) produced by w . l . gore & amp ; associates , inc . anion membrane was either neosepta am1 , also obtained from astom or fumasep fab 30 um non - brominated ( lot mi0507 - 140 ), obtained from fumatech gmbh . the spacer was a woven polyester screen , 0 . 004 ″ thick , 180 threads per inch , petenyl , obtained from tenyl tecidos técnicos ltda , brazil . a test water made to simulate a “ hard ” tap water was formulated using the following recipe . calcium chloride dehydrate 293 . 6 mg / l ( cacl2 • 2h2o ) sodium bicarbonate ( nahco3 ) 310 . 7 mg / l magnesium sulfate heptahydrate 246 . 5 mg / l ( mgso4 • 7h2o ) the resulting water had a total hardness of 300 mg caco3 / l , calcium hardness of 200 mg / l , alkalinity 185 mg caco3 / l and a ph of approximately 8 . 0 . 1 . electrodes and membranes are cut to 3 ″ od by 0 . 5 ″ id . spacer is cut slightly oversized 3 . 25 ″ od by 0 . 5 ″ id . 2 . all materials are soaked in a solution of 1000 ppm naci for a minimum of 1 hour . 3 . the materials are assembled in the cell as shown in fig1 - 2 . 4 . the cell is closed and the materials compressed by means of the pneumatic cylinder . 5 . a flow of 7 ml / min of test water is initiated by means of a peristaltic pump . 6 . potential was applied by an arbin battery cycler . the test protocol consisted of the application of 1 . 3 v across the cell ( also called charging or purify ). tds was recorded as a function of time as illustrated in fig4 . 7 . upon applying a potential , ions are removed and tds drops . this continues until the cell becomes saturated . at this point the tds exiting the cell begins to increase . 8 . when the tds level reaches 320 ppm , the polarity of the voltage is reversed (− 1 . 3 volts ) to fully discharge the cell ( also called discharge or waste ). this discharge step is continued until the outlet tds reaches a value of 580 ppm . at that point the cycle is repeated . 9 . average tds is calculated by averaging the tds measurements over the course of an entire charge ( purify ) cycle . a test is stopped when the average tds reaches 60 % of the incoming tds or an average tds of approximately 290 ppm . 10 . one can also define a cell capacity as the integrated tds over the duration of a charge cycle as illustrated in fig7 . the difference between tds in and tds out is measured at each point , multiplied by the flow rate and the time interval . this is integrated over all the peaks , to produce an integrated ion capacity . in the example and comparative examples , the cation membrane was gore select and the anion membrane was fumatech fab . current interrupt experiments were conducted to determine the in - situ capacitance of the electrodes in operation . it is well known that double layer capacitance is a function of both voltage and concentration , so measurement of the actual capacitance during operation must be determined by current interrupt techniques . the experiment is conducted much like described above , except the cell is configured with a ag / agcl reference electrode , as shown in fig5 , above . at periodic intervals an open circuit condition is created , which generates an interruption in current . the cell potential observed immediately after current interrupt is defined as the ir free potential of the cell . total cell potential and the potential of the anion electrode ( relative to the reference electrode ) are obtained experimentally . the potential of the cation electrode is taken by difference . the battery cycler also records the integrated charge over the course of each cycle . capacitance , dq / dv , can then be calculated as shown in fig8 . since three potential differences are available , total potential , anion potential and cation potential , three capacitances can also be obtained : ccell , canion and ccation . some of the experiments from the table 1 were repeated using the current interrupt protocol . in these experiments , neosepta membranes were utilized . in most cases only a few cycles were conducted and capacitance was averaged over the last few cycles after capacitance had stabilized . although nominally identical electrodes , the current interrupt data suggests that there is a very large difference in capacitance between the cation and anion electrodes . the anion electrode has approximately 1 / 10 the capacitance of the cation electrode . see table 2 once again , nominally identical electrodes had quite different capacitance when measured by means of current interrupt protocols . the average capacitance of the anion electrode was once again 1 / 10 of the cation electrode . total cell capacitance increased due to the extra capacity available from the thicker electrode . ( see table 2 ) by utilizing a 250 micron cation electrode in conjunction with a 800 micron anode electrode , the capacitance was balance so the difference in in - situ capacitance of the cation and anion electrodes was only about a factor of ½ . as shown in table 1 , above , achieving this balance unexpectedly resulted in a significant improvement in cell durability . in this experiment , an 800 micron cation and a 250 micron anion electrode were employed . in this case capacitance could not be calculated because the potential of the cation electrode became more positive , rather than more negative , over the course of a charging cycle . this indicates that some process other than electrostatic charging is taking place . it is interesting that this behavior coincides with the worst overall performance observed in table 1 . while particular embodiments of the present invention have been illustrated and described herein , the present invention should not be limited to such illustrations and descriptions . it should be apparent that changes and modifications may be incorporated and embodied as part of the present invention within the scope of the following claims .
| 2 |
an embodiment of the present invention will now be described with reference to fig3 to 6 . fig3 shows a block diagram of a video camera to which an embodiment of the exposure control circuit of a solid state imager according to this invention is applied . in fig3 reference numeral 1 designates a solid state imager ( hereinafter simply referred to as a ccd ) whose electric charge storage time can be controlled . this ccd 1 stores an image light incident thereon through an imager lens ( not shown ) in the form of electric charge at every pixel and outputs the stored electric charge as an electrical imager signal . the electric charge storage time is controlled by a reset pulse sub which will be described later . the imager signal from the ccd 1 is amplified by an amplifying circuit 2 and then controlled to be a predetermined level by an automatic gain control circuit ( agc circuit ) 3 . then , the imager signal from the agc circuit 3 is supplied to a video signal processing circuit 4 and is converted by this video signal processing circuit 4 into a video signal of a predetermined format such as an ntsc system or the like . the video signal thus converted is supplied to a variety of video appliances such as a monitor receiver , a video tape recorder ( vtr ) or the like through an output terminal 5 . in this embodiment , the imager signal from the amplifying circuit 2 is supplied to a detecting circuit 11 and the image signal is peak - detected ( or detected in a mean value ) by this detecting circuit 11 . the detected output from the detecting circuit 11 is supplied to a comparator 12 . then , the detected output is compared with an output potential of a reference voltage generating circuit 13 by this comparing circuit 12 , and a difference therebetween is supplied to an analog - to - digital ( a / d ) converter 14 . the difference signal from the comparator 12 will hereinafter be referred to as a shutter control voltage . the shutter control voltage thus converted to digital data by the a / d converter 14 is supplied to a central processing unit ( cpu ) 15 which is formed of a microcomputer . this cpu 15 is connected with a mode switch 16 and corrects the shutter control voltage data by an exposure control mode instructed by the mode switch 16 and the shutter control voltage data thus corrected is supplied to a digital - to - analog ( d / a ) converter 17 in the form of a pulse - width - modulated wave ( pwm wave ), in which it is converted into an analog voltage signal . in that case , the pwm wave output from the cpu 15 is generated so as to have a nonlinear characteristic relative to the input shutter control voltage data . assuming that d p represents a value indicated by the pwm wave , then the maximum changed amount δd p of the pwm value d p per unit time is set by the following equation : where k is the constant . by setting the changing amount of the pwm value d p on the basis of the equation ( 1 ), the maximum changing amount δd p can be increased if the pwm value d p is a value of relatively low level and the maximum changing amount δd p can be suppressed if it is a value of relatively high level . then , a voltage signal , which results from converting the pwm wave , that is , the shutter control voltage data in the form of analog data , is supplied to a shutter speed control circuit 20 through a terminal 21 . the shutter speed control circuit 20 is constructed as shown in fig4 which is supplied with a image read - out pulse sg from a terminal 6 , a reset pulse rp from a terminal 7 and a vertical blanking signal vblk from a terminal 8 . the shutter speed control circuit 20 includes a saw tooth wave generating circuit 30 , and in this saw tooth wave generating circuit 30 , an output of a constant current source 31 is supplied to an inverting input terminal of an operational amplifier 32 and a noninverting input terminal of the operational amplifier 32 is grounded via a resistor r 1 . in this case , the output current value of the constant current source 31 is controlled by a current control circuit 24 which will be described later . the inverting input terminal of this operational amplifier 32 is connected to an output terminal of the operational amplifier 32 via a capacitor c 1 and a connection switch 33 is connected to the capacitor c 1 in parallel . this connection switch 33 is controlled by a connection control circuit 23 . this connection control circuit 23 is supplied with the image read - out pulse sg from the terminal 6 and generates a connection control signal which connects the connection switch 33 thereto in response to the image read - out pulse sg from the terminal 6 . in this case , the image read - out pulse sg is a pulse supplied to the connection control circuit 23 at every field of the video signal and supplied at the beginning of each field with the result that the connection switch 33 is temporarily placed in the connected state at the beginning of each field . the vertical blanking signal vblk supplied from the terminal 8 is supplied to the current control circuit 24 and the constant current source 31 is controlled by the current control circuit 24 in such a manner that the output current value is increased by a predetermined value only during the vertical blanking period . the saw tooth wave generating circuit 30 is constructed as described above so that it can derive a saw tooth wave in which an output potential is increased each time the connection switch 33 is placed in the connected state ( i . e ., at every field ) and instantly returned to the original potential after having reached to the predetermined potential . in this case , since the output current value of the constant current source 31 by the vertical blanking period vblk is increased as compared with that during other period according to this embodiment , as shown in fig5 d , the increasing ratio of this potential is increased ( i . e ., an inclination in which the potential is changed becomes steep ) when the output potential is increased more than a predetermined value during the vertical blanking period . the resultant saw tooth wave is supplied to the inverting input terminal of a comparator 25 and also fed to a detecting circuit 40 . the detecting circuit 40 is adapted to detect a peak value wherein the output of the saw tooth wave generating circuit 30 is supplied to the anode of a diode d 1 and the cathode of the diode d 1 is connected to a noninverting input terminal of an operational amplifier 41 . the cathode of the diode d 1 is grounded via a capacitor c 2 , and an output terminal of the operational amplifier 41 is connected to the inverting input terminal thereof . further , the shutter control voltage developed at the terminal 21 is supplied through a resistor r 2 to the anode of the diode d 2 , and the output terminal of the operational amplifier 41 is connected to the cathode of the diode d 2 . the anode of the diode d 2 is connected to the noninverting input terminal of the comparator 25 . since the shutter speed control circuit of this embodiment is constructed as described above , the peak level of the saw tooth wave from the saw tooth wave generating circuit 30 is detected by the detecting circuit 40 and the shutter control voltage is converged to the peak - detected level in a nonlinear fashion . that is , due to the nonlinear characteristic of the diode d 2 connected between the input side of the shutter control voltage and the detecting circuit 40 , as shown in fig6 if the input voltage ( shutter control voltage ) v s at the terminal 21 is low in level , the anode potential v d of the diode d 2 is changed in accordance with the change of the input voltage v s . whereas , if the input voltage v s approaches the peak v p of the saw tooth wave , then the potential v d is changed with a delay time due to the nonlinear characteristic of the diode d 2 . the comparator 25 compares the shutter control voltage developed at the anode of the diode d 2 and the saw tooth wave to produce a detecting signal which changes when the shutter control voltage exceeds the level of the saw tooth wave . this detecting signal is supplied to one input terminals of and gates 27 and 28 as a gate pulse , whereby a logical product of this gate pulse and the reset pulse rp supplied to the other input terminal of the and gate 27 from the terminal 7 and a logical product of negative logical value of the vertical blanking signal vblk supplied to the other input terminal of the and gate 28 from the terminal 8 an the gate pulse are respectively obtained at the and gates 27 and 28 . then , the logical product outputs of the two and gates 27 and 28 are supplied to one and the other input terminals of an or gate 29 to thereby obtain a logical sum output . this logical sum output is fed to the output terminal 22 as the reset pulse sub . this reset pulse sub developed at the terminal 22 is supplied through a driving circuit 18 to the ccd 1 ( see fig3 ) and electric charges stored in the ccd 1 are discharged in response to the reset pulse sub . operation of the video camera according to this embodiment will be described below , highlighting the control of the shutter speed with reference to fig5 a to 5h . if a picture of an object is taken in synchronism with the vertical synchronizing signal vd shown in fig5 a , then the vertical blanking signal vblk ( see fig5 b ) and the image read - out pulse sg ( see fig5 c ) are generated on the basis of the vertical synchronizing signal vd and electric charges stored in the ccd 1 are read out at every vertical period in synchronism with the image read - out pulse sg . then , as shown in fig5 d , the saw tooth wave generated from the saw tooth wave generating circuit 30 within the shutter speed control circuit 20 is synchronized with the image read - out pulse sg and the vertical blanking signal vblk goes to low level signal &# 34 ; 0 &# 34 ; with the result that the increasing ratio of the potential is increased during the vertical blanking period . when the potential of the saw tooth wave is lower than the shutter control voltage , then the output of the comparator 25 goes to high level signal &# 34 ; 1 &# 34 ;. accordingly , the pulse duration of the high level signal &# 34 ; 1 &# 34 ; output from the comparator 25 is successively ( in an analog fashion ) controlled by the shutter control voltage so that , if the object becomes bright and the shutter control voltage is increased , then the pulse duration of the high level signal &# 34 ; 1 &# 34 ; is increased . as shown in fig5 f or 5h , the reset pulse rp supplied through the terminal 7 is a signal synchronized with the horizontal synchronizing signal and which goes to high level signal during the horizontal blanking period so as not to affect the imager signal now being read - out . then , the and gate 27 opens to pass therethrough the reset pulse rp when the output of the comparator 25 is at high level . while , the and gate 28 is opened to pass therethrough the negative logic value of the vertical blanking period vblk supplied thereto through the terminal 8 and which is illustrated in fig5 b when the output of the comparator 25 is high in level . accordingly , the or gate 29 outputs the reset pulse rp as the reset pulse sub during the period in which the object , for example , is dark , the shutter control voltage is low and the high level period of the output from the comparator 25 is shorter than the high level period of the vertical blanking period vblk , that is , so - called video period ( hereinafter referred to as a low speed shutter region ). more specifically , in the low speed shutter region , the or gate 29 outputs the reset pulse sub which is controlled in the unit of 1h ( i . e ., one horizontal period ). for example , when the comparator 25 generates the compared output ( see fig5 e ) which is changed to low level during the video period in the comparison of the shutter control voltage va ( see fig5 d ) and the saw tooth wave , then the output of the reset pulse rp is stopped from a timing point at which the compared output is changed to the low level as shown in fig5 f , and electric charges are stored during a period ta from the stop of the reset pulse rp to a timing point at which the image read - out pulse sg rises next . this storage period ta becomes a time period corresponding to the shutter speed . when on the other hand the shutter control voltage is high and the high level period of the output from the comparator 25 is longer than the video period ( hereinafter referred to as a high speed shutter region ), the reset pulse rp is output during the video period and the reset pulse sub of high level is output during the period in which the output of the comparator 25 is high in level in the vertical blanking period . that is , in the high speed shutter region , the or gate 29 outputs the reset pulse sub which is controlled successively . for example , when the comparator 25 generates a compared output ( see fig5 g ) which is changed to the low level during the vertical blanking period in the comparison of the shutter control voltage vb ( see fig5 d ) and the saw tooth wave , as shown in fig5 h , the pulse is output as the reset pulse rp during the vertical blanking period and the duration of this pulse is changed in response to the compared output . then , electric charges are stored during the period tb in which the next image read - out pulse sg rises after the pulse was changed to the low level . this storage time tb becomes a time period corresponding to the shutter speed . as set out above , the shutter speed control circuit 20 supplies the substrate of the ccd 1 through the driving circuit 18 with the reset pulse sub controlled in the unit of 1h during the video period in the low speed shutter region in which the object is dark and the output level of the ccd 1 is detected to be low by the detecting circuit 11 and controls in the unit of 1h the electric charge storage time in which the next image read - out pulse is supplied after the final reset pulse sub was supplied . on the other hand , in the high speed shutter region in which the object is bright and the output level of the ccd 1 is detected to be high by the detecting circuit 11 , the reset pulse sub successively controlled on the basis of the output level of the ccd 1 is supplied through the driving circuit 18 to the substrate of the ccd 1 during the vertical blanking period in which the read - out operation of the imager signal is not affected at all , to thereby successively control the electric charge storage time in which the next image pulse sg is supplied after the final reset pulse sub was supplied . then , the imager signal from the ccd 1 whose electric charge storage time is controlled , that is , the imager signal whose exposure is automatically controlled in response to the brightness of the object is converted into the video signal based on the ntsc system or the like and this video signal is fed to the terminal 5 . according to this embodiment , since the saw tooth wave compared with the shutter control voltage in the high speed shutter region ( i . e .,, during the vertical blanking period ) is arranged to have a large inclination in which the increasing ratio of the potential is large as compared with the saw tooth wave compared in the low speed shutter region , the high speed shutter region has a higher resolution as compared with the low speed shutter region . accordingly , in the high speed shutter region , the brightness of the object can be detected at high resolution and the shutter speed can be controlled at high accuracy . further , the peak level of the saw tooth wave is detected and the shutter control voltage is converged to the value thus peak - detected in the nonlinear fashion as described above so that , when the shutter control voltage lies near the peak value of the saw tooth wave , the rapid fluctuation can be suppressed . therefore , the shutter speed can be prevented from being fluctuated rapidly when the shutter speed is very high so that the exposure can be controlled at high accuracy in the very high shutter speed . furthermore , when the shutter control voltage data is pwm - detected by the cpu 15 , the shutter control voltage data is converted in the nonlinear characteristic so that the exposure can be controlled at high accuracy in the considerably high shutter speed from this viewpoint . according to the present invention , even when the object is very bright and the shutter speed is very high , the exposure can be controlled smoothly and properly , thereby making it possible to enlarge a range of the quantity of an incident light which can be applied to the so - called electronic shutter utilizing the ccd . therefore , the cameraman can take a picture satisfactorily by using a video camera which utilizes an imager lens of so - called manual iris in which the iris is fixed . having described the preferred embodiment of the invention with reference to the accompanying drawings , it is to be understood that the invention is not limited to that precise embodiment and that various changes and modifications thereof could be effected by one skilled in the art without departing from the spirit or scope of the novel concepts of the invention as defined in the appended claims .
| 7 |
while the following description illustrates a configuration of the system of the present invention which is particularly suitable for removing used oil from and dispensing the fresh oil to the internal combustion engine of a vehicle , it is to be understood that the present system is suitable for changing any type of fluid in a fluid receptacle having a drain plug opening . further , although the present system is described as having the capacity to dispense several different grades of oil , the system may be configured to dispense either one type of fluid or more than one type of fluid . the present system also may be used to remove and dispense any type of fluid . in a preferred embodiment , substantially all of the principal components of the automated fluid changing system are enclosed in a cabinet formed from sheet metal or other suitable material . referring now to the drawings , there is shown in fig1 the automated fluid changing system of the present invention , generally designated as 1 . the system 1 is removably connected to oil pan 7 in engine 2 by a quick connect nipple 4 , which is mounted in the drain plug opening 3 of oil pan 7 , and a quick connect coupling 5 which is affixed to a valve 60 . the valve 60 directs the flow of fluids to and from the oil pan 7 . as shown in fig2 valve 60 includes a valve housing 6 which may be formed from any material which is suitable to withstand the temperatures , fluids , and pressures required for changing a particular fluid . in a preferred embodiment , valve housing 6 is made from aluminum . valve 60 is provided at one end with a connector port 62 . quick connect coupling 5 is disposed within connector port 62 and attaches to nipple 4 to connect system 1 to the drain plug opening 3 . preferably , quick connect nipple 4 is permanently mounted within drain plug opening 3 and quick connect coupling 5 is permanently mounted within connector port 62 . while the use of quick connect couplers 4 and 5 provides the most convenient and efficient means to connect the system 1 to the drain plug opening 3 , any suitable connecting means may be employed for attaching system 1 to a fluid receptacle . the connector port 62 serves as a passageway for fluids to enter and exit a valve chamber 79 disposed within the housing 6 of valve 60 . valve chamber 79 is provided with an outlet port 77 through which the used oil 22 flows , and an inlet port 78 through which the fresh oil flows . outlet port 77 opens into one end of a suction cavity 61 which is also disposed within the body 6 of valve 60 . the opposite end of suction cavity 61 is provided with a suction port 63 for receiving a suction conduit 14 . inlet port 78 opens into one end of a check valve chamber 58 within valve 60 . the opposite end of check valve chamber 58 is provided with a dispenser port 64 . the fresh fluid flows through dispenser port 64 , through check valve chamber 79 , through inlet port 78 , and into valve chamber 79 . in a preferred embodiment , the valve 60 is actuated by air pressure which flows through air line 20 , through air flow port 67 into a diaphragm cavity 66 . the air pressure displaces a diaphragm 68 , which is horizontally disposed within cavity 66 of valve 60 . the diaphragm 68 is connected to one end of a valve shaft 69 . valve shaft 69 is positioned perpendicular to diaphragm 68 and is maintained in a vertical alignment within a valve shaft channel 59 by seals 70 and 71 . valve shaft channel 59 is disposed between diaphragm cavity 66 and valve chamber 79 . the seals 70 and 71 also prevent used and fresh fluid from flowing through the valve shaft channel 59 into the diaphragm cavity 66 . the end of shaft 69 opposite diaphragm 68 is provided with valve seal 72 . a retaining spring 73 is disposed between valve seal 72 and shaft seal 70 . when valve 60 is in a closed position , the force of retaining spring 73 retains valve seal 72 against outlet port 77 to prevent the suction force from being exerted on valve cavity 79 . a ball check valve 75 is seated against the orifice of dispenser conduit 49 which is connected to dispenser port 64 . ball check valve 75 is retained against the open end of dispensing conduit 49 by ball check valve spring 76 . ball check valve spring 76 rests against stop pins 74 , which protrude into check valve chamber 58 at inlet port 78 . in a particularly preferred embodiment , valve 60 is connected to a coaxial hose 23 , which includes an outer suction conduit 14 and an inner dispenser conduit 49 . one end of the outer suction conduit 14 is connected to suction port 63 of valve 60 . the suction conduit 14 may be sealed and joined to suction port 63 by threads ( not shown ) or any other suitable sealing or connecting means . one end of the inner dispenser conduit 49 is connected to dispenser port 64 of valve 60 and may be sealed to dispenser port 64 by o - rings ( not shown ) or any other suitable sealing or connecting means . the ends of both suction conduit 14 and dispenser conduit 49 which are opposite valve 60 are connected to a splitter 13 . splitter 13 directs dispenser conduit 49 to communicate with dispenser pipe 48 and directs suction conduit 14 to communicate with suction hose 12 . suction hose 12 is provided with a suction pump 11 . suction pump 11 applies a suction force to suction hose 12 and suction conduit 14 for withdrawing used oil 22 from oil pan 7 . a vacuum switch 24 is disposed within suction hose 12 between splitter 13 and suction pump 11 . vacuum switch 24 evaluates the pressure within suction hose 12 to determine when all of the used oil 22 has been evacuated from oil pan 7 . optionally , a sampler 26 may be provided in waste oil hose 27 for removing a sample of the used oil to submit for evaluation . in one embodiment , sampler 26 may be air actuated by means of a control operator 30 . control operator 30 is actuated by air flowing through air line 29 from an external air source 16 . bottle 31 , which receives the sample of used oil , is removably connected to sampler 26 . air pressure is supplied to system 1 from the external source 16 through air line 17 . air line 17 is connected to a regulator 18 . regulator 18 controls the pressure of the air which flows through air lines 20 , 29 and 51 . air line 20 is connected on one end to air flow port 67 in the diaphragm cavity 66 of valve 60 . the opposite end of air line 20 is connected to regulator 18 . air valve 15 is disposed within air line 20 for controlling the air flow to the valve operator 21 on valve 60 . air valve 15 may be a 3 - way valve or any suitable means for controlling the air flow . air line 51 is connected on one end to dispenser pipe 48 . the opposite end of air line 51 is connected to regulator 18 . air valve 50 is disposed within air line 51 to control the flow of air into dispenser pipe 48 . air pressure from external source 16 is used to actuate valve 50 , allowing the air to pass through to flush any remaining fresh fluid out of dispenser pipe 48 . air line 29 is connected on one end to sampler 26 and on the other end to regulator 18 . air valve 21 is disposed within air line 29 to control the flow of air to sampler 26 . optionally , the regulator 18 may be provided with an air filter 19 . dispenser pipe 48 is connected to a meter 47 which is provided with a meter inlet 46 . the meter inlet 46 receives the fresh fluid lines 39 , 40 , and 41 for transporting fresh fluids from fluid storage tanks 33 , 34 , and 35 . the fresh fluid storage tanks 33 , 34 and 35 are provided with pumps 36 , 37 and 38 which withdraw the fresh fluid and dispense the fluid through lines 39 , 40 and 41 under pressure . fresh fluid lines 39 , 40 , and 41 may be provided with regulator valves 42 , 43 , and 44 , respectively , for controlling the flow rate and pressure of the fresh fluid . fluid level indicators 53 , 54 and 55 may be provided on fresh fluid tanks 33 , 34 , and 35 for monitoring the amount of fresh fluid stored in the tanks . a computer controller 8 communicates with system 1 of the present invention to automatically initiate the evacuation phase and the dispensing phase of the fluid changing process of the present invention . computer controller 8 may include a screen 9 for displaying menus to prompt an operator of the system 1 . numeric keypad 10 may be used by an operator to enter the commands required to activate the system 1 . computer controller 8 may be provided with a printer 52 for recording data pertaining to the fluid change . computer controller 8 also may be provided with a magnetic strip card reader 57 or any other suitable means for receiving information pertaining to the fluid change , such as the vehicle identification number or the number of quarts of fluid required . to change the oil 22 in the oil pan 7 of an internal combustion engine 2 using the fluid changing system 1 of the present invention , a quick connect nipple 4 is mounted in the drain plug opening 3 of oil pan 7 . typically , quick connect nipple 4 remains permanently in drain plug opening 3 so that the vehicle is permanently configured for the automated oil change process of the present invention . the system 1 is then connected to the quick connect nipple 4 by the quick connect coupling 5 which is affixed to the connector port 62 in valve 60 . the fluid change system 1 is activated by operator interface with the computer controller 8 . the lcd screen 9 prompts the operator to use numeric keypad 10 to enter the commands required to activate system 1 . when the oil change process has been initiated by an operator , the suction pump 11 is energized to begin the evacuation of used oil 22 . as the suction pump 11 operates , a suction force is applied to suction hose 12 . the splitter 13 directs the flow of the suction force to the suction conduit 14 within coaxial hose 23 . as suction pump 11 is activated , air valve 15 opens to allow air to flow from the external source 16 through air line 17 . the air travels through regulator 18 and filter 19 , through the now open air valve 15 , and into air line 20 . as shown in fig3 air from air line 20 enters diaphragm cavity 66 through air flow port 67 to force diaphragm 68 in a downward direction . as diaphragm 68 moves downward , the diaphragm shaft 69 pulls valve seal 72 away from outlet port 77 , allowing the suction force to flow from suction cavity 61 through outlet port 77 and into valve chamber 79 . the suction force draws the used oil 22 through the quick connect nipple 4 in drain plug opening 3 , through the quick connect coupling 5 , and into valve cavity 79 within valve 60 . the used oil 22 exits valve cavity 79 through outlet port 77 . the used oil 22 flows through suction cavity 61 and exits valve 60 through suction port 63 . the used oil 22 is then drawn through suction conduit 14 in coaxial hose 23 , through the splitter 13 and to the suction hose 12 . the used oil 22 is transported through suction hose 12 , past vacuum switch 24 , through the suction pump 11 and into waste oil hose 27 . waste oil hose 27 directs the used oil 22 through sampler 26 . used oil 22 exits sampler 26 through the opposite end of waste oil hose 27 and is deposited in waste oil reservoir 28 . if the operator elected to remove a sample of the used oil for evaluation , air valve 21 will open as used oil 22 passes through sampler 26 to allow air to flow through air line 29 to activate operator 30 on sampler 26 . the air pressure flowing through air line 29 opens a valve ( not shown ) in sampler 26 to deposit a sample of the used oil 22 into bottle 31 . when the oil change process is complete , bottle 31 can be removed and sent to an oil analysis lab for evaluation . as the used oil 22 is evacuated from oil pan 7 , the vacuum switch 24 evaluates the vacuum within suction hose 12 . when the vacuum within suction hose 12 has shifted to near ambient pressure , a signal is sent to the computer controller 8 to disengage the suction pump 11 . simultaneously , the computer controller 8 signals air valve 15 to close , allowing the air in diaphragm cavity 66 to reverse the direction of flow and exit cavity 66 through air flow port 67 . as the pressure in diaphragm cavity 66 is returned to ambient , retaining spring 73 forces valve seal 72 against outlet port 77 to close valve chamber 79 . as the suction pump 11 is disengaged and valve 60 returns to a closed position , the computer controller 8 opens one of the valves 42 , 43 , or 44 corresponding to the selected grade of oil to be dispensed into the oil pan 7 . referring to fig1 for example , if 20w / 50 weight oil is selected initially , valve 43 opens to allow fresh 20w / 50 weight oil to flow from tank 34 through pump 37 . pump 37 forces the fresh 20w / 50 oil under pressure through pipe 40 , through open valve 43 , into meter inlet 46 and through meter 47 , which measures the volume of oil being dispensed . the fresh oil then continues through dispenser pipe 48 to splitter 13 , which directs the fresh oil to flow into dispenser conduit 49 within coaxial hose 23 . the fresh oil passes from dispenser conduit 49 through dispenser port 64 in valve 60 . as shown in fig4 pressure from the fresh oil forces ball check valve 75 against the opposing ball check valve spring 76 . this allows the fresh oil to pass through check valve chamber 58 via inlet port 78 into valve chamber 79 . the fresh oil exits valve chamber 79 through connector port 62 via quick connect couplers 4 and 5 to enter the oil pan 7 through the drain plug opening 3 . valve 60 controls the flow direction of both the used and the fresh oil to prevent the fresh oil from entering suction conduit 14 or returning to dispenser conduit 49 in coaxial hose 23 . as the fresh fluid dispensing phase is completed , air valve 50 opens to allow air to flow from air line 51 , through open air valve 50 , and into dispenser pipe 48 . the air flows from dispenser pipe 48 into dispenser conduit 49 to force any remaining fresh oil out of pipe 48 , conduit 49 , and valve 60 , and into oil pan 7 . ball check valve 75 prevents any fresh oil from traveling back into dispenser conduit 49 so that there is no substantial mixing of the fresh oil with a different grade of oil which may be subsequently dispensed through system 1 of the present invention . at any time during the process of changing the oil using the system 1 , an operator may remove oil filter 32 and replace it with a new filter . when the oil change process has been completed , data pertaining to the oil change may be stored into the computer controller 8 . optionally , data may be printed on printer 52 . an interface menu suitable for use with the software in computer controller 8 is illustrated in fig5 . the software is written and programmed into the computer controller 8 and is specific in nature to the operation of the automated fluid changing system 1 . as the operator initiates an oil change process , the computer interface screen 9 displays menus which drive the controller 8 to automatically activate the appropriate components in the fluid changing system 1 of the present invention . a typical interface menu is described with reference to fig5 . the computer interface screen 9 begins with the statement &# 34 ; welcome , press yes to proceed &# 34 ; displayed in screen 80 . if yes is entered , the computer controller screen 81 displays the statement &# 34 ; is your engine off ? press yes or no .&# 34 ; if no is entered , then the computer controller screen 81 returns to the statement displayed on screen 80 . if yes is entered , the computer controller screen 82 displays the statement &# 34 ; select grade of new oil required .&# 34 ; after a specific grade of fresh oil is selected , the computer controller screen 83 displays the statement &# 34 ; take a sample ? press yes or no .&# 34 ; if yes in entered , the computer controller screen 84 displays the statement &# 34 ; bottle in place ? press yes or no .&# 34 ; if no is entered , the computer controller 8 will not allow the operator to continue and screen 83 will be displayed again . if yes is entered , the computer controller screen 85 displays the statement &# 34 ; enter new oil quarts to fill , use keypad .&# 34 ; at this time , the operator enters the desired number of quarts of fresh oil using the keypad 10 . the computer controller screen 86 displays the statement &# 34 ; 00 . 0 qts to fill , press yes when set .&# 34 ; the &# 34 ; 00 . 0 &# 34 ; numbers will change as the operator enters the desired number of quarts . for example , if the operator enters the number 44 . 0 indicating that 44 quarts are needed , then the &# 34 ; 00 . 0 &# 34 ; numbers on the screen will read &# 34 ; 44 . 0 .&# 34 ; after the quantity is entered and yes is entered , the computer controller screen 87 displays the statement &# 34 ; make connections , press yes to start .&# 34 ; if no is entered , then the computer controller screen 87 continues to display the same statement . if yes is entered , then the computer controller screen 88 displays the statement &# 34 ; oil being removed , change filters now .&# 34 ; the computer controller screen 88 continues to display this statement for a predetermined period of time . then , computer controller screen 89 may optionally display the statement &# 34 ; filters changed ? press yes when ready .&# 34 ; if the optional statement is not included in the system &# 39 ; s program , then computer controller 8 will automatically begin refilling oil pan 7 and screen 90 will be displayed . if no is entered , the computer controller screen 89 continues to display the same statement . if yes is entered , the computer controller screen 90 displays the statement &# 34 ; adding new oil , please wait . . . 00 . 0 .&# 34 ; the numeric display &# 34 ; 00 . 0 &# 34 ; indicates the number of quarts being dispensed to oil pan 7 and counts down or up ( optional ) until the total number of quarts desired have been dispensed to oil pan 7 . upon completion of the dispensing phase , the computer controller screen 91 displays the statement &# 34 ; new oil installed , check oil level now .&# 34 ; at this time , the operator should check the oil level in the engine of the vehicle being serviced . after a predetermined period of time , the computer controller screen 92 displays the statement &# 34 ; is oil level correct ?, press yes or no .&# 34 ; if yes is entered , the computer controller screen 98 will be displayed . if no is pressed , the computer controller screen 93 displays the statement &# 34 ; to add oil press yes , remove oil press no .&# 34 ; if yes is entered , the computer controller screen 94 displays the statement &# 34 ; enter qts to add , press yes when set 0 . 0 .&# 34 ; as the operator uses the numeric keypad 10 to enter the number of quarts to be added , the numeric display on screen 94 changes from &# 34 ; 0 . 0 &# 34 ; to the number of quarts entered . for example , if the operator desires to add 2 and 1 / 2 quarts of oil , the numeric value of 2 . 5 should be entered . this value will be displayed on the computer controller screen 94 in place of the numeric value 0 . 0 . if no is entered , the computer controller screen 95 displays the statement &# 34 ; enter qts to remove , press yes when set 0 . 0 .&# 34 ; as the operator uses the numeric keypad 10 to enter the number of quarts to be removed , the numeric display on screen 95 changes from &# 34 ; 0 . 0 &# 34 ; to the number of quarts entered . for example , if the operator desires to remove 1 and 1 / 2 quarts of oil , the numeric value of 1 . 5 is entered . this value is displayed on the computer controller screen 95 in place of the numeric value of 0 . 0 . after the desired amount of oil has been added or removed , and yes is entered to indicate that the amount to be added or removed has been set , the computer controller screen 96 displays either the statement &# 34 ; adding oil , please wait . . . 0 . 0 &# 34 ; for the adding oil procedure or the statement &# 34 ; removing oil , please wait . . . 0 . 0 &# 34 ; for the removal of oil procedure . in either case , the numeric value on the computer controller screen 96 will scroll to zero value as the procedure is being executed . upon completion of the procedure , the computer controller screen 97 displays the statement &# 34 ; is oil level correct , press yes or no .&# 34 ; if no is entered , the computer controller screen 93 will be displayed and the sequence of steps for adding or removing oil will be repeated . if yes is entered , the computer controller screen 98 displays the statement &# 34 ; remove connections , press yes when done .&# 34 ; when yes is entered , the computer controller screen 99 displays the statement &# 34 ; print data ? press yes or no .&# 34 ; if no is entered , the computer controller screen 100 displays the final statement &# 34 ; process complete , thank you .&# 34 ; if yes is entered , the computer controller 8 will print the designated data on either an internal printer 52 or on a remote printer connected to the computer controller 8 . the computer controller screen 100 then displays the final statement &# 34 ; process complete , thank you .&# 34 ; after a predetermined period of time , the computer controller screen automatically resets to display the statement in screen 80 . although the invention is described with respect to a preferred embodiment , modifications thereto will be apparent to those skilled in the art . therefore , the scope of the invention is to be determined by reference to the claims which follow .
| 5 |
crystalline nitrilotriacetonitrile produced from a nitrilotriacetonitrile - water mixture at a temperature in excess of 95 ° c . that is rapidly cooled in one step to 25 ° c . to 35 ° c . tends to produce very fine crystals that are difficult to separate from the nitrilotriacetonitrile mother liquor , and are difficult to wash . this results in a product that is more contaminated with the components of the mother liquor . additionally , a dispersion containing a large amount of fine crystals is difficult to handle , is difficult to pump , and has a tendency to plug lines . it has been found that larger and more uniform crystals are produced if the high temperature nitrilotriacetonitrile - water mixture is cooled in two stages to form the crystalline nitrilotriacetonitrile . temperature of the first stage must be about 70 ° c . to about 90 ° c ., preferably about 80 ° c . to about 90 ° c ., and more preferably about 85 ° c . at temperatures in excess of about 90 ° c ., insufficient crystal formation occurs in the first stage , leaving a large proportion of nitrilotriacetonitrile in solution going into the second stage . when this more concentrated solution is cooled in the second stage , an unacceptable percentage of fine crystals is formed . at temperatures below about 70 ° c ., excess nucleation occurs in the first stage , also resulting in formation of an excess number of fine crystals . the sojourn time in the first stage must be at least about 5 minutes , preferably at least about 10 minutes , and most preferably at least about 15 minutes . the sojourn time is defined in continuous crystallization equipment as the volume of the first stage reactor divided by the feed rate , and in batch crystallization processes as the time period beginning with the commencement of cooling to the first stage temperature and ending with the commencement of cooling to the second stage temperature . sojourn time less than about 5 minutes provides an insufficient amount of time for crystal formation in the first stage , resulting in formation of an unacceptable number of fine crystals in the second stage . longer sojourn times reduce the capacity of the crystallization equipment . sojourn time in excess of about 30 minutes is generally not necessary . in the first stage , the cooling should be as rapid as possible . a preferred method is direct cooling by recycling the cooled slurry from the second stage into the first stage in the proper proportion to produce the desired temperature . this recycled slurry also seeds the solution , resulting in larger , more uniform crystals . an acceptable , but less preferred method is use of cooling coils or cooling jackets . this method is less preferred due to riming that can occur on the cold surfaces . vacuum cooling is another acceptable method , but is less preferred due to difficulty of condensing the vapors produced and due to foaming that can occur . the nitrilotriacetonitrile - water mixture should be agitated for uniformity of temperature . however , high agitation and recirculation can result in foaming , crystal breakage , and increased nucleation . crystal breakage and excessive nucleation can result in formation of an undesirable number of fine crystals . agitation and recirculation should be controlled to minimize these effects . it is preferred that at least about 50 % of the total nitrilotriacetonitrile be present as crystals at the completion of the first stage . it is also preferred that the high temperature nitrilotriacetonitrile solution be fed to the first stage over a period of time , during the first stage cooling . cooling in the second stage can also be rapid . however , cooling methods in this stage are more flexible . a preferred method is vacuum cooling . this method is preferred because , in addition to being an efficient cooling method , it also serves to improve the yield during the crystallization step by concentrating the solution , and removes any gaseous hydrogen cyanide that might present a later safety problem . other suitable methods of cooling include cooling jackets and coils , and recycling of cooled mother liquor resulting from separation of the crystalline nitrilotriacetonitrile back into the second stage . the temperature should be below 35 ° c ., preferably below 30 ° c ., and particularly below about 25 ° c . this temperature range is sufficient for a good yield of crystals . some riming can occur in the second stage , but this can be minimized by coating the cool surfaces in the crystallizer with a nonstick coating , such as a fluorocarbon polymer . the sojourn time in stage two is less critical than in stage one . however , the mixture must remain in stage two for a sufficient time to complete formation of crystals . stage two should also be agitated to keep crystals in suspension . this process is preferably carried on as a continuous process using two continuous crystallization tanks , one for stage one and one for stage two . additionally , multiple tanks could be used for either stage one , stage two or both . this process can also be adapted for use in single tank batch crystallization provided that the tank is adapted for feeding of the nitrilotriacetonitrile solution during first stage cooling to the desired temperature with the desired sojourn time , and is also adapted to further cooling for stage two . the following examples serve to illustrate the process of this invention . they are intended as illustrative only and are not intended in any way to limit the scope of this invention . all parts and percentages are by weight unless otherwise specified . nitrilotriacetonitrile was produced from hexamethylenetetramine , formaldehyde and hydrogen cyanide , at a temperature of 115 ° c . in the first run , the reaction solution was collected in a receiver cooled in a bucket of ice and water . in run two , the reaction product was collected at 90 ° c . and was thereafter cooled to ambient temperatures by vacuum cooling . the crystal size distribution for each of the runs was determined by measuring the weight percent of the crystals that was retained on each of a series of progressively finer standard screens . these results , and a comparison with run 3 , in which nitrilotriacetonitrile is produced at 80 ° c . and cooled in one step to 25 ° c .- 30 ° c ., are shown in table i . table i______________________________________crystal size distribution (%) uss mesh run 1 run 2 run 3______________________________________ + 20 0 12 1 - 20 + 50 0 31 71 - 50 + 100 3 . 5 51 14 - 100 + 120 3 . 5 4 1 - 120 93 2 13______________________________________ a 33 % solution of nitrilotriacetonitrile and water was prepared and heated to approximately 100 ° c . this solution was fed into a first stage crystallizer at a controlled rate . the first stage crystallizer was a small tank equipped with an agitator and with a overflow pipe through which the nitrilotriacetonitrile - water mixture flowed into a second stage crystallizer . the second stage crystallizer was a water jacketed tank equipped with an agitator . a recirculation pump drew the nitrilotriacetonitrile - water mixture from the second stage crystallizer and circulated part of this mixture to a product collector , part to the first stage crystallizer to provide cooling , and part to the second stage crystallizer . samples of the product were subject to accumulative screen analysis , and the mean crystal size of each run was determined from these results . the temperature of the first stage crystallizer , the sojourn time in the first stage crystallizer and the resulting mean crystal size in millimeters are shown in table ii . this compares to nitrilotriacetonitrile that is crystallized in one step from an 80 ° c . reaction mixture to 25 ° c .- 30 ° c ., which has a mean crystal size of 0 . 134 millimeters . table ii______________________________________average crystal size with respect tofirst stage temperature and sojourn time sojourn mean temp ° c . time - mins . crystalrun no . first stage first stage size mm______________________________________1 80 17 0 . 112 80 13 . 3 0 . 103 85 13 . 3 0 . 1144 85 17 0 . 1325 85 17 0 . 1436 85 20 0 . 1467 90 20 0 . 120______________________________________ about 255 ml of a 33 % solution of nitrilotriacetonitrile was prepared and heated to approximately 100 ° c . this solution was fed into a first stage crystallizer at about 15 ml / min . the first stage crystallizer was a 400 ml stainless steel beaker with good agitation . the first stage crystallizer initially contained about 35 ml of 33 % nitrilotriacetonitrile slurry at the desired temperature . the temperature of the first stage crystallizer was maintained at the desired temperature by a water bath . when feeding of the nitrilotriacetonitrile was completed , the beaker and its contents were cooled to about 25 ° c . in an ice - water bath . additionally , one run was done in which the 100 ° c . solution was cooled to 25 ° c . in one stage . mean crystal sizes for each of the runs was determined in example 2 . the results are shown in table iii . table iii______________________________________mean crystal size with respect tofirst stage temperature temp . ° c . mean crystalrun no . first stage size mm______________________________________ 8 80 . 115 9 70 . 11210 65 . 08711 60 . 08012 25 . 074______________________________________ a comparison of runs 1 , 2 and 8 shows that the results of examples 2 and 3 are quite comparable even though example 2 uses a continuous process , and example 3 uses essentially a batch process , and even though there are other differences in procedure and apparatus . in order to filter the crystalline nitrilotriacetonitrile , the crystals should have a mean crystal size in excess of about 0 . 11 mm , preferably in excess of about 0 . 12 mm , and more preferably in excess of about 13 mm . from the results of examples 2 and 3 , the first stage crystallization must occur in a temperature range above about 70 ° c . to produce a mean crystal in excess of about 0 . 11 mm . to produce a mean crystal in excess of about 0 . 12 mm , the first stage crystallization must occur at about 80 ° c . to about 90 ° c . and , to produce a mean crystal size in excess of about 0 . 13 mm , the first stage crystallization must occur at about 85 ° c .
| 2 |
fig1 - 7b illustrate a first embodiment of the invention . in fig1 the ground clamp 10 comprises a first jaw 12 coupled to a second jaw 14 by a hinge 16 and a hinge pin 18 . the first jaw 12 has a first distal end 20 having an elongated hole 22 therein . the second jaw 14 has a second distal end forming a curve having a slot 26 formed therein forming a curved fork 24 . a cylindrical nut 26 has a diameter substantially matching the curve or radius of the curved fork 24 formed on to the second distal end of the second jaw 14 . the cylindrical nut 28 is held on the threaded portion or end 33 of bolt 30 having a head 31 . the head 31 of the bolt 30 retains the bolt 30 within the elongated hole 22 . the conduit 32 , which may be electrical metallic tubing or emt or a rigid conduit , is held between the first and second jaws 12 and 14 . the first jaw 12 has a first inside angled jaw surface 34 and a first outside angled jaw surface 36 separated by a first intermediate surface 35 . the second jaw 14 has a second inside angled jaw surface 38 and a second outside angled jaw surface 40 separated by a second intermediate surface 39 . attached to the first jaw 12 are a stem 42 and a lip 44 forming an opening in which to drop in a ground conductor or wire 50 . the stem 42 has a threaded hole 46 for receiving screw 48 . the grounding clamp 10 of the invention is made of a conductive material , preferable a metal . the grounding clamp 10 may be made of extruded aluminum , die cast zinc , cast bronze , cast brass , or zinc plated steel . fig2 more clearly illustrates the cylindrical nut 28 having a diameter and the mating with the curve or radius of the curved fork 24 on the distal end of the second jaw 14 . additionally , the slot 26 forming the curved fork 24 is more clearly illustrated . the slot 26 has a width for receiving the threaded portion of the bolt 30 . also , the elongated hole on the first distal end 20 of the first jaw 12 is better illustrated . fig3 and 4 illustrate the ability of the ground clamp 10 of the invention to accommodate a wide variety or range of sizes of electrical conduits . a larger conduit 32 is illustrated in fig1 and 2 , and a smaller conduit 32 ′ is illustrated in fig3 and 4 . fig3 and 4 illustrate the ground clamp 10 adjusted to hold a smaller diameter electrical conduit 32 ′. the different angled jaw surfaces 34 , 36 , 38 , and 40 in combination with the intermediate surfaces 35 and 39 securely hold different size electrical conduits 32 , illustrated in fig1 and 2 , or 32 ′ illustrated in fig3 and 4 . fig5 is a plan view more clearly illustrating the electrical conduit 32 held within the first jaw 12 of the ground clamp 10 . the ground conduit or wire 50 is also more clearly illustrated being held by stem 42 and screw 48 . fig6 is an exploded view of the embodiment of the invention illustrated in fig1 - 5 . fig6 more clearly illustrates the parts and assembly of the invention . the hinge 16 and the hinge pin hole 52 as well as the hinge pin 18 are more clearly illustrated . additionally the cylindrical nut hole 54 that receives the threaded portion or end 33 of the bolt 30 is more clearly illustrated . fig7 a more clearly illustrates the angled jaw surfaces of the first jaw 12 . the first inside angled jaw surface 34 is positioned in a plane that is substantially 45 ° from a horizontal reference line 56 . the first outside angled jaw surface 36 is positioned in a plane that is substantially 60 ° from a horizontal reference line 56 . the first intermediate surface 35 between the first inside angled jaw surface 34 and the first outside angled jaw surface 36 is in a plane substantially perpendicular to the horizontal reference line 56 . the angle between the first inside angled jaw surface 34 and the first outside angled jaw surface 36 is therefore preferably substantially 105 °. additionally , the angle between the first inside angled jaw surface 34 and the first intermediate surface 35 is preferably substantially 135 ° and the angle between the first outside angled jaw surface 36 and the first intermediate surface 35 is preferably substantially 150 °. fig7 b schematically illustrates the angular relationship of the second inside angled jaw surface 38 and second outside angled jaw surface 40 of the second jaw 14 . the second inside angled jaw surface 38 is positioned in a plane that is preferably substantially 45 ° from a horizontal reference line 56 . the second outside angled jaw surface 40 is positioned in a plane that is preferably substantially 60 ° from a horizontal reference line 56 . the second intermediate surface 39 between the second inside angled jaw surface 38 and the second outside angled jaw surface 40 is in a plane preferably substantially perpendicular to the horizontal reference line 56 . the angle between the second inside angled jaw surface 38 and the second outside angled jaw surface 40 is therefore preferably substantially 105 °. additionally , the angle between the second inside angled jaw surface 38 and the second intermediate surface 39 is preferably substantially 135 ° and the angle between the second outside angled jaw surface 40 and the second intermediate surface 35 is preferably substantially 150 °. accordingly , in both the first and second jaws 12 and 14 the first and second inside angled jaw surfaces 34 and 38 are positioned at a different angle relative to a horizontal reference line 56 than the first and second outside angled jaw surfaces 36 and 40 . these different relative angles permit the first and the second jaws 12 and 14 to securely grip a wide range of different size or diameter electrical conduits . these angular relationships of the jaw surfaces 34 , 35 , 36 , 38 , 39 , and 40 of the first and second jaws 12 and 14 allows the ground clamp to be attached to different electrical conduit having a range of sizes . in a preferred embodiment the difference in angles accommodates different electrical conduit ranging from approximately 0 . 700 to 1 . 32 inches or 1 . 78 to 3 . 35 cm in diameter . therefore the ground clamp can securely hold a standard electrical metallic tube from one - half to one inch and a standard rigid conduit from one - half to one inch . however , it should be appreciated that the ground clamp of the invention may be rescaled to securely hold different sized conduits within a broad range . fig8 is an exploded view of another embodiment of the invention . in this embodiment , a different means for attaching a ground conductor is illustrated . the ground clamp 110 has a lug or mound 142 having a ground conductor through hole 144 . placed within the lug or mound 142 is a threaded hole 146 for receiving the screw 48 . a ground conductor or a wire , not shown , placed within the ground conductor or wire through hole 144 is securely held in place by tightening screw 48 down thereon . fig9 is an exploded view of another embodiment of the invention . the ground clamp 210 in this embodiment has a pad 242 having a threaded hole 246 therein . the screw 48 threads within the threaded hole 246 . therefore , a ground conductor or wire , not shown , wrapped around or placed under screw 48 may be securely held by tightening screw 48 within the threaded hole 246 and securing the ground conductor or wire adjacent the pad 242 . as illustrated in the figures and in particular in fig1 to 4 , the ground clamp 10 can easily be adjusted to accommodate electrical conduits 32 and 32 ′ of substantially different diameters . additionally , the ground clamp 10 can easily be adjusted without disassembling or separating any parts of the ground clamp which may be lost or dropped during attachment to an electrical conduit . the combination of the cylindrical nut 28 and the slot 26 in the curved fork 24 permits the second jaw 14 to pivot downward , providing a substantial and large space between the first and second jaws 12 and 14 . after insertion of the electrical conduit 32 or 32 ′ head 31 may be turned causing the cylindrical nut 28 placed adjacent the curved fork 24 to draw the first and second jaws together so that the angled jaw surfaces 34 , 36 , 38 and 40 securely hold the electrical conduit 32 or 32 ′. the elongated hole 22 formed in the first distal end of the first jaw 12 permits some movement of the bold 30 maintaining alignment when different size electrical conduits are held . the cylindrical nut 28 and curved fork 24 permits the bolt 30 to pivot so as to accommodate and securely hold a wide range of different sized electrical conduits . the present invention , by providing a unique combination of angled jaw surfaces 34 , 36 , 38 and 40 in combination with the bolt 30 having a cylindrical nut 28 and curved fork 24 provides an improved electric ground clamp that can securely hold different sized or diameters of electrical conduits and that can be assembled quickly and easily without disassembly of any portion of the ground clamp . the electric ground clamp can easily be placed in hard to reach locations without difficult manipulation . fig1 - 13 illustrate another embodiment of the invention . in this embodiment a terminal block 358 is formed on the first jaw 12 of the ground clamp 310 . in this embodiment the terminal block 358 permits multiple electrical devices to be grounded on a single ground clamp 310 . the ground clamp 310 comprises a first jaw 12 and a second jaw 14 connected by a hinge 16 and hinge pin 18 . the first jaw 12 has a first distal end 320 with an elongated hole 322 therein and a flat portion 321 . the first jaw 12 has a first inside angled jaw surface 34 , first intermediate surface 35 , and first outside angled surface 36 . the second jaw 14 has second distal end with a curved fork 24 , a second inside angled jaw surface 38 , second intermediate surface 39 , and second outside angled surface 40 . the first and second jaws 12 and 14 are drawn together by bolt 330 having head 331 and cylindrical nut 28 . the first jaw 12 has an opening formed by lip 344 and stem 342 . screw 348 is used to hold ground conductor or wire 50 securely therein . when closed the first and second jaws 12 and 14 securely hold pipe or rigid conduit 32 therein . the ground clamp 310 has terminal block 358 formed thereon . the terminal block 358 has a plurality of holes 360 therein . the holes 360 are adapted to receive conductors 362 from ground wires 364 . the ground wires 364 are coupled to other electrical devices that may need to be grounded , such as phone , data , or cable tv . screws 366 are placed within threaded holes 368 , illustrated in fig1 , to securely hold the conductors 362 . therefore , a plurality of electrical devices , not illustrated , may be grounded with a single ground clamp 310 . while four holes 360 for receiving conductors 362 have been illustrated any number of holes 360 may be used . fig1 illustrates another embodiment of a ground clamp . this embodiment is similar to the embodiment illustrated in fig1 - 13 , however in this embodiment a different means for attaching ground conductor 50 is illustrated . the ground clamp 410 has a mound 442 formed within the first jaw 12 and terminal block 458 . a hole 444 is placed in the mound 442 for receiving the ground conductor 50 . screw 348 is threaded into a threaded hole intersecting with the hole 444 so as to contact the ground conductor 50 placed therein and securely hold it in position . fig1 illustrates yet another embodiment of a ground clamp . this embodiment is similar to the embodiment illustrated in fig1 - 13 , however in this embodiment another different means for attaching a ground conductor is illustrated . the ground clamp 510 in this embodiment has a pad 542 having a threaded hole with screw 548 threaded therein . therefore , a ground conductor or wire , not shown , wrapped around or placed under screw head 549 may be securely held by tightening screw 548 within the threaded hole and securing the ground conductor or wire adjacent the pad 542 . as illustrated in fig1 - 15 , the ground clamps illustrated therein provide the additional advantage of having a terminal block formed thereon for attaching or retaining a ground conductor for a multiple number or plurality of electrical devices . the plurality of retainers permits additional electrical devices to be grounded without disrupting or removing the ground clamp . this saves considerable time when connecting additional electrical devices and provides a more reliable ground connection . while the present invention has been described with respect to several different embodiments , it will be obvious that various modifications may be made without departing from the spirit and scope of this invention .
| 7 |
embodiments of the presently disclosed multi - lumen access port will now be described in detail with reference to the drawing figures wherein like reference numerals identify similar or identical elements . in the drawings and in the description which follows , the term “ proximal ”, as is traditional , will refer to the end of the multi - lumen access port which is closest to the operator while the term “ distal ” will refer to the end of the device which is farthest from the operator . referring initially to fig1 , the presently disclosed multi - lumen access port is shown generally as access port 100 . access port 100 includes a plurality of access tubes 10 , 20 , 30 . one or more of the access tubes 10 , 20 , 30 may contain a fluid - tight seal . each access tube 10 , 20 , 30 has an open proximal end 14 , 24 , 34 and an open distal end 16 , 26 , 36 . a passageway 12 , 22 , 32 is defined between open proximal ends 14 , 24 , 34 and open distal ends 16 , 26 , 36 . each access tube 10 , 20 , 30 is generally an elongate tubular structure that is adapted for receiving at least a portion of an endoscopic surgical instrument ( not shown ) therethrough . in one embodiment , the configuration of at least one passageway 12 , 22 , 33 allows passage of a surgical instrument having an outside diameter ranging between about 5 mm and about 12 mm through access tubes 10 , 20 , 30 . access tubes 10 , 20 , 30 may be configured , however , to receive surgical instruments having other suitable sizes . the present disclosure envisions access tubes 10 , 20 , 30 having a variety of sizes and shapes . access tubes 10 , 20 , 30 may have circular cross - sections , oval cross - sections , or any other suitable shape so long as they are capable of receiving a surgical instrument . in addition to their ability to receive a surgical instrument , access tubes 10 , 20 , 30 are able to move axially with respect to one another . access port 100 includes a mechanism 56 adapted to facilitate relative movement of access tubes 10 , 20 , 30 . mechanism 56 operably connects access tubes 10 , 20 , 30 at a pivot point p . consequently , a portion of each access tube 10 , 20 , 30 overlaps at pivot point p . the location of pivot pin p allows users to employ mechanism 56 to pivot access tubes 10 , 20 , 30 with respect to one another . in the depicted embodiment , mechanism 56 includes a pivot pin 58 or any other suitable fastening member adapted to interconnect access tubes 10 , 20 , 30 . pivot pin 58 facilitates pivotal movement of access tubes 10 , 20 , 30 about an axis . alternatively , pivot pin 58 operably couples only two access tubes 10 , 20 . in any case , the location of pivot pin 58 coincides with the location of pivot point p . accordingly , access tubes 10 , 20 , 30 rotate about pivot point p upon manipulation by a user during operation . fig2 illustrates an alternate embodiment of the present disclosure . this embodiment is generally designated as access port 200 . access port 200 is substantially similar to access port 100 . the presently disclosed access port 200 includes a plurality of access tubes 210 , 220 , 230 . at least one access tube 210 , 220 , 230 may include a fluid - tight seal . each access tube 210 , 220 , 230 has an open proximal ends 214 , 224 , 234 and an open distal end 216 , 226 , 236 . open proximal ends 214 , 224 , 234 and open distal ends 216 , 226 , 236 each defines a passageway 212 , 222 , 232 therebetween . each passageway 212 , 222 , 232 has a cross - section adapted to receive an endoscopic surgical instrument . in one embodiment , the cross - section of at least one passageway 212 , 222 , 232 is capable of receiving therethrough a surgical instrument having an outside diameter ranging between about 5 mm and about 12 mm . during use , a surgeon may introduce a surgical instrument through open proximal end 214 , 224 , 234 until it reaches a location beyond open distal ends 216 , 226 , 236 . the open distal ends 216 , 226 , 236 of access port 200 form a juncture 256 , as illustrated in fig2 . juncture 256 operatively connects open distal ends 216 , 226 , 236 with one another . during operation , juncture 256 facilitates relative movement of access tubes 210 , 220 , 230 upon manipulation by a user . therefore , juncture 264 is sufficiently strong to maintain open distal ends 216 , 226 , 236 joined , but sufficiently flexible to allow relative movement of access tubes 210 , 220 , 230 . as seen in fig1 and 2 , the embodiments of the present disclosure include a support body 50 . support body 50 supports access tubes 10 , 20 , 30 . in use , support access 50 serves as a standalone component for providing access to a working space in the patient &# 39 ; s body . alternatively , a user may use support body 50 in conjunction with other access devices ( i . e . access ports ). in any case , support body 50 has a flexible outer wall 54 . the resiliency of flexible outer wall 54 permits temporarily deformation of support body 50 during its installation . after installation , support body 50 along with its flexible outer wall 54 reverts to its original configuration and provides a fluid - tight seal in conjunction with the patient &# 39 ; s skin ( i . e . standalone mode ) or the access device . in either mode , support body 50 conforms to the skin at an opening in the patient &# 39 ; s body or the interior wall of the access device , thereby providing a fluid - tight seal for inhibiting leakage of insufflation fluids from the working space or the introduction of external contaminants into the working space . the structural relationships between support body 50 and access tubes 10 , 20 , 30 is substantially similar to the structural relationship between support body 50 and access tubes 210 , 220 , 230 . therefore , the mechanical cooperation and operation of support body 50 and access tubes 210 , 220 , 230 will not be described herein in detail . referring to fig3 and 4 , an embodiment of support body 50 has a circular cross - section . the present disclosure nevertheless envisions support bodies with other configurations . in the depicted embodiment , support body 50 includes a plurality of bores 52 . bores 52 are laterally and longitudinally spaced apart from one another . each bore 52 is adapted to receive an access tube 10 , 20 , 30 and extends through support body 50 . the cross - section of each bore 55 is larger than the cross - section of access tubes 10 , 20 , 30 , as seen in fig3 and 4 . this configuration provides access tubes 10 , 20 , 30 certain freedom of movement within bores 52 . in an alternative embodiment , support body 50 includes at least one slit 60 extending along at least a portion of the length of support body 50 , as illustrated in fig5 . slit 60 enhances the flexibility of support body 50 . the presence of slit 60 allows user to move access tubes 10 , 20 , 30 beyond the boundaries of bores 52 . in use , a surgeon may employ access port 100 or 200 to create and maintain access into a working space inside a patient &# 39 ; s body during a surgical procedure . in particular , physicians may employ either access port 100 , 200 during a laparoscopy or a hals procedure . initially , the surgeon may first incise a body wall with scalpel or any other suitable instrument . alternatively , the surgeon may penetrate the body wall with a sharp tip . once the body wall has an opening , the surgeon may place support body 50 in the desired site . the physician may employ support body 50 by itself or in conjunction with other access device . before placing access port 100 inside a patient &# 39 ; s body , the surgeon may deform support body 50 . thereafter , the surgeon places access port 100 inside the patient &# 39 ; s body . immediately after its installation , support body 50 reverts to its original configuration and creates a fluid - tight seal in conjunction with the patient &# 39 ; s skin ( in the standalone mode ) or an access device . after the establishing the fluid - tight seal , the surgeon inserts one or more surgical instruments through access tubes 10 , 20 , 30 . in particular , the surgeon may initially insert an insufflation device through any access tube 10 , 20 , 30 . before activating the insufflation device , the user may move access tubes 10 , 20 , 20 to direct the delivery of insufflation gas . once in position , the insufflation device delivers gas to a body cavity upon activation by the surgeon . this gas expands the body cavity and prepares the surgical site . subsequently , the physician may insert a laparoscope or any other suitable viewing apparatus through another access tube 10 , 20 , 30 . the laparoscope facilitates visual observation of the surgical site . again , the operator may move access tubes 10 , 20 , 30 to observe several areas of the body cavity . after visually inspection the body cavity , the physician may insert a surgical instrument through any of the open proximal ends 14 , 24 , 34 . the surgeon should advance the surgical instrument through the corresponding passageway 12 , 22 , 32 until it reaches a location beyond corresponding open distal end 16 , 26 , 36 . the surgeon may then move access tubes 10 , 20 , 30 to reach the desired surgical site . access tubes 10 , 20 , 30 may move upon manual manipulation by the operator . the operator , however , may use any suitable means to move access tubes 10 , 20 , 30 . during operation , access tubes 10 , 20 , 30 of access port 100 move relative to one another about pivot point “ p .” the boundaries of bores 52 may slightly restrict the movement of access tubes 10 , 20 , 30 , as shown in fig4 . nonetheless , access tubes disposed in a support body 50 having a slit 60 may easily move beyond the boundaries of bores 52 . the method of using access port 100 is substantially similar to the method of using access port 200 . during the operation of access port 200 , however , a surgeon may move access tubes 210 , 220 , 230 with respect to one another , but their distal open ends 216 , 226 , 236 are fixed in relation to each other . it will be understood that various modifications may be made to the embodiments of the presently disclosed surgical stapling instruments . therefore , the above description should not be construed as limiting , but merely as exemplifications of embodiments . those skilled in the art will envision other modifications within the scope and spirit of the present disclosure .
| 0 |
in this embodiment , first , the structure and the operation of a presence server and a network for realizing service using the presence server will be described . afterward , the structure and the operation of an sip server to which an sip message routing method according to the invention is applied will be described . fig1 a schematic functional block diagram showing the presence server equivalent to this embodiment . in fig1 , logical functional configuration realized by software is shown , however , each functional block may be also configured by hardware . fig2 shows how the functional blocks shown in fig1 are realized by hardware . the operation of various functional blocks shown in fig1 is stored in a processing module group 26 in a memory 22 shown in fig2 , cpu 23 reads and executes its operational procedure in operation . terminal type information required when an individual processing module is operated is stored in a terminal type information management table 30 in a database 24 and presence information is stored in a presence information management table 31 in the database 24 . these information items are timely stored in a various information temporary table 25 in the memory 22 via an interface 33 when the presence server 1 is utilized and processing is executed in cpu 23 . the result is written to the database 24 via the interface 33 . fig2 is a flowchart showing the processing of the functional block groups shown in fig1 . each functional block is operated according to the flowchart shown in fig2 when a message is input / output . fig3 shows a network in an example of service using terminal type information and fig4 shows its sequence . in this example , a user b denoted by 43 in fig3 logs in the sip server 41 and the presence server 1 on terminals 45 , 46 owned by the user b . a user a denoted by 42 and a user c denoted by 47 also log in them and subscribe to the terminals 45 , 46 of the user b denoted by 43 . afterward , the user a communicates with the user b by an ip phone . the whole operation from extracting terminal type information to notifying another user of presence which is provided with terminal information will be described referring to these drawings below . in this example of service , a presence system is operated using sip for a protocol , however , sip is not essential to configure the presence system and another protocol can be also utilized . in case another protocol is utilized , the concrete contents of a message and a detailed sequence are different , however , a basic concept is unchanged . further , in fig3 , the terminals 45 , 46 owned by the user b denoted by 43 are shown as different hardware , however , there is also a case in which the terminals are dealt as different applications 45 , 46 on the same hardware 49 as shown in fig2 . first , in a step 51 shown in fig4 , the user b logs in the sip server 41 and the presence server 1 on the tv phone terminal 45 . fig5 shows the contents of an sip message in login . in sip , in login , a message using register method is transmitted . next , the presence server 1 registers a contact address 71 described in a contact header in a login message shown in fig5 as a terminal address . in a step 52 , the presence server recognizes terminal type information . referring to fig2 a , the contents of concrete processing in the step 52 will be described below . when the presence server 1 receives a message via an interface 13 - 1 to 13 - n shown in fig1 in a step 1291 , it starts terminal type extracting processing in a step 1292 . first , the presence server transfers to a login information transmission / reception module 12 and extracts login information in a step 1293 , that is , extracts the contact address 71 . in a step 1294 , a terminal type information extraction / transfer module 10 extracts a user - agent header value 72 of the login information and transfers the information to a terminal type information management module 7 . in this embodiment , the presence server judges a terminal type based upon a user - agent header , the presence server may also judge a terminal type in another method . for example , a method of adding a parameter assigned to the contact header for extending the original header on its own terms is conceivable . for an example in case a parameter is assigned to the contact header , description “ contact :& lt ; sip : usera @ abc . com & gt ;; agent = tvphone ” is conceivable . in case a method of judging a terminal type is changed , the processing of the terminal type information extraction / transfer module 10 is changed . next , the presence server 1 estimates a terminal type based upon the terminal type information extracted in the step 1294 and stores it together with login information . its concrete processing will be described below . the terminal information transferred from the terminal type information extraction / transfer module 10 is received by the terminal type information management module 7 . the terminal type information management module 7 manages a table 101 shown in fig8 a in a table for input 37 in a terminal type information management table 30 of the database 24 shown in fig2 . a terminal type judgment process in a step 1295 is executed utilizing this table 101 . a table 106 shown in fig8 b managed in a table for output 36 shown in fig2 is a table for outputting presence information , however , the tables 101 and 106 can be also managed in the same table in view of utilization in the database . in this embodiment , the tv phone terminal 45 which is a log - in terminal and which is owned by the user b adds terminal type information “ tvphone / 1 . 0 ( xxcorp tv phone )” to login information . in rfc 3261 of ietf in which a standard of sip is described , it is described that a description format of a user - agent header value is similar to that in rfc 2616 . as a description format of a user - agent header value is defined as [ terminal name ]/[ version number ] ([ comment ]) in rfc 2616 , the terminal type information of the log - in terminal is judged “ tvphone ” which is a value acquired by subtracting a version number and a comment from the user - agent header value 72 in the step 1295 . in the method of dealing with the user - agent header value , logic except that described in this embodiment may be also utilized . in this embodiment , only “ terminal name ” is utilized for terminal type information , however , a pattern in which “ version number ” and “ comment ” are utilized for terminal type information is also conceivable . in the above - mentioned process , the terminal type information of the log - in terminal is judged “ tvphone ”. next , in the step 1295 , the table for input 101 of the terminal type management table is retrieved to judge an actual terminal type based upon terminal type information . it is login information ( the user - agent header ) 102 that is retrieved and a retrieval key is terminal type information “ tvphone ”. the result of retrieval “ tvphone ” can be judged a tv phone based upon a terminal type for internal management 103 . when the terminal type information management module 7 judges a terminal type , it transmits the data to a terminal information input module 4 . a terminal information output module 5 registers the information in a log - in terminal type management table 34 of the database 24 via the interface 33 in a step 1296 . the log - in terminal type management table 34 is configured by a table according to a format shown in 91 in fig7 and a data record having a terminal type 93 and log - in terminal id 92 in pairs is added to the table . the presence server 1 describes the information of the log - in terminal in the presence information management table 31 of the database 24 which is a table for managing the log - in state of the terminal and presence information in a step 1297 at the same time as the proper processing . the presence information management table 31 is configured by a table according to a format shown in 81 in fig6 and adds a data record having a terminal address 82 which is id of the log - in terminal and an owner 83 of the terminal in pairs . presence information such as the other session status 84 and the current status 85 is separately registered in a method different from a login process . in this embodiment , presence information and login information are dealt as separate sequences , however , they may be also dealt as one sequence utilizing the same message . next , the user b denoted by 43 instructs the ip phone terminal 46 to log in in steps 53 , 54 , however , a procedure of the presence server 1 at this time is similar to that in the steps 51 , 52 . however , a user - agent header value of a log - in message transmitted to the sip server 41 and the presence server 1 by the ip phone terminal 46 is different from the value shown in 72 in fig5 . this reason is that the tv phone terminal 45 and the ip phone terminal 46 are different in a terminal type . as a result , the presence server 1 recognizes the ip phone terminal 46 as a terminal type different from that of the tv phone terminal 45 . this is also similar in case no user - agent header is used for terminal type information , different terminal type information is necessarily added to a different terminal and login is made . afterward , the user a denoted by 42 instructs the ip phone terminal 44 to log in , however , the procedure of the presence server 1 at this time is also similar in that in the steps 51 , 52 . suppose that the types of the ip phone terminals 44 and 46 are the same , however , as to the terminal 44 , “ ipphone ” is described as a user - agent header value and as to the terminal 46 , “ iptelephone ” is described . that is , the case is a case in which different user - agent header values are described though they are the same type . for example , possibility that the user - agent header values of the same ip phone terminals are different depending upon vendors that develop them is conceivable . the presence server 1 maps such terminals in which different user - agent header values are described though the terminal types of them are the same as the same terminal type . this reason is that management is made as in two records 1101 , 1102 described in the table 101 shown in fig8 a and even different user - agent headers 102 are mapped in the same terminal type for internal management 103 and in the same output mode ( for simple ) 104 . terminals designed by multiple vendors can be classified depending upon a function and service by preparing a table which functions as a dictionary for translating terminal type information of which each terminal notifies to terminal type information for internal management when the terminal type information is managed as described above . further , some vendors may not append such id of a terminal type in login . for such a terminal , a method of uniformly mapping in a terminal type which is default as in a record 1103 is conceivable . a method of judging a terminal type using a different method is also conceivable . next , the user a denoted by 42 transmits an information acquisition request to the presence server 1 in a step 36 to check the current presence information of the user b denoted by 43 and reserve notification when presence information hereafter changes . in case sip / simple is utilized for an interface , a message utilizing subscribe method as described in the non - patent document 3 is transmitted . the presence server 1 that receives the message executes processing for notifying the presence information of the user b to the user a in a step 57 shown in fig4 . referring to fig2 b , the concrete contents of the processing will be described below . when a request for the notification of presence information is made inside the presence server 1 in a step 1301 , processing for notification is started in a step 1302 . first , in a step 1303 , it is checked whether the user b permits the user a the publication of his / her presence information or not . concretely , permission information described in a permission information management table 35 in the database 24 shown in fig2 is retrieved . fig1 shows the concrete configuration of the table . the table 35 includes an access user 302 that requests to read presence information , an access target user 303 who is a user publishing presence information and permission information 304 in which the presence publication policy of the access target user is described . in the permission information , each presence information and permission information every terminal , that is , the setting of whether presence information is to be published or not are described . in this embodiment , as the user b reads the presence information of the user a , retrieval is made in a state in which a retrieval key is located in user b in a column 302 and is located in user a in a column 303 . the retrieved permission information is temporarily stored in the various information temporary table 25 shown in fig2 to utilize when presence information is configured later . the presence server 1 acquires all the presence information of the user b from the presence information management table 31 of the database 24 shown in fig2 via the interface 33 using the terminal information output module 5 in a step 1304 after presence information publication permission is verified . the presence information of the user b means the presence information of both the tv phone terminal 45 and the ip phone terminal 46 respectively owned by the user b . presence information acquired from the database 24 is held in the various information temporary table 25 in the memory 22 shown in fig2 to configure the subsequent presence information . next , the presence server 1 selects presence information in which notification to the user a is permitted based upon the user b &# 39 ; s presence information held in the various information temporary table 25 in a notified information selection module 14 shown in fig1 in a step 1305 . this processing is executed using the permission information retrieved formerly and temporarily held in the various information temporary table 25 of the user b for the user a . presence information the publication of which is not permitted is filtered in this step . the filtered presence information of the user b is transferred to a presence information formation module 9 . next , in a step 1306 , the terminal type information management module 7 is inquired , and the terminal type information of each terminal and additional information when presence information is configured are acquired . a method of notifying presence information is different every protocol . therefore , a method of adding terminal type information is also different every protocol . in the terminal type information management table denoted by 106 in fig8 b , an output mode in each protocol is described . the output mode is changed every protocol and presence information is notified . in this embodiment , an output mode for http is described in 105 except sip / simple . next , in a step 1307 , the contents of notice are configured in a format when the presence information formation module 9 notifies the user a . in this embodiment , presence information is notified the user a using a format called presence information data format ( pidf ) defined in the non - patent document 4 . the name space function of exchange markup language ( xml ) which is the original format of pidf is utilized for the addition of terminal type information . fig9 shows an example of configured presence information . in 111 , 112 in fig9 , name space for an ip phone and a tv phone described in fig8 is defined . the definition of xml is required to be described first to utilize name space . the user b denoted by 43 in fig3 owns two terminals of the tv phone terminal 45 and the ip phone terminal 46 and as both presence information is notified the user a , two name space is defined to identify the terminal types of the two terminals . default when the name space is represented is declared in the defined part and afterward , in case name space is added to an xml sentence , a character string of the default has only to be described as a prefix . in this embodiment , a prefix of name space for a tv phone terminal is defined as “ tvphone ” and a prefix of name space for an ip phone is defined as “ phone ”. for presence information afterward described , an xml prefix representing a terminal type is added to a front part of a name of presence information . as in 113 , 114 shown in fig9 , the current status ( the availability ) of an ip phone and a session status are written , a prefix is “ phone ”. as in 115 , 116 , the current status of a tv phone and session status are written , a prefix is “ tvphone ”. in this embodiment , terminal information is given utilizing xml name space , however , a terminal type is considered one presence information and a method of describing in parallel with other presence information is also conceivable . the presence information generated in the above - mentioned process is transferred to a presence information transmission / reception module 11 shown in fig1 in a step 1308 and is transmitted to the user a in a step 58 shown in fig4 in an sip message using notify method defined in the non - patent document 3 . suppose that afterward , the user c denoted by 47 in fig3 logs in on an ip phone terminal 48 which he / she owns . a procedure from the step 59 to the step 63 shown in fig4 is similar to that in case the user a logs in and the user c reads the user b &# 39 ; s presence information . next , suppose that the user a denoted by 43 in fig3 tries to call the user b utilizing the ip phone terminal 44 owned by him / her . the user a can grasp which of the terminals owned by the user b is the ip phone terminal based upon the user b &# 39 ; s presence information received in the step 58 . concretely , a terminal address is verified based upon terminal id ( an sip address ) described in 117 , 118 and the type of each terminal is verified based upon the xml name space . therefore , the user a can directly ring the ip phone terminal 46 owned by the user b denoted by 43 in fig3 and never calls the tv phone terminal 45 by mistake . in a step 64 shown in fig4 , the user a calls the user b and starts conversation . at that time , the ip phone terminal 46 owned by the user b notifies the presence server 1 that the ip phone terminal is in session status in a step 65 . the presence server 1 notifies the user a and the user c who reserve notification that presence information is updated in steps 66 and 67 because the presence of the user b changes . when the user a and the user b communicate in a step 68 , “ session status ” which is one of the presence information of the ip phone terminal owned by the user b is turned “ closed ”. as the ip phone terminal of the user b is in session status , that is , the user c knows that the user b is on the phone even if the user c would like to communicate with the user b , the user c can grasp that the user b does not answer the phone even if the user c calls until the user b hangs up . if the user b owns a terminal for character chat and the “ session status ” of the terminal for character chat is “ closed ”, the user c knows that the terminal for character chat of the user b is in session status , that is , the user b is in chat session . at this time , as his / her ears and mouth are available though the user b utilizes his / her hands to input a character of chat , the user c can judge that he / she can communicate with the user b in emergency . though the user a also directly communicates with the user b , the user a can grasp that the “ session status ” of the ip phone terminal of the user b is “ closed ” like the user c . afterward , when conversation between the user a and the user b is finished in a step 69 , the ip phone terminal 46 of the user b notifies the presence server 1 of the termination of a session in a step 70 and as a result , the presence server 1 notifies the user a and the user c that the “ session status ” of the ip phone of the user b is idle in steps 1070 , 1071 . terminal information is added to presence information notified the user a and the user b at this time in a form shown in fig9 . when session status is displayed on gui of the terminals of the user a and the user c , it can be displayed by utilizing this information on what application session is established based upon a terminal type . a balloon 228 shown in fig1 shows what display is actually made on gui of the user a . a reference number 1221 shown in fig1 shows an image of a table held inside the terminals of the user a and the user c and it is described how each terminal determines a display format of session status . for example , as a value in session status 1224 of a terminal a owned by the user b is “ closed ” and its terminal type 1225 is an ip phone , its display format 1226 is estimated to be “ telephone session ”. this estimate depends upon a terminal and may be different every terminal . as the terminal of the user a is estimated in “ telephone session ”, display that the terminal a of the user b is in “ telephone session ” is made in 228 shown in fig1 . fig1 shows a case that a sequence in a part shown by 1072 in fig4 is realized in another method . a sequence except the part shown by 1072 in fig1 is similar to that in fig4 . in the sequence shown in fig4 , when the session of each terminal is established and when session is finished , the presence server 1 is notified of it as presence information in steps 65 and 70 . in fig1 , this method is different from fig4 . in fig1 , each terminal does not notify the presence server 1 of the establishment / the termination of session but the sip server 41 notifies in steps 1111 , 1112 . the sip server 41 is a server for managing the session status of each terminal and also grasps the status of the establishment / the termination of the session of the user a &# 39 ; s terminal 44 and the user b &# 39 ; s terminal 2 denoted by 46 . therefore , the information of the establishment / the termination of session can notify the presence server 1 in place of each terminal . as the sip server registers the session status in the presence server 1 by deputy by using this method when the session of the existing ip phone not provided with a function for notifying session status is established / finished , another user can grasp the session status of the terminal . fig1 shows a network in case an sip server 321 specifies a route in which the type of each terminal is grasped . fig1 shows its sequence . fig1 is a functional block diagram showing the sip server for routing according to this method and fig2 is a flowchart showing the operation of the sip server . fig2 shows a sequence in case routing in which a terminal type is grasped is realized in a different method from the method shown in fig1 , fig2 is a functional block diagram showing an sip server function at that time , and fig2 and 24 are flowcharts showing a process executed by an sip server at that time . fig2 is a hardware block diagram showing the sip server adopting this method . the operation of various functional blocks shown in fig1 and 22 is stored in a processing module group 1279 in a memory 1272 as in fig1 and 2 , in operation , cpu 1273 reads an operational procedure and executes the operation . information required when an individual processing module is operated is stored in a location table 1278 and a terminal type table 1280 in the memory 1272 . the functional block diagrams shown in fig1 and 22 show logical functional configuration realized by software , however , each functional block may be also configured by hardware . first , difference between fig1 , 21 and fig4 will be described . in the sequence shown in fig4 , the terminal ( the ip phone ) denoted by 44 and owned by the user a acquires the type of a terminal which a partner user instructs to log in from presence information and judges that the ip phone terminal denoted by 46 out of the terminals which the user b instructs to log in should be called using the information . however , in case the ip phone terminal denoted by 44 and owned by the user a does not have a presence acquiring function with which a terminal 324 shown in fig1 is provided , it cannot specify the type of a partner terminal . therefore , this method cannot be utilized as it is . in the method shown in the sequence shown in fig1 , 21 , it is not the ip phone terminal denoted by 324 of a user a but the sip server 321 which is a deputy that checks the type of a terminal which a user b instructs to log in . as a result , even if the ip phone terminal denoted by 324 and owned by the user a does not a presence information acquiring function , a call conscious of a terminal type is enabled . referring to the sequence shown in fig1 , 21 , the method will be described below . terminals 325 , 326 owned by a user b denoted by 323 shown in fig1 are described as separate hardware , however , as in fig3 , they may be also like the terminal 49 shown in fig1 and the applications 45 , 46 . as shown in fig1 , first , in a step 1121 , the ip phone terminal denoted by 325 of the user b logs in the sip server 321 and a presence server 1 . at this time , in a step 1122 , the presence server 1 extracts the type information of the terminal 325 , however , a method is similar to the above - mentioned method . the sip server 321 stores the information of the log - in terminal in a location table 1278 shown in fig2 by a terminal location management module 1206 after the sip server receives a login message by a login information transmission / reception module 1204 shown in fig1 in terminal login . afterward , in a step 1123 , the terminal 2 denoted by 326 of the user b logs in and in a step 1125 , the ip phone terminal denoted by 324 of the user a logs in , however , a procedure at that time is similar to that in the steps 1121 , 1122 . next , the ip phone terminal denoted by 324 of the user a calls the user b . at this time , as the terminal 324 does not grasp the presence of the user b , it calls by specifying not his / her terminal address but the user b &# 39 ; s address . the sip server 321 that receives the call inquires the presence server 1 of the type of the terminal 324 of the calling user a and the type of a terminal currently instructed to log in by the called user b in a step 1128 . the presence server 1 that receives the inquiry returns the result in a step 1123 . concretely , when an sip message for calling the user b from the ip terminal 324 of the user a is received in a step 1127 , the sip server 321 receives the sip message in a step 1211 shown in fig2 and starts processing for transferring the message in a step 1212 . first , the sip server 321 discriminates the type of the message in a message routing module 1203 shown in fig1 in a step 1213 . when the type of the message is discriminated , it is determined whether the type of the message requires routing conscious of a terminal type or not in a step 1214 . at this time , when it is judged that the type of the message is not required to be conscious of the terminal type , control is shifted to a step 1220 , normal sip message routing is performed , the message is transferred in a step 1221 , and the process is finished in a step 1224 . in case the terminal type is required to be conscious , control is shifted to a step 1215 . in the step 1215 , the presence server 1 is inquired of the type of the ip terminal 324 of the user a who is an originator and the type of a terminal which the user b currently instructs to log in utilizing the terminal information inquiring module 1205 shown in fig1 . for a method of inquiring , an sip message may be also utilized and another method may be also used . afterward , when terminal type information is received from the presence server 1 in a step 1129 shown in fig1 , the type of the ip terminal 324 of the user a which is the originator is verified in a step 1216 shown in fig2 and next in a step 1217 , the log - in terminal and its type of the user b which is a destination of transmission are verified . in this embodiment , as the user b instructs the tv phone terminal 325 and the ip phone terminal 326 to log in , it is verified . next , in a step 1218 , the message routing module 1203 checks whether the user b instructs a terminal of the same type as the ip phone terminal 324 of the user a which is the originator to log in or not . in case the user b who is the destination of the transmission does not instruct a terminal of the same type as the originator to log in , no session comes into effect even if the message is transferred to any terminal instructed to log in by the user b . therefore , the sip server 321 transfers no message , generates a response message 403 showing that the user a who is the originator cannot communicate in a step 1222 , returns the response message to the user a in a step 1223 , and terminates the process in a step 1224 . in this embodiment , as the user b instructs the ip phone terminal 326 to log in , the terminal of the same type exists at the destination of transmission . therefore , the process proceeds to a step 1219 , an address of a transfer destination of a calling message is set in the ip phone terminal 326 of the user b , and in a step 1221 , the message is transmitted . in a step 1224 , the process is finished . as a result , the message for calling the user b from the user a is transferred from the sip server 321 to the ip phone terminal 326 of the user b in a step 1130 shown in fig1 and conversation is started in a step 1131 . afterward , in a step 1132 , the conversation is finished . fig2 shows a sequence in case the sip server 321 realizes message routing conscious of a terminal type without using the method shown in fig1 . a part different from fig1 is a method when the sip server 321 checks the type of each terminal . in fig1 , it is realized by inquiring the presence server 1 , however , in fig2 , the sip server 321 is provided with the similar terminal type extracting function to the presence server 1 and the sip server grasps the terminal type when login information is received . the details of fig2 will be described below . in fig2 , as in fig1 , first , in a step 1141 , the tv phone terminal 325 of the user b logs in the sip server 321 and the presence server 1 . next , the sip server 321 extracts the type of a log - in terminal in a step 1142 before the sip server transfers a log - in message to the presence server 1 . concretely , after a log - in message is received in a step 1231 shown in fig2 , processing for grasping a terminal type is executed in a step 1232 . when the processing is started , a terminal type information extraction module 1207 shown in fig2 extracts terminal type information from the log - in message in a step 1233 . the contents of the processing are completely similar to processing when the presence server 1 grasps the terminal type and material for determining the terminal type is extracted from a header , a parameter and others of register message which is the log - in message . next , in a step 1234 , the terminal type is determined , however , this process is also similar to a case of the presence server 1 . determined terminal information is registered in the terminal type table 1280 in the memory 1272 shown in fig2 in the step 1225 . besides , login information is registered in a location table 1278 in the memory 1272 shown in fig2 in a step 1236 and the process is finished in a step 1237 . afterward , the sip server 321 transfers the login information to the presence server 1 in the step 1143 shown in fig2 . the processing of the presence server 1 in the afterward step 1143 is similar to the above - mentioned processing . afterward , the ip phone terminal 326 of the user b and the ip phone terminal 324 of the user a log in in steps 1145 , 1149 , however , the procedures of the sip server 321 and the presence server 1 at that time are similar to the case of the step 1141 . afterward , in a step 1153 , the ip phone 324 of the user a calls the user b . the sip server 321 judges which of terminals which the user b instructs to log in should be called in a step 1154 , however , a sequence procedure is different from that shown in fig1 , the sip server 321 does not inquire the presence server 1 of terminal type information but retrieves terminal type information in the terminal type table 1280 in the memory 1272 shown in fig2 . concretely , processing is executed according to a flowchart shown in fig2 . the flowchart shown in fig2 is similar to that shown in fig1 except a step 1255 . in the step 1255 , the terminal type information management module 1208 shown in fig2 is inquired of the types of the terminal 324 of the user a , the terminal 1 denoted by 325 of the user b and the terminal 2 denoted by 326 . afterward , as a result of selecting a transmission destination terminal inside the sip server 321 in the step 1154 , the sip server 321 transfers a message for calling the user b from the user a to the terminal 2 denoted by 326 of the user b , that is , the ip phone terminal in a step 1155 . as a result , in a step 1156 , conversation is started and afterward , in a step 1157 , the conversation is finished .
| 7 |
a description of the forces imparted upon an arrow by a bow and the archer shall first be described with reference to fig7 , and 9 . a bow generally indicated at 3 indicates a handle provided with a vertical support member 7 and a lateral support member 9 . a bowstring 4 is depicted in fig7 and fig8 at its full draw position with an arrow 2 nocked thereon . it is indicated in fig7 that arrow 2 is nocked on bowstring 4 at a traditional distance above the center line of force f . line f is in relation to bow 3 and is always vertically and laterally stable relative to bowstring 4 with arrow 2 nocked thereon . the point end of arrow 2 is maintained stable relative to line f by support members 7 and 9 . with reference to the conditions set up in fig7 the primary force serving to propel arrow 2 from bow 3 is that force imparted by the pull or draw weight of the bow limbs ( not shown ) and transmitted to arrow 2 through bowstring 4 . this primary force is directed along the center line of force indicated by f . because of the high length - to - diameter ratio of arrow 2 when the nock end of arrow 2 is displaced away from line f as depicted by angle 5 in fig7 the primary force imposed thereon at the moment of release causes arrow 2 to bend downwardly , therefore directing the point thereof to assume a path inclined in the vertical direction . having nocked arrow 2 above the center line of force f as indicated in fig7 a vertical displacement force was generated at the moment of release to influence arrow 2 to bend downwardly . in the absence of this force , arrow 2 would bend in an unpredictable and erratic manner . fig8 is a view of bow handle 3 taken on the line 8 -- 8 of fig9 . as indicated , bowstring 4 with arrow 2 nocked thereon has been displaced laterally away from force line f , indicated by angle 6 . this lateral displacement of bowstring 4 will initiate lateral displacement force upon impact of release to influence arrow 2 to bend toward force line f or inwardly toward bow 3 , causing the point end of arrow 2 to assume a path inclined laterally away from bow 3 . when the fingers of an archer are utilized for drawing and releasing bowstring 4 , there inevitably exists a lateral shifting of bowstring 4 with arrow 2 nocked thereon , due to the rolling of bowstring 4 off the fingers of the archer . this shifting is in either the left or right direction , depending upon whether a left - handed or right - handed bow is used . assuming that a right - handed bow is being utilized as depicted in fig7 , and 9 , this lateral displacement force is indicated by arrow l in fig9 and is opposed by lateral arrow support member 9 . vertical displacement force is indicated by arrow v in fig9 and is opposed by vertical support member 7 . the vertical displacement angle 5 of fig7 and the lateral displacement angle 6 of fig8 will initiate displacement forces upon impact of release of a value relative to the degree of displacement . if the vertical and lateral displacement forces are equal , then the resultant effects will provide a theoretical net force in the direction indicated by arrow n in fig9 . depending upon the degree of difference between the values of the lateral and vertical displacement , net force n may be oriented anywhere within the 90 degree quandrant represented by arrows l and v . as depicted in fig7 and 8 , the moment that bowstring 4 is released from full draw , equal vertical and lateral displacement forces imposed by bow 3 immediately cause arrow 2 to bend in a curve directed in a path downwardly at an angle inclined toward the side of bow 3 and along net force line n of fig9 . the resiliency inherent in arrow 2 will cause an immediate tendency to recover from this initial bend , and arrow 2 will over - compensate , rebounding away from support members 7 and 9 to bend into a curved path directed outwardly at an angle inclined away from bow 3 along force line n to form a bending pattern traditionally called the s curve . the second bend of the s curve is both the result and the inverse of the first bend . the embodiment of the improved arrow support device shown in this disclosure holds that lateral and vertical displacement forces can be adjusted so they are equal , giving a net displacement force which bisects the 90 degree quandrant formed by arrows v and l in fig9 . in making this adjustment , the archer traditionally sets the nocking point above the center line of force by an amount equal to the combined lateral displacement of his shooting style and any built - in torque in the bow . this is the accepted way that a bow is tuned , whether or not the archer is aware of what he is actually doing . the present invention does not alter this tuning procedure , but simply operates along the resultant net line of force , making the above tuning procedure extremely simple . a preferred embodiment of the present invention shall now be described with reference to fig1 - 6 . the arrow support device includes a pair of elongated , generally non - resilient arrow support members 35 and 38 , adapted with mounting flanges 35a and 38a having apertures 40a and 40b , disposed therein as depicted in fig4 for the purpose of mounting to yoke 23 . the mounting is accomplished by suitable means , such as screws 36 and 39 and threaded apertures 37 and 41 , shown in fig1 and 4 . arrow support members 35 and 38 and yoke 23 are intended to be as non - yielding as materials , space limitations , and weight considerations will allow , providing in combination an arrow support - yoke assembly , which moves as a unit as depicted in fig1 and 2 . elongated aperture 40a disposed in the mounting flange 38b of arrow support member 38 shown in fig4 provides lateral adjustment of arrow support member 38 to accomodate various sizes of arrow shafts . the outer tips of arrow support members 35 and 38 can be provided with a cushion material to minimize noise for hunting purposes . pivot bearings 24 and 30 are pressed into pivot - bearing sockets 25 and 31 of yoke 23 as depicted in fig6 . yoke 23 , with arrow support members 35 and 38 attached thereto , is secured in pivot frame 14 by mating conical pivot members 26a and 26b with said pressed - in pivot bearings 24 and 30 . yoke 23 can be centered in pivot frame member 14 by adjusting the position of conical pivot members 26a and 26b in apertures 29 and 34 . when the yoke is satisfactorily centered , conical pivot members 26a and 26b are then clamped in place by screws 27 and 32 , disposed in threaded apertures 28 and 33 . partial cutaway details of the pivot clamping system is shown by fig5 . conical pivot members 26a and 26b can be in the form of threaded set screws , in which case apertures 29 and 34 would be threaded to provide screwdriver - type adjustment for centering yoke 23 . as depicted in fig2 and 6 , pivot frame 14 is secured to bow 3 by satisfactory means such as mounting member 10 using suitable , laterally - adjustable means such as captive studs 15 and 16 , shim plate 18 , lock washers 21 and 22 , thumb nuts 19 and 20 , and shim - pack 17 . shim pack 17 is disposed on one or both sides of mounting member 10 to provide a means of lateral adjustment of pivot frame 14 without requiring a change in the length of captive studes 15 and 16 . mounting member 10 is secured to bow 3 by suitable means , such as screw 11 as depicted in fig1 and 3 . pivot frame member 14 and mounting member 10 can be adapted to use any of various securable telescoping spindle - or spline - type devices to provide lateral movement of pivot frame member 14 relative to the axis of intended arrow flight . the said spindle or spline can be a lead screw driven by satisfactory means , such as a captive indexing drum secured to mounting member 10 . spring holder hook 43 is provided with a lateral portion 43a for insertion into stop block 42 through aperture 44b extending into aperture 44a and secured by suitable means , such as deforming the terminal and of 43a by punching through aperture 44a as shown in fig2 and 4 . stop block 42 with spring holder hook 43 attached thereto is secured to yoke 23 by suitable means , such as screw 45 and threaded aperture 46 shown in fig2 and 4 . optional cushion pad 47 can be used to silence any clicking sound made when stop block 42 strikes pivot frame member 14 during the discharge of a shot . a spring tension adjustment assembly comprising screw 54 , spring - holder hook alignment plate 50 having aperture 52 disposed in guide flange 51 to accomodate shank portion 49a of spring holder hook 49 , and washer 53 is assembled as shown in fig3 and 4 . the spring tension adjustment assembly is securable anywhere along slot 55 disposed in flange 58 of mounting means 10 . guide flange 51 extends into slot 55 to act in combination with screw 54 to maintain satisfactory alignment of the spring tension adjustment assembly . one end of spring 48 is attached to yoke 23 by spring holder hook 43 carried by stop block 42 ; the other end of spring 43 is attached to mounting means 10 by adjustable spring holder hook 49 . flange 58 provides protection from physical damage for relatively fragile spring 48 . the outer ends of spring holder hooks 43 and 49 protrude slightly beyond the edge of flange 58 to facilitate changing spring 48 without requiring the use of tools , as shown in fig3 . wire - type spring holder hooks are used in this invention rather than traditional screws or studs in order to minimize the lateral torque that would be imposed on spring 48 by such screws or studs , thereby minimizing spring oscillation fatigue and objectionable noise generated by such oscillation . the otherwise detrimental effect of slight changes in bearing friction is minimized by the design of the present invention by providing space within the framework of the device to allow for attachment of extensive - type spring 48 to yoke 23 about one inch away from pivot axis p . the leverage thus achieved permits the use of a relatively light spring tension to operate the yoke assembly , providing an added degree of forgiveness claimed for the device of this disclosure . satisfactory spring loading of yoke 23 can be achieved by any type of spring system commonly used in rotatable devices which can be adapted to urge yoke 23 against a stop means . the extention - type spring system illustrated herein is used to provide generally constant spring tension during the alternating movement of yoke 23 . an adjustable leaf , torque or compression spring system can be used to provide increasing tension as yoke 23 is moving away from the first stop means and decreasing tension as yoke 23 moves toward the first stop means . the spring system can be attached to or embodied in yoke 23 , extending to pivot frame 14 or bow 3 ; or attached to , or embodied in , pivot frame 14 extending to yoke 23 . a satisfactory counterweight system secured to yoke 23 can be used to supply decreasing resistance to movement as yoke 23 moves away from the first stop means upon impact of release , providing peak resistance when peak lateral displacement forces are imposed on the arrow - support means . bow 3 has a threaded aperture to receive screw 11 shown in fig1 and 3 , provided in the manufacture of most modern bows and disposed at a point generally where the axis of intended arrow flight , indicated by line a of fig3 and the axis of the torque center of the box handle cross , as depicted by lines a and t of fig3 . the outer end 35b of arrow support member 35 is disposed near the center of this aperture as shown by fig1 . the forward extending longitudinal axes of this invention are intended to be generally along lines parallel to the axis of intended arrow flight facilitating longitudinal alignment of the device in that the uppermost edge of mounting member 10 , pivoting about screw 11 , can be made parallel with the axis of an in - place arrow . proper adjustment of arrow support member 38b is accomplished when the horizontal plane of the axis of an in - place arrow is aligned with the center of outer end 35b of arrow support member 35 , shown in fig2 . the embodiment of the invention illustrated herein uses a relatively large number of individual parts that in practice combine as a single functional part , such as the spring - holder hook adjustment assembly and the pivot frame - mounting means assembly . referring now to fig7 and 8 , when arrow 2 absorbs the initial impact of the primary propelling force upon release of bowstring 4 , the vertical displacement angle 5 and lateral displacement angle 6 will cause arrow 2 to start bending downwardly along net force line n of fig9 . referring now to fig1 , and 3 , the present invention is used in place of supports 7 and 9 of fig7 , and 9 . when the point end of arrow 2a exerts downwardly - directed force on the outer tips of arrow suport members 35 and 38 , yoke 23 will rotate about pivot axis line p of fig2 causing apex portion 23a of yoke 23 to move outwardly as indicated by 23b of fig3 carrying stop block 42 ( with spring member 48 attached thereto ) away from pivot frame 14 and against the tension of spring 48 , allowing arrow 2a to move downwardly along line n and across pivot axis p to a position 2b as indicated by phantom lines in fig1 and 2 , conteracting most of the tendency of arrow 2a to bend . as arrow 2a proceeds out of bow 3 , it will recover from the effects of the vertical and lateral forces imposed on it by the impact of release . the tendency to bend downward will subside and the tension of spring 48 will return accelerating arrow 2a upwardly along net force line n until stop block 42 rests against pivot frame 14 . arrow 2a will proceed out of bow 3 to complete the discharge of the shot . referring now to fig2 it is important to notice that the pivot axis , indicated by line p , passes through the horizontal plane of the longitudinal axis of arrow 2a , which is disposed along the axis of intended arrow flight , indicated by line a of fig3 . when arrow 2a is discharged from bow 3 , downwardly - directed lateral forces cause the arrow shaft to exert a net downwardly - directed lateral force on the forward - protruding outer tips of the arrow support members , causing the arrow support - yoke assembly to pivot about the pivot axis line p between two stop means provided by stop block 42 and the bottoming - out of arrow support member 35 . the mechanical strength of the present invention is great enough to require that portion of accelerating arrow 2a riding in the arrow - supporting portion of the yoke assembly to be disposed along line n . if arrow 2a moves to the position indicated by phantom arrow 2b , part of the circular cross - section of the arrow shaft can cross the pivot axis indicated by line p . lateral interaction between the arrow - contacting portions of the arrow - supporting yoke assembly is minimized by the non - resilient nature of the device . recess 23a , indicated in fig4 provides means to allow arrow 2a to pass near or across the pivot axis line p to provide a relationship between arrow support members 35 and 38 and pivot axis p selected to minimize radial shifting of the arrow - supporting portions of the arrow support members 35 and 38 about the surface of accelerating arrow 2a during discharge of the shot . if under some shooting conditions interaction of the arrow support members is not considered objectionable , two or more resilient arrow support members can be used , provided that the combination is less resilient than spring 48 . when the tendency of accelerating arrow 2a to bend downwardly has subsided , the tension of spring 48 will return the arrow - supporting yoke assembly to the at - rest stop position , carrying accelerating arrow 2a back to the axis of intended arrow flight . this lifting of accelerating arrow 2a back to the axis of intended arrow flight occurs when the arrow shaft is straight and because there is no interaction between the arrow - supporting members , no additional lateral force is transmitted by the arrow support members to arrow 2a when stop block 42 comes to rest against pivot frame 14 , minimizing overcompensation common with presently - used devices . this would be considered an ideal shot with the present invention having counteracted most of the first tendency of the arrow shaft to bend , allowing the arrow to proceed out of the bow with little or no s curve . if on the next shot the archer produces an inconsistent release , causing more lateral displacement than vertical displacement and a net force which is different from the first shot , the present invention will react exactly as described previously , pivoting an axis line p and thereby applying counteractive force to the accelerating arrow to follow line n . this counteractive force is opposed to the different net line of force and is derived from the non - variable plane of line n and is added to the different net line of force , resulting in a net line of force closer to line n . when the arrow has lost its tendency to bend along the different net force line , the energy stored in spring 48 will return the arrow shaft upwardly along line n until stop block 42 again rests against pivot frame 14 , effectively counteracting a change in lateral displacement force . the yoke will react in the same way to a change in vertical displacement force . when using the yoke arrow support , the bending of the arrow generally does not transmit appreciable lateral energy to the bowhandle , the tension of spring 48 being the maximum pressure the arrow can transfer back to the bow . under these conditions , during the time the energy stored in the bow limbs is being transmitted to the arrow through the bow string , the bow - arrow unit displays a gyro - effect as long as the arrow is accelerating . this gyro - effect maintains the bow vertically stable as long as the arrow is absorbing energy from the bow . if the archer has heeled his bow , the effect of this heeling -- which kicks the lower limb forward , effectively lowering the nocking point -- will generally not occur until near the end of the power stroke of the bow , when the gyro - effect subsides . at this time , the arrow will be affected as though the nocking point were suddenly lowered , causing the arrow support to pivot downwardly along line n , counteracting to a large degree the effects of severe heeling of the bow . it is the combination of mechanical parts capable of providing this action for which i seek letters patent as set forth in the following claims .
| 5 |
referring now to the several drawing figures in which identical elements have been numbered identically throughout , a description of the preferred embodiment of the invention will now be provided . fig1 shows a prior art fiber optic module which is discussed more thoroughly in that section of this application entitled &# 34 ; description of the prior art .&# 34 ; with reference directed to fig2 - 3 , a connector module 100 is shown having a sheet metal housing 102 which includes a front wall 104 and a rear wall 106 . the front wall carries a first receive fiber optic connector 108 , a first transmit fiber optic connector 110 , a receive monitor connector 112 and a transmit monitor connector 114 . the rear wall 106 carries a second receive fiber optic connector 116 and a second transmit fiber optic connector 118 . it will be appreciated that fiber optic connectors such as connectors 108 , 110 , 112 , 114 , 116 and 118 are well known in the art and form no part of this invention per se . connectors 108 , 110 , 112 and 114 are secured with their axes at an angle relative to the face 104 . for reasons that will become apparent , connectors 112 , 114 are preferably so called angled connectors to prevent back reflection . namely , the terminal face of the connector is non - orthogonal to the axis of the fiber contained within the connector ferrule 124 . by reason of this angle , light transmitted through the fiber does not reflect back into the fiber when a second cable is not connected to the connector . the preferential use of an angled connector for connectors 112 , 114 is attributable to the fact that in normal operation , it is anticipated that fibers will not be connected to the free ends of connectors 112 , 114 . in anticipated operation , external cables will be connected to connectors 108 , 110 , 116 and 118 . accordingly , these connectors need not be angled connectors . each of connectors 108 , 110 , 112 , 114 , 116 and 118 have free ends 108a , 110a , 112a , 114a , 116a and 118a exposed external to an interior 103 of housing 102 to permit connection to external cables ( not shown ). a receive fiber optic cable 130 is provided contained within interior 103 and optically coupled to first receive connector 108 . the receive cable 130 is also connected to second receive connector 116 . a transmit fiber optic cable 132 is optically connected to the first transmit fiber optic connector 110 . cable 132 is also connected to the second transmit fiber optic connector 118 . a transmit monitor fiber optic cable 134 is optically connected to the transmit monitor connector 114 . similarly , a receive monitor fiber optic cable 136 is optically connected to the receive monitor fiber optic connector 112 . a first beam splitter 140 is provided on cable 130 to split a receive signal beam from receive connector 108 into first and second receive distribution beams . the first receive distribution beam is transmitted along cable 130 to connector 116 . the second receive distribution beam is transmitted along cable 136 to connector 112 . for reasons that will be described , first beam splitter 140 preferably splits the receive signal with ninety percent of the signal transmitted to connector 116 and the remaining ten percent of the signal transmitted to connector 112 . similarly , a second beam splitter 142 is provided on cable 132 . the splitter 142 is selected to send 90 percent of the signal from connector 118 through cable 132 to connector 110 . the remaining 10 percent of the signal is distributed through cable 134 to connector 114 . a variable attenuator 144 is provided on cable 130 . the variable attenuator is selectively actuated by an operator by means of rotation of a handle or knob 146 extending beyond face 104 . the knob 146 is connected via a shaft 148 to the attenuator 144 . upon turning of the knob 146 attenuation of a signal along cable 130 may be varied . it will be appreciated that beam splitters and variable attenuators such as those schematically shown in fig2 are commercially available and well known . with the structure thus described , a signal is received into module 100 through connector 108 . the signal is attenuated through variable attenuator 144 and passed to first splitter 140 . ninety percent of the signal is emitted from module 100 through connector 116 . ten percent of the signal is directed to monitor connector 112 . similarly , a signal is inputted at connector 118 and passed through splitter 142 with 90 percent of the signal sent to connector 110 and the remaining 10 percent directed to connector 114 . in intended use , connectors 110 , 108 , 116 and 118 are connected to fiber optic cables connecting various pieces of fiber optic equipment . at an operator &# 39 ; s election , fiber optic cables may be connected to either of connectors 112 , 114 to monitor the signal passing through lines 130 , 132 , respectively . in intended operation , connector 116 is connected via a fiber optic cable ( not shown ) to a piece of fiber optic equipment . such equipment typically has a limited dynamic range for receiving signals . for example , such a dynamic range may be - 25 db 5 dbm . by monitoring through connector 112 , an operator can determine if the signal beam discharged through connector 116 is within the prescribed dynamic range . for example , due to the 90 / 10 split of first splitter 140 , if the dynamic measurement at connector 112 is measured at - 35 dbm then an operator knows that the output of connector 116 is - 25 dbm . if the measured power at connector 112 is other than - 35 dbm , the operator can manually engage knob 146 and vary the attenuation of attenuator 144 until the measured dynamic output of connector 112 attains the desired - 35 dbm . the use of a 90 / 10 splitter 140 is desirable as compared to other types of splitters ( for example , 80 / 20 splitters ) since an operator can readily determine the amount of attenuation necessary . specifically , a ninety percent splitter results in a 10 db loss . a fifty percent splitter results in a 3 db loss . using a 90 / 10 splitter , an operator readily knows that the db output of connector 116 is + 10 at measured at connector 112 . from the foregoing detailed description of the present invention , it has been shown how the objects of the invention have been attained in a preferred manner . however , modifications and equivalence of the disclosed concepts such as those which readily occur to one skilled in the art are intended to be included within the scope of the present invention .
| 6 |
referring to the drawings , there is shown a gaming system having a game controller arranged to implement a game where a player is allocated a number of game rounds to achieve a target outcome . during the game rounds contributions towards the outcome are accumulated and the player receives an award if the target outcome is achieved . in an embodiment , the player selects the target outcome from target outcomes having different levels of difficulty with greater awards associated with higher difficulty , thus introducing a tension between the player &# 39 ; s selection and the prospects of success . the gaming system can take a number of different forms . in a first form , a stand alone gaming machine is provided wherein all or most components required for implementing the game are present in a player operable gaming machine . in a second form , a distributed architecture is provided wherein some of the components required for implementing the game are present in a player operable gaming machine and some of the components required for implementing the game are located remotely relative to the gaming machine . for example , a “ thick client ” architecture may be used wherein part of the game is executed on a player operable gaming machine and part of the game is executed remotely , such as by a gaming server ; or a “ thin client ” architecture may be used wherein most of the game is executed remotely such as by a gaming server and a player operable gaming machine is used only to display audible and / or visible gaming information to the player and receive gaming inputs from the player . however , it will be understood that other arrangements are envisaged . for example , an architecture may be provided wherein a gaming machine is networked to a gaming server and the respective functions of the gaming machine and the gaming server are selectively modifiable . for example , the gaming system may operate in stand alone gaming machine mode , “ thick client ” mode or “ thin client ” mode depending on the game being played , operating conditions , and so on . other variations will be apparent to persons skilled in the art . irrespective of the form , the gaming system comprises several core components . at the broadest level , the core components are a player interface 50 and a game controller 60 as illustrated in fig1 . the player interface is arranged to enable manual interaction between a player and the gaming system and for this purpose includes the input / output components required for the player to enter instructions and play the game . components of the player interface may vary from embodiment to embodiment but will typically include a credit mechanism 52 to enable a player to input credits and receive payouts , one or more displays 54 , a game play mechanism 56 comprising one or more input devices that enable a player to input game play instructions ( e . g . to place bets ), and one or more speakers 58 . the game controller 60 is in data communication with the player interface and typically includes a processor 62 that processes the game play instructions in accordance with game play rules and outputs game play outcomes to the display . typically , the game play instructions are stored as program code in a memory 64 but can also be hardwired . herein the term “ processor ” is used to refer generically to any device that can process game play instructions in accordance with game play rules and may include : a microprocessor , microcontroller , programmable logic device or other computational device , a general purpose computer ( e . g . a pc ) or a server . a gaming system in the form of a stand alone gaming machine 10 is illustrated in fig2 . the gaming machine 10 includes a console 12 having a display 14 on which are displayed representations of a game 16 that can be played by a player . a mid - trim 20 of the gaming machine 10 houses a bank of buttons 22 for enabling a player to interact with the gaming machine , in particular during game play . the mid - trim 20 also houses a credit input mechanism 24 which in this example includes a coin input chute 24 a and a bill collector 24 b . other credit input mechanisms may also be employed , for example , a card reader for reading a smart card , debit card or credit card . a player marketing module ( not shown ) having a reading device may also be provided for the purpose of reading a player tracking device , for example as part of a loyalty program . the player tracking device may be in the form of a card , flash drive or any other portable storage medium capable of being read by the reading device . a top box 26 may carry artwork 28 , including for example pay tables and details of bonus awards and other information or images relating to the game . further artwork and / or information may be provided on a front panel 29 of the console 12 . a coin tray 30 is mounted beneath the front panel 29 for dispensing cash payouts from the gaming machine 10 . the display 14 shown in fig2 is in the form of a video display unit , particularly a cathode ray tube screen device . alternatively , the display 14 may be a liquid crystal display , plasma screen , any other suitable video display unit , or the visible portion of an electromechanical device . the top box 26 may also include a display , for example a video display unit , which may be of the same type as the display 14 , or of a different type . fig3 shows a block diagram of operative components of a typical gaming machine which may be the same as or different to the gaming machine of fig2 . the gaming machine 100 includes a game controller 101 having a processor 102 . instructions and data to control operation of the processor 102 are stored in a memory 103 , which is in data communication with the processor 102 . typically , the gaming machine 100 will include both volatile and non - volatile memory and more than one of each type of memory , with such memories being collectively represented by the memory 103 . the gaming machine has hardware meters 104 for purposes including ensuring regulatory compliance and monitoring player credit , an input / output ( i / o ) interface 105 for communicating with peripheral devices of the gaming machine 100 . the input / output interface 105 and / or the peripheral devices may be intelligent devices with their own memory for storing associated instructions and data for use with the input / output interface or the peripheral devices . a random number generator module 113 generates random numbers for use by the processor 102 . persons skilled in the art will appreciate that the reference to random numbers includes pseudo - random numbers . in the example shown in fig3 , a player interface 120 includes peripheral devices that communicate with the game controller 101 and comprise one or more displays 106 , a touch screen and / or buttons 107 , a card and / or ticket reader 108 , a printer 109 , a bill acceptor and / or coin input mechanism 110 and a coin output mechanism 111 . additional hardware may be included as part of the gaming machine 100 , or hardware may be omitted as required for the specific implementation . for example , while buttons or touch screens are typically used in gaming machines to allow a player to place a wager and initiate a play of a game any input device that enables the player to input game play instructions may be used . in addition , the gaming machine 100 may include a communications interface , for example a network card 112 . the network card may , for example , send status information , accounting information or other information to a central controller , server or database and receive data or commands from the central controller , server or database . fig4 shows a block diagram of the main components of an exemplary memory 103 . the memory 103 includes ram 103 a , eprom 103 b and a mass storage device 103 c . the ram 103 a typically temporarily holds program files for execution by the processor 102 and related data . the eprom 103 b may be a boot rom device and / or may contain some system or game related code . the mass storage device 103 c is typically used to store game programs , the integrity of which may be verified and / or authenticated by the processor 102 using protected code from the eprom 103 b or elsewhere . it is also possible for the operative components of the gaming machine 100 to be distributed , for example input / output devices 106 , 107 , 108 , 109 , 110 , 111 to be provided remotely from the game controller 101 . fig5 shows a gaming system 200 in accordance with an alternative embodiment . the gaming system 200 includes a network 201 , which for example may be an ethernet network . gaming machines 202 , shown arranged in three banks 203 of two gaming machines 202 in fig5 , are connected to the network 201 . the gaming machines 202 provide a player operable interface and may be the same as the gaming machines 10 , 100 shown in fig2 and 3 , or may have simplified functionality depending on the requirements for implementing game play . while banks 203 of two gaming machines are illustrated in fig5 , banks of one , three or more gaming machines are also envisaged . one or more displays 204 may also be connected to the network 201 . for example , the displays 204 may be associated with one or more banks 203 of gaming machines . the displays 204 may be used to display representations associated with game play on the gaming machines 202 , and / or used to display other representations , for example promotional or informational material . in a thick client embodiment , game server 205 implements part of the game played by a player using a gaming machine 202 and the gaming machine 202 implements part of the game . with this embodiment , as both the game server and the gaming device implement part of the game , they collectively provide a game controller . a database management server 206 may manage storage of game programs and associated data for downloading or access by the gaming devices 202 in a database 206 a . typically , if the gaming system enables players to participate in a jackpot game , a jackpot server 207 will be provided to perform accounting functions for the jackpot game . a loyalty program server 212 may also be provided . in a thin client embodiment , game server 205 implements most or all of the game played by a player using a gaming machine 202 and the gaming machine 202 essentially provides only the player interface . with this embodiment , the game server 205 provides the game controller . the gaming machine will receive player instructions , pass these to the game server which will process them and return game play outcomes to the gaming machine for display . in a thin client embodiment , the gaming machines could be computer terminals , e . g . pcs running software that provides a player interface operable using standard computer input and output components . servers are also typically provided to assist in the administration of the gaming network 200 , including for example a gaming floor management server 208 , and a licensing server 209 to monitor the use of licenses relating to particular games . an administrator terminal 210 is provided to allow an administrator to run the network 201 and the devices connected to the network . the gaming system 200 may communicate with other gaming systems , other local networks , for example a corporate network , and / or a wide area network such as the internet , for example through a firewall 211 . persons skilled in the art will appreciate that in accordance with known techniques , functionality at the server side of the network may be distributed over a plurality of different computers . for example , elements may be run as a single “ engine ” on one server or a separate server may be provided . for example , the game server 205 could run a random number generator engine . alternatively , a separate random number generator server could be provided . further , persons skilled in the art will appreciate that a plurality of game servers could be provided to run different games or a single game server may run a plurality of different games as required by the terminals . in the embodiment , the game is triggered by trigger monitor 626 a as a feature game from a base game conducted by base game controller 626 and displayed in a first display area 54 a . in the embodiment , the feature is conducted as a second screen feature and is displayed in a second display area 54 b which may be on a separate display to the first display area 54 a . the feature can be triggered in accordance with any of the know eligibility criteria including based on turnover , by being purchased in the base game , by a system event or by a symbol combination in the base game . the selection processor 623 is arranged to offer via display 54 a plurality of different selectable target outcomes specified by target outcome data 642 . in the embodiment , the player operates game play mechanism 56 to select one of the target outcomes . in an alternative embodiment , the player may be allowed to construct the target outcome from a plurality of components specified by target outcome data 642 . for example , the player may be offered a plurality of different start components to the target outcome and , depending on the selected start , a plurality of different end components . in such embodiments , an award may be made for achieving a component of the target outcome . in some embodiments , the selection processor may make a default selection based on game rules if a time out condition is met . the game round controller 622 a of outcome generator 622 then conducts a series of game rounds for achieving the target outcome ; the initial number of game rounds being related to the selected target outcome . each game round involves a symbol selector 622 b selecting symbols specified by symbol data 641 . the selected symbols are advised to the display controller 625 which causes them to be displayed on display 54 at a set of display positions . one example of selecting symbols is for the symbol selector 622 b to access the random number generator 621 to select symbols using the game rules 644 for display as a plurality of spinning reels . the symbol sets 641 can specify a sequence of symbols for each reel such that the symbol selector 622 b can select a symbol by selecting a stopping position in the sequence . the selected symbols are then evaluated by symbol evaluator 622 c to determine whether they include any contributions towards the target outcome , for example , a specific symbol combination that contributes toward the target outcome . accumulator 622 d accumulates any contribution and progress towards the target outcome is displayed on display 54 b by display controller 625 . in some embodiments , players may be entitled to purchase additional contributions . the game round controller 622 a continues to conduct game rounds until all the game rounds have been exhausted . the number of available game rounds 644 is specified by the game rule data 644 and the number of game rounds may be used as one factor to control the difficulty of achieving the target outcome . in some embodiments , particular outcomes of symbol selection may cause the number of game rounds to be varied , for example by adding to or subtracting from the current number of game rounds . the remaining number of game rounds is stored as the game round data 643 . the player may also be able to place an additional bet to buy more game rounds . accordingly , it will be appreciated that the game round controller 622 a is arranged to continue to conduct rounds until either the accumulator 622 d accumulates sufficient contributions to achieve the target outcome or the game rounds are exhausted . if sufficient contributions are made , the award determiner 624 is advised and the award determiner 624 determines the prize 645 corresponding to the target outcome 642 , updates the credit meter 646 and controls the display by means of display controller 625 to show the awarding of the prize . it will be appreciated that contributions towards the outcome can be achieved in a number of ways , for example , they can relate to a specific symbol combination created by selecting a set of symbols for display , they can be created by specific symbol being in the set of symbols , etc . a person skilled in the art will appreciate that other techniques could be used to select symbols including drawing a card from a set of cards , rolling a dice , etc . by way of example , the contributions can be in the form of a movement towards an outcome in the form of a destination or by removing an obstacle to reaching a destination . in such embodiments , the relative difficulty of achieving an outcome can be controlled in a number of ways , including the amount of movement needed to reach an destination associated with the target outcome ( which may be an origin ), the number of obstacles , or the number of game rounds . accordingly , as the difficulty of achieving an outcome can be controlled , there is a tension between a player &# 39 ; s selection of a target outcome and the player &# 39 ; s prospects of achieving the outcome . persons skilled in the art will appreciate that the target outcome may be chosen in some other manner than by a player . for example , the target outcome be defined based on a player &# 39 ; s previous expenditure in the game , the number times they have entered the feature game or the manner in which they enter the feature game , for example a particular combination achieved when entering the feature game . the method is summarised in fig7 which shows a feature being triggered 705 , a player selection of a target outcome being made 710 , and a set of bonus games started 715 . in each bonus game round , symbols are selected 720 and it is determined 725 whether this results in a contribution to the outcome . if it does , the contribution is accumulated 730 and is determined 735 whether the outcome has been achieved . if the outcome has been achieved , an award is made 740 . if not , the number of allocated game rounds is decremented 745 and is determined whether the allocation of game rounds has been exhausted 750 in which case the game ends 755 . if the allocation has not been exhausted , the method proceeds by selecting the symbols for a further game round 720 . fig8 shows an exemplary display 800 of an example where a player is given a limited number of total feature spins and the player can select three levels of difficulty and hence select from three outcomes . the higher the number of obstacles , the greater the reward at the end , as denoted by the increasing sizes of the treasure chests 850 , 840 , 830 . in this example , the theme is of salvaging treasure from a wreck 823 and accordingly a salvage ship 822 is displayed and a diver 821 indicates the player &# 39 ; s current progress towards the target outcome . the target outcomes are each of the three treasure chests 830 , 840 and 850 . there are obstacles 831 , 832 , 841 , 842 and 851 between the player position 821 and the target outcomes 830 , 840 and 850 . the player has a trade off for the higher prize of less chance to actually getting the prize . the obstacles are chosen to fit with the theme and are displayed as blocked doors , rubble , barrels , hanging nets , etc . reels are displayed in areas 811 , 812 and 813 , where the player has a chance to spin up items that help clear the obstacles . for example , the player may spin up a key to open a lock door . once the player reaches a treasure chest 830 , 840 or 850 the remaining spins are used to drag the treasure chest back to the salvage ship . thus , the higher level of obstacles and the more positions the player is required to traverse to get the obstacle back to the ship 822 depict the level of difficulty . it will be appreciated that the individual reel spins of each game outcome displayed in the reels 811 to 813 contribute to towards the players progress to achieving the target outcome and that this accumulation of contributions is represented by the diver &# 39 ; s current position and status ( e . g . the direction the diver is shown travelling in , whether or nor they are carrying the treasure , etc ). a person skilled in the art will appreciate that there can be a number of variations to this example , for example , it may be possible for obstacles to be put back after they have been removed or for additional obstacles added in response to a particular outcome of the reels 811 or 813 or for game rounds ( i . e . spins ) to be added or subtracted . in the above example , the target outcome combines the player &# 39 ; s trip from an origin to a destination and back to the origin . in other embodiments the player may journey solely to the destination . obstacle replacement could be dependent on the outcome of reels , duration of time or the amount of funds bet . in one embodiment , the player could purchase the removal of an obstacle . persons skilled in the art will also appreciate that the method of the embodiment could be embodied in program code . the program code could be supplied in a number of ways , for example on a computer readable medium , such as a disc or a memory ( for example , that could replace part of memory 103 ) or as a data signal ( for example , by transmitting it from a server ). it will be understood to persons skilled in the art of the invention that many modifications may be made without departing from the spirit and scope of the invention . it is to be understood that , if any prior art publication is referred to herein , such reference does not constitute an admission that the publication forms a part of the common general knowledge in the art , in australia or any other country . in the claims which follow and in the preceding description of the invention , except where the context requires otherwise due to express language or necessary implication , the word “ comprise ” or variations such as “ comprises ” or “ comprising ” is used in an inclusive sense , i . e . to specify the presence of the stated features but not to preclude the presence or addition of further features in various embodiments of the invention
| 6 |
reference is made to fig1 a , 1b , 1c and 1d , which are simplified isometric illustrations , taken from four different viewpoints , of an assembled sprinkler constructed and operative in accordance with a preferred embodiment of the present invention , and to fig2 a and 2b , which are simplified exploded view illustrations , taken from two different viewpoints , of the sprinkler of fig1 a - 1d . as seen in fig1 a - 2b , the sprinkler comprises a sprinkler body 102 including a riser portion 104 , a forward nozzle mounting portion 106 , a rearward nozzle mounting portion 108 and a bridge portion 110 . riser portion 104 preferably includes a generally hollow cylindrical portion 112 , a top flange portion 114 and a bottom threaded portion 116 . forward nozzle mounting portion 106 preferably includes a radially extending and upwardly extending generally hollow cylindrical portion 122 , which communicates with the interior of generally hollow cylindrical portion 112 , and a pair of nozzle mounting protrusions 124 on an upwardly and radially outward edge of cylindrical portion 122 . rearward nozzle mounting portion 108 preferably includes a radially extending and upwardly extending generally hollow cylindrical portion 132 , which communicates with the interior of generally hollow cylindrical portion 112 , and a pair of nozzle mounting protrusions 134 on an upwardly and radially outward edge of cylindrical portion 132 . bridge portion 110 preferably includes a pair of upwardly extending arms 142 and 144 , which support a joining portion 146 defining a flange 148 having a central aperture 150 which is spaced from a corresponding recess 152 along a vertical axis 154 . underlying flange 148 there are provided a plurality of , typically four , spring mounting protrusions 156 . as seen most clearly in fig2 a & amp ; 2b , mounted on riser portion 104 are multiple elements , which are here described in physical descending order from the element which lies below and against top flange portion 114 . a sand protection sleeve 162 encloses a compressed thrust spring 164 . a thrust spring seat 166 underlies spring 164 and overlies and partially surrounds a top flange 168 of a threaded connector base 170 . connector base 170 is formed with an outer threaded bottom portion 172 , which serves for mounting of the entire sprinkler . a plurality of washers , typically including a two rubber washers 174 and 176 and an intermediate low friction washer 178 , are retained about riser cylindrical portion 112 by an apertured retaining cap 180 , which is threaded onto bottom threaded portion 116 of riser 104 . a selectable size forward nozzle 190 is replaceably mounted onto forward nozzle mounting portion 106 and retained thereon by engagement with nozzle mounting protrusions 124 . a selectable size rearward nozzle 192 is replaceably mounted onto rearward nozzle mounting portion 108 and is retained thereon by engagement with nozzle mounting protrusions 134 . alternatively a plug ( not shown ) may replace the selectable rearward nozzle 192 . a vertical hammer mounting shaft 196 is preferably mounted along vertical axis 154 and extends through aperture 150 and is seated in recess 152 . disposed about shaft 196 is a hammer sand protection sleeve 198 and a drive spring 200 , which is mounted at one end thereon onto four spring mounting protrusions 156 . a hammer 210 is rotatably mounted onto shaft 196 . various embodiments of hammers are described hereinbelow in detail . a spray diffuser 212 may optionally be mounted on hammer 210 . reference is now made to fig3 a and 3b , which are simplified side view illustrations of a hammer element 300 forming part of the sprinkler of fig1 a - 2b , fig3 a & amp ; 3b being mutually rotated by 180 degrees , and to fig3 c and 3d , which are simplified isometric illustrations of the hammer element of fig3 a and 3b , taken from two different viewpoints . reference is also made to fig3 e , 3f and 3g , which are simplified sectional illustrations taken along respective section lines e - e , f - f and g - g in fig3 a , and to fig3 h , 3i , 3j and 3k , which are simplified sectional illustrations taken along respective section lines h - h , i - i , j - j and k - k in fig3 a . as seen in fig3 a - 3k , hammer 300 preferably includes a generally central hub portion 302 that defines a cylindrical sleeve portion 304 which is preferably sized to rotatably accommodate vertical hammer mounting shaft 196 . hub portion 302 also preferably defines a plurality of , typically four , spring mounting protrusions 306 . extending generally forwardly from hub portion 302 is a deflector mounting arm 308 from which extends a deflector 310 . deflector mounting arm 308 also preferably includes an attachment recess 312 and aperture 314 for optional mounting thereon of spray diffuser 212 . extending generally rearwardly from hub portion 302 is a balancing arm 316 . reference is now particularly made to deflector 310 and to fig3 e - 3k . it is a particular feature of the present invention that deflector 310 includes a first pressurized water stream engagement surface 320 , which receives a water stream from the forward nozzle 190 , and a second pressurized water stream engagement surface 322 , downstream of the first pressurized water stream engagement surface 320 , wherein the first pressurized water stream engagement surface 320 has a pressurized water stream channeling configuration arranged : to direct a first portion of the pressurized water stream impinging on the first pressurized water stream engagement surface 320 , which does not exceed a predetermined water stream quantity , onto the second pressurized water stream engagement surface 322 , and to direct at least a second portion of the pressurized water stream impinging on the first pressurized water stream engagement surface 320 , which second portion exceeds the predetermined water stream quantity , not onto the second pressurized water stream engagement surface 322 . preferably , the second pressurized water stream engagement surface 322 has at least one , and typically two , water stream bypass apertures 324 formed therein and the first pressurized water stream engagement surface 320 is arranged to direct at least a second portion of the pressurized water stream impinging on the first pressurized water stream engagement surface 320 through the water stream bypass aperture or apertures 324 . it is also a particular feature of the present invention that the first pressurized water stream engagement surface 320 is preferably formed with two mutually spaced generally parallel upstanding vanes 330 , having parallel mutually facing surfaces and non parallel opposite surfaces , which divide surface 320 into preferably three water engagement sub - surfaces 332 , 334 and 336 . in the illustrated embodiment , the width of each of water engagement sub - surfaces 332 , 334 and 336 is generally identical , however , alternatively , the individual sub - surfaces 332 , 334 and 336 may have different widths . alternatively , the number of vanes 330 provided may be more or less than two . preferably vanes 330 have a generally truncated triangular cross section and have increased thickness from a stream incoming edge 340 of first pressurized water stream engagement surface 320 to a stream exiting edge 342 of the first pressurized water stream engagement surface 320 . preferably vanes 330 each have a tapered stream facing edge 344 . first water stream engagement surface 320 is preferably generally flat except for a short tapered portion adjacent incoming edge 340 . both the first and second water stream engagement surfaces 320 and 322 are defined by side walls 350 and 352 , which join first and second water stream engagement surfaces 320 and 322 and define an open space therebetween . it is a further particular feature of the present invention that the second pressurized water stream engagement surface 322 is preferably formed with two mutually spaced generally parallel upstanding vanes 360 which divide surface 322 into preferably three water engagement sub - surfaces 362 , 364 and 366 . in the illustrated embodiment , the width of each of water engagement sub - surfaces 362 , 364 and 366 is generally identical , however , alternatively , the individual sub - surfaces 362 , 364 and 366 may have different widths . alternatively , the number of vanes 360 provided may be more or less than two . preferably vanes 360 have a generally uniform thickness from a stream incoming edge 370 of second pressurized water stream engagement surface 322 to a stream exiting edge 372 of the second pressurized water stream engagement surface 322 . preferably vanes 360 each have a tapered stream facing edge 374 . second water stream engagement surface 322 is preferably generally curved , faces generally oppositely to first water stream engagement surface 320 and includes a generally flat portion 376 adjacent incoming edge 370 , which extends into a generally curved portion 378 , adjacent stream exiting edge 372 . it is an additional particular feature of the present invention that preferably water engagement sub - surfaces 362 and 366 , on opposite sides of water engagement sub - surface 364 , are formed with apertures extending nearly all along generally curved portion 378 and preferably along a downstream part of flat portion 376 . reference is now made to fig4 a and 4b , which are simplified side view illustrations of a hammer element 400 forming part of the sprinkler of fig1 a - 2b , fig4 a & amp ; 4b being mutually rotated by 180 degrees , and to fig4 c and 4d , which are simplified isometric illustrations of the hammer element of fig4 a and 4b , taken from two different viewpoints . reference is also made to fig4 e , 4f and 4g , which are simplified sectional illustrations taken along respective section lines e - e , f - f and g - g in fig4 a , and to fig4 h , 4i , 4j and 4k , which are simplified sectional illustrations taken along respective section lines h - h , i - i , j - j and k - k in fig4 a . as seen in fig4 a - 4k , hammer 400 preferably includes a generally central hub portion 402 that defines a cylindrical sleeve portion 404 which is preferably sized to rotatably accommodate vertical hammer mounting shaft 196 . hub portion 402 also preferably defines a plurality of , typically four , spring mounting protrusions 406 . extending generally forwardly from hub portion 402 is a deflector mounting arm 408 from which extends a deflector 410 . deflector mounting arm 408 also preferably includes an attachment recess 412 and aperture 414 for optional mounting thereon of spray diffuser 212 . extending generally rearwardly from hub portion 402 is a balancing arm 416 . reference is now particularly made to deflector 410 and to fig4 e - 4k . it is a particular feature of the present invention that deflector 410 includes a first pressurized water stream engagement surface 420 , which receives a water stream from the forward nozzle 190 , and a second pressurized water stream engagement surface 422 , downstream of the first pressurized water stream engagement surface 420 , wherein the first pressurized water stream engagement surface 420 has a pressurized water stream channeling configuration arranged : to direct a first portion of the pressurized water stream impinging on the first pressurized water stream 420 , which does not exceed a predetermined water stream quantity , onto the second pressurized water stream engagement surface 422 , and to direct at least a second portion of the pressurized water stream impinging on the first pressurized water stream engagement surface 420 , which second portion exceeds the predetermined water stream quantity , not onto the second pressurized water stream engagement surface 422 . preferably , the second pressurized water stream engagement surface 422 has at least one , and typically two , water stream bypass apertures 424 formed therein and the first pressurized water stream engagement surface 420 is arranged to direct at least a second portion of the pressurized water stream impinging on the first pressurized water stream engagement surface 420 through the water stream bypass aperture or apertures 424 . it is also a particular feature of the present invention that the first pressurized water stream engagement surface 420 is preferably formed with two mutually spaced generally parallel upstanding vanes 430 , having parallel mutually facing surfaces and non parallel opposite surfaces , which divide surface 420 into preferably three water engagement sub - surfaces 432 , 434 and 436 . in the illustrated embodiment , the width of each of water engagement sub - surfaces 432 , 434 and 436 is generally identical , however , alternatively , the individual sub - surfaces 432 , 434 and 436 may have different widths . alternatively , the number of vanes 430 provided may be more or less than two . preferably vanes 430 have a generally truncated triangular cross section and have increased thickness from a stream incoming edge 440 of first pressurized water stream engagement surface 420 to a stream exiting edge 442 of the first pressurized water stream engagement surface 420 . preferably vanes 430 each have a tapered stream facing edge 444 . first water stream engagement surface 420 is preferably generally flat except for a short tapered portion adjacent incoming edge 440 . both the first and second water stream engagement surfaces 420 and 422 are defined by side walls 450 and 452 , which join first and second water stream engagement surfaces 420 and 422 and define an open space therebetween . it is a further particular feature of the present invention that the second pressurized water stream engagement surface 422 is preferably formed with two mutually spaced generally parallel upstanding vanes 460 which divide surface 422 into preferably three water engagement sub - surfaces 462 , 464 and 466 . in the illustrated embodiment , the width of each of water engagement sub - surfaces 462 , 464 and 466 is generally identical , however , alternatively , the individual sub - surfaces 462 , 464 and 466 may have different widths . alternatively , the number of vanes 460 provided may be more or less than two . preferably vanes 460 have a generally uniform thickness therealong from a stream incoming edge 470 of second pressurized water stream engagement surface 422 . preferably vanes 460 each have a tapered stream facing edge 471 . second water stream engagement surface 422 is preferably generally curved , faces generally oppositely to first water stream engagement surface 420 and includes a generally flat portion 472 adjacent incoming edge 470 . only water engagement sub - surface 464 extends into a generally curved portion 474 . thus it is appreciated that , as distinct from the embodiment described hereinabove with reference to fig3 a - 3k , in the embodiment of fig4 a - 4k , the water engagement sub - surfaces 462 and 466 have respective stream exiting edges 476 and 478 , which are relatively close to and downstream of stream incoming edge 470 and water engagement sub - surface 464 has a stream exiting edge 480 which is much further downstream thereof . reference is now made to fig5 a and 5b , which are simplified side view illustrations of a hammer element 500 forming part of the sprinkler of fig1 a - 2b , fig5 a & amp ; 5b being mutually rotated by 180 degrees , and to fig5 c and 5d , which are simplified isometric illustrations of the hammer element of fig5 a and 5b , taken from two different viewpoints . reference is also made to fig5 e , 5f and 5g , which are simplified sectional illustrations taken along respective section lines e - e , f - f and g - g in fig5 a , and to fig5 h , 5i , 5j and 5k , which are simplified sectional illustrations taken along respective section lines h - h , i - i , j - j and k - k in fig5 a . as seen in fig5 a - 5k , hammer 500 preferably includes a generally central hub portion 502 that defines a cylindrical sleeve portion 504 which is preferably sized to rotatably accommodate vertical hammer mounting shaft 196 . hub portion 502 also preferably defines a plurality of , typically four , spring mounting protrusions 506 . extending generally forwardly from hub portion 502 is a deflector mounting arm 508 from which extends a deflector 510 . deflector mounting arm 508 also preferably includes an attachment recess 512 and aperture 514 for optional mounting thereon of spray diffuser 212 . extending generally rearwardly from hub portion 502 is a balancing arm 516 . reference is now particularly made to deflector 510 and to fig5 e - 5k . it is a particular feature of the present invention that deflector 510 includes a first pressurized water stream engagement surface 520 , which receives a water stream from the forward nozzle 190 , and a second pressurized water stream engagement surface 522 , downstream of the first pressurized water stream engagement surface 520 , wherein the first pressurized water stream engagement surface 520 has a pressurized water stream channeling configuration arranged : to direct a first portion of the pressurized water stream impinging on the first pressurized water stream engagement surface 520 , which does not exceed a predetermined water stream quantity , onto the second pressurized water stream engagement surface 522 , and to direct at least a second portion of the pressurized water stream impinging on the first pressurized water stream engagement surface 520 , which second portion exceeds the predetermined water stream quantity , not onto the second pressurized water stream engagement surface 522 . preferably , the second pressurized water stream engagement surface 522 has at least one , and typically two , water stream bypass apertures 524 formed therein and the first pressurized water stream engagement surface 520 is arranged to direct at least a second portion of the pressurized water stream impinging on the first pressurized water stream engagement surface 520 through the water stream bypass aperture or apertures 524 . it is also a particular feature of the present invention that the first pressurized water stream engagement surface 520 is preferably formed with two mutually spaced generally parallel upstanding vanes 530 , having parallel mutually facing surfaces and non parallel opposite surfaces , which divide surface 520 into preferably three water engagement sub - surfaces 532 , 534 and 536 . in the illustrated embodiment , the width of each of water engagement sub - surfaces 532 , 534 and 536 is generally identical , however , alternatively , the individual sub - surfaces 532 , 534 and 536 may have different widths . alternatively , the number of vanes 530 provided may be more or less than two . preferably vanes 530 have a generally triangular cross section and have increased thickness from a stream incoming edge 540 of first pressurized water stream engagement surface 520 to a stream exiting edge 542 of the first pressurized water stream engagement surface 520 . preferably vanes 530 each have a tapered stream facing edge 544 . first water stream engagement surface 520 is preferably generally flat except for a short tapered portion adjacent incoming edge 540 . both the first and second water stream engagement surfaces 520 and 522 are defined by side walls 550 and 552 , which join first and second water stream engagement surfaces 520 and 522 and define an open space therebetween . it is a further particular feature of the present invention that the second pressurized water stream engagement surface 522 is preferably formed with two mutually spaced generally parallel upstanding vanes 560 which divide surface 522 into preferably three water engagement sub - surfaces 562 , 564 and 566 . in the illustrated embodiment , the width of each of water engagement sub - surfaces 562 , 564 and 566 is generally identical , however , alternatively , the individual sub - surfaces 562 , 564 and 566 may have different widths . alternatively , the number of vanes 560 provided may be more or less than two . preferably vanes 560 have a generally uniform thickness from a stream incoming edge 570 of second pressurized water stream engagement surface 522 to a stream exiting edge 572 of the second pressurized water stream engagement surface 522 . preferably vanes 560 each have a tapered stream facing edge 574 . second water stream engagement surface 522 is preferably generally curved , faces generally oppositely to first water stream engagement surface 520 and includes a generally flat portion 576 adjacent incoming edge 570 , which extends into a generally curved portion 578 , adjacent stream exiting edge 572 . it is an additional particular feature of the present invention that preferably water engagement sub - surfaces 562 and 566 , on opposite sides of water engagement sub - surface 564 , are formed with apertures extending nearly all along generally curved portion 578 and preferably along a downstream part of flat portion 576 . reference is now made to fig6 a and 6b , which are simplified side view illustrations of a hammer element 600 forming part of the sprinkler of fig1 a - 2b , fig6 a & amp ; 6b being mutually rotated by 180 degrees , and to fig6 c and 6d , which are simplified isometric illustrations of the hammer element of fig6 a and 6b , taken from two different viewpoints . reference is also made to fig6 e , 6f and 6g , which are simplified sectional illustrations taken along respective section lines e - e , f - f and g - g in fig6 a , and to fig6 h , 6i , 6j and 6k , which are simplified sectional illustrations taken along respective section lines h - h , i - i , j - j and k - k in fig6 a . as seen in fig6 a - 6k , hammer 600 preferably includes a generally central hub portion 602 that defines a cylindrical sleeve portion 604 which is preferably sized to rotatably accommodate vertical hammer mounting shaft 196 . hub portion 602 also preferably defines a plurality of , typically four , spring mounting protrusions 606 . extending generally forwardly from hub portion 602 is a deflector mounting arm 608 from which extends a deflector 610 . deflector mounting arm 608 also preferably includes an attachment recess 612 and aperture 614 for optional mounting thereon of spray diffuser 212 . extending generally rearwardly from hub portion 602 is a balancing arm 616 . reference is now particularly made to deflector 610 and to fig6 e - 6k . it is a particular feature of the present invention that deflector 610 includes a first pressurized water stream engagement surface 620 , which receives a water stream from the forward nozzle 190 , and a second pressurized water stream engagement surface 622 , downstream of the first pressurized water stream engagement surface 620 , wherein the first pressurized water stream engagement surface 620 has a pressurized water stream channeling configuration arranged : to direct a first portion of the pressurized water stream impinging on the first pressurized water stream engagement surface 620 , which does not exceed a predetermined water stream quantity , onto the second pressurized water stream engagement surface 622 , and to direct at least a second portion of the pressurized water stream impinging on the first pressurized water stream engagement surface 620 , which second portion exceeds the predetermined water stream quantity , not onto the second pressurized water stream engagement surface 622 . preferably , the second pressurized water stream engagement surface 622 has at least one , and typically two , water stream bypass apertures 624 formed therein and the first pressurized water stream engagement surface 620 is arranged to direct at least a second portion of the pressurized water stream impinging on the first pressurized water stream engagement surface 620 through the water stream bypass aperture or apertures 624 . it is also a particular feature of the present invention that the first pressurized water stream engagement surface 620 is preferably formed with two mutually spaced generally parallel upstanding vanes 630 , having parallel mutually facing surfaces and non parallel opposite surfaces , which divide surface 620 into preferably three water engagement sub - surfaces 632 , 634 and 636 . in the illustrated embodiment , the width of each of water engagement sub - surfaces 632 , 634 and 636 is generally identical , however , alternatively , the individual sub - surfaces 632 , 634 and 636 may have different widths . alternatively , the number of vanes 630 provided may be more or less than two . in this embodiment , vanes 630 are joined by an integrally formed top plate 638 , thereby defining a water flow channel 639 between vanes 630 and top plate 638 . preferably vanes 630 have a generally truncated triangular cross section and have increased thickness from a stream incoming edge 640 of first pressurized water stream engagement surface 620 to a stream exiting edge 642 of the first pressurized water stream engagement surface 620 . preferably vanes 630 each have a tapered stream facing edge 644 . first water stream engagement surface 620 is preferably generally flat except for a short tapered portion adjacent incoming edge 640 . both the first and second water stream engagement surfaces 620 and 622 are defined by side walls 650 and 652 , which join first and second water stream engagement surfaces 620 and 622 and define an open space therebetween . it is a further particular feature of the present invention that the second pressurized water stream engagement surface 622 is preferably formed with two mutually spaced generally parallel upstanding vanes 660 which divide surface 622 into preferably three water engagement sub - surfaces 662 , 664 and 666 . in the illustrated embodiment , the width of each of water engagement sub - surfaces 662 , 664 and 666 is generally identical , however , alternatively , the individual sub - surfaces 662 , 664 and 666 may have different widths . alternatively , the number of vanes 660 provided may be more or less than two . preferably vanes 660 have a generally uniform thickness from a stream incoming edge 670 of second pressurized water stream engagement surface 622 to a stream exiting edge 672 of the second pressurized water stream engagement surface 622 . preferably vanes 660 each have a tapered stream facing edge 674 . second water stream engagement surface 622 is preferably generally curved , faces generally oppositely to first water stream engagement surface 620 and includes a generally flat portion 676 adjacent incoming edge 670 , which extend into a generally curved portion 678 , adjacent stream exiting edge 672 . it is an additional particular feature of the present invention that preferably water engagement sub - surfaces 662 and 666 , on opposite sides of water engagement sub - surface 664 , are formed with apertures extending nearly all along generally curved portion 678 and preferably along a downstream part of flat portion 676 . reference is now made to fig7 a and 7b , which are simplified side view illustrations of a hammer element 700 forming part of the sprinkler of fig1 a - 2b , fig7 a & amp ; 7b being mutually rotated by 180 degrees , and to fig7 c and 7d , which are simplified isometric illustrations of the hammer element of fig7 a and 7b , taken from two different viewpoints . reference is also made to fig7 e , 7f and 7g , which are simplified sectional illustrations taken along respective section lines e - e , f - f and g - g in fig7 a , and to fig7 h , 7i , 7j and 7k , which are simplified sectional illustrations taken along respective section lines h - h , i - i , j - j and k - k in fig7 a . as seen in fig7 a - 7k , hammer 700 preferably includes a generally central hub portion 702 that defines a cylindrical sleeve portion 704 which is preferably sized to rotatably accommodate vertical hammer mounting shaft 196 . hub portion 702 also preferably defines a plurality of , typically four , spring mounting protrusions 706 . extending generally forwardly from hub portion 702 is a deflector mounting arm 708 from which extends a deflector 710 . deflector mounting arm 708 also preferably includes an attachment recess 712 and aperture 714 for optional mounting thereon of spray diffuser 212 . extending generally rearwardly from hub portion 702 is a balancing arm 716 . reference is now particularly made to deflector 710 and to fig7 e - 7k . it is a particular feature of the present invention that deflector 710 includes a first pressurized water stream engagement surface 720 , which receives a water stream from the forward nozzle 190 , and a second pressurized water stream engagement surface 722 , downstream of the first pressurized water stream engagement surface 720 , wherein the first pressurized water stream engagement surface 720 has a pressurized water stream channeling configuration arranged : to direct a first portion of the pressurized water stream impinging on the first pressurized water stream engagement surface 720 , which does not exceed a predetermined water stream quantity , onto the second pressurized water stream engagement surface 722 , and to direct at least a second portion of the pressurized water stream impinging on the first pressurized water stream engagement surface 720 , which second portion exceeds the predetermined water stream quantity , not onto the second pressurized water stream engagement surface 722 . preferably , the second pressurized water stream engagement surface 722 has at least one , and typically two , water stream bypass apertures 724 formed therein and the first pressurized water stream engagement surface 720 is arranged to direct at least a second portion of the pressurized water stream impinging on the first pressurized water stream engagement surface 720 through the water stream bypass aperture or apertures 724 . it is also a particular feature of the present invention that the first pressurized water stream engagement surface 720 is preferably formed with a central , generally arched water flow channel 726 defined by an elongate arch 728 joining two , mutually spaced generally parallel upstanding vanes 730 , which divide surface 720 into preferably three water engagement sub - surfaces 732 , 734 and 736 . in the illustrated embodiment , the width of each of water engagement sub - surfaces 732 , 734 and 736 is generally identical , however , alternatively , the individual sub - surfaces 732 , 734 and 736 may have different widths . alternatively , the number of vanes 730 provided may be more or less than two . preferably vanes 730 have increased thickness from a stream incoming edge 740 of first pressurized water stream engagement surface 720 to a stream exiting edge 742 of the first pressurized water stream engagement surface 720 . preferably vanes 730 each have a tapered stream facing edge 744 . first water stream engagement surface 720 is preferably generally flat except for a short tapered portion adjacent incoming edge 740 . both the first and second water stream engagement surfaces 720 and 722 are defined by side walls 750 and 752 , which join first and second water stream engagement surfaces 720 and 722 and define an open space therebetween . it is a further particular feature of the present invention that the second pressurized water stream engagement surface 722 is preferably formed with two mutually spaced generally parallel upstanding vanes 760 which divide surface 722 into preferably three water engagement sub - surfaces 762 , 764 and 766 . in the illustrated embodiment , the width of each of water engagement sub - surfaces 762 , 764 and 766 is generally identical , however , alternatively , the individual sub - surfaces 762 , 764 and 766 may have different widths . alternatively , the number of vanes 760 provided may be more or less than two . preferably vanes 760 have a generally uniform thickness from a stream incoming edge 770 of second pressurized water stream engagement surface 722 to a stream exiting edge 772 of the second pressurized water stream engagement surface 722 . preferably vanes 760 each have a tapered stream facing edge 774 . second water stream engagement surface 722 is preferably generally curved , faces generally oppositely to first water stream engagement surface 720 and includes a generally flat portion 776 adjacent incoming edge 770 , which extends into a generally curved portion 778 , adjacent stream exiting edge 772 . it is an additional particular feature of the present invention that preferably water engagement sub - surfaces 762 and 766 , on opposite sides of water engagement sub - surface 764 , are formed with apertures extending nearly all along generally curved portion 778 and preferably along a downstream part of flat portion 776 . reference is now made to fig8 a and 8b , which are simplified side view illustrations of a hammer element 800 forming part of the sprinkler of fig1 a - 2b , fig8 a & amp ; 8b being mutually rotated by 180 degrees , and to fig8 c and 8d , which are simplified isometric illustrations of the hammer element of fig8 a and 8b , taken from two different viewpoints . reference is also made to fig8 e , 8f and 8g , which are simplified sectional illustrations taken along respective section lines e - e , f - f and g - g in fig8 a , and to fig8 h , 8i , 8j and 8k , which are simplified sectional illustrations taken along respective section lines h - h , i - i , j - j and k - k in fig8 a . as seen in fig8 a - 8k , hammer 800 preferably includes a generally central hub portion 802 that defines a cylindrical sleeve portion 804 which is preferably sized to rotatably accommodate vertical hammer mounting shaft 196 . hub portion 802 also preferably defines a plurality of , typically four , spring mounting protrusions 806 . extending generally forwardly from hub portion 802 is a deflector mounting arm 808 from which extends a deflector 810 . deflector mounting arm 808 also preferably includes an attachment recess 812 and aperture 814 for optional mounting thereon of spray diffuser 212 . extending generally rearwardly from hub portion 802 is a balancing arm 816 . reference is now particularly made to deflector 810 and to fig8 e - 8k . it is a particular feature of the present invention that deflector 810 includes a first pressurized water stream engagement surface 820 , which receives a water stream from the forward nozzle 190 , and a second pressurized water stream engagement surface 822 , downstream of the first pressurized water stream engagement surface 820 , wherein the first pressurized water stream engagement surface 820 has a pressurized water stream channeling configuration arranged : to direct a first portion of the pressurized water stream impinging on the first pressurized water stream engagement surface 820 , which does not exceed a predetermined water stream quantity , onto the second pressurized water stream engagement surface 822 , and to direct at least a second portion of the pressurized water stream impinging on the first pressurized water stream engagement surface 820 , which second portion exceeds the predetermined water stream quantity , not onto the second pressurized water stream engagement surface 822 . preferably , the second pressurized water stream engagement surface 822 has at least one , and typically two , water stream bypass apertures 824 formed therein and the first pressurized water stream engagement surface 820 is arranged to direct at least a second portion of the pressurized water stream impinging on the first pressurized water stream engagement surface 820 through the water stream bypass aperture or apertures 824 . it is also a particular feature of the present invention that the first pressurized water stream engagement surface 820 is preferably formed with a central water flow channel 826 of generally triangular cross section defined by two mutually inclined generally parallel - extending upstanding vanes 830 , which divide surface 820 into preferably three water engagement sub - surfaces 832 , 834 and 836 . in the illustrated embodiment , the width of each of water engagement sub - surfaces 832 , 834 and 836 is generally identical , however , alternatively , the individual sub - surfaces 832 , 834 and 836 may have different widths . alternatively , the number of vanes 830 provided may be more or less than two . preferably vanes 830 have increased thickness from a stream incoming edge 840 of first pressurized water stream engagement surface 820 to a stream exiting edge 842 of the first pressurized water stream engagement surface 820 . preferably vanes 830 each have a tapered stream facing edge 844 . first water stream engagement surface 820 is preferably generally flat except for a short tapered portion adjacent incoming edge 840 . both the first and second water stream engagement surfaces 820 and 822 are defined by side walls 850 and 852 , which join first and second water stream engagement surfaces 820 and 822 and define an open space therebetween . it is a further particular feature of the present invention that the second pressurized water stream engagement surface 822 is preferably formed with two mutually spaced generally parallel upstanding vanes 860 which divide surface 822 into preferably three water engagement sub - surfaces 862 , 864 and 866 . in the illustrated embodiment , the width of each of water engagement sub - surfaces 862 , 864 and 866 is generally identical , however , alternatively , the individual sub - surfaces 862 , 864 and 866 may have different widths . alternatively , the number of vanes 860 provided may be more or less than two . preferably vanes 860 have a generally uniform thickness from a stream incoming edge 870 of second pressurized water stream engagement surface 822 to a stream exiting edge 872 of the second pressurized water stream engagement surface 822 . preferably vanes 860 each have a tapered stream facing edge 874 . second water stream engagement surface 822 is preferably generally curved , faces generally oppositely to first water stream engagement surface 820 and includes a generally flat portion 876 adjacent incoming edge 870 , which extend into a generally curved portion 878 , adjacent stream exiting edge 872 . it is an additional particular feature of the present invention that preferably water engagement sub - surfaces 862 and 866 , on opposite sides of water engagement sub - surface 864 , are formed with apertures extending nearly all along generally curved portion 878 and preferably along a downstream part of flat portion 876 . reference is now made to fig9 a and 9b , which are simplified side view illustrations of a hammer element 900 forming part of the sprinkler of fig1 a - 2b , fig9 a & amp ; 9b being mutually rotated by 180 degrees , and to fig9 c and 9d , which are simplified isometric illustrations of the hammer element of fig9 a and 9b , taken from two different viewpoints . reference is also made to fig9 e , 9f and 9g , which are simplified sectional illustrations taken along respective section lines e - e , f - f and g - g in fig9 a , and to fig9 h , 9i , 9j and 9k , which are simplified sectional illustrations taken along respective section lines h - h , i - i , j - j and k - k in fig9 a . as seen in fig9 a - 9k , hammer 900 preferably includes a generally central hub portion 902 that defines a cylindrical sleeve portion 904 which is preferably sized to rotatably accommodate vertical hammer mounting shaft 196 . hub portion 902 also preferably defines a plurality of , typically four , spring mounting protrusions 906 . extending generally forwardly from hub portion 902 is a deflector mounting arm 908 from which extends a deflector 910 . deflector mounting arm 908 also preferably includes an attachment recess 912 and aperture 914 for optional mounting thereon of spray diffuser 212 . extending generally rearwardly from hub portion 902 is a balancing arm 916 . reference is now particularly made to deflector 910 and to fig9 e - 9k . it is a particular feature of the present invention that deflector 910 includes a first pressurized water stream engagement surface 920 , which receives a water stream from the forward nozzle 190 , and a second pressurized water stream engagement surface 922 , downstream of the first pressurized water stream engagement surface 920 , wherein the first pressurized water stream engagement surface 920 has a pressurized water stream channeling configuration arranged : to direct a first portion of the pressurized water stream impinging on the first pressurized water stream engagement surface 920 , which does not exceed a predetermined water stream quantity , onto the second pressurized water stream engagement surface 922 , and to direct at least a second portion of the pressurized water stream impinging on the first pressurized water stream engagement surface 920 , which second portion exceeds the predetermined water stream quantity , not onto the second pressurized water stream engagement surface 922 . preferably , the second pressurized water stream engagement surface 922 has at least one , and typically two , water stream bypass apertures 924 formed therein and the first pressurized water stream engagement surface 920 is arranged to direct at least a second portion of the pressurized water stream impinging on the first pressurized water stream engagement surface 920 through the water stream bypass aperture or apertures 924 . it is also a particular feature of the present invention that the first pressurized water stream engagement surface 920 is preferably formed with two , mutually spaced generally parallel upstanding vanes 930 , having parallel mutually facing surfaces and non parallel opposite surfaces , which divide surface 920 into preferably three water engagement sub - surfaces 932 , 934 and 936 . in the illustrated embodiment , the width of each of water engagement sub - surfaces 932 , 934 and 936 is generally identical , however , alternatively , the individual sub - surfaces 932 , 934 and 936 may have different widths . alternatively , the number of vanes 930 provided may be more or less than two . preferably vanes 930 have a generally truncated triangular cross section and have increased thickness from a stream incoming edge 940 of first pressurized water stream engagement surface 920 to a stream exiting edge 942 of the first pressurized water stream engagement surface 920 . preferably vanes 930 each have a tapered stream facing edge 944 . first water stream engagement surface 920 is preferably generally flat except for a short tapered portion adjacent incoming edge 940 . both the first and second water stream engagement surfaces 920 and 922 are defined by side walls 950 and 952 , which join first and second water stream engagement surfaces 920 and 922 and define an open space therebetween . it is a further particular feature of the present invention that the second pressurized water stream engagement surface 922 is preferably formed with two mutually spaced generally parallel upstanding vanes 960 which divide surface 922 into preferably three water engagement sub - surfaces 962 , 964 and 966 . it is a particular feature of the embodiment of fig9 a - 9k , that vanes 960 are formed as continuations of vanes 930 , such that vanes 930 of the first pressurized water stream engagement surface 920 , vanes 960 of the second pressurized water stream engagement surface 922 and intermediate vanes 968 , each joining a vane 930 with a vane 960 , together define continuous vanes 969 , spanning both first and second pressurized water stream engagement surfaces 920 and 922 . in the illustrated embodiment , the width of each of water engagement sub - surfaces 962 , 964 and 966 is generally identical , however , alternatively , the individual sub - surfaces 962 , 964 and 966 may have different widths . alternatively , the number of vanes 960 provided may be more or less than two . preferably vanes 960 have a generally uniform thickness from a stream incoming edge 970 of second pressurized water stream engagement surface 922 to a stream exiting edge 972 of the second pressurized water stream engagement surface 922 . second water stream engagement surface 922 is preferably generally curved , faces generally oppositely to first water stream engagement surface 920 and includes a generally flat portion 976 adjacent incoming edge 970 , which extend into a generally curved portion 978 , adjacent stream exiting edge 972 . it is an additional particular feature of the present invention that preferably water engagement sub - surfaces 962 and 966 , on opposite sides of water engagement sub - surface 964 , are formed with apertures extending nearly all along generally curved portion 978 and preferably along a downstream part of flat portion 976 . reference is now made to fig1 a , 10b & amp ; 10c , which are respective simplified front view , top view and back view illustrations of the sprinkler of fig1 a - 3d , showing water flows therethrough when a relatively small nozzle is employed , and to fig1 d , which is a simplified sectional illustration taken along lines d - d in fig1 a . as seen in fig1 a - 10d , in the illustrated embodiment , when a relatively small forward nozzle is employed , such as a nozzle 190 having an internal diameter of 2 mm , nearly all of the water stream emanating from nozzle 190 , here designated by reference numeral 1000 , is confined between vanes 330 of first water stream engagement surface 320 in engagement with first water engagement sub - surface 334 , as designated by reference numeral 1002 . nearly all of the water stream then impinges on second water engagement sub - surface 364 , and is confined between vanes 360 of the second water stream engagement surface 322 , as designated by reference numeral 1004 . nearly all of the water stream as designated by reference numeral 1006 exits in a direction indicated by an arrow 1008 . accordingly , nearly all of the water stream applies a rotational force , indicated by an arrow 1010 , to hammer 300 , causing it to rotate about vertical axis 154 . reference is now made to fig1 a , 11b & amp ; 11c , which are respective simplified front view , top view and back view illustrations of the sprinkler of fig1 a - 3d , showing water flows therethrough when a relatively large nozzle is employed , to fig1 d , which is a simplified sectional illustration taken along lines d - d in fig1 a , and to fig1 e , which is a simplified sectional illustration taken along lines e - e in fig1 a . as seen in fig1 a - 11e , in the illustrated embodiment , when a relatively large forward nozzle is employed , such as a nozzle 190 having an internal diameter of 5 mm , a water stream 1100 emanates from nozzle 190 . in accordance with a preferred embodiment of the present invention , only part of water stream 1100 , here designated by reference numeral 1102 , is confined between vanes 330 of first water stream engagement surface 320 in engagement with first water engagement sub - surface 334 . two side water streams , respectively designated by reference numerals 1104 and 1106 , flow outside vanes 330 in engagement with respective first water engagement sub - surfaces 332 and 336 . nearly all of the water stream 1102 impinges on second water engagement sub - surface 364 , and is confined between vanes 360 of the second water stream engagement surface 322 , as designated by reference numeral 1110 . nearly all of the water stream 1110 exits , as designated by reference numeral 1112 , in a direction indicated by an arrow 1114 . accordingly , nearly all of the water stream 1112 applies a rotational force , indicated by an arrow 1116 , to hammer 300 , causing it to rotate about vertical axis 154 . the two side water streams 1104 and 1106 generally do not impinge on the second water engagement surface 364 but rather exit , as respectively designated by reference numerals 1124 and 1126 , through apertures 324 in directions respectively indicated by arrows 1134 and 1136 . the side water streams generally do not apply a rotational force to hammer 300 . it is a particular feature of an embodiment of the present invention that , as appreciated from a comparison of fig1 a - 10d with fig1 a - 11e , it is seen that the proportion of the water stream output from the forward nozzle , which applies a rotational force to hammer 300 varies as a function of the size of the forward nozzle and thus of the discharge volume of the nozzle . it will be appreciated by persons skilled in the art that the present invention is not limited to what has been particularly shown and described hereinabove . rather the scope of the invention includes both combinations and subcombinations of the various features described hereinabove as well as modifications and variations thereof which would occur to persons skilled in the art upon reading the foregoing description and which are not in the prior art .
| 1 |
the preferred embodiments of the present invention will be described below by referring to the attached drawings . in fig1 an sbms is software relating to a software battery management system , and a site access tool sat charges a battery from a host machine hm in cooperation with the system on a user machine pc storing the software . the sat is a site access tool , and provides a user with the information about the host machine hm to be connected to using , for example , a portable storage medium cd ( compact disk ), an md ( minidisk ), a fdd ( floppy disk ), or semiconductor memory , etc . otherwise , when software is provided from the site in the communications , the information about the host machine hm can be received together with application software through a communications medium , or only the software can be received . a battery supply module bsm is incorporated into a host machine hm to provide a user - selected battery at a predetermined position by the amount specified by the user . the predetermined position is set in the user machine pc , or in the memory of the server . the host machine hm and the user machine pc are connected to network or a internet net . [ 0031 ] fig1 is a block diagram of the present invention . in fig1 a reference characters pc denote a computer of the user machine , and comprises : a processing unit cpu for performing a process procedure ( performed by the software of a site access tool and a software battery management system ) described later and shown in fig3 ; an input unit in for inputting information ; an output unit out for outputting information ; a storage unit mem 1 for storing the software of the site access tool executed by the processing unit cpu ; a storage unit mem 2 for storing the software of a software battery management system executed by the processing unit cpu ; a battery bu of storage means ( for example , a floppy , semiconductor memory , a hard disk , etc .) for storing data ( an application id , a battery id , and a predetermined value for operation of application software ) for control of the operation of the application software ; a storage unit mem 3 for storing application software ; a drive unit pdu for reading data from and writing data to a removable storage unit ; and a communications line unit com 1 for connection to a network or internet net . then , a removable storage medium cd is installed , and the data is loaded from the storage medium cd to the computer pc . at least a setup application software and the operation software for control of the valid period of the application software are stored on the storage medium cd and installed to the computer pc . the operation software stored on the storage medium cd comprises a site access tool and a battery data structure list . when the operation software is setup in the user machine from the storage medium cd , the battery data structure list contains a predetermined value ( a value corresponding to , for example , several hours , relating to the predetermined application software as a trial process ) as an initial value , and the value of the above mentioned battery data structure list is decreased each time the application software to be managed by the operation software is used in the user machine . when the value decreases , a predetermined value of data transmitted from a communications line or an external storage medium is rewritten to the battery data structure list , thereby allowing the application software to be reused . the operation software contains the software management system and the site access tool . the reference characters hm denote a host machine . the host machine comprises : a processing unit cpu 2 for performing the process procedure ( process procedure by a program of the battery supply module bsm ) shown in fig4 ; a storage unit bmem for storing the software of the battery supply module executed by the processing unit cpu 2 ; a storage unit almem for storing the application list ; a storage unit blmem for storing a battery list ; a storage unit llmem for storing a log report ; and a communications line unit com 2 for connection to a network and internet . when the valid period of the application software is extended on the computer pc , the computer pc communicates with the host machine hm to extend the valid period by rewriting the above mentioned value . the application software list al , the battery list bl , and the battery supply history list bh are shown in fig2 . using the lists , the application software can be matched , and the battery unit price , etc . can be set for each piece of application software . ( 1 ) the step is performed by the site access tool sat of the user machine according to the address information about the information host machine hm . in the case of internet , it corresponds to an ip address and a url . the user machine pc is connected to the host machine hm through a network using the site access tool sat . ( 2 ) in the step performed by the battery supply module bsm of the host machine hm , listing information about available batteries is provided . the information is displayed as a list on the screen of the display device of the user machine . the user searches for a battery for a target application from the displayed list , and selects the corresponding portion on the list by clicking the mouse button , etc . ( 3 ) in addition , by operating the site access tool sat which receives the battery listing information , an inquiry is issued to the software battery management system sbms about whether or not each battery has already been managed , and batteries are displayed on the screen of the user machine pc with managed batteries distinguished from non - managed batteries . ( 4 ) according to the information obtained from the application list al and the battery list bl transmitted from the host machine hm , the user selects a desired battery and its amount from the displayed list by moving the cursor to select a target battery . the user also can input a value using an input device without using the cursor . ( 5 ) by operating the site access tool sat , the user - selected battery and its amount are transmitted to the battery supply module bsm . ( 6 ) based on the received battery and the amount , battery addition information is generated in the battery bu by the battery supply module bsm , and is transmitted to the site access tool sat . the generated information is stored as a log . ( 7 ) the battery addition information is received by the site access tool sat , and the site access tool sat passes the information to the software battery management system sbms . then , the information ( the value for control of the application operating time ) is written to the battery bu , and it is confirmed that the battery bu has been charged . ( 8 ) the confirmation information is transmitted by the site access tool sat to the battery supply module bsm . ( 9 ) the confirmation information is recorded in addition to the above mentioned log by the battery supply module bsm . ( 10 ) when a series of communications terminate , the site access tool sat terminates the communications with the host machine hm . it is obvious that , after a battery has been supplied , the value decreases each time an application is performed in the user machine pc , the operation management data of the battery bu has finally been exhausted , and the application software cannot be used . the above mentioned processes are described below furthermore in detail by referring to the sequence flow of the host machine hm shown in fig4 performed by each piece of software of the site access tool sat , the software battery management system , and the battery supply module bsm , and the control flow of the computer pc shown in fig3 . in step s 3001 , the process unit cpu 1 is connected to the host machine hm according to the ip address or the url . if it has been connected , then the processing unit cpu 1 receives a battery list bl and a key 1 list of the storage unit blmem from the host machine hm in s 3002 . then , in s 3003 , the processing unit cpu 1 inquires the existence of the value of the battery bu and the remainder of the software battery management system sbms , and recomposes the battery list bl . then , in s 3004 , the battery list bl recomposed by the processing unit cpu 1 is displayed on the display screen of the computer pc . then , in s 3005 , the processing unit cpu 1 operates the mouse and moves the cursor to select the battery bu and its amount from the battery list bl displayed on the display screen . then , in s 3006 , the processing unit cpu 1 determines whether or not cancellation is selected . if the process is continued , the processing unit cpu 1 transmits a battery issue request and a key to the host machine hm in s 3007 . in the next step s 2008 , the processing unit cpu 1 receives the battery addition information from the host machine hm . in step s 3009 , the processing unit cpu 1 transmits the battery addition information to the software battery management system , and charges the battery . in s 3010 , the processing unit cpu 1 receives charging confirmation information from the software battery management system sbms . in step s 3011 , the processing unit cpu 1 transmits the charging confirmation information together with the key 1 to the host machine hm . in step s 3012 , the processing unit cpu 1 receives a key 8 from the host machine hm . in step s 3013 , the processing unit cpu 1 combines the charging confirmation information with the keys 1 and 3 to display the result for confirmation of a user . in step s 3014 , the processing unit cpu 1 terminates the connection with the host machine hm . then , the function of the battery supply module bsm is described below by referring to the sequence shown in fig5 and based on fig4 . in step s 4001 , the processing unit cpu 2 waits for the connection from the user machine pc . in step s 4002 , the processing unit cpu 2 generates a key as a session number , and transmits the battery list and the key 1 to the user machine pc . in step s 4003 , the processing unit cpu 2 receives the amount of the battery , and the keys 1 and 2 from the user machine pc . in s 4004 , the processing unit cpu 2 makes a time - out check . if a time - out has not occurred , the processing unit cpu 2 determined in step s 4005 whether or not the correspondence between the keys 1 and 2 is correct . if yes , then the processing unit cpu 2 generates the battery addition information in step s 4006 , transmits it to the user machine pc , and stores it in the log ll of the storage unit llmem . in step s 4007 , the processing unit cpu 2 receives the charging confirmation information and the key 1 from the user machine pc . in step s 4008 , the processing unit cpu 2 determines whether or not a time - out has occurred . if not , it generates the key 3 according to the charging confirmation information in step s 4009 , and adds it to the log . in step s 4010 , the processing unit cpu 2 transmits the key 3 to the user machine pc . then , in step s 4011 , the processing unit cpu terminates the connection to the user machine pc . by the above mentioned connection , the battery is charged , and the application is performed . by performing the application , the charging process is performed again in the above mentioned process , thereby performing the application again . in the above mentioned example , the host corresponds one to one to the user machine . however , there can be a plurality of hosts . in this case , it is obvious that a host is to be specified according to the information in the site access tool . otherwise , the site information is downloaded and specified through internet . in the above mentioned example , application software is stored in a terminal unit , and the operation of the application software is managed by a battery . however , the effect can also be obtained by setting application software and a battery in a server of a network , and by using them at a terminal unit . that is , application software is used through a network , the use of the application software is controlled by a battery , and the value of the battery is supplemented when the value of the battery decreases . the information for use in charging a battery is not transmitted as a file , but communications are established through a program , thereby avoiding making copies in a simple operation by , for example , copying a file , supplied batteries can be distinguished between those already used by the user and those not used by the user , thereby not confusing the user during the operation , and since the confirmation information about the battery charge is recorded in the log , means for guaranteeing the charge of a user machine can be provided .
| 6 |
seasoned snack food products are produced with a tumbling bed device in accordance with the invention are coated with seasoning . in practice , snack food products , such as potato chips , corn chips , tortilla chips , puffed - extruded cornmeal , or the like , are seasoned prior to being packaged for sale to consumers . with the tumbling bed device made and used in accordance with the invention , seasoning applied to snack food products with a seasoning dispenser are tumbled on the tumbling bed device that can be modified depending on the snack products &# 39 ; parameters . [ 0021 ] fig2 shows a preferred embodiment of the invention of variable geometry seasoning tumbler 100 . a support base 110 has ascending support arm 120 for upper support roll 140 and ascending support arm 130 for lower support roll 142 . the support rolls 140 and 142 can comprise drum rollers or large diameter sprockets . these rolls 140 , 142 maybe retained by shafts ( not shown ) that are held cantilevered as shown by support arm 120 , 130 . alternatively , rolls 140 , 142 may be supported at the end , which is shown unattached in fig2 by another set of support arms ( not shown ). these rolls 140 , 142 support and retain belt 150 such that belt 150 has a catenary portion 152 and a taut portion 154 . the catenary portion 152 is slack to allow snack food product to be tumbled within this region . on belt 150 , flights 160 are provided along the surface in a transverse pattern for picking up snack food product being tumbled by tumbler 100 . while belt 150 is shown with flights 160 , alternative protrusions such as cleats may be used to aid in tumbling the snack food product . positioned beneath a portion of belt 150 is conveyor belt 170 for receiving tumbled snack food product from belt 150 . the variable geometry seasoning tumbler 100 can be made from conventional materials such as metal , plastic , and other materials . particularly , rolls 140 , 142 are generally comprised a durable material that can withstand the rotation and contact with belt 150 . likewise , belt 150 is generally comprised of a durable material capable of withstanding rotation and contact by rolls 140 , 142 and contact with snack food product that can have an elevated temperature above ambient . belt 150 is rotated by rolls 140 , 142 and is rotated in the direction towards upper roll 140 . rotation is provided through the rotation of lower roll 142 to create the slack portion of catenary portion 152 . lower roll 142 can be rotated by a drive mechanism supplied through ascending support arm 130 . by adjusting the speed of rolls 140 , 142 , the tumbling action , product residence time in the product tumbling bed ( region of tumbling ) of belt 150 , and the product tumbling bed depth . the effect of this rotation of belt 150 is shown in fig3 and 4 . tumbling of snack food product 190 occurs generally in the catenary portion 152 . seasoning 182 is supplied from a seasoning applicator 180 that is positioned above belt 150 so that seasoning 182 will fall onto snack food product 190 as it tumbles in catenary portion 152 . with tortilla chip seasoning , oil is applied to the surface of the chips to promote seasoning adhesion to the surface of the chips . therefore , oil application equipment ( not shown ) is generally located toward the entrance of seasoning tumblers . with the instant invention , the oil application equipment would be located about where tortilla chips would be introduced onto belt 150 . seasoning 182 is applied a shortly thereafter at a location further down belt 150 . this minimizes contamination of the seasoning application equipment with oil . the length of belt 150 wherein snack food product 190 is tumbled is optimally minimized to a length that includes the zones of application of oil , if utilized , and seasoning , and the space between the zones . in instances where no oil is applied , then the length would be minimized to optimally be no longer than about the zone of application for seasoning . minimizing the time that snack food product 190 is tumbled generally reduces the amount of snack food product breakage . the tumbling motion is exemplified in fig3 wherein snack food product 190 is tumbled in a product bed 162 with an elliptical path . this is similar to tumbling path that would occur in a conventional tumbling drum . snack food product 190 is supplied from snack food product supply 200 onto belt 150 . depending on the amount of tumbling time desired , the depositing position of snack food product onto belt 150 can be altered by adjusting the position of supply 200 . the depositing position is shown with arrow 202 and arrow 204 ( shown in phantom to show an alternative position on belt 150 ). in addition to the depositing position , tumbling time can be varied by adjusting the rotational speed of belt 150 , changing the inclination of the belt 150 , or by some combination thereof . in a preferred embodiment however , having the ability to introduce the product to the tumbling area of belt 150 farther along its length is desirable to adjust tumbling time independent of other factors to affect seasoning coverage . once deposited onto belt 150 at product entrance 156 , snack food products 190 are captured by flights 160 that protrude upward from belt 150 . the snack food product then travels upward towards roll 140 until snack food product 190 falls free from flights 160 due to the increasing slope of belt 150 as it travels upward toward roll 140 . snack food product 190 will then fall back down toward roll 142 and will be picked up again by more flights 160 rotating further down on belt 150 towards the product exit 158 on belt 150 . this process repeats until snack food product 190 reaches the exit on belt 150 . the result of this process is that the bed of tumbling snack food product is cradled and tumbled in the catenary portion 152 . after exiting belt 150 , seasoned snack food product 190 is then deposited onto belt 170 for transport to product packaging or additional processing . [ 0027 ] fig5 and 6 show different positions of rolls 140 , 142 to control the radius of curvature of the belt catenary and lateral inclination of the tumbling surface of belt 150 . the radius of the tumbling surface is increased from r 1 to r 2 as shown in fig5 by moving roll 140 backward away from roll 142 . this results in moving belt 150 from position p 1 to position p 2 ( shown in phantom ). the tumbling region in catenary portion 152 can be adjusted to allow for narrow , deep product bed 162 with close roll spacing between rolls 140 and 142 or to allow for wide , shallow product bed 162 with wide roll spacing between rolls 140 and 142 . with fig6 by moving the roll 140 forward and upward relative to roll 142 will increase the inclination of the tumbling bed 162 . this results in moving belt 150 from position p 1 to position p 2 with snack food product being tumbled more rapidly . selection of the positioning of rolls 140 , 142 is dependent on the product being seasoned and the desired seasoning effect . by altering the horizontal and vertical separation between rolls 140 , 142 , the tumbling action and product bed depth can be controlled . to change the inclination of the entire belt 150 , both rolls 140 , 142 can be adjusted as shown in fig7 . when both rolls 140 , 142 are moved downward to increase the slope of tumbling bed 162 , assembly 100 moves from position p 1 to position p 4 . as the slope is increased , the rate of travel of snack food products 190 across belt 150 is increased . this is an additional parameter to control product seasoning . with the above described invention , seasoning can be applied to snack food product with uniform seasoning coverage with minimum product breakage . the seasoning assembly achieves this with its flexible surface of variable curvature that is easily changeable to desirable parameters depending upon the product being tumbled . another advantage is that the tumbling device of the seasoning assembly is used to tumble product in an open environment as opposed to an internal surface of conventional tumbling drum . this facilitates sanitation of the device and enables use of powder dispensers or coating applicators that are generally too large to fit into the inside of a conventional tumbling drum . while the invention has been particularly shown and described with reference to a preferred embodiment , it will be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the spirit and scope of the invention .
| 0 |
briefly reviewing the operating principles of a multi - tone photonic oscillator , random electrical noise generated in the feedback loop modulates the laser light , which then propagates through the optical delay path and is photodetected to then be regeneratively fed back to the transceiver ( or modulator ). this constitutes a positive feedback if the open loop gain of the oscillator is greater than one . the amplification of the noise signal as a result of positive feedback occurs at frequency intervals ( δf ) equal to an integer multiple of the inverse of the loop delay time ( τ ), i . e . δf = k ÷ τ , where k is an integer . this gives rise to potential multi - tone oscillations at the above frequency intervals . the delay loop also acts as a storage medium to increase the quality factor ( q ) of the oscillator , which is proportional to the square of the loop &# 39 ; s delay time ( q = 2πfτ 2 / δ ), where f is the oscillation frequency and δ is the noise - to - signal ratio of the input to the oscillator . thus , the oscillator phase noise s ( f ′), which is inversely proportional to the quality factor s ( f ′)= δ /[( 2π ) 2 ( τf ′) 2 ], where f ′ is the offset frequency , decreases quadratically as the optical delay in the loop is increased . referring to fig2 , a new implementation of a photonic oscillator 20 using an electroabsorption device serving a dual function as modulator and detector in accordance with the embodiments disclosed herein includes a laser source 100 emitting a continuous wave ( cw ) laser beam to be detected by an electroabsorption transceiver 210 . the laser beam emitted by the laser source 100 is passed through an optical isolator 220 that prevents the propagation of circulating oscillation tones back into the optical branch containing the laser beam . a terminating electrical bandpass filter at the electrical port of the electroabsorption transceiver 210 provides an electric load z l 235 selected to band limit the rf oscillation tones modulating the rf lightwave in the electroabsorption transceiver . the modulated rf lightwave is passed through a delay loop 240 and then through an optical amplifier 250 before being split in an optical splitter 260 to generate the oscillating rf lightwave carrier signal as well as an oscillating rf lightwave feedback signal that is combined with the laser beam generated by the laser source 100 by an optical combiner 270 prior to being detected by the electroabsorption transceiver . as well known to those skilled in the art , the delay loop may incorporate one or more delay paths having different parameters . as known in the art , the random noise generated in the delay loop 240 of the oscillator 20 is the starting mechanism of subsequent oscillations as a result of positive loop feedback . the steady - state value of the electric field component of this random noise in the optical domain after repeated feedback circulation , amplification , and saturation , is denoted by ( p ss ) 1 / 2 exp ( jω λ t + jω m t ), where p ss is the optical power of the steady - state oscillating tone , and ω λ and ω m are the optical frequency of the laser and electrical frequency of the rf multi - tones modulating the lightwave signal , respectively . the total optical power obtained by the combination of the power of the oscillating tone ( p ss ) and the cw power of the laser beam generated by the laser source 100 ( p 0 ) are then partially absorbed in the electroabsorption transceiver 210 . the resulting photocurrent flowing through the modulator termination ( i . e . load ) consequently results in a voltage drop across the transceiver given by : v mod = 1 2 ( p 0 + p ss sin ω m t ) α ρ z l ( 1 ) where α is the fractional absorption of the electroabsorption device , ρ is its photocurrent conversion efficiency ( a / w ), and z l is the device resistive termination . this induced electroabsorption modulator voltage in turn modulates the intensity of its transmitted rf lightwave signal . equation ( 1 ) may be further refined by analyzing an equivalent ac electrical circuit of the electroabsorption transceiver 210 , as shown in fig3 . the circuit 30 in fig3 was originally published in the publication “ rf - small - signal equivalent circuit of mqw ingaas / inalas electroabsorption modulator ,” electronics letters , vol . 33 , pp 1822 - 1823 , 1997 , the entire contents of which are incorporated herein by reference thereto . the desired ac load termination z l 235 of the electroabsorption transceiver 210 is applied to the ac circuit 30 , which includes a current source i p 300 for modeling the photocurrent generated in the electroabsorption transceiver as a result of its detecting function , a reverse - biased junction capacitance c j 310 of the electroabsorption transceiver , and the transceiver series resistance r s 320 . a series r a l a branch 330 is connected in parallel with the junction capacitance c j 310 , wherein r a is related to the optical responsivity of the transceiver and l a = τr a where τ is the carrier escape time from the quantum wells of the transceiver . modeling this equivalent circuit 30 , the total steady - state optical power received p opt by the transceiver is p opt = p 0 + p ss sin ω t ( 1a ) the total absorbed transceiver photocurrent i p is a sum of the dc absorbed photocurrent i p0 and the ac absorbed photocurrent i p1 : i p = i p0 + i p1 sin ω t ( 1b ) the photocurrent conversion efficiency ρ of the transceiver is typically also comprised of a dc component ρ 0 and an ac component ρ 1 : the ac component ρ 1 of the photocurrent conversion efficiency may be expressed as : ρ 1 = v m1 r a p 0 ( 1 d ) where v ml is the ac component of the transceiver induced modulation voltage . the generated photocurrents thus become : using the relationships defined above by equations 1a - 1f and a generalized ac load termination z l , an analysis of the circuit 30 can provide a more accurate expression for the induced modulation voltage v mod = v m0 + v m1 sin ωt . as will be appreciated by those skilled in the art , the rf band pass filtering function of the oscillator 20 can be adjusted via appropriate selection of the ac load termination z l in conjunction with the other ac equivalent circuit parameters discussed above . with continued reference to fig2 , the voltage dependent transmission characteristics of an electroabsorption modulator is , generally : t ( v ) = t 0 exp ( - v v 0 ) ″ ( 2 ) where t 0 is the zero - bias transmission of the modulator , or its insertion loss , and v 0 and n are empirical parameters related to the shape of the transmission vs . voltage characteristics of the modulator . substituting the induced modulator voltage from equation ( 1 ) into the transmission - voltage characteristics in equation ( 2 ) results in : t ( v mod ) = t 0 exp [ - ( v b + v ss sin ω m t ) v 0 ] ″ ( 3 ) where v b = 0 . 5p 0 αρr l and v ss = 0 . 5p ss αρr l and are the induced bias and small - signal rf modulator voltages , respectively . assuming n = 1 for ease of calculation , and using a taylor series expansion of ( 3 ) with the first few terms , the following relationship for the modulator optical transmission as a function of the self - induced modulator voltage parameters described above is obtained : the output optical power of the modulator as a function of the input optical power and the modulator transmission characteristics described in ( 4 ) above is given by : p out = 1 2 β ( p 0 + p ss sin ω m t ) t ( v mod ) ( 5 ) where β is the modulator insertion loss . combining equations ( 4 ) and ( 5 ), expanding the terms above , and using known trigonometric identities , the modulated output optical power of the modulator as a result of the induced voltage may be expressed as : equation ( 6 ) may be simplified by dropping the second and higher powers of small signal rf voltage v ss , and substituting v ss for p ss , to obtain the following relationship between the modulated power levels at the output of the optical amplifier 250 and the input of the optical combiner 270 : g ol = p out p ss = 1 2 β exp ( - v b v 0 ) [ p 0 α ρ r l 2 v 0 + 1 ] g oa ( 7 ) where g ol and g oa are the open loop gain and the optical amplifier power gains , respectively . equation 7 thus defines the small - signal open loop gain of the photonic oscillator 20 . rf oscillations modulating the lightwave at frequency intervals equal to the inverse of the loop delay time will occur only if the above open loop gain ( g ol ) is above unity . substituting exp (− v b / v 0 )/ v 0 = π / v π , where v π is the equivalent “ half - voltage ” of the electroabsorption modulator , results in the following relationship for the oscillator open loop gain : the first term in the bracket in equation 8 is similar to the rf gain obtained in an optical link consisting of an electroabsorption modulator with an insertion loss β , a fractional absorption of α , and an equivalent “ half - voltage ” v π , and a photodetector with a detectivity ρ and a load resistance z l fed by a laser with cw power p 0 . the second term is an artifact of this implementation of a photonic oscillator 20 as disclosed herein . thus , one of the consequences of this oscillator configuration is that it reduces the gain required by the optical amplifier to achieve an open loop gain above unity . for purposes of illustrating the significant benefits conferred by the novel photonic oscillator disclosed herein , we may assume p 0 = 20 mw , α = 0 . 5 , ρ = 0 . 5 a / w , β =− 5 db , v π = 1 v and z l = 50ω to obtain for the contribution of the first term in equation 8 to the open loop gain a value of 0 . 125 . the self - induced bias voltage of the modulator given by v b = 0 . 5p 0 αρz l is 0 . 125 v . from the definition of the electroabsorption modulator equivalent “ half - voltage ”, exp (− v b / v 0 )/ v 0 = π / v π , v 0 = 0 . 1 v can be deduced when v π = 1 v . thus the second term in equation 8 , exp (− v b / v 0 ), is equal to 0 . 28 and therefore without the novel use of the electroabsorption device as a simultaneous modulator and detector , an optical amplifier gain of about 17 db would be required to obtain an open loop gain of more than unity in a photonic oscillator with a feedback loop consisting of an optical link with the same modulator and a separate photodetector with equivalent detectivity . for a photonic oscillator with the novel implementation of the electroabsorption device as dual modulator / detector , the gain required from the optical amplifier to have an oscillator open loop gain above unity would only be about 12 db using the same parameter values given above . this reduction in the minimum value of the optical amplifier gain is a result of the addition of the second term in the photonic oscillator open loop relationship in equation 8 , which is a direct consequence of the novel dual usage of the electroabsorption device as an optical modulator and detector . this lower requirement for the optical amplifier minimum gain translated into a lower amplifier noise , and hence , a lower photonic oscillator phase noise . as will be appreciated by those skilled in the art , a significant advantage of a photonic oscillator as disclosed herein is the reduction in complexity , and hence fabrication cost . furthermore , avoiding use of fet - based electrical amplifiers may improve the flicker noise contribution to the device phase noise . also , as explained above , the novel photonic oscillator disclosed herein reduces the gain requirement of an optical amplifier required in an equivalent oscillator with a feedback loop consisting of an optical link with an electroabsorption modulator , an optical amplifier , and a photodetector . the use of the electroabsorption device as a photodetector further allows the addition of electrical bandpass filters to the photonic oscillator that would not otherwise be possible in an all - optical oscillator configuration . the electrical bandpass filter has the advantage of obtaining pre - selected rf bands at the output of the photonic oscillator . although the preceding discussion has been predicated upon the use of an electroabsorption optical transceiver , it must be understood that the novel concepts presented and claimed herein are not limited solely to use with this type of optical modulator , and any type of optical modulator offering the requisite dual functionality of modulator and detector may be employed in accordance with the principles disclosed herein . having now described the invention in accordance with the requirements of the patent statutes , those skilled in this art will understand how to make changes and modifications to the present invention to meet their specific requirements or conditions . such changes and modifications may be made without departing from the scope and spirit of the invention as disclosed herein .
| 6 |
fig1 and 2 illustrate a portion of a wheel hub 10 having a vehicle drive axle 12 and a clutch mechanism received therein . the hub 10 has internal splines 14 formed on its interior that extend axially along a portion of its length . splines 16 are provided on the periphery of the end of the axle 12 in a known manner and are of sufficient length to receive the inner gear 18 . the inner gear 18 , as best seen in fig3 and 5 is a cylindrical member having internal axial splines 20 and external axial splines 22 , 24 and 26 . splines 22 are provided on one end of the gear 18 and splines 26 are provided on the opposite end . splines 24 are positioned near the center of the gear 18 with a space 28 being provided between splines 22 and 24 and a space 30 being provided between splines 24 and 26 . splines 22 , 24 and 26 are axially aligned . the inner gear 18 is mounted on the end of the axle 12 with the inner splines 20 of the gear 18 mating with the splines 16 of the axle 12 . the inner gear 18 mounted on the axle 12 in effect becomes part of the axle and the assembly of the inner gear 18 on the axle 12 may be referred to as an axle . a clutch ring 40 ( best seen in fig3 and 5 ) is a cylindrical member having external axially extended splines 42 and having internal splines 44 and 46 aligned one with the other . splines 44 are provided at one end and splines 46 are provided at the other end of the clutch ring 40 with a space 48 being provided between splines 44 and 46 . referring once again to fig1 and 2 , the clutch ring 40 is received in the hub 10 with the external splines 42 of the clutch ring 40 mating with the internal splines 14 of the hub 10 . the clutch ring 40 circumscribes the inner gear 18 . the hub 10 , the clutch ring 40 , the inner gear 18 and the axle 12 are thus concentrically mounted and have a common axis of rotation 11 . the clutch ring 40 is slidably movable along axis 11 , the splines 42 of the clutch ring 40 being in continuous engagement with the splines 14 of the hub 10 . movement of the clutch ring 40 in one axial direction couples or locks the hub 10 to the axle 12 to provide unity of rotation , and movement in the opposite direction uncouples the hub 10 from the axle 12 . shift mechanism , indicated generally as 60 , is provided to move the clutch ring 40 axially . shift mechanisms are known for affecting movement of the clutch ring 40 and may be of the manual type , the semi - automatic type or the automatic type . the manual shift mechanism generally has a hub mounted dial that is rotated in one direction to move the clutch ring 40 in one axial direction and rotated in an opposite direction to move the clutch ring 40 in the opposite axial direction . semi - automatic shifting mechanism is operably remote from the hub , e . g ., in the cab adjacent the driving controls , and may include for example controlling devices to supply or withdraw fluid such as air to affect movement . automatic shifting devices generally operate upon relative rotation as between the hub and the drive axle . when the axle is driven , the clutch ring is moved in one direction into engagement and when the drive axle is idle and the hub is rotated the clutch ring is moved in the opposite direction . fig1 illustrates the condition where the hub 10 is free to rotate independent of the axle 12 . that is , the clutch ring 40 is engaged only with the hub 10 , the splines 42 of the clutch ring 40 being in engagement with the splines 14 of the hub 10 . the internal splines 44 , 46 of the clutch ring 40 are received in the spaces 28 , 30 of the inner gear 18 and the splines 24 of the gear 18 are received in space 48 of the clutch ring 40 . the hub 10 and the clutch ring 40 thus may rotate independent of the inner gear 18 and the axle 12 . fig2 illustrates the condition where the clutch ring 40 has been moved axially by the shifting mechanism 60 to a position of engagement with both the hub 10 and the inner gear 18 . as previously stated , the splines 42 of the clutch ring 40 are in continuous engagement with the splines 14 of the hub 10 . the clutch ring 40 has been moved axially to a position where the splines 44 of the clutch ring engage the splines 22 of the inner gear and splines 46 of the clutch ring 40 engage the splines 24 of the inner gear 18 . there is a tandem engagement between the splines of the inner gear and the splines of the clutch ring . this is particularly important when the engagement results in a limited overlap of the engaging splines . the tandem arrangement doubles the contact area as between the engaging splines for the same degree of overlap as opposed to previous arrangements wherein there was a singular engagement of one spline with another . fig4 illustrates an alternate arrangement of the hub , clutch ring and inner gear . the inner gear 18 &# 39 ; has splines 20 provided on its interior in the same manner as on gear 18 , and has splines 21 formed on its exterior that are axially aligned and extend substantially along its length . the gear 18 &# 39 ; is mounted on the end of the axle 12 in the same manner as gear 18 . the clutch ring 40 &# 39 ; has internal splines 41 mateable with the splines 21 of the gear 18 &# 39 ;. splines 43 , 45 are provided on the exterior of the clutch ring 40 &# 39 ;, splines 43 being provided at one end and splines 45 at the opposite end . the splines 43 , 45 are axially aligned and are in a spaced apart relation , there being a space 47 between them . hub 10 &# 39 ; has internal splines 15 , 17 that are aligned axially and one with the other . the splines 15 , 17 are in a spaced relation , the splines 15 , 17 being separated by a space 19 . the clutch ring 40 &# 39 ; is axially movable in the same manner as clutch ring 40 of fig2 and 3 clutch ring 40 &# 39 ; however is in permanent engagement with the inner gear 18 &# 39 ; and is moved axially to either be in engagement with the hub 10 &# 39 ; or out of engagement with hub 10 &# 39 ;. a shift mechanism is provided to move the clutch ring 40 &# 39 ; axially . the clutch ring 40 &# 39 ; and hub 10 &# 39 ; have tandem rows of splines that become engaged to lock the rotation of the hub 10 &# 39 ; to the axle 12 . the tandem arrangement of engaging splines is particularly suited to automatic hub locks that rely on rotation of the drive axle to affect movement of the clutch ring . fig5 illustrates in exploded view an automatic hub lock employing a fixed cam , a moving cam and a cam follower to affect movement of the clutch ring . the automatic locking clutch is shown assembled in fig6 and 7 . the operative function of the cam arrangement is as disclosed in u . s . pat . no . 4 , 327 , 821 telford issued may 4 , 1982 . the automatic hub clutch as will now be described is an improved version of &# 39 ; 821 patent . basically a fixed cam 70 is secured to the vehicle in a non rotative manner with respect to the drive axle or wheel hub . a moving cam 80 surrounds the fixed cam 70 and is rotatively coupled to a cylindrical friction shoe 90 . the moving cam 80 and friction shoe 90 are rotatably mounted on a wheel bearing retainer 98 . a cam follower 100 engages the fixed cam 70 and is in splined engagement with the inner gear 18 , the follower 100 having internal splines 102 mateable with the splines 26 of the gear 18 . the cam follower 100 is axially moveable on the inner gear 18 . the cam follower is in abutment with a cage 110 that encloses a biasing spring 118 and the clutch ring 40 . the clutch ring 40 is in splined engagement with the splines 14 of the hub 10 . rails 112 of the cage 110 are in splined engagement with the splines 42 of the clutch ring 40 , thus the cage rotates with the clutch ring 40 . an end 114 of the cage 110 is in abutment with one end of a return spring 120 with the opposite end of the return spring in contact with an interior end of the hub 10 . the inner gear 18 is mounted on an axle 12 in splined engagement as previously described and the inner gear 18 is received in the clutch ring 40 . rotation of the axle 12 forces rotation of the cam follower 100 , causing the cam follower to ramp up the lobes of the fixed cam 70 which causes the cam follower to move axially away from the fixed cam thus forcing the cage 110 to move axially . movement of the cage 110 axially will urge the clutch ring 40 to move axially via the spring 118 . ( as the cage 110 moves axially , end 114 of the cage will compress the return spring 120 to remove its resistive force .) the clutch ring 40 will thus be urged into splined engagement with the inner gear 18 as shown in fig7 . as the cam follower 100 continues to rotate , extending posts 104 on the cam follower will engage the ramps 82 of the moveable cam 80 thus urging further axial displacement of the cam follower 100 which will separate the cam follower from the fixed cam 70 . the extending posts 104 on the cam follower 100 will engage cam stops 84 on the moveable cam thus urging the moving cam to rotate with the cam follower . in order to function properly , the movable cam 80 must be rotatable but it must have a resistance to rotate . the resistance to rotate must be sufficient to force the cam follower 100 to ramp up the ramping surfaces 82 on the moving cam 80 until the cam stops 84 are engaged . an improved friction shoe 90 , as illustrated fig8 is provided to provide the necessary braking or rotative resistance . the shoe 90 is a formed cylindrical member sized to fit closely on the cylindrical surface 99 ( see fig5 ) of the wheel bearing retainer 98 . a slot 92 is provided in the shoe 90 to permit reducing the diameter of the shoe 90 by closing the width of the slot . radial grooves 94 are provided in the shoe 90 to receive protruding spring retainers 86 of the movable cam 80 . tabs 95 and bosses 96 extending radially outward around the periphery of the shoe 90 cooperatively form a channel 97 around the circumference of the shoe 90 for receiving an endless coil spring 79 . the moving cam 80 is mounted to the friction shoe 90 with the spring retainers 86 being received in the radial grooves 94 . the coil spring 79 is fitted in the channel 97 , the spring 79 engaging the spring retainers 86 to secure the moving cam 80 and the shoe 90 together . the retainers 86 of the movable cam 80 engaging the grooves 94 will cause the cam 80 and the shoe 90 to rotate in unison . the assembly of the shoe 90 and the movable cam 80 are mounted on the bearing retainer nut 98 . the spring 79 urges the shoe to reduce in diameter , in effect clamping the shoe 90 to the nut 98 to provide the required resistance to rotation . a braking device is thus provided that is of one piece construction and easily produced . relative rotation between the cam follower 100 and the cage 110 occurs as the hub 10 rotates relative to the axle 12 . an applied torque is thus applied as between the cam follower 100 and the cage 110 . there is little rotational torque applied when the cam follower is seated in the fixed cam and the clutch ring is not engaged with the inner gear . the cage is urged axially toward the cam follower by the return spring 120 , however , a retaining ring 130 ( see fig5 and 7 ) fitted within the hub 10 limits the axial movement of the cage . the largest rotational torque applied as between the cage and the follower occurs as the cam follower 100 and the cage 110 are moving axially , that is during engagement of the clutch ring and during disengagement . during engagement , the axle is rotating relative to the hub and therefore the follower is rotating relative to the cage . the follower as it moves axially to affect engagement must apply a sufficient force on the cage to compress the return spring 120 and spring 118 . the applied force results in a rotational torque since the cam follower is rotating relative to the cage . this rotational torque is applied to the end ( base ) 116 of the cage 110 and particularly at the connections between the end 116 and rails 112 . the cage 110 ( see fig5 ) has the end 116 formed integral with the rails 112 to provide a structure that will sustain the rotational torque applied . end 114 is removably mounted on the ends of the rails 112 . tabs 113 formed on the end of the rails 112 fit in formed latches 115 on the end 114 . extending posts 117 on the end 114 are arranged to receive the end of the spring 120 . an alternate arrangement of the cage is illustrated in fig9 . a cage 110 &# 39 ; has an end 116 &# 39 ; integrally formed with the rails 112 &# 39 ;. the rails 112 &# 39 ; extend from the end 116 &# 39 ; and have a spring receiving formation 111 formed on the extended ends . an end of the return spring 120 is received in the formations 111 . those skilled in the art will recognize that modifications and variations may be made without departing from the true spirit and scope of the invention . the invention is therefore not to be limited to the embodiments set forth in the drawings and specification but is to be determined from the appended claims .
| 5 |
[ 0020 ] fig1 is a side elevational view of a mug 10 , having a liner 12 . the liner 12 depicted in fig2 is formed in a first injection mold and removed therefrom . the liner 12 is then placed in a second injection mold wherein the rest of the mug 10 is molded around the liner 12 to provide the mug exterior 14 , a base 22 and a handle 16 all of which are integral to form the mug 10 . [ 0021 ] fig2 is a side elevational view of the liner 12 having an exterior 17 , a bottom 15 and a rim 13 . in addition , the liner 12 has a tab or jut out 18 at the top of the liner 12 on one side of the liner 12 . the tab 18 allows the location of the liner 12 to be properly oriented when the liner 12 is placed in the second injection mold . this allows accurate registration of any indicia or imprint 26 on the exterior of the liner 12 which appears through the translucent or transparent exterior 14 of the mug 10 . however , orientation is not required for a tumbler . [ 0022 ] fig3 is a top plan view of the liner 12 clearly depicting the tab 18 with respect to placement on the exterior 17 of the liner 12 . [ 0023 ] fig4 is a side elevational view of a vertical section taken through the mid - point of the handle and embodiment of fig1 . this section view of the mug 10 allows a further understanding of the relationship of the liner 12 with its tab 18 with respect to registration of the imprint 26 in relation to the handle 16 as desired by the manufacturer . the tab 18 interlocks with corresponding locations ( not shown here ) in the second injection mold . this accurate placement of the liner 12 in the second injection mold allows formation of the handle 16 consistently with relation to the imprint 26 and the rest of the mug 10 . the imprint 26 may extend all around the mug 10 or may be located on both sides of the mug 10 or just one side of the mug 10 as illustrated here . the rim 24 of the mug 10 extends over the rim 13 of the liner 12 . thus the exterior 14 of the mug 10 formed in the second injection mold , covers and is fused to the liner exterior 17 , the liner bottom exterior 15 , the tab 18 and the liner rim 13 to form the integral mug 10 . [ 0024 ] fig5 is a side elevational view of a mug 50 , having a liner 52 . the liner 52 depicted in fig6 is formed in a first injection mold and removed therefrom . the liner 52 is then placed in a second injection mold wherein the rest of the mug 50 is molded around the liner 52 to provide the mug exterior 54 , a base 62 and a handle 56 all of which are integral to form the mug 50 . [ 0025 ] fig6 is a side elevational view of the liner 52 having an exterior 57 , a bottom 55 and a rim 53 . in addition , the interior 59 of the liner 52 has a vertical small flat edge 60 . the vertical small flat edge 60 allows the location of the liner 52 to be properly oriented when the liner 52 is placed in the second injection mold . this allows accurate registration of any indicia or imprint 66 on the exterior of the liner 52 which appears through the translucent or transparent exterior 54 of the mug 50 . [ 0026 ] fig7 is a top plan view of the liner 52 clearly depicting the vertical small flat edge 60 with respect to placement on the interior 59 of the liner 52 . the vertical small flat edge 60 need not extend the entire height of the interior of the liner 52 , however , aesthetically , the extension of the vertical small flat edge 60 for most of the height of the liner 52 is desirable . [ 0027 ] fig8 is a side elevational view of a vertical section taken through the mid - point of the handle and embodiment of fig5 . this section view of the mug 50 allows a further understanding of the relationship of the liner 52 with the vertical small flat edge 60 with respect to registration of the imprint 66 in relation to the handle 56 as desired by the manufacturer . the vertical small flat edge 60 interfaces with a corresponding flat edge ( not shown here ) in the second injection mold . this accurate placement of the liner 52 in the second injection mold allows formation of the handle 56 consistently with relation to the imprint 66 and the rest of the mug 50 . the imprint 66 may extend all around the mug 50 or may be located on both sides of the mug 50 or just one side of the mug 50 as illustrated here . the rim 64 of the mug 50 extends over the rim 53 of the liner 52 . thus the exterior 54 of the mug 50 formed in the second injection mold , covers and is fused to the liner exterior 57 , the liner bottom exterior 55 , and the liner rim 53 to form the integral mug 50 . styrene acrylonitrile in the form of a commercial product identified as san is prepared by known procedures for a first injection mold . the styrene acrylonitrile material may contain color dye or other suitable materials to make the liner 12 opaque , solid in appearance , translucent or transparent . the san is injected into the first mold at a predetermined temperature suitable for injection molding of the styrene acrylonitrile polymer . the injection molding step generally ranges from about one to about three minutes depending on the desired thickness of the product liner 12 . the liner 12 is then removed from the mold . the liner 12 contains tab 18 as described heretofore . any desired imprint or indicia is placed on the exterior 17 of the liner by suitable means . for example , the imprint may be effected in ink , e . g ., nasdar screen ink , or pad print accomplished by screen printing or in the form of a printed paper , decal or the like . the imprint indicia is secured , if necessary , to the outside 17 of the liner 12 . the liner 12 is placed in a second injection mold , or alternatively in a second compartment of the first mold , with the tab 18 properly aligned with the corresponding negative registries , i . e ., a notch for the tab 18 of the liner 12 . a suitable styrene acrylonitrile material or an acrylic material , containing the desired dyes for color is loaded to be dispensed through the second injection mold at the predetermined temperatures and times outlined above . the plastic material injected into the second mold covers the liner exterior 17 , liner bottom exterior 15 , and the liner rim 13 . in addition , the second mold contains die space for the mug base 22 and handle 16 to form a completed mug . the finished mug 10 is then removed from the mold , cooled , and is ready for shipment or sale . the exterior of the second mold may be highly polished to provide excellent clarity of the mug exterior 14 thus making any indicia or imprint 26 on the liner 12 highly visible . if desired , an additional imprint may be added to the outside of the mug over the internal imprint to provide a 3 - d effect , however , such an imprint is not protected from external wearing , scratching and other destruction without further treatment . by merely changing the die of the mold , other drinking vessels may be produced by the process of the present invention . for instance , a more conventional cup design may be formed . the same process steps may be employed and if desired , the same type of registration tabs may be used . the registration tab may be placed at any appropriate location on the liner so long as the mug exterior 14 covers the tab 18 to provide a smooth exterior 14 of the mug 10 . in addition , a tumbler is easily formed and does not require the tab for registration of a handle . a tumbler does not have a handle and because it exhibits complete symmetry , the indicia does not ordinarily require registration , however , if there are multi color portions of the indicia , some form of registration may be necessary . acrylic in the form of a commercial product is prepared by known procedures for a first injection mold . the acrylic material may contain color dye or other suitable materials to make the liner 52 opaque , solid in appearance , translucent or transparent . the acrylic material is injected into the first mold at a predetermined temperature suitable for injection molding of the acrylic polymer . the injection molding step generally ranges from about one to about three minutes depending on the desired thickness of the product liner 52 . the liner 52 is then removed from the mold . the liner 52 contains the vertical small flat edge 60 as described heretofore . any desired imprint or indicia is placed on the exterior 57 of the liner by suitable means . the imprint indicia is secured , if necessary , to the outside 57 of the liner 52 . the liner 52 is placed in a second injection mold , or alternatively in a second compartment of the first mold , with the vertical small flat edge 60 properly aligned with the corresponding flat edge registry in the mold . a suitable acrylic material , containing the desired dyes for color is loaded to be dispensed through the second injection mold at the predetermined temperatures and times outlined above . the plastic material injected into the second mold covers the liner exterior 57 , liner bottom exterior 55 , and the liner rim 53 . in addition , the second mold contains die space for the mug base 62 and handle 56 to form a completed mug . the finished mug 50 is then removed from the mold , cooled , and is ready for shipment or sale . by merely changing the die of the mold , other articles having the protected advertising surface , may be produced by the process of the present invention . for instance , a taller vessel simulating a tumbler , but with a handle may be formed . the same process steps may be employed and the same type of vertical small flat edge may be used for registry of any indicia . the vertical small flat edge may be placed at any appropriate location on the interior of the liner so long as the second mold has a corresponding vertical flat edge . although either the tab or the vertical small flat edge may be used to satisfactorily register the second mold with the liner , other registration forms would be suitable and are included herein . other products upon which protected advertising surfaces are desirable , are containers which include change dishes , lids and / or coasters for drinking vessels , candy dishes or dishes of any type , or the like . the protected “ advertising ” surface may also be simply a design and therefore is not used exclusively for advertising . although the invention has been described in considerable detail in the foregoing , it is to be understood that such detail is solely for the purpose of illustration and that variations can be made without departing from the spirit and scope of the invention .
| 6 |
referring now to the drawings , and initially to fig1 a freezer is generally indicated at 10 . the freezer 10 includes a tunnel enclosure 12 , and a conveyor belt 14 which moves product through the freezer from an inlet end 16 to an outlet end 18 ( see fig2 ). also included is a cryogen control cabinet 20 and an electrical control cabinet 22 . the cryogen control cabinet directs cryogen coolant to gas release means or nozzles 24 . in the preferred embodiment , the freezer 10 comprises an in - line tunnel freezer commercially available from the assignee of the present invention as model no . je - u4 . preferably , the cryogen employed is co 2 , although other cryogen coolants such as liquid nitrogen can also be used . as can be seen in fig1 and 2 , the freezer 10 includes a pair of overhead fans 30 , 32 driven by electric motors 34 , 36 located outside of enclosure 12 , atop the enclosure roof . blowers 40 , 42 driven by electric motors 44 , 46 are located between the upper and lower runs of conveyor belt 14 . the blowers 40 , 42 are oriented in a generally horizontal direction , being tilted at a slight downward angle . fig3 and 4 show the blowers 40 , 42 from a vantage point looking generally toward exit end 18 of the freezer , from a point at the left hand end of fig2 . as can be seen in fig3 and 4 , the blowers 40 , 42 are laterally offset from one another so as to avoid interference with the circulation within enclosure 12 . referring again to fig1 and 2 , the motors 44 , 46 receive electrical power from control cabinet 22 through electrical conductors 50 enclosed within a first conduit run 52 , a junction box 54 , a rigid conduit 56 and flexible conduit lines 60 , 62 . cryogen coolant enters the system through a line 66 from a supply tank ( not shown ). the cryogen coolant is split up at junction 68 into two flow paths . the first flow path passes through line 70 to the nozzles 24 . the cryogen coolant also travels along a second path through a valve 74 and regulator 76 , passing along line 78 to junction box 54 . preferably , cryogen coolant traveling through line 78 is in a gaseous form , although it could also be in a liquid or mixed phase form , if desired . a pressure block or seal is provided at the junction of conduit 52 and junction box 54 to prevent cryogen coolant from entering the electrical control cabinet 22 . the cryogen coolant is , however , allowed to pass through junction box 54 to pressurize conduits 56 and flexible lines 60 , 62 , entering into motors 44 , 46 . the cryogen coolant system upstream of junction box 54 is shown outside of cryogen control cabinet 20 for clarity of illustration , although most of this equipment is located within the cryogen control cabinet . preferably , the conduit 56 is located at a back wall of freezer 10 ( located in the background of fig1 and 2 ). conduit 56 includes a horizontal run portion 58 visible in fig3 and 4 , which travels in a direction generally perpendicular to the direction of travel of conveyor belt 14 . referring briefly to fig1 the upper run of conveyor belt 14 is borne by below by support members 90 . as seen in fig3 and 4 , the conveyor run 58 is supported from support members 90 and provides a convenient mounting for blowers 40 , 42 . preferably , the conduit 58 is relatively rigid compared to the flexible lines 60 , 62 . the junction box 54 , conduit lines 56 , 58 and flexible lines 60 , 62 are preferably of pressure - tight construction so as to contain the pressure of cryogen coolant controlled by regulator 76 and so as to sustain a controlled flow of cryogen coolant through the motors 44 , 46 . referring to fig5 blower 40 and motor 44 ( which drives the fan blades of the blower ) is shown on an enlarged scale . preferably , motor 44 is an electric motor of the closed frame or sealed type . in the preferred embodiment , electric motor 44 is commercially available from baldor electric company as a special horizontal motor of type tenv , model 33m - nema 42z . ring type seals are provided on the motor shaft , and neoprene gaskets are used in the construction of the motor frame to prevent moisture intrusion into the motor interior . fig5 also shows electrical conductors 50 located in flexible line 60 . the flexible line 60 is mounted to a back wall 100 of motor 44 by a coupling 102 . as shown in fig4 flexible line 60 is connected through a junction 104 . in the preferred embodiment , the motor 44 has a generally cylindrical frame with a front wall 106 located opposite the aforementioned back wall 100 . in the preferred embodiment , back and front walls 100 , 106 preferably comprise end bells typical of conventional electrical motor constructions . as mentioned above , cryogen coolant pressurizes conduit line 58 and flexible line 60 . the cryogen coolant is allowed to pressurize the interior of motor 44 , and this alone may be sufficient in some installations to adequately protect the electric motor . as indicated in fig7 by arrows 112 , cryogen coolant flows through motor 44 , between the internal components of the motor ( both electrical components such as field windings and mechanical components such as bearings ) so as to exit through plug 110 . by way of experimentation using the above - mentioned commercial freezer model je - u4 , the plugs 110 were sealed and , after two weeks of regular operation , substantial condensation was found in the motor interiors , even though co 2 vapor pressure had been maintained continuously during the test period . it was found necessary to maintain a minimum flow of cryogen coolant through the electric motors in order to prevent moisture accumulation through the motor interior . accordingly , a plug 110 having a controlled orifice size is installed in front wall 100 . in the preferred embodiment , plugs 110 are those commercially available from the motor manufacturer as t - drain plug part no . sp - 5435 . initial tests performed on the model je - u4 freezer indicate that a flow rate of approximately 10 standard cubic feet per hour for each blower is adequate to prevent moisture - related premature failure of the blower motors . as will be appreciated by those skilled in the art , the freezer shown in fig2 is of a modular construction type , and if longer residence time is needed to refrigerate products of a particular type , additional freezer enclosures may be added back - to - back , in a serial array to form a continuous freezer production line . tests were conducted with the number of blowers ranging between 2 and 8 and the required increase in flow rate from regulator 76 was found to be linear , with 80 standard cubic feet per hour being required to supply purge flow for 8 blowers . the blowers tested were of the fractional horsepower size , and were operated at 240 volts a . c . the required cryogen flow rate through the motor may differ for other installations . in the test , the regulator 76 was employed to limit the vapor line pressure in conduit 78 from between 3 and 6 psi . a co 2 vapor flow meter was inserted downstream of the regulator 76 to measure flow to the blower motors . fig8 - 12 show various alternative freezer configurations to which the cryogen purge flow system may be adapted to protect electric motors located within refrigerated environments . in fig8 a tunnel freezer 116 is shown . the freezer is described in u . s . patent application ser . no . 08 / 245 , 531 , filed may 13 , 1994 , and assigned to the assignee of the present invention . the disclosure of this patent application is incorporated as if set forth fully herein . the freezer 116 in fig8 includes a tunnel enclosure 118 and a conveyor belt 120 formed in an endless loop , for transporting products through the freezer interior . overhead fans 122 circulate co 2 cryogen coolant , preferably in the form of finely divided particles or &# 34 ; snow &# 34 ; form exiting injectors 124 . injectors 124 are fed by cryogen supply lines 126 which also extend to the rear walls of electric motors 128 disposed below the upper run of conveyor belt 120 . motors 128 drive fan blades with a generally downwardly directed discharge , circulating the co 2 snow and freezer atmosphere across deflection plates 130 located in the floor of the freezer . the motors 128 are preferably provided with an exit orifice adjacent the front wall of the motors to allow cryogen coolant flow through the motor interior in the manner described above . fig9 - 11 show cabinet freezers of the type described in commonly assigned u . s . pat . no . 4 , 344 , 291 , the disclosure of which is incorporated as if fully set forth herein . the freezer 210 shown in fig9 is provided with both cryogen and mechanical types of refrigeration equipment . the mechanical refrigeration equipment 211 is mounted atop the roof of cabinet enclosure 212 . cryogen refrigeration equipment is located behind sidewall 213 of the cabinet enclosure . blowers 226 , driven by electric motors , are also located in sidewall 213 and are coupled to the cryogen supply lines in the manner described above so as to set up a flow of cryogen coolant through the electric motor housing to prevent moisture accumulation within the motors . if desired , the mechanical refrigeration 211 could be relied upon the cool the interior of cabinet 212 , with the cryogen coolant being supplied solely to the electric motors , if desired . however , it is generally desired that the mechanical refrigeration equipment 211 be supplemented by cryogen cooling of the cabinet enclosure . fig1 shows an arrangement similar to fig9 except for the presence of three blowers 226 and the omission of mechanical refrigeration equipment 211 . fig1 is a cross - sectional view of a freezer having a spiral conveyor belt generally shown and described in u . s . pat . no . 4 , 356 , 707 , assigned to the assignee of the present invention . u . s . pat . no . 4 , 356 , 707 is incorporated as if fully set forth herein . the freezer generally indicated at 240 in fig1 has a helical or so - called &# 34 ; spiral &# 34 ; conveyor belt having an inlet end 242 and an exit end 244 . as shown in fig1 , the conveyor belt is of endless form , and returns from the top of freezer 240 over a series of tension - controlling rollers to the inlet end 242 . the conveyor belt then travels to the left in fig1 upwardly along the spiral path shown . co 2 cryogen injection units 250 receive cryogen flow from line 254 . the cryogen flow is split at junction box 256 so as to flow through lines 258 which are terminated at blower motors 260 . a cryogen flow is maintained through the electric motors 260 in the manner described above , so as to prevent moisture intrusion within the motors . referring now to fig9 - 11 , a cryogenic cabinet freezer is generally indicated at 210 . the freezer 210 includes an insulated cabinet 212 having a door 214 allowing access to the cabinet interior . typically , carts loaded with food products to be refrigerated are wheeled over ramp 216 , through the opening formed by open door 214 . referring to fig1 , injection nozzle 220 and inducer 222 inject cryogen coolant into the interior of cabinet 212 . blowers 226 circulate freezer atmosphere within cabinet 212 . the blowers 226 are driven by electric motors ( not shown ) which are disposed within the cryogenic environment . as indicated by the arrows in fig1 and 11 , circulation patterns are set up within cabinet 212 , which bring moisture from products being cooled into contact with the blowers , and the electric motors associated therewith . preferably , the cryogen media employed is liquid co 2 which exits the inducers 222 in the form of finely divided snow particles . the cryogen is supplied through piping 30 ( see fig1 ) to the inducers 222 . the drawings and the foregoing descriptions are not intended to represent the only forms of the invention in regard to the details of its construction and manner of operation . changes in form and in the proportion of parts , as well as the substitution of equivalents , are contemplated as circumstances may suggest or render expedient ; and although specific terms have been employed , they are intended in a generic and descriptive sense only and not for the purposes of limitation , the scope of the invention being delineated by the following claims .
| 5 |
an exemplary indium bump transfer process is outlined in fig1 . an exemplary template wafer as fabricated is shown in fig1 a . details of this process are discussed below . such an exemplary template wafer is comprised of a conductive core layer 101 and nonconductive layers 102 , 103 deposited and defined upon both sides of it . the top nonconductive layer 102 is based on polytetrafluoroethylene ( ptfe ) as indium does not stick well to it . the dimensions of this wafer can be at least as large as the dimensions of the area to be bumped on the microchip . after the fabrication step , the template wafer is placed in an electroplating setup fig1 b . the electroplating setup includes a power supply 103 that has the capability to run in a constant current mode . one such power supply is the agilent 3616a . the positive terminal of the power supply 104 is electrically connected to one terminal of an ammeter 106 to monitor current being provided by the power supply . one may use the fluke 8845a digital multimeter operating in ammeter mode . the other terminal of the ammeter is electrically connected to the anode 107 . in an exemplary embodiment , the anode is composed of high - purity indium with a purity of 99 . 99 % or better . one face of the anode has a surface area that is equal to or greater than that of the template wafer . the negative terminal of the power supply 105 is electrically connected to the template wafer 108 . the template wafer is thus the cathode of the electroplating setup . both the anode and cathode are placed in an acryllic tank 109 . the two electrodes are placed parallel to one another , separated by 5 centimeters . the tank is filled with an indium electroplating solution 110 so that the electrodes can be fully immersed . one can use the indium sulfamate electroplating solution provided by indium corporation of america . a sparging tube 111 is also placed in the electroplating bath to improve mass transport by piping an inert gas , such as ar or n 2 . once the electroplating setup is connected , the power supply is turned on and current is raised to initiate indium plating . initiation of plating 112 is shown in fig1 c , occurring only in regions where the conductive layer is exposed . the current is roughly in direct proportion to deposition rate , though current density should be kept between 108 and 216 a / m 2 , where the area is the surface area of indium plating regions . fig1 d shows completion of plating when the indium overgrows the nonconductive layer 113 . this overgrowth 114 should be on the order of 1 to 2 microns . the plated template wafer , shown in fig1 d is now ready for removal of exposed indium oxide and transfer of indium to a microchip . fig1 e shows the beginning of this process . the plated template wafer 115 is placed on the vacuum chuck 116 of a hybrid bump - bonder capable of micron resolution alignment . one such piece of equipment is the suss microtec fc - 150 . the microchip 117 after removal of oxide from the metallization pads is placed on the other vacuum chuck 118 . the two wafers are aligned by the system so the indium 119 lines up with the metallization pads 120 of the microchip . once aligned , the hybrid bump bonder presses the two , with or without heat , resulting in a bond between the indium and metallization pads . upon releasing the two , the indium sticks to the metallization pads and releases from the template wafer , as shown in fig1 f . the release is possible due to the small surface area of indium at the conductive layer interface of the template wafer 121 compared to that of the metallization pad interface of the microchip 122 . this is also possible due to the low adhesion of indium to ptfe that allows it to easily transfer . the result is a set of indium bumps 123 on the microchip 124 . fig1 g shows the bumped microchip 125 held on the vacuum chuck of a hybrid bump bonder 126 after oxide removal from a remaining exposed indium , as in the above paragraph . another microchip 127 which has the oxide likewise removed from its metallization pads is placed on the other vacuum chuck 128 . the two wafers are aligned by the system so the indium 199 lines up with the metallization pads 130 of the second microchip . once aligned , the hybrid bump bonder presses the two , with or without heat , resulting in a bond between the indium and metallization pads . fig1 h shows the hybridized microchips after the release of vacuum from the hybrid bump bonder . the initial layers of an exemplary fabrication of the template wafer are shown in fig2 a . in such an exemplary embodiment , a si wafer 201 is the core of the template wafer . the si wafer can be degreased by dipping in , e . g ., acetone , methanol , isopropyl alcohol , and deionized water for two minutes . the oxide surface of the si wafer can then be removed by dipping in a 2 % hf in deionized water solution for 1 minute . a 1 micron ni layer 202 is deposited on the front side of this wafer . one can perform deposition by a variety of techniques including ( electron beam or heated ) evaporation or ( ac or dc ) sputtering . this ni layer will serve as the plating base where indium growth is initiated during the electroplating process described above . a 200 nanometer al layer 203 is then deposited on the ni layer by similar deposition techniques . al is chosen because it sticks well to ptfe and will act as an adhesion layer . after deposition of these layers , a 1 micron ni 204 layer followed by a 200 nanometer al layer 205 are deposited on the backside of the si wafer by the same deposition techniques . the purpose of these layers is to balance stress on the si wafer to keep it as flat as possible . the sum of these layers 201 - 205 comprises the conductive layer of the transfer wafer 206 . in an exemplary embodiment , the top side nonconductive layer 209 is based on ptfe ( polytetrafluoroethylene ) teflon ™ af 1601s with 18 % solids provided by dupont de nemours & amp ; co . this layer is spun onto the conductive layer at spin speeds in the 3000 - 5000 rpm range . by diluting the teflon ™ 1691s in fluorinert ™ fc - 770 provided by 3m , the thickness of the nonconductive layer can be spun - on as thick as 20 microns . the thickness of this layer is chosen to be roughly 1 to 2 microns less than the desired final height of the indium bumps . after spin - on of the nonconductive layer , a baking procedure is necessary to drive out solvents and allow for smoothing out of the surface . this procedure is as follows . the wafer is placed on a hotplate held at 112 ° c . for 15 minutes . the temperature is then ramped to 165 ° c . for 15 minutes . at this point , all of the solvents are driven out of the nonconductive layer . finally , the wafer is held for 30 minutes at 335 ° c . on the hotplate to smoothen out the layer . afterwards , the wafer is allowed to cool . a backside nonconductive layer 208 is spun onto the backside of the wafer by the same procedure as for the top side layer . the baking process is also the same , except the 335 ° c . step is omitted as surface morphology of the backside is not critical . the purpose of this layer is to stop any deposition of indium onto the backside of the wafer during electroplating . fig2 b shows the deposition , patterning and etching of an al etch mask necessary to define the top side nonconductive layer 209 . this process begins with the deposition of 200 nanometers of al 210 . this layer can be deposited by a variety of standard techniques including ( electron beam or heated ) evaporation or ( ac or dc ) sputtering . the al layer acts as the etch mask for the nonconductive layer because teflon ™ af 1601s has a high etch selectivity over it during plasma etching . al is also chosen because it adheres well to teflon ™ af 1601s . after the al deposition , a standard photolithography step is performed to define features in the photoresist layer 211 . these features will eventually be defined down to the conductive layer by etching , so their dimensions are those upon which indium plating will initiate to form indium bumps during the electroplating step . to produce , e . g ., 10 micron pitch bumps , these features can have a 10 micron pitch and their individual size can be on the order of 2 - 4 microns . this photolithography step can be the limiting factor of the minimum bump size and pitch attainable for such an exemplary template fabrication procedure . therefore , higher resolution photolithography techniques should allow for bump sizes under 1 micron and pitches on the order of a couple of microns . the al layer is then etched , where exposed regions are etched , exposing the nonconductive layer underneath . the etching can be performed either by chemical etching or plasma etching . one chemical etch that can be used is the pan etch . this etch is comprised of phosphoric acid , acetic acid , nitric acid , and de - ionized water in a 16 : 1 : 1 : 2 ratio held at 40 ° c . fig2 c shows the template wafer after etching of the al etch mask layer and removal of the photoresist by acetone bath of photoresist stripper . after definition of the etch mask , the nonconductive layer 212 is defined by a plasma etching step . etching of ptfe , including teflon ™ af 1601s is achieved by a reactive ion etching process using a mixture of ar and o 2 gases at several hundred ev . obtaining proper sidewall angle is critical for good transfer of indium from the template wafer to the microchip , as already discussed . the gas mixture should thus be tuned to obtain sidewall angles of roughly 70 degrees with respect to interface of the layers of the wafer . fabrication of the template wafer is completed by etching away the exposed al under layer 213 by a chemical etch or plasma etch . once again , the pan etch described above could be used to for this purpose . fig2 e shows the finished template wafer , where exposed ni 214 will serve as the plating base upon which indium growth will begin during electroplating . another exemplary embodiment follows fig2 a - e . the following steps occur in the same manner as the initial exemplary embodiment : degreasing and oxide etching dip of the si wafer , about 500 nanometer to 1 micron topside ni deposition and 200 nanometer al deposition , and backside about 500 nanometer to 1 micron ni deposition and 200 nanometer al deposition . this exemplary embodiment uses a different set of techniques to deposit the topside nonconductive layer 207 and backside nonconductive layer 208 of fig2 b . instead of using spin - on teflon ™ af 1601 - s to deposit these layers , ptfe can be deposited in a vacuum chamber onto the conductive layer of the transfer wafer 206 shown in fig2 a . one can use either rf sputtering deposition or atomic layer deposition ( ald ) to perform deposition of ptfe . the thickness of the deposition of the topside nonconductive layer can be chosen to be roughly 1 to 2 microns less than the desired final height of the indium bumps . the thickness of the deposition of the backside nonconductive layer can be chosen to be about 1 micron . this thickness is not critical and only serves to cover the backside of the wafer to stop any deposition of indium onto the backside of the wafer during electroplating . no baking steps are required after deposition . after deposition of the ptfe nonconductive layers , fabrication proceeds as in the initial exemplary embodiment . this includes : deposition , patterning and etching of the 200 nanometer thick al etch mask , plasma etching of the topside nonconductive layer , removal of the 200 nanometer thick al etch mask , and etching of the exposed 200 nanometer thick al under layer . yet another exemplary embodiment follows fig2 a . the following steps occur in the same manner as the initial exemplary embodiment : degreasing and oxide etching dip of the si wafer , about 500 nanometer to 1 micron topside ni deposition and 200 nanometer al deposition , backside about 500 nanometer to 1 micron ni deposition and 200 nanometer al deposition , deposition of the topside nonconductive layer by either of the techniques described in the previous exemplary embodiments , and deposition of the backside nonconductive layer by either of the techniques described in the previous exemplary embodiments . fig3 a shows how fabrication proceeds for this exemplary embodiment . just as in the initial exemplary embodiment , a 200 nanometer al etch mask 303 is deposited on the nonconductive layer 301 by the same techniques . after the al deposition , a standard photolithography step is performed to define features in the photoresist layer 304 . these features , unlike the previous exemplary embodiments , will not be used to etch down to the nonconductive layer 302 . instead , these features will be used to define features that are etched partially down the nonconductive layer , which will be referred to as isolation notches . the purpose of these features is to delay touching of indium of adjacent plating regions of the template wafer . as previously set forth , indium overgrowth above the nonconductive layer facilitates the indium transfer process . as overgrowth occurs , lateral growth of indium occurs as well . these isolation notches will essentially isolate adjacent growth areas from one another by providing a longer path for lateral growth before touching occurs . the dimension of these features will depend on the pitch and size of bumps required . for 10 micron pitch bumps with an individual size of 3 microns , e . g ., 2 micron notches can be used . as discussed in the initial exemplary embodiment , the size of these features is limited by the photolithography process involved . the al layer is then etched , where exposed regions are etched , exposing the nonconductive layer underneath . the etching can be performed either by chemical etching or plasma etching as discussed in the initial exemplary embodiment . fig3 b shows the template wafer after etching of the al etch mask layer and removal of the photoresist with acetone or photoresist stripper . after definition of the etch mask , the nonconductive layer 305 is defined by a plasma etching step using the same techniques as the described in the initial exemplary embodiment . the etching proceeds until roughly half of the thickness of the exposed nonconductive layer is exposed to form the isolation notches . fig3 c shows the template wafer after the nonconductive layer etching process to define isolation notches 306 and removal of the al layer by a chemical etch previously described . fig3 d shows the deposition , patterning and etching of an al etch mask necessary to define the top side nonconductive layer 307 . this process follows the procedure of the initial exemplary embodiment , where a 200 nanometer al layer 308 is deposited , followed by definition of features in a photoresist layer 309 by a standard photolithography process and etching away of the exposed al layer . fig3 e shows the template wafer after etching of the al etch mask layer and removal of the photoresist with acetone or photoresist stripper . after etching of the al etch mask , fabrication proceeds as in the initial embodiment . this includes : plasma etching of the topside nonconductive layer 310 , removal of the 200 nanometer thick al etch mask 311 , and etching of the exposed 200 nanometer thick al under layer 312 . the completed template wafer is shown in fig3 f . yet , another exemplary embodiment follows fig2 a . the following steps occur in the same manner as the initial embodiment : degreasing and oxide etching dip of the si wafer , about 500 nanometer to 1 micron topside ni deposition and 200 nanometer al deposition , backside about 500 nanometer to 1 micron ni deposition and 200 nanometer al deposition , deposition of the topside nonconductive layer by either of the techniques described in the previous embodiments , and deposition of the backside nonconductive layer by either of the techniques described in the previous embodiments . this exemplary embodiment differs from previous ones in the way that the features on the topside nonconductive layer are defined . rather than using an etch mask followed by etching , this exemplary embodiment involves imprinting the topside nonconductive layer with features defined on another wafer , to be called the imprinting wafer . the result is that the features on the nonconductive layer will be a negative of the features defined on the imprinting wafer . the procedure for this process is described below . as shown in fig4 a , fabrication of such an exemplary imprinting wafer begins with a si wafer 401 of the same dimensions as the si wafer used as the core of the template wafer . a standard photolithography step is performed to define features in the photoresist layer 402 . in the end , these features 403 will be used to etch into the silicon wafer and then imprinted into the nonconductive layer to form the mesas 215 shown in fig2 e . the dimension of these features will depend on the pitch and size of bumps required . if a 10 micron bump pitch is desired with 3 micron bumps , these features will be roughly 7 microns because these features are the negative of the features imprinted in the nonconductive layer . fig4 b shows such an exemplary patterned imprinting wafer after etching trenches 404 in it . these trenches can be formed by placing the wafer in a plasma etching system , such as a reactive ion etching ( rie ) system or inductively coupled plasma ( icp ) etching system where a mixture of o 2 and sf 6 etch away the exposed si . sidewall angle is controlled by the ratio of the two gasses and is controlled to etch sidewalls roughly 70 degrees with respect to the surface of the imprinting wafer . etching proceeds until the etch depth is equal to the thickness of the nonconductive layer . after etching , the photoresist layer is removed with acetone or photoresist stripper . after completing the fabrication of the imprinting wafer , the imprinting step follows , shown in fig4 c . the incomplete template wafer 405 , consisting of a conductive layer 406 , an undefined topside nonconductive layer 407 and a nonconductive backside layer 408 , is placed on the vacuum chuck 409 of a hybrid bump - bonder capable of micron resolution alignment . one such piece of equipment is the suss microtec fc - 150 . the imprinting wafer 410 is placed on the other vacuum chuck 411 . the two wafers are roughly aligned and heated past the glass transition temperature of the nonconductive layer . if this layer was formed using the first embodiment using teflon af 1601s , this temperature is 160 ° c . if this layer was formed using the second embodiment , this temperature will depend on the specific ptfe used . after heating , the two wafers are pressed together , held for several minutes , allowed to cool back to room temperature , and finally separated from one another . the result is an exemplary completed template wafer , shown in fig4 d . using this process , it is possible to form the isolation notches fabricated in the third embodiment . this requires an extra photolithography and etching step in the imprinting wafer to form negatives of the notches . the invention has been described in an illustrative manner . it is to be understood that the terminology which has been used is intended to be in the nature of words of description rather than limitation . many modifications and variations of the invention are possible in light of the above teachings . therefore , within the scope of the appended claims , the invention may be practiced other than as specifically described .
| 7 |
as used herein , “ margarines ” include an aqueous phase and at least 80 wt % of a fat phase . although spreads are often used to mean similar products which contain less than 80 % fat phase , for convenience in the present application the word “ spreads ” is used also to include margarines unless otherwise stated explicitly or clearly required by context . the product of the invention can be either a margarine having 80 wt % fat or higher , or a spread having less than 80 wt % fat . preferably the margarine or spread has a continuous fat phase and a dispersed aqueous phase , i . e ., it is a water - in - oil emulsion . however , other arrangements can be used including but not limited to a continuous aqueous phase and dispersed fat phase ( oil - in - water emulsion ), or water - in - oil in water emulsion and oil - in - water - in oil emulsions . consistent with the desired indulgent taste , the margarine or spread of the invention preferably includes at least 70 wt % fat phase , especially at least 75 wt % fat phase up to 85 wt % fat phase or so . the fat phase will typically predominantly comprise edible triglcyerides , e . g . 95 - 99 wt % of the fat phase will be edible triglyceride . since saturated fatty acids are ideally minimized , the fat of the spreads preferably include from 0 to less than 18 wt % saturated fatty acids , preferably from 1 to 17 wt % saturated fatty acids most preferably from 5 to 15 wt % saturated fatty acids . likewise trans fatty acids are preferably minimized or eliminated . if present , they are preferably present at no more than 1 . 5 wt % of the fat , especially less than 1 wt % of the fat , more preferably between 0 . 001 wt % and 0 . 5 wt % of the fat . in accordance with the invention , the fat includes at least 30 wt % monounsaturated fatty acids and at least 30 wt % polyunsaturated fatty acids . more preferably , the fat includes at least 35 wt % monounsaturated fatty acids and at least 35 wt % polyunsaturated fatty acids . the spreads of the invention preferably include similar levels of monounsaturated fatty acids and polyunsaturated fatty acids to attempt to ensure that consumers receive full benefits of both . for example , the monounsaturated fatty acids are preferably between 125 % and 75 % of the level of polyunsaturated fatty acids , especially between 125 % and 80 %, especially between 125 % and 90 % ( calculated by dividing the monounsaturated fatty acids weight percent in the fat phase by the fat phase polyunsaturated fatty acids weight percentage ). soybean oil is preferably included at from 340 wt % of the total fat . as indicated above , the fat phase is formed by combining one or more liquid ( at 72 ° f .) oils with a hard fat , which is substantially solid at 72 ° f ., and which imparts structure to the spread . typically the fat includes 5 - 15 wt % hard fat and 85 - 95 wt % liquid oil . the liquid oils preferably are one or more of soybean , canola ( low erucic acid rapeseed oil ), corn , sunflower , rapeseed , safflower , cottonseed , peanut and olive oils . especially preferred is a combination of soybean , canola and sunflower oils . although less preferred , other digestible fat sources which may be used for the liquid oil are fish oil , milk fat , skim milk fat , and butterfat . omega 6 fats , such as linoleic acid , are known for their ability to lower serum ldl cholesterol levels in humans . accordingly , it is preferred that at least 80 wt % of the polyunsaturated fats used in the invention , more preferably at least 90 wt % of the polyunsaturated fat used in the invention are omega 6 fats , more preferably they are linoleic acid . if desired , a limited amount of omega 3 fats such as docosahexaenoic acid and eicosapantaenoic acid can be included within the fat of the invention . in view of the desire to minimize or eliminate trans fats , the fats and oils used in the spread or margarine of the invention preferably are not subjected to chemical hydrogenation , that is hydrogenation other than occurs in nature . hard fats are solid at 72 ° f . and preferably comprise interesterified fractions of palm and palm kernel oils . fats / oils useful in hard fats include soybean , canola , corn , sunflower , palm , palm kernel , rapeseed , coconut , safflower , cottonseed , peanut and olive oils , fish oil , milk fat , skim milk fat , butterfat , lard and tallow and fractions or fractions thereof or interesterifications of the oils or their fractions . examples of suitable hard fats , and procedures for their preparation , are described in huizing a et al . u . s . pat . no . 6 , 156 , 370 , the disclosure of which is hereby incorporated herein . non - digestible fats may also be used as the fat source . among the non - digestible fats are included polyol polyesters of c 8 to c 22 fatty acids such as sucrose polyester , sucrose polyethers , silicone oils / siloxanes , polycarboxylic acid esters , branched chain fatty acid triglycerides , neopentyl alcohol esters , dicarboxylic acid esters , jojoba oil and triglycerol ethers . non - digestible fats may be used as from 0 to 100 % of the fat , especially from 10 to 90 %, and most especially from 25 to 75 %. non - lipid fat replacers may also be used , to provide body to the product . these include protein - based fat replacers such as those described in singer et al ., u . s . pat . no . 4 , 961 , 953 and cellulosic bulking agents such as microcrystalline cellulose and carboxymethyl cellulose . optional ingredients in the fat phase include emulsifiers , salt ( particularly sodium chloride or potassium chloride ), preservatives , flavors , protein , vitamins , especially fat soluble vitamins such as vitamin . a , antioxidants , antimicrobials , and preservatives including citric and other acids . the emulsifiers can include mono - and diglycerides , polyglycerol esters , lecithin and polyoxyethylene sorbitan monoesters such as tween 60 and tween 80 . emulsifiers may be included at from 0 . 05 to 2 % by weight , typically not more than 1 % by weight . coloring agents , such as beta carotene , paprika , turmeric , annatto and yellow # 5 and 6 and combinations thereof may be employed . the yellow color may desirably be used in combination with an opacifier like tio 2 . preservatives , such as benzoic acid , sorbic acid , phosphoric acid , lactic acid , acetic acid , hydrochloric acid and the soluble salts thereof may be used . antioxidants may include propyl gallate , the tocopherols , including vitamin e , butylated hydroxyanisole ( bha ), butylated hydroxytoluene ( bht ), nordihydrorguaiaretic acid ( ndga ), tertiary - butylhydroquinon ( tbqh ) and citric acid . metal chelators or sequestrants such as sodium calcium salts of ethylenediamine tetra acetic acid ( edta ) may also be used . the aqueous phase comprises water and , optionally , other ingredients . a preferred ingredient is one or more gelling agents such as gelatin . it may be advantageous for the aqueous composition to be pre - gelled , i . e ., gelled prior to combining the aqueous composition with the fat - continuous emulsion . other suitable gelling agents include waxy maize starch such as ultra - tex 2 , available from the national starch and chemical co ., bridgewater , n . j . or a rice starch such as remyrise ac . a particularly effective combination of gelling agents has proven to be gelatin and waxy maize or rice starch . other gelling agents include carrageenan , and a gelling hydrolyzed starch derivative such as gelling maltodextrin , for example , paselli maltodextrin sa2 ®. the amount of gelling agent may lie between 0 and 15 %, mostly between 0 . 1 and 25 % based on the weight of the aqueous phase of the spread . if hydrolyzed starches are present , their level may be from 2 - 20 %; other gelling agents may be used at levels of up to 10 %, mostly 1 - 7 %, most preferred 2 - 5 %, all of these percentages being based on the weight of the aqueous phase . hydrocolloids which are thickening rather than gelling agents may also be used . hydrocolloids are described in zeitschrift fur lebenmittletechnologie and verfahrenstechnk 32 ( 1981 ) 6 , pp . 253 - 256 . hydrocolloids in addition to those mentioned above include polysaccharides such as native and modified starches , cellulose derivatives , pectins , galleon , xanthan gum , agar , danish agar , furcellaran , gum arabic , guar gum , locust bean gum , algin , and alginates . hydrocolloids will generally be used at levels of from 0 . 2 to 6 %, based on total product . it will be appreciated that the gelling and thickening agents may be used in various combinations . additional ingredients which may be present in the aqueous phase include salt ( particularly sodium chloride ), preservatives , such as potassium sorbate , lactic and other acid , proteins , coloring agents , flavors , antimicrobials , antioxidants and vitamins , particularly water - soluble vitamins such as the b vitamins . proteins , water - soluble coloring agents , flavors , preservatives and antimicrobials and antioxidants useful in the aqueous composition are the same as those discussed above in connection with the fat phase , it being appreciated that generally the more hydrophilic additives are best placed in the aqueous phase . an optional ingredient which may be included in the fat or the aqueous phase is the sterol or sterol ester . sterols are known among other things , as cholesterol lowering agents . in this application where reference is made to sterols or sterol esters , this also includes their saturated derivatives , the stanol or stanol esters , and combinations of sterol - and stanols and / or their esters . sterols or phytosterols , also known as plant sterols or vegetable sterols can be classified in three groups , 4 - desmethylsterols , 4 - monomethylsterols and 4 , 4 ′- dimethylsterols . in oils they mainly exist as free sterols and sterol esters of fatty acids although sterol glucosides and acylated sterol glucosides are also present . there are three major phytosterols namely beta - sitosterol , stigmasterol and campesterol . schematic drawings of the components meant are as given in “ influence of processing on sterols of edible vegetable oils ” s . p . kochhar ; prog . lipid res . 22 : pp . 161 - 188 . the respective 5 alpha - saturated derivatives such as sitostanol , campestanol and ergostanol and their derivatives are in this specification referred to as stanols . preferably the ( optionally esterified ) sterol or stanol is selected from the group comprising fatty acid ester of 3 - sitosterol , 3 - sitostanol , campesterol , campestanol , stigmasterol , brassicasterol , brassicastanol or a mixture thereof . the sterols or stanols are optionally at least partly esterified with a fatty acid . preferably the sterols or stanols are esterified with one or more c 2 - 22 fatty acids . for the purpose of the invention the term c 2 - 22 fatty acid refers to any molecule comprising a c 2 - 22 main chain and at least one acid group . although not preferred within the present context the c 2 - 22 main chain may be partially substituted or side chains may be present . preferably , however the c 2 - 22 fatty acids are linear molecules comprising one or two acid group ( s ) as end group ( s ). most preferred are linear c 8 - 22 fat acids as these occur in natural oils . suitable examples of any such fatty acids are acetic acid , propionic acid , butyric acid , caproic acid , caprylic acid , capric acid . other suitable acids are for example citric acid , lactic acid , oxalic acid and maleic acid . most preferred are myristic acid , lauric acid , palmitic acid , stearic acid , arachidic add , behenic acid , oleic add , cetoleic acid , erucic acid , elaidic acid , linoleic acid and linolenic acid . when desired a mixture of fatty acids may be used for esterification of the sterols or stanols . for example , it is possible to use a naturally occurring fat or oil as a source of the fatty acid and to carry out the esterification via an interesterification reaction . the amount of sterol in the spread , if used , is preferably from 0 to 15 % on total weight of the spread , preferably from 0 . 5 to 10 wt %. the amount of crystallized fat is determined by nmr at the indicated temperature , as described in “ fette , seifen , anstrichmittel ” 80 ( 1978 ), 180 - 186 ( n - value , expressed in weight percent ). for example , n10 would indicate the amount of crystallized fat at 10 ° c . the d3 . 3 value indicates the average particle size calculated with weighing factors according to volume . see m alderliesten , part , part . syst . caract . 7 ( 1990 ), 233 . d3 . 3 values herein are for the dispersed aqueous phase droplets . unless otherwise indicated or required by context , d3 . 3 is given in microns . e - sigma is the droplet size distribution when plotted as a function of the logarithm of the diameter . sigma . ( e - sigma ). e - sigma is a measure for the width of the droplet - size distribution . the “ stevens ” hardness ( st ) is expressed in grams . the product is stored at 5 [ deg .] c . and thereafter equilibrated for 24 hours at a temperature of 5 [ deg .] c . or 20 [ deg .] c . as indicated . the stevens value is measured using a 6 . 4 mm 0 cylindrical penetration probe and a stevens - lfra texture analyzer ( ex stevens advanced weighing . systems , dunmore , u . k .) or sms texture analyzer xt2 ( ex stable microsystems , surrey uk ). the load range is 1000 g for lfra and 25000 g for sms ta - tx2 equipment . the stevens lfra texture analyzer is operated in the “ normal ” mode and set at 10 mm penetration depth and 2 mm / s penetration rate . the balance of the spread is largely water , which may be incorporated at levels of up to 30 % by weight , more generally from 10 to 25 wt %, preferably from 20 to 25 % by weight . unless stated otherwise or required by context , the terms “ fat ” and “ oil ” are used interchangeably herein . unless otherwise stated or required by context , percentages are by weight . sterols and their esters shall not be counted when considering of components of the fat or aqueous phases or in the total fat of the product . as indicated above , unless otherwise indicated or clearly required by context , percentages of fatty acids in this application are given in terms of the total amount of fatty acids , i . e ., the calculation excludes the glycerol component of the triglyceride . it will be appreciated in preparation of the spreads normally more hydrophobic additives will be added to the fat phase whereas more hydrophilic additives will normally be added to the aqueous phase . liquid soybean oil ( held at ambient temperatures ), liquid canola oil ( held at ambient temperatures ), liquid sunflower oil ( held at ambient temperatures ), melted hard fat ( melted and held at 140 f , above melting point ), emulsifier / saturated monoglyceride ( melted ), emulsifier / lecithin ( melted ) are blended together and held at 130 ° f . water , buttermilk powder ( bagged ), salt ( bagged ), citric acid , calcium disodium edta , and potassium sorbate are mixed together , and then heat treated for 15 minutes at 165 ° f . the oil phase is brought to a batch tank and held at 130 f . agitation is turned on and the aqueous phase is added . then colors and flavors are added . the batch is then transferred to a run tank . the emulsion is sent through several cooling steps in scraped surface heat exchangers , and a working step in a crystallization unit to provide structure and growth of the fat crystals . the product is then filled into containers . so the margarine process is : emulsion in run tank — scraped surface heat exchanger to cool to 80 ° f .— scraped surface heat exchanger to cool to 70 ° f .— crystallization unit — scraped surface heat exchanger to cool to 40 ° f .— fill into tubs . the spread of the example has an indulgent taste and approximately 39 wt % on fat monounsaturated fatty adds , almost 40 wt % on fat polyunsaturated fatty acids and only approximately 15 wt % on fat saturated fatty acids . it should be understood of course that the specific forms of the invention herein illustrated and described are intended to be representative only , as certain changes may be made therein without departing from the clear teaching of the disclosure . accordingly , reference should be made to the appended claims in determining the full scope .
| 0 |
the present invention provides a complex circuit board and a fabrication method thereof by using mechanical - combining technique to effectively increase the pull strength of the complex circuit board and strengthen the connection of a printed circuit board assembly and a flexible printed circuit . furthermore , the elimination of the conventional step of attaching attachment units simplifies the assembly procedure and reduces the cost of attachment units . the complex circuit board of the present invention and a fabrication method thereof can achieve the advantages of improving the strength of the complex circuit board and reducing the product cost . as shown in fig3 a , the complex circuit board includes a printed circuit board assembly 300 and a flexible printed circuit 400 . the printed circuit board assembly 300 has a supporting section 310 and a connecting section 320 . the supporting section 310 supports several light sources 212 . specifically , the supporting section 310 has a supporting surface 312 and the light sources 212 are disposed on the supporting surface 312 . the light sources 212 are preferably light emitting diodes ( leds ) for supplying illumination . the connecting section 320 extends from one end of the supporting section 310 and is provided for fixing and electrically connecting with the flexible printed circuit 400 . the flexible printed circuit 400 is preferably formed by cutting from a flexible circuit board and has a contacting section 420 . the contacting section 420 of the flexible printed circuit 400 is disposed corresponding to the connecting section 320 of the printed circuit board assembly and electrically connected thereto to transmit control signals of the light sources 212 . fig3 b is a partially enlarged view of the complex circuit board . the connecting section 320 of the printed circuit board assembly 300 extends form the end of supporting section 310 . the connecting section 320 has a first surface 322 extending from the supporting surface 312 and a first side surface 324 adjacent to the first surface 322 . a first fixing portion 325 is disposed on the first side surface 324 . in the present embodiment , the first fixing portion 325 is a protrusion on the first side surface 324 . the connecting section 320 further includes a second surface 328 corresponding or opposite to the first surface 322 , preferably parallel to the first surface 322 . the first side surface 324 is situated between the first surface 322 and the second surface 328 and approximately perpendicular to the first surface 322 and the second surface 328 . a first connecting unit 327 is disposed on the connecting section 320 and correspondingly adjacent to the first fixing portion 325 . in the present embodiment , the first connecting unit 327 is disposed on the second surface 328 and can be , for example , electrical conductive patterns or contact pads to transmit control signals of the light sources 212 . the material of the first connecting unit 327 is preferably copper , aluminum or alloys thereof . the contacting section 420 of the flexible printed circuit 400 has a second connecting unit 427 . the contacting section 420 has a third surface 422 and a fourth surface 424 opposite to the third surface 422 , wherein the second connecting unit 427 can be disposed on the third surface 422 or the fourth surface 424 . in the present embodiment , the second connecting unit 427 is disposed on the third surface 422 . the second connecting unit 427 can be electrical conductive patterns or contact pads and the material can be copper , aluminum or alloys thereof . when the third surface 422 of the contacting section 420 and the second surface 328 of the connecting section 320 are correspondingly disposed , the second connecting unit 427 is electrically connected to the first connecting unit 327 of the printed circuit board assembly 300 . for example , the second connecting unit 427 can be soldered to the first connecting unit 327 using a hot bar process or electrically connected to the first connecting unit 327 by a thermal press process . a first fixing hole 425 is located between the second connecting unit 427 and the end of flexible printed circuit 400 . the first fixing portion 325 is inserted into the first fixing hole 425 to couple the printed circuit board assembly 300 and the flexible printed circuit 400 . after the printed circuit board assembly 300 and the flexible printed circuit 400 are combined , the extending directions of the circuit boards 300 , 400 are approximately perpendicular to each other . referring to fig3 c , the first fixing portion 325 is inserted into the first fixing hole 425 to assemble the printed circuit board assembly 300 with the flexible printed circuit 400 and electrically connect the first connecting unit 327 and the second connecting unit 427 . as shown in the fig3 b and fig3 c , the flexible printed circuit 400 is bent to form a first bend portion 410 and a second bend portion 430 . the extending direction of the flexible printed circuit 400 is changed via the first bend portion 410 and the second bend portion 430 from the contacting section 420 . the first bend portion 410 and the second bend portion 430 respectively have a bending angle . for example , the bending angle is 90 degrees or other specific degrees modulated according to the product design . in other words , the first bend portion 410 and the second bend portion 430 are located on two opposite sides of the contacting section 420 . furthermore , as shown in fig3 b and fig3 c , a first indentation 326 is preferably formed on the connecting section 320 and disposed on at least one side of the first fixing portion 325 . in the present embodiment , the first indentations 326 are disposed on two opposite sides of the first fixing portion 325 . the first indentation 326 at least partially accommodates the first bend portion 410 of the flexible printed circuit 400 . when combining the complex circuit board , the strength of the combining section 330 is improved and the smoothness of the complex circuit board is promoted . similarly , another indentation can be disposed on the other side surface opposite to the first fixing portion 325 to at least partially accommodate the second bend portion 430 of the flexible printed circuit 400 . by means of the above structural design , the pull strength of the complex circuit board is structurally enhanced without using extra attachment units on the combining portion 330 and the assembly of the complex circuit board is easily accomplished . as shown in fig4 a to fig4 c , the present invention provides another embodiment , wherein the elements with same reference numbers are the same as those disclosed in the previous embodiment . as shown in fig4 a , the complex circuit board includes a printed circuit board assembly 300 and a flexible printed circuit 400 . the printed circuit board assembly 300 has a supporting section 310 and a connecting section 320 . the supporting section 310 supports several light sources 212 . specifically , the supporting section 310 has a supporting surface 312 and the light sources 212 are disposed on the supporting surface 312 . the light sources 212 preferably include light emitting diodes ( leds ) for supplying illumination . the connecting section 320 extends from one end of the supporting section 310 and is provided for fixing and electrically connecting with the flexible printed circuit 400 . the flexible printed circuit 400 is preferably formed by cutting from a flexible circuit board and has a contacting section 420 . the contacting section 420 of the flexible printed circuit 400 is disposed correspondingly to and electrically connected with the connecting section 320 of the printed circuit board assembly 300 to transmit control signals of the light sources 212 . fig4 b is a partially enlarged view of the complex circuit board . the connecting section 320 of the printed circuit board assembly 300 extends form the end of the supporting section 310 . the connecting section 320 has a first surface 322 extending from the supporting surface 312 and a first side surface 324 adjacent to the first surface 322 . a first fixing portion 325 is disposed on the first side surface 324 . in the present embodiment , the first fixing portion 325 is a protrusion on the first side surface 324 . a first connecting unit 327 is disposed on the first surface 322 of the connecting section 320 and adjacent to the first fixing portion 325 . in the present embodiment , the second side surface 329 is parallel to the first side surface 324 . a second fixing portion 321 is disposed on the second side surface 329 and is preferably a protrusion on the second side surface 329 . in the present embodiment , the protrusions of first fixing portion 325 and second fixing portion 321 are symmetrically located on two opposite sides of the first connecting unit 327 . the protrusion of first fixing portion 325 or second fixing portion 321 can be aligned to the first connecting unit 327 , but not limited thereto . that is , the protrusion of first fixing portion 325 or second fixing portion 321 can be not aligned to the first connecting unit 327 . the first connecting unit 327 is electrical conductive patterns or contact pads for transmitting control signals of the light sources 212 . the most common material of the first connecting unit 327 is copper , aluminum or alloys thereof . the contacting section 420 of the flexible printed circuit 400 has a second connecting unit 427 . the second connecting unit 427 is disposed on the fourth surface 424 . the second connecting unit 427 can be electrical conductive patterns or contact pads and the material is copper , aluminum or alloys thereof . when the fourth surface 424 of the contacting section 420 and the first surface 322 of the connecting section 320 are correspondingly disposed , the second connecting unit 427 is electrically connected to the first connecting unit 327 of the printed circuit board assembly 300 . for example , the second connecting unit 427 can be soldered to the first connecting unit 327 using a hot bar process or electrically connected to the first connecting unit 327 by a thermal press process . the contacting section 420 of the flexible printed circuit 400 further includes a first hook 401 and a second hook 402 . a first fixing hole 425 and a second fixing hole 421 are disposed on the first hook 401 and the second hook 402 , respectively . the first hook 401 and the second hook 402 are bent to form a first bend portion 410 and a second bend portion 430 . the first fixing portion 325 is inserted into the first fixing hole 425 and the second fixing portion 321 is inserted into the second fixing hole 421 to couple and fix the printed circuit board assembly 300 and the flexible printed circuit 400 . after the printed circuit board assembly 300 and the flexible printed circuit 400 are combined , the extending directions ( 300 a , 400 a , see fig4 b ) of the circuit boards 300 , 400 are approximately parallel . finally , the flexible printed circuit 400 is bent to form a third bend portion 440 . the extending direction of the flexible printed circuit 400 is changed via the third bend portion 440 . the third bend portion 440 has a bending angle . the bending angle can be a specific degree modulated according to the product design . in the present embodiment , the first bend portion 410 and the second bend portion 430 of the contacting section 420 are symmetrically disposed on two opposite sides of the second connecting unit 427 . the first hook 401 or the second hook 402 can be aligned or not aligned with the second connecting unit 427 . a first indentation 326 and a second indentation 323 are disposed on one side of the first fixing portion 325 and the second fixing portion 321 , respectively . the first indentation 326 is disposed between the first fixing portion 325 and the supporting section 310 . the second indentation 323 is disposed between the second fixing portion 321 and the supporting section 310 . the first indentation 326 and the second indentation 323 at least partially accommodate the first bend portion 410 and the second bend portion 430 of the flexible printed circuit 400 , respectively . therefore , the strength of the complex circuit board is improved due to the structural design . moreover , as shown in fig5 a to fig5 c , to enhance the strength of the combining section 330 , the first fixing portion 325 and the second fixing portion 321 can be rectangle , wedge , or arc shaped protrusions , so that the flexible printed circuit 400 and the printed circuit board assembly 300 are prevented from being detached from each other . the present invention also provides a fabrication method of the complex circuit board . as shown in fig6 , the step s 10 is forming a first fixing portion 325 on a connecting section 320 of a printed circuit board assembly 300 . in another embodiment , a second fixing portion 321 is further formed on the printed circuit board assembly 300 . the step s 10 further includes forming a first indentation 326 and a second indentation 323 on one side of the first fixing portion 325 and the second fixing portion 321 , respectively . the step s 20 includes forming a first fixing hole 425 on a contacting section 420 of the flexible printed circuit 400 . the first fixing hole 425 corresponds to the first fixing portion 325 . in another embodiment , a second fixing hole 421 is formed on the flexible printed circuit 400 and the second fixing hole 421 is disposed corresponding to the second fixing portion 321 . the step s 30 includes inserting the first fixing portion 325 into the first fixing hole 425 and inserting the second fixing portion 321 into the second fixing hole 421 to combine the flexible printed circuit 400 and the printed circuit board assembly 300 . the step s 40 includes bending the flexible printed circuit 400 at the first fixing hole 425 to form the first bend portion 410 . in another embodiment , the first hook 401 with the first fixing hole 425 and the second hook 402 with the second fixing hole 421 are bent to form the first bend portion 410 and the second bend portion 430 of the flexible printed circuit 400 . the first bend portion 410 is parallel to the second bend portion 430 . the first indentation 326 and the second indentation 323 at least partially accommodate the first bend portion 410 and the second bend portion 430 of the flexible printed circuit 400 , respectively . the step s 50 includes bending the flexible printed circuit 400 from another side of the contacting section 420 to form a third bend portion 440 . in another words , before the third bend portion 440 is formed , the bending directions of the first hook 401 and the second hook 402 are respectively perpendicular to the extending direction of the flexible printed circuit 400 . the step s 60 includes electrically connecting the flexible printed circuit 400 and the printed circuit board assembly 300 . the circuit boards 300 , 400 are soldered using the hot bar process . the flexible printed circuit 400 and the printed circuit board assembly 300 are combined and electrically connected via the first connecting unit 427 and the second connecting unit 327 . although the preferred embodiments of the present invention have been described herein , the above description is merely illustrative . further modification of the invention herein disclosed will occur to those skilled in the respective arts and all such modifications are deemed to be within the scope of the invention as defined by the appended claims .
| 8 |
reference will now be made to the drawing figures to describe the present invention in detail . referring to fig1 - 3 , a connector assembly 100 in accordance with the first embodiment of the present invention comprises an insulative housing 2 , a plurality of conductive contacts 3 assembled to the housing 2 , a circuit board 4 assembled to the housing 2 , a plurality of conductive elements 8 respectively electrically connecting with the contacts 3 and the circuit board 4 , a strain relief member 5 assembled to and electrically connecting with the circuit board 4 , a cable ( not shown ) electrically connecting with the strain relief member 5 and the circuit board 4 to achieve the electrical connection with the conductive contacts 3 , front and rear covers 1 , 7 respectively assembled to the housing 2 and together enclosing the elements mentioned above therebetween . now turning to fig1 - 2 , the housing 2 is made from insulative material . the housing 2 defines two pairs of large - size first receiving passages 23 and a center small - size second receiving passage 24 respectively recessed from a front face thereof to a rear face thereof . particularly , the right side surface is curved for forming a whole toothbrush design of the connector assembly 100 . now referring to fig1 - 2 , the conductive contacts 3 consist of a pair of ground contacts 32 , a pair of power contacts 31 located between the pair of ground contacts 32 and a center detect contact 33 located between the pair of power contacts 31 . each contact 3 is of a pogo pin type ( spring - type pin pressure pin ), that is to say , there is a spring ( not shown ) inside the contact 3 , thus , when mating , front contacting portion 37 of the contact 3 can be pressed to rearward move along the mating direction . each ground contact 32 comprises the column - shape contacting portion 37 with a relatively small diameter and capable of being compressed , a column - shape media portion 35 with a relatively large diameter , and an end portion 36 formed at rear end of the media portion 35 with a column - shape and larger diameter . the power contact 31 has the same structure as that of the ground contact 32 except the contacting portion 37 thereof has a length shorter than that of the ground contact 32 . thus , the ground contacts 32 will firstly mate with a complementary connector and lastly disengage from the complementary connector for assuring safe power and signal transmission . the detect contact 33 has the same structure as that of the power contact 31 except each portion thereof has a smaller diameter than that of the power contact 31 . referring to fig1 - 2 and 4 , the conductive elements 8 , or the solder tails , consist of five pieces and each is z - shape . each conductive element 8 comprises a first connecting section 81 , a second connecting section 82 parallel to the first connecting section 81 , and a horizontal media section 83 interconnecting the first and second connecting sections 81 , 82 . referring to fig1 - 2 , the circuit board 4 is mainly located in a vertical plane and has a certain thickness along a front - to - back direction , that is , the mating direction . the circuit board 4 comprises a substrate 40 having a front surface and an opposite rear surface , also having a left end and a right end . a plurality of passageways 41 penetrating from the front surface to the rear surface of the substrate 40 with diameters corresponding the those of the media portions 35 of the contacts 3 . the passageways 41 are arranged in one line along transverse direction perpendicular to the mating direction . a plurality of through holes 42 are defined in the substrate 40 and around the right end of the substrate 40 . each through hole 42 is plated with conductive material for electrically soldering with conductors of the cable ( not shown ). a pair of leds ( light emitting diode ) is formed on the front surface and the rear surface and located adjacent to the left end of the substrate 40 . the circuit board 4 may be equipped with an ic 44 for driving the leds 43 to emit light . the strain relief member 5 is stamped from metal material or other conductive material . the strain relief member 5 comprises a strain relief section 52 for grasping with metal braiding layer of the cable ( not shown ) and a pair of arms 51 extending horizontally from upper and lower locations of the strain relief section 52 and parallel to each other . each arm 51 located in the horizontal plane and comprises an inclined section 511 connecting with the strain relief section 52 , a flat section 512 , and a tail section 510 formed at free end of the flat section 512 . the tail section 510 is of u - shape and comprises a pair of side sections bending from the flat section to form the u - shape for electrically connecting with the circuit board 4 . the cable comprises a plurality of wires each comprising an inner conductor , a metal braiding layer surrounding the inner conductor , and an outer jacket enclosing the metal braiding layer . a front portion of the outer jacket is stripped to expose part of the inner conductor and the metal braiding layer . the front and rear covers 1 , 7 are respectively assembled to the housing 2 . the front cover 1 is made from conductive material and capable of being attracted by the complementary connector . the front cover 1 comprises a body portion 12 and a front rectangular flange 10 with certain thickness and formed with front edge of the body portion 12 . the flange 10 defines an elliptical - shape front receiving cavity 101 recessed rearwardly from a front surface thereof for receiving complementary connector . the body portion 12 defines a rectangular rear receiving passage 120 recessed forwardly from a rear surface thereof to communicate with the front receiving cavity 101 for receiving the housing 2 . the receiving passage 120 has a large size along a lateral direction of the front cover 1 than that of the receiving cavity 101 , thus , forming a step surface 16 . the rear cover 7 is made from resin material and of toothbrush shape . the rear cover 7 comprises a substantially rectangular main body 70 and a pipe - shape existing portion 72 extending vertically from the main body 70 . the main body 70 defines a receiving space 700 recessed rearwardly from front surface thereof , while , the existing portion 72 defines a circular existing channel 720 communicating with the receiving space 700 for existing the cable therefrom . particularly , the rear cover 7 defines a window area 73 with irregular shape . a light pipe 71 is firstly molded and shaped corresponding to the configuration of the left end of the circuit board 4 and the pair of leds 43 , then the rear cover 7 is molded over the light pipe 71 to expose the light pipe 71 in the window area 73 . thus , the rear cover 7 and the light pipe 71 are formed as a unitary one . the light emitted from the pair of leds 43 spreads from the inner mold 6 to the light pipe 71 , and finally can be seen from outside . the inner mold 6 is made from transparent or semitransparent material and the light emitted from the leds 43 is capable of being spread out through the inner mold 6 to outside . referring to fig3 - 8 in conjunction with fig1 - 2 , in assembly , the conductive contacts 3 firstly pass through the passageways 41 of the circuit board 4 from rear - to - front direction until the end portions 36 abutting against the rear surface of the circuit board 4 . each z - shape solder tail 8 is respectively soldered with corresponding contact 3 and trace formed on the rear surface of the circuit board 4 . the first and second connecting sections 81 , 82 are respectively soldered to the end portion 36 and the trace of the circuit board 4 , while , the media section 83 attaches to side surface of the end portion 36 . the contacts 3 then are assembled to the insulative housing 2 with the media portions 35 interferentially received in the first and second receiving passages 23 , 24 of the housing 2 , while , the contacting portions 37 exposed beyond the front surface of the insulative housing 2 . the housing 2 with the contacts 3 and the circuit board 4 is assembled to the front cover 1 with the housing 2 received in the receiving passage 120 of the body portion 12 and the contacting portions 37 of the contacts 3 are exposed in the receiving cavity 101 . then the inner mold 6 is molded to the connection area between the contacts 3 and the circuit board 4 , the solder tails 8 , and rear portion of the insulative housing 2 . since the material of the inner mold 6 is transparent or semitransparent , the light emitted from the leds 43 of the circuit board 4 can be spread out from the left corner of the inner mold 6 . the conductors of the cable ( not shown ) are soldered to the through holes 42 of the circuit board 4 to form electrical connection with the circuit board 4 , further with the contacts 3 . the strain relief member 5 is assembled to the circuit board 4 and the cable . the pair of u - shape tail sections 510 are respectively soldered to traces arranged on front and rear surface of the circuit board 4 adjacent to the through holes 42 of the circuit board 4 . the front end of the cable is sandwiched between the pair of arms 51 and compressed by the inclined sections 511 and grasped by the strain relief section 52 . particularly , the front end of the cable is partially stripped to expose the inner metal braiding layer which is grasped by the strain relief section 52 of the strain relief member 5 to form electrical connection with the circuit board 4 . finally , the rear cover 7 and the light pipe 71 are assembled to the assembly achieved above to enclose the all elements except for the flange 10 of the front cover 1 . thus , the toothbrush configuration of the connector assembly 100 is achieved . after the assembly , the front portion of the cable is received in the pipe - shape existing portion 72 of the rear cover 7 and other portion exists from the rear end of the existing portion 72 . now referring to fig9 , a second embodiment of the solder tails 8 ′ is shown . the solder tail 8 ′ is of ω - shape and comprises a pair of second connecting sections 82 ′ soldered with the traces of the circuit board 4 , the first connecting section 81 ′ soldered with the end portions 36 of the contacts 3 , and a pair of media sections 83 ′ respectively connecting the opposite ends of the second connecting section 82 ′ with the pair of first connecting sections 81 ′. it is to be understood , however , that even though numerous characteristics and advantages of the present invention have been set forth in the foregoing description , together with details of the structure and function of the invention , the disclosure is illustrative only , and changes may be made in detail , especially in matters of shape , size , and arrangement of parts within the principles of the invention to the full extent indicated by the broad general meaning of the terms in which the appended claims are expressed .
| 7 |
the present disclosure will be further explained in conjunction with specific examples , which are not to limit the scope of the present disclosure . the α - alumina carrier of the present disclosure is modified by the elements of lanthanum and silicon . the carrier can be used for producing ethylene oxide by oxidation of ethylene . in some embodiments , the mass ratio of the element of lanthanum to the element of silicon in the carrier is in the range from 0 . 1 : 1 to 20 : 1 . in some embodiments , the mass ratio of the element of lanthanum to the element of silicon in the carrier is in the range from 0 . 5 : 1 to 2 . 5 : 1 . in some embodiments , the mass ratio of the element of lanthanum to the element of silicon in the carrier is in the range from 3 . 0 : 1 to 4 . 5 : 1 . in some embodiments , the mass ratio of the element of lanthanum to the element of silicon in the carrier is in the range from 5 . 0 : 1 to 7 . 5 : 1 . in some embodiments , the mass ratio of the element of lanthanum to the element of silicon in the carrier is in the range from 8 . 0 : 1 to 12 . 0 : 1 . in some embodiments , the mass ratio of the element of lanthanum to the element of silicon in the carrier is in the range from 2 . 0 : 1 to 10 . 0 : 1 . in some embodiments , the mass ratio of the element of lanthanum to the element of silicon in the carrier is in the range from 2 . 0 : 1 to 9 . 0 : 1 . in some other embodiments , the mass ratio of the element of lanthanum to the element of silicon in the carrier is in the range from 2 . 0 : 1 to 8 . 0 : 1 . the initial activity and selectivity of the silver catalysts involved in the present disclosure were measured by a laboratory microreactor ( hereinafter “ microreactor ”) evaluation device , which is a stainless steel tube with an inner diameter of 4 mm and is arranged in a heating jacket . the loading volume of the catalyst is 1 ml filled with an inert filler at a lower portion thereof , so that the catalyst bed is located in a constant temperature zone of the heating jacket . the activity and selectivity measurement conditions employed in the present disclosure were as follows . when the above reaction conditions were stably obtained , the composition of the gasses at the inlet and outlet of the reactor were constantly measured . the measurement results after applying volume shrinkage correction were used for calculation of the selectivity ( s ) by the following formula : in the above formula , δeo represents the differential concentration of ethylene oxide in the inlet gas and the outlet gas , and δco 2 represents the differential concentration of carbon dioxide in the inlet gas and the outlet gas . the average of 10 groups of test data was taken as the test result of the day . a mixture of 372 g of trihydrate alumina having a particle size in the range from 200 meshes to 500 meshes , 112 g of pseudo bohemite having a particle size in the range from 200 meshes to 400 meshes , 3 g of mgf 2 , and 0 . 5 g of ba ( no 3 ) 2 were added into a mixer and homogeneously blended , and then transferred to a kneader , followed by addition of 90 ml of dilute nitric acid solution ( the weight ratio of nitric acid to water being 1 : 3 ) into the kneader . the resulting mixture was kneaded into an extrudable and moldable paste , and extrusion molded into five - hole cylinder bodies , of which the outer diameter , length , and inner diameter were 8 . 0 mm , 6 . 0 mm , and 1 . 0 mm , respectively . the cylinder bodies were dried for 10 h at a temperature in the range from 80 ° c . to 120 ° c . to reduce the free water content thereof to be lower than 10 wt %, so as to prepare the green bodies of molded α - alumina carriers . the green bodies were then put into an electric furnace , which was heated from room temperature to 1 , 400 ° c . within 30 h and kept constant at this temperature for 2 h to obtain the white α - alumina carriers named z - 1 . the side crushing strength , water adsorption , and specific surface area of z - 1 were measured and the results thereof are shown in table 1 . a mixture of 372 g of trihydrate alumina having a particle size in the range from 200 meshes to 500 meshes , 112 g of pseudo bohemite having a particle size in the range from 200 meshes to 400 meshes , 3 g of mgf 2 , 0 . 5 g of ba ( no 3 ) 2 , and 0 . 51 g of sio 2 were added into a mixer and homogeneously blended , and then transferred to a kneader , followed by addition of 90 ml of dilute nitric acid solution ( the weight ratio of nitric acid to water being 1 : 3 ) into the kneader . the resulting mixture was kneaded into an extrudable and moldable paste , and extrusion molded into five - hole cylinder bodies , of which the outer diameter , length , and inner diameter were 8 . 0 mm , 6 . 0 mm , and 1 . 0 mm , respectively . the cylinder bodies were dried for 10 h at a temperature in the range from 80 ° c . to 120 ° c . to reduce the free water content thereof to be lower than 10 wt %, so as to prepare the green bodies of molded α - alumina carriers . the green bodies were then put into an electric furnace , which was heated from room temperature to 1 , 400 ° c . within 30 h and kept constant at this temperature for 2 h to obtain the white α - alumina carriers named z - 2 . the side crushing strength , water adsorption , and specific surface area of z - 2 were measured and the results thereof are shown in table 1 . a mixture of 372 g of trihydrate alumina having a particle size in the range from 200 meshes to 500 meshes , 112 g of pseudo bohemite having a particle size in the range from 200 meshes to 400 meshes , 3 g of mgf 2 , 0 . 5 g of ba ( no 3 ) 2 , and 0 . 58 g of la 2 o 3 were added into a mixer and homogeneously blended , and then transferred to a kneader , followed by addition of 90 ml of dilute nitric acid solution ( the weight ratio of nitric acid to water being 1 : 3 ) into the kneader . the resulting mixture was kneaded into an extrudable and moldable paste , and extrusion molded into five - hole cylinder bodies , of which the outer diameter , length , and inner diameter were 8 . 0 mm , 6 . 0 mm , and 1 . 0 mm , respectively . the cylinder bodies were dried for 10 h at a temperature in the range from 80 ° c . to 120 ° c . to reduce the free water content thereof to be lower than 10 wt %, so as to prepare the green bodies of molded α - alumina carriers . the green bodies were then put into an electric furnace , which was heated from room temperature to 1 , 400 ° c . within 30 h and kept constant at this temperature for 2 h to obtain the white α - alumina carriers named z - 3 . the side crushing strength , water adsorption , and specific surface area of z - 3 were measured and the results thereof are shown in table 1 . a mixture of 372 g of trihydrate alumina having a particle size in the range from 200 meshes to 500 meshes , 112 g of pseudo bohemite having a particle size in the range from 200 meshes to 400 meshes , 3 g of mgf 2 , 0 . 5 g of ba ( no 3 ) 2 , 0 . 58 g of la 2 o 3 , and 0 . 51 g of sio 2 were added into a mixer and homogeneously blended , and then transferred to a kneader , followed by addition of 90 ml of dilute nitric acid solution ( the weight ratio of nitric acid to water being 1 : 3 ) into the kneader . the resulting mixture was kneaded into an extrudable and moldable paste , and extrusion molded into five - hole cylinder bodies , of which the outer diameter , length , and inner diameter were 8 . 0 mm , 6 . 0 mm , and 1 . 0 mm , respectively . the cylinder bodies were dried for 10 h at a temperature in the range from 80 ° c . to 120 ° c . to reduce the free water content thereof to be lower than 10 wt %, so as to prepare the green bodies of molded α - alumina carriers . the green bodies were then put into an electric furnace , which was heated from room temperature to 1 , 400 ° c . within 30 h and kept constant at this temperature for 2 h to obtain the white α - alumina carriers named z - 4 . the side crushing strength , water adsorption , and specific surface area of z - 4 were measured and the results thereof are shown in table 1 . the steps were the same as those in example 4 except that the mixture contained 1 . 14 g of la 2 o 3 , and the white α - al 2 o 3 carrier obtained was named z - 5 . the side crushing strength , water adsorption , and specific surface area of z - 5 were measured and the results thereof are shown in table 1 . the steps were the same as those in example 4 except that the mixture contained 1 . 71 g of la 2 o 3 , and the white α - al 2 o 3 carrier obtained was named z - 6 . the side crushing strength , water adsorption , and specific surface area of z - 6 were measured and the results thereof are shown in table 1 . the steps were the same as those in example 4 except that the mixture contained 2 . 28 g of la 2 o 3 , and the white α - al 2 o 3 carrier obtained was named z - 7 . the side crushing strength , water adsorption , and specific surface area of z - 7 were measured and the results thereof are shown in table 1 . table 1 indicates that the alumina carrier of the present disclosure has significantly improved side crushing strength and reduced water adsorption , which is beneficial for used of the carrier . the alumina carrier of the present disclosure has a significantly improved specific surface area which can facilitate dispersion of silver . 700 g of silver nitrate was taken and dissolved in 750 ml of deionized water to obtain a solution . 325 g of ammonium oxalate was taken and dissolved into 250 ml of deionized water at 50 ° c . to obtain a solution . the above two solutions were mixed under violent stirring to generate a white precipitate of silver oxalate . after 1 h of aging treatment , filtration was performed and the filter cake obtained was washed with deionized water until there was no nitrate ion in the filtrate . a filter cake of a silver oxalate paste , which contained 60 wt % of the metal silver and 15 wt % of water , was thus obtained . 300 g of ethylenediamine , 110 g of ethanol amine , and 375 g of deionized water were added into a glass flask having a stirrer to obtain a mixed solution . the silver oxalate paste prepared above was slowly added into the mixed solution under stirring at a temperature kept in the range from − 5 ° c . to 10 ° c ., so as to enable complete dissolution of the silver oxalate . subsequently , 2 . 2 g of cesium sulfate and 1 . 4 g of strontium acetate were added , which preceded addition of deionized water so that the total mass of the solution reached 2 , 000 g . thus , impregnation liquid m , which contained 22 wt % of silver , was prepared for use . 100 g of the sample of z - 1 prepared in example 1 was taken and put into a container that could be vacuum pumped . the absolute pressure in the container was pumped to be lower than 10 mmhg and impregnation liquid m prepared above was added to impregnate the carrier for a period of 30 min . next , redundant solution was removed through leaching . the carrier after being impregnated was heated for 5 min in an air flow at 350 ° c ., and then cooled down to obtain a silver catalyst named cz - 1 . the steps were the same as those in example 8 except that 100 g of carrier z - 1 was replaced by 100 g of carrier z - 2 , and the silver catalyst obtained was named cz - 2 . the steps were the same as those in example 8 except that 100 g of carrier z - 1 was replaced by 100 g of carrier z - 3 , and the silver catalyst obtained was named cz - 3 . the steps were the same as those in example 8 except that 100 g of carrier z - 1 was replaced by 100 g of carrier z - 4 , and the silver catalyst obtained was named cz - 4 . the steps were the same as those in example 8 except that 100 g of carrier z - 1 was replaced by 100 g of carrier z - 5 , and the silver catalyst obtained was named cz - 5 . the steps were the same as those in example 8 except that 100 g of carrier z - 1 was replaced by 100 g of carrier z - 6 , and the silver catalyst obtained was named cz - 6 . the steps were the same as those in example 8 except that 100 g of carrier z - 1 was replaced by 100 g of carrier z - 7 , and the silver catalyst obtained was named cz - 7 . the steps were the same as those in example 8 except the following points . 2 . 41 g of na 2 sio 3 · 9h 2 o and 3 . 15 g of lacl 3 · 7h 2 o were added into impregnation liquid m to obtain an impregnation liquid containing the elements of silicon and lanthanum . 100 g of the carrier sample z - 1 prepared in example 1 was taken and added into a container that could be vacuum pumped . the absolute pressure in the container was pumped to be lower than 10 mmhg , followed by addition of the impregnation liquid prepared above containing the elements of silicon and lanthanum to impregnate the carrier for 30 min . the redundant solution was then removed by leaching . the carrier after being impregnated was heated for 5 min in an air flow at 350 ° c ., and then cooled down to obtain a silver catalyst named cz - 8 . the catalysts cz - 1 , cz - 2 , cz - 3 , cz - 4 , cz - 5 , cz - 6 , cz - 7 , and cz - 8 prepared in examples 8 to 14 were each analyzed for contents of silver and additives based on the metals , respectively . the results thereof show that the contents of silver and additives ( caesium and strontium ) among the catalysts were more or less the same with one another , respectively , wherein the contents of silver , caesium , and strontium were about 16 . 1 wt %, 360 ppm , and 280 ppm , respectively . in addition , the activity and selectivity of each of the catalysts were measured by the microcreator evaluation device under the process conditions as described above under “ measurement of catalytic performance ”. the data above temperature and selectivity on the 7th day of the reaction were listed in table 2 . table 2 indicates that , compared to an existing catalyst having a carrier which contains no silicon or lanthanum , the catalyst containing the carrier of the present disclosure has a lower reaction temperature , i . e ., a significantly improved reaction activity , while keeping a high selectivity of the silver catalyst . compared to a catalyst prepared by a carrier containing only silicon , the catalyst of the present disclosure possesses significantly improved selectivity while ensuring a low reaction temperature ( i . e ., a high reaction activity ). compared to a catalyst prepared by a carrier containing only lanthanum , the catalyst of the present disclosure possesses improved selectivity while ensuring a low reaction temperature ( i . e ., a high reaction activity ). and compared to a catalyst impregnated with the elements of silicon and lanthanum on the surface thereof ( cz - 8 ), the catalyst of the present disclosure has improved reaction activity and selectivity . table 2 shows that compared to a catalyst containing only the element of silicon or lanthanum ( cz - 2 or cz - 3 ), the catalyst of the present disclosure ( cz - 4 to cz - 7 ) which contains the elements of silicon and lanthanum presents a synergistic effect , and can further improve selectivity while keeping a low reaction temperature ( i . e ., a high reaction activity ). it should be noted that the above examples are only used to explain , rather than to limit the present disclosure in any manner . although the present disclosure has been discussed with reference to preferable examples , it should be understood that the terms and expressions adopted are for describing and explaining instead of limiting the present disclosure . the present disclosure can be modified within the scope of the claims , and can be amended without departing from the scope or spirits of the present disclosure . although the present disclosure is described with specific methods , materials , and examples , the scope of the present disclosure herein disclosed should not be limited by the particularly disclosed examples as described above , but can be extended to other methods and uses having the same functions .
| 1 |
next , with reference to the accompanying drawings , an embodiment of the present invention will be described . fig1 shows the structure of the system according to the embodiment of the present invention . a host system 40 and a memory apparatus 1 are connected through communication paths 31 and 41 . the memory apparatus 1 is a card shaped device that is removable from the host system 40 . the memory apparatus 1 has a communicating portion 30 that communicates with the host system 40 . the memory apparatus 1 has a data processing portion 20 and a memory portion 50 . the memory portion 50 is an irreversibly write memory that is called otp and of which data can be written one time . the memory apparatus 1 is also a non - volatile semiconductor memory . in other words , data that has been written to the memory portion 50 cannot be erased . after the power of the memory apparatus 1 is turned off , the stored data is retained . in the memory portion 50 , data is read and written in a predetermined data unit . the memory portion 50 has a boot area from which data is initially read by the host system when the memory is attached thereto . a variety of types of information such as attribute information are pre - recorded in the boot area . the data processing portion 20 and the communicating portion 30 are connected through internal buses 21 and 32 . likewise , the data processing portion 20 and the memory portion 50 are connected through internal buses 22 and 51 . the data processing portion 20 can access memory management information 10 through internal buses 13 , 23 , and 14 . the memory management information 10 contains an unusable block correlation table 11 and mapping reference information 12 . a memory apparatus 1 ′ shown in fig2 has a memory portion 56 . the memory portion 56 has a plurality of memory cells each of which is an irreversibly write memory . internal data buses 22 and 51 are disposed between a memory portion 56 and a data processing portion 20 . in this example , memory management information 10 is stored in a non - volatile memory . in this case , the memory management information 10 may be stored in a memory integrated with a memory portion 50 . alternatively , the memory management information 10 may be stored in the memory portion 50 , 56 . the host system 40 can write data to the memory portion 50 , 56 of the memory apparatus 1 , 1 ′ and read data therefrom . an example of the host system 40 is a personal computer . another example of the host system 40 is a digital electronic camera . a photographed picture is written to the memory apparatus 1 , 1 ′. in addition , a picture is read from the memory apparatus 1 , 1 ′. another example of the host system 40 is an audio recording / reproducing apparatus . in this case , compressed audio data is written to the memory apparatus 1 , 1 ′. in addition , compressed audio data is read from the memory apparatus 1 , 1 ′. fig3 shows an example of the unusable block correlation table 11 of the memory apparatus 1 that has one memory portion 50 . the table 11 has an unusable block number portion 60 and a substitute block number portion 61 . the unusable block number portion 60 contains k unusable block numbers in succession . the substitute block number portion 61 contains substitute block numbers corresponding to unusable block numbers . fig4 shows an unusable block correlation table 11 of the memory apparatus 1 ′ shown in fig2 . the unusable block correlation table 11 of the memory apparatus 1 ′ has an unusable block portion 62 and a substitute block number portion 63 . the unusable block portion 62 contains unusable block numbers in succession . the substitute block number portion 63 contains substitute block numbers in succession . in addition , each of the unusable block portion 62 and the substitute block number portion 63 contain cell numbers that distinguish a plurality of memory cells . the unusable block correlation table 11 is created by the data processing portion 20 . in the memory apparatus 1 shown in fig1 , when the data processing portion 20 recognizes any unusable physical block in the memory portion 50 , the data processing portion 20 sets the block number thereof to the unusable block number portion 60 through the internal bus 13 , designates a substitute usable block number , and sets the designated block number to the substitute block number portion 61 . in the memory apparatus 1 ′ shown in fig2 , when the data processing portion 20 recognizes any unusable physical block in the memory portion 56 , the data processing portion 20 sets the block number and the cell number thereof to the unusable block number portion 62 , designates a substitute usable block number and a cell number , and sets the designated block number and cell number to the substitute block number portion 63 . in the memory apparatus 1 ′ shown in fig2 , each cell may has an unusable block correlation table . in this case , the table is structured as shown in fig3 . next , with reference to fig5 , a method for referencing the unusable block correlation table created in the forgoing manner will be described . at step s 1 , the physical block number to be processed is designated as n phy . at step s 2 , i is initialized . at step s 3 , it is determined whether or not the i - th unusable block matches the physical block number n phy . when they do not match , the flow advances to step s 4 . at step s 4 , i is incremented . at step s 5 , it is determined whether or not i is equal to or larger than ( k − 1 ) at steps s 3 , s 4 , and s 5 , it is determined whether or not the physical block number n phy is an unusable block number . when the determined result at step s 3 represents that the physical block number n phy matches the i - th unusable block , the flow advances to step s 6 . at step s 6 , an i - th substitute block is used instead of the physical block number n phy . thereafter , the process is completed . in contrast , when the determined result at step s 5 represents that i is equal to or larger than ( k − 1 ), the flow advances to step s 7 . at step s 7 , the physical block number n phy is not an unusable block , but a usable block . thereafter , the process is completed . when physical block numbers or logical information of the unusable block correlation table are sorted in the ascending order or descending order , the process that references the unusable block correlation table can be performed at high speed . fig6 is a flow chart showing a high speed referencing process accomplished by sorting physical block numbers in the ascending order . at step s 11 , a physical block number n phy is designated as an object to be processed . at step s 12 , i is initialized . at step s 13 , it is determined whether or not an i - th unusable block matches the physical block number n phy . when they do not match , the flow advances to step s 14 . at step s 14 , it is determined whether or not the physical block number n phy is equal to or smaller than the i - th unusable block . when the determined result at step s 14 represents that the physical block number n phy is neither equal to nor smaller than the i - th unusable block , the flow advances to step s 15 . at step s 15 , i is incremented . at step s 16 , it is determined whether or not i is equal to or larger than ( k − 1 ). at steps s 13 , s 14 , s 15 , and s 16 , it is determined whether or not the physical block number n phy is an unusable block number . when the determined result at step s 13 represents that the physical block number n phy matches the i - th unusable block , the flow advances to step s 17 . at step s 17 , an i - th substitute block is used instead of the physical block number n phy . thereafter , the process is completed . when the determined result at step s 14 represents that the physical block number n phy is equal to or smaller than the i - th unusable block , the flow advances to step s 18 . at step s 18 , the physical block number n phy is not an unusable block , but a usable block . thereafter , the process is completed . when the determined result at step s 16 represents that i is equal to or larger than ( k − 1 ), the flow advances to step s 18 . at step s 18 , the physical block number n phy can be used . thereafter , the process is completed . in the process shown in fig6 , at step s 14 , it is determined whether or not the physical block number n phy is equal to or smaller than an i - th unusable block . since unusable blocks have been sorted in the ascending order , if the relation is satisfied , it can be determined that the physical block number n phy can be used without need to check the rest of the table . thus , the process can be performed at high speed . next , the mapping reference information 12 of the memory apparatus 1 and 1 ′ will be described . the mapping reference information 12 contains information necessary for converting logical information into physical information . fig7 shows the mapping reference information 12 of the memory apparatus 1 . the mapping reference information 12 is composed of a logical — physical conversion criterion 15 and a logical — physical conversion multiplier 16 . the logical — physical conversion criterion 15 is in reality 0 , + 2 , or the like . the logical — physical conversion multiplier 16 is in reality 4 , ½ , or the like . fig8 shows the mapping reference information 12 of the memory apparatus 1 ′. as with the mapping reference information 12 of the memory apparatus 1 , the mapping reference information 12 of the memory apparatus 1 ′ has a logical — physical conversion criterion 15 and a logical — physical conversion multiplier 16 . in addition , the mapping reference information 12 of the memory apparatus 1 ′ has a physical block number 17 corresponding to the number of cells of the memory portion . the physical block number 17 is in reality 512 , 1024 , or the like . the content of the mapping reference information 12 is set when the memory apparatus 1 , 1 ′ is structured . when the logical information unit is the same as the physical information unit and logical address 0 matches physical block number 0 in the memory apparatus 1 , the logical — physical conversion criterion 15 and the logical — physical conversion multiplier 16 of the mapping reference information 12 are set to “ 0 ” and “ 1 ”, respectively . when the logical information unit is twice as large as the physical information unit and logical address 0 corresponds to physical block numbers 4 and 5 in the memory apparatus 1 , the logical — physical conversion criterion 15 and the logical — physical conversion multiplier 16 of the mapping reference information 12 are set to “ 4 ” and “ 2 ”, respectively . when the logical information unit is ¼ times as small as the physical information unit and logical addresses 0 , 1 , 2 , and 3 correspond to physical block number 3 in the memory apparatus 1 , the logical — physical conversion criterion 15 and the logical — physical conversion multiplier 16 of the mapping reference information 12 are set to “ 3 ” and “ ¼ ”, respectively . when the logical information unit is the same as the physical information unit thereof , the number of physical blocks per cell of the memory portion is 1024 , and logical address 0 corresponds to physical block number 2 in the memory apparatus 1 ′, the logical — physical conversion criterion 15 , the logical — physical conversion multiplier 16 , and the physical block number 17 per cell of the mapping reference information 12 are set to “ 2 ”, “ 1 ”, and “ 1024 ”, respectively . with the forgoing mapping reference information 12 , a converting process from logical information into physical information is performed . in the system that uses the memory apparatus 1 shown in fig1 , an equation that calculates the physical block number n phy with the logical address n log is expressed as follows . where n base is a designated value of the logical — physical conversion criterion 15 and n mul is a designated value of the logical — physical conversion multiplier 16 . in the system that uses the memory apparatus 1 ′ shown in fig2 , an equation that calculates the physical block number n phy and the memory cell number n cell with the logical address n log can be expressed as follows . n phy =( n log × n mul + n base )% n blknum n cell =( n log × n mul + n base )÷ n blknum where n base is a designated value of the logical — physical conversion criterion 15 , n mul is a designated value of the logical — physical conversion multiplier 16 , and n blknum is a designated value per cell . the forgoing converting process from logical information into physical information is performed by the data processing portion 20 . alternatively , the converting process may be performed by the host system 40 . in this case , as an initializing process , the host system 40 should read and retain the content of the memory management information 10 from the memory apparatus 1 , 1 ′. fig9 is a flow chart showing the data reading process with the logical information n log in the case that the process that converts logical information into physical information is performed by the data processing portion 20 of the system shown in fig1 . at step s 21 , a data read request for the logical address n log is supplied from the host system 40 to the memory apparatus 1 . the data processing portion 20 receives the read request through the communicating portion 30 ( at step s 22 ). at step s 23 , the data processing portion 20 calculates the physical block number n phy corresponding to the logical address n log and the designated values n base and n mul of the mapping reference information 12 . at step s 24 , the data processing portion 20 determines that the physical block number n phy is not an unusable block with reference to the unusable block correlation table 11 . this process corresponds to the process shown in fig5 or fig6 . at step s 25 , it is determined whether or not the physical block number n phy is an unusable block . when the physical block number n phy is an unusable block , the flow advances to step s 26 . at step s 26 , a substitute block number is used instead of the physical block number n phy . at step s 27 , the physical block number n phy is read from the memory portion 50 . the read data is denoted by data ( n phy ). data ( n phy ) is supplied to the data processing portion 20 ( at step s 28 ). data ( n phy ) is supplied from the data processing portion 20 to the communicating portion 30 ( at step s 29 ). the communicating portion 30 supplies the read data data ( n phy ) to the host system 40 ( at step s 30 ) fig1 is a flow chart showing the data read process with the logical information n log in the case that the process that converts logical information into physical information is performed by the data processing portion 20 of the system shown in fig2 . steps s 21 , s 22 , and s 23 shown in fig9 correspond to steps s 31 , s 32 , and s 33 shown in fig1 , respectively . at step s 33 , the data processing portion 20 calculates the physical block number n phy and the cell number n cell corresponding to the logical address n log and the designated values n base , n mul , and n blknum of the mapping reference information 12 . steps s 24 , s 25 , s 26 , s 27 , s 28 , s 29 , and s 30 shown in fig9 correspond to steps s 34 , s 35 , s 36 , s 37 , s 38 , s 39 , and s 40 shown in fig1 , respectively . in fig1 , since the memory portion 56 is composed of a plurality of memory cells , the cell number n cell that designates a cell is used in addition to the physical block number n phy . fig1 is a flow chart showing the data reading process with the logical information n log in the case that the process that converts logical information into physical information is performed by the host system 40 in the system shown in fig1 . as an initializing process , the host system 40 supplies a read request for the mapping reference information 12 to the memory apparatus 1 . the memory apparatus 1 supplies the mapping reference information 12 to the host system 40 . the host system 40 converts a logical address into the physical block number n phy corresponding to the mapping reference information 12 . thus , at step s 41 , the host system 40 supplies a data read request for the physical block number n phy to the memory apparatus 1 . the data processing portion 20 receives the read request through the communicating portion 30 ( at step s 42 ). at step s 43 , the data processing portion 20 determines that the physical block number n phy is not an unusable block with reference to the unusable block correlation table 11 . at step s 44 , it is determined whether or not the physical block number n phy is an unusable block . when the physical block number n phy is an unusable block , the flow advances to step s 45 . at step s 45 , a substitute block number is used instead of the physical block number n phy . at step s 46 , the physical block number n phy is read from the memory portion 50 . the read data is denoted by data ( n phy ). data ( n phy ) is supplied to the data processing portion 20 ( at step s 47 ). the data processing portion 20 supplies data ( n phy ) to the communicating portion 30 ( at step s 48 ). the communicating portion 30 supplies the read data data ( n phy ) to the host system 40 ( at step s 49 ). fig1 is a flow chart showing the data reading process with the logical information n log in the case that the process that converts logical information into physical information is performed by the host system 40 in the system shown in fig1 . in the process shown in fig1 , the host system 40 converts a logical address into the physical block number n phy . in addition , the host system 40 performs a referencing process for the unusable block correlation table obtained from the memory apparatus 1 . thus , the referencing process for the unusable block correlation table shown in fig1 ( at steps s 43 , s 44 , and s 45 ) is not required in fig1 . except for this point , the process shown in fig1 is the same as the process shown in fig1 . for simplicity , in fig1 , similar steps to those in fig1 are denoted by similar reference numerals and their description will be omitted . fig1 is a flow chart showing a data reading process with physical information n globalphy supplied from the host system 40 in the system shown in fig2 . n globalphy is a value of which the physical information n phy and n cell are added as a numeric value . at step s 51 , the host system 40 supplies a data read request for physical information n globalphy to the memory apparatus 1 . the data processing portion 20 receives the read request through the communicating portion 30 ( at step s 52 ). at step s 53 , the data processing portion 20 calculates physical information n phy and n cell corresponding to n globalphy and designated values n base , n mul , and n blknum of the mapping reference information 12 . at step s 54 , the data processing portion 20 determines that the physical information n phy , n cell is not an unusable block with reference to the unusable block correlation table 11 . at step s 55 , it is determined whether or not n phy , n cell is an unusable block . when n phy , n cell is an unusable block , the flow advances to step s 56 . at step s 56 , a substitute block number is used instead of n phy , n cell . at step s 57 , physical information n phy , n cell is read from the memory portion 56 . the read data is denoted by data ( n cell , n phy ) data ( n cell , n phy ) is supplied to the data processing portion 20 ( at step s 58 ). the data processing portion 20 supplies data ( n cell , n phy ) to the communicating portion 30 ( at step s 59 ). the communicating portion 30 supplies the read data data ( n cell , n phy ) to the host system 40 ( at step s 60 ). fig1 is a flow chart showing a data reading process with physical information n globalphy supplied from the host system 40 in the system shown in fig2 . in the process shown in fig1 , the host system 40 performs a referencing process for the unusable block correlation table . thus , in the process shown in fig1 , the referencing process for the unusable block correlation table ( at steps s 54 , s 55 , and s 56 ) shown in fig1 is not required . except for this point , the process shown in fig1 is the same as the process shown in fig1 . for simplicity , in fig1 , similar steps to those in fig1 are denoted by similar reference numerals and their description will be omitted . fig1 is a flow chart showing a data reading process with physical information n cell , n phy supplied from the host system 40 in the system shown in fig2 . at step s 61 , the host system 40 supplies a data read request for physical information n cell n phy to the memory apparatus 1 . in the process shown in fig1 , physical information n globalphy is used . in contrast , in the process shown in fig1 , the host system 40 calculates physical information n cell , n phy that represents a cell number and a block number . this physical information is supplied to the memory apparatus 1 . thus , step s 53 at which n cell , n phy are calculated shown in fig1 is not required . except for this point , the process shown in fig1 is the same as the process shown in fig1 . for simplicity , in fig1 , similar steps to those in fig1 are denoted by similar reference numerals and their description will be omitted . fig1 is a flow chart showing a data reading process with physical information n cell , n phy supplied from the host system 40 in the system shown in fig2 . in the process shown in fig1 , the host system 40 performs a referencing process for the unusable block correlation table . thus , in the process shown in fig1 , the referencing process for the unusable block correlation table shown in fig1 ( at steps s 54 , s 55 , and s 56 ) is not required . except for this point , the process shown in fig1 is the same as the process shown in fig1 . for simplicity , in fig1 , similar steps to those in fig1 are denoted by similar reference numerals and their description will be omitted . fig1 is a flow chart for explaining a function that performs a verifying process that verifies whether or not a writing process requested by the host system 40 has been correctly completed . at step s 71 , the data processing portion 20 performs a writing process for the physical block number n phy to the memory portion 50 . the writing process is performed in the same manner as the forgoing reading process . at step s 72 , the writing process starts . at step s 73 , the data processing portion 20 waits until the writing process is completed . immediately after the writing process is completed , the reading process is performed with the physical block number n phy ( at step s 74 ). the read data is denoted by data r ( n phy ). at step s 75 , data r ( n phy ) is compared with data w ( n phy ) ( write data ). when they match , assuming that the writing process has been normally completed , the process is completed ( at step s 76 ). when the determined result at step s 75 represents that the read data matches the write data , it is determined that the writing process has not been normally performed . at step s 77 , the physical block number n phy is added to the unusable block correlation table . at step s 78 , the data processing portion 20 decides a substitute block corresponding to the physical block number n phy . at step s 79 , the substitute block is designated as a content of the unusable block correlation table . at step s 80 , the physical block number n phy is substituted with the designated substituted block number . thereafter , the flow returns to step s 71 . it should be noted that the present invention is not limited to the forgoing embodiment . in other words , without departing from the spirit of the present invention , various modifications and applications of the forgoing embodiment are available . for example , when the contents of the unusable block correlation table have been sorted in the ascending order , it is determined whether or not a physical block number of a block to be processed is larger ( smaller ) than ½ of the maximum physical block number . corresponding to the determined result , the determination order of whether or not an objective block is an unusable block may be selected . in other words , the ascending order or descending order is selected . according to the present invention , since the correlation table does not contain logical information and physical information for all blocks , the storage capacity of the irreversibly write memory open to the user can be increased . in addition , according to the present invention , since a conversion between logical information and physical information can be performed by a calculation , even if mapping information is lost , data can be accessed to some extent .
| 6 |
the invention disclosed below relates most generally soi semiconductor transistors , which can be used in a variety of integrated circuits , including memory devices such as dram , sram , flash , pcram etc . ( see , e . g ., fig9 ), or peripheral circuitry , logic circuitry , and a number of other circuits . in the following detailed description , reference is made to various specific embodiments in which the invention may be practiced . these embodiments are described with sufficient detail to enable those skilled in the art to practice the invention , and it is to be understood that other embodiments may be employed , and that structural and electrical changes may be made without departing from the spirit or scope of the invention . now referring to the figures , where like reference numbers designate like elements , fig1 shows a preliminary stage of fabrication of a buried transistor in accordance with the invention . throughout the following description the fabrication of a single transistor is shown for simplicity sake ; however , a plurality of like transistors are typically fabricated simultaneously in the same substrate , adjacent to one another or not , as is known in the art . as shown , in fig1 , a trench 12 is formed in a semiconductor substrate 10 by etching as is known in the art . preferably , the substrate 10 is a silicon substrate ; however , the invention also has applicability to other semiconductor - on - insulator structures , in which the core substrate 10 may be formed of other semiconductor materials . etching can be performed , for example , by photolithographic masking of the substrate followed by wet etching or dry etching through openings in the masking material . the sides of the trench are preferably substantially vertical relative to the trench &# 39 ; s depth , such that anisotropic etching is preferred . the width 11 of the trench will , in part , dictate the size of the resulting transistor . after trench 12 is formed , doping is performed as shown in fig2 . an ion implant 14 is performed to form a doped layer at the bottom of the trench 12 . as an alternative to implantation , ion diffusion can be used . this doped layer will form a lightly doped drain ( ldd ) region 16 of the ultimate transistor . the implant 14 for the ldd region 16 can be relatively shallow so as not to dope too much of the substrate 10 . at this stage in processing , it is also possible to use an angled implant 14 , as shown in fig2 a , if a halo - type implantation of dopant is desired . a halo implant may be desirable if , for example , enhancement of isolation between devices by reducing the depletion region is a goal , or if grading of junctions in order to control hot - carrier effects is needed . the trench 12 itself can act to shadow the implant if a halo implant is desired . if a halo implantation is used , the ldd region 16 will be graded with increased concentration of dopant toward the sides of the trench . fig3 shows the next stage in processing where sidewall spacers 18 are formed on the interior of the trench 12 . the spacers 18 are sidewall insulators for the transistor gate to be formed later . if the spacers 18 are nitride , a nitride layer is formed within the trench 12 and over substrate 10 and etched to remove the nitride layer from the bottom of the trench and upper surface of substrate 10 to create the spacers 18 . the etching of the nitride layer can be controlled such that the space between the spacers 18 exposing the bottom of the trench 12 can be made to be a specific and desired length 20 . this length 20 will ultimately be the gate length 20 of the resulting transistor . controlling gate length 20 is highly desirable in any semiconductor transistor because changing the gate length 20 effects the transistor threshold voltage ( v t ) needed to activate the transistor . different transistors across the wafer can be formed with different gate lengths to set various v t across the wafer . also , drive current is related to gate length 20 as well , wherein essentially “ faster ” logic devices can be fabricated by making certain transistor gates shorter . following the spacer 18 formation of fig3 , a further doping occurs to set v t , as illustrated in fig4 . a v t implant 22 is performed to form a dopant region 24 in the substrate 10 between the nitride spacers 18 . the spacers 18 shield the substrate 10 directly beneath so that what will become the transistor ldd regions 16 remain . as an alternative to ion implantation , ion diffusion can be used to form dopant region 24 . as a general rule , for short channel devices , as the gate length 20 is reduced the v t is reduced as well . if it is desired that the v t be increased , for instance , to keep the same v t with a shorter gate length 20 , the wafer &# 39 ; s bulk doping can be increased , the gate oxide thickness can be increased , source / drain junction depth can be decreased , back - bias voltage can be increased , or the drain voltage can be decreased . more easily , however , the v t implant 22 can be adjusted in this stage of processing to control v t . next , as shown in fig5 , the transistor gate structure is fabricated . after a preferred cleaning step , a gate oxide 26 can be grown over the substrate 10 along the bottom of the trench 12 between the spacers 16 . silicon oxide is a standard gate oxide 26 material , but others can be used as is known in the art . next , a doped polysilicon layer 28 is formed over the gate oxide 26 and between the spacers 16 . this layer 28 may be deposited by cvd , sputtering , or other techniques known in the art . a metal layer may be next deposited over the polysilicon layer 28 and heat annealed to form a silicide layer 30 . titanium and tantalum are commonly used for this purpose . a nitride cap 31 is then formed over the silicide layer , if desired ; though this protective cap can be excluded if other insulating materials are later provided over the transistor structure . the above - described layers 26 , 28 , 30 , 31 make up the gate stack 32 of the transistor . any excess materials of these layer 26 , 28 , 30 , 31 over the wafer ( i . e ., not in the trench 12 ) can be removed after deposition by a polishing or etching step . the wafer is polished ( by , e . g ., cmp ) or etched to expose a surface of the substrate 10 below the surface of the dopant implants 14 and 22 on either side of the gate stack 32 . fig6 illustrates the next step in the process . a source / drain implant 34 is performed in substrate 10 to form source / drain regions 36 on either side of the gate stack 32 and spacers 18 . the implant 34 can be accomplished using a mask as needed . the implant 34 should be of such a power and concentration so as to penetrate the substrate 10 to a level “ below ” the gate stack 32 so that a channel region 38 is formed “ below ” the level of the gate stack 32 . an annealing step can be included to activate the implanted dopant forming the source / drain 36 , if needed . after implanting ( and activating ) the source / drain regions 36 , the transistor 90 is substantially complete . next , an insulating layer 40 ( which will become a buried insulator ) can be formed over the transistor and substrate . this insulating layer 40 can be formed of silicon oxide or other insulating materials . in an alternative embodiment shown in fig6 a , the silicon of the substrate 10 adjacent to the gate stack 32 can be patterned using , e . g ., a photomask 35 , and etched prior to the implant 34 to be recessed below the nitride cap 31 towards the level of the gate oxide 26 , if desired . the etch mask 35 would be subsequently removed after the etch and implant 34 . in such an embodiment a self - aligned implant with no critical mask is necessary . then , the substrate 10 material ( e . g ., silicon ) can be regrown , by e . g ., epitaxy , back up to be level with the “ top ” of the gate stack 32 as is shown in fig6 b , or the gate stack 32 can be left exposed for further processing as desired . after such regrowth , the processing continues as described above and hereafter . once a substantially complete transistor 90 and the insulating layer 40 are formed , additional processing can be performed as shown in fig7 . the wafer can be flipped over and a second substrate 42 , preferably comprising a semiconductor material and , particularly silicon when substrate 10 is also silicon , can be bonded to the insulating layer 40 , making it a buried insulating layer 40 . if the insulating layer 40 is an oxide layer , the bonding of two thermally matched substrates can be accomplished by silicon oxide bonding techniques , wherein a chemical reaction occurs between the oxidized surfaces of each substrate 10 and 42 . an annealing step can facilitate the silicon - oxide bond . in this way , the buried oxide insulating layer 40 truly becomes buried , as does the transistor 90 . the new “ top ” surface of the substrate 10 can be etched or polished to a desired thickness , wherein the source / drain regions 36 can be exposed for subsequent processing . subsequent processing of the wafer can include the deposition of dielectric layers and formation of other semiconductor devices in contact with the buried transistor 90 . as is known in the art , capacitors can be formed in contact with the source / drain regions 26 , or with plugs thereto , as can bit lines or other interconnects , if for instance , a dram device is to be formed . a circuit diagram for a dram memory cell incorporating the transistor 90 is shown in fig9 , where the transistor 90 acts as an access transistor between a bit line and a capacitor that provides charge coupling therebetween . also , interconnects can be formed to the source / drain regions 26 electrically linking the transistor to , e . g ., logic circuitry , or sensing devices ( e . g ., sense amplifiers ) if the transistor is to be located in periphery circuitry . there is no limit to the uses of the buried transistor 90 in an integrated circuit and , as discussed above , the functioning of the transistor 90 can be tuned during processing so that it has a gate length 20 , channel length 38 , or v t as desired or necessary . fig8 illustrates an exemplary processor system 900 , which can utilize the transistor device 90 of the present invention , as incorporated into a cpu 901 or memory devices 100 . the processor system 900 can include one or more processors 901 coupled to a local bus 904 , the processor containing transistors 90 fabricated as described above . a memory controller 902 and a primary bus bridge 903 can also be coupled the local bus 904 . the processor system 900 can include multiple memory controllers 902 and / or multiple primary bus bridges 903 . the memory controller 902 and the primary bus bridge 903 may be integrated as a single device 906 . the memory controller 902 can also be coupled to one or more memory buses 907 . each memory bus accepts memory components 908 , which include at least one memory device 100 containing present invention . the memory components 908 may be a memory card or a memory module . some examples of memory modules include single inline memory modules ( simms ) and dual inline memory modules ( dimms ). the memory components 908 may include one or more additional devices 909 . for example , in a simm or dimm , the additional device 909 might be a configuration memory , such as a serial presence detect ( spd ) memory . the memory controller 902 may also be coupled to a cache memory 905 . the cache memory 905 may be the only cache memory in the processing system . alternatively , other devices , for example , processors 901 may also include cache memories , which may form a cache hierarchy with cache memory 905 . if the processing system 900 include peripherals or controllers which are bus masters or which support direct memory access ( dma ), the memory controller 902 may implement a cache coherency protocol . if the memory controller 902 is coupled to a plurality of memory buses 907 , each memory bus 907 may be operated in parallel , or different address ranges may be mapped to different memory buses 907 . the primary bus bridge 903 can be coupled to at least one peripheral bus 910 . various devices , such as peripherals or additional bus bridges may be coupled to the peripheral bus 910 . these devices may include a storage controller 911 , a miscellaneous i / o device 914 , a secondary bus bridge 915 , a multimedia processor 918 , and a legacy device interface 920 . the primary bus bridge 903 may also coupled to one or more special purpose high speed ports 922 . in a personal computer , for example , the special purpose port might be the accelerated graphics port ( agp ), used to couple a high performance video card to the processing system 900 . the storage controller 911 can couple one or more storage devices 913 , via a storage bus 912 , to the peripheral bus 910 . for example , the storage controller 911 may be a scsi controller and storage devices 913 may be scsi discs . the i / o device 914 may be any sort of peripheral . for example , the i / o device 914 may be a local area network interface , such as an ethernet card . the secondary bus bridge may be used to interface additional devices via another bus to the processing system . for example , the secondary bus bridge may be an universal serial port ( usb ) controller used to couple usb devices 917 via to the processing system 900 . the multimedia processor 918 may be a sound card , a video capture card , or any other type of media interface , which may also be coupled to one additional devices such as speakers 919 . the legacy device interface 920 can be used to couple legacy devices ; for example , older styled keyboards and mice , to the processing system 900 . the processing system 900 illustrated in fig8 is only an exemplary processing system with which the invention may be used . while fig8 illustrates a processing architecture especially suitable for a general purpose computer , such as a personal computer or a workstation , it should be recognized that well known modifications can be made to configure the processing system 900 to become more suitable for use in a variety of applications . for example , many electronic devices , which require processing may be implemented using a simpler architecture , which relies on a cpu 901 , coupled to memory components 908 and / or memory devices 100 . these electronic devices may include , but are not limited to audio / video processors and recorders , gaming consoles , digital television sets , wired or wireless telephones , navigation devices ( including system based on the global positioning system ( gps ) and / or inertial navigation ), and digital cameras and / or recorders . the modifications may include , for example , elimination of unnecessary components , addition of specialized devices or circuits , and / or integration of a plurality of devices . the above description and accompanying drawings are only illustrative of exemplary embodiments , which can achieve the features and advantages of the present invention . it is not intended that the invention be limited to the embodiments shown and described in detail herein . the invention can be modified to incorporate any number of variations , alterations , substitutions or equivalent arrangements not heretofore described , but which are commensurate with the spirit and scope of the invention . the invention is only limited by the scope of the following claims .
| 7 |
a schematic diagram of a conventional cmos active pixel 100 and associated column readout circuit 101 is shown in fig1 . incident photons on the pixel 101 generate electrons that are collected in the floating diffusion area 102 . the charge is buffered by an in - pixel source follover 105 . a number of pixels are typically arranged horizontally to form a row of pixels and also vertically to define a column of pixels . row selection transistor 103 is enabled to allow charge from a given row of pixels to be selectable for readout . a more detailed discussion of the general principles of pixel readout is provided in u . s . pat . no . 5 , 841 , 126 . while the illustrative implementation shows a photodiode pixel , it should be understood that a photogate , phototransistor or the like could be used instead . during imaging , the photodiode floating diffusion area 102 is first reset . this is achieved by pulsing a gate of reset transistor 104 to a high voltage , for example vdd . after a period of time , the voltage of the floating diffusion area 102 drops to reflect the number of electrons accumulated in the floating diffusion area 102 . the voltage v s of the floating diffusion area is then read out from the pixel 100 into the column readout circuit 101 using source follower 105 within pixel 100 . voltage v s is then sampled onto storage capacitor c s 106 by enabling the sample - hold signal ( shs ) transistor 107 . after the signal charge v s is read out , the pixel 100 is then reset and the gate of reset transistor 104 is again pulsed to a high voltage . the resultant voltage v r of floating diffusion area 102 is then read out to the column readout circuit 101 as before . this time the voltage v r is sampled onto storage capacitor c r 108 by enabling the sample - hold reset ( shr ) transistor 109 . fig2 shows the timing for the above photodiode operation . the voltage difference between the voltages stored in the two capacitors , c s 106 and c r 108 is indicative of the charge collected in the floating diffusion area 102 . typically , all the pixels 100 in a same row are processed simultaneously . the signals are sampled onto capacitors c s and c r in their respective column readout circuits collectively arranged beneath the row ( or multiple rows : array 10 ) of pixels . after a row sampling process is complete , voltage signal vout_s , vout_r in each column is read out successively by successively enabling the associated n - channel column selection transistors 110 , 111 . a high level block diagram of an array of pixels 10 and associated linear array 10 ′ of corresponding column readout circuits 101 , arranged in parallel fashion , is shown in fig3 . the outputs of vout_r and vout_s of column readout circuits 101 each share a common readout line . fig4 is a simplified partial schematic diagram of the respective output stages of the column readout circuits 101 in a linear array of pixels 10 ′. each column output stage contributes a parasitic capacitance resulting in an effective load capacitance of cp , represented by capacitor 401 . assuming ci to be the parasitic capacitance contributed by each column circuitry , total parasitic capacitance and total rc time constant ( charge and discharge ) turn - on / off settling time , may then be represented as follows : where r is the built - in resistance associated with each of column select transistors 110 , 111 in the on state , and m is the total number of column readout circuits 101 in a column - addressable row . as explained above , column readout circuit 101 output signals ( vout_s and vout_r ) are each connected to a pair of corresponding shared column readout lines . an image sensor with a horizontal resolution of 1000 pixels could theoretically result in the column output stage of a selected column readout circuit 101 having to drive the load capacitance associated with the other 999 columns . the parasitic capacitance in such a case could effectively be in the tens or even hundreds of picofarads . a larger capacitance requires longer time to charge the capacitance to a desired voltage value , and results in a greater rc time constant which translates into greater settling time . to increase pixel readout rate at a predetermined maximum frame rate necessarily involves minimizing the effective load capacitance seen by a selected column output buffer ( transistor 110 , 111 ). settling time may be improved by increasing the biasing current on the column output buffer . the time to charge up a capacitance to a certain voltage is well known and may be represented by the following equation : increasing the current would mean more power dissipation since p diss = v * i . for portable video systems , power dissipation is a key issue because higher power dissipation would reduce the lifetime of the battery . the present inventor has determined this not a desirable or optimum solution . settling time may also be reduced by reducing the effective load capacitance on the column output buffer . a technique for reducing effective load capacitance for faster readout is called tree - style column decoding . an example of a ram tree - style column decoder and multiplexer is shown in fig5 . data bit lines are coupled to a pool of switches ( transistors 401 ) which are selectively enabled to drive only a desired data bit through to a shared bit line 402 . in the configuration shown , a selected bit line receives a parasitic capacitance contribution from at least four transistors . with such a scheme , however , the overall effective capacitance seen on the shared bit line 402 can be reduced by as much as half that which might be imparted were all eight bit lines to be directly coupled to shared bit line 402 by only a single parallel bank of eight transistors . tree - style column decoding reduces the effective capacitance seen by each bit output line . the present inventor has discovered that by splitting the column circuitry into different blocks , as will be explained in greater detail below , the readout bus capacitance seen by a currently selected column output stage could be significantly reduced beyond that possible by known techniques . in accordance with a preferred embodiment , the load capacitance is mathematically modeled . the effective rc constant seen by any column output stage at a particular time is determined . by using a differentiated derived equation , a desirable optimum number of connections per block as well as a desired number of blocks for a given size of column readout circuits can be easily determined from this equation . an improved configuration for coupling the column output stages resulting in reduced parasitic capacitance effects is illustrated in fig6 . fig6 shows the column readout circuits 101 . only one portion of the respective column out put stage is shown . these are logically divided up into blocks 200 , each comprised of k contiguous column readout circuits . a set of block switches ( n channel transistors ) 601 are used to select among the blocks 200 . each switch 601 functions as a block select switch allowing the column readout circuits 101 in a given block to become actively coupled to the shared column readout line 500 . block switches 601 are used to select among the blocks 200 every time an associated column readout circuit 101 is to be turned on . once a column readout circuit 101 is selected for readout , its corresponding block switch 601 is also selected , but none of the other block switches are selected . those blocks 200 which are not selected prevent or block associated column readout circuits from imparting a parasitic capacitance on the shared readout line 500 , and / or on the column output stage of the currently active column readout circuit . block switches 601 also collectively impart a proportionate parasitic capacitance on the currently active column readout circuit , regardless of whether or not they are connected . thus , in an arrangement of 64 - wide block column readout circuits servicing a 1024 - pixel wide row , there would be a total 1024 / 64 = 8 blocks . each of the eight block switch transistors 601 would impart a parasitic capacitance of its own . this capacitance of eight transistors , however , is much less than the collective capacitance of 1024 non - blocked column select transistors . in this regard , it might be said that block select switches 601 function as parasitic capacitance blockers . the present inventor has determined that the optimum number of column readout circuits 101 per block 200 ( i . e ., the optimum value of k ) for a given size pixel configuration may be calculated from the following mathematical quadratic relation , c p2 =( k + 2 + m / k ) c i , eq . ( 3 ) for k ( n - channel ) column select transistors ( 110 or 111 ) and m / k groups , where m is the total number of column readout circuits 101 . the numeral 2 constant is derived from the parasitic capacitance of the group selection ( nmos ) transistor of the particular block being selected . this is based on a previous assumption that ci is the parasitic capacitance of the source / drain diffusion of the nmos selection transistor . minimizing c p2 in eq . ( 3 ) by differentiating c p2 with respect to k and equating it to zero , we get : then substituting the value of k back into eq . ( 3 ), we get : now , since each block switch transistor 601 is in series with a selected column output buffer ( transistors 110 or 111 ), the result is a doubling in the effective resistance r imparted on each associated vout_s , vout_r column readout line 500 . the doubled resistance impacts doubly on the rc time constant settling time . this doubled resistance may be mathematically represented in terms of a relevant time constant from equations ( 2 ) and ( 3 ) as : from the above , a parasitic capacitance improvement ( or reduction ) between c p1 ( without block switching ) and c p2 ( with block switching ) may be expressed as a ratio c p1 : c p2 as for large m , 2m 1 / 2 + 2 , approximates to 2m 1 / 2 , substituting back in eq . ( 7 ), we get a ratio of m : 2m 1 / 2 , which equates to a ratio of m 1 / 2 : 2 . thus , for large m ( e . g , 512 , 1024 , or greater ), parasitic capacitance is effectively reduced by a factor of about m 1 / 2 / 2 . in a 1024 - row architecture having block switching and an optimum block size of 32 ( k = m 1 / 2 ), a parasitic capacitance reduction of 16 (= m 1 / 2 / 2 = 32 / 2 ) may be realized over the case where no block switching is utilized . a similar analysis may be used to determine rc time constant improvement ( or reduction ) in the cases where there is no block switching ( rc 1 ) versus the case where block switching ( rc 2 ) is provided . representing the two cases by rc p1 : rc p2 , from equations ( 6 ) and ( 7 ), we get substituting back in eq . ( 8 ), the ratio can be expressed as thus it is shown that block switching can reduce the effective rc constant by a factor of about m 1 / 2 / 4 . accordingly , for a pixel array of 1024 × 1024 , the parasitic capacitance may be reduced by a factor of 8 × 2 (= 10241 / 2 / 4 × 2 ), while the rc time constant is reduced by a factor of 8 , by utilizing block switching . in a 32 ( 1024 1 / 2 ) block orientation , each column output stage is imparted an effective loading equivalent to having 1024 / 16 = 64 columns connected together . fig7 shows the timing for effecting column selection in block group fashion in accordance with a preferred implementation in which it is contemplated that the column read out circuits 101 in a given block will be readout first . after all the columns in the block have been read out , the associated block switch is disabled , and the block switch associated with the next column readout circuit to be read out is enabled ( turned on ). the present implementation has been described having only one level of block switches . another embodiment uses multiple levels of cascaded stages of block switching to further reduce the effective parasitic capacitance seen by a selected column output stage . in summary , the present solution provides a way for reducing the effective load capacitance thereby allowing for an increase in pixel readout rate without any increase in power dissipation . it is contemplated however that the present solution also allows for a way to improve ( reduce ) power dissipation in applications where a low pixel readout is desirable . as should be readily apparent from the above discussion of the preferred embodiments , block switching provides additional advantages beyond those in conventional tree - style decoding . a typical tree - style single stage implementation decoding method reduces the effective load capacitance by a factor of 2 . for n cascaded stages , the load capacitance is reduced by a factor of 2 n at the expense of very high circuit complexity . the non - cascaded system of fig6 with a large image array with a horizontal resolution of 1024 could have its effective capacitance reduced by a factor of 16 . this system can also increase the pixel readout rate ( due to faster settling time ) without any increase in the biasing current of the column output stages , and without introducing substantial circuit complexity to the overall active pixel sensor column readout architecture . although only a few embodiments have been described in detail , those having ordinary skill in the art would certainly understand that many modifications are possible in the preferred embodiment without departing from the teachings thereof . for example , although the block switching is described in terms of “ rows ”, the blocks could be columns or any other shape of blocks . all such modifications are intended to be encompassed by the following claims .
| 7 |
fig1 illustrates a down light fixture 10 in accordance with an embodiment of the present invention . the down light fixture 10 includes a cylindrical body 12 defining a hollow interior that encloses electrical components , a tapered shroud 14 slip fit and secured by a set screw 15 into a lower end of the cylindrical body 12 that directs and confines the emitted light , and a pivotable mounting device in the form of a knuckle joint assembly 16 attached to an upper end of the cylindrical body 12 . the foregoing components are preferably machined from cast aluminum alloy parts for durability . an anodized coating is preferably applied to the exterior of the machined aluminum alloy parts to prevent oxidation and to provide an aesthetically appealing finish . these components can also me made of other suitable metals such as brass alloy , aluminum , copper , etc . some or all of them can be molded out of suitable plastic , however , a material with high thermal conductivity is preferred for the cylindrical body 12 so that this component can facilitate the dissipation of heat generated by the source of illumination contained therein . an upper segment of the exterior of the cylindrical body 12 is provided with an integral heat sink in the form of a plurality of spaced - apart radially and circumferentially extending ribs 12 a . referring to fig2 , a disc - shaped led luminary printed circuit board ( pcb ) 18 is mounted inside the cylindrical body 12 . the luminary pcb 18 supports a high intensity led 20 ( fig3 ) and provides a conductive path to the electrical power . the luminary pcb 18 is readily replaceable in the event of a failure of the led 20 . the down light fixture 10 may have a single led and a pcb formed with electrically conductive paths for power connection and without other electronic components . alternatively , the down light 10 may be of the intelligent led type disclosed in u . s . patent application ser . no . 12 / 564 , 840 filed sep . 22 , 2009 by peter j . woytowitz entitled “ low voltage outdoor lighting power source and control system ” and published apr . 8 , 2010 under publication no . us - 2010 - 0084985 - a1 , or u . s . patent application ser . no . 13 / 244 , 869 filed sep . 26 , 2011 by peter j . woytowitz entitled “ systems and methods for providing power and data to lighting devices ,” now u . s . pat . no . 8 , 278 , 845 ; the entire disclosures of which are hereby incorporated by reference . said applications are assigned to hunter industries , inc ., the assignee of the subject application . the down light fixture 10 can have red , green and blue leds and can be connected to the aforementioned power source and control system in order to generate different lighting effects such as variable color and intensity in a reliable and energy efficient manner . u . s . publication &# 39 ; 985 provides examples of a power source and control system that rectify line voltage ac into a low voltage to be provided to a light fixture . for example , according to some embodiments , line voltage ac is rectified into a first high dc voltage . this first dc voltage is switched by a first switching circuit to create a high frequency ac voltage . the high frequency ac voltage is coupled through a transformer for isolation and step - down purposes . because the frequency is high , the transformer is small and light compared to a 50 / 60 hz transformer . the output of the transformer is rectified and filtered to produce a low voltage ( 12v ) dc signal . the 12vdc signal is fed into a second switching circuit in the form of an h - bridge circuit that generates a low frequency ac signal with data periodically encoded at a high frequency . the low frequency ac signal is transmitted to the lighting fixtures via the buried power conductors . as discussed in u . s . patent &# 39 ; 845 , a low voltage power signal between approximately 11vac and 14vac , or of approximately 12vac , or of approximately 24vac , may be used to power the down light fixture 10 . referring still to fig3 , a parabolic reflector 22 surrounds the led 20 so that the led 20 is located at the approximate focus of the reflector 22 which gathers and forwardly directs the light emitted by the led 20 in a predetermined desired pattern to the target area . the inner end of the reflector 22 is secured to the cylindrical body 12 with a pair of machine screws 23 a and 23 b ( fig2 ). the luminary pcb 18 is securely sandwiched between the reflector 22 and the cylindrical body 12 referring to fig2 and 3 , a disc - shaped color filter 24 and a disc - shaped diffuser 26 are mounted over the led 20 and reflector 22 . the diffuser 26 softens the intensity of the light emitted by the led 20 as perceived by an observer &# 39 ; s naked eye . an upper cylindrical segment 14 a ( fig3 ) of the shroud 14 removably slips into the lower segment 12 b of the cylindrical body 12 . the female - to - male overlap of the lower body segment 12 b with the upper cylindrical segment 14 a of the shroud helps prevent entry of water into the cylindrical body 12 . additionally , entry of water into the cylindrical body 12 is further impeded by a pair of o - rings 28 and 30 made of a suitable elastomeric material that are seated in annular grooves formed in the exterior of the upper cylindrical segment 14 a of the shroud 14 and are squeezed between the cylindrical body 12 and the shroud 14 . the set screw 15 is threaded into a threaded hole 12 c ( fig4 ) that is formed in the lower body segment 12 b and is tightened against an annular groove 14 e formed on the outer surface of upper cylindrical segment 14 a to hold the shroud 14 securely in position both axially and radially . a disc - shaped protective transparent cover 32 extends across the diffuser 26 and provides an optical path for light to leave the down light fixture 10 . by way of example , the transparent cover 32 can be made of glass , high temperature resistant plastic , or scratch resistant sapphire . on one side of the transparent cover 32 a periphery of the transparent cover 32 engages the interior of a circular flange 14 b that projects radially inwardly from the upper cylindrical segment 14 a of the shroud 14 . a circular frame 36 supports the color filter 24 . the circular frame 36 carries the circular frame 34 and the diffuser 26 . the circular frame 36 and the color filter 24 are in turn supported by the reflector 22 . when the shroud 14 is screwed into the cylindrical body 12 , the shroud 14 , o - rings 28 and 30 , and the transparent cover 32 seal off a lower portion of the hollow interior of the cylindrical body 12 and protect the luminary pcb 18 and the led 20 . the knuckle joint assembly 16 ( fig1 ) includes a base knuckle 16 a and a top knuckle 16 b that are pivotally connected by a machine bolt 34 ( fig2 ). the male threaded distal end of the machine bolt 34 is screwed into a transversely extending female threaded sleeve 37 ( fig3 ) formed in the top knuckle 16 b to pivotally connect the base knuckle 16 a and the top knuckle 16 b . the top knuckle 16 b is secured to the upper end of the cylindrical base 12 with a pair of machine bolts 38 and 40 ( fig2 ) that pass through a pair of side - by - side bores 42 formed in the top knuckle 16 b . the male threaded distal ends of the bolts 38 and 40 are screwed into axially extending female threaded sleeves 44 and 46 ( fig4 ) formed in the top of the cylindrical body 12 . the upper end of the cylindrical body 12 is formed with a circular mounting flange 12 d ( fig4 ) which mates with a shoulder ( not visible ) of the top knuckle 16 b as best seen in fig3 . a pair of diametrically opposed slots 47 a and 47 b formed in the mounting flange 12 d receive corresponding projections ( not illustrated ) on the top knuckle 16 b to rotationally align the top knuckle 16 b and the cylindrical body 12 during assembly . an o - ring 48 ( fig2 ) made of a suitable elastomeric material is seated in a pair of opposing circular grooves formed in the base knuckle 16 a and the top knuckle 16 b . the o - ring 48 helps to seal the knuckle joint assembly 16 against the unwanted intrusion of water . a plurality of radially extending teeth 16 c formed in the circular face surface of the top knuckle 16 b mate with and fit between a plurality of radially extending teeth 16 d ( fig3 ) formed on the mating circular face of the base knuckle 16 a to prevent unwanted slippage then the machine screw 34 is tightened . this arrangement permits the angle of the top knuckle 16 b to be adjusted relative to the base knuckle 16 a when the machine screw 34 has been loosened enough to allow the teeth 16 c and 16 d to pass by each other . the base knuckle 16 a and the top knuckle 16 b are formed with recesses or grooves ( not illustrated ) that create a passageway . this passageway provides a conduit that allows a twin conductor insulated wire 49 ( fig2 ) to pass through a hollow male threaded shank 50 of the base knuckle 16 a and through the top knuckle 16 b . the wire 49 then passes through an axially extending cylindrical hollow potting cup 52 ( fig4 ) formed in the cylindrical base 12 . the potting cup 52 is located inside the hollow interior of the cylindrical base 12 and provides a tubular conduit that extends between the knuckle joint assembly 16 and the luminary pcb 18 . the passageway that extends through the base knuckle 16 a and the top knuckle 16 b is dimensioned and configured to allow the wire 49 to traverse the interior of the knuckle joint assembly 16 without binding or chafing while still allowing the knuckle joint assembly 16 to be pivotally adjusted to change the angle of illumination provided by the down light fixture 10 . the proximal end of the wire 49 ( not illustrated ) extends a sufficient distance from the down light fixture 10 to facilitate operative connection of the conductors in the wires 49 to the terminals of the power source and control system . additionally , the knuckle assembly 16 may be of the type found in u . s . pat . no . 6 , 902 , 200 granted jun . 7 , 2005 to joshua beadle and entitled “ contaminant - resistant pivot joint for outdoor lighting fixture ”, the entire disclosure of which is hereby incorporated by reference . the aforementioned patent is also assigned to hunter industries , inc . the male threaded shank 50 ( fig2 ) of the knuckle joint assembly 16 can be screwed into a bracket ( not illustrated ) that can in turn be secured with wood screws or bolts to a beam or overhang of a building or to a structure such as a trellis or gazebo located in a lawn or garden . typically the bracket would be secured to an overhead member so that the central longitudinal axes of the cylindrical base 12 and the shroud 14 are pointed in a downward direction . the down light fixture 10 can thus illuminate the target area below the down light fixture . the beveled lower portion 14 c ( fig1 ) of the shroud 14 is preferably oriented so that a peripheral oval - shaped lip 14 d thereof faces downwardly . in the preferred orientation , a plane that passes through the peripheral lip 14 d is substantially perpendicular to a plane normal to the axis of rotation of the knuckle joint assembly 16 defined by the bolt 34 ( fig2 ). the set screw 15 ( fig3 ) fixes the rotational position of the shroud 14 relative to the cylindrical body 12 when it is tightened . the luminary pcb 18 ( fig2 and 3 ) has two conductive male pins made of metal that mate with corresponding metal contacts of a female electrical socket 56 ( fig2 ) operatively connected to the distal end of the wire 49 . during assembly of the down light fixture 10 the wire 49 is potted inside the bore of the potting cup 52 with a predetermined quantity 57 of a suitable potting compound such as part no . 041108 - fc - 4 from ellsworth adhesives . when the quantity of potting compound 57 cures , the potting compound 57 inside the potting cup 52 provides a substantially water tight seal between the wire 49 and an interior wall of the potting cup 52 . the wire 49 is permanently potted and sealed in an effort to prevent water intrusion from the upper end of the cylindrical body 12 into the lower portion of the interior of the cylindrical body 12 where it might reach the luminary pcb 18 , causing a short or damage to the led 20 . the upper portion of the hollow interior of the cylindrical body 12 includes a reservoir or cavity 58 ( fig3 ) through which the potting cup 52 extends . the cavity 58 is separated from the lower portion of the hollow interior of the cylindrical body 12 that contains the luminary pcb 18 by a transverse wall 60 . the lower end of the potting cup 52 is integrally formed with the transverse wall 60 and the bore that extends through the potting cup 52 communicates with a hole formed in the transverse wall 60 . this arrangement allows the electrical socket 56 to be pushed over the pair of metal pins that extend from the luminary pcb 18 . due to the normal inclined orientation of the down light 10 at a typical angle as illustrated in fig3 , a small quantity of water 62 can accumulate in the cavity 58 . a slot 64 ( fig4 ) formed in the circular mounting flange 12 d of the cylindrical body 12 provides a drain port . this drain port is rotationally oriented so that it is on the low side of the down light fixture 10 . the upper end of the potting cup 52 is higher in reference to the longitudinal axis of the down light fixture 10 than the drain port . the size of the drain port is sufficient so that the water 62 will always drain out of the cylindrical body 12 via the drain port before it reaches the upper end of the quantity of potting compound 57 . this prevents the water from standing on top of the potting compound 57 and seeping down through the potting cup 52 to the luminary pcb 18 . this is true even if the down light fixture 10 is mounted with its longitudinal axis completely vertical . while an embodiment of a down light fixture has been described in detail , it will be understood by those skilled in the art , based on the description herein , that the present invention can be modified in both arrangement and detail . for example , the source of illumination could be an incandescent bulb instead of an led . see u . s . pat . no . 6 , 784 , 905 granted apr . 5 , 2005 to joshua z . beadle or u . s . pat . no . 7 , 387 , 409 granted jun . 17 , 2008 to joshua z . beadle , the entire disclosures of which are hereby incorporated by reference . said patents are also assigned to hunter industries , inc . the down light fixture 10 could be designed to work with the lighting controller disclosed in pending u . s . patent application ser . no . 13 / 189 , 718 filed on jul . 25 , 2011 by peter j . woytowitz entitled “ programmable landscape lighting controller with self - diagnostic capabilities and fail safe features ”, the entire disclosure of which is hereby incorporated by reference . said application is also assigned to hunter industries , inc . therefore , the protection afforded the present invention should only be limited in accordance with the scope of the following claims .
| 5 |
shown in fig1 ( a ) is a cross - sectional view of a semiconductor structure having a polysilicon substrate 10 of n - conductivity . a p - conductivity well region 11 is formed in substrate 10 , and an n - conductivity well region 12 is formed in substrate 10 . it should be readily understood that well regions 11 and 12 are electrically isolated from each other , and are illustrated adjacent one another solely for the purposes of illustration . a gate oxide layer 14 is uniformly deposited over p - well region 11 and n - well region 12 . above the layer of gate oxide 14 is deposited a layer of undoped polysilicon 15 . in the illustrated form , the layers of gate oxide 14 and undoped polysilicon 15 are planar . although the thickness of the layer of undoped polysilicon 15 may vary , an exemplary thickness of undoped polysilicon 15 is five hundred angstroms . shown in fig1 ( b ) is a cross - sectional view of the semiconductor structure after a second layer of polysilicon is deposited , patterned and selectively etched . it should be well understood that the present invention may be implemented in other forms including the deposition of a single layer of polysilicon having first and second thicknesses with first and second doping concentrations , respectively , performed in - situ . the relative thicknesses of the layers having differing doping concentrations may be reversed from that shown in fig1 . also , a single deposition of insitudoped polysilicon rather than two distinct layered depositions may be made wherein the doping concentrations of the polysilicon are varied during the single deposition . gate electrodes 17 and 18 comprised of n + doped polysilicon are formed . the patterning of the doped layer of polysilicon is accomplished by depositing a layer of conventional photoresist material , such as photoresist layers 20 and 21 , over the doped polysilicon where gate electrodes 18 and 17 are respectively desired to be formed . the doping sensitive endpoint etch of the doped layer of polysilicon forms gate electrodes 17 and 18 but leaves the layer of undoped polysilicon over the remaining top surface of the semiconductor structure . therefore , the present invention provides an effective method for etching the doped polysilicon layer which is used to form gate electrodes 17 and 18 without also etching away the layer of undoped polysilicon 15 . as will be shown below , it is very important to the present invention that undoped polysilicon 15 not be removed at this time . the selective etching of the doped polysilicon layer to form gate electrodes 17 and 18 is accomplished by an etching process which uses a doping sensitive endpoint . the semiconductor structure is placed in a conventional etching system such as a parallel plate etcher . an etchant gas is used to perform a selective etch where photoresist is not placed from which gate electrodes 17 and 18 are formed . the etch is substantially anisotropic . during the etch , two basic reactions occur . the primary etchant is a fluorine containing species , such as sf6 , which reacts with polysilicon to form volatile fluorides of silicon as follows : where &# 34 ; m &# 34 ; is an integer between one and six inclusive , and &# 34 ; n &# 34 ; is an integer between one and four inclusive . the optical emissions from the plasma is filtered so that only the wavelengths associated with the sif n species reaches a photodetector . because the undoped polysilicon is less conductive than the doped polysilicon , the sf 6 plasma reacts more slowly when it reaches the undoped polysilicon layer 15 . as the reaction slows down , the sif n emissions decrease . in order to amplify the early endpoint signal , a second etchant gas can be added to the etch plasma . this gas is preferably a chlorinated freon compound , such as cfcl 3 . in the plasma , this gas can be added to the etch plasma . this gas is preferably a chlorinated freon compound , such as cfcl 3 . in the plasma , this gas dissociates into subfluorides and subchlorides of carbon , which react with the polysilicon to form volatile subfluorides and subchlorides of silicon as follows : where w , x , y and z are integers between one and four , inclusive . the optical emissions from the plasma is sent through a second filter so that only the wavelengths associated with the cclx species reaches a second photodetector . as previously described , the reaction stated by equation two will also slow down when the etch plasma reaches the undoped polysilicon layer 15 . in this case , however , the emission from the reactant cclx increases and reaches a maximum at the approximate midpoint of layer 15 . by ratioing these two divergent emission signals , v sifn / v cclx , the amplitude of the early endpoint signal can be significantly amplified . therefore , the ratio of fluorine to chlorine emissions is magnified when etching between doped and undoped polysilicon layers and specific etch points between differing doped layers can be easily and accurately detected . this doping sensitive technique can also apply to a technique which is a chlorine based etch chemistry . in the illustrated form , by having the undoped polysilicon layer 15 remain on the top surface of the gate oxide 14 , the etching process used to form gate electrodes 17 and 18 does not penetrate or degrade the layer of gate oxide 14 . gate oxide 14 is also protected from potential rupturing associated with electrical charge build - up on the top surface of the oxide during source / drain implantation . it should be understood that the doping sensitive endpoint etching of the gate electrode material may be implemented by using more than two regions or distinct layers of doping concentrations . for example , the gate electrode material may be formed from three regions of differing doping concentrations so that a transition into and out of a middle region may be detected . further , the doping impurities are not limited to group iii or group iv elements . other doping impurities such as oxygen , nitrogen or carbon may be utilized . shown in fig1 ( c ) is a cross - sectional view of the semiconductor structure after photoresist layers 20 and 21 are removed and sidewall spacers are formed at the sides of gate electrodes 17 and 18 . sidewall spacers 26 and 27 are formed adjacent gate electrode 17 , and sidewall spacers 28 and 29 are formed adjacent gate region 18 . in one form , sidewall spacers 26 - 29 are formed of a low temperature oxide ( lto ) which is uniformly deposited over polysilicon layer 15 and gate electrodes 17 and 18 . it should be well understood that many types of materials may be utilized as sidewall spacers including any type of low temperature oxide , a photographically enhanced oxide , a refractory metal or a nitride . any type of material which can be etched selectively over polysilicon may be utilized . a reactive ion etch may be performed to remove the lto above the undoped polysilicon layer 15 . at the interface of the lto and doped polysilicon gate electrodes 17 and 18 , the reactive ion etch is sufficiently slow as compared to the remaining top surface of undoped polysilicon layer 15 to form the sidewall spacers 26 - 29 . although the lto may have any predetermined thickness in a wide range of values , a typical thickness for the lto is in the range of one thousand to four thousand angstroms . shown in fig1 ( d ) is a cross - sectional view of the semiconductor structure after a photoresist mask 32 has been placed over the semiconductor structure substantially above the n conductivity well region 12 . the semiconductor structure is then subjected to an n + ion implant which forms diffusions 38 and 39 of n + conductivity . diffusions 38 and 39 are respectively aligned to the edges of sidewall spacers 26 and 27 . shown in fig1 ( e ) is a cross - sectional view of the semiconductor structure after sidewalk spacers 26 and 27 are removed from gate region 17 . sidewall spacers 26 and 27 may e washed off from gate region 17 and undoped polysilicon layer 15 by a solution of hydrogen fluoride , hf . by using a wet etch of the sidewall spacers 26 and 27 , there is no inadvertent etching of gate regions 17 and 18 as is common when a reactive ion etch is required . also , a wet etch of sidewall spacers provides reliable , efficient manufacturability . the semiconductor structure is then subjected to a selective n - ion implant whereby diffusions 41 and 42 of n - conductivity are formed . diffusions 41 and 42 are each aligned to the one of the two sides of gate electrode 17 . photoresist mask 32 remains in place substantially above the n conductivity well region 12 during the formation of the ldd transistor in the p well region 11 . the semiconductor wafer is thus not subjected to a radiation environment during the selective implants . shown in fig1 ( f ) is a cross - sectional view of the semiconductor structure wherein photoresist mask 32 has been removed and a photoresist mask 44 is placed over well region 11 . the semiconductor structure is then subjected to a p + ion implant which forms diffusions 46 and 48 of p + conductivity . diffusions 46 and 48 are respectively aligned to the sides of sidewall spacers 28 and 29 . shown in fig1 ( g ) is a cross - sectional view of the semiconductor structure after sidewall spacers 28 and 29 are removed from gate region 18 . sidewall spacers 28 and 29 are also readily removable from the sides of gate region 18 by using the solution of hydrogen fluoride , hf . photoresist mask 44 remains in place over well region 11 . the semiconductor structure is then subjected to a p - ion implant which form diffusions 50 and 51 of p - conductivity . diffusions 50 and 51 are each aligned to one of the two sides of gate region 18 . shown in fig1 ( h ) is a cross - sectional view of the semiconductor structure after photoresist mask 48 is removed . during the previous process steps , the undoped layer of polysilicon 15 has been in place over the gate oxide layer 14 to protect the gate oxide during the diffusions described above . as a result , gate oxide layer 14 is structurally intact after the formation of an ldd transistor in both well region 11 and well region 12 . a further advantage of having the layer of undoped polysilicon 15 in place above gate oxide layer 14 relates to protection from electric charge buildup . the ion implant steps described above may be done using a commercially available implanter . clamps of the implanter which function to position and hold the semiconductor device must be fastened to edges of the semiconductor wafer on which the semiconductor is being fabricated . in the present invention , the clamps of the implanter make contact with the undoped polysilicon layer 15 rather than the gate oxide layer 14 . the undoped polysilicon layer 15 creates a ground plane for directing charge created from the source / drain implants away from the gate oxide layer 14 . therefore , charge associated with the ion implanted diffusions does not have an opportunity to collect on the gate oxide layer 14 and rupture layer 14 . in fig1 ( h ), the undoped polysilicon has been conventionally etched . although the etch removes a small quantity of polysilicon from the top surface of gate electrodes 17 and 18 , the gate electrodes 17 and 18 are left substantially intact . at this point , gate oxide layer 14 is now exposed and is the top layer of the semiconductor structure . however , the processing of the ldd transistors , an n - channel transistor in well region 11 and a p - channel transistor in well region 12 , is virtually complete . shown in fig1 ( i ) is a cross - sectional view of the completed semiconductor structure in the fabrication of an ldd n - channel transistor and an ldd p - channel transistor . the structure is reoxidized with an oxide layer 55 to insure the integrity of the oxide surrounding the corners of gate electrodes 17 and 18 . the structure is then annealed wherein the n + polysilicon of gate electrodes 17 and 18 diffuses with the undoped polysilicon layer 15 to form n + gate electrodes 17 &# 39 ; and 18 &# 39 ;, respectively . in the illustrated form , the above described process provides the inherent advantages associated with removable gate sidewall spacers which can be washed off in an hf solution . the gate oxide layer 14 is protected during the gate sidewall spacer formation and removal and also during all the ion implant steps . the protective undoped polysilicon layer 14 provides a ground plane during the ion implant which prevents electric charge rupture of gate oxide layer 14 . by using the doping sensitive endpoint etching described above , a thin , planar layer of undoped polysilicon can always be assured to remain above the gate oxide until the final reoxidation and anneal step . although various thicknesses of the undoped polysilicon layer can be accurate chosen , a thickness of approximately five hundred angstroms will adequately protect the gate oxide in most applications . it should be appreciated that although a cmos ldd process is illustrated , the present invention may be utilized to provide only n - channel lld transistors if desired and conventional p - channel transistors used otherwise . shown in fig2 are cross - sectional views of another transistor structure commonly referred to as an inverse - t gate structure lld transistor ( itldd ) which uses an undoped polysilicon layer provided by using the doping sensitive endpoint described above . in fig2 ( a ) is a cross - sectional view of the initial formation of the itldd structure . an n conductivity substrate 60 is provided wherein a p conductivity well region 61 and an n conductivity well region 62 is formed . a gate oxide layer 63 is grown on a top surface of the well regions 61 and 62 . above the gate oxide layer 63 is grown a relatively shallow layer 65 of undoped polysilicon . in one form , a layer of approximately five hundred angstroms is grown . shown in fig2 ( b ) is a cross - sectional view of the itldd structure after n + doped polysilicon gate electrodes 70 and 72 have been formed . gate electrodes 70 and 72 are formed by depositing a blanket planar layer of n + polysilicon and using photoresist 74 and 75 to respectively mask off gate electrodes 70 and 72 during an etch of the layer of n + polysilicon . the etch of the n + polysilicon layer is done by using the doping sensitive endpoint process described above in connection with fig1 . as soon as n + polysilicon layer is etched where photoresist 74 and 75 is not placed , the undoped polysilicon layer 65 is reached and the chemical reaction described above provides an easily detectable indicator of the transition between layers . shown in fig2 ( c ) is a cross - sectional view of the itldd structure after a photoresist mask 76 is placed over n well region 62 . the remainder of the semiconductor structure is subjected to a selective n - implant to respectively form source / drain diffusions 78 and 79 of n - conductivity . the source / drain diffusions are aligned to the side edges of gate electrode 70 . shown in fig2 ( d ) is a cross - sectional view of the itldd structure after photoresist mask 76 is removed and a photoresist mask 80 is placed over well region 61 . the remainder of the semiconductor structure is subjected to a selective p - implant to respectively form source / drain diffusions 81 and 82 of p - conductivity . the source / drain diffusions are aligned to the side edges of gate electrode 72 . shown in fig2 ( e ) is a cross - sectional view of the itldd structure after photoresist mask 80 is removed and sidewall spacers 84 and 85 are formed on the sides of the n + polysilicon of gate electrode 70 . sidewall spacers 86 and 87 are also formed on the sides of gate electrode 72 . in one form , the sidewall spacers are comprised of low temperature oxide ( lto ) and are deposited above the undoped polysilicon 65 . as previously mentioned , other materials may be used to implement the sidewall spacers . shown in fig2 ( f ) is a cross - sectional view of the itldd structure after photoresist mask 88 is placed over the n well region 62 . the remainder of the semiconductor structure is subjected to an n + ion implant to form n + diffusions 90 and 91 in p well region 61 . due to the masking action of sidewall spacers 84 and 85 and the gate electrode 70 , the diffusions 90 and 91 respectively align with the outside edges of sidewall spacers 84 and 85 . shown in fig2 ( g ) is a cross - sectional view of the itldd structure after photoresist mask 88 is removed and a photoresist mask 93 is placed over the p well region 61 . the remainder of the semiconductor structure is subjected to a p + ion implant to form p + diffusion 94 and 95 in n well region 82 . due to the masking action of sidewall spacers 86 and 87 and gate electrode 72 , the diffusions 94 and 95 respectively align with the outside edges of sidewall spacers 86 and 87 . shown in fig2 ( h ) is a cross - sectional view of the completed itldd structure wherein photoresist mask 93 is removed . the undoped polysilicon layer 65 is etched where exposed at the top surface of the structure so that gate oxide 63 is exposed at the top surface adjacent both sidewall spacers 84 and 85 and adjacent sidewall spacers 86 and 87 . a cmos itldd structure is thus provided . the inverse - t gate structure ldd transistor allows a lower n - implant level which results in a transistor with a higher breakdown voltage and better hot carrier injection performance . the inverse - t gate structure ldd described herein uses self - aligning ldd implants and is easily manufacturable and reliable . by selectively etching the doped and undoped polysilicon layers using a doping sensitive endpoint , the initially unetched polysilicon layer protects the gate oxide during device fabrication so that gate oxide layer 63 has improved integrity and does not get overly etched . shown in fig3 are cross - sectional views of another embodiment of the present invention for providing an ldd transistor structure . the ldd transistor structure of fig3 may be implemented with two masks and only two implant stpes . in fig3 ( a ) is a cross - sectional view of the initial formation of the ldd structure . an n conductivity substrate 100 is provided wherein a p conductivity well region 101 and an n conductivity well region 102 is formed . a gate layer 104 is grown on a top surface of the well regions 101 and 102 . above the gate oxide layer 104 is formed a relatively shallow layer 106 of undoped polysilicon . in one form , a layer of approximately five hundred angstroms is grown . shown in fig3 ( b ) is a cross - sectional view of the ldd transistor structure after n + doped polysilicon gate electrodes 108 and 110 have been formed . gate electrodes 108 and 110 are formed by depositing a blanket layer of n + polysilicon and using photoresist 11 , and 112 to respectively mask off gate electrodes 108 and 110 during an etch of the layer of n + polysilicon . the etch of the n + polysilicon layer is done by using the doping sensitive endpoint process described above . as soon as the n + polysilicon layer is etched where photoresist 111 and 112 is not placed , the undoped polysilicon 106 is reached and the chemical reaction described above provides an easily detectable indicator of the transition between layers so that polysilicon 106 can be left a protection layer for gate oxide 104 . shown in fig3 ( c ) is a cross - sectional view of the ldd transistor structure after silicon nitride sidewalls spacers 116 and 117 are formed around the sides of the gate electrode 108 and sidewall spacers 120 and 121 are formed around the sides of gate electrode 110 . although sidewall spacers of other material may be used , a sidewall spacer which may be subsequently removed without reacting with gate oxide is desired . silicon nitride is one possible material which meets this criteria . shown in fig3 ( d ) is a cross - sectional view of the ldd transistor structure after the undoped polysilicon 106 is etched to expose gate oxide 104 . the portions of undoped polysilicon 106 which are under gate electrodes 108 and 110 and sidewall spacers 116 , 117 , 120 and 121 are not etched . shown in fig3 ( e ) is a cross - sectional view of the ldd transistor structure after the sidewall spacers 116 , 117 , 120 and 121 are removed . since sidewall spacers 116 , 117 , 120 and 121 are comprised of a material which can be etched without damaging the integrity of the gate oxide layer 104 . the removal of the sidewall spacers without etching gate oxide layer 104 is very important . shown in fig3 ( f ) is a cross - sectional view of the ldd transistor structure after a photoresist mask 130 is placed over the n - well region 102 . the remainder of the semiconductor structure is subjected to an n + ion implant to form both n + source / drain diffusions 132 and 134 and n - source / drain diffusions 136 and 138 . the n + diffusions 132 and 134 respectively align substantially with the sides of the undoped polysilicon 106 below gate electrode 108 . adjacent the n + diffusions 132 and 134 are n - diffusions 136 and 138 which respectively align substantially with the sides of gate electrode 108 . the n - diffusions 136 and 138 are formed concurrently with n + diffusions 132 and 134 in p - well region 101 as a result of less penetration of the n + doping thru the undoped polysilicon 106 which is adjacent the sides of gate electrode 108 and thru gate oxide layer 104 into p - well region 101 . therefore , an ldd n - channel transistor is formed around gate electrode 108 in a single ion implant step . shown in fig3 ( g ) is a cross - sectional view of the ldd transistor structure after photoresist mask 130 is removed and a photoresist mask 140 is placed over the p - well region 140 . the remainder of the semiconductor structure is subjected to a p + ion implant to form both p + source / drain diffusions 144 and 146 and p - source / drain diffusions 147 and 148 . the p + diffusions 144 and 146 respectively align substantially with the sides of the undoped polysilicon 106 below gate electrode 110 . adjacent the p + diffusions 144 and 146 are diffusions 147 and 148 which respectively align substantially with the sides of gate electrode 110 . the p - diffusions 147 and 148 are formed concurrently with p + diffusions 144 and 146 in n - well region 102 as a result of less penetration of the p + doping through the undoped polysilicon 106 which is adjacent the sides of gate electrode 110 nd thru gate oxide layer 104 in n - well region 102 . therefore , an ldd p - channel transistor is formed around gate electrode 110 in a single ion implant step . in the illustrated form , a cmos inverse - t gate ldd transistor process requiring two photoresist masks and only two ion implant steps is provided . mask count is thereby minimized and the gate oxide and gate electrode material is not damaged during the etch steps of the process . in another form of the fig3 embodiment of the present invention , undoped polysilicon 106 can be etched adjacent the sides of gate electrodes 108 and 110 and above the layer of gate oxide 104 . such an etch would modify the ldd transistors from an inverse - t gate structure to a conventional ldd structure . a benefit of the additional etch step would be to reduce source - to - gate and drain - to - gate overlap capacitance . the desirability of the additional etch step would depend upon the application . also , the source / drain to gate overlap capacitance will vary as a function of the size of the n - diffusions 136 and 138 . therefore , the desirability of reducing the overlap capacitance must be compared with benefits otherwise provided by the inverse - t gate structure . by now it should be apparent that a process involving the initially incomplete etch of gate electrode material for use in fabricating an ldd transistor has been provided . the process described herein provides protection to a gate oxide layer during implant and sidewall formation steps . by using an etching technique which has a doping sensitive endpoint , the gate oxide layer may be protected by a thin undoped polysilicon layer during the majority of the fabrication steps of the device . at the completion of the device , a reliable gate oxide layer exists . while the invention has been described in the context of a preferred embodiment , it will be apparent to those skilled in the art that the present invention may be modified in numerous ways and may assume many embodiments other than that specifically set out and described above . accordingly , it is intended by the appended claims to cover all modifications of the invention which fall within the true spirit and scope of the invention .
| 7 |
the present invention will now be described more fully hereinafter with reference to the accompanying drawings , in which preferred embodiments of the invention are shown . this invention may , however , be embodied in many different forms and should not be construed as limited to the embodiments set forth herein . rather , these embodiments are provided so that this disclosure will be thorough and complete , and will fully convey the scope of the invention to those skilled in the art . fig1 shows an exemplary cdma system configuration for the purpose of illustrating embodiments of the invention configured to perform soft - weighted subtractive cancellation . in the present example , a k th user terminal 100 receives communications from sources ( e . g ., base stations ) 101 and 102 via signal paths 111 and 112 , respectively . in an alternative embodiment not shown , the sources 101 and 102 may correspond to two propagation paths from one base station . the sources 101 and 102 employ orthogonalizing ( e . g ., walsh ) codes w j with pn / scrambling code covers p j where j = 1 or 2 . the orthogonalizing codes spread the symbol transmission by a factor of n . a data symbol for a k th user of a j th base - station may be represented by a jk . a received signal r [ n ] at the k th user terminal 100 for an n th chip and a symbol duration that spans n chips is expressed by where w jk [ n ] denotes the n th chip of the k th user from the j th source , and u [ n ] is additive white gaussian noise of variance σ 2 . although this exemplary embodiment excludes pulseshape filtering effects , alternative embodiments that consider pulse shaping may be provided . the variables k 1 and k 2 denote the number of user channels multiplexed by the 1 st and 2 nd transmit sources , respectively . if both sources correspond to the same base station , then k 1 = k 2 . the values c j are complex channel gains corresponding to the signal from the j th base station to the receiver . although a single path per base station is described , embodiments of the invention may be configured to account for multiple paths from each base station . if the first base station 101 transmits a signal of interest , then transmissions from the second base station 102 may comprise interference . interference cancellation , such as subtractive and / or projective cancellation may be employed . according to one aspect of the present invention , a receiver may synthesize interference from a combination of soft - weighted and hard - coded pre - processed symbol estimates . a synthesized interference signal s 2 [ n ] corresponding to the second base station 102 may be expressed by where ã 2k [ l ] is a pre - processed soft estimate of a k th user &# 39 ; s symbol on symbol period l , and λ 2k ( a 2k [ l ]) is a companding function acting on the estimated symbol ã 2k [ l ]. although the expression for the synthesized interference s 2 [ n ] may assume perfect channel estimates c 2 , uncertainty in the channel estimates may be factored into the functions λ 2k ( ã 2k [ l ]). the receiver may subtract the synthesized interference s 2 [ n ] from the received signal r [ n ]. an interference - cancelled version of the first path 111 , { circumflex over ( r )} 1 , is given by each chip of a corresponding pn - stripped output x 1 [ n ] is given by where * denotes a complex conjugate and the identity p 1 *[ n ] p 1 [ n ]= 1 is enforced . this step is followed by matching to an m th code for a user of interest . the result of this operation , â 1m , is has been enforced , and ρ mk is the correlation between the m th code of the first base station 101 and the k th code of the second base station 102 that includes the effects of the pn covers : symbol estimates ã 1m [ l ] for the m th user signal from the first base station 101 are is modeled as a complex random variable with zero mean and variance a w 2 , and e 1m is the expected value of | a 1m | 2 . the post - processed sinr is maximized by minimizing the expectation terms per subchannel ( e . g . walsh channel ). this is accomplished by decomposing the function λ 2k ( ã 2k ) into its real and imaginary components and differentiating with respect to each component . the minimizing function is the real scalar weighting λ 2k ã 2k . the symbol estimates ã 2k may be assumed to be uncorrelated symbol estimates , which have mean ã 2k and variance σ 2k 2 . the post - processed sinr m for a particular subchannel m may be maximized by selecting weights for the other subchannels as where e 2k = e | a 2k | 2 is the average energy of subchannel k for source 2 , e | ã 2k | 2 = e 2k + σ 2k 2 , and is the pre - processed sinr . if e 2k is known , the soft weight λ 2k may be estimated as where avg (.) denotes an average of the variable (.) over a sequence of symbol transmissions . this average may be quite general , and it may be based on prior knowledge or probability models for e 2k and / or α 2k k . if e 2k is unknown and σ 2k 2 is known , then λ 2k may be estimated as if { circumflex over ( λ )} 2k is quantized to zero or one , such as for selecting active subchannels , then { circumflex over ( λ )} 2k is where z is a predetermined threshold value . in one embodiment of the invention , the threshold value z = 2 may be used . if neither e 2k nor σ 2k 2 is known , then σ 2k 2 may be estimated from another subchannel having a common value σ 2m 2 = σ 2k 2 known e 2m , and known symbols . then λ 2k may be estimated as or with a corresponding quantized version . in some cases , avg ( σ 2k 2 ) can be obtained from avg ({ tilde over ( σ )} 2k k ) as an estimate of σ 2m 2 = e | ã 2m −√{ square root over ( e 2m )} a 2m | 2 , where a 2m is a known symbol on a pilot channel . similarly , other channels having known values of a 2m and √{ square root over ( e 2m )} may be used . if there is prior information about the distribution of e 2k , then λ 2k may be estimated as the posterior mean , given a sequence of symbol estimates { a 2k [ l ], l = 1 , 2 , . . . , l }: { circumflex over ( λ )} 2k = e [ λ 2k ∥ ã 2k | 2 [ l ], l = 1 , 2 , . . . , l ] the expectation is over the posterior distribution of e 2k , given the sequence { a 2k [ l ]}. when the posterior mean is intractable to compute , it may be numerically approximated to produce estimates of λ 2k = e | ã 2k | 2 /( e | ã 2k | 2 + σ 2k 2 ) that are companded versions of | ã 2k | 2 /(| ã 2k | 2 + σ 2k 2 ) or companded versions of (| ã 2k | 2 |− σ 2k 2 )/| ã 2k | 2 . in some embodiments , hard decisions may be made for the pre - processed symbol estimates when λ 2k exceeds a predetermined threshold . the derivation for the sinr in such embodiments is described in the co - pending application , entitled “ soft - weighted subtractive interference cancellation systems ,” which is hereby incorporated by reference . some embodiments may employ weighted soft decisions on some subchannels and hard decisions on others . in one such embodiment , all subchannels having a preprocessed sinr ( 1 ) between two predetermined thresholds employ soft weighted ( e . g ., companded ) estimates for interference synthesis . subchannels having values of sinr ( 1 ) below the lower threshold may be zeroed . subchannels having values of sinr ( 1 ) above the upper threshold may be hard - coded to a nearest constellation point ( i . e ., hard decisions are used ). a cdma2000 system in which symbols are drawn from a single qpsk constellation may use a combination of soft and hard decisions based on predetermined thresholds . however , in a system where w - cdma and hsdpa coexist , constellations for various users may differ . thus , the constellations of interfering users are typically unknown at the receiver , making hard decisions impractical , unless constellation classification is performed per user . however , the estimation of e 2k + σ 2k 2 remains unchanged . other embodiments may quantize the weighting of soft estimates . fig2 a is a block diagram that shows a receiver embodiment of the invention that may be employed in a cdma system . the receiver includes a baseband receiver 201 coupled to an sinr - estimation module 202 and a companding module 204 . a thresholding module 203 is coupled between the sinr - estimation module 202 and the companding module 204 . the companding module 204 is coupled to an interference synthesizer 205 , followed by a channel emulator 206 , and a canceller 207 . the baseband receiver 201 provides pre - processed symbol estimates for subchannels of a received baseband signal . for example , a rake receiver may be employed for producing pre - processed estimates for all of the received cdma subchannels . in another embodiment , symbol estimates may be chosen per rake finger . in some embodiments , the baseband receiver 201 may comprise an equalizer receiver . the pre - processed estimates are coupled into the sinr - estimation module 202 , which estimates a pre - processed sinr ( 1 ) for each subchannel . sinr estimates may be extracted from evms . alternatively , the noise - plus - interference variance may be measured on a representative subchannel ( e . g ., a pilot channel ) and used for all subchannels . the value avg ( ã 2k 2 ) may be used to estimate e 2k + σ 2k 2 directly without resolving onto a constellation . the thresholding module 203 compares estimated sinr to a predetermined threshold for determining whether soft or hard decisions are to be used for generating interference - symbol estimates for each subchannel . the companding module 204 generates the hard decisions and / or weighted soft decisions for each pre - processed symbol estimate . the companding module 204 may employ filtering for each subchannel to estimate user amplitudes , and amplitude scaling may be employed prior to hard decisions . the estimated sinr may be used to generate weights used to soft weight symbol estimates for each subchannel . the interference synthesizer 205 performs source - specific operations on the symbol estimates ( which may be soft and / or hard symbol estimates ) to produce a synthesized interference signal . for example the interference synthesizer 205 may perform an inverse fast walsh transform ( ifwt ) to respread user symbol estimates , followed by a pn covering that provides for pn / scrambling cover codes . a transmitter pulse - shaping filter may be used to shape the scrambled , code - multiplexed signal . the channel emulator 206 , which may optionally be part of the interference synthesizer 205 , adds channel distortions to the synthesized interference signal . in one embodiment , a path of interest is selected from a multipath signal . for example , the first signal path 111 from base station 101 corresponding to a first finger of a rake receiver may be denoted as the path of interest . in this case , the channel emulator 206 may convolve the synthesized interference with a channel profile that excludes the channel effects corresponding to the first finger ( i . e ., the first signal path 111 ). this enables a canceller ( e . g ., canceller 207 ) to remove effects of other multipath components from the path of interest ( i . e ., signal path 111 ). receiver embodiments of the invention may be configured to remove any number of multipath components from a path of interest . furthermore , when multiple transmit sources are present , signals from sources other than the source corresponding to the path of interest may be removed . the canceller 207 may include a subtractive canceller or a projective canceller configured to remove interference from the received baseband signal , which may be obtained from a receiver pulse - shaping filter ( not shown ). thus , the interference synthesizer 205 or the channel emulator 206 may optionally emulate the effects of receiver pulse - shaping for the synthesized interference . in some embodiments of the invention , the canceller 207 may provide for a scale factor α to adjust the amount of interference that is removed . in some cases , the received signal and the synthesized interference are not to scale . for example , walsh codes and pn codes typically are not normalized . walsh stripping and walsh insertion together introduce a scale equal to the code length n , and pn code stripping and insertion together introduce an additional factor of 2 . furthermore , mrc combining for m paths results in a scaling factor given by where b i is a weighting factor employed for an i th finger . for example , | b i | 2 =| c i | 2 or | b i | 2 =| c i | 2 / σ 2 . the normalizing factor in this case is the term α may also represent a projective cancellation factor that accounts for path correlations . an example of α for such a case is given by where p s is a projection operator p s = ss h / s h s . interference - cancelled signals output by the canceller 207 may be coupled to one or more rake fingers . in an exemplary rake receiver configured to process four multipath components , interference - cancelled signals in which the effects of a third and a fourth path are removed may be coupled to fingers configured for processing first and second multipath components . a comparator ( not shown ) may optionally be employed for selecting one of the interference - cancelled signal and the uncancelled signal for processing by a rake receiver , embodiments of the invention may be configured for receivers having more than one receive antenna . for example , in fig2 b , each of a plurality n of rake receivers 201 . 1 - 201 . n corresponding to a different receive antenna ( not shown ) may include an interference canceller 207 . 1 - 207 . n , respectively . a generalized combiner may be used to combine paths that are common to two or more receive antennas . a combiner 211 may perform maximal ratio combining across the rake 201 . 1 - 201 . n fingers . alternative types of combining may be performed . pre - processed soft estimates are output by the combiner 211 and used to produce synthesized interference , such as described previously . the synthesized interference is coupled to a plurality of channel emulators 206 . 1 - 206 . n , wherein each channel emulator 206 . 1 - 206 . n has an associated rake receiver 201 . 1 - 201 . n . in an exemplary two - antenna system configured for receiving two multipath components from a single transmit source , a first channel emulator produces two interference signals corresponding to the two paths received by the first antenna . similarly , a second channel emulator produces two interference signals corresponding to the two paths received by the second antenna . in this case , the receiver may include four rake fingers , each matched to one of the four paths . the first finger may be assigned to the signal received by the first antenna , wherein interference due to the second path is removed via subtractive or projective cancellation . the second finger may be assigned to the signal received by the first antenna wherein the interference due to the first path is removed . similarly , the third and fourth fingers may be matched to the multipath components received by the second receive antenna . in “ data optimized ” cdma , such as high - speed downlink packet access ( hsdpa ), multiple subchannels transmitting high data rates have the same frequency - selective fade and each of these coded subchannels has the same transmission amplitude . these subchannels coexist with voice channels , which have a lower data rate . unlike the high - rate subchannels , these low - rate channels may have different amplitudes . in such systems , only one weight may be calculated for each of the k subchannels carrying high data rates . signal amplitudes may be averaged over time and / or across subchannels , and the noise power may also be averaged over subchannels to obtain a single sinr estimate . in one embodiment of the invention , an sinr estimate may be compared to a predetermined threshold for determining whether to perform hard decisions , weighted soft decisions , or zeroing for all of the high data rate subchannels . fig3 is a flow chart that illustrates a cancellation method in accordance with an embodiment of the invention . rake synthesis 301 . 1 processes a received baseband signal to produce soft symbol estimates for data symbols modulated on subchannels by a first source ( e . g ., a first base station ). similarly , rake synthesis 301 . n produces soft symbol estimates for data symbols modulated on subchannels by an n th source . the rake synthesis steps 301 . 1 - 301 . n may optionally be cross - coupled if source diversity is present for at least some of the subchannels , such as may typically occur during a soft hand over . for each source , an sinr estimate or a vector magnitude is made from the soft symbol estimates 302 . 1 - 302 . n . these measurements are used to determine the reliability of the soft symbol estimates . based on this reliability determination , either a hard decision or a weighted soft - decision is produced for each soft symbol estimate 303 . 1 - 303 . n . this companding process 303 . 1 - 303 . n may implement subchannel selection , such as by discarding subchannels that have a signal energy that falls below a predetermined threshold . interference synthesis ( such as providing for pn covering , walsh covering , pulse shaping , and channel emulation ) 304 . 1 - 304 . n is performed to synthesize interference received from each source ( i . e . each base station and / or multipath ). interference for a particular rake finger is synthesized 305 using synthesized multipath signals from each of the first source to the n th source . scaling 306 may optionally be used to scale interference received from the different sources . some form of interference cancellation 307 ( such as subtractive cancellation , weighted subtractive cancellation , projective cancellation , or weighted projective cancellation ) is provided for cancelling interference from a predetermined path of interest . rake finger input selection 308 is performed to select between an interference - cancelled signal and the original received baseband signal ( depending on which signal has the highest value of estimated sinr or an alternative figure of merit ) prior to coupling the resulting selected signal into a rake finger . rake synthesis 309 produces soft estimates for each subchannel . signal and noise powers are measured 310 , followed by another selection process 311 configured to select either soft estimates produced by some combination of rake synthesis 301 . 1 to 301 . n or soft estimates produced by rake synthesis 309 , the selected signals may be output for further processing . those skilled in the art should recognize that method and apparatus embodiments described herein may be implemented in a variety of ways , including implementations in hardware , software , firmware , or various combinations thereof . examples of such hardware may include application specific integrated circuits ( asics ), field programmable gate arrays ( fpgas ), general - purpose processors , digital signal processors ( dsps ), and / or other circuitry . software and / or firmware implementations of the invention may be implemented via any combination of programming languages , including java , c , c ++, matlab ™, verilog , vhdl , and / or processor specific machine and assembly languages . computer programs ( i . e ., software and / or firmware ) implementing the method of this invention may be distributed to users on a distribution medium such as a sim card , a usb memory interface , or other computer - readable memory adapted for interfacing with a consumer wireless terminal . similarly , computer programs may be distributed to users via wired or wireless network interfaces . from there , they will often be copied to a hard disk or a similar intermediate storage medium . when the programs are to be run , they may be loaded either from their distribution medium or their intermediate storage medium into the execution memory of a wireless terminal , configuring an onboard digital computer system ( e . g . a microprocessor ) to act in accordance with the method of this invention . all these operations are well known to those skilled in the art of computer systems . fig4 a illustrates a method for estimating subchannel symbols as part of an interference - cancellation technique . for a given pre - processed sinr , hard decisions are employed if the sinr is higher than a first predetermined threshold 401 . weighted soft decisions may be employed for an intermediate range of sinrs defined by an upper bound ( e . g ., the first predetermined threshold ) and a lower bound 402 ( e . g ., a second predetermined threshold ). subchannel symbol values may be discarded ( e . g ., set to zero ) if the pre - processed sinr falls below the second predetermined threshold 403 . in a related embodiment , an interference cancellation circuit may be turned off if the measured sinr falls below a predetermined threshold , since , in some embodiments of the invention , it is known that interference cancellation may not be as useful as power conservation at lower pre - processed sinrs . fig4 b illustrates a method for estimating subchannel symbols for a given system that employs different signal constellations corresponding to different data rates . a system identification 400 is performed for each subchannel . for example , system identification 400 may distinguish between hsdpa subchannels and non - hsdpa subchannels , which have a lower data rate . for subchannels ( e . g ., hsdpa subchannels ) having a higher data rate , some predetermined strategy may be used to estimate subchannel symbols based on whether the symbol constellation for those subchannels is known or unknown . weighted soft estimates may be employed or cancellation may be bypassed for hsdpa subchannels in which the constellation is unknown . if the constellation is known , hard decisions 411 , weighted soft decisions 412 , and / or no cancellation 413 may be performed . for non - hsdpa ( e . g ., wcdma ) subchannels , it is assumed that the constellation is known . thus , hard decisions 421 , weighted soft decisions 422 , and / or no cancellation 423 may be performed . the functions of the various elements shown in the drawings , including functional blocks labeled as “ modules ” may be provided through the use of dedicated hardware , as well as hardware capable of executing software in association with appropriate software . when provided by a processor , the functions may be performed by a single dedicated processor , by a shared processor , or by a plurality of individual processors , some of which may be shared . moreover , explicit use of the term “ processor ” or “ module ” should not be construed to refer exclusively to hardware capable of executing software , and may implicitly include , without limitation , digital signal processor dsp hardware , read - only memory ( rom ) for storing software , random access memory ( ram ), and non - volatile storage . other hardware , conventional and / or custom , may also be included . similarly , the function of any component or device described herein may be carried out through the operation of program logic , through dedicated logic , through the interaction of program control and dedicated logic , or even manually , the particular technique being selectable by the implementer as more specifically understood from the context . the method and system embodiments described herein merely illustrate particular embodiments of the invention . it should be appreciated that those skilled in the art will be able to devise various arrangements , which , although not explicitly described or shown herein , embody the principles of the invention and are included within its spirit and scope . furthermore , all examples and conditional language recited herein are intended to be only for pedagogical purposes to aid the reader in understanding the principles of the invention . this disclosure and its associated references are to be construed as applying without limitation to such specifically recited examples and conditions . moreover , all statements herein reciting principles , aspects , and embodiments of the invention , as well as specific examples thereof , are intended to encompass both structural and functional equivalents thereof . additionally , it is intended that such equivalents include both currently known equivalents as well as equivalents developed in the future , i . e ., any elements developed that perform the same function , regardless of structure .
| 7 |
the term “ mammalian dna - r ” as used herein refers to proteins consisting essentially of , and having substantially the same biological activity as , the protein encoded by the amino acid depicted in fig1 ( seq id no . : 2 ). this definition is intended to encompass natural allelic variations in the disclosed dna - r . cloned nucleic acid provided by the present invention may encode dna - r protein of any species of origin , including , for example , mouse , rat , rabbit , cat , and human , but preferably the nucleic acid provided by the invention encodes dna - rs of mammalian , most preferably human , origin . the nucleic acids provided by the invention comprise dna or rna having a nucleotide sequence encoding a mammalian dna - r . specific embodiments of said nucleic acids are depicted in fig1 ( seq id no . : 1 ), and include any nucleotide sequence encoding a mammalian dna - r having an amino acid sequence as depicted in fig1 ( seq id no . : 2 ). nucleic hybridization probes as provided by the invention comprise any portion of a nucleic acid of the invention effective in nucleic acid hybridization under stringency conditions sufficient for specific hybridization . mixtures of such nucleic acid hybridization probes are also within the scope of this embodiment of the invention . nucleic acid probes as provided herein are useful for isolating mammalian species analogues of the specific embodiments of the nucleic acids provided by the invention . nucleic acid probes as provided herein are also useful for detecting mammalian dna - r gene expression in cells and tissues using techniques well - known in the art , including but not limited to northern blot hybridization , in situ hybridization and southern hybridization to reverse transcriptase - polymerase chain reaction product dnas . the probes provided by the present invention , including oligonucleotides probes derived therefrom , are also useful for southern hybridization of mammalian , preferably human , genomic dna for screening for restriction fragment length polymorphism ( rflp ) associated with certain genetic disorders . the production of proteins such as mammalian dna - r from cloned genes by genetic engineering means is well known in this art . the discussion which follows is accordingly intended as an overview of this field , and is not intended to reflect the fall state of the art . nucleic acid encoding a dna - r may be obtained , in view of the instant disclosure , by chemical synthesis , by screening reverse transcripts of mrna from appropriate cells or cell line cultures , by screening genomic libraries from appropriate cells , or by combinations of these procedures , in accordance with known procedures as illustrated below . screening of mrna or genomic dna may be carried out with oligonucleotide probes generated from the nucleic acid sequence information from mammalian dna - r nucleic acid as disclosed herein . probes may be labeled with a detectable group such as a fluorescent group , a radioactive atom or a chemiluminescent group in accordance with know procedures and used in conventional hybridization assays , as described in greater detail in the examples below . in the alternative , mammalian dna - r nucleic acid sequences may be obtained by use of the polymerase chain reaction ( pcr ) procedure , using pcr oligonucleotide primers corresponding to nucleic acid sequence information derived from a dna - r as provided herein . see u . s . pat . nos . 4 , 683 , 195 to mullis et al . and 4 , 683 , 202 to mullis . mammalian dna - r protein may be synthesized in host cells transformed with a recombinant expression construct comprising a nucleic acid encoding the dna - r nucleic acid , comprising genomic dna or cdna . such recombinant expression constructs can also be comprised of a vector that is a replicable dna construct . vectors are used herein either to amplify dna encoding a dna - r and / or to express dna encoding a dna - r gene . for the purposes of this invention , a recombinant expression construct is a replicable dna construct in which a nucleic acid encoding a dna - r is operably linked to suitable control sequences capable of effecting the expression of the dna - r in a suitable host . the need for such control sequences will vary depending upon the host selected and the transformation method chosen . generally , control sequences include a transcriptional promoter , an optional operator or enhancer sequence to control transcription , a sequence encoding suitable mrna ribosomal binding sites , and sequences which control the termination of transcription and translation . amplification vectors do not require expression control domains . all that is needed is the ability to replicate in a host , usually conferred by an origin of replication , and a selection gene to facilitate recognition of transformants . see , sambrook et al ., 2001 , molecular cloning : a laboratory manual ( cold spring harbor press : new york ). vectors useful for practicing the present invention include plasmids , viruses ( including phage and mammalian dna and rna viruses ), retroviruses , and integratable dna fragments ( i . e ., fragments integratable into the host genome by homologous recombination ). the vector can replicate the gene of interest and function independently of the host genome , or can , in some instances , integrate into the genome itself . suitable vectors will contain replicon and control sequences which are derived from species compatible with the intended expression host . transformed host cells are cells which have been transformed or transfected with recombinant expression constructs made using recombinant dna techniques and comprising nucleic acid encoding a dna - r protein . preferred host cells are hek293 cells , cos - 7 cells ( gluzman , 1981 , cell 23 : 175 - 182 ) and ltk − cells . transformed host cells may express the dna - r protein , but host cells transformed for purposes of cloning or amplifying nucleic acid hybridization probe dna need not express the receptor . when expressed , the dna - r of the invention will typically be located in the host cell membrane . accordingly , the invention provides preparations of said cell membranes comprising the dna - r protein of the invention , as well as purified , homogeneous preparations of the receptor protein itself . see , sambrook et al ., ibid . cultures of cells derived from multicellular organisms are a desirable host for recombinant dna - r protein synthesis . in principal , any higher eukaryotic cell culture is useful , whether from vertebrate or invertebrate culture . however , mammalian cells are preferred , as illustrated in the examples . propagation of such cells in cell culture has become a routine procedure . see tissue culture , academic press , kruse & amp ; patterson , editors ( 1973 ). examples of useful host cell lines are human embryonic kidney ( hek ) 293 cells , vero and hela cells , chinese hamster ovary ( cho ) cell lines , mouse ltk − cell lines and wi138 , bhk , cos - 7 , cv , and mdck cell lines . hek293 cell , cos - 7 cells and ltk − cells are preferred . the invention provides homogeneous compositions of mammalian dna - r protein produced by transformed eukaryotic cells as provided herein . each such homogeneous composition is intended to be comprised of a dna - r protein that comprises at least 75 %, more preferably at least 80 %, and most preferably at least 90 % of the protein in such a homogenous composition ; in said homogeneous preparations , individual contaminating protein species are expected to comprise less than 5 %, more preferably less than 2 % and most preferably less than 1 % of the preparation . the invention also provides membrane preparations from cells expressing mammalian dna - r protein as the result of transformation with a recombinant expression construct , as described herein . also specifically provided by the invention are fragments of the dna - r of the invention , most preferably dna binding fragments thereof . in preferred embodiments , said fragments include soluble forms of the receptor lacking the transmembrane domain and an amino - terminal fragment ( most preferably amino acids 1 - 575 ) comprising zinc finger and ring sequence motifs known in the art to be related to dna - protein binding . mammalian dna - r proteins made from cloned genes in accordance with the present invention may be used for screening compounds that effect dna binding to cells in vivo and in vitro , as more fully described herein , and that affect dna uptake and expression of genes encoded thereby . for example , host cells may be transformed with a recombinant expression construct of the present invention , a mammalian dna - r expressed in those host cells , and the cells or membranes thereof used to screen compounds for their effect on dna binding . by selection of host cells that do not ordinarily express a dna - r , pure preparations of membranes containing the receptor can be obtained . the recombinant expression constructs of the present invention are useful in molecular biology to transform cells which do not ordinarily express a dna - r to thereafter express this receptor . such cells are useful as intermediates for making cell membrane preparations useful for receptor binding activity assays , which are in turn useful for drug screening . the recombinant expression constructs of the present invention thus provide a method for screening potentially useful drugs at advantageously lower cost than conventional animal screening protocols . while not completely eliminating the need for ultimate in vivo activity and toxicology assays , the constructs and cultures of the invention provide an important first screening step for the vast number of potentially useful drugs synthesized , discovered or extracted from natural sources each year . this utility thereby enables rational drug design of novel therapeutically - active drugs using currently - available techniques ( see walters , “ computer - assisted modeling of drugs ”, in klegerman & amp ; groves , eds ., 1993 , pharmaceutical biotechnology , interpharm press : buffalo grove , ill ., pp . 165 - 174 ). the recombinant expression constructs of the present invention may also be useful in gene therapy . cloned genes of the present invention , or fragments thereof , may also be used in gene therapy carried out homologous recombination or site - directed mutagenesis . see generally thomas & amp ; capecchi , 1987 , cell 51 : 503 - 512 ; bertling , 1987 , bioscience reports 7 : 107 - 112 ; smithies et al ., 1985 , nature 317 : 230 - 234 . nucleic acid and oligonucleotide probes as provided by the present invention are useful as diagnostic tools for probing dna - r gene expression in tissues of humans and other animals . for example , tissues are probed in situ with oligonucleotide probes carrying detectable groups by conventional autoradiographic or other detection techniques , to investigate native expression of this receptor or pathological conditions relating thereto . further , chromosomes can be probed to investigate the presence or absence of the corresponding dna - r gene , and potential pathological conditions related thereto . oligonucleotides , particularly antisense oligonucleotides , are also useful for decreasing expression of the dna - r in cells that overexpress the receptor or whose expression is disadvantageous in a host organism , either generally or in specific tissues . an example of the latter instance is in airway epithelial cells and macrophages in lung tissues in cystic fibrosis patients , as set forth more fully herein . the invention also provides antibodies that are immunologically reactive to the dna - r protein or epitopes thereof provided by the invention . the antibodies provided by the invention may be raised , using methods well known in the art , in animals by inoculation with cells that express a dna - r or epitopes thereof , cell membranes from such cells , whether crude membrane preparations or membranes purified using methods well known in the art , or purified preparations of proteins , including protein fragments and fusion proteins , particularly fusion proteins comprising epitopes of the dna - r protein of the invention fused to heterologous proteins and expressed using genetic engineering means in bacterial , yeast or eukaryotic cells , said proteins being isolated from such cells to varying degrees of homogeneity using conventional biochemical methods . synthetic peptides made using established synthetic methods in vitro and optionally conjugated with heterologous sequences of amino acids , are also encompassed in these methods to produce the antibodies of the invention . animals that are useful for such inoculations include individuals from species comprising cows , sheep , pigs , mice , rats , rabbits , hamsters , goats and primates . preferred animals for inoculation are rodents ( including mice , rats , hamsters ) and rabbits . the most preferred animal is the mouse . cells that can be used for such inoculations , or for any of the other means used in the invention , include any cell line which naturally expresses the dna - r provided by the invention , or more preferably any cell or cell line that expresses the dna - r of the invention , or any epitope thereof , as a result of molecular or genetic engineering , or that has been treated to increase the expression of an endogenous or heterologous dna - r protein by physical , biochemical or genetic means . preferred cells are mammalian cells , most preferably cells syngeneic with a rodent , most preferably a mouse host , that have been transformed with a recombinant expression construct of the invention encoding a dna - r protein , and that express the receptor therefrom . the present invention also provides monoclonal antibodies that are immunologically reactive with an epitope derived from a dna - r of the invention , or fragment thereof , present on the surface of such cells or in membrane preparations thereof or used after varying degrees of biochemical purification . particularly useful are soluble fragments of the dna - r of the invention , including for example species of the receptor genetically engineered to remove the transmembrane domain , and amino - terminal fragments , most preferably dna binding fragments of the receptor . such antibodies are made using methods and techniques well known to those of skill in the art . monoclonal antibodies provided by the present invention are produced by hybridoma cell lines , which are also provided by the invention and are made by methods well known in the art . hybridoma cell lines are made by fusing individual cells of a myeloma cell line with spleen cells derived from animals immunized with cells expressing a dna - r of the invention , as described above . the myeloma cell lines used in the invention include lines derived from myelomas of mice , rats , hamsters , primates and humans . preferred myeloma cell lines are from mouse , and the most preferred mouse myeloma cell line is p3x63 - ag8 . 653 . the animals from whom spleens are obtained after immunization are rats , mice and hamsters , preferably mice , most preferably balb / c mice . spleen cells and myeloma cells are fused using a number of methods well known in the art , including but not limited to incubation with inactivated sendai virus and incubation in the presence of polyethylene glycol ( peg ). the most preferred method for cell fusion is incubation in the presence of a solution of 45 % ( w / v ) peg - 1450 . monoclonal antibodies produced by hybridoma cell lines can be harvested from cell culture supernatant fluids from in vitro cell growth ; alternatively , hybridoma cells can be injected subcutaneously and / or into the peritoneal cavity of an animal , most preferably a mouse , and the monoclonal antibodies obtained from blood and / or ascites fluid . monoclonal antibodies provided by the present invention are also produced by recombinant genetic methods well known to those of skill in the art , and the present invention encompasses antibodies made by such methods that are immunologically reactive with an epitope of an amino acid receptor of the invention . the present invention also encompasses antigen - binding fragments , including but not limited to f v , f ( ab ) and f ( ab )′ 2 fragments , of such antibodies . fragments are produced by any number of methods , including but not limited to proteolytic or chemical cleavage , chemical synthesis or preparation of such fragments by means of genetic engineering technology . the present invention also encompasses single - chain antibodies that are immunologically reactive with an epitope of a dna - r , made by methods known to those of skill in the art . the present invention also encompasses an epitope of a dna - r of the invention , comprised of sequences and / or a conformation of sequences present in the receptor molecule . this epitope may be naturally occurring , or may be the result of chemical or proteolytic cleavage of a receptor molecule and isolation of an epitope - containing peptide or may be obtained by chemical or in vitro synthesis of an epitope - containing peptide using methods well known to those skilled in the art . the present invention also encompasses epitope peptides produced as a result of genetic engineering technology and synthesized by genetically engineered prokaryotic or eukaryotic cells . the invention also includes chimeric antibodies , comprised of light chain and heavy chain peptides immunologically reactive to a dna - r - derived epitope . the chimeric antibodies embodied in the present invention include those that are derived from naturally occurring antibodies as well as chimeric antibodies made by means of genetic engineering technology well known to those of skill in the art . nucleic acids encoding the receptor , the dna - r and dna - binding fragments thereof , are advantageously used to modulate expression or activity of the receptor in cells in vivo and in vitro . as provided herein , the dna - r of the invention , particularly soluble embodiments thereof , can competitively bind dna to reduce said binding to cells expressing the dna - r . dna binding to the dna - r in certain cells , such as airway epithelial cells and macrophages in lung , is associated with the activation of inflammatory processes that cause a significant proportion of the morbidity and mortality associated with cystic fibrosis , chronic bronchitis and other chronic lung diseases . thus , the invention provides a variety of methods for reducing said morbidity and mortality by interfering with dna binding to cells in the lung . in one embodiment , soluble dna - r species can be administered , most preferably by aerosol administration using formulations , excipients and vehicles well known in the art , directly to lung tissue , and competitive dna binding achieved thereby . in alternative embodiments , antisense oligonucleotides can be delivered to lung tissue , most preferably by aerosol administration , and expression of the dna - r in target cells of the lung repressed thereby . in further alternatives , antibodies , most preferably monoclonal antibodies , that specifically inhibit dna binding to the dna - r of the invention can be used to inhibit dna binding to said lung cells . the dna - r of the invention , particularly soluble embodiments and dna - binding fragments thereof , are also useful in treating other inflammation - associated diseases and conditions , including otitis media , septic arthritis and any bacterial or viral infection that causes inflammation by interaction with the dna - r additionally , the dna - r of the invention can be used to screen compounds that modulate dna binding , uptake and expression . introduction of dna , particularly dna encoding a desired gene , is a methodology well known in the art . however , dna introduction methods have been developed empirically and without any understanding of the molecular bases of dna uptake . specifically , heretofore specific dna binding to a dna - r as disclosed herein and uptake thereby by endocytosis was unappreciated in the art . identification of the dna - r of the invention thus provides a novel target for developing compounds and methods for increasing efficiency of dna uptake and expression of genes encoded thereby . another advantageous method provided by this invention is the use of dna - r expressed in tumor cells to facilitate delivery of dna - binding anticancer drugs to tumor cells . drugs such as adriamycin ( doxorubicin ) are in clinical use for the treatment of cancer patients . enhanced extracellular dna uptake in tumor cells expression the dna - r of the invention would facilitate uptake of such dna - binding anticancer drugs by using extracellular dna as a carrier of the drug into the cell . the association of the drug with the extracellular dna might enable the drug to avoid active efflux produced in tumor cells , inter alia , by drug resistance mediators such as p - glycoprotein . employing the same rationale as with gene transfer , the selective augmentation of dna binding receptors on tumor cells would enhance uptake of dna - binding drugs and result in an increased therapeutic effect . in alternative embodiments , other diseases , such as malaria , can be treated in a similar fashion , based on the development of cell - surface dna binding in red blood cells parasitized with the malarial parasite plasmodium falciparum . the examples which follow are illustrative of specific embodiments of the invention , and various uses thereof . they set forth for explanatory purposes only , and are not to be taken as limiting the invention . as described in the specification above , dna binding to cells had been observed in the art , and the behavior of said binding suggested the existence of a dna binding protein expressed at the cell surface . in order to isolate a novel dna - binding protein from human cells , serum from a patient with systemic lupus erythematosus ( sle ), treated to deplete the sera of anti - dna antibodies by multiple ( 6 ×) passages over a dna sepharose column , was used to screen a λgt11 cdna expression library made from liposaccharide stimulated human monocytes . this serum has been shown to have anti - dna receptor activities ( defined by the blocking of dna binding to cells ; bennet et al ., 1992 . j . clin . invest . 76 : 2182 - 2190 ). from approximately one million plaques screened with this sera , ten positive phage clones were identified and isolated according to the technique of young and davis ( 1983 , proc . natl . acad . sci . usa 80 : 1194 - 1198 ). the clones were grouped into two classes , based on southern blot and western blot analyses using eluted antibodies . sequence analysis of the 1 . 4 kilobase ( kb ) insert of one clone ( clone 88 ), which was highly reactive on western blots with sle serum , revealed an open reading frame that was open at the 5 ′ end of the clone and contained a translation stop codon at the 3 ′ end . this open reading frame coded for a 46 . 7 kilodalton ( kda ) protein fragment . the full length cdna for the putative dna - r was obtained in segments from peripheral blood mononuclear cells , human burkitt lymphoma cells ( raji ; accession no . ccl 86 , american type culture collection , manassas , va . ), human cervical carcinoma cells ( hela ; atcc accession no . ccl 2 ), and human lymphoblastic leukemia cells ( molt - 4 ; atcc accession no . crl 1582 ). a 731 base pair ( bp ) dna probe from clone 88 was used to screen a λgt11 phage library from a raji cell line ( the library was obtained from clonetech labs , palo alto , calif .). a 2409 bp clone which contained an additional 462 bp of 5 ′ open reading frame ( orf ) sequence was obtained from this screening . additional sequence from the 5 ′ extent of the cdna was isolated using two variations of the 5 ′ race ( rapid amplification of cdna ends ) method . in the first 5 ′ race method , single stranded dna ( ssdna ) was synthesized from hela cell mrna using polyt primers and reverse transcriptase . a polya tail was added to the 5 ′ end of the ssdna by terminal transferase . the single stranded cdna was amplified using a gene specific primer and a polyt primer . this clone contained 753 bp of additional sequence 5 ′ of the previously obtained sequence . the remainder of the 5 ′ sequence of the cdna was obtained from molt - 4 cdna by marathon race cdna amplification ( clonetech labs , palo alto , calif .) according to the manufacturer &# 39 ; s instructions . this procedure produced an additional 1290 bp clone consisting of 340 bp of orf and a 950 bp 5 ′ untranslated region . combining the results from these screening and amplification experiments produced the predicted full length cdna encoding the dna - r of the invention . a complete , full - length cdna for the putative dna receptor was cloned as a single rt - pcr product from molt - 4 mrna using oligonucleotide primers having the following sequence : primer 5 ′: acccgagcatggatccgccaccatggctgtgcaggcagc ( seq id no : 5 ) and primer 3 ′: ggtatctagatccatggtgtggtcac ( seq id no : 6 ) the complete sequence was 4351 nucleotides ( seq id no : 1 ) in length with a defined open reading frame of 3576 nucleotides encoding a protein of 1192 amino acids ( seq id no : 2 ). the isolation protocol is schematically illustrated in fig1 . tissue - specific and cell line - specific expression patterns of its corresponding mrna in various human tissues was analyzed by northern blot analysis on rna isolated from various tissues and cancer cell lines . the results of these experiments are shown in fig2 . a panel of tissue samples was examined by northern hybridization analysis performed under low stringency conditions , defined as hybridization at 42 ° c . in 5 × sspe ( 0 . 75m nacl , 0 . 05m nah 2 po 4 , 5 mm edta ), 10 × denhardt &# 39 ; s solution ( 0 . 2 % ficoll , 0 . 2 % polyvinylpyrrolidone , 0 . 2 % bovine serum albumen ), 100 μg / ml salmon sperm dna , 2 % sds and 50 % deionized formamide and 1 - 2 × 10 6 cpm random - primed , 32 p labeled probe , followed by washing in 0 . 1 × ssc ( 15 mm nacl , 1 . 5 mm trisodium citrate , 0 . 1 % sds ). the blots were hybridized with a probe consisting of442 bp of sequence from the 3 ′ end of the coding sequence from the dna - r gene to determine the distribution of receptor mrna . this analysis revealed two major transcripts of 9 . 5 and 6 . 8 kb in all human tissues and cancer cell lines examined . transcript expression was relatively abundant in spleen , testis , ovary , and small intestine . several smaller transcript sizes were also observed in some of the tissues and cell lines examined ( fig2 ). a homology search against human genomic sequence placed the dna receptor on chromosome 9q34 ( genbank accession number ac007066 , marker him9 . 89 on contig chr9 . sl27 ). the genomic sequence , which covered 85 % of the cdna starting from the 5 ′ end , revealed the location of 16 complete exons and the beginning of a 17 th exon . a blast search of the expressed tag sequence ( est ) database indicated wide expression of this gene in normal human tissue ( liver / spleen , prostate epithelial , germinal b cell , white adipose , pregnant uterus , fetal heart / liver and spleen ) and in tumor and transformed human cells ( jurkat , hl60 , 293 , g361 , b - cell lymphocytic leukemia , colon tumor , melanoma , and parathyroid tumor ). [ 0091 ] fig3 provides a schematic diagram of the structure of the dna - r protein encoded by seq id no . 1 . hydropathy analysis identified a 38 amino acid hydrophobic region near the carboxy terminus of the protein ( amino acids 1133 - 1171 ) which is a potential transmembrane domain . expression of a soluble species of this receptor by deleting these amino acids supported identification of this region as a transmembrane domain . in addition , seven consensus sites for - linked glycolsylation have been identified ( amino acid positions 122 , 394 , 430 , 451 , 466 , 468 , and 1150 ) and there is a proline rich ( 20 % of the residues are proline ) region spanning amino acids 549 - 809 ( fig3 ). the calculated isoelectric point of the dna receptor protein is 6 . 4 . the blast search also identified two art - recognized amino acid sequence motifs in the dna - r sequence : a c3hc3d ring finger subtype located near the amino terminus ( amino acids 14 - 50 ) and a c3h zinc finger located near the center of the protein sequence ( amino acids 416 - 435 ). an alignment of several ring finger motifs is shown in fig4 a ; dna - r differs from the originally identified c3hc4 ring finger motif by the replacement of the last cysteine with an aspartic acid . the alignment of the conserved cysteines and histidines of the c3h zinc finger motif is shown in fig4 b . the dna - r of the invention was produced recombinantly as follows . a bamhi - hpai cdna fragment containing the coding sequence for amino acids 1 - 1190 ( i . e ., missing the two most carboxylterminal amino acids ) of the dna - r of the invention was cloned into ptriplflu ( obtained from j . epstein , university of pennsylvania , philadelphia , pa .). this vector contains a sequence encoding an epitope tag from the influenza hemagglutinin gene in triplicate inserted immediately 3 ′ of the multiple cloning site of the parent vector , pcdna3 , and which are in - frame with the inserted dna - r cdna sequence . this vector was introduced into human 293 cells by transfection using lipofectamine ( life technologies , gaithersburg , md .) according to the manufacturer &# 39 ; s instructions . transfected cells ( 293 - dna - r / flu ) were selected by culturing in growth media ( dmem supplemented with 10 % fetal calf serum , 2 mm l - glutamine , 100 u / ml penicillin and 100 μg / ml streptomycin ) supplemented with 500 μg / ml g418 . in order to characterize dna - r protein expression in mamnmalian cells , immunoprecipitation and western blotting experiments were performed with protein extracts isolated from several cell lines using polyclonal antisera raised against an amino - terminal fragment of the dna - r of the invention , comprising amino acid residues 1 - 575 . polyclonal antibodies were produced to a purified fragment of the dna - r ( comprising amino acids 1 - 575 ) using conventional techniques . three female new zealand white rabbits ( western oregon rabbit company ), weighing 2 . 3 - 3 . 0 kg , were injected subcutaneously with 50 μg of the dna - r peptide that was produced in bacteria as a gst fusion protein ( described in example 4 ) and purified from its fusion partner . the antigen was emulsified with titre - max ( cytrx corp ., norcross , ga .) in a final volume of 0 . 5 ml . the rabbits were boosted 4 weeks later with 15 μg of antigen / titre - max mixture , again 2 weeks later , and were maintained on a once - a - month booster schedule thereafter . the rabbits were bled 7 - 10 days after each boost with antigen and the sera analyzed for reactivity to the immunizing antigen . the polyclonal antisera obtained from the inoculated rabbits was used in western blot analyses . a protein of mr ˜ 1 . 5 × 10 5 was identified by the anti - dna - r antibody in most cells tested ( including 293 , cos7 , g361 , hela , hre605 , molt - 4 , raji , a549 , b16 ). a protein with a similar mobility was detected in lysates of genetically - engineered human 293 cells ( 293 - dna - r / flu ) that were stably transfected with an expression vector for a carboxy - terminal ha - tagged dna - r ( pdna - r / flu ). as shown in fig5 this protein was detected by immunoprecipitation and / or western blot analysis with either the rabbit polyclonal anti - dna - r ( 1 - 575 ) antisera described above or with a mouse monoclonal antibody ( anti - ha ) specific for the carboxyl - terminal ha tag in the recombinantly - produced protein . in order to determine cellular localization of the dna - r protein , crude membrane fractions from recombinant 293 - dna - r / flu cells were examined by western blot analysis with either anti - dna - r or anti - ha antibodies . the results shown in fig6 indicated that essentially all the dna - r protein in those cells was associated with the membrane fraction . indirect immunofluorescence on fixed , permeabilized cells showed anti - dna - r staining was predominantly localized to the perinuclear region of the cell , although no nuclear staining was observed ( fig7 ). double staining with anti - dna - r and anti - transferrin receptor antibodies showed partial colocalization of the dna - r and transferrin receptor , however the dna - r did not colocalize with the transferrin receptor in peripheral endosomes ( fig7 ). these results indicate that extracellular dna is taken up by cells expressing the dna - r of the invention by endocytosis , and suggest that compounds that influence intracellular trafficking of molecules taken by endocytosis are useful for modulating the intracellular fate ( such as degradation in lysosomes or transport to the cell nucleus ) of extracellular dna . to determine if dna - r is located on the cell surface , cells were incubated with anti - dna - r ( 1 - 575 ) immune rabbit serum . antibody binding was detected by flow cytometry with fitc labeled secondary antibodies to rabbit igg . at all serum dilutions the fluorescence intensity of the cells incubated with immune serum was significantly higher than that of cells incubated with preimmune serum ( p & lt ; 0 . 003 ) suggesting that dna - r is expressed on the cell surface ( fig8 ). these results demonstrated that the dna - r protein , either natively expressed or expressed from the cloned cdna of the invention , or genetically - engineered embodiments thereof , localized to cell membranes as predicted by the hydropathy plot of the carboxyl terminus . the capacity of the dna - r of the invention to bind dna , and particularly the capacity of a soluble form of the dna - r protein to bind dna ( which would be useful for the development of a therapeutic agent as described more particularly below ) was determined . for these experiments , a fusion protein between the amino terminal portion of the dna receptor ( amino acids 1 - 575 ), lacking the transmembrane region but containing both the ring and zinc finger domains , was produced using the pgex vector system ( pharmacia , kalamazoo , mich .) for expression of glutathione - s - transferase ( gst )- fusion proteins in e . coli and named gst / dna - r ( 1 - 575 ). a schematic diagram of the production of this protein fragment and its structure relative to the full - length dna - r of the invention is shown in fig9 a . polyacrylamide gel analysis of the production , proteolysis , and purification of the recombinant dna - r peptide is shown in fig9 b . the calculated molecular weights of the gst / dna - r fusion protein and the dna - r peptide are 90 kda and 63 kda respectively . the purified gst / dna - r fusion protein was then examined for its ability to bind plasmid dna . three independent in vitro assays were used to assess dna binding by the fusion protein . first , the ability of gst / dna - r , bound to glutathione sepharose beads , to bind yoyo - labeled plasmid dna was determined by incubation with 0 . 9 μg yoyo / dna in 0 . 5 ml of medium . ( yoyo - 1 is an intercalating fluorochrome that is flourescent only when bound to dna , obtained from molecular probes , eugene , oreg .) beads ( 3 . 5 × 10 5 ) and yoyo / dna were incubated for 30 minutes at 4 ° c ., washed once and then fluorescence intensity analyzed by facs . as seen in fig1 , the gst / dna - r fusion protein was extremely efficient in binding dna whereas purified gst protein alone and two additional , unrelated gst - fusion proteins ( gst - cbd and gst - hst . 1 , gifts from dr . roland kwok , vollum institute , portland oreg .) failed to show any dna binding capability . following facs analysis an aliquot of glutathione sepharose - bound protein from each sample used in the dna binding assay was analyzed by sds - page followed by coomassie blue staining . an approximately equivalent amount of each gst - fusion protein was shown to be present in each sample . to further assess whether the gst / dna - r fusion protein was a dna - binding molecule , a southwestern blot was performed . the purified gst / dna - r fusion protein and gst protein alone were electrophoresed on a polyacrylamide gel , electrophoretically transferred to nitrocellulose and then probed with biotinylated dna . dna binding was visualized by addition of steptavidin conjugated with horse radish peroxidase ( hrp ) using conventional methods . as seen in fig1 , purified gst / dna - r fusion protein ( fig1 b , lane 1 ), but not gst protein alone ( fig1 b , lane 2 ) bound biotinylated plasmid dna . other peptides seen to react with biotinylated dna / streptavidin - hrp in the gst / dna - r samples ( fig1 b , lanes 1 ) probably represent partially degraded gst / dna - r peptides and / or traces of contaminating bacterial proteins . lanes in fig1 a represent no added dna . third , as a final assessment of the dna binding ability of the purified dna receptor fragment ( amino acids 1 - 575 ) the ability of the purified peptide to bind to elisa plates coated with plasmid dna ( varelisa dsdna kit , pharmacia ) was determined . binding of the dna receptor peptide was detected using the rabbit anti - dna - r polyclonal antisera described example 3 . as shown in fig1 , purified dna - r peptide bound to dna coated plates when tested at both 1 μg / ml and 10 μg / ml . negative controls not including the dna - r fragment showed no reactivity . these results demonstrate that the dna receptor gene of the invention encodes a protein that specifically binds dna , and that the dna binding portion of the molecule resided in the protein fragment having amino acid sequence 1 - 575 of the native protein . having demonstrated that the protein encoded by the cloned cdna of the invention bound dna , the affinity of soluble gst - dna - r for dna was estimated using a nitrocellulose filter - binding assay . the assay was performed using cold dna competition where known amounts of gst / dna - r ( 2 nm ) and labeled dna ( 200 pm ) were titrated with increasing amounts of unlabeled calf thymus dna . these results demonstrated that dna binding to the dna - r of the invention was saturable , consistent with its identification as a specific receptor . a scatchard transformation of the data yield a k d ˜ 4 nm ( fig1 ). to demonstrate that the binding of dna by the soluble form of the dna - r ( amino acids 5 1 - 575 ) was not due to monospecific charge - related interactions , the role in dna binding of the zinc finger domain at amino acids 416 - 435 was examined . using site - directed mutagenesis , the codon for the conserved zinc finger cysteines at either amino acids 416 or 431 were altered to a codon for either alanine or serine . the mutagenized gst / dna - r fusion proteins were expressed in e . coli and affinity purified on glutathione sepharose , then tested for their ability to bind to immobilized dna by elisa , all substantially as described above . purified gst / dna - r ( 1 - 575 ) fusion protein bound to elisa plates coated with calf thymus dna ( magiwel , united biotech , mountain view , calif . ), as shown in fig1 . mutagenesis of either cysteine 416 or 431 reduced dna binding to approximately 50 % of the level observed for wild - type gst / dna - r fusion protein , strongly suggesting that this zinc finger domain is involved in specific dna binding fig1 . these results demonstrated that dna binding by the soluble dna - r fragment is not simply a nonspecific charge related interaction , but rather is mediated by specific a dna - binding motifs in the protein , including at least the zinc finger motif . soluble dna - r protein inhibits dna - induced cytokine secretion and blocks binding of dna to cells the presence of extracellular dna in lung tissue of several chronic lung diseases , including cystic fibrosis , chronic bronchitis and bronchiectasis , causes or contributes to chronic inflammation of lung tissues with long - term pathological consequences . extracellular dna is known in the art to cause lung macrophages and other cells to release cytokines that mediate inflammation as part of the chronic symptomology of cystic fibrosis patients . as described in example 2 , the dna - r protein of the invention is expressed in lung tissues , specifically in epithelial cells of the lung . this suggests that the dna - r receptor protein of the invention is involved in inflammation by triggering the release of inflammation - causing cytokines . thus , the ability of a soluble form of the dna - r to bind dna suggested that this protein fragment could compete for binding extracellular dna in cystic fibrosis patients and would be useful thereby as a therapeutic agent . to determine if the soluble dna - r fragment of the invention inhibits dna - induced cytokine secretion , soluble dna - r protein was examined for inhibition of cf - dna - induced il - 6 release from j774 murine monocyte / macrophage cells in culture . in the absence of stimulating dna , dna - r did not induce il - 6 secretion ( shown in table i ). dna isolated and purified from a patient with cystic fibrosis ( cf dna ) induced 611 pg / ml of il - 6 from j774 cells . when cf dna was incubated first with dna - r protein ( 10 ng / ml ) and then added to j774 cells , the amount of il - 6 was reduced by 36 % in the presence of the soluble dna - r protein ( 10 ng / ml ). as a negative control , calf thymus dna failed to induce detectable il - 6 . to eliminate the possibility that cytokine release was caused by the presence of contaminating endotoxin , a limulus amoebacyte assay was performed , and the cf dna had & lt ; 0 . 25 ng / ml of contaminating endotoxin . in control experiments , this amount of lps induced only 4 pg / ml of il - 6 . in the second experiment ( also shown in table 1 ), contaminating endotoxin was removed from the soluble dna - r , permitting the use of increased dna - r concentrations . soluble dna - r protein ( used in the range 10 ng / ml - 50 ng / ml ) was incubated with j774 cells and 50 μg / ml of e . coli dna . cell - free supernatants were collected and il - 6 quantified by elisa . in the absence of bacterial dna soluble dna - r did not induce il - 6 secretion . when bacterial dna was added to the system , however , soluble dna receptor protein inhibited il - 6 secretion in a dose - dependent manner ( table i ). table i stimulus treatment il - 6 ( pg / ml ) % inhibition — medium 0 — — dna - r ( 10 ng / ml ) 0 — cf dna ( 10 μg / ml ) medium 611 — cf dna ( 10 μg / ml ) dna - r ( 10 ng / ml ) 438 22 e . coli ( 10 μg / ml ) medium 1467 — e . coli ( 10 μg / ml ) dna - r ( 10 ng / ml ) 945 36 e . coli ( 50 μg / ml ) medium 2390 ± 344 — e . coli ( 50 μg / ml ) dna - r ( 10 ng / ml ) 1193 ± 128 50 . 1 e . coli ( 50 μg / ml ) dna - r ( 20 ng / ml ) 983 ± 212 58 . 9 e . coli ( 50 μg / ml ) dna - r ( 50 ng / ml ) 652 ± 76 72 . 7 ct dna 1 medium 0 — lps 2 medium 4 — to determine whether soluble dna - r protein fragment was capable of preventing dna binding to cells , j774 cells ( 5 × 10 5 cells ) and yoyo labeled pgem - dna were incubated with either the soluble dna - r protein fragment or control gst protein . cells were incubated for 30 minutes at 4 ° c ., centrifuged and washed twice with assay media , resuspended and incubated with 7 - amino actinomycin d ( 7aad ) on ice for 20 minutes in order to assess viability . the samples were assessed for dna binding by facscan ( becton - dickinson , franklin lanes , n . j .). results showed a dose - dependent inhibition of dna binding to j774 cells ( fig1 ). similar results were observed using human 293 cells . additionally , the soluble dna - r protein / dna complex does not bind to the cell surface . the soluble dna - r protein bound to dna and is effective at preventing the association of dna with the cell surface . these results indicate that the soluble dna - r fragment provided by this invention is useful for inhibiting cytokine release , and inflammation consequent thereto , by competitively binding either bacterial or mammalian extracellular dna and reducing the amount of such dna bound by cytokine - producing cells expressing the dna - r of the invention . the experimental results disclosed above established that the soluble dna - r fragment comprising amino acids 1 - 575 of the dna - r of the invention was capable of binding dna . further experiments were performed to characterize dna binding to the receptor , particularly whether the native receptor protein was capable of binding extracellular dna at the cell surface , and whether binding is consistent with a receptor - mediated process . in these experiments , a549 human lung carcinoma cells were harvested from log - phase cultures and treated with dnase and rnase to remove exogenous cell - surface bound nucleic acids . after treatment , the cells were washed with 10 mm edta and phosphate buffered saline ( pbs ) to stop the action of dnase and rnase . the cells were then plated in v - bottom 96 - well plates at 10 6 cells / well in pbs containing 1 % fetal calf serum ( fcs ) and 1 mm ca ++ mg ++ . yoyo - labeled pgem4z plasmid dna was added at concentrations from 0 - 25 μg / ml in 0 . 2 ml media containing 1 % fcs and 1 mm ca ++ mg ++ . the cells plus labeled plasmid were incubated for 30 minutes at 4 ° c ., to minimize internalization of plasmid dna . upon completion of the 30 minute incubation , the cells were washed with 2 × in pbs containing 1 % fcs and 1 mm ca ++ mg ++ and resuspended in 0 . 3 ml of pbs . cells were then fixed in 1 % formaldehyde and cell - surface binding of plasmid dna quantified by facs . the results of these experiments are shown in fig1 . this representative facs histogram demonstrates the a549 cell profiles seen when comparing cells incubated with either medium ( fig1 , curve on the left ) or cells incubated with 5 μg / ml of yoyo / pgem4z plasmid ( fig1 , curve shifted to the right ). the geometric mean of the intensity is used to describe the cell populations . in this example , the geometric mean of the a549 cell population , treated with medium only , was 13 and increased to 34 when incubated with yoyo - labeled plasmid dna . a binding curve for a549 cells was then generated using a range of plasmid dna from 0 - 25 μg / ml ( fig1 a and 17b ). the y - axis of the graph in fig1 a represents the geometric mean of the fluorescence intensity of the cell populations in the graph . cell surface binding of plasmid dna to a549 cells began to show saturation at approximately 10 μg / ml of dna . treatment of cells with a 25 - 100 fold excess of unlabeled dna significantly blocked the binding of yoyo / dna to the cell surface ( fig1 a ). the specific cell - surface binding to a549 cells , represented as the difference between total binding seen with excess unlabeled dna , shows a binding curve with a characteristic saturation profile ( fig1 b ). also examined were the cell - surface plasmid dna binding profiles for a variety of tumor cell lines , including b16 murine melanoma cells , molt - 4 human lymphoblastic leukemia cells , and the human raji burkitt lymphoma cells . in all cells examined , cell - surface dna saturable binding profiles were obtained , consistent with a receptor - mediated mechanism of binding . under optimal dna binding conditions the percent of cells in the population capable of binding dna above the background level as detected by facs , ranged from greater than 70 % ( s49 , dhl - 6 , molt - 4 ) to less than 10 % ( d10 . s , hut - 78 , k562 and g361 ). table ii cell type % cells binding dna lineage s49 98 murine t - cell lymphoma molt - 4 79 human lymphoblastic leukemia dhl - 6 70 human b - cell a549 55 human lung carcinoma dami 44 human leukemia b16 32 murine leukemia b9 21 murine plasmacytoma cos - 7 20 african green monkey kidney cell hbe014 20 human bronchial epithelial cell mo - 7 16 human leukemia nor - 10 16 murine muscle j558 15 murine plasmacytoma raji 15 human burkitt lymphoma hela 12 human cervical cancer sw480 12 human colon adenocarcinoma hut - 78 7 human cutaneous t - cell lymphoma k562 5 human myelogenous leukemia d10 . s 3 murine t cell g361 3 human malignant melanoma spleen 80 normal mouse spleen cells to determine if dna binding is mediated by a cell - surface protein , the experiments were performed substantially as described after cells were treated with trypsin . cell - surface dna - binding of plasmid dna on a549 cells was significantly inhibited by treatment of cells with trypsin after binding with yoyo - labeled dna at 4 ° c . ( fig1 ). finally , the effect of divalent cations on cell surface dna binding was examined , using b16 melanoma cells . these studies demonstrated a four - fold increase in fluorescence intensity when ca ++ is added to the binding media ( fig1 ). these results indicate that the dna - r protein of the invention mediates cell surface binding of extracellular dna in mammalian cells . the experiments described in example 6 established that extracellular dna was specifically bound to the dna - r of the invention . internalization of dna into cells by the receptor was characterized using the following assay . yoyo - labeled plasmid dna was used to examine the kinetics of plasmid dna internalization . the plasmid used in these assays was pegfp - n1 , encoding green fluorescent protein ( clontech , palo alto , calif .). the assay required that cell surface binding of labeled dna be distinguished from internalized plasmid dna . this was accomplished by treatment of cells with trypsin to remove cell - surface proteins after incubation with plasmid dna . this procedure permitted cell surface - bound plasmid dna to be distinguished from internalized plasmid dna , since trypsin treatment abolished cell surface bound dna but not internalized plasmid dna . in this assay , cells were plated in 24 well plates and incubated in culture media for 24 h . media was then removed and various concentrations ( 0 - 25 μg / ml ) of yoyo - labeled pegfp - n1 plasmid dna were added . the cells plus plasmid dna were incubated for various times ( 0 . 5 to 5 hours ) at 37 ° c . thereafter , the media was removed , cells were treated with trypsin , washed , and then fixed with 1 % formaldehyde . facs analysis was used to quantify fluorescence intensity . b16 murine melanoma cells were examined for internalization of yoyo / dna using the above protocol after incubation for 1 , 3 , and 5 hours ( fig2 ). internalization of pegfp - n1 were found to be both dose - and time - dependent . an increasing amount of internalized plasmid dna was seen with increasing dose of dna and increasing time of incubation . internalization of plasmid dna by a549 cells was evaluated both with and without pre - treatment with unlabeled dna . this assay was repeated with a549 cells , and similar results were obtained ( fig2 ). moreover , pre - treatment of the a549 cells with a25 - 100 - fold excess of unlabeled calf thymus dna significantly inhibited subsequent internalization of plasmid dna ( fig2 ). similar inhibition of internalization by pre - treatment of cells with excess unlabeled dna was observed using a number of other cell lines ( including b16 , raji , and molt - 4 ). this demonstration of saturable dna binding and internalization indicates that the cell - surface dna receptor of the invention mediates internalization of extracellular plasmid dna . internalization of plasmid dna was also observed to be a temperature - dependent process . treatment of b16 cells at 4 ° c . significantly inhibited the amount of plasmid dna that was internalized as compared to cells maintained at 37 ° c . ( fig2 ). in order to ascertain whether the amount of dna - r expressed on the cell surface influences the extent of extracellular dna binding or dna internalization , binding and internalization of plasmid dna was compared in two cell lines : human melanoma g361 and the 293 human cell line . the g361 cells bound relatively low amounts of dna , while 293 cells bound larger amounts of plasmid dna as assessed by the cell - surface dna binding assay ( fig2 ). consistent with the binding results were the results obtained in these cells for dna internalization , which showed that g361 cells internalized less plasmid dna then 293 cells ( fig2 ). these data are consistent with identification of the dna - r of the invention as a cell surface dna receptor protein . conditions for transgene expression using dna internalized by the dna - r of the invention were developed . the experiments described above established plasmid dna concentrations that saturated cell - surface binding . used the pegfp - n1 plasmid coding for green fluorescent protein ( gfp ), which was used because gfp remains exclusively intracellular . facs analysis was used to quantify gfp expression . in this assay , cells ( 1 . 25 × 10 5 / well ) were plated in 24 - well plates and incubated overnight under mammalian cell culture conditions . on the next day , media was removed and the cells incubated for 3 hours at 37 ° c . in 5 % co 2 with plasmid dna in 0 . 3 ml of growth medium . dna was then removed and fresh medium added to the cells . in some cases 0 . 3 ml of growth medium was added to cells without removing the dna . after 24 - 72 hours further incubation media was removed and cells washed once and then fixed with formaldehyde . fluorescence intensity in the fixed cells was determined by facs . however , no gfp expression was detected , even when using several different concentrations of pegfp - n1 plasmid and incubation times . this result was consistently obtained , using a variety of cell lines ( a549 , b16 , raji ), incubation times ( 24 - 72 hours ), and ranges of plasmid dna concentrations ( 0 . 1 to 100 μg / ml ). this result was obtained using cell lines that bind relatively higher levels of dna on their cell - surface and those that bind lower levels of dna . in positive controls , pegfp - n1 plasmid was delivered by liposomes ( lipofectamine , gibco - brl , gaithersburg , md .) and resulted in significant gfp fluorescence within 24 hours . representative data using the b16 cell line incubated with either pegfp - n1 alone or pegfp - n1 delivered by liposomes shows the difference in gfp expression between these two techniques ( fig2 ). in view of these results , the experiments were repeated with a549 cells in the presence of nocodazol , a microtubule inhibitor . use of this inhibitor was indicated because one possible explanation of the unsuccessful experiments is that the dna internalized by the dna - r of the invention had been degraded , and nocodazol treatment was expected to reduce the extent of such degradation . treatment of a549 cells with nocodazol prior to incubation with pegfp - n1 resulted in a significant increase in expression of gfp as compared to cells that were not treated with nocodazol and incubated with pegfp - n1 ( fig2 ). cells which were not treated with nocodazol failed to demonstrate detectable expression of gfp ( fig2 ). these results indicated that uptake of extracellular dna mediated by the dna - r of the invention required additional treatment to result in expression of genes encoded therein , and the above assay provides a prototype of assays for identifying such compounds . in these assays , an amount of gfp - encoding plasmid dna known to reliably produce detectable gfp expression is contacted with a mammalian cell expression the dna - r of the invention at levels known to mediate efficient uptake of extracellular dna . gfp gene expression is then assayed in the presence and absence of a test compound to detect increased gene expression in the presence of the compound . it should be understood that the foregoing disclosure emphasizes certain specific embodiments of the invention and that all modifications or alternatives equivalent thereto are within the spirit and scope of the invention as set forth in the appended claims . a atg cct gtg cag gca gct caa tgg aca gaa ttt ctg tcc tgt cca atc 649 met pro val gln ala ala gln trp thr glu phe leu ser cys pro ile tgc tat aat gaa ttt gat gag aat gtg cac aaa ccc atc agt tta ggt 697 cys tyr asn glu phe asp glu asn val his lys pro ile ser leu gly tgt tca cac act gtt tgc aag acc tgc ttg aat aaa ctt cat cga aaa 745 gct tgt cct ttt gac cag act gcc atc aac aca gat att gat gta ctt 793 ala cys pro phe asp gln thr ala ile asn thr asp ile asp val leu cct gtc aac ttc gca ctt ctc cag tta gtt gga gcc cag gta cca gat 841 cat cag tca att aag tta agt aat cta ggt gag aat aaa cac tat gag 889 gtt gca aag aaa tgc gtt gag gat ttg gca ctc tac tta aaa cca cta 937 agt gga ggt aaa ggt gta gct agc ttg aac cag agt gca ctg agc cgt 985 cca atg caa agg aaa ctg gtg aca ctt gta aac tgt caa ctg gtg gag 1033 pro met gln arg lys leu val thr leu val asn cys gln leu val glu gaa gaa ggt cgt gta aga gcc atg cga gca gct cgt tcc ctt gga gaa 1081 aga act gta aca gaa ctg ata tta cag cac cag aac cct cag cag ttg 1129 tct gcc aat cta tgg gcc gct gtc agg gct cga gga tgc cag ttt tta 1177 ser ala asn leu trp ala ala val arg ala arg gly cys gln phe leu ggg cca gct atg caa gaa gag gcc ttg aag ctg gtg tta ctg gca tta 1225 gaa gat ggt tct gcc ctc tca agg aaa gtt ctg gta ctt ttt gtt gtg 1273 cag aga cta gaa cca aga ttt cct cag gca tca aaa aca agt att ggt 1321 gln arg leu glu pro arg phe pro gln ala ser lys thr ser ile gly cat gtt gtg caa cta ctg tat cga gct tct tgt ttt aag gtt acc aaa 1369 his val val gln leu leu tyr arg ala ser cys phe lys val thr lys aga gat gaa gac tct tcc cta atg cag ctg aag gag gaa ttt cgg agt 1417 tat gaa gca tta cgc aga gaa cat gat gcc caa att gtt cat att gcc 1465 atg gaa gca gga ctc cgt att tca cct gaa cag tgg tcc tct ctt ttg 1513 met glu ala gly leu arg ile ser pro glu gln trp ser ser leu leu tat ggt gat ttg gct cat aaa tca cac atg cag tct atc att gat aag 1561 tyr gly asp leu ala his lys ser his met gln ser ile ile asp lys cta cag tct cca gag tca ttt gca aag agt gtc cag gaa ttg aca att 1609 leu gln ser pro glu ser phe ala lys ser val gln glu leu thr ile gtt ttg caa cga aca ggt gac cca gct aac tta aat aga ctg agg cct 1657 cat tta gag ctt ctt gca aac ata gac cct aat cca gac gct gtt tca 1705 cca act tgg gag cag ctg gaa aat gca atg gta gct gtt aaa aca gta 1753 pro thr trp glu gln leu glu asn ala met val ala val lys thr val gtt cat ggc ctt gtg gac ttc ata caa aat tat agt aga aaa ggc cat 1801 val his gly leu val asp phe ile gln asn tyr ser arg lys gly his gag acc cct cag cct cag cca aac agc aaa tac aag act agc atg tgc 1849 cga gat ttg cga cag cag ggg ggt tgt cca cga gga aca aat tgt aca 1897 ttt gcc cat tct cag gaa gag ctt gaa aag tat cga tta agg aac aaa 1945 phe ala his ser gln glu glu leu glu lys tyr arg leu arg asn lys aag atc aat gcc act gta aga acg ttt cct ctt cta aat aaa gtt ggt 1993 lys ile asn ala thr val arg thr phe pro leu leu asn lys val gly gta aac aac act gtc aca acc aca gcc gga aat gtc att tct gtc ata 2041 gga agt act gaa aca aca ggg aaa att gtt cca agt aca aac gga att 2089 tca aat gca gaa aac agt gtt tcc cag cta atc tca cgt agt act gac 2137 ser asn ala glu asn ser val ser gln leu ile ser arg ser thr asp agt acc tta aga gct ctg gag acc gtg aag aaa gtg gga aag gtt ggc 2185 gct aat ggt cag aat gct gct ggg ccc tct gca gat tct gta act gaa 2233 aat aaa att ggt tct cca ccc aag act cct gta agt aat gta gca gct 2281 acc tca gct ggg ccc tct aat gtt gga aca gag ctg aat tct gtg cct 2329 caa aaa tcc agc cca ttt cta act aga gta cca gta tat cct ccg cat 2377 gln lys ser ser pro phe leu thr arg val pro val tyr pro pro his tct gaa aac att cag tat ttt caa gat cca agg act cag ata ccc ttt 2425 ser glu asn ile gln tyr phe gln asp pro arg thr gln ile pro phe gaa gtc cca cag tac cca cag aca gga tac tat cca cca cct cca acg 2473 gta cca gct ggt gtg gct ccc tgt gtt cct cgc ttt gtg agg tcc aat 2521 aac gtt cca gag tcc tcc ctc cca cct gct tcc atg cca tat gcc gat 2569 cat tac agt aca ttt tcc cct cga gat cga atg aat tct tct cct tac 2617 cag cct cct cct ccg cag ccg tat gga cca gtt cct cca gta cct tct 2665 gga atg tat gct cct gtg tac gac agc agg cgc atc tgg cgc cca cct 2713 gly met tyr ala pro val tyr asp ser arg arg ile trp arg pro pro atg tac caa cga gat gac att att aga agc aat tct tta cct cca atg 2761 gat gtg atg cac tca tct gtc tat cag aca tct ttg cgg gaa aga tat 2809 asp val met his ser ser val tyr gln thr ser leu arg glu arg tyr aac tca tta gat gga tat tat tcg gtg gct tgt cag cca cca agt gag 2857 asn ser leu asp gly tyr tyr ser val ala cys gln pro pro ser glu cca agg aca act gtg cct tta cca agg gaa cct tgt ggt cat ttg aag 2905 acc agt tgc gag gag cag ata aga aga aag cca gat cag tgg gca cag 2953 thr ser cys glu glu gln ile arg arg lys pro asp gln trp ala gln tac cac act cag aaa gca cct ctt gtc tct tca act ctt cct gtg gca 3001 aca cag tca cca aca cca cct tct cct ctg ttc agt gta gac ttt cgt 3049 gcg gat ttc tca gag agt gtg agt ggt aca aaa ttt gaa gaa gat cat 3097 ctt tcc cat tat tct ccc tgg tct tgt ggc acc ata ggc tcc tgt ata 3145 aat gcc att gat tca gag ccc aaa gat gtc att gct aat tca aat gct 3193 gtg tta atg gac ctg gac agt ggt gat gtt aag aga aga gta cat tta 3241 ttt gaa acc cag aga agg aca aaa gaa gaa gat cca ata att ccc ttt 3289 agt gat gga ccc atc atc tca aaa tgg ggt gcg att tcc aga tct tcc 3337 cgt aca ggt tac cat acc aca gat cct gtc cag gcc act gct tcc caa 3385 arg thr gly tyr his thr thr asp pro val gln ala thr ala ser gln gga agt gcg act aag ccc atc agt gta tca gat tat gtc cct tat gtc 3433 aat gct gtt gat tca agg tgg agt tca tat ggc aac gag gcc aca tca 3481 asn ala val asp ser arg trp ser ser tyr gly asn glu ala thr ser tca gca cac tat gtt gaa agg gac aga ttc att gtt act gat tta tct 3529 ser ala his tyr val glu arg asp arg phe ile val thr asp leu ser ggt cat aga aag cat tcc agt act ggg gac ctt ttg agc ctt gaa ctt 3577 cag cag gcc aag agc aac tca tta ctt ctt cag aga gag gcc aat gct 3625 ttg gcc atg caa cag aag tgg aat tcc ctg gat gaa ggc cgt cac 3670 leu ala met gln gln lys trp asn ser leu asp glu gly arg his ctt acc tta aac ctt tta agc aag gaa att gaa cta aga aat gga 3715 gag tta cag agt gat tat aca gaa gat gca aca gat act aaa cct 3760 glu leu gln ser asp tyr thr glu asp ala thr asp thr lys pro gat agg gat atc gag tta gag ctt tca gca ctt gat act gat gaa 3805 cct gat gga caa agt gaa cca att gaa gag atc ttg gac ata cag 3850 ctt ggt atc agt tct caa aat gat cag ttg cta aat gga atg gca 3895 gtg gaa aat ggg cat cca gta cag cag cac caa aag gag cca cca 3940 aag cag aag aaa cag agt tta ggt gaa gac cat gtg att ctg gag 3985 lys gln lys lys gln ser leu gly glu asp his val ile leu glu gag caa aaa aca att ctg ccg gta act tct tgc ttt agc cag cca 4030 glu gln lys thr ile leu pro val thr ser cys phe ser gln pro ctc cca gtg tct att agc aat gca agt tgc ctc ccc atc acc aca 4075 tct gtc agt gct ggc aac ctc att ctg aaa act cat gtt atg tct 4120 ser val ser ala gly asn leu ile leu lys thr his val met ser gaa gat aaa aac gac ttt tta aaa cct gtt gca aat ggg aag atg 4165 glu asp lys asn asp phe leu lys pro val ala asn gly lys met met pro val gln ala ala gln trp thr glu phe leu ser cys pro ile cys tyr asn glu phe asp glu asn val his lys pro ile ser leu gly ala cys pro phe asp gln thr ala ile asn thr asp ile asp val leu pro met gln arg lys leu val thr leu val asn cys gln leu val glu ser ala asn leu trp ala ala val arg ala arg gly cys gln phe leu gln arg leu glu pro arg phe pro gln ala ser lys thr ser ile gly his val val gln leu leu tyr arg ala ser cys phe lys val thr lys met glu ala gly leu arg ile ser pro glu gln trp ser ser leu leu tyr gly asp leu ala his lys ser his met gln ser ile ile asp lys leu gln ser pro glu ser phe ala lys ser val gln glu leu thr ile pro thr trp glu gln leu glu asn ala met val ala val lys thr val val his gly leu val asp phe ile gln asn tyr ser arg lys gly his phe ala his ser gln glu glu leu glu lys tyr arg leu arg asn lys lys ile asn ala thr val arg thr phe pro leu leu asn lys val gly ser asn ala glu asn ser val ser gln leu ile ser arg ser thr asp gln lys ser ser pro phe leu thr arg val pro val tyr pro pro his ser glu asn ile gln tyr phe gln asp pro arg thr gln ile pro phe gly met tyr ala pro val tyr asp ser arg arg ile trp arg pro pro asp val met his ser ser val tyr gln thr ser leu arg glu arg tyr asn ser leu asp gly tyr tyr ser val ala cys gln pro pro ser glu thr ser cys glu glu gln ile arg arg lys pro asp gln trp ala gln arg thr gly tyr his thr thr asp pro val gln ala thr ala ser gln asn ala val asp ser arg trp ser ser tyr gly asn glu ala thr ser ser ala his tyr val glu arg asp arg phe ile val thr asp leu ser leu ala met gln gln lys trp asn ser leu asp glu gly arg his glu leu gln ser asp tyr thr glu asp ala thr asp thr lys pro lys gln lys lys gln ser leu gly glu asp his val ile leu glu glu gln lys thr ile leu pro val thr ser cys phe ser gln pro ser val ser ala gly asn leu ile leu lys thr his val met ser glu asp lys asn asp phe leu lys pro val ala asn gly lys met a atg gct gtg cag gca gct caa tgg aca gaa ttt ctg tcc tgt cca atc 649 met ala val gln ala ala gln trp thr glu phe leu ser cys pro ile tgc tat aat gaa ttt gat gag aat gtg cac aaa ccc atc agt tta ggt 697 cys tyr asn glu phe asp glu asn val his lys pro ile ser leu gly tgt tca cac act gtt tgc aag acc tgc ttg aat aaa ctt cat cga aaa 745 gct tgt cct ttt gac cag act gcc atc aac aca gat att gat gta ctt 793 ala cys pro phe asp gln thr ala ile asn thr asp ile asp val leu cct gtc aac ttc gca ctt ctc cag tta gtt gga gcc cag gta cca gat 841 cat cag tca att aag tta agt aat cta ggt gag aat aaa cac tat gag 889 gtt gca aag aaa tgc gtt gag gat ttg gca ctc tac tta aaa cca cta 937 agt gga ggt aaa ggt gta gct agc ttg aac cag agt gca ctg agc cgt 985 cca atg caa agg aaa ctg gtg aca ctt gta aac tgt caa ctg gtg gag 1033 pro met gln arg lys leu val thr leu val asn cys gln leu val glu gaa gaa ggt cgt gta aga gcc atg cga gca gct cgt tcc ctt gga gaa 1081 aga act gta aca gaa ctg ata tta cag cac cag aac cct cag cag ttg 1129 tct gcc aat cta tgg gcc gct gtc agg gct cga gga tgc cag ttt tta 1177 ser ala asn leu trp ala ala val arg ala arg gly cys gln phe leu ggg cca gct atg caa gaa gag gcc ttg aag ctg gtg tta ctg gca tta 1225 gaa gat ggt tct gcc ctc tca agg aaa gtt ctg gta ctt ttt gtt gtg 1273 cag aga cta gaa cca aga ttt cct cag gca tca aaa aca agt att ggt 1321 gln arg leu glu pro arg phe pro gln ala ser lys thr ser ile gly cat gtt gtg caa cta ctg tat cga gct tct tgt ttt aag gtt acc aaa 1369 his val val gln leu leu tyr arg ala ser cys phe lys val thr lys aga gat gaa gac tct tcc cta atg cag ctg aag gag gaa ttt cgg agt 1417 tat gaa gca tta cgc aga gaa cat gat gcc caa att gtt cat att gcc 1465 atg gaa gca gga ctc cgt att tca cct gaa cag tgg tcc tct ctt ttg 1513 met glu ala gly leu arg ile ser pro glu gln trp ser ser leu leu tat ggt gat ttg gct cat aaa tca cac atg cag tct atc att gat aag 1561 tyr gly asp leu ala his lys ser his met gln ser ile ile asp lys cta cag tct cca gag tca ttt gca aag agt gtc cag gaa ttg aca att 1609 leu gln ser pro glu ser phe ala lys ser val gln glu leu thr ile gtt ttg caa cga aca ggt gac cca gct aac tta aat aga ctg agg cct 1657 cat tta gag ctt ctt gca aac ata gac cct aat cca gac gct gtt tca 1705 cca act tgg gag cag ctg gaa aat gca atg gta gct gtt aaa aca gta 1753 pro thr trp glu gln leu glu asn ala met val ala val lys thr val gtt cat ggc ctt gtg gac ttc ata caa aat tat agt aga aaa ggc cat 1801 val his gly leu val asp phe ile gln asn tyr ser arg lys gly his gag acc cct cag cct cag cca aac agc aaa tac aag act agc atg tgc 1849 cga gat ttg cga cag cag ggg ggt tgt cca cga gga aca aat tgt aca 1897 ttt gcc cat tct cag gaa gag ctt gaa aag tat cga tta agg aac aaa 1945 phe ala his ser gln glu glu leu glu lys tyr arg leu arg asn lys aag atc aat gcc act gta aga acg ttt cct ctt cta aat aaa gtt ggt 1993 lys ile asn ala thr val arg thr phe pro leu leu asn lys val gly gta aac aac act gtc aca acc aca gcc gga aat gtc att tct gtc ata 2041 gga agt act gaa aca aca ggg aaa att gtt cca agt aca aac gga att 2089 tca aat gca gaa aac agt gtt tcc cag cta atc tca cgt agt act gac 2137 ser asn ala glu asn ser val ser gln leu ile ser arg ser thr asp agt acc tta aga gct ctg gag acc gtg aag aaa gtg gga aag gtt ggc 2185 gct aat ggt cag aat gct gct ggg ccc tct gca gat tct gta act gaa 2233 aat aaa att ggt tct cca ccc aag act cct gta agt aat gta gca gct 2281 acc tca gct ggg ccc tct aat gtt gga aca gag ctg aat tct gtg cct 2329 caa aaa tcc agc cca ttt cta act aga gta cca gta tat cct ccg cat 2377 gln lys ser ser pro phe leu thr arg val pro val tyr pro pro his tct gaa aac att cag tat ttt caa gat cca agg act cag ata ccc ttt 2425 ser glu asn ile gln tyr phe gln asp pro arg thr gln ile pro phe gaa gtc cca cag tac cca cag aca gga tac tat cca cca cct cca acg 2473 gta cca gct ggt gtg gct ccc tgt gtt cct cgc ttt gtg agg tcc aat 2521 aac gtt cca gag tcc tcc ctc cca cct gct tcc atg cca tat gcc gat 2569 cat tac agt aca ttt tcc cct cga gat cga atg aat tct tct cct tac 2617 cag cct cct cct ccg cag ccg tat gga cca gtt cct cca gta cct tct 2665 gga atg tat gct cct gtg tac gac agc agg cgc atc tgg cgc cca cct 2713 gly met tyr ala pro val tyr asp ser arg arg ile trp arg pro pro atg tac caa cga gat gac att att aga agc aat tct tta cct cca atg 2761 gat gtg atg cac tca tct gtc tat cag aca tct ttg cgg gaa aga tat 2809 asp val met his ser ser val tyr gln thr ser leu arg glu arg tyr aac tca tta gat gga tat tat tcg gtg gct tgt cag cca cca agt gag 2857 asn ser leu asp gly tyr tyr ser val ala cys gln pro pro ser glu cca agg aca act gtg cct tta cca agg gaa cct tgt ggt cat ttg aag 2905 acc agt tgc gag gag cag ata aga aga aag cca gat cag tgg gca cag 2953 thr ser cys glu glu gln ile arg arg lys pro asp gln trp ala gln tac cac act cag aaa gca cct ctt gtc tct tca act ctt cct gtg gca 3001 aca cag tca cca aca cca cct tct cct ctg ttc agt gta gac ttt cgt 3049 gcg gat ttc tca gag agt gtg agt ggt aca aaa ttt gaa gaa gat cat 3097 ctt tcc cat tat tct ccc tgg tct tgt ggc acc ata ggc tcc tgt ata 3145 aat gcc att gat tca gag ccc aaa gat gtc att gct aat tca aat gct 3193 gtg tta atg gac ctg gac agt ggt gat gtt aag aga aga gta cat tta 3241 ttt gaa acc cag aga agg aca aaa gaa gaa gat cca ata att ccc ttt 3289 agt gat gga ccc atc atc tca aaa tgg ggt gcg att tcc aga tct tcc 3337 cgt aca ggt tac cat acc aca gat cct gtc cag gcc act gct tcc caa 3385 arg thr gly tyr his thr thr asp pro val gln ala thr ala ser gln gga agt gcg act aag ccc atc agt gta tca gat tat gtc cct tat gtc 3433 aat gct gtt gat tca agg tgg agt tca tat ggc aac gag gcc aca tca 3481 asn ala val asp ser arg trp ser ser tyr gly asn glu ala thr ser tca gca cac tat gtt gaa agg gac aga ttc att gtt act gat tta tct 3529 ser ala his tyr val glu arg asp arg phe ile val thr asp leu ser ggt cat aga aag cat tcc agt act ggg gac ctt ttg agc ctt gaa ctt 3577 cag cag gcc aag agc aac tca tta ctt ctt cag aga gag gcc aat gct 3625 ttg gcc atg caa cag aag tgg aat tcc ctg gat gaa ggc cgt cac 3670 leu ala met gln gln lys trp asn ser leu asp glu gly arg his ctt acc tta aac ctt tta agc aag gaa att gaa cta aga aat gga 3715 gag tta cag agt gat tat aca gaa gat gca aca gat act aaa cct 3760 glu leu gln ser asp tyr thr glu asp ala thr asp thr lys pro gat agg gat atc gag tta gag ctt tca gca ctt gat act gat gaa 3805 cct gat gga caa agt gaa cca att gaa gag atc ttg gac ata cag 3850 ctt ggt atc agt tct caa aat gat cag ttg cta aat gga atg gca 3895 gtg gaa aat ggg cat cca gta cag cag cac caa aag gag cca cca 3940 aag cag aag aaa cag agt tta ggt gaa gac cat gtg att ctg gag 3985 lys gln lys lys gln ser leu gly glu asp his val ile leu glu gag caa aaa aca att ctg ccg gta act tct tgc ttt agc cag cca 4030 glu gln lys thr ile leu pro val thr ser cys phe ser gln pro ctc cca gtg tct att agc aat gca agt tgc ctc ccc atc acc aca 4075 tct gtc agt gct ggc aac ctc att ctg aaa act cat gtt atg tct 4120 ser val ser ala gly asn leu ile leu lys thr his val met ser gaa gat aaa aac gac ttt tta aaa cct gtt gca aat ggg aag atg 4165 glu asp lys asn asp phe leu lys pro val ala asn gly lys met met ala val gln ala ala gln trp thr glu phe leu ser cys pro ile cys tyr asn glu phe asp glu asn val his lys pro ile ser leu gly ala cys pro phe asp gln thr ala ile asn thr asp ile asp val leu pro met gln arg lys leu val thr leu val asn cys gln leu val glu ser ala asn leu trp ala ala val arg ala arg gly cys gln phe leu gln arg leu glu pro arg phe pro gln ala ser lys thr ser ile gly his val val gln leu leu tyr arg ala ser cys phe lys val thr lys met glu ala gly leu arg ile ser pro glu gln trp ser ser leu leu tyr gly asp leu ala his lys ser his met gln ser ile ile asp lys leu gln ser pro glu ser phe ala lys ser val gln glu leu thr ile pro thr trp glu gln leu glu asn ala met val ala val lys thr val val his gly leu val asp phe ile gln asn tyr ser arg lys gly his phe ala his ser gln glu glu leu glu lys tyr arg leu arg asn lys lys ile asn ala thr val arg thr phe pro leu leu asn lys val gly ser asn ala glu asn ser val ser gln leu ile ser arg ser thr asp gln lys ser ser pro phe leu thr arg val pro val tyr pro pro his ser glu asn ile gln tyr phe gln asp pro arg thr gln ile pro phe gly met tyr ala pro val tyr asp ser arg arg ile trp arg pro pro asp val met his ser ser val tyr gln thr ser leu arg glu arg tyr asn ser leu asp gly tyr tyr ser val ala cys gln pro pro ser glu thr ser cys glu glu gln ile arg arg lys pro asp gln trp ala gln arg thr gly tyr his thr thr asp pro val gln ala thr ala ser gln asn ala val asp ser arg trp ser ser tyr gly asn glu ala thr ser ser ala his tyr val glu arg asp arg phe ile val thr asp leu ser leu ala met gln gln lys trp asn ser leu asp glu gly arg his glu leu gln ser asp tyr thr glu asp ala thr asp thr lys pro lys gln lys lys gln ser leu gly glu asp his val ile leu glu glu gln lys thr ile leu pro val thr ser cys phe ser gln pro ser val ser ala gly asn leu ile leu lys thr his val met ser glu asp lys asn asp phe leu lys pro val ala asn gly lys met
| 2 |
[ 0076 ] fig1 represents an example of a pyrolysis device according to the invention . this device here feeds a low temperature pem fuel cell 1 . in its most simple form , this device comprises a single cylindrical reactor r heated by a cylindrical burner b incorporated at the centre so as to provide excellent heat transfer . the reactor - burner unit is placed in a cylindrical heat insulated sheath 2 intended to limit the heat losses of the system . reactor r is defined by the cylindrical wall of the burner and by an outer cylindrical wall coaxial to the burner . it is enclosed by a spherical cup - shaped bottom fd and by a ring - shaped top da located around the top of the burner . in this configuration , the pyrolysis reactor functions cyclically . it is in turn the seat of pyrolysis reactions that produce a hydrogen - rich gas and carbon oxidation reactions that regenerate the reactor . to supply a pem fuel cell , it is necessary to avoid introducing co in the hydrogen - rich gas . as a result , for this application , the pyrolysis of an oxygenised fuel ( alcohol , etb , mtb , . . . ) will be avoided in favour of a hydrocarbon such as methane or propane . concerning the pyrolysis phase , reactor r is heated by means of a burner b at a temperature enabling cracking reactions of the hydrocarbon used . this temperature is in the neighbourhood of 550 - 650 ° c . for propane and 700 - 800 ° c . for methane . the fuel , after eventual desulfonation , is introduced in reactor r through duct 3 located at the top of reactor r . the cracking by pyrolysis creates a hydrogen - rich gas and solid pulverulent carbon that is deposited in reactor r . filter 4 made of aluminium wool , located at the back of reactor r , retains the carbon particles in the reactor and eliminates them from the hydrogen - rich gas extracted by duct 5 located on the other side of filter 4 . before introduction in the anode compartment of fuel cell 1 , the hydrogen - rich gas is cooled by means of heat exchanger 6 , at a temperature compatible with this type of cell , or about 50 ° c . at the anode compartment outlet , the mixture of gas residues , mainly unburned hydrogen and methane , is recycled towards burner b by means of duct 7 . burner b is a combustion chamber fed at the top in fuel by duct 7 and in air by duct 8 . an additional supply of fuel may be planned to ensure auxiliary heat . the combustion , when the system is cold , is triggered by means of a plasma produced , for example , by an electrical discharge between the electrodes of a combustion engine spark plug 9 located at the top of burner b . when the temperature of burner b becomes high enough , the self - ignition of the combustion occurs and the plasma is no longer necessary . in order to increase the efficacy of the heat transfer between the hot gases circulating in burner b and the hydrocarbon to crack in pyrolysis chamber r , metal structures 10 , for example of the wing , honeycomb or metal foam type are placed from one end to the other of the burner wall . the hot gases resulting from the combustion in the burner escape through duct 11 located at the back of burner b . the useful heat contained in the exhaust gas is recovered in a heat exchanger 12 . the duration of the pyrolysis sequence is limited by the accumulation of pulverulent carbon in reactor r . this duration varies according to the parameters in the system . it may typically range from 15 to 30 minutes . when reactor r is full of carbon , it is necessary to pass to the regeneration phase . concerning the regeneration phase , a simple way to eliminate the carbon accumulated in reactor r consists of oxidising it to form a mixture of co and co 2 . an appropriate and heated flow of air is introduced through heat exchanger 6 at the top of reactor r by means of duct 13 . duct 3 is then closed . the reactions of the carbon with the oxygen in the air are : the co + co 2 mixture thereby formed is evacuated by duct 5 and led to the burner by duct 7 . during this regeneration phase , pem fuel cell 1 should not receive co . for this purpose , it is isolated by means of electrovalves 14 . it should be noted that electrovalves ev placed on the ducts , controlled by an electric control circuit control the different supplies of gas . the conversion of co into co 2 is achieved by the combustion of the gases in the burner . the heat given off is recovered in heat exchanger 6 before admission in burner b and then the excess heat not transmitted through the walls of the burner is recovered by heat exchanger 12 via the exhaust gases . if we consider the pyrolysis of methane or propane with the device represented in fig1 the ideal reactions are : the pyrolysis thereby allows for the extraction of a maximum of 2 moles of hydrogen per mole of methane and 4 moles of hydrogen per mole of propane . as indicated in fig1 the method in the invention , allows for the co - production of heat and electricity from hydrocarbons such as natural gas or propane . the heat is recovered by the two exchangers 6 and 12 . electricity is here produced by a pem fuel cell 1 that is supplied by the hydrogen derived from pyrolysis . if the yield of the pem fuel cell is 50 %, this device produces a maximum of 241 kj of electricity per mole of methane , that is 30 % of the ncv of methane . the thermal energy that can be recovered on the exchangers is then 247 kj . in co - generation , the maximum value of the global ncv yield of the heat + electricity production is therefore 61 %. in the case of propane , a production of electricity of 482 kj is obtained per mole of propane , that is 23 . 6 % of the ncv of propane . the thermal energy that can be recovered on the exchangers will be 1180 kj per mole of propane . the maximum value of the global ncv yield of the heat + electricity production is therefore 81 %. this example is given by way of indication in order to define an order of magnitude of the power produced and the yields . [ 0092 ] fig2 represents a pyrolysis device according to the invention coupled with a high temperature sofc fuel cell 15 . its function is then to transform the fuel into synthesis gas ( co + h 2 ) that is directly useable by fuel cell 15 . this conversion upstream from the cell will be called pre - reforming . it is well known that the conversion yield of sofc fuel cells is improved when they are supplied with synthesis gas ( co + h 2 ) rather than directly by a hydrocarbon . besides the benefit represented by the improved yield , another benefit is related to the length of operation of the sofc fuel cell . in fact , an attempt to avoid the outer reforming would lead to the introduction of hydrocarbon in the anode compartment of fuel cell 15 and to proceed with the inner vapour - reforming using the water formed at the anode . this very elegant solution however comes up against a major difficulty linked to the deposit of carbon in fuel cell 15 . in fact , pyrolysis reactions of the hydrocarbon can not be avoided at working temperatures of sofc fuel cell . these reactions produce solid carbon that accumulates in fuel cell 15 where it perturbs the operation . in order to avoid this problem , it is advisable to have a pre - reformer upstream from fuel cell 15 . in this case , reactor r will play this role . in fact , h 2 is produced during the pyrolysis phase and co during the regeneration phase . the device presents a great many similarities with the case presented above for a pem fuel cell except for the following points : heat exchanger 6 located at outlet 5 is no longer useful since the gases derived from the pyrolyser can be introduced at high temperature in the anode compartment of fuel cell 15 . electrovalves 14 were eliminated since fuel cell 15 accepts co and therefore doesn &# 39 ; t need to be isolated during the regeneration phase . the air flow entering the cathode compartment of fuel cell 15 leaves very hot and is recycled in both directions . electrovalve ev 1 leads the hot air to burner b through duct 8 to maintain the combustion , or to reactor r through duct 13 for the regeneration sequence . the operation of the method during the pyrolysis phase is fairly identical to that described in the example in fig1 when the pyrolyser supplies a pem fuel cell . however , the following differences are noted : fuel cell 15 very well accepts being fed a h 2 + co mixture of gases . the constraint to produce a gas rich in hydrogen and fully exempt of co is no longer required in the present situation . it is therefore possible to expand the choice of fuel to pyrolyse and extend it to ethanol or other oxygenised fuels . during the pyrolysis phase , a mixture of gas rich in hydrogen is produced with possibly a co content . this mixture of gas is extracted from reactor r by duct 5 and is directly sent to the anode compartment of fuel cell 15 . the gas emissions of fuel cell 15 leave at high temperature and are directed towards burner b by duct 7 to finish combustion . this combustion is provided by an additional supply of very hot air brought by duct 8 and removed at the outlet of the cathode compartment of fuel cell 15 . during the regeneration phase , as in the case of coupling with a pem fuel cell , the pulverulent carbon accumulated in reactor r during the pyrolysis sequence should be gasified by oxidation . it should be noted that there is a basic difference here with the case of a pem fuel cell . in fact , in the present case , the mixture of co + co 2 gases produced during regeneration in reactor r can be directly sent to the anode compartment of fuel cell 15 via outlet 5 . therefore , due to the conversion of co in fuel cell 15 , an additional contribution to the production of electricity is obtained . to maximise this contribution , the operating parameters during the regeneration phase should be set so that the ratio α = co / co 2 resulting from the oxidation of carbon is a maximum . the means to maximise this ratio consist of carrying out gentle combustion of the carbon during the regeneration phase in order to stop the reaction at the formation of co , that is mainly : by way of example , a . sofc fuel cell is considered operating with an electrical conversion efficiency of 45 % and is supplied with gases produced during pyrolysis . the reactor is supplied with methane and the pyrolysis reaction produces full conversion of this fuel . with the hydrogen produced , it turns out that this device provides a maximum of 217 kj of electricity per mole of methane , that is 27 % of the ncv of methane . if the co produced during the regeneration phase is also converted into electricity , an additional contribution is added to the electric production of a sofc fuel cell that may reach 127 kj of electricity per mole of methane , that is 16 % of the ncv of methane . the global electric production may thereby in principle reach 344 kj of electricity per mole of methane , that is 43 % of the ncv of methane . the production of heat energy is therefore considerably the same . a system of co - generation operating with methane according to this principle can then produce a considerably equal electrical power and thermal power with a global efficiency ( heat + electricity ) of about 80 %. the same system supplied with propane , from the hydrogen formed , may reach an electric production of 434 kj of electricity per mole of propane , that is 21 % of the ncv of propane . the electric production from the co formed may reach 381 kj per mole of propane , that is 18 . 7 % of the ncv of propane . the global electric production may thereby in principle reach 815 kj of electricity per mole of propane , that is 40 % of the ncv of propane . again in this case , the production of thermal energy is considerably equal to the electric production and the global efficiency ( heat + electricity ) reaches about 80 %. contrary to most of the results obtained with the solutions known to date , it should be noted that the electrical and thermal power given off are more or less the same . the performances announced above assume full pyrolysis and regeneration reactions , which is not the case in reality . it therefore consists of maximum values that it is necessary to try to reach in real conditions . [ 0113 ] fig3 represents a system with two reactors r 1 and r 2 to obtain continuous and no longer cyclic operation . the two reactors are defined by an outer cylindrical wall and by the cylindrical walls of burner b ′. the reactors , like the burner , are respectively enclosed in a top and bottom in the shape of a spherical cap . the reactor - burner unit is placed in a cylindrical heat - insulated sheath 16 intended to facilitate the maintenance of the pyrolysis reactors at high temperature and reduce the heat losses of the system . the operating principles of the double pyrolysis chamber device are much the same as those described above in reference to fig1 and 2 . the existence of two reactors helps one operate in pyrolysis sequence while the other operates in regeneration sequence and vice versa . this means that a reactor producing hydrogen - rich gas produced by pyrolysis and a reactor in regeneration sequence providing the oxidation of carbon is constantly available . burner b ′: located at the centre of the system . it is cylindrical and has a shell ring at the centre enabling the enlargement of the combustion chamber . this shell ring helps house ignition device 10 at the middle of the left side of burner b ′ and the passage of several pipes at the middle of the right side : an evacuation duct 17 collecting the smoke at the top of burner b ′, a duct 18 supplying the burner with fuel at the bottom and a duct 19 supplying the burner with air also at the bottom . a reactor r 1 located at the top part of the device and a reactor r 2 at the bottom : the two reactors r 1 and r 2 are identical . both are connected to a fuel supply duct 20 , an air supply duct 21 and a duct for the evacuation of products 22 . for reactor r 1 , ducts 20 and 21 are placed at the top of the reactor and duct 22 at the bottom just above the ducts for burner b . for reactor r 2 , ducts 20 and 21 are placed at the bottom of the reactor and duct 22 at the top , just below the ducts for burner b ′. the transfer of heat between the hot gases ( fumes ) of burner b ′ and each reactor is provided by high efficiency heat exchange structures 23 of the same type as those mentioned in the examples of fig1 and 2 . the carbon particles produced by the pyrolysis reactions are trapped in reactor r 1 and in reactor r 2 by filters 24 in refractory fibres , for example , in aluminium fibres , located in ducts 22 , on each side of the right side of the shell ring . this double reactor system can be used to constantly supply a pem fuel cell connected in an analogous manner to the case represented in fig1 or a sofc fuel cell connected in an analogous manner to the case represented in fig2 . [ 0123 ] fig4 represents a full circuit incorporating the device in fig3 . here , only the gas supply circuits comprising electrovalves controlled by an electrical control circuit will be described . the supply of pyrolysis chambers ( r 1 , r 2 ) occurs by means of two supply circuits : on for the fuel . it comprises a 3 track valve ev 2 in turn delivering in both reactors , the other for the air . it comprises a 3 track valve ev 3 in turn delivering in both reactors and piloted by the control circuit so as to inject air in the reactor that is not supplied with fuel in order to provoke the combustion of pulverulent carbon derived from the pyrolysis reaction carried out during the previous cycle . both outlet ducts for the gases from the reactors converge towards a set of two 3 track electrovalves , ev 4 and ev 5 , that can send the gases produced during the pyrolysis and during the partial combustion of the carbon , in the fuel cell for electrovalve ev 4 and in the burner for electrovalve ev 5 . the burner is supplied in air by the same supply circuit as the pyrolysis chambers but upstream from electrovalve ev 3 and in fuel via either electrovalve ev 5 as described supra or electrovalve ev 6 controlling the choice of gases derived from the fuel cell or the fuel by an engagement upstream from electrovalve ev 2 . [ 0129 ] fig5 and 7 describe a variant of the device , the object of the invention , consisting of incorporating , before the fuel cell , a hydrogen purification membrane in the circuit for the extraction of gases produced by the pyrolysis . the system can thereby be used as a very pure hydrogen generator . there are two categories of hydrogen permeable membranes that may be used in the system : polymer membranes . they are very extensively used for the purification of hydrogen in industry . such membranes only operate at low temperature , less than 120 ° c ., and can therefore only be used outside of the reactor , after the cooling of the hydrogen - rich gas ( fig5 ), metal membranes . they are very selective membranes consisting of a very hydrogen permeable metal , generally an alloy of palladium . these membranes can be used at high temperature , typically 500 to 550 ° c . they can therefore be integrated either in the high temperature gas circuit ( fig6 ) or in the reactor strictly speaking ( fig7 ). [ 0133 ] fig5 represents a device using a polymer membrane 25 . the device is similar to that in fig1 except for the following points : membrane 25 is sandwiched between heat exchanger 6 and the fuel cell ; the mixture of hydrogen - rich gas extracted from the reactor by duct 5 , then cooled at under 120 ° c . by means of exchanger 6 is sent to the purifier at membrane 25 . it leaves by two channels . the first channel v 1 carries the very pure hydrogen thereby extracted to the pem fuel cell in order to supply it and the second channel v 2 evacuates the residual gases that are recompressed with a heating compressor 26 so as to be recycled with the fuel supplying the pyrolysis reactor by duct 3 . [ 0136 ] fig6 represents a device using a metal membrane 27 made of palladium alloy operating at high temperature . this device is similar to that in fig4 except for the fact that membrane purifier 27 is located in front of heat exchanger 6 . the very pure hydrogen thereby extracted is sent towards the pem fuel cell after being cooled by means of heat exchanger 6 . the residual gases are recompressed by means of compressor 26 in order to be recycled with the fuel supplying the pyrolysis reactor by duct 3 . [ 0137 ] fig7 represents a device presenting a metal membrane 28 placed inside the pyrolysis reactor . this membrane made of palladium alloy operates at high temperature , typically at 500 - 550 ° c . and has the shape of a cylindrical rod . in order to avoid an accumulation of carbon particles in direct contact with the membrane , the latter is protected by a sleeve 29 of refractory fibres , for example an aluminium fabric . the purpose of this sleeve is to keep the carbon particles away from the membrane . it should be noted that pyrolysis reactor r can contain , if necessary , several identical membranes so as to increase the active membrane surface and thereby the flow of hydrogen extracted . it should also be noted that even if a membrane consisting of a cylindrical pencil or a beam of cylindrical rods is one of the possibilities considered , other configurations are also possible . therefore , membranes in the form of plates or a stack of plates can also be considered . the main advantage of placing the membrane inside the pyrolysis reactor is the simplicity of the system since compressor 26 and the fuel circulation loop are not required . the devices represented in fig5 to 7 can be adapted to the case of the double pyrolysis reactor in fig3 . this adaptation does not raise any specific problems . among the applications of the method , we can include the production of co - generation boilers ( heat and electricity ) in the habitat sector as well as recreational vehicles ( camping cars , trailers , . . . ). for home applications , for example single family homes , the power level of a co - generation module will be about 5 kwe + 5 kwth . according to the case , the fuels are : natural gas , propane , domestic fuel , . . . in particular pem and sofc fuel cells offer plans adapted to this type of application . for more powerful installations , such as the urban co - generation for buildings , groups of buildings , hospitals , modules with a power of about 200 kwe + 200 kwth have to be developed . considering the relatively low cost and very developed distribution , natural gas will be the fuel most often used for this application . openings in the field of farm applications are also to be considered . for example , farm greenhouses reveal the need for heat and electricity . it should be possible to use ecological fuels such as ethanol for such applications . an application of the method has a place in the petrochemicals field . in fact , the method is an easy and cheap way to produce synthesis gas ( co + h 2 ) for which there are major uses in the chemistry industry ( manufacture of acetic acid , formic acid , acrylic acid , phosgen , isocyannates , . . . ).
| 2 |
referring , now , to fig1 there is shown a multiple - function banking apparatus embodying the principles of this invention . this multiple - function banking system is designed , for example , to function as an automatic over - the - counter service package which includes a plurality of transactions . thus , the system includes such transactions as cash dispensing , cash exchanging , depositing , balance reference and bankbook entry . the front panel of the banking apparatus 10 is provided with a gate 11 which accepts a magnetic card carrying such data as the personal code of a person who is eligible for transactions , an inlet 12 for inserting a bank note , an outlet 13 for issuing a receipt in the case of a transaction without a bankbook , and a rotatable how - to - use instruction display 28 which displays the method of operating the apparatus for each transaction mode of the banking system . the operation panel of the banking apparatus 10 is provided with a display 14 which displays key - entered numerical information , a transaction selection button keyboard 15a by which the customer may select the transaction he wants to do with the bank from among a plurality of , five in the illustrated embodiment , transaction modes , a confirmation button 15b , a ten - key keyboard 16 ( marked 0 to 9 ) for entering the customer &# 39 ; s select number and requested withdrawl amount , a gate 17 for the insertion of a bankbook in the cash dispensing , deposit or entry mode , a confirmation window 18a for confirming the number of e . g . ten - dollar bills ready to be dispensed , another confirmation window 18b for confirming the number of , e . g . fifty - dollar bills , an outlet 19a for dispensing the ten - dollar bills delivered to a window 18a to the customer on depression of button 15b , and an outlet 19b for similarly dispensing the fifty - dollar bills . disposed inside the card gate 11 is a card detecting switch 32 ( fig3 ) which detects the card inserted into the apparatus 10 . preferably , there is arranged in a bankbook gate 17 a shutter device adapted to selectively open and allow the bankbook to enter only when a personal card has been inserted and the bankbook entry mode has been selected by the customer . there also is disposed , either inside or on the backside of apparatus 10 , an operation mode pre - setting switch 25 in which the pattern of available transactions is set according to either the status of the transaction devices and / or a predetermined banking time schedule . before proceeding to a more detailed description of the banking system according to the invention , each transaction mode thereof will be briefly explained . the cash withdrawal mode involves the following sequence of events . first , the customer inserts a magnetic card including data such as his personal code and secret number into the gate 11 . he then inserts his bankbook into the gate 17 if he wants to have a withdrawal amount entered into the bankbook . then , he selects the cash withdrawal mode by means of selection button keyboard 15a . the customer enters his secret number identifying his authority to use the card and the amount he wants to withdraw on the ten - key keyboard 16 . if the key - entered secret number corresponds to his individualized secret number read from the card and the amount he wants to withdraw is not in excess of the outstanding balance in his account , bank notes in a value equivalent to the amount he wants to withdraw are conveyed to the confirmation window 18a and / or 18b . the customer checks to see that the bank notes appearing in the window 18a and / or 18b are in agreement with those he requested and , if the result of this inspection is affirmative , he depresses the confirmation button 15b . in response to this depression of button 15b , the inserted card is returned to the customer through the card gate 11 , the requested bank notes are dispensed through the ten - dollar bill outlet 19a and / or fifty - dollar bill outlet 19b and the bankbook , if it has been entered , is returned to the customer through the bankbook gate 17 . the deposit mode involves the following sequence of events . the customer inserts his card into the card gate 11 and selects the deposit mode on the transaction selection button keyboard 15a . in response to the depression of the correct button , the shutter disposed in the throat of the bankbook gate 17 opens to admit the bankbook . the customer then inserts bank notes in the value which he wants to deposit into the banknote inlet 12 , whereupon the value of the banknotes is displayed on the display 14 . he then enters his secret number by means of keyboard 16 , if necessary . the amount is entered into the bankbook only when the secret number agrees with the number read from the card . the bankbook and the card are then returned to the customer . the exchange mode involves the following sequence of events . the customer inserts his card into the gate 11 and , then , selects the exchange mode on the transaction selection button keyboard 15a . he then inserts a bank note to be exchanged , for example a fifty - dollar - bill , into the banknote inlet 12 . thereupon , the value is displayed on the display 14 and the small changes ( five ten - dollar bills ) are conveyed to the confirmation window 18a . the customer inspects the ten - dollar bills and , if the value represented by these bills is equal to that of the bank note tendered in exchange , he depresses a confirmation button 15b , whereupon the ten - dollar bills are dispensed from dispenser outlet 19a . the balance reference mode involves the following sequence of events . the customer inserts his magnetic card into the card gate 11 and selects the balance reference transaction mode by means of button 15a . then , if the customer desires to check the balance , he enters his secret number on the ten - key board 16 . when the secret number magnetically recorded on the card agrees with the key - input number , the balance of his deposit account is displayed on the display 14 . it may also be so arranged that a slip imprinted with the balance is issued through a receipt issue outlet 13 when the balance is displayed . the card is returned to the customer . the entry mode involves the following sequence of events . the customer selects the entry mode on the transaction selection button keyboard 15 . of course , he must insert his card into the gate 11 beforehand . as the button 15 is depressed , the shutter adjacent the backnote gate 17 opens , thus activating the acceptance of the bankbook . when the bankbook has thus been accepted , the information on any past transactions made without entries in the bankbook , such as automatic transfer transactions , is printed and the updated bankbook is then returned to the customer . the five transaction modes briefly described above are merely illustrative of the variety of banking services which may be rendered by the apparatus and method of this invention and should not be construed as meaning that the invention is limited to those particular transaction modes . referring , now , to fig2 there is shown a block diagram of one embodiment of this invention . in association with a main controller segment 20 , there are provided a magnetic card reader 21 which is disposed behind the card gate 11 and adapted to read the magnetically recorded information , i . e . the secret number or personal code , from the magnetic card , a slip issue device 22 which records each mode of transaction and details of the transaction such as the requested amount of withdrawal or the depositing amount for posting in the bank &# 39 ; s reference and evidence files , an imprinter 23 adapted to prepare and issue to the customer a receipt or evidence slip relevant to the transaction , a bank note dispenser 24 which dispenses bank notes equivalent to the withdrawal amount or exchanged amount into the confirmation window 18a or 18b , an operation mode pre - setting switch 25 which is adapted to change the processable pattern of transactions according to the status of the banking apparatus , a bank note checker 26 which verifies the kind of the bank note ( for example , ten - dollar bill or fifty - dollar bill ) inserted from the inlet 12 , a bankbook printer 27 which prints deposit amounts on the deposit mode or make entries updating the bankbook on the entry mode , a rotatable how - to - use display device 28 disposed on the front panel of the apparatus 10 and adapted to display a how - to - use instruction for each transaction mode , and a customer operating panel 29 which includes a transaction selection keyboard 15a , the confirmation button 15b and the ten - key keyboard 16 . the main controller 20 transmits transaction processing data to a control center through a line controller 30 and a modulator - demodulator 31 and receives input data ( for example , the information not recorded yet in the bankbook ) from the center through the modulator - demodulator 31 and the line controller 30 . fig3 is a detailed block diagram of the main controller 20 . the main controller 20 comprises a micro - processor 201 which performs various operations and control processes , a read - only memory prom 202 which is pre - loaded with the program of this embodiment which is hereinafter described in detailed with reference to the flow diagram of fig5 a random - access memory ram 203 which records and reads transaction process data , an encoder 204 which encodes a output from the operation mode pre - setting switch 25 and provides the micro - processor with the encoded signal , an encoder 205 which encodes an output designating a selected transaction mode from the transaction selection button 15a and provides the micro - processor 201 with the encoded selected transaction mode output signal , a decoder 206 which drives a display 33 , a data bus 207 which transmits transaction data to the micro - processor 201 or distributes micro - processor output data to various parts of the apparatus , a control bus 208 which transmits a control signal for reading and recording functions and an address bus 209 which provides the read - only memory 202 and random access memory 203 with address data and controls a read - out gate of each switch . the data bus 207 and the control bus 208 are connected with the card detecting switch 32 for detecting the card inserted into the gate 11 and the card reader 21 , respectively . to the decoder 206 is applied the information on the transaction mode selected by means of the selection button 15a , and a signal for actuating an available - transaction indicating lamp 33 corresponding to the particular transaction is supplied to the display . the micro - processor 201 includes an arithmetic logic unit alu which performs operations in accordance with the program data stored in the read - only memory 202 , an accumulator a which temporally stores certain data , a flag z which memorizes the fact that the result of an operation by said accumulator a is zero , and a flag c which memorizes the occurrence of a carry - up in accumulator a . now , some operable transaction modes in the event of a local malfunction of the system will be explained . let it now be assumed that a bank note dispenser 24 has failed and ceased to issue bank notes ( i . e . a jam ). then , the cash withdrawal and exchange modes will become unoperable . in the event of a failure of a bank note checker 26 for verifying the kind of an inserted bank note due to a jam or a severed belt , for instance , both the exchange and the deposit modes will become unoperable . if a bankbook printer 27 fails , the cash withdrawal , deposit and entry modes will all become inoperative . in accordance with this invention , a bank employee may pre - set the available transaction modes according to the customer service schedule of the bank , i . e . the transaction modes available to the customer during a certain calendar time of the day . this pre - setting may be conveniently performed by operating the pre - setting switch 25 manually . as an alternative , an automatic detector for detecting a system failure , i . e . a failure of a certain transaction function , may be built into , or associated with , said pre - setting switch so that the system may remain operable with regard to the remainder of the functions , i . e . all the transaction modes offered except the mode or modes affected by such a failure as described above . the principle will now be explained which is involved in the detection of operable transaction modes in the event of a failure . fig4 is a schematic representation of an exemplary set of information stored in the accumulator a . in this example , accumulator a has 8 bits , namely x1 through x8 . the memory of the available transaction modes set by pre - setting switch 25 and the logic state as designated by transaction selection button 15 are shown in tandem for each of understanding . the first bit ( x1 ) of accumulator a stores a logic signal specifying the presence or absence of a withdrawal mode input as selected by the pre - setting switch 25 or selected by the transaction selection switch 15a ; the second bit ( x2 ) similarly stores a logic signal specifying the depository mode ; the third bit ( x3 ) stores a logic signal specifying the exchange mode , the fourth bit ( x4 ) stores a logic signal specifying the balance reference mode ; and the fifth bit ( x5 ) stores a logic signal specifying the bankbook entry mode . thus , each bit specifies a transaction mode by memorizing a logic &# 34 ; 1 &# 34 ;, and also specifies , by memorizing a logic &# 34 ; 0 &# 34 ;, that the particular mode is not pre - set or is not selected . now , as the pre - setting switch 25 is actuated to set a pattern indicating that the entire system 10 is valid or normal , an encoder 204 generates a coded signal &# 34 ; 11111000 &# 34 ; and lets the accumulator a store the information that all the modes are valid and available to the customer . fig4 ( a ) shows the logic state of the accumulator a which has memorized this coded signal representing the availability of all the modes . if the bank note checker 26 has failed , the encoder 204 generates a coded signal &# 34 ; 10011000 &# 34 ; meaning that the cash withdrawal , balance reference and bankbook entry modes are still available to the customer and lets the accumulator store that information . fig4 ( b ) shows the logic state of accumulator a in this situation . if the transaction mode pre - setting switch 25 is actuated to set a failure of the bank note dispenser , the encoder 204 generates a coded signal &# 34 ; 01011000 &# 34 ; designating that the deposit , balance reference and entry modes are available to the customer and lets the accumulator a store the information . the logic state of accumulator a in this situation is schematically shown in fig4 ( c ). on the other hand , if the customer actuates the selection button 15a to designate the kind of transaction he desires to consummate with the bank , the encoder 205 generates a coded signal including a logic of &# 34 ; 1 &# 34 ; in the digit corresponding to the transaction he is requesting and lets the accumulator a store the information temporally . the logic states of accumulator a for the modes that may be designated by the transaction selection button 15a are shown in fig4 ( d ) through ( h ). fig5 is a flow diagram illustrating the functioning of an embodiment of this invention . referring , now , to fig1 through 5 , the operation of judging whether any of the multiple functions of the banking apparatus 10 is operable or not is illustrated . if a certain mechanical failure has developed in the banking apparatus , the bank employee in charge of the apparatus may manually set the operable modes by means of the pre - setting switch 25 . as previously discussed , a self - check , self - correction function may be built into the banking apparatus . in the former case , the system 10 warns the employee that something is wrong with the machine . the employee checks the machine and sets the modes which are still operable . for example , if the bank note checker 26 fails to function properly , the cash withdrawal mode , balance reference mode and entry mode are still available , although the deposit and exchange modes are not utilizable . the employee thereupon operates the pre - setting switch 25 to set a first pattern as shown in fig4 ( b ). similarly , when the bank note dispenser 24 has failed , the deposit , balance reference and entry modes are still available , although the cash withdrawal and exchange modes are not available to the customer . therefore , the employee actuates the pre - setting switch 25 to select a second pattern , whereupon the coded signal shown in fig4 ( c ) is read into the accumulator a . he then depresses an initiator button ( not shown ) to allow the following operation to start from step 100 as illustrated in fig5 . in step 101 , the available - mode information encoded by the encoder 204 in accordance with a pattern set by the pre - setting switch 25 is stored into the accumulator a of the micro processor 201 through the data buss 207 . namely , when the entire system 10 is in a normal condition , a logic &# 34 ; 1 &# 34 ; may be stored in the first bit through the fifth bit ( x1 through x5 ), and the logic status stored in the accumulator a forms the pattern shown in fig4 ( a ). when the bank note checker 26 has failed , the coded signal as shown in fig4 ( b ) is stored into the accumulator a . when the bank note dispenser 24 has failed , the coded signal as shown in fig4 ( c ) is stored into the accumulator a . in step 102 , the available - mode information stored in accumulator a is memorized in a first memory area ( a ) of the random - access memory 203 via the data bus 207 . then , in step 103 , as a card detecting switch 32 detects the insertion of a magnetic card , the logic &# 34 ; 1 &# 34 ; is memorized in the eighth bit ( x8 ) of accumulator a through the data bus 207 . in step 104 , an inquiry is made as to whether a logic &# 34 ; 1 &# 34 ; has been stored in the eighth bit ( x8 ) of accumulator a . if no card has been inserted , the eighth bit ( x8 ) of accumulator a does not carry the logic &# 34 ; 1 &# 34 ; and the sequence , therefore , returns to step 101 . if , on the other hand , the card has been inserted , the logic &# 34 ; 1 &# 34 ; is stored in the eighth bit ( x8 ) of accumulator a . therefore , the sequence proceeds to step 105 . in step 105 , magnetically recorded data are read from the card inserted from the card gate 11 and transmitted to the magnetic card reader 21 , the data including the account number and secret number of the customer . this card information is applied to a second memory area ( b ) of said random - access memory 203 through data bus 207 . in step 106 , the available - mode information stored in the first memory area ( a ) of random - access memory 203 is read and stored by accumulator a via data bus 207 . in step 107 , the available - mode information stored in the accumulator a is fed to the decoder 206 via data bus 207 . the decoded signal is supplied to available - mode lamps 33 , whereupon the lamps light up . for example , in the first transaction pattern mentioned above , i . e . the case in which the bank note checker 26 has failed , the lamps displaying the cash withdrawal , balance reference and entry modes are lit up . in step 108 , the customer viewing the display illuminations 33 designates the desired transaction mode by operating the selection button 15a if the particular mode is available . in step 109 , a signal representing the mode so selected by depression of the button 15a is fed to the encoder 205 . the encoder 205 converts the mode - designating signal to a coded signal specifying the mode of transaction so designated . the coded signal is then transmitted to the accumulator a in micro - processor 201 through data bus 207 . thus , when the cash withdrawal mode has been designated by button 15a , the logic &# 34 ; 1 &# 34 ; is stored in the first bit ( x1 ) of accumulator a ; when the depository mode has been designated , the logic &# 34 ; 1 &# 34 ; is stored in the second bit ( x2 ); when the exchange mode has been designated , the logic &# 34 ; 1 &# 34 ; is stored in the third bit ( x3 ); when the balance reference mode has been selected by button 15a , the logic &# 34 ; 1 &# 34 ; is stored in the fourth bit ( x4 ); or when the designated mode is bankbook entry , the logic &# 34 ; 1 &# 34 ; is stored in the fifth bit ( x5 ). in step 110 , the memory bits representing the available modes stored in said first memory area ( a ) of random - access memory 203 are anded with the corresponding memory bits specifying the designated modes in the accumulator a . thus , the results of these logic operations are fed back again to the accumulator a . if the logic &# 34 ; 1 &# 34 ; has been memorized in said first memory area ( a ) of random - access memory 203 in the bit corresponding to the bit of accumulator a where the logic &# 34 ; 1 &# 34 ; has been stored , the designated transaction mode is judged to be available to the customer . for this purpose , the sequence proceeds to the next step 111 . in step 111 , the arithmetic logic unit alu inquires if the flag z is &# 34 ; 0 &# 34 ;. if the flag z is &# 34 ; 0 &# 34 ;, it shows that the customer has not designated any available transaction mode yet via the selection button 15a . therefore , in step 112 the logic &# 34 ; 1 &# 34 ; is stored in the eighth bit of accumulator a by direct instruction and , in step 113 , this data in the accumulator is fed to the magnetic card reader as a card return instruction signal . in step 114 , the magnetic card reader reads this signal and returns the card to the customer . the sequence now returns to step 101 . incidentally , the yes response to the enquiry in step 111 may be directly applied to step 114 , bypassing steps 112 and 113 . if the flag z is judged to carry the logic &# 34 ; 1 &# 34 ; in step 111 , it shows that the customer has selected one of the available transaction modes on the selection keyboard ( button 15a ). thus , this transaction is processed in the following manner . in step 115 , the data in accumulator a is shifted by one bit . then , in step 116 , enquiry is made if the flag c specifying a carry - up of accumulator a is &# 34 ; 1 &# 34 ; or not . in other words , enquiry is made as to whether the logic &# 34 ; 1 &# 34 ; has been stored in the first bit of accumulator a . if a logic &# 34 ; 1 &# 34 ; has been stored in the first bit of accumulator a and the response to the enquiry in step 116 is affirmative , i . e . there has been a carry - up , the cash withdrawal transaction designated by the customer is executed in step 117 . the function of the cash withdrawal mode has been described hereinbefore . if , in step 116 , the flag c does not carry the logic &# 34 ; 1 &# 34 ; specifying a carry - up , the data stored in the accumulator a is further shifted to the left by one bit in step 118 . then , in step 119 , enquiry is made as to if the flag c is &# 34 ; 1 &# 34 ;. thus , in step 119 , enquiry is made if the logic &# 34 ; 1 &# 34 ; has been stored in the second bit ( x2 ) of accumulator a , and if the response is affirmative , it is fed to step 120 so that the deposit mode is executed . if no logic &# 34 ; 1 &# 34 ; exists in flag c in step 119 , the data stored in the accumulator a is shifted to the left by one bit after another to enquire if there has been a carry - up until , finally , the selected transaction is executed . after any of such transactions has been completed , the sequence returns to step 101 . in another embodiment of this invention , there may be provided an additional step between step 101 and each of steps 117 , 129 , 120 , 123 , 126 and 114 , such additional steps enquiring if there is any transaction rendered unavailable by either a malfunction or an instruction from a control center , and according to the response to each such enquiry , the transaction mode pre - setting switch 25 is actuated . thus , in the several embodiments described hereinbefore , if a malfunction or abnormal event takes place in any part of the multiple - transaction apparatus , the unaffected transaction modes still viable can be selectively offered to the customer . thus , a local malfunction does not necessitate a shut - down of the entire apparatus , thus contributing to an improved banking efficiency . moreover , if the transaction requested by the customer is not among the pre - set modes , the transaction is automatically declined by the system , with the result that erratic or unnecessary operations may be avoided . of course , it may also be so arranged that , in the event of such a malfunction , one of the intact transaction modes will be available to the customer . in still another embodiment of this invention , the customer who has found a transaction unavailable may select other transaction modes . in this connection , it is preferable that he be allowed to repeat his designation several times . while in the above embodiments , the available modes are pre - set in the event of a malfunction , it is of course possible that unavailable transaction modes are selectively pre - set . while the embodiments generally shown in fig2 through 5 have been explained mainly in connection with the case in which the pre - setting switch 25 is activated by or in response to a local malfunction of the system , the pre - setting of available transaction modes may be performed in accordance with a predetermined or routine banking time schedule . thus , the switch 25 may be activated either manually by a bank employee or automatically by an instruction signal from a control center . fig6 and 7 show such an embodiment of the invention . in fig6 there is shown a block diagram of a main controller in the particular embodiment . the main controller comprises a clock device 25a for generating a clock signal representing a current time in lieu of the pre - setting switch 25 shown in fig3 and a micro - processor 201a in lieu of the micro - processor 201 shown in fig3 . the micro - processlor 201a comprises a register x storing a standard time , an accumulator a , an arithmetic logic unit alu , a flag z which stores the information that the result of an operation by accumulator a is zero , a flag c which stores a carry - up in accumulator a and a flag s which stores a logic &# 34 ; 1 &# 34 ; when the result of operation is minus . the main controller further comprises prom 202 , ram 203 , encoders 204 and 205 and busses 207 , 208 and 209 which correspond to the parts designated by like numerals in fig3 . the operation sequence of this embodiment will be described by reference to fig6 and 5 . in a typical situation , an initiator button , not shown , is depressed by a bank employee at 9 o &# 39 ; clock in the morning . in step 151 , the current time from clock 25 is temporally stored in the accumulator a through data bus 206 . in step 152 , a standard time is stored in register x , for example by a direct instruction from outside of the system . the standard time may represent a closing calendar time ( 15 : 00 ) for the full - mode service ( 9 : 00 to 15 : 00 ) or 17 : 00 for service modes other than the deposit mode ( i . e . 9 : 00 to 17 : 00 ). this standard time information is permanently stored in the register x . in step 153 , the standard time is subtracted from the current time stored in the accumulator a and the result of this operation updates the storage of the accumulator a . in this step , if the current time ( t ) is prior to the standard time ( 15 : 00 ), namely 9 & lt ; t & lt ; 15 , and the updated storage of the accumulator a is minus , the alu allows the flag s to store a logic &# 34 ; 1 &# 34 ;. in step 154 , alu enquires if the flag s carries a logic &# 34 ; 1 &# 34 ; and , if it does , it means that the current time has not reached the standard time as yet . then , in step 155 , a coded signal &# 34 ; 11111000 &# 34 ; representing the availability of all the transaction modes is temporally stored in the accumulator a by a direct instruction . if , on the other hand , the flag s does not carry a logic &# 34 ; 1 &# 34 ;, the current time is past the standard time ( 15 & lt ; t & lt ; 17 ) and , therefore , the deposit mode is shut down in accordance with the banking schedule . in step 156 , a coded signal &# 34 ; 10111000 &# 34 ; representing the availability of all the modes but the deposit mode is temporally stored in the accumulator . from step 155 or 156 , the sequence proceeds to the step 102 shown in fig5 and all the subsequent operations are similar to those hereinbefore described by reference to fig5 . it should be understood that while , in the embodiments described hereinbefore , a micro - processor is used in combination with soft ware , the corresponding functions and processes may be performed by means of hardware circuitry . it should also be understood that the above description is merely illustrative of this invention and that many changes and modifications may be made by those skilled in the art without departing from the scope of the appended claims . thus , for example , the apparatus according to this invention may be further provided with means whereby the pattern of transactions representing a combination of modes processable by the machine prevails over the pattern of transactions manually pre - set by the bank employee when the two patterns happen to be not in agreement .
| 6 |
reference will now be made in detail to the example embodiments , which are illustrated in the accompanying drawings . wherever possible , the same reference n umbers will be used throughout the drawings to refer to the same or like parts . shipped object location information , as well as other environmental information associated with a shipped object , can be determined more accurately and frequently by including a sensor device with or near a shipped object . a server may store data that links a sensor device with one or more shipped objects , if , for example , one sensor device is placed in a container that includes a plurality of shipped objects . as sensor data is received from the sensor device at the server , the data may be associated with shipped objects associated with the sensor device . a shipped object may be associated with a number of risks , such as , for example , a risk that a shipped object is lost , damaged , or stolen . the location data received from a sensor device helps , for example , to improve handling of risks associated with a shipped object . for example , one or more geofences ( i . e ., selected or defined geographical areas ) may be established . times may be associated with the established geofences , such that , if a sensor device and thus a shipped object ) does not reach or exit a particular geofence by a selected time , a risk may be detected . a number of operations can be performed based on a detected risk . for example . a panic button may be enabled in as user interface . if the panic button is selected , a number of actions may be performed such as , for example transmitting a panic mode indication to the sensor device to alter a reporting time interval of sensor data , notifying one or more parties associated with the shipped object that is associated with the sensor device , disabling any delay of location data about the shipped object that is available in a user interface , and / or creating a customer support case to resolve issues that will arise because of the determined risk . fig1 is a diagram illustrating an example system 100 that may be used for implementing the disclosed embodiments . system 100 includes , among other things , one or more servers 110 , one or more sensor devices 120 , one or more user interfaces 130 , one or more remote devices 140 , and one or more data sources 150 . in some embodiments , as depicted in fig2 , server 110 includes , among other things , one or more processors 210 , memory 220 , and one or more transceivers 230 . processor 210 may be any processor suitable for the execution of a computer program including , by way of example , one or more general purpose microprocessors or special purpose microprocessors . memory 220 may store computer program code that may be executed by the processor 210 . transceiver 230 may facilitate sending data to and receiving data from external sources ( e . g ., via the internet or via a cellular network ). for example , server 110 may be configured to send data to and receive data from a sensor device 120 , a user interface 130 , a remove device 140 , and / or a data source 150 . in some embodiments , memory 220 of server 110 also stores a database . the database may comprise , for example , data regarding the status ( e . g ., data regarding location , acceleration , motion , temperature , pressure , and / or other environmental parameters ) of one or more shipped objects . in some embodiments , as depicted in fig3 , sensor device 120 includes , among other things , one or more sensors 310 , one or more processors 320 , memory 330 , one or more wake - up mechanisms 340 , one or more transceivers 350 , and one or more antennas 360 . sensor ( s ) 310 may measure one or more environmental parameters associated with the sensor device 120 . for example , a sensor 310 may measure acceleration , motion , temperature , pressure , location , and / or other environmental parameters . for example , to sensor 310 may be as gps sensor that measures the gps coordinates associated with sensor device 120 . memory 330 may store computer program code that may be executed by the processor 320 . processor 320 may be configured to monitor sensor ( s ) 310 . processor 320 may , for example , stare monitored sensor data in memory 330 and / or may transmit monitored sensor data via transceiver 350 and antenna 360 . while sensor device 120 is depicted as a single device , sensor device 120 may also be a set of devices that operate in conjunction . for example , a set of devices may include sensors 310 that send monitored sensor data to another device that transmits monitored sensor data via a transceiver 350 and antenna 360 . in some embodiments , sensor device 120 is capable of entering a “ sleep ” mode in which some or all of its components are powered aft or put in a low - power state . wake - up mechanism 340 may receive power in such a sleep mode and may be configured to cause sensor device 120 to resume normal operation upon receiving a signal to exit sleep mode . for example , wake - up mechanism 340 may be connected to a clock ( not shown ), wherein , at a predetermined time determined based on the dock , the wake - up mechanism 340 causes sensor device 120 to resume normal operation . transceiver 350 may facilitate sending data to and receiving , data from external sources ( e . g ., via the internet or via a cellular network ). transceiver 370 may utilize antenna 360 to send and receive data via , for example , a cellular network . in some embodiments , memory 330 stores data regarding the destination for data obtained from sensor ( s ) 310 . sensor device 120 may , for example , be configured to transmit , using transceiver 350 and antenna 360 , data from sensor ( s ) 310 to server 110 . in some embodiments sensor device 120 and server 110 interact directly . however , in other embodiments , any number of intermediary devices may route data sent between sensor device 120 and server 110 . in some embodiments , memory 330 stores a predetermined transmission rate . sensor data from sensor ( s ) 310 may be transmitted , using transceiver 350 and antenna 360 , to server 110 at a rate that corresponds to the predetermined transmission rate . in some embodiments , if data temporarily cannot be sent from sensor device 110 ( e . g ., due to a temporary loss of cellular reception or due to the sensor device 110 being in an “ airplane ” mode in which the transceiver 350 and antenna 360 are turned off ), data from sensor ( s ) 310 may be temporary stored in memory 330 until data can be sent from sensor device 110 , and , optionally , may be sent in a batch to server 110 . in some embodiments , the sensor device 120 is capable of receiving notifications regarding altered modes of operation . for example , sensor device 120 may be notified that it should enter a special mode in which sensor data is transmitted to server 110 at an altered time interval . in some embodiments , sensor device 120 is placed within or near a shipped object . server 110 may store data that associates a shipped object identifier with sensor device 120 . in some embodiments , more than one shipped object may be associated with a single sensor device 120 . thus , as data is received by server 110 from sensor device 120 , the data may be associated with each shipped object that is associated with sensor device 120 . user interface 130 provides a user interface for accessing information regarding shipments . for example , user interface 130 may display a travelled path of a shipped object ( based on a travelled path of sensor device 120 ) based on data stored in server 110 . moreover , use interface 130 may display historical and current alerts associated with a shipped object . for example , in some embodiments , server 110 may send user interface 130 an indication that a potential risk associated with a shipped object is present . the user interface 130 may be configured to display a panic button in response to the potential risk . in some embodiments , a panic button is a selectable visual indication that a panic mode may be entered . thus , a user may select the panic button to cause various actions to occur , described in more detail below . a selection may be received in a number of ways , including , for example , a mouse click , a finger touch ( e . g ., if a user interface is displayed on a touch - sensitive screen ), a textual entry , a spoken command , etc . in some embodiments , user interface 130 is an application that is executed on server 110 . in such embodiments , a user may use a device ( e . g ., a computer , a mobile phone , a laptop , etc .) to access the user interface 130 remotely . in other embodiments , however , user interface 130 could be executed locally on a user &# 39 ; s device . in such embodiments , user interlace 130 may obtain data from server 110 . moreover , user interface 130 may be a single user interface that users ( e . g ., registered senders or receivers of a shipped package ) and administrators ( e . g ., individuals associated with the entity responsible for managing the shipping process ) can access . alternatively , user interface 130 may be two or more user interfaces configured for access by various entities ( e . g ., one user interface that can be accessed by users and another user interface , with greater authorization , that can be accessed by administrators ). system 100 may also include a number of remote devices 140 . for example , a user may provide a phone number for a mobile device to receive alerts . in addition to , or as an alternative to , sending indications of potential risks to user interface 130 , server 110 may send indications of potential risks to remote devices 140 . for example , an indication of as potential risk may be sent to a user &# 39 ; s mobile device , the mobile device may display a panic button , and the user may select the panic button to cause various actions to occur . moreover , server 110 may be configured to send other information to remote devices 140 . for example , server 110 may be configured to send remote devices 140 information in response to a determination that a panic button has been selected . system 100 may also include a number of data sources 150 . a data source 150 may be any source of data other than sensor device 120 , including , for example , a schedule of flights , a weather forecast , traffic data , etc . server 110 may access data sources 150 for a variety of reasons , such as , for example , to determine a travel path to a destination , including alternate travel paths once a shipped object is already in route to a destination , or to calculate an estimated time ardor distance to a location on the travel path . fig4 illustrates an example method 400 for determining a potential risk . method 400 begins with a generation of a time - based geofence ( step 410 ). the term “ geofence ” refers to a selected or defined geographical area . for example , server 110 may store geographical areas surrounding a number of known locations . thus , for example , a geofence may be generated lot a geographical area surrounding an intermediary shipping facility that is on a shipped object &# 39 ; s scheduled travel path . moreover , a geofence can be generated for new locations . for example , a geofence may be generated for an area ( e . g ., 1 mile , 5 miles , 10 miles ) surrounding the destination of a shipped object . a “ time - based geofence ” refers to a geofence that is associated with one or more times . in some embodiments , a time is automatically associated with the generated geofence . for example , a time that is a predetermined amount of time before an estimated delivery time , or an estimated arrival to an intermediary geofence along a scheduled travel path , may be associated with the generated geofence . alternatively , the time associated with a geofence may be selected by as user . for example , as depicted in fig8 , a user may be provided with a menu 800 that enables the user to indicate which geofence a time - based rule will apply to ( e . g ., a destination geofence or an intermediary geofence ), what type of action is associated with the geofence ( e . g ., a shipped object entering a geofence or a shipped object exiting a geofence ), whether to associate the geofence with a time ( e . g ., a time - based event ), and whether the time should be a specific time or a specified number of hours from an event ( e . g ., a specified number of hours after the geofence is created , a specified number of hours after a journey for the shipped object begins , or a specified number of hours after an estimated time of arrival to , or departure from , the geofence ). for example , as depicted in fig9 , a user may be provided with a menu 900 that enables the user to enter a time , a time zone , and a date to associate with a geofence . in some embodiments , a determination is made that sensor device 120 has not satisfied a time based event ( step 420 ). for example , a determination may be made that sensor device 120 has not reached any location within the time - based geofence by the time associated with the time - based geofence . alternatively , for example , a determination may be made that sensor device 120 has not exited an area associated with the time - based geofence by the time associated with the time - based geofence . to determine whether the sensor device 120 has not reached any location within the time - based geofence by the time associated with the time - based geofence , a history of the past locations of the sensor device 120 may be analyzed to determine if any location falls within an area associated with the time - based geofence by the time associated with the time - based geofence . alternatively , for example , each location capture associated with the sensor device 120 may be compared to an area associated with the time - based geofence and a flag may be cleared once a location associated with the sensor device 120 falls within an area associated with the time - based geofence ; a determination may be made as to whether the flag has been cleared at or before the time associated with the time - based geofence . to determine whether the sensor device 120 has not exited an area associated with the time - based geofence by the time associated with the time - based geofence , a history of the past locations of the sensor device 120 may be analyzed to determine if any location falls outside of an area associated with the time - based geofence by the time associated with the time - based geofence . alternatively , for example , each location capture associated with the sensor device 120 may be compared to an area associated with the based geofence and a flag may be cleared once a location associated with the sensor device 120 falls outside an area associated with the time - based geofence ; determination may be made as to whether the flag has been cleared at or before the time associated with the time - based geofence . in some embodiments , a potential risk is determined based on a failure of the sensor device 120 to satisfy the time - based event ( step 430 ). while the above process is explained with reference to one time - based geofence and one - time based event , n are than one time - based geofence used for a shipped object and one that one time - based event may be applied to a time - based geofence . for example , a geofence may be generated and associated with both an expected entrance time and an expected exit time . fig5 illustrates an example method 500 for determining are estimated distance or time to reach a destination or geofence for a shipped object . method 500 begins with a determination of a location of a sensor device 120 associated with the shipped object ( step 510 ). for example , server 110 may store a database which links a shipped object to a particular sensor device 120 being shipped with the shipped object . in some embodiments , sensor device 120 may automatically transmit server 110 its location , for example , at predetermined intervals . in such embodiments , a latest received location may be used . in other embodiments , server 110 may send sensor device 120 a location request and , in response to the location request , may receive a location of the sensor device 120 . in some embodiments , server 110 then calculates a distance and / or time to reach a shipped object &# 39 ; s destination or a geofence before the destination ( step 520 ). for example , server 110 may analyze past shipment data associated with the current location ( e . g ., the origin or an intermediary location determined from the location of the sensor device 120 ) and the destination or geofence location . for example , an estimated time and / or distance between a current location and a destination or geofence location may be determined based on past travel routes used for shipping an object from the current location to the destination or geofence location , based on , for example , an average time and / or distance of the past travel routes . other data may also be utilized to determine an estimated distance and / or time . for example , server 110 may determine from a data source 150 that one or more past travel routes are unavailable ( e . g ., due to road construction or inclement weather ). based on this additional data , some past travel routes may be ignored . alternatively , for example , a weighted average may be calculated by assigning each past travel route a probability associated with the probability that the travel route will be used for the current shipped object . in some embodiments , server 110 then transmits the calculated distance and / or time to user interface 130 ( step 530 ). user interface 130 may enable a user or an administrator to view the estimated distance and / or time for a shipped object to reach a destination or geofence location . fig6 illustrates an example method 600 for implementing a panic button . method 600 begins with a determination of a potential risk associated with a shipped object ( step 610 ). for example , as discussed above , a sensor device 120 may fail to enter or exit a time - based geofence by a particular time and a determination may be made that the sensor device 120 is associated with one or more shipped objects . alternatively , for example , sensor data from sensor device 120 may indicate a risk based on , for example , a high or low temperature , a high or low acceleration , a high or low pressure , or a high or low speed . in some embodiments , the determination of a potential risk is made at the server 110 . in other embodiments , the determination of a potential risk is made at the sensor device 120 . in some embodiments , based on the potential risk , server 110 enables a panic button in the user interface 130 ( step 620 ). in some embodiments , the panic button may only be enabled when a potential risk is received from sensor device 120 and one or more additional conditions are satisfied . the one or more additional conditions may include , for example : the shipped object being high value or the shipped object containing perishable material . however , in other embodiments , a panic button may always be enabled in user interface 130 for one or more users of the user interface 130 . additionally , far example , an administrator may have access to the panic button even without an indication of a potential risk from sensor device 120 . as discussed above , the panic button may be a selectable visual indication that a panic , mode may be entered . a panic button may be selected in a number of ways , including , for example , a mouse click , a finger touch ( e . g ., when a user interlace is displayed on a touch - sensitive screen ), a textual entry , a spoken command , etc . in some embodiments , server 110 receives an indication that the panic button has been selected ( step 630 ). in response to the indication that the panic button has been selected , server 110 may perform a number of actions , either simultaneously or in sequence . for example , server 110 may perform one or more of the following actions : transmit a panic mode indication to sensor device 120 ( step 640 ), notify one or more parties associated with the shipped object ( step 650 ), disable a delay of location data available to the user interface 130 ( step 660 ), and / or create a customer support case ( step 670 ). at step 640 , sensor device 120 may receive the panic mode indication from the server 110 . as discussed above , sensor device 120 may have a predetermined rate of transmitting its location and / or other environmental parameters ( e . g ., battery life , temperature , humidity , pressure , light , acceleration , or motion ) to server 110 . as discussed in more detail below , in response to receiving the panic mode indication , sensor device 120 may increase the rate in which it transmits its location / or other environmental parameters to server 110 for example , for a predetermined amount of or until another indication is received that panic mode has been resolved . in some embodiments , the increased rate is predetermined ( e . g ., twice the rate of when panic mode is not active or as frequently as the device supports transmission ). in other embodiments , the increased rate of location and environmental transmissions is received from server 110 . at step 650 , the parties that are notified of the panic mode indication may include , for example , company security , a legal department , a police department closest to the shipped object &# 39 ; s location , one or more monitoring , or intervention groups , and / or all participants who have signed up to receive notifications regarding a particular shipped object ( e . g ., a shipped &# 39 ; s object &# 39 ; s sender and / or receiver ). to increase security for certain carriers , location data that is displayed in user interface 130 may ordinarily be delayed ( e . g ., by 30 minutes ) when a panic mode is not active . at step 660 , the delay may be removed such that the user interface 130 displays the latest known location data of a shipped object without any intentional delay for a predetermined amount of time or until another indication is received that panic mode has been resolved . at step 670 , a customer support case may be created . a customer support case may be used to ensure that any issues associated with the shipped object are handled and tracked , including , for example , any billing issues that arise by a shipped object being delayed , lost , stolen , or damaged . in some embodiments , a determination may be made that the risk associated with the shipped object has abated ( step 680 ). for example , if the potential risk was associated with a determination that a shipped object has not reached a time - based geofence by a predetermined time , a determination that the risk has abated may occur if the shipped object reaches the time - based geofence . alternatively , or additionally , a determination may be made that the risk associated with the shipped object has abated if the shipped object is found at a secure location . for example , a determination may be made that the risk has abated because the shipped object is located at a known shipping facility and was delayed due to weather . alternatively , or additionally , a determination may be made that the risk associated with the shipped object has abated if a particular button in user interface 130 is selected . in some embodiments , based on the determination that the risk has abated , panic mode is resolved ( step 690 ). for example , any changed settings that were made in steps 640 - 670 may be undone . moreover , while the above process explains a single instance of a panic mode , a given shipped object may be associated with a panic mode more than once . that is , once a panic mode has been resolved , a panic mode may be entered into again . fig7 illustrates an example method 700 for implementing a panic button . method 700 begins with a sensor device 120 reporting sensor data to server 110 at a predetermined time interval ( step 710 ). for example , as discussed above , sensor device 110 may store a predetermined time interval to use during normal operation . in some embodiments , sensor device 120 receives a panic mode indication from server 110 ( step 720 ). based on the panic mode indication , sensor device 120 may alter the time interval at which it reports sensor data ( step 730 ). for example , as discussed above , sensor device 120 may store an altered reporting time interval associated with panic mode or may receive an altered reporting time interval from server 110 . sometime after receiving the panic mode indication , sensor device 120 may receive an indication from server 110 that panic mode has been resolved ( step 740 ). based on the indication that panic mode has been resolved , sensor device 120 may resume reporting sensor data at its predetermined time interval for normal operation ( step 750 ). while various operations are described above as being performed by server 110 , in some alternative embodiments sensor device 120 performs some of or all of the operations described above as being performed by server 110 . for example , a determination that a sensor device 130 has failed to satisfy a time - based geofence may be made by server 110 or by sensor device 120 . embodiments and all of the functional operations described in this specification can be implemented in digital electronic circuitry , or in computer software , firmware , or hardware , including the structures disclosed in this specification and their structural equivalents , or in combinations of them . embodiments can be implemented as one or more computer program products , i . e ., one or more modules of computer program instructions encoded on a computer readable medium , e . g ., a machine readable storage device , a machine readable storage medium , a memory device , or a machine readable propagated signal , for execution by , or to control the operation of , data processing apparatus . the term “ data processing apparatus ” encompasses all apparatus , devices , and machines for processing data , including by way of example a programmable processor , a computer , or multiple processors or computers . the apparatus can include , in addition to hardware , code that creates an execution environment for the computer program in question e . g ., code that constitutes processor firmware , a protocol stack , a database management system , an operating system , or a combination of them . a propagated signal is at artificially generated signal , e . g ., a machine - generated electrical , optical , or electromagnetic signal , which as generated to encode information for transmission to suitable receiver apparatus . a computer program ( also referred to as a program , software , an application , a software application , a script , or code ) can be written in any form of programming language , including compiled or interpreted languages , and it can be deployed in any form , including as a stand - alone program or as a module , component , subroutine , or other unit suitable for use in a computing environment . a computer program does not necessarily correspond to as file in a tile system . a program can be stored in a portion of a file that holds other p of rams car data ( e . g ., one or more scripts stored in as markup language document ), in a single file dedicated to the program in question , or in multiple coordinated files ( e . g . files that store one or more modules , sub programs , or portions of code ). a computer program can be deployed to be executed on one computer or on multiple computers that are located at one site or distributed across multiple sites and interconnected by a communication network . the processes and logic flows described in this specification ( e . g ., fig4 - 7 ) can be performed by one or more programmable processors executing one or more computer programs to perform functions by operating on input data and generating output . the processes and logic flows can also be performed by and apparatus can also be implemented as , special purpose logic circuitry , e . g ., an fpga ( field programmable gats array ) or an asic ( application specific integrated circuit ). while disclosed processes include particular process flows , alternative flows or orders are also possible in alternative embodiments . processors suitable for the execution of a computer program include , by way of example , both general and special purpose microprocessors , and any one or more processors of any kind of digital computer , generally , a processor will receive instructions and data from a read only memory or a random access memory or both . the essential elements of a computer are a processor for executing instructions and one or more memory devices for storing instructions and data . generally , a computer will also include , or be operatively coupled to , a communication interface to receive data from or transfer data to , or both , one or more mass storage devices for storing data , e . g ., magnetic , magneto optical disks , or optical disks . moreover , a computer can be embedded in another device . information card suitable for embodying computer program instructions and data include all forms of non - volatile memory including by way of example semiconductor memory devices , e . g ., eprom , eeprom , and flash memory devices ; magnetic disks , e . g ., internal hard disks or removable disks ; magneto optical disks ; and cd rom and dvdrom disks . the processor and the memory can be supplemented by , or incorporated in , special purpose logic circuitry . to provide for interaction with a user , embodiments of the invention can be implemented on a computer having a display device , e . g ., a crt ( cathode ray tube ) or lcd ( liquid crystal display ) monitor for displaying information to the user and a keyboard and a pointing device , e . g ., a mouse or a trackball , by which the user can provide input to the computer . other kinds of devices can be used to provide for interaction with a user as well ; for example , feedback provided to the user can be any form of sensory feedback , e . g ., visual feedback , auditory feedback , or tactile feedback ; and input from the user can be received in any form , including acoustic , speech , or tactile input . embodiments can be implemented in a computing system that includes a back end component . e . g ., as a data server , or that includes a middleware component , e . g ., an application server , or that includes a front end component , e . g . a client computer having a graphical user interface or a web browser through which a user can interact with an implementation of the invention , or any combination of such back end , middleware , or front end components . the components of the system can be interconnected by any form or medium of digital data communication , e . g ., a communication network . examples of communication networks include a local area network (“ lan ”) and a wide area network (“ wan ”), e . g ., the internet . the computing system can include clients and servers . a client and server are generally remote from each other and typically interact through a communication network . the relationship of client and server arises by virtue of computer programs running on the respective computers and having a client / server relationship to each other . certain features which , for clarity , are described in this specification in the context of separate embodiments , may also be provided in combination in a single embodiment . conversely , various features which , for brevity , are described in the context of a single embodiment , may also be provided in multiple embodiments separately or in any suitable sub - combination . moreover , although features may be described above as acting in certain combinations and even initially claimed as such , one or more features from a claimed combination can in some cases be excised from the combination , and the claimed combination may be directed to a subcombination variation of a subcombination . particular embodiments have been described . other embodiments are within the scope of the following claims .
| 6 |
in accordance with the present invention , there are provided magnetic metallic glass alloys that are characterized by relatively linear magnetic responses in the frequency region where harmonic marker systems operate magnetically . such alloys evidence all the features necessary to meet the requirements of markers for surveillance systems based on magneto - mechanical actuation . generally stated the glassy metal alloys of the present invention have a composition consisting essentially of the formula co a fe b ni c m d b e si f c g , where m is selected from molybdenum and chromium and &# 34 ; a &# 34 ;, &# 34 ; b &# 34 ;, &# 34 ; c &# 34 ;, &# 34 ; d &# 34 ;, &# 34 ; e &# 34 ;, &# 34 ; f &# 34 ; and &# 34 ; g &# 34 ; are in atom percent , &# 34 ; a &# 34 ; ranges from about 40 to about 43 , &# 34 ; b &# 34 ; ranges from about 35 to about 42 and &# 34 ; c &# 34 ; ranges from about 0 to about 5 , &# 34 ; d &# 34 ; ranges from about 0 to about 3 , &# 34 ; e &# 34 ; ranges from about 10 to about 25 , &# 34 ; f &# 34 ; ranges from about 0 to about 15 and &# 34 ; g &# 34 ; ranges from about 0 to about 2 . the purity of the above compositions is that found in normal commercial practice . ribbons of these alloys are annealed with a magnetic field applied across the width of the ribbons at elevated temperatures below alloys &# 39 ; crystallization temperatures for a given period of time . the field strength during the annealing is such that the ribbons saturate magnetically along the field direction . annealing time depends on the annealing temperature and typically ranges from about a few minutes to a few hours . for commercial production , a continuous reel - to - reel annealing furace may be preferred . in such cases , ribbon travelling speeds may be set at about one meter per minute . the annealed ribbons having , for example , a length of about 38 mm , exhibit relatively linear magnetic response for magnetic fields up to or more than 8 oe applied parallel to the marker length direction and mechanical resonance in a range of frequencies from about 48 khz to about 66 khz . the linear magnetic response region extending to the level of more than 8 oe is sufficient to avoid triggering most of the harmonic marker systems . the annealed ribbons at lengths shorter or longer than 38 mm evidence higher or lower mechanical resonance frequencies than 48 - 66 khz range . ribbons having mechanical resonance in the range from about 48 to 60 khz are preferred . such ribbons are short enough to be used as disposable marker materials . in addition , the resonance signals of such ribbons are well separated from the audio and commercial radio frequency ranges . most metallic glass alloys that are outside of the scope of this invention typically exhibit nonlinear magnetic response regions below about 8 oe level . resonant markers composed of these alloys accidentally trigger , and thereby pollute , many article detection systems of the harmonic re - radiance variety . there are a few metallic glass alloys outside of the scope of this invention that do show linear magnetic response for an acceptable field range . these alloys , however , contain high levels of molybdenum or chromium , resulting in increased raw material costs and reduced ribbon castability owing to the higher melting temperatures . the alloys of the present invention are advantageous , in that they afford , in combination , extended linear magnetic response , improved mechanical resonance performance , good ribbon castability and economy in production of usable ribbon . apart from the avoidance of the interference among different systems , the markers made from the alloys of the present invention generate larger signal amplitudes at the receiving coil than conventional mechanical resonant markers . this makes it possible to reduce either the size of the marker or increase the detection aisle widths , both of which are desirable features of article surveillance systems . examples of metallic glass alloys of the invention include co 42 fe 40 b 11 si 7 . co 42 fe 40 b 12 si 6 , co 42 fe 40 b 13 si 5 , co 42 fe 40 b 14 si 4 , co 42 fe 40 b 15 si 3 , co 42 fe 40 b 16 si 2 , co 42 fe 40 b 17 si 1 , co 42 , fe 40 b 13 si 3 c 2 , co 40 fe 40 ni 2 b 13 si 5 co 40 fe 38 ni 4 b 13 si 5 , co 41 fe 40 mo 1 b 13 si 5 , co 41 fe 38 mo 3 b 13 si 5 , co 41 fe 40 cr 1 b 13 si 5 , co 41 fe 38 cr 3 b 13 si 5 , and co 43 fe 35 ni 3 b 13 si 4 c 2 , wherein subscripts are in atom percent . the magnetization behavior characterized by a b - h curve is shown in fig1 ( a ) for a conventional mechanical resonant marker , where b is the magnetic induction and h is the applied field . the overall b - h curve is sheared with a non - linear hysteresis loop existent in the low field region . this non - linear feature of the marker results in higher harmonics generation , which triggers some of the harmonic marker systems , hence the interference among different article surveillance systems . the definition of the linear magnetic response is given in fig1 ( b ). as a marker is magnetized along the length direction by an external magnetic field , h , the magnetic induction , b , results in the marker . the magnetic response is relatively linear up to h a , beyond which the marker saturates magnetically . the quantity h a depends on the physical dimension of the marker and its magnetic anisotropy field . to prevent the resonant marker from accidentally triggering a surveillance system based on harmonic re - radiance , h a should be above the operating field intensity region of the harmonic marker systems . the marker material is exposed to a burst of exciting signal of constant amplitude , referred to as the exciting pulse , tuned to the frequency of mechanical resonance of the marker material . the marker material responds to the exciting pulse and generates output signal in the receiving coil following the curve leading to v o in fig2 . at time t o , excitation is terminated and the marker starts to ring - down , reflected in the output signal which is reduced from v o to zero over a period of time . at time t 1 , which is 1 msec after the termination of excitation , output signal is measured and denoted by the quantity v 1 . thus v 1 v o is a measure of the ring - down . although the principle of operation of the surveillance system is not dependent on the shape of the waves comprising the exciting pulse , the wave form of this signal is usually sinusoidal . the marker material resonates under this excitation . the physical principle governing this resonance may be summarized as follows : when a ferromagnetic material is subjected to a magnetizing magnetic field , it experiences a change in length . the fractional change in length , over the original length , of the material is referred to as magnetostriction and denoted by the symbol λ . a positive signature is assigned to λ if an elongation occurs parallel to the magnetizing magnetic field . when a ribbon of a material with a positive magnetostriction is subjected to a sinusoidally varying external field , applied along its length , the ribbon will undergo periodic changes in length , i . e ., the ribbon will be driven into oscillations . the external field may be generated , for example , by a solenoid carrying a sinusoidally varying current . when the half - wave length of the oscillating wave of the ribbon matches the length of the ribbon , mechanical resonance results . the resonance frequency f r is given by the relation where l is the ribbon length , e is the young &# 39 ; s modulus of the ribbon , and d is the density of the ribbon . magnetostrictive effects are observed in a ferromagnetic material only when the magnetization of the material proceeds through magnetization rotation . no magnetostriction is observed when the magnetization process is through magnetic domain wall motion . since the magnetic anisotropy of the marker of the alloy of the present invention is induced by field - annealing to be across the marker width direction , a dc magnetic field , referred to as bias field , applied along the marker length direction improves the efficiency of magneto - mechanical response from the marker material . it is also well understood in the art that a bias field serves to change the effective value for e , the young &# 39 ; s modulus , in a ferromagnetic material so that the mechanical resonance frequency of the material may be modified by a suitable choice of the bias field strength . the schematic representation of fig3 explains the situation further : the resonance frequency , f r , decreases with the bias field , h b , reaching a minimum , ( f r ) min , at h b2 . the signal response , v 1 , detected , say at t = t 1 at the receiving coil , increases with h b2 , reaching a maximum , v m , at h b1 . the slope , df r / dh b , near the operating bias field is an important quantity , since it related to the sensitivity of the surveillance system . summarizing the above , a ribbon of a positively magnetostrictive ferromagnetic material , when exposed to a driving ac magnetic field in the presence of a dc bias field , will oscillate at the frequency of the driving ac field , and when this frequency coincides with the mechanical resonance frequency , f r , of the material , the ribbon will resonate and provide increased response signal amplitudes . in practice , the bias field is provided by a ferromagnet with higher coercivity than the marker material present in the &# 34 ; marker package &# 34 ;. table i lists typical values for v m , h b1 , ( f r ) min and h b2 for a conventional mechanical resonant marker based on glassy fe 40 ni 38 mo 4 b 18 . the low value of h b2 , in conjunction with the existence of the nonlinear b - h behavior below h b2 , tends to cause a marker based on this alloy to accidentally trigger some of the harmonic marker systems , resulting in interference among article surveillance systems based on mechanical resonance and harmonic re - radiance . table i______________________________________typical values for v . sub . m , h . sub . b1 , ( f . sub . r ). sub . min and h . sub . b2 fora conventionalmechanical resonant marker based on glassy fe . sub . 40 ni . sub . 38 mo . sub . 4b . sub . 18 . this ribbon at a length of 38 . 1 mm has mechanical resonancefrequencies ranging from about 57 and 60 khz . v . sub . m ( mv ) h . sub . b1 ( oe ) ( f . sub . r ). sub . min ( khz ) h . sub . b2 ( oe ) ______________________________________150 - 250 4 - 6 57 - 58 5 - 7______________________________________ table ii lists typical values for h a , v m , h b1 , ( f r ) min , h b2 and df r / dh b h b for the alloys outside the scope of this patent . field - annealing was performed in a continuous reel - to - reel furnace on 12 . 7 mm wide ribbon where ribbon speed was from about 0 . 6 m / min . to about 1 . 2 m / min . table ii__________________________________________________________________________values for h . sub . a , v . sub . m , h . sub . b1 , ( f . sub . r ). sub . min , h . sub . b2 anddf . sub . r / dh . sub . b taken at h . sub . b = 6 oe for the alloys outside thescope of this patent . field - annealing was performed in a continuousreel - to - reel furnacewhere ribbon speed was from about 0 . 6 m / min . to about 1 . 2 m / min andribbon temperaturewas about 380 ° c . the annealing field was about 1 . 4 koe appliedacross the ribbon width . composition ( at . %) h . sub . a ( oe ) v . sub . m ( mv ) h . sub . b1 ( oe ) ( f . sub . r ). sub . min ( khz ) h . sub . b2 ( oe ) df . sub . r / dh . sub . b__________________________________________________________________________ ( hz / oe ) a . co . sub . 42 fe . sub . 35 mo . sub . 5 b . sub . 13 si . sub . 5 11 70 4 . 5 59 7 . 5 900__________________________________________________________________________ alloy a shows not only an unacceptable magnetomechanical resonance responses but contains a high level of molybdenum , resulting in increased raw material costs and reduced ribbon castability . the following examples are presented to provide a more complete understanding of the invention . the specific techniques , conditions , materials , proportions and reported data set forth to illustrate the principles and practice of the invention are exemplary and should not be construed as limiting the scope of the invention . glassy metal alloys in the co -- fe -- b -- si -- c series , designated as samples no . 1 to 8 in table iii and iv , were rapidly quenched from the melt following the techniques taught by narasimhan in u . s . pat . no . 4 , 142 , 571 , the disclosure of which is hereby incorporated by reference thereto . all casts were made in an inert gas , using 100 g melts . the resulting ribbons , typically 25 μm thick and about 12 . 7 mm wide , were determined to be free of significant crystallinity by x - ray diffractometry using cu -- kα radiation and differential scanning calorimetry . each of the alloys was at least 70 % glassy and , in many instances , the alloys were more than 90 % glassy . ribbons of these glassy metal alloys were strong , shiny , hard and ductile . the ribbons were cut into small pieces for magnetization , magnetostriction , curie and crystallization temperature and density measurements . the ribbons for magneto - mechanical resonance characterization were cut to a length of about 38 . 1 mm and were heat treated with a magnetic field applied across the width of the ribbons . table iii lists saturation induction ( b s ), saturation magnetostriction ( λ s ), crystallization temperature ( t c ) of the alloys . magnetization was measured by a vibrating sample magnetometer , giving the saturation magnetization value in emu / g which is converted to the saturation induction . saturation magnetostriction was measured by a strain - gauge method giving in 10 - 6 or in ppm . curie and crystallization temperatures were measured by an inductance method and a differential scanning calorimetry , respectively . table iii______________________________________magnetic and thermal properties of co - fe - b - si - c glassy alloys . curie temperatures of these alloys are above the crystallizationtemperatures and are not listed . composition ( at . %) no . co fe b si c b . sub . s ( tesla ) λ . sub . s ( ppm ) t . sub . c (° c . ) ______________________________________1 42 40 11 7 -- 1 . 56 26 4512 42 40 12 6 -- 1 . 55 26 4563 42 40 13 5 -- 1 . 55 25 4544 42 40 14 4 -- 1 . 55 25 4545 42 40 15 3 -- 1 . 55 25 4546 42 40 16 2 -- 1 . 55 25 4527 42 40 17 1 -- 1 . 55 25 4528 42 40 13 3 2 1 . 57 26 442______________________________________ each marker material having a dimension of about 38 . 1 mm × 12 . 7 mm × 20 μm was tested by a conventional b - h loop tracer to measure the quantity h a and then was placed in a sensing coil with 221 turns . an ac magnetic field was applied along the longitudinal direction of each alloy marker with a dc bias field changing from 0 to about 20 oe . the sensing coil detected the magneto - mechanical response of the alloy marker to the ac excitation . these marker materials mechanically resonate between about 48 and 66 khz . the quantities characterizing the magneto - mechanical response were measured and are listed in table iv for the alloys listed in table iii . table iv______________________________________values of h . sub . a , v . sub . m , h . sub . b1 , ( f . sub . r ). sub . min , h . sub . b2 anddf . sub . r / dh . sub . b taken ath . sub . b = 6 oe for the alloys of table iii heat - treated at 375 ° c . for15 min in a magnetic field of about 1 . 4 koe applied perpendicularto the ribbon length direction ( indicated by asterisks ). alloysno . 1 , 2 and 8 were field annealed in a reel - to - reel anealingfurnace at 380 ° c . with a ribbon speed of about 0 . 6 m / mimute . h . sub . a h . sub . b1 ( f . sub . r ). sub . min h . sub . b2 df . sub . r / dh . sub . balloy no . ( oe ) v . sub . m ( mv ) ( oe ) ( khz ) ( oe ) ( hz / oe ) ______________________________________1 20 415 8 . 0 53 . 5 17 . 0 6102 20 350 9 . 0 52 . 3 16 . 2 6203 21 330 7 . 5 50 . 8 18 . 5 4704 20 375 9 . 0 50 . 5 17 . 2 5405 21 320 8 . 5 51 . 3 18 . 7 4206 21 320 8 . 8 51 . 5 18 . 5 4907 20 330 8 . 5 51 . 0 18 . 2 5508 20 325 9 . 0 54 . 8 17 . 0 550______________________________________ all the alloys listed in table iv exhibit h a values exceeding 8 oe , which make them possible to avoid the interference problem mentioned above . good sensitivity ( df r / dh b ) and large response signal ( v m ) result in smaller markers for resonant marker systems . glassy metal alloys in the co -- fe -- ni -- mo / cr /-- b -- si -- c system were prepared and characterized as detailed under example 1 . table v lists chemical compositions , magnetic and thermal properties and table vi lists quantities characterizing mechanical resonance responses of the alloys of table v . table v______________________________________magnetic and thermal properties of low cobalt containing glassyalloys . t . sub . c is the first crystallization temperature . b . sub . salloy composition ( at . %) ( tes - λ . sub . s t . sub . cno . co fe ni mo cr b si c la ) ( ppm ) (°. c ) ______________________________________1 41 40 -- 1 -- 13 5 -- 1 . 51 24 4632 41 38 -- 3 -- 13 5 -- 1 . 34 20 4673 41 40 -- -- 1 13 5 -- 1 . 51 24 4604 41 38 -- -- 3 13 5 -- 1 . 37 20 4635 40 40 2 -- -- 13 5 -- 1 . 53 27 4566 43 35 3 -- -- 13 4 2 1 . 50 19 4687 40 38 4 -- -- 13 5 -- 1 . 50 23 456______________________________________ table vi______________________________________values of h . sub . a , v . sub . m , h . sub . b1 , ( f . sub . r ). sub . min , h . sub . b2 anddf . sub . r / dh . sub . b taken ath . sub . b = 6 oe for the alloys listed in table v heat - treated at380 ° c . in a reel - to - reel annealing furnace with a ribbon speed of about0 . 6 m / minute . h . sub . b1 ( f . sub . r ). sub . min h . sub . b2 df . sub . r / dh . sub . balloy no . h . sub . a ( oe ) v . sub . m ( mv ) ( oe ) ( khz ) ( oe ) ( hz / oe ) ______________________________________1 18 400 8 . 0 52 . 3 15 . 3 7302 14 270 6 . 0 56 . 3 12 . 4 9403 18 330 8 . 5 52 . 6 16 . 5 7204 16 320 7 . 3 53 . 9 13 . 8 8605 20 250 8 . 0 54 . 7 15 . 2 5906 19 330 8 . 2 56 . 7 16 . 0 5007 20 420 9 . 3 53 . 8 16 . 4 500______________________________________ all the alloys listed in table vi exhibit h a values exceeding 8 oe , which make them possible to avoid the interference problems mentioned above . good sensitivity ( df r / dh b ) and large magneto - mechanical resonance response signal ( v m ) result in smaller markers for resonant marker systems . having thus described the invention in rather full detail , it will be understood that such detail need not be strictly adhered to but that further changes and modifications may suggest themselves to one skilled in the art , all falling within the scope of the invention as defined by the subjoined claims .
| 6 |
many aspects of the invention can be better understood with the references made to the drawings below . the components in the drawings are not necessarily drawn to scale . instead , emphasis is placed upon clearly illustrating the components of the present invention . moreover , like reference numerals designate corresponding parts through the several views in the drawings . by way of a quick summary of the invention , the insert is color - coded to a particular broselow ® child size . each insert has a blocking ledge in a certain position such that it provides a stopping point beyond which a vial of medication cannot be pushed , thereby limiting the amount of medication that is delivered to a child . as the vial is depressed , medication flows through the needle and is stopped when the outer edge of the vial contacts the blocking ledge , thereby limiting the amount of medication delivered by the syringe . since the blocking ledges are located at different levels of the insert depending on the correct dosage for a child of that broselow ® color code , all emergency medical personnel have to do is select the proper color and medication from the kit provided . fig1 is a front view of the invention illustrating the basic physical structure of the insert . fig2 is a cross - sectional view , fig3 is a top view and fig4 is a perspective view of the insert shown in fig1 . the insert , generally referenced as 1 , is a cylindrical container with two sections : an insert top portion 2 which has a narrower outside diameter 5 than the second part , an insert bottom portion 4 , which has a larger diameter 6 . this is caused by the fact that the insert top wall thickness 7 has a thinner width than the width of the insert bottom wall thickness 8 . the increase in outside diameter between the insert top 2 and the insert bottom 4 causes a blocking ledge 3 . the insert 1 is placed in a syringe ( in a preferred embodiment , the syringe is a hospira abboject ®), with insert top 2 upright , and a vial of medication is installed by screwing the vial stopper into the syringe over the insert . the vial wall is then pushed down and medication flows through the syringe needle until the vial wall &# 39 ; s progress is stopped by the blocking ledge of the insert hitting a vial lip ( 17 as referenced in other figures ). thus , by adjusting the location of the blocking ledge 3 , the volume of medication delivered can be changed from insert to insert , such that the proper dosage is given to a child of that particular size . the outside diameter of the insert top 2 is small enough to allow a vial wall to slip over it , and the blocking ledge 3 is wide enough to prevent the vial wall from slipping any further down the insert , thereby limiting the amount of medication delivered from the vial through the syringe . fig5 is a cross - sectional view of the insert , syringe , and vial , which are the three basic components , that when used correctly , can provide an error - free dosage to a child . the syringe 9 is a cylindrical container with a needle 29 at one end and an open top . the insert 1 is slid into the open top and nestled at the bottom of the syringe . the vial 10 is a cylinder with a vial wall 13 with a vial wall width 11 , and open top defined by a vial lip 17 , a vial bottom 12 , where the inner sides of the vial wall define a vial internal diameter 22 . inside the cylinder is a quantity of medication 14 , and retaining the medication in the vial is a rubber plunger 15 . after insert 1 is placed within the syringe 9 , the vial is screwed onto the syringe . when properly installed the syringe needle 29 penetrates the rubber plunger 15 that is used to seal the vial of medication . note that as the vial is pushed down , the medication 14 will be directed through the needle 29 until the vial lip 17 hits the blocking ledge 3 . fig6 is a series of drawings showing cross - sectional depictions showing the insert positioning prior to and after installation into a syringe . fig7 is a series of drawings showing cross - sectional depictions showing how the insert appears when placed within the syringe and the vial is being attached . fig8 is a series of cross - sectional views showing the vial bring pressed into the syringe , delivering a dose limited by the step or “ blocking ledge ” in the insert . the insert 1 is slid into the syringe cavity 31 of the syringe 9 until the insert bottom 16 hits the syringe outer chamber bottom 27 . the syringe outer chamber width 26 is wide enough to accommodate the insert bottom wall thickness 8 , such that the insert 1 slides easily into the syringe 9 . the vial 10 is then attached to the syringe 9 . after the vial is installed on the syringe , the vial bottom 12 is pushed toward the blocking ledge 3 , the appropriate amount of medication 14 will flow through the needle 29 , until the vial lip 17 contacts the blocking ledge 3 . when the vial has been fully compressed to the point where the vial lip 17 has hit the blocking ledge 3 , the correct quantity of medication 14 has been properly delivered . the vial 10 is then pressed down . the vial internal diameter 22 is larger than the insert top outer diameter 5 , but less than the insert bottom outer diameter 6 , such that vial lip 17 , cannot be pushed beyond the blocking ledge 3 . thus , a set quantity of medication is injected through the needle 29 in the syringe inner chamber 28 , as the rubber plunger 15 in the vial mates to the syringe inner chamber stopper 30 , such as the medication 14 in the vial is injected up to the point where the vial lip 17 hits the blocking ledge 3 . because the blocking ledges are located at different heights in different colors of inserts , emergency medical personnel can easily pick the appropriate insert by matching it to the appropriate color code of the broselow ® pediatric emergency tape . fig9 is a cross - sectional view of the vial after it has been depressed as far as it will go , thereby limiting the dosage given to the child . the vial 10 has been pushed into the syringe 9 as far as it will go based upon the color of insert that was used . the blocking ledge 3 of the insert has stopped the vial wall 13 from entering the syringe 9 further , thereby limiting the amount of medication 14 , that was injected into the child . the threaded rubber plunger 15 has directed the medication 14 through the needle 29 . fig1 is a perspective view of a series of epinephrine inserts , each color coded to the appropriate “ zone ” of the broselow ® tape . note how the blocking ledge is a different distance “ down ” each insert , so that a particular color of insert will allow the proper dosage of a medication to a child whose height corresponds to the particular broselow ® color “ zone ”. fig1 is a front view of how the invention might appear in an emt &# 39 ; s medication kit , with different color - coded inserts for different medications , with each insert color coded to the appropriate “ zone ” of the broselow ® tape . the medication here , used by way of example , is epinephrine , a common emergency medication . the inserts are color coded to the appropriate broselow ® color zone , such that all an emt needs to do if dealing with a child under emergency circumstances is measure the child with the broselow ® tape and pick out the appropriate insert , then place the insert into the syringe , attach a vial of epinephrine , and depress the vial of epinephrine until the lip of the epinephrine vial hits the blocking ledge of the insert . fig1 is a front view of how the invention might appear in an emt &# 39 ; s medication kit , with different color - coded inserts 3 for different medications , with each insert color coded to the appropriate “ zone ” of the broselow ® tape and the type of medication written on each insert . note how the various color and size - coded inserts can be organized horizontally , or vertically , by either the medication type or the dosage category . it is also envisioned that other inserts or labels can be attached to the vial to provided various types of information , included but not limited to : name and concentration of the medication , amount based upon dosage weight , amount based on dosage volume , calculated amount based on pediatric patient weight , and color - coding based on broselow ® pediatric emergency tape . fig1 is a front view of how the invention might appear in another embodiment of an emt &# 39 ; s medication kit , with different color - coded inserts 3 for different medications , with each insert color coded to the appropriate “ zone ” of the broselow ® tape and the inserts organized by dosage category . it should be understood that while the preferred embodiments of the invention are described in some detail herein , the present disclosure is made by way of example only and that variations and changes thereto are possible without departing from the subject matter coming within the scope of the following claims , and a reasonable equivalency thereof , which claims i regard as my invention . all of the material in this patent document is subject to copyright protection under the copyright laws of the united states and other countries . the copyright owner has no objection to the facsimile reproduction by anyone of the patent document or the patent disclosure , as it appears in official governmental records but , otherwise , all other copyright rights whatsoever are reserved .
| 0 |
referring to fig1 a recording and reading apparatus of a flexible disk driving apparatus according to an embodiment of the present invention comprises a flexible disk 1 , a flexible disk drive 2 for recording information onto and reading information from the flexible disk 1 , and disk drive control unit 3 for controlling the disk drive 2 in accordance with a host computer 4 . in the disk drive 2 , a magnetic head 10 is connected to a read / write ( r / w ) amplifier 20 which amplifier the analog signal a read out from the flexible disk 1 by the magnetic head 10 and translates it to digital signal b . the digital signal b is supplied to a variable frequency oscillator ( vfo ) 30 and the control unit 3 . the vfo 30 creates first window signal d and second window signal f in accordance with the digital signal b . a switching circuit 70 selects the first or second window signal d or f in response to a read - after - write instruction signal g and supplies the selected window signal j to the control unit 3 . as described later , the first window signal d is supplied to the control unit 3 during the reading operation , and the second window signal f is supplied to the control unit 3 during the read - after - write operation . a write controller 40 of the disk drive 2 receives a digital signal k to be recorded on to the disk 1 and recording instruction l from the control unit 3 . the digital signal k encoded by the frequency modulation ( fm ) is translated to a signal c by the controller 40 and supplied to the r / w amplifier 20 . the r / w amplifier 20 translates the recording signal c to the analog form and amplifies it suitable to record on the disk 1 via the head 10 . if the recording operation is completed , i . e ., the recording instruction l turns off , the write controller 40 sends a reading instruction h to a write detecting circuit 60 . the write detecting circuit 60 also receives an index signal i which is obtained by an optical sensor 80 detecting an index hole 1 &# 39 ; of the disk 1 . the index signal i is obtained every one rotation of the disk 1 . the wire detecting circuit 60 produces the read - after - write instruction signal g in response to the beginning of the reading instruction h ( i . e ., the end of the recording instruction 1 ) until a predetermined number of the pulses of the index signal i are obtained . thus , the read - after - write instruction signal g is produced immediately after the recording operation during a predetermined number of disk rotations . in this embodiment , the read - after - write instruction signal g is produced during two rotations of the disk 1 . the control unit 3 includes a memory 5 for storing the information to be recorded which is sent by the host computer 4 , a recording controller 6 for translating the information to the digital signal k and sending the recording instruction l , a sampling circuit 7 for sampling the data bits of the digital signal b by using the window signal j , and a comparator 8 for comparing the data bit with the information to be recorded which is held in the memory 5 . the result of the comparison is supplied to the recording controller 6 . referring to fig2 and 3 , the information i to be recorded on the disk are stored in the memory 5 . the information i is translated to the fm code form , and then , to the digital signal k ( fig3 ) by the recording controller 6 of the control unit 3 . in the recording mode , which occurs during a period t 1 , the digital signal k is supplied to the write controller 40 together with the recording instruction l . the digital signal k is translated to the signal c of the square waveform , and then , to the analog signal a . the recording medium 1 is magnetized in response to the analog signal a . when the recording operation is completed by one track , the recording instruction l is turned off and the reading instruction h . then , the read - after - write instruction signal g is turned on , as described later , to change into the read - after - write mode indicated by a period t 2 . in this mode , the signal c which had just been recorded is read out . the signal a read - out in the analog form is produced by the magnetic head 10 and translated to the digital signal b . the first and second window signals d and f are produced by the vfo 30 , but only the second window signal f is supplied to the control unit 3 as the window signal j in this mode . the and gate 72 does not have any output during the period of time from t 1 to t 4 . in the period t 1 and t 3 it has no input d , though it is opened by g . in the periods t 2 and t 4 it is closed by g , though its input d is applied . the output of the and gate 72 ( the first window signal d ) is generated only in the period t 5 ( read mode ) when both g and d are present at its inputs . the data bit of the digital signal b in the period t 2 is sampled by the sampling circuit 7 by using the window signal j and compared with the information i still stored in the memory 5 by the comparator 8 . the control unit 3 carries out the read - after - write operation to the even sector of the track in the period t 21 and to the odd sector in the period t 22 . if the data bit of the digital signal b is equal to the information i , the control unit 3 recognizes that the recording operation is correctly completed . if not , the recording controller 6 of the control unit 3 carries out the recording operation for the same information i again on another area of the recording medium 1 . the recording and the read - after - write operation for the next track are carried out in the same manner as indicated by the periods t 3 and t 4 . when the recording and read - after - write operations for all the information to be recorded may be completed , the disk drive 2 is changed into the reading mode , as indicated by the period t 5 . in this mode , the recording instruction l and the read - after - write instruction signal g take the off state and only the reading instruction takes the on state . the reading signal a is produced by the magnetic head 10 and translated to the digital signal b by the r / w amplifier 20 . although both the first and second window signals d and f are created by the vfo 30 , only the first window signal d is sent to the control unit 3 as the window signal j to read the digital signal b . the sampling circuit 7 samples the data bit of the digital signal b by using the window signal j and sends the data bit to the host computer 4 . a more detailed description of the recording and reading apparatus may be obtained by referring to fig4 . there , during the read or read after write mode , the digital signal b is supplied to an one - shot pulse generating circuit 31 and the set terminal of an s - r type flip - flop 35 . the outputs m and n of the circuit 31 and the flip - flop 35 are connected to a phase detector 32 in which the phase difference o between the outputs m and n is detected . the phase difference o is translated to a difference voltage p by a filter 33 and supplied to a variable voltage control oscillator ( vco ) 34 . the vco 34 produces a pulse signal q whose frequency is varied in response to the difference voltage p , which is supplied to a counter 36 . the counter 36 counts the number of pulses in signal q and outputs a count value r from &# 34 ; 0 &# 34 ; to &# 34 ; 7 &# 34 ;. after the count value r becomes &# 34 ; 7 &# 34 ;, the count value r is returned to &# 34 ; 0 &# 34 ; by the next pulse signal q input to counter 36 . the count value r of the counter 36 is decoded by a decoder 37 having three output signals s , e and e &# 39 ;. the decoder 37 outputs the signal s when the count value r is &# 34 ; 0 &# 34 ;, the signal e when the count value r is &# 34 ; 2 &# 34 ; and the signal e &# 39 ; when the count value r is &# 34 ; 6 &# 34 ;. the signal s is connected to the reset terminal of the flip - flop 35 and a t type flip - flop 38 . the signals e and e &# 39 ; are connected to the set and reset terminals of a flip - flop 50 , respectively . the t type flip - flop 38 changes its output level ( high or low ) every time the signal s is generated , i . e ., every time the count value r returns to &# 34 ; 0 &# 34 ;, so that the rectangular first window signal d is produced . the s - r type flip - flop 50 generates a rectangular signal f which takes high level during the period from he signal e to the signal e &# 39 ;, i . e ., while the count value r is &# 34 ; 2 &# 34 ; to &# 34 ; 6 &# 34 ;. the output d of the flip - flop 38 is used as the first window signal . an and gate 51 is connected to the outputs d and f &# 39 ; of the flip - flops 38 and 50 , respectively . the and gate allows the output f &# 39 ; to pass only when the output d is at a high level . the output f of the and gate 51 is used as the second window signal . the first and second window signal d and f are sent to one input terminals of each of and gates 72 and 74 of the switching circuit 70 , respectively . the other input terminal of the and gate 72 is connected to the line of the read - after - write instruction signal g via an invertor 71 while that of the and gate 74 is directly connected to the line of the same . both of the outputs of the and gates 72 and 74 are connected to an or gate 73 whose output j is used for the selected window signal . the write detecting circuit 60 includes a counter 61 and a flip - flop 62 . the counter 61 starts its counting operation when a low level signal h is supplied thereto , and the flip - flop 62 is set and reset when a low level signal is supplied to its set terminal s and reset terminal r , respectively . the set terminal s of the flip - flop 62 is supplied with the h signal which is generated by the inverter 63 from the read instruction signal h . when the instruction signal h turns to a high level , the inverted signal h becomes low and the flip - flop 62 is set to output the read - after - write instruction signal g . the counter 62 is supplied with the index signal i . when the inverted instruction signal h turns to the low level , the counter 61 is reset to &# 34 ; 0 &# 34 ; and starts counting the pulse number of the index signal i . one of the index pulses ( i 1 ), generated simultaneously with the instruction signal h is not counted by the counter 61 . the counter 61 outputs a signal when it counts two pulses , i . e ., the index pulses i 2 and i 3 , which signal is supplied as a reset pulse to the reset terminal r of the flip - flop 62 . this turns the output g of the flip - flop 62 to the low level . accordingly , the read - after - write instruction signal g turns high in response to the generation of the read instruction signal h and keeps the high level for the period from the index pulse i 1 , to the index pulse i 3 , i . e ., for two rotation period of the disk 1 . the read - after - write instruction signal g makes the and gate 74 open to supply the second window signal f to the or gate 73 when its goes high , and the and gate 72 open to supply the first window signal d to the or gate 73 when it goes low . in other words , after the recording operation , the disk drive carries out the read - after - write operation during the two rotations of the disk 1 in which the second window signal f is used to separate the data bits from the digital signal b . after that , if the recording instruction l is not generated , the disk drive can carry out the reading operation in which the first window signal d is used to separate the data bits from the signal . referring to fig5 in the read - after - write operation indicated by the periods t 2 and t 4 in fig2 the recorded data fm &# 39 ; on the recording medium 1 is read by the magnetic head 10 to produce the analog signal a . the analog signal a is translated to the digital signal b by the r / w amplifier 20 which detects the high and low peaks of the signal a . normally , the minimum period between the peaks is 2μ second and the maximum period is 4μ second . the one - shot circuit 31 is triggered by the pulses t n and makes a square wave signal m which maintains the high level in the predetermined period ( 1μ second ). the flip - flop 35 is set by the pulses t n of the signal b and reset by the signal s from the decoder 37 to produce the square wave signal n . the phase detector 32 puts out the voltage o of 2 . 5 v when the high - level period of the signal m is the same as that of the signal n . when the high - level period of the signal m is longer than that of the signal n , the detector 32 puts out the voltage of 0 v during the time that the signal m is higher than the signal n . when the high - level period of the signal n is longer than that of the signal m , the detector 32 puts out the voltage of 5 v during the time that the signal n is higher than the signal m . when the phase detector 32 puts out the voltage 2 . 5 v , the filter 33 puts out the same voltage 2 . 5 v , and heightens and lowers the voltage in response to the output voltage o of the phase detector 32 . the vco 34 translates the voltage 2 . 5 v to the pulse signal q having the pulse interval of 250 nsecond ( corresponding to the frequency of 4 mhz ), and makes the pulse interval shorter or longer when the voltage p beocmes higher or lower than 2 . 5 v , respectively . the count value r is increased by the pulse signal q and returns to &# 34 ; 0 &# 34 ; next to &# 34 ; 7 &# 34 ;. the pulse of the signal s is raised every time the count value r = 0 to make the first window signal d . the pulses of the signals e and e &# 39 ; are raised every time the count value r = 2 and 6 , respectively , to make the second window signal f . accordingly , the high level period ( pulse width ) of the second window signal f is shorter than that of the first window signal d . since the output f &# 39 ; of the flip - flop 50 is gated by the first window signal d , the second window signal f is not turned high level during the low level of the first window signal d . if the data fm is accurately recorded on the medium 1 , the reading signal a shows the waveform as illustrated by a dotted line , and the digital signal b has pulses t 3 &# 39 ; to t 6 &# 39 ;. however , the read - out signal a may be deflected as illustrated by a solid line , due to a defect of the recording medium 1 , mis - recording operation , and so on . in this case , the pulses t 3 to t 6 are shifted in comparison with the pulses t 3 &# 39 ; to t 6 &# 39 ;. for instance , considering the pulse t 3 which is shifted to right on the time chart , the pulse t 3 delays the rising of the signals m and n . since the high level period of the signal m is constant ( 1 μsec ) while that of the signal n is shortened by the signal s , the phase difference is arisen and detected by the phase detector 32 . the phase detector 32 makes the voltages o and p lower and the pulse interval of the vco 34 longer . therefore , the count operation of the counter 36 and output timing of the signals s , e and e &# 39 ; are also delayed to adjust the rising timing and the width of the high level periods ( windows ) w 2 and w 2 &# 39 ; of the first and second window signals d and f . a large peak shift should not be allowed in the read - after - write operation because mis - reading is supposed to be corrected by this operation . at the portion of a data pulse t 5 , the reading signal a is largely deflected from the correct form illustrated by the dotted line . as mentioned above , the window w 3 of the first window signal d for the data pulse t 5 is defined by the pulses s 6 and s 7 of the signal s while the window w 3 &# 39 ; of the second window signal f is defined by the pulses e 6 and e 6 &# 39 ; of the signals e and e &# 39 ;, respectively . if the data pulse t 5 is read by using the window w 3 , the data pulse t 5 is read as &# 34 ; 1 &# 34 ; as shown in data 1 and the large peak shift of this portion cannot be detected . on the other hand , in the case where the window w 3 &# 39 ; is used in the read - after - write mode , the data pulse t 5 cannot be detected within the window w 3 &# 39 ; so as to read as &# 34 ; 0 &# 34 ; as shown in data 2 . accordingly , unallowable peak shift is detected by comparing the data 2 with the information to be recorded , and the control unit 3 can re - record the information to another area of the recording medium 1 . as described above , according to the present invention , the second window signal is used to sample the data bit of the digital signal read from the recording medium in the read - after - write operation . the second window signal has narrower window than the first window signal which is used in the reading operation . if the recorded data is confirmed to be correctly recorded on the medium by the read - after - write operation , it is guaranteed that the data bits of the recorded data can be accurately read in the reading operation , even if the peak shift occurs in the reading operation , since the first window signal has a wider window than the second window signal . accordingly , the read - after - write operation is strictly carried out and the recorded information on the recording medium has a high reliability after the read - after - write operation .
| 6 |
an imaging sensor arrangement is presented in fig1 a as one embodiment of aspects of the present invention . in this arrangement , the transmit signal generator 650 outputs u signals to a multi - dimensional thinned transmit antenna network 601 for electromagnetic transmission , where u is an integer greater than or equal to 1 . a typical frequency of the transmitted signal from the multi - dimensional thinned transmit antenna network 601 can be within , but is not limited to , the frequency range of 1 ghz - 1 thz , and can be a fixed frequency or be frequency modulated . the imaging sensor &# 39 ; s total occupied transmit spectral bandwidth is dependent on the frequency modulation bandwidth , and can be wideband ( wb ) or ultra - wideband ( uwb ) in order to achieve adequate range resolution for some applications . a typical wb bandwidth value can be , but is not limited to , a value greater than 100 mhz . a typical uwb bandwidth value can be , but is not limited to , a value greater than 1 ghz . the reflected signal from an object is received by the multi - dimensional thinned receive antenna network 621 , which outputs v signals to a receiver / down - converter 670 , where v is an integer greater than or equal to 1 . the receiver / down - converter 670 also accepts q signals from the transmit signal generator 650 , where q is an integer greater than or equal to 1 , and outputs one or a plurality of signals each comprising at least one of the frequency or phase difference between components of the transmitted signal and corresponding received reflected signal from an object as an input to a signal processor 690 . the receiver / down - converter 670 can utilize one or a plurality of down - conversion operations in generating the output difference signals . the transmit signal generator 650 can include , but is not limited to , generation of one or a plurality of fixed frequency or frequency modulated signals , intermediate frequency signal generation , local oscillator signal generation , transmit and / or receive gating signal generation , or transmit pulsing signal generation . the multi - dimensional thinned transmit antenna network 601 can include , but is not limited to , a two - dimensional array of spatially separated antennas , multiple one - dimensional arrays arranged in multiple axes , a conformal array of spatially separated antennas , a three - dimensional array of spatially separated antennas , or one or a plurality of groups of spatially separated antennas with one or a plurality of antennas simultaneously selected for transmission of one or a plurality of signals , wherein at least two adjacent antennas have a distance between them that is different than at least two adjacent antennas in the multi - dimensional thinned receive antenna network 621 . the multi - dimensional thinned receive antenna network 621 can include , but is not limited to , a two - dimensional array of spatially separated antennas , multiple one - dimensional arrays arranged in multiple axes , a conformal array of spatially separated antennas , a three - dimensional array of spatially separated antennas or one or a plurality of groups of spatially separated antennas with one or a plurality of antennas simultaneously selected for reception of one or a plurality of signals , wherein at least two adjacent antennas have a distance between them that is different than at least two adjacent antennas in the multi - dimensional thinned transmit antenna network 601 . according to aspects of the present invention , the multi - dimensional thinned transmit antenna network 601 and the multi - dimensional thinned receive antenna network 621 are utilized to synthesize an array having more elements than the sum of the elements contained in multi - dimensional thinned transmit antenna network 601 and the multi - dimensional thinned receive antenna network 621 , for the purpose of reducing the sensor hardware necessary for imaging applications . the term “ thinned ” in this application refers to the utilization of a lower number of physical transmit and receive antenna elements to synthesize an array with a larger number of synthesized or virtual elements than the sum of the physical transmit and receive elements . the term “ imaging ” in this application includes , but is not limited to , multi - dimensional object image construction , detection or identification of objects using , but not limited to , image processing or image recognition techniques , and / or object signatures such as , but not limited to , radar cross - section signatures , angular cross - section signatures , range cross - section signatures , wideband or ultra - wideband frequency response signatures , wideband or ultra - wideband frequency resonance signatures , or polarization signatures . examples of objects that may be detected using imaging techniques can include , but are not limited to , concealed weapons , guns , knives , explosives , contraband , or improvised explosive devices ( ied &# 39 ; s ). signal processor 690 may comprise a single or plurality of individual processors . signal processor 690 may perform , but is not limited to , any single or combination of the functions of signal or image processing , real or complex dft or fft signal processing , cfar threshold detection , spectral peak detection , target peak association , frequency measurement , magnitude measurement , phase measurement , magnitude scaling , phase shifting , spatial fft processing , digital beam - forming ( dbf ) processing , super - resolution processing such as , but not limited to , the use of the multiple signal classification algorithm ( music ) or the estimation of signal parameters via rotational invariance techniques ( esprit ) algorithm , neural network processing , two - dimensional image processing , three - dimensional image processing , two or three - dimensional image reconstruction processing , microwave or millimeter - wave holography processing , backward - wave reconstruction processing , wavefront reconstruction processing , synthetic aperture radar ( sar ) processing , or kirchoff diffraction integral processing . additional processing techniques used in the above - mentioned functions may include , but are not limited to , windowing , digital filtering , hilbert transform , least squares algorithms , or non - linear least squares algorithms . furthermore , one or a combination of object signature methods can be used to determine the presence or identification of potential threats , weapons or contraband such as , but not limited to , radial cross - section characteristics , angular cross - section characteristics , strength of returns , wideband or ultra - wideband frequency response characteristics , wideband or ultra - wideband frequency resonance characteristics , polarization response characteristics , spectral absorption characteristics , or image shape characteristics , and such signatures may be determined for the entire object or for one or more regions of an object or detection zones . the signal processor may include , but is not limited to , one or more digital signal processors ( dsps ), microprocessors , micro - controllers , electrical control units , or other suitable processor blocks . an imaging sensor arrangement is presented in fig1 b as another embodiment of aspects of the present invention . the arrangement in fig1 b is similar to the arrangement in fig1 a , except that instead of the multi - dimensional thinned transmit antenna network 601 and multi - dimensional thinned receive antenna network 621 , a mechanically scanned thinned transmit antenna network 601 b and mechanically scanned thinned receive antenna network 621 b are utilized . the same components are denoted by the same reference numerals , and will not be explained again . in this arrangement , the transmit signal generator 650 outputs u signals to a mechanically scanned thinned transmit antenna network 601 b for electromagnetic transmission , where u is an integer greater than or equal to 1 . a typical frequency of the transmitted signal from the mechanically scanned thinned transmit antenna network 601 b can be within , but is not limited to , the frequency range of 1 ghz - 1 thz , and can be a fixed frequency or be frequency modulated . the imaging sensor &# 39 ; s total occupied transmit spectral bandwidth is dependent on the frequency modulation bandwidth , and can be wideband ( wb ) or ultra - wideband ( uwb ) in order to achieve adequate range resolution for some applications . the reflected signal from an object is received by the mechanically scanned thinned receive antenna network 621 b , which outputs v signals to a receiver / down - converter 670 , where v is an integer greater than or equal to 1 . the receiver / down - converter 670 also accepts q signals from the transmit signal generator 650 , where q is an integer greater than or equal to 1 , and outputs one or a plurality of signals each comprising at least one of the frequency or phase difference between components of the transmitted signal and corresponding received reflected signal from an object as an input to a signal processor 690 . this arrangement utilizes a one - dimensional or multi - dimensional thinned transmit array and a one - dimensional or multi - dimensional thinned receive array , mechanically scanned or dithered in one or more directions for the purpose of sampling different spatial positions for the elements along the mechanically scanned or dithered direction . for example , not meant as a limitation , a one - dimensional azimuth line - array consisting of a transmit array with spacing d and a receive array with spacing different than d and a position where there is no overlap in the azimuth dimension between transmit and receive arrays , is mechanically scanned in the elevation dimension . through spatial sampling at various positions in elevation during the mechanical scanning in that dimension , a two dimensional set of array measurements is achieved and can be utilized for image processing . in another example , not meant as a limitation , a two - dimensional thinned transmit array and a two - dimensional thinned receive array are utilized , where one or both of the arrays utilize positional dithering in one or more directions in order to provide additional spatial sampling positions in the synthesis of a virtual array . the thinned transmit and receive arrays are utilized to reduce the hardware necessary for the imaging sensor , as is the mechanical scanning and spatial sampling along the mechanical scanning path . when the thinned array and mechanical scanning methods are utilized in combination , the sensor hardware required and / or sensor cost can be reduced for applications where the mechanical scan time is acceptable . an imaging sensor arrangement is presented in fig1 c as an alternate embodiment of aspects of the present invention . the arrangement in fig1 c is similar to the arrangement in fig1 a , except that a processor 690 a provides u output signals to a multi - dimensional thinned transmit antenna network 601 for electromagnetic transmission , and accepts v input signals from a multi - dimensional thinned receive antenna network 621 , where u and v are each integers greater than or equal to 1 . the same components are denoted by the same reference numerals , and will not be explained again . a typical frequency of the transmitted signal from the multi - dimensional thinned transmit antenna network 601 can be within , but is not limited to , the frequency range of 1 ghz - 1 thz , and can be a fixed frequency or be frequency modulated . the imaging sensor &# 39 ; s total occupied transmit spectral bandwidth is dependent on the frequency modulation bandwidth , and can be wideband ( wb ) or ultra - wideband ( uwb ) in order to achieve adequate range resolution for some applications . in addition , this arrangement can be mechanically scanned or dithered in one or more directions for the purpose of sampling different spatial positions for the elements along the mechanically scanned or dithered direction . an antenna arrangement with mechanical movement capability is presented in fig1 d as an embodiment of aspects of the present invention . the example of an antenna arrangement with mechanical movement capability shown in fig1 d is for illustration purposes and is not considered a limitation . in this arrangement , a mechanical actuator 601 d provides mechanical movement of a multi - dimensional antenna array 601 c in one or more directions . the arrangement shown in fig1 d can be utilized to provide mechanical movement for a transmit array , a receive array , or both transmit and receive arrays in one or more directions . in addition , the arrangement shown in fig1 d can be utilized to provide mechanical dithering for a transmit array , a receive array , or both transmit and receive arrays in one or more directions . furthermore , the arrangement shown in fig1 d can be utilized to provide mechanical scanning for a transmit array , a receive array , or both transmit and receive arrays in one or more directions . fig2 a illustrates the phase shift in received signals from an object 22 for spatially separated antennas 157 , 158 , 159 , 160 across an array , according to aspects of the present invention . the example of antenna spatial separation shown in fig2 a is for illustration purposes and is not considered a limitation . in this arrangement , k antennas 157 , 158 , 159 , 160 are separated from one another in the axis of object direction ( θ determination as illustrated in fig2 a . the axis of object direction determination can be , but is not limited to , the azimuth or the elevation axis . as can be seen , the received reflected signals from object 22 at angle θ from boresight will generate phase shifts δψ 1 , 2 , δψ 1 , k - 1 , δψ 1 , k between ant 1 and the other antenna elements due to the angle of the reflected rf wavefronts as illustrated . for an antenna array , these received phase shifts can be utilized to determine the direction of an object , and it is the unique spatial position of the elements in the array that allows unique phase sampling of the received signals across the array . the concept of building an array from a set of unique phase length combinations between transmit and receive elements makes it possible for a thinned transmit and thinned receive array to synthesize an array having a larger number of elements than the sum of the transmit and receive array elements , which is termed a “ virtual array ” in the present invention . through selection of various combinations of transmit and receive antenna pairs , a receive antenna array , or virtual array , is synthesized with the number of elements and spacing of elements based upon the number of unique transmit and receive pairs selected and the physical spacing between the elements of these pairs . let the physical transmit antenna elements 140 a , 140 b and receive antenna elements 145 a , 145 b , 145 c , 145 d be spaced in the axis of target direction determination as illustrated in fig2 b . let transmit antenna tx 1 be selected and receive antenna rx 1 be selected simultaneously . during the radar dwell time let the down - converted signals be digitized and stored . then let the receive element rx 2 be selected for the next radar dwell time during which the down - converted signals be digitized and stored . perform the same operations for the elements rx 3 and rx 4 . repeat the above receive antenna selection settings for the next four radar dwell times but with the transmit antenna tx 2 selected instead of the transmit antenna tx 1 . when completed , digitized down - converted signals corresponding to 8 combinations of transmit and receive antenna selections will be stored and can be used for image processing . the 8 combinations of transmit and receive antenna selections can be used to synthesize a receive virtual array 150 of 8 elements with each element having a center - to - center spacing of d as illustrated in fig2 c . as an example , not meant as a limitation , let the antenna combination of tx 1 rx 1 be utilized for the received signal reference . then the next antenna combination in the virtual array , which is tx 1 rx 2 in fig2 c , will have a relative amplitude and phase of the received signal with respect to the received signal reference that is equivalent to that of an antenna element being offset by distance d from the reference element as shown . continuing the example , the third element in the virtual array , which is tx 1 rx 3 in fig2 c , will have a relative amplitude and phase of the received signal with respect to the received signal reference that is equivalent to that of an antenna element being offset by distance 2 * d from the reference element as shown . this can be repeated for all the elements in the virtual array . one advantage of using the thinned transmit and thinned receive arrays illustrated in fig2 b is that only 6 antenna elements were needed to synthesize an 8 - element virtual array as shown in fig2 c resulting in a reduction in hardware . for larger one - dimensional or two - dimensional thinned arrays , the hardware savings can be much greater . the example illustrated in fig2 b is for a one - dimensional array where the spacing distance between the transmit and receive elements is utilized in synthesizing a one - dimensional virtual array . for multi - dimensional arrays , the spatial displacement between selected transit and receive element pairs must be used in synthesizing the virtual array element spatial positions rather than the spacing between them as for the one - dimensional array . the spatial displacement is a vector quantity which is composed of the scalar displacement values in each of the dimensions of the multi - dimensional arrays . for example , for two - dimensional transmit and receive arrays , the spatial displacement between a selected pair of transmit and receive elements would include a scalar value for the difference in x coordinates between the elements , and a scalar value for the difference in y coordinates between the elements . it is the set of unique spatial displacements between transmit and receive element pairs that is utilized to synthesize a multi - dimensional virtual array . the thinned array arrangement shown in fig2 b can be modified according to aspects of the present invention . one example of such a modification , not meant as a limitation , can be to utilize a spacing between receive antenna elements that is greater than a spacing between transmit antenna elements . as an example , not meant as a limitation , the antenna elements 140 a , 140 b in fig2 b can be utilized for a receive function , and the antenna elements 145 a , 145 b , 145 c , 145 d can be utilized for a transmit function as part of a thinned array configuration . another example of such a modification , not meant as a limitation , can be to utilize a non - uniform spacing between elements . a two - dimensional , bi - static thinned - array arrangement is presented in fig2 d as one embodiment of aspects of the present invention . in this arrangement , a k by p rx antenna array 168 is illustrated with an element - to - element spacing of d in each axis , and an m by n tx antenna array 165 is illustrated with an element - to - element spacing of k * d in the y - axis and p * d in the x - axis , where m and n are non - zero integers whose sum is greater than or equal to 3 , and k and p are non - zero integers whose sum is greater than or equal to 3 . in this arrangement , the tx antenna array 165 and rx antenna array 168 are illustrated to be oriented diagonally with respect to each another , where the rows of the tx antenna array 165 span a range in the x - axis that is non - overlapping with the span of the rows of the rx antenna array 168 in the x - axis , and the columns of the tx antenna array 165 span a range in the y - axis that is non - overlapping with the span of the columns of the rx antenna array 168 in the y - axis . whether the arrays are one - dimensional or multi - dimensional , utilizing non - overlapping arrays allows synthesis of a virtual array having an order equal to the multiplication of the orders of the smaller arrays . as an example , using this arrangement , an ( m * k ) by ( n * p ) array having m * n * k * p elements can be synthesized from the unique combinations of transmit and receive elements , resulting in a reduction in sensor hardware . as an example , not meant as a limitation , let m = n = k = p = 3 . for this exemplary arrangement , the synthesized 9 - by - 9 virtual array 210 is illustrated in fig2 e according to aspects of the present invention . in the virtual array 210 , let the antenna combination t 1 , 1 r 1 , 1 be defined as the reference element in the virtual array 210 , and let the received signal for that reference element be defined as the reference signal for the virtual array 210 . the remaining elements of the virtual array 210 have relative spatial displacements from the reference element that correspond to the sum of the relative spatial displacements of the physical transmit and receive element pair with respect to the physical t 1 , 1 r 1 , 1 element pair that represents the reference element in the virtual array 210 . since all the sums of the relative spatial displacements of the physical transmit and receive element pairs with respect to the physical t 1 , 1 r 1 , 1 element pair are unique , the corresponding relative spatial positions in the virtual array 210 with respect to the reference element are unique , resulting in a fully populated virtual array having a number of virtual elements that is far greater than the sum of the physical transmit and receive elements that was used to synthesize it . using that definition of reference element in the virtual array 210 , the antenna combinations indicated in the virtual array 210 will have a relative amplitude and phase of the corresponding received signal with respect to the defined reference signal that is equivalent to that of an antenna element having a physical position relative to the reference element as shown in fig2 e . since many image processing techniques , such as , but not limited to , digital beam - forming processing , utilize the relative phase of measurements made between elements in a two - dimensional array , the absolute phase resulting from the positional offset of the rx antenna array 168 relative to the tx antenna array 165 can be non - critical , since it is the relative distances between elements within each array that affects the synthesized virtual array configuration . however , it may be advantageous to have the tx and rx arrays close to one another to avoid other issues that may cause performance degradation , such as , but not limited to , the difference in transmit illumination angles versus reception angles , or performance of the virtual array for imaging objects that are closer than the far - field . the digitized , down - converted signals corresponding to the transmit and receive antenna combinations illustrated in the virtual array in fig2 e can be utilized for object imaging , through the use of image processing techniques well known in the art , such as , but not limited to , digital beam - forming ( dbf ) processing , super - resolution processing , such as , but not limited to , the use of the multiple signal classification algorithm ( music ), or the estimation of signal parameters via rotational invariance techniques ( esprit ) algorithm , spatial fourier transform processing , two - dimensional image processing , three - dimensional image processing , two or three - dimensional image reconstruction processing , microwave or millimeter - wave holography processing , backward - wave reconstruction processing , wavefront reconstruction processing , synthetic aperture radar ( sar ) processing , or kirchoff diffraction integral processing . the examples shown are meant as an illustration of virtual array synthesis techniques , not as a limitation . for example , not meant as a limitation , the distance between elements in each array need not be constant , but can be varied or be given multiple different values by one skilled in the art for advantage . in addition , not meant as a limitation , the spacing between receive array elements can be greater than the spacing between transmit array elements . as an example , not meant as a limitation , the antenna array 168 can be utilized for a transmit function and the antenna array 165 can be utilized for a receive function as part of a thinned array configuration . another example , not meant as a limitation , can be for a transmit array to be a one - dimensional array positioned at an angle or orthogonal to a one - dimensional receive array for the purpose of synthesizing a virtual array without departing from the spirit of the present invention . furthermore , overlapping or intertwined transmit and receive arrays may be utilized to synthesize a virtual array without departing from the spirit of the present invention . other array sizes and configurations can be implemented by one of ordinary skill in the art without departing from the spirit of the present invention . an antenna arrangement is illustrated in fig3 a as one embodiment of the multi - dimensional thinned transmit antenna network 601 , as one embodiment of the multi - dimensional thinned receive antenna network 621 , as one embodiment of the mechanically scanned thinned transmit antenna network 601 b , and as one embodiment of the mechanically scanned thinned receive antenna network 621 b according to aspects of the present invention . in this arrangement , a plurality of antennas 178 , 179 are connected to the u transmit signals and / or v receive signals as defined in fig1 a - b . the antennas can be arranged in a one - dimensional array , two - dimensional array , a conformal array , or a multi - dimensional array according to aspects of the present invention . the antennas can each have similar characteristics to one another , or can have different characteristics from one another depending on the requirements of the application . in addition , the antennas can have a polarization such as , but not limited to , linear polarization , circular polarization , or dual polarization according to aspects of the present invention . an antenna arrangement is illustrated in fig3 b as another embodiment of the multi - dimensional thinned transmit antenna network 601 , as another embodiment of the multi - dimensional thinned receive antenna network 621 , as another embodiment of the mechanically scanned thinned transmit antenna network 601 b , and as another embodiment of the mechanically scanned thinned receive antenna network 621 b according to aspects of the present invention . in this arrangement , a selector 112 selectively establishes a connection between each of a plurality of antennas 180 , 181 and a common input or output connection depending on whether the selector is used for a transmit or receive application respectively . in this way , this arrangement can be used to sequentially select between a number of antenna elements , and can be utilized to enable electrical sequencing or scanning of antenna arrays . a selector 112 can be used with each or any of the u transmit signals and / or v receive signals as defined in fig1 a - b . selector 112 can be implemented by , but is not limited to , a switch or a combination of switches , variable attenuators , or a combination of switched amplifiers and signal combiners / splitters wherein switching the gain / loss of said amplifiers is used for the selection function and said signal combiners / splitters can be implemented by , but are not limited to , wilkinson combiners / splitters . one advantage of using switched amplifiers and signal combiners / splitters as a selection means is the elimination of the signal loss associated with series selection switches . the antennas can each have similar characteristics to one another , or can have different characteristics from one another depending on the requirements of the application . the antennas can be arranged in a one - dimensional array , two - dimensional array , a conformal array , or a multi - dimensional array according to aspects of the present invention . in addition , the antennas can have a polarization such as , but not limited to , linear polarization , circular polarization , or dual polarization according to aspects of the present invention . an antenna arrangement is illustrated in fig3 c as a further embodiment of the multi - dimensional thinned transmit antenna network 601 , as a further embodiment of the multi - dimensional thinned receive antenna network 621 , as a further embodiment of the mechanically scanned thinned transmit antenna network 601 b , and as a further embodiment of the mechanically scanned thinned receive antenna network 621 b according to aspects of the present invention . in this arrangement , a plurality of selectors 114 , 116 are used to select between antennas in a plurality of antenna groups . selector 114 selectively establishes a connection between each of the plurality of antennas 183 , 185 in one antenna group and a common input or output connection depending on whether the selector is used for a transmit or receive application respectively . similarly , selector 116 selectively establishes a connection between each of the plurality of antennas 187 , 189 in another antenna group and a common input or output connection depending on whether the selector is used for a transmit or receive application respectively . in this way , this arrangement can be used to sequentially select between a number of antenna elements , and can be utilized to enable electrical sequencing or scanning of antenna arrays . selectors 114 , 116 can be used with each or any of the u transmit signals and / or v receive signals as defined in fig1 a - b . selectors 114 , 116 can be implemented by , but are not limited to , switches or a combination of switches , variable attenuators , or combinations of switched amplifiers and signal combiners / splitters . the antennas can each have similar characteristics to one another , or can have different characteristics from one another depending on the requirements of the application . the antennas can be arranged in a one - dimensional array , two - dimensional array , a conformal array , or a multi - dimensional array according to aspects of the present invention . in addition , the antennas can have a polarization such as , but not limited to , linear polarization , circular polarization , or dual polarization according to aspects of the present invention . in addition , the multi - dimensional thinned transmit antenna network 601 and the multi - dimensional thinned receive antenna network 621 can share one or a plurality of antennas according to aspects of the present invention . furthermore , the mechanically scanned thinned transmit antenna network 601 b and the mechanically scanned thinned receive antenna network 621 b can share one or a plurality of antennas according to aspects of the present invention . an imaging sensor arrangement is presented in fig4 a as one embodiment of aspects of the present invention . in this arrangement , a signal generated by the signal generator 405 is split by a signal splitter 27 , where one portion of the signal proceeds to an amplifier 30 where it is amplified prior to proceeding to a selector 501 . the selector 501 is used to selectively connect the signal to one of a plurality of an antennas 101 a , 101 b , designated by tx 1 , 1 , tx m , n , where m and n are non - zero integers whose sum is greater than or equal to 3 , for transmission in a sequential manner . a signal designated as tx_sel controls which antenna 101 a , 101 b is selected by selector 501 . a typical frequency of the transmission signal can be within , but is not limited to , the frequency range of 1 ghz - 1 thz , and can be a fixed frequency or be frequency modulated . the imaging sensor &# 39 ; s total occupied transmit spectral bandwidth is dependent on the frequency modulation bandwidth , and can be wideband ( wb ) or ultra - wideband ( uwb ) in order to achieve adequate range resolution for some applications . a typical wb bandwidth value can be , but is not limited to , a value greater than 100 mhz . a typical uwb bandwidth value can be , but is not limited to , a value greater than 1 ghz . the arrangement of the antennas 101 a , 101 b can be , but is not limited to , a one - dimensional array , a two - dimensional array , a three - dimensional array , multiple one - dimensional arrays arranged in multiple axes , or a conformal array . the reflected signal from an object is received by a plurality of receive antennas 102 a , 102 b , designated by rx 1 , 1 , rx k , p , where k and p are non - zero integers whose sum is greater than or equal to 3 . the arrangement of the receive antennas 102 a , 102 b can be , but is not limited to , a one - dimensional array , a two - dimensional array , a three - dimensional array , multiple one - dimensional arrays arranged in multiple axes , or a conformal array . a selector 502 is used to selectively connect one receive antenna at a time with the low noise amplifier 62 where the received signal is amplified prior to being split by splitter 28 . a signal designated as rx_sel controls which antenna 102 a , 102 b is selected by selector , 502 . one of the outputs from splitter 28 is input to mixer 55 , which mixes the signal with the 0 - degree phase output signal from the 90 - degree splitter 77 a , and the other output from splitter 28 is input to mixer 56 , which mixes the signal with the 90 - degree phase output signal from the 90 - degree splitter 77 a , creating in - phase ( i ) and quadrature ( q ) down - converted signals . the i and q down - converted signals are then amplified by amplifiers 65 , 66 and filtered by filters 45 , 46 prior to sampling by a / d converters 340 , 341 . the resulting sampled i and q signals are then input to signal processor 300 for signal processing . the block diagram shown in fig4 a can be modified according to aspects of the present invention . one example of such a modification , not meant as a limitation , can be to not perform complex ( i and q ) signal down - conversion or to perform it digitally in the signal processor , only having one down - converting mixer path to a single a / d converter , and to modify the block diagram accordingly . another example of such a modification , not meant as a limitation , can be for the sensor architecture to use remote signal processing , remote analog - to - digital ( a / d ) conversion , or shared processing and / or a / d conversion with another sensor or system . a further example of such a modification , not meant as a limitation , can be for the sensor architecture to replace one or both of the selectors 501 , 502 with a plurality of switched amplifiers and signal combiners , utilizing the gain / loss of the switched amplifiers to realize an antenna selection and routing function . a yet further example of such a modification , not meant as a limitation , can be for the sensor architecture to utilize any of the antenna networks illustrated in fig3 a - c for any or both of the transmit or receive selectors and antenna functions . another example of such a modification , not meant as a limitation , can be for the sensor architecture to use a plurality of simultaneously selected transmit signals and / or a plurality of simultaneously selected receive signals connected to a plurality of receiver / down - converter circuits . mixers 55 , 56 can be implemented by , but are not limited to , mixers , multipliers , or switches without changing the basic functionality of the arrangement . filters 45 , 46 can be implemented by , but are not limited to , low - pass filters or band - pass filters . signal splitters 27 , 28 can be implemented by , but are not limited to , wilkinson power dividers , passive splitters , active splitters , or microwave couplers . a variety of amplifiers , filters , or other system elements known to those skilled in the art , such as low - noise amplifiers , power amplifiers , drivers , buffers , gain blocks , gain equalizers , logarithmic amplifiers , equalizing amplifiers , switches , and the like , can be added to or deleted from the described arrangement , or the position of existing elements may be modified , without changing the basic form or spirit of the invention . signal processor 300 shown in fig4 a may comprise a single or plurality of individual processors . signal processor 300 may perform , but is not limited to , any single or combination of the functions of signal or image processing , real or complex dft or fft signal processing , cfar threshold detection , spectral peak detection , target peak association , frequency measurement , magnitude measurement , phase measurement , magnitude scaling , phase shifting , spatial fft processing , digital beam - forming ( dbf ) processing , super - resolution processing such as , but not limited to , the use of the music or esprit algorithms , neural network processing , two - dimensional image processing , three - dimensional image processing , two or three - dimensional image reconstruction processing , microwave or millimeter - wave holography processing , backward - wave reconstruction processing , wavefront reconstruction processing , synthetic aperture radar ( sar ) processing , or kirchoff diffraction integral processing . additional processing techniques that can be used with the abovementioned methods may include , but are not limited to , windowing , digital filtering , hilbert transform , least squares algorithms , or non - linear least squares algorithms . furthermore , one or a combination of object signature methods can be used to determine the presence or identification of potential threats , weapons or contraband such as , but not limited to , radial cross - section characteristics , angular cross - section characteristics , strength of returns , wideband or ultra - wideband frequency response characteristics , wideband or ultra - wideband frequency resonance characteristics , polarization response characteristics , or image shape characteristics , and such signatures may be determined for the entire object or for one or more regions of an object . in addition , the object signature methods can utilize complex signal attributes such as amplitude and / or phase . the signal processor may include , but is not limited to , one or more digital signal processors ( dsps ), microprocessors , micro - controllers , electrical control units , or other suitable processor blocks . an imaging sensor arrangement is presented in fig4 b as another embodiment of the present invention . the arrangement in fig4 b is similar to the arrangement in fig4 a , except for the addition of a transmission pulsing switch 8 , a receiver gating switch 9 , and the omission of amplifiers 62 , 30 for clarity . the same components are denoted by the same reference numerals , and will not be explained again . in this configuration , the tx pulse control signal is used to control the operation of a transmission pulsing switch 8 , pulse modulating the output signal . the rx gate control signal is used to control the operation of the receiver gating switch 9 , which only allows received signals to pass through for down - conversion during specified time periods dictated by the rx gate control signal . through the use of this arrangement of transmit pulsing and receive signal gating , the performance of the sensor can be improved as illustrated in the signal timing example in fig5 . one example of pulsed transmit and gated receiver signal timing for an imaging sensor is shown in fig5 in accordance with aspects of the present invention . the timing diagram shown in fig5 is meant as an example to illustrate the operation and potential benefits of pulsed transmission and gated reception , and is not meant as a limitation . in this example , during the time period τ 1 , the antenna pair consisting of transmit antenna tx 1 , 1 and receive antenna rx 1 , 1 is selected by use of the signals tx_sel and rx_sel , followed by a pulse of the transmit signal by use of the tx pulse control signal , and a subsequent gating of the receiver after some time delay by use of the rx gate control signal . the gating “ on ” time of the receiver corresponding to the “ on ” state of the rx gate control signal as shown in fig5 can be matched to the transmit pulse “ on ” time corresponding to the “ on ” state of the tx pulse control signal as shown in fig5 , and is configured that way for this example . also shown in fig5 is an example of the output envelope of a typical matched filter that could be utilized for filters 45 , 46 in fig4 b in the receiver , and i and q a / d sampling at the peak of the matched filter output envelope that could be utilized by a / d converters 340 , 341 in fig4 b for optimal signal - to - noise - ratio performance . the pulsing of the transmit signal and gating of the received signal allows the sensor to selectively receive object returns in a range zone between a specific minimum range ( rmin ) and maximum range ( rmax ), related to the time delay between transmit pulse and receive gate and the time durations of each , and to reject object returns that occur at ranges less than rmin and ranges greater than rmax . this operation allows rejection of signals such as , but not limited to , signals coupling directly from the transmitter to the receiver , radome returns , near - field clutter , and far - field clutter . in addition , this operation can give the ability to design spatial selectivity to the range of detection for a particular application or scenario , and can be used to eliminate multi - path reflections from near - field objects . a variety of modifications can be made to the sensor timing shown in fig5 by those skilled in the art , such as , but not limited to , the order of antenna pair selection or the number of transmit pulses and receive gates per antenna pair dwell time without changing the basic form or spirit of the invention . an imaging sensor arrangement is presented in fig6 a as a further embodiment of aspects of the present invention . the arrangement in fig6 a is similar to the arrangement in fig4 a , except for the replacement of signal generator 405 with tx & amp ; lo signal generator 407 , the addition of an if frequency reference 70 , and modification of the down - conversion circuitry used to create in - phase ( i ) and quadrature ( q ) signals prior to signal a / d conversion . the same components are denoted by the same reference numerals , and will not be explained again . in this arrangement , one signal generated by the tx & amp ; lo signal generator 407 designated by tx is fed to an amplifier 30 where it is amplified prior to transmission . the other signal generated by the tx & amp ; lo signal generator 407 , designated by lo , has a frequency which is offset from the frequency of the tx signal by an amount equal to the frequency of if frequency reference 70 , and is fed to the mixer 55 where it is mixed with the received signal output from amplifier 62 ′. a typical frequency used for the if frequency reference 70 can be within , but is not limited to , the frequency range of 1 mhz - 500 mhz . the output signal from mixer 55 is then input to filter 39 , and the output signal from filter 39 is split and input to mixers 85 and 86 . one of the outputs from filter 39 is input to mixer 85 , which mixes the signal with the 90 - degree phase output signal from 90 - degree splitter 77 b , and the other output from filter 39 is input to mixer 86 , which mixes the signal with the 0 - degree phase output signal from 90 - degree splitter 77 b , creating in - phase ( i ) and quadrature ( q ) down - converted signals . the i and q down - converted signals are then filtered by filters 36 , 35 , respectively , prior to sampling by a / d converters 340 , 350 . the resulting sampled i and q signals are then input to signal processor 300 . through the use of this arrangement of intermediate frequency conversion , the noise associated with the down - conversion process can be improved . an imaging sensor arrangement is presented in fig6 b as a yet further embodiment of aspects of the present invention . the arrangement in fig6 b is similar to the arrangement in fig4 a , except for the replacement of selectors 501 , 502 and associated antennas with polarization selectors 510 , 520 , antenna selectors 503 , 504 , 505 , 506 and associated antennas 103 a , 103 b , 104 a , 104 b , 105 a , 105 b , 106 a , 106 b , and the omission of amplifiers 62 , for clarity . the same components are denoted by the same reference numerals , and will not be explained again . in this arrangement , one signal from splitter 27 is input to a polarization selector 510 , which outputs the signal to either selector 503 or 504 according to a control signal designated as tx_pol_sel . the selector 503 is used to selectively connect a transmission signal to one of a plurality of antennas 103 a , 103 b which have a certain polarization , designated by tx - p 1 1 , 1 , tx - p 1 m , n , where m and n are non - zero integers whose sum is greater than or equal to 3 , for transmission in a sequential manner . the selector 504 is used to selectively connect a transmission signal to one of a plurality of an antennas 104 a , 104 b which have a polarization different than that of antennas 103 a , 103 b , designated by tx - p 2 1 , 1 , tx - p 2 m , n , where m and n are non - zero integers whose sum is greater than or equal to 3 , for transmission in a sequential manner . a typical frequency of the transmission signal can be within , but is not limited to , the frequency range of 1 ghz - 1 thz , and can be a fixed frequency or be frequency modulated . the imaging sensor &# 39 ; s total occupied transmit spectral bandwidth is dependent on the frequency modulation bandwidth , and can be wideband ( wb ) or ultra - wideband ( uwb ) in order to achieve adequate range resolution for some applications . a typical wb bandwidth value can be , but is not limited to , a value greater than 100 mhz . a typical uwb bandwidth value can be , but is not limited to , a value greater than 1 ghz . the arrangement of the antennas 103 a , 103 b can be , but is not limited to , a one - dimensional array , a two - dimensional array , a three - dimensional array , multiple one - dimensional arrays arranged in multiple axes , or a conformal array , and can have a polarization that is , but not limited to , vertical , horizontal , or circular . the arrangement of the antennas 104 a , 104 b can be , but is not limited to , a one - dimensional array , a two - dimensional array , a three - dimensional array , multiple one - dimensional arrays arranged in multiple axes , or a conformal array , and can have a polarization that is , but not limited to , linear , vertical , horizontal , or circular . the reflected signal from an object is received by a plurality of receive antennas 105 a , 105 b , designated by rx - p 1 1 , 1 , rx - p 1 k , p , where k and p are non - zero integers whose sum is greater than or equal to 3 , and a plurality of receive antennas 106 a , 106 b , designated by rx - p 2 1 , 1 , rx - p 2 k , p , where k and p are non - zero integers whose sum is greater than or equal to 3 . antennas 105 a , 105 b have the same polarization as antennas 103 a , 103 b , and antennas 106 a , 106 b have the same polarization as antennas 104 a , 104 b . the arrangement of the antennas 105 a , 105 b can be , but is not limited to , a one - dimensional array , a two - dimensional array , a three - dimensional array , multiple one - dimensional arrays arranged in multiple axes , or a conformal array , and can have a polarization that is , but not limited to , linear , vertical , horizontal , or circular . the arrangement of the antennas 106 a , 106 b can be , but is not limited to , a one - dimensional array , a two - dimensional array , a three - dimensional array , multiple one - dimensional arrays arranged in multiple axes , or a conformal array , and can have a polarization that is , but not limited to , vertical , horizontal , or circular . a selector 505 is used to selectively connect one receive antenna 105 a , 105 b at a time with one input of polarization selector 520 . a selector 506 is used to selectively connect one receive antenna 106 a , 106 b at a time with the other input of polarization selector 520 . the polarization selector 520 is used , to selectively connect one receiver antenna of a certain polarization and a certain spatial position at a time with the receiver / down - converter circuitry for the sensor in a sequential manner . a signal designated as rx_pol_sel controls which selector 505 , 506 is selected by polarization selector 520 . through the use of this arrangement , the response of objects to signals having multiple polarizations can be sampled and utilized for image processing and / or object identification . the block diagram shown in fig6 b can be modified according to aspects of the present invention . one example of such a modification , not meant as a limitation , can be for the sensor architecture to replace any or all of the selectors 503 , 504 , 505 , 506 , 510 , 520 with a plurality of switched amplifiers and signal combiners , utilizing the gain / loss of the switched amplifiers to realize an antenna selection and routing function . another example of such a modification , not meant as a limitation , can be for the sensor architecture to utilize any of the antenna networks illustrated in fig3 a - c for any or both of the transmit or receive selectors and antenna functions . a further example of such a modification , not meant as a limitation , can be for the sensor architecture to use a plurality of simultaneously selected transmit signals and / or a plurality of simultaneously selected receive signals connected to a plurality of receiver / down - converters . a yet further example of such a modification , not meant as a limitation , can be for the sensor architecture to utilize antenna elements that are dual - polarized , such that selectors 503 , 504 feed only one set of dual - polarized antenna elements , and selectors 505 , 506 feed only one set of dual - polarized antenna elements . another example of such a modification , not meant as a limitation , can be for the sensor architecture to share one or a plurality of antennas between transmit and receive functions . a further example of such a modification , not meant as a limitation , can be for the sensor architecture to utilize a two - stage down - conversion structure such as illustrated in fig6 a . a variety of amplifiers , filters , or other system elements known to those skilled in the art , such as low - noise amplifiers , power amplifiers , drivers , buffers , gain blocks , gain equalizers , logarithmic amplifiers , equalizing amplifiers , switches , and the like , can be added to or deleted from the described arrangement , or the position of existing elements may be modified , without changing the basic form or spirit of the invention . one example of a two - dimensional , dual - polarized thinned - array is illustrated in fig6 c according to aspects of the present invention . the configuration shown is meant as an illustration of a dual - polarized thinned - array , not as a limitation . in this configuration , a tx arrangement 193 , containing a transmit antenna array having a polarization p 1 and a transmit antenna array having a polarization p 2 , and an rx arrangement 197 , containing a receive antenna array having a polarization . p 1 and a receive antenna array having a polarization p 2 , are positioned diagonally . the polarization p 1 can be , but is not limited to , linear , vertical , horizontal , or circular . the polarization p 2 can be , but is not limited to , linear , vertical , horizontal , or circular . in this arrangement , the tx arrangement 193 and rx arrangement 197 are illustrated to be diagonal to one another , where the rows of the tx arrangement 193 span a range in the x - axis that is non - overlapping with the span of the rows of the rx arrangement 197 in the x - axis , and the columns of the tx arrangement 193 span a range in the y - axis that is non - overlapping with the span of the columns of the rx arrangement 197 in the y - axis . the 3 by 3 element p 1 polarized transmit and receive arrays can synthesize a 9 by 9 p 1 polarized virtual array using the method described in fig2 d & amp ; 2e . similarly , the 3 by 3 element p 2 polarized transmit and receive arrays can synthesize a 9 by 9 p 2 polarized virtual array using the method described in fig2 d & amp ; 2e . utilizing this configuration , each virtual array can be processed separately to generate images of object responses to each of the polarizations . the digitized , down - converted signals can be utilized for object imaging , through the use of image processing techniques well known in the art such as , but not limited to , digital beam - forming ( dbf ) processing , super - resolution processing such as , but not limited to , the use of the multiple signal classification algorithm ( music ) or the estimation of signal parameters via rotational invariance techniques ( esprit ) algorithm , spatial fourier transform processing , two - dimensional image processing , three - dimensional image processing , two or three - dimensional image reconstruction processing , microwave or millimeter - wave holography processing , backward - wave reconstruction processing , wavefront reconstruction processing , synthetic aperture radar ( sar ) processing , or kirchoff diffraction integral processing . the example shown is meant as an illustration of a dual - polarized virtual array synthesis technique , not as a limitation . for example , not meant as a limitation , the distance between elements in each array need not be constant , but can be varied or be given multiple different values by one skilled in the art for advantage . other array sizes and configurations can be implemented by one of ordinary skill in the art without departing from the spirit of the present invention . according to one aspect of the present invention , the use of multiple selectable polarizations can be used for generation of object polarization signatures and utilized for object detection and / or identification purposes . according to another aspect of the present invention , the angular resolution provided by imaging techniques such as , but not limited to , digital beam - forming can provide spatial selectivity for object signatures as well as spatial rejection of other object signatures or clutter signals for improved performance and object identification capability . the object signature methods that can be used with the spatial selectivity methods described to determine the presence or identification of potential threats , weapons or contraband can include , but are not limited to , strength of returns , wideband or ultra - wideband frequency response characteristics , wideband or ultra - wideband frequency resonance characteristics , polarization response characteristics , spectral absorption characteristics , or image shape characteristics . in addition , a combination of object imaging and spatially isolated regional scanning for weapons signatures can be utilized in order to provide additional capability or performance . furthermore , the beam - width or area of the spatially isolated regions utilized for detection of weapons signatures can be different than the resolution utilized for object imaging , and the techniques utilized for object imaging and scanning of spatially isolated regions need not be the same . for example , not meant as a limitation , a high resolution object image can be generated utilizing a two - dimensional image reconstruction technique for the purpose of providing image characteristics for image processing , while a lower resolution spatially isolated beam could be generated by a digital beam - forming process and scanned across areas of the object in order to utilize weapons signature techniques for detection and / or identification of concealed weapons . additionally , the resolution of the image and / or the size of the spatially isolated region can be varied adaptively . furthermore , the area of the spatially isolated region can encompass a part of an object in order to isolate weapons signatures from other parts of the object , or can encompass the entire object in order to isolate weapons signatures from the surroundings of the object . in accordance with one aspect of the present invention , the millimeter - wave imaging techniques and / or weapons signature techniques can be combined with an image generated by another sensor such as , but not limited to , an optical wavelength camera . for example , not meant as a limitation , an optical wavelength image of an object can be enhanced by the addition of indicators added to the optical image at locations where threats or contraband is suspected to be . the indicators can include , but are not limited to , colored shapes where the color indicates threat or confidence level and / or the shape indicates type of threat , text indicating a threat type with an arrow pointing to a location on the object in the optical image , or any combination of these . one benefit of this arrangement is that the optical image can be utilized additionally for identification of the object such as , but not limited to , the identification of a person carrying the concealed threat . another benefit of this arrangement is that if the millimeter - wave image is not shown to the operator , then privacy concerns for the individual being scanned may be avoided . indicator types other than the ones presented can be utilized without departing from the spirit of the present invention . another aspect of the present invention is the utilization of the electrically sequenced or scanned virtual array arrangement for through - wall imaging . for example , not meant as a limitation , the electrically sequenced or scanned virtual array can be utilized to provide a 2d or 3d image of the interior of a room from behind a door or wall of the room . the digital lensing and image reconstruction methods can be adapted to additionally compensate for the characteristics of the medium of the wall or door though which the electro - magnetic waves propagate . one embodiment of signal generator 405 is shown in fig7 a . in this configuration , a frequency controller 410 controls the frequency of a transmit voltage - controlled - oscillator 90 . the embodiment shown in fig7 a represents an open - loop transmit signal generator configuration . the configuration shown is meant as an illustration of a transmit signal generation technique , not as a limitation . other open - loop signal generation techniques can be implemented by one of ordinary skill in the art without departing from the spirit of the present invention . another embodiment of signal generator 405 is shown in fig7 b . in this configuration , the output of a frequency controller 430 controls the frequency of a transmit voltage - controlled - oscillator 90 . the output signal from the transmit voltage - controlled - oscillator 90 is split by signal splitter 411 , where one portion of the signal is output , and the other portion of the signal is fed back to the frequency controller 430 , where it is used to monitor and adjust the frequency of the transmit voltage - controlled - oscillator 90 , forming a closed - loop transmit signal generator . a further embodiment of signal generator 405 is shown in fig7 c . in this configuration , the output of a phase - locked loop ( pll ) 465 is filtered by loop filter 421 and used to control the frequency of a transmit voltage - controlled - oscillator ( tx vco ) 90 . the pll 465 can be implemented by , but is not limited to , a phase detector , phase - frequency detector , integer - n pll , or fractional - n pll . the output from tx vco 90 is split by splitter 411 , where one portion of the signal is output and the other portion of the signal is frequency divided by n by divider 417 , where n is an integer greater than 1 , and fed back to the pll 465 forming a closed - loop transmit signal generator . a frequency reference 444 is input to the pll 465 , and the pll 465 can be controlled by an external control signal if required . a yet further embodiment of signal generator 405 is shown in fig7 d . in this configuration , the output of a pll 465 is filtered by loop filter 421 and used to control the frequency of a transmit voltage - controlled - oscillator ( tx vco ) 90 . the output from tx vco 90 is split by splitter 411 , where one portion of the signal is output and the other portion of the signal is frequency divided by n by divider 417 , where n is an integer greater than 1 , and fed back to the pll 465 forming a closed - loop transmit signal generator . a direct - digital - synthesizer ( dds ) 482 is input as a frequency reference to the pll 465 . through the control of the output frequency of the dds 482 , the frequency of the tx vco 90 can be controlled . another embodiment of signal generator 405 is shown in fig7 e . the arrangement in fig7 e is similar to the arrangement in fig7 c , except for the use of a frequency multiplier 573 at the output of transmit voltage - controlled - oscillator ( tx vco ) 90 . the same components are denoted by the same reference numerals , and will not be explained again . the use of a frequency multiplier 573 allows the frequency of tx vco 90 to be lower than the output transmit frequency of the signal generator 405 . the arrangement shown in fig7 e can be modified according to aspects of the present invention . one example of such a modification , not meant as a limitation , can be for the frequency reference 444 to be replaced by a dds 482 , such as described in the arrangement of fig7 d . other modifications can be implemented by one of ordinary skill in the art without departing from the spirit of the present invention . one embodiment of tx & amp ; lo signal generator 407 is shown in fig7 f . in this configuration , the output of a pll 465 is filtered by loop filter 421 and used to control the frequency of a transmit voltage - controlled - oscillator ( tx vco ) 90 . the output from tx vco 90 is split by splitter 411 , where one portion of the signal is fed to splitter 412 , while the other portion of the signal is frequency divided by n by divider 417 , where n is an integer greater than 1 , and fed back to the pll 465 forming a closed - loop transmit signal generator . a direct - digital - synthesizer ( dds ) 482 is input as a frequency reference to the pll 465 . through the control of the output frequency of the dds 482 , the frequency of the tx vco 90 frequency can be controlled . the output from splitter 411 is split by splitter 412 , where one portion of the signal is output as the signal designated by tx , while the other portion of the signal is fed to mixer 59 , where it is mixed with an if frequency reference signal . the output from mixer 59 is filtered by filter 426 and output as the signal designated by lo . another embodiment of tx & amp ; lo signal generator 407 is shown in fig7 g . in this configuration , the output of a pll 465 is filtered by loop filter 421 and used to control the frequency of a transmit voltage - controlled - oscillator ( tx vco ) 90 . the output from tx vco 90 is split by splitter 411 , where one portion of the signal is output as the signal designated by tx , and the other portion of the signal is frequency divided by n by divider 417 , where n is an integer greater than 1 , and fed back to the pll 465 forming a closed - loop transmit signal generator . a direct - digital - synthesizer ( dds ) 482 is input as a frequency reference to the pll 465 . an if frequency reference is input to the dds 482 as a frequency reference for the dds . a second pll 465 b is filtered by loop filter 421 b and used to control the frequency of a local oscillator voltage - controlled - oscillator ( lo vco ) 90 b . the output from lo vco 90 b is split by splitter 411 b , where one portion of the signal is output as the signal designated by lo , while the other portion of the signal is frequency divided by n by divider 417 b , where n is an integer greater than 1 , and fed back to the pll 465 b forming a closed - loop local oscillator signal generator . a direct - digital - synthesizer ( dds ) 482 b is input as a frequency reference to the pll 465 b . an if frequency reference is input to the dds 482 b as a frequency reference for the dds . the dds 482 b is programmed to have a frequency offset from the dds 482 such that the tx output signal and lo output signal are offset in frequency an amount equal to the if frequency reference frequency . the embodiments shown in fig7 a - g represent examples of signal generation configurations . the configurations shown are meant as an illustration of signal generation techniques , not as a limitation . other signal generation techniques can be implemented by one of ordinary skill in the art without departing from the spirit of the present invention . fig8 a illustrates a linearly frequency - modulated waveform for use in the transmit signal generator 650 , signal generator 405 or tx & amp ; lo signal generator 407 according to aspects of the present invention . this waveform shows a linearly modulated frequency with a period equal to tp . this waveform shown is an example of linear frequency modulation and is not meant as a restriction . the waveform can also comprise , but is not limited to , a repeating pattern of linearly increasing frequency ramps , a repeating pattern of linearly decreasing frequency ramps , or alternating periods of linearly increasing and decreasing frequency ramps . also , periods where the frequency modulation is stopped may be inserted into the abovementioned patterns . furthermore , in order to achieve adequate range resolution for some applications , the total frequency modulation bandwidth , defined as | f 2 − f 1 | in fig8 a , can be wideband ( wb ) or ultra - wideband ( uwb ). using the frequency modulation waveform described in fig8 a , object range information may be calculated from the down - converted signals of the architectures shown in fig1 a - c , fig4 a - b and fig6 a - b in the following way . peaks in the down - converted signal spectrum represent returns from objects within the field of view . the frequency of the peaks is proportional to object range and is used to calculate object range . as an example , not meant as a limitation , let the arrangement of fig4 a utilize a linearly increasing frequency modulation as shown in fig8 a . let the down - converted signal be sampled & amp ; measured during each coherent measurement interval t p . under these conditions , object range can be calculated by the following equation : r = c · t p 2 · ( f 2 - f 1 ) · ( f b ) ( 1 ) where r is the calculated object range , c is the speed of light in a vacuum , f 2 is the maximum frequency of the linear modulation , f 1 is the minimum frequency of the linear modulation , and f b is the beat frequency in the down - converted signal corresponding to measurements during the coherent measurement interval t p . the object range data calculated using this method can be utilized to generate three - dimensional object images through use with methods well known in the art , such as , but not limited to , digital beam - forming angular processing or super - resolution angular processing . another approach to calculating object range data is to use an inverse fast fourier transform ( ifft ) or inverse discrete fourier transform ( idft ), after sampling the down - converted signal , to build an object return range profile . the peaks in the ifft or idft profile represent object returns with range proportional to the peak &# 39 ; s associated time bin . the object range data calculated using this method can be utilized to generate three - dimensional object images through use with methods well known in the art , such as , but not limited to , digital beam - forming angular processing or super - resolution angular processing , which will be described in more detail in the following text . fig8 b illustrates a stepped frequency modulation waveform for use in the transmit signal generator 650 , signal generator 405 or tx & amp ; lo signal generator 407 according to aspects of the present invention . this waveform shows a linearly stepped frequency pattern with a frequency increasing step sequence period equal to t p . this waveform shown is an example of linearly stepped frequency modulation and is not meant as a restriction . a typical value of δf s can be within , but is not limited to , the range of 100 khz - 100 mhz . a typical value of t s can be within , but is not limited to , the range of 500 nanoseconds ( ns )- 20 microseconds ( μs ). the waveform can also comprise , but is not limited to , a repeating pattern of linearly increasing frequency steps , a repeating pattern of linearly decreasing frequency steps , or alternating periods of linearly increasing and decreasing frequency step patterns . also , periods where the stepped frequency modulation pattern is stopped may be inserted into the abovementioned patterns . in addition , the value of t s may be varied or dithered , or the linearity of the frequency steps with respect to time may be varied by one skilled in the art without departing from the spirit of the present invention . furthermore , in order to achieve adequate range resolution for some applications , the total frequency modulation bandwidth , defined as | f 2 − f 1 | in fig8 b can be wideband ( wb ) or ultra - wideband ( uwb ). using the frequency modulation waveform described in fig8 b , object range information may be calculated from the down - converted signals of the architectures shown in fig1 a - c , fig4 a - b and fig6 a - b in the following way . peaks in the down - converted signal spectrum represent returns from objects within the field of view . the frequency of the peaks is proportional to object range and is used to calculate object range . as an example , not meant as a limitation , let the arrangement of fig4 a utilize a linearly increasing frequency step sequence as shown in fig8 b . let the down - converted signal be sampled & amp ; measured during each coherent measurement interval t p , which for this example also corresponds to the frequency - modulated step sequence period . under these conditions , object range can be calculated by the following equation : r = c · t s 2 · δ f s · ( f b ) ( 2 ) where r is the calculated object range , c is the speed of light in a vacuum , t s is dwell time of each frequency step , δf s is the difference between adjacent frequency step values in the linear step sequence , and f b is the beat frequency in the down - converted signal corresponding to measurements during the frequency - stepped sequence period t p . the object range data calculated using this method can be utilized to generate three - dimensional object images through use with methods well known in the art , such as , but not limited to , digital beam - forming angular processing or super - resolution angular processing . another approach to calculating object range data is to use an inverse fast fourier transform ( ifft ) or inverse discrete fourier transform ( idft ), after sampling the down - converted signal , to build an object return range profile . the peaks in the ifft or idft profile represent object returns with range proportional to the peak &# 39 ; s associated time bin . the object range data calculated using this method can be utilized to generate three - dimensional object images through use with methods well known in the art , such as , but not limited to , digital beam - forming angular processing or super - resolution angular processing which will be described in more detail in the following text . fig8 c illustrates a multiple - slope , linearly frequency - modulated waveform for use in the transmit signal generator 650 , signal generator 405 or tx & amp ; lo signal generator 407 according to aspects of the present invention . this waveform shows a linear up - slope frequency modulation during a first time period tp , and a linear down - slope frequency modulation during a second time period tp . this waveform shown is an example of frequency modulation , and is not meant as a restriction . a typical value of tp can be within , but is not limited to , the range of 100 microseconds ( μs )- 100 milliseconds ( ms ). the frequency modulation can also consist of , but is not limited to , a repeating pattern of linear up - slope modulation , a repeating pattern of linear down - slope modulation , an alternating pattern of up - and down - slope modulation , a monotonically increasing frequency over a time period , a monotonically decreasing frequency over a time period , or an alternating pattern of monotonically increasing and decreasing frequency modulation . in addition , one or more blanking periods where the frequency is constant may be inserted within or between the up or down slope periods . furthermore , in order to achieve adequate range resolution for some applications , the total frequency modulation bandwidth , defined as | f 2 − f 1 | in fig8 c can be wideband ( wb ) or ultra - wideband ( uwb ). using the frequency modulation waveform described in fig8 c , object information may be calculated from the down - converted signals of the architectures shown in fig1 a - c , fig4 a - b and fig6 a - b in the following way . peaks in the down - converted signal spectrum represent object returns . the frequency of the peaks is proportional to object range , and is used to calculate object range . as an example , not meant as a limitation , let the sensor arrangement of fig4 a utilize a frequency modulation according to fig8 c . let the down - converted signal be sampled & amp ; measured during each coherent measurement interval t p , which also corresponds in this example to the frequency up - ramp and down - ramp periods . under these conditions , object range can be calculated by the following equation : r = c · t p 4 · δ f bw · ( f u + f d ) ( 3 ) where r is the calculated object range , c is the speed of light in a vacuum , t p is the period of the up - ramp or down - ramp of the frequency modulation , δf bw is the total frequency excursion during the coherent measurement interval t p which is equal to | f 2 − f 1 | in fig8 c , and f u and f d are the beat frequencies in the down - converted signal corresponding to measurements during the frequency up - ramp and frequency down - ramp periods tp respectively . the doppler frequency shift of the frequency peaks measured across the down - converted signal spectrum is used to calculate object relative velocity . as an example , not meant as a limitation , let the sensor arrangement of fig4 a utilize a frequency modulation according to fig8 c . let the down - converted signal be sampled and measured during each coherent measurement interval t p , which also corresponds in this example to the frequency up - ramp and down - ramp periods . under these conditions , object relative velocity can be calculated by the following equation : v = c · ( f d - f u ) 4 · f 0 ( 4 ) where v is the calculated object relative velocity defined as positive for an approaching target , c is the speed of light in a vacuum , f u and f d are the beat frequencies in the down - converted signal corresponding to measurements during the frequency up - ramp and frequency down - ramp modulation intervals t p respectively , and f 0 is the average frequency of the transmitted signal during a coherent measurement period t p . fig8 d illustrates a stepped frequency modulation waveform for use in the transmit signal generator 650 , signal generator 405 or tx & amp ; lo signal generator 407 according to aspects of the present invention . this waveform shows a linearly stepped frequency pattern with a frequency increasing step sequence period and decreasing step sequence period each equal to tp . this waveform shown is an example of linearly stepped frequency modulation and is not meant as a restriction . a typical value of δf s can be within , but is not limited to , the range of 100 khz - 100 mhz . a typical value of t s can be within , but is not limited to , the range of 500 nanoseconds ( ns )- 20 microseconds ( μs ). the waveform can also comprise , but is not limited to , a repeating pattern of linearly increasing frequency steps , a repeating pattern of linearly decreasing frequency steps , or alternating periods of linearly increasing and decreasing frequency step patterns . also , periods where the stepped frequency modulation pattern is stopped may be inserted into the abovementioned patterns . in addition , the value of t s may be varied or dithered , or the linearity of the frequency steps with respect to time may be varied by one skilled in the art without departing from the spirit of the present invention . furthermore , in order to achieve adequate range resolution for some applications , the total frequency modulation bandwidth , defined as | f 2 − f 1 | in fig8 d can be wideband ( wb ) or ultra - wideband ( uwb ). using the frequency modulation waveform described in fig8 d , object information may be calculated from the down - converted signals of the architectures shown in fig1 a - c , fig4 a - b and fig6 a - b in the following way . peaks in the down - converted signal spectrum represent object returns . the frequency of the peaks is proportional to object range and is used to calculate object range . as an example , not meant as a limitation , let the sensor arrangement of fig4 a utilize a linearly increasing frequency step sequence and linearly decreasing frequency step sequence as shown in fig8 d . let the down - converted signal be sampled and measured during each coherent measurement interval t p , which for this example also corresponds to the frequency increasing step sequence period and decreasing step sequence period . under these conditions , object range can be calculated by the following equation : r = c · t s 4 · δ f s · ( f u + f d ) ( 5 ) where r is the calculated object range , c is the speed of light in a vacuum , t s is dwell time of each frequency step , δf s is the difference between adjacent frequency step values in the linear step sequence , and f u and f d are the beat frequencies in the down - converted signal corresponding to measurements during the frequency increasing sequence and frequency decreasing sequence periods t p , respectively . the doppler frequency shift of the frequency peaks measured across the down - converted signal spectrum is used to calculate object relative velocity . as an example , not meant as a limitation , let the sensor arrangement of fig4 a utilize a linearly increasing frequency step sequence and linearly decreasing frequency step sequence as shown in fig8 d . let the down - converted signal be sampled once per frequency step in each sequence , and measured during each coherent measurement interval t p , which for this example also corresponds to the frequency increasing step sequence period and decreasing step sequence period . under these conditions , object relative velocity can be calculated by the following equation : v = c 2 · ( f 1 + f 2 ) · ( f d - f u ) ( 6 ) where v is the calculated object relative velocity defined as positive for an approaching target , c is the speed of light in a vacuum , f 1 and f 2 are the minimum and maximum frequency steps in the linear sequence during a coherent measurement period t p , and f u and f d are the beat frequencies in the digitized down - converted signal corresponding to the measurements during the frequency up - step sequence and down - step sequence periods t p , respectively . object velocity information can be utilized in a variety of applications according to aspects of the present invention . one application , not meant as a limitation , is to utilize the velocity information of an object in conjunction with its positional information to determine the threat potential for purposes such as , but not limited to , deployment of countermeasures . another application , not meant as a limitation , is to determine if there is object motion as part of a security system . an alternate way to utilize the frequency - modulated data is with three - dimensional image reconstruction techniques well known in the art . according to these techniques , the data sampled at different frequencies is utilized to reconstruct a three - dimensional rendered image using an algorithm such as , but not limited to , a backward - wave reconstruction technique . another way to utilize the frequency - modulated data is with two - dimensional image reconstruction techniques well known in the art for each frequency step in the sequence , then average or combine the two - dimensional rendered images to improve the image characteristics such as , but not limited to , reduction of speckle or noise in the image . fig9 a illustrates an example of timing of thinned - array antenna selection for use with a fixed transmission frequency according to aspects of the present invention . according to this example , unique combinations of transmit and receive antennas in the thinned - array architecture are each selected for a period of time designated by t dw , during which the down - converted signal is sampled and stored . in this example , not meant as a limitation , the transmit array consists of m by n elements , and the receive array consists of k by p elements , where m and n are non - zero integers whose sum is greater than or equal to 3 , and k and p are non - zero integers whose sum is greater than or equal to 3 . a typical value of t dw can be within , but is not limited to , the range of 100 nanoseconds ( ns ) 100 microseconds ( μs ). after all unique combinations of transmit and receive elements are sequenced through , the sequence is repeated for the duration of the coherent processing time period t p . the stored digital samples of the down - converted signals during this period tp are grouped separately for each unique combination of transmit and receive antennas to create a sequence of time - ordered samples of the down - converted signals for each synthesized array element spatial position , and will be utilized for image processing . alternately , a sequence of samples can be taken for each unique antenna combination period of time t dw before switching to the next unique antenna combination without departing from the present invention . fig9 b illustrates another example of timing of thinned - array antenna selection for use with a linearly frequency - modulated waveform according to aspects of the present invention . according to this example , unique combinations of transmit and receive antennas in the thinned array architecture are each selected for a period of time denoted t dw , during which the down - converted signal is sampled and stored . in this example , not meant as a limitation , the transmit array consists of m by n elements , and the receive array consists of k by p elements , where m and n are non - zero integers whose sum is greater than or equal to 3 , and k and p are non - zero integers whose sum is greater than or equal to 3 . a typical value of t dw can be within , but is not limited to , the range of 100 nanoseconds ( ns )- 100 microseconds ( is ). after all unique combinations of transmit and receive elements are sequenced through , the sequence is repeated for the duration of the coherent processing time period t p of the linearly frequency - modulated waveform . the stored digital samples of the down - converted signals during this period t p are grouped separately for each unique combination of transmit and receive antennas to create a sequence of time ordered samples of the down - converted signals for each synthesized array element spatial position , and will be utilized for image processing . alternately , the entire linear frequency modulation can be performed and a sequence of samples can be taken for each unique antenna combination period of time t dw and the linear frequency modulation repeated for the next unique antenna combination without departing from the present invention . fig9 c illustrates a further example of timing of thinned - array antenna selection for use with a linearly frequency stepped modulation waveform according to aspects of the present invention . according to this example , unique combinations of transmit and receive antennas in the thinned array architecture are each selected for a period of time denoted t dw , during which the down - converted signal is sampled and stored . in this example , not meant as a limitation , the transmit array consists of m by n elements , and the receive array consists of k by p elements , where m and n are non - zero integers whose sum is greater than or equal to 3 , and k and p are non - zero integers whose sum is greater than or equal to 3 . a typical value of t dw can be within , but is not limited to , the range of 100 nanoseconds ( ns )- 100 microseconds ( μs ). after all unique combinations of transmit and receive elements are sequenced through , the sequence is repeated for the duration of the coherent processing time period t p of the stepped frequency modulation waveform . the stored digital samples of the down - converted signals during this period t p are grouped separately for each unique combination of transmit and receive antennas to create a sequence of time ordered samples of the down - converted signals for each synthesized array element spatial position , and will be utilized for image processing . fig9 d illustrates a yet further example of timing of antenna selection for use with a linearly frequency stepped modulation waveform , compatible with image processing methods according to aspects of the present invention . this example is similar to that illustrated in fig9 c , with the exception that the entire set of unique combinations of transmit and receive antennas in the thinned array architecture is sequentially selected and corresponding down - converted signals sampled during each step of the frequency stepped waveform . fig9 e illustrates another example of timing of antenna selection for use with a linearly frequency stepped modulation waveform , compatible with image processing methods according to aspects of the present invention . this example is similar to that illustrated in fig9 c , with the exception that the entire stepped - frequency waveform is repeated for each time period t dw for each unique combination of transmit and receive antennas in the thinned array architecture . fig9 f illustrates an example of a down - converted object return signal and a / d sample timing consistent with the stepped frequency modulation waveform and receiver antenna sequencing method described in fig9 c . the a / d sample values of the down - converted signal are illustrated by the black dots superimposed on the signal , and are labeled aj m , n , p , k , where j is an integer representing the sample number for each of the unique transmit and receive antenna combinations , m and n represent the transmit antenna element index m , n , and p and k represent the receive antenna element index p , k . as can be seen , each successive a / d sample is delayed in time with respect to the preceding a / d sample by a time equal to t dw , and occurs at a different phase on the down - converted object return signal . for image processing methods that utilize complex signal phase , it is advantageous to utilize digitized down - converted signals which have the difference in a / d sample timing between them compensated . the difference in sample timing can be compensated for in the complex frequency domain as a frequency - dependent phase shift . as an example , let each digitized sample sequence ai m , n , p , k of the down - converted signals during the period t p be grouped separately for each corresponding unique transmit and receive antenna combination and ordered in time . let each separate n - sample sequence be processed separately by an n - point complex fft . the difference in sample timing between each antenna combination &# 39 ; s fft sequence can be compensated by applying the phase shift in the following equation to the complex frequency points in the fft sequence : where δψ j is the complex phase shift to be applied the jth complex fft point , f j is the frequency of the jth position in the fft sequence , j is an integer between 1 and n − 1 for an n - point fft sequence , and δt k is the difference in time between the a / d samples in the n - sample sequence . according to one aspect of the present invention , the digital beam - forming ( dbf ) method is presented as one method of image processing . the digital beam - forming method is adapted for use with the architectures illustrated in fig1 a - c , fig4 a - b and fig6 a - b utilizing the digitized fast fourier transformed ( fft ) phase - corrected sequences for each unique combination of transmit and receive antennas in the thinned array architecture , which represent the spatial positions in the synthesized array . once an fft sequence is obtained for each element in this synthesized array , a multitude of array gain patterns can be generated from this set of data , and target range can be determined from the fourier transform profiles calculated for each . one method of digital beam - forming signal processing is to generate array gain beam - patterns through combining of digitally phase shifted or digitally phase shifted and amplitude scaled complex fft data from each synthesized array spatial position . one method of imaging an object is through scanning of these generated beam patterns across the field of view for each range bin , creating a three - dimensional rendering of the object or objects in the field of view . according to another aspect of the present invention , a super - resolution processing method is presented as another method of image processing . the super - resolution processing method is adapted for use with the architectures illustrated in fig1 a - c , fig4 a - b and fig6 a - b utilizing the digitized fast fourier transformed ( fft ) phase - corrected sequences for each of the synthesized antenna positions . in this method , a super - resolution algorithm is used to process the phase of the complex sampled signals . as an example , for a synthesized line - array of k antenna elements , the relation of the phase difference between antenna elements and angular direction of object returns can be expressed by the following equation : where θ j is the direction from boresight in the axis of the array elements of the j th object return , δψ j , b , g is the phase difference corresponding to the j th object return between synthesized antenna spatial positions b and g , d b , g is the distance separating synthesized receive antenna positions b and g in the axis in which target direction θ is to be determined , λ is the average wavelength of the transmitted waveform during a coherent measurement interval , k is an integer greater than or equal to 3 , b is an integer greater than 1 and less than or equal to k + 1 , and g is an integer greater than 0 and less than or equal to k . since phase differences between receive antenna positions are preserved after down - conversion , the phase differences between the down - converted difference signals corresponding to the synthesized receive antenna positions can be used for δψ . the set of phase measurements between a plurality of synthesized antenna spatial positions can be used as inputs to a super - resolution algorithm , which outputs the maximum likelihood of object return angular positions based upon the set of input data . furthermore , a super - resolution algorithm has the ability to provide angular resolution of object returns within the field of view . one super - resolution algorithm well known in the art is the multiple signal classification algorithm ( music ). another super - resolution algorithm well known in the art is the estimation of signal parameters via rotational invariance techniques ( esprit ). although the preceding examples have illustrated one - dimensional and two - dimensional antenna array arrangements , the concepts and methods described can be extended to multi - dimensional arrays such as , but not limited to , multiple one - dimensional arrays arranged in multiple axes , orthogonal line - arrays , conformal arrays or three - dimensional arrays by one skilled in the art without departing from the spirit of the present invention . also , although the preceding examples illustrate the use of switching elements to sequentially switch between antenna elements in an array to minimize hardware and cost , multiple parallel receive down - conversion channels can be utilized , as well as combinations of parallel and sequential operation as part of the present invention . additionally , according to aspects of the present invention , a method can be utilized whereby a coarse , lower - resolution imaging mode is used to determine the location of an object rapidly , and a higher - resolution imaging mode is utilized to analyze the object . one way this can be achieved is to utilize a lower number of antenna array elements , or a sub - array of elements , for the lower - resolution imaging to determine the location of objects , and to utilize a higher number of array elements for the higher - resolution imaging where objects are determined to be located . one benefit of such a method can be to reduce the time and processing required to scan an area or volume of space . additionally , according to aspects of the present invention , a method can be utilized whereby two or more sensors are utilized to image a common area or volume , and the sensors are synchronized such that only one sensor transmits at a time . utilizing this method , the images from each sensor can be integrated into a common multi - dimensional view of the common area or volume . furthermore , according to aspects of the present invention , a method is presented whereby the imaging sensor can be utilized to determine if a further action by another sensor or system is deployed . one example , not meant as a limitation , utilizes the imaging sensor to determine the location where a second type of sensor such as , but not limited to , an optical imager or camera should focus . one way the sensor can be utilized is for , but not limited to , detection of movement of one or more objects within the field of view . another example , not meant as a limitation , utilizes the imaging sensor to determine if an object is a threat whereby a countermeasures system can be deployed . the preceding concepts , methods , and architectural elements described are meant as illustrative examples of aspects of the present invention , not as a limitation . different combinations of these concepts , methods , and architectural elements than that described in the preceding figures can be utilized by one of ordinary skill in the art without departing from the spirit of the present invention . while certain exemplary embodiments have been described and shown in the accompanying drawings , it is to be understood that such embodiments are merely illustrative of and not restrictive on the broad invention , and that this invention not be limited to the specific constructions and arrangements shown and described , since various other modifications may occur to those ordinarily skilled in the art .
| 7 |
with reference to the drawings , like reference characters designate like or similar elements throughout the drawings . now referring to fig1 there is shown a cross - sectional view of a medium ( semiconductor integrated circuit or printed circuit board , or the like ) 8 having a substrate layer 20 , an insulation layer 10 , a first conductor 12 ( also referenced as conductor a ), a conductor 14 ( also referenced as conductor d ) and a conductor 16 ( also referenced as conductor e ) formed in the insulation layer 10 . as will be appreciated , if the medium 8 is printed circuit board , the substrate layer 20 may not be present . fig1 also shows capacitance paths 18 ( illustrated in dotted lines ) between the first conductor 12 and the conductors 14 , 16 . additionally shown in fig1 are the substrate layer 20 ( which may include a conductive layer or other elements ) and capacitance paths between the conductor 12 and the substrate layer 20 . in addition , capacitance paths may exist between the conductor 12 and other elements or materials located proximate ( above , beside , below ) the conductor 12 , but are not shown for convenience . as will be appreciated , as the conductor 12 extends through the medium 8 , many different conductors or elements having different ( and dynamic ) electrical signals thereon will be positioned proximate the conductor 12 . these couple capacitively to the conductor 12 . it is readily understood that the amount of capacitive coupling depends on several factors , including the distance from the conductor 12 , the length of the coupling region , the rate of change of the potential difference between conductor 12 and each proximate conductor , and the dielectric constant ( s ) of the material ( s ) therebetween . the total value of the capacitance is one factor that determines the “ speed ” and / or propagation delay of an electrical signal transmitted along the conductor 12 . as the capacitance increases , the speed decreases ( or propagation delay increases ). therefore , reducing the capacitance that an electrical signal “ sees ” as it propagates along the conductor 12 will increase its speed ( or decrease its propagation delay ). in general terms , a signal on one conductor increasing in voltage while a signal on another conductor decreases in voltage ( resulting in an increase in delta over time ) generates the maximum capacitive effect , while two signals increasing ( or decreasing ) together generates the least capacitive effect . in other words , the capacitive effect is great between non - shielded conductor lines when both signals are active and opposite in direction . this effect remains substantial when one signal is active ( increasing or decreasing ) and the other signal is static ( e . g ., one signal is rising to a logic one and the other signal is held at a logic zero ). now referring to fig2 there is illustrated a circuit 100 having a conductor 120 extending from a first circuit 112 located in a first area 114 of an integrated circuit 100 to a second circuit 116 located in a second area 118 of the integrated circuit 100 . the conductor 120 has a length l , as shown in fig2 . the conductor 120 in accordance with the present invention reduces or decreases the propagation delay time ( increases the speed ) of an electrical signal transmitted along the conductor 120 . as will be appreciated , the circuit 100 may also be any other electrical circuit , including a printed circuit board . accordingly , the description of the present invention with respect to integrated circuits is also applicable to printed circuit boards and the like . in the preferred embodiment , the signal transmitted on the conductor 120 is a clocking signal and the propagation delay of the signal is reduced or decreased , thus increasing the speed of the signal . to obtain most of the benefits and advantages of the present invention , the length l of the conductor 120 should be more than about 250 microns , and preferably about 1000 microns or more . as will be appreciated , when used in an integrated circuit , the length l will most likely be less than 50 , 000 microns , depending on the size of the integrated circuit substrate . the signal ( s ) transmitted on the conductor 120 are generally about 10 mhz or greater and , preferably , about 200 mhz or greater , to obtain the many advantages of the present invention . now referring to fig3 a , there is illustrated a more detailed diagram of the conductor 120 of the present invention . the conductor 120 includes a first conductor 120 a , a second conductor ( or conductive portion ) 120 b extending substantially parallel and along the first conductor 120 a , and a third conductor ( or conductive portion ) 120 c extending substantially parallel and along the first conductor 120 a . the conductors 120 a , 120 b , 120 c are shown extending from the first circuit 112 ( in the first area 114 ) to the second circuit 116 ( in the second area 118 ) ( see also fig2 ). each of the conductors 120 a , 120 b , 120 c are made of any conductive metal or material , preferably of low resistance , including copper , tungsten , aluminum , polysilicon or other material , or combination thereof . it will be understood that due to routing and process constraints and requirements , the additional conductor ( s ) may not run along the conductor 120 a the entire distance l , but instead substantial portions may run along the conductor 120 a . now referring to fig3 b , there is shown a cross - sectional view cut along line a - a of fig3 a . the conductors 120 a , 120 b , 120 c are formed in a insulating layer 200 ( of an integrated circuit or printed circuit board , or the like ). additional layers of substrate may be provided , such as a substrate layer 202 . the conductors 120 b and 120 c are each spaced apart substantially laterally from the conductor 120 a , with the conductor 120 b positioned along one side of the conductor 120 a and the conductor 120 c positioned along the other side of the conductor 120 a . as will be appreciated , using present processes and methods , the width of each of the conductors is generally about 0 . 7 microns and the spacing therebetween is about 0 . 7 microns . however , the width and spacing dimensions may vary , and elements / dimensions in the figure may vary and may not be drawn to scale . it is expected that next generation processes will generate widths on the order of 0 . 2 to 0 . 4 microns , and perhaps even smaller . now referring to fig4 a - 4 c , there are illustrated different configurations or embodiments for electrically connecting the conductors 120 b , 120 c to the main conductor 120 a . in fig4 a , the conductors 120 a , 120 b , 120 c are electrically connected at or near the source end , as illustrated , using a conductive material , such as the material used to fabricate the conductors . it will be understood that the designations “ source ” and “ destination ” are used for convenience and illustrative purposes only , and that the designations could be switched , such that the source end may refer to the first circuit 112 or first area 114 , or the second circuit 116 or second area 118 . moreover , the conductor 120 ( or 120 a ) may be bidirectional , depending on the desired circuitry and functioning of the integrated circuit ( or electrical circuit ). now referring to fig4 b , there is illustrated another configuration or embodiment of the conductor 120 wherein the conductor 120 a is electrically connected at one end to three separate drivers 210 . each driver 210 drives the respective conductors 120 a , 120 b , 120 c . the drivers 210 may include any other type of circuitry , and are not limited to inverters . now referring to fig4 c , there is illustrated yet another configuration or embodiment of the conductor 120 wherein a plurality of switches 220 are used to electrically connect the conductor 120 a to the conductor 120 b , and to electrically connect the conductor 120 a to the conductor 120 c . the switches could also be tri - state devices . it will be understood to those skilled in the art that other circuits and methods may be used to electrically connect the conductor 120 a to the conductors 120 b , 120 c . as shown in fig4 c , the conductors 120 b and 120 c could also be utilized by other circuitry when the conductor 120 a is not active , unused , or when a signal is transmitted whose speed or propagation delay is unimportant . this is accomplished using switches and / or tri - state devices with appropriate control lines , and can be implemented by those skilled in the art . now referring to fig5 a - 5 b , there are shown cross - sectional views of several embodiments of the conductor 120 alternative to the embodiment shown in fig3 a and 3b . in fig5 a , the conductor 120 includes a first conductor 120 a , a second conductor ( or conductive portion ) 120 b extending substantially parallel and along the first conductor 120 a , and a third conductor ( or conductive portion ) 120 c extending substantially parallel and along the first conductor 120 a . the conductors 120 b and 120 c are each spaced apart substantially vertically from the conductor 120 a , with the conductor 120 b positioned along the top side of the conductor 120 a and the conductor 120 c positioned along the bottom side of the conductor 120 a . now referring to fig5 b , there is shown another alternative embodiment of the present invention that includes the features illustrated in fig3 b and 5a . the conductor 120 includes a first conductor 120 a and a plurality of conductors ( or conductive portions ) 120 b , 120 c , 120 d , 120 e , whereby the conductors 120 b , 120 c , 120 d , 120 e each extend substantially parallel and along the first conductor 120 a . the conductors 120 b and 120 c are each spaced apart substantially laterally from the conductor 120 a , with the conductor 120 b positioned along one side of the conductor 120 a and the conductor 120 c positioned along the other side of the conductor 120 a . the conductors 120 d and 120 e are each spaced apart substantially vertically from the conductor 120 a , with the conductor 120 d positioned along the top side of the conductor 120 a and the conductor 120 e positioned along the bottom side of the conductor 120 a . now referring to fig5 c , there is shown yet another alternative embodiment of the present invention . the conductor 120 in includes the conductors 120 b , 120 c , 120 d , 120 e as set forth in fig5 b , and also includes a conductor 120 f , a conductor 120 g , a conductor 120 h , and a conductor 120 i , as shown in fig5 c . now referring to fig6 a - 6 d , there are shown in fig6 a signal waveforms in graphical representation illustrating rise times for a prior art conductor shown in fig6 b , for one embodiment of the present invention shown in fig6 c , and for another embodiment of the present invention shown in fig6 d . in fig6 b , there is shown the prior art conductor 12 with additional conductors 14 and 16 . the width of each conductor 12 , 14 , 16 is about 0 . 7 microns and the spacing therebetween is about 2 . 1 microns . the conductors 14 and 16 are not electrically connected to the conductors 14 and 16 . in fig6 c , there is shown one embodiment of the present invention having the conductor 120 including the conductor 120 a and 120 b . the width of each conductor 120 a , 120 b , 14 , 16 is about 0 . 7 microns and the spacing between the conductors 14 , 120 b and 120 a is about 0 . 7 microns while the spacing between the conductors 120 a and 16 is about 2 . 1 microns . the conductors 120 a and 120 b are electrically connected while the conductors 14 and 16 are not electrically connected to the conductor 120 . in fig6 d , there is shown one embodiment of the present invention having the conductor 120 including the conductor 120 a and 120 b . the width of each conductor 120 a , 120 b , 120 c , 14 , 16 is about 0 . 7 microns and the spacing therebetween is about 0 . 7 microns . the conductors 120 a and 120 b are electrically connected while the conductors 14 and 16 are not electrically connected to the conductor 120 . now referring to fig6 a , there is shown a graph of voltage ( volts ) versus time ( nanoseconds ) comparing simulation results of the present invention with a prior art conductor . an ideal signal waveform for a signal transition from a logic zero ( about 0 volts ) to a logic one ( about 3 . 3 volts ) is identified by reference numeral 600 , and illustrated with an instantaneous rise time . for the prior art conductor illustrated in fig6 b , the waveform of a signal on the conductor 12 is identified by reference numeral 602 , with the conductors 14 and 16 held at a logic zero . as is shown , the prior art conductor 12 has a rise time ( measured at about 90 % of the logic one level of about 3 . 3 volts ) of approximately 0 . 28 nanoseconds due to the capacitive effects of the conductors 14 and 16 on the conductor 12 . now referring to two of the embodiments of the present invention as illustrated in fig6 c and 6d , there is a substantial decrease in the rise time and corresponding decrease in the propagation delay ( or increase in speed ) for the conductor 120 of the present invention . as will be appreciated , the conductor 120 a corresponds to the prior art conductor 12 shown in fig6 b . for the conductor 120 ( including the conductors 120 a and 120 b ) illustrated in fig6 c , the waveform of the signal on the conductor 120 a is identified by reference numeral 604 , with the conductors 14 and 16 held at a logic zero . as is shown , the conductor 120 a has a rise time of approximately 0 . 16 nanoseconds due to the capacitive effects of the conductors 14 and 16 on the conductor 12 . by adding the additional conductor 120 b substantially parallel and along the conductor 120 a , the conductor 120 a is “ shielded ” from some of the capacitive effects of the conductors 14 and 16 on the conductor 120 a . the conductor 120 results in an increase in speed and decrease in rise time ( with a corresponding decrease in propagation delay ) of a signal transmitted on the conductor 120 . for the conductor 120 ( including the conductors 120 a , 120 b and 120 c ) illustrated in fig6 d , the waveform of the signal on the conductor 120 a is identified by reference numeral 606 , with the conductors 14 and 16 held at a logic zero . as is shown , the conductor 120 a has a rise time of approximately 0 . 13 nanoseconds due to the capacitive effects of the conductors 14 and 16 on the conductor 12 . by adding the additional conductors 120 b and 120 c substantially parallel and along the conductor 120 a , the conductor 120 a is “ shielded ” from some of the capacitive effects of the conductors 14 and 16 on the conductor 120 a . the conductor 120 results in an increase in speed and decrease in rise time ( with a corresponding decrease in propagation delay ) of a signal transmitted on the conductor 120 . the decrease / gain in rise time is about 0 . 15 nanoseconds . as shown , the decrease in rise time ( increase in speed ) is greater than a factor of two ( and the corresponding reduction in propagation delay is greater than 50 %). as will be appreciated , the signal on the conductors 120 b and 120 c will have slower rise time in voltage at the end of the conductor line than the conductor 120 a . it will also be understood that the advantages of the present invention are also present for decreases in voltage ( fall time ) and not limited to increases in voltage ( rise time ). the capacitive effect ( which causes delay ) becomes greater as the dimensions of the integrated circuit ( including printed circuit boards ) decreases , and the next smaller generation of integrated circuits will incur a greater capacitive effect from line to line . therefore , the present invention will be of increased benefit for future generation devices , although the present invention and its advantages have been described in the foregoing detailed description and illustrated in the accompanying drawings , it will be understood by those skilled in the art that the invention is not limited to the embodiment ( s ) disclosed but is capable of numerous rearrangements , substitutions and modifications without departing from the spirit and scope of the invention as defined by the appended claims .
| 7 |
turning now to the drawing , and in particular to fig1 , there is shown a longitudinal section of one embodiment of a chain tensioner according to the present invention , attached to a , not shown , cylinder head ( or engine block ) of an internal combustion engine , for keeping a power transmitting member ( not shown ), such as a chain of a chain drive in a tensioned state . it is to be understood that the principles described in the following description with respect to a chain tensioner are generally applicable to any other type of tensioner which generally follows the concepts outlined here . for convenience and sake of simplicity , fig1 and the following description refer only to those areas of the chain tensioner that form part of the present invention and are necessary for the understanding . the chain tensioner includes a cylinder 1 and a tensioner piston 2 , which is received in the cylinder 1 for axial displacement in the direction of the chain . the cylinder 1 has a bottom 4 for supporting one end of a helical compression spring 3 which biases the piston 2 in a direction of the chain . the piston 2 and the cylinder 1 define together a pressure chamber 5 for hydraulic fluid , e . g . motor oil . the bottom 4 has a passageway 11 which is fluidly connected to the pressure chamber 5 , whereby the flow of hydraulic fluid through the passageway 11 is controlled by a check valve , generally designated by reference numeral 6 and disposed in the cylinder bottom 4 . the check valve 6 cuts a fluid flow , when the pressure in the pressure chamber 5 is greater than a pressure outside of the cylinder 1 , and includes a ball 7 , a hood 8 projecting inwardly from and mounted to the bottom 4 , a spring 9 extending between the ball 7 and the hood 8 , and a ball seat 10 for the ball 7 . formed between the cylinder 1 and the piston 2 is a first leakage gap 12 through which hydraulic fluid can issue out of the pressure chamber 5 , when the piston 2 is moved inwards , whereby the volume of the pressure chamber 5 is reduced . fitted in the piston 2 is a bushing 13 which is formed at its bottom - distal end with an inwardly directed shoulder 19 for supporting the other end of the helical spring 3 . the bottom - distal end of the bushing 13 is configured with a conical wall 20 to define a substantially conical bore , thereby forming a first valve seat 17 for a ball 15 of a valve , generally designated by reference numeral 14 . the valve 14 is arranged in the tensioner piston 2 and includes a valve spring 16 which extends between an inside wall surface of the piston 2 and the ball 15 and biases the ball 15 against the valve seat 17 . the conical wall 20 has formed therein several circumferentially spaced grooves 21 to define a second leakage gap 22 . at a bushing - distal area facing the ball 15 , the piston 2 is formed with a conical wall 23 for defining a second valve seat 18 . the ball 15 is tightly seated against the valve seat 18 , when the ball 15 is moved away from the valve seat 17 against the valve seat 18 . a channel 24 is provided behind the valve seat 18 for communication with the surrounding area of the chain tensioner or atmosphere . while fig1 shows the tensioner piston 2 in a first operative state , in which the piston is moved out , fig2 shows the operative state , in which the piston 2 is moved in . the chain tensioner according to the invention operates as follows : during operation of the chain tensioner , the piston 2 oscillates within the cylinder 1 . when the piston 2 moves inwards , the volume of the pressure chamber 5 decreases so that hydraulic fluid seeps through the leakage gap 12 and the leakage gap 22 . the leakage flow is hereby subdivided in a first partial stream , which is routed between the cylinder 1 and the piston 2 into the surrounding , and a second partial stream , which is conducted between the ball 15 of the valve 14 and the conical wall 20 of the bushing 13 and between the ball 15 and the conical wall 23 of the piston 2 , and ultimately via the channel 24 into the surrounding . this split of the leakage flow is maintained so long as the pressure in the pressure chamber 5 does not drop below a critical lower level so that the ball 15 is held by the valve spring 16 in abutment against the valve seat 17 , with hydraulic fluid migrating through the grooves 21 ( leakage gap 22 ). as soon as the pressure in the pressure chamber 5 reaches a critical upper level as a result of rapid chain knocks , the elevated pressure applies on the ball 15 of the valve 14 a force which is greater than the force applied by the valve spring 16 so that the ball 15 is shifted away from the valve seat 17 to the second valve seat 18 . when abutting against the valve seat 18 , the hydraulic connection between the pressure chamber 5 and the pressureless channel 24 is cut as the valve 14 seals off the leakage gap 22 . thus , the leakage gap 22 is ineffective and the hydraulic fluid can no longer leak through the leakage gap 22 . as a consequence , hydraulic fluid can now only leak through the leakage gap 12 , so that the inward movement of the piston 2 is damped much harder and the piston 2 cannot sink as far as would be the case when both leakage gaps 12 , 22 were open . the harder damping action at greater pressure has the effect that the helical compression spring 3 is able to more rapidly push the piston 2 outwards , whereby the check valve 6 opens to allow intake of hydraulic fluid into the pressure chamber 5 . the chain tensioner according to the invention eliminates collapse of the chain tensioner , a problem experienced by conventional chain tensioners under peak load , when more motor oil is pressed out of the pressure chamber than can be aspirated in the relaxed phase . this problem is encountered in conventional chain tensioners in particular when the leakage gap is too large , thus set for a soft damping action , or at high motor speeds that allow only short intake times for renewed charging of the pressure chamber . when insufficient amounts of motor oil are available in the pressure chamber , a sudden load will cause the piston to move inwards to such an extent as to mechanically strike internal parts . as a result , very high force peaks are experienced in the chain drive , ultimately leading to a destruction of the chain drive . this problem is now eliminated by the chain tensioner according to the present invention . turning now to fig3 , there is shown a longitudinal section of another embodiment of a chain tensioner according to the present invention in a first operative state . in this embodiment , the chain tensioner has a tensioner piston 25 which is configured as hollow sheet metal part . a cylinder 26 is inserted in the hollow piston 25 and defines an interior space 40 which is hydraulically connected with the surrounding of the chain tensioner . the piston 25 and the cylinder 26 demarcate with their confronting surface areas a first leakage gap 27 . a helical compression spring 28 biases the tensioner piston 25 against the , not shown , chain . securely fitted in the cylinder 26 is a bushing 29 . on its bushing - distal end , the cylinder 26 has a bottom 30 . arranged within the interior space 40 of the cylinder 26 in axial alignment with the bushing 29 is a plunger 31 , which is biased by a valve spring 33 of a valve 32 against the bottom 30 . when the plunger 31 bears against the bottom 30 , a first piston stop is defined . the valve 32 is hydraulically connected via a recess 50 in the cylinder bottom 30 to a pressure chamber 35 , which is defined by the tensioner piston 25 and the cylinder 26 . the plunger 31 and the cylinder 25 bound with their confronting surface areas a second leakage gap 36 for seepage of hydraulic fluid out of the pressure chamber 35 . the plunger 31 is formed about its bottom - confronting end face with several , circumferentially spaced notches 37 which ensure a reliable fluid transfer from the pressure chamber 35 to the leakage gap 36 . the plunger 31 is moved away from the stop 34 against a stop 38 by a pressure force , when the pressure in the pressure chamber 35 exceeds a critical upper level . the stop 38 has a seat area 39 which is formed by a piston - confronting end face of the bushing 29 . when the plunger 31 abuts with its end face against the seat area 39 , hydraulic fluid collected in the leakage gap 36 can no longer leak into the interior space 40 of the bushing 29 . thus , only the leakage gap 27 is effective in this situation . the plunger 31 is combined with a check valve 41 to a structural unit , whereby the plunger 31 has a bottom 42 formed with an opening 43 , with the opening - encircling wall of the bottom 42 defining a valve seat 45 for a ball 46 of the check valve 41 . the check valve 41 corresponds otherwise to the configuration of the afore - described check valve 6 of fig1 . when the check valve 41 opens , hydraulic fluid can be aspirated from the interior space 40 via the opening 43 into the pressure chamber 35 . of course , the chain tensioner may also be designed in such a manner that the leakage gap 27 is omitted altogether , and the leakage gap 36 constitutes the only leakage gap . in this case , when the plunger 31 abuts against the second stop 38 , the leakage gap in the second stop 38 is still maintained open to allow migration of hydraulic fluid into the interior space 40 , whereby this leakage gap is smaller than the leakage gap in the first stop 34 . thus , the leakage gap 36 remains open in this case , its size being regulated by the plunger 31 in dependence on the outer diameter of the plunger 31 and the innerdiameter of cylinder 26 . in contrast thereto , when the chain tensioner is provided also with leakage gap 27 between the tensioner piston 25 and the cylinder 26 , the leakage gap 36 is completely closed , when the plunger 31 abuts against the stop 38 . function and mode of operation of the chain tensioner according to fig3 corresponds to the function and mode of operation of the chain tensioner according to fig1 and 2 , so that further description is omitted for the sake of simplicity . while the invention has been illustrated and described as embodied in a chain tensioner , it is not intended to be limited to the details shown since various modifications and structural changes may be made without departing in any way from the spirit of the present invention . what is claimed as new and desired to be protected by letters patent is set forth in the appended claims .
| 5 |
reference will now be made to various embodiments according to this invention , examples of which are shown in the accompanying drawings and will be obvious from the description of the invention . in the drawings , the same reference numbers represent the same or similar elements in the different drawings whenever possible . fig1 is an exemplary embodiment of a message content identifier system ( mcis system ) 100 for a mail service . fig1 illustrates a system layout where a mailer sends electronic messages directly to an e - mail system , in which system filtering takes place as a front end function of the e - mail system . in fig1 , an mcis participating sender or mailer ( mpsm ) 101 enters mcis system 100 by registering with mcis system 100 . during the registration process , mpsm 101 is assigned a participant code or standardized content identifier for identification within mcis system 100 . the mcis participant code , in addition to specifically identifying the industry segment of mpsm 101 and their company , identifies multiple permutations of product type codes or offering codes that are associated with the specific company , so that electronic messages sent by mpsm 101 to mcis system 100 can be accordingly identified . once the registration process is complete , these product codes are provided to mpsm 101 , with the product type permutations , via some electronic communication , such as an e - mail . the registration process and the mcis participant code structure and coding process will be described in greater detail below . before transmitting the electronic message , mpsm 101 embeds the mcis participant code into the electronic messages that are generated and transmits the electronic messages through network 102 to mcis mailer interface 104 . network 102 may be the internet or any type of analog or digital communications network . mcis mailer interface 104 communicates with a core application 120 of mcis system 100 . core application 120 interfaces e - mail system 114 and icrs system 112 and allows the setup of mpsm 101 on e - mail system 114 , using master content id database 122 . master content id database 122 contains the codes that core application 120 interrogates and stores for allocating the participant code to each mpsm 101 , during the registration process . to access the e - mail message transmitted by mpsm 101 , a customer 106 must register with an e - mail system 114 of mcis system 100 . using laptop 108 , customer 106 , through network 110 , logs into an internet customer registration system ( icrs system ) 112 . network 110 may be the internet or any type of digital or analog communications network . with icrs system 112 , customer 106 registers and sets up the e - mail account by making selections for message filtering options . for additional information on icrs system 112 , please refer to u . s . application ser . no . 09 / 809 , 328 filed on mar . 16 , 2001 . in this embodiment of the present invention , the filtering selection could occur when a customer registers or it could be an adjunct feature once the actual mailbox is established . when implemented as an adjunct feature , the filters may be set up within the mailbox itself rather than during the process of obtaining the mailbox . once mpsm 101 is registered as a participating mailer and customer 106 has signed up with mcis system 100 , then when mpsm 101 sends e - mail directly to the front end of e - mail system 114 via network 102 and mcis filter 116 , mcis filter 116 checks the mcis participant code against the preferences that the specific customer has indicated and executes appropriate routing . at this point , mcis filter 116 may either route the electronic message and deliver it to the customer &# 39 ; s mailbox within e - mail system 114 or reject the electronic message and notify mpsm 101 that the message has been rejected . as a third option , mcis filter 116 may deliver the electronic message into a generic pool instead of an identified specific mcis filtered mail folder within the customer &# 39 ; s mailbox . customer 106 would then know that this electronic message did not meet the filtering criteria to be delivered to the mailbox , but it was sorted as it entered the box and was rejected . in any event , feedback is provided to mpms 101 as notification of the outcome of the attempt , either successful or unsuccessful . customer 106 then may enter his e - mail box 118 within e - mail system 114 , using laptop 108 and network 110 , and view the mcis filtered electronic messages , non - filtered electronic messages , or another functional segments of the e - mail box 118 . fig1 as previously described , focuses on the system layout and flow where the mailer is sending electronic messages directly or attempting to send electronic messages directly to customer 106 . fig2 is an alternative embodiment where mpsm 101 may submit electronic files containing physical addresses , and possibly electronic addresses , and message content that contains mcis participant coding . the service provided by this alternative embodiment may be implemented as a separate intermediate service . in this alternative embodiment , a physical address mailing list file 202 is uploaded , using a program , from mpms 101 to an e - address processor 206 . e - address processor 206 will be described in greater detail below . e - address processor 206 queries an icrs customer database 208 . as a result , icrs customer database 208 outputs the customer &# 39 ; s e - address and filtering preferences . icrs customer database 208 contains the data supplied when customer 106 registered and set up the virtual e - addressing account with the mail service and initially recorded the filtering preferences . the query executed by e - address processor 206 may be implemented by several different means . for example , the query may be based on the physical address , codes that are associated with the physical address , the customer &# 39 ; s name , or account numbers associated with the customer . the query uses one or more of the above mentioned components to translate the physical address mailing list file 202 to an electronic address . furthermore , in this alternative embodiment , message content with mcis coding 204 is also uploaded , using a program , to e - addressing processor 206 , where the e - addressing information , message content and the mcis coding are combined and the electronic message is created . the electronic message with the embedded coding is then sent to the mcis filter 116 of fig2 , where the customer preferences are identified . the electronic message is subsequently sent into an e - mail message routing system 210 for delivery into electronic mailbox repository 212 . then , return statistics are sent to mpsm 101 via an e - address status reporting module 214 . before describing , in fig3 , the internal details of e - addressing processor 206 , it is important to emphasize that the filtering executed by mcis filter 116 may be implemented as part of the icrs database query . because the customer preferences may be stored on icrs customer database 208 , the filtering may take place as part of the querying process . the filtering process may also be implemented within e - address processor 206 . the filtering process may be implemented in either fashion , that is , as part of the query of icrs customer database 208 , or by referencing back to the mail merge processor within e - address processor 206 . the mail merge processor provides the function of creating the electronic message and will be discussed in the description of the internals of e - addressing processor 206 . in the case where the message filtering is performed during the querying of icrs customer database 208 , the e - mail message does not have to run through the entire system before the filtering may take place . processing may occur at the icrs customer database 208 to identify those customers that in fact will accept the message content . using this approach , message routing / handling decisions may be made upstream versus downstream in the process , and the message may be delivered directly to the e - mail message routing system 210 for delivery into electronic mailbox repository 212 . fig3 is a block diagram of the internal processes within the e - addressing processor 206 . the numbers used in fig3 correspond to the numbering system that is used in fig2 . fig3 illustrates that physical address mailing list file 202 may be uploaded to an address matching system 302 . in address matching system 302 , the physical addresses are parsed and match codes are constructed for interrogating a match directory , within the address matching system , to obtain a match directory address associated with the input physical address . if a match is obtained , then the zip plus 4 code and all the other associated information contained within the address matching system for the associated physical address is fed into a key generation and e - addressing query function 304 , which in turn feeds a query to icrs customer database 208 . as a result of the database query , an output is provided from the icrs customer database 208 to e - addressing processor 206 . the output is an electronic address mailing list file 306 , which is fed into a mail merge processor 308 . mail merge processor 308 receives message content with mcis coding 204 and creates the electronic message . the resulting electronic message is then transferred to mcis filter 116 , where the customer preferences are identified . the electronic message is subsequently sent into e - mail message routing system 210 for delivery into electronic mailbox repository 212 . the intelligence from within mail merge processor 308 may be returned to the icrs customer database 208 and messages may be tagged with appropriate routing information for historical information tracking . fig4 illustrates the process for applying the participant coding or standard content identifier to the message content . mpsm 101 inputs a message content 402 to a content coding program 404 , where message content 402 is coded with a participant coding or standard content identifier 406 . the participant code or standard content identifier may be inserted into the header section of an electronic message . then , the electronic message is sent to e - mail system 114 via mcis filter 116 . next , fig5 illustrates that the electronic message , including content 402 , participant or standardized content identifier 406 , and a recipient address 502 , is received and submitted to filters 504 . the recipient address 502 may be the customer &# 39 ; s electronic mail box address . filters 504 , in turn , identify the customer &# 39 ; s preferences , which were setup during the registration process , and apply the preferences to participant or standardized content identifier 406 . then , according to the identified preferences that are consistent with the participant or standardized content identifier 406 , the electronic messages are delivered to the appropriate folders . for example , bills are delivered to a folder 510 , secure mail may be delivered to a folder 512 , advertisements may be delivered to a folder 514 , and e - mail may be delivered to a folder 516 . for additional security , security features 506 and 508 are applied before bills and secured mail are delivered to their appropriate folders . the security features ( 506 and 508 ) may be a type of electronic security message , protocol , or handshake used to distinguish between authorized and unauthorized system users . for example , the security features ( 506 and 508 ) may be a fire wall . mcis system 100 provides a standardized method for electronic messages and their content to be identified and subsequently filtered ( accepted or rejected ), based upon on the mcis participant code or standardized content identifier 406 . as described above , mcis participating sender or mailer ( mpsm ) 101 is provided with content coding program 404 ( fig4 ) to provide associated product type identifiers that may be incorporated into mcis system 100 . once established as an mcis system 100 participant , mpsm 101 provides this participant code or standardized content identifier 406 as part of all submitted messages for potential electronic delivery by the mail service or by other private commercial electronic message services licensed by the mail service to provide mcis system messages to their customers . the participant code or standardized content identifier may be implemented with the following mcis code format : the mcis code format is 18 characters in length plus a check digit and is divided into three segments : i . the first six characters ( nnnnnn ) identify the industry segment and is based upon the north america industry classification system ( naics ); ii . the next six characters of the code ( aaaaaa ) specifically identify a company within the industry segment and is based on the address change service ( acs ) participant code , which is describe in the publication of appendix a ( united states postal service , address change service , publication 8 ( july 1998 )); iii . the last six characters ( nnnnnn ) are used to identify a specific product type or offering by a company ; iv . the last digit ( c ) is used to ensure the integrity or accuracy of the preceding 18 characters ; for example , the mcis participant code or standardized content identifier may be 721191brxjkt5011521 . the component parts are : i . 721191 — the naics code that identifies the industry segment for bed - and - breakfast inns ; ii . brxjkt — identifies a specific bed - and - breakfast inn ( e . g ., xyz bed - and - breakfast in anytown , usa ); iii . 501152 — identifies the contents of the messages as being an advertisement for discount offers for rooms booked 60 days in advance for stays during the month of july ; iv . 1 — identifies the check digit that ensures the integrity or accuracy of the preceding 18 characters . fig6 is a flow diagram of a method 600 used by mpsm 101 to send electronic messages to a recipient &# 39 ; s mailbox . to initiate the transfer of information , method 600 starts , the sender applies a standard coding to the message content to be delivered to the recipient , and the recipient specifies the type of content to be received and / or identifies the approved senders . ( stage 602 - 606 ). once the mail service receives the content with the standard coding from mpsm 101 , the mail service reads the standard coding and compares the standard code to the recipient &# 39 ; s preferences ( stage 608 ). the recipient &# 39 ; s preferences specify the content that the recipient wishes to receive and / or identifies the approved senders . ( stage 610 ). if the standard code from mpsm 101 is inconsistent with the recipient &# 39 ; s preferences , the mail service does not route the message content to the recipient &# 39 ; s mailbox , and may notify mpsm 101 of non - delivery . ( stage 614 ). then , the method ends . ( stage 620 ). if the standard code from mpsm 101 is consistent with the recipients specification , the mail service routes the content to the appropriate folder in the recipient &# 39 ; s mailbox , and may notify the sender of the delivery . ( stage 616 and 618 ). then , the method ends . ( stage 620 ). in view of the foregoing , it will be appreciated that the present invention provides a system and method directed to identifying electronic messages based on a message content identifier or participant code . still , it should be understood that the foregoing relates only to the exemplary embodiments of the present invention , and that numerous changes may be made thereto without departing from the spirit and scope of the invention as defined by the following claims .
| 7 |
as briefly described above , embodiments are directed to dynamic computation of identity - based attributes . with reference to fig1 , one example system for managed code assemblies includes a computing device , such as computing device 100 . computing device 100 may be configured as a client , a server , a mobile device , or any other computing device that interacts with data in a network based collaboration system . in a very basic configuration , computing device 100 typically includes at least one processing unit 102 and system memory 104 . depending on the exact configuration and type of computing device , system memory 104 may be volatile ( such as ram ), non - volatile ( such as rom , flash memory , etc .) or some combination of the two . system memory 104 typically includes an operating system 105 , one or more applications 106 , and may include program data 107 such that data store monitor 120 , attribute computer 122 , and cache 124 can be implemented ( which are discussed below ). computing device 100 may have additional features or functionality . for example , computing device 100 may also include additional data storage devices ( removable and / or non - removable ) such as , for example , magnetic disks , optical disks , or tape . such additional storage is illustrated in fig1 by removable storage 109 and non - removable storage 110 . computer storage media may include volatile and nonvolatile , removable and non - removable media implemented in any method or technology for storage of information , such as computer readable instructions , data structures , program modules , or other data . system memory 104 , removable storage 109 and non - removable storage 110 are all examples of computer storage media . computer storage media includes , but is not limited to , ram , rom , eeprom , flash memory or other memory technology , cd - rom , digital versatile disks ( dvd ) or other optical storage , magnetic cassettes , magnetic tape , magnetic disk storage or other magnetic storage devices , or any other medium which can be used to store the desired information and which can be accessed by computing device 100 . any such computer storage media may be part of device 100 . computing device 100 may also have input device ( s ) 112 such as keyboard , mouse , pen , voice input device , touch input device , etc . output device ( s ) 114 such as a display , speakers , printer , etc . may also be included . computing device 100 also contains communication connections 116 that allow the device to communicate with other computing devices 118 , such as over a network . networks include local area networks and wide area networks , as well as other large scale networks including , but not limited to , intranets and extranets . communication connection 116 is one example of communication media . communication media may typically be embodied by computer readable instructions , data structures , program modules , or other data in a modulated data signal , such as a carrier wave or other transport mechanism , and includes any information delivery media . the term “ modulated data signal ” means a signal that has one or more of its characteristics set or changed in such a manner as to encode information in the signal . by way of example , and not limitation , communication media includes wired media such as a wired network or direct - wired connection , and wireless media such as acoustic , rf , infrared and other wireless media . the term computer readable media as used herein includes both storage media and communication media . in accordance with the discussion above , computing device 100 system memory 104 ( and processor 102 , and related peripherals can be used to implement data store monitor 120 , attribute computer 122 , and cache 124 . data store monitor 120 , attribute computer 122 , and cache 124 in an embodiment can be used to implement dynamic computation of identity - based attributes ( described below with reference to fig2 - 3 ). data store monitor 120 can be used for detecting changes to identity - based attributes for structured data in a data store and changes to relationships amongst the structured data . attribute computer 122 can be used for computing in response to a detected change a computed attribute for a query ( that can be an identity function , for example ). cache 124 can be used for persisting the computed attribute and sending the computed attribute in response to a query that be the same ( or substantially similar to ) or different from the query for which the change was detected . fig2 is an illustration of dynamically calculated , identity - based attributes . in an embodiment , an identity - based attribute computation can be directly associated with an attribute chosen to hold the result of the computation . the chosen attribute thus becomes dedicated to the result of the computation , and can be referred to as a “ computed attribute .” the value of a computed attribute typically only changes when the result of the computation itself changes . a straightforward implementation could perform the actual computation on - demand whenever the computed attribute is accessed . however , to improve processing efficiency , another implementation can use a more sophisticated system whereby the result of the computation is cached . while this approach typically requires more physical storage , it typically reduces computational overhead since identity - based attribute computations are normally only executed when the inputs into the computation change . in dynamic computation of identity - based attributes , the values of a computed attribute on a specific object are calculated from the attribute values present on a set of related objects ( which may or may not include the object holding the computed attribute ). in a server implementation , the object holding the computed attribute is called the “ base object ” ( 220 ), and the set of related objects are called “ match objects ” ( 210 , 230 , and 240 ). the base object itself may also be a match object . after the base and match objects have been established , an arbitrary operation over the set of values from all match objects can be performed to produce a resultant set of values for the computed attribute . in general , any mathematical operation can be used for the computation , depending on the amount of flexibility desired for a given scenario . in one embodiment , the operations can be restricted to only allow the relocation of values to different operations . ( in other embodiments operations can be supported that modify the content of individual values , such as arithmetic or string manipulation operators .) the feature of identity - based attribute computations is typically implemented on top of “ normalized ” identity data store . in the embodiment , any value - level transformations are performed before the data enters the normalized identity store . ( in other embodiments value - level transformation operators can be provided .) in the embodiment , the transformation from match object values into computed attribute values is defined by listing the names of one or more attributes from the match objects which thus forms the computed value set . these attributes are called “ value attributes .” thus the result of the computation is the union of all values from all value attributes from all match objects . as illustrated in fig2 , two relationships ( 250 and 260 ) and two value attributes are used to compute five values from the three match objects . thus components used to define a computed attribute for the example comprises two lists . the first is the list of relationships , and the second is the list of value attributes . the definition of ca1 in this example can be given as follows in table i : in the embodiment , the definitions are stored in the dsml schema of the aggregate identity store , using custom xml elements to extend the dsml schema description format . an example extended dsml definition for ca1 can be written as : the example dsml definition does not describe how the relationships are defined . not defining the relationships in the dsml code illustrates an important modularity in the definitions of identity - based attribute computations . the conditions that define a relationship are normally established independently of the computations which use those relationships . the modularity allows the logic for a relationship to be reused in multiple computations . it also potentially allows different parties , with different areas of expertise , to author relationships and computations independently . the modularity of the code can thus offer a significant improvement in system manageability . a relationship can be defined as any set of conditions that can be evaluated to determine the set of match objects for a given base object . in an embodiment , a relationship can be defined by three optional components : a “ filter ” on the match object , a “ filter ” on the base object , and a list of “ search conditions .” a “ filter ” is an arbitrary test that can be applied to a single object to determine if it is a candidate for the relationship . a “ search condition ” is a test that can take as input both the match object and the base object , and determine if the two objects are related according to the specific attribute values on each . a relationship is determined to exist between two objects when the match filter test passes , when the base filter test passes , and when all search condition tests pass . if any of these tests has not been defined for a given relationship , then that test is considered to always pass . the definition of a relationship can be given as follows in table ii : in an embodiment , a “ filter ” is defined as a mathematical combination of boolean operators , conditional operators , constant values , and object attributes . a typical example for a filter might be “ title starts - with ‘ vp ’ and buildingnumber = 22 .” this filter would only pass for objects whose “ title ” attribute has the string prefix “ vp ” and whose “ buildingnumber ” attribute has the numeric value 22 . a “ search condition ” can be primarily defined by two listing attributes , one called the “ base attribute ” and one called the “ match attribute .” a simple search condition is considered to “ pass ” for a given pair of base object and match object when the match attribute on the match object and the base attribute on the base object share at least one value in common . however , there can be three additional options on a search condition that influence the matching logic . the first is an “ inversion ” flag which negates the result of the search condition . in other words , an inverted search condition passes for a given pair of objects usually only if the match attribute on the match object has no values in common with the base attribute on the base object . the second and third options are “ transitivity ” flags which can be independently set on either the match or the base object ( discussed below ). the definition of a search condition can be given as follows in table iii : normally , a search condition directly tests the immediate values of the match attribute against the immediate values of the base attribute . however , if the transitive flag is turned on for either attribute , then the value set that will be tested for that attribute will actually be the “ transitive closure ” of the immediate values of the attribute . the transitive closure operation is usually only defined for attributes of reference type , so it is normally invalid to set this flag for a match or base attribute which is not of a reference type . the actual transitive closure operation typically has the standard mathematical definition : the result is the set of all objects reachable through the specified reference attribute in any number of “ hops .” for example , the standard “ manager ” reference - type attribute can be used . for a given user object , the immediate value of the attribute is a reference to the one person who is that user &# 39 ; s manager . additionally , the transitive closure of this attribute is the entire set of the user &# 39 ; s manager , the user &# 39 ; s manager &# 39 ; s manager , and the like , all the way up the management chain of the user in question . like the computed attribute definitions discussed above , relationship definitions can be stored in an aggregated identity store schema using an extended dsml grammar . an example of a relationship definition in using an extended dsml grammar can be as follows : as noted above , relationship and computed attribute definitions frequently reference other attributes in the identity store schema . according to the given schema , any of these referenced attributes can be themselves computed attributes . thus a computed attribute can be referenced as a value attribute in another computed attribute . a computed attribute can also be used as a match attribute or base attribute in a search condition . additionally a computed attribute could be referenced in the match or base filters of a relationship . these types of nested definitions are allowed to any degree of depth or complexity , such that typically none of the definitions are cyclically related . the dependencies are calculated between the various nested definitions , and calculations are performed in the proper order such that the dependencies are obeyed and all computation results are kept current . fig3 is a top - level illustration of a flow diagram for dynamic computation of identity attributes . in operation 302 , a data store is monitored for changes to identity - based attributes for structured data and changes to relationships amongst the structured data . in operation 304 , a computed attribute is dynamically computed for a first query . the calculation is performed in response to the detected change as detected by the data store monitoring above . the query can be persisted in a cache for replying to queries that are the same or similar to ( sharing some identical components ) the first query . the cache can be implemented in a server . in operation 306 , the information from the computed attribute is provided in response to a second query . in various embodiments , the second query can be the same as , a duplicate of , similar to , different from ( and the like ) as the first query . the second query is received after the computed attribute has been computed . in various embodiments , the information from the computed attribute can be published ( either in conjunction with , or separately from operation 307 ) by exporting the computed result to a connected system . the connected system can then use the exported results to query against the connected systems querying capabilities . the above specification , examples and data provide a complete description of the manufacture and use of embodiments of the invention . since many embodiments of the invention can be made without departing from the spirit and scope of the invention , the invention resides in the claims hereinafter appended .
| 6 |
with continued reference to the drawing figures , a sailboat 10 is shown which includes a foredeck 11 , an aftdeck 12 and a stern 13 . a mast 14 extends upwardly from the sailboat to which is secured the luff or front edge 15 of a mainsail 16 . the foot or lower edge 18 of the sail is secured by a plurality of tie lines 19 which extend through grommets 20 which are spaced along the foot of the sail to boom 22 intermediate the tack 23 and the clew 24 . the boom is pivotable with respect to the mast so as to allow the sail angle to change relative thereto depending upon wind direction and the direction of tacking of the sailboat . the pivotable movement of the boom is controlled by a mainsheet 25 which is connected to a traveller 26 slideable along a guide 27 secured adjacent the stern of the boat . the forward portion of the boom is stabilized and guided by a boom vang 28 which is secured at the base of the mast and to a vang hook 29 extending from the bottom of the boom . by playing the line of the mainsheet 25 in and out , the outer end of the boom is caused to pivot from side to side relative to the sailboat . it should be noted that the boom structure on sailboats varies and , in some instances , the foot of the mainsail is only secured to the boom at the tack 23 and clew 24 . in other instances , as opposed to having tie lines for securing the foot of the mainsail to the boom , the sail may be mounted on brackets 32 which slide along a rail 33 which is mounted to and extends outwardly from the upper portion of the boom , as shown in fig5 . the present invention is provided to prevent injury to individuals on the sailboat caused by being hit by the boom as it swings relative to the sailboat . with particular reference to fig2 through 4 , a first embodiment of the present invention is disclosed . in this embodiment , the boom is provided with a protective cushion 40 which consists of an elongated body portion 41 in the form of an open tubular sleeve having a first end 42 which is designed to be positioned adjacent the mast and an outer end 43 which is designed to extend to a point adjacent the outer portion of the boom near the clew 24 . the body portion further includes opposing elongated sides 44 and 45 which are normally spaced from one another by an elongated slot or opening 46 . the cushion 40 is preferably formed of soft resilient material such as a spongy foam rubber . the material may be substantially any material which is capable of resiliently yielding to absorb a great deal of the impact energy when the boom contacts an object including various natural and artificial soft rubbers , soft foams and various fibrous padding and the like which are capable of yielding and then re - assuming their original configuration after impact . in the preferred embodiment , the material should be a minimum of approximately 3 / 4 to 1 inch in thickness . the body is preferably coated on both the inner and outer surfaces with a flexible or pliable water impermeable layer 47 and 48 . as shown in fig3 the body may be pre - formed in a substantially arcuate configuration wherein the inner surface 47 of the body is concave . further , to allow the cushion to compatibly engage the length of the tapering boom , the body may be formed with a converging radius from the mast or inner end 42 to the outer end 43 thereof relative to an elongated axis a -- a defined thereby . in some instances , where the boom structure is not tapered , the cross section defined by the body of the cushion will remain constant throughout its length . as opposed to preshaping the cushion with an arcuate configuration , the cushion may be formed of in a sheet - like configuration having relatively flat front and rear surfaces but which is flexible so as to be wrapped to conform to the outer surface of the boom when attached thereto , as shown in fig1 - 13 . in the embodiment of fig2 through 4 , a plurality of fastening elements in the form of straps 50 are secured adjacent to the side edge 45 by an appropriate adhesive , stitching or hook and loop fasteners . the inner surface of each strap 50 includes a strip of hook and loop fastening materials 51 which are selectively engageable with mating strips of hook and loop fastening materials 52 which are adhesively secured , stitch or applied by hook and loop fasteners , to the body 41 adjacent the elongated side 44 thereof , as shown in fig5 . the straps 50 are pulled tightly so as to urge the opposing sides 44 and 45 into close or contacting relationship to one another , as shown in fig5 . in some instances , due to the structure of the boom , it may be necessary to have a slight spacing or slot , such as 46 , remaining between the elongated sides 44 and 45 to make space for the tie elements which connect the foot of the sail to the boom . in order to allow for the connection of the boom vang 28 with the vang hook 29 , an opening 53 is provided through the body portion of the cushion , as shown in fig3 . it should be noted that other types of fasteners may be utilized to connect or mount the cushion to the boom . for instance , the straps 50 may be separately provided and secured by wrapping entirely about the cushion and united together utilizing conventional fastening elements including hook and loop fasteners , buckles or bayonet type fasteners . also , in addition to forming the body in a single length , it is possible that the cushion may be formed with two or more separate body portions each being secured to the boom along a portion of the length thereof . with specific reference to fig5 through 7 , a further embodiment of the present invention is disclosed in detail . in this embodiment , the boom is shown as being generally rectangular in cross section and is designated at 22 &# 39 ;. as previously discussed , a rail 33 is mounted along the upper surface of the boom to which slidable clips 32 are secured which connect the foot of the mainsail to the rail . in this embodiment , the cushion 60 is defined by a pair of opposing body sections 61 and 61 &# 39 ; each having a first or mast end 62 and an outer end 63 . each section also includes opposite side edges 64 and 65 . as shown in fig7 strips of hook and loop material 66 and 67 are provided along the length of the sections 61 and 61 &# 39 ; adjacent the sides 64 and 65 and along the inner surfaces thereof . in order to mount the body sections 61 and 61 &# 39 ; to the boom , a pair of strips of mating hook and loop fabric fastening materials 68 are adhesively secured in spaced relationship to the upper surface of the boom and a pair of parallel strips of hook and loop fastening material 69 are mounted in spaced relationship along the lower surface of the boom . the body sections 61 and 61 &# 39 ; are mounted so as to completely cover the opposite sides of the boom , as shown in fig4 by securing each of the body sections 61 and 61 &# 39 ; to the boom by connecting the strips 64 with the strips 68 at the top of the boom and the strips 67 with the mating strips 69 on the bottom of the boom . with specific reference to fig8 and 9 , another embodiment of the present invention is disclosed which incorporates features of the previous two embodiments . in this embodiment , the cushion 70 includes a pair of opposing body portions 71 and 71 &# 39 ; which have concave facing inner surfaces 72 and upper and lower elongated edges 73 and 74 . each body portion is pre - formed so that the two bodies may be brought into opposing engagement with the boom 22 , as shown in fig9 . hook and loop strips 75 and 76 are provided on the inner surface adjacent each of the sides of each body portion and mate with hook and loop fastening strips 78 and 79 applied along the length of the boom . in this embodiment , separate straps such as those shown at 50 may also be utilized to mount the sections 71 and 71 &# 39 ; to the boom . with continued reference to fig9 - 13 of the drawing figures , another embodiment of the invention is discussed in greater detail . in this embodiment , the protective cushion 80 is formed as a sheet of soft resilient material having the same characteristics with respect to deformability and impact resistance as discussed above with respect to the previous embodiments . the cushion includes a body portion 81 having opposite end portions 82 and 83 and opposite elongated sides 84 and 85 . in order to mount the flexible sheet to the boom 22 of a sailboat , the inner surface 86 thereof is provided with a pair of generally parallel strips of hook and loop type fastening materials 87 and 88 which extend adjacent each of the sides 84 and 85 . the width of the body between the sides 84 and 85 is sufficient for the body to be wrapped about the sides and bottom of the boom , as shown in fig1 , thereafter being secured by engagement with a pair of generally parallel hook and loop material strips 89 which are adhesively or otherwise secured along the length of the upper portion of the boom . in this embodiment , one of the hook and loop fabric strips 87 or 88 is secured to one of the mating strips 89 on the boom and thereafter the body of the cushion is wrapped about the boom and the other of the hook and loop strips is secured to the other of the hook and loop fabric strips 89 secured to the boom . the present embodiment may also be formed of a sheet of soft resilient material which tapers inwardly along its length to thereby conform to a tapering boom in much the same manner as discussed with the embodiment shown in fig1 - 4 . with the present embodiment , the flexible body may be rolled upon itself , as shown in fig1 , and thereafter secured with a hook and loop fastening strap 90 to a mating pad 91 provided on the outer surface adjacent the opposite end 82 of the sheet so that , when not in use , the cushion may be conveniently and compactly stored . a further embodiment of the present invention is disclosed in fig1 - 17 . in this embodiment , the protective cushion 92 includes a pair of opposing generally flexible padded sections 93 . each of the sections 93 is made of a soft resilient material similar to the materials previously discussed . each section includes an upper elongated edge 95 and lower elongated edge 96 and opposite ends 97 and 98 . a single strip of a hook - and - loop or other type of fastening material 99 is secured along the inner surface 100 . the strip is applied so as to be spaced from both the upper and lower edges 95 and 96 , as is shown in fig1 . to mount the opposing sections 93 to the boom , a pair of mating hook - and - loop or other fastening materials 101 and 102 are applied along the length of the boom and on generally opposite sides thereof and slightly above the center line of the boom . when the strips 99 associated with each section are engaged with the either one of the strips 101 or 102 , the cushioned sections will hang relative to the engaged strips so that the lower edge of the section is suspended below the lower surface of the boom . when it is desired to store the protective cushion 92 , the sections 93 are simply pulled from there engaging relationship with the strips 101 and 102 boom and thereafter folded or rolled for storage . in each of the embodiments of the present invention , it is important that at least the outer surface , and preferably both the inner and outer surface , of each body portion or section of the cushion be coated with a moisture impermeable layer . the moisture resistant layer should be flexible so as to yield together with the material forming the body of the cushion but provide resistance to moisture seeping into the body of the cushion and protect the cushion from destruction from salt water . the foregoing description of the preferred embodiment of the invention have been presented to illustrate the principles and not to limit the invention to the particular embodiments illustrated . it is intended that the scope of the invention be defined by all of the embodiment encompassed within the following claims and their equivalence .
| 1 |
the securement arrangement for a seat belt closure , which can be seen in fig1 comprises an anchor piece 10 , which is secured to the vehicle in a not - illustrated manner , to which a closure body retaining assembly 11 is mounted , the closure body retaining assembly 11 being , in turn , connected with a closure body 12 , and the securement arrangement further comprising a closure tongue 13 , to which a not - illustrated seat belt of a three - point seat belt is secured , which is inserted into the closure body 12 . the closure body retaining assembly 11 is u - shaped with two u - forming legs 14 and a closed end 15 , whereby the free ends 21 of the u - forming legs 14 of the closure body retaining assembly 11 are connected with the closure body 12 . a fastening stone 16 is disposed between the u - forming legs 14 of the closure body retaining assembly 11 by means of which the closure body retaining assembly 11 is secured to the anchor piece 10 via a fastening bolt 17 extending through the u - forming legs 14 and the fastening stone 16 . additionally , a compression spring 18 is disposed between the u - forming legs 14 of the closure body retaining assembly 11 and is secured , on one side , to the fastening stone 16 and , on the other side , to the closed end 15 of the closure body retaining assembly 11 , the compression spring 18 biasing the closure body retaining assembly 11 and , thus , as well , the closure body 12 , into the home position toward the left as shown in fig1 in which the fastening stone 16 is in a disposition against a switch element 19 mounted on the closure body retaining assembly 11 . [ 0031 ] fig2 shows features of the afore - described securement arrangement in more detail , including , especially , the feature that the fastening stone 16 comprises a shoulder 20 for guiding of the compression spring 18 . it can be further seen that a retainer 23 is mounted on the closure body retaining assembly 11 for the switch element 19 and , additionally , that a fastening bolt 22 is provided by means of which the closure body 12 is mounted to the ends 21 of the u - forming legs 14 of the closure body retaining assembly 11 . it can be further seen in fig2 as well as in fig3 that longitudinal holes 24 are provided in the u - forming legs 14 of the closure body retaining assembly 11 which have the fastening bolt 17 extending therethrough , so that the closure body retaining assembly 11 , in connection with overcoming the bias exerted thereagainst by the compression spring 18 , is displaceable toward the right as viewed in the figures of the drawings within the bounds of the maneuver or free play room provided by the longitudinal holes 24 . in connection with a locked - together seat belt , so long as the tension imposed on the seat belt due to the loading thereof does not overcome the predetermined bias of the compression spring 18 , the arrangement of the closure body 12 , the closure body retaining assembly 11 , and the anchor piece 10 shown in fig1 - 3 remains as illustrated in which the switch element 19 secured to the closure body retaining assembly 11 is , via the biasing of the compression spring 18 , maintained in a disposition against the fastening stone 16 . in the event that the predetermined biasing force of the compression spring 18 is overcome , the closure body 12 is displaced toward the right , in that the longitudinal holes 24 in the u - forming legs 14 permit a displacement relative to the fixedly secured fastening bolt 17 , in the context of which the switch element 19 is lifted away from the fastening stone 16 and is thereby actuated . an electrical signal is transmitted , as a consequence of the switch actuation , to a control device mounted on the vehicle at which it is decided whether a dedicated airbag device is to be deployed or not . the additional embodiment shown in fig4 and 5 operates according to the same operating principle as the embodiment shown in fig1 - 3 , whereby , in a modification of the embodiment shown in fig1 - 3 , the closed end 15 of the u - shaped closure body retaining assembly 11 extends into a fastening opening 25 formed in an end of the anchor piece 10 . the compression spring 18 , which is again likewise provided , is supported against the closed end 15 of the closure body retaining assembly 11 and its other end is in engagement with the opposing edge of the fastening opening 25 of the anchor piece 10 . as can be seen in fig5 three compression springs 18 arranged adjacent one another provide better stabilization of the connection between the closure body retaining assembly 11 and the anchor piece 10 . to likewise promote such stabilization , tongues 26 extend axially outwardly of the closed end 15 of the closure body retaining assembly which enclose therebetween the anchor piece 10 and thus act as stabilizing guides for the anchor piece 10 . [ 0034 ] fig5 shows closer details of the configuration of the contact . thus , a shoulder 27 is provided on the anchor piece 10 extending in the direction toward the closure body 12 into the housing 28 of the closure body 12 , the shoulder being disposed against a permanent magnet 29 mounted on the closure body 12 which is biased via a spring 30 toward the shoulder 27 of the anchor piece . a hall effect switch 31 is arranged relative to the permanent magnet 29 such that the movement of the permanent magnet 29 relative to the hall effect switch 31 effects the emission of a signal . if , in connection with such movement , the closure body 12 has been displaced from its position as described with respect to fig1 - 2 toward the right against the biasing force of the compression spring 18 , the shoulder 27 on the anchor piece 10 lifts away from the permanent magnet 29 , which has been displaced by the spring 30 . this displacement is sensed by the hall effect switch 31 . the further embodiment shown in fig6 - 8 is distinguished from the two heretofore described embodiments in that solely the closure body 12 is moveably mounted relative to the closure body retaining assembly 11 . the closure body retaining assembly 11 , which , as before , is configured with u - forming legs 14 , corresponds to that shown in the embodiment described with respect to fig4 and 5 with its closed end 15 hooked into the fastening opening 25 of the anchor piece 10 . a tongue 32 extends out of one of the u - forming legs 14 of the closure body retaining assembly 11 and is bent inwardly between the u - forming legs 14 in a manner such that the tongue encloses the end of the anchor piece which extends over the fastening opening 15 of the anchor piece 10 ; this tongue 32 simultaneously serves as a hook for securing the end of a tension spring 33 whose opposing end is secured to the closure body 12 . the displacement of the closure body 12 relative to the closure body retaining assembly 11 is made possible by the provision of longitudinal holes 34 in the ends 21 of the u - forming legs 14 of the closure body retaining assembly 11 through which extend the fastening bolt 22 , the longitudinal holes providing the required free movement space for the displacement of the closure body 12 relative to the closure body retaining assembly 11 . in the event that the closure body is moved due to the load imposed thereon by the closure tongue 13 from its position shown in fig7 to the right against the biasing force of the tension spring 33 , the fastening bolt 22 mounted on the closure body 12 likewise moves to the right within the longitudinal holes 34 . in the same manner as heretofore described , a switch element comprised of a permanent magnet 29 , a spring 30 , and a hall effect switch 31 can be provided on the closure body 12 to emit signals corresponding to such a displacement , the shoulder 27 of the closure body retaining assembly 11 , which extends in the direction of the closure body 12 into its housing 28 , being in contact against the switch ( fig8 ); to this extent , the relationships with respect to the release of contact operate in the same manner as those described with respect to the additional embodiment described with respect to fig4 and 5 . to provide for better guiding of the closure body 12 on the closure body retaining assembly 11 , the longitudinal holes 34 in both u - forming legs 14 of the closure body retaining assembly 11 comprise different transverse extents , whereby the fastening bolt 22 comprises a correspondingly stepped transverse section corresponding to the transverse extents of both longitudinal holes 34 . in this manner , a step 35 is configured on the fastening bolt 22 on which is disposed the upper u - forming leg 14 having , as viewed in the illustration shown in fig7 the longitudinal hole 34 with the smaller transverse extent , whereby the stepped transverse section 35 of the fastening means guides the upper u - forming leg 14 during displacement of the closure body 12 relative to the closure body retaining assembly 11 . the specification incorporates by reference the disclosure of german priority document 101 63 917 . 1 filed dec . 22 , 2001 . the present invention is , of course , in no way restricted to the specific disclosure of the specification and drawings , but also encompasses any modifications within the scope of the appended claims .
| 1 |
fig1 depicts , in a simplified block diagram , a computer system 100 suitable for implementing embodiments of the present system . computer system 100 has central processing unit 110 ( also referenced herein as cpu 110 ), which is a programmable processor for executing programmed instructions stored in memory 108 . memory 108 can also comprise hard disk , tape or other storage media . while a single cpu 110 is depicted in fig1 , it is understood that other forms of computer systems can be used to implement the present system . it is also appreciated that the present system can be implemented in a distributed computing environment having a plurality of computers communicating via a suitable network 119 . cpu 110 is connected to memory 108 either through a dedicated system bus 105 and / or a general system bus 106 . memory 108 can be a random access semiconductor memory for storing application data for processing such as that in a database partition . memory 108 is depicted conceptually as a single monolithic entity but it is well known that memory 108 can be arranged in a hierarchy of caches and other memory devices . fig1 illustrates that operating system 120 may reside in memory 108 as well as trace facility 122 and trace buffer 124 ( also referenced herein as trace history buffer 124 ). trace buffer 124 is a segment of memory 108 used by trace facility 122 for capturing trace data for a running program . the trace buffer 124 is configurable with regard to size ( number of trace records ). it may also be known as a circular buffer due to the nature in which new records overwrite old records after the buffer space has been filled . new data wraps around and replaces old data in a cyclical manner . operating system 120 provides functions such as device interfaces , memory management , multiple task management , and the like as known in the art . cpu 110 can be suitably programmed to read , load , and execute instructions of operating system 120 . computer system 100 has the necessary subsystems and functional components to implement selective program tracing functions such as gathering trace records and historical data as will be discussed later . other programs ( not shown ) comprise server software applications in which network adapter 118 interacts with the server software application to enable computer system 100 to function as a network server via network 119 . general system bus 106 supports transfer of data , commands , and other information between various subsystems of computer system 100 . while shown in simplified form as a single bus , bus 106 can be structured as multiple buses arranged in hierarchical form . display adapter 114 supports video display device 115 , which is a cathode - ray tube display or a display based upon other suitable display technology . the input / output adapter 112 supports devices suited for input and output , such as keyboard / mouse device 113 , and a disk drive unit ( not shown ). storage adapter 142 supports one or more data storage devices 144 , which could comprise a magnetic hard disk drive or cd - rom , although other types of data storage devices can be used , including removable media . adapter 117 is used for operationally connecting many types of peripheral computing devices to computer system 100 via bus 106 , such as printers , bus adapters , and other computers using one or more protocols including token ring , lan connections , etc . as known in the art . network adapter 118 provides a physical interface to a suitable network 119 , such as the internet . network adapter 118 comprises a modern that can be connected to a telephone line for accessing network 119 . computer system 100 can be connected to another network server via a local area network using an appropriate network protocol and the network server that can in turn be connected to the internet . fig1 is intended as an exemplary representation of computer system 100 by which embodiments of the present invention can be implemented . it is understood that in other computer systems , many variations in system configuration are possible in addition to those mentioned here . fig2 is a process flow chart describing the steps in the process of an embodiment of the present system that begins with operation 200 wherein all normal setup activity required to run a program and initialize trace facility 122 of fig1 has been performed . during operation 210 , a program is set into execution mode as would be normal and processing moves to operation 220 wherein tracing of the program is initiated . as trace data is collected during operation 220 , the collection reaches a predetermined point where the data is written out as a trace record into a trace history buffer 124 during operation 230 . trace buffer 124 is typically contained in more volatile storage or memory of the system such as memory 108 of fig1 . during normal activity , trace records fill the trace buffer 124 and overwrite older records causing trace buffer 124 of fig1 to be viewed as a circular buffer . it is circular in the sense that upon filling the buffer , the oldest records are overwritten by newer records in a cyclical manner . each of the trace records has a trace level associated with it such as ‘ fatal ’, ‘ warning ’, or ‘ info ’ or it may be in numeric form such as ‘ 1 ’, ‘ 2 ’, and ‘ 3 ’ or alphanumeric . the number of levels of trace is dependent upon the level of granularity of control desired . the trace levels range between a high and low severity based on impact within the running program . the tracing facility has a configurable overall logging level that is used to determine if a trace record is to be written to a log file ( typically persistent storage such as that of storage device 144 of fig1 ). for example if a trace record is deemed to be at a high enough level , such as ‘ fatal ’, the record may be written out to the log file . the trace record written during operation 230 is then examined during operation 240 to determine if it exceeds an established threshold value . when the trace record level exceeds the threshold , the trace record is written to a persistent log file during operation 250 . otherwise processing reverts to operation 210 wherein tracing of the running program is performed as before . the trace facility 122 also has a configurable history level that is used to determine at what level of severity the content of the trace buffer 124 is caused to be written to the log file . typically this level would be set low such as that of ‘ info ’ so as to capture any history data related to an error condition . having written a trace record in operation 250 , processing moves to operation 260 during which a determination is made regarding existence of a specific trap value . a trap value is a specified value used as a trigger or signal to initiate logging of history data for a specific program activity . such a trap value may be a condition code unique to a program event or process of interest or other suitable programmable indicator . a trap value may be a single value or a multiple of such values , anyone of which would become a trigger value . the trap value is more specific than other trace values that are more suited to classes of program activity . if a trap value has been specified as the target of a trace and that value is encountered in a trace , processing moves to perform the actions of operation 270 wherein the content of trace buffer 124 ( history data ) is written to the log file during operation 270 . otherwise the level of that trace record is compared to a history trace threshold value during operation 265 . if it is determined that the trace record level exceeds the level of the history trace threshold , processing moves to perform the actions of operation 270 just stated . otherwise processing reverts to operation 210 wherein tracing of the running program is performed as before . having written the content of trace buffer 124 ( history data ) to the log file during operation 270 processing moves to operation 280 during which it is determined if trace buffer 124 is in need of resizing . if a resizing requirement is determined during operation 280 , processing moves to operation 285 where the necessary storage is allocated . processing then moves to operation 290 during which trace buffer 124 is reset and cleared . if during operation 280 it was determined that no resizing of trace buffer 124 was required processing would move directly to operation 290 during which trace buffer 124 is reset and cleared . processing then reverts to operation 210 wherein tracing of the running program is performed as before and the steps are repeated as needed . during normal operation when the logging or tracing facility is set to a first level ( less than maximum ), the highest level of trace detail active at that time is recorded to trace buffer 124 . the number of log or trace records stored in trace buffer 124 may be configured based on size of memory allocation available or perhaps number of records desired . when trace facility 122 detects an error and logging or tracing has not been set to a second level ( the maximum ) then the facility may automatically write the contents of trace buffer 124 to a log . the data written to the log provides another level of detail and prior program history needed to diagnose a problem without having to raise the log level and recreate the problem . tracing can be kept at a low level until more detailed information is required at which time tracing is then automatically set to a higher level . variations of providing a trigger value to the tracing facility could come in various forms . the trigger could come from a hardware signal , such as an interrupt or a state machine programmed to monitor trace records to determine heuristically if an event has occurred a specified number of times in absolute terms or occurred a number of times within a specified time interval . the history buffer can be any means providing a capability to store trace data records for future use while having control over the amount or size of storage space consumed . for example if an error is found to be occurring frequently , the trace facility 122 could provide a form of expanded or secondary allocation of storage to capture more data as required . this secondary allocation can also be controlled through known means to avoid total exhaustion of memory 108 . it is to be understood that the specific embodiments of the invention that have been described are merely illustrative of certain application of the principle of the present invention . numerous modifications may be made to the system and method for automatically collecting trace detail and history data invention described herein without departing from the spirit and scope of the present invention .
| 6 |
the present invention provides a hydration bag and a method for manufacturing a hydration bag . in a first embodiment , the flat inventive hydration bag contains an interior space having an osmotic agent contained within . however , the nature and character of the osmotic agent allows for a wide - ranging flexibility of uses for the hydration bag . for example , when the osmotic agent is simply composed of a formulation of sugars and salts , the hydration bag will create an electrolyte solution suitable for drinking or even ( when pre - sterilized ) intravenous administration . the hydration bag can have dehydrated blood components for reconstitution , or even dehydrated food for creation of meals by hydration without the need to boil water in a cooking process . in the first flat bag embodiment designed for single use systems , after sealing the bag with the osmotic agent inside , the outside of the bag can be sprayed with a glycerin solution and allowed to dry . the dried bag or a number of bags can be sealed inside a polyethylene sack . this sack can then be autoclaved to sterilize the contents and the bags will be shelf - stable for years . sealing three sides , adding the osmotic agent , and sealing the fourth side is a preferred method for sealing of the bags . in yet another embodiment ( fig1 ) of the flat hydration bag , one can add plastic stiffener bars ( from about 2 mm to about 5 mm diameter or length ) on the sides of the hydration bag . this makes the solution contact more membrane during the earlier stages of the hydration , and significantly speeds up the process . the spiral wound membrane element comprises a center tube element at the center of the spiral wound element having perforations that communicate with the inside of the membrane envelope . the center tube further comprises a refillable chamber for holding the osmotic agent . preferably , the spiral wound first embodiment is best used for military or backpacking applications . in this application a person would carry a membrane element that could be loaded with osmotic agent , preferably having some nutrient or even medicinal utility and preferably in a powder or syrup form . within 15 minutes this spiral wound embodiment of the inventive hydration bag will begin producing a dilute solution having the nutrient or medicinal function according to the osmotic agent used . for example a nutrient solution is a balanced oral rehydration drink with a concentration of 1 to 3 % solids ( by weight ), and it would be produced at a constant rate for 6 to 12 hours . the size of the hydration bag is according to the desired use and desired degree of portability but is scalable to almost any size . a table of the expected performance versus size is shown below : membrane nutrient total element weight weight size rate fluid / charge 500 g 250 g 30 cm × 0 . 7 liter / hr 7 - 10 liters 6 cm dia 300 g 150 g 20 cm × 0 . 4 liter / hr 3 - 5 liters 6 cm dia a drawing of the device is shown in fig4 and 6 . fig4 shows an end view of the spiral wound membrane element and a side cross - section , while fig6 shows the spiral wound membrane element as it would appear if it were unwound . to operate the spiral wound membrane element , nutrient powder or syrup ( osmotic agent ) is introduced into the osmotic agent chamber through an osmotic agent port . the osmotic agent port is plugged , and the spiral wound membrane element is placed in any available water . the element operation is unhindered by highly turbid dirty water . the available or dirty water comprises a dirty water chamber or bag that is carried or worn is a backpacking embodiment . ambient or available water from a questionable source is used to fill the dirty water spacer through the openings , optionally located on either end . initially water is pulled through the membrane element because during filling of the osmotic agent or nutrient powder , a small amount of the powder migrates from the osmotic agent chamber through the transfer holes into the nutrient channel and comes into contact with the membrane . when the dirty water is introduced , this osmotic agent in the form of a dry powder or syrup hydrates by osmotically pulling water from the dirty water channel across the membrane . a diluted clean ( nutrient ) solution then fills the nutrient channel , and some of the solution enters the osmotic agent chamber , gradually diluting the nutrient there . the device could be used in two ways . firstly , the spiral wound membrane element is loaded with osmotic agent in the form of a nutrient mix ( or one having medicinal value ) and placed in a questionable purity water source overnight . the clean ( nutrient ) solution produced would be collected in a bag and drunk as needed . the second use would be to load the spiral wound membrane element osmotic agent chamber with nutrient solution syrup and put the spiral wound membrane element in a bag as shown in fig5 . in this “ backpacking ” application , dirty water is carried with the user and during the day the nutrient solution fills the nutrient drink section of the bag . the user could drink the solution as it is produced during the day through a tube from the bottom of the bag . the spiral wound membrane element embodiment of the inventive hydration bag can be reused if it is stored in a dilute sterilizer solution . for example , for storage , the spiral wound membrane element is detached from the drink collector bag and placed in a sealed , water - filled container with an initial concentration of iodine , chlorine or sodium metabisulfite below 25 ppm . the sterilizer solution can pass through the membrane to sterilize the entire spiral wound membrane element . upon reuse , the storage water is discarded and very little oxidizer remains in the spiral wound membrane element . as a result , little off - taste is imparted to the later - made nutrient drink . the oxidizer will eventually degrade the membrane , but it expected that at least 50 uses will be obtained . after many uses , the ability of the spiral wound membrane element to keep the sugar from crossing into the dirty water chamber will be degraded and the element will begin to produce less drink . the size of sugar molecules is far smaller than any biological agents so the element will continue to block biological contamination even as its performance degrades . this loss in drink volume produced will indicate a new membrane element is needed . another feature of the spiral wound membrane element embodiment of the inventive hydration bag that helps it avoid fouling is the “ self - flushing ” design of the dirty water channel . during operation , dissolved solids in the dirty water tend to be concentrated in the dirty water channel as water is pulled into the nutrient channel . if the solids are not flushed out they can reduce performance or precipitate in the channel . the spiral wound membrane element embodiment of the inventive hydration bag device avoids this problem because when it is completely immersed in water with its exit tube pointing up ( out of the water it is immersed in ), water in the dirty water channel that becomes concentrated with solids will flow out the bottom of the element . this happens due to the increase in density of the solids - enriched water . a significant , and very desirable feature of the spiral wound membrane element embodiment of the inventive hydration bag is it produces a dilute nutrient solution at a constant rate with a simple - to - operate device . the drink is potentially sterile and good tasting , and the powder or syrup used to load the device is a nutrient that the user needs to ingest in any case . moreover , a 100 g charge of osmotic agent / nutrient , for example , produces 3 - 5 liters of drink that , in most circumstances , is enough for a hiker or soldier for a day . the combined weight of the element and powder to produce drinking water for a week is 1 kg . two factors enabling the steady production of a dilute drink are ( 1 ) the center tube of the spiral wound membrane element has a limited number of holes . this keeps the osmotic agent / nutrient from dissolving quickly and keeps the supply of osmotic agent / nutrient to the osmotic agent / nutrient channel slow and steady . moreover , ( 2 ), to exit , the osmotic agent / nutrient must spiral to the outermost portion of the membrane element and then spiral back in . this is accomplished by putting a plug in the center tube between the nutrient chamber and the exit , and by putting a glue line in the nutrient channel to force the solution spiral outward and back in . the reason for this feature is to only allow the most dilute solution from the element . in the second embodiment of the spiral design , the element has a similar construction as the first embodiment . that is it has a plug in the center tube and a glue line down the center of the membrane envelope which forces fluid flow to spiral to the outside of the element and back in again . however in the second embodiment the dirty water is fed through the element and a nutrient syrup is fed to the outside of the membrane envelope . in this design the syrup is fed continuously and the element is capable of producing more concentrated drink in high volumes . this design would be useful in truck mounted or stationary aid stations for refugee populations , or for mobile kitchens for the military . in a third embodiment illustrated in fig9 the membrane of this embodiment is configured in a plate and frame format instead of a spiral wound format . the membranes used in the inventive hydration bags ( in any configuration ) are hydrophilic , cellulose - ester based membranes with salt rejections in the 80 % to 95 % range when tested as reverse osmosis membrane ( 60 psi , 500 ppm nacl , 10 % recovery , 25 ° c .). preferably , the membranes are asymmetric and are formed by the immersion precipitation process . the membranes are either unbacked , or have a very open backing that does not impede water reaching the rejection layer , or are hydrophilic and easily wick water to the membrane . the flat embodiment hydration bags are preferably formed with the rejection side ( i . e ., non - backed side ) facing towards the inside . this is done so the sugar or other osmotic agents do not need to diffuse through the porous sublayer of the membrane to reach the rejection layer . the flux rates are higher with this configuration than with the membrane rejection layer to the outside . the membrane used in the spiral wound element embodiment is preferably a hydrophilic , cellulose - based membrane cast by the immersion precipitation process . the nominal molecular weight cut - off of the membrane is 100 daltons . the inventive hydration bags remain sterile on the inside after immersion because a preferred asymmetric membrane has a molecular - weight cutoff of 150 to 300 daltons . the smallest infectious microbial agents have a molecular weight over 10 , 000 . the hydration bags might be used as is for iv solution bags as well as drinkable solutions . another method of making the inventive hydration bags is to spray a solid border on the support fabric before casting the membrane on it . the membrane is cast onto a drum . hydration bags are preferably made from a casted membrane made from a hydrophilic membrane material , for example , cellulose acetate , cellulose proprianate , cellulose butyrate , cellulose diacetate , blends of cellulosic materials , polyurethane , polyamides . preferably the membranes are asymmetric , that is the membrane has a thin rejection layer on the order of 10 microns thick and a porous sublayer up to 300 microns thick . for mechanical strength they are in one embodiment cast upon a hydrophobic porous sheet backing , wherein the porous sheet is either woven or non - woven but having at least about 30 % open area . preferably , the woven backing sheet is a polyester screen having a total thickness of about 65 microns ( polyester screen ) and total asymmetric membrane is 165 microns in thickness . preferably , the asymmetric membrane was caste by an immersion precipitation process by casting the cellulose material onto the polyester screen . in a preferred embodiment , the polyester screen was 65 microns thick , 55 % open area . in a second support sheet embodiment , the membrane is cast on a dense hydrophilic material which wicks water easily through it . backings that have this property include , for example , cotton paper and surface modified polypropylene . for bag production , casted asymmetric membrane material had the water in it replaced with glycerin . however , one can use other materials , such as soaps or ethylene glycols or other glycols . however , glycerin is appropriate because it is food grade . the asymmetric membrane is immersed in a glycerin bath and the glycerin , by diffusion , replaces the water . cellulosic membranes are difficult to seal due to the weakness of the porous sublayer and the nonweldability of cellulose . one technique used to weld membrane to windows in polymeric sheets employed a solvent welding step . borders are laid out ( painted on or sprayed on the membrane ) with acrylic solvent by solvent welding to the backed side of the membrane . on a piece of medical - grade pvc , a window is cut out ( about 18 × 25 cm ) and piece of membrane with acrylic borders is radio frequency welded such that the membrane covers the window in the pvc sheet . preferably , the backing side of the membrane is welded to the frame of the window on the pvc sheet . a hydration bag can have either a one - sided membrane or a two - sided membrane . a one - sided hydration bag is designed to float on the surface of water , membrane - side down . a two - sided hydration bag was designed to have a vertical alignment in a body of water , such that the outer membrane surface areas is preferably immersed in the water . for the one - sided hydration bag , a second , solid sheet of pvc is welded ( radio frequency welding process is preferred ) to the first sheet of pvc ( having a window with a membrane attached thereto . preferably the welding of the two pvc sheets is done with a larger , circumferential perimeter weld layer . the outer weld is made such that the membrane / pvc weld is not subject to as much stress . in a two - sided embodiment , the pvc - windowed sheets are welded to each other , again with the pvc / pvc weld in an outer circumferential location . preferably , an osmotic agent is placed within the interior space formed by welding the pvc sheets . in the one - sided 18 × 25 area membrane hydration bag , approximately 100 g of dextrose powder was added as an osmotic agent . another process for producing the inventive hydration bags is to cast the membrane onto a weldable hydrophilic backing . weldable hydrophilic backings include , for example , dense polypropylene nonwoven fabric that has been surface modified with acrylic acid to make it hydrophilic . the membrane for use in the inventive hydration bag is cast so that it does not penetrate the weldable hydrophilic backing . the weldable hydrophilic backing is then be welded to itself or to a pvc window to form the inventive hydration bag according to the embodiments described herein . if it is welded to itself the bag produced will have its membrane face outward , that is the weldable backing material will be inward within the hydration bag . if the membrane having the weldable hydrophilic backing is welded to a window cut within a polymeric sheet ( e . g ., pvc ), the membrane faces inward again and the weldable hydrophilic backing side of the membrane will face outward on this embodiment of the inventive hydration bag . in either case no solvent welding of the membrane is required . the second embodiment inventive hydration bag can be a smaller bag that can be carried by a backpacker or a soldier ( fig5 ) or a larger hydration design spiral - wound element ( fig2 ). the spiral wound membrane element is similar to a conventional spiral wound ro ( reverse osmosis ) element except there is a glue line down the center of the membrane envelope on the permeate side , and there is plug in the center of the permeate tube . the second embodiment inventive hydration bag operates by introducing any water available to what would be the permeate side of the ro element . a syrup ( osmotic agent ) is then introduced to the feed side and osmosis pulls water from the water side of the membrane into the sugar . a small amount of water is continually drained from the element to prevent the build - up of contaminants on the water side of the membrane . fluid moves from the syrup bag to the dilute bag , even though the dilute bag is higher , because of density differences between the dilute and concentrated fluids . as the syrup becomes diluted in the element its density decreases and the column of dilute fluid above the element is higher than the column of syrup . this height difference can be used to set the concentration of the fluid coming out . this setting will be determined during the design phase and will not need to be adjusted in the field . another method of adjusting the rate of osmotic agent being fed to the element is to use a drip system similar to that used in iv applications to supply osmotic agent to the bottom of the element . initial testing of an element with about 0 . 3 m 2 membrane produced 20 ml / min of a 10 % glucose with a 60 % glucose feed at 30 ° c . a 35 cm diameter by 60 cm long spiral wound membrane element produces about 1 liter / min of a 5 to 10 % solution . the application for this system is in relief work where getting water to the site is difficult . the powder in the bag should be primarily a monosaccharide ( e . g ., glucose ) but can contain flavors , salts , vitamins or medicines as desired . the hydration time for a single bag in a horizontal orientation was 1 . 2 l in 7 hrs and 40 min at 16 . 5 ° c . a preferred osmotic agent was sodium chloride = 6 . 21 wt %, potassium chloride = 7 . 92 wt %, trisodium citrate = 10 . 41 wt %, glucose = 58 . 24 wt %, and fructose = 17 . 22 wt %. other osmotic agents ( or hydration formulations ) include , for example , medicines within a dextrose formulation , dehydrated foods , and any other solute that can be hydrated with water . the nutrients form of osmotic agents can be powders or syrups made from the following : fructose , sucrose , glucose , sodium citrate , potassium citrate , citric acid , potassium ascorbate , sodium ascorbate , ascorbic acid , water soluble vitamins , sodium chloride , and potassium chloride . for example , a mixture of 60 % fructose , 10 % potassium citrate , 10 % sodium citrate and 20 % water was tested in the 30 cm element and had performance similar to 80 % fructose - 20 % water nutrient syrup . the preferred osmotic agents that are nutrients include , for example , fructose , glucose , sucrose , sodium citrate , potassium citrate , sodium ascorbate , potassium ascorbate , and other water - soluble vitamins . flavorings and aspartame can be added to improve the taste . this example illustrates the manufacturing of a batch of inventive hydration bags that were used for testing in the subsequent examples . the subsequent examples tested the hydration bag for permeation by various agents , including black pigment - based ink , bacterium escherichia coli , bacteriophage ms2 , bacteriophage m13 mp18 ( a derivative of the f1 coliphage ); purified dna from m13 phage . hydration bags were made from a casted membrane made from cellulose triacetate ester , asymmetric with a polyester screen having a total thickness of 65 microns ( polyester screen ) and total membrane is 165 microns . the asymmetric membrane was caste by an immersion precipitation process by casting the cellulose material onto the polyester screen . the polyester screen was 65 microns thick , 55 % open area . casted asymmetric membrane material had the water in it replaced with glycerin . the asymmetric membrane was immersed in a glycerin bath and the glycerin , by diffusion , replaced the water . borders were laid out ( painted on or sprayed on the membrane ) with acrylic solvent by solvent welding to the backed side of the membrane . on a piece of medical - grade pvc , a window was cut out ( about 18 × 25 cm ) and radio frequency weld the pvc sheet to the membrane such that the membrane the window in the pvc sheet . preferably , the backing side of the membrane was welded to the frame of the window on the pvc sheet . this process was repeated many times for each hydration bag . a hydration bag can have either a one - sided membrane or a two - sided membrane . one - sided hydration bags were used for the tests described below . for the one - sided bag , a second , solid sheet of pvc was welded ( radio frequency welding ) to the first sheet of pvc ( having a window with a membrane attached thereto ). the welding of the two pvc sheets was done with a larger , circumferential perimeter weld layer . the outer weld was made such that the membrane / pvc weld was not subject to as much stress . an osmotic agent was placed within the interior space formed by welding the pvc sheets . in the one - sided 18 × 25 area membrane hydration bag , approximately 100 g of dextrose powder was added as an osmotic agent . this example provides an experiment wherein the inventive hydration bag was tested for permeation through the membrane and structures the inventive hydration bag . the bag was immersed in a suspension of diluted black inkjet ink made from pure carbon - based pigment particles ( cone editions , inc ., bradford , vt .). the diameter of the pigment particles was in the range of 0 . 4 - 1 . 0 μm . the bag was kept immersed in 2 liters of ink for 1 hour and then for 24 hours . approximately 250 ml of water accumulated inside the bag . measuring light absorption of the accumulated water - sugar solution in a beckman spectrophotometer using ink dilutions as controls carried out evaluation of ink permeation . the results are shown in table 1 . this example provides an experiment wherein the inventive hydration bag was tested for e . coli permeation through the membrane and structures the inventive hydration bag . e . coli ( non - pathogenic laboratory strain hb 101 ) was grown in liquid lb medium overnight ( lb medium ( per liter ; in di water ): 10 g trypton ( difco ), 5 g yeast extract ( difco ), 5 g nacl ( sigma ), 1 ml 1n naoh . sterilized in autoclave ). two parallel cell suspensions were diluted to a density of 10 6 and 10 8 bacteria per ml culture in a 4 - liter plastic container . two inventive hydration bags were immersed into the bacterial suspension ; one for 1 hour and the other for 24 hours at room temperature (˜ 21 ° c .). passage of bacteria through the membrane was tested by colony counts on lb - agar plates . the container and liquids with bacteria were disinfected with clorox ® bleach after each experiment . a control experiment was carried out to test if the osmotic formulation water - sugar solution affected in any way viability of the bacteria . for this purpose , a bacterial suspension ( 10 3 cells per ml ) was incubated for 1 hour and 24 hours in the ( tainted ) water - sugar solution produced in the bags , followed by assessing plating efficiency . this example provides an experiment wherein the inventive hydration bag was tested for m3 phage permeation through the membrane and structures the inventive hydration bag . m13 ( strain mp18 ), a known derivative of the non - pathogenic f1 filamentous coliphage , was grown in the non - pathogenic laboratory strain e . coli jm 101 . this phage particle carries a single - stranded dna genome . the phage was produced in the bacterial host by infecting a liquid culture of e . coli in lb medium overnight . bacteria were precipitated by centrifugation and the phage particles were purified from the growth medium by precipitation with polyethylene glycol ( peg ) solution ( 5 ×; in 700 ml h 2 o : 414 g peg 6000 , 12 g dextran sulfate , 99 g nacl .) and re - suspension in the 4 - liter water sample , in which the hydration bags were immersed . phage concentrations were assessed by counting the phage plaques on continuous lawns of e . coli cells in petri dishes . two phage dilutions were used in a 4 - liter plastic container : 10 7 and 10 9 phage particles per ml . two hydration bags were immersed into the phage suspension ; one for 1 hour and the other for 24 hours at room temperature (˜ 21 ° c .). passage of phage through the membrane was tested by infecting a 10 - ml culture of e . coli , followed plaque counts on lb - agar plates in a continuous lawn of e . coli . the container and liquids with bacteria and phages were disinfected with clorox ® bleach after each experiment . these data demonstrated no passage ( permeation ) of the m13 phage through the membrane of the hydration bag . statistical analysis of the data was not needed . this example provides an experiment wherein the inventive hydration bag was tested for ms2 phage permeation through the membrane and structures the inventive hydration bag . these tests were carried out with the ms2 bacteriophage in the same way ( see above ) as the experiments with m13 phage ( example 3 ), except that the phage particle concentrations in the 4 - liter water sample were 10 6 / ml and 10 8 / ml . the results were similar in that no phage particles passage through the membrane was observed . this example provides an experiment wherein the inventive hydration bag was tested for m13 phage permeation through the membrane and structures the inventive hydration bag . the dna of the m13 phage was used in a series of experiments designed to test if an infectious viral dna were able to penetrate through the hydration bag &# 39 ; s membrane . m13 dna is a circular single - stranded molecule of ˜ 7 , 250 nucleotides , which corresponds to a molecular weight of approximately 2 . 4 × 10 6 daltons . in comparison , the double - stranded circular dna of the poliovirus is of 4 , 500 - nucleotide pairs , corresponding to ˜ 3 × 10 6 daltons . phage dna was purified from the phage particles obtained from the e . coli liquid culture supernatant by peg precipitation ( see method in example 4 ). the phage pellet precipitated by peg was re - suspended in 2 ml of te buffer ( 10 mm tris . hcl , ph 7 . 5 ; 1 mm edta ) extracted with 1 ml of buffered phenol , and the dna was precipitated with 3m sodium acetate and dried after washing with 70 % cold ethanol . 2 mg of phage dna was dissolved in 4 liters of test water , and the hydration bags were immersed for 1 hour and 24 hours , consistently to the experimental conditions described in examples 2 - 5 above . the phage dna was collected from 100 ml of water samples from inside and outside the bags by running through a deae - cellulose ion exchange chromatography column ( 1 × 3 cm ). bound dna was eluted in 1 ml 0 . 45 m licl , and used directly to transfect e . coli . phage plaques were formed overnight and counted ( table 4 ). this example illustrates the making of a second embodiment inventive hydration bag having a spiral wound membrane element . the membrane element was a 30 cm by 6 cm diameter membrane having a total area of about 0 . 65 m 2 . the nutrient or osmotic agent was 300 g of an 80 % fructose solution . when immersed in 20 ° c . water the element began producing 1 . 4 bx solution within 10 minutes . the production was steady at 900 to 1000 ml / hour and 1 . 2 to 1 . 4 bx for the first 6 hours . after 24 hours the element had produced 14 liters of solution averaging 1 . 1 bx . this example illustrates the making of a second embodiment inventive hydration bag having a spiral wound membrane element . the membrane element was 16 cm by 6 cm diameter with a membrane having a surface area of about 0 . 3 m 2 . the nutrient / osmotic agent was 140 g of an 80 % fructose solution . when immersed in 20 ° c . water the membrane element began producing 1 . 4 bx solution within 10 minutes . the production was steady at 400 to 450 ml / hour and 1 . 1 to 1 . 4 bx for the first 6 hours . after 24 hours the element had produced 6 liters of solution . this example illustrates the making of a second embodiment hydration bag having a spiral wound membrane element . an element with the following characteristics was constructed : the element was immersed in 25 ° c . water and after 15 minutes began producing a 2 % solution of gatorade ® at a rate of 20 ml / min . the production rate remained steady for 6 hours in which time it had produced 6 . 7 liters with an average strength of a 2 . 2 %. after 20 hours it had produced 12 liters with an average strength of 1 . 7 %.
| 1 |
embodiments of the present invention will now be described in greater detail with reference to the drawings . [ 0042 ] fig1 is a diagram illustrating the configuration of a crossbar switch system according to an embodiment of the present invention . as shown in fig1 the system includes eight nodes 0 to 7 , nine cross - bar switches 10 to 18 , a failure processing circuit 20 , and selection circuits 0 - 0 to 0 - 7 , . . . , 7 - 0 to 7 - 7 , 11 - 0 to 11 - 7 , . . . , and 17 - 0 to 17 - 7 . the nodes 0 to 7 are identically constructed and so are the crossbar switches 10 to 18 . each of the cross - bar switches 10 to 18 has eight input ports , eight output ports , an 8 × 8 cross - bar switch unit ( not shown ) and a connection controller ( not shown ) for controlling switching of the input and output ports to the cross - bar switch unit . each port is constructed to input or output data on a per - byte ( 8 - bit ) basis . fig1 is mainly for the purpose of describing the principle of the present invention ; the number of nodes , for example , is not limited to eight , as a matter of course . as for the cross - bar switches and the failure detection , reference is made to jp - a - 11 - 331374 which is incorporated herein by reference thereto . data communicated between any two nodes of the nodes 0 to 7 is transferred from the source node to the destination node by the crossbar switches 10 to 18 . the data width of data communication between two nodes is eight bytes ( 8 × 8 = 64 bits ), by way of example . byte - 0 data of the 8 - byte data output from respective ones of the nodes 0 to 7 is input to the crossbar switch 10 at a respective one of the eight input ports . with regard to cross - bar switch 11 , byte - 0 data and byte - 1 data output from node 0 is input to the selection switch 11 - 0 , the output of the selection switch 11 - 0 is applied to the first input port of the cross - bar switch 11 , byte - 0 data and byte - 1 data output from node 1 is input to the selection switch 11 - 1 , and the output of the selection switch 11 - 1 is applied to the second input port of the cross - bar switch 11 . similarly , byte - 0 data and byte - 1 data output from node 7 is input to the selection switch 11 - 7 and the output of the selection switch 11 - 7 is applied to the eighth input port of the cross - bar switch 11 . in response to a control signal from the failure processing circuit 20 , the selection circuits 11 - 0 to 11 - 7 select one of byte - 0 data and byte - 1 data in the 8 - byte data output from the nodes 0 to 7 and output the selected data to the cross - bar switch 11 . the selection circuits 11 - 0 to 11 - 7 select the byte - 1 data in the absence of a failure and select the byte - 0 data when the crossbar switch 10 fails ( see fig4 described later ). with regard to cross - bar switch 17 , byte - 6 data and byte - 7 data output from node 0 is input to the selection switch 17 - 0 , the - output of the selection switch 17 - 0 is applied to the first input port of the cross - bar switch 17 , byte - 6 data and byte - 7 data output from node 1 is input to the selection switch 17 - 1 , and the output of the selection switch 17 - 1 is applied to the second input port of the cross - bar switch 17 . similarly , byte - 6 data and byte - 7 data output from node 7 is input to the selection switch 17 - 7 and the output of the selection switch 17 - 7 is applied to the eighth input port of the cross - bar switch 17 . the byte - 7 data in the 8 - byte data output from each of the nodes 0 to 7 enters respective ones of the eight input ports of crossbar switch 18 . the data output from the cross - bar switches 10 to 18 is selected by the selection circuits 0 - 0 to 0 - 7 , 1 - 0 to 1 - 7 , 7 - 0 to 7 - 7 and input to the nodes 0 to 7 . the selection circuit 0 - 0 corresponding to node 0 receives as inputs the byte - 0 data output from the first output port of cross - bar switch 10 and the byte - 0 data output from the first output port of cross - bar switch 11 , selects one of these inputs based upon the control signal from the failure processing circuit 20 and outputs the selected data to the node 0 . the selection circuit 0 - 7 corresponding to node 0 receives as inputs the byte - 7 data output from the first output port of cross - bar switch 17 and the byte - 7 data output from the first output port of cross - bar switch 18 , selects one of these inputs based upon the control signal from the failure processing circuit 20 and outputs the selected data to the node 0 . similarly , the selection circuit 7 - 0 corresponding to node 7 receives as inputs the byte - 0 data output from the eighth output port of cross - bar switch 10 and the byte - 0 data output from the eighth output port of cross - bar switch 11 , selects one of these inputs based upon the control signal from the failure processing circuit 20 and outputs the selected data to the node 7 . the selection circuit 7 - 7 selects byte - 7 data , which is output from the eighth output port of cross - bar switch 17 and the eighth output port of cross - bar switch 18 , based upon the control signal from the failure processing circuit 20 and outputs the selected data to the node 7 . on the basis of failure information relating to a failure that has occurred , the failure processing circuit 20 outputs the selection control signal to the selection circuits 0 - 0 to 0 - 7 , 1 - 0 to 1 - 7 , 7 - 0 to 7 - 7 , 11 - 0 to 11 - 7 , 17 - 0 to 17 - 7 . [ 0055 ] fig2 illustrates an example of the internal structure of the node 0 to 7 show in fig1 . each node is composed of four cpus 100 to 103 , a memory controller 104 , a memory 105 and an input / output ( i / o ) controller 106 . each of the cpus 100 to 103 performs memory access and i / o access via the memory controller 104 . in a case where a cpu accesses the memory 105 within its own node , the memory 105 is accessed from the memory controller 104 . however , when a memory within another node is accessed , the access re quest is sent from the memory controller 104 to a memory controller of the other node via a cross - bar switch , thereby accessing the memory within the other node . [ 0058 ] fig3 illustrates the internal structure of the failure processing circuit 20 shown in fig1 . the failure processing circuit 20 outputs the selection control signal to the selection circuits 0 - 0 to 7 - 7 , 11 - 0 to 17 - 7 after the system is restarted , for example , whereby control is performed in such a manner that the faulty crossbar switch is taken out of service and the redundant crossbar switch is placed in service . failure information concerning the crossbar switches 10 to 18 output from a system controller enters a 9 - bit crossbar switch failure information register 200 . each bit of the register 200 holds information as to whether the respective one of the cross - bar switches 10 to 18 is faulty or not . the information from the crossbar switch failure information register 200 is output to a selection - circuit control output circuit 201 . on the basis of this information , the selection - circuit control output circuit 201 outputs a selection control signal to each of the selection circuits 0 - 0 to 7 - 7 , 11 - 0 to 17 - 7 . the information from the crossbar switch failure information register 200 is also output to a multiple - failure detector 202 . if two or more of the crossbar switches 10 to 18 fail , the multiple - failure detector 202 notifies the system controller of the occurrence of multiple failure . [ 0062 ] fig4 illustrates , in table form , which crossbar switches switch each byte of data transferred between nodes when the crossbar switches 10 to 18 fail . under normal conditions in the absence of failure , the data of bytes 0 to 7 are switched by the cross - bar switches 10 to 17 , respectively , as illustrated by the lowermost row of the table in fig4 . if the crossbar switch 10 , for example , develops a failure , the data of bytes 0 to 7 are switched by the crossbar switches 11 to 18 , respectively , as indicated by the second row of the table of fig4 . if any of the cross - bar switches 11 to 18 fails , then , in similar fashion , the data of each byte is switched by a respective one of the cross - bar switches indicated in fig4 while the faulty cross - bar switch is avoided . the operation of this embodiment of the invention will now be described . as shown in fig1 the crossbar switches 10 to 18 are cross - bar switches in a redundant arrangement for effecting communication between nodes . if a failure has not occurred , the crossbar switches 10 to 17 are employed and the crossbar switch 18 is not used . under normal conditions , the byte - 0 data in the 8 - byte data output from each of the nodes 0 to 7 is switched by the cross - bar switch 10 , the byte - 1 data is switched by the cross - bar switch 11 and the byte - 7 data is switched by the cross - bar switch 17 . in a case where the cpu 100 in node 0 accesses the memory within node 1 , which is a remote node , the byte - 0 data in 8 - byte request data is switched by the cross - bar switch 10 and is sent to node 1 . though the byte - 0 data is sent from node 0 to the selection circuit 11 - 0 , the latter responds to the control signal from the failure processing circuit 20 by selecting and outputting its other input , namely the byte - 1 data in the 8 - byte data from node the byte - 0 data output from the cross - bar switch 10 enters the selection circuit 1 - 0 which , in response to the selection control signal from the failure processing circuit 20 , selects the byte - 0 data and outputs this data to the node 1 . if the system develops a failure and it is determined as a result of diagnostic processing executed after the occurrence of the failure that the cross - bar switch 10 is faulty , then , in response to the selection control signal output from the failure processing circuit 20 to the selection circuits after the system is restarted , the cross - bar switch 10 is taken out of service and the items of byte - 0 data , byte - 1 data and byte - 7 data in the 8 - byte data output from nodes 0 to 7 are switched by the cross - bar switches 11 , 12 and 18 , respectively . as for the transfer of data from node 0 to node 1 in this case , the byte - 0 data that was output from node 0 to selection circuit 11 - 0 is selected by the selection control signal from the failure processing circuit 20 and is delivered to the cross - bar switch 11 . the byte - 0 data output from cross - bar switch 11 enters the selection circuit 1 - 0 , and the latter responds to the selection control signal from the failure processing circuit 20 by selecting the byte - 0 data and inputting it to the node 1 . if a failure occurs in any of the cross - bar switches 11 to 18 , each byte of node transfer data is transferred by control similar to that set forth above via the cross - bar switches indicated in fig4 . if two or more of the crossbar switches 10 to 18 fail , then the crossbar multiple - failure detector 202 in the failure processing circuit 20 detects multiple crossbar failure and so informs the system controller . in this case , the system is not restarted and remains down until it is repaired . according to the embodiment described above , each node outputs 8 - byte data , and each selection circuit and each port of the crossbar switches inputs and outputs data in single - byte units . however , the present invention is not limited to this implementation and it goes without saying that an implementation in which data is input and output in word units or bit units may be adopted . further , the present invention is not only ideal for application to a multinode computer system but can be similarly applied to crossbar switches that control the connections between multiple cpus and memories . the meritorious effects of the present invention are summarized as follows . the present invention has a number of advantageous effects , which will now be described . first , in a case where cross - bar switches are provided with redundancy and a cross - bar switch fails , the failure processing circuit controls the selection circuits , which are provided at the inputs and outputs of each of the cross - bar switches , based upon failure information , thereby making it possible to achieve an operation in which the faulty cross - bar switch is avoided after the system is started up . second , it is possible to avoid a situation in which system recovery cannot be achieved until a faulty crossbar switch is repaired . avoiding this situation does not require that all crossbar switches be made redundant . third , in a case where a cross - bar switch is designed to be inserted into and withdrawn from a live wire , it is possible for cross - bar switch components to be replaced on - line . this means that maintenance can be performed without shutting down the system . fourth , when switching is performed in the event of failure of a crossbar switch , the switching takes place between crossbar switches whose data branching inputs are mutually adjacent . as a consequence , the fluctuation in data delay time caused by detouring the data , which is a problem encountered with the system of jp - a - 11 - 331374 described earlier , either does not occur or is so small as to be negligible . this has applications in computer systems that operate at high operating frequencies . as many apparently widely different embodiments of the present invention can be made without departing from the spirit and scope thereof , it is to be understood that the invention is not limited to the specific embodiments thereof except as defined in the appended claims . it should be noted that other objects , features and aspects of the present invention will become apparent in the entire disclosure and that modifications may be done without departing the gist and scope of the present invention as disclosed herein and claimed as appended herewith . also it should be noted that any combination of the disclosed and / or claimed elements , matters and / or items may fall under the modifications aforementioned .
| 7 |
this invention relates to , and claims , quartz crystals ( as articles of manufacture ) cut at specific calculated angles to the method that is used to select specific angles of cut to obtain quartz plates having desired properties . control devices in radios , cellular telephony , and other modem communications devices demand that shifts in frequency caused by temperature fluctuations be kept to a minimum . one advantage of the new cut angles of the present invention stems from the fact that quartz crystals manufactured according to the present invention exhibit low shifts in natural frequency of resonance as a function of changes in temperature . this invention also describes and claims a method that allows the manufacture of quartz plates that counteract frequency shifts over temperature excursion caused by other electrical components that make up typical oscillator circuits . in addition , this invention enables and claims angles of cut selected for a desired margin of error , which provides for large scale manufacture of quartz plates with greater reproducibility and at lower cost than has traditionally been the case . at the outset , it should be clearly understood that like reference numerals used in the related drawings are intended to identify the same structural elements , portions , or surfaces consistently throughout the several drawing figures , as may be further described or explained by the entire written specification of which this detailed description is an integral part . the to drawings are intended to be read together with the specification , and are to be construed as a portion of the entire “ written description ” of this invention , as required by 35 u . s . c . § 112 . for purposes of this patent , the terms appearing in the description and in the claims are intended to have the following meanings : “ q value ” as used here is a measure of the activity of a crystal relative to the amount of activity ( grid current ) that is produced in an electrical oscillator circuit . φ ′= the phase delay imposed on the wave traversing the crystal face due to resistance by its surroundings . δ = offset value between the idealized wave and the wave with a damping function as used herein , the angle theta ( θ ) refers to an angle of rotation from the z axis and about the x axis such that axes x , y ′ and z ′ are formed . the angle phi ( φ ) refers to an angle of rotation about the z ′ axis , or in the case where theta θ is 0 °, a rotation about the z axis . the first step in improving the existing approximations ( see eq . 1 ) is to address the area of idealized perfectly elastic oscillations . if the idealized case were true , it should be possible to add electrical energy to a quartz crystal causing it to vibrate , and ideally , the crystal should vibrate essentially forever without additional energy input . this is much like the mechanical analogy where a mass attached to a spring is pulled by grasping the mass and stretching the spring , pulling the mass in a direction away from the spring , to add energy to the system and then releasing the mass . in the ideal case the mass will oscillate forever , as in the ideal case no energy is lost in the compression or extension of the spring and there would be no loss of energy to the surroundings . in the case of a vibrating quartz plate , the q value of quartz is very high , therefore it behaves as a very efficient spring having a very high stiffness , thus minimizing losses due to inelastic motion . being finite , losses do occur , but they are a small fraction of the actual energy lost . in the case of quartz , the rate of vibration is high compared to a mechanical spring analog , and so much of the energy is lost as velocity squared proportional damping . this effect , commonly called “ wind resistance ” is found to be important in any projectile or other type motions as the speed of motion increases . in the case of modem quartz chips that are vibrating at frequencies of many megahertz , wind resistance becomes the dominant loss term even though the amplitude of the physical vibration is small and the total mass of atmosphere moved is also very small . adding a loss term ( eq . 3 , which is a basic velocity proportional damping term ) to the conventional equation ( eq . 1 ), where the magnitude of the loss term is proportional to the square of the wave velocity , produces a modified curve ( fig6 ) as compared to the curve ( fig5 ) that was produced using eq . 1 . the dashed line in fig6 is a short segment of the prior graph ( fig5 ) and the solid line is the curve produced by adding the damping term to the traditional mathematical formulation . in this close up view , one can see that not only is the at cut accounted for , but also the sc cut at 34 . 2 °, the it cut at 36 °, the st cut at 42 . 4 ° and the ct cut at 38 . 1 °. additionally , we see not only that the st cut is represented , but why st cut quartz plates are so difficult to manufacture . as shown in fig6 the st cut angle resides on a very steep slope as compared to the at and sc cut angles , so if the st cut is missed by even a small margin , the resulting plates very quickly lose their first order zero temperature coefficient . in the expanded view of the curve ( fig7 ) produced using the modified traditional mathematical formulation ( eq . 2 ) more of the known cuts are also accounted for . the loss term added to the traditional first order approximation of the variation of temperature coefficient with temperature ( eq . 1 ), has the form : equation 1 ( as given in the background section ), equation 2 ( as given in the summary section ), and equation 3 are periodic functions , which means that it is possible to fit the actual behavior of the quartz plate with a number of combinations involving multiples of the frequency term ω with differing values of the other variables . these particular values are used as a close approximation of the description of the actual physical behavior of know cuts and to demonstrate the mathematical form of the damping function . further refinements would increase the accuracy of the fit of the curve to the known cuts , but as a first order approximation , the addition of the basic velocity proportional damping term accounts for much more of the known quartz behavior than does the prior mathematical description alone . to test the model , a trial cut was made in the area close to the gt cut angle of 51 °. the concept being that an ideal commercial cut would have a lower third order coefficient similar to the gt cut , but unlike a plate made using a gt cut where the edges of the blank are vibrating and the center is not vibrating , an ideal commercial cut would vibrate in a shear like mode such that the edges of the quartz plate do not vibrate like the familiar at cut . this would facilitate manufacturability , a key obstacle to the adoption of the gt cut despite its technical advantage of a low frequency deviation over an exceptionally wide temperature range . test cuts in the range of interest produced the results illustrated in fig8 . this experiment shows that reduced frequency deviation can be obtained over a wide temperature range as compared to the industry standard at cut . this reduction in frequency deviation allows the quartz plate to perform temperature compensation functions that are currently required in modern designs . the elimination of these compensation electronics reduces both electronics cost and complexity . conversely , applying the compensation electronics to the new crystal cut would achieve tighter frequency control in a given application . a review of related literature underscores that the currently accepted mathematical interpretation predicts two first order zero temperature coefficient quartz cut angles . when , in actual fact , by experimental practice , more than a dozen first order zero temperature coefficient cuts are known to exist . the discrepancy between the cuts known to exist and the lack of a predictive mathematical structure has lead to the more complete description and mathematical model of this invention . the improved model of this invention allows for faster exploration of potentially commercially successful cut angles and development of those candidate cuts into operating devices . it should be remembered that to uncover the actual behavior of quartz without benefit of the more accurate model of the present invention would entail making trial cuts on both the theta and phi crystal axes in mutual increments of no more than a few minutes of arc . the small step size of the trials is due to the very high rate of change of the temperature coefficient as a function of cut angle . much like the “ needle in a haystack ” analogy , random or widely spaced trial cuts are unlikely to produce successful results . the level of difficulty of discovery of new cuts by experimental trail and error using the conventional mathematical approach as indicated by this analysis is borne out by the fact that the last commercially successful quartz cut , the “ sc ” cut , was patented over twenty two years ago despite the support of a burgeoning electronics industry and the large worldwide demand spurred by the computer , fax and cellular telephony industries . thus , it is seen that the objects of the invention are efficiently obtained . it should be appreciated , however , that the invention is not directed solely to the particular embodiment described herein , but is capable of various modifications , rearrangements , and substitutions should be readily apparent to those having ordinary skill in the art without departing from the scope of the invention . the foregoing detailed description is an explanation of the preferred embodiment of the present invention , as well as the best mode presently known to the inventor . however , the scope of the invention is not to be limited by the description of the preferred embodiment but rather is defined by the scope of the claims , following which are appended hereto and are hereby included in and made part of this specification by this reference .
| 8 |
fig1 shows a novel cane foot . fig2 shows a cross - section of the novel cane foot shown in fig1 . load bearing cup - shaped collar 12 is attached to the distal end of shaft 11 . said collar is advantageously made of metal similar to that of the shaft , such as aluminum 6063 or 6061 . in one embodiment , collar 12 is affixed to shaft 11 using a tight press fit or an adhesive , although other means may be used . for example , flange 13 of collar 12 may be made as part of the shaft with a special forming process , or it may be affixed as a ring with no bottom using an adhesive or fasteners such as rivets . the distance from the bottom of flange 13 to the distal end of the shaft is designed to approximately match the inner depth of elastomeric foot 14 . in an advantageous embodiment , this distance is 1 to 1 . 5 inches . cup - shaped elastomeric foot 14 is pressed onto the distal end of collar 12 and shaft 11 such that the friction of said foot 14 provides a suitable attachment . alternately , in an advantageous embodiment , collar 12 includes a bulge 15 to further secure foot 14 . other attachment aids are possible . for example , an attachment aid may be the use of a ridge , knurl , or adhesive . when force is applied to the foot , such as when a person presses his or her weight onto the cane with the cane touching the ground , the top surface of foot 14 bears against the lower surface of flange 13 , compressing the outer walls of foot 14 into a barrel shape , shown in fig3 . this compression uses the cushioning ability of the cylindrical portion of foot 14 , in addition to the usual cushioning attained by the distal end of the shaft striking inner surface 17 of foot 14 . in an advantageous embodiment , inner surface 17 is lower than the distal end of shaft 11 and collar 12 by 1 - 2 mm . this gap allows the distal end of shaft 11 and collar 12 to move axially under normal loads , and to impact surface 17 under heavy loads , so that the entire foot provides cushioning function . this design further allows for varied compression around the cylinder of foot 14 when an angular force is applied , as shown in fig4 . angular forces are very common in the use of canes , walkers and crutches , and it is crucial that the cane foot allow for excellent traction under these situations , so as to prevent the mobility aid from slipping out from under the user . foot 14 is made from an elastomeric or rubber material that is resilient and of medium to soft durometer . this provides improved shock absorption over standard crutch foot material , which is often of a harder durometer for wear - resistance . in an advantageous embodiment , tread 16 is bonded to or co - molded with foot 14 to provide a long - wearing and high - traction surface for the foot where it meets the ground or walking surface . this combination gives the foot both shock - absorbing and durable grip and wear in a simple compact design . in an advantageous embodiment , tread 16 is made from a different color than foot 14 to demonstrate the functionality and to allow the user to observe when the tread is worn . alternatively , tread 16 and foot 14 can be the same color . further , tread 16 could be eliminated if foot 14 is made from a medium to high durometer material with good abrasion resistance , however , while the barrel - like shock - absorbing feature will still exist , the cushioning feel will be reduced . fig5 shows an alternative embodiment , in which metal cup 12 does not include a bulge , and foot 14 is attached by means of friction , using a compressive fit over cup 12 . further , cup 12 in this embodiment uses a flat bottom with large radii , rather than a dome . the cushioning action is still provided by means of the gap between the bottom of cup 12 and the inside surface of foot 14 . the outer perimeter of foot 14 may have different shapes at rest , while still providing the function described . one such embodiment is shown in fig6 , which depicts a truncated inverted cone shape . numerous other shapes are possible as well . the foregoing detailed description is to be understood as being in every respect illustrative and exemplary , but not restrictive , and the scope of the invention disclosed herein is not to be determined from the detailed description , but rather from the claims as interpreted according to the full breadth permitted by the patent laws . it is to be understood that the embodiments shown and described herein are only illustrative of the principles of the present invention and that various modifications may be implemented by those skilled in the art without departing from the scope and spirit of the invention . those skilled in the art could implement various other feature combinations without departing from the scope and spirit of the invention .
| 0 |
an embodiment of the present invention will hereinafter be described with reference to the drawings . in the following description , the same parts are provided with the same reference characters , and have the same names and functions . therefore , the detailed description thereof will not be repeated . with reference to fig1 , description will be made on an image display device according to an embodiment of the present invention . laser projector 10 includes an optical system 100 , a system controller 150 , an x driver 130 , and a y driver 132 . optical system 100 includes red / blue lasers 110 , a green laser 112 , a polarization beam splitter 114 , a collimator lens 116 , a scanner mirror 120 , a half mirror 124 , a photoreceptor 126 , and a position detector 122 . system controller 150 includes a laser controller 152 , a drive frequency controller 154 , a position detection controller 156 , a memory 158 , and a cpu ( central processing unit ) 160 . laser projector 10 projects an image onto a screen 170 provided in front of optical system 100 . a red laser beam and a blue laser beam delivered by red / blue lasers 110 are reflected by polarization beam splitter 114 , and the reflected lights are directed to collimator lens 116 . a laser beam delivered by green laser 112 passes through polarization beam splitter 114 and is directed to collimator lens 116 . scanner mirror 120 reflects the laser beams of respective colors , which have passed through collimator lens 116 , toward a range predefined as a scan range . scanner mirror 120 is driven by x driver 130 and y driver 132 in a horizontal direction and a vertical direction , respectively . half mirror 124 allows a part of the laser beams reflected by scanner mirror 124 to pass therethrough , and reflects another part of the laser beams . the light reflected by half mirror 124 is received by photoreceptor 126 . in contrast , the part of the laser beams that has passed through half mirror 124 is projected onto screen 170 via a lens ( not shown ). photoreceptor 126 is configured with , for example , a plurality of photodiodes . an output of photoreceptor 126 is inputted to position detector 122 . position detector 122 scans an output obtained from photoreceptor 126 in a horizontal direction and a vertical direction , and delivers data obtained through the scanning to system controller 150 . in system controller 150 , cpu 160 is configured to control laser controller 152 and drive frequency controller 154 based on an output from position detection controller 156 . furthermore , cpu 160 stores in memory 158 positional information of scanner mirror 120 , which has been calculated based on the output from position detection controller 156 . the positional information includes , for example , a scan angle , a signal value outputted for providing the scan angle ( e . g . a voltage value ), and the like . memory 158 is implemented as a nonvolatile memory such as a flash memory in a certain aspect , or as a volatile memory in another aspect . laser controller 152 is configured to control red / blue lasers 10 and green laser 112 based on an output from cpu 160 and an output from a laser power detector 118 . further , laser controller 152 can deliver to cpu 160 an output obtained from laser power detector 118 . drive frequency controller 154 is configured to control x driver 130 and y driver 132 based on an output from cpu 160 . more specifically , drive frequency band controller 154 delivers to x driver 130 a signal having a frequency that defines drive in a horizontal direction such that scanner mirror 120 is driven in the horizontal direction ( hereinafter also referred to as a “ horizontal drive signal ”), in response to a command from cpu 160 . furthermore , drive frequency controller 154 delivers to y driver 132 a signal having a frequency that defines drive in a vertical direction such that scanner mirror 120 is driven in the vertical direction ( hereinafter also referred to as a “ vertical drive signal ”), in response to a command from cpu 160 . based on the horizontal drive signal , x driver 130 drives scanner mirror 120 in the horizontal direction . based on the vertical drive signal , y driver 132 drives scanner mirror 120 in the vertical direction . based on an output from position detector 122 , position detection controller 156 a / d ( analog to digital )- converts positional information of scanner mirror 120 ( scan range ), which is defined by the output of photoreceptor 126 , and delivers the converted digital data to cpu 160 . based on the digital data , cpu 160 detects the position of scanner mirror 120 , and in accordance with the detection result , controls laser controller 152 or drive frequency controller 154 . a vertical drive frequency and a horizontal drive frequency are predefined based on the size of scanner mirror 120 , the scan direction , and drive characteristics of x driver 130 or y driver 132 . in a certain aspect , data that provides the vertical drive frequency and data that provides the horizontal drive frequency are stored in advance in memory 158 . in the present embodiment , a part or a whole of system controller 150 may also be implemented by a combination of hardware such as circuit elements . in another aspect , system controller 150 may also be implemented as a configuration that controls an operation of the hardware by software , by means of cpu 160 executing a program stored in memory 158 . with reference to fig2 , description will be made on a configuration of photoreceptor 126 that configures optical system 100 according to the present embodiment . fig2 is a diagram that schematically represents a light - receiving region in photoreceptor 126 . photoreceptor 126 is configured with a plurality of light - receiving elements . photoreceptor 126 includes a region for receiving a laser beam for projecting an image , and other regions . more specifically , photoreceptor 126 includes a peripheral region 200 , which differs from a region for projecting an image , and regions 210 , 220 , 230 , and 240 for projecting an image . portions of a laser beam reflected by scanner mirror 120 which correspond to light - receiving regions 210 , 220 , 230 , and 240 are projected onto screen 170 as an image . peripheral region 200 is defined as a region that does not relate to image projection , and is intended for switching a scan direction of scanner mirror 120 . in photoreceptor 126 , a boundary between light - receiving regions 210 , 240 and light - receiving regions 220 , 230 is orthogonal to a horizontal scan direction of scanner mirror 120 . further , a boundary between light - receiving regions 210 , 220 and light - receiving regions 230 , 240 is defined to be parallel with a horizontal direction of scanner mirror 120 . in the example shown in fig2 , the light - receiving region is defined as four regions 210 , 220 , 230 , and 240 . however , the number of light - receiving regions is not limited to the one specified by fig2 . for example , three or more light - receiving regions may be defined in a horizontal direction , or three or more light - receiving regions may be defined in a vertical direction . with reference to fig3 , description will be made on a configuration of cpu 160 that implements laser projector 10 according to the present embodiment . fig3 is a block diagram that represents a configuration of functions implemented by cpu 160 . cpu 160 includes a laser light emission control unit 310 , a detection unit 320 , and a timing correction unit 330 . these functions are implemented by cpu 160 executing an executable program stored in memory 158 . laser light emission control unit 310 controls light emission and shut off of each of red / blue lasers 110 and green laser 112 . in another aspect , laser light emission control unit 310 is configured to shut off a light - emitting first light source ( e . g . a laser beam source of any color in red / blue lasers 110 , or green laser 112 ) when sensing that a laser beam emitted from the first light source is received in light - receiving regions 210 , 240 ( hereinafter also referred to as a “ first light - receiving region ”). in this case , laser light emission control unit 310 allows the first light source to emit light again at an elapse of predetermined time from the shut off of the first light source . the predetermined time is defined as one piece of design information on laser projector 10 . this time is defined in accordance with a scan speed of scanner mirror 120 and a size of the light - receiving region in photoreceptor 126 . in another aspect , when laser light emission control unit 310 senses that a laser beam emitted from a light - emitting second light source ( e . g . a laser beam source different from a laser beam source corresponding to the above - described first light source ) is received in light - receiving regions 210 , 240 , laser light emission control unit 310 terminates the light emission caused by the second light source . furthermore , laser light emission control unit 310 allows the second light source to emit light again at an elapse of predetermined time from the shut off of the second light source . detection unit 320 detects a deviation between an optic axis of the first light source and an optic axis of the second light source , based on a timing at which a laser beam emitted from the first light source is received in light - receiving regions 220 , 230 ( hereinafter also referred to as a “ second light - receiving region ”), and a timing at which a laser beam emitted from the second light source is received in the second light - receiving region . timing correction unit 330 corrects the light emission timing of a laser beam source corresponding to the second light source , based on the “ deviation ” detected by detection unit 320 . in another aspect , detection unit 320 includes a first calculation unit , a second calculation unit , and a third calculation unit . the first calculation unit calculates time that starts at a timing when reception of the laser beam emitted from a laser beam source serving as the first light source is sensed in the first light - receiving region ( i . e . light - receiving regions 210 , 240 ) and ends at a timing when the reception of the laser beam emitted from that laser beam source is sensed in the second light - receiving region ( i . e . light - receiving regions 220 , 230 ) ( hereinafter also referred to as “ first time ”). the second calculation unit calculates time that starts when the laser beam emitted from the first light source is received in the first light - receiving region and ends when the laser beam emitted from another laser beam source corresponding to the “ second light source ” is received in the second light - receiving region ( hereinafter also referred to as “ second time ”). for example , the second time is calculated as time between the timing at which reception of a laser beam of one color is sensed in one light - receiving region and the timing at which reception of a laser beam of another color is sensed in another light - receiving region . the third calculation unit calculates a difference between the first time and the second time . timing correction unit 330 corrects the light emission timing of a laser beam source corresponding to the second light source , based on the difference calculated by the third calculation unit . in an aspect , the scan direction includes a direction along which scanner mirror 120 is driven horizontally . in another aspect , the scan direction includes a direction along which scanner mirror 120 is driven vertically . in another aspect , detection unit 320 detects the above - described deviation when laser projector 10 is started up . in still another aspect , detection unit 320 may also detect the above - described deviation in response to an input of a correction instruction to laser projector 10 . this input can be accepted , for example , via a switch provided at a housing of laser projector 10 . in a further aspect , memory 158 stores data representing the relation between a scan angle of scanner mirror 120 and a scan speed predetermined in accordance with the relevant scan angle . timing correction unit 330 corrects the “ deviation ” detected by detection unit 320 , based on the data . with reference to fig4 , description will be made on a control structure of laser projector 10 according to the present embodiment . fig4 is a flowchart that represents a part of a series of operations executed by cpu 160 provided at laser projector 10 . in step s 410 , cpu 160 delivers a command to laser controller 152 to thereby command a laser beam source of any one color , out of the laser beam sources of three colors , to emit a laser beam . the laser beam source of any one color is used as a reference for detecting a deviation of an optic axis . in step s 420 , when cpu 160 senses that the laser beam is received in light - receiving regions 210 , 240 in photoreceptor 126 , based on an output from position detection controller 156 , cpu 160 causes the relevant laser to be shut off . in step s 430 , cpu 160 causes a laser of a color , which is to be detected as to the presence or absence of a deviation of an optic axis , to be applied until the reception thereof is sensed in light - receiving regions 220 , 230 . the laser beam source lit at this time differs from the laser beam source lit in step s 410 . in step s 440 , cpu 160 keeps time that starts when light reception is sensed in light - receiving regions 210 , 240 and ends when light reception is sensed in light - receiving regions 220 , 230 . in step s 450 , cpu 160 determines whether or not the lasers of all colors , namely , red , blue and green , have been lit and shut off . for example , whenever cpu 160 delivers to laser controller 152 a command to allow a laser of any color to be emitted , cpu 160 sets a flag indicating that a laser beam of the relevant color has been lit . cpu 160 determines whether or not the lasers of all colors have been lit and shut off , based on a set state of the flags . if cpu 160 determines that the lasers of all colors have been lit and shut off ( yes in step s 450 ), cpu 160 switches the control to step s 460 . if not so ( no in step s 450 ), cpu 160 returns the control to step s 420 , and allows a laser beam source of another color to be lit and shut off . in step s 460 , cpu 160 calculates a relative time difference as to each color with respect to the reference color . in step s 470 , cpu 160 corrects the light emission timing of the laser beam source of each color , based on the time calculated in step s 460 . more specifically , cpu 160 delivers to drive frequency controller 154 a command in which a light emission timing is corrected . drive frequency controller 154 drives x driver 130 or y driver 132 based on the command in which the light emission timing is corrected . with reference to fig5 , description will be made on a deviation of an optic axis of a laser beam source in laser projector 10 in a horizontal direction . fig5 is a diagram that represents the relation between a timing of each of light emission and light - up of a laser of each color and an output of photoreceptor 126 . as an example , description will be made on the case that a red laser beam source in red / blue lasers 110 is used as a reference laser beam source . however , a laser beam of another color may also be used . in fig5 , with reference to graph ( a ), a red laser beam source in red / blue lasers 110 performs irradiation based on a command from laser controller 152 . specifically , the red laser beam source is lit at time point t ( 0 ) ( a sign of “ r ”). when the light reflected from half mirror 124 reaches the first light - receiving region ( light - receiving regions 210 , 240 ) by the drive of scanner mirror 120 in a horizontal direction , the laser beam from the red laser beam source is received in light - receiving regions 210 , 240 at time point t ( 1 ) ( see timing chart a + d ). at time point t ( 2 ), the red laser beam source is shut off based on a command from laser controller 152 . as a result , no laser beam is received in light - receiving regions 210 , 240 after time point t ( 2 ) ( see timing chart a + d ). subsequently , at time point t ( 3 ), the red laser beam source is lit again based on a command from laser controller 152 . an output from the first light - receiving region appears again ( see timing chart a + d ). note that time from time point t ( 2 ) to time point t ( 3 ) is predefined as design information , based on a width of the first light - receiving region and a scan speed of scanner mirror 120 . when scanner mirror 120 scans in a horizontal direction while the red laser beam source is being lit , the sensing of light reception in light - receiving regions 210 , 240 continues from time point t ( 3 ) to time point t ( 4 ). at time point t ( 4 ), an output of the laser beam in photoreceptor 126 is sensed as light reception in light - receiving regions 220 , 230 ( see timing chart b + c ). at time point t ( 5 ), the red laser beam source is shut off in accordance with a command from laser controller 152 . as a result , the output from light - receiving regions 220 , 230 also disappears ( see timing chart b + c ). cpu 160 calculates a difference between the timing ( time point t ( 1 )) at which light reception in light - receiving regions 210 , 240 is sensed , and the timing ( time point t ( 4 )) at which reception of the laser beam in light - receiving regions 220 , 230 is sensed , as reference time t hr . reference time t hr is used for comparison with corresponding time of a laser beam of another color . in fig5 , with reference to graph ( b ), after the red laser beam source selected as a reference laser beam source is lit and shut off , similar processing is executed on the laser beam sources of other colors . for example , processing for detecting a deviation of an optic axis of green laser 112 is initiated . more specifically , laser controller 152 initially provides a command to the red laser beam source and allows it to be lit at time point t ( 10 ) and shut off at time point t ( 12 ). in this case , an output from light - receiving regions 210 , 240 continues from time point t ( 11 ) to time point t ( 12 ) ( timing chart a + d ). at time point t ( 13 ), laser controller 152 provides a command to green laser 112 and allows it to be lit . the light - up of green laser 112 continues from time point t ( 13 ) to time point t ( 15 ). reception of the green laser beam in light - receiving regions 210 , 240 is sensed from time point t ( 13 ). when scanner mirror 120 is kept driven in a horizontal direction , an output indicating the reception of the laser beam from green laser 112 is switched at time point t ( 14 ) from light - receiving regions 210 , 240 ( timing chart a + d ) to light - receiving regions 220 , 230 ( timing chart b + c ). cpu 160 calculates time that starts at the light emission timing ( time point t ( 10 )) of the reference laser beam source ( the red laser beam source ) and ends at time point t ( 14 ), as determination target time t hg . cpu 160 compares determination target time t hg with reference time t hr , and determines the presence or absence of the difference therebetween . in fig5 , with reference to graph ( c ), laser controller 152 executes processing for detecting a deviation of an optic axis of a laser beam source of still another color . for example , laser controller 152 provides a command to a blue laser beam source in red / blue lasers 110 . more specifically , laser controller 152 allows the red laser beam source to be lit at time point t ( 20 ). when scanner mirror 120 is kept driven in a horizontal direction , an output indicating the reception of the red laser beam in light - receiving regions 210 , 240 appears at time point t ( 21 ) ( timing chart a + d ). subsequently , at time point t ( 22 ), laser controller 152 allows the red laser beam source to be shut off . the output from light - receiving regions 210 , 240 disappears ( see timing chart a + d ). at time point t ( 23 ), laser controller 152 allows the blue laser beam source in red / blue lasers 110 to be lit . the light - up of the blue laser beam source continues until time point t ( 25 ). the reception of the blue laser beam in light - receiving regions 210 , 240 continues , for example , from time point t ( 23 ) to time point t ( 24 ). after time point t ( 24 ), the reception of the blue laser beam is sensed as an output from the second light - receiving region . cpu 160 calculates a difference between time point t ( 21 ) and time point t ( 24 ) as determination target time t hb . cpu 160 compares the calculated determination target time t hb with reference time t hr , and determines the presence or absence of a deviation of an optic axis of the blue laser beam source . with reference to fig6 , description will be made on detection of the presence or absence of a deviation of an optic axis in a vertical direction in optical system 100 . fig6 is a diagram that represents the relation between drive of scanner mirror 120 in a vertical direction and an output based on irradiation by a green laser 112 and red / blue lasers 110 . the red laser beam source in red / blue lasers 110 is used as a reference . in fig6 , with reference to graph ( a ), the drive of scanner mirror 120 is started at time point t ( 30 ) based on a command from y driver 132 , and scanner mirror 120 is vertically driven until time point t ( 35 ). scanner mirror 120 is returned to the initial position between time point t ( 35 ) and time point t ( 36 ). with reference to graph ( b ), the red laser beam source is lit based on a command from laser controller 152 at time point t ( 31 ). the output of the red laser beam continues from time point t ( 31 ) to time point t ( 34 ). the light reflected from half mirror 124 is directed to light - receiving regions 210 , 220 , and at time point t ( 32 ), directed to light - receiving regions 230 , 240 ( second light - receiving region ). accordingly , the output from light - receiving regions 230 , 240 starts at time point t ( 32 ). at time point t ( 33 ), when the light reflected from half mirror 124 deviates from light - receiving regions 230 , 240 , the output in light - receiving regions 230 , 240 is terminated ( see timing chart c + d ). subsequently , at time point t ( 34 ), the red laser beam source terminates irradiation of the laser beam based on a command from laser controller 152 . cpu 160 calculates reference time t vr from time point t ( 31 ) to time point t ( 32 ), as reference time . reference time t vr is used for determining the presence or absence of a deviation of an optic axis of the laser beam of another color . with reference to graph ( c ), at time point t ( 41 ), laser controller 152 allows green laser 112 to be lit ( see ld irradiation ( g )). when scanner mirror 120 is driven in a vertical direction , the light reception in light - receiving regions 230 , 240 is sensed at time point t ( 42 ). the light reception in light - receiving regions 230 , 240 continues from time point t ( 42 ) to time point t ( 43 ). at time point t ( 44 ), laser controller 152 terminates the light - up caused by green laser 112 . cpu 160 calculates a difference between time point t ( 41 ) and time point t ( 42 ) as determination target time t vg . with reference to graph ( d ), at time point t ( 51 ), laser controller 152 allows the blue laser beam source in red / blue lasers 110 to be lit ( see ld irradiation ( b )). when scanner mirror 120 is driven in a vertical direction , the light reception in light - receiving regions 230 , 240 is sensed at time point t ( 52 ). the light reception in light - receiving regions 230 , 240 continues from time point t ( 52 ) to time point t ( 53 ). at time point t ( 54 ), laser controller 152 terminates the light - up caused by the blue laser beam source . cpu 160 calculates a difference between time point t ( 51 ) and time point t ( 52 ) as determination target time t vb . with reference to fig7 , description will be made on the correction to irradiation timings of green laser 112 and red / blue lasers 110 . in fig7 , timing chart ( a ) represents a timing at which laser controller 152 provides a command to emit light to a light source of any of the colors selected as a reference color . specifically , the red laser beam source is selected as a reference laser beam source . a laser beam source of another color may also be selected . the red laser beam source is applied from time point t ( 60 ) to time point t ( 61 ), from time point t ( 62 ) to time point ( 63 ), from time point t ( 64 ) to time point t ( 65 ), and from time point t ( 66 ) to time point t ( 67 ), so as to determine the presence or absence of a deviation of an optic axis . with reference to timing chart ( b ), the red laser beam is lit based on the command from laser controller 152 , at the same interval as the interval between the starts of irradiation defined in timing chart ( a ). with reference to timing chart ( c ), green laser 112 is lit in accordance with a corrected timing calculated based on the examples shown in fig5 and 6 . specifically , green laser 112 is lit at time point t ( 71 ). time point t ( 71 ) is delayed with respect to time point t ( 60 ) at which the red laser is lit , by corrected time ( t vg − t vr )+( t hg − t hr ). with reference to timing chart ( d ), the blue laser source in red / blue lasers 110 is lit in accordance with the corrected timing calculated based on the examples shown in fig5 and 6 . specifically , the blue laser beam source is lit at time point t ( 81 ). time point t ( 81 ) is advanced with respect to time point t ( 60 ) at which the red laser is lit , by corrected time ( t vb − t vr )+( t hb − t hr ). as described above , laser projector 10 according to the embodiment of the present invention detects the presence or absence of a deviation of an optic axis of a light source of each of the colors of r , g and b at start - up , and based on the detection results , corrects the emission timing of a laser beam to be emitted from the light source in which a deviation is detected . before projecting an image , laser projector 10 drives scanner mirror 120 in a horizontal direction or a vertical direction , while applying a laser beam of a single specific color . the laser beam is received in the two light - receiving regions in photoreceptor 126 , the two light - receiving regions being defined by a boundary orthogonal to the moving direction of scanner mirror 120 . laser projector 10 calculates each output time from each of the light - receiving regions , each output time being based on the emission of the laser beam of the single specific color . subsequently , laser projector 10 applies laser beams of other colors one by one , and drives scanner mirror 120 in the same direction . laser projector 10 calculates each output time from each of the light - receiving regions , each output time being based on the emission of the laser beam of the single color , as to each of the colors . laser projector 10 further calculates a difference between the time calculated as to the single specific color and the time calculated as to one of the other colors , so as to check whether or not there is a difference . the existence of the difference means that the emission timing of that color deviates , so that laser projector 10 corrects the deviation . for example , laser projector 10 calculates the time to be corrected , based on the time calculated as a difference and a movement speed of scanner mirror 120 . for example , if the interval between when the reception in one light - receiving region is sensed and when the reception in another light - receiving region is sensed , as to the color to be compared , is shorter than the corresponding interval as to the specific color serving as a reference , laser projector 10 makes a correction to delay the irradiation timing of the laser beam . in contrast , if the interval between when the reception in one light - receiving region is sensed and when the reception in another light - receiving region is sensed , as to the color to be compared , is longer than the corresponding interval as to the specific color serving as a reference , laser projector 10 makes a correction to advance the irradiation timing of the laser beam . by doing so , the optic axes of respective laser beam sources coincide with one another when an image is projected , so that each of the colors is accurately reproduced . consequently , adjustment of the optic axes can readily be achieved without an increase in number of components . although the timing of correction is set at the start - up of laser projector 10 , the timing is not limited thereto . for example , the switch that accepts an instruction of adjustment is provided at a housing of laser projector 10 , and a deviation of the optic axes may be corrected in response to a manipulation on the relevant switch . alternatively , the correction may also be made at a timing at which the data to be projected is inputted to laser projector 10 . with reference to fig8 a and fig8 b , description will be made on a modification of the present embodiment . scanner mirror 120 has a scan speed that varies depending on a scan angle , and hence laser projector 10 according to the present modification may have a configuration in which a lookup table of a scan speed of scanner mirror 120 is included and cpu 160 corrects the detected time difference by referring to the table . it is noted that laser projector 10 according to the present modification has a hardware configuration similar to that of laser projector 10 shown in fig1 , and has the same functions . accordingly , the detailed description of the hardware configuration is not repeated . fig8 a is a diagram that shows a pattern of the drive of scanner mirror 120 in a horizontal direction . fig8 b is a diagram that shows the relation between a scan angle and a scan speed at each location shown in fig8 a . more specifically , when scanner mirror 120 is positioned at opposite ends of the scan range in the horizontal direction ( specifically , at locations 810 , 820 , and 830 ), the scan speed is 0 . in contrast , in proximity to the center of photoreceptor 126 in the horizontal direction , the scan speed of scanner mirror 120 has local maximum . therefore , the timing at which each of the laser beams is lit for correcting a deviation of the optic axes may be calculated based on the relation between the scan angle and the scan speed as shown in fig8 b ( e . g . the relation expressed as a sine curve ). such a relation is retained in memory 158 , for example , as a mapped data table or a function . although the present invention has been described and illustrated in detail , it is clearly understood that the same is by way of illustration and example only and is not to be taken by way of limitation , the scope of the present invention being interpreted by the terms of the appended claims .
| 7 |
referring to the drawings in particular , the saw cable guide 1 shown in fig1 and 2 is used in conjunction with a cable saw ( not shown ), which is used to cut workpieces , e . g ., block - shaped bodies consisting of concrete , brickwork or other materials . such a cable saw has been known from , e . g ., wo95 / 18692 . the saw cable guide 1 shown is used to deflect and guide the saw cable 19 at the workpiece ( not shown ). it is usually present for this purpose in duplicate and may be arranged and fastened at or in the vicinity of the workpiece in a suitable manner . the saw cable guide 1 has a stand 2 , which may have any suitable design . in the embodiment shown , it has a foot plate 3 and a column 4 sticking out therefrom vertically . a plurality of leveling pins , with which the stand 2 can be aligned in the desired manner in relation to the workpiece and / or the foundation , may be present on the foot plate 3 . the fixing is performed by means of a dowel screw or in any other suitable manner . the saw cable guide 1 also has two cable guide rollers 5 , 9 , which are mounted on a respective pivot housing 7 , 11 via an oblique extension arm 20 each . the cable guide rollers 5 , 9 are mounted with their axes freely rotatably on their extension arms 20 , and the extension arms 20 are in turn mounted freely rotatably by 360 ° on the pivot housings 7 , 11 . via suitable bent brackets 6 , the pivot housings 7 , 11 are detachably or rigidly fastened to a common sleeve 16 , which is guided slidingly vertically adjustably and lockably on the column 4 . as an alternative , the pivot housings 7 , 11 may also be guided vertically adjustably independently from one another on sleeves or the like of their own . the sleeve 16 with the cable guide rollers 5 , 9 can be fixed at the desired height by means of a locking means 17 . the pivot housings 7 , 11 permit the rotation of the cable guide rollers 5 , 9 around one pivot axis 8 , 12 each . these pivot axes 8 , 12 are preferably arranged in a common plane and preferably in parallel to the foot plate 3 . furthermore , they are arranged at a 90 ° angle in relation to one another . as is shown in fig2 the saw cable is led around the column 4 of the stand 2 . the brackets 6 are rigidly fastened to the sleeve 16 in the exemplary embodiment shown . as a result , the pivot axes 8 , 12 form a fixed angle preferably equaling 90 ° with one another . as an alternative , the brackets 6 may also be mounted adjustably on the sleeve 16 with a suitable locking means , so that the pivot axes 8 , 12 can also be set and fixed at another angle in relation to one another . in the preferred embodiment , a deflecting roller 13 is mounted freely rotatably around the axis of the column on the stand 2 and especially on the column 4 . the deflecting roller 13 may also be arranged with its bearing 14 on the sleeve 16 . as an alternative , the deflecting roller 13 may be vertically adjustable and lockable in itself . it is preferably located with its cable guide surface 15 in the same plane as the pivot axes 8 , 12 , so that the saw cable 19 runs between the cable guide rollers 5 , 9 via the deflecting roller 13 in the same plane and is led around the stand 2 at the desired angle . the cable guide surface 15 consists of an elastic material , preferably rubber , and imparts a forced twist to the saw cable 19 due to lateral contact . as is illustrated in fig1 the cable guide surface 15 is provided for this purpose with an oblique profiling 21 , which is arranged , e . g ., at the lower end of the guide surface . the forced twist reduces the circumferential wear of the saw cable 19 and makes it more uniform . in addition , the noise caused by the running of the cable is reduced . the cable guide surface 15 may be designed as a smooth surface or with grooves extending at right angles or obliquely not shown . the saw cable 19 is additionally guided by the deflecting roller 13 between the cable guide rollers 5 , 9 during use , as a result of which vibrations between the workpiece and the saw cable guide 1 or the cable saw ( not shown ) are reduced . furthermore , the pivot housings 7 , 11 may be designed as hollow housings , in which case the saw cable 19 is led through the pivot housings 7 , 11 and is flush with the pivot axes 8 , 12 . the guiding through the hollow pivot housings 7 , 11 is used for safety as a cable catch in the case of possible cable breaks and additionally prevents the cable from snapping backward . the oblique extension arms 20 and the distance between the rollers and the pivot housings 7 , 11 are selected to be such that the saw cable 19 guided along the pivoting axes 8 , 12 runs up onto the cable guide rollers 5 , 9 tangentially . various modifications of the embodiment shown are possible . on the one hand , another type of deflecting means may be present between the cable guide rollers arranged at an angle in relation to one another instead of the deflecting roller 13 . likewise , the mounting of the cable guide rollers 5 , 9 may vary as well . the deflecting roller 13 may have an additional vertical adjustment in relation to the sleeve 16 and the cable guide rollers 5 , 9 . an oblique position of the deflecting roller 13 is optionally also possible . while specific embodiments of the invention have been shown and described in detail to illustrate the application of the principles of the invention , it will be understood that the invention may be embodied otherwise without departing from such principles .
| 1 |
fig1 is a schematic illustrating a system for improving efficient use of cinema resources . fig1 shows a plurality of users , user 1 through user n . each user can communicate selections and otherwise interact via associated devices 101 - 103 . in one embodiment the devices 101 - 103 represent computing systems which are available to users . fig1 also shows plurality of social networking websites sn 1 through sn 3 . each of the social networking systems includes a different computing system illustrated as computing systems 501 - 503 . fig1 also shows plurality specialty websites s 1 - s 3 each including a computing system illustrated as computing systems 301 - 303 . the specialty websites are dedicated to public interaction concerning content which may be selected by users . one specialty website may be dedicated to western movies , others dedicated to different sports , etc . finally , fig1 also shows a plurality of exhibitors web sites e 1 - e n with computing systems 401 - 403 . the exhibitor websites e 1 - e n provide a communications path to / from the exhibitor . in the embodiment illustrated in fig1 , users may employ message based communication devices ( computer systems , whether desk - top , laptop , handheld or otherwise ) to send and receive information and make selections . in other embodiments the users may use telephone based devices to send and receive ( audible ) information for selection purposes . the exhibitors associated with computing systems 401 - 403 operate one or more cinemas . some exhibitors have cinemas which may be restricted geographically to one or a limited number of neighborhoods , towns , cities or zip codes while other exhibitors have cinemas which are more widely distributed . fig1 also shows on - demand servicer 500 in accordance with a first embodiment of the invention . the functions and apparatus of the on - demand servicer 500 will be described in detail . as is the case with some of the other devices shown in fig1 , the on - demand servicer 500 also has a dedicated website available to users for performing the functions set forth later in this description . each of the devices shown in fig1 is interconnected by a network 600 . the network 600 may be wired , wireless or a combination of wired and wireless . in one embodiment the network 600 may comprise or include the internet . in other embodiments the network 600 may be a local area network or a combination of local area networks interconnected by a wide area network . in addition the network 600 may include the public switched telephone network ( pstn ) allowing users to use telephone based devices for making selections . as will be apparent to those skilled in the art a user , such as user 1 , using the network 600 and computing system 101 , can access the on - demand servicer website as well as any of the social networking websites , any of the specialty websites or any of the available exhibitor websites . in general the computing systems referred to will include processor ( s ), memory , 1 / 0 devices and related interfaces . this application does not describe the details of computing systems which are identified as computing systems 101 - 103 , 301 - 303 , 401 - 403 , 501 - 503 and the on - demand servicer 500 . those skilled in the art are well acquainted with computing systems capable of performing the required functions . while the user systems 101 - 103 could be hard wired to the network 600 , in some embodiments one or more of the user systems 101 - 103 could be connected to the network 600 via wireless access . the same is true of other computing systems of fig1 . the user systems 101 - 103 which are message based can be selected from a wide variety of devices including pcs or apple based desk top , portable or laptop . message based systems also include smart phones and tablets ( apple , android , rim or webos software ) operating with specialized apps or web interfaces . as noted the user systems may also be telephone based so long as the cooperating equipment ( on demand servicer ) provided access via an interactive voice response platform allowing conventional wired or wireless telephones to respond to interactive , menu based voice prompts or voice recognition interfaces . one of the functions of the on - demand servicer 500 is making selection information available the user systems 101 - 103 . the selection information includes available program content . as has been noted that available program content maybe pre - recorded and / or live . the content is identified in a meaningful way to the user such as by movie title , sporting event type and participants etc . the content made available to the users can be presented in many different ways . for message type systems the content can be presented alphabetically by title , by genre , by relation to past selections of the user , etc . on - demand servicer 500 will also make available to the user systems 101 - 103 theatre and time slot information . theatre information identifies the cinema in which the program content is to be displayed in the future . the theatre may be identified in any recognizable way , by number , name , street address , city , town , city / town and state , zip code etc . for each theatre or cinema which is identified as a potential display location , one more time slots is also identified . the time slot represents the period of time , in the future , during which the potential program material would be displayed at the theatre . while there are many ways to identify a time slot , one way to identify a time slot is by month and day ( feb . 3 ). another way is by month day and year ( feb . 3 , 2011 ). and still another way to identify a time slot is by month day and time of day ( feb . 3 , 12 : 15 pm ). telephone based user devices interact with an on demand servicer voice response platform to provide the user with voice prompts describing the available content , venue and temporal choices . voice recognition equipment operated by the on demand servicer is used to create digital data corresponding to the user &# 39 ; s audible responses to the available content , venue and temporal choices . that digital data is then stored in a database in the same way that a user &# 39 ; s message based choices lead to digital data which may be stored in the same database . a user intending to make use of the services provided by the on - demand servicer 500 will arrange his computing system 101 to access the on - demand servicer website . one of the features of the on - demand servicer website will allow the user to select a particular program content and a particular theatre / timeslot . fig2 a illustrates some of the components of the on - demand servicer 500 . as shown in fig2 a the on - demand servicer 500 , in accordance with one embodiment , includes four databases , a content selection database 35 , a theatre / timeslot database 45 , an available content database 40 and a scheduled database 50 . each of the databases are coupled to processor 55 which in tum is connected to the network 600 . before describing how the data in the databases is manipulated reference is made to fig2 b to illustrate one of the routines which is performed by the processor 55 on access by user . as shown in fig2 b a user may login ( 201 ). in some embodiments of the invention the user will have registered prior to execution of the procedure of fig2 b . in that case the user login will merely require the user to input some combination of data to identify the user and related registration records . in other embodiments the user need not be registered before accessing servicer 500 and initiating the procedure of fig2 b . in that event the user login ( 201 ) may require the input of additional information from the user for identification purposes such as name , address , credit information etc . regardless of the particular requirements of the login procedure ( 201 ), once the login procedure has been completed the user is presented with a choice 202 , whether or not a content selection process will be performed . in other words , does user intend to make some content selection ? if not , processing follows the “ no ” path from function 202 to perform other procedures ( not illustrated ). in the event the user indicates that content selection is desired then processing moves to step 203 where available content and related parameters are made accessible or displayed to the user . the available content and related parameters are accessed from the databases 40 and 45 . for example , the user may be presented with potential available content selections from the database 40 . there are many ways in which available content may be presented to the user . prior content choices of the user may be consulted to identify presently available content which is most nearly like the user &# 39 ; s prior choices . alternatively , choices can be presented to the user randomly , alphabetically or by genre ; user selected genre , alphabetically presented or randomly presented genre choices . there are still other ways of selecting content for presentation to the user which will occur to those skilled in the art . all of these techniques fall within the scope of the invention . when a user makes a selection from the available content database 40 , then the user is presented with the choice of theatre and timeslot . again the theatres presented to the user for selection may be driven by the knowledge of the user &# 39 ; s address or the choices may be presented randomly , or in some other fashion . typically , for each theatre choice , there will be a choice of plural time slots . on the other hand in some cases there will be only a single timeslot for a given theatre , in other cases there will be only a single theatre for a given content . after the user has made selections for all required parameters so that there is a fixed choice for all three items ( content , theatre , timeslot ) step 204 will recognize that the required selections have been made . as will be described the user selection will be recorded in the content selection database 35 . before recording , however , function 205 compares the current user selections with selections already recorded in the content selection database 35 to determine if the current user selections are identically matched by a selection already in the content selection database 35 . either the current selection is matched or it is not . in the case the current selection is not matched then the “ no ” path is followed and the step 207 is executed to create a new record in the content selection database 35 reflecting the user &# 39 ; s current selection . alternatively , if the current selection is matched in the content selection database 35 then the yes path is followed and information concerning the current user selection will be added to the database 35 . in one embodiment the user &# 39 ; s identification is added to the record in the database 35 which corresponds to the user &# 39 ; s current selections . fig2 c is an example of the organization of the contents of the content selection database 35 in accordance with one embodiment . fig2 c shows the database 35 comprises a series of records , record number 1 , record number 2 and so on to record n . as shown in fig2 c each record in the content selection database includes a number of components . one component is content data 28 which represents the user &# 39 ; s selection from available content database 40 . another component is theatre data 29 , selected from the theatre / timeslot database 45 . another component is temporal data 30 , selected from timeslot information of the theatre / timeslot database 45 . in addition , each record includes component 31 recording at least one user id ( identifying a user having made the related selection ). as will be described , when an additional , identical selection is made by a new user ( identified in step 205 ), the new user &# 39 ; s id is added to the record . thus a record may include the id of many users , i . e ., precisely those users who in the past have made the related selections . in another embodiment of the content selection database , each record will include four components , the content data 28 selected by a user , the theatre data 29 selected by that user , the temporal data 30 selected by that user , and that user &# 39 ; s id . in this embodiment there will be a different record made for each user selection . still other variations in recording this data will be apparent to those skilled in the art . returning to the description of fig2 b , after either step 206 or step 207 is executed the next step to be performed is step 208 where a threshold is checked . at this stage in the processing , the content selection database 35 will enable the processor to identify the number of users having made the same selection . the exhibitor associated with a theatre may identify a threshold as that number of customers considered a minimum to justify scheduling content for display at a particular theatre and particular timeslot . this threshold may be constant for all exhibitors , it may vary by exhibitor , it may vary with the theatre and / or theatre and timeslot . in any event at step 208 a comparison is made between that threshold and the number of users having made the related selection so as to determine if the threshold is or is not met . if the threshold is not met , then this portion of the procedure has been completed . on the other hand , if the threshold is met then a sufficient number of users have made the selection to justify the scheduling the presentation of the particular content in the particular theatre in the particular selected timeslot . therefore function 209 is performed to create a new record in the scheduled database 50 ( see fig2 a ). fig2 d is an example of one form in which the data recorded in the scheduled database 50 can be stored . as shown in fig2 d , one record , record number 1 includes content data 128 , theatre data 129 , temporal data 130 and reference data 131 . the reference data component 131 is a way of capturing the identity of the users having made the data selection found in records 128 - 130 . the reference data 131 may be simply a list of user ids . alternatively , it could be a reference to a record ( in the content selection database 35 or elsewhere ) in which is stored the user ids having made that selection . regardless of how this data storage is implemented , reference data 131 enables the processor 55 to identify the particular users having made the associated selections and the number of those users . another procedure performed by the processor 55 is illustrated in fig2 e . as shown , the procedure of fig2 e operates on the contents of the scheduled database 50 . the first function , 310 accesses the scheduled database 50 . step 320 selects a recent entry , for example an entry in scheduled database 50 that has not yet been processed by the procedure of fig2 e . step 330 distributes information from this record to the related exhibitor site . referring again to fig2 d , the scheduled database 50 includes records which identify a particular content ( 128 ), theatre ( 129 ) and related temporal data ( 130 ). once the threshold number of users has been identified to justify scheduling a particular content , step 330 transmits the pertinent content ( at least components 128 - 130 ) to the exhibitor operating the particular theatre . processor 55 has access to theatre / exhibitor site address information to allow proper addressing of this information for transmission to the exhibitor . receipt of this information enables the exhibitor to integrate the information received from the scheduled database 50 into operating schedule of a particular theatre . the information from the scheduled database 50 may be used to actually schedule the presentation or the scheduling may be conditional on receipt of payment by the users who actually made the selections . in the latter case the exhibitor may also receive the identification of the users associated with the selections reflected in components 128 - 130 . in some embodiments the exhibitor will be concerned with payment functions . in that event the exhibitor requires the identity of the users who had requested the presentation of the particular selected content . by transmitting that information to the exhibitor , the exhibitor is enabled to request payment from the users . alternatively , payment functions can be handled by the on - demand servicer 500 or by a still different entity . in any event , the identity of the selecting users , which is available from the reference data 131 , will be important in completing the payment function . after distributing the content to the appropriate exhibitor ( 330 ) the next step ( 340 ) distributes relevant content to the related user . in this step the users who actually made the selections which led to the entry in the scheduled database 50 are informed that their selection will be presented at the selected theatre selection at the time slot of their selection . this may signal to those users the need or obligation to make payment , etc . the next step in the procedure of fig2 e is to distribute relevant content to appropriate social networking sites ( 350 ). as those skilled in the art are aware , social networking sites can identify a group of interested individuals from the identification of a particular user . accordingly , step 350 distributes the relevant content , e . g . the content data 128 , theatre data 129 , temporal data 130 and related user identification to particular social networking sites . for example , the user login or registration procedure may identify a social networking site related to the user . for each user identified in the record being processed , a message is transmitted to any related social networking site ( s ). the message identifies both the user and the particulars of the scheduled presentation . in this way , individuals who are associated with the user at that social networking site can be informed , by the social networking site , of the particular presentation which is scheduled and the fact that the driving impetus for the scheduling is the particular user . presumably some portion of the individuals associated with the user may be interested in also attending the presentation . distributing this information increases the probability that those viewing the scheduled presentation will include some of the individuals whom the social networking site has associated with the selecting user of the content . step 360 is executed to distribute the relevant content ( in this case the particular content , the particular theatre and the particular temporal data ) to a particular specialty site . for example , a specialty site which specializes in “ westerns ” can be informed of the scheduled presentation of a western film . information presented by the specialty site enables individuals accessing the specialty site ( presumably interested in presentation of western content ) to be informed of the scheduled display of the western allowing those individuals to attend the presentation as well . finally , step 370 determines if there are more recent entries for processing and , if so , processing returns to step 320 to begin the loop again with respect to another record from the scheduled database 50 . another embodiment is illustrated in fig1 , 3 a and 3 b . in this embodiment the on demand servicer 500 of fig2 a is replaced by the on demand servicer 505 shown in fig3 a . as seen in fig3 a , the on demand servicer 505 differs from the on demand servicer 500 ( of fig2 a ) in that the content selection database 35 and scheduled database 50 of fig2 a are replaced by the single selection database 60 . fig3 b is an illustration of one format in which the data may be stored in selection database 60 . a typical record of selection database 60 includes fields 76 - 80 . fields 76 - 79 may be the same as fields 28 - 31 of content selection database 35 storing , respectively , content data , theatre data , temporal data and user id . field 80 is a scheduled field . scheduled field 80 stores distinctive information to indicate whether a number of users in excess of the related predetermined threshold have made the associated selections . the first time a selection is made with given content , venue and temporal data a corresponding record may be written to the selection database 60 . on each subsequent occasion the same selection is made by a user , that user &# 39 ; s id is added to the record ( either directly or indirectly ) and the number of users identified in the record is compared to the predetermined threshold . when the number of users exceeds the threshold the distinctive information ( which need only be a schedule flag indicating that the conditions required for scheduling have been met ) is written to field 80 . thereafter information may be distributed to users , exhibitors , social and specialty networks as described in connection with fig2 e . procedures like those found in fig2 b and 2e are also associated with the embodiment of fig3 a / b . the procedure for writing to the selection database 60 is almost identical to the procedure shown in fig2 a . there are three changes . in steps 205 and 207 the database referred to is the selection database 60 and not the content selection database 35 . in step 209 rather than creating a new record in a scheduled database 50 , the scheduled field 80 of the selection database 60 is written with distinctive information indicating that the number of users having made the selection exceeds the predetermined threshold and scheduling the display is justified . the procedure for distributing information is also almost identical to the procedure of fig2 e . the changes from the procedure of fig2 e are now described . the access of step 310 is to the selection database 60 and not the scheduled database 50 . step 320 addresses only recent entries meeting two conditions : a ) entries where field 80 includes the distinctive information representing selection by more users than the predetermined threshold and b ) entries from which information has not yet been distributed . in some embodiments the on demand servicer will not actually distribute selection information to exhibitors , social networking sites or specialty sites unless the user selection is accompanied by payment or the promise of payment . this may be implemented by requiring the user to add credit card information ( or make other payment arrangements such as paypal , google or other bank related procedures ) to the selection information . the users may be informed that no charge will be processed unless the user &# 39 ; s selection is actually scheduled and in the event the user &# 39 ; s selection is scheduled but later cancelled then a refund will be provided to the user . the credit card or other payment information may be collected in either step 203 or 209 of fig2 b . in other embodiments the exhibitor associated with the selected theatre receives user id information and carries out payment related procedures . in still another embodiment payment is not required until the user attends the actual display of the content . in the following claims the term “ user ” or “ users ” shall mean a member or members of the consuming public as consumers of content exhibition in theatres , cinemas or other viewing locations simultaneously serving multiple users or viewers . while several specific embodiments of the invention have been described it will be understood that many changes can be made to the specific features described herein ; the scope of the invention is to be determined from the claims appended hereto .
| 6 |
conventional afm oxidation lithographic processes are inherently serial since they rely on a single afm tip to fabricate the entire pattern . for example , to fabricate a single 3 μm long trench in graphene , the tip may be moved pixel by pixel at a scan speed of 0 . 05 μm / s . while such a trench may be fabricated in minutes , repeating a pattern of 20 or 30 longer trenches over a 100 μm 2 area would take hours . for example , fig2 is a schematic illustration of a portion 20 of a graphene layer 22 on a silicon dioxide substrate 24 being etched using a single afm tip 26 , exposing silicon dioxide 24 to define a series of quantum dots 28 surrounded by trenches 30 , which serve as electron tunneling barriers . the completed portion 20 is shown as fig3 . such structures could be used in a single or thin - layer graphene transistor 32 made according to an embodiment of the present invention . a schematic representation of such a transistor 32 , without electrical leads , is shown in fig4 in relation to the portion 20 of the graphene layer 22 of fig3 . such a transistor 32 could be on the order of a few square microns , but would require hours to fabricate using an afm tip because of its complexity . further , afm tip material tends to be hydrophilic silicon . if the substrate is hydrophobic , like graphene , the moving tip tends to pick up the water meniscus and separate it from the substrate . this effect tends to leave undesirable gaps in the pattern , decreasing the utility of any structure formed by that method . for these reasons , it is impractical to etch complex patterns using afm tip lithography . according to an embodiment of the present invention , a flash lithography technique , based on the general principles of afm - tip local oxidation described above , can be used to precisely and controllably fabricate complex , large - area structures having nanoscale features ( i . e ., “ nanostructures ”). such nanostructures can be produced at much higher rates by the disclosed flash lithography technique than by single - tip techniques . in brief , an electrically - conductive silicon chip is prepared with a raised template that can repeatedly create large - area nanostructures of any two - dimensional morphology on any material which can be locally oxidized . the pattern of the template is transferred to the substrate in a single flash - patterning step . exemplary embodiments of the invention are discussed herein with respect to graphene substrates , but the technique may be applied to other substrates that are susceptible to local oxidation . for the purposes of the present disclosure a nanoscale feature is one having at least one dimension of less than 1000 nm , preferably in the range of about 10 nm to about 100 nm . in principle , line widths as small as 20 nm can be achieved using the flash lithography method disclosed herein . in a nanolithographic method according to an embodiment of the present invention , a position sensor is magnetically attached to the magnetic scanner of an afm , and a templated silicon chip , such as that described above , is placed therein with the templated surface of the chip ( i . e ., the template ) facing outward . useful embodiments of the position sensor and templated chips are discussed elsewhere herein . by means of the afm , the template is brought into close proximity to an oxidizable substrate ( e . g ., a layer of graphene on silicon dioxide ). in some embodiments of the method , the template is brought to within 20 nm to 50 nm of the substrate . the ambient relative humidity in the environment of the template is adjusted to a user - defined value in the range of from about 20 % to about 60 %, causing the formation of a water meniscus between the template and the substrate that bridges the template and substrate and shadows the pattern of the template . a voltage is applied across the templated chip and the substrate for a set patterning time ( i . e ., a hold time ), oxidizing the substrate only where it is linked to the template through the water meniscus . in some embodiments of the invention , the voltage is in the range of from about − 4v to about − 10v , and the hold time is in the range of from about 60 milliseconds ( ms ) to about 100 ms , depending on the material to be oxidized and the values of other process parameters . as a result of the oxidation , a pattern is formed in the substrate that matches the pattern of the template . process parameters such as applied voltage , hold time , radius of curvature of the tip , the distance between the tip , and ambient humidity , can be varied during the nanolithographic process to control the dimensions of the features in the patterned substrate . the aforesaid nanolithographic method and the apparatus used to implement the method are described more fully with respect to the figures and examples discussed hereinbelow . fig5 is schematic illustration of an exemplary templated silicon chip 34 that is suitable for use in a flash lithography technique according to an embodiment of the present invention . the templated chip 34 includes an electrically - conductive template 36 having a sharp edge 38 in the form of a letter “ s ”. the template 36 is integral with the silicon body 40 of the chip 34 , which also has a metallic layer 42 opposite the template 36 . in an embodiment of the present invention , the sharp edge 38 has a width in the range of about 10 nm to about 30 nm , with the width being limited by the method used to make the template 36 and the material of which the template 36 is made . an exemplary method of making such a chip 34 is described elsewhere herein . fig6 is a schematic illustration of the chip 34 mounted on a position sensor 44 for positioning the chip 34 . the position sensor 44 includes a silicon body 46 with a substantially flat face 48 having a recess ( not shown ) therein for receiving the chip 34 . the chip 34 is placed in the recess such that the template 36 faces outward from the position sensor 44 . the position sensor 44 further includes a number of cantilevers 50 having sharp tips 52 that extend away from the silicon body 46 . in some configurations , such as that of fig6 , the arms 50 may be roughly co - planar with the face 48 , and the tips 52 may be structurally similar to afm tips . however , the cantilevers 50 are not necessary co - planar with the face 48 , or even straight ( see , e . g ., fig7 ). the cantilevers 50 and the tips 52 are configured that contacting the tips 52 with a substrate ( not shown ) causes the template 36 to be spaced from the substrate by a desired distance . the cantilevers 50 and the tips 52 may be made of silicon , but should include an electrically - insulating material ( e . g ., silicon dioxide ) where they approach or contact a substrate 54 of fig7 . fig7 is a schematic front view of a chip 34 in place over an exemplary substrate 54 during a flash lithographic process according to an embodiment of the present invention . the substrate 54 includes a graphene layer 56 on a silicon dioxide insulating layer 58 formed on a silicon chip 60 . the arms 50 and tips 52 of the position sensor 44 maintain a set distance between the template 36 and the graphene layer 56 . a water meniscus 62 forms between the sharp edge 38 of the template 36 and the graphene layer 56 . the position sensor 44 is supported by an afm ( not shown ), which also applies an electrical potential across the position sensor 44 and the substrate 54 to drive the oxidation reaction . the meniscus 62 provides the only direct electrical contact between the template 36 and the substrate 54 . fig8 is a schematic orthogonal top view of the substrate 54 after completion of the flash lithographic step . an s - shaped portion 64 of the graphene layer 56 has been removed by oxidation and volatilization of the resulting co 2 . removal of the s - shaped portion 64 has exposed the silicon dioxide layer 58 , which does not oxidize . the exemplary flash lithography process disclosed herein can be applied to more complex patterns than that discussed with respect to fig5 - 8 . fig9 is schematic illustration of a templated silicon chip 66 that includes an electrically - conductive template 68 that is suitable for forming a single - electron transistor such as transistor 32 of fig4 . the template 68 is formed with sharp edges , such as sharp edges 70 , which may have widths in the range of from about 10 nm to about 30 nm . in all other respects the chip 66 is similar to the chip 34 of fig5 . fig1 is a schematic front view of the chip 66 in place over an exemplary substrate 72 during a flash lithographic process according to an embodiment of the present invention . in practice , the chip 66 would be mounted in a position sensor , such as the position sensor 44 discussed with respect to fig6 and 7 . the substrate 72 includes a graphene layer 74 on a silicon dioxide insulating layer 76 formed on a silicon chip 78 . a water meniscus 79 forms between the sharp edges 70 of the template 68 and the graphene layer 74 , and has the contours of the template 68 . in all other respects , the flash lithography step may be same as that described with respect to fig7 . fig1 is a schematic orthogonal top view of the substrate 72 after completion of the flash lithographic step . trenches 80 have been formed by removal of the graphene layer 74 by oxidation and volatilization of the resulting co 2 . removal of the lines 80 has exposed the silicon dioxide layer 76 . the resulting trenches 80 match those of the template 68 and the transistor 32 of fig4 . fig1 a - 12g are a sequenced set of schematic diagrams illustrating an exemplary method of forming templates , such as template 36 of fig5 and template 68 of fig9 , for use in a flash lithography process according to an embodiment of the present invention . referring to fig1 a , a layer 82 of silicon dioxide , a few nanometers thick , is formed on a surface 84 of a n - type ultra - flat silicon chip 86 . referring to fig1 b , a pattern 88 in the shape of the desired template is formed by spin - coating a layer ( not shown ) of a high - resolution electron - beam resist ( e . g ., hydrogen silsesquioxane , zep - 520 , zeon corp ., tokyo , japan ) onto the silicon dioxide layer 82 , defining the pattern 88 by electron - beam lithography , and removing the excess resist with a solvent ( e . g ., acetone ) to expose the silicon dioxide 82 outside of the pattern 86 . electron - beam lithography may be used to define patterns having line widths as small as about 20 nm . referring to fig1 c , the exposed silicon dioxide is then etched away ( e . g ., by a hf / nh 4 f solution or ch 4 reactive etching ) to create a silicon dioxide mask 90 for the silicon chip 86 . referring to fig1 c and 12d , the electron - beam resist pattern 88 is removed , the portion of the silicon surface 84 outside of the silicon dioxide mask 90 is etched away ( e . g ., by cl 2 and hbr plasma etching ) to a desired thickness , and the silicon dioxide mask 90 is etched away , leaving behind a silicon layer 92 with a raised template 94 . referring to fig1 e , the silicon layer 92 and template 94 are subjected to low - temperature oxidation ( e . g ., at a temperature of 950 ° c .) to sharpen the contours of the template 94 , depositing silicon dioxide to a thickness of about 1 - 2 nm and forming a sharp edge 96 , followed by ion implantation of boron to make the template 94 electrically - conductive . a heavy dose of boron may be needed to provide an adequate electrical conductivity in the template . the boron may be activated by annealing at a temperature of about 950 ° c . in nitrogen gas for about 30 minutes . referring to fig1 f , a photoresist layer 98 is spin - coated over the template 94 and adjacent portions of the silicon layer 92 , and a metallic layer 100 ( e . g ., a layer of nickel ) is deposited on the back - side 102 of the silicon chip 86 so that it may provide an electrical and magnetic connection to an afm . in an embodiment of the present invention , the metallic layer 100 is formed to a thickness in the range of from about 100 nm to about 200 nm . referring to fig1 g , the photoresist layer 98 is removed , exposing at least the template 94 formed on the silicon chip 86 . fig1 is a schematic illustration of the chip 86 mounted to a silicon block 104 , such that the template 94 faces away from the block 104 . the block 104 is provided with spacers 106 , 108 , 110 , 112 positioned around the chip 86 . the spacers 106 , 108 , 110 , 112 are made of an electrically - insulating material and may be formed by deposition of silicon dioxide onto the silicon block 104 by methods known in the art . the spacers 106 , 108 , 110 , 112 extend past the template 94 such that contacting the spacers 106 , 108 , 110 , 112 with a substrate ( not shown ) causes the template 94 to be spaced away from the substrate by a desired distance . fig1 is a schematic front view of the chip 86 in place over an exemplary substrate 114 during a flash lithographic process according to an embodiment of the present invention . the substrate 114 includes a graphene layer 116 on a silicon dioxide insulating layer 118 formed on a silicon chip 120 . the spacers 106 , 108 , 110 , 112 maintain a set distance between the template 94 and the graphene layer 116 . a water meniscus 122 forms between the sharp edge 96 of the template 94 and the graphene layer 116 . the block 104 is supported by an afm ( not shown ), which also applies an electrical potential across the block 104 and substrate 114 to drive the oxidation reaction . fig1 a - 15i are a sequenced set of schematic diagrams illustrating a method for fabricating a position sensor 124 ( see fig1 h and 15i ) of the same type as the position sensor 44 discussed with respect to fig6 and 7 . in all of the illustrated steps of the method ( i . e ., fig1 a - 15i ), the views are end views taken from the same direction as the end view of the position sensor 124 shown in fig1 i . referring to fig1 a , layers 126 , 128 of a positive electron beam resist are applied to the backside 130 of a silicon - on - insulator ( soi ) wafer 132 in contact with the layers 126 , 128 to protect the backside 130 of the soi 132 during subsequent processing steps . the layers 126 , 128 are formed by well - known methods of spin - coating and electron - beam lithography . referring to fig1 b , a metallic layer 134 ( e . g ., a layer of nickel ) is deposited on the exposed area 136 of the backside 130 of the soi wafer 132 so that the position sensor 124 may be electrically and magnetically connected to an afm ( note shown ). in an embodiment of the present invention , the metallic layer 134 has a thickness in the range of from about 100 nm to about 200 nm . referring to fig1 c , a negative photoresist 138 is patterned onto the front side 140 of the soi wafer 132 so as to define an exposed area 142 of the front side 140 . silicon is then etched from the exposed area 142 . the silicon etching may be performed by methods using cl 2 and hbr , or other methods known in the art . referring to fig1 d , the aforementioned silicon etching creates a recess 144 for receiving a templated chip 146 ( see fig1 ) of the same type discussed with respect to fig5 , 9 and 12 a - 12 g . the negative photoresist 138 is then removed ( e . g ., by use of acetone ) from areas 148 , 150 . referring to fig1 e , removal of the negative photoresist 138 exposes portions ( not shown ) of the front side 140 of the soi wafer 132 corresponding to areas 148 , 150 . layers 152 , 154 of silicon dioxide , layers 156 , 158 of silicon , and layers 160 , 162 of silicon dioxide are exposed at the front side 140 using techniques described in j . han et al ., j . micromech . microeng . ( 2006 ), vol . 16 , pp . 198 - 204 ( hereinafter , “ the han article ”), which is incorporated by reference herein in its entirety . additional layers 164 , 166 of silicon dioxide are added to the backside 130 of the soi wafer 132 , to protect the soi wafer 132 in contact with the silicon dioxide layers 164 , 166 . referring to fig1 f , a layer of photoresist 168 is formed over the backside 130 of the soi wafer 132 and the silicon dioxide layers 164 , 166 to protect them during subsequent etching steps , and the upper silicon dioxide layers 152 , 154 are etched so as to leave silicon dioxide remnants 170 , 172 to protect the ends 174 , 176 of the silicon layers 156 , 158 , where conical tips 174 , 176 ( see fig1 g - 15h ) will be formed distal to the soi wafer 132 . silicon layers 164 , 166 are etched , and silicon dioxide remnants 170 , 172 are removed to form conical tips 174 , 176 , according to methods described in the han article . referring to fig1 g , the conical tips 174 , 176 extend transversely from the etched silicon layers 156 , 158 . the etched silicon layers 156 , 158 , in combination with the respective conical tips 174 , 176 are referred to hereinafter as cantilevers 178 , 180 . the photoresist 168 is removed and the back side 130 of the soi wafer 132 is etched , followed by etching of silicon dioxide layers 160 , 162 , 164 , 166 ( e . g ., by using tetramethylammonium hydroxide at 80 ° c .) to free the cantilevers 178 , 180 . the cantilevers 178 , 180 , especially including the tips 174 , 176 , are made non - conductive by the deposition of silicon dioxide layers 182 , 184 , 186 , 188 . silicon dioxide layers 186 , 188 should generally conform to the underlying tips 174 , 176 . the photoresist 138 is then removed . the completed position sensor 124 is shown in end view in fig1 i . fig1 shows a templated chip 136 situated in the recess 144 of the position sensor 124 . the templated chip 136 may be of the same type as templated chips 34 , 66 , 86 discussed with respect to fig5 , 9 and 12 a - 12 g , respectively . fig1 is a bottom orthogonal view of the position sensor 124 with the templated chip 136 showing another view of the cantilevers 178 , 180 , and additional cantilevers 182 , 184 formed by an extension of the method discussed with respect to fig1 e - 15i . the necessary steps of such an extension will be recognized by those having ordinary skill in the art and possession of the present disclosure . the position sensor 124 can be magnetically mounted to a conventional afm scanner head . the position sensor 124 can be used as part of a sensor in a system for controlling the position and orientation of a templated chip relative to a substrate . the components of the system and their arrangement are not illustrated by a figure , but are described in sufficient detail herein to enable a person having ordinary skill in the art to comprehend and construct such a system . components of position sensor 124 are numbered with reference to fig1 and 17 . position sensing may be accomplished using a light lever technique . in an embodiment of the present invention , the position sensor 124 is mounted on the scanner head of an afm , which moves the position sensor 124 . separate laser beams are directed at each of the cantilevers 178 , 180 , 182 , 184 from the backside 130 of the position sensor 124 . in an embodiment of the present invention , a beam from a single laser source is split by beam splitters to generate separate laser beam for each cantilever 178 , 180 , 182 , 184 . each laser beam is reflected off of the cantilever and onto the center of a four - quadrant diode , which is a device well - known in the art . as a cantilever 178 , 180 , 182 , 184 is brought closer to the substrate , electrostatic forces cause it to deflect in the z - direction and laterally . this deflection is seen as a change in the position of the reflected laser beam and measured as a voltage differential between the top - bottom and left - right halves of the photodiode . voltage differentials for the respective diodes can be compared through a simple feedback loop . this system will continuously monitor the position and orientation of the position sensor 124 relative to the substrate , allowing for manual or automatic control . the disclosed nanolithography technique can reproducibly transfer a pattern to a large area of substrate by a single application of voltage . arrays of such patterns can be fabricated in a short amount of time simply by changing the lateral position of the templated chip . high reproducibility is achieved since the short patterning time and the rigidity of the templated chip configuration fortifies the technique against thermal or mechanical instability . table 1 presents a comparison of an embodiment of the present invention with lithography techniques in the prior art . ** an array of several tens to hundreds of afm tips is capable of producing arbitrary patterns per tip , however this pattern is repeated per tip , thereby creating arrays of such patterns . a series of experiments were conducted using single - tip anodic oxidation ( i . e ., point oxidation using a standard afm tip ) of graphene to define parameter ranges for the design of the nanolithographic processes of the present disclosure . experiments were performed using a pacific nanotechnology nano - i2 afm . single - tip local anodic oxidation was used to cut few - layer graphene ( flg ) and inscribe insulating patterns on highly - ordered pyrolyzed graphite ( hopg ) using a standard afm tip . a bias of − 10v was applied to the tip with no feedback in a high humidity atmosphere to create 0 . 5 nm trenches spaced 27 nm apart on flg , and having depths of 0 . 5 nm . under the same conditions , with the afm in scan mode , non - volatile , electrically - insulating square patterns of graphene oxide were formed on hopg . the squares had dimensions of about 50 μm × 50 μm and line widths of about 600 nm to 800 nm . local oxidation was used to segment multi - walled carbon nanotubes at selected points . a standard afm tip was positioned over a selected point on a nanotube having a diameter of about 50 nm , and a bias of about − 5 v was applied for 100 ms . local oxidation of a graphene substrate using a standard afm conductive diamond tip was performed to evaluate the effect of the distance between the tip and the substrate at high relative humidity ( i . e ., relative humidity greater than 60 %) across a voltage range of − 4v to − 8v and a hold time of about 100 ms . feature sizes obtained under the process conditions that were evaluated are presented in table 2 and plotted in fig1 . local oxidation of a graphene substrate using a standard afm conductive diamond tip was performed to evaluate the effect of the distance between the tip and the substrate at low relative humidity ( i . e ., relative humidity less than 30 %) across a voltage range of − 6v to − 9v and a hold time of about 100 ms . feature sizes obtained under the process conditions that were evaluated are presented in table 3 and plotted in fig1 . local oxidation of a graphene substrate using a standard afm conductive diamond tip was performed to evaluate the effect of the voltage holdtime on feature size . tests were made at an applied voltage of − 7 . 85 v , a relative humidity of about 33 %, and a tip / substrate distance of 45 - 50 nm . feature sizes obtained under the process conditions that were evaluated are presented in table 4 and plotted in fig2 . it should be understood that the embodiments described herein are merely exemplary and that a person skilled in the art may make many variations and modifications thereto without departing from the spirit and scope of the present invention . all such variations and modifications , including those discussed above , are intended to be included within the scope of the invention , which is described , in part , in the claims presented below .
| 1 |
before describing the present invention in detail , it is to be understood that this invention is not limited to specific materials or device structures or geometries , as such may vary . it is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only , and is not intended to be limiting . as used in this specification and the appended claims , the singular forms “ a ,” “ an ,” and “ the ” include both singular and plural referents unless the context clearly dictates otherwise . thus , for example , reference to “ an active ingredient ” includes a plurality of active ingredients as well as a single active ingredient , reference to “ a temperature ” includes a plurality of temperatures as well as single temperature , and the like . it has been discovered that in a fluidized bed reactor which has fluid at approximately atmospheric pressure flowing through it and suitably sized electrodes being excited at appropriate frequencies and voltages , it is possible to observe an intermittent discharge which we call “ multi - arc .” this discharge is characterized by the existence of arcs which start at one electrode or inside the particle bed , and proceed towards the other electrode , passing through or near particles in the fluidized bed reactor . the individual arcs may last , for example , for milliseconds to seconds . the discharges persist continuously as long as the fluid flows , the density of particles is maintained , and the electrodes are excited at appropriate frequencies and voltages . although reference is made here primarily to fluidized beds , it is understood that other similar moving bed reactors , such as entrained beds , rotary kilns , and cascade beds , will have similar ability to benefit from our invention . the general appearance of a multi - arc discharge may be understood by reference to fig1 . the figure depicts schematically an elevation view of a thin cross section of a multi - arc discharge between two parallel electrodes 10 and 12 . the cross section is taken perpendicular to the electrodes , as depicted in the inset 18 . the entire discharge would consist of a number of such cross sections stacked against each other . fig1 is not to scale . in particular , the particles such as 14 are depicted as larger than would normally be expected for a realistic separation between electrodes 10 and 12 . as may be seen in fig1 , a multi - arc discharge exists in a fluidized bed or similar fluidized collection of particles such as 14 moving in a fluid . the discharge consists of a multitude of small arcs such as 16 going either from an electrode to a particle or between two particles or between two electrodes . while the arcs depicted in fig1 remain within the cross - section shown in the figure , it is also possible for arcs to go from a particle in one cross - section to a particle in another cross section like the on depicted . the cross - sections are merely an artificial subdivision of the space between the electrodes which we adopt for ease in depicting schematically the multi - arc discharge . without being bound by theory , it is hypothesized that a multi - arc discharge occurs because the individual particles in a fluidized bed reactor act in combination with the electrodes as a variable capacitor with continuous locally variable dimensions . the electric fields so created on occasion exceed the breakdown voltage of the gas or gases in the bed . small arcs form , and those arcs are then able to propagate from particle to particle . multi - arc discharges may be produced with an apparent bed density of particles in the fluidized bed reactor which is , for example , about 0 . 1 g / cm 3 to about 0 . 3 g / cm 3 to about 1 g / cm 3 to about 3 g / cm 3 to about 10 g / cm 3 . this density is taken relative to the volume in which the particles are fluidized . a wide range of particles may be used in the bed . they may take part in the chemical reaction which is being assisted by the multi - arc discharge , for example by having a coating deposited on them as a result of that reaction . alternatively , they may be inert particles which are in the bed solely to facilitate the formation of the discharge . the particles may be , for example , metallic , ceramic , organic , semiconductor , or composite . the particles may be from about 1 μm in mean diameter to about 10 μm , 100 μm , about 300 μm , about 500 μm , or about 1 mm in mean diameter . a wide range of gases may be introduced into the fluidized bed . such gases may be inert gases chosen simply to assist in the fluidization , as for example noble gases , or they may alternatively be reactive gases that take part in the chemical reaction . the fluidizing gas or gases should have a flow rate into the bed sufficient for it to be fluidized . preferably the gases should have a flow rate that does not cause the production of large bubbles in the fluidized bed . as is known to those skilled in the art , the precise rate of flow sufficient to initiate fluidization with a given collection of particles may depend , inter alia , on the particle size distribution and density of the particles . as is known by persons of skill in the art , a fluidized bed reactor design may differ , for example , according to whether the process is intended for batch or continuous practice . design may differ also , for example , based on whether the particles are a product of the process . in addition , depending on the heat generated by the reaction carried out in the reactor , it may be necessary to provide for cooling , for example by tubes embedded in the fluidized bed cooled by the circulation of a liquid such as water through the tubes . many other design considerations for fluidized bed reactors exist . a general introductory reference on the design of fluidized bed reactors is j . r . howard , fluidized bed technology : principles and applications ( bristol , 1989 ). the multi - arc discharges of the invention may be useful in accelerating any reaction already known to be assisted by the formation of reactive species in a discharge of some type . there is an extensive literature on such reactions which carried out with the assistance of low - pressure plasmas , corona discharges , dielectric barrier discharges , and the like . reactions which are accelerated by multi - arc discharges may , for example , occur between gases . they may alternatively occur between one or more gases and the surface of the particles , as for example when the reaction results in the deposition of a layer upon the surface of the particles or in the etching away of a portion of the surface of the particles . the reactions may alternatively occur between one or more gases which have passed through the multi - arc discharge and then impinge upon a surface , or upon a liquid , or upon a solid workpiece of some shape . it should be understood that when we say that reactions occur between gases or between a gas and something else such as a particle or workpiece , we include a situation in which intermediates are formed from gas molecules ( by means of the discharge or otherwise ), and these intermediates go on to react further . it is believed that the formation of such reactive intermediates is a common occurrence in reactions involving gases in a discharge or gases which have passed through a discharge . the intermediates may be ions , radicals , adsorbates , absorbates , or other types of intermediates . the formation of these species may be enhanced by the addition to the particles in the bed or the surface of the particles of catalytic materials , coatings , or islands that can affect the reaction rate or extent or direction as well as absorbants materials that may absorb part of the products or byproducts , thus reducing their presence in the gas phase and increasing the overall reaction rate and extent , or even changing the composition of the final products . the reactions for which a multi - arc discharge is useful may , for example , include the depositions of oxides , nitrides , and carbides that are carried out with plasma - enhanced chemical vapor deposition in the semiconductor industry . the reactions may include , for example , depositions which result in films of sin x o y , sic x h y , or sio x c y h z with varying values of x , y , and z . silicon depositions may employ , for example , chlorosilanes . silica depositions may employ , for example , tetraethyl orthosilicate ( teos ). these depositions may be carried on a wide variety of substrates , for example ceramics , semiconductors , or metals . a multi - arc discharge may also be useful , for example , for surface treatments of particles in which the particles are cleaned or etched in some manner by bombardment of ions from the discharge or by reaction with suitable cleaning or etching gases , for example halides , oxygen , or ammonia . surface treatments of this type may , for example , serve to facilitate adhesion of additional layers to the surfaces treated . such treatments using plasma discharges are particularly used for polymeric materials . surface treatments may , for example , be used to render a polymeric material more hydrophilic or more dispersible . hydrophilicity may be achieved , for example , by using oxygen gas to create c ═ o and c ( o ) o groups on a vinyl polymer backbone . reactions for which the multi - arc discharge is useful include , for example , halogenation of metals , such as titanium . the reactions may be carried out using metal particles in the fluidized bed and a process gas which can halogenate the metal particles . a discussion of some reactions in this class is found in u . s . published patent application no . 2005 / 0097991 , assigned to the same assignee as the present application . reactions in which halogenated organic compounds are converted to potentially less harmful species are a further class of reactions for which multi - arc discharges may be useful . example 2 shows the utility of multi - arc discharges for the reaction ccl 4 + 2h 2 o → co 2 + 4hcl . multi - arc discharges would also be expected to be useful for reactions of ccl 4 with oxygen . more generally , multi - arc discharges would be expected to be useful to dispose of undesired types of compounds such as dioxins , even when they are present in a low concentration such as less than a part per million by volume . more generally , multi - arc discharges may be useful for processes which involve converting undesirable substances to potentially less harmful species , since variations between the discharge - assisted and unassisted reactions may be acceptable as long as the undesirable substance is eliminated . other reactions which may benefit from a multi - arc discharge would be , for example , those discussed in u . s . pat . nos . 4 , 810 , 524 , 5 , 372 , 799 , and 5 , 399 , 832 . other reactions that may benefit from multi - arc discharges are those that generally are not perceived as practical with normal thermal systems even when operating at very high temperatures , including those not possible at over 1000 ° c . and even over 1500 ° c . for example , production of metals by reduction of many ores such as oxide ores by h 2 is not possible even at temperatures over 1000 ° c . examples are sio 2 and tio 2 . a multi - arc discharge approach permits the formation of atomic hydrogen , which does have the reductive power to produce metals from those oxides . the reactions of interest may take place within the area in which the multi - arc discharge is occurring . alternatively , such reactions may take place in an area to which a gas or gases flow after passing through the multi - arc discharge . in order to produce a multi - arc discharge it is convenient to have a control circuit which energizes the electrodes at appropriate voltages and frequencies to produce a discharge of that type . the control circuit may be a simple analog oscillator , power amplifier , and voltage divider or transformer , or it may be a more complex electronic circuit capable , for example , of communicating with a computer which may be able to control multiple instruments and actuators . fig3 depicts a simple arrangement for energizing two electrodes . an oscillator 42 generates a waveform which is passed to a power amplifier 44 . a transformer 46 is used at the output of the power amplifier 44 to produce voltages which swings up and down above and below ground at the outputs in order to drive two electrodes within the fluidized bed reactor 40 . where the control circuit can communicate with a computer , the computer may control the voltages and frequencies which are applied to the electrodes in order to produce the discharge , and may also monitor or control , for example , the actuators , for example pumps and valves , which are used to feed the fluidized bed reactor . the computer may also use information on the operation of the discharge , for example information from temperature sensors , plasma - diagnostic style probes , or optical sensors , to drive the electrodes and / or to control the actuators which determine how the reactor is fed . this computer control may be particularly useful , for example , in the startup phase of the reactor . the computer control may be part of a larger integrated control system covering a variety of conditions relating to the operation of the fluidized bed reactor or of a larger process of which it is a part . the computer control may be expected also to maintain records of the operation of the reactor , for example on disk storage , or to dispatch information about the operation of the reactor over a communications medium of some sort to other computer systems . the control circuit would be expected in many cases to have some type of operator interface allowing an operator to control the operation of the system . this interface could , for example , be implemented in a computer with which the control circuit communicates , or it may be implemented with buttons and dials , or by a combination of the two . to produce a multi - arc discharge it is preferred to energize the electrodes at a frequency predominantly or substantially under 20 khz , including for example with dc voltages . more preferably , the electrodes are energized at a frequency between about 1 khz and about 3 khz . alternatively , the electrodes may be energized at two or more frequencies , including energizing at dc . the voltages which are employed will depend on the distance between the electrodes , since electrical discharges in general have been observed to have thresholds at particular electric field strengths . in general , for small laboratory scale reactors a voltage of no more than about 10 kv may be employed . a wide variety of electrode shapes and arrangements may be employed . in fig2 , a simple arrangement of two cylindrical hollow electrodes is shown . we have a cylindrical reactor with distributor plate 26 , gas inlet 32 and gas outlet 30 . a lower hollow electrode 24 is in contact with the bed 22 . the upper hollow electrode 20 can be still immersed in the bed 22 above the first one 24 , or at the top of the bed or above the bed up to 2 cm higher for voltages in the kv level . the power oscillator 28 provides power to the two electrodes . it is alternatively possible to have a variant on fig2 in which only the upper hollow electrode 20 is present , and the distributor plate 26 serves as a second electrode . in fig4 , an alternate arrangement of electrodes is shown , in which there are four electrodes 60 , 62 , 64 , and 66 . as may be seen , these four electrodes are arranged to form a cylinder around the fluidized bed . the electrodes may be energized in a pattern which rotates around the cylinder . for example , electrodes numbers 60 , 62 , 64 , and 66 may be energized with the same waveform but at different phases , so that the phase of the waveform energizing electrode 62 is offset 90 ° from that energizing electrode 60 , the phase of the waveform energizing electrode 64 is offset 180 ° from that energizing electrode 60 , and the phase of the waveform energizing electrode 66 is offset 270 ° from that energizing electrode 60 . other arrangements involving multiple electrodes energized with different - phase versions of the same waveform are possible . for example , three electrodes could be employed which are energized by three - phase power type waveforms . a variety of circuits may be used to produce different - phase versions of the same waveform . an exemplary circuit is given in fig5 . there is an oscillator 70 which drives a power amplifier 72 and a 90 ° phase shifter 78 , the latter in turn driving power amplifier 73 . the output of each power amplifier is fed into its respective transformer 74 and 76 . taps are taken off the power transformers to drive electrodes through connections 80 , 82 , 84 , and 86 . it is to be understood that while the invention has been described in conjunction with the preferred specific embodiments thereof , the foregoing description is intended to illustrate and not limit the scope of the invention . other aspects , advantages , and modifications within the scope of the invention will be apparent to those skilled in the art to which the invention pertains . all patents , patent applications , and publications mentioned herein are hereby incorporated by reference in their entireties . however , where a patent , patent application , or publication containing express definitions is incorporated by reference , those express definitions should be understood to apply to the incorporated patent , patent application , or publication in which they are found , and not to the remainder of the text of this application , in particular the claims of this application . the following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to implement the invention , and are not intended to limit the scope of what the inventors regard as their invention . efforts have been made to ensure accuracy with respect to numbers ( e . g ., amounts , temperature , etc .) but some errors and deviations should be accounted for . unless indicated otherwise , parts are parts by weight , temperature is in ° c . and pressure is at or near atmospheric . a fluidized bed reactor is constructed comprising a tube of inner diameter 22 mm , a gas inlet passing through a distributor , a metal frit serving as an electrode , and a mesh electrode which is movable with respect to the tube . helium is supplied at 0 . 6 liters / min to create a fluidized bed of porous aluminum oxide particles of about 60 μm mean diameter . a multi - arc may be produced in this reactor by energizing the electrodes at about 1 kv and frequencies ranging from 500 hz to 3000 hz . the reaction ccl 4 + 2h 2 o → co 2 + 4hcl is carried out as follows . a flow of he of 0 . 6 liters / min is provided to a fluidized bed reactor comprising a porous aluminum oxide powder , forming a fluidized bed . a flow of 0 . 5 ml / hour of ccl 4 and 0 . 5 ml / hour of h 2 o is supplied . a multi - arc discharge is started up over a period of 600 s and continued at full strength until 4000 s have elapsed . a voltage of about 1 kv is applied at frequencies of about 2000 hz between two steel screen electrodes , one situated at the bottom of the bed immediately on top of the distribution plate and a second a few mm from the top of the bed during fluidization . the bed thickness is about 1 cm . the concentrations of gases exiting the reactor are measured using a quadrupole mass analyzer ( qma ). fig6 depicts the resulting measurements , where it is seen that the multi - arc discharge has permitted the reaction of ccl 4 and h 2 o to occur . using the same design and working conditions as in example 2 , ticl 4 and n 2 were injected . a golden tin coating was obtained on a quartz tube partially immersed in the bed .
| 1 |
the disclosure will now be described with reference to the drawing figures , in which like reference numerals refer to like parts throughout . as shown in fig1 , a machine assisted laminator 10 (“ mal ”) suitable for use in an embodiment of the disclosure includes one or more robotic vehicles 12 to position a ply material 14 upon a form 16 to generate an item 18 . the robotic vehicles 12 are guided by a guidance system 20 . the guidance system 20 includes one or more laser emitters 22 , laser receivers 24 , and a control unit 26 . the control unit 26 is configured to receive instructions from a user and forward instructions to the laser emitters 22 . the laser emitters 22 are configured to forward signals , via laser , to the laser receivers 24 and thereby control the movement of the robotic vehicles 12 . in this manner , a set of computer readable instructions are utilized by the mal 10 to fabricate the item 18 . a more detailed description of the robotic vehicles 12 and the guidance system therefore are to be found in u . s . patent application ser . no . 10 / 986 , 292 , entitled , optical laser guidance system apparatus and method , filed on nov . 12 , 2004 , by roger j . ledet and john e . yestrau , the disclosure of which is hereby incorporated in its entirety . in an embodiment , the mal 10 includes two or more robotic vehicles 12 configured to co - operatively apply the ply material 14 to the form 16 . for example , as shown in fig1 , each robotic vehicle 12 initiates placement of the ply material 14 at or near a center portion of the form 16 and then co - operatively work outward and to different portions of the form 16 . thus , it is an advantage of embodiments of the disclosure that material lay down rates are increased over atlms that have only one conventional end effector . in another example , the robotic vehicles 12 are configured to co - operatively weave two or more layers of the ply material 14 together upon the form 16 . thus , it is an advantage of embodiments of the disclosure that structural integrity of the item 18 is increased and de - lamination of the item 18 is decreased by weaving multiple layers of the ply material 14 together . in another embodiment of the disclosure , the mal 10 includes a robotic armature or gantry - type positioning device configured to position or otherwise control the placement of the ply material upon the form 16 . in a particular example , the gantry - type positioning device is configured to control ten axes of movement ( five axes of the gantry and five axes of an end effector ). however , it is to be understood that the specific number of axes may depend upon the particular operating condition and thus , the number of axes controlled is not critical to the disclosure . in yet other embodiments , the set of computer readable instructions are utilized to control the movements of the tool 16 . for example , the tool 16 includes a rotating mandrel or x - y table . each robotic vehicle 12 is configured to apply course material 14 on the form 16 . in various forms , the robotic vehicles 12 include a compaction roller , sweep , and / or vacuum placement shoe to apply the course material 14 to the form 16 . the form 16 is configured to provide a suitably stable and finished surface for ply placement . characteristics of the form 16 , such as size , shape , contour , and the like , are based upon design parameters of an item 18 . the item 18 is shown in fig1 being constructed from a plurality of courses 28 . each layer of the courses 28 placed upon the form 16 or a substrate 30 is described as a ply and the item 18 is typically fabricated from a plurality of plies . the substrate 30 includes the form 16 surface and / or a previously applied course 28 . fig2 is a perspective view of a front of an end effector 32 that is suitable for use with the mal 10 . the end effector 32 is positioned by the robotic vehicle 12 or any suitable positioning device such as , for example , a robotic armature , gantry type device , and the like . as shown in fig2 , the end effector 32 includes a supply roll 34 to dispense a course material 14 . this supply roll 34 is supported by a support 36 . in a particular embodiment , the support 36 includes a pair of rollers to facilitate rolling of the supply roll 34 . in this manner , the course material 14 is withdrawn from the supply roll 34 . specifically , the rollers facilitate an unpowered or “ free wheeled ” removal of the course material 14 from the supply roll 34 . that is , the course material 14 is drawn off the supply roll 34 via the movement of the end effector 32 without need of relatively complex servo motors and control systems . thus , simplifying and improving the reliability . the course material 14 includes any suitable course material . examples of suitable course material include various fibers , films , foils , and / or the like . particular examples of fibers include glass , aramid , carbon , and various other fibers in the form of unidirectional “ tape ,” woven fabric , biaxial cloth and the like . in addition , the course material 14 may be pre - impregnated with a resin or other such binding substance . the course material 14 optionally includes a backing or separator film 40 ( shown in fig4 ) to substantially prevent the course material 14 from adhering to itself while in roll form . the end effector 32 further includes a sensor 38 . the sensor 38 includes any suitable sensing device . examples of suitable sensing devices include tactile , optical , and systems employing various forms of electromagnetic radiation such as infra red ( ir ), microwave , and the like . in a particular example and as discussed further herein , the sensor 38 includes a machine vision system configured to determine the position of an edge 42 of a previously applied course 28 . in various other examples , the sensor 38 includes an array of feelers that contact the substrate 30 and sense a difference in height and / or an array of photo detectors that sense differences in incident light reflected from the substrate 30 . the mal 10 typically applies the course material 14 upon the substrate 30 along a “ natural path .” generally , the natural path is described in terms of a path the course material 14 would take when rolled out upon the substrate 30 . more specifically , a centerline 44 of the natural path is described geometrically as a geodesic curve on the substrate 30 . that is , the shortest distance between two points that lies on the substrate 30 . fig2 additionally illustrates an interface 46 disposed between two adjoining courses 28 . this interface 46 generally coincides with the warp direction of the flanking courses 28 . the interface 46 may diverge somewhat from the warp direction of one or both of the flanking courses 28 depending upon the taper or profile of the courses 28 . the item 18 typically includes multiple plies and it is not uncommon that two or more plies may lay in the same or approximately same warp direction . plies laying in the same warp direction are generally separated by several plies in other warp directions . still , it is preferable that interfaces 46 of the plies laying in the same or similar warp direction are not in alignment . it is an advantage of an embodiment that the alignment of the interfaces 46 are determined and adjusted or offset if found to be in alignment . fig3 is a perspective view of a rear of the end effector 32 suitable for use with the mal 10 . as shown in fig3 , the end effector 32 further includes a cutting assembly 48 configured to cut the course material 14 . in general , the cutting assembly 48 performs cuts to generate a side edge profile . in addition , the cutting assembly performs end cuts , such as leading edge and trailing edge cuts . the cutting assembly 48 includes any suitable cutting device 50 operable to sever or otherwise cut the course material 14 . suitable devices include ultrasonic knives , saws , lasers , and the like . furthermore , the cutting assembly 48 includes an actuator 52 to position the cutting device 50 along a rail 54 that traverses the course material 14 . the actuator 52 is configured to respond to signals from a controlling device . in operation , the mal 10 is configured to apply the courses 28 to generate a ply of the item 18 . the course material 14 , is typically applied according to the manufacturer &# 39 ; s specifications . for example , courses of unidirectional tape are typically abutted and / or applied within a gap tolerance of about 0 . 10 inches with essentially no overlap tolerance . in another example , fabric typically has no gap tolerance , but rather , may have an overlap tolerance of 0 . 25 to 0 . 50 inches . depending upon the contour of the substrate 30 , the natural path of the courses may converge or diverge beyond these tolerances . in an embodiment , the paths of the courses 28 are defined such that an overlap 56 is generated . the overlap 56 is configured such that at a relative maximum divergence between two abutting courses 28 , the respective edges of the abutting courses 28 are not further away than the gap tolerance . in the event that the overlap 56 exceeds the overlap tolerance , excess course material 14 is trimmed . the amount of excess to trim is determined based upon the sensed edge of the previously applied course 28 . for example , when applying unidirectional tape , the cutting assembly 48 is controlled to cut a profile along the edge of the course material 14 to essentially coincide with the edge of the previously applied course 28 . in a preferred embodiment , the cutting assembly 48 is configured to function with a vacuum placement shoe s . in general , the vacuum placement shoe s is configured to generate a partial vacuum between the ply material 14 and the substrate 30 . as the end effector 32 advances and the ply material 14 is withdrawn from the vacuum placement shoe s , the ply material 14 is pressed upon the substrate 30 via atmospheric pressure . specifically , the vacuum placement shoe s is configured to form a seal over a portion of the substrate 30 and generate a partial vacuum within the sealed area . the ply material 14 is fed through the sealed area and pressed upon the substrate 30 via atmospheric pressure . a more detailed description of the vacuum placement shoe is to be found in u . s . patent application ser . no . 10 / 437 , 067 , entitled vacuum assisted ply placement shoe and method , filed on may 14 , 2003 , by roger j . ledet , arnold j . lauder , and matthew j . shewfelt , the disclosure of which is hereby incorporated in its entirety . fig4 is an exploded view of a ply layup according to an embodiment of the disclosure . as shown in fig4 , a ply 58 is consolidated upon the form 16 . that is , the courses 28 are applied to the form 16 and together these courses generate the ply 58 . in the example illustrated in fig4 , the separator film 40 is shown severed into strips 40 a and 40 b with the strip 40 a covering the portion of the course material 14 utilized to generate the ply 58 and the strip 40 b covering a trimmed excess course material 14 b . in another embodiment , the separator film 40 is essentially left intact during edge cutting operations . for example , the cutting assembly 48 is disposed upon the course material 14 side rather than the separator film 40 side and the cutting assembly 48 is configured to substantially leave the separator film 40 uncut as the course material 14 is cut . according to an embodiment , the separator film 40 is removed following fabrication of the ply 58 . it is an advantage of this embodiment that the separator film 40 substantially prevents the excess course material 14 b from adhering to the previously applied course 28 . as shown in fig4 , the separator film 40 a substantially prevents the excess course material 14 b from adhering to the previously applied course 28 . in addition , the separator film 40 a facilitates protection of the ply 58 from dust , debris , and physical insult such as , for example , scratches , abrasion , and the like . in various embodiments , the separator film 40 is removed prior to or during application of successive courses of the course material 14 to the substrate 30 , as is the case when edges of successive courses of the course material 14 are overlapped . in such instances , a take up reel , for example , is configured to accumulate the separator film 40 , 40 a and / or 40 b , and / or the excess course material 14 b . a suitable take up reel for use with the mal 10 is described in u . s . patent application ser . no . 10 / 975 , 433 , entitled , automated fabric layup system and method , filed on oct . 29 , 2004 , by w . robert nelson , michael c . dowling , mark k . stephen , raymond l . royal , and c . tim harbaugh , the disclosure of which is hereby incorporated in its entirety . fig5 is a block diagram of a system 60 suitable for use with the mal 10 . as shown in fig5 , the system 60 includes a controller 62 . the controller 62 is operable to execute computer readable code . in this regard , the system 60 includes a set of computer readable instructions or code 64 . according to the code 64 , the controller 62 is configured to access a file 66 . this file 66 includes one or more of the following : a computer readable model of the composite item ; a computer readable representation of the surface of the layup form or the form 16 ; a computer readable representation of the edges of the form 16 ; the thickness of the composite item ; a source code based upon at least one of the composite item and the form 16 ; a set of movement instructions based upon the source code ; data gathered while laying up the composite item ; timestamp information ; positional information ; identification numbers ; and the like . the controller 62 is further configured to communicate across a network 68 . the network 68 is optionally included to provide additional data storage and / or processing capabilities . in this regard , the network includes a database 70 and a server 72 . the database 70 is configured to store a copy of the code 64 and / or file 66 . the server 72 is configured to generate , store , and perform any suitable processing of the code 64 and / or file 66 . in this manner , composite items generated on computer aided design ( cad ) machines such as the server 72 , for example , may be forwarded to the mal 10 . in addition , the server 72 is operable , via the network 68 , to forward updates for the code 64 and / or file 66 . in addition , the system 60 optionally includes a memory 74 . if present , the memory 74 is configured to store a copy of the code 64 and / or file 66 . also shown in fig5 is a positioning device controller 76 to control the robotic vehicle 12 and / or other such positioning devices . the positioning device controller 76 is optionally included in the system 60 depending upon the requirements of the various actuators and / or servo motors of the mal 10 . that is , depending upon the particular configuration of the mal 10 , a plurality of actuators and / or servo motors modulate the rotation , position , speed , direction , and the like of the various components of the mal 10 . more particularly , these actuators and / or servo motors of the robotic vehicle 12 and / or positioning device are at least configured to advance the robotic vehicle 12 or otherwise modulate the various axes of the end effector 32 and / or mal 10 . if present , parameters of the positioning device controller 76 are based upon the specification of the various actuators , servos , and / or the controller 62 . the positioning device controller 76 , if present , is configured to control some or all of these actuators and / or servo motors . in addition , these actuators and / or servo motors are optionally operable to be modulated by the controller 62 directly , and thus , the system 60 may not include the positioning device controller 76 . in addition , the controller 62 is configured to receive signals from the sensor 38 and , in response to these signals , determine the position of the edge 42 of a previously applied course 28 . for example , employing an optical sensor , image signals are received from the sensor 38 and the controller 62 , utilizing image analysis algorithms , identifies differences between the edge 42 and the underlying substrate 30 . in a particular example , the separator film 40 is a white or light color and the course material 14 and form 16 are black or a relatively darker color . thus , by identifying an interface between the white and black regions , the position of the edge is determined . in another example , the course material 14 is a relatively light color and the separator film 40 is a relatively darker color . similarly , other differentiating optical characteristics may be employed to determine the edge . in another example , the sensor 38 includes feelers that contact the substrate and signals from the sensor 38 are utilized to determine a height difference between the previously applied course 28 and the underlying substrate 30 . the controller 62 is further configured to modulate any suitable actuator such as , for example , servo motor , rack and pinions , linear drive belts , linear slides , x - y tables , pneumatic rams , linear actuators , and the like . in particular , the controller 62 is configured to control the action of the actuator 52 in response to the sensed edge of the previously applied course 28 . in this manner , a profile is cut upon an edge of the course material 14 , by the cutting assembly which substantially conforms to the sensed edge . the system 60 , optionally , further includes a plurality of sensors configured to sense the various suitable operating conditions or attributes of the mal 10 . examples of suitable attributes include some or all of the temperature of the course material 14 , the temperature at the location where the separator film 40 is separated from the course material 14 ( release point ), feed rate and direction , material placement , backing integrity , supply of course material 14 , and / or the like . the system 60 optionally includes a heater 80 . the heater 80 includes any suitable heating device such as , for example an electrical heating element and blower , infrared device , induction heater , and / or the like . in a particular example , the heater 80 includes a heating element and a blower configured to direct a stream of heated air as appropriate . in addition , the heater 80 optionally includes a nib heater , chute heater , and release point blower . if present , these devices are modulated by the controller 62 . the nib heater applies a controlled amount of heat to the form 16 , the course material 14 and / or the separator film 40 in response to controlling signals generated by the controller 62 . similarly , the chute heater applies a controlled amount of heat to the course material 14 and / or the separator film 40 in response to controlling signals generated by the controller 62 . in addition , the release point blower directs a flow of air toward the release point in response to controlling signals generated by the controller 62 . fig6 is a system architecture for the controller 62 suitable for use in the system 60 . as shown in fig6 , the controller 62 includes a processor 90 . this processor 90 is operably connected to a power supply 92 , memory 94 , clock 96 , analog to digital converter ( a / d ) 98 , and an input / output ( i / o ) port 100 . the i / o port 100 is configured to receive signals from any suitably attached electronic device and forward these signals to the a / d 98 and / or the processor 90 . if the signals are in analog format , the signals may proceed via the a / d 98 . in this regard , the a / d 98 is configured to receive analog format signals and convert these signals into corresponding digital format signals . conversely , the a / d 98 is configured to receive digital format signals from the processor 90 , convert these signals to analog format , and forward the analog signals to the i / o port 100 . in this manner , electronic devices configured to receive analog signals may intercommunicate with the processor 90 . the processor 90 is configured to receive and transmit signals to and from the a / d 98 and / or the i / o port 100 . the processor 90 is further configured to receive time signals from the clock 96 . in addition , the processor 90 is configured to store and retrieve electronic data to and from the memory 94 . furthermore , the processor 90 is configured to determine signals operable to modulate the positioning device controller 76 and thereby control the various actuators and / or servo motors of the mal 10 to exert a particular force and / or rotate to a particular degree . according to an embodiment of the disclosure , the processor 90 is configured to execute the code 64 . based on this set of instructions and signals from the various components of the mal 10 , the processor 90 is configured to determine a set of controlling signals and forward these signals to the heater 80 , cutting assembly 48 , and the like . fig7 illustrates steps involved in a method 110 of placing plies to produce a composite structure or product . prior to the initiation of the method 110 , a composite product is designed and , based on this design , a series of computer readable instructions specifying attributes of the composite product , such as the item 18 , is generated . in addition , a maximum width of material is determined based upon contours of the item 18 . for example , the contour along the course paths are determined and if a contour exceeds a recommended contour for a particular width of course material , a narrower or otherwise more accommodating material is selected and the course paths are re - calculated as appropriate . furthermore , the interfaces 46 between plies 58 laid in a similar warp direction are determined . if two or more of the interfaces 46 approximately overlap , course paths of at least one of the plies are adjusted or offset and the course paths are re - calculated as appropriate . the computer readable instructions are utilized to control the operations of the mal 10 . in addition , a form or tool such as the form 16 is designed and constructed based upon the design of the composite product . furthermore , the supply roll 34 is installed in the end effector 32 and the course material 14 is threaded through the end effector 32 . moreover , co - ordinated movements of a plurality of robotic vehicles 12 are optionally determined . these co - ordinated movements , if present , are stored to the file 66 and utilized to fabricate the item 18 . an example of the co - ordinated movements include instructions for a plurality of the robotic vehicles 12 to essentially simultaneously apply the course material 14 to the form 16 , thereby increasing the material lay down rate as compared to conventional atlms . another example of the co - ordinated movements include instructions for the plurality of the robotic vehicles 12 to essentially simultaneously apply a woven pattern of the course material 14 to the form 16 , thereby increasing the integrity of the item 18 as compared to conventional atlms . at step 112 , the method 110 is initiated by turning on the various components of the mal 10 described herein above and executing the computer readable instructions . at step 114 , the course material 14 is modulated by the action of the positioning device 12 and / or the supply roll 34 . for example , in response to the end of the course material 14 differing from the edge of the form 16 , the course material 14 is in position to be cut by the cutting assembly 48 . it is to be noted that in an embodiment , the course material 14 is essentially always cut along one or both edges ( profiles ) and that the step 114 is optionally performed to position the course material 14 for a leading edge cut . it is an advantage of this embodiment that a substantially continuous band of edge material is maintained throughout placement of the course material 14 to facilitate removal of the excess course material 14 b from the form 16 . at step 116 , instructions from the file 66 are utilized for cutting an appropriate leading edge and / or profile for the course material 14 at the start of a course . in response to the instructions , the cutting assembly 48 cut the leading edge and / or profile . in addition , profile and diagonal cuts are performed in conjunction with movement of the end effector 32 relative to the form 16 . in this regard , cutting operations and movement of the positioning device 12 are generally performed concurrently . in addition , while the course material 14 is being advanced , edge profile cuts based on the file 66 are performed on the course material 14 by the cutting assembly 48 . in another embodiment , an edge of a previously applied course 28 is sensed in a manner similar to step 120 and the profile of the course material 14 is cut in a manner similar to step 122 prior to and / or during the step 116 . at step 118 , the course material 14 is “ tacked ” to the substrate 30 . the substrate 30 includes , at least , the form 16 and / or a previously applied course 28 . for example , the positioning device 12 is controlled to move the end effector 32 to a starting position for the course 28 and into a suitable orientation . a downward force is applied to the course material 14 , pressing the course material 14 down upon the form 16 with sufficient force to cause adhesion . in addition , the location on the form 16 is determined based upon the series of computer readable instruction and / or the location of a previously positioned course material 14 . as described herein , the path of a course 28 placed adjacent to a previously applied course 28 is offset to generate the overlap 56 on the previously applied course 28 . this overlap 56 or a portion thereof is cut away during profiling of the edge of the course material 14 at step 122 . at step 120 , a previously applied course 28 , if present , is sensed . that is , when applying a second course 28 , the edge of the first course is sensed . more particularly , the edge 42 of the first course 28 at the interface between the first course 28 and the path of the second course 28 is sensed . in a similar manner , subsequent courses 28 are sensed . at step 122 , the profile of the course material 14 is generated in response to the edge sensed at step 120 . for example , in response to signals from the sensor 38 , the controller 92 determines a profile that corresponds to the sensed edge . the controller 92 further generates signals to modulate the cutting assembly 48 according to the determined profile . these signals are forwarded to the actuator 52 . in this manner , a profile is generated upon the course material 14 that substantially corresponds to the previously applied course 28 . depending upon the course material 14 , this profile is generated such that it overlaps , abuts , or approaches the edge of the previously applied course 28 . a more detailed description of this method of slitting and applying plies is to be found in u . s . patent application ser . no . 11 / 058 , 267 , entitled , slit - course ply placement device and method , filed on feb . 16 , 2005 , by roger j . ledet , trevor m . mcdonald , and arnold j . lauder , the disclosure of which is hereby incorporated in its entirety . at step 124 , the course material 14 is dispensed along a path across the form 16 . as described herein , in order to minimize deformations in the course material 14 ( e . g ., wrinkles ), this path is typically calculated to coincide with a “ natural path ” based upon any contours in the form 16 . as the end effector 32 is controlled along the path across the form 16 , the course material 14 is withdrawn or “ free wheeled ” from the supply roll 34 via the movement of the end effector 32 relative to the substrate 30 . that is , the tacked portion of the course material 14 acts to pull course material 14 from the supply roll 34 . in other embodiments , the course material 14 is advanced via the action of the supply roll 34 , any suitable feed assembly , take - up roll , and the like . as the course material 14 is dispensed or applied , one or more edge profiles of the course material 14 are cut , as described at step 122 , via the action of the cutting assembly 48 in response to the edge sensed at step 120 . at step 126 , the placement of the course material 14 on the form 16 is optionally evaluated . for example , an operator or a sensor senses the relative position of the courses 28 and determine if the distance between these courses is within a predetermined tolerance . if the distance between these courses is not within the predetermined tolerance , an error may be generated at step 128 . if the distance between these courses is within the predetermined tolerance , it is determined if the end of the path has been reached at step 130 . in addition to placement of the course material 14 , wrinkles , bridges , foreign objects , debris , and the like are optionally sensed for by an operator and / or sensor . if any such abnormalcy is sensed , an error is generated . in addition or alternatively , the placement of the courses 28 is optionally evaluated following the completion of the ply 58 . it is an advantage of an embodiment that by leaving the separator film 40 on the course material 14 until the completion of the ply 58 , the ply 58 is protected from contamination and / or physical insult that may occur during evaluation . at step 130 , it is determined if the end of the course has been reached . more specifically , it is determined if the course material 14 that is approaching the cutting assembly 48 is to be end cut . if , based on the series of computer readable instruction , it is determined the course material 14 has not advanced to the end of the course , the edge of the previously applied course is sensed at step 120 . if , it is determined the course material 14 has advanced to the end of the course , the course material 14 is end cut at step 132 . at step 132 , the end of the course material 14 is cut based upon the series of computer readable instruction contained in the file 66 , the orientation of a previously positioned course material 14 , and / or the location of a previously positioned course material 14 . at step 134 , it is determined if the placement of course material 14 on the composite product has been completed . for example , if all of the computer readable instructions in the file 66 have been completed , it may be determined that the placement of plies 58 for the item 18 has been completed and the mal 10 may idle until another series of computer readable instructions is initiated . if is determined the placement of course material 14 for the item 18 is not completed , an additional course material 14 placement may proceed at step 114 . following the method 110 , the composite product may be cured in any suitable manner . in the aerospace industry , thermoset resins are generally utilized to pre - impregnate ply material . these thermoset resins are typically cured at an elevated temperature and pressure for a predetermined amount of time . times , pressures , and temperatures may be selected depending on the resin used , the size and thickness of the composite product , and the like . although an example of the end effector 32 is shown being controlled by the robotic vehicles 12 , it will be appreciated that other control systems can be used . in this regard , a gantry system , robotic armature , mandrel , or other such positioning devices that support and control the movement of any suitable end effector are suitable for use with end effector 32 . also , although the mal 10 is useful to place plies for composite products in the airline industry it is also suitable for use in other industries that construct composite product . these industries include , but are not limited to , automobile , marine , spacecraft , building , and consumer products . the many features and advantages of the disclosure are apparent from the detailed specification , and thus , it is intended by the appended claims to cover all such features and advantages of the disclosure that fall within the true spirit and scope of the disclosure . further , since numerous modifications and variations will readily occur to those skilled in the art , it is not desired to limit the disclosure to the exact construction and operation illustrated and described , and accordingly , all suitable modifications and equivalents may be resorted to , falling within the scope of the disclosure .
| 1 |
a detailed description will now be given of an embodiment of a communications device according to the present invention , with reference to fig1 through fig3 . fig1 is a system block diagram of an embodiment of the present invention . components identical to those depicted in fig4 are numbered identically and descriptions thereof omitted . it should be noted that the connection switching circuit 101 of the communications device 100 of the present embodiment differs from the communications device shown in fig4 . fig2 is a block diagram of the connection switching circuit according to an embodiment of the present invention . connection switching circuit 101 comprises a first switch 111 and a second switch 112 . the first switch 111 corresponds to the first switch as claimed in the claims , and switches during transmission and reception . in the first switch 111 , the moving contact t 21 is connected to the first antenna 2 , the first fixed contact t 22 is connected to the transmitter circuit 5 and the second fixed contact t 23 is connected to the second switch 112 . the moving contact t 21 of first switch 111 is connected to either the first fixed contact t 22 or the second fixed contact t 23 according to the transmission - reception switching control signal supplied by the signal processing circuit 7 . the second switch 112 corresponds to the second switch as claimed in the claims , and switches in order to select the reception antenna . in the second switch 112 , the moving contact t 31 is connected to the receiver circuit 6 , the first fixed contact t 32 is connected to the second fixed contact t 23 of the first switch 111 and the second fixed contact t 33 is connected to the second antenna 3 . the moving contact t 31 of second switch 112 is connected to either the first fixed contact t 32 or the second fixed contact t 33 according to the antenna switching control signal supplied by the signal processing circuit 7 . the signal processing circuit 7 switches the processing mode to the transmit mode and sets the transmission - reception switching control signal supplied to the first switch 111 to high when the level of the transmission enable signal supplied to the external switching terminal ttx is high and the level of the reception enable signal supplied to the external switching signal is low . when the transmission - reception switching control signal is high , the first switch 111 connects the moving contract t 21 to the first fixed contact t 22 . when the moving contact t 21 is connected to the first fixed contact t 22 , the first antenna 2 is connected to the transmitter circuit 5 via only the first switch . additionally , the signal processing circuit 7 switches the processing mode to the receive mode and sets the transmission - reception switching control signal supplied to the first switch 111 to low when the level of the transmission enable signal supplied to the external switching terminal ttx is low and the level of the reception enable signal supplied to the external switching signal is high . when the transmission - reception switching control signal is low , the first switch 111 connects the moving contact t 21 to the second fixed contact t 23 . when the moving contact t 21 is connected to the second fixed contact t 23 , the first antenna 2 is connected to the first fixed contact t 32 of the second switch 112 via the first switch 111 . when the processing mode changes to the receive mode , the signal processing circuit 7 first inverts the antenna selection signal from high to low . the antenna selection processing signal output from the signal processing circuit 7 is supplied to the second switch 112 . when the antenna selection signal is high , the second switch 112 connects the moving contact t 31 to the first fixed contact t 32 . at this time the transmission - reception switching control signal is at a level low , so the moving contact t 21 of the first switch 111 is connected to the second fixed contact t 23 and the first antenna 2 is connected to the receiver circuit 6 via the first and second switches 111 , 112 . in so doing , the reception signals received at the first antenna 2 are supplied to the signal processing circuit 7 via the receiver circuit 6 . when the antenna selection signal is at a level low , the second switch 112 connects the moving contact t 31 to the second fixed contact t 33 . when the moving contact t 31 of the second switch 112 is connected to the second fixed contact t 33 , the second antenna 3 is connected to the receiver circuit 6 via the second switch 112 . as a result , the reception signals received at the second antenna 3 are supplied to the signal processing circuit 7 via the receiver circuit 6 . the signal processing circuit 7 compares the reception signals supplied by the first antenna 2 and the reception signals supplied by the second antenna 3 and detects the antenna with the higher reception signal strength . when the strength of the reception signals supplied from the first antenna 2 is greater than the strength of the reception signals supplied from the second antenna 3 , the signal processing circuit 7 sets the antenna selection signal to high . when the antenna selection signal is high , the second switch 112 connects the moving contact t 31 to the first fixed contact t 32 . at this time , the transmission - reception switching control signal is at a level low , so the moving contact t 21 of the first switch 111 is connected to the second fixed contact t 23 and the first antenna 2 is connected to the receiver circuit 6 via the first and second switches 111 , 112 . as a result , the reception signals received at the first antenna 2 are supplied to the signal processing circuit 7 via the receiver circuit 6 . when the strength of the reception signals supplied from the second antenna 3 is greater than the strength of the reception signals supplied from the first antenna 2 , the signal processing circuit 7 sets the antenna selection signal to low . when the antenna selection signal is low , the second switch 112 connects the moving contact t 31 to the second fixed contact t 33 . when the moving contact t 31 of the second switch 112 is connected to the second fixed contact t 33 , the second antenna is connected to the receiver circuit 6 via the second switch 112 . as a result , the reception signals received at the second antenna 3 are supplied to the signal processing circuit 7 via the receiver circuit 6 . fig3 is a diagram describing the operation of an embodiment of the present invention , and more specifically , the attenuation of reception and transmission signals caused by the first and second switches 111 , 112 of an embodiment of the present invention . according to the embodiment of the present invention as described above , and as shown in fig3 when transmitting , the first antenna 2 is connected to the transmitter circuit 5 via only the first switch 111 . as a result , the transmission signal output from the transmitter circuit 5 is attenuated by only a single switch and thus signal attenuation can be reduced to a minimum . for example , the attenuation caused by one switch is approximately 1 - 2 db depending on the transmission signal frequency . accordingly , signal attenuation can be reduced by approximately 1 - 2 db compared to the conventional arrangement , in which the signals must pass through two switches . additionally , when receiving as well , when the second antenna 3 is selected the signals received at the second antenna 3 are supplied to the receiver circuit 6 via only the second switch 112 . as a result , the signal is attenuated by only a single switch and thus signal attenuation can be reduced to a minimum . additionally , according to the present invention , simply by changing the connections of the first and second switches 111 , 112 the transmission - reception switching control signal and antenna selection signal can be applied as is , and thus can be easily adapted for use with a conventional communications devices . the above description is provided in order to enable any person skilled in the art to make and use the invention and sets forth the best mode contemplated by the inventors of carrying out their invention . the present invention is not limited to the specifically disclosed embodiments , and variations and modifications may be made without departing from the scope of the present invention . the present application is based on japanese priority application no . 10 - 115516 filed on apr . 24 , 1998 , the entire contents of which are hereby incorporated by reference .
| 7 |
fig1 is a schematic sectional view of a typical image forming apparatus comprising an image heating apparatus , as a fixing apparatus , in accordance with the present invention , showing the general structure thereof . the image forming apparatus in this embodiment is a color laser beam printer of a tandem type employing one of the electrophotographic processes . designated by referential characters y , m , c , and bk are four image formation stations ( first to fourth stations ) which form toner images corresponding in color to the yellow , magenta , cyan , and black color components of an intended image , respectively , and which are vertically stacked in parallel in the listed order counting from the bottom . the first to fourth image formation stations y , m , c , and bk comprise electrophotographic photosensitive members ( which hereinafter will be referred to simply as photosensitive drum ) 1 a , 1 b , 1 c , and 1 d , as latent image bearing members , which are rotated at a predetermined process speed in the direction indicated by arrow marks in the drawing ( counterclockwise direction ), primary charging means 2 a , 2 b , 2 c , and 2 d , laser beam based exposing means ( which hereinafter will be referred to as scanner ) 3 a , 3 b , 3 c , and 3 d , developing portions 4 a , 4 b , 4 c , and 4 d , cleaning means 6 a , 6 b , 6 c , and 6 d , etc ., respectively . designated by a referential symbol 9 a is an endless conveying belt as a member for conveying a recording medium while electrostatically holding it . the endless electrostatic adhesion conveying belt 9 a is located on the photosensitive drum side ( front side of printer ) of the set of the vertically stacked first to fourth image formation stations y , m , c , and bk , being vertically extended from the first to the fourth image forming stations . referential symbols 9 b , 9 c , 9 d , and 9 e designate rollers around which the electrostatic adhesion conveying belt 9 a is stretched and suspended . the roller 9 a is a driver roller , and rollers 9 c and 9 d are support rollers . the roller 9 d is a tension roller . the electrostatic adhesion conveying belt 9 a is circularly driven by the driver roller 9 b in the direction indicated by an arrow mark in the drawing ( clockwise direction ) at a peripheral velocity matching the peripheral velocities of the photosensitive drums 1 a - 1 d . designated by referential symbols 5 a , 5 b , 5 c , and 5 d are four transfer rollers ( first to fourth ), which are kept pressed against the photosensitive drums 1 a - 1 d of the first to fourth image formation stations y , m , c , and bk , with the electrostatic adhesion conveying belt 9 a sandwiched between the transfer rollers 5 a , 5 b , 5 c , and 5 d and photosensitive drums 1 a - 1 d , respectively . in the first to fourth image forming stations y , m , c , and bk , the photosensitive drums 1 a - 1 d are rotationally driven . these photosensitive drums are rotationally driven by an unshown drum motor ( dc servo motor ). however , each photosensitive drum may be provided with its own driving force source . the rotation of the drum motor is controlled by an unshown dsp ( digital signal processor ), whereas the other controls are executed by an unshown cpu . in the first to fourth image formation stations y , m , c , and bk , the photosensitive drums 1 a - 1 d are uniformly charged to predetermined polarity and potential level by the primary charging means 2 a - 2 d , respectively , as they are rotated . then , the charged peripheral surfaces of the photosensitive drums 1 a - 1 d are exposed to four optical images , one for one , by scanners 3 a - 3 d , respectively . as a result , an electrostatic latent image is formed on each of the photosensitive drums 1 a - 1 d . the electrostatic latent images on the photosensitive drums 1 a - 1 d are developed by the development stations 4 a - 4 d into images formed of yellow , magenta , cyan , and black toners , which correspond in color to the four color components into which an intended full - color image has been separated by the electrophotographic process ( hereinafter , images formed of toner will be referred to simply as toner images ). as a result , yellow , magenta , cyan , and black toner images are formed on the photosensitive drums 1 a - 1 d , respectively . meanwhile , multiple pieces of recording medium s ( transfer sheet ) stored in a sheet feeder cassette 8 a located in the bottom portion of the main assembly of the image forming apparatus are sequentially fed , while being separated , into the main assembly , by a sheet feeder roller 8 b , in accordance with a predetermined image formation sequence control timing , and are conveyed to a pair of registration rollers 8 c , which keep the recording mediums s on standby or allow them to be further conveyed to the electrostatic adhesion conveying member 9 a , from the bottom side of the conveying member 9 a , in synchronism with the progression of the image forming operation . as each of the recording mediums s is delivered to the electrostatic adhesion conveying belt 9 a , it is electrostatically adhered to the surface of the electrostatic adhesion conveying belt 9 a , being thereby securely held thereto , and is conveyed upward as the belt 9 a is circularly driven . as the recording medium s is conveyed upward , yellow , magenta , cyan , and black toner images formed on the peripheral surfaces of the photosensitive drums 1 a - 1 d in the first and fourth image formation stations y , m , c , and bk are transferred in layers onto the recording medium s in the first and fourth transfer stations , that is , the contact areas between the photosensitive drums 1 a - 1 d and the electrostatic adhesion conveying belt 9 a , respectively . as a result , a single unfixed full - color toner image is synthetically formed . after the transfers of the toner images onto the recording medium s in the first to fourth image formation stations y , m , c , and bk , the residues such as the toner remaining adhered to the peripheral surfaces of the photosensitive drums 1 a - 1 d are removed by the cleaning means 6 a - 6 d , and then , the photosensitive drums 1 a - 1 d are used for the following image formation cycle . after being conveyed to the top end of the electrostatic adhesion conveying belt 9 a while the toner images are transferred in layers from the four photosensitive drums 1 a - 1 d onto the recording medium s , the recording medium s is separated from the surface of the conveying belt 9 a , at the location of the driving roller 9 a , and is further conveyed to a fixing apparatus 10 ( fixing device ), in which the toner images are thermally fixed . thereafter , the recording medium s is discharged by a pair of discharge rollers 10 into a delivery tray 13 . the above described is the image forming operation of the image forming apparatus in the one - sided print mode . when the image forming apparatus is in the two - sided print mode , its operation is as follows . after the separation of the recording medium s , on one surface of which an image has been transferred , it is incompletely discharged by the pair of discharge rollers 10 c , that is , the recording medium s is partially moved out of the apparatus main assembly , up to a point at which the trailing end of the recording medium s will have moved past the two - side print mode sheet guide 10 d . then , the pair of discharge rollers 10 c are rotated in reverse to guide the recording medium s into the two - sided print mode sheet guide 10 d . more specifically , as the pair of discharge rollers 10 c are rotated in reverse , the recording medium s is moved into the sheet guide 10 d , with the former trailing end becoming the leading end , and is guided by the top side of the guide 10 d . then , the recording medium s is guided to a pair of two - sided print mode rollers 14 by a guide rib lla located under an air duct 11 , and a guide rib 12 a located under the control panel 12 . then , it is conveyed downward by the pair of rollers 14 to a pair of two - sided printer mode rollers 15 , is conveyed further downward by the pair of rollers 15 to a pair of two - sided print mode rollers 16 , is conveyed further by the pair of rollers 16 to the pair of registration rollers 8 a along the u - turn guide 17 . then , it is released by the pair of registration rollers 8 c to be delivered to the transfer nips between the photosensitive drums 1 a - 1 d and electrostatic adhesion conveying belt 9 a , in synchronism with the progression of the image forming operation in the two - sided print mode . the sequence thereafter is exactly the same as that in the one - sided print mode . fig2 is an enlarged schematic sectional view of the essential portion of the fixing apparatus 10 . this fixing apparatus 10 is a heating apparatus of a film heating and pressure roller driving type ( tensionless ). it employs a cylindrical fixation film ( fixation film in the form of an endless belt ), that is , a flexible member . designated by a referential number 30 is a heating unit comprising the circularly rotatable heating member , and designated by a referential number 20 is a pressure roller , which is an elastic roller . the two are kept pressed against each other , forming a fixation nip n . the pressure roller 20 comprises : a metallic core 21 formed of aluminum or iron ; an elastic layer 22 covering the peripheral surface of the metallic core 21 ; and a mold release layer 23 covering the peripheral surface of the elastic layer 22 . it is rotatably supported between and by an unshown pair of lateral plates of the apparatus main frame , at the lengthwise end portions of the metallic core 21 , with the interposition of a pair of bearings . it is rotationally driven by an unshown driving system at a predetermined velocity in the direction indicated by an arrow mark in the drawing ( clockwise direction ). the elastic layer 22 is formed of solid silicon rubber , sponge rubber made by foaming the silicon rubber to make the silicon rubber thermally insulative , foamed rubber made by dispersing hollow filler particles in the silicon rubber to make the silicon rubber thermally insulative , or the like . the mold release layer 23 may be formed by coating the peripheral surface of the elastic layer 22 with fluorinated resin , such as perfluoroalkoxyl resin ( pfa ), polytetrafluoroethylene resin ( ptfe ), and tetrafluoroethylene - hexafluoropropylene resin ( fep ), or gls latex ( registered commercial name : daikin co ., ltd .). it may be in the form of a tube fitted over the elastic layer 22 . it may be formed by coating the peripheral surface of the elastic layer 22 with mold releasing paint . the heating unit 30 comprises a heating member holder 32 , a heating member 33 , a rigid pressure application stay 34 , a fixation film 31 ( flexible sleeve ), etc . the heating member holder 32 extends in the direction perpendicular to the drawing ( direction intersectional to recording medium conveyance direction ) which is heat resistant , thermally insulative , and rigid . the heating member 33 is firmly attached to the holder 32 by being fitted in the groove of the holder 32 cut in the outwardly facing surface of the holder 32 in the lengthwise direction of the holder 32 . the rigid stay 34 is u - shaped in cross section , and is formed of a metallic substance . it is placed on the inward side of the holder 32 to support the holder 32 . the fixation film 31 is loosely fitted around the assembly of the heating member holder 32 , heating member 33 , and rigid stay 34 . in the case of the fixing apparatus 10 in this embodiment , the lengthwise ends of the metallic core 21 of the pressure roller 20 are rotatably supported by the pair of lateral plates of the apparatus main assembly frame , with the interposition of the pair of bearings , so that the pressure roller 20 is rotatably supported between the pair of lateral plates . the heating unit 30 is placed on the left side , in fig2 , of the pressure roller 20 , in parallel to the pressure roller 20 , so that the heating member 33 of the heating unit 30 faces the pressure roller 20 . the lengthwise end portions of the rigid pressure application stay 34 are kept pressured toward the pressure roller 2 by an unshown pressure applying means , such as a pair of springs , so that the rigid pressure application stay 34 is kept pressured against the elastic layer 22 of the pressure roller 20 by a predetermined amount of pressure f . as a result , the elastic layer 22 of the pressure roller 20 is kept compressed , on the left - hand side thereof , by a predetermined thickness in the radius direction of the pressure roller 20 by the combination of the heating member 33 and heating member holder 32 , with the fixation film 31 remaining pinched between the combination of the heating member 33 and heating member holder 32 , and the pressure roller 22 , forming thereby the fixation nip n . as the pressure roller 20 is rotationally driven , the torque from the rotational driving of the pressure roller 20 is transmitted to the cylindrical fixation film 31 . as a result , the fixation film 31 is rotated around the assembly of the heating member holder 32 , heating member 33 , and rigid pressure application stay 34 , in the direction indicated by an arrow mark in the drawing ( clockwise direction ), with the fixation film 31 sliding on the heating member holder 32 and heating member 33 in such a manner that the inward surface of the fixation film 31 remains perfectly in contact with the outwardly facing surfaces of the heating member holder 32 and heating member 33 . as the pressure roller 20 is rotationally driven , and the cylindrical fixation film 31 is rotationally driven by the pressure roller 20 , power is supplied to the heating member 33 to raise the temperature of the heating member 33 to a predetermined temperature level , and maintain it at the predetermined temperature level . as the temperature of the heating member 33 is maintained at the predetermined temperature level , the recording medium s bearing an unfixed toner image t is introduced info the fixation nip n , that is , the interface between the heating unit 30 ( fixation film 31 ) and pressure roller 20 , and is conveyed through the fixation nip n , with the recording medium s pinched between the fixation film 31 and pressure roller 20 so that the toner image bearing surface of the recording medium s is kept perfectly in contact with the outwardly facing surface of the fixation film 31 . while the recording medium s is conveyed through the fixation nip n as described above , the heat from the heating member 33 is given to the recording medium s through the fixation film 31 . as a result , the unfixed toner image t on the recording medium s is welded ( fixed ) to the recording medium s by heat and pressure . after being conveyed through the fixation nip n , the recording medium s becomes separated from the fixation film 31 due to the curvature of the cylindrical fixation film 31 . the fixation film 31 ( flexible member ) comprises a substrate layer formed of heat resistant and heat insulating film of resin , such as polyamide , polyamide - imide , peek , pes , pps , pfa , ptfe , fep , etc ., and a surface layer formed of a single or mixture of heat resistant resins , such as pfa , ptfe , fep , silicone resin , etc ., superior in mold releasing properties . the heating member holder 32 is formed of resin such as liquid polymer , phenol resin , pps , peek , etc ., which are heat resistant and slippery . fig3 is a schematic drawing of the heating member 33 in this embodiment , showing the structure thereof . this heating member 33 is a low heat capacity ceramic heater , which generates heat at its top surface . it basically comprises a substrate , a heat generating resistive layer , a dielectric layer , and power supply electrodes . the substrate is formed of dielectric ceramics such as alumina or aluminum nitride , or heat resistant resin such as polyimide , pps or liquid polymer . the heat generating resistive layer is a line or narrow strip of ag / pd , ruo 2 , ta 2 n , etc ., formed on the surface of the substrate . it generates heat as electric current is flowed through it . it is coated on the surface of the substrate with the use of such a means as screen printing , and baked . the dielectric layer is a layer of glass or the like coated over the combination of the substrate and heat generating resistive layer . the power supply electrodes are electrically connected to the heat generating resistive layer , and voltage is applied to the power supply electrodes from a power supply circuit through a power supply connector . 1 . substrate 33 a which is a piece of thin , narrow , and flat plate of al 2 o 3 , ain , or the like , and extends in the direction parallel to the direction intersectional ( perpendicular ) to the direction in which a recording medium s is conveyed through the fixation nip n ; 2 . two parallel strips of heat generating resistive layer 33 b , which are roughly 10 μm thick and 1 - 5 mm wide , extending in the direction parallel to the lengthwise direction of the substrate 33 b , are formed on the top surface of the substrate 33 a , of electrically resistive substance such as ag / pd , with the use of a method in which the electrically resistive substance is coated in a predetermined pattern on the substrate 33 b by screen printing or the like , and is baked ; 3 . first and second power supply electrodes 33 d and 33 e formed on the substrate , being electrically connected to the two parallel strips of heat generating layer 33 b , one for one , at one of the lengthwise ends of the substrate 33 a ; 4 . electrically conductive portion 33 f formed , by patterning , on the substrate 33 a to electrically connect in series the two parallel strips of heat generating resistive layer 33 b , at the other lengthwise end of the substrate 33 a ; 5 . first and second temperature control output electrodes 33 g and 33 h formed on the substrate 33 a by patterning , being located outward side of the electrically conductive portion 33 f in terms of the lengthwise direction of the substrate 33 a ; 6 . a thin ( roughly 10 μm thick ) protective layer 33 c formed on the substrate 33 a , by patterning , in a manner to cover the combination of the heat generating resistive layer and electrically conductive portion 33 f , along with the surface of the substrate 33 a ; 7 . a temperature detection element 51 , such as a thermistor , placed on the back ( rear ) side of the substrate 33 a , in contact with the center portion , in terms of the lengthwise direction of the substrate 33 a , of the rear ( back ) surface of the substrate 33 a ; 8 . first and second electrically conductive portions 33 i and 33 j formed on the back ( rear ) surface of the substrate 33 a by patterning , being electrically connected to the temperature detection element 51 ; 9 . through holes 33 k and 33 l formed through the substrate 33 a so that the first and second electrically conductive portions 33 i and 33 j on the back ( rear ) surface of the substrate 33 a can be electrically connected to the first and second temperature control output electrodes 33 g and 33 h , respectively , on the outward surface of the substrate 33 a ; this heating member 33 is firmly embedded , in a manner of being inlayed , in the groove formed in the outward surface of the heating member holder 32 so that the top surface of the heating member 33 ( top surface of substrate 33 a which bears heat generating resistive layer 33 b and protective glass layer 33 c ) faces outward to be placed in contact with the inward surface of the fixation film 31 . designated by a referential number 52 is a thermo - protector such as a thermal fuse , thermo - switch , or the like , which is placed on the back ( rear ) side of the substrate 33 a , with its heat collector plate 52 a placed in contact with a predetermined portion of the back surface of the heating member 33 . designated by a referential number 52 is a power supply connector , which is attached to one of the lengthwise end portions of the substrate 33 a having the first and second power supply electrodes 33 d and 33 e of the heating member 33 firmly held to the heating member holder 32 , electrically connecting the power supply electrodes 33 d and 33 e to the electrical contacts of the power supply connector 53 . designated by a referential number 54 is a temperature control connector , which is attached to the other lengthwise end of the heating member 33 having the first and second temperature control output electrodes 33 g and 33 h , electrically connecting the temperature control output electrodes 33 g and 33 h to the electrical contacts of the temperature control connector 54 . referential numbers 55 , 56 , and 57 designate an ac power source , a control circuit ( cpu ), and a triac ( triode ac switch ). the heating member 33 is supplied with electric power by the ac power source 55 through the power supply connector 53 , first and second power supply electrodes 33 d and 33 e ; more specifically , power is supplied to the heat generating resistive layer 33 b . as a result , heat is generated across the entirety of the heat generating resistive layer 33 b , very quickly raising the temperature of the heating member 33 . the temperature increase of the heating member 33 is detected by the temperature detection element 51 , and the information , in the form of electrical signal , regarding the detected temperature is inputted into the control circuit 56 through the first and second electrically conductive portions 33 i and 33 j , electrically conductive walls of the through holes 33 k and 33 l , first and second temperature control output electrodes 33 g and 33 h , and temperature control connector 54 . the control circuit 56 controls the triac 57 in response to the inputted information regarding the detected temperature of the heating member 33 ; it keeps the temperature of the heating member 33 at a predetermined fixation temperature by controlling the phase , wave count , etc ., of the electric power supplied to the heat generating layer 33 b of the heating member from the ac power source 55 . the thermo - protector 52 located on the back side of the heating member 33 , with its heat collector plate 52 a kept in contact with the back side of the heating member 33 , is serially inserted in the circuit for supplying electric power to the heat generating resistive layer 33 b of the heating member 33 . thus , if the heating member 33 overheats , that is , the temperature of the heating member 33 exceeds the allowable level , because the power supply to the heat generating resistive layer 33 b of the heating member 33 from the power source 55 become uncontrollable , and therefore , the heat generating layer is continuously supplied with power , because of some problem occurring to the control circuit 56 , triac 57 , etc ., the thermo - protector is melted by the heat from the heating member 33 , breaking thereby the power supply circuit , and therefore , forcefully shutting down the power supply to the heat generating resistive layer 33 b for safety . the structural arrangement for controlling the temperature of the heating member 33 does not need to be limited to the above described one . for example , it may be such that the temperature level at which the surface temperature of the fixation film 31 needs to be for fixing the toner image t on the recording medium s , in the fixation nip n , is set as the target temperature for the surface of the fixation film 31 , and the amount by which electric power is supplied to the heat generating resistive layer 33 b of the heating member 33 is controlled according to the surface temperature level of the fixation film 31 detected by the unshown temperature detecting means such as a thermistor disposed so that it remains in contact with the inward surface of the fixation film 31 , at an optional point within the range of the fixation nip n , in order to keep the surface temperature of the fixation film 31 at the target temperature . the substrate of the heating member 33 is formed of dielectric ceramic such as alumina or aluminum nitride , heat resistant resin such as polyimide , pps , or liquid polymer , or the like . therefore , the heating member 33 can be simplified in shape ; for example , it can be made thin and flat . fig4 is a schematic sectional view of the fixation nip n of the fixing apparatus 10 in this embodiment , depicting the structure thereof . incidentally , in fig2 , the fixation nip n of the fixing apparatus is oriented so that a recording medium s is vertically fed into the fixation nip n . in fig4 , however , for ease of description , the fixation nip n is oriented so that the recording medium s is horizontally fed into the fixation nip n . the gist of the present invention is as follows . a fixing apparatus is structured so that as the recording medium s is conveyed through the fixation nip n , the amount of the pressure which applies to a given point of the recording member s reaches its peak with virtually no decline between the recording medium entrance ( upstream end in terms of recording medium conveyance direction ) of the fixation nip n and the peak pressure point in the fixation nip n , that is , the point at which the amount of pressure which applies to the recording medium s is highest in the fixation nip n . further , the heating member is located on the upstream side of the peak pressure point of the fixation nip n , in terms of the recording medium conveyance direction . looking at the fixation nip n and its adjacencies in this embodiment from the direction parallel to the lengthwise direction of the fixation nip n , the line c 1 , which is perpendicular to the flat portion a of the recording medium pressing portion of the fixation film guiding ( contacting ) slippery surface of the heating unit 30 , made up of the outwardly facing surfaces of the heating member 33 in the form of a piece of thin plate ( which hereinafter may be referred to as heating plate 33 ) and heating member holder 32 , and which coincides with the center of the portion a , in terms of the recording medium conveyance direction , is on the upstream side of the line c 2 ( hypothetical line parallel to line c 1 ), which coincides with the rotational axis of the pressure roller ; it is on the recording medium entrance side of the line c 2 . in other words , the heating member , heating member holder , and pressure roller are positioned so that the hypothetical line , which is perpendicular to the surface of the heating member , which is in contact with the fixation film , and coincides with the center of the heating member in terms of the recording medium conveyance direction , is on the upstream side of the rotational axis of the pressure roller in terms of the recording medium conveyance direction . with the employment of this structural arrangement , the upstream end j of the flat portion a of the fixation film guiding slippery surface of the heating unit , made up of the outward surface of the heating plate 33 and the outward surface of the heating member holder 32 is on the upstream side of the recording medium entrance of the fixation nip n , and the downstream end k of the flat portion a of the fixation film guiding slippery surface of the heating unit 30 , made up of the outward surface of the heating plate 33 is within the fixation nip n . the heating unit 30 is kept pressed against the pressure roller 20 , with the fixation film 31 pinched between the heating unit 30 and pressure roller 20 . further , as described above , the fixation film 31 pinched by the pressure roller 20 and the combination of the heating member holder 32 and heating plate 33 is circularly moved around the combination of the heating member holder 32 and rigid pressure application stay 34 by the rotation of the pressure roller 20 . also with the employment of the above described structural arrangement , the portion b is created , as a part of the fixation nip n , which extends from the downstream end k of the recording medium pressing flat portion a to the recording medium ext of the fixation nip n , and in which the internal pressure of the fixation nip n sharply reduces toward the recording medium exit . as described above , in the sectional view of the fixing apparatus in this embodiment , perpendicular to the rotational axis of the heating unit 30 , the line c 1 perpendicular to the aforementioned flat portion a and coinciding with the center of the flat portion a in terms of the recording medium conveyance direction sf , is on the upstream side , in terms of the recording medium conveyance direction sf , that is , on the recording medium entrance side , of the line c 2 perpendicular to the flat portion a and coinciding with the rotational axis of the pressure roller 20 . further , the upstream end j of the recording medium pressing slippery surface made up of the outwardly facing surfaces of the heating plate 33 and heating plate holding member 32 is outside the recording medium entrance of the fixation nip n . with the provision of this structural arrangement , the pressure distribution within the fixation nip n becomes such that the closer to the downstream end k of the portion a of the recording medium guiding ( pressing ) surface of the heating unit 30 , the higher the amount of pressure which applies to the recording medium s as the recording medium s is conveyed through the fixation nip n while being heated by the heating plate 33 . at this time , the various phenomena which occur in the fixation nip n in this embodiment will be described . first , referring to fig5 ( b ), the pressure distribution in the fixation nip n will be described . as will be evident from fig5 ( b ), the pressure distribution in the fixation nip n in this embodiment is such that as the recording medium s is conveyed through the fixation nip n , the amount of the pressure which applies to the recording medium s begins to increase shortly after the recording medium s is moved into the fixation nip n , and continuously increases to its peak with virtually no decrease . then , as the recording medium s is moved past the peak pressure point k in the fixation nip n , the pressure which applies to the recording medium s begins to decrease , and steeply decreases to virtually zero by the time the recording medium s reaches the recording medium exit of the fixation nip n . in order to realize this pressure distribution , the fixing apparatus in this embodiment is structured to position its heating member , heating member holder , and pressure roller so that the upstream end j of the portion a of the recording medium pressing surface of the heating unit 30 is on the upstream of the recording medium entrance of the fixation nip n ( outside fixation nip n ), and the hypothetical line ( c 1 in fig4 ) perpendicular to the flat surface of the heating member substrate which contacts the fixation film , and coinciding with the center of the flat surface in terms of the recording medium conveyance direction , is on the upstream of the rotational axis of the pressure roller , in terms of the recording medium conveyance direction . to describe in more detail , the upstream end j of the portion a of the recording medium pressing surface of the heating unit is located on the upstream of the recording medium entrance of the fixation nip n ( outside fixation nip ), and the downstream end k roughly coincides with the intersection of the hypothetical plane h connecting the upstream and downstream ends j and k of the portion a of the recording medium pressing surface of the heating unit , and the hypothetical plane v perpendicular to the hypothetical plane h and coinciding with the rotational axis of the pressure roller 20 ( distance from hypothetical plane v to downstream end k is virtually zero ), as shown in fig6 - 1 . with the provision of the above described positional arrangement , the amount of the invasion of the portion a of the recording medium pressing surface of the heating unit into the pressure roller 20 between the recording medium entrance of the fixation nip n and the downstream end k of the portion a of the recording medium pressing surface of the heating unit is such that the closer to the point k , the greater the amount of the invasion ; in other words , the relationship between the amount of the invasion and the distance from the recording medium entrance of the fixation nip n is roughly linear , and is maximum at the point k . therefore , as the recording medium s is conveyed through the fixation nip n , the amount of the pressure applied to the recording medium s by the fixation nip n begins to increase at the recording medium entrance of the fixation nip n , and roughly linearly increases until the recording medium s reaches the downstream end k of the portion a of the fixing film pressing surface of the heating unit past the center of the fixation nip n ( center between recording medium entrance to exit ), reaching its peak at the point k . also in this embodiment , the fixation film pressing surface of the heating unit ( heating member ) is provided with the second portion b , which is the portion between the downstream end k of the portion a and the recording medium exit of the fixation nip n , and is virtually flat . therefore , the amount of the invasion of the heating unit into the pressure roller 20 between the downstream end k of the portion a and the recording medium exit of the fixation nip n is such that the closer to the exit , the smaller the amount of the invasion , and the relationship between the distance from the point k to a given point in this range , and the amount of the invasion is roughly linear . therefore , as the recording medium s is conveyed through the fixation nip n , the amount of the pressure applied to the recording medium s by the fixation nip n begins to decrease at the downstream end k of the portion a , and steeply decreases until it falls to virtually zero at the recording medium exit of the fixation nip n . further , the temperature distribution in the fixation nip n is as represented by line 1 in fig5 ( a ). as for the temperature distribution of the fixation nip n , the portion of the fixation nip n , which extends from the recording medium entrance to the area immediately before the downstream end k of the portion a , via the center of the fixation nip n , is heated by the heating plate 33 , the internal temperature of the fixation nip n linearly increases toward the area immediately before the downstream end k . since the heating plate 33 is on the upstream of the downstream end k of the portion a , in terms of the recording medium conveyance direction , in the fixation nip n , the internal temperature of the fixation nip n reaches the predetermined temperature level before the point k . further , no heat source ( heating plate 33 ) is on the downstream side of the point k , in terms of the recording medium conveyance direction . therefore , after the downstream end k , the internal temperature of the fixation nip n remains roughly the same toward the recording medium exit of the fixation nip n . it is reasonable to think that as the combination of the recording medium s and the unfixed toner image on the recording medium is moved through the fixation nip n while pressure and heat is applied to the toner as described above , the toner image on the recording medium s is melted as described next with reference to fig7 , and 25 , which show the changes in physical form of the toner in the fixation nip n in this embodiment . fig2 shows in detail the actual structure of the essential portion of the fixing apparatus in this embodiment , and fig2 shows the progression of the fixation process , in terms of the physical form of the toner , in the fixation apparatus shown in fig2 . in fig2 , paper thickness , toner particle diameter , etc ., are exaggerated . first , it is thought that prior to the entry into the fixation nip n of the fixing apparatus 10 , the state of the toner layer ( toner image t ) on the recording medium s is as depicted in the area in fig7 , or as depicted in fig2 . in other words , there are four layers of toner images t having been sequentially transferred in layers onto the recording medium s from the four photosensitive drums 1 a - 1 d . when the toner images t were transferred onto the recording medium s , they were not transferred so that no gap was left between the adjacent two toner layers ( toner images t ). in other words , there are a certain number of minute pockets of air between the adjacent two toner layers ( toner images t ). while the recording medium s is conveyed from the recording medium entrance of the fixation nip n to the downstream end k of the portion a of the fixation film pressing surface of the heating unit , the amount of the heat applied to the toner layers on the recording medium s by the fixing nip n linearly increases as represented by line 1 in fig5 , and the amount of the pressure applied to the recording medium s by the fixation nip n roughly linearly increases as shown in fig5 ( b ). therefore , while the recording medium s is conveyed from the recording medium entrance of the fixation nip n to the downstream end k of the portion a of the fixation film pressing surface of the heating unit , the toner layers on the recording medium s gradually melt , while remaining in contact with the fixation film 31 , as shown in the area 2 in fig7 , and fig2 . while the toner layers melt , the minute pockets of air in the toner layers gradually expand in the melting toner layers . by the time a given portion of the recording medium s reaches the downstream end k , the toner layers thereon are thoroughly melted by the heat from the heating plate 33 . referring to fig5 ( b ), the amount of the pressure applied to the toner layers on the recording medium s by the fixation nip n is highest at the downstream end k . further , while the recording medium s is conveyed from the recording medium entrance of the fixation nip n to the point k , or the point at which the fixation nip pressure is highest , the amount of the pressure applied to the toner layers on the recording medium s continuously increases , that is , with virtually no decrease , keeping thereby the toner layers on the recording medium s perfectly in contact with the fixation film , in terms of the lengthwise direction of the fixation nip n . therefore , by the time the recording medium s is conveyed to the point k , or the point at which the internal pressure of the fixation nip n is highest , the toner layers are thoroughly melted . then , as the recording medium s is moved past the downstream end k , the melted toner layers are uniformly squeezed in terms of the lengthwise direction of the downstream end k . as a result , the pockets of air in the toner layers are completely squeezed out of the toner layers by the squeezing function of the downstream end k as shown in the area 3 in fig7 , and fig2 . in other words , there remains no pockets of air in the portions of the toner layers having been moved past the downstream end k . in comparison , if the fixation nip n has an area in which the amount of the pressure applied to the recording medium s is smaller than that applied in the immediately upstream area thereof , and which is located on the upstream side of the maximum pressure point k , this area prevents the toner layers from being satisfactorily melted . as a result , the toner layers fail to be satisfactorily squeezed to purge the pockets of air therein , at the downstream end k of the portion a of the fixation film pressing surface of the heating unit . while the recording medium s is conveyed from the downstream end k to the recording medium exit of the fixation nip n , the temperature level of the toner layers remains roughly the same , as represented by line 1 in fig5 ( a ), whereas the amount of the pressure applied to the toner layers steeply falls as shown in fig5 ( b ). therefore , the toner layers are more uniformly melted , while maintaining a certain degree of elasticity , and being subjected to the small amount of pressure , as shown in area 4 in fig2 . since the temperature of the toner layers remains roughly the same while the recording medium s is conveyed from the downstream end k to the recording medium exit of the fixation nip n , the toner layers still maintain a certain level of elasticity at the recording medium exit of the fixation nip n . therefore , the toner layers can be smoothly separated from the fixation film 31 . also , while the recording medium s is conveyed from the downstream end k to the recording medium exit of the fixation nip n , it is kept pressed , along with the fixation film 31 , against the second portion b of the fixation film pressing surface of the heating unit , on the downstream side of the downstream end k . therefore , the curvature given to the recording medium s at the downstream end k in the fixation nip n is properly removed . in addition , the fixation film 31 is pulled in the direction in which it is circularly moved . therefore , the recording medium s cleanly separates from the fixation film 31 ; it does not remain wrapped around the fixation film 31 . through the above described process , the toner layers on the recording medium s are fixed to the recording medium s , turning into an image which is highly glossy , and also , uniform in the other surface properties . thereafter , the recording medium s is outputted from the main assembly of the image forming apparatus . as will be evident from the description of the structure of the fixing apparatus in this embodiment , the employment of the above described structural arrangement for the fixing apparatus affords more latitude in the setting of a fixing apparatus regarding hot offset , making it possible to output a permanent copy of an intended image , which does not suffer from hot offset , is superior in glossiness , is uniform in surface properties , and does not curl or remain adhered to the fixation film . incidentally , the application of the present invention is not limited to a fixing apparatus such as the fixing apparatus in this embodiment in which there is no difference in elevation between the fixation film pressing slippery surface of the heating plate 33 and the fixation film pressing slippery surface of the heating plate holder 32 . in other words , all that is necessary is that there is virtually no area , between the fixation film pressing slippery surface of the heating plate 33 and the point k ( at which internal pressure of fixation nip is highest ), in which the amount of the internal pressure of the fixation nip n is smaller than that in the immediately upstream area thereof . in other words , the structure for a fixing apparatus may be such that the downstream end of the fixation film pressing slippery surface of the heating plate 33 , in terms of the recording medium conveyance direction , is slightly lower in elevation than the portion of the fixation film pressing surface of the heating member holder , next to the downstream end of the heating plate 33 , in terms of the recording medium conveyance direction . the studies made by the inventors of the present invention revealed that as long as the difference in elevation between the downstream end of the fixation film pressing slippery surface of the heating plate 33 and the upstream end of the fixation film pressing surface of the heating plate holder , next to the downstream end of the heating plate 33 , is no more than 100 μm , the effect of the reduction in the internal pressure of the fixation nip n caused by this difference in elevation is negligible . further , the structure of a fixing apparatus may be such that the downstream end of the fixation film pressing slippery surface of the heating plate 33 , in terms of the recording medium conveyance direction , is slightly higher in elevation than the upstream end of the fixation film pressing surface of the heating plate holder , immediately after the heating plate 33 , in terms of the recording medium conveyance direction . in such a case , the downstream end of the fixation film pressing slippery surface of the heating plate 33 in terms of the recording medium conveyance direction is where the internal pressure of the fixation nip n is highest . however , if the point at which the internal pressure of the fixation nip n is highest coincides with the downstream end of the fixation film pressing slippery surface of the heating plate 33 in terms of the recording medium conveyance direction , the inward surface of the fixation film is shaved by the edge of the heating plate 33 . therefore , the structure of a fixing apparatus is desired to such that the point at which the internal pressure of the fixation nip n is highest is created by the heater holder 32 . further , even if there is a slight gap ( in terms of recording medium conveyance direction ) between the downstream end of the heating plate 33 and the upstream wall of the recess of the heater holder 32 , in which the heating plate 33 is embedded , it does not matter . the studies made by the inventors of the present invention revealed that as long as this gap is no more than 300 μm , the pressure reduction caused by this gap is virtually negligible . according to the above described structure of the fixing apparatus in this embodiment , the upstream end j of the recording medium pressing portion a of the fixing film pressing slippery surface of the heating unit is on the upstream side of the recording medium entrance of the fixation nip n in terms of the recording medium conveyance direction . however , the upstream end j of the recording medium pressing portion a made up of the outward surfaces of the heating plate 33 and heating plate holder 32 has only to coincide with the recording medium entrance of the fixation nip n , or on the upstream side the recording medium entrance of the fixation nip n . the employment of the above described structure which makes the end j coincide with the recording medium entrance of the fixation nip n , or be on the upstream side of the recording medium entrance of the fixation nip n , makes it possible to make the other end k coincide with the point in the fixation nip n at which the internal pressure of the fixation nip n is highest , and also , make the internal pressure of the fixation nip n drastically lower on the upstream side of the downstream end k than on the upstream side of the downstream end k . therefore , the toner layers are very effectively squeezed at the downstream end k ; in other words , the effects of the present invention are fully realized . if the end j of the recording medium pressing portion a made up of the outward surfaces of the heating plate 33 and heating plate holder 32 is in the fixation nip n , the internal pressure of the fixation nip n is higher at the point coinciding with the upstream end j of the portion a than that in the adjacencies of that point , making less drastic the difference in the internal pressure between the portion of the fixation nip n on the immediately upstream side of the end k and the portion of the fixation nip n on the immediately downstream side of the end k . therefore , the portion of the fixation nip n corresponding in position to the downstream end k of the recording medium pressing portion a fails to apply high pressure while the toner is in the thoroughly melted state ; in other words , the effects of the present invention cannot be realized . however , a fixing apparatus may be structured so that the upstream end j is located inward of the fixation nip n , as long as the amount of the reduction in the difference in the internal pressure between the portion of the fixation nip n on the immediately upstream side of the downstream end k and the portion of the fixation nip n on the immediately downstream side of the downstream end k , which is caused by the structural arrangement which places the upstream end j in the fixation nip n , is virtually negligible . further , as described above , the fixing apparatus in this embodiment is structured so that the downstream end k roughly coincides with the intersection of the hypothetical plane h connecting the upstream and downstream ends j and k of the recording medium pressing portion a of the fixation film pressing surface of the heating unit , and the hypothetical plane v perpendicular to the hypothetical plane h and coinciding with the rotational axis of the pressure roller 20 ( distance from hypothetical plane v to downstream end k is virtually zero ), as shown in fig6 - 1 . with the provision of this positional arrangement , the amount of the invasion of the recording medium pressing portion a of the fixation film pressing surface of the heating unit into the pressure roller 20 between the recording medium entrance of the fixation nip n and the downstream end k of the portion a of the fixation film pressing surface of the heating unit is such that the closer to the point k , the greater the amount of the invasion ; in other words , the relationship between the amount of the invasion and the distance from the recording medium entrance of the fixation nip n is roughly linear , and the internal pressure of the fixation nip n is maximum at the point k . however , the employment of the structural arrangement , in this embodiment , for a fixing apparatus is not mandatory to make the internal pressure of the fixation nip n highest at the downstream end k . in other words , one of the essential aspects of the present invention is the manner in which , and the distance by which , the heating unit , more specifically , the downstream end k , is made to invade into the pressure roller 20 . if the fixing apparatus is structured so that the downstream end k deviates upstream , in terms of the recording medium conveyance direction , by a substantial distance from the normal position of the downstream end k in this embodiment ( position in fig6 - 1 ), the distribution of the internal pressure of the fixation nip n becomes as shown in fig6 - 2 . that is , the distribution curve of the internal pressure of the fixation nip n remains definitely sharp , but the distance from the recording medium entrance of the fixation nip n to the point of the fixation nip n ( downstream end k ) at which the internal pressure of the fixation nip n is highest , becomes shorter , reducing the size of the heating portion of the fixation nip n . on the other hand , if the fixing apparatus is structured so that the downstream end k deviates downstream , in terms of the recording medium conveyance direction , by a substantial distance , from the normal position of the downstream end k in this embodiment , the distribution of the internal pressure of the fixation nip n becomes as shown in fig6 - 3 . that is , the distribution curve of the internal pressure of the fixation nip n becomes dull , making the present invention less effective . thus , the present invention requires a fixing apparatus to be structured to satisfy the following conditions , which will be described with reference to fig8 , in which a referential letter h designates the hypothetical plane coinciding with the slippery outward surface of the heating plate 33 ; a referential letter v designates the hypothetical plane perpendicular to the plane h and coinciding with the rotational axis of the pressure roller ; and a referential letter l stands for the distance between the line perpendicular to the plane h and coinciding with the intersection of the plane h and the peripheral surface of the pressure roller 20 ( fig8 shows only the distance l on the upstream side of the plane v in terms of the recording medium conveyance direction ; the distance l is present on the downstream side of the plane v ). all that is necessary for the present invention to be effective is that a fixing apparatus is structured so that the downstream end k is positioned in the hatched area m in fig8 ; in other words , it is positioned upstream of the plane v , in terms of the recording medium conveyance direction , and the distance between the downstream end k and the plane v is no more than “ half of the distance l ”, preferably , no more than “ one third of the length l ”, more preferably , no more than “ one quarter of the length l ”. the hatched portion m in fig8 represents the area in which the distance between the downstream end k and the plane v is no more than “ one third of the length l on the upstream side of the plane v ”, and the area in which the distance between the downstream end k and the plane v is no more than “ one quarter of the length l on the downstream side of the plane v ”, in terms of the recording medium conveyance direction . to describe in more detail the above described conditions with reference to fig8 , the referential letter l stands for the distance between the plane v to the recording medium entrance of the fixation nip n , in the sectional view of the fixation nip n at the plane h . the portion of the borderline of the hatched area m , on the upstream side of the plane v , is where the distance from the plane v is roughly one third of l , whereas the portion of the borderline of the hatched area m , on the downstream side of the plane v , is where the distance from the plane v is roughly one quarter of l . in other words , as the amount by which the heating unit is made to invade into the pressure roller ( as plane h shifts upward in fig8 ) is reduced , the distance l reduces , reducing thereby the size of the hatched area m . on the other hand , as the amount by which the heating unit is made to invade into the pressure roller ( as plane h shifts downward in fig8 ) is increased , the distance l increases , increasing thereby the size of the hatched area m . therefore , the borderline of the hatched area m curves . further , since the proper range for the position of the downstream end k , on the downstream side of the plane v , in fig8 , is no more than one quarter of the distance l from the plane v , being different from that on the upstream side , that is , no more than one third of the distance l . therefore , the portion of the curved borderline of the area m , on the upstream side of the plane v , is slightly different from that on the downstream side of the plane v . however , the proper range for the position of the downstream end k , on the downstream side of the plane v , may extend as far as one half of the distance l , as described above . the reason for the inward curvature of the bottom portion of the borderline of the hatched area m is as follows . that is , if the heating unit is made to invade into the pressure roller by an amount greater than a certain value , even the upstream end j of the recording medium pressing portion a is made to invade into the pressure roller , although the position of the downstream end k still satisfies the condition that the distance of the downstream end k from the plane v must be no more than { fraction ( 1 / 3 )} and { fraction ( 1 / 4 )} of the distances l , on the upstream and downstream sides of the plane v , respectively . therefore , such an area must be eliminated from the proper area for the placement of the downstream end k , and the elimination of such an area causes the borderline of the hatched area m to inwardly curve . further , in the above described embodiment of the present invention , the first recording medium pressing portion a , that is , the portion of fixation film pressing slippery surface of the heating member , from the upstream end j of the recording medium pressing portion of the fixation film pressing slippery surface made up of the outward surfaces of the heating plate 33 and heating plate holder 32 , to the point ( downstream end k of first portion a ), at which the internal pressure of the fixation nip n is highest , was defined as a flat surface . however , all that is necessary is that the first recording medium pressing slippery portion a is configured so that the closer to the downstream end k , the higher the fixation pressure . in other words , all that is necessary is that the portion a does not curve upward relative to the plane h coinciding with the upstream j of the recording medium pressing portion of the fixation film pressing slippery surface made up of the outward surfaces of the heating plate 33 and heating member holder 32 , and the line ( downstream end k ) at which the internal pressure of the fixation nip n is highest ; the portion a may curve slightly downward . as long as the first recording medium pressing portion a is flat or curves downward as shown in fig9 ( 1 ) and 9 ( 2 ), the distribution of the internal pressure of the fixation nip n across the first portion a becomes such that the closer to the downstream end of the first portion a , the higher the internal pressure . therefore , there is no area in the portion of the fixation nip n , corresponding to the first portion a , in which the amount of the pressure which applies to the recording medium s is less than that which applies to the recording medium s in the immediately preceding area in terms of the recording medium conveyance direction . therefore , as the combination of the recording medium s and toner images thereon is conveyed through this portion of the fixation nip n , it is kept perfectly in contact with the fixation film , in terms of the lengthwise direction of the fixation nip n , being thereby uniformly squeezed in terms of the lengthwise direction of the fixation nip n . as a result , the level of uniformity in surface properties , in particular , glossiness , at which an image is outputted improves . if the first recording medium pressing portion a curves toward the heating unit as shown in fig9 ( 3 ), the fixation pressure of the fixation nip n is lower in the area p . therefore , while the recording medium s is conveyed through this area p , the combination of the recording medium s and the toner images thereon cannot be perfectly in contact with the fixation film , being therefore unevenly squeezed in terms of the lengthwise direction of the fixation nip n . as a result , the level of uniformity in surface properties , in particular , glossiness , at which an image is outputted falls . further , in the above described embodiment of the present invention , the structure of the portion of the fixation nip n after the downstream end k , at which the internal pressure of the fixation nip n is highest , in terms of the recording medium conveyance direction , in other words , the structure of the recording medium pressing portion b , is such that the entirety of the portion b was flat . however , it is not mandatory that the entirety of the portion b is flat . for example , the portion b may curve inward of the heating unit as shown in fig1 - 12 , 24 , and 25 , for the following reason . that is , even if the portion b curves inward of the heating unit , the recording medium s is kept pressed , along the fixation film s , against the portion b by the pressure roller 20 , being thereby made to conform to the inward curvature of the portion b , being thereby prevented from curving toward the fixation film . in addition , the recording medium exit of the fixation nip n is preceded , in terms of the recording medium conveyance direction , by the inward curvature of the recording medium pressing portion b . therefore , as the fixation film 31 is pulled to be circularly rotated around the heating unit , the recording medium s more smoothly separates from the fixation film s . in other words , making the recording medium pressing portion b slightly inwardly curve does not adversely affect the present invention . incidentally , the fixation nips n in fig1 - 12 are the same as those in fig4 , and 7 , except for the inward curving of the recording medium pressing portion b , and therefore , will not be described here . the heating plate 33 and heating member holder 32 , the outwardly facing surfaces of which make up the fixation film pressing surface of the heating unit , are rigid members , making it easier to structurally control the amount of the pressure f applied by them . fig1 is a schematic sectional view of the essential portion of the first example of a fixing apparatus comparable to that in the first embodiment . fig1 is an external perspective view of the heating member of the first example of a fixing apparatus comparable to that in the first embodiment . the structural members and portions of this fixing apparatus identical to those in the first embodiment will be given referential symbols identical to those in the first embodiment , and will not be described here . the difference between the first example of a fixing apparatus comparable to the fixing apparatus in the first embodiment and the fixing apparatus in the first embodiment is that the heating member in this example of a fixing apparatus is wide enough , in terms of the recording medium conveyance direction , to extend downstream beyond the downstream end k , at which the fixation pressure of the fixation nip n is highest . otherwise , the two fixing apparatuses are the same in structure . here , referring to the temperature and pressure distributions of the fixation nip n in fig5 , the difference between the first example of a fixing apparatus comparable to the fixing apparatus in the first embodiment , and the fixing apparatus in the first embodiment , will be described . the difference between the first comparative example and first embodiment is that the heating member in this example of a fixing apparatus is wide enough , in terms of the recording medium conveyance direction , to extend downstream beyond the downstream end k , at which the fixation pressure of the fixation nip n is highest . otherwise , the two fixing apparatuses are the same in structure . therefore , the distribution of the internal pressure of the fixation nip n in this example , is the same as that in the first embodiment shown in fig5 ( b ). in this comparative example , however , the heating member 33 is wide enough , in terms of the recording medium conveyance direction , to make contact with the fixation film 31 across virtually the entire range of the fixation nip n in terms of the recording medium conveyance direction . therefore , heat is generated across virtually the entire range of the fixation nip n in terms of the recording medium conveyance direction . therefore , the temperature curve ( distribution ) in the fixation nip n does not become one such as the one in the first embodiment , represented by line 1 in fig5 ( a ), that the point at which the internal temperature ( fixation temperature ) of the fixation nip n becomes optimal for fixation is on the immediately upstream side of the point ( downstream end k of recording medium pressing portion a ) at which the internal pressure ( fixation pressure ) of the fixation nip n is highest . in this first comparative example , therefore , even if the target temperature ( fixation temperature ) of the heating member is set to a level slightly below the level at or above which hot offset occurs , the internal temperature of the fixation nip n becomes highest on the downstream side of the downstream end k , at which the internal pressure of the fixation nip n is highest , in terms of the recording medium conveyance direction ( line 2 in fig5 ( a )). therefore , the toner on the recording medium s cannot be thoroughly melted by the time the recording medium s reaches the point k , at which the internal pressure of the fixation nip n is highest . therefore , the minute pockets of air cannot be effectively squeezed out of the toner layers . as a result , the toner layers ( toner images ) cannot be uniformly fixed in terms of surface properties , in particular , glossiness ; an outputted image is not as glossy as the one outputted from the image forming apparatus in the first embodiment . on the other hand , if the target temperature level of the fixation apparatus in this example is set so that the internal temperature of the fixation nip n thereof at the point k , at which the internal pressure of the fixation nip n is highest , becomes the same as that in the first embodiment ( line 3 in fig5 ( a )), the toner on the recording medium s will have been overheated by the time the recording medium s reaches the adjacencies of the recording medium exit of the fixation nip n , because , in the case of the fixation apparatus structure in this comparative example , the combination of the recording medium and the toner image thereon is continuously heated by the heating member 33 even after the combination is conveyed past the point k at which the internal pressure of the fixation nip n is highest . therefore , the elasticity of the toner layers at the recording medium exit of the fixation nip n in this comparative example is lower than that in the first embodiment . as a result , hot offset occurs . in other words , if a fixing apparatus is structured so that heating occurs throughout the fixation nip n as it does in the first comparative example , it becomes impossible to realize the effect of the present invention . this is why in the first embodiment , the heating member is disposed so that , in terms of the recording medium conveyance direction , the downstream end of the heating member is positioned on the upstream side of the point at which the internal pressure of the fixation nip n is highest . fig1 is a schematic sectional view of the second fixing apparatus comparable to that in the first embodiment . the structural members and portions of this fixing apparatus identical to those in the first embodiment will be given referential symbols identical to those in the first embodiment , and will not be described here . the difference between this second comparative example of a fixing apparatus and the fixing apparatus in the first embodiment is that the portion of the heating member holder in this example of a fixing apparatus , on the downstream side of the heating member , is made to substantially ( by no less than 100 μm ) project inward of the pressure roller . otherwise , the structure of this example of a fixing apparatus comparable to that in the first embodiment is the same as the structure of that in the first embodiment . next , referring to fig1 , the difference between the fixing apparatus in the first embodiment and this example of a fixing apparatus comparable to the fixing apparatus in the first embodiment will be described . it is feasible to place a rib - like member in the fixation nip n to locally increase the internal pressure of the fixation nip n in order to enhance the effect of the present invention that the pockets of air are squeezed out of the toner layers , in the fixation nip n . definitely , providing the fixation nip n with a point at which the internal pressure of the fixation nip n is higher than its adjacencies assures that a glossier image is yielded . however , with the presence of an area such as the area p in fig1 , in which the internal pressure of the fixation nip n is lower than the immediately preceding area in terms of the recording medium conveyance direction , the amount of the pressure applied to the recording medium and the toner layers thereon by the fixation nip n temporarily reduces immediately before it becomes highest . therefore , while the combination of the recording medium and the toner layers thereon is conveyed through this area like the area p , the contact between the combination of the recording medium s and the toner layers thereon and the fixation film becomes nonuniform , in terms of the lengthwise direction of the fixation nip n . therefore , the heat transmission from the fixation film to the toner on the recording medium s becomes insufficient . therefore , the toner fails to melt enough to achieve the level of viscosity necessary to allow the pockets of air to be squeezed out of the toner . as a result , a substantial number of pockets of air remain in the toner . in addition , the presence , in the fixation nip n , of the area in which the internal pressure of the fixation nip n is lower than the immediately preceding area in terms of the recording medium conveyance direction makes nonuniform , in terms of the lengthwise direction of the fixation nip n , the contact between the fixation film 31 and the toner t on the recording medium s . as a result , the fixation nip n becomes nonuniform , in terms of its lengthwise direction , in the effect of squeezing the pocket of air out of the toner t , making the fixing apparatus inferior in the uniformity of the surface properties , in particular , glossiness , of an image outputted from the fixing apparatus ; an image which is nonuniform in glossiness in terms of the lengthwise direction of the fixation nip n is yielded . next , referring to fig1 , the relationship between the state of contact between the fixation film and the combination of the recording medium s and the toner thereon , and the temperature distribution and pressure distribution in the fixation nip n , will be described . the pressure distribution in the fixation nip n of this second example of a fixing apparatus is as shown in fig1 ( b ). that is , there is an area , in the fixation nip n , in which the internal pressure is lower than the internal pressure of the immediately preceding area in terms of the recording medium conveyance direction . therefore , as the recording medium s is conveyed through the fixation nip n , the contact between the fixation film and the toner on the recording medium s becomes nonuniform in terms of the lengthwise direction of the fixation nip n . in terms of the recording medium conveyance direction , the temperature distribution of the fixation nip n , corresponding to the portion of the fixation nip n , in terms of its lengthwise direction , in which the contact is satisfactory ( the fixation film and the toner on the recording medium are perfectly in contact with each other ) in the aforementioned low pressure area , is as represented by line 1 in fig1 ( a ). that is , the internal temperature of the fixation nip n reaches the optimal level at a point on the upstream side of the point k at which the internal pressure of the fixation nip n is highest , allowing thereby the fixation nip n to satisfactorily squeeze the pockets of air out of the toner at the point k . in comparison , the temperature distribution of the fixation nip n , corresponding to the portion of the fixation nip n , in terms of its lengthwise direction , in which the contact is unsatisfactory ( the fixation film and the toner on the recording medium are imperfectly in contact with each other ) in the aforementioned low pressure area , is as represented by line 2 in fig1 ( a ). that is , the rate of the upward change in the temperature distribution begins to reduce at the point at which pressure drop begins . therefore , the internal temperature of the fixation nip n does not reach the optimal level on the upstream side of the point k , preventing thereby the pockets of air from being efficiently squeezed out of the toner . obviously , even the internal temperature of the portion of the fixation nip n , in which the state of the contact is unsatisfactory as represented by line 3 in fig1 ( a ), can be increased to the optimal level by increasing the amount by which the heating member 33 generates heat . however , such a remedy causes the temperature of the portion of the fixation nip n , in which the state of contact is satisfactory , to become too high as indicated by line 4 in fig1 ( a ), making the toner too low in elasticity . as a result , hot offset occurs . in other words , if a fixing apparatus is structured as is this second example of a fixing apparatus comparable to that in the first embodiment , in which an area , in which the internal pressure of the fixation nip n is lower than the immediately upstream side thereof is created in the fixation nip n , no latitude is afforded in achieving a desired level of surface uniformity ; in other words , it is impossible to realize the effects of the present invention . therefore , the distance by which the downstream side of the heating member holder in terms of the recording medium conveyance direction is made to protrude toward the pressure roller beyond the outwardly facing slippery surface of the downstream side of the heating member is desired to be no more than 100 μm . incidentally , even if this example of a fixing apparatus comparable to the fixing apparatus in the first embodiment is modified in structure in order to change the position of the contact area ( fixation nip n : fixation pressure generation area ) between the heating unit and pressure roller in terms of the horizontal direction , more specifically , in order to cause the line c 1 which is perpendicular to the recording medium pressing flat portion of the fixation film guiding surface made up of the outwardly facing slippery surfaces of the heating member 33 and heating member holder 32 , and coincides with the center thereof in terms of the recording medium conveyance direction , to coincide with the rotational axis of the pressure roller 20 , the area , the internal pressure of which is lower than that in the immediately preceding area in terms of the recording medium conveyance direction , remains in the fixation nip n , and therefore , the effects of the present invention cannot be realized . fig1 ( a )- 19 ( b ) are schematic sectional views of the essential portion of the fixing apparatus in this embodiment . the structural members and portions of the fixing apparatus in this embodiment identical to those in the first embodiment will be given the same referential symbols as those in the first embodiment , and will not be described here . essentially , the fixing apparatus 10 in this embodiment comprises a pressure roller 20 and a heating unit 40 . the pressure roller 20 is 20 mm in diameter , and is provided with an elastic layer , the hardness of which is 60 ° in asker - c hardness scale . the heating unit 40 is kept pressed against the pressure roller 20 , forming a fixation nip n , and is provided with a heating means for heating the fixation nip n . the pressure roller 20 comprises a metallic core 21 formed of aluminum or iron , an elastic layer 22 fitted around the metallic core 21 , and a mold release layer 23 coated on the peripheral surface of the elastic layer 22 . the elastic layer 22 is a solid rubber layer formed of silicon rubber or the like , a sponge rubber layer formed of foamed silicon rubber made by foaming the silicon rubber in order to make the silicon rubber thermally insulative , a foamed rubber layer formed of foamed silicon rubber made by dispersing hollow filler particles in the silicon rubber to make the silicon rubber thermally insulative , or the like . the mold release layer 23 may be formed by coating the peripheral surface of the elastic layer 22 with fluorinated resin , such as perfluoroalkoxyl resin ( pfa ), polytetrafluoroethylene resin ( ptfe ), and tetrafluoroethylene - hexafluoropropylene resin ( fep ), or gls latex . it may be a tube fitted over the elastic layer 22 . it may be formed by coating the peripheral surface of the elastic layer 22 with mold releasing paint . the heating unit 40 comprises : a heat resistant cylindrical fixation film 41 which is 18 mm in diameter and 64 μm in thickness ; a heating member holder 42 for cylindrically holding the fixation film 41 ; and a rigid metallic pressure application stay 44 for holding the heating member holder 42 . the fixation film 44 is loosely fitted around the combination of the heating member holder 42 and stay 44 . the heating unit 40 also comprises a heating member 43 in the form of a piece of plate ( which hereinafter may be referred to as heating plate ), which is 5 . 83 mm in width , and is held to the heating member holder 42 , extending in the lengthwise direction of the holder 42 . the heating unit 40 is kept pressed against the pressure roller 20 by an unshown pressing means , which generates pressure f (= 20 kgf ), with the fixation film 41 sandwiched between the heating plate 43 and pressure roller 20 , forming thereby a fixation nip n shown in fig1 ( b ). referring to fig1 ( c ), the plane of which is perpendicular to the rotational axis of the pressure roller 20 , the heating unit 40 is kept pressured toward the rotational axis of the pressure roller 20 by the force f . the direction u of the normal line to the flat portion of the recording medium pressing surface of the heating member holder 42 is not parallel to the direction in which the force f is applied to the heating unit 40 to keep the heating unit 40 pressed against the pressure roller 20 . in other words , the flat portion of the recording medium pressing slippery surface of the heating unit 40 made up of the outwardly facing surfaces of the heating plate 43 and heating member holder 42 , forms an angle of 4 . 4 ° relative to the horizontal plane , making the amount of the invasion by the flat portion into the pressure roller 20 relative to the peripheral surface of the pressure roller 20 , gradually increase toward the downstream end of the flat portion in terms of the recording medium conveyance direction . incidentally , the direction in which force is applied to the heating member holder 43 is desired to be set so that the angle at which force is applied to the heating member holder 43 , relative to the direction of the normal line to the outwardly facing slippery surface of the heating member 43 ( hypothetical line perpendicular to the outwardly facing surface of heating member 43 ) falls in the range of 0 - 30 °. with the employment of such a structural arrangement , the upstream end j of the flat portion of the recording medium pressing portion of the fixation film pressing surface of the heating unit 40 is placed outside the recording medium entrance of the fixation nip n , and the downstream end k thereof is placed in the fixation nip n . in this second embodiment , the portion a , that is , the portion between the recording medium entrance of the fixation nip n and the downstream end k of the aforementioned flat portion , is 7 . 7 mm , and the distance by which the downstream end k of the flat portion invades into the pressure roller 20 is 1 . 09 mm . also in this embodiment , the hypothetical line which is perpendicular to the fixation film contacting surface of the heating member , and coincides with the center thereof , is on the upstream side of the vertical plane coinciding with the rotational axis of the pressure roller 20 . the heating unit 40 is kept pressed against the pressure roller 20 with the interposition of the fixation film 44 . the fixation film 44 held pinched between the heating member 42 and heating plate 43 is circularly rotated around the combination of the heating member holder 42 and rigid pressure application stay 44 by the rotation of the pressure roller 20 . the portion of the heating member holder 42 , on the downstream side of the downstream end k of the portion a , is made to curve inward of the heating unit 40 , forming the second portion b of the recording medium pressing slippery surface of the heating unit 40 , which extends from the downstream end k to the recording medium exit of the fixation nip n , and is 3 mm in width in terms of the recording medium conveyance direction . the fixation film 41 is a resin film comprising a substrate layer formed of heat resistant and heat insulating film of resin , such as polyamide , polyamide - imide , peek , pes , pps , pfa , ptfe , fep , etc ., and a surface layer formed of a single or mixture of heat resistant resins , such as pfa , ptfe , fep , silicone resin , etc ., superior in mold releasing properties . the heating member holder 42 is formed of resin such as liquid polymer , phenol resin , pps , peek , etc ., which are heat resistant and slippery . the heating plate 43 , that is , a heating member in the form of a piece of flat plate , is controlled in such a manner that the surface temperature of the pressure roller 20 or temperature of the inward surface of the heating plate 43 is maintained at a target temperature based on such information as the temperature detected by an unshown temperature detecting means , such as a thermistor , placed at an optional location next to the inward surface of the portion of the fixation film 44 , within the range of the fixation nip n . as described above , in this embodiment , the direction u of the normal line to the flat portion of the recording medium pressing portion of the fixation film pressing slippery surface of the heating unit 40 made up of the outwardly facing surfaces of the heating plate 43 and heating member holder 42 is not parallel to the direction in which the force f is applied to keep the heating unit 40 pressed against the pressure roller 20 . therefore , the recording medium pressing flat portion is angled relative to the horizontal plane ( fig1 ( c ). further , the upstream end j of the flat portion is outside the fixation nip n , and the downstream end k of the flat portion is in the fixation nip n ( fig1 ( b )). therefore , the distribution of the internal pressure of the fixation nip n is such that the internal pressure gradually increases toward the point k , at which the internal pressure is highest in the fixation nip n . therefore , as the recording medium s is conveyed through the fixation nip n , not only is it continuously heated by the heating plate 43 , but also , the pressure which applies to the recording medium s gradually increases with virtually no decrease until the recording medium s reaches the point k . further , the heating member is located on the upstream side of the point k of the heating member holder 42 , at which the internal pressure of the fixation nip n is highest . therefore , the portion of the fixation nip n , which includes the portion a , and in which the combination of the recording medium s and the unfixed toner image is continuously heated without any drop in temperature , and in which the pressure which applies to the combination continuously and gradually increases , can be separated from the portion of the fixation nip n at which the internal pressure of the fixation nip n is highest . the pressure distribution of the fixation nip n of the fixing apparatus in this embodiment is the same as that of the fixing apparatus in the first embodiment , which is represented by line 1 in fig5 ( a ), and the temperature distribution thereof is the same as that of the fixing apparatus in the first embodiment , shown in fig5 ( b ). therefore , before the toner reaches the point k ( downstream end k of flat portion a ), at which the internal pressure of the fixation nip n is highest , the toner is thoroughly melted , allowing the pockets of air to be efficiently squeezed out of the toner . further , the toner is not unnecessarily heated after it is moved past the point k ; the temperature of the portion of the fixation nip n , on the downstream side of the point k remains at the target temperature level . therefore , it is possible to achieve the desired level of uniformity in surface properties , in particular , glossiness , and more latitude is afforded in controlling the fixation temperature in order to prevent hot offset . in addition , the direction u of the normal line to the flat portion a of the fixation film pressing slippery surface made up of the outwardly facing surfaces of the heating plate 43 and heating member holder 42 is not parallel to the direction f in which the heating unit 40 is kept pressured toward the pressure roller . therefore , the flat portion a is tilted relative to the horizontal plane tangential to the peripheral surface of the pressure roller 20 . therefore , not only is the force f 1 , the direction of which is perpendicular to the flat portion a , generated , but also , the force f 2 , the direction of which is parallel to the flat portion a and the direction sf in which the recording medium s is conveyed , while sandwiched between the fixation film and pressure roller , is generated , raising the level of stability at which the recording medium s is conveyed through the fixation nip n . therefore , the possibility that the amount of the pressure applied to the recording medium s by the recording medium pressing slippery surfaces of the heating plate 43 and heating member holder 42 , through the fixation film 41 , locally reduces within the fixation nip n , is reduced , enabling thereby the fixation nip n to reliably squeeze the pockets of air . therefore , it is possible to further raise the level of uniformity in surface properties , in particular , glossiness . also in this embodiment , the heating plate 43 and heating member holder 42 which make up the fixation film pressing slippery surfaces of the heating unit 40 are rigid members , as those in the first embodiment , making it easier to control the pressure f . further , the fixing apparatus in this embodiment is provided with the portion b as is the fixing apparatus in the first embodiment . therefore , it is possible to raise the level of glossiness without the occurrence of hot offset , as it can be done in the first embodiment . further , the provision of the portion b prevents the recording medium s from remaining curled . therefore , the recording medium s is smoothly separated from the fixation film 41 at the recording medium exit of the fixation nip n ; it is prevented from remaining wrapped around the fixation film 41 . the shapes and materials of the members of the fixing apparatus in this embodiment , and the values representing the properties thereof , are not mandatory . as long as they can realize the pressure and temperature distributions shown in fig5 ( line 1 in fig5 ( a ), and fig5 ( b ), respectively ), they do not adversely affect the effects of the present invention . fig2 is a schematic sectional view of the essential portion of the fixing apparatus in this embodiment . the structural members and portions of the fixing apparatus in this embodiment identical to those in the first embodiment will be given the same referential symbols as those in the first embodiment , and will not be described here . the difference between this embodiment and the second embodiment is that in the second embodiment , the surface which catches the force f from the heating member holder 42 is roughly perpendicular to the direction of the force f ( surface which catches force f of heating member holder is nonparallel to outwardly facing slippery surface of heating member 43 ), whereas in this embodiment , the surface which catches the force f of the heating member holder 42 is not perpendicular to the direction of the force f ( surface which catches force f from heating member holder 42 is roughly parallel to the outwardly facing slippery surface of the heating member holder 42 ). referring to fig2 , the plane of which is perpendicular to the rotational axis of the fixation film of the heating unit 30 , in the case of the fixing apparatus in this embodiment , the direction parallel to the direction of the force f , in which the heating unit 30 is kept pressured toward the pressure roller 20 ( direction in which pressure is applied on heating member holder 42 ), is tilted upstream in terms of the recording medium conveyance direction sf , that is , tilted toward the recording medium entrance of the fixation nip n , at an angle d , which is no more than 30 °, relative to the direction u of the normal line to the flat portion of the recording medium pressing surface of the heating member holder 42 , in the range of the fixation nip n . in other words , 0 °& lt ; d ≦ 30 °. the pressure and temperature distributions similar to those shown in fig5 ( line 1 in fig5 ( a ), and fig5 ( b ), respectively ), which are realized in the first embodiment , can also be realized by the employment of the above described structural arrangement for a fixing apparatus in this embodiment . therefore , the effects realized by the first embodiment , that is , improvement in the level of uniformity in surface properties , in particular , glossiness , achieved by the flat slippery portion a , more latitude in prevention of hot offset , uncurling of the recording medium s by the slippery portion b , and prevention , by the slippery portion b , of the wrapping of the recording medium around the fixation film , can be realized also by the structural arrangement in this embodiment . in the case of the above described structural arrangement in this embodiment , the direction of the force f is tilted upstream , at an angle d . therefore , not only the force f 1 , the direction of which is perpendicular to the slippery surface , is generated , but also , the force f 2 , the direction of which is parallel to the slippery surface , and the direction sf in which the recording medium s is conveyed , being sandwiched between the fixation film and pressure roller , is generated , raising thereby the level of stability at which the recording medium s is conveyed through the fixation nip n . therefore , the possibility that the amount of the pressure applied to the recording medium s by the recording medium pressing slippery surfaces of the heating plate 43 and heating member holder 42 , through the fixation film 41 , locally reduces within the fixation nip n , is reduced , enabling thereby the fixation nip n to reliably squeeze the pockets of air . therefore , it is possible to further raise the level of uniformity in surface properties , in particular , glossiness , at which a toner image is fixed . if the angle d is no less than 30 °, the force f , the direction of which is perpendicular to the slippery surface , generates an excessive amount of force f 2 , which acts on the recording medium s in the direction to convey the recording medium s , raising the level of stability at which the recording medium s is conveyed . however , the pressure for keeping the fixation film satisfactorily in contact with the toner image on the recording medium s reduces or becomes unstable . therefore , the pockets of air cannot be efficiently squeezed out , lowering the level of the uniformity in surface properties at which the toner image is fixed . this is why the angle d of the force f is to be set to a value in the aforementioned range . with the angle d set to a value within the aforementioned range , the pockets of air can be more reliably squeezed out to raise the level of uniformity in surface properties , in particular , glossiness , at which the unfixed toner image is fixed by the fixing apparatus . regarding the value to which the angle d between the direction of the force f relative to the direction u of the normal line to the slippery surface , it should be selected in accordance with the coefficient of the friction between the recording medium s and slippery surface , or the like factors . however , it should be set to a value no more than 30 °, because as long as it is set to a value no more than 30 °, the effects of the present invention are satisfactorily realized . by structuring a fixing apparatus as the fixing apparatus in this embodiment is structured so that the direction in which the force f is applied to keep the heating unit pressured toward the pressure roller is tilted at the angle d , relative to the normal line u to the slippery surface , not only is the effects realized by the first embodiment , but also , the effects realized by the second embodiment can be realized . this embodiment is characterized in that the portion the heating member holder ( 32 and 42 in embodiments 1 - 3 ), which remains in contact with the inward surface of the fixation film ( 32 and 42 in embodiments 1 - 3 ) as the fixing film is circularly rotated around the heating member holder , sliding thereon , or the entirety of the heating member holder , is formed of ptfe , or a substance comparable in heat resistance and slipperiness . forming the portion of the heating member holder ( 32 and 42 ), which remains in contact with the inward surface of the fixation film ( 32 and 42 ) as the fixation film is circularly rotated around the heating member holder , sliding thereon , or the entirety of the heating member holder , of a substance such as ptfe which is heat resistant as well as slippery , improves the level of stability at which the fixation film is circularly moved around the heating member holder , and also , the durability of the fixation film . therefore , a fixing apparatus is improved in the state of contact between the heating member holder and fixation film , and the state of contact between the heating plate ( 33 in embodiment 1 - 3 ) and fixation film , not only making it possible to more reliably fix an unfixed toner image , but also , raising the level of uniformity in surface properties , in particular , glossiness , at which the unfixed toner image is fixed . this embodiment is characterized in that the portion the heating member holder ( 32 and 42 in embodiments 1 - 3 ), which remains in contact with the inward surface of the fixation film ( 32 and 42 in embodiments 1 - 3 ), in the fixation nip n , as the fixing film is circularly rotated around the heating member holder , sliding thereon , or the entirety of the heating member holder , is coated with fluorinated substance which is heat resistant and slippery . forming the portion of the heating member holder ( 32 and 42 ), which remains in contact with the inward surface of the fixation film ( 32 and 42 ) as the fixation film is circularly rotated around the heating member holder , sliding thereon , or the entirety of the heating member holder , of a substance such as ptfe , or the like , mentioned in the fourth embodiment , which is heat resistant as well as slippery , raises the level of stability at which the fixation film is circularly moved around the heating member holder , and also , the durability of the fixation film . therefore , a fixing apparatus is improved in the state of contact between the heating member holder and fixation film , and the state of contact , in the fixation nip n , between the heating plate ( 33 in embodiments 1 - 3 ) and fixation film , not only making it possible to more reliably fix an unfixed toner image , but also , raising the level of uniformity in surface properties , in particular , glossiness , at which the unfixed toner image is fixed . 1 ) a fixing apparatus in accordance with the present invention includes such an image heating apparatus as an image fixing apparatus for temporarily fixing an unfixed image to recording medium , a surface property improving apparatus for reheating a recording medium bearing a fixed image to improve the image in surface properties such as glossiness , or the like heating apparatus . 2 ) in the preceding embodiments of the present invention , a ceramic heater structured as shown in fig3 is employed as the heating member . obviously , a ceramic heater employed as the heating member may have a structure different from the one shown in fig3 . for example , it may be a ceramic heater of the so - called rear surface heating type , in which the heat generating resistive layer 33 b is placed on the opposite surface of the substrate 33 a from the surface on which the flexible member slides . further , it may be a heating device employing a piece of nichrome wire , or the like , or a heat generating device comprising a piece of iron plate or the like , in which heat can generated by electromagnetically induced current . 3 ) in the preceding embodiments , a thermistor of a contact type is employed as a means for detecting the temperature of the heating member . however , the temperature detecting means may be of a noncontact type , which detects radiant heat , and the employment of such a temperature detecting means causes no problem at all . further , the location of the temperature detecting means does not need to be limited to those in the preceding embodiments ; the temperature control is possible even if the temperature detecting means is disposed at a location different from those in the preceding embodiments . 4 ) the material for the flexible member does not need to be limited to the film of heat resistant resin . it may be metallic film , or composite film . 5 ) in the preceding embodiments , the flexible member is a cylindrical member ( flexible sleeve ), and is rotated by the rotation of the pressure roller driven by a driving means . however , the means for rotating the flexible member is optional . for example , a driver roller may be placed within the loop of the endless film ( flexible member ) to rotationally drive the endless film by rotationally driving the driver roller . 6 ) the flexible member may be in the form of a roll of a long piece of web , which is rolled out and moved in contact with the heating member . as described above in detail , according to the present invention , the pressure and temperature distributions in the fixation nip can be optimized . therefore , an image which is highly glossy and does not suffer from the defects attributable to nonuniform heating can be outputted , without sacrificing the benefits of a fixing apparatus of a film heating type , that is , thermal efficiency , rapid startup , low cost , etc . while the invention has been described with reference to the structures disclosed herein , it is not confined to the details set forth , and this application is intended to cover such modifications or changes as may come within the purposes of the improvements or the scope of the following claims . this application claims priority from japanese patent applications no . 195772 / 2003 filed jul . 11 , 2003 and no . 193164 / 2004 filed jun . 30 , 2004 , which is hereby incorporated by reference .
| 6 |
the present invention uses a single capacitor to generate an electric field and to detect changes in that field due to the passage of material with varying resistivity or dielectric constant . this technique is useful for measurements in several different fields of endeavour , such as : geophysical exploration and mine development , both surficial and in boreholes archaeological detection of cavities and / or objects having a significant dielectric contrast with surrounding material hydro - geological detection of the saline markers associated with groundwater in arid climates environmental detection of conductive contaminant plumes or monitoring in connection with the rehabilitation of contaminated sites the basis of the present invention stems from the fundamental physical property exhibited by a capacitor when the electric field generated by the capacitor is modified by an intersecting material , thereby altering the effective capacity . the capacitor then behaves as a variable reactive impedance , becoming a single sensor that responds to changes in electrical parameters of the environment through which it passes . the variations are detected by incorporating an integrated capacitor sensor ( ics ) as a frequency determining element of an electrical oscillator that , in turn , drives the ics . the resulting frequency variations of the oscillator are then transmitted directly to a data acquisition system for conversion to resistivity or dielectric constant measurements . the ics involves two alternative capacitive array configurations when used in boreholes . for use in dry boreholes , an array is formed from parallel rods , wherein each pair of rods has one rod connected to the driver and the other rod connected to ground . the electric field extends outwardly and is used to measure the parameters of the surrounding borehole , such as resistivity and dielectric constant . the apparatus is encased in a composite tubular housing between metal plugs with an isolated power source . for use in fluid - filled boreholes , a second embodiment of the array benefits from the fact that the fluid is conductive and employs metal plugs to generate an electric field therebetween which takes the form of an arc with radial symmetry from one plug to the other . direct galvanic contact with the fluid provides high efficiency coupling of the electric field to the formation . a fixed capacitor is used rather than the non - conductive probe housing to prevent a direct contact between the fluid and the internal circuitry . in both configurations an oscillator is employed to energize an rc circuit consisting of a fixed resistor and an adjacent plate or rod capacitor . any phase shift at the output of the rc circuit is a function of the time constant that depends upon the product of the fixed resistance and the measured capacitance , which in turn is dependent upon the material that intersects the capacitive electric fields . in the preferred embodiment for use in fluid - filled or dry boreholes , the digital frequency signal is acquired and processed by a standard pc . for borehole measurements , most conventional sensor systems generate signals that require specialized custom designed boxes at the surface to provide signal conditioning before being fed to any standard data acquisition system . in the present invention , however , the signal is a frequency that is transmitted by an industry standard line driver element for reception by a corresponding receiver chip . the system is thus compatible with off the shelf data acquisition plug - in cards that are available from a number of third party manufacturers of pc accessories , making the ics and processing unit an inexpensive package , suitable for the budgets of environmental groups or municipalities concerned with the monitoring of contamination leaching from landfill sites or ‘ brown lands ’. in one embodiment of the present invention shown in fig3 a , an ics probe 18 is constructed in the form of parallel rods 20 , 22 arranged in a circular array and separated by circular spacers 24 . alternate rods 22 are connected to ground to form the passive or ground element of the array , while the other rods 20 are connected to the driving circuitry to form the active element . in operation , the probe is a multi - capacitive array that has radial symmetry , with the electric field 10 fringing out symmetrically into the formation , as shown in fig3 b . although not shown , the probe is housed in a composite tubular housing between two metal plugs . another embodiment of the present invention is shown in fig4 . this embodiment is particularly advantageous when the borehole is filled with fluid 66 . fig4 shows the borehole wall 67 and the logging cable 68 . an ics probe 18 is constructed with the capacitor elements formed by the metal plugs 70 , 72 that seal the two ends of the probe housing 74 . both metal plugs 70 , 72 act as electrodes in direct galvanic contact with the fluid , which provides a high efficiency coupling of the electric field 10 with the formation . one of the electrodes 72 is connected to the local ground of the oscillator circuit , while the other one 70 , the active element , is connected to the driving circuitry via a fixed capacitor c s . the electric field is generated as a radially symmetrical arc between the two electrodes , thereby intersecting the formation . with the electrodes in direct contact with the fluid , the electric field is coupled to the fluid and hence to the formation , forming a high efficiency configuration . the base frequency of the device is the frequency obtained when the electrodes are shorted together , and thus is determined by the value of the series capacitance and the value of the feedback resistance used in the oscillator circuit . the fixed capacitor c s performs the same function as the capacitance between the rods 20 , 22 inside the non - conductive probe housing of the parallel rod array of fig3 a . both of the embodiments of fig3 and 4 preferably use an isolated power supply for the oscillator circuit . if the oscillator circuit and the associated capacitive array share a common ground with the logging cable supplying power from the surface equipment , there is a possibility that undesirable capacitive interaction between the capacitive array and the cable conductors may occur . fig5 a shows waveforms of the ics probe . a square wave oscillator energizes a two - element rc network consisting of a fixed resistance r and the fixed capacitance c . in this embodiment , the signal at the junction of the two elements is a degraded square wave 30 that is used as the input to a second logic gate 32 , which in turn produces a second square wave 34 identical to the original 35 except for a shift in phase . “ t ” indicates the trigger point of the second logic gate 32 . the extent of the phase shift 36 is a function of the time delay produced by the product of the r and c values . in another embodiment , a schmitt trigger oscillator is used to generate the waveforms and detect the phase shift . as shown in fig5 b , the resistive element r is connected between the output 39 and the input 41 of an inverting logic gate 40 having a hysteresis loop . this ensures that a change in state of the output 39 occurs only when the input 41 reaches a predetermined high - level threshold on the rising edge , and a predetermined low - level threshold on the trailing edge . trigger levels 44 are indicated by dashed lines on the waveforms taken at the input 41 . capacitor 42 represents the fixed capacitance and is connected from the input 41 to ground 43 . changes in the impedance value cause changes in the frequency of operation of the oscillator such that a long rc time constant results in a slower output frequency , as illustrated in waveform set 46 , while a short rc time constant results in a higher output frequency as per waveform set 48 . fig6 a shows a typical phase - locked loop ( pll ) circuit . a pll generally employs a voltage controlled oscillator ( vco ) 50 that is a square wave oscillator with a frequency that can be altered via a voltage level change applied to its input . a pll circuit also employs a phase comparator 52 that has two inputs , one of which is usually the vco output , the other being a reference waveform . the phase comparator 52 outputs a dc level that is proportional to the phase difference between its two inputs . this dc level is applied to the vco , which alters the frequency of oscillation until the phase difference is driven to some predetermined value , usually ninety degrees . pll circuits are available as low power single - chip integrated circuits , which are suitable for use with a borehole probe . in the example shown in fig6 a , the vco 50 generates a frequency that is an exact multiple of the 60 hz ac supply , i . e . 600 hz in this example . the vco output is applied to a divide - by - ten counter chip 54 to produce an output that is approximately 60 hz . the phase comparator 52 receives the output signal of the counter chip 54 and a low voltage signal derived from the 60 hz ac supply . a dc level is generated at the output of the phase comparator 52 to drive the vco frequency to be exactly 600 hz and hence phase - lock to the 60 hz supply . an oscilloscope display would show the two waveforms phase - locked and stationary , with ten periods of the vco corresponding to exactly one period of the ac supply . if the ac supply frequency drifts from the value of 60 hz for any reason , the vco generated frequency of 600 hz follows it precisely . fig6 b shows a pll in an embodiment of the present invention . the vco 50 drives the two - element rc circuit and the signal 56 at the junction 58 of the rc circuit is applied to a second logic gate ( not shown ) to generate a second square wave signal . the second square wave signal has the same frequency as the vco 50 , but with a phase lag that depends on the value of the rc combination . the vco output and the output of the second logic gate are input to the phase comparator 52 . if the rc product varies due to variations in electrical properties of the surrounding environment , then the phase difference seen by the phase comparator is altered and the phase comparator output has an altered dc level . this in turn alters the frequency of the vco 50 in such a way as to restore the phase difference between the two signals . this altered dc level is the signal that represents the changing resistivity / dielectric constant parameters of the borehole formation or surrounding environment . probes of the embodiments of fig3 and 4 have been constructed and tested to obtain resistivity measurements in a well - documented borehole . when compared to measurements obtained by conventional electrical techniques in the same borehole , the probes were found to display excellent reproducibility and close correlation . borehole resistivity logs were recorded in one of six geological survey of canada ( gsc ) test holes that were drilled in 1981 and intersect approximately 60 meters of sedimentary paleozoics overlying a crystalline basement . there is an unconformity at the interface that is characterized by altered granite basement rocks that form a highly conductive stratum . a number of geophysical parameters for these holes have been extensively documented , both by analysis of the cores and from instrumental measurements recorded using a variety of different borehole probes . for example , reference logs have been made of the resistivity using both the galvanic technique and the timofeev capacitive probe . fig7 shows borehole resistivity logs where ( a ) is a 40 cm normal array galvanic resistivity log ; ( b ) is a log recorded with the fluid - filled borehole array ics probe lowered down the hole ; ( c ) is a log recorded with the six - rod fluid - filled borehole array ics probe pulled up the hole ; and ( d ) is a capacitive resistivity log recorded with the old timofeev probe . the correlation between the ics probe readings and the two reference logs is excellent and demonstrates the validity of the ics technique for the measurement of formation resistivity . fig8 shows a capacitive log recorded with the ics probe in a hole drilled near a landfill site and lined with plastic casing . each casing section is three meters long . it is notable that the joints in the plastic casing at three meter intervals are clearly visible on the log , confirming that the capacitive technique responds to changes in dielectric constant . superimposed on this casing response is a low wavelength signal reflecting a change in formation resistivity . fig9 is a schematic representation of the ics probe in the borehole formation for the embodiment of fig3 . in both the schematic of fig9 and that of fig4 , the formation is represented by an approximate electrical equivalence consisting of capacitive and resistive elements in parallel and denoted in both figures by c f and r f . the modus operandi of the circuit is also the same for both array configurations . the fixed capacitance between the active and grounded rods is denoted by c 0 . the distributed formation capacitance and resistance ( c f r f ) combine with c 0 and c s to form a reactive impedance that causes frequency variations . in practice , the resistive element dominates the response and if c f is disregarded , then a simplified analogous illustration is possible . consider the borehole wall as a conductive sheet with the formation resistance provided by surrounding material of resistivity , ρ . the conductive sheet has no effect if it is not grounded . if the conductive sheet is grounded , then it represents the maximum possible formation capacitance and a value of zero for ρ . if the ground is moved from the conductive sheet out into the surrounding material , the material becomes equivalent to a lumped resistance of some value r eq . when the conductive sheet is grounded and the probe is inserted into the borehole , the capacitance is at a maximum since the conductive sheet becomes an additional ground element in the array of rods . as the ground is moved out into the surrounding material or formation , the effective resistance increases and the frequency increases toward the value that is obtained in air with no conductive sheet , which is the same as with the sheet present but ungrounded . in reality , the frequency , f , is proportional to the equivalent resistivity , r eq . an analysis of the equivalent circuit of fig9 shows that the relation is non - linear and approximates the form : where k is an arbitrary constant . as shown in fig9 , an empirical calibration curve for a selected probe in a hole of a given diameter is constructed by plotting the frequency from a log made by the probe over as large a range as possible against the resistivity values obtained from a galvanic log taken in the same hole . the resulting calibration curve is then applicable to all logs taken in holes of the same diameter . the theory of equivalent resistance described above was validated experimentally by wrapping the shell housing ( 40 mm abs pipe ) of a test probe with adhesive aluminium foil to represent the smallest possible borehole diameter for this particular probe . the parallel rod array was inserted into the housing and , as expected , the frequency was not affected unless the foil was grounded , at which point the frequency dropped substantially . a selection of fixed resistor values were then inserted in turn between the ground and the foil and the frequencies were recorded for each value . fig1 shows a resulting plot of frequency versus equivalent resistance for resistor values up to 33 kω , illustrating the exponential nature of the relationship . in practice , this shows that higher values of formation resistivity will be recorded as less than their true values due to the non - linearity of the ics system response beyond about 8 kω . the relationship between r eq and the actual resistivity ρ can be quantified by noting that cylindrical symmetry makes this a two dimensional problem . considering a constant current i o generating a potential drop v ab between the conductive sheet at the borehole wall of radius a and another virtual cylinder in the formation of radius b , which is the effective limit of the penetration of the electric field generated by the probe and is thus the effective radius of investigation . the surface current density j at the borehole wall is given per unit length by : j a = i o 2 π a ( 1 ) the current density at a surface at some intermediate radius r between a and b is then : j r = i o 2 π r ( 2 ) δ v = ρ i o δ r 2 π r ( 3 ) the total potential drop from a to b is then given by : v ab = ρ i o 2 π r dr = ln ( b a ) ρ i o 2 π ( 4 ) the equivalent resistance r ab is by definition v ab / i o , which from ( 4 ) means that : r ab = ln ( b a ) ( ρ 2 π ) ( 5 ) b = a e ( 2 π r ab ρ ) ( 6 ) if the relationship between true resistivity and frequency has been established using the empirical procedure described previously , then the effective radius of investigation ‘ b ’ can be estimated . this is done by pairing values of equivalent resistance r eq taken from an experimental curve as in fig9 , with values of ρ for corresponding frequencies obtained in an empirical calibration against a galvanic log as described above . by substituting the values of r ab / ρ into equation ( 6 ), a regression line can then be applied to determine the best - fit value of ‘ b ’, the radius of investigation . if ρ is specified in ohm - meters , then ‘ a ’ and ‘ b ’ are specified in meters . in previously known measurement techniques , such as galvanic electrodes , receiving and transmitting coils and dual capacitors , physical separation of the excitation and measurement units imposes a distortion on the measurement . this distortion is always evident in the response of the system to a very thin vein or seam of material that contrasts with the remainder of the material . rather than recording a single spike corresponding to the thin vein , the system records a double event as the thin vein is encountered first by one system element and then by the other . the ics system is robust with minimal measurement distortion . the system records a single spike corresponding to a vein without recording a double spike . in addition , the system is simple to manufacture and requires minimal electronics . the borehole probe that was used to generate the test data employed parts and materials commonly found in a hardware store . for example , the electronics of one of the probes consists of only four 1970 &# 39 ; s vintage cmos integrated circuit logic elements mounted on a small circuit board , yet producing results comparable with much more expensive and sophisticated probe assemblies . the capability of the capacitive technique to respond to variations in dielectric constant makes it inherently a remote sensor for certain kinds of plastics , which could include plastic explosives such as land mines . a different configuration of the capacitive array is required for this application . instead of the cylindrical squirrel - cage array used for the borehole measurements , a planar version is employed . tests of such an arrangement have shown that objects such as 5 mm plastic polycarbonate sheets placed in proximity to the array are clearly detected , similar to the test illustrated in fig8 that clearly shows the casing joints every three meters . as an example of this use , a planar array version of the ics mounted beneath a raft could be used to detect land mines sown in rice paddy fields in shallow water . in that case the contrast between the dielectric constant of water ( 80 ) and that of the plastic explosives ( less than 2 ), enhances the detection capability , while the water environment has a fairly uniform resistivity , generating minimal interference in the signal . the present invention , due to its basic simplicity , is well suited to large - scale production . it has wide applications in fields such as mineral exploration , groundwater investigations and environmental monitoring . the technique of capacitive resistivity measurement has not been previously viable for borehole applications due to the cost and complexity of the equipment required , a problem which the ics system addresses . the technique of the present invention is clearly applicable to both surficial and borehole measurements . variations in the system will be appreciated by one skilled in the art . for example , the metal end caps can be recessed into the housing .
| 6 |
as used herein , the term “ pesticidally effective ” is used to indicate an amount or concentration of a pesticidal compound which is sufficient to reduce the number of pests in a geographical locus as compared to a corresponding geographical locus in the absence of the amount or concentration of the pesticidal compound . the term “ pesticidal ” is not intended to refer only to the ability to kill pests , such as insect pests , but also includes the ability to interfere with a pest &# 39 ; s life cycle in any way that results in an overall reduction in the pest population . for example , the term “ pesticidal ” includes inhibition of a pest from progressing from one form to a more mature form , e . g ., transition between various larval instars or transition from larva to pupa or pupa to adult . further , the term “ pesticidal ” is intended to encompass anti - pest activity during all phases of a pest &# 39 ; s life cycle ; thus , for example , the term includes larvacidal , ovicidal , and adulticidal activity . as used herein , the term “ alkyl ” ( e . g ., alkyl , alkylxcarboxy , alkylphenyl , etc .) refers to a straight or branched chain hydrocarbon having from one to twelve carbon atoms , optionally substituted with substituents selected from the group which includes lower alkyl , lower alkoxy , lower alkylsulfanyl , lower alkylsulfenyl , lower alkylsulfonyl , oxo , hydroxy , mercapto , amino optionally substituted by alkyl , carboxy , carbamoyl optionally substituted by alkyl , aminosulfonyl optionally substituted by a substituent selected from the group including alkyl , nitro , cyano , halogen and lower perfluoroalkyl , multiple degrees of substitution being allowed . examples of “ alkyl ” as used herein include , but are not limited to , n - butyl , n - pentyl , isobutyl , isopropyl and the like . loweralkyl is preferred . the term “ loweralkyl ” as used herein means linear or branched c 1 to c 4 alkyl , preferably methyl , ethyl or propyl . the term “ loweralkoxy ” as used herein means linear or branched c 1 to c 4 alkoxy , preferably methoxy , ethoxy , or propoxy . the term “ halo ” as used herein means halogen , preferably fluoro , chloro , bromo or iodo , most preferably fluoro . certain of the compounds as described contain one or more chiral , or asymmetric , centers and are therefore be capable of existing as optical isomers that are either dextrorotatory or levorotatory . the invention includes the respective dextrorotatory or levorotatory pure preparations , as well as mixtures ( racemic or enantiomerically enriched mixtures ) thereof . a first group of compounds of the present invention are compounds of formula ia and ib below : r 2 , r 3 , r 4 , r 5 , and r 6 are each independently selected from the group consisting of h , halogen , hydroxyl , alkyl , alkylhydroxy , alkoxy , or phenyl ; or a pair of r 2 and r 3 , r 3 and r 4 , r 4 and r 5 , and r 5 and r 6 together are —( ch ) 4 — to form a naphthyl group ; r 7 is h , alkyl , phenyl , alkylphenyl , or alkylcarboxy ; and subject to the proviso that at least one of r 7 and r 8 is carboxy or alkylcarboxy ; and subject to the proviso that when r 1 is — nh 2 , then one of r or r 8 is not carboxy or alkylcarboxy . additional compounds of the present invention are compounds of formula iia and iib below : r 2 , r 3 , r 4 , r 5 , and r 6 are each independently selected from the group consisting of h , halogen , hydroxyl , alkyl , alkylhydroxy , alkoxy , or phenyl ; or a pair of r 2 and r 3 , r 3 and r 4 , r 4 and r 5 , and r 5 and r 6 together are —( ch ) 4 — to form a naphthyl group ; and specific examples of compounds of formula iia and iib include , but are not limited to , the following : compounds as described herein may be prepared by techniques known to those skilled in the art taken together with the information provided in the examples set forth herein . a further aspect of the subject invention are addition salts , complexes , or prodrugs such as esters of the compounds described herein , especially the nontoxic pharmaceutically or agriculturally acceptable acid addition salts . the acid addition salts can be prepared using standard procedures in a suitable solvent from the parent compound and an excess of an acid , such as hydrochloric , hydrobromic , sulfuric , phosphoric , acetic , maleic , succinic , ethanedisulfonic or methanesulfonic acids . esterification to form derivatives such as the methyl or ethyl esters , can also be performed using standard procedures . tartarate salts can be prepared in accordance with standard procedures . also , derivation of the pesticidal compounds with long chain hydrocarbons will facilitate passage through the cuticle into the pest body cavity . therefore , in a further embodiment , the subject invention provides compositions comprising the pesticidal compounds bound to lipids or other carriers . the subject invention concerns novel pest control compounds and methods for using such compounds . specifically exemplified are novel pesticidal compounds , compositions comprising said pesticidal compounds and the use of such pesticidal compounds and compositions in controlling pests , particularly insect pests such as mosquitoes preferably , the subject compounds have an ld 50 against mosquito larvae of less than 3 . 0 μmole / ml . more preferably , the compounds have an ld 50 of less than 2 . 0 μmole / ml , and , most preferably , the compounds have an ld 50 of less than 1 . 0 μmole / ml . as used herein , “ ld 50 ” refers to a lethal dose of a peptide able to cause 50 % mortality of larvae maintained on a diet of 1 mg / ml autoclaved yeast supplemented with the pesticidal polypeptide . control of pests using the pest control compounds of the subject invention can be accomplished by a variety of methods known to those skilled in the art . the plant pests that can be controlled by the compounds of the subject invention include pests belonging to the orders coleoptera , lepidopterans , hemiptera and thysanoptera . these pests all belong to the phylum arthropod . other pests that can be controlled according to the subject invention include members of the orders diptera , siphonaptera , hymenoptera and phthiraptera . other pests that can be controlled by the compounds of the subject invention include those in the family arachnida , such as ticks , mites and spiders . the use of the compounds of the subject invention to control pests can be accomplished readily by those skilled in the art having the benefit of the instant disclosure . for example , the compounds may be encapsulated , incorporated in a granular form , solubilized in water or other appropriate solvent , powdered , and included into any appropriate formulation for direct application to the pest or to a pest inhabited locus . formulated bait granules containing an attractant and the pesticidal compounds of the present invention can be applied to a pest - inhabited locus , such as to the soil . formulated product can also be applied as a seed - coating or root treatment or total plant treatment at later stages of the crop cycle . plant and soil treatments may be employed as wettable powders , granules or dusts , by mixing with various inert materials , such as inorganic minerals ( phyllosilicates , carbonates , sulfates , phosphates , and the like ) or botanical materials ( powdered corncobs , rice hulls , walnut shells , and the like ). the formulations may include spreader - sticker adjuvants , stabilizing agents , other pesticidal additives , or surfactants . liquid formulations may be aqueous - based or non - aqueous ( i . e ., organic solvents ), or combinations thereof , and may be employed as foams , gels , suspensions , emulsions , microemulsions or emulsifiable concentrates or the like . the ingredients may include theological agents , surfactants , emulsifiers , dispersants or polymers . as would be appreciated by a person skilled in the art , the pesticidal concentration will vary widely depending upon the nature of the particular formulation , particularly whether it is a concentrate or to be used directly . the pesticidal compound will be present in the composition by at least about 0 . 0001 % by weight and may be 99 or 100 % by weight of the total composition . the pesticidal carrier may be from 0 . 1 % to 99 . 9999 % by weight of the total composition . the dry formulations will have from about 0 . 0001 - 95 % by weight of the pesticide while the liquid formulations will generally be from about 0 . 0001 - 60 % by weight of the solids in the liquid phase . these formulations will be administered at about 50 mg ( liquid or dry ) to 1 kg or more per hectare . the formulations can be applied to the pest or the environment of the pest , e . g ., soil and foliage , by spraying , dusting , sprinkling or the like . the pest control compounds may also be provided in tablets , pellets , briquettes , bricks , blocks and the like which are formulated to float , maintain a specified depth or sink as desired . in one embodiment the formulations , according to the present invention , are formulated to float on the surface of an aqueous medium ; in another embodiment they are formulated to maintain a depth of 0 to 2 feet in an aqueous medium ; in yet another embodiment the formulations are formulated to sink in an aqueous : environment . the pesticidal compounds of the present invention may be used advantageously to control an insect population of a specific geographical area . the specific geographical area can be as large as a state or a county and is preferably ½ to 10 square miles , more preferably one square mile , and more preferably ½ to one square miles , and may also be much smaller , such as 100 - 200 square yards , or may simply include the environment surrounding and / or inside an ordinary building , such as a barn or house . in general , the pesticidal compounds or compositions containing one or more of the pesticidal compounds are introduced to an area of infestation . for example , the composition can be sprayed on as a wet or dry composition on the surface of organic material infested with a target pest , or organic material or habitat susceptible to infestation with a target pest . alternately , the composition can be applied wet or dry to an area of infestation where it can come into contact with the target pest . the pesticidal compound may also be applied to an area of larvae development , for example , an agricultural area or a body of water such as a pond , rice paddy , watering hole or even a small puddle . in one aspect of the invention , a target pest population is exposed to a pesticidally effective amount of a pesticidal compound to decrease or eliminate the population of that pest in an area . the method of introduction of the pesticidal compound into the target pest can be by direct ingestion by the target pest from a trap , or by feeding of a target pest on nutrient - providing organic matter treated with the pesticidal compound , ( e . g ., killed yeast or algae in the case of mosquito larvae ). for some applications it will be advantageous to deliver the pesticidal composition to the location of the pest colony . in other applications , it will be preferable to apply the pesticidal composition to a prey or host of the pest , such as a human or other animal . amounts and locations for application of the pesticidal compounds and compositions of the present invention are generally determined by the habits of the insect pest , the lifecycle stage at which the pest is to be attacked , the site where the application is to be made and the physical and functional characteristics of the compound . the pesticidal compounds of the present invention are generally administered to the insect by oral ingestion , but may also be administered by means which permit penetration through the cuticle or penetration of the insect respiratory system . the pesticide may be absorbed by the pest , particularly where the composition provides for uptake by the outer tissues of the pest , particularly a larval or other pre - adult form of the pest , such as a detergent composition . where the pesticidal compounds are formulated to be orally administered to the insect pests , the compounds can be administered alone or in association with an insect food . the compounds are preferably so associated with the food that it is not possible for the insect to feed on the food without ingesting the pesticidal compound . preferred foods for mosquito larvae are algae ( particularly green , unicellular ) and yeast . the food may comprise live organisms or killed organisms . in one embodiment for the control of plant pests , plants or other food organisms may be genetically transformed to express the pesticidal compound such that a pest feeding upon the plant or other food organism will ingest the pesticidal compound and thereby be controlled . the pesticidal compound may also be mixed with an attractant to form a bait that will be sought out by the pest . further , the pesticidal compound may be applied as a systemic poison that is absorbed and distributed through the tissues of a plant or animal host , such that an insect feeding thereon will obtain an insecticidally effective dose of the pesticidal compound . the compounds according to the present invention may be employed alone or in mixtures with one another and / or with such solid and / or liquid dispersible carrier vehicles as described herein or as otherwise known in the art , and / or with other known compatible active agents , including , for example , insecticides , acaricides , rodenticides , fungicides , bactericides , nematocides , herbicides , fertilizers , growth - regulating agents , etc ., if desired , in the form of particular dosage preparations for specific application made therefrom , such as solutions , emulsions , suspensions , powders , pastes , and granules as described herein or as otherwise known in the art which are thus ready for use . for example , a dosage form for a pond environment may be provided in the form of time releasable bricks , briquettes , pellets , powders , liquids , and the like , comprising at least one pesticidal compound according to the present invention and at least one other active ingredient selected from the group consisting of insecticides , acaricides , rodenticides , fungicides , bactericides , nematocides , herbicides , fertilizers , and growth - regulating agents , for administration to the pond . the pesticidal compounds may be administered with other insect control chemicals , for example , the compositions of the invention may employ various chemicals designed to affect insect behavior , such as attractants and / or repellents , or as otherwise known in the art . the pesticidal compounds may also be administered with chemosterilants . the pesticidal compounds are suitably applied by any method known in the art including , for example , spraying , pouring , dipping , in the form of concentrated liquids , solutions , suspensions , sprays , powders , pellets , briquettes , bricks and the like , formulated to deliver a pesticidally effective concentration of the pesticidal compound . the pesticidal formulations may be applied in a pesticidally effective amount to an area of pest infestation or an area susceptible to infestation , a body of water or container , a barn , a carpet , pet bedding , an animal , clothing , skin , and the like . formulated pesticidal compounds can also be applied as a seed - coating or root treatment or total plant treatment at later stages of the crop cycle . plant and soil treatments may be employed as wettable powders , granules or dusts , by mixing with various inert materials , such as inorganic minerals ( phyllosilicates , carbonates , sulfates , phosphates , and the like ) or botanical materials ( powdered corncobs , rice hulls , walnut shells , and the like ). such formulations suitably include spreader - sticker adjuvants , stabilizing agents , other pesticidal additives , or surfactants . liquid formulations may be aqueous - based or non - aqueous and employed as foams , gels , suspensions , emulsifiable concentrates , or the like . the pesticidal compounds and compositions of the present invention can be delivered to the environment using a variety of devices known in the art of pesticide administration ; particularly preferred devices are those which permit continuous extended or pulsed extended delivery of the pesticidal composition . for example , u . s . pat . no . 5 , 417 , 682 discloses a fluid - imbibing dispensing device for the immediate , or almost immediate , and extended delivery of an active agent over a prolonged period of time together with the initially delayed pulse delivery of an active agent to a fluid environment of use . other dispensing means useful for dispensing the pesticidal compositions of the present invention include , for example , osmotic dispensing devices which employ an expansion means to deliver an agent to an environment of use over a period of hours , weeks , days or months . the expansion means absorbs liquid , expands , and acts to drive out beneficial agent composition from the interior of the device in a controlled , usually constant manner . an osmotic expansion device can be used to controllably , usually relatively slowly and over a period of time , deliver the pesticidal compositions of the present invention . the osmotic expansion device may be designed to float on water and deliver the pesticidal compound to the surface of the water . the compositions of the present invention may also be employed as time - release compositions , particularly for applications to animals , or areas that are subject to reinfestation , such as mosquito - infested ponds or animal quarters . various time - release formulations are known in the art . common analytical chemical techniques are used to determine and optimize the rate of release to ensure the delivery of a pesticidally effective concentration of the pesticidal compound . the amount of the time - release composition necessary to achieve a pesticidally effective concentration of pesticide in the environment where the pesticide is applied , e . g ., a body of water , is based on the rate of release of the time - release formulation . in one aspect , the time - release formulations may be formulated to float on top of the water . in another aspect , the formulation may be formulated to rest on the bottom , or below the surface of the body of water , and to gradually release small particles which themselves float to the surface , thereby delivering the pesticidal composition to the niche of the pest , e . g ., mosquito larvae . delayed or continuous release can also be accomplished by coating the pesticidal compounds or a composition containing the pesticidal compound ( s ) with a dissolvable or bioerodable coating layer , such as gelatin , which coating dissolves or erodes in the environment of use , such as in a pond , to then make the pesticidal compound available , or by dispersing the compounds in a dissolvable or erodable matrix . such continuous release and / or dispensing means devices may be advantageously employed in a method of the present invention to consistently maintain a pesticidally effective concentration of one or more of the pesticidal compounds of the present invention in a specific pest habitat , such as a pond or other mosquito - producing body of water . the continuous release compositions are suitably formulated by means known in the art to float on a body of water , thereby delivering the pesticidal compound to the surface layer of the water inhabited by insect larvae . the following examples are illustrative of the practice of the present invention and should not be construed as limiting . all percentages are by weight and all solvent mixture proportions are by volume unless otherwise noted . the benzyl ester of ( s )- proline hydrochloride was combined with the n - tert - butylcarbamate mono - benzyl ester of ( s )- aspartic acid in methylene chloride . peptide coupling was affected by the addition of dicyclohexylcarbodiimide , n - hydroxybenzotriazole , and n - ethylmorpholine at 0 ° c . and then allowing the mixture to warm to room temperature . the coupled dipeptide was then subjected to trifluoroacetic acid to remove the tert - butylcarbamate protecting group . the amine trifluoroacetate salt was then combined with 3 - phenylpropionic acid , diisopropylethylamine , and bop (( benzotriazol - 1 - yloxy ) tris ( dimethylamino )- phosphonium hexafluorophosphate ) in methylene chloride at 0 ° c . the tripeptide derivative was obtained in 79 % yield . the benzyl esters were then cleaved by hydrogenolysis ( hydrogen at 1 atm using pd / c as catalyst ) in ethanol . the free diacid tripeptide , compound 1 , was obtained in 85 % yield . all new compounds were fully characterized by spectroscopic methods ( infrared and nuclear magnetic resonance ) and combustion analysis . the benzyl ester of ( s )- proline hydrochloride was combined with the n - tert - butylcarbamate mono - benzyl ester of ( s )- aspartic acid in methylene chloride . peptide coupling was affected by the addition of dicyclohexylcarbodiimide , n - hydroxybenzotriazole , and n - ethylmorpholine at 0 ° c ., and then allowing the reaction mixture to warm to room temperature . the coupled dipeptide was then subjected to trifluoroacetic acid to remove the tert - butylcarbamate protecting group . the amine trifluoroacetate salt was then combined with 3 -( 4 - hydroxyphenyl ) propionic acid , dicyclohexylcarbodiimide , n - hydroxybenzotriazole , and n - ethylmorpholine at 0 ° c ., and the reaction mixture was then allowed to warm to room temperature . the dipeptide amide dibenzyl ester was isolated in 60 % yield . the benzyl esters were then cleaved by hydrogenolysis ( hydrogen at 1 atm using pd / c as catalyst ) in ethanol . the free diacid dipeptide amide , compound 2 , was obtained in 74 % yield . all new compounds were fully characterized by spectroscopic methods ( infrared and nuclear magnetic resonance ) and combustion analysis . the benzyl ether derivative of ( s )- prolinol hydrochloride was combined with the n - tert - butylcarbamate mono - benzyl ester of ( s )- aspartic acid in methylene chloride . peptide coupling was affected by the addition of dicyclohexylcarbodiimide , n - hydroxybenzotriazole , and n - ethylmorpholine at 0 ° c ., and then allowing the reaction mixture to warm to room temperature . the coupled dipeptide was then subjected to trifluoroacetic acid to remove the tert - butylcarbamate protecting group . the trifluoroacetate salt was exchanged to a p - toluenesulfonate salt , and the sulfonate salt was then coupled to the o - benzyl ether n - tert - butylcarbamate derivative of ( s )- tyrosine using dicyclohexylcarbodiimide , n - hydroxybenzotriazole , and n - ethylmorpholine at 0 ° c . in tetrahydrofuran . the fully protected dipeptide amidederivative was obtained in 60 % yield after chromatography . deprotection of the tert - butylcarbamate was realized with trifluoroacetic acid , and the benzyl ether and benzyl esters were simultaneously removed by hydrogenolysis ( hydrogen at 1 atm using pd / c as catalyst ) in ethanol . the unprotected dipeptide amide , compound 3 , was obtained in 70 % yield . all new compounds were fully characterized by spectroscopic methods ( infrared and nuclear magnetic resonance ) and combustion analysis . pyrrolidine was combined with the n - tert - butylcarbamate mono - benzyl ester of ( s )- aspartic acid in methylene chloride . amide coupling was affected by the addition of dicyclohexylcarbodiimide , n - hydroxybenzotriazole , and n - ethylmorpholine at 0 ° c ., and then allowing the reaction mixture to warm to room temperature . the protected amino acid amide derivative was then subjected to trifluoroacetic acid to remove the tert - butylcarbamate protecting group . the trifluoroacetate salt was then coupled to the o - benzyl ether n - tert - butylcarbamate derivative of ( s )- tyrosine using dicyclohexylcarbodiimide , n - hydroxybenzotriazole , and n - ethylmorpholine at 0 ° c . in tetrahydrofuran . the fully protected dipeptide amide derivative was obtained in 54 % yield after chromatography . deprotection of the tert - butylcarbamate was realized with trifluoroacetic acid and the benzyl ether and benzyl ester were simultaneously removed by hydrogenolysis ( hydrogen at 1 atm using pd / c as catalyst ) in ethanol . the dipeptide amide , compound 4 , was obtained in 60 % yield . all new compounds were fully characterized by spectroscopic methods ( infrared and nuclear magnetic resonance ) and combustion analysis . the benzyl ester of ( s )- proline hydrochloride was combined with the n - tert - butylcarbamate mono - benzyl ester of ( r )- aspartic acid in methylene chloride . peptide coupling was affected by the addition of bop (( benzotriazol - 1 - yloxy ) tris ( dimethylamino )- phosphonium hexafluorophosphate ) and diisopropylethylamine at 0 ° c ., and then allowing the reaction mixture to warm to room temperature . the coupled dipeptide was then subjected to trifluoroacetic acid to remove the tert - butylcarbamate protecting group . the amine trifluoroacetate salt was then combined with 3 -( 4 - hydroxyphenyl ) propionic acid , diisopropylethylamine and bop (( benzotriazol - 1 - yloxy ) tris ( dimethylamino )- phosphonium hexafluorophosphate ) in methylene chloride at 0 ° c . the dipeptide amide derivative was obtained in 73 % overall yield . the benzyl esters were then cleaved by hydrogenolysis ( hydrogen at 1 atm using pd / c as catalyst ) in ethanol . the free diacid dipeptide amide , compound 5 , was obtained in 92 % yield . all new compounds were fully characterized by spectroscopic methods ( infrared and nuclear magnetic resonance ) and combustion analysis . pyrrolidine was combined with the n - tert - butylcarbamate mono - benzyl ester of ( s )- aspartic acid in methylene chloride . amide coupling was affected by the addition of dicyclohexylcarbodiimide , n - hydroxybenzotriazole , and n - ethylmorpholine at 0 ° c ., and then allowing the reaction mixture to warm to room temperature . the protected amino acid amide derivative was then subjected to trifluoroacetic acid to remove the tert - butylcarbamate protecting group . the trifluoroacetate salt was then coupled to 3 -( 4 - hydroxyphenyl ) propionic acid using diisopropylethylamine and bop (( benzotriazol - 1 - yloxy ) tris ( dimethylamino )- phosphonium hexafluorophosphate ) in methylene chloride at 0 ° c . the benzyl ester was then cleaved by hydrogenolysis ( hydrogen at 1 atm using pd / c as catalyst ) in ethanol . the free acid dipeptide amide , compound 6 , was obtained in 96 % yield . all new compounds were fully characterized by spectroscopic methods ( infrared and nuclear magnetic resonance ) and combustion analysis . dihydrocinnamic acid was combined with the hydrochloride salt of ethyl 3 - aminopropionate in the presence of dicyclohexylcarbodiimide , triethylamine , and a catalytic amount of 4 - n , n - dimethylaminopyridine in methylene chloride . the ester - amide intermediate was purified by chromatography and then subjected to saponification using sodium hydroxide in methanol / water at room temperature . the acid , compound 20 , was obtained in 77 % yield . all new compounds were fully characterized by spectroscopic methods ( infrared and nuclear magnetic resonance ) and combustion analysis . compound 21 was prepared in substantially the same fashion as compound 20 by substitution of 3 -( 4 - hydroxyphenyl ) propionic acid for dihydrocinnamic acid in the first step of the sequence . all new compounds were fully characterized by spectroscopic methods ( infrared and nuclear magnetic resonance ) and combustion analysis . compound 22 was prepared in substantially the same fashion as compound 20 by substitution of 3 -( 4 - methoxyphenyl ) propionic acid for dihydrocinnamic acid in the first step of the sequence . all new compounds were fully characterized by spectroscopic methods ( infrared and nuclear magnetic resonance ) and combustion analysis . 2 - phenylethyl amine was combined with succinic anhydride and triethylamine in tetrahydrofuran at room temperature . the reaction mixture was then subjected to an aqueous work - up and acidified to ph 3 using dilute aqueous hydrochloric acid . compound 23 was isolated in 65 % yield . all new compounds were fully characterized by spectroscopic methods ( infrared and nuclear magnetic resonance ) and combustion analysis . the foregoing is illustrative of the present invention , and is not to be construed as limiting thereof . the invention is defined by the following claims , with equivalents of the claims to be included therein .
| 2 |
a major disadvantage is associated with the use of fluorinated pyromellitates as soil and water repellents . the disadvantage is that fluorinated soil and water repellents are very expensive to produce . the high cost of production of fluorinated soil and water repellents is directly related to the high cost of fluorinated alcohol starting materials . therefore , the discovery of compounds that are inexpensive in comparison to the fluorinated compounds and which may be used as diluents for the fluorinated compounds would be advantageous . this would be true , of course , only if the mixtures formed by the addition of a diluent were found to impart soil and water repelling characteristics to fibers that parallel the soil and water repelling characteristics imparted to fibers treated with only fluorocarbon compounds . we have surprisingly discovered that hydrocarbon esters of pyromellitic dianhydride when used in admixture with partially fluorinated esters of pyromellitic dianhydride disclosed in u . s . pat . no . 4 , 209 , 610 ( mares et al ., 1980 ) result in a mixture that imparts soil and oil repelling characteristics to fibers that parallel soil and oil repelling characteristics imparted to fibers containing only the compounds of u . s . pat . no . 4 , 209 , 610 . this finding was most unexpected as our own experimental work had demonstrated that the use of hydrocarbon esters of pyromellitic dianhydride by themselves did not impart soil and oil repelling characteristics to fibers . furthermore , this discovery was additionally unexpected due to the fact our experimental work had also demonstrated that compounds prepared by reacting pyromellitic dianhydride with a mixture of fluorocarbon and hydrocarbon alcohols also did not impart equivalent soil and oil repelling characteristics to fibers . the novel hydrocarbon compounds of the present invention are represented by the general structure ## str3 ## or mixtures thereof wherein b is coochohch 2 q where q is cl , oh , h , or br and d is cow ( ch 2 ) n ch 3 , with w being -- o --, -- nh --, -- s -- or -- n ( ch 3 )--, and n is an integer from 2 to 24 . in the preferred embodiments of this invention q in the above formula is cl , w is 0 , and n is 1 to 6 . another embodiment of this invention is the use of the above - described pyromellitates alone where n is 14 to 20 as water repelling agents . in the preferred embodiment of this aspect of the invention , n is 17 . the longer chain hydrocarbon pyromellitates are extremely hydrophobic and are very desirable water repelling compounds . the use of these compounds as water repelling agents is illustrated in example 4 of this application . the above - described hydrocarbon esters may be synthesized in general by initially reacting an alkanol with pyromellitic dianhydride to form an intermediate diester - diacid . this intermediate is then reacted with an epoxide containing radical to synthesize the desired hydrocarbon ester compound . the procedure for synthesizing the compounds of this invention is essentially the same as that described in u . s . pat . no . 4 , 209 , 610 for the compounds disclosed by that patent , except that instead of using fluorinated alcohols and fluorinated amines , the compounds of this invention require saturated hydrocarbon alcohols and saturated hydrocarbon amines . in the preferred embodiments of this invention the novel hydrocarbon esters of pyromellitic dianhydride are combined with the partially fluorinated esters of pyromellitic dianhydride disclosed in u . s . pat . no . 4 , 209 , 610 to form mixtures of the described esters . the mixtures are formed by simply dissolving the esters in a common solvent to form a homogeneous solution . suitable solvents for forming the solutions include chloroform , dioxane , acetone , and other similar solvents . the fluorinated esters of pyromellitic dianhydride useful for the practice of this invention have the general structure ## str4 ## or mixtures thereof wherein a is cowx ( cf 2 ) p cf 3 with w being -- o --, -- nh --, -- s -- or -- n ( ch 3 )--; wherein x is alkylene of 1 - 6 carbons and p is from 3 to 15 with b being of the formula cooch 2 chohch 2 q ; wherein q is cl , oh , h , or br . the preferred fluorinated pyromellitates for the practice of this invention are those derived from fluorinated hydrocarbyl ethanols represented by the formula cf 3 ( cf 2 ) p ch 2 ch 2 o -- where p is a commercial mixture of 3 - 15 , but is preferably 3 - 13 . slightly less preferred are those derived from fluorinated hydrocarbyl propanols and from fluorinated hydrocarbyl butanols . substituents a with alkylenes of 1 - 6 carbons other than 1 , 2 - ethylene , 1 , 2 - propylene or 1 - 4 - butylene may also be used , but are less preferred . the novel mixtures of the present invention comprise between about 20 and 50 weight percent of the non - fluorinated ester of pyromellitic dianhydride , and between about 50 and 80 weight percent of the fluorinated ester of pyromellitic dianhydride . in the preferred embodiments of this invention the novel compositions contain between about 30 and 35 weight percent of the non - fluorinated ester of pyromellitic dianhydride and between about 65 and 70 weight percent of the fluorinated ester of pyromellitic dianhydride . the mixtures of the present invention may be incorporated into nylon and polyethylene terephthalate fibrers according to the procedure described in u . s . pat . no . 4 , 209 , 610 . in general , incorporation of the compositions into such fibers is accomplished by contacting such fibers with a liquid emulsion , dispersion or solution which contains a composition as described above , and thereafter usually heating this fiber sufficiently to develop water and oil repellency thereof which is retained at least in substantial part after five standard dry cleaning cycles and after five standard home laundering cycles . into a dry one liter round bottom flask fitted with a thermometer , stirring bar , water cooled condenser , dropping funnel and a bleed of dry nitrogen to maintain an anhydrous atmosphere , was added pyromellitic dianhydride ( 81 . 3 g , 0 . 373 mol ) and dry 1 - methyl - 2 - pyrrolidone ( 75 ml ). 1 - hexanol ( 76 . 2 g , 0 . 746 mol ) was added over about 20 minutes and the exothermic reaction was not allowed to go above 54 ° c . the reaction mixture was then stirred under nitrogen at a constant temperature of 45 ° c . for 22 hours to insure complete reaction . triethyl amine ( 3 . 1 ml ) was added as catalyst , the temperature was raised to 55 ° c . and epichlorohydrin ( 175 ml , 2 . 24 mol ) was added via a dropping funnel over 45 minutes . the reaction was monitored by following the disappearance of carboxyl groups by titration and was complete within 6 . 5 hours . the reaction mixture was cooled to room temperature and then poured into well agitated ice water ( 2500 ml ) and stirred for 30 minutes to extract water soluble material . the washing procedure was repeated once with fresh ice water and the product was then taken up in a mixture of dichloromethane ( 200 ml ) and dichloroethane ( 100 ml ). the solution was filtered and flash evaporated with the product ( 210 . 4 g , 0 . 304 mol ) being recovered as a very viscous red - brown liquid . the structure was confirmed by proton nmr . the procedure was essentially the same as that described in example 1 . the pyromellitic dianhydride ( 32 . 7 g , 0 . 15 mol ) in 1 - methyl - 2 - pyrrolidone ( 25 ml ) was reacted with ethanol ( 17 . 5 ml , 0 . 3 mol ) and the intermediate diester - diacid was further reacted with epichlorohydrin ( 70 . 34 ml , 0 . 9 mol ) and with triethylamine ( 1 . 25 ml ) as catalyst at 55 ° c . the reaction was complete in six hours and the product ( 64 . 9 g ) was recovered as before . the structure was confirmed by proton nmr . four solutions were prepared in acetone in order to determine the oil repellency of nylon - 6 tricot fabric that was treated with one of the four solutions . the first solution contained 0 . 1 % of the commercially available difluoroalkyl - dichlorohydrin tetraester of example 1 as disclosed in u . s . pat . no . 4 , 321 , 403 ( oxenider et al ., 1982 ) hereinafter referred to as dsr . the second solution contained 0 . 15 % dsr . the third solution contained 0 . 1 % dsr and 0 . 05 % of the product from example 2 of this application hereinafter referred to as h2dsr . the fourth solution contained 0 . 1 % dsr and 0 . 05 % of the product from example 1 of this application hereinafter referred to as h1dsr . four nylon swatches were each dipped in only one of the solutions , air dried for one hour , and then annealed in a circulating air oven at 120 ° c . for 0 . 5 hours . the initial oil repellency was determined by the standard aatcc oil droplet test , and again after subsequent laundering in an automatic washing machine and drying in an electric dryer . the fabric swatches were not ironed after drying . the results appear in table i . the oil repellency values in table 1 correspond to the rating values utilized for oil repellency by the american assocation of textile colorists and chemists . table i______________________________________ oil repellencies no . of cyclesadditive 0 1 2 3 4 5 6 7______________________________________ . 1 % dsr 7 7 7 6 5 2 . 15 % dsr 7 7 7 6 6 5 4 1 . 1 % dsr + . 05 % h2dsr 7 7 6 6 6 4 2 . 1 % dsr + . 05 % h1dsr 7 6 6 5 4 4 4 4______________________________________ to a dry 200 ml round bottom flask , n 2 atmosphere , was added pyromellitic dianhydride ( 10 . 9 g , 0 . 05 mol ), 1 - octadecanol ( 27 . 1 g , 0 . 1 mol ) and dmf ( 27 ml ). react at 45 ° c . for 22 hours . the reaction mixture had set up and was heated to 60 ° c . to liquify . epicholorhydrin ( 23 . 5 ml , 0 . 29 mol ) and triethylamine ( 0 . 42 ml ) were added and within 5 . 25 hours the reaction was completed . the reaction mixture was cooled to room temperature and poured into rapidly - agitated ice water ( 1200 ml ). the water was decanted and the precipitate was washed four additional times . the product was recovered by filtration and was dried under vacuum yielding 38 . 2 grams of a cream colored solid . the structure was confirmed by proton nmr . 0 . 5 % was coated on nylon 6 tricot fabric as previously described . there was no oil repellency by aatcc test . however , the aatcc water spray test indicated a water repellency that was somewhat stable to home laundering . the results appear in table ii . table ii______________________________________ cycles spray rating______________________________________ 0 90 1 90 2 80 3 70 4 50 5 0______________________________________
| 2 |
fig1 shows a system for the implementation of the invention , wherein a computer 101 is connected to a printer 102 by means of a series or parallel link 103 . this printer is provided with a cartridge 104 that takes the place of a normal font cartridge but enables the printing , upon a command from the computer , of legitimate franking marks . this cartridge is preferably of the pcmcia type meeting the iso 7816 standard . the cartridge 104 , in its memory , has the statutory franking marks which are memorized in the format expected by the printer , namely for example a pixel matrix format called a &# 34 ; rasterized &# 34 ; format or a bezier curve format called a &# 34 ; vectorized &# 34 ; format . as we have seen further above , this does not entail any difficulty per se . to obtain , on the contrary , the necessary security and prevent the fraudulently reconstituted or misused image of these marks from being borrowed in another freely accessible cartridge , the cartridge comprises a security system that associates an additional original security mark with each franking mark , when this franking mark is called up by the printer to be printed , the additional original security mark being associated with this franking mark and with this franking mark alone . this security mark could then be recognized by the post office provided with appropriate reading systems and it will authenticate the franking mark . this security mark may be formed by any desired type of graphics . the preferred exemplary embodiment of the invention proposes the use , as the simplest variant , of a bar code representing a series of numbers and / or characters whose decoding will authenticate the franking mark . the association between the franking mark and the security mark will be done according to a cryptographic system whose key will be known only to the post office and could be , for example , the key described in the patent application filed by the present applicant under ser . no . 91 / 11275 published on 19 mar . 1993 under u . s . pat . no . 2 , 681 , 490 . in view of the very small size of the cartridge and of its use in a standard printer , it is quite desirable to secure its utilization in order to reserve its use for the legitimate holder . for this purpose , one embodiment given by way of an illustration proposes the use of a system of security access such as the one described in the patent application filed by the present applicant under ser . no . 92 / 00321 . thus , when the cartridge is inserted into the printer , it will be able to deliver the franking marks and the corresponding security marks only after the entering of a secret code number known only to the legitimate user . the cartridge will therefore use circuits of an already known type enabling the implementation of these security systems . it will furthermore comprise the devices , which are themselves known , that enable it to be shielded from physical tampering wherein , for example , it would be opened with a view to the reconstituting of the contents of the memories and the specialized protection integrated circuits . the security mark will therefore comprise , in an encrypted form , all the particulars needed for identifying the cartridge and hence its possessor , i . e . essentially an identification number . it could furthermore comprise particulars pertaining to date and time enabling the subsequently used checking devices to compare the date and the time that may be printed on the franking mark so as to detect any attempts at fraud in a relatively simple way . these particulars could be obtained in the cartridge in this case by means of a clock saved by a long - life battery , according to a known method . this clock could then be used to restrict the duration of use of the cartridge , for example in the case of a fixed - price and fixed - period franking contract or , to oblige the user of the cartridge to have it checked at regular intervals . the latter point will be especially useful for the more frequent case where the cartridge has a counter that increments the fee units as and when it is used , as this counter will have to be read by the post office so that the user can be invoiced . in an ordinary printer , when a font of characters is loaded into the central memory of the printer from the cartridge , the printer makes routine use of the font thus stored until it receives an instruction ordering it to reload another font . naturally , in the case of the use of the printer to frank an envelope and if this payment of the franking is done per unit , it is necessary to reload the font at each printing of the franking mark and of its associated security mark since the latter has to be unique . it is then upon reception of this reloading command that the counter contained in the cartridge , when the payment is done per unit , will get incremented . for this purpose , the most practical method is to make provision , in the franking printer software contained in the computer connected to the printer , for an instruction that enforces this reloading of a cartridge . this software , which is itself very simple , will preferably be supplied by the postal authority along with the cartridge . since most users are trustworthy and are not very well informed about computers , the possibilities of fraud wherein action will be taken in this program to remove this instruction will be very limited . the deterrence of fraudulent individuals if any will take place at the central postal authority level during the checking of the security marks , when two or more security marks are detected whereas there should be only one of them . fig2 shows a block diagram of an exemplary embodiment of the electronic circuits forming a cartridge such as this . in a package 104 , terminated on one side by a connector 201 , there is assembled a set of memory circuits 202 storing the fonts and fixed data elements such as the identification numbers , and capable of storing variable data elements such as the number of fee units consumed since the cartridge was put into operation . these memories are connected to the connector 201 by an interface circuit 203 that , in particular , enables the decoding of the commands and addresses coming from the printer through the connector 201 , according to a hardware and software interface that will depend on the printer and will preferably follow the pcmcia standard . the link between this interface circuit and the memories will be parallel - connected to a security circuit 204 of a known type as referred to here above , which is furthermore connected to the memories 202 . this circuit will carry out a detection , on the link between the interface circuit and the memories , of the signals ordering the reading of a franking font and , in this case , will implement the security procedure . if this security procedure is followed , it will compute the variable elements of the security mark and send them to the memories so that they are then read after the font corresponding to the franking mark . if the security procedure is not followed , it will block the reading of the memories both directly and by means of the interface circuit . as a variant , one embodiment given by way of an example also proposes a hardware approach to prevent these problems as shown in fig3 . as can be seen in this figure , the computer 101 is connected to the printer 102 not directly but by means of the franking cartridge 304 . for this purpose , this cartridge has connectors designed to be connected to external links . one of these connectors is designed to receive a link 303 coming from the computer 101 , of the series or parallel type as the case may be . the other connector is designed to receive a link 305 which is itself connected to the normal input of the printer 102 . this link 305 , here too , is a series or parallel link depending on the normal input connector of the printer . the cartridge 304 then has circuits enabling the detection of each request for the printing of a franking mark and then the transmission , on the link 305 , of a command for reloading a font of characters to the printer 102 . the printer control signals will , besides , be retransmitted from the link 303 to the link 305 so that the printer works normally . the only difference as compared with a direct link as in fig1 therefore consists , for the additional circuits of the cartridge 304 , in interrupting the link coming from the computer by sending it a &# 34 ; printer not ready &# 34 ; signal for the time during which the font is getting recharged . this is done very speedily by the connector which provides a direct link between the cartridge and the printer . during this stopping time , the cartridge first of all sends a font reloading signal to the printer through the link 305 . this gives rise to an incrementing of the counter of the cartridge . when the font is reloaded , the cartridge again sends the computer a &# 34 ; printer ready &# 34 ; signal and lets through the control signals from the link 303 to the link 305 . thus , for the computer , the link through the cartridge 304 is quite transparent , from both the logic and the electrical points of view . consequently , when the computer has to order the printer to print normal text , the action of the cartridge 304 is totally undetected since it comes into play only in detecting a command for the printing of a franking mark . it is even quite possible to make provision , in the cartridge 304 , for unprotected ordinary fonts that may be loaded directly as chosen by the user without the action of devices for protecting the franking fonts . although the different varieties of cartridges or printers are tending to get unified and , more especially , are tending to evolve towards the pcmcia standard , there still exists a large number of them . to then avert the need for the postal department to procure and handle large numbers of cartridges of different formats , one embodiment given by way of an illustration proposes , by way of a variant , to separate at least a part of the security elements in order to introduce them into a standardized packet for use by all . this packet could be , for example , of the pcmcia type or even more simply it could have the bank credit card format defined by the iso 7816 standard or possibly meeting the so - called etsi gsm plug - in standard . fig4 shows a block diagram of an exemplary embodiment of this variant comprising a cartridge 114 designed to be connected to the printer by a connector 401 and a standard ancillary card called a chip card 124 designed to be connected to the cartridge 114 by means of a connector 421 that gets connected to an external connector 411 of the cartridge ( in fact the form of these connectors which is well known is quite different from that of the figure ). in this variant , the security circuit 404 contained in the cartridge is a public type of circuit no . 1 , namely a circuit comprising keys that are accessible to everybody . it is connected to a security circuit no . 2 , referenced 414 , contained in the chip card 124 which , for its part , is a circuit reserved for the authority distributing the card . this circuit is secured by the usual systems so that it cannot be tampered with . this separation into two separate circuits , one having the public key and the other the secret key , is well known in the prior art . the chip card further comprises a memory 405 comprising in particular the credits allocated by the authority as well as , possibly , a number of other specific data elements such as , for example , the duration of use . consequently , only the detachable part corresponding to the chip card 124 has to be managed by the postal authority , which greatly facilitates its job . the individual user of the system for his part has to procure the cartridge 114 directly , for example from the manufacturer of the printer . as we have seen further above , the loading of the fonts between the cartridge and the memory of the printer is very speedy , as compared with the method , used sometimes , of the remote loading of fonts from the computer . by contrast , the computing of the security mark by the specialized security circuit may require a certain amount of time , given firstly the length of the computations needed to use a truly secured algorithm and , secondly , the time needed for the formation , from the codes thus obtained , of the pattern forming the security mark proper . however , as and when the numbers representing the pattern of the security mark emerge from the specialized security circuit , these numbers are stored and , with the franking mark , they form the full pattern which will subsequently be transmitted to the printer . thus , there is nothing to prevent the advance preparation of the next security mark and its storage in a second memory where it will be ready to be called up if need be , possibly as soon as the previous mark has been printed . for this purpose , in one variant of an embodiment of the invention shown in fig5 the memory of the cartridge is subdivided into two distinct arrays 212 and 222 that are accessible separately . the points of access to these arrays are managed by a memory array switch - over logic 501 that switches over after each printing of a franking mark and its associated security mark . this logic enables direct access by one of the arrays to the printer to print the franking mark with its security mark , and access by the other array to the security circuit to load the next security mark . at the end of the loading of the font contained in the memory called for a franking operation , the logic switches over and reverses the types of access to the two memory arrays . this variant is especially useful when , as is often the case for reasons of cost , one and the same printer is being shared among several computers . it is possible to envisage the use , as is common , of an automatic change - over switch whose output is connected either to the printer or to the cartridge according to one of the two variants corresponding to fig1 and 3 . however , by way of a variant and in order to enable discriminating among the rights of access of the different computers connected to the printer , one embodiment of the invention proposes the use of a structure similar to that shown in fig6 . in this structure , the franking system is divided into two parts , a cartridge 614 proper introduced into the ad - hoc location of the printer 102 and a franking pack 624 that is external to the printer and to the computers 611 , 621 and 631 that share this printer . the electronic circuits of the franking system will be distributed between the cartridge 614 and the pack 624 which has a sufficient number of connectors to be connected to the different computers . this variant uses the structure corresponding to the variant of fig3 where the commands for the printer go through the franking system . the pack 624 therefore has a link 603 with the cartridge 614 and a direct link 605 with the main input connector of the printer 102 . the distribution of the electronic circuits between the pack and the cartridge could be variable but , preferably , the main security circuits and circuits for the storage of variable data elements such as the utilisation credits will be left in the cartridge according to the variant of fig4 . in this way , the relations with the postal authority could be limited to the transportation of the cartridge 614 which , principle , will be more compact than the pack 624 . the loading of entitlement credits into the cartridge could be done according to a system of pre - payment as well as according to a system of post - payment . in a system of pre - payment , a franking entitlement , represented for example in the form of a monetary value , is loaded into the cartridge and , as and when the cartridge is used , the security circuit decrements the value of this entitlement credit . when this value reaches zero , the cartridge refuses to print . it is quite possible to provide for the possibility of consulting this value through the computer in order to make provision , sufficiently in advance , for the reloading of the entitlement credits . this loading could be done , for example , as a complement to the entitlement credits remaining in the cartridge so that there is no interruption in the middle of the job . in a system of post - payment , on the contrary , a counter is incremented as and when there are successive users of the cartridge and this counter is brought back to the issuing authority which reads the value therein and then issues an invoice . to prevent abuses , it is possible to make provision , in the post - payment system , for a ceiling beyond which the system shuts down , or for a limit date of use . in practice , the pre - payment and the post - payment systems correspond above all to different business operations on the part of the postal authority which may very well , in the case of post - payment , require a deposit which will in fact fulfil the same role as prior payment in the pre - payment system . the consultation by the authority of the counting memories of the cartridge as well as the loading of the different entitlement credits will be done according to different modalities of secured transaction which are well known , especially in the context of memory cards .
| 6 |
before describing the present invention and in order to further the understanding of the latter , a prior art variable reactance circuit will be described with reference to fig1 a and 1b . as shown on fig1 a , such prior art variable reactance circuit includes a constant current source 1 and a diode 2 connected in series between an operating voltage source + v cc and ground , a transistor 3 whose emitter electrode is grounded , a control voltage source 4 connected between the base electrode of transistor 3 and the anode electrode of diode 2 , and a capacitor 5 connected between the collector electrode of the transistor 3 and the anode of the diode 2 . further , as hereinafter described in detail , a suitable collector load 6 is connected between the collector electrode of transistor 3 and the operating voltage source + v cc . an equivalent to the variable reactance circuit of fig1 a can be as shown on fig1 b . if in the circuit of fig1 b , the current flowing from a signal source e in into a variable reactance circuit is i in ; the current flowing from the signal source e in through a capacitive reactance z c into an amplifier a is i i 1 ; the output current from the amplifier a is i 2 ; and the forward current gain of the amplifier a is β ; then the following relationships are established : ## equ1 ## accordingly , the total impedance z in of the circuit viewed from the signal source to the load is expressed as follows : ## equ2 ## one of the practical circuits which may change the current gain of the amplifier a is the circuit shown in fig1 a . if in the circuit of fig1 a , i s represents the saturation current of transistor 3 and diode 2 ; i out represents the collector current of transistor 3 ; and i in represents the current flowing into diode 2 ; then the following equations ( 2 ), ( 3 ) and ( 4 ) are obtained : ## equ3 ## from equations ( 3 ) and ( 4 ), the collector current i out of transistor 3 is expressed as follows : ## equ4 ## since β is expressed by the following equation ( 6 ) ## equ5 ## the following equation ( 7 ) is obtained by substituting equation ( 6 ) in equation ( 1 ). ## equ6 ## if the capacitance of the capacitor 5 is c o , the input impedance of transistor 3 , that is , the impedance of transistor 3 between its collector electrode and the ground , is expressed as follows : ## equ7 ## as may be apparent from equation ( 8 ), the input impedance z in can be varied by the control voltage e b and a variable capacitance can be obtained as the input impedance . however , with the variable reactance circuit shown in fig1 a , the signal current i in is supplied to transistor 3 from its collector , so that if the output impedance of the variable reactance circuit is not great , the signal current i in flows into the collector load 6 to lower the efficiency of the circuit as a capacitive reactance circuit . accordingly , the described prior art variable reactance circuit generally requires a large coil as the collector load 6 of transistor 3 , as shown on fig1 a , and hence it is not suited to be formed as an integrated circuit . further , in the variable reactance circuit of fig1 a , when the control voltage e b is zero ( e b = 0 ), β = 1 ; and when e b = ∞ β = 0 , or the variable range of β is 1 ˜ 0 and the input impedance z in expressed by equation ( 8 ) is determined by c o . further , if it is desired to obtain a large capacitance , the capacitance of capacitor 5 must be made great , which also makes it difficult to use integrated circuit techniques for forming the circuit . the prior art circuit also requires a relatively high dc voltage , and accordingly , it becomes difficult to directly connect the circuit to the next stage , such as , an oscillator or the like . the theoretical basis for circuits according to the present invention will now be described with reference to fig2 a . in the circuit shown on fig2 a , a transistor 7 has its emitter electrode grounded and its collector electrode connected with a load 8 . a reactance element 9 is connected between the collector and base electrodes of transistor 7 . in such a circuit , the input impedance z in &# 39 ; viewed from the base electrode of transistor 7 , or betweem such base electrode and the ground , is expressed in the following manner . more particularly , if the mutual conductance of transistor 7 is gm ; the impedance of load 8 is r l ; the reactance of reactance element 9 is z c &# 39 ;; the input voltage is e &# 39 ; in ; the output voltage taken is e &# 39 ; out ; the input current is i &# 39 ; 1 + i ; 40 2 ; and if the input impedance of transistor 7 is assumed to be sufficiently great , the following relationships are established : ## equ8 ## since the input impedance of transistor 7 is assumed to be sufficiently great , an equivalent to the circuit shown on fig2 a can be as shown on fig2 c . accordingly , the input impedance z &# 39 ; in of transistor 7 is expressed as follows : ## equ9 ## if the elements are selected to satisfy the condition z &# 39 ; c & gt ;& gt ; r l , equation ( 9 ) may be rewritten as follows : ## equ10 ## as will be apparent from equation ( 10 ), if the mutual conductance gm of transistor 7 is changed by the control signal , the reactance component which is varied in accordance with the control signal can be obtained as the input impedance z &# 39 ; in . a practical embodiment of the invention based upon the above theory will now be described with reference to fig3 in which reference numerals 7a and 7b indicate transistors which form a differential amplifier . the transistor 7a has a load resistor 10 connected to its collector electrode and a capacitor 11 as a reactance element connected between its collector and base electrodes , that is , capacitor 11 functions similarly to reactance 9 connected between the collector and base electrodes of transistor 7 on fig2 a . the emitter electrodes of transistors 7a and 7b are connected together to the collector electrode of a transistor 13 whose emitter electrode is grounded through a resistor 14 and whose base electrode is connected with a source 15 of a control signal which is superposed on a dc component provided by a source 15a . in fig3 the variable reactance circuit according to the invention is shown associated with an oscillator 17 which includes a transistor 16 . a ceramic vibrator 18 is connected to a feedback path between the emitter and base electrodes of transistor 16 , and the base electrode of transistor 16 is connected to the base electrode of transistor 7a . the base electrodes of transistor 7b and of transistors 7a and 16 are supplied with a dc bias through resistors 19 and 20 , respectively . the dc bias is produced by a transistor 22 whose base electrode is connected with a dc voltage source 21 and a resistor 23 connected between the emitter electrode of the transistor 22 and the ground . further , a capacitor 24 for decoupling is connected to the base electrode of transistor 7b . with the circuit shown on fig3 if the impedance value of load resistor 10 is r l ; and the reactance of capacitor 11 is z &# 39 ; c ; then the input impedance z &# 39 ; i of transistor 7a , as viewed from its base electrode , can be expressed by the following equation ( 11 ) which is similar to equation ( 10 ): ## equ11 ## if the current flowing through transistor 13 is i ; and the emitter resistance of each of transistors 7a and 7b is r e ; then the input impedance z &# 39 ; d of the differential amplifier constituted by transistors 7a and 7b is expressed as follows : in general , the emitter resistance r e of each of the transistors 7a and 7b which form the differential amplifier is expressed as follows : ## equ12 ## where k is the boltzmann &# 39 ; s constant ; t the absolute temperature ; and q is the electron charge . therefore , if equation ( 13 ) is substituted in equation ( 12 ), z &# 39 ; d is rewritten as follows : ## equ13 ## accordingly , if i b is the base current of transistor 7a , the output voltage e &# 39 ; out of transistor 7a is expressed as follows : ## equ14 ## since the term at the right - hand side of equation ( 15 ) must become equal to gm . r l . e &# 39 ; in , the mutual conductance gm of the differential amplifier is expressed as follows : ## equ15 ## if equation ( 16 ) is substituted in equation ( 11 ), the following equation ( 17 ) is obtained . ## equ16 ## in the embodiment of fig3 if the capacitance of capacitor 11 is c , the reactance z &# 39 ; c is (- j1 / wc ). as will be apparent from equation ( 18 ), z &# 39 ; i depends upon the factor - j or is a capacitive component . accordingly , the whole circuit within the block 25 shown in broken lines on fig3 can be considered equivalent to a variable capacitance c &# 39 ; which , as is shown in broken lines on fig3 is connected in parallel to the ceramic vibrator 18 of oscillator 17 . this variable capacitance c &# 39 ; is varied in proportion to the control current i , and hence the oscillation frequency of oscillator 17 may be varied in response to changes in the control current . fig4 shows another embodiment of this invention in which elements corresponding to those shown on fig6 are identified by the same reference numerals . in the circuit 25 &# 39 ; of fig4 an emitter - follower transistor 26 , having a current amplification factor β , is connected between capacitor 11 and the collector of transistor 7a as a buffer load , and the remainder of the circuit is substantially the same as that shown on fig3 . with the circuit 25 &# 39 ; of fig4 the equation corresponding to equation ( 9 ) is as follows : ## equ18 ## it will be seen that the above equation ( 19 ) is similar to equation ( 10 ), so that the term r l in equation ( 19 ) can be more reasonably neglected . when the variable reactance circuit 25 or 25 &# 39 ; according to the invention is connected to oscillator 17 , as on fig3 and the control signal source 15 is a modulating signal source , an fm modulated signal can be obtained at an output terminal t 1 connected to the collector electrode of transistor 16 . further , in a variable reactance circuit 25 &# 34 ; according to this invention as shown on fig5 and which may be otherwise similar to the circuit 25 described above with reference to fig3 a tank circuit 10 &# 34 ; may be used in place of the load resistor 10 on fig3 and 4 , or in addition to such load resistor . when such tank circuit 10 &# 34 ; is employed , it is selected to have its impedance variation in the direction opposed to the direction of impedance variation of the equivalent tank circuit contained in the ceramic vibrator 18 of oscillator 17 , that is , the impedance of tank circuit 10 &# 34 ; varies inversely in respect to the impedance of the equivalent tank circuit of oscillator 17 , so that the output of oscillator 17 will have a constant amplitude . therefore , when the variable reactance circuit 25 &# 34 ; is used with the oscillator 17 as an fm modulator , the fm modulated output has a constant amplitude and there is no need to provide a limiter therefor . further , if desired , in a variable reactance circuit according to this invention , a coil may be used as the reactance element in place of the capacitor 11 , for example , as indicated at 11 &# 34 ; on fig5 . although illustrative embodiments of the invention have been described in detail herein with reference to the accompanying drawings , it is to be understood that the invention is not limited to those precise embodiments , and that various changes and modifications may be effected therein by one skilled in the art without departing from the scope or spirit of the invention as defined in the appended claims .
| 7 |
referring initially to prior art fig1 , a cross sectional view shows a wellbore 11 having vertical section 11 a and horizontal section 11 b . wellbore 11 provides a flow path between the well surface and producing sand or reservoir 31 . tubing string 13 and slotted liner 15 are also shown in fig1 . the horizontal section 11 b of tubing string 13 includes a heel portion 13 a and an opposite toe portion 13 b . slotted liner 15 is a completion device lining horizontal section 11 b of wellbore 11 and is typically isolated by a lead seal 17 from vertical section 11 a of wellbore 11 . live steam is supplied via tubing string 13 and exits from toe portion 13 b at end 19 . the steam flow is as indicated by arrows 21 . direct impingement of live steam onto slotted liner 15 at the area numbered 23 can potentially cause erosion and collapse of the liner 15 , which is an undesirable condition . also , using this technique the steams &# 39 ; heat is concentrated near toe portion 13 b in areas 25 and 27 of reservoir 31 rather than along the length of slotted liner 15 . referring now to prior art fig2 , wellbore 29 has vertical section 29 a , which goes to the surface , and horizontal section 29 b that penetrates a long horizontal section of producing sand or reservoir 31 . slotted liner 37 lines horizontal section 29 b of wellbore 29 . tubing string 33 is run in from the surface and , on the lower end thereof is plugged off by plug 35 . the horizontal section 29 b of tubing string 33 includes a heel portion 33 a and an opposite toe portion 33 b . the length of tubing string 33 , prior to the plug 35 , is provided with spaced apart drilled holes 39 along its entire horizontal section between heel portion 33 a and toe portion 33 b . each drilled hole 39 is covered with a sacrificial impingement strap 41 . sacrificial impingement straps 41 are constructed of a carbon steel material and may be ceramic coated if desired . sacrificial impingement straps 41 are welded to tubing string 33 with an offset above each drilled hole 39 . a steam generator source ( not shown ) is located at the surface and provides an input of steam into tubing string 33 . the steam travels down tubing string 33 to its lower horizontal section 29 b where it exits via drilled holes 39 . as will be described , while steam can exit tubing string 33 between heel portion 33 a and toe portion 33 b , uniform mass distribution and latent heat is not achieved along horizontal section 29 b . referring to fig3 , a cross - section of a portion of tubing string 33 that is located within slotted liner 37 of fig2 is shown . sacrificial impingement straps 41 are not shown in fig3 . tubing string 33 includes inner surface 43 and outer surface 45 . a plurality of drilled holes 39 extend from inner surface 43 to outer surface 45 . each drilled hole 39 extends radially outward , substantially perpendicular to inner surface 43 . typically , drilled holes 39 are intermittently spaced between heel portion 33 a and toe portion 33 b of tubing string 33 for delivering steam to reservoir 31 . a two - phase fluid f , typically steam having vaporous water and liquid water droplets d , travel through tubing string 33 for delivery into oil sands or reservoir 31 . when two - phase fluid f is under low velocity conditions , such as less than 40 feet per second , the flow is stratified . in particular , gravity causes the liquid phase to travel along the bottom portion of the pipe . when superficial vapor and liquid velocities are both low , the interface between the liquid and vapor phases is smooth . as vapor velocities begin to increase , the interface becomes wavy . as the superficial liquid velocities increase , the flow tends to form in slugs or large waves of liquid ( short in duration ) separated by stratified wavy flow . at very high superficial flow velocities , the liquid forms a ring on the inner surface of the pipe wall and the vapor travels in the center of the pipe . at high superficial vapor velocities and steam qualities , the liquid becomes entrained in the vapor core such that the pipe is filled with vapor except for small droplets of liquid mist . liquid droplets d have higher densities and thus higher momentum than the vaporous water , which restricts the ability of liquid droplets d to change direction . when liquid droplets d traveling in the main flow of fluid f encounter a smaller vapor flow , or velocity profile , toward drilled holes 39 , liquid droplets d experience a drag force to change direction . however , the momentum of liquid droplets d opposes this change of direction , thereby resulting in less movement toward drilled holes 39 . in the embodiment shown in fig3 , the liquid droplets entrained in the vapor core must make sharp , radially outward turns with respect to the flow of fluid f for liquid droplets to enter drilled holes 39 for delivery into reservoir 31 . this results in the extracted steam having less liquid droplets d such that the quality of the steam delivered at the upstream portion of tubing string 33 is different from the steam delivered to the downstream portion of tubing string 33 . in particular , more liquid droplets will be delivered toward the downstream toe portion 33 a of tubing string 33 than to heel portion 33 b . such a phenomenon is known as “ phase splitting .” in fig4 - 8 , alternative tubing configurations are provided to counteract the phase splitting described above so that more uniform quality steam is delivered to reservoir 31 from both the upstream and downstream portions of the respective tubing strings . more particularly , fig4 - 8 each show a portion of tubing sub or string of tubing 111 disposed between the heel portion and the toe portion of the horizontal section of a wellbore . as will be described , steam generated at the surface is delivered to tubing 111 for a more uniform steam quality distribution along the horizontal section of a wellbore into reservoir 31 . referring to fig4 , tubing 111 includes a plurality of openings 117 extending from inner surface 113 to outer surface 115 . openings 117 include an opening formed on inner surface 113 that defines inlet 117 a , an opening formed on outer surface 115 that defines outlet 117 b , and passageway 117 c extending between inlet 117 a and outlet 117 b such that steam received by inlet 117 a is delivered to outlet 117 b . inlet 117 a is formed in the string of tubing axially closer to the heel portion than outlet 117 b . while openings 117 are illustrated as having about fifteen degree outward angles to the flow of fluid f , it should be understood that the optimum angle for openings 117 is the smallest angle allowed by machining tools . a plurality of openings 117 are preferably intermittently spaced along the length of tubing 111 . for example , openings 117 can be positioned every 100 to 500 feet along tubing 111 . in general , spacing of openings 117 will be dependent upon the particular reservoir characteristics . one skilled in the art will appreciate that isolation between a first group of openings 117 and a second group of openings 117 can be utilized . furthermore , conventional sand control mechanisms , such as a sand screen , can be placed adjacent to openings 117 . in one embodiment , tubing 111 ends near the heel portion and openings 117 are configured in the liner . openings 117 reduce the directional change necessary for liquid droplets to enter openings 117 , thereby making it easier for liquid droplets to exit tubing 111 . in particular , when steam is received by passageway 117 c an axial momentum of the steam is maintained . accordingly , the difference in steam quality delivered from the upstream portion of tubing 111 compared with the downstream portion of tubing 111 is reduced as more liquid droplets entrained in the vapor core are able to exit openings 117 . referring to fig5 , an alternative tubing configuration is provided to counteract the segregation of vapor and liquid in fluid f so that more uniform quality steam is delivered to reservoir 31 from both the upstream and downstream portions of the respective tubing strings . as shown in fig5 , tubing 111 includes mandrel portion or tubing sub 120 with a reduced cross - sectional flow area and a plurality of openings 117 extending from inner surface 113 to outer surface 115 . openings 117 include an opening formed on inner surface 113 that defines inlet 117 a , an opening formed on outer surface 115 that defines outlet 117 b , and passageway 117 c extending between inlet 117 a and outlet 117 b such that steam received by inlet 117 a is delivered to outlet 117 b . inlet 117 a and outlet 117 b are formed at substantially the same axial locations between the heel and the toe of the string of tubing . as with the embodiment in fig4 , a plurality of openings 117 are preferably intermittently spaced along the length of tubing 111 , with each opening 117 being associated with a tubing sub 120 . tubing sub 120 includes inwardly tapered surface 121 that extends between the portion of inner surface 113 having the normal diameter of tubing 111 and reduced diameter surface 123 , which is where openings 117 are located . inwardly tapered surface 121 is located upstream of openings 117 to condition the flow of fluid f . tubing sub 120 can also include outwardly tapered surface 125 that is positioned downstream of openings 117 , and that extends from reduced diameter surface 123 to the portion of inner surface 113 having the normal diameter of tubing 111 . the reduction in the diameter of tubing 111 at inwardly tapered surface 121 increases the velocity of fluid f , while the increase in diameter from outwardly tapered surface 125 reduces the velocity of fluid f . the continued variation of the velocity of fluid f along the length of tubing 111 induces mixing of liquid droplets d with the vaporous water prior to flowing toward openings 117 . mixing fluid f can help provide a more uniform steam quality being delivered along the length of tubing 111 . by way of example , if tubing 111 were a conventional string of 4 . 5 inch tubing , inner diameter 113 would be about 3 . 96 inches . the desired velocity change could be achieved when reduced diameter surface 123 is equivalent to the inner diameter of standard 2⅜ inch tubing , which is about 2 . 44 inches . preferably inwardly and outwardly tapered surfaces 121 , 125 are at about fifteen degree respective inclines or declines . referring to fig6 , an alternative tubing configuration is shown where tubing 111 includes openings 117 extending at an angle from inner surface 113 to outer surface 115 . openings 117 include an opening formed on inner surface 113 that defines inlet 117 a , an opening formed on outer surface 115 that defines outlet 117 b , and passageway 117 c extending between inlet 117 a and outlet 117 b such that steam received by inlet 117 a is delivered to outlet 117 b . inlet 117 a is formed in the string of tubing axially closer to the heel portion than outlet 117 b . in the embodiment , the diameter of inner surface 113 adjacent openings 117 is reduced , thereby making the thickness of tubing 111 immediately upstream and downstream of openings 117 thicker than in the embodiment shown in fig4 . similar to fig5 , tubing sub 120 includes inwardly extending tapered surface 121 that extends between the portion of inner surface 113 having the normal diameter of tubing 111 and reduced diameter surface 123 , which is where openings 117 are located . inwardly tapered surface 121 is located upstream of openings 117 to condition the flow of fluid f . outwardly tapered surface 125 is positioned downstream of openings 117 and extends from reduced diameter surface 123 to the portion of inner surface 113 having the normal diameter of tubing 111 . tubing sub 120 in fig7 is substantially the same as in fig5 and 6 except that openings 117 extend axially through tubing 111 from inwardly tapered surface 121 . openings 117 include an opening formed on inner surface 113 that defines inlet 117 a , an opening formed on outer surface 115 that defines outlet 117 b , and passageway 117 c extending between inlet 117 a and outlet 117 b such that steam received by inlet 117 a is delivered to outlet 117 b . inlet 117 a is formed in the string of tubing axially closer to the heel portion than outlet 117 b . preferably , openings 117 are as close to parallel with the axial flow of fluid f as possible with machining capabilities . locating openings 117 on inwardly tapered surface 121 allows liquid droplets to enter outlets 117 with minimal deviation from the path of liquid droplets d prior to encountering reduced diameter surface 123 . for example , the inwardly tapered surface 121 can be tapered about fifteen degrees from an axis of the tubing 111 and the inlet can be about parallel to the axis of the tubing 111 . as shown in fig7 , openings 117 extend axially to an annulus 129 formed radially outward of reduced diameter surface 123 . in particular , annulus 129 is formed in the outer surface 115 of the string of tubing and extends around the circumference thereof . however , in some embodiments annulus 129 is not present and openings 117 axially extend between inwardly tapered surface 121 and outer surface 115 . the embodiment shown in fig8 is substantially the same as fig7 except that nozzles 131 are positioned in annulus 129 to receive fluid from openings 117 . nozzles 131 can be sized to more precisely control the rate of steam delivery into reservoir 31 from each opening 117 along tubing 111 . examples of nozzles 131 include an orifice with a reduced cross - section or a venturi . additionally , because nozzles 131 are controlling the rate of steam delivery in this embodiment , openings 117 can be enlarged to enhance liquid droplet d capture to a predetermined amount . the uniform steam delivery described with respect to the above embodiments can prevent steam migration into the underlying water zone or into the upper desaturated portion of the reservoir . also by delivering the steam uniformly along the entire horizontal section of the producing zone penetrated by the horizontal section of the well , any potential damage to a production liner in this horizontal bore is reduced . furthermore , the above embodiments reduce phase splitting along the horizontal section of the wellbore , thus delivering a uniform steam quality and ensuring uniform latent heat to the reservoir . the performance of alternative tubing configurations can be illustrated through the use of a two - phase flow model . in particular , fluid typically flows as a film along the wall of the pipe and as droplets entrained in the vapor core . the liquid entrainment and film thickness in a flowing pipe can be determined using the two - phase flow model . liquid entrainment can be estimated by the percent of the total liquid on the circumference of the pipe wall that is traveling at significantly lower velocity . at high superficial vapor velocities the liquid on the circumference of the pipe wall becomes entrained in the vapor core resulting in the pipe being filled with vapor and small liquid droplets d . since gravitational effects in a horizontal section creates thicker films on the bottom , often the liquid thickness is also expressed in terms of a mean film thickness , which would represent the thickness of the film if evenly distributed over the entire inner circumference . in general , if more of the liquid is entrained in the vapor , a more representative sampling or extraction of two - phase flow will occur . a two - phase flow model for 4 . 5 inch diameter tubing with a pressure of 400 psig , a mass flow rate of 1200 barrels of steam per day , and a steam quality of seventy percent ( 70 %) was performed . the calculated liquid entrainment was twenty - six percent ( 26 %), the mean liquid film thickness was 0 . 037 inches , and the bottom liquid film thickness was 0 . 14 inches . when the tubing is reduced to 3 . 5 inches and the other flow conditions are kept the same , the liquid entrainment is ninety - six percent ( 96 %), the mean liquid film thickness is 0 . 003 inches , and the bottom liquid film thickness is 0 . 008 inches . the reduced cross - section increased the calculated entrained liquid from twenty - six percent ( 26 %) to ninety - six percent ( 96 %) and greatly reduced the liquid film to yield a more evenly and predictable extraction or distribution . as will be described below , the performance of alternative tubing configurations are compared to prior art tubing string distribution assemblies using a surface horizontal steam injection facility . the horizontal steam injection facility is capable of testing a wide range of full - sized downhole completion equipment , such as tubing and liner flow control devices , at the surface under controlled conditions . additional details of the surface horizontal steam injection facility can be found in s . p . e . paper # 132410 , titled , “ addressing horizontal steam injection completions challenges with chevron &# 39 ; s horizontal steam injection test facility .” the steam quality extracted from the various tubing configurations was measured for all possible combinations of three inlet pressures , two inlet steam qualities , six inlet rates and two pressure extraction ratios . the figures below show the difference between the steam quality extracted through the device &# 39 ; s exit and the steam quality flowing in the tubing as a function of the tubing superficial vapor velocity . fig9 shows steam quality results obtained using 4 . 5 inch tubing with four one - quarter inch holes drilled perpendicular from horizontal and phased 90 degrees around the circumference . this tubing device is similar to that shown in fig3 , where liquid droplets must make a sharp 90 degree turn with respect to the flow of fluid for the liquid droplets to enter the holes for delivery into the reservoir . the range of steam quality differences between the entrance and extraction of the device has a large variation of − 15 to + 15 steam quality units . fig1 shows steam quality results obtained using a 4 . 5 inch tubing with four one - quarter inch holes drilled perpendicular from horizontal and phased 90 degrees around the circumference of a reduced 2 ″ internal diameter . improvement in the steam quality difference can be observed with the holes positioned proximate to a reduced internal diameter compared to a device without a reduced cross - section ( fig9 )— particularly at velocities greater than 40 ft / sec where the steam quality difference is maintained within a smaller steam quality difference band (− 10 to + 5 ). as previously discussed , the reduced internal diameter varies the velocity of the steam along the length of tubing , thus inducing mixing of liquid droplets with the vaporous water prior to the steam exiting via the drilled holes . fig1 shows steam quality results obtained using 4 . 5 inch tubing with four one - quarter inch holes drilled at 15 degree angles from horizontal and phased 90 degrees around the circumference of a reduced 2 ″ internal diameter . the tubing configuration used to produce the results shown in fig1 is substantially the same as the tubing configuration used to produce the results shown in fig1 except that the drilled holes are now angled at 15 degrees from horizontal . the difference between the steam quality extracted through the angled holes and the steam quality flowing through the tubing is minimized for all tubing superficial vapor velocities . in particular , the steam quality over the entire velocity range yields a tighter steam quality difference band compared to the steam quality obtained using the four one - quarter inch holes drilled perpendicular from horizontal without a reduced internal diameter as shown in fig9 . while the invention has been shown in only some of its forms , it should be apparent to those skilled in the art that it is not so limited , but susceptible to various changes without departing from the scope of the invention . for example , tubing 111 for each of the embodiments shown in fig4 - 8 could be a tubing sub that is positioned between pairs of tubing rather than being integrated in the string of tubing itself .
| 4 |
while this invention is susceptible to embodiment in many different forms , there are shown in the drawings , and will be described herein in detail , specific embodiments thereof with the understanding that the present disclosure is to be considered as an exemplification of the principles of the invention and is not to be limited to the specific embodiments described . fig1 illustrates an incandescent halogen type bulb commonly available . the features of this bulb have been derived from the operating characteristics implicit in the operation of these type illumination devices : they operate at high temperatures ; they require an evacuated envelope separated from the hot filament ; they emit large quantities of infrared radiation experienced by the user as heat ; and they consume large quantities of electrical power . nonetheless these devices are in common usage and fixtures and appliances have been constructed to accommodate the form , fit , and function of these bulbs . this particular unit is a model mr - 16 . fig1 illustrates the incandescent halogen bulb and its essential components . these are a connector 101 that attaches to a standard source of electrical power which has a mating adapter ; an evacuated transparent capsule 102 containing the hot filament 105 ; an envelope 103 that acts as a shade and filter to allow infrared radiation to pass , while reflecting a portion of the desirable visible light to the objects below ; a transparent front cover 104 that allows the radiation to pass , while protecting the evacuated capsule 102 from breakage . in contrast to incandescent lights , leds consume less power , emit in a narrow beam , emit less heat , and can be formulated in a wide variety of colors both inside and outside the spectrum visible to humans . because of these implicit differences , the use of leds creates opportunities to add operation features to light bulbs , which heretofore were considered simple illumination devices . it is the object of this disclosure to enumerate unique features that will improve the usefulness of the lighting devices based on leds . fig2 illustrates the first embodiment of the current invention . this illuminating device is intended to have the same form fit and function as the incandescent illumination device of fig1 and as such has a similar electrical connector 201 and similarly shaped transparent or translucent envelope 202 . the envelope 202 will act to scatter light emitted from inside the envelope and be visible from the outside . as such , the envelope 202 can serve as a screen onto which are projected and displayed images , colors or other decorative or information - containing light either visible to humans or at shorter or longer wavelengths . the content of this information is formulated by circuitry contained on one or more circuit boards 206 contained within the envelope of the bulb 202 . this circuit 206 in its simplest form controls other illumination devices such as the leds 207 also located on the back of the circuit board 204 . another circuit 205 can be used to control high power leds 209 in an array 208 located on the opposite side for direct illumination of objects outside the envelope of the lighting device . however , this circuit or circuits may enable several useful features . these are : 1 . a timer to adjust the color and illumination level according to some preset or user - adjustable schedule . 2 . a photocell to turn on or off the light depending on the ambient light level and or a proximity sensor . 3 . a signaling function that communicates with other lights 4 . a switch that is user accessible that allows a switching of illumination characteristics such intensity , color , continuous or flashing illumination modes . also located on circuit board 204 is a power conditioning circuit 205 that regulates power to the high intensity leds 208 located on the underside of the board . this circuit adapts and controls the power available via the connector 201 and conducted to the board via wires 203 . the circuit 205 may contain storage features including a battery to enable the lighting device to act as an emergency light source in the event of a power failure . the circuit may rectify ac power to dc to suit the desired current and voltage required by the series and / or parallel array of leds and provide power to other on - board circuitry . in this embodiment , the leds 207 on the backside of the pc board 204 can serve the function of communication and or decoration . for decorative purposes , the shade 202 will be made of a colored or white transparent or preferably translucent material such as plastic or glass which is textured so as to scatter light . in this manner light from the leds 207 impinge on this surface and are made more visible to the user , and can serve the function of decoration . the shade 202 may also contain penetrations 210 to allow heat to exit the led enclosure . fig3 illustrates a similar incandescent replacement product . this product also contains an electrical connector 301 , a shaped translucent or transparent envelope 302 with holes 310 to remove heat , one or more printed circuit boards 304 within the enclosure , means such as wires 303 to conduct electrical power to these board ( s ). the product now has high intensity illumination leds 307 on the top surface and other high intensity leds 309 in an array 308 on the bottom surface . unlike the product of fig2 which had small leds with a narrow exit beam and low intensity , these high intensity leds 309 and 307 have a higher light output generally greater than 10 lumens and the exit angle of the light may range from a narrow angle to a very broad beam as desired . to control these leds additional circuitry may be required as shown in the figure . in addition to the power transforming circuit 305 , and the control circuits 306 , additional power handling circuits 311 may be necessary . these high power leds may have one or more colored light outputs other than white , and have different orientations other than vertical to provide decorative illumination above the lighting product . a switch 311 that is accessible by the user can be used to control characteristics of operation of the lighting product . fig4 illustrates another embodiment of the product . unlike the previous examples in which modification of the color , intensity and pattern took place by electrically controlling the electrical power to individual devices of one or more orientations and color , this product contains a mechanical method for varying the intensity , and pattern with time . this is accomplished for example using a multi - faceted mirror 420 , operated by a miniature electric motor 421 that changes the orientation and position of the mirror . in this way light is reflected or diffracted to form a pattern of shapes and color on the translucent or transparent envelope 402 . fig5 illustrates another embodiment in which is added the feature of a patterned mask 520 that casts a shadow or other optical means a predetermined pattern by blocking or otherwise modifying the pattern of light emanating from the internal leds 507 located on the back side of the circuit board 504 . other features from other embodiments discussed already may also be incorporated . it may be appreciated from these descriptions that the leds used in these embodiments , though small , occupy considerable space that limits the overall light output of the product . this is due to the need to provide electrical connections to each of the semiconductor light emitting chips that are housed in large packages that provide both electrical connections and a means for removing heat and permit the exiting of useful light . the packages also often contain a lens or mirror for shaping and directing this light . while these packages allow some freedom of use , they also limit the density and eliminate the means to provide the integration of the functions of heat dissipation , light direction and electrical connection by independent means . many of these functions could be accommodated within a printed circuit board of appropriate design for a group of devices at the same time and within the circuit as it is formed . one means of improving the light density of the overall product is to incorporate the light emitting dies onto a suitable patterned circuit board that contains the external circuitry needed to power and connect the led devices without the excess baggage of a package . fig6 illustrates such an arrangement . the embodiment consists of a printed circuit board comprised of at least a middle portion 601 that may be the usual fiberglass core or one that contains metals , ceramics or other materials to enhance thermal conductivity , a top metal clad layer 603 and a bottom cladding layer 602 . it should be well understood that these top and bottom layers can easily be patterned by such processes as etching . a light emitting assembly can be attached to the patterned surface of cladding 603 by cementing with a thermally and electrically conducting compound or by welding or some other method . then the cladding 603 may act as either or both a thermal and electrical conducting pathway . the light emitting assembly consists of a metal base 604 to which is bonded a semiconductor light emitting chip 605 . this light emitting chip contains a pn junction that emits light and conducting top and bottom surface layers for electrical and thermal contact . a conducting wire or tab connects the top conducting member of the junction to the opposite conducting pad on the next assembly , thus building up a circuit that is in series . using a different connection scheme , but the same general method , a parallel connection can be assembled . by doing this , a relatively dense build - up of light emitting chips can be assembled using the thermal and electrical transfer characteristics of the printed circuit board . furthermore , heat sinking , cooling or other components can be attached to the board , improving performance , for example on the back side 602 of the printed circuit board . although not shown , it should be understood that this connection method can be extended in the two dimensions of the plane of the board . such chips as illustrated in fig6 will emit light in all directions . such a distribution of light may not be desired for any lighting applications . therefore , a matching array of lens that is positioned over the light emitting chips would be desirable . this separation of the top lens array from the leds is desirable as it allows the lens array to be positioned independently , allowing the light directed by the lens to be moved and / or focused by moving the lens array in the three dimensions . the movement can be controlled via a variety of methods such as stepper motors or piezoelectric activated motion controllers whose support electronics is also contained on the printed circuit board . the array of lenses can be molded from a transparent clear or colored material with a variety of spherical or hemi - spherical shapes . fig7 illustrates such an arrangement . the pc board 701 containing patterned metal traces 703 has located on its surface light emitting portions consisting of semiconductor light emitting devices 705 that are mounted on bases 704 . these areas are bonded together with electrically conducting wires or strips to form a series / parallel circuit . positioned over the top of these light emitting regions is a lens array 710 into which have been formed by a method such molding , a matching series of optical elements . three such elements of two different shapes labeled 711 and 712 are shown . this lens array 710 is spaced apart from the semiconductor array and mounted in such a manner that it can be externally manipulated in one or more of the three dimensions as shown by the opposing pairs of arrows . hence , by moving the lens array , the light emitted from the matching led array can be directed and focused as required , in essence steering the light beam . this can be controlled by onboard electronics , and via remote control or such other means as required such as proximity sensors , timers and the like . these lighting products require a source of alternating ( ac ) or direct current ( dc ). although leds utilize direct current , it is possible to use the leds to rectify ac power provided the number of leds is chosen to match the ac voltage . it is well understood how to transform ac power to dc via a variety of well - established methods . the use of dc power as supplied by batteries however , presents some problems because as the battery voltage declines under load , the current drawn by the leds rapidly declines , owing to the extremely non - linear current - voltage characteristic inherent in a diode . since the light output of a led is directly proportional to current , this means the light output rapidly declines . on the other hand , if battery voltage exceeds a predetermined level , heating of the semiconductor junction that comprises the led is excessive and can destroy the device . moreover , excess heat in the led junction causes a condition called thermal runaway , in which the heat raises the current drawn at a given voltage , leading to further heating , which in turn leads to greater current draw and quickly destroys the device . this is especially a problem with high power leds and requires careful thermal management . in order to help avoid this problem it is useful to fix the current through the leds rather than the voltage . using a battery as the source of current however presents a problem because of the differing voltage and current behavior of the battery power source and the led load . therefore , a circuit is desired to regulate and fix the current independent of the voltage supplied by the battery . in the case where the battery voltage is less than the load voltage required by the series and / or parallel led circuit , a boost circuit can be used as pictured in fig8 a and 8 b . in this circuit an integrated circuit device , ic 1 801 is used to control the charging and discharging of an inductor l 1 803 . this integrated circuit may be one of several that are available such as the texas instruments tps61040 . after a charging cycle , the ic switches the circuit so that the inductor l 1 803 is permitted to discharge through the load , which in this case is the light emitting diodes 805 . the current is controlled via a feedback resistor r 1 806 . the value of the resistor is chosen to fix the maximum current that is permitted to flow through the load , which in this case , is one or more leds ( led 1 , led 2 ) shown as 805 . this manner of control occurs because the voltage drop across r 1 806 is compared to an internally generated reference voltage at pin fb of ic 1 801 . when the two voltages are equal the current is considered fixed and will be controlled to that predetermined value . a diode d 3 802 is used to ensure protection of the ic 1 801 in case the battery source ( not shown ) is connected backwards . the diode 804 allows current flow through the leds 805 in only the forward , or light emitting direction . in this invention , such a circuit would be enclosed within the envelope of the bulb . fig8 b differs from fig8 a in that it builds into the circuit an easy and inexpensive means of protecting the leds from excessive current flow and the runaway that results from high temperatures . in this circuit a resistor with a positive resistance rate of change with temperature , r 2 807 is placed in series with a fixed resistor . resistor r 2 is physically located on the circuit board so as to be placed in the thermal pathway of heat emanating from the leds 805 . therefore , when the temperature of the leds 805 increases , the resistance of r 2 807 also increases , and its resistance is added to that of r 1 806 . since the voltage drop across these combined resistances appears on the feedback pin fb of ic 1 801 , the increased voltage is interpreted as a request for decreased current . hence , the natural tendency of the leds 805 to draw more current that would ordinarily lead to the failure of the part is averted by introducing a self - limiting control function . this circuit has the advantage of being very efficient and compact and having built into it a temperature regulation that allows the resulting system to automatically adapt to the thermal environment in which it is placed . because of these attributes , it can , for example be put into a miniature lamp base of the kind used for flashlights ( pr type flange base ). however , the remaining limitation of the circuit is that it can only boost voltage from a lower value to a higher value required by the led load . therefore , in situations where only one led is required , but a higher input voltage is all that is available , the excess voltage will appear across the led even if the circuits in fig8 are used . this will cause an excessive current to be drawn , leading to premature failure of the led and premature draining of the battery . to solve this problem we require a circuit that is still compact enough to fit into a bulb or bulb base , and that is capable of either raising or lowering the output voltage above or below the voltage of the incoming battery or other dc supply in order to maintain the desired current through the led load . hence this circuit would either boost the voltage if the input voltage were lower than required by the led or reduce the voltage if it were higher than that required to sustain the necessary constant current through the led . it is understood that led here may refer to one or more leds in a series , parallel or series / parallel circuit . furthermore , because of the deleterious effects of temperature , this circuit must have the ability to regulate the current through the led depending on the ambient temperature . the ambient temperature may be determined by the environment as well as heat dissipated by the circuit and the led . such a circuit is disclosed in fig9 . this circuit utilizes a so - called cuk converter that is ordinarily used as an inverting switching voltage regulator . such a device inverts the polarity of the source voltage and regulates the output voltage depending on the values of a resistor bridge . in this invention , the inverter circuit has been altered in a unique fashion so that it acts to boost the voltage output or buck the voltage input in order to maintain a constant current through the load represented by one or more leds 905 . the circuit incorporates an integrated circuit ic 1 901 such as the national semiconductor lm2611 cuk converter or equivalent . in this circuit , ic 1 &# 39 ; s internal transistor is closed during the first cycle charging the inductor l 1 902 from the battery source indicated as vbat . at the same time the capacitor c 2 904 charges inductor l 2 903 , while the output current to the leds 905 is supplied by inductor l 2 903 . in the next cycle the ic 1 901 changes state to permit the inductor l 1 902 to charge capacitor c 2 904 and l 2 903 to discharge through the leds 905 . the control of the charging power and current through the load is performed by the resistor network consisting of r 2 906 a and r 3 907 a . the overall value of these resistors together with the current passing through the leds 905 from ground , sets a voltage that appears on the feedback pin ( fb ) of ic 1 901 . resistor 907 a has a positive temperature coefficient so that its resistance increases with temperature . because of thermal effects such as heat dissipation by the leds , heat produced by the ic 1 or other circuit components and the ambient environmental conditions , the current must also be altered to accommodate these changes . this is affected by a temperature dependent resistor r 3 . in fig9 a , resistor r 3 907 a has a positive temperature coefficient in which the resistance increases with temperature . the additive effect of the series circuit with r 2 906 a means that as temperature rises , the overall resistance of the combination does also , leading to an increase in voltage drop . this in turn causes ic 1 to decrease the output current to the leds 905 . in fig9 b the resistor network is comprised of resistors in parallel and series . in this instance , resistors r 2 and r 4 906 b , 908 are fixed and resistor r 3 907 b is temperature dependent with a positive temperature coefficient . the use of a parallel arrangement allows a greater freedom of choice of temperature dependence than a simple series arrangement .
| 5 |
referring now to fig1 , a cross - sectional view of a core sleeve 2 of the present invention is shown . the core sleeve 2 is made up from easy weldable and machinable material such as carbon steel in the preferred embodiment . the core sleeve 2 can also be constructed of a hard plastic . the core sleeve 2 has an outer diameter surface 4 and an inner diameter surface 6 . as will be more fully set out , it is important to retain an accurate measurement of the outer diameter surface 4 . fig2 is a cross - sectional view of the core sleeve 2 of fig1 with a first coating applied thereto . more specifically , the operator will apply a layer of hard facing to the outer diameter surface 4 . in the most preferred embodiment , the fusion process is utilized . an oxygen settling process or a laser process , both of which are commercially available , can be utilized in this hard facing step . in the most preferred embodiment , the laser process is utilized as set out below . also in the most preferred embodiment , the hard facing material can be selected from the group consisting of tungsten carbide , silicon carbide or ceramics , all of which are commercially available . in the most preferred embodiment , tungsten carbide is used , and is commercially available . thus , the hard facing material does not have to be heated up above temperatures that would change the mechanical property of the core or carrier sleeves . also , very hot application temperatures can cause cracks in the structure ( of the hard facing material ) of the wear particles . as noted earlier , in the most preferred embodiment , a laser assisted procedure with inert gas coverage is used to apply the hard facing , and the temperature should not exceed 3500 degrees fahrenheit . it should be noted that it is also possible to use a high velocity oxygen fuel process system ( hvos ) in order to apply the hard facing to the outer diameter surface 4 . both the hvos and the laser assisted procedure is commercially available . the hard facing application in effect generates a new outer diameter surface 8 . referring now to fig3 , a cross - sectional view of the core sleeve 2 of fig2 with a second coating applied thereto will now be described . more specifically , the process would include applying a layer of metal ( material layer ) on the top of the previously applied hard facing surface 8 . thus , a new outer diameter surface 10 is formed . in this step , the operator applies a layer of metal on top of the hard facing . in the most preferred embodiment , the same process that was used for applying the hard facing is used in the step shown in fig3 . also , the same set up is used , namely a laser assisted procedure with inert gas coverage while not going over temperatures above 3500 degrees fahrenheit . the metal should have high ductility and medium yield i . e . soft carbon steel . in the most preferred embodiment , the metal used in fig3 is commercially available . fig4 is a cross - sectional view of the core sleeve 2 of fig3 having been machined on the outer diameter 10 . in the preferred embodiment , a commercial lathe can be used . it is important to keep as close as possible to a cylindrical shape . hence , this first cut is referred to as rough since it is important to get a cylindrical shape so that the inner diameter can be measured and machined , as will be discussed in more detail . referring now to fig5 , a cross - sectional view of the core sleeve 2 of fig4 having been machined on the inner diameter 6 will now be described . a commercially available lathe can also be used . hence , the operator will utilize known techniques to machine out the inner diameter 6 to a specific dimension , the specific dimension depending on the specific size mud motor used , thereby exposing a new inner diameter surface 12 . additionally , the core sleeve 2 is cut to a specific length l , wherein the length l corresponds to the mud motor dimension as will be more fully set out later in the disclosure . the type of tool used to cut the length may be a commercially available saw . it should be noted that it is within the teachings of this invention that the starting tubular sleeve may be of sufficient length that it is possible for the operator , in this step , to cut several bearings to a predetermined length from this single piece . in other words , the finished bearing of fig5 may be cut into a plurality of bearings so that several bearings are produced , which will save on manufacturing cost and improve time efficiency . in fig6 , the cross - sectional view of the core sleeve 2 of fig5 having been machined on the outer diameter surface 10 to the specific dimensions and tolerances of the mud motor is shown . therefore , fig6 depicts a new outer diameter surface 14 having been exposed through machining . a commercially available lathe may be used in this step . referring now to fig7 , a cross - sectional view of the completed bearing , which is represented by the numeral 15 . hence , bearing 15 is the core sleeve 2 of fig6 having been machined on the inner diameter thereby producing a new inner diameter surface 16 . in the most preferred embodiment , this cut is the final machine to the inner diameter area to given specifications and tolerances . the type of tool used to machine the inner diameter , in one preferred embodiment , is a grinding type of tool well known in the art . the steps illustrated in fig4 through 7 represent the most preferred embodiment of manufacturing the bearing 15 and were done in this specific order , and wherein this specific order has been shown by experimentation to prevent deformation of the bearing 15 due to residual stress generated when machining . another option to reduce residual stress caused when machining is a controlled heat stress relieve process which entails controlled heating and cooling procedures of the bearing . referring now to fig8 , a partial cross - sectional view of the bearing 15 of fig7 concentrically disposed within a lower housing 20 of a mud motor is illustrated . the bearing 15 is a product made by the process illustrated in steps of fig1 through 7 . the bearing 15 is press fitted in the most preferred embodiment into the inner bore 22 of the lower housing 20 . it should be noted that it is also possible to utilize heat shrinking or welding of the bearing 15 into the inner bore portion 22 of the lower housing 20 . all these processes are commonly used and known throughout the industry . the combination of the outer radial bearing female 15 placed in the lower housing 20 with the mandrel ( that will be described in the discussion of fig9 ) provides a complete radial bearing assembly means of the present invention . returning to fig8 , the lower housing 20 contains an outer surface 24 , which is generally cylindrical . the inner bore portion 22 contains a first inner diameter portion 26 that extends to a second inner diameter portion 28 , and wherein the inner bore portion 22 contains the radial shoulder 30 . the end 32 of the bearing 15 will abut the radial shoulder 30 . the lower housing 20 has an opening 33 a for placement of punch means 33 b for punching and removing the bearing . for instance , the operator may find it desirable to remove and replace the bearing , and therefore , the operator can utilize the punch 33 b via opening 33 a to crimp the radial bearing and remove as appropriate . fig9 is a partial cross - sectional view of a mandrel 34 with a hard coating 36 applied to the first outer diameter surface 38 . the mandrel 34 may also be referred to as the drive shaft 34 . the hard coating 36 is applied to the outer diameter surface 38 using known techniques of applying metal material , as was discussed with reference to fig2 above . returning to fig9 , the first outer diameter surface 38 extends to a second outer diameter surface 40 , which is an enlarged cylindrical surface . extending radially inward is the inner bore 42 . generally , the mandrel 34 is the rotational component of the mud motor , and the mandrel 34 can be attached to a bit means , as will be more fully explained later in the application . referring now to fig1 , a partial cross - sectional view of the mandrel 34 within the lower housing 20 of a mud motor 44 will now be described . as will be appreciated by those of ordinary skill in the art , mud motors are commercially available from several vendors , and are attached to a drill string 45 . for instance , baker hughes inc . has a commercially available mud motor under the name navi drill . fig1 depicts the lower housing 20 being connected to an upper housing 46 , and wherein the drive shaft 34 ( i . e . mandrel 34 ) is disposed therein . the bearing 15 is shown disposed within the lower housing 20 and wherein the bearing 15 will cooperate with the hard coating 36 of the drive shaft 34 . the lower housing 20 and the upper housing 46 is collectively referred to as the housing . with the drive shaft 34 disposed within the housing , a cavity is formed , and wherein the thrust bearing 48 is disposed therein . the purpose of the thrust bearing 48 is to transmit the axial load from the drill string via drive shaft 34 to the bit 50 . as understood by those of ordinary skill in the art , the circulation of drilling fluid down the inner portion of the drill string , and through the mud motor 44 , will cause the drive shaft 34 to rotate . the drive shaft 34 will be connected to a bit means 50 for boring a bore hole 52 . the purpose of the radial bearing is to allow rotation of the drive shaft 34 relative to the lower housing 20 , to clutch radial forces and to allow stabilization of the drive shaft relative to the lower housing 20 while minimizing the friction forces . operators find it desirable to design the mud motors to rotate at 100 to 300 revolutions per minute . hence , having a bearing section is critical . the present invention allows for an economical and efficient bearing assembly , with a long life as compared to prior art bearing assemblies . referring now to fig1 a , a partial schematic illustration of a preferred embodiment of the hard facing material 60 and the material layer 62 , which have been applied according to the teachings of the present invention , as set out in fig1 thru 7 . additionally , the hard facing material 60 has undergone rapid cooling after application . more specifically , fig1 a depicts the particulate material 64 suspended within the filler material ( seen generally at 66 ). the particulate material 64 may be a carbide and the filler material may be a cobalt or nickel composition , both being commercially available and well known in the art . the hard facing material 60 , which may also be referred to as the wear surface 60 , is the surface that will abut the mandrel . therefore , the wear surface 60 bears the rotational and radial force ( including friction ) of the moving components . the material layer 62 will bear the stress imposed during operation . for instance , in the mud motor application , the material layer 62 will bear the normal stress , shear stress , radial stress , etc . fig1 a depicts a good distribution of the particulate material . as understood by those of ordinary skill in the art , the hard facing material is applied at temperatures in the 3500 degree fahrenheit range . one of the methods of obtaining good particle distribution is to rapidly cool the hard facing material after controlled application . in other words , the hard facing material is not allowed to cool normally , but rather is rapidly cooled so that the particles are not allowed to settle . this is done by fast cooling which includes cooling the hard facing , material from a temperature of 3500 degrees fahrenheit ( immediately after application ) to a temperature of approximately 500 degrees fahrenheit in approximately 2 to 5 minutes . continued rapid cooling beyond this point could result in major cracks in the material layer 62 which could result in portions of the material layer 62 breaking off from the hard facing material . instead , after the rapid cooling , the material layer 62 may be wrapped or otherwise covered with a layer of insulation and allowed to cool slowly . the material layer may be slowly cooled to a temperature of 250 degrees fahrenheit with the layer of insulation around the material layer 62 . more preferably , the material layer may be slowly cooled to a temperature of 200 degrees fahrenheit in this manner . in an alternate embodiment , the material layer may be cooled to ambient temperature in this manner . this subsequent slow cooling step will help to prevent major cracks in the material layer 62 while achieving good particle distribution in the hard facing material 60 . the layer of insulation may be formed of any insulating material . for example , a heat blanket may be used as the insulation layer . fig1 b is a partial schematic illustration of one embodiment of the hard facing material and the material layer , wherein the hard facing material had not undergone rapid cooling . in the embodiment seen in fig1 b , the particle distribution is poor . this poor distribution was caused by improper cooling . referring now to fig1 c , a schematic illustration of another embodiment of the hard facing material and the material layer , wherein the hard facing material has not been applied in a controlled manner . in fig1 c , the particle distribution is poor . this poor distribution was caused by improper cooling , and an improper mixture of the filler material . thus , according to the teachings of the present invention , the rapid cooling of the hard facing material 60 and the subsequent slow cooling of the material layer 62 will allow for good particle distribution in the hard facing material 60 and will prevent major cracks in the material layer 62 , thereby allowing the hard facing material 60 and the material layer 62 to assist its load and wear function of the bearing . fig1 is a schematic illustration of the micro cracks formed in the hard facing material after rapid cooling , according to one preferred embodiment . the micro cracks are represented by the diagonal lines traversing fig1 . the micro cracks , such as seen at 68 , are introduced into the hard facing material 60 by the rapid cooling . the micro cracks makes the hard facing material flexible . at the same time , the hard facing material 60 is not allowed to chip and fall off . hence , the hard facing material 60 is flexible , but does not fall off . while preferred embodiments of the present invention have been described , it is to be understood that the embodiments described are illustrative only and that the scope of the invention is to be defined solely by the appended claims when accorded a full range of equivalence , many variations and modifications naturally occurring to those skilled in the art from a review thereof .
| 5 |
as shown in fig1 - 6 , and in accordance with an aspect of the present invention , a lighting apparatus 1 has a reflector 4 which is coupled to a top rim 3 , wherein the top rim 3 is coupled to a heat conducting body 2 . the heat conducting body 2 contains a heat pipe 8 which is cladded by a cladding 9 , and a mounting platform 5 located on one side of the heat conducting body 2 facing opposite the front side of the reflector 4 . as shown in fig3 , an led 6 is coupled to a metal core printed circuit board (“ pcb ”) 7 which is then coupled to the mounting platform 5 . the mounting platform 5 is shaped ( which , in this aspect of the present invention , is circular ) in such a manner that it provides increased non - glare protection from the led relative to existing lighting apparatuses . in this aspect of the present invention , the led 6 is located above at or near a central optical axis 300 of the reflector 4 , and is positioned so that light emitted from the led 6 is substantially or entirely directed to the front side of the reflector 4 ; thereby , as shown in fig6 , allowing the reflector 4 to collect and colliminate the light emitted from led 6 , and reflect the colliminated light away from the reflector 4 and past led 6 and the heat conducting body 2 . the heat conducting body 2 intercepts very little of the exiting reflected , colliminated light from reflector 4 due to its flat , narrow construction . as shown in fig3 , the flat , narrow construction of the heat conducting body 2 creates a small cross - section 10 to the exiting reflected , colliminated light from reflector 4 . in this aspect of the present invention , the heat generated from the led 6 travels the following heat path through the lighting apparatus : metal core pcb 7 , mounting platform 5 , cladding 9 , heat pipe 8 , cladding 9 , and then top rim 3 and reflector 4 . the heat generated from the led 6 can also travel through metal core pcb 7 , mounting platform 5 , cladding 9 , heat pipe 8 , and then top rim 3 and reflector 4 . the top rim 3 and reflector 4 act as heat sinks . another aspect of the present invention is shown in fig8 - 13 . specifically , the lighting apparatus 50 contains a reflector 53 which is coupled to a top rim 52 , wherein the top rim 52 is coupled to a heat conducting body 51 . the heat conducting body 51 contains a heat pipe 56 which is cladded by a cladding 59 , and a mounting platform 54 located on one side of the heat conducting body 51 facing opposite the reflector 53 . the led 55 , as shown in fig1 , is coupled to a metal core pcb 60 which is then coupled to the mounting platform 54 . this aspect of the present invention includes a main housing 57 which has one or more heat dissipating fins 58 for maximizing surface area ; thereby , increasing its heat dissipation capacity . the top rim 52 , reflector 53 , and the main housing 57 act as heat sinks , with the main housing 57 acting as the primary heat sink . as shown in fig1 and 11 , the main housing 57 is coupled to a reflector edge 63 . there is an air gap 62 between the reflector 53 and the main housing 57 , as shown in fig1 and 11 . the size of air gap 62 can vary depending on the size of the reflector 53 . the heat generated from the led 55 travels a heat path which includes travelling through metal core pcb 60 , mounting platform 54 , cladding 59 , heat pipe 56 , cladding 59 , and then top rim 52 , reflector 53 and main housing 57 . the heat can also travel through metal core pcb 60 , mounting platform 54 , cladding 59 , heat pipe 56 , and then top rim 52 , reflector 53 and main housing 57 . another aspect of the present invention is shown in fig1 - 20 . here , the lighting apparatus 500 includes a main housing 501 ; a reflector 502 having a front side and a rear side ; a top rim 503 coupled to the main housing 501 ; a heat conducting body 1000 which is positioned on the front side of the reflector 502 and coupled to the top rim 503 ; an led 504 being positioned facing directly at the front side of the reflector 502 so that light emitted from the led 504 is substantially or entirely directed to the front side of the reflector 502 . as shown in fig1 , the heat conducting body 1000 is substantially s - shaped and includes a middle portion 1001 that is bar - shaped or substantially bar - shaped ; and curved wing portions 1002 and 1003 which extend from each end of the middle portion 1001 . as shown in fig2 , curved wing portions 1002 and 1003 are coupled to the top rim 503 , wherein the top rim 503 has slots 520 and 521 which permit the curved wing portions 1002 and 1003 to fit within the slots 520 , 521 , respectively ; thereby , permitting coupling of the heat conducting body 1000 and the top rim 503 . the heat conducting body 1000 and the top rim 503 can also be coupled via soldering , thermal epoxy or any other techniques known in the art which are used to couple the heat conducting body 1000 to the top rim 503 . the heat conducting body 1000 includes a mounting platform 530 which is positioned near or at the central optical axis of the reflector 502 , and a mounting plate 531 coupled between the mounting platform 530 and led 504 . the heat conducting body 1000 also includes a heat pipe is located at the middle portion 1001 and / or one or both of the curved wing portions 1002 and 1003 . a metal cladding 550 can be coupled to the heat conducting body 1000 . for example , as shown in fig1 , a substantial portion of the middle portion 1001 of the heat conducting body 1000 is coupled to the metal cladding 550 . the metal cladding 550 can bemused to secure and direct electrical cable or wires which extends from the top rim 503 to the led 504 along the middle portion 1001 of the heat conducting body 1000 , and is made of a thermally - conductive material , such as stainless steel , aluminum , copper or any other high - heat conductive material . as shown in fig1 , the present invention can include a glass cover 800 which is coupled to the top rim 503 and a cap rim 509 . the glass cover 800 protects at least the reflector 502 , the heat conducting body 1000 , the mounting platform 530 , the mounting plate 531 and led 504 from environmental hazards , such as water and dust . the glass cover can also be used in conjunction with the aspects of the present invention set forth in fig1 - 6 and 8 - 13 . the present invention can also include a plastic housing 700 that is coupled to the bottom end of the main housing 501 , and a lamp base 701 ( e . g ., an e26 lamp base , a gu10 lamp base , an e27 lamp base ) that is coupled to the plastic housing 700 . as shown in fig4 and 11 , the heat conducting body 2 , 51 contain a heat pipe 8 , 56 which is cladded by a cladding 9 , 59 , and a mounting platform 5 , 54 located on one side of the heat conducting body 2 , 51 facing opposite the reflector 4 , 53 . the cladding 9 , 59 can be made of a thermally - conductive material such as aluminum , copper , graphite or zinc , and can include a mounting platform 5 , 54 . the cladding 9 , 59 can be used to increase structural strength of the heat pipe 8 , 56 , assist in transferring and spreading the heat from the led 6 , 55 to the heat pipe , and assist in the transferring and spreading the heat from the heat pipe 8 , 56 to the heat sinks , such as top rim 3 , 52 , reflector 4 , 53 and main housing 57 . as discussed above , and as shown in fig1 , the heat conducting body 1000 can be coupled to a metal cladding 550 . metal cladding 550 covers a substantial portion of the middle portion 1001 of the heat conducting body 1000 , and is used for aesthetic purposes , securing electric cable or wires between heat conducting body 1000 and metal cladding 550 , and / or directing such electric cable or wires to the led 504 . the metal cladding 550 can be made of thermally - conductive material , such as stainless steel , aluminum , copper or any other high - heat conductive material . alternatively , as shown in fig1 , the led 91 can be directly affixed onto a heat conducting body 90 ( via the mounting platform 92 of cladding 93 ). in another aspect of the present invention , the heat pipe is not cladded . for example , fig1 shows a heat conducting body 100 wherein an led 103 is coupled onto a mounting platform 102 , which is , in turn , directly coupled to a heat pipe 101 . the mounting platform 102 can be cylindrically - shaped , and can partially or completely encase at least the center of the heat pipe 101 . the heat pipe ( such as heat pipe 8 , 56 , 101 ) can be made of porous copper incorporating a large number cavities filled with pure water . as shown in fig7 , water within the heat pipe evaporates to vapor as it absorbs thermal energy from a heat source . see 400 in fig7 . the vaporized water then migrates along the vapor cavity to cooler sections of the heat pipe . see 401 in fig7 . there , the vapor quickly cools and condenses back to fluid , and the fluid is absorbed by the wick , releasing thermal energy . see 402 in fig7 . the fluid then returns along the inner cavities to the heated sections ( see . 403 in fig7 ), and repeats the heat pipe thermal cycle described above . the heat pipe use the above - described mechanism to transmit thermal energy from the led to heat sinks , such as the top rim 3 , 52 , reflector 4 , 53 , and main housing 57 , 501 . the heat pipe can be flattened ( in a cross - section direction ) into a thin strip in order to minimize light absorption . another aspect of the present invention includes a heat conducting body with one or more heat pipes . for multiple heat pipes , each heat pipe is connected to a center hub ( like a spoke on a wheel ) positioned near or at the central optical axis of a reflector . the center hub acts as a mounting platform for one or more leds , and is made of thermally - conductive material such as aluminum , copper or any other high - heat conductive material . in another aspect of the present invention , the heat conducting body extends up to or near the central axis of a reflector and being coupled to the top rim at only one connection point ( such as connection point 900 or 901 for fig1 , or connection point 910 or 911 for fig8 ). as a result , the heat conducting body does not form a chord to or a diameter of the top rim of fig1 and 8 . at or near the central axis of the reflector , the heat conducting body includes a mounting platform with an led directly coupled thereto , or an led coupled to a metal core pcb or a mounting plate , which is then coupled to the mounting platform . this alternative aspect of the present invention reduces light blockage caused by the heat conducting body and improves lens efficiency , while promoting heat dissipation and anti - glare . the mounting platform 5 , 54 , 102 , 530 are made of a thermally - conductive material such as aluminum , copper or any other high - heat conductive material . also , as mentioned above , the mounting platform provides increased non - glare protection from the led relative to existing light apparatuses . in the present invention , the possibility of direct glare from the led is eliminated ( or at least mitigated ) since ( 1 ) the led is coupled onto the mounting platform and positioned facing directly at the reflector so as that light emitted from the led is substantially or entirely directed to the reflector , and ( 2 ) the mounting platform is shaped ( e . g ., circular ) in a manner which prevents a direct view of the led at any viewing angle . the reflector 4 , 53 , 502 are made of a thermally - conductive material such as aluminum , and act as a heat sink . alternatively , the reflector 4 , 53 , 502 can be made of a non - thermally - conductive material such as plastic . as shown in fig6 , light emitted from the led 6 is substantially or entirely directed toward the reflector 4 , wherein the reflector 4 collimates the light emitted from the led 6 into a light beam and reflects the light beam with a particular beam angle . the beam angle can range from 2 to 60 full width half maximum (“ fwhm ”) degree . to eliminate or reduce glare , the reflector 4 of the present invention is designed to collect substantially or entirely the light emitted from the led 6 , and redirect the light in a manner which eliminates ( or at least mitigates ) luminance of the present invention within a direct glare zone ( i . e ., approximately 45 to 85 degree with respect to vertical ). the reflector 4 , 53 , 502 can take a variety of shapes to achieve various light beam patterns . it can be shaped in any conic section ( e . g ., hyperbola , ellipse or parabola ), used singularly or in various combinations , in two - dimension or three - dimensional shapes . an led can be an led module with one or more chips . the led can be a high - powered led . one or more leds can be used in the present invention . the led 6 , 55 , 504 are coupled to a metal core pcb 7 , 60 or a mounting plate 531 . in the alternative , the led 91 , 103 are coupled to the mounting platform 92 and 102 . the led can be soldered onto a metal core pcb , mounting plate , or mounting platform . thermal paste , thermal grease , soldering , reflow soldering or any other soldering materials or techniques known in the art can be used to couple the led onto the metal core pcb , mounting plate , or mounting platform . the present invention includes a metal core pcb ( see metal core pcb 7 , 60 shown in fig3 and 12 ). the metal core pcb includes led circuitry , and acts as a heat - transporting medium . for example , the metal core pcb comprises a base metal plate ( copper or aluminum , which is approximately 0 . 8 to 3 mm thick ), a dielectric layer ( laminated on top of the base metal plate , which is approximately 0 . 1 mm thick ), and a copper circuit track ( printed on top of dielectric layer , which is approximately 0 . 05 to 0 . 2 mm thick ). alternatively , as shown in fig1 and 16 , a metal core pcb is not included in the present invention in order to further reduce thermal resistance ; thereby , reducing led junction temperature and increasing maximum led power . alternatively , as shown in fig1 , a mounting plate 531 is used , wherein the mounting plate 531 being coupled to the led 504 and to the mounting platform 530 . the mounting plate is made of a thermally - conductive material such as copper or any other high - heat conductive material , and approximately 0 . 8 to 3 mm thick . mechanical techniques ( such as screws ) known in the art are used to couple the mounting plate to the mounting platform , and a thermal grease or paste with high thermal conductivity can be used between the mounting plate and mounting platform . the top rim 3 , 52 , 503 are made of a thermally - conductive material , such as aluminum , copper or zinc or any other high - heat conductive material . the top rim 3 acts as a primary heat sink ( for example , see fig1 ), or , like top rim 52 , 503 , as a secondary heat sink ( for example , see fig8 and 18 ). as shown in fig1 and 18 , the present invention includes a cap rim 509 which helps secures the glass cover 800 to the top rim 503 . the main housing 57 , 501 are made of a thermally - conductive material , such as aluminum , copper , zinc or any other high - heat conductive material . the main housing 57 , 501 act as a primary heat sink ( for example , see fig8 and 17 ). as shown in fig8 and 17 , the main housing 57 , 501 can have one or more fins 58 or 570 and / or take a conical - like shape to increase its surface area in order to increase its heat dissipation capacity . the main housing 57 , 501 can be substantially frustoconical in shape . the main housing can also be cylindrical or cubical in shape . in an aspect of the present invention , one end of the main housing 57 , 501 are coupled with a plastic housing 700 , the plastic housing 700 coupled to a lamp base 701 ( e . g ., an e26 lamp base , a gu10 lamp base , an e27 lamp base , a gu24 lamp base ). the plastic housing 700 contains main circuit boards , and electrically insulate such main circuit boards from the main housing 57 , 501 . it will be appreciated by one skilled in the art that the main housing can be utilized in conjunction with the aspect of the present invention set forth in fig1 - 6 , and the plastic housing 700 and lamp base 701 can be utilized with the aspects of the present invention shown in fig1 - 6 and fig8 - 13 . although specific embodiments have been illustrated and described herein , it will be appreciated by those of ordinary skill in the art that a variety of alternate and / or equivalent implementations may be substituted for the specific embodiments shown and described without departing from the scope of the present invention . this application is intended to cover any adaptations or variations of the specific embodiments discussed herein . therefore , it is intended that this invention be limited only by the claims and the equivalents thereof .
| 5 |
referring to fig1 a typical prior art cylindrical bored lock and latch mechanism is shown . the mechanism includes an outer knob 10 and an outer escutcheon 12 . a lock cylinder 14 is carried within the outer knob 10 . a key 16 is insertable into the lock cylinder 14 through an opening in the front of the outer knob 10 . operation of the key 16 will cause rotation of a tail piece 18 of the lock cylinder 14 . the tail piece 18 interconnects with a cylinder spindle 19 which interacts with a latch retraction assembly 20 . rotation of the tail piece 18 by means of the key 16 will cause the latch retractor assembly 20 to retract a latch bolt 22 . an outer spindle 24 is connected to the outer knob 10 and surrounds the cylinder spindle 19 . the outer spindle 24 is interconnected with the latch retractor assembly 20 so that rotation of the outer spindle 24 will also cause the latch bolt 22 to be retracted . a lock control 26 prevents rotation of the outer spindle 24 when it is in a locked position . a cover 28 fits over the latch retractor assembly 20 , outer spindle 24 and the lock control 26 . an inner knob 30 is supported by an inner escutcheon 32 and is connected to the outer spindle 24 . the outer knob 10 is also connected to the outer spindle 24 . in normal operation , when the lock control 26 of fig1 is in an unlocked position , rotation of either the outer knob 10 or inner knob 30 will cause rotation of the outer spindle 24 or inner spindle 27 and therefore retraction of the latch bolt 22 . when the lock control 26 is in its locked position , however , rotation of the outer spindle 24 by means of the outer knob 10 is prevented . in this case , the mechanism may be operated only be means of the key 16 or by rotation of inner knob 30 . it should be recognized that the mechanism described in fig1 is but one of several variations which may be used . for example , the mechanism may be designed so that when a lock control is in a locked position , the latch bolt 22 may be retracted only by operating the key 16 ( i . e ., rotation of the inner knob 30 is prevented as well as rotation of the outer knob 10 ). a detailed description of the precise operation of the lock mechanism of fig1 need not be given here , since it is but one of several different arrangements which are used with conventional cylindrical lock mechanisms . the present invention is directed to a modification of a standard cylindrical lock mechanism , and the mechanism of fig1 is described for illustrative purposes only . since the lock cylinder 14 in the mechanism of fig1 is carried within the outer knob 10 , removal of the outer knob 10 by the application of external force will expose the cylinder spindle 19 . the cylinder spindle 19 may then be manipulated to cause retraction of the latch bolt 22 . in addition , the application of excessive torque to the outer knob 10 can result in failure of the lock control 26 , which would then permit rotation of the outer spindle 24 and withdrawal of the latch bolt 22 . the present invention eliminates these potential hazards . as shown in fig2 the present invention includes an outer escutcheon 40 which has an integral outer protrusion 42 and supports an outer knob 10 &# 39 ; below the protrusion 42 . for purposes of clarity , elements shown in fig2 - 5 which correspond to elements of fig1 are labeled with a prime . the outer escutcheon 40 is secured to a door 38 . a key 16 &# 39 ; fits in an opening ( not shown ) in the front of the outer protrusion 42 . mounted on the opposite side of the door 38 is an inner escutcheon 48 through which passes an inner knob 30 &# 39 ;. a lock control button 52 extends from the inner knob 30 &# 39 ;. a latch bolt 22 &# 39 ; extends outwardly from the edge of the door 38 and is surrounded by a latch face 54 . the inner knob 30 &# 39 ;, latch bolt 22 &# 39 ; and key 16 &# 39 ; all lie on a common axis 36 . the outer knob 10 &# 39 ; lies on an axis 39 which is offset with respect to the axis 36 . referring now to fig3 a lock cylinder assembly 14 &# 39 ; is carried within the outer protrusion 42 of the escutcheon 40 in order to resist tampering . the lock cylinder assembly 14 &# 39 ; includes a cylinder key core 60 which is exposed though the opening in the outer protrusion 42 and into which the key 16 &# 39 ; is inserted . rotation of the key 16 &# 39 ; will cause rotation of a tail piece portion 18 &# 39 ; of the lock cylinder assembly 14 &# 39 ;. the tail piece 18 &# 39 ; is coupled to a cylinder spindle 19 &# 39 ;, and rotation of the tail piece 18 &# 39 ; will cause rotation of the cylinder spindle 19 &# 39 ; which in turn causes retraction of a latch retractor 20a &# 39 ; or release of a lock mechanism 26 &# 39 ;, depending upon the particular design utilized . located within the inner escutcheon 48 is a support plate 70 to which is secured a housing 72 by means of screws 74 . the housing 72 supports an outer spindle 24 &# 39 ;. the cylinder spindle 19 &# 39 ; is carried within the outer spindle 24 &# 39 ;. an upper cam 78 is secured to the outer spindle 24 &# 39 ; by welding or otherwise and rotation of the cam 78 will cause rotation of the outer spindle 24 &# 39 ;, which in turn will cause retraction of the latch retractor 20a &# 39 ;. when the lock mechanism 26 &# 39 ; is locked , rotation of the outer spindle 24 &# 39 ; is prevented . the upper cam 78 is actuated by means of a pair of pushrods 80 which extend vertically downward from the cam 78 . the pushrods 80 cooperate with a lower cam 82 which is attached to a spindle 84 of the outer grip knob 10 &# 39 ;. the cam 82 and knob 10 &# 39 ; are held in position by a spindle retainer 86 which fits around the spindle 84 . referring now to fig4 the operation of the inventive portion of the locking mechanism will be described . a positioning bracket 88 serves to accurately position the pushrods 80 within the outer escutcheon 40 , permitting them to move only in the vertical direction . when the outer grip knob 10 &# 39 ; is rotated , the lower cam 82 will in turn rotate and will raise one of the pushrods 80 . the raised pushrod 80 will contact the upper cam 78 , causing it to rotate and in turn rotate the outer spindle 24 &# 39 ;. the rotation of the outer spindle 24 &# 39 ; will cause retraction of the latch retractor 20a &# 39 ; and the latch bolt 22 &# 39 ;. a pair of springs 76 are biased between an extension 40a of the outer escutcheon 40 and an end of the pushrods 80 , and serve to return the pushrods 80 to their original position . when the locking mechanism 26 &# 39 ; is in a locked position , the outer spindle 24 &# 39 ; will be prevented from rotating . this in turn restricts rotation of the outer grip knob 10 &# 39 ;. by modifying the design of a conventional cylindrical lock mechanism in the manner described above so that the lock cylinder and inner knob are located on an axis which is offset from the axis of the outer knob 10 &# 39 ;, the security of the lock mechanism is greatly increased . since the lock cylinder 14 &# 39 ; is not carried within the outer knob 10 &# 39 ;, removal of the knob 10 &# 39 ; will not expose the lock cylinder 14 &# 39 ; to tampering . in addition , the protruding portion 42 of the escutcheon 40 can be reinforced in order to make it more difficult to gain access to the lock cylinder 14 &# 39 ;. although the above described design is still subject to the potential problem of breaking the lock mechanism 26 &# 39 ; by the application of excess torque to the outer knob 10 &# 39 ;, a feature which also eliminates this problem may be easily incorporated . simply by designing the pushrods 80 so that they will will fail before the lock mechanism 26 &# 39 ; ( i . e ., by making them structurally weaker than the lock mechanism 26 &# 39 ;), the application of excess torque to the outer knob 10 &# 39 ; will cause failure of the pushrods 80 and the lock mechanism 26 &# 39 ; will remain intact . this may be accomplished , for example , by making the pushrods 80 of plastic or zinc . although the pushrods 80 will have to be replaced , the latch bolt 22 &# 39 ; will remain extended and the door 38 will thus remain locked . the locking mechanism of the present invention may be further strengthened by the addition of a pair of screws 89 and 90 ( fig3 ) which are used to secure the support plate 70 to the outer escutcheon 40 . the only change over a normal lock mounting is that the requirement that two additional holes 92 and 94 be drilled in the door 38 . as well as securing the outer escutcheon 40 to the support plate 70 , the lower screw 90 also functions to position the bracket 88 within the escutcheon 40 . referring now to fig5 an alternate means of solving the problem of the application of excess torque to the outer knob 10 &# 39 ; is shown . in this embodiment , the locking mechanism 68 is designed so that when it is locked , the outer spindle 24 &# 39 ;, and therefore the upper cam 78 , will be longitudinally moved as shown by arrow 90 so that it will be out of the path of the pushrods 80 . when this is done , the rotation of the outer knob 10 &# 39 ; will have no effect upon the locking mechanism 26 &# 39 ; since it will not contact any portion of it . when the locking mechanism 26 &# 39 ; is returned to its unlocked position , the upper cam 78 will be moved back into a position where it will be contacted by the pushrods 80 when the knob 10 &# 39 ; is rotated . also , as shown in fig5 the key core 60 may be covered with a hardened steel cap 61 to resist drilling of pins within the key core 60 . although it is most convenient to mount the cam and pushrod mechanism between the outer escutcheon 40 and the door 38 , the mechanism could be mounted within the door 38 itself . although this might provide marginally increased security , it would require an additional opening to be formed in the door beyond the standard opening which the preferred embodiment utilizes . in summary , the present invention is directed to an improved cylindrical lock mechanism which has increased security compared to a normal common axis cylindrical lock and yet is simple enough so that its cost will be significantly less than typical high security deadbolt lock mechanisms . the invention can be easily adapted to operate with various types of cylindrical lock mechanisms as long as they depend upon the rotation of a spindle for their operation . the basic design of the lock provides protection against tampering with the lock cylinder by positioning the lock cylinder away from the outer knob . with slight modifications , the mechanism will also prevent the application of excess torque to the outer knob from releasing the lock mechanism .
| 8 |
shown in fig1 is a portion of a circuit board 10 in accordance with a first embodiment of this invention . conductors 12 define a conductor pattern on the circuit board 10 , with each conductor 12 configured in accordance with this invention to have a bond pad 14 delineated by a reduced - width portion 16 that separates the bond pad 14 from the remainder of the conductor 12 . the circuit board 10 is shown prior to placement of a flip chip or other surface mount device on the board 10 , by which solder bumps on the chip would be registered with and then reflowed on the bond pads 14 . optional “ dummy bumps ” 18 in accordance with commonly assigned u . s . pat . no . 5 , 400 , 950 are shown within an interior region 20 of the circuit board 10 surrounded by the conductor pattern . these bumps 18 are not electrically active , but are used if additional mechanical lift is desired to promote the stand - off height of the chip on the board 10 . as typical in the art , after registration with the bond pads 14 , the solder bumps of the chip are reflowed in any suitable manner to form solder connections that physically and electrically connect the chip to the conductors 12 . suitable solder alloys include , but are not limited to , tin - based , lead - based and indium - based alloys , with notable examples being tin - lead alloys containing about ten to about sixty percent tin , with possible alloying additions of antimony , silver , etc . these alloys can be reflowed at sufficiently low temperatures to avoid thermal damage to the circuitry of the chip and circuit board 10 . the solder alloy for the bumps is typically screen printed or electrodeposited on contact pads on the chip , and must be accurately deposited in limited amounts such that , after reflow , the solder bumps will be substantially of equal size and will accurately and uniquely register with the bond pads 14 when the chip is registered with the conductors 12 . the conductors 12 are formed of a solderable material , which denotes a material to which solder will metallurgically bond and reliably adhere for purposes of making an electrical interconnection , as determined in the art using known test methods . a preferred conductor material for laminate circuit boards ( e . g ., fr4 ) is planar copper deposited by plating or by lamination of a copper foil , with a suitable thickness being about 0 . 015 to about 0 . 040 millimeters . while the invention has particular applicability for laminate circuit boards , conductors configured in accordance with this invention can be printed or otherwise formed on the surface of other circuit board materials , including ceramic and silicon substrates and flexible circuits , as is known in the art . a solder mask 22 is shown as surrounding the bond pads 14 , the reduced - width portions 16 , and the interior region 20 of the circuit board 10 . the solder mask 20 is preferably a photoresist material so that an opening 24 in the mask 22 can be defined by known photoengraving techniques . the opening 24 in the mask 22 would typically be required on a laminate circuit board to expose a limited portion of the conductors 12 for the purpose of defining the bond pads 14 , resulting in the opening 22 being roughly a square - shaped trench corresponding to the square pattern formed by solder bumps located along the perimeter of a chip . however , in accordance with this invention , the solder mask 22 is excluded from the interior region 20 of the board 10 , and the conductors 12 are truncated to define the interior end of each bond pad 14 , while the opposite end of each pad 14 is delineated by the interface with its reduced - width portion 16 . according to the invention , the reduced - width portions 16 serve as solder stops by physically impeding the flow of molten solder beyond their respective bond pads 14 , and preventing solder flow onto the remainder of the conductors 12 set apart from the bond pads 14 by the reduced - width portions 16 . as the molten solder coalesces during reflow , the surface tension of the solder constrains the final shape of the solder connections formed by the bumps in accordance with the size and shape of the bond pads 14 . because the solder mask 22 is not required within the interior region 20 , the stand - off height of a chip attached to the bond pads 14 by reflow soldering is effectively increased by the width of the solder mask 22 . with this increase in stand - off height , the penetration of cleaning solutions , mechanically bonding and encapsulation materials is promoted during processing of the board 10 , and stress relief of the solder connections is promoted during thermal cycling of the circuit board 10 . because bonding and encapsulation materials typically adhere better to circuit board materials than solder mask materials , another advantage of this invention is that underfill materials are able to bond directly to the circuit board 10 rather than the solder mask 22 . in view of the above , the transverse widths of the bond pads 14 and reduced - width portions 16 are critical to achieving the objects of this invention , while the width of the remainder of each conductor 12 is not . because the surface area of each bond pad 14 determines the manner in which the molten solder will flow , the length of each bond pad 14 is important , while the length of each reduced - width portion 16 should be sufficient to prevent molten solder from flowing over the portion 16 and onto the remainder of the conductor 12 . the square corners shown in fig1 at the junction between each bond pad 14 and its reduced - width portion 16 improve the ability of the portion 16 to impede the flow of solder across the junction . in practice , the surface areas , widths and lengths of the bond pads 14 are preferably the same , as are the widths and lengths of the reduced - width portions 16 . to be sufficiently narrower than its bond pad 14 for the purpose of effectively impeding the flow of molten solder , the maximum width for a reduced - width portion 16 should be about 75 % the width of its bond pad 14 , and preferably about 40 % to about 70 % of the width of the bond pad 14 . as an example , for conductors 12 on a 0 . 008 inch pitch ( 200 micrometers ), a suitable length and width for a bond pad 14 is about 0 . 007 inch ( about 175 micrometers ) and about 0 . 004 inch ( about 100 micrometers ), respectively , a suitable length for each reduced - width portion 16 is about 0 . 007 inch ( about 175 micrometers ), and a maximum width for each reduced - width portion 16 is believed to be about 0 . 003 inch ( about 76 micrometers ), with a suitable width being about 0 . 002 inch ( about 50 micrometers ). the bond pads 14 of fig1 are shown as being rectangular and linearly aligned on the circuit board 10 . as a result , solder connections formed on the bond pads 14 will generally have an oblong shape whose major axis is in the longitudinal direction of each conductor 12 . in a second embodiment of the invention shown in fig2 conductors 112 are formed to have circular bond pads 114 set apart from the remainder of each conductor 112 by , a reduced - width portion 116 whose intersection with the conductor 112 defines a square transverse edge 118 . the bond pads 114 are arranged in a staggered pattern on a circuit board 110 as a result of adjacent reduced - width portions 116 having different lengths . to maximize the spacing between circular - shaped solder connections subsequently formed at each bond pad 114 , pads 114 with shorter reduced - width portions 116 are preferably aligned adjacent to the reduced - width portions 116 of adjacent conductors 112 , as depicted in fig2 . in this embodiment , the maximum width of each reduced - width portion 116 is about 50 % of the diameter of its bond pad 114 , and preferably about 33 % to about 42 % of the diameter of the pad 114 . as an example , for conductors 112 on a 0 . 008 inch pitch ( 200 micrometers ), a suitable diameter for a bond pad 114 is about 0 . 006 inch ( about 150 micrometers ), and a maximum width for each reduced - width portion 116 to adequately impede the flow of molten solder is believed to be about 0 . 003 inch ( about 76 micrometers ), with a suitable width being about 0 . 0025 inch ( about 63 . 5 micrometers ). to produce the desired staggered arrangement of the pads 114 , the lengths of adjacent reduced - width portions 116 preferably differ by the diameter of the bond pads 114 . e . g ., about 0 . 006 inch ( about 175 micrometers ) for the pattern just described . it is foreseeable that the pads 114 could be staggered greater distances apart , with the maximum length of each reduced - width portion 116 generally being limited by the allowable temperature rise and resistance increase of its conductor 112 . as with the embodiment of fig1 a solder mask 122 is shown as being limited to surrounding the bond pads 114 and reduced - width portions 116 of the conductors 112 . the solder mask 122 is excluded from the interior region of the circuit board 110 surrounded by the bond pads 114 , where the mask 122 would conventionally be required as a solder stop , and instead the reduced - width portions 116 serve as solder stops by physically impeding the flow of molten solder beyond the bond pad 114 , and preventing solder flow onto the remainder of the conductors 112 set apart from the bond pads 114 by the reduced - width portions 116 . the benefit of excluding the solder mask 122 from the interior region of the board 110 is again the increased stand - off height of a chip attached to the bond pads 114 by reflow soldering . an additional benefit of the embodiment of fig2 is that the staggered arrangement of solder connections on the bond pads 114 provides for greater clearance between connections for a given conductor pitch , which reduces the risk of shorts when fine conductor pitches ( e . g ., 0 . 010 inch or less ) are used . a third embodiment of this invention is shown in fig3 in which conductors 212 have bond pads 214 defined between pairs of reduced - width portions 216 , each of which intersects its conductor 212 to define a square transverse edge 218 . the length and width of each reduced - width portion 216 is again sized to prevent molten solder from flowing across the portion 216 and onto the remainder of the conductor 212 , as indicated by the solder connections 220 depicted in fig3 . as with the previous embodiments of fig1 and 2 , a solder mask is not used to delineate the bond pads 214 , and therefore can be excluded from beneath a flip chip attached to the bond pads 214 with the solder connections 220 . similar to the embodiment of fig1 a maximum width for a reduced - width portion 216 is about 75 % of the width of its bond pad 214 , and preferably about 40 % to about 70 % of the width of the pad 214 . an example of suitable dimensions for conductors 212 configured in accordance with fig3 are , for a conductor pitch of about 0 . 008 inch ( about 200 micrometers ), bond pad lengths and widths of about 0 . 007 inch ( about 150 micrometers ) and about 0 . 004 inch ( about 100 micrometers ), respectively , and lengths and widths for the reduced - width portions 216 of about 0 . 002 inch ( about 50 micrometers ). while the invention has been described in terms of a preferred embodiment , it is apparent that other forms could be adopted by one skilled in the art . accordingly , the scope of the invention is to be limited only by the following claims .
| 8 |
the present invention is based upon utilization of a plurality of tanks for growing environments , each comprising a relatively independent system , including means for introducing feed , means for recirculating and heating water and in the course of recirculation filtering and aerating the water , all as described in the literature referred to above . typically , such a growing environment or system has a relatively fixed capacity for water recirculation , filtration and aeration . this is a limiting factor in the amount of fish growth which can be produced in that environment . a growing fish population , on the other hand has a constantly increasing capacity to consume nutrients , including air , and to produce waste products , as the fish population grows . the present invention &# 39 ; s system for the continuous production and harvest of fresh fish from a closed - system aquaculture design depends on the use of a multiple tank design , each with its own capability for biofiltration , clarification , aeration , heating , and insulation . in such closed systems , water quality control must be strictly observed , particularly because of the relatively constant and high nutrient input levels . in order to maintain optimal conditions for fish growth , several methods for maintaining water quality are employed , essentially as a unified or a combined approach . because a primary advantage of the present invention is its relatively low operational costs , in order to be economically feasible in accomplishing the continuous production described herein , certain adaptations of otherwise known water treatment techniques and apparatus are necessary . for example , in order to circulate water through the system &# 39 ; s components with low energy utilization , all water levels must be kept relatively at the same level . water can then be easily moved from the tank into an associated clarifier and then into an associated biofiltration tank and then finally back into the tank using an air lift . the air lift is a device for moving water by means of air . it is generally a u - shaped tube having in one end a connection for an air source . when placed between adjacent water compartments , air delivered inside of the tube drives the water out of the tube and into the adjacent compartments . if , as in the present invention the compartments are also connected beneath the level of the tube , water removed from one compartment causes the water in the adjacent compartment to adjust in response to the influx of water . thus , water levels are uniformly maintained with water movement being more or less constant in response to the removal and influx of water . similarly , aeration costs are also reduced relative to other fish production methods . aeration is accomplished using low pressure / high volume air blowers . the depth of water is necessarily shallow to accomplish this . particulate matter such as unconsumed fish feed and fish wastes are removed by circulating the water through a baffle - type clarifier which causes solids to settle out before the water is treated by the bio disk filtration system . the biodisc filtration system provides efficient ammonia removal without subsequent clogging of the filter with solid waste , and also operates using only air for the turning of the filter . the efficiency of the filtration system is enhanced further because of the multiple - tank design , requiring a quantity of much smaller individual filters , in essence increasing the water to filter - surface ratio , as compared to other fish growing schemes . thus , the overall multiple - tank concept as embodied in the present invention considers all of the relevant environmental parameters , including tank size ( circulation rate , pumping rate through the filters , production capacity / volume ), aeration method , clarifier sizing , heating and insulation efficiency , as well as feeding techniques and density manipulations . furthermore , by following the production scheme of the present invention , other immediate advantages include the ability to monitor fish growth as well as keeping all multiples of the system separate for disease control . in accordance with the present invention , the fish population growth cycle is divided into a number of intervals or phases in which the fish population is subdivided at the beginning of each interval or phase and thus the fish population or subdivisions thereof in the successive intervals are all relatively well matched , in their capacity to absorb nutrients and to produce wastes , with the relatively fixed capacity of each independent growing environment to aerate and remove waste from the recirculating water in that environment . thus , at the beginning of the growth cycle , the number of fingerlings introduced into one of the tanks or containers is selected so that the capacity of the tank or container to aerate and remove wastes from the recirculating growth medium ( water ) is comparable but somewhat greater than the capacity of the fingerlings to consume nutrients , including air , and produce wastes . as the fingerlings grow and their capacity to consume nutrients and produce waste become excessive relative to the capacity of the container to provide nutrients and remove waste , the fingerling population is subdivided . this is done by removing part of the fish population . for example , approximately one - half of the fingerling fish population may be placed in one additional tank or container . the growth cycle then proceeds until the subdivided fish populations &# 39 ; capacity to consume nutrients and produce waste again becomes excessive relative to the capacity of the individual containers , in which the sub - division of the original population is contained . at that point , the subdivided fish population is again subdivided , this time , for example , by again removing one - half of the fish in each of the two containers and evenly distributing them into two additional containers . in this manner , the capacity of all of the containers to introduce nutrients , filter the recirculating water and remove wastes from it , is used relatively efficiently throughout the fish growth cycle . preferably , a number of fish populations are simultaneously grown in this manner with the beginning of the growth cycle for each of the populations offset by the length of one interval or growth phase , so that at any one time a relatively constant number of containers are in use . typically , the method of the instant invention is carried out in a plurality of thermally insulated culture tanks , each of which has an associated bio - disk filtration and clarifier system . the insulated culture tanks are preferably circular , about 10 feet in diameter and 40 inches high . the tanks are also preferably raised above the ground so that associated piping , located below the tanks , may be easily installed and accessed . an air lift provides for movement of the water from compartment to compartment . thus , water moves from the tank to the clarifier and to the biofilter and finally back into the tank without the use of a siphon , simply by maintaining a constant water in all compartments . each tank also has associated with it an aeration and heating system which provides oxygen and heat for the fish . the aerator preferably also may provide for rotating the bio - disk filter and differential pressure to operate an integrally associated air - lift flow system . by way of example of the present invention , a first tank is stocked with a quantity of fish , typically about 4 , 000 fingerling . the fingerlings are supplied nutrients such as food and oxygen , and their waste is removed through a bio - disk filter / clarification system . fish are raised in a first tank for a six week period , after which one half of the fish are removed and placed in a second tank . the preferred six - week period may be longer or shorter depending upon the species of the fish or the ability of the tank and the associated filtration system to effectively handle waste products . in any event when the capacity of the fish population to absorb nutrients and produce wastes becomes excessive relative to the system &# 39 ; s capacity to introduce nutrients and remove wastes , the fish population is again subdivided from two tanks into four and six weeks later this population is divided again into eight tanks where they remain for an additional six week period until such time as they are ready for harvest . from the above - described method , it can be seen that where the first tank is supplied with 4 , 000 fingerling fish , after three sequential density manipulations , by subdivision into additional tanks , and with proper feeding , each of the eight harvest tanks should contain approximately 500 fish weighing over one pound each . a preferred density manipulative sequence in utilizing the present invention is to have 15 tanks and 4 fish populations ( of varying sizes ) in process at any one time , with staggered growth cycles so that when a first tank is divided between the first and the second tank a third tank is then stocked with fingerlings . when the third tank reaches optimum capacity , this tank as well as the first and second tanks are likewise divided into additional tanks . this scheme is best illustrated by reference to table 1 in which there is shown a tank manipulative sequence , by which 15 tanks are kept in relatively constant use , at relatively optimum fish growing conditions through a cycle of about 6 months . each fish population is subdivided four times . a population which is loaded originally as fingerlings in one tank is eventually harvested 6 months later from 8 tanks . this tank utilization sequence provides an appropriate number of tanks so that each tank will be operating at or near capacity at all times and so that 8 out of the 15 tanks can provide a standard harvest weight of fish every six weeks . while the present invention has been described with reference to specific embodiments thereof , the invention is not limited thereto . the method and apparatus of this invention may in fact include systems with other numbers of tanks . the manipulative sequence to effect relatively constant output may also be varied considerably . all such variants , however , are within the scope of the present invention . the appended claims are intended to be construed to encompass all such variants as may be devised by those skilled in the art without departing from the true spirit and scope of this invention . table 1__________________________________________________________________________stocking / harvest sequence ( 15 tank system ) set # 1 set # 2 set # 3 set # 4date activity / tank # activity / tank # activity / tank # activity / tank # __________________________________________________________________________jan 1 harvest / all divide 2 , 7 , 13 , 14 ≧ divide 4 , 15 ≧ divide 8 ≧ stock 1 3 , 5 , 6 , 9 10 , 11 12feb 15 divide 1 ≧ harvest / all divide 4 , 15 , 10 , 11 ≧ divide 8 , 12 ≧ 3 stock 2 5 , 6 , 7 , 9 13 , 14apr 1 divide 1 , 3 ≧ divide 2 ≧ harvest / all divide 8 , 12 , 13 , 14 ≧ 5 , 6 7 stock 4 9 , 10 , 11 , 15may 15 divide 1 , 3 , 5 , 6 ≧ divide 2 , 7 ≧ divide 4 ≧ harvest / all 9 , 10 , 11 , 12 13 , 14 15 stock 8july 1 repeat repeat repeat repeat__________________________________________________________________________ tank set # 1 ( 1 , 3 , 5 , 6 , 9 , 10 , 11 , 12 ) tank set # 2 ( 2 , 3 , 5 , 6 , 7 , 9 , 13 , 14 ) tank set # 3 ( 4 , 5 , 6 , 7 , 9 , 10 , 11 , 15 ) tank set # 4 ( 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 )
| 8 |
[ 0056 ] fig1 depicts a vertical - dipole transmitter coil ( tx ) 10 , a calibration coil ( cx ) 12 , an optional bucking coil ( bx ) 14 , and a pair of receiver coils rx ( plc ) 16 and rx ( hcop ) 18 . each of the coils has an axis specifically a transmitter axis 20 , a calibration axis 22 , a bucking axis 24 , a receiver plc axis 26 and a receiver hcop axis 28 respectively . similarly each of these has an effective center . the effective center of a receiver type device , including the cx 12 , bx 14 , rx plc 16 and rx hcop 18 , may be defined as the centroid of the sensitive region of the receiver device with respect to the component of electromagnetic field intensity being sensed by the device . the sensitive region is that area or volume of the receiver device which is sensitive to the intensity of the electromagnetic field in the vicinity of the receiver device . it will be appreciated by those skilled in the art that the centroid of the sensitive region is typically substantially coincident with the geometrical center of the sensitive region . the effective center of a transmitter device may be defined as the geometrical center of the transmitter device . the hcop rx 16 coil is coplanar with the tx 10 or their effective centers are coplanar and separated from it by r rx 30 . the perpendicular loop coil ( plc ) 18 is oriented perpendicular to the tx - rx plane , with its axis 28 directed toward the transmitter coil 10 . the plc 18 and hcop 16 coils may be concentric or offset . if they are offset , the distance between the tx to the plc is r rxp which may be larger or smaller than r rx . if the bx coil is present , it is located at r bx 32 . the distance between the calibration coil 12 and the transmitter 10 is r cx 34 and is less than r rx 30 [ 0058 ] fig2 schematically depicts the first embodiment of the calibration apparatus . the cx coil 12 supplies a signal through an anti - alias filter to certain poles on switch # 1 46 and directly to an analog to digital converter ( adc ) 48 . the output of this adc is called the calibration data stream 58 or input 1 . switch # 1 permits the cx signal to be applied to the other adc &# 39 ; s when required in order to establish their calibration factors relative to adc # 1 . a separate pair of leads runs to switch # 2 50 ( if present ), which is normally open , but when closed places the cx coil 12 in opposition to the rx coil 16 . switch # 2 50 may be present in the circuit only during initial calibration of the system , when it may be used to position the cx 12 and / or rx 16 coils and / or to adjust the parameters of the cx 12 and / or rx 16 coils , such that the combined signal from the rx 16 and cx 12 due to direct pickup of the tx 10 field is at a minimum . this methodology allows the calibration signal emanating from the cx 12 to be adjusted so as to generally match the amplitude and phase of the rx signal due to direct pickup of the tx field . two receiver coils , labelled z rx 18 and x rx 16 , are connected via an amplifier and anti - alias filter 52 to certain poles on switch # 1 46 , such that in position 1 of the switch they are connected through to the second and third adc &# 39 ; s 54 and 56 respectively . the corresponding output data streams of these adc &# 39 ; s are called the z signal 60 and x signal 62 , or inputs 2 and 3 respectively . [ 0061 ] fig3 shows the relationship between the tx 10 , bx 24 ( if present ) and rx coils 36 in a terrain conductivity meter ( tcm ). in a ground conductivity meter ( gcm ), the single receiver coil labelled rx 36 would be replaced by a pair of coils 16 and 18 such as those shown in fig2 . the array , of length r rx 30 , is normally used with its long axis horizontal at a height h 38 above the ground surface . [ 0062 ] fig4 depicts a vertical - dipole transmitter coil ( tx ) 10 , a calibration coil ( cx ) 12 , and multiple receiver assemblies ra 1 40 , ra 2 40 ′, and so on to ra m 40 m . these receiver assemblies 40 may include hcop and / or plc receiver coils and / or a coil oriented at right angles to both of these , for depth sounding purposes , hcop and plc coils are typically sufficient . the receiver assemblies are located at r 1 , r 2 , . . . r m , 42 1 , 42 2 , 42 m respectively from the transmitter . if bx coils were present , they would be located at rbx 1 , rbx 2 , . . . rbx m ( not shown ). [ 0063 ] fig5 shows the multiple receiver array of fig4 in relation to a layered earth structure . each of the tx - ra pairs samples this structure to a different set of doi values 44 , 44 ′. suitable choices of tx - ra distances yields a sensor which is in principle capable of providing a continuous profile of earth material conductivity depth sections over the range of doi &# 39 ; s provided by the unit as the sensor is moved over the earth &# 39 ; s surface . [ 0064 ] fig6 shows a schematic of a sensing apparatus that includes a plurality of receiver devices 16 which may each be spaced differently from the transmitter . the range of spacings present provides a range of depths of investigation of the apparatus in its depth sounding application . switches sw 1 64 to sw n 64 n permit the routing of signals from receiver devices 1 to n to inputs 2 to n + 1 66 during normal operation , and from the calibration device to one , two or all of inputs 1 to n + 1 so that the relevant input may be calibrated relative to input 1 66 1 . [ 0065 ] fig7 is a schematic similar to the shown in fig6 but is enhanced through the addition of a plurality of receiver devices which may each be spaced differently from the transmitter . the range of spacings present provides a range of depths of investigation of the apparatus in its depth sounding application . the range of spacings present provides a range of depths of investigation of the apparatus in its depth sounding application . switches sw 1 to sw n 64 permit the routing of signals from receiver devices 1 to n to inputs 2 to n + 1 66 2 to n + 1 during normal operation , and from the calibration device to one , two or all of inputs 1 to n + 1 66 1 to n + 1 so that the relevant input may be calibrated relative to input 1 66 1 . in addition , switches sw n + 1 to sw 2n 671 to 2n permit the corresponding receiver device 1 to n or the calibration signal . the normal operating state would be sw 1 to sw n in the up state , and sw n + 1 to sw 2n in the down state . inverting sw1 to sw n to the down state substantially simultaneously with switching sw n + 1 to sw 2n to the up state permits the simultaneous re - routing of the calibration signal from inputs n + 1 to 2n into inputs 1 to n , while receiver signals 1 to n are re - routed to inputs n + 1 to 2n . this re - routing permits the calibration of inputs 1 to n with respect to inputs n + 1 to 2n without significant loss of receiver signal output . calibration could also be performed by switching one or more corresponding pairs of inputs rather than the entire set . [ 0066 ] fig8 schematically depicts an alternate embodiment of the calibration apparatus . the cx coil 12 supplies a signal through an attenuator 68 to certain poles on switch # 1 70 and directly to certain poles on switch # 2 72 . switch # 1 70 permits the cx signal to be routed to either the amp 1 preamplifier 74 ( state 0 ) or to the amp 2 preamplifier 76 ( state 1 ). in state 1 , the signal from the rx combined with the signal from switch # 2 ( if present ) is routed to the amp 1 preamplifier 74 and thence to anti - alias filters and the adc 1 78 . in state 0 , the signal from the rx ( combined with the output of switch # 2 , if present ) is routed to the amp 2 preamplifier 76 and thence to anti - alias filters and the adc 2 80 . state 1 may be considered to be the normal state of the circuit , in which the received signal from the rx ( combined with the output of switch # 2 , if present ) travels through the signal analog channel and is converted to a digital data stream by the sig adc 78 , while the calibration data travels through the calibration analog channel and is converted to a digital data stream by the cal adc 80 . when state 0 is selected , the signal and calibration signals travel through the calibration and signal analog channels and are digitized by the adc &# 39 ; s 1 and 2 ( 78 and 80 ), respectively . switching from state 1 to state 0 thus permits calibration of the signal analog circuits 74 and adc 1 78 using the signal from the cx , while continuing to acquire the signal from the rx 16 ( combined with the output of switch # 2 , if present ) via the calibration analog circuits 76 and adc 2 80 . the control circuitry and / or software controlling switch # 1 may swap the digital data streams generated by the adc &# 39 ; s 1 and 2 ( 78 and 80 ) in a complementary fashion when the analog data streams are switched between state 1 and state 0 , or this complementary switching may be performed during later processing of the digital data streams . the purpose of this aspect of the calibration apparatus and methodology is to ensure that both the signal and calibration analog circuitry and their corresponding adc &# 39 ; s may be calibrated in a symmetrical manner using the cx signal , and to ensure that negligible sig data loss occurs during the calibration operation . if switch # 2 72 is present , a separate pair of leads runs to certain poles on switch # 2 72 , which poles are normally open ( state 0 ), but when closed ( state 1 ) place the cx coil 12 in opposition to the rx coil 16 . if a bx coil 14 is present and distinct from the cx coil 12 and if switch # 2 72 is present , its leads run to certain poles on switch # 2 72 , which poles are normally closed ( state 0 ) so that the bx 12 is connected in opposition to the rx coil 16 for normal operation of the system . state 1 of switch # 2 72 is used for calibration of the cx coil 12 relative to the rx coil 16 , according to the following methodology . switch # 2 72 may be present in the circuit only during initial calibration of the system , when it may be used to position the cx 12 and / or rx 16 coils and / or to adjust the parameters of the cx 12 and / or rx 16 coils , such that the combined signal from the rx and cx due to direct pickup of the tx field is at a minimum . this methodology ensures that the calibration analog signal emanating from the cx precisely matches the amplitude and phase of the rx analog signal due to direct pickup of the tx field . [ 0069 ] fig9 shows a two - dimensional embodiment of the array conductivity meter ( acm ) for the case with three receiver assemblies ( m = 3 case ) in which the transmitter tx 10 is located at the center of the array ( hatched ring ), the three receiver assemblies rx 1 , rx 2 and rx 3 80 , 82 and 84 respectively are disposed symmetrically at the vertices of an equilateral triangle at distances r rx from the transmitter ( large solid rings ), and the calibration coil cx 12 is located in proximity to the tx , for example at location cx a between the transmitter tx and the receiver assemblies or cx b inside the transmitter . [ 0070 ] fig1 shows an two - dimensional embodiment of the acm for the case with four receiver assemblies ( m = 4 case ) in which the transmitter tx 10 is located at the center of the array ( hatched ring ), the four receiver assemblies rx 1 , rx 2 , rx 3 and r 4 92 , 94 , 96 and 98 respectively are disposed symmetrically at the vertices of a square at distances r rx from the transmitter ( large solid rings ). as with the configuration described above the calibration coil cx is located in proximity to the tx , for example at location cx a outside or cx b inside the transmitter 10 . [ 0071 ] fig1 schematically depicts the application of the alternate embodiment of the modular calibration apparatus for the case of a two - coil acm showing receiver coils rx 1 100 and rx 2 , 102 a transmitter tx 10 and a calibration coil cx 12 . in this simplified circuit diagram the two receiver coils 100 , 102 are normally connected in opposition via switch # 2 ( state 0 ) 104 . state 1 of switch # 1 106 routes the signal output from switch 2 104 through the signal preamplifier 108 to the sig adc 110 , while the cx signal is routed through the calibration preamplifier 112 to the cal adc 114 . state 2 of switch # 1 reverses these signals . [ 0072 ] fig1 shows a schematic of a simplified version of the sensing apparatus wherein the calibration device 12 ( cx ) signal passes via attenuator att # 1 116 ( which may include anti - alias filters ) directly to analog - digital converter adc 1 118 and thence to input 1 or calibration signal 120 , and also to poles on sw 1 122 . the first receiver device ( rx 1 ) 124 and the second receiver device ( rx 2 ) 126 signals pass via preamplifiers amp 1 128 and amp 2 130 ( which may include anti - alias filters ) to a second set of poles on switch sw 1 132 . the output poles of sw 1 132 connect to analog - digital converters adc 2 134 and adc 3 136 and thence to inputs 2 or rx 1 signal 138 and input 3 or rx signal 140 , respectively . in this arrangement , adc / input channels 2 and 3 receive receiver signals 1 and 2 when sw1 is in position 1 ( operate ), and may be calibrated using the calibration signal by placing sw 1 in position 0 ( calibrate ) while the calibration signal continues to be monitored by input 1 . this approach permits the calibration of the electronics of adc 2 and adc3 and inputs 2 and 3 , respectively , relative to adc 1 and input 1 . monitoring of the calibration signal on input 1 permits the continuous calibration of the system for variations in transmitter signal amplitude and / or phase . in fig1 , the calibration device 12 cx signal passes via attenuator att # 1 116 ( which may incude anti - alias filters ) directly to input 1 120 ( here assumed to include signal conditioners and an analog - digital converter ), and also to an input pole on sw 1 142 . the receiver device 144 ( rx ) signal is connected to the other input pole of sw 1 142 . the output pole of sw 1 142 connects to input 2 146 ( here assumed to include signal conditioners and an analog - digital converter .) in sw 1 position 1 ( operate ) the receiver signal is routed by the switch to input 2 . in sw 1 position 0 ( calibrate ) the calibration signal is routed by the switch to input 2 while continuing to be monitored by input 1 . this approach permits the calibration of input 2 relative to input 1 . monitoring of the calibration signal on input 1 permits the continuous calibration of the system for variations in transmitter signal amplitude and / or phase . [ 0074 ] fig1 , shows an embodiment which enhances the operation of the embodiment shown in fig1 through the addition of sw 2 150 , which provides a means independent of the state of sw 1 142 of routing either the calibration signal or the receiver signal to input 1 120 . the normal operating mode would be with sw 1 142 up and sw 2 150 down , so that the calibration signal is routed to input 1 while the receiver signal is routed to input 2 146 . by switching sw 1 to the down position , the calibration signal is routed through input 2 in order to calibrate it relative to input 1 . by inverting the normal operating mode by switching sw 1 down and sw 2 up substantially simultaneously , the calibration signal can be transferred from input 1 to input 2 , while simultaneously switching the receiver signal from input 2 to input 1 . thus the calibration signal can be applied to one channel at a time without significant loss of receiver signal output . it will be appreciated by those skilled in the art that these figures describe the major components in the claimed embodiments of the present invention , and that other components , including but not limited to preamplifiers , amplifiers , filters , attenuators , analog - digital converters , and the details of the processing means , may or may not be represented , and that these other components may be located at more than one position in these drawings , such location differences leading to varying tradeoffs in performance , cost and flexibility in the resulting embodiment the invention consists of apparatus and methodology for improved quantitative measurement of the electromagnetic properties of earth materials . it includes two principal improvements over the state of the art and a number of secondary ones . the principal innovations comprise apparatus and methodology for quantitative calibration of the secondary field coupling ratio ( sfcr ) output of electromagnetic sensors ( or the analogous time - domain quantity in a time - domain sensor ) and apparatus and methodology for estimation of the electromagnetic properties of earth materials using multiple receiver arrays . one aspect of the invention provides a means of obtaining a precise amplitude and phase reference for calibration of electromagnetic sensors , and of using this calibration to compute calibrated secondary field coupling ratios ( sfcr &# 39 ; s ), which are the standard way to express the strength and phase behaviour of single or multi - frequency electromagnetic sensors . sfcr &# 39 ; s must also be computed , at least implicitly , when calibrating the output of time - domain electromagnetic sensors . specifically , quantitative calibration of electromagnetic sensors is accomplished through the use of a rigidly mounted calibration coil ( cx ) located in the vicinity of the transmitter coil ( tx ), preferably it is on or near the axis of the transmitter - receiver array . this coil should be wound such that its output arising from the primary field transmitted by the tx closely matches that of a receiver coil ( rx ) which is maximum - coupled to ( i . e . has the same geometrical configuration as ) the tx at that rx &# 39 ; s final location . the location of all coils is defined to be the geometric center of each coil . the cx position is then tuned by connecting the rx in opposition to the cx and monitoring the difference signal in an environment which generates negligible secondary field ( i . e . arising from eddy currents induced in the environment by the primary field ) response . the difference signal varies according to the location of the cx : at the optimal location , the difference signal goes through a minimum . the cx is then attached permanently to the mounting structure at this location . alternatively , the cx can be attached permanently at the outset of the procedure and the tx or rx position adjusted slightly to achieve the desired minimum in the difference signal before permanently attaching it to the mounting structure . when this procedure has been completed , the signal from the cx represents the strength of the primary field and is insensitive to variations in secondary field signal amplitude or phase ( as compared to the rx ) by the cube of the ratio of the distance between the tx and the rx to the distance between the tx and cx . a desired degree of sensitivity to a given maximum secondary field level in the calibration signal can be achieved by designing the cx effective area to be smaller than that of the rx by the desired sensitivity ratio and then mounting it at the appropriate distance ( the cube root of the ratio of the effective areas of the cx and the rx , multiplied by the tx - rx distance ) from the tx . the rx signal incorporates signals due to the secondary field and to the primary field . the rx and cx signals are digitized and may be digitally filtered , before computation of the discrete or fast fourier transform is performed to yield complex ( i . e . real and imaginary ) components at one or more frequencies of each signal , known as the signal and calibration , respectively . the complex ratio of the signal to the calibration at the frequency under consideration is multiplied by three factors the first relating to the complex ratio of the transfer functions of the preamplifier , amplifier , filters and analog to digital converters between the signal and calibration electronic channels at the frequency under consideration , the second to the effective areas of the cx , rx and bx ( if present ), and the third to the cubed ratio of the tx - rx distance to the tx - cx distance . the transfer function ratio between the signal and calibration electronic channels is estimated by switching the cx signal into each signal electronic channel using an appropriate switch or electronic switching network while continuing to monitor the cx signal through the calibration electronic channel , fourier - transforming the two signals , and computing the complex ratio of each cx - via - signal frequency component to the corresponding calibration frequency component . by maintaining an extra signal electronic channel through which any displaced rx signal can be digitized , or by simply swapping the rx and bx signals in a single - receiver system , the transfer function ratios at for each signal channel can be determined relative to the calibration channel at each frequency under consideration , improvements in this aspect of the calibration method and apparatus over the state of the art include : the use of electronic or switch switching to achieve effectively continuous digitisation of all data channels , which minimises the loss of data and so maximises the quantity of information obtained per unit of energy expended in the em transmitter , and the availability of explicit formulas for conversion of the signal and calibration measurements into the sfcr &# 39 ; s . the availability of continuous calibration information during the measurement is an improvement on methods in which the calibration is sampled at intervals . precise values of the transfer functions may be obtained during the measurement without significant loss of data . this ensures that errors in the sfcr &# 39 ; s due to temporal or thermally - induced changes in the transfer functions of the calibration or signal channels are reduced to negligible levels . variations in tx output amplitude or phase are automatically eliminated from the sfcr &# 39 ; s by this technique on a continuous basis . conventional hem sensors or signal processors , and some other mems and tcm &# 39 ; s , incorporate no means of compensating for such variations on a dynamic basis and must rely on the stability or regulation of the transmitter circuit and receiver circuitry themselves . another aspect of the invention exploits the observation that adding multiple receiver elements to a self - contained em sounding instrument need not add significantly to the instrument &# 39 ; s power consumption . the inclusion of multiple em receivers set up as an array relative to an em transmitter yield considerable additional information about the distribution of earth materials properties in the vicinity of the array . for depth sounding , the doi below the em sensor for each value of tx - rx coil separation or r rx 30 ( shown in fig1 ) or r 1 42 ( shown in fig4 ) in the array is strongly related to this separation . this effect is most easily exploited in the low induction number regime , i . e . when all coil separations are smaller than one - third of the average electromagnetic skin depth in the near - surface materials , although the benefits do persist at declining levels to larger values of coil separation and / or sensor height . in the low induction number regime , as noted during the description of the prior art , the rule - of - thumb doi for the hcop configuration is 1 . 5 times the tx - rx separation , while the doi for the plc is 0 . 5 times the tx - rx separation . for example , including multiple receiver assemblies as indicated in fig4 yields m doi &# 39 ; s of 1 . 5r 1 , 1 . 5 r 2 , . . . 1 . 5 r m when hcop receiver coils are included in the receiver assemblies , and m doi &# 39 ; s of 0 . 5 r 1 , 0 . 5 r 2 , . . . 0 . 5 r m when plc receiver coils are included in the receiver assemblies . these multiple doi &# 39 ; s provide mutually independent information about the conductivity structure of earth materials in the vicinity of the sensor array , which can be interpreted using a variety of techniques to yield an approximate image of the conductivity structure . such interpretation can be performed in real time for use by an operator or as an input to a process or machine . for enhanced detection of regions of anomalous earth materials properties in the vicinity of the array , multiple receiver assemblies may be disposed symmetrically about the transmitter . in the simplest case , pairs of receiver assemblies ( for m = 2 , 4 , 6 , . . . ) could be located at symmetrical distance increments to either side of the transmitter . such an array could be moved perpendicular to its long axis to search a swath for gradient anomalies in earth material conductivities . additional receiver assemblies could be added at the vertices of a polygon centered on the transmitter to improve areal coverage of the array ( eg fig9 - 10 ). for even values of the receiver assembly count m , symmetrical elements of the array may be directly connected in opposition and their combined outputs processed electronically ( see fig1 ) or their processed outputs may be differenced after acquisition ( see fig1 ). note that if the receiver assembly count m is an odd number ( eg fig9 ), direct connection in opposition is not an option . the direct - connection approach , in which only the difference signal between a given pair of coils is amplified , acquired and processed , yields a wider dynamic range , since most common em noise sources such as sferics ( arising from distant lightning strokes ) and power line interference tend to be relatively uniform over practical array dimensions ranging from fractional meters to say ten meters . the parallel - acquisition approach is more flexible and diagnostic , and may be implemented without major losses in dynamic range if high precision adc &# 39 ; s are used for data acquisition of each receiver &# 39 ; s output . parallel - acquisition also permits depth sounding data to be acquired along the swath covered by the array at doi &# 39 ; s dictated by the tx - rx separation and the receiver coil configuration ( s ) in each receiver assembly . the calibration methodology described above can be readily applied to this geometry , using a cx coil located either inside or outside of the tx ( eg at locations cx a or cx b in fig7 - 8 ) it will be appreciated by those skilled in the art that these two aspects of the present invention can have wide applications and can be incorporated into a wide variety of electromagnetic systems . the following are some examples of the application of the present invention : em sensors , in which the transmitter coil ( s ), calibration coil ( s ), receiver coils ( s ) and bucking coil ( s ) are integrated into the wing of an aircraft made of nonconductive composite materials ; calibration using transmitter current monitors rather than magnetic field pickup via cx coils ; application of inversion methods to multiple - receiver data for conductivity - depth section construction ; and method for improved estimation of the thickness and conductivity of a layer of moderate conductivity overlying a more conductive layer of known conductivity ( theoretical development not included here at this point ). it will be appreciated that the above description relates to the invention by way of example only . many variations on the invention will be obvious to those skilled in the art and such obvious variations are within the scope of the invention as described herein whether or not expressly described .
| 6 |
a preferred embodiment of a hub and pole assembly ( 10 ) in accordance with the invention is shown by itself in fig1 - 4 . the hub and pole assembly ( 10 ) comprises a hub ( 12 ) and a plurality of poles ( 14 ) attached thereto . the hub ( 10 ) comprises first and second portions ( 16 , 18 ) that are pivotally connected to each other about a hub axis . preferably , the first and second portions ( 16 , 18 ) are each a crossmember that crisscrosses the other crossmember . to minimize the thickness of the hub ( 12 ) without significantly impacting the strength and stiffness of the crossmembers ( 16 , 18 ), the first crossmember ( 16 ) comprises an opening ( 20 ) through which the second crossmember ( 18 ) extends . a central screw ( 22 ) is aligned with the hub axis and extends through the first and second crossmembers ( 16 , 18 ). a nut ( 24 ) secures the central screw ( 22 ) to the first crossmember ( 16 ) and the central screw ( 22 ) serves as an axle about which the second crossmember ( 18 ) can pivot . the opening ( 20 ) of the first crossmember ( 16 ) is preferably dimensioned such that the second crossmember ( 18 ) is pivotable through a range of slightly less than sixty degrees relative to the first crossmember ( 16 ). in the middle of its pivotable range , the second crossmember ( 18 ) preferably extends longitudinally at ninety degrees from the longitudinal direction of the first crossmember ( 16 ). fig1 and 2 depict the two extremes of the pivotal nature between the first and second crossmembers ( 16 , 18 ). the first crossmember ( 16 ) also preferably comprises a pair of oppositely projecting wings ( 26 ) that extend outwardly adjacent the opening ( 20 ) of the first crossmember . the wings ( 26 ) help prevent pliable shell material from interfering with the pivotal nature of the hub ( 12 ) when , as shown in fig5 , the hub and pole assembly ( 10 ) is attached to a pliable shell ( 28 ) to form a collapsible shelter ( 30 ) . the hub 12 also preferably comprises a plurality of pole attachment portions ( 32 ) that connect the poles ( 14 ) to the crossmembers ( 16 , 18 ). the pole attachment portions ( 32 ) preferably are pivotally attached adjacent the longitudinal ends of crossmembers ( 16 , 18 ) via screws ( 34 ). preferably , the screws ( 34 ) are oriented perpendicular to the radial and axial directions defined by the central screw ( 22 ) of the hub ( 12 ). each pole attachment portion ( 32 ) also preferably comprises a socket ( 36 ) configured to receive the end of the pole ( 14 ), which is preferably press fit or adhered into the socket such that it cannot easily be removed therefrom . each of the longitudinal ends of each of the crossmembers ( 16 , 18 ) preferably comprises a pivot - stop ( 38 ) that is configured to engage and abut the respective pole attachment portion ( 32 ) in a manner preventing the pole attachment portion from pivoting beyond a particular limit . when a collapsible shelter ( 30 ) comprising the hub and pole assembly ( 10 ) is in its erected configuration , each pole attachment portion ( 32 ) is biased against and firmly engages its respective pivot - stop ( 38 ). the hub and pole assembly ( 10 ) of the preferred embodiment is particularly configured to serve as a roof hub and pole assembly of a collapsible shelter ( 30 ), as shown in fig5 . each pole ( 14 ) that is attached to the hub ( 12 ) is preferably one of several poles that together constitute one of several legs ( 40 ) of the collapsible shelter ( 30 ). as shown in fig5 , each leg ( 40 ) of the collapsible shelter ( 30 ) passes through several loops ( 42 ) that are connected to the pliable shell ( 28 ) of the shelter . each leg ( 40 ) preferably comprises two telescopically attached pole sections ( 44 ) that extend primarily vertical . each leg ( 40 ) also preferably comprises an elbow joint ( 46 ) that pivotally connects the upper one of the telescopically attached pole sections ( 44 ) to the pole ( 14 ) of the leg that is connected to the hub ( 12 ). like the crossmembers ( 16 , 18 ) of the hub ( 12 ), each elbow joint also comprises pivot - stops that prevent the included angle between the telescopically attached pole sections ( 44 ) and the pole ( 14 ) of the respective leg ( 40 ) from decreasing beyond a particular amount , such as that shown in fig5 . in view of the foregoing , it should be appreciated that when the collapsible shelter ( 30 ) is in its erected configuration ( as shown in fig5 ), each leg ( 40 ) is generally rigid . in other words , the leg ( 40 ) can resiliently flex but it will not pivot at its elbow joint ( 46 ) or relative to the respective crossmember ( 16 or 18 ) that it is attached to because the pliable shell prevents it from doing so . thus , it follows then that the two or more legs ( 40 ) that are attached to a particular one of the crossmembers ( 16 , 18 ) of the hub ( 12 ) together also act as a generally rigid unit . notably however , due to the pivotal nature of the hub ( 12 ), such legs ( 40 ) are able to pivot about the hub axis relative to the two or more legs ( 40 ) that are attached to the other of the crossmembers ( 16 , 18 ). when the collapsible shelter ( 30 ) is collapsed , the poles ( 14 ) attached to the crossmembers ( 16 , 18 ) pivot about the screws ( 34 ) that secure the pole attachment portions ( 32 ) to their respective crossmember , as shown in fig3 . the telescopically attached pole sections ( 44 ) can also be collapsed and the leg can be folded in over itself via the elbow joint ( 46 ) that pivotally connects the upper one of the telescopically attached pole sections ( 44 ) to the pole ( 14 ) of the leg . thus , the hub and pole assembly ( 10 ) allows the collapsible shelter ( 30 ) to be stored or transported compactly . in view of the foregoing , it should be appreciated that the invention has several advantages over the prior art . as various modifications could be made in the constructions and methods herein described and illustrated without departing from the scope of the invention , it is intended that all matter contained in the foregoing description or shown in the accompanying drawings shall be interpreted as illustrative rather than limiting . thus , the breadth and scope of the present invention should not be limited by any of the above - described exemplary embodiments , but should be defined only in accordance with the following claims appended hereto and their equivalents . it should also be understood that when introducing elements of the present invention in the claims or in the above description of exemplary embodiments of the invention , the terms “ comprising ,” “ including ,” and “ having ” are intended to be open - ended and mean that there may be additional elements other than the listed elements . additionally , the term “ portion ” should be construed as meaning some or all of the item or element that it qualifies . moreover , use of identifiers such as first , second , and third should not be construed in a manner imposing any relative position or time sequence between limitations . still further , the order in which the steps of any method claim that follows are presented should not be construed in a manner limiting the order in which such steps must be performed , unless such and order is inherent .
| 8 |
accompanying fig1 depicts a system 10 which embodies an improved process for forming environmentally desensitized carpet yarns of the present invention . in this regard , a supply tank 12 containing a fiber - forming thermoplastic polymer in chip or flake form supplies a melt extruder 14 which forms a flowable melt of the thermoplastic polymer . preferably , the thermoplastic polymer is a nylon , such as nylon 6 , nylon 6 , 6 and the like . the melt flow of thermoplastic polymer is then directed to metering pumps 16 which deliver a metered flow of the thermoplastic polymer melt to the spinnerette 18 . as is well known , the melt flow of thermoplastic material is extruded through multiple orifices in the spinnerette 18 to form a corresponding plurality of filamentary polymeric strands 20 . before entering the spinnerette orifices , the melt flow of polymer has been filtered , as is generally employed and well understood by those of skill in the art . the particular temperature for the polymer in the spinnerette 18 depends upon the type of polymer being spun as well as its molecular weight . alternatively , the polymer may be made and spun in a one step process . that is , the polymer may be polymerized continuously from its constituent monomers and then fed as an already molten stream to the spinnerette . in such a case , of course , the melt extruder would not necessarily be employed . the molten filamentary polymeric strands 20 are quenched by means of a standard quench cabinet 22 which provides a flow of transversely moving cooling gas , especially air , as shown by the arrows . the thus solidified filamentary polymer strands are then configured into a close - packed , essentially monofilamentary layer so that a lubricating composition may be applied thereto by means of a finish applicator 24 . virtually any conventional finish applicator 24 may be employed , such as those disclosed in u . s . pat . no . 3 , 893 , 412 ( the entire content of which is expressly incorporated hereinto by reference ). guides 26 are employed to direct the individual lubricated multifilamentary yarn around a standard , commercially available , unheated pre - tensioning godet and separator roll 28 . the pretensioned multifilamentary yarn is then supplied to a first set of heated duo rolls 30 and then to a second set of heated duo rolls 32 operating at yarn speeds at the duo rolls 32 of from about 2000 to about 4500 m / min , more preferably between about 2700 and about 3800 m / min . the yarn is thus drawn between the rolls 30 and 32 at a draw ratio of between about 1 . 4 ( for high drawing speeds ) to about 3 . 6 ( for low drawing speeds ), preferably between about 2 . 8 to about 3 . 6 , and most preferably between about 3 . 0 to about 3 . 2 . the temperature of the second set of duo rolls 32 is most preferably at least between about 70 ° c . to about 190 ° c . greater than the temperature of the first set of duo rolls 30 . thus , for example , when processing nylon - 6 yarns , a temperature of between about 50 to about 70 ° c . for the first set of duo rolls 30 is desirable , whereas a temperature of between about 170 to about 200 ° c . ( advantageously about 190 ° c .) for the second set of duo rolls 32 is desirable . where processing nylon 6 , 6 yarns , a temperature of between about 50 to about 100 ° c . for the first set of duo rolls 30 is desirable , whereas a temperature of between about 170 to about 240 ° c . for the second set of duo rolls 32 is desirable . this relatively high draw ratio achieved between the first set of duo rolls 30 and the second set of duo rolls 32 and the relatively high precrimp temperature achieved at the second set of duo rolls 32 is believed to decrease substantially the sensitivity of the resulting carpet yarn when the yarn also exhibits a relatively high moisture content . although the duo roll 30 is depicted in fig1 as comprising a set of rolls , the process and systems in accordance with the present invention may be advantageously practiced with a single heated roll and an idler roll providing similar functions . the drawn and precrimped yarn is then directed to a conventional texturing unit 34 in order to produce a relatively bulky yarn which is discharged in crimped form onto a commercially available cooling drum 36 . directing the threadline into the individual texturing unit 34 can be conveniently accomplished by means of the devices disclosed in u . s . pat . no . 4 , 280 , 260 ( the entire content of which is expressly incorporated hereinto by reference ). the texturing unit 34 is preferably a fluid jet texturing unit well known to those of skill in the art and exemplified by u . s . pat . no . 6 , 141 , 843 , the entire content of each being expressly incorporated hereinto by reference . one particularly preferred texturizing unit is model no . stm - 25 commercially available from barmag / saurer gmbh & amp ; co . kg . the textured yarn is removed from the cooling drum 36 by means of guide roll 38 and takeaway godet 40 . the textured yarn is passed through a conventional fluid interlacer jet 42 to as to entangle the individual filaments in the yarn . the fluid interlacing jet may be , for example , those disclosed in u . s . pat . nos . 3 , 115 , 691 and 3 , 125 , 793 , the entire content of each being expressly incorporated hereinto by reference . the interlaced yarn is then directed via rolls 44 to a compensator 46 which facilitates winding of the yarn onto a take - up spool at the winder 56 . important to the present invention , however , is that prior to being wound onto the take - up winder 56 , the moisture content of the yarn is increased by bringing the yarn into contact with water applied via a water applicator assembly 48 . in this regard , deionized water at a substantially constant flow rate is supplied to the applicator assembly 48 by means of a non - peristaltic , continuous pressure , steady stream pump 50 . one particularly preferred pump 50 is model spx - 12 - 0500s1 commercially available from slack & amp ; parr ltd . of derby , england . the pump 50 supplies a constant uninterrupted stream of water at a relatively low pressure of less than about 10 inches - h 2 o which is maintained by head tank 52 . make - up deionized water is supplied to the tank 52 via valve 54 . an increased moisture content is thereby imparted to the filaments in the textured yarn by virtue of the applicator assembly 48 . the yarn spool at the winder 56 is most preferably encased in a sealed moisture - proof plastic envelope ( not shown ) and allowed to age for a few days , e . g ., for about 1 day up to about 14 days , and more preferably at least about 7 to about 10 days . alternatively , the yarn spool may be placed in a rigid moisture - proof container so as to seal it against water evaporation and / or placed in a humidity controlled atmosphere ( e . g ., a room or enclosure having between about 80 to about 100 % relative humidity atmosphere ). when wrapped with a moisture - proof plastic envelope , it is presently preferred to use a film formed of a polyolefin ( e . g ., polypropylene ) having a sufficient thickness and / or wrapped a sufficient number of time to achieve the moisture - proof envelope that is desired . especially preferred films for such purpose include 0 . 8 mil thick polypropylene film which is wrapped around the package several turns ( e . g ., about three turns ). multiple yarn spools are most preferably wrapped by the film . in this manner , the yarn on the spool will be further exposed to its own high moisture content environment within the envelope thereby facilitating its take - up of moisture to achieve the desired high moisture content as noted above . an especially preferred water applicator assembly 48 is depicted in cross - sectional schematic fashion in accompanying fig2 . in this regard , the water applicator assembly includes a winged wheel 48 - 1 to direct the textured yarn to a stationary applicator guide 48 - 2 . the applicator guide 48 - 2 includes a smooth convex surface 48 - 2 a surrounded by a pair of lateral guide arms 48 - 2 a ( only one of such arms 48 - 2 a being depicted in the cross - sectional view of fig2 ). a supply channel 48 - 2 c fluid - connects a supply inlet port 48 - 2 d to the surface 48 - 2 a . the supply inlet port 48 - 2 d is in turn fluid - connected to the non - peristaltic pump 50 . thus , a constant uninterrupted stream of water at a relatively low pressure is fed into the inlet port 48 - 2 d and is discharged onto the surface 48 - 2 a where it contacts the traveling textured yarn being guided therealong . the supply of water is thus picked up by the traveling textured yarn prior to proceeding to the winder 56 . excess water which is discharged to the surface 48 - 2 a but which is not picked up by the traveling textured yarn is captured within an anti - spray housing ( not shown ) surrounding the applicator assembly 48 and recycled for further use . it has been found according to the present invention that an increased moisture content of greater than about 3 . 5 wt . %, preferably between about 4 to about 10 wt . % ( based on the total yarn weight ), and more preferably between about 5 . 0 to about 8 . 0 wt . % yields carpet yarn which is dramatically less sensitive to ambient environmental conditions or temperature and / or atmospheric moisture ( relative humidity ). when the multifilamentary yarn is formed of nylon - 6 filaments , it has been found that a moisture content of between about 6 . 0 to about 7 . 0 wt . % (+/− about 0 . 5 wt . %) is especially desirable . the present invention will be further understood by reference to the following non - limiting example . a 1400 d solution dyed nylon - 6 automotive carpet yarn was made with 3 % ( low ) water addition using a peristaltic pump . the conditioned yarn was packaged in two stretch wrap units and aged in inventory for 10 days . after the initial 10 days , one of the stretch wrap units was opened and stored in a controlled environment of 85 % relative humidity ( wet ). the other stretch wrap unit of the low water addition conditioned yarn remained sealed in the stretch wrap ( dry ). after humid conditioning for 10 days , the wet yarn samples were tufted into the same carpet with the dry yarn samples . the wet and dry yarn samples were arranged in bands so that they could be compared side - by - side . the wet yarn in the carpet appeared visually darker due to crimp relaxation in the humid environment . likewise the dry yarn in the carpet appeared lighter since it has not been exposed to environmental moisture . example 1 was repeated using a 1400 d solution dyed automotive yarn was conditioned with 6 % ( high ) water addition using a non - peristaltic , continuous pressure , steady stream pump . the conditioned high water addition yarn was packaged in two stretch wrap units and aged in inventory for 10 days . after the initial 10 days , one of the stretch wrap units was opened and stored in a controlled environment of 85 % relative humidity ( wet ). the other stretch wrap unit of high moisture addition yarn remained sealed in the stretch wrap ( dry ). after humid conditioning for 10 days , the wet yarn samples were tufted into the same carpet with the dry yarn samples . the wet and dry yarn samples were arranged in bands so that they could be compared side - by - side . the yarn in the carpet with 6 % ( high ) water add - on exhibited less contrast wet to dry ( light to dark ) as compared to the 3 % ( low ) water add - on yarn . the additional water content which was added to the yarn by means of the present invention thus desensitized the yarn from the environmental difference . the moisture add - on effects of peristaltic and non - peristaltic pumps were examined using 1400 d solution dyed nylon - 6 automotive carpet yarn . the results graphically appear in fig3 . as shown , all other parameters being equal , a non - peristaltic pump achieves greater water add - on to the yarn as compared to a peristaltic pump at all pump rpm outputs . furthermore , by using a non - peristaltic pump , a greater maximum water add - on as compared to conventional peristaltic pumps is possible . while the invention has been described in connection with what is presently considered to be the most practical and preferred embodiment , it is to be understood that the invention is not to be limited to the disclosed embodiment , but on the contrary , is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims .
| 3 |
although the following description focuses on a patio door screen , it is not intended that the invention be limited in this aspect . the invention also may be embodied with other doors , windows , or the like . those skilled in the art will recognize these other uses without limitation . referring generally to the figures , there is illustrated a screen frame assembly ( 10 ) which includes a screen housing ( 14 ) and frame sections ( 11 , 12 , and 13 ) making up the frame ( 10 ). the assembly ( 10 ) slides within an opening of a closure assembly such as a patio door . the sliding action of the screen frame ( 10 ) is accomplished by sliding the screen frame along the edges ( 11 b and 13 b ) within tracks or channels normally found within a patio door assembly . these channels are found in the sill and the header of the door assembly . the screen frame ( 10 ) therefore moves as is known in prior art sliding constructions . however , integral with the framing section ( 10 ) is a compartment ( 15 ) within which is found a spring biased roll screen assembly . as best seen in fig2 the leading edge ( 31 ) of the screen ( 30 ) travels within the inside edges ( 13 a and 11 a ) of the frame portions ( 11 and 13 ) to and from a fully accumulated position wherein the screen is accumulated on the roll tube which will be described hereinafter , to a fully extended position wherein the leading edge ( 31 ) is located proximate the channel portion ( 12 a ) adjacent the interior of section ( 12 ) which screen edge ( 31 ) may be latched and / or locked in position . whether the screen ( 30 ) is at the fully accumulated or the fully extended position , the entire screen assembly ( 10 ) may be slid across the patio door opening . in this manner , the screen is slid out of a position where it might block the threshold to an occupant . this allows passage of wheel chairs , walkers and the like in a simple manner and overcomes one of the problems in the art . as best seen in fig3 and 4 the portion ( 13 b ) of section ( 13 ) has opening ( b ) therein to be received in standard sized channels or rails provided in the sill and header frames of the track assembly . the leading edge of the screen ( 31 ) will slide or be guided via guide ( g ) within the section ( 13 a ) within channel ( a ) thereof as described above and hereinafter to assist motion of the leading edge ( 31 ) of the screen ( 30 ). rollers ( r ) may be provided with the brackets ( 21 and 20 ) at mounting slots ( 20 d ) and ( 21 d ) which rollers travel within the sill track . they also may be provided for brackets ( 22 ) and ( 23 ) for the header . the bracket portions ( 20 , 21 , 22 and 23 ) also provide channel portions ( 20 a , 21 a , 22 a and 23 a ) which marry within the track portions of the closure assembly and which assist with the assembly of the screen frame 10 . as seen in fig1 a leg portions ( d ) and ( f ) for brackets ( 20 and 22 ) and ( 21 and 23 ) respectively interfit in channels ( b ), ( d ′) and ( b ′) respectively to assemble the frame sections ( 11 , 12 and 13 ) with the housing ( 14 ). the brackets also provide extensions for example , track portion ( 13 b ) and providing a channel ( b ) to receive the track disposed within the sill and header of the rails normally provided . the roller ( r ) therefore is spring biased as is known to accommodate various tensions . release pins may be provided , as is known , within the legs of brackets ( 21 and 23 ) to allow installation and replacement of the screen frame in a similar manner as conventional planer screen frames , which are known in the art . the brackets ( 22 and 20 ) support the roll screen assembly ( s ) therebetween mounted on a tube . the tube has a slot in it to receive one end of the screen with the other end of the screen being proximate the exit from the tube housing ( 15 ) as best seen in fig1 at ( 15 c ). the brackets ( 20 and 22 ) as best seen in fig6 , 8 and 9 have holes therein for aligning with holes ( y ) within the housing ( 14 ) to align the portion ( 22 z ) with portion ( 15 b ) and receipt of threaded screws . the mouth ( 15 c ) therefore of the cover ( 15 ) allows for the free end ( 31 ) of the screen assembly ( 30 ) to extend therefrom . locking portions ( 22 c ) provide locking of the roller tube in position . when fully assembled the screen assembly ( 10 ) therefore can replace an existing sliding screen utilizing the same channels of the existing patio door . this enables the homeowner to effect the replacement without the need for an experienced installer or add on supplementary components . no assembling is required . the screen assembly 10 merely drops into the existing channels . as can be seen from the figures , the present invention resembles the well - known prior art sliding patio door screen in that it may be slid from a position where it fully covers the door opening to a position where it does not . however , it clearly has the added advantage in that the screen may be accumulated on the roller when the entire frame is at the first position so that it does not block the view of the occupants when the patio door is in fact closed . however , when the patio door is open , the roll screen may be extended to the fully extended position and latched thereat so as to prevent insects from entering the dwelling . however , when an occupant wishes to exit the dwelling , the patio screen assembly ( 10 ) may be slid in a conventional manner so as to not obstruct the threshold as is the case with prior art structures discussed in the background of the invention . the framing sections ( 11 , 12 , 13 and 14 ) may be made from aluminum extrusions or the like , and the brackets ( 20 , 21 , 22 and 23 ) may be manufactured from nylon or other resins . section 14 may be an aluminum extrusion as well . the entire assembly may be provided in a kit of components wherein all of the framing sections ( 10 , 11 , 12 , 13 and 14 ), brackets ( 20 , 21 , 22 and 23 ) housing ( 14 ) and the roller screen assembly may be provided in the kit which may be easily assembled . when compared to the prior art constructions of phantom ™ or mirage ™, instead of the typical 22 steps in order to provide such a prior art construction which typically is done by an expensive installer , the present roll out screen will be marketed for substantially the same price as the well - known standard sliding planer screens in various consumer outlets and may be used to replace standard screens when they are in need of repair . further applicants may utilize the flexible screen connectors of fig1 in the screen assembly ( 10 ) as taught in its prior patent technology referenced above , using a roll tube having a compatible detent therein and handle portion having compatible detent therein for receiving the flexible t - shaped connector at each end of a screen cloth which may therefore may accommodate easy screen replacement . it is required that the same dimensions ( length , width and thickness ) be utilized for the threshold and header track engaging framing portions ( 11 and 13 ) as those which are standard at the present date . this will allow for easy replacement of the conventional planer screen with the present invention . as is taught in applicant &# 39 ; s prior invention the tube may be tensioned by the means as disclosed therein . referring now to fig1 , 10 a , 11 , 11 a , 11 b , and 14 there is illustrated the assembly ( 10 ) of fig1 engaging top rail ( r t ) bottom rail ( r b ) proximate the top thereof ( l ). conveniently therefore the sections ( 11 ) and ( 13 ) are provided having openings or channel sections as best seen in fig3 and 4 at ( 11 a ) and ( 11 b ) and ( 13 a ) and ( 13 b ) which as best seen in fig1 defining the top and bottom sections of the screen assembly ( 10 ) which now includes the housing for the roll out screen ( s ) and the frame sections ( 11 ) and ( 13 ) which includes an upper and a lower section or profile ( 11 a ) and ( 11 b ), ( 13 a ) and ( 13 b ) respectively . the inside portions ( 11 a ) and ( 13 a ) are for the receipt of the legs ( d ) and ( f ) of the brackets ( 20 , 21 , 22 and 23 ) to close the frame sections and integrate the entire assembly by attaching the housing and roll screen thereto . clearly , as can best be seen in fig1 a the roller ( r ) 24 ¢, engages the rail ( r b ) proximate the top thereof ( l ) in a conventional manner , said roller being provided with the brackets ( 21 and 20 ) and preferably ( 23 and 22 ) as previously described in relation to fig2 . the patio screen assembly ( 10 ) will therefore be free to roll upon the rails ( t , r and b ) in a conventional manner . however , the sections ( 11 and 13 ) also include sections ( 13 a and 11 a ) for receipt of and the carriage of the guide ( g ) for the handle ( h ) of the screen assembly accumulated on the tube ( t ) advanced via handle ( h ) to the guides ( 11 a and 13 a ) to proximate the section opening of ( 12 a ) where at the handle may be latched . the latch is not illustrated nor described and would be as is known . the brackets therefore in combination with the framing sections ( 11 , 12 , and 13 ) provide , along with housing ( 14 ), an integrated screen frame which will slide along the known rails in a patio door closure assembly with the guides ( g ) attached to handle ( h ) via the legs which extend upwardly and downwardly into the opening provided in the handle with the handle being engaged with the t section shown in fig1 at ( s 2 ) attached to the screen and the handle at ( 305 y ) and to the tube at ( 305 x ) via t section ( s 1 ). as seen in fig1 b the tube is attached to bushings ( b 1 and b 2 ) which are subsequently attached to the pins provided with each bracket ( 20 and 22 ) to allow for the rotation of the tube . the bushings therefore provide for the pivoting of the tube while the spring is attached to the pivot ( 20 b and 22 b ) and allows for pre - winding of the roller screen to a pre - determined tension to ensure that it will return to its fully accumulated position . referring now to fig1 and 13 there is illustrated examples of the various forms which the present invention may take without intending any limitation being derived by the reader in providing these examples . with regard to fig1 there is illustrated corresponding sections found in prior art installations typical for a slider window , for example a , wherein a channel is provided within which a typical screen frame fixed in position . however , the screen frame blocks the view of the individual as it is permanently placed in position until such time as it is removed . as seen in fig1 a , the present invention provides for a combination of the screen including a frame which engages the same channel section in the prior art window of fig1 a , and yet provides with the same frame section , the movement of the roll screen to and from the housing ( 14 ) to allow for the occupant to have the screen in place when the window is open and have the screen out of view when the window is closed . this may be accomplished utilizing the same window channel provided in known window and typically slider window constructions . referring now to fig1 b , there is illustrated a typical rail of a patio door having a section ( l ) which engages a roller attached to a frame section which also has permanently installed therewith a screen . with regard to fig1 b , the present invention includes and provides with the framing section and the assembly 10 , as seen and described in relation to the prior figures , a roller within section ( 13 b ) which engages the known rail ( l ) within channel section ( 13 b ), and wherein in addition the free end ( 31 ) of the roll screen is movable within the channel ( 13 a ) of section 13 . the same advantages are described in relation to fig1 a and are realized therefore as well with the patio door screen embodying the invention . the screen frame may roll on the rail ( l ) and the screen may be guided to and from an accessible position to a position wherein the screen is out of view . referring now to fig1 c or 12 d there is illustrated a typical casement window planer screen which is attached to a framing section permanently and would permanently block the view of an occupant through the casement window . the planer screen is released via a pin release in fig1 c or with a pivot pin in fig1 d moved in the directions indicated . utilizing the same channels and stops therefore the present invention in fig1 c and 13d provide for placing of a casement screen of the present invention in exactly the same manner as with the prior art constructions with the additional combination heretofore unknown of the framing section ( 13 ″) including portions ( 13 ″ b ) for engaging the known hardware within the frame section and section ( 13 ″ a ) for providing for the guiding channel of the free end of a roll out screen assembly which has been integrated therewith . as is normally required it is highly recommended that sealing portions ( not shown ) be provided for sections 12 and housing 14 disposed along the entire outside vertical edges thereof . referring now to fig1 a , 2a , 3 a , 4 a , 6 a , 7 a , 8 a , 9 a , 10 b , 10 c , 11 e and 11 d there is illustrated the screen assembly ( 100 ) similar in all respects to screen assembly ( 10 ) as previously described with the difference being that the screen assembly ( 100 ) does not roll or slide within a track . the screen assembly ( 100 ) which includes sections ( 111 , 112 , 113 ) and housing ( 114 ) supported on brackets ( 120 and 122 ) and further assembled with the assistance of brackets ( 121 and 123 ) consistent with the previous patio door example , and utilizing the similar bracket ( 122 ) for example in fig6 a and 7a which includes a leg ( 122 x ) which will be inserted within the framing sections ( 113 and 111 ) to assist with the assembly of the embodiment . as best seen in fig1 c , 11d and 11 e the conventional u - shaped section ( 200 ) is provided in a window assembly frame to which the window screen ( 100 ) will engage in a manner as shown in relation to fig1 b and 10c consistent with previously described patio door embodiment with the section ( 200 ) being engaged by the leg ( 122 b ) of the window screen ( 100 ) having a roll screen as seen in fig1 e contained within the housing ( 114 ) identical to fig1 a in all respects except that it is now a window screen as opposed to a patio door screen . therefore , fig1 b and 11e are comparable and the reader is referred thereto for like parts , and the operation thereof with the exception of the sliding . the descriptions are very much the same . the essence therefore , is that the window screen assembly ( 100 ) will interfit within the frame section ( 200 ) provided adjacent the header and sill of a window closure assembly with the invention ( 100 ) including the roll out screen within housing ( 114 ) being guided via guides ( g ) within frame elements ( 111 a and 113 a ) to and from the accumulated and the employed position . when the window screen requires replacement or repair , it can easily be removed from the channel ( 200 ), repaired or replaced by dropping the new screen or repaired screen in position . the window embodiment of window screen ( 100 ) may also be utilized with the other examples provided in fig1 a , b and c . a man skilled in the art would understand what minor modifications would have to be made to do so . therefore , in essence the present invention provides for a combination of features heretofore unknown allowing for installation of the various forms of the invention within the hardware and channel portions already provided with known window constructions , patio door constructions , and casement window constructions . the illustrations and descriptions in relation to fig1 and 13 are for illustrative purposes only and in no way limit the invention . as many changes can be made to the preferred embodiments of the invention without departing from the scope thereof . it is intended that all matter contained herein be considered illustrative of the invention and not it a limiting sense .
| 4 |
reference will now be made in detail to embodiments , examples of which are illustrated in the accompanying drawings . in the following detailed description , numerous non - limiting specific details are set forth in order to assist in understanding the subject matter presented herein . it will be apparent , however , to one of ordinary skill in the art that various alternatives may be used without departing from the scope of the present invention and the subject matter may be practiced without these specific details . for example , it will be apparent to one of ordinary skill in the art that the subject matter presented herein can be implemented on any type of standalone system or client - server compatible system containing any type of client , network , server , and database elements . wherever possible , like reference numbers will be used for like elements . a web - based system is a web - based or internet enabled desktop or mobile software application . a web - based system is a software system that communicates with a server or backend system over the internet . a web - based application is accessed by its users over the internet . an internet enabled desktop or mobile application may need its users to access its functionality in a browser . web service ( also webservice ), as defined by the w3c , is a software system designed to support interoperable machine - to - machine interaction over a network . an application programming interface ( api ) is an interface that defines the ways by which an application program may request services from libraries and / or operating systems . real - time in the context of this invention is as the user performs an action . fig1 is an illustration of an exemplary embodiment 100 in accordance with the present invention where usage data may be recorded client - side , transmitted to and stored on one or more servers , then accessed over a network . the exemplary system 100 comprises a computer 101 , which may be connected to a network 10 ( e . g ., wide area network ( wan ), metropolitan area network ( man ), or local area network ( lan )) over a wired ( e . g ., tcp / ip over ethernet , ieee 802 . 3 ) or wireless ( e . g ., wifi ( 802 . 11 ), gsm , gprs , w - cdma , edge , or the like ) communications protocol / layer , for access to one or more hosted website ( s ) 107 . a handheld device ( not shown ) with a processor and memory may also be used in lieu of the computer 101 . the handheld device may be configured for communication over the network 10 . the network 10 may be connected to one or more servers 103 with access to one or more media storage devices ( e . g ., storage servers , databases , or the like ). the servers 103 may receive requests over the network 10 to store ( via the client - side recording application 102 ), retrieve ( via the access and play application 104 ), and transmit one or more files that may contain usage content ( e . g ., usage content of a user using computer 101 , or the like ). the client - side recording application 102 and access and play application 104 may be implemented as separate applications or as features of a single recording / playback application , without departing from the scope of the present invention ( for ease of reference , the names of the applications may be used interchangeably herein and the use of one of the applications does not imply exclusion of any of the other applications ). alternatively , the computer 101 may store and load files locally in and from storage ( e . g ., hard drive , flash drive , cd - rom / rw , tape drive , solid state memory , or the like ) ( as described for the exemplary embodiment 200 of fig2 ), or via a connection to one or more other computers or servers 103 ( e . g ., remotely ). in some embodiments , the client - side recording application 102 ( or , alternatively , recording / playback application ) may be implemented by a recording / playback application module 409 ( shown in fig4 ) that executes on an operating system 407 ( also shown in fig4 ). the recording / playback application module 409 ( or , a browser module 408 executing an embedded recording / playback application module 404 ) may call one or more modules via an application programming interface ( api ), or may implement the programming code ( e . g ., object - oriented event / exception - based code ) necessary , for recording the usage data of a user of the computer 101 . for example , the client - side recording application 102 may record the usage data of a user of the computer 101 by repeatedly invoking the print screen function , then saving each image , or may record specific websites accessed , alphanumeric characters entered , text / video chat sessions opened , or recognizable events on the computer 101 ( collectively or individually referred to herein as usage , usage data , or usage content ). the client - side recording application 102 may associate each saved image with any combination of a date / time stamp , user - name , website 107 accessed over the network 10 , and / or other criteria . the print screen function may be invoked at a specific time interval ( e . g ., 1 millisecond , second , minute , hour etc .) or the application 102 may have a default setting associated with recording the user &# 39 ; s usage data at a default interval . the images , which may correspond to the graphics shown on the display device of the computer 101 , may be saved to memory ( e . g ., memory 302 , local storage 306 , fig3 ) on the computer 101 and maintained there for some period of time or may be transmitted over the network 10 using , for example , network interface card 304 , to one or more servers 103 with access to one or more storage devices . the transmission of the saved usage data by the application 102 using the network 10 may be performed continuously or at a specific time interval . in some embodiments , the saved usage data is stored locally in memory until a threshold capacity of the memory is reached . the threshold may be the maximum size of the memory , a default value , or may be configured through the client - side recording application 102 . the one or more servers 103 with access to one or more storage devices may receive and record the transmitted usage data , and may associate the transmitted usage data with the client - side recording application 102 , user , and / or computer 101 from which the usage data was received . the application 102 may execute as background process in a multi - threaded environment , for example , without the user of the computer 101 being aware of the application &# 39 ; s execution . for example , the parent ( or any qualified user ) of a child user ( or any user ) may configure the settings of the application 102 such that it starts upon the child ( or any user ) logging in , at a predetermined start time , or based on other criteria such as a next user session , for a given number of user sessions , during all sessions within a date range , or for all sessions all the time . in some embodiments , immediately upon starting , the client - side recording application 102 may start recording user actions along with user interaction with the user interface . in some embodiments , the settings of the application 102 may also be configured to stop its execution upon the child ( or any user ) logging in / out of the computer 101 , at a predetermined stop time , after some time has passed since the application &# 39 ; s start time , or based on other criteria . the settings associated with the application 102 may be stored locally in the computer 101 in an encrypted file or other file that may not be accessed or altered by any user except a qualified user . in some embodiments , the access and play application 104 ( or , alternatively , recording / playback application ) may be implemented by a recording / playback application module 409 ( shown in fig4 ) that executes on an operating system 407 ( also shown in fig4 ). the recording / playback application module 409 ( or , a browser module 408 executing an embedded recording / playback application module 404 ) may call one or more modules via an application programming interface ( api ), or may implement the programming code ( e . g ., object - oriented event / exception - based code ) necessary , for accessing and playing usage data , of a user of the computer 101 , from the one or more servers 103 with access to one or more storage devices . for example , the application 104 may execute on a playback computer 105 ( or handheld / mobile device , not shown ), which may communicate with the one or more servers 103 over the network 10 . the application 104 may send a request to the servers 103 for access to the usage data of the user of the computer 101 . the request may be approved following an authorization procedure such as , for example , a login by way of a username or password or other means known to one of ordinary skill in the art . if the request for access is not approved following the authorization procedure , the playback computer 105 executing the access and application 104 is denied access to the usage data of the user of the computer 101 . if the request is approved , a network connection may be established between the servers 103 and the playback computer 105 for transmitting the usage data from the one or more server 103 to the computer 105 . the access and play application 104 may , upon receipt of the transmitted usage data , play the usage data in a player 106 . the usage data played in the player 106 may be text , picture , slideshow , video , or other media format , with or without audio . although the usage data may be played immediately upon receipt , the player 106 may utilize memory ( e . g ., memory 302 , local storage 306 ) to buffer the usage data as it is received . the size of the buffer available for the player 106 may be configured using the settings of the access and play application 104 . in some embodiments , the usage data received may be saved to memory first , prior to the user of the playback computer 105 invoking the play feature of the player 106 . fig2 is an illustration of an exemplary embodiment 200 in accordance with the present invention where usage data may be recorded client - side and accessed directly without the use of a network . the client - side recording application 202 operates like the client - side recording application 102 except that it may not interface with any servers ( e . g ., servers 103 ) over network 10 . rather , the usage data that is recorded may be saved locally in memory ( e . g ., memory 302 , local storage 306 ), and not in the storage devices accessible by any servers . in addition , the access and play applications 204 , 208 , whether executed on the playback computer 205 or the user computer 201 , operate similar to the access and play application 104 except that they may not request usage data from any servers , or receive any such usage data from any servers . rather , if the qualified user of the access and play application 204 , 208 is authorized ( e . g ., successful login ), the usage data ( e . g ., interactions with hosted website ( s ) 207 ) may be received from the memory of the user &# 39 ; s computer 201 and played in the player 206 ( also available to the access and play application 208 ). 100471 in some embodiments , as shown , the access and play application 208 and the client - side recording application 202 may be implemented as separate applications or as features of a single recording / playback application , without departing from the scope of the present invention . in some embodiments , the playback computer 205 may connect directly with the user &# 39 ; s computer 201 using a wired ( e . g ., usb , serial / parallel port ) or wireless ( e . g ., bluetooth ) connection . the access and play application 204 may request access to the usage data saved in memory on the user &# 39 ; s computers 201 as a client of the access and play application 208 , which may be executing on the user &# 39 ; s computers 201 . fig3 is an illustration of an exemplary system block diagram 300 of a computer or mobile device executing the parent recording / playback application in accordance with the present invention . the exemplary system 300 for implementing an exemplary embodiment of the present invention comprises a computer processing unit ( cpu ) 301 , memory 302 , display device ( s ) 303 , a network interface card ( nic ) 304 , auxiliary device ( s )/ component ( s ) 305 , and local storage 306 . these elements may communicate over one or more local buses . the cpu 301 may fetch instructions to execute from memory 302 , where the instructions may be from an operating system 307 and , further , from a browser 308 ( with or without having an embedded recording / playback application ) and / or recording / playback application 309 ( with or without being embedded in a browser ) executing via the operating system 307 . the recording / playback application 309 may receive / fetch files from local storage 306 and / or over a network 10 using the nic 304 for communication with one or more servers 103 . the recording / playback application 309 may also be embedded within a browser 308 and may access files in local storage 306 and / or over a network 10 . the display device ( s ) 303 may be a laptop or computer display , tv screen , or other display ( e . g ., such as that of a handheld device ) capable of receiving display signals . the display signals may comprise , for example , one or more frames per second of video or other content . the content may be opened and played by the recording / playback application 309 . other auxiliary device ( s )/ component ( s ) 305 may also receive or otherwise communicate via the local bus . for example , a portable media player , mobile telephone , or other auxiliary device may act as a source / sink of files . the auxiliary device ( s )/ component ( s ) 305 may also be additional display devices and / or devices capable of supporting the execution of the recording / playback application 309 . fig4 is an illustration of an exemplary application modules diagram 400 of the execution of the modules / engines of a recording / playback application 409 in accordance with the present invention . the exemplary modules 400 for implementing an exemplary embodiment of the present invention comprise browser modules 401 - 404 and / or recording / playback application 410 - 412 . the browser modules 401 - 404 may comprise a communications module 401 , an interpreter 402 ( e . g ., xml , html or script / mark - up language interpreter ), browser components 403 ( e . g ., navigation functions , add - in ( s )/ on ( s ), custom user options ), and an embedded recording / playback application 404 . the recording / playback application modules 410 - 412 may comprise feature components 410 , a content reader 411 , and a controller 412 . the browser modules 401 - 404 may be used to implement the browser - related features of the exemplary embodiments , while the recording / playback application modules 410 - 412 may be used to implement the recording / playback application - related features of the exemplary embodiments . in some embodiments , the communications module 401 receives and transmits data over a network ( e . g ., network 10 ) through one or more ports ( e . g ., http port 80 ); the interpreter 402 may interpret scripts / mark - up languages and execute them in accordance with their instructions ; the browser components 403 may implement features such as those for navigating the internet , supporting add - in ( s )/ on ( s ), implementing custom user options and executing in accordance with those options ( e . g ., permissions , home page preference , bookmarks , script preferences , history preferences , privacy preferences , web page preferences , and / or other internet / user options ); and , the embedded recording / playback application 404 ( which may , in some embodiments , be an add - in / on ) may record , transmit , and play usage content in accordance with the present invention as described herein . fig5 is an illustration of exemplary method steps 500 for monitoring , transmitting , and recording usage of a computer or mobile device connected to a network . the computer - implemented methods steps are for executing a script locally on the computer or mobile device , the script facilitating a connection to one or more servers accessible by the computer or mobile device over the network 501 ; monitoring the usage of the computer or mobile device as displayed on a display device 502 ; transmitting usage data to a storage device , the storage device residing on the one or more servers accessible by the computer or mobile device over the network 503 ; and recording , by the storage device , the usage data received from the script 504 . fig6 is an illustration of exemplary method steps 600 for playing recorded usage of a computer or mobile device . the computer - implemented methods steps are for connecting , by a playback computer or playback mobile device , to one or more servers accessible by the playback computer or playback mobile device over a network 601 ; requesting access to the recorded usage of the computer or mobile device , as displayed on a display device of the computer or mobile device 602 ; receiving access to usage data stored on a storage device , the storage device residing on the one or more servers accessible by the playback computer or playback mobile device over the network 603 ; and playing , by the playback computer or playback mobile device , the usage data stored on the storage device 604 . fig7 is an illustration of exemplary method steps 700 for playing recorded usage of a computer or mobile device without connecting to a network . the computer - implemented methods steps are for connecting directly , by a playback computer or playback mobile device , to a computer or mobile device 701 ; requesting access to the recorded usage of the computer or mobile device , as displayed on a display device of the computer or mobile device 702 ; receiving access to usage data stored locally on a storage device , the storage device residing on the computer or mobile device 703 ; and playing , by the playback computer or playback mobile device , the usage data stored on the computer or mobile device 704 . it will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the spirit or scope of the invention . thus , it is intended that the present invention cover the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents .
| 6 |
referring to fig1 a dynamoelectric machine is illustrated , that is an ac generator with a superconducting dc field winding 10 on a rotor 12 . the machine also comprises a stator 14 with a stator winding 16 . rotor 12 on a shaft 18 is located within the stator . the stator 14 and its winding 16 are only partially shown in fig1 . the rotor 12 carries the supercooled field winding 10 enclosed within a structure that includes , for example , a retaining cylinder and a radiant heat shield within a vacuum shell , the details of which are not shown . outside the vacuum shell of the rotor 12 is a warm damper shield 20 with which the present invention is particularly concerned . damper shield 20 comprises over a major portion of its length a central cylinder 21 of highly conductive material such as copper , aluminum , or alloys of copper or aluminum ( zirconium - copper and ofhc copper are more specific examples ), with inner and outer support cylinders 22 and 23 metallurgically bonded to it of a high strength , less conductive material such as one of the superalloys , for example that available commercially under the name inconel 706 . the outer damper 20 has a fixed attachment at at least one end 24 to the rotor but may have a flexible attachment at its other end 25 such as in accordance with u . s . pat . no . 4 , 123 , 676 . fig2 shows more specifically the structural features and nature of the end portions of the damper shield 20 . as seen here the central core cylinder 21 terminates a distance from each end of the damper shield 20 and is there joined with end cylinders 26 and 27 of high strength material , such as inconel 706 , in a manner in accordance with the present invention that includes having mating grooves 28 within the adjacent axial elements 21 , 26 and 27 that can be fit together to provide a unitary cylinder of uniform inner and outer dimensions . to the central cylinder of the core cylinder 21 and end cylinders 26 and 27 there is formed on its surfaces by explosive welding additional cylinders of high strength material . in this example these include two such cylinders on each side , inner support cylinders 22a and 22b and outer support cylinders 23a and 23b , for an overall structure that is substantially free of voids that performs with high strength under the conditions to which the superconducting rotor 12 is subjected and , by the conductivity of the central core 21 , shields the rotor winding 10 from the effects of fields in the air gap and the like . proceeding with a description of the method by which the damper assembly 20 is formed , the separate pieces 21 , 22a , 22b , 23a , 23b , 26 and 27 of the assembly are processed , such as by cold working , including cold roll extrusion , to provide relatively high strength elements . the superalloy ( e . g . inconel 706 ) pieces can be solution annealed and aged to obtain maximum properties after final cold working . after the core cylinder 21 and end cylinders 26 and 27 are initially formed of uniform inner and outer dimensions , mating end regions are subjected to a machining operation to provide the mating grooves 28 therein . as depicted in fig2 the grooves are formed in the inner surface of the ends of core cylinder 21 and in the outer surfaces of the ends of the end cylinders 26 and 27 . it is however to be understood that the grooving operation may be reversed and that each end of the warm damper 20 need not be identically grooved . in the case in which the grooves 28 are separate , substantially parallel and identical grooves , it is then necessary to expand one of the elements , the core cylinder 21 in the example shown in fig2 sufficiently to allow the end cylinders 26 and 27 to be inserted therein and to have them mate at the grooves 28 . thermal expansion and shrinking is not employed for this purpose because of danger of destroying the cold worked properties of the copper piece 21 . mechanical expansion is possible but is an undesirable technique in view of the size of the elements involved . it also may result in a greater need for further reduction by cold working or machining to completely work the unit back into a uniformly dimensioned continuous cylinder . in accordance with a more preferred technique , the grooves 28 at each end of the central cylinder elements 21 , 26 and 27 are essentially screw threads , that is , continuous spiral grooves , that permit the mating elements to be screwably joined or threaded together without heating or mechanical expansion to result in a uniformly continuous cylinder normally without need for subsequent machining . no additional cold working is required for the screwed together elements except that occurring in the subsequent explosive welding operation . in either form of assembly , soldering or brazing can be performed if desired at the mating grooved joint 28 , but it is advantageous that the technique of this invention does not require reliance on soldering or brazing for achieving a good joint , free of voids , and high strength throughout the structure to the extent of the technique of the copending application . if soldering or brazing is done , care must be taken to do it at a temperature below that at which the cold worked properties of the copper 21 would be damaged . after the central cylinder is formed as described , the inner and outer shells 22 and 23 are explosively welded to it and , as shown in the example of fig2 may each comprise more than one individual shell where successive ones are explosively welded to the prior welded ones . explosive welding provides well bonded joints over the major surfaces of the cylinders . the problem with it is that it imposes such forces on the elements that the previously formed joints of the central cylinder are highly stressed . the problems are aggravated by the large dimensions of the element as they are required for a superconducting rotor . for example , for a superconducting rotor of the 300 mva generator , the following table presents the design dimensions : ______________________________________element approx . dimension______________________________________damper shield 20 , overall 153 . 75 in . ( 390 cm . ) lengthend cylinders 26 and 27 , 10 . 0 in . ( 25 . 4 cm . ) length ( including groovedportion ) grooved joint 28 , length 5 . 0 in . ( 12 . 7 cm . ) grooved joint 28 , depth and 3 / 16 in . ( 0 . 5 cm . ) pitchdamper shield , 20 , inner 31 in . ( 79 cm . ) diameter of cylinder 22bdamper shield 20 , outer 37 . 5 in . ( 95 cm . ) diameter of cylinder 23bcore cylinder 21 and end 1 . 0 in . ( 2 . 5 cm . ) cylinders 26 and 27 , thicknessinner and outer cylinders 9 / 16 in . ( 1 . 4 cm . ) 22a , 22b , 23a , 23b , thickness ( each ) ______________________________________ the dimension of the table indicate how large are the areas of the joints involved in the structure of this example and the length of the joints of the central cylinder that are subjected to the large forces of the explosive welding process , i . e ., roughtly about 100 in . ( 250 cm .) in circumference . ensuring close contact with no significant separation over the entirety of such extensive joints is , however , achievable by the practice of this invention despite the large dimensions and the large forces incurred in explosively welding the additional cylinders . generally speaking , the present invention is regarded as particularly advantageous and desirable in constructing warm dampers of at least about 50 cm . in diameter and at least about 200 cm . in length . it is therefore seen that the present invention provides an improved means to hold components of the central cylinder of the dissimilar metals together in such a manner so as to substantially prevent voids from forming as the explosive welding forces are applied over the joints . a warm damper shield results that is effective in the operation of a superconducting rotor even when subjected to perturbations normally encountered in machine operation .
| 7 |
examples of a power amplifier according to the invention will be described with reference to fig3 through 6 . fig3 is a circuit diagram showing the arrangement of a first example of a power amplifier of this invention . for simplification in description , in fig3 those components which have been previously described with reference to fig1 are designated by the same reference characters or numerals , and the following description is primarily directed to the components in fig3 which are different from those in fig1 . as is apparent from comparison of fig3 with fig1 the circuit in fig3 is different from that in fig1 in the provision of diodes d 3 and d 4 . the diode d 3 is connected between the positive terminal of the dc source + e 2 and the collector of the transistor q 1 in the class a amplifier , which is connected to the collector of the transistor q 3 in the class b amplifier . the diode d 4 is connected between the negative terminal of the dc source - e 2 and the collector of the transistor q 2 in the class a amplifier , which is connected to the collector of the transistor q 4 in the class b amplifier . the operation of the power amplifier thus arranged will be described with reference to waveform diagrams in fig4 and 5 . the waveform diagram of fig4 is for the case where the power amplifier is operating normally , and the waveform diagram of fig5 is for the case where the load becomes abnormally heavy . in the normal operation , an input is applied to the drive stages a 1 and a 2 , the outputs of which are applied to the transistors q 1 and q 2 in the class a amplifier and the transistors q 3 and q 4 in the class b amplifier , respectively . thus , the transistors q 1 and q 2 and the transistors q 3 and q 4 operate according to the amplitudes of the outputs of the drive stages a 1 and a 2 . in this operation , a current i b as shown in fig4 ( a ) flows in the collector of the transistor q 3 in the class b amplifier , a current i a as shown in fig4 ( b ) flows in the collector of the transistor q 1 in the class a amplifier , and a current i c as shown in fig4 ( c ) flows in the diode d 3 . a voltage waveform at the connecting point a of the collectors of the transistors q 1 and q 3 is as indicated by reference character a in fig4 ( d ). a voltage waveform at the connecting point b of the collectors of the transistors q 2 and q 4 is as indicated by reference character b in fig4 ( d ). a voltage at the connecting point c or at the output terminal out is as indicated by reference character c in fig4 ( d ). as the load is increased and the class a amplifier is caused to operate in a class b amplification mode , the waveforms at the aforementioned various circuit points become as shown in fig5 ( a ) through ( d ), wherein fig5 ( a ) through ( d ) correspond to fig4 ( a ) through ( d ), respectively . when the class a amplifier is caused to operate in class b amplification mode , then no currents are supplied to the class a amplifier from the dc sources + e 2 and - e 2 ; that is , the class a amplifier is effectively disconnected from the dc sources at the diodes d 3 and d 4 . thus , the application of feedback to the class b amplifier is temporarily suspended . therefore , with a large positive signal the transistor q 3 is rendered completely conductive , and with a large negative signal the transistor q 4 is rendered completely conductive . thus , the collector current i b of the transistor q 3 is as shown in fig5 ( a ). on the other hand , with the large positive signal the transistors q 4 and q 2 are rendered non - conductive , and with the large negative signal the transistors q 3 and q 1 are rendered non - conductive . therefore , the currents i b , i a and i c mentioned above become as shown in fig5 ( a ), ( b ) and ( c ), respectively . the voltage at the connecting point c or at the output terminal out is as indicated by reference character c in fig5 ( d ). as is apparent from the above description , even when a problem occurs in the class b amplifier , no over - voltage is applied to the capacitors c 1 and c 2 ( fig2 ) forming the dc sources + e 2 and - e 2 , and accordingly the capacitors c 1 and c 2 will never be damaged . fig6 is a circuit diagram showing a second example of the power amplifier according to the invention . the circuit shown in fig6 can be obtained by connecting a resistor r between the connecting points a and b in the circuit of fig3 . owing to the provision of the resistor r , a current i r flows in the resistor r at all times even when the class a amplifier is caused to operate in a class b amplification mode . therefore , a potential slightly lower than 2e 2 is maintained between the connecting points a and b . in other words , the voltages at the connecting points a and b follow voltage variation at the connecting point c . thus , there is substantially no possibility that when the connecting points a and b are released from the circuit in the example shown in fig2 the transistors q 3 and q 4 will be rendered conductive to thus increasing the collector loss . in summary , the circuit in fig6 is advantageous in that the class a amplifier is protected from the adverse effect of a problem occurring in the class b amplifier , and lowering of the efficiency of the class b amplifier can be prevented . as is clear from the above description , according to the invention , the diodes are inserted between the dc sources of the class a amplifier and the collectors of the transistors in the class b amplifier so that , when the operation of the class a amplifier is shifted into a class b amplifier operation as the load is increased , the supply of current from the class b amplifier to the dc sources of the class a amplifier is prevented . thus , the capacitors forming the dc sources of the class a amplifier can be protected from damage .
| 7 |
this invention pertains to injection molding techniques wherein the term &# 34 ; injection molding &# 34 ; is defined as a conventional injection molding process involving the rapid injection of a moldable material into a cavity formed by at least a pair of closed mold members . this invention is also directed at the use of expanded thermoplastics , the term &# 34 ; thermoplastic &# 34 ; is used in its conventional sense , which is a polymeric material that is capable of being repeatedly softened by heat and hardened by cooling and includes as examples materials such as styrene polymers and copolymers , acrylics , cellulosics , polyolefins , vinyls , nylons , various fluorocarbons and mixtures thereof . also included in the term &# 34 ; thermoplastics &# 34 ; are the aforementioned thermoplastics containing minor amounts of ordinary compounding ingredients such as lubricants , stabilizers , antioxidants , fillers , colorants , and small or minor amounts i . e ., less than about 10 % by weight , of specialty materials including thermosetting plastics which are generally defined as materials that will undergo a chemical reaction by action by heat , catalysts , ultraviolet light , etc ., leading to a relatively infusible state , and are exemplified by such materials as amino compounds ( melamines and ureas ), polyesters , alkyds , epoxides , phenolics and elastomers that are generally defined as substances that can be stretched at room temperature to at least twice their original length and , after having been stretched and the stress removed , return with force to approximately their original length in a short time and are exemplified by such materials as natural rubber , acrylic rubber , butadiene - styrene ( sbr ) rubber , chloroprene ( cr ) rubber , chlorosulfonated polyethylene rubber , fluorocarbon rubber , isobutylene - isoprene ( iir ) rubber , isoprene ( ir ) and butadiene ( br ) rubbers , nitrile - butadiene ( nbr ) rubber , ethylene - propylene - diene ( epdm ) rubber , polyisobutylene rubber , polysulfide rubber , silicone rubber and urethane rubber . two of the more useful thermoplastics in this particular invention are terpolymers of acrylonitrile , butadiene , and styrene generally known as &# 34 ; abs &# 34 ; resins and polystyrene . the aforementioned thermoplastics are compounded to expand in the injection molding cycle by action of expansion agents which are generally defined as chemicals that generate inert gasses on heating causing the composition in which they are placed to assume a cellular ( or expanded ) structure . typical of these expansion agents are ammonium bicarbonate ; ammonium carbonate ; surface coated urea ; biuret / urea compositions ; p , p &# 39 ;- oxybis -( benzenesulfonyl hydrazide ); 1 , 3 - diphenyl triazene ; azodicarbonamide ; 4 , 4 &# 39 ; diphenyl - disulfonyl azide ; dinitrosopentamethylenetetramine ; n , n &# 39 ;- dimethyl n , n &# 39 ;- dinitrosoterephthalamide ; etc . these materials may be used in amounts ranging from 0 . 1 to 20 parts by weight based on the amount of thermoplastic . there are many articles that may be made from this inventive method including the aforementioned appliance housings , furniture components , as well as other articles such as automobile interior trim , airplane interior components , etc . these articles , made by this novel method , are characterized by a smooth , evenly colored skin over a substantial portion of their surface . by the term &# 34 ; substantial portion &# 34 ; is meant usually greater than about 50 % of the surface area and as much as all of the surface except that which is adjacent the sprue hole or holes . this invention may be practiced with conventional injection mold members which generally comprise blocks of hard materials , usually of metal , that are adapted to come together at highly machined mating surfaces to form at least one fluid tight cavity therein in the shape of the article to be molded . injection molds are generally made of high quality steel or other ferrous metals ; however , this invention may be utilized with other conventional mold materials including , but not limited to , nickel - chrome steel , brass , aluminum , etc . referring now to the drawings wherein like elements are identified with like numerals throughout the seven figures , fig1 shows in cross - sectional view , a pair of typical injection mold members in the open position . these members are generally mounted in a molding machine ( not shown ) and are adapted to move toward and away from each other in controlled alignment . mold member 1 is shown comprised of mold sides 3 that surround a portion of mold cavity 5 formed therein . the terminal portions of mold side 3 form mold mating edges 7 that surround mold opening 9 ; edges 7 are machined to a high precision finish . positioned adjacent but apart from mold member 1 is sprue - containing mold member 11 . mold member 11 is comprised of mold sides 13 that surround a portion of mold cavity 5 formed therein . the terminal portions of mold sides 13 form mating edges 15 that also surround mold opening 9 . mating edges 15 are machined to fit in fluid tight relationship with edges 7 upon closure of mold members 1 and 11 to form mold cavity 5 as shown in fig2 . mold members 1 and 11 are maintained at a temperature below about 100 ° f throughout the molding cycle for reasons explained later . sprue - containing mold member 11 contains at least one sprue 17 that comprises a passageway through member 11 and is adapted to receive the injection nozzle ( not shown ) from an injection molding machine ( not shown ) for receipt of a charge of moldable plastic . mold cavity surface 19 that surrounds mold cavity 5 is usually a polished surface in the outline of the article to be molded therein . positioned in mold sides 3 , and optionally in mold sides 13 , are fluid passageways 21 that connect mold cavity 5 with the outside of the respective mold members and throughwhich fluid is directed to pass according to the invention as later described . positioned about sprue 17 on mold cavity surface 19 is membrane 23 which comprises a thin , smooth - surfaced , non - porous elastic membrane that is anchored to mold member 11 by anchoring means 25 . anchoring means 25 is shown in fig1 - 3 to comprise snap - collar 27 that is complementally received in groove 29 . the function of means 25 is to anchor membrane 23 to cavity surface 19 in a fluid tight condition to aid in containing a later injected charge of moldable plastic . means 25 may be of temporary or of permanent construction depending upon the configuration of membrane 23 and may comprise other , well - known anchoring devices such as bolted - in collars , glued - in marginal edges , a threaded base receiving a threaded terminal ring on the membrane , etc . membrane 23 is denoted as being &# 34 ; thin ;&# 34 ; this term is used herein to indicate a range of thicknesses between about 1 / 2 to 20 mils ; however , it may be made thicker or thinner for specialized purposes . membrane 23 should be smooth surfaced so that it will enter into high fidelity conformity with mold surfaces 19 that form the interior of cavity 5 and to easily release from both cavity surface 19 and the article molded therein . membrane 23 should also be non - porous so that it will contain an injected charge of molten thermoplastic without leakage . finally , membrane 23 should be constructed of an elastic material so that it will repeatedly and easily deform and stretch of fit the confines to mold cavity 5 without rupturing or otherwise failing . examples of materials useful as membrane 23 include thin sheets of cured natural rubber , phenolic cured butyl rubber , and other cured rubbery materials , for example acrylic rubber , styrene butadiene rubber , chloroprene rubber , chlorosulfonated polyethylene rubber , fluorocarbon rubber , isobutylene - isoprene rubber , ethylene - propylene - diene terpolymer rubber , isoprene rubber and butadiene rubber , nitrile - butadiene rubber , polyisobutylene rubber , polysulfide rubber , silicon rubber , and urethane rubbers . these rubbers may include minor amounts of other materials , for example , mold release agents , fillers , reinforcing powders , and other compounding ingredients , and synthetic polymeric materials , such as the thermoplastics and thermosetting resins . it should be pointed out that membrane 23 should be treated under processes generally known in the art so as to be non - adherent to both mold cavity surface 19 and to the expanded thermoplastics injected therein , such as by compounding mold release agents into membrane 23 or by applying a coating of mold release agent to both surfaces thereof . fig2 shows mold member 1 and sprue - containing mold member 11 in closed position and after the injection of short - shot 31 of molten expandable thermoplastic through sprue 17 . the injection is accomplished by placing the nozzle portion of the injection mechanism ( not shown ) against sprue 17 and injecting short - shot 31 through sprue 17 and into cavity 5 and membrane 23 so as to form a pocket therein . the term &# 34 ; short - shot &# 34 ; denotes that the quantity of molten material injected into cavity 5 is less than the total volume of cavity 5 ; this is so that the molten material may later expand to form a cellular structure within cavity 5 . the expandable thermoplastic injected into mold cavity 5 is in a molten state i . e ., it is at a temperature sufficient to make it fluid ; for acrylonitrile - butadiene - styrene ( abs ) resins this temperature may be around 430 ° f . and for other thermoplastics the temperatures would be polyethylene ( 120 ° f . - 170 ° f . ), polyvinyl chloride ( 300 ° f . - 360 ° f . ), polystyrene ( 520 ° f . ), nylon ( 500 ° f . - 540 ° f . ), acetal resins ( 390 ° f . - 450 ° f . ), etc . in addition the injection is usually conducted in stages , a first stage of high pressure injection ( termed &# 34 ; booster &# 34 ;) and a second stage of lower pressure injection ( termed &# 34 ; injection forward &# 34 ;). booster stages are usually of shorter duration than injection forward stages , e . g . 4 seconds vs . 6 seconds , and the pressure levels of the stages also vary -- booster being higher , e . g ., 1200 psi ., than injection forward , e . g . 1000 - psi . however , the establishment of proper molding conditions for each particular thermoplastic is fully within the ambit of one skilled in the art and should be gained without undue experimentation . during the injection of molten expandable thermoplastic short shot 31 , there should be a simultaneous increase or raising of the pressure within mold cavity 5 , via fluid passageways 21 ( from a pressurization source that is not shown ) so that the cavity pressure increases to a level below that of the injection pressure but above that of the thermoplastic expansion pressure prior to completion of the injection . that is to say , the injection molding machine should be controlled or programmed to cause pressurization of mold cavity 5 , during injection of short - shot 31 , so that the expandable thermoplastic enters mold cavity 5 and forms a pocket 33 in membrane 23 , but does not expand into a cellular structure at this point . the cavity pressure may be most conveniently increased by application of compressed air through passageways 21 into cavity 5 from a pressurization source that is connected through conventional controls with the injection molding machine . other pressurization fluids may be used in particular instances such as steam , nitrogen , water , etc ., however the fluid must be compatible with the material making up membrane 23 i . e ., not react with or deteriorate it . the final level of pressurization in cavity 5 should be below the injection pressure ( generally 1200 - 1400 p . s . i . in the case of abs resins and above the thermoplastic expansion pressure ( generally 70 to 90 p . s . i . in the case of abs resins ), and has been found to produce the best results at between 100 to 180 psi and more preferably about 140 p . s . i . the term &# 34 ; p . s . i .&# 34 ; is used herein to denote &# 34 ; pounds per square inch gauge &# 34 ; pressure . the pressurization of cavity 5 must be controlled so that the buildup occurs either over a substantial portion of the total injection time or such that membrane 23 is not exposed to the final cavity pressure prior to being deformed by at least part of the thermoplastic charge . this is necessary because membrane 23 tends to rupture in the area of sprue 17 when exposed to full cavity pressure without something ( material , mold nozzle , etc .) to abut against it -- similar to a tire blowout condition . short - shot 31 forms pocket 33 in membrane 23 that generally takes the form of a spherical mass . it is extremely important that short - shot 31 forms this interim configuration within mold cavity 5 prior to expanding into full conformity with mold surface 19 . the reason for this is that the rate of heat transfer from short - shot 31 to mold sides 3 is significantly reduced through the combined heat flow resistances of membrane 23 and the compressed air or other fluid in mold cavity 5 . this decreased heat transfer rate permits slower cooling of the surface of short - shot 31 and the development of a very thin film or skin 35 on the exterior of the thermoplastic charge adjacent membrane 23 . this development of a skin occurs at a rapid rate , albeit at a lower rate than that which would occur if short shot 31 were injected immediately into contact with cavity surface 19 . upon achieving the development of the thin skin adjacent the smooth surface of membrane 23 the pressure in mold cavity 5 is released to permit expansion of the molten thermoplastic by action of the expansion agent and concomitant deformation of membrane 23 into full conformance with mold cavity surface 19 as shown in fig3 . upon expansion of the molten thermoplastic into a cellular structure , thin skin 35 , developed adjacent membrane 23 , is slightly stretched and placed into conformance with mold cavity surface 19 ( separated therefrom by membrane 23 ) and forms a smooth , evenly colored skin over the article formed therein . the thickness of skin 35 over the article formed in cavity 5 may vary from 0 . 10 to greater than about 10 mils depending on the thermoplastic and the molding cycle parameters however , it is of the same polymeric composition as that of the cellular structure absent , of course , the cellular structure . the formation of skin 35 is almost completed by the end of the total injection cycle , i . e ., by the time short - shot 31 is fully injected into cavity 5 . thus , the pressure in cavity may be released shortly thereafter ; in the case of abs resins the skin forms rapidly enough to permit release of the cavity pressure immediately after the injection cycle is completed . with other thermoplastics the time may vary one way or the other ; the best time for each particular molding situation may be readily determined by trial and error -- generally speaking if the cavity pressurization occurs too early in the injection cycle the membrane ruptures ; if the pressurization occurs too late the expansion is premature and the surface is of poor quality , if the pressure is released ( and optionally a vacuum applied as described later ) too early the expansion is premature and the surface is of poor quality , and if the pressure is released ( and optionally vacuum used ) too late the skin becomes too thick and cracks during expansion . a separate embodiment of this method is the inclusion of the application of a vacuum to mold cavity 5 after release of the pressure therein , said vacuum being applied via passageways 21 to aid in the expansion of the thermoplastic in short - shot 31 . skin 35 developed adjacent membrane 23 is developed at a slower rate than would occur upon injection against cavity mold surface 19 so that the skin that is developed is smooth and free of defects such as mottling , swirl patterns , flow lines , and pin holes . the cycle time from the initial injection of short shot 31 into cavity 5 , the subsequent release of cavity pressure ( and optional application of vacuum ), and expansion of thermoplastic into full conformance with surfaces 25 occupies a period of time not significantly greater than conventional injection molding cycle times for similar materials without the practice of this invention . it is especially important to maintain mold members 1 and 11 at a temperature approaching room temperature , i . e ., 70 ° f ., but at least below about 100 ° f . to permit rapid chilling and setting of the expanded thermoplastic material upon release of the cavity pressure . by maintaining the mold members at temperatures below 100 ° f . the shin that is formed over the article , is formed rapidly , and the balance of the expanded cellular structure inside the article produced in mold cavity 5 is chilled at a rate that permits demolding within reasonable injection molding cycle times . upon demolding of the article shown in mold cavity 5 of fig3 membrane 23 is required to be removed therefrom . for this purpose , anchoring means 25 may be in the form of a temporary anchor such as a spring clip , etc ., that may be easily removed from groove 29 in mold member 11 , and either membrane 23 peeled from or cut from the article produced therein . another membrane is then inserted in mold cavity 5 . another embodiment of the method of this invention is shown in fig4 - 7 . fig4 shows mold members 1 and 11 in an arrangement similar to fig1 except that mold member 11 has extended sides 3 so as to take up more of the surface of the article produced therein . membrane 23 is placed in cavity opening 9 between open members 1 and 11 . thereafter , the mold members are closed tightly against mating edges 7 and 15 to form fluid tight cavity 5 therein and also to clamp membrane 23 between the mating edges in fluid tight relationship to form a pair of compartments 37 and 39 . thereafter , the air is exhausted from the sprue side compartment 39 to force membrane 23 to deform into conformance with surface 19 of sprue - containing mold member 11 . simultaneously , the opposite side compartment 37 is gradually pressurized to aid in the deformation of membrane 23 . thereafter , ( fig6 ) short shot 31 is injected through sprue 17 against membrane 23 , while cavity 5 is simultaneously gradually pressurized to a level below that of the injection pressure and above that of the thermoplastic expansion pressure , so that non - expanded thermoplastic short shot 31 forms a pocket 33 in the sprue side of the mold cavity ( compartment 35 ) bounded by membrane 23 and mold surface 19 . that portion of short shot 31 in contact with membrane 33 gradually cools and forms thin smooth skin 35 adjacent thereto . thereafter , the pressurization in mold cavity 5 is exhausted through fluid passageways 21 , and optionally a vacuum is applied thereto , to permit expansion of the short shot 31 and deformation of membrane 23 into full conformance with mold surfaces 19 to form an article having a smooth , thin skin over that portion of the cellular structure in contact with membrane 23 . this expansion of shot 31 is shown in fig7 . although the article produced in this embodiment of the invention will have a smooth , unmottled skin , over approximately half of the mold surface , the length of mold sides 3 in either mold members 1 and 11 may be adjusted to obtain a skin over that portion of the articles surface that will be exposed to view and / or wear . an example of an abs thermoplastic usable in the practice of this invention is cycolac jp which is an expandable , injection molding grade acrylonitrilebutadiene - styrene terpolymer resin from marbon chemical company . another preferred material for use in the practice of this invention is a polystyrene such as styron 666 polystyrene resin from dow chemical company that is compounded with 2 % by weight of celogen az blowing agent obtainable from uniroyal corporation . following is an example given to show one skilled in the art an indication of how to practice the method of this invention , and to indicate how a conventional injection molding machine may be set up to conduct this inventive method . a conventional screw - type injection molding machine was set up identical with the embodiment shown in fig4 - 7 and with the conditions shown below in table i . table i______________________________________injection molding conditionstemperature pressure cycle______________________________________ booster - nozzle 430 ° f . 1200 p . s . i . booster - 4 sec . injectionfront zone 450 ° f . forward - injection 1100 p . s . i . forward - 10 sec . center zone 420 ° f . back - mold closed - 50 p . s . i . variablerear zone 390 ° f . mold members 70 ° f . ______________________________________ a quantity of cycolac jp was placed in the feed hopper of the molding machine and the machine started up to commence molding . the pressurization of mold cavity was varied , and the surface smoothness ( in microinches ) of the article molded therein was measured to obtain an indication of the level of pressurization required to obtain a smooth surface skin . for the purposes of this example , from 1600 and more micro - inches is considered a rough surface , 1100 to 1600 microinches is considered an improved surface , and below 1100 microinches is considered a smooth surface . in addition , the air pressure and vacuum applied to the cavity ( and the membrane ) was applied at different times during the process and their effects judged by viewing the article molded in that particular cycle . further , the mold temperature was varied in combination with the air pressure and with the placement and removal of the membrane in the mold cavity to demonstrate the variation in surface smoothness produced by the method of this invention . finally , the effects of these latter conditions ( mold temperature -- membrane placement -- air pressure ) were also determined for a feed of styron 666 polystyrene resin from dow chemical containing 2 % by weight celogen az expansion agent . a sheet of cured natural rubber 10 mils thick and 36 inch × 36 inches in size was placed over the mold opening and used as the membrane . this material was a smooth surface , elastic , non - porous membrane known as code 14 - 125 rubber sheet ( otherwise known as &# 34 ; dental dam &# 34 ;) obtainable from fisher scientific company , 711 forbes avenue , pittsburgh , pennsylvania . the cavity was pressurized at a linear rate from zero to maximum pressure such that the maximum pressure occurred during the last half of the injection cycle . thereafter it was immediately exhausted or released ( maximum delay after full injection was 0 . 5 seconds - 0 . 1 seconds ) to permit expansion of the thermoplastic . all of the results are shown below in tables ii , iii , and iv . table ii - effect of cavity pressure on smoothness of abs molded article table ii______________________________________effect of cavity pressureon smoothness of abs molded articlemaximum cavity article surfacepressure ( psig ) smoothness ( microinches ) ______________________________________0 175010 175075 1500140 900______________________________________ table iii - effect of mold temperature , use of membrane , and cavity pressure on smoothness of expanded abs molded article table iii______________________________________effect of mold temperature , use ofmembrane , and cavity pressure onsmoothness of expanded abs molded article maximumcavity cavity article surfacemold pressure smoothnesstemperature membrane ( psig ) ( microinches ) ______________________________________70 ° f not used 0 180070 ° f used 0 175070 ° f not used 140 incomplete expansion150 ° f not used 0 150070 ° f used 180 900______________________________________ table iv - effect of mold temperature , use of membrane , and cavity pressure on smoothness of expanded polystyrene molded article table iv______________________________________effect of mold temperature , use ofmembrane , and cavity pressure onsmoothness of expanded polystyrenemolded articlemold maximum cavity article surfacecavity pressure smoothnesstemperature membrane ( psig ) ( microinches ) ______________________________________70 ° f not used 0 130070 ° f used 0 125070 ° f used 100 900150 ° f not used 0 1200______________________________________ this example shows that the skin forms on the injected charge of molten thermoplastic adjacent the membrane during the injection cycle , and that the skin is formed sufficiently at the end of the injection cycle so that , almost immediately , the pressurization in the mold cavity may be released and optionally a vacuum applied to permit full expansion of the thermoplastic . the expansion forces the developed skin into conformity with the mold surface . this indicates that although the molding cycle of this invention is not significantly greater than conventional molding cycles , the interposition of the membrane permits a lower rate of cooling and development of the skin on the thermoplastic and that this novel feature permits an article to be molded by this method that has a smooth evenly colored skin over a substantial portion of its surface .
| 8 |
fig1 a symbolically illustrates the start of a color file which contains a picture - like motif as a stored data set . the format shown is the simplest format which is used for such a recording . in the case of this example , one byte is used as data storage space for each image point , and it is intended that this format be designated as the whole - tone format . in order to provide sufficient range using such a small memory requirement per pixel , the pattern must satisfy the precondition that the sum of the different color tones , including their intensities , does not exceed the number 255 . in the field of the color finishing ( printing ) of textiles , there are many patterns which correspond to this requirement . this is primarily because , in the case of many color systems which are used , for example , for reasons of color fastness , unsightly mixed colors are dispensed with . since , for reasons of cost , reliance is placed on a small number of stencils , the economically processable patterns are those which consist of only 6 to 16 different colors . the representation of a byte in this image is symbolized by boxes a , into which the value of one byte is entered . this value denotes the number of the color . for some applications , it is necessary to define how the color of a given number is to be composed from components . other definitions are also necessary . if the pattern which is described by this file is to be output , for example , on a monitor screen , it is necessary to know which r , g , b intensities are to be associated with a specific byte value . in addition , it must be known how many image points or pixels or bytes form a pattern row , whether this pattern row is to be displayed horizontally or vertically on the monitor screen , how often , if necessary , the motif thus formed is to be repeated horizontally or vertically , etc . for the purpose of engraving a stencil , on the other hand , it would not be absolutely necessary to know the exact composition of the color . however , it is important to know , for example , how many bytes of the file form an image point row , how often this image point row must be repeated on the circumference of a stencil , etc . in the case of the production methods which are common nowadays , it is often not possible during the production of a pattern on an engraving system to dispense with displaying it on a monitor , therefore , all this information , together with the color information , is most expediently placed in a file header . this header is not shown in fig1 a , but it has a defined format . the program controlling the engraving on an engraver is aware of this format and is therefore capable of extracting from the file header all the information which is necessary for the operation and reading - out of the pattern . the engraver , for example , a laser engraver , must receive switching - on and switching - off signals for the laser during the engraving of a stencil , since , for example , a lacquer layer must be removed from the surface of a rotary screen or must be hardened , which can be carried out in a manner known per se by a laser beam . for the purpose of rapid data transfer , recourse is made here to the smallest logic unit which is capable of transporting a switch - on or switch - off command , and this is just one bit . although it would be conceivable to use a byte (= 8 bits ) or a nibble (= 4 bits ) for a switch - on or switch - off command , for the reason mentioned this is not the aim or is the aim only in very infrequent cases ( long , severely disturbed data lines from the control computer to the engraving machine ) the task is therefore to form from the whole - tone format shown in fig1 a bit sequence - the so - called engraving format - which is suitable and correct for the respective engraving task . this format is shown in fig1 b . in the case of this example , in contrast to fig1 a , a dedicated box b is used for each bit . one byte is then formed by eight successive boxes b and is identified by the sections c . in addition , it is assumed that the engraving format for the stencil is intended to be produced with the number 1 , that is to say for the first stencil of the set or the first color . a bit may only be set , that is to say obtain the value 1 , if the value content of a byte of the whole - tone format ( fig1 a ) corresponds exactly to the number 1 . in the other case , when the value of a byte in the whole - tone format does not correspond to the number ( here 1 ) of the stencil which is about to be engraved , then that bit in the engraving format which corresponds to this byte must be set to the value 0 . in other words , a logic and operation is carried out between the number of the desired color and the color information contained in the byte . according to the invention , this conversion of the byte sequence of fig1 a to the bit sequence of fig1 b takes place in the control computer 16 of the engraving system or on a further computer , which is not identical to the computer of the cad system which is pre - processing the pattern , but which can most certainly be connected to the latter via a data network line or a bus line . the number of the desired color is entered into the control computer 16 or further computer via a keyboard . in addition to the previously discussed pattern reproductions and the files associated with these for the storage of the pattern data , there are cases in which the color reproduction at each individual image point is intended to be carried out by mixing different amounts of color or by means of the output of different intensities of three different color components . this is a common process , for example , in the case of a correspondingly multicolored display of a pattern on a monitor . in the case of textile printing colors , too , such a mixture is sometimes the aim in spite of all the difficulties involved with the formation of mixed colors . a set of stencils which consists of three to six individual stencils is able to reproduce a highly colored pattern using this small number of stencils . since , in spite of its high color , such a pattern reproduction gives rise to only low investment costs , it is cost - effective . the color system of the printing colors must be suitable for such a mixed - color formation . such a pattern then needs very much more color information and , therefore , a greater memory capacity must be available for one image point . therefore , fig2 a shows once more the part of a color file which describes a pattern , but here a monitor image which contains a large number of different color values and intensities is described . on the monitor , the colors , as is known per se , are represented by the three color components r ( ed ), g ( reen ), b ( lue ), the intensity of each of these three color components being able to be set between a minimum color value and a maximum color value . further , it is intended to be assumed that a dataword of length two bytes is available for describing each intensity of the three components , and that the intensities can therefore be described by values between 0 and 65535 . these colors are intended to be transferred to a set of stencils , which consists of 13 stencils and with which , therefore , 13 different colors can be printed . in each case three 2 - byte - long datawords d are combined to form one data set e , which precisely describes the three color components r , g , b in their respective intensity . the format of the data in this color file is intended to be designated as the half - tone format , since , using this type of data recording , it is possible to characterize colors having a very large number of hues and a large number of intensities - so - called halftones . however , it is still not possible to form the engraving format using this information alone . in order to produce the engraving format , it is necessary to define colors , for example in a table , by means for the statement of limiting values for the individual color components . such a table or color palette is shown in fig2 b . this contains , for each of the printing colors listed , an upper and a lower limiting value which must be transgressed if a hue is intended to be assigned to the printing color listed . a data set e of the half - tone format ( fig2 a ) is then replaced by one of the color numbers 1 to 13 of the table if the intensity of each color component of this data set e is located within all the component limiting values of this color . if a data set which describes the color of an image point cannot be assigned to any of the 13 colors , it may then receive , for example , the color number of the image point which could last be assigned . this is of importance in the case of mixed hues in the transition region between two hues . if the color number which is obtained in this manner agrees with the number of the stencil which is about to be engraved or of the stencil for which the engraving format is being produced , then the bit representing the data set is set to 1 , otherwise it is set to 0 . the corresponding bit sequence is shown in fig2 c . here , too , the conversion of the halftone format ( fig2 a ) into the engraving format ( fig2 c ) is executed according to the invention by the control computer 16 of the engraver or by a further computer which is interlinked with the latter . for this purpose , the color palette according to fig2 b is stored in the control computer or further computer and the number ( e . g ., 13 ) of the desired color is also entered . if the operating speed of the control computer 16 or of the computer combination of this and the further computer is sufficient , the comparison of the half - tone format with the color component limiting values of the stencil which is about to be engraved is best carried out during the engraving - that is to say &# 34 ; on the fly &# 34 ;. the comparison of the color intensities with the limiting values can be carried out very rapidly in the case of &# 34 ; on the fly &# 34 ; scanning , since each data set e of the half - tone format only has to be compared with the 3 times 2 limiting values for the color components of the stencil which is about to be engraved . however , in this case , it is not so simple to decide to which color an image point is to be allocated if the component intensities do not fit into the table . this color point is lost or leaves a white point behind on the substrate to be printed . on the other hand , if temporary memory files are produced for the 13 stencils , then the loss of one image point is less probable , since this is replaced by the color (= stencil ) of the last assigned image point . the risk of forming white flecks in the transition zones from one color to the other is therefore lower . shown in fig3 a is a further pattern - describing part of a color file in the half - tone format . it is assumed here that the intensity values correspond to the normal monitor intensities , that is to say they have values which lie between 0 and 255 . furthermore , it is presupposed here that , using this file , a half - tone stencil set which consists of only three stencils is to be produced . this set of stencils must then produce mixed colors during the subsequent printing process . one stencil is then produced for one of the three color components r , g , b . since the color intensity values do not exceed that value which can be represented by one byte , one data set e needs only three bytes of memory capacity here , namely one byte for each of the three color components r , g , b . during the engraving of the red stencil that byte which describes the intensity of the red component for each image point to be produced on the stencil is read out . the same is true for the other color components . fig3 b shows a further part of the information which is important for the processing of the data set of fig3 a . this is the gray tone reference cell of a half - tone grid . such reference cells can be defined in separate files . in the header of the data set of fig3 a , there is then only an indication of the correct reference cell and the correct reference cell file . this gray tone reference cell consists here of 11 times 11 color or individual cells g . these individual cells g contain , for example in a rectangular spiral h running towards the center , monotonically increasing intensity values from 1 to 255 . since , in this example , there are fewer color or individual cells than intensity values , the intensity values increase from cell to cell by a value 2 and , after every ninth cell , by the value 3 . both the representation of the gray tone reference cell and that of the color or individual cell are to be understood symbolically . with its individual cells , the gray tone reference cell serves as a type of comparison original and is stored only temporarily in the control computer 16 or further computer . it is the smallest part of the half tone grid on which the pattern image is desired to be based and which is necessary for assigning the pattern data on a half - tone - like grid . the half - tone grid is rotated with respect to the circumferential direction or the axial direction for several reasons ( e . g ., avoidance of moire , avoidance of seams ) . due to this rotation , the reference cell of the half - tone grid must also be thought of as rotated with respect to the circumferential direction of the stencil to be engraved . the focused , engraving laser beam moves over the stencil on a track of closely adjacent helical lines . therefore , the laser beam has , in relation to the reference cell f , virtually the same inclination which the circumferential direction assumes . a section of such a helical line is designated as i . the control computer of the engraver or a further computer assigned to this section follows , by means of a corresponding calculation , the track of the focused laser beam through the reference cell f and its individual cells g , and also the intensity values which are to be lifted from the half - tone file ( fig3 a ) for the respectively current image point . each time that the laser beam dips into an individual cell g , the intensity value of the cell is compared with the intensity value of the image point to be engraved . if the intensity value from the half - tone file is greater than that of the individual cell g , the laser is then switched on or remains switched on . if , on the other hand , the intensity value from the halftone file is smaller than that of the individual cell g , then the laser is switched off or remains switched off . if the grid assignment is not carried out &# 34 ; on the fly &# 34 ; but beforehand , and if a temporary file in which the bit sequence of the engraving format is stored is formed , then a bit is set to 1 in a quite analogous manner if the laser were to be switched on or were to remain switched on , vice versa . here , too , the gray tone reference cell according to fig3 b is stored in the control computer 16 or further computer . in addition , it is possible to communicate to the computer ( also via manual entry ) information regarding for which color components r , g , b a stencil is to be produced or engraving bit sequence is to be created . fig4 shows a laser engraver 1 known per se . on the latter , a stencil 2 to be engraved is clamped between two supporting cones , the headstock supporting cone 4 and the tailstock supporting cone 7 . the tailstock 6 serves for the rotatable mounting of the tailstock supporting cone 7 and the headstock 3 drives the headstock supporting cone 4 with the aid of a motor , which is not visible . an encoder 5 is used for the generation of pulses which correspond to the respective rotary motion of the supporting cones 4 , 7 . a slide 8 is moved parallel to the axis of the stencil 2 on guides 9 . a threaded spindle 10 is used to drive this slide 8 . a laser 11 , which is mounted on the slide 8 , emits a laser beam 13 which is deflected through 90 degrees by a deflecting mirror 12 and is focused at 16 by a lens system 15 . the surface of the stencil 2 is covered with a light - sensitive lacquer . the lacquer either is hardened by the action of the laser beam or is removed at the exposed points . the tailstock 6 , together with the tailstock supporting cone 7 , can be displaced on guides 14 and , in this way , the tailstock supporting cone 7 can be set to the respective length of the stencil 2 . a control computer 16 is assigned to the laser engraver 1 . this control computer 16 receives the pattern data from the server 21 of the cad system 22 via the data line 23 . the pattern data consist of the numeric or byte sequence , already described many times , for the stencil numbers , which can be combined with half - tone information . from these pattern data , the control computer 16 generates the respective bit sequence . in the case of flat stencils , a bit in this bit sequence receives the value 1 if the corresponding pattern point on the stencil 2 is to be engraved . if the pattern point is not to be engraved , the associated bit is allocated the value 0 . in the case of half - tone stencils , the stencil number and , additionally with the aid of the half - tone conversion table according to fig2 b , the half - tone value are determined from one value of the numeric sequence . the respective bit sequence is fed to the laser 11 via a power converter , not shown in any more detail , the laser being switched on or off in accordance with this bit sequence . by means of this process , the pattern is produced on the stencil 2 . the control computer 16 also determines when the stepping motor 18 must execute the next step . the necessary stepping pulses are transmitted to the stepping motor 18 via the line 20 and a power amplifier , likewise not shown in any more detail . the stepping motor 18 drives the threaded spindle 10 and in this way moves the slide 8 with the laser 11 . the cad system shown here further comprises a keyboard 24 , a digitizer 25 for the entry of graphic data , and the monitor screen 26 . a large - scale memory 27 is used for storing image data , which are transmitted to the large - scale memory 27 or to the server 21 via the bidirectional data line 28 . in the large - scale memory 27 , it is possible to store the color files according to fig1 a , 2a and 3a temporarily , before they are transferred to the control computer 16 for the purpose of creating the respective bit sequences according to fig1 b , 2a and the bit sequence according to the third exemplary embodiment . the invention being thus described , it will be obvious that the same may be varied in many ways . such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims .
| 7 |
the present invention provides a method of and means for keeping an encryption engine ( such as those employing the data encryption standard ( des ) or other block encryption algorithm ) pipeline full so that the encryption engine can run at full capacity in cbc mode , or in other encryption modes requiring feedback from a previous computation . in the preferred embodiment of the invention , referring to fig1 , as data blocks from various sources enter the encryption engine , their virtual circuit ( vc ) or security association ( sa ) identifier ( or other standard identifier of “ encryption context ”) is used to index into a bank of keys and initial variables ( ivs ) or the results of the previous encryption for this data stream ( vc or sa ). this information is then passed to the encryption engine along with the data block for processing . a first variant uses multiple ivs , the ivs being used to seed the encryption function for encryption of the first block of plaintext . there is one iv per stage of the encryptor / decryptor to seed the encryption function . referring to fig2 , if there are 18 stages to a particular encryptor , such as that for the sandia national laboratories des asic . ( see d . craig wilcox , lyndon g . pierson , perry j . robertson , edward l . witzke , and karl gass , a des asic suitable for network encryption at 10 gbps and beyond , in cryptographic hardware and embedded systems , vol . 1717 of lecture notes in computer science , held in worcester , mass ., aug . 12 - 13 , 1999 . springer - verlag , berlin , 1999 . ), then 18 ivs are required . if there are 50 stages ( such as for a triple - des implementation using only one initial - final permutation pair ), then 50 ivs would be needed . in order to keep a pipelined encryptor from stalling and having to wait for blocks to be flushed through it , there must be as many ivs as there are pipeline stages . this variant must start with n ivs ( where n is the number of individually clocked stages of the encryption algorithm ) instead of only one iv as in traditional cbc mode encryption / decryption . it also needs n times 64 ( or in general , the length of the iv / ciphertext / plaintext blocks ) bits for storage of ivs ; subsequent ivs are consumed as soon as they are generated . the method of this variant will not interoperate between encryption engine implementations containing differing number of clocked stages . it also will not interoperate with traditional cbc mode as specified in fips pub 81 , supra . in the fips pub 81 specification of cbc mode , each block fed into the encryptor is related to the ciphertext of the previous blocks , with the exception of the first , which is related to the iv . in this variant of the invention , the n ivs are preferably unrelated . because there are n stages seeded by n independent ivs , this results in block 2 n + 1 being related to block n + 1 , which is related to block 1 , and in block 2 n + 2 being related to block n + 2 , which is related to block 2 , and so forth . in other words , rather than each block being related to the previous , every nth block is related . note that in a traditional cbc mode encryptor of one stage ( n = 1 ), each block would be related to the previous block . the second variant of the preferred embodiment also uses multiple ivs , but uses one per encryption context . in this variant , each sa or vc that is being fed through the encryption / decryption engine has its own encryption context . along with key material , this encryption context includes an iv or the previous ciphertext block for that sa or vc , as shown in fig3 . the ciphertext throughput for any one vc or sa in the second variant will still only be ( full rate )/ n , but aggregate throughput will be at full rate if there are at least n active vcs or sas . it is necessary to keep the encryption engine “ fully stoked ” so that it can run at full rate , even if each vc or sa is only getting a fraction of the encryption throughput . this variant is interoperable with the traditional cbc set forth in fips pub 81 , because each block is related to the previous block of its sa or vc . in asynchronous transfer mode ( atm ) communications , one can break up the data stream into n separate vcs ( one for each clocked stage of the encryption engine ), and one would incur n call setup overheads but get full rate encryptor / decryptor throughput . however , note that block n + 1 would be related to block 1 , not to block n , etc . this would not permit the encryption implementation to interoperate with a traditional cbc implementation at the other end of the communication link . if the pipelined encryption engine is viewed as a collection of resources , where each “ resource ” is one stage of the pipeline , with the associated data and key , then these “ resources ” can be allocated to incoming data packets or blocks from various communication sessions . as long as there are significantly more sessions generating communication packets and requesting communication services for them than there are clocked stages of the encryption pipeline , then the engine will run at full rate , without stalling to flush the pipeline . fig4 shows multiple encryption sessions aggregated through one pipelined encryptor ( in this q example , single des , cbc mode ) to individual , conventional ( non - pipelined ) des decryptors operating in cbc mode . this is useful where many users are sharing a computing resource ( or a set of computing resources ) connected to a high - performance communication line that uses a single , key - agile , high - performance encryptor . after the encrypted data travels through the network and goes through switching equipment and rate adaptation , it can arrive at a smaller computing resource ( e . g ., workstation ) at a slower data rate . this would enable the use of slower , simpler ( non - pipelined ), and less expensive decryptors at the workstations . in this way the high - performance cbc mode encryptor at the large computing resource can interoperate with the cheaper decryptors used with the smaller resources . as next shown in fig5 , this kind of encryptor can still pass data from the type of encryptor described in the first variant of the preferred embodiment in addition to data destined for conventional cbc mode encryptors . fig5 shows multiple encryption sessions aggregated through one pipelined encryptor , but one session is separated into numerous sub - sessions , in the manner of the first variant of the preferred embodiment . in this example , a 54 - stage triple - des engine is used in the cipher block chaining , external feedback mode of operation , see ans x 9 . 52 - 1998 , supra , tcbc mode . the encryptor and decryptors do not care whether the blocks are coming from many sessions ( each generating a low volume of data ) or one session ( generating a large volume of data ) separated into sub - sessions for performance reasons . each session &# 39 ; s ( or sub - session &# 39 ; s ) data , key , and iv or previous ciphertext are treated as a “ client ” requiring a resource . the processes ( whether software or hardware ) at the source and destination ends ( outside the scope of the encryptors / decryptors ) determine whether the session data should be divided into / combined from multiple sessions or left as a single session . the encryptors and decryptors merely deal with one key and one iv per session , although in the case of multiple sessions from a data source ( referred to earlier as sub - sessions ), those keys may be identical to each other . this preserves interoperability between aggregate encryptors - scattering decryptors , aggregate encryptors - conventional decryptors , and conventional encryptors - scattering decryptors , as long as the system designers and users keep the number of sessions that a data source generates and a data sink consumes consistent at each end of the communication path . although the invention has been described in detail with particular reference to these preferred embodiments , other embodiments can achieve the same results . variations and modifications of the present invention will be obvious to those skilled in the art and it is intended to cover in the appended claims all such modifications and equivalents . the entire disclosures of all references , applications , patents , and publications cited above are hereby incorporated by reference .
| 7 |
the present invention is based on the recognition that pmd in communication systems can be corrected by methods analogous to the spin - echo method of nuclear magnetic resonance ( nmr ). this recognition itself is founded on some fundamental principles concerning the nature of pmd . as pointed out above , depolarization of a pulse may occur ( 1 ) due to random fluctuations due to interaction with the environment or ( 2 ) due to pmd . the first effect is an error ( in the quantum mechanical language ) since the polarization gets entangled with an environmental degree of freedom to which one has no access . the second effect is not , strictly speaking an error . rather , it is a well - defined unitary evolution , describing the interaction between two degrees of freedom of the photon . since no information is lost to the environment , this effect could , in principle , be corrected by some device , ( placed for example at the output of the fiber ) that implements an interaction between frequency and polarisation so as to compensate the different rotations that took place in the fiber . however , in general such a device is difficult to make . the difficulty of correcting pmd is compounded by two effects . first of all , the coupling of polarization to frequency changes randomly over distances which are typically a few meters to a few tens of meters . thus the overall evolution over long distances ( many kilometers ) results in extremely complicated correlations of polarization and frequency ( especially for short pulses which are composed by many different frequencies ). second , the coupling of frequency and polarization changes over time due to changes in temperature and mechanical stress . ( the time scale for these changes is typically slow compared to the time of propagation of the light through the fiber ). thus any compensating device needs to be extremely complicated and change over time . here we present a method , inspired by the spin - echo methods of nmr , to reduce depolarisation and pulse distortion that result from pmd in communication systems . the basic idea of the method is to introduce along the communication line sequences of controlled polarisation rotations . these polarisation rotations can either occur at discrete locations along the communication line , or act continuously along the communication line , or a combination of both discrete and continuous . the origin of this method is in the pulse sequences ( called spin - echo techniques ) that have been developed in nmr to eliminate the dephasing which arises due to inhomogeneities of the magnetic field [ 11 ]. this inspired viola and lloyd to develop methods , called “ bang - bang ” decoupling , to supress decoherence of a quantum two level system interacting with an environment through the use of a suitable time dependent control hamiltonian [ 14 ]. wu lo and lidar [ 12 ] and wu and lidar [ 13 ] applied this to overcoming noise in optical fibers by implementing bang - bang control in space — along the fiber — rather than in time , but did not address the issue of polarization mode dispersion and pulse spreading . as mentioned above the method we present here to reduce pmd in communication systems is inspired by the spin - echo method of nmr . the fundamental reason why this method devised to deal with atomic nuclei and the magnetic fields surrounding them could be at any relevance at all for photons propagating through optical fibers is that any two quantum systems that are described by hilbert spaces of the same dimension ( in our case spin ½ nuclei and polarization of photons ) can be formally ( i . e . mathematically ) mapped one onto the other ; the same mathematics applies to both . however , to realize that these methods can be applied to pmd in communication systems , and in particular to light propagation through optical fibers requires several conceptual breakthroughs . 1 . at first sight , one would think that the methods for spin cannot — realisticaly — apply to light propagation in optical fibers because when the photon interacts with , say , an impurity in the fiber , the interaction takes place in an extremely short time — while the photon flies by — and during , this time there is no way to make all the polarization rotations required . the key here is to realize that in the fiber there is also the issue of gradual polarisation rotations , and in particular the gradual frequency - polarization interaction . this interaction takes a much longer time . in fact , residual birefringence in today &# 39 ; s fibers is rather small , which means that during propagation through many meters of fiber the unitary evolution due to frequency - polarization interaction is very close to identity , so one can perform the correction rotations . 2 . second , the idea of the spin echo , and of other error correction methods in general , is supposed to apply when the system we are interested in interacts with an environment out of our control — such as an unknown external magnetic field in the generalized spin echo example , or a photon and the optical fiber in the case of [ 12 ] and [ 13 ]. in , all these cases information is lost from the system . on the other hand , in the case of polarization mode dispersion the interaction is not between the photon &# 39 ; s polarization and the environment , but between two of the photons own degrees of freedom — its polarization and its frequency . hence , there is in principle no loss of information — all the information stays in the photon and is available to us . however , because it is difficult to actually determine the parameters entering the polarization - frequency interaction hamiltonian , and also to use this knowledge in an effective way to construct a device that implements the reverse unitary transformation , we suggest to simply ignore this information , that is , treat the ( in principle ) known interaction between polarization and frequency as an interaction between polarization and an unknown environment ! in other words , the frequency degrees of freedom , which are internal degrees of freedom belonging to the photon itself , can be treated as environmental ( i . e . external ) degrees of freedom . one should also note a further element that strongly differentiates interactions between a true environment and polarization from the interactions between frequency and polarization and makes it difficult to imagine that methods devised to deal with true environments can work for the pseudo - environment consisting of the frequency degree of freedom . frequency is a degree of freedom of the photon itself and as such it is carried by the photon wherever the photon goes . information transferred from polarization to frequency follows the photon at all time and is not left at the location where the transfer occurred , or propagate from there independently from the photon as would be the case with a true interaction with an environment . the consequences of this can be seen dramatically in the fact that the error filtration method for correcting depolarization described in [ 15 ] does not work for pmd ( when all the fibers used for multiplexing have identical pmd ). the error filtration method cannot filter out depolarizations due to the well - defined interaction between the polarization and frequency because there is no record left in the different fibers : whenever the photon emerges from the interferometer used in this method , the information is lost about which arm of the interferometer the depolarization error occurred . the method is particularly suited for reducing depolarisation and pulse distortion resulting from pmd in optical fibers . we emphasize however that it can also be used to decrease depolarisation and pulse distortion resulting from pmd in other communication systems , such as electrons propagating in electric wires , holes propagating in semiconductor electrical wires , etc . in particular the method does not rely on the fact that the transmitted particles are bosons or fermions . by reducing depolarization , our method automatically reduces the distortion of pulses due to pmd . this will be the case both in the linear and non linear regime ( as illustrated in [ 10 ]). a basic feature of our method is that , in the case of light signals , our method applies both to quantum signals , such as single photon states , squeezed states etc . as well as to classical signals ( i . e . classical light ). this is due to the fact that we use only linear optical elements . a major issue concerning implementation is that the compensating actions ( polarization rotations ) that we need in order to reduce depolarization and pulse distortion are implemented via interactions that introduce pmd by themselves . this might limit the frequency of the compensating interactions and ultimately the efficiency of the method . we present here a method by which the polarization rotations are implemented by sequences of interactions that “ self - compensate ”, i . e . they are arranged in such a way as to correct the pmd that each one individually introduces . we also suggest a number of methods to implement these polarisation rotations in practice , either during or after manufacture of optical fibers . in the following , we present in section 2 the basic principles of our method , using the language of a spin ½ particle precessing in an unknown magnetic field . to this end we consider a specific example . in section 3 we generalise the results of section 2 . we introduce the notions of exactly compensating sequences and partially compensating sequences , both in the case of discreet , ie . effectively instantaneous , control operations , and in the case of continuous control operations . in section 4 we discuss how to map these results to photons propagating in optical fibers , and address the specific issues which arise in this case . in section 5 we address the fact that in general the control elements used in our method will themselves induce pmd because their effect will depend slightly on the frequency . we show that one can compensate for this effect by devising the sequence of control operations such that the pmd of the control operations cancels in first order . we call such sequences self - correcting sequences . in section 7 we discuss specific ways in which the control elements can be implemented in optical fibers . the theoretical foundation of the method is quite simple , and it is inspired by techniques (“ generalized spin echo ”) used in nuclear magnetic resonance ( nmr ) [ 11 ]. we will first describe our technique in the nmr language and then we will convert the description to optics . consider a spin ½ particle in a magnetic field . the hamiltonian is h ={ right arrow over ( b )}{ right arrow over ( σ )}= b x σ x + b y σ y + b z σ z . ( 1 ) the time evolution due to the interaction is given by the unitary operator here { right arrow over ( σ )} are the pauli matrices , ie . they are the three 2 × 2 traceless hermitian matrices that obey σ x σ y = iσ z and cyclic permutations . suppose we do not know the value of { right arrow over ( b )}. can we compensate for the evolution — in the spirit of the spin echo — so that after compensation the spin is left in its initial state ? the following procedure accomplishes this . the procedure consists of four basic steps that are then repeated . step 1 . we let the system evolve for a time τ . the time τ is taken short enough such that { right arrow over ( b )}{ right arrow over ( σ )} τ & lt ;& lt ; 1 ( or equivalently τ & lt ;& lt ; 1 b ⇀ ) and the time evolution can be well approximated by the first - order approximation : u ( τ )≈ 1 − i { right arrow over ( b )}{ right arrow over ( σ )} τ = 1 − i τ ( b x σ x + b y σ y + b z σ z ). ( 3 ) step 2 . we interrupt the evolution by flipping the spin around the x axis . we then leave it evolve for a new period τ and finally we flip again the spin around the x axis . the actions in step two are described by σ x u ( τ ) σ x where σ x describes the flip around the x axis . since σ x u ( τ ) σ x ≈ σ x ( 1 − i { right arrow over ( b )} σ { right arrow over ( τ )} ) τ x = 1 − i τ ( b x σ x − b y σ y − b z σ z ) ( 7 ) which effectively compensates the evolution due to the b y and b z components . the evolution due to the b x component is not yet compensated ; this will be accomplished during the next two steps . step 3 . the same as step 2 , but the spin is flipped around the y axis . step 3 is thus described by σ y u ( τ ) σ y . given that σ y u ( τ ) σ y ≈ σ y ( 1 − i { right arrow over ( b )}{ right arrow over ( σ )} τ ) σ y = 1 − i τ (− b x σ x + b y σ y − b z σ z ) ( 11 ) step 4 . the same as step 2 , but the spin is flipped around the z axis . step 3 is thus described by σ z u ( τ ) σ z . given that σ z u ( τ ) σ z ≈ σ z ( 1 − i { right arrow over ( b )}{ right arrow over ( σ )} τ ) σ z = 1 − i τ (− b x σ x − b y σ y + b z σ z ) ( 15 ) u ≈ 1 i τ ( b x σ x + b y σ y + b z σ z + b x σ x − b y σ y − b z σ z +− b x σ x + b y σ y − b z σ z − b x σ x − b y σ y + b z σ z ) = 1 + o (| b | 2 τ 2 ) ( 17 ) where | b | 2 = b x 2 + b y 2 + b z 2 . this shows that the evolution is effectively stopped ( i . e . the overall time evolution , after the entire time period of 4τ is approximately the identity ). the procedure is then repeated again and again . what happens if we change τ , and for instance make it shorter ? to compare different values of τ , we need to compare the evolution , not over a time τ ( which is variable ), but over a fixed time t . for simplicity we take t to be an integer multiple of τ . then the evolution after time t is obtained by taking the product of eq . ( 17 ) t / τ times . one obtains u ( t )=( 1 + o (| b | 2 τ 2 )) t / τ = 1 + o (| b | 2 t τ ). ( 18 ) thus the effect of the control sequence is better and better if τ is taken smaller and smaller . the method relies on the fact that the interaction , although unknown to us , is constant in time ( at least for the short times τ we are considering here ). the unknown hamiltonian that is responsible for the rotation of the spin in the first place is there all the time and affects the spin after the x , y and z rotations , and brings it back to the initial state . in the above subsection we considered the unknown hamiltonian to be time independent . it is essential for applications that our method works even if the hamiltonian is time dependent , if the compensating rotations are performed after a time τ short enough so that the hamiltonian doesn &# 39 ; t change substantially during this time . indeed , suppose that { right arrow over ( b )} is a function of time , { right arrow over ( b )}( t ) in this case equation ( 3 ) will contain a second - order term i ∂ t { right arrow over ( b )}( 0 ){ right arrow over ( σ )} τ 2 that comes from the taylor expansion { right arrow over ( b )} ( t )= { right arrow over ( b )} ( 0 )+ t ∂ t { right arrow over ( b )} ( 0 )+ o ( t 2 ). ( 19 ) in order for this term to be negligible compared to the first order term the following condition must be obeyed ∂ t { right arrow over ( b )}{ right arrow over ( σ )} τ 2 & lt ; { right arrow over ( b )}{ right arrow over ( σ )} τ ( 20 ) that is the method will work well for time dependent magnetic fields if τ is smaller than the rate of change of the magnetic field . the method works equally well when b x , b y and b z are not real numbers as above , but quantum ( possibly non - commuting ) operators — the same mathematics applies . hence , in the first order of perturbation , the above method works for the most general spin ½ hamiltonian . h ={ circumflex over ({ right arrow over ( b )} ( t ) { right arrow over ( σ )}= b { circumflex over ( b )} x ( t ) σ x +{ circumflex over ( b )} y ( t ) σ y +{ circumflex over ( b )} z ( t ) σ z , ( 22 ) where { circumflex over ( b )} x ( t ), { circumflex over ( b )} y ( t ) and { circumflex over ( b )} z ( t ) are arbitrary operators . this means that in the first order of perturbation we can exactly compensate for the effect of the interaction of the spin with any other quantum system . the time scales for the validity of the first order perturbation are obtained by generalizing the discussion in the above subsections . there are two conditions on τ for the first order approximation to be valid : 1 ) first of all τ should be such that in the absence of the compensating sequence — the unknown operator valued magnetic field cannot significantly modify the state of a spin in time τ . in other words the unknown operator valued magnetic field modifies the state of spins , for instance by rotating them , depolarising them , etc . . . . this modification of the state of spins is not instantaneous , but takes a characteristic time . τ should be less than this characteristic time . mathematically we can express this as τ & lt ; 1 b ^ ⇀ ( 23 ) where by ∥{ circumflex over ({ right arrow over ( b )}∥ we mean a suitable operator norm , such as ∥{ circumflex over ({ right arrow over ( b )}∥=√ { square root over ( tr [{ circumflex over ({ right arrow over ( b )})} † ·{ circumflex over ({ right arrow over ( b )} ρ ] )}=√{ square root over ( tr [( { circumflex over ( b )} x † { circumflex over ( b )} x +{ circumflex over ( b )} y † { circumflex over ( b )} y +{ circumflex over ( b )} z † { circumflex over ( b )} z ) ρ ])} ( 23b ) where ρ represents the state all the degrees of freedom that enter in { circumflex over ({ right arrow over ( b )}. 2 ) τ should be such that the unknown operator valued magnetic field does not change significantly in time τ . mathematically this can be expressed as τ & lt ; b ^ ⇀ ∂ t b ^ ⇀ , ( 24 ) where ∥.∥ is a suitable operator norm , for instance the same as in eq . ( 23b ). for the rest of this paper equations ( 23 ), ( 24 ) and their fiber equivalents described later , define the validity of “ first order perturbation ”. of course , here we consider that the exact value of { circumflex over ({ right arrow over ( b )} is unknown — indeed , the main issue under investigation here is compensating for an unknown magnetic field . however , for determining the time scale ( i . e . for determining the time scale of the “ first order regime ”) we don &# 39 ; t need to know the exact values of the field but it is enough to have estimates on its magnitude and rate of change . these estimates can be determined experimentally by studying the time evolution of spins in the magnetic field . note that we expect that even when eqs . ( 23 ) and ( 24 ) are not obeyed , the effects of { circumflex over ({ right arrow over ( b )} will be reduced , even thought the effect may be small . on the other hand it can be shown that when eqs . ( 23 ) and ( 24 ) are obeyed , the smaller τ , the more the effects of the unknown magnetic field { circumflex over ({ right arrow over ( b )} are reduced , see discussion around eq . ( 18 ). thus one should always try to take τ as small as possible . the sequence of operations described in section 2 is not unique . there are many different sequences of spin flips that succeed to the first order of approximation to exactly compensate for the effects of a constant unknown magnetic field . we call such a sequence an “ exactly compensating sequence ” ( ecs ). a simpler form of the sequence ( 16 ) is possible . indeed , since a general sequence consists of k equal time evolutions , each followed by a rotation : u = r k u ( τ ) r k − 1 u ( τ ) . . . r 2 u ( τ ) r 1 u ( τ ) ( 28 ) where r i represents a particular spin rotation . to see that this is the most general form , note that even if after each time interval there are more rotations performed one after the other , we can describe their total effect by a single total rotation ( such as in the example of the sequences ( 16 ) and ( 27 )). note also that by considering only equal time evolutions between the rotations we do not limit the scope of the method . indeed , a longer period of uninterrupted evolution can be considered as two periods of evolution interrupted by a trivial rotation ( i . e . r = i ); since some of the rotations r i in ( 28 ) could be taken to be equal to the identity , our method is completely general . { tilde over ( r )} i = r i r i − 1 . . . r 1 ( 30 ) u ={ tilde over ( r )} k { tilde over ( r )} k − 1 † u ( τ ) { tilde over ( r )} k − 1 { tilde over ( r )} k − 2 † u ( τ ) . . . { tilde over ( r )} 2 { tilde over ( r )} 1 † u ( τ ) { tilde over ( r )} 1 { tilde over ( r )} 0 † u ( τ ) { tilde over ( r )} 0 ( 31 ) in order to be an ecs the sequence of rotations must obey the condition ∑ j = 0 k - 1 r ~ j † σ ⇀ r ~ j = 0 , ( 33 ) which is in fact a set of 3 conditions , one for each component of { right arrow over ( σ )}. note that { tilde over ( r )} k represents a known overall rotation of the spin at the end of the sequence . some sequences are particularly simple , in the sense that { tilde over ( r )} k = i , i . e ., the spin doesn &# 39 ; t undergo any overall known rotation ( such as the sequence discussed in subsection 2 . 1 ), but this is not a necessary condition for compensating the evolution to the unknown magnetic field in ( 22 ). the condition ( 33 ) has a geometric interpretation . for each value of j , the three quantities , { tilde over ( r )} j † σ x { tilde over ( r )} j , { tilde over ( r )} j † σ y { tilde over ( r )} j , { tilde over ( r )} j † σ z { tilde over ( r )} j , can be represented as 3 orthogonal vectors on the bloch sphere . these 3 vectors realise thus an orthonormal frame which is obtained from the frame when j = 0 by the rotation r j . this implies that all the frames have the same chirality . to find an ecs we thus need to find a set of orthonormal frames of identical chirality such that the sums of the first , second and third vectors of the frames are all zero . from the rotation which , maps the frames one onto the other , one immediately finds the { tilde over ( r )} j and then the r j . as we mentioned above , the most general sequence can be described by ( 28 ). however , each of the operators r j can be implemented in many different ways . an example is in the sequences ( 16 ) and ( 27 ) above , where a flip such as σ x could be implemented directly or by a flip around y followed immediately by a flip around z . practical considerations will determine which particular implementation is better in each case . we note that the conditions the sequence must obey are independent of the magnetic field { circumflex over ({ right arrow over ( b )}. the only thing that { circumflex over ({ right arrow over ( b )} affects in the first order of perturbation are the conditions for the validity of the first order , that is the conditions on the total duration kτ of the sequence . this is true for all the sequences discussed in this paper . in the previous section we discussed ecs , sequences that exactly compensate in the first order the effect of an unknown hamiltonian . however in some embodiments it may not be necessary or practical to implement an ecs sequence . one reason is that there are always imprecisions in practically realizing a desired rotation , so some attempts to construct an ecs may not be perfectly successful . another case is when we do not actually try to build an ecs because of limitations in what rotations we can practically realize . however even in such cases partial compensation can be obtained . consider again eq ( 32 ) that describes the evolution under a general sequence of rotations . in order for the sequence to be exactly compensating it needs to fulfil the condition ( 33 ). on the other hand , had we done nothing , i . e . if all the rotations r j = i the first order disturbance of the spin would have been ∑ j = 0 k - 1 r ~ j † σ i r ~ j = λ i σ ξ i ( 35 ) where σ ξ i is the pauli matrix describing the spin in some direction ξ i and the coefficients λ i are real and positive . the maximal value of each coefficient λ i is k , and it is obtained in the case when no compensation is attempted . if at least one of the coefficients λ i is smaller than k , then the sequence achieves partial compensation . we call such a sequence a “ partially compensating sequence ” ( pcs ). as an example of a pcs , we consider the simple spin echo . the sequence is given by r 1 = σ x and r 2 = σ x . the corresponding { tilde over ( r )} j are { tilde over ( r )} 0 = i , { tilde over ( r )} 1 = σ x and { tilde over ( r )} 2 = i . by inserting these values in ( 35 ) we find that from ( 36 ), ( 37 ) and ( 38 ) we see this is a pcs . this simple method works particularly well if the hamiltonian is known not to contain any σ x interaction , i . e . when the hamiltonian is of the form h ={ circumflex over ( b )} y ( t ) σ y + { circumflex over ( b )} z ( t ) σ z , ( 39 ) furthermore , in this simple situation , if it is also the case that the hamiltonian is independent of t then we are not bound by first order perturbation , but can apply compensating rotations after any length of time . note that in an optical implementation , if the compensating rotations ( polarization flips in this case ) are realised alternatively by rotating the polarisation by π in one direction and then in the other , i . e . if they are implemented by exp [+ iπσ x ph ] and then by exp [− iπσ x ph ], then any pmd induced by the control element σ x ph automatically cancels , see the discussion in section 5 . 1 . note also that the above simplifications apply whenever the hamiltonian has a simple form in any particular basis , i . e . h ={ circumflex over ( b )} 1 ( t ) σ 1 +{ circumflex over ( b )} 2 ( t ) σ 2 ( 40 ) where 1 and 2 denote some orthogonal directions of the spin . in this case , one needs to perform flips around the third axis , i . e . r 1 = r 2 = σ 3 . an interesting case is that of a completely random sequence , that is , one in which the rotations r i ( and therefore also the rotations { tilde over ( r )} i ) are chosen at random . in this case , ∑ j = 0 k - 1 r ~ j † σ i r ~ j is a sum of k randomly rotated spin matrices . the result is a spin matrix oriented in some random direction ξ i and having magnitude of the order of √{ square root over ( k )}, i . e . hence a random sequence of rotations is ( with very high probability ) a pcs . in the above section we considered spin rotations that are effectively instantaneous , i . e . that they take place on a time scale much shorter than the time τ between the rotations . this allowed us to neglect the evolution due to the unknown interaction { right arrow over ( b )} during this time . on the other hand , one can also consider continuous compensating rotations . the conditions for a continuous ecs turn out to be rather similar to those of the instantaneous ecs discussed above . where h d represents the “ dispersive ” hamiltonian h d ={ circumflex over ({ right arrow over ( b )}{ right arrow over ( σ )} that has to be corrected and h c ( t ) is the “ control ” ( time dependent ) hamiltonian that describes the correction that we apply . ( we neglect here the possible time dependence of h d . the discussion of subsection 2 . 2 applies to the present subsection , as well as to all the rest of this work ). consider now the evolution decomposed into a large number n of short time steps of duration τ , with nτ = t fixed . at the end of the calculation we will take τ → 0 . u =( 1 − ih c ( n τ ) τ )( 1 − ih d τ )( 1 − ih c (( n − 1 ) τ ) τ ) . . . u c ( k τ )=( 1 − ih c ( k τ ) τ )( 1 − ih c (( k − 1 ) τ ) τ ) . . . ( 1 − ih c ( τ ) τ )( 1 − ih c ( 0 ) τ ). ( 44 ) the u c defined above in ( 44 ) is , of course , nothing else than the time evolution under the control hamiltonian alone . noting that in first order u c ( k τ ) u c † (( k − 1 ) τ )=( 1 − ih c ( k τ ) τ ) ( 45 ) u = u c ( n τ ) u c (( n − 1 ) τ ) † ( 1 − ih d τ ) u c (( n − 1 ) τ ) u c (( n − 2 ) τ ) † . . . u c ( τ ) u c ( 0 ) † ( 1 − ih d τ ) u c ( 0 ) ( 46 ) furthermore , denoting { tilde over ( h )} d ( kτ )= u c † ( kτ ) h d u c ( kτ ) we can write ( 46 ) as u ( n τ ) = u c ( n τ ) ( 1 - ⅈ h ~ d ( ( n - 1 ) τ ) τ ) ( 1 - ⅈ h ~ d ( ( n - 2 ) τ ) τ ) … … ( 1 - ⅈ h ~ d ( τ ) τ ) ( 1 - ⅈ h ~ d ( 0 ) τ ) ≈ u c ( t ) ( 1 - ⅈ ∫ 0 t h d ( t ′ ) ~ ⅆ t ′ ) = u c ( t ) ( 1 - ⅈ ∫ 0 t u c † ( t ′ ) h d u c ( t ′ ) ⅆ t ′ ) ( 47 ) where t = nτis fixed , and we have taken the limit τ → 0 , n →∞. since the dispersive hamiltonian h d is constant in time , we have thus , a time independent dispersive interaction can be corrected by a continuous control if ∫ 0 t u c † ( t ′ ) σ i u c ( t ′ ) ⅆ t ′ = 0 , ( 49 ) note that , similarly to the sequences of instantaneous rotations eq . ( 32 ) the continuous compensating sequences can also result in a known rotation of the spin given by u c ( t )= u c ( nτ ). the spin is left unchanged when u c ( t )= u c ( nτ )= i . as an example of continuous ecs , consider the following time dependent control hamiltonian h c ( t ) = + c σ x for 0 ≤ t & lt ; π 2 c = + c σ z for π 2 c ≤ t & lt ; 2 π 2 c = - c σ x for 2 π 2 c ≤ t & lt ; 3 π 2 c = - c σ z for 3 π 2 c ≤ t & lt ; 4 π 2 c = - c σ x for 4 π 2 c ≤ t & lt ; 5 π 2 c = - c σ z for 5 π 2 c ≤ t & lt ; 6 π 2 c = + c σ x for 6 π 2 c ≤ t & lt ; 7 π 2 c = + c σ z for 7 π 2 c ≤ t & lt ; 8 π 2 c ( 50 ) where c & gt ; 0 determines the time t = 4π / c after which the compensating sequence is finished . one can calculate that this sequence obeys the conditions eq . ( 49 ) for a continuous ecs . ( one also checks that it obeys the condition eq . ( 84 ) for first order compensation of the pmd of the control hamiltonian itself , see section 5 . 1 ). similar to the case of sequences of instantaneous rotations , we can also have continuous partial compensating sequences . the effect of the dispersion generated by b x σ x and b y σ y vanishes if while the effect of b z σ z is not compensated by this control . 3 . 7 . compensating sequences in the presence of a large known magnetic field a case which may be important in practice is when the hamiltonian contains both a known magnetic field b k and an unknown magnetic field b u . of course we can still use the compensating sequences described above to compensate both b k and b u . but this is problematic if the known magnetic field is much larger than the unknown one , since in order for the compensating sequences to work well one needs that the effects of both b k and b u be first order . thus the compensating sequence will need to be applied very often . the way round this is to incorporate b k into the compensating sequence . thus in the presence of a control hamiltonian , the total hamiltonian is h ={ right arrow over ( b )} u ·{ right arrow over ( σ )}+{ right arrow over ( b )} k ·{ right arrow over ( σ )}+ h c ( t ) ( 58 ) h ={ right arrow over ( b )} u ·{ right arrow over ( σ )}+ h ′ c ( t ) ( 59 ) with h ′ x ( t )={ right arrow over ( b )} k ·{ right arrow over ( σ )}+ h c ( t ) the effective control hamiltonian . we now need to impose that h ′ c compensates for the unknown magnetic field h u . as an illustration of this method , suppose that { right arrow over ( b )} k points in the z direction so that { right arrow over ( b )} k ·{ right arrow over ( σ )}= b k σ z . the following is an ecs : 1 . set h c to zero from time t = 0 to t = nπ / b k . at time nπ / b k the spin has precessed by exactly 2nπ . 2 . at time t = nπ / b k carry out an instantaneous σ x spin flip . 3 . set h c to zero from time t = nπ / b k to t = 2nπ / b k . 4 . at time t = 2nπ / b k carry out an instantaneous σ x spin flip . the integer n , and thus the time 2nπ / b k to carry out the sequence can be freely chosen . it may be that the magnetic field fluctuates along different axes with different time scales . for instance the component of { right arrow over ( b )} along the x and y axes may change rapidly , whereas the component along the z axis changes slowly . the cs can be adapted to these different time scales . for instance one can carry out the simple spin echo of subsection 3 . 3 at a rate corresponding to the fast time scale to compensate the components along x and y . there remains the component along z which can be compensated by much less frequent insertions of σ x operations . as noted in section 1 any two quantum systems that are described by hilbert spaces of the same dimension ( in our case spin ½ nuclei and polarization of photons ) can be formally ( i . e . mathematically ) mapped one onto the other . ( for further convenience we call the hilbert space of polarization and that of spin the “ polarization space ”.) one possible mapping is the following : let | h & gt ; denote horizontal polarization and | v & gt ; vertical polarization . the photon equivalent of ↑ z ( i . e . spin polarized “ up ” along the z axis ) is | h & gt ; and the equivalent of ↓ z ( spin polarized “ down ” along the z axis ) is | v & gt ;. furthermore , the equivalent of the spin operator σ z is a photon polarization operator σ z ph defined by note that the eigenstates of σ y ph are left and right circular polarized states : in other words , the y axis in the polarization space is the axis defined by the fact that rotations around it preserve the circular polarized light . the “ horizontal ” and “ vertical ” directions are defined , according to usual optical convention as two orthogonal directions conventionally chosen ; they need not be the actual horizontal and vertical . the “ horizontal ” and “ vertical ” axis need to be defined not only at a single point but at all points along the fiber . there are many ( infinite ) ways to do this , and it is again a matter of convention how we do it . however , the precise form of the hamiltonian depends on the convention used to define the axis . h ={ circumflex over ({ right arrow over ( b )} ( l ){ right arrow over ( σ )} ph = { circumflex over ( b )} x ( l ) σ x ph +{ circumflex over ( b )} y ( l ) σ y ph + { circumflex over ( b )} z ( l ) σ z ph , ( 68 ) the operator { circumflex over ( b )}( l ) contains all the information about all the other variables that affect the polarization , and through it one can also determine the effect that polarization has on the other degrees of freedom of the photon . we make this more explicit in the next subsection , where we use the standard optical formalism . as we noted above , the precise form of the hamiltonian depends on the convention used to define the linear polarization axis along the fiber . indeed , even in a perfect fiber where polarization stays constant , polarization would appear to rotate if our definition of the axis rotates along the fiber . changing from one convention to another has the effect of introducing a supplementary known ( position dependent but frequency independent ) field { right arrow over ( b )} 0 ( l ) in the hamiltonian . a convenient convention is to define the linear polarization axis along the fiber in such a way that any known frequency independent field { right arrow over ( b )} 0 ( l ) is eliminated . we adopt this convention here . we also note that optical fibers have losses , i . e . photons can be absorbed . this can simply be modeled by considering { circumflex over ( b )} to be non - hermitian . furthermore note that in general a fiber contains both polarization independent and ( a generally smaller ) amount of polarization dependent absorption . the polarization independent absorption is not of interest for us here : since it commutes with all the operations that compose our compensating sequences it does not modify our method and its length scale at all . hence we can simply ignore , the polarization independent absorption and include only the polarization dependent one . as we mentioned in the preceeding subsection , the operator { circumflex over ( b )} 0 ( l ) contains all the information about all the degrees of freedom that affect the polarization . here we illustrate this by analyzing the ( very common ) case of a fiber with negligible non - linearity . we emphasize however that , similar to the case of nmr , the compensating sequences are totally independent on the specific form of { circumflex over ( b )} 0 ( l ); only the length scale for the validity of the first order approximation depends on { circumflex over ( b )} 0 ( l ))— but in any case this quantity has to be determined experimentally . therefore our method applies to any type of fiber , including fibers with high non - linearities . in this subsection , to make connection with the usual fiber optics language , we derive our equations using classical physics , following [ 16 ]; the same equations then define the heisenberg evolution of the quantum observables . consider a light pulse propagating along an fiber . the pulse is centered on frequency ω and has wave number k ; the distance along the fiber is denoted l . its amplitude can be written as where a is the slowly varying envelope of the pulse . we introduce the variable t ′= t − l / v g where v g is the group velocity of the pulse . if we neglect all polarisation effects a obeys an equation of the form where β 2 describes the dispersion . one can also include in this equation other effects describing for instance non linearities ( giving rise to the non linear schrödinger equation ), higher order dispersion , etc . . . . here we are interested in analyzing birefringence . we must then view a as a two component vector . each component describes the amplitude of the pulse along one of two orthogonal polarisation components . we then obtain an equation of the form i ∂ l a = b 0 a + i ∂ t ′ b 1 a ( 71 ) where we have neglected terms with higher order derivatives in t ′ ( they could easily be included , but the main effects can be seen from the above equation ). here b 0 and b 1 are matrices , which we take to be traceless . ( the part of b 0 and b 1 proportional to the identity can be incorporated into the wave vector k and the average group velocity v g ). where a ( ω ) is the fourier transform of a ( t ) at frequency ω . since b 0 and b 1 are traceless 2 × 2 matrices , we can write them as b 0 ={ right arrow over ( b )} 0 ·{ right arrow over ( σ )} ph and b 1 ={ right arrow over ( b )} 1 ·{ right arrow over ( σ )} ph . this equation has exactly the same form as the equation of evolution of spin in an unknown , operator valued , magnetic field , with { circumflex over ({ right arrow over ( b )}={ right arrow over ( b )} 0 + ω { right arrow over ( b )} 1 and the evolution parameter being the position along the fiber rather than time . note that the magnetic field is operator valued since { right arrow over ( b )} 1 is multiplied by the frequency ω . the birefringence thus induces both different phase velocities ( through b 0 ) and different group velocities ( through b 1 ). in most fibers the phase velocity difference and the group velocity difference are of the same order of magnitude . this implies that the order of magnitude of b 1 is b 1 ▭ b 0 / ω . in general the matrix b 1 need not be proportional to b 0 . but in most cases we expect them to be almost proportional one to the other , since they originate from the same physical effect ( for instance bending or twisting of the fiber ). this will be used in subsection 5 . equations ( 71 ) and ( 72 ) describe the evolution of the envelope of a classical pulse . upon quantizing the electro - magnetic field , one will find that the heisenberg equations for the field operator â ( t ) and its fourier transform â ( ω ) are identical to eqs . ( 71 ) and ( 72 ). the “ generalized spin echo ” methods apply formally to the photon exactly as to a nuclear spin , under the mapping described above . as discussed above the most general interaction hamiltonian affecting the polarization is h ={ circumflex over ({ right arrow over ( b )} ( l ){ right arrow over ( σ )} ph = { circumflex over ( b )} x ( l ) σ x ph + { circumflex over ( b )} y ( l ) σ y ph +{ circumflex over ( b )} z ( l ) σ z ph , ( 73 ) the formal equivalent of ( 22 ). here the equivalent of the time t in ( 22 ) is l , the location of the photon along the optical fiber . in order to implement the formal equivalent of the sequences of rotations in polarization space described in section 2 , i . e . in order to interrupt the evolution and make polarization rotations all we need to do is to insert from place to place in the fiber appropriate achromatic polarization rotation devices . as examples see fig1 which corresponds to the method of eq . ( 16 ) and fig2 which corresponds to the method of eq . ( 27 ). these figures represent an optical fiber ( 1 . 10 ) interrupted by polarization flip devices ( 1 . 2 , 1 . 3 , 1 . 4 ) which can be built into the fiber or independent of it . the number 1 . 2 corresponds to a σ z flip , 1 . 3 corresponds to a σ y flip , 1 . 4 corresponds to a σ x flip . the number 1 . 1 , associated to the empty box , corresponds to the identity l , ie . to no polarisation rotation taking place . a compensating sequence is denoted 1 . 20 ; in the case of fig1 it contains 2σ z flips , 2σ y flips , 2σ x flips , 2 identities l ; in the case of fig2 it contains 2σ z flips and 2σ x flips . one way to realise the polarisation flips is to cut the fiber in pieces and insert between two subsequent pieces the appropriate polarization rotation device . in alternative more preferred embodiments , the fiber is fabricated with polarization flip regions included at regular intervals . the polarization flip regions may be implemented , for example , by appropriately changing the chemical content , or the mechanical properties of the fiber material ( see discussion in section 7 ). in order to implement the equivalent of continuous spin rotations ( subsections 3 . 5 , 3 . 6 ) we need to act on the fiber continuously along its length . we now reach a crucial point of our discussion . until now we discussed the effects of our methods on polarisation . we emphasize here that when we reduce depolarisation we automatically reduce pmd , hence the spread of pulses due to pmd is also reduced . the reason that our method reduces both depolarisation and polarization mode dispersion is that it effectively averages the interaction hamiltonian to zero , also note that , since the effect of any unknown { circumflex over ({ right arrow over ( b )}( l ) can be compensated , the above described compensation procedures work in any type of fiber , including fibers with high nonlinearities . the length of fiber after which the polarization rotation devices must be placed is formally equivalent to the time interval after which the rotations on the spin should be implemented . in particular the analogues of conditions 23 and 24 for validity of first order perturbation become : 1 ) the length l seq of the compensating sequence should be such that — in the absence of the compensating sequence — the unknown operator valued polarisation interaction { circumflex over ({ right arrow over ( b )} ( see eq . ( 73 )) cannot significantly modify the state of polarisation of light over distance l seq in other words the unknown operator valued field { circumflex over ({ right arrow over ( b )} modifies the state of polarisation of light , for instance by rotating it , depolarising , it , etc . . . . this modification of the polarisation is not instantaneous , but takes a characteristic length . l seq should be less than this characteristic length . mathematically we can express this as l seq & lt ; 1 b ^ _ ( 75 ) where by ∥{ circumflex over ({ right arrow over ( b )}∥ we mean a suitable operator norm , such as ∥ { circumflex over ({ right arrow over ( b )}=√ { square root over ( tr [{ circumflex over ({ right arrow over ( b )})} † ·{ circumflex over ({ right arrow over ( b )} ρ ])}=√{ square root over ( tr [( { circumflex over ( b )} x † { circumflex over ( b )} x +{ circumflex over ( b )} y † { circumflex over ( b )} y +{ circumflex over ( b )} z † { circumflex over ( b )} z ) ρ ])} ( 75b ) where ρ represents the state all the degrees of freedom that enter in { circumflex over ({ right arrow over ( b )}. 2 ) the length l seq of the compensating sequence should be such that the unknown operator valued polarisation interaction { circumflex over ({ right arrow over ( b )} does not change significantly over distance l seq . mathematically this can be expressed as l seq & lt ; b ^ _ ∂ l b ^ _ , ( 76 ) where ∥·∥ is a suitable operator norm , for instance the same as in eq . ( 75b ). as we noted before , compensation will occur even when the conditions for first order are not fulfilled ; experiments will also tell how well the compensation works in this case . on the other hand it was shown previously that , even when conditions ( 75 ) and ( 76 ) are satisfied , the compensation will work better and better if l seq is made shorter and shorter . for the case illustrated in subsection 4 . 2 , we can further detail the conditions ( 75 ) and ( 76 ). we emphasize again however that ultimately the conditions should be determined experimentally . l b = 2 π b _ 0 is known as the beat length . it is the length after which the state of polarisation repeats itself . it can be readily measured using standard techniques . ( if we suppose , which is generally the case , that ω |{ right arrow over ( b )} 1 |& lt ;& lt ;|{ right arrow over ( b )} 0 |). [ we note that it may happen in some cases that { right arrow over ( b )} 0 is known , and one only wants to correct { right arrow over ( b )} 1 . in this case the techniques of section 3 . 7 can be used . and then the length scale must be modified and becomes l seq & lt ; 1 ω b _ 1 ( 76 c ) second note that the rate of change of { right arrow over ( b )} is known as the mode coupling length l mcl , see for instance [ 3 ] for a definition . it can be measured using standard techniques , see for instance [ 1 ]. we expect the rate of change of { right arrow over ( b )} 0 to be similar to the rate of change of { right arrow over ( b )} 1 . when this is the case the analogue of eq . ( 76 ) is if the rates of change of { right arrow over ( b )} 0 is different from the rate of change of { right arrow over ( b )} 1 , then it is the smallest rate of change which determines the analogue of ( 76 ). we would like draw attention to the fact that although above { circumflex over ( b )} x ( l ), { circumflex over ( b )} y ( l ) and { circumflex over ( b )} z ( l ) were taken to be due to interactions with the frequency , our method automatically corrects for any sources of depolarization — indeed , all interactions of polarization with other physical systems can be described by ( 68 ). the only requirement is for the interaction to be “ gradually changing ”, i . e . to be weak enough over the length of fiber l after which it is practical to insert the polarization rotation devices , so as to be in the first order of perturbation . it is also important to mention that while making the polarization rotations at intervals which assure the application of first order perturbation is desirable , this doesn &# 39 ; t mean that going outside this regime renders the method completely useless . on the opposite , the method can certainly be used . however the efficiency of the method is in general reduced ; the precise results can easily be computed by simply taking into account more orders in eq ( 32 ), depending on the particular parameters of the hamiltonian . it is worthwhile to note that ordinary polarization rotation devices ( such as ordinary λ / 2 plates etc .) are not generally achromatic . this means that such devices may themselves entangle polarization with frequency and using them may result in depolarization even when the fiber is perfect . of course , such devices could be used instead of the ( preferred ) achromatic ones as long as the depolarization due to the polarization rotation device is much smaller than the fiber - due depolarization that it helps correct . however even if the pmd of the polarisation rotation devices is larger than the pmd it is supposed to correct , one can devise the sequence in such a way that — at least to first order — the pmd induced by the rotation devices cancel . we call such sequences “ self - correcting sequences ” ( scs ). 5 . 1 . examples based on the proportionality of { right arrow over ( b )} 0 and { right arrow over ( b )} 1 in this subsection we described scs which exploit the fact that , when the model of section 4 . 2 is valid , { right arrow over ( b )} 0 and { right arrow over ( b )} 1 will in general be proportional one to the other , with ω { right arrow over ( b )} 1 much smaller than { right arrow over ( b )} 0 . as illustration we consider the sequence eq . ( 27 ) consisting alternating σ x and σ z operations . because of dispersion in the control elements , we suppose these control elements are implemented by operations of the form where β is equal to the ratio of { right arrow over ( b )} 1 to { right arrow over ( b )} 0 for the control elements . we suppose that βω & lt ;& lt ; 1 . we need to compute to first order in βω where l is the distance between the control elements . we recall that u ( l )▭ 1 − il { right arrow over ( b )}·{ right arrow over ( σ )} ph can be expanded to first order in 1 . we already know that the terms of first order in l , zero &# 39 ; th order in βωcancel . let us now consider the terms of zero &# 39 ; th order in l , first order in βω . we obtain for these terms which vanishes . thus we see that in this example the effect of pmd of the control optical elements cancels to first order . we now derive a general condition for first order compensation of the chromatic effects produced by the control operations . we derive this for ccs . using the notation of subsection 3 . 5 ( and in particular replacing length l by time t ), we write we want the first order terms in βω to cancel . define { tilde over ( h )} c ( t )= u c † ( t ) h c ( t ) u c ( t ) ( 83 ) where u c ( t ) is defined as the continuous limit of eq . 44 . the condition for first order cancellation of the dispersion produced by the control operations themselves is ( with t the duration of the sequence ) ∫ 0 t h ~ c ( t ) ⅆ t = 0 . ( 84 ) we now give a second method to correct imperfections in the control hamiltonian . as above we denote h c ( t ) the control hamiltonian we wish to implement . we suppose that when implementing h c ( t ), we also implement an additional hamiltonian h ad ( t ) which is unwanted . ( in the example above h ad = βωh c ( t ); here we do not require proportionality between h c and h ad .) thus we suppose that the total hamiltonian is h = h d + h c ( t )+ h ad ( t ). let us denote the unitary evolution engendered by h c by u c ( t ). more precisely it is given by the time ordered product : u c ( t ) = lim n → ∞ ( 1 - i t n h c ( ( n - 1 ) t n ) ) … ( 1 - i t n h c ( t n ) ) ( 1 - i t n h c ( 0 ) ) . ( 85 ) we will suppose that h c corrects polarisation mode dispersion . for instance it could obey the equations ∫ 0 t ⅆ tu c † ( t ) σ _ u c ( t ) = 0 , ( 86 ) or could obey other conditions ; the precise conditions do not matter here . here t is the time it takes to implement the sequence the idea of the method is to implement first the evolution u c , and then the inverse evolution u c † . in this way any imperfections which arise during the evolution of u c will get undone during the inverse evolution . more precisely we will suppose that the total hamiltonian takes the form the hypothesis that are required for the present method to work are thus that one can implement both h c and − h c , and that when one implements − h c , the unwanted additional hamiltonian h ad also gets a minus sign . this , will generally be the case when the physical process which gives rise to h c also gives to h ad . for instance in section 7 we suggest that h c = σ z ph can be implemented by squeezing the fiber in the vertical direction and that h c =− iσ z ph can be implemented by squeezing the fiber in the horizontal direction . we expect that in this case when h c changes sign , h ad will also change sign . to see that the present method works , we proceed as follows . denote by u the time ordered evolution for the total hamiltonian h ( i . e . it is the analogue of eq . ( 85 ), but with h c replaced by h ). we then have : 1 ) to zero &# 39 ; th order in h d ( that is if we set h d = 0 ), the relation u ( 2t − t )= u ( t ) holds . in particular this implies that to order zero in h d , u ( 2t )= i . in other words if the dispersive hamiltonian h d is equal to zero , then after time 2t the effects of h c and of h ad have cancelled , independently of the details of h ad . 2 ) any conditions which we impose on u c will continue to be satisfied to zero &# 39 ; th order in h ad ( that is if we set h ad = 0 ). for instance if the condition is of the form eq . ( 86 ), then to zero &# 39 ; th order in h ad it becomes : in summary in the present method , the effect of h ad will only be felt in terms which are both first order in h d and first order in h c . the advantage of this method is that it does not require any hypothesis to be made on h ad , except that it will change sign when we change the sign of h c . we note that the entire above discussion referred to depolarization of photons going through optical fibers . it must be clear however that identical procedures are effective in many other cases that are similar to this . examples are depolarization of electron spin during the propagation of electrons through electric wires , or depolarization of the spin of holes through semiconductor wires . in particular applications emerging from recent advances in the fields of spintronics , mesoscopy and nanoelectronics might benefit from our method . control elements of the form discussed above can of course be implemented by bulk optics , such as λ / 2 plates . but this implies that the light must be coupled out of the fiber and then reinjected into the fiber . this is both costly and induces losses , but could be useful for specific applications . the control elements ( polarisation rotation devices ) can be realized by modifying locally the fiber itself . indeed , any birefringence produces polarization rotation . by inducing a controlled amount of birefringence along an appropriate axis , any polarization rotation can be implemented . it is well known that birefringence can be induced by many effects , including 1 . inducing stress in the fiber 2 . applying pressure to the fiber 3 . bending the fiber 4 . twisting the fiber 5 . inducing stresses by in - homogenous cooling during fabrication . 6 . anisotropy in the structure of the fiber itself , as in elliptic core fibers . any of these methods can be used to realize the control operations . one preferred method is to induce permanent linear birefringence by inducing stresses in the fiber , for instance by deforming the fiber . this can be done either after the fiber has been drawn , or while it is being drawn . one possibility is to squeeze the fiber while it is being drawn so as to induce a permanent deformation . this idea is illustrated when the squeezing is realized by a pair of rollers in fig3 and 4 . in these figures the fiber is denoted 1 . 10 and the rollers 3 . 1 . the rollers are placed at an appropriate relative angle to each other . fig3 and 4 represent the same device , but in fig3 one views the fiber from the side , whereas in fig4 one views the fiber along its axis . the fiber is pulled through the rollers as indicated by the arrow on the fiber in fig3 . for example , in order to implement the sequence ( 27 ) we need to produce σ z ph and σ x ph rotations . this can be done by squeezing along alternating axes ( say along the horizontal direction and at 45 degrees to the horizontal ). the squeezings need to induce an appropriate amount of birefringence so that the squeezed regions effectively behave as λ / 2 plates and therefore implement the σ z ph and σ x ph rotations . a possibility is to have two squeezing mechanisms , one oriented horizontally and the other at 45 degrees to the horizontal and have them squeeze alternately , with an appropriate time delay , so that the fiber , after being drawn , ends up squeezed periodically along the desired axis . different combinations of squeezings ( oriented along different axis , and producing different amounts of birefringence ) can implement different sequences of rotations . note that squeezing along the vertical and horizontal directions induces an effective control hamiltonian which in one case is h c =+ σ z ph and in the other is h c =− σ z ph . this remark can be useful when implementing continuous compensating sequences , and when trying to ensure that the defects and in particular the pmd of the control elements cancels ( as in section 5 ). in order to implement continuous rotations of polarization we can use a squeezing mechanism that continuously squeezes the fiber as it is drawn . the amount of squeezing can be varied continuously . the orientation of the squeezing device ( and hence the axis of the rotation of polarization that the squeezing produces ) can be varied continuously as well . another method for implementing the polarization rotations is to apply periodic pressure and / or bending via some of the coatings . ( here by coating we refer to any of the layers that cover the optical fiber ; in practice each of the layers may have a specific name , such as inner coating , external coating , buffer , jacket , etc .) this can be done for example by using non - uniform ( periodically modulated ) coatings . one possibility is to periodically place on the fiber , or on one of the coatings of the fiber , little quantities of appropriate material ( say in form of drops or non - uniform rings or any other appropriate shape ) that are then covered by a normal uniform coating . the coating exerts pressure on these drops or rings which then press on the fiber . this is illustrated in fig5 and 6 . in these figures the fiber is denoted by 1 . 10 , the coating by 5 . 2 . fig5 illustrates the case where pressure is applied on the fiber via non - uniform rings ( denoted 5 . 1 ) placed periodically on the fiber and at different angles . the rings 5 . 1 can be placed directly on the fiber or on one of the inner coatings . fig6 illustrates the case where pressure is applied on the fiber via drops ( denoted 6 . 1 ) placed periodically on the fiber at different angles . the drops can be placed directly on the fiber or on one of the inner coatings . another method consists of subjecting the fiber to anisotropic thermal stresses while it cools during drawing . this can be done for instance by subjecting the fiber to sideways jets of cold air , or sideways heating by laser beams or other heating devices , as it is being drawn . the anisotropic cooling leads to controlled stress , thus controlled birefringence and ultimately controlled rotations of polarization . the intensity and / or direction of the cooling or heating devices ( jets or laser beams for instance ) can be changed , so as to induce changes in the induced rotations of polarisation . as in the case of sequeezing we note that one can implement h c and its opposite − h c by making the cooling / heating act in orthogonal directions , and that this can be particularly useful when implementing self correcting sequences described in section 5 . note that systems which rotate the polarisation will in general induce back reflection of light . this is an unwanted effect . however there are standard methods to reduce this back reflection , and in preferred embodiments the method comprises a step of reducing back reflection . one method is to put antireflection coating on bulk optical elements . in the cases where the control elements are introduced by modifying the birefringence of the fiber , back reflection will be minimized if the birefringence changes very little over a length equal to the wavelength of light . we also note that all the above implementations , indeed , all the compensating sequences presented here , can be combined with the method of spinning the fiber during manufacturing [ 4 ][ 5 ] to obtain the benefits of both methods . in one preferred embodiment which combines the two methods , a polarisation flip , σ x ph or σ z ph , is carried out after each spin period . we have presented a large number of different types of compensating sequences . they can be implemented separately or in different combinations . for example on the same fiber one can use a number of different ecs , in a random order . this prevents for any possible imperfections in a particular ecs to add - up systematically . one can also use a number of different pcs , in a random order . by its very definition , each pcs produces only partial compensation , but alternating them randomly produces further compensation . a skilled person can select an appropriate sequence for a particular fiber , depending on the fiber optical and mechanical properties , details of fabrication process , etc . thus for each particular type of fiber , a different sequence or combination of sequences may be preferred . in general exactly compensating sequences are preferred to partially compensating sequences . self - correcting sequences are also particularly preferred , see section 5 . in this way the imperfections in the implementation of the polarization rotations cancel automatically . we want to emphasize that although the sequences presented here are designed to produce best results when the constituent rotations are applied frequently enough such that the first order of perturbation applies , they also achieve some degree of compensation even outside this regime . on the other hand it can be shown that , when the first order of perturbation applies , the compensating sequences achieve better compensation if the length of the compensating sequence is shorter , see eq . ( 18 ). thus it general it is preferred that the compensating sequences are as short as possible . n . gisin , j . p . von der weid and j . p . pellaux polarization mode dispersion of short and long single mode fibers , ieee j . lightwave technology , 9 , 821 - 827 , 1991 . n . gisin and j . p . pellaux , polarization mode dispersion : time domain versus frequency domain , optics commun ., 89 , 316 - 323 , 1992 . d . a . nolan , x . chen , m .- j . li , fibers with low polarization - mode dispersion , ieee j . lightwave technology , 22 , 1066 , 2004 . a . j . barlow , j . j . ramskov - hansen , and d . n . payne , birefringence and polarisation mode - dispersion in spun single - mode fibers , applied optics , 20 ( 1981 ) hart , jr . arthur c . ; huff , richard g . ; walker , kenneth l ., u . s . pat . no . 5 , 298 , 047 ( 1994 ). m j li , d a nolan , fiber spin - profile designs for producing fibers with low polarization mode dispersion , opt . lett , 1998 , vol . 23 , no . 21 , 1659 r e schuh , x shan , a s siddiqui , polarization mode dispersion in spun fibers with different linear birefringence and spinning parameters , ieee j . lightwave technology , 16 , 1583 , 1998 . x chen , m j li , d a nolan , polarization mode dispersion of spun fibers : an analytical solution , opt . lett , 2002 , vol . 27 , no . 5 , 294 x chen , m j li , d a nolan , scaling properties of polarization mode dispersion of spun fibers in the presence of random mode coupling , opt . lett , 2002 , vol . 27 , no . 18 , 1595 m . chertkov , i . gabitov , i . kolokolov , t . schafer , periodic compensation of polarisation mode dispersion , j . opt . soc . am . b 21 ( 2004 ) 486 c . p . slichter , principles of magnetic resonance , 3rd . ed . ( springer verlag , new - york , 1990 ) l .- a . wu , h - k lo and d . a . lidar , simple solution to loss and decoherence in optical fibers , quant - ph / 0307178v1 l .- a . wu and d . a . lidar , overcoming quantum noise in optical fibers , phys . rev . a 70 , 062310 ( 2004 ) l . viola and s . lloyd , dynamical suppression of decoherence in two - state quantum systems , phys . rev . a ( 1998 ) 2733 , quant - ph / 9803057 n . gisin , n . linden , s . massar and s . popescu , error filtration and entanglement purification for quantum communication , quant - ph 0407021 , phys . rev . a 72 , 012338 ( 2005 ) g . p . agrawal , nonlinear fiber optics , third edition , academic press , 2001
| 6 |
in the following , the invention will be illustrated by referring to wcdma access scheme used in 3gpp umts system . it is , however , notified that the invention is not limited to umts solely , but it can be implemented in any communication system , wherein always - on applications or similar applications requiring continuous transmission of small application - related messages . for example , the invention may be utilized in gsm or wlan terminals including always - on applications . umts ( universal mobile telecommunications system ) is the 3 rd generation mobile communication system , wherein the wireless cellular access network is implemented using wcdma . in the system architecture of the umts terrestrial radio access network ( utran ) shown in fig1 , a radio network controller ( rnc ) is connected to a core network via an iu interface , the rncs are interconnected via an iur interface , and one rnc is connected to one or more node bs via an iub interface . a node b contains one or more cells , the cell being a basic unit to which user equipment ( ue ) has wireless access via a radio interface uu . considering the umts radio interface protocol architecture from the control plane perspective , as shown in fig2 , the bottom layer is a physical ( wcdma phy l1 ) layer , above the physical layer are a media access control ( mac ) layer , a radio link control ( rlc ) layer and a radio resource control ( rrc ) layer . the rrc layer offers services to higher layers of non - access stratum , i . e . to mobility management ( mm ), call control ( cc ), session management ( sm ) etc ., the signalling of which is encapsulated into rrc messages for transmission over the radio interface . the rrc layer uses the lower layer protocols , in turn , to configure the parameters for the physical , transport and logical channels , and to command the lower layer protocols to perform various measurements . from the rrc layer point of view , the user equipment ue operates either in a connected mode or in an idle mode . the connected mode is further divided into service states , which define what kind of physical channel the ue is using . when the ue is switched on , it operates in the idle mode by selecting a suitable cell of appropriate plmn ( public land mobile network ), and then tunes into its control channel , i . e . the ue “ camps on a cell ”. the ue remains in the idle mode until it transmits a request to establish an rrc connection , which , if successful , transits the ue into the connected mode . from the idle mode , the ue may transit into the cell_dch state or the cell_fach state of the connected mode . in the cell_dch state , a dedicated physical channel ( dch ) is allocated to the ue . the ue uses the dch in its user data and control information transmission . in the cell_fach state the ue uses either the forward access channel ( fach ) or the random access channel ( rach ) for transmitting both signalling messages and small amounts of user plane data . from the cell_fach state the ue may further transit into the cell_pch state or the ura_pch state to minimise the battery consumption , whereby the ue can only be reached via the paging channel ( pch ). in the cell_pch state , the ue is identified on a cell level in the serving rnc , but in ura_pch state only on utran registration area ( ura ) level . the ue leaves the connected mode and returns to the idle mode when the rrc connection is released or failed . the 3gpp document tr25 . 922 discloses a handover between a dch / dch and a rach / fach based on a traffic measurement of a transmission channel , and a method for dch / dch rate change . accordingly , when the traffic exceeds a certain threshold , there is a capability for a handover from a rach / fach to a dch / dch , or improving the dch rate by decreasing spreading factors . on the contrary , when the traffic is less than a certain threshold , there is a capability for a handover from the dch / dch to the rach / fach , or improving the dch rate by increasing spreading factors . the 3gpp documents tr25 . 922 and ts25 . 331 further disclose how the channel handover between a dch / dch and a rach / fach is carried out via rrc processes “ physical channel reconfiguration ” or “ transmission channel reconfiguration ”. for further details , a reference is made to said documents . the current consumption of the ue varies significantly , depending on the mode / state the ue is using . for example , the current consumption of the dch during transmission is substantially twice the current consumption of the fach . furthermore , a channel stay - up time has been defined for the dch , whereby after transmission the dch is specified to stay active for the stay - up time , during which the current consumption is similar to that of transmission . a typical value for the dch stay - up time is three seconds . in this view , the quite randomly scheduled messaging patterns of various always - on applications cause unnecessary power consumption . each transmission of a message , despite of its size , requires its own radio channel activation causing extra power consumption . this has led to solutions , wherein small messages are gathered for a certain time period , e . g . for 10 minutes , and then grouped into a package of messages for transmission . however , since the larger messages exceeding the given threshold must be transmitted on the dch , in such case the increase in power consumption is significant due to the higher current consumption combined with the dch stay - up time . according to an embodiment , savings in current consumption can be achieved by an implementation , wherein messages from different always - on applications are combined to use a uniform messaging pattern such that a number of messages are sent simultaneously , while still enabling extensive usage of the most energy efficient wcdma channels ( rrc states ). the implementation is most preferably carried out as a software application stored and executable in the ue , which application is herein referred by a name “ always - on battery saver ”, i . e . abs application . the operation of the abs application is further disclosed by referring to a block chart of fig3 . in fig3 , the terminal 300 includes the abs function 302 , which has a task of gathering information on the used parameters of the rrc states , on one hand , and on the communication patterns used by the various always - on applications 304 currently executed in the terminal , on the other hand . the terminal 300 may include one or more always - on applications 304 , which all have individual messaging patterns , which are collected to the abs function 302 . the terminal 300 further includes a radio resource management ( ue rrm ) block 306 , which together with nw rrm block 308 of the network controls the rrc states and the parameters required to set up , modify and release the lower layer protocol entities . now the abs function 302 gathers information on the communication patterns of the one or more always - on applications 304 . as mentioned above , the always - on applications may include presence / instant messaging services , ims services , push mail , which typically have a messaging pattern designed at least for downlink direction , but also possibly for uplink direction ( e . g . for uplink instant messaging messages ). most of the messages relating to the always - on applications are not critical to be transmitted real - time , i . e . in most cases a transmission delay of several minutes is still acceptable . for such messages , the abs function combines messages from various always - on applications into a group of messages , which at least in theory could be sent simultaneously together ( i . e . no unreasonable delay caused ). a second factor affecting the actual communication pattern is the objective to use the most energy efficient wcdma channels ( rrc states ) as extensively as possible . now these groups of messages combined by the abs function are examined further , if they could be transmitted in the fach state instead of the high current consuming dch state . for that purpose , the number of messages sent from each group of messages at a time is optimised in view of the capacity of the fach , for example . thus , the size of the messages is compared to the maximum size of data to be transferred on fach , and then preferably a message package is determined , which includes one or more messages from various always - on applications such that the total size of the message package is as close to the maximum size of fach data as possible . naturally , if the size of even one message exceeds that the maximum size of fach data , then the dch must be used for transmitting the message . according to an embodiment , the abs function preferably examines whether the current cell of the terminal supports the cell_pch state . if the cell_pch state is supported , then it could be used instead of the idle state to minimize the current consumption of the terminal during idle times . regardless of whether the cell_pch state is supported or not , the abs function preferably further examines if the network supports state transitions from idle - to - fach or merely from idle - to - dch , and what are the inactivity periods and the threshold values of data amount for state transitions . then , based on these parameters and gathered or presumed values of current consumption in different states , the abs function then starts to determine the most energy efficient messaging pattern . according to an embodiment , if only the state transition from idle - to - dch is supported , then based on the average amount of message data from the various always - on applications , the abs function calculates whether it is advantageous to optimise the total size of the message package and its transmission interval such that the terminal ue automatically stays on the cell_fach state ( i . e . no transit to the idle state ). the other option is to transit to the idle state after the transmission of the message package , whereby current savings are achieved in the idle state , but the wake - up to the connected mode is always performed via the high current consuming cell_dch state . on the other hand , if the current cell of the terminal supports the cell_pch state or state transitions from idle - to - fach , then according to an embodiment , the total size of the message package is preferably optimised in view of fach transmission . between the transmissions the terminal ue may transit to the idle state or the cell_pch state , and by the time of the next transmission a state transition from idle - to - fach or from pch - to - fach is carried out . altogether , the parameters which typically affect to the determination of the most energy efficient messaging pattern include at least current consumption in different rrc states , inactivity timers of state transitions , and the adjusted data transmission capacity of each rrc state . in wcdma networks , there are typically determined at least three different inactivity timers for state transitions : timer t 1 for the state transition from dch - to - fach , timer t 2 for the state transition from fach - to - pch or fach - to - idle , and timer t 3 from pch - to - idle . all these timers and their values are network controlled , typically managed by the rnc . timer t 1 determines the inactivity period , which is required after traffic on the dch channel , after which period the ue may transit to the cell_fach state . the t 1 value is typically a couple of seconds ( e . g . 2 - 5 s ) and it may depend on the used dch data rate such that the higher the data rate , the shorter the inactivity period . on the other hand , the t 1 value should not be too short , because it would deteriorate user experience e . g . in web browsing . timer t 2 determines the inactivity period , which is required after traffic on the fach channel , after which period the ue may transit to the idle state or cell_pch state . also the t 2 value is typically a couple of seconds ( e . g . 2 s ), but depending on the used services it is also possible to have no timer t 2 at all , i . e . the t 2 value is zero . timer t 3 determines the rrc connection release period , i . e . the inactivity period of the cell_pch state to transit to the idle state , which is typically at least ten minutes . the current consumption of a terminal ue in different states is always terminal - specific , and therefore only rough estimates can be given . in the contemporary mobile terminals , the current consumption in the dch state is about 200 - 260 ma . in the fach state , the current consumption is roughly half of that in the dch state , i . e . about 100 - 130 ma . in the pch state , the current consumption is very minimal , typically only a few ( 2 - 5 ) ma . however , it is very likely that as the technology advances , the absolute current values will become smaller , while their mutual ratio probably stays essentially the same . accordingly , it is obvious that the values of the timers t 1 and t 2 and the current consumption of the terminal in the dch and fach states are the parameters that have significance , when determining the most energy efficient messaging pattern . regarding the data transmission capacity of each rrc state , the thresholds of buffered data triggering a state transition can be adjusted by the network operator . in many cases , a state transition threshold from fach - to - dch has been adjusted to 128 bytes of buffered data , but , for example , a threshold value of 1 kb data could be used as well . once the appropriate size of the message packages has been determined , a transmission interval is then calculated , i . e . how often the message packages should be sent such that no unreasonable delay or buffering of the messages is caused . naturally , the inactivity periods triggering the state transitions are also taken into account . as mentioned above , in some occasions , it is preferable that the terminal ue stays all the time on the fach state rather than transiting to idle state and then via dch state back to the fach state . then on the basis of the message package size and the transmission interval uniform messaging patterns are determined , preferably separately for both the uplink messaging and the downlink messaging . however , when considering especially the dch state , both the uplink messaging and the downlink messaging should be taken into account , since the dch channel is always established in both directions . therefore , it there is downlink traffic on the dch , it is also preferably to send as much data as possible to uplink direction . the abs function 302 indicates the downlink messaging pattern to always - on application servers 310 connected to the access network . then the application servers 310 operate together with the rrm block 308 of the network to organise the downlink messages to be transmitted such that they are received in the terminal in optimised way . regarding the uplink messaging , the abs function preferably itself controls the formation and transmission of the always - on messages according to the determined uplink messaging pattern . then based on the message package size , the rrm block of the terminal allocates a suitable state for the transmission , e . g . via the above - mentioned rrc processes “ physical channel reconfiguration ” or “ transmission channel reconfiguration ”. according to an embodiment , if there are particular reasons to use a high transmission capacity channel having low energy efficiency ( e . g . dch in case of wcdma ) for transmitting a certain message , then the abs function is configured to transmit other buffered messages at the same time . typically this does not cause any significant increase in current consumption , since most of the current consumption is due to the long inactivity timer . hence , the dch channel activation is utilised most efficiently . thus , if the user of the ue sends a long message ( e . g . email polling ) on the dch or an always - on application requires a certain message to be transmitted at a particular time instance on the dch , then for example the buffered status and keep - alive messages of the other always - on applications are transmitted on the dch as well . according to an embodiment , the abs function may still be configured to use a timer for adjusting the transmission of the messages from the other always - on applications . then if , for example , a status message of an always - on application has just been sent ( i . e . the timer has not yet expired ), no new status message is sent , even if the dch channel is activated “ for free ”. some basic principles relating to the process of determining a uniform messaging pattern for the always - on application messages is further illustrated in the flow chart of fig4 . in this illustration , the process is described on a general level , without limiting it particularly to wcdma networks and its rrc states . the process of determining a uniform messaging pattern in the abs function starts by gathering ( 400 ) information on the messaging patterns of the one or more always - on applications used in the terminal . another step is to gather ( 402 ) information on parameters of communication channels allocated for said sending and receiving of said messages . in case of wcdma , this practically means gathering information on the used parameters of the rrc states . the order of these steps may vary , and on the other hand , the latter step may be performed e . g . simultaneously with one or more of the steps described below . in this illustration , the next step is to determine ( 404 ) an allowable transmission delay for said messages . as mentioned above , in most cases an acceptable transmission delay of several minutes may be allocated to most of the always - on application messages . next , messages from the one or more always - on applications used in the terminal are calculated ( 406 ) during the allowable transmission delay , resulting in a cumulative group of messages . now the size of this group of messages is compared ( 408 ) to the allocated parameters of communication channels ( e . g . the parameters of the rrc states ), and if the transmission capacity of the most energy efficient communication channel (“ 1 st channel ” in fig4 ) allows , then a message package including one or more messages transmittable within said transmission capacity is determined . finally , for completing the uniform messaging pattern , a transmission interval is determined ( 410 ) for the message packages such that all messages within said group of messages are transmitted during said allowable transmission delay . however , if it is noticed ( in step 408 above ) that no message package transmittable within the transmission capacity of the most energy efficient communication channel can be defined , then it is examined whether it is possible to define ( 412 ) a message package transmittable within the transmission capacity of the next most energy efficient communication channel (“ 2 nd channel ” in fig4 ). if such message package can be defined , then a transmission interval is determined ( 410 ) for the message packages . if there is still no transmittable message package found , then the least energy efficient communication channel (“ 3 rd channel ” in fig4 ) is allocated ( 414 ) for transmitting the message package with a suitable transmission interval ( 410 ). in this example , it is assumed that there are only three communication channels with different transmission capacities available . a skilled man appreciates that if there are more than three channels available , then the steps 408 - 414 should be repeated until a suitable communication channel for transmitting the message package is found . a skilled man also appreciates that in a real case of wcdma , the actual implementation is not as straightforward as described in fig4 . in case of wcdma , the state transition supported by the network and the inactivity timers for the state transitions should be carefully taken into account , and their effect to the total current consumption should be evaluated . furthermore , in the wcdma , there are only two channels ( fach and dch ) available for transmitting the messages , but also the third channel ( pch ) should be considered for state transitions . a skilled man further appreciates that any of the embodiments described above may be implemented as a combination with one or more of the other embodiments , unless there is explicitly or implicitly stated that certain embodiments are only alternatives to each other . the advantages of the embodiments can be illustrated by the following hypothetical example . let us suppose that the user of the ue has 100 presence contacts that change their status 10 times in a day , and the size of a user update message is 300 bytes . regarding the relevant rrc parameters , the dch minimum bitrate is 64 kbps , the inactivity timer t 1 ( the dch stay - up time ) is set to three seconds , and the current consumption of an active dch channel is 220 ma . for the fach , the maximum size of data to be transferred on fach is adjusted to 1000 bytes ( 1 kb ), there is no inactivity timer ( t 2 = 0 ), and the fach current consumption is 120 ma . now considering a conventional ( prior art ) implementation for sending the update messages , the update messages would be first collected for the period of 10 minutes and then the whole package of the collected messages would be sent to the ue . 100 presence contacts , each sending a status update message 10 times in a day , makes 1000 update messages in a day , i . e . about 6 . 9 messages per 10 minutes . the size of the package (˜ 6 . 9 * 300 b ) is little more than 2 kb , which means that the package must be sent on the dch . the duration of the transmission is 64 kbps /˜ 2 kb =˜ 0 . 25 s , plus the dch stay - up time three seconds = 3 . 25 s in total . thus , the average current consumption for the 10 minutes period is 220 ma * 3 . 25 s /( 10 * 60 s )= 1 . 2 ma . according to an embodiment , a more optimised method for sending the update messages can be achieved , if the number of update messages sent at a time is optimised in view of the capacity of the fach . thus , since the maximum size of data to be transferred on fach is 1000 bytes and the size of a user update message is 300 bytes , the update message package may include three messages . in order to send all the 1000 update messages in a day , such update message package including three messages must be sent 1000 /( 24 * 3 )= 13 . 9 times per hour , i . e . every 4 . 32 minutes . thus , the average current consumption for the 4 . 32 minutes period is 120 ma * 0 . 25 s /( 4 . 32 * 60 s )= 0 . 115 ma . accordingly , the average current consumption of the ue is dropped to one tenth , i . e . by about 90 %, compared to the prior art implementation . a skilled person appreciates that the above example is only hypothetical and in real use - cases , the savings in current consumption may be more or less than said 90 %, depending on the used always - on applications and their various parameters . however , at the same time it is evident that the embodiments disclosed herein provide significant savings in current consumption , regardless of the used always - on applications and their parameters . it should be noted that from the network viewpoint , the current savings are even more significant , since the number of messages can easily grow exponentially , when more users subscribe the presence service , which results in growing number of contacts for each user and growing number of update messages at the same time . an example of a possible implementation of a user equipment ue is illustrated in a simplified block diagram shown in fig4 . the user equipment ue comprises an rf part including a transceiver tx / rx for arranging radio frequency communication via the antenna ant with a node b ( base station ) of the network . user interface means ui typically comprise a display , a keyboard , a microphone ( μf ) and a loud speaker ( ls ). the user equipment ue further comprises a memory mem for storing computer program code to be executed by the central processing unit cpu comprising at least one processor . the memory mem includes a non - volatile portion for storing the applications controlling the central processing unit cpu and other data to be stored and a volatile portion to be used for temporary data processing . the functionalities of the invention , i . e . the abs function , may be implemented in the user equipment ue , such as a mobile station , as a computer program which , when executed in a central processing unit cpu or in a dedicated digital signal processor dsp , affects the terminal device to implement procedures of the invention . the functions of the computer program , e . g . different sub - routines , may be distributed to several separate program components communicating with one another . the computer software may be stored into any memory means , such as the hard disk of a pc or a cd - rom disc , from where it can be loaded into the memory of mobile terminal . the computer software can also be loaded through a network , for instance using a tcp / ip protocol stack . it is also possible to use hardware solutions or a combination of hardware and software solutions to implement the inventive means . accordingly , the above computer program product can be at least partly implemented as a hardware solution , for example as asic or fpga circuits , in a hardware module comprising connecting means for connecting the module to an electronic device , or as one or more integrated circuits ic , the hardware module or the ics further including various means for performing said program code tasks , said means being implemented as hardware and / or software . it is obvious that the present invention is not limited solely to the above - presented embodiments , but it can be modified within the scope of the appended claims .
| 8 |
the present invention will now be described in detail for specific preferred embodiments of the invention . these embodiments are intended only as illustrative examples and the invention is not to be limited thereto . one embodiment of the present invention is an inhaler for delivery of medication from either of a first canister 10 or a second canister 11 to the lungs of a patient by inhalation through the patient &# 39 ; s mouth . the first and second canisters are not a part of the invention , but are supplied by pharmaceutical companies . this embodiment of the invention accepts nearly all of the commonly prescribed mdi canisters , which have a compression spray outlet . the inhaler comprises a cowling 26 , which is a universal receptor and holder for the mdi canisters . in a typical embodiment , a dual canister inhaler has a cowling , which is further comprised of a support structure 110 , a first canister receptor and a second canister receptor . each of the first canister receptor and the second canister receptor has a flexible fitting 113 and a ring 114 . the flexible fitting is supported within the ring . the ring has an inner diameter , which supports and guides the compression spray outlets of each of the mdi canisters into the flexible fitting . the flexible fitting engages the compression spray outlet 14 ( see fig8 ) of each of the two canisters , creating a seal around compression spray outlets of the mdi canisters . the support structure of the cowling 26 has the ring and flexible fitting fixed in one end , and the other end is open , allowing the patient to insert each of the two mdi canisters , with diameter about 0 . 94 inches or less , into the cowling . the shape of the inner walls of the support structure 110 of the cowling is the same cylindrical shape typical of mdi canisters , but the wall of the support structure is not homogeneously solid . as shown in fig5 one embodiment of the cowling has solid cylindrical walls only on the upper half of the cowling . the solid wall in the upper half of the cowling helps the patient insert the mdi canister into the inhaler . the lower half has solid walls connecting to the ring only on the front and back surfaces of the cowling . this allows a sliding selector switch to engage the lip of a mdi canister to selectively engage either one or the other mdi canister that is inserted into the cowling . in another embodiment , the support structure of the cowling could have solid walls on the left and right of the cowling , connecting to the ring , allowing a sliding selector switch to engage the lip of a mdi canister from the front and back of the cowling . it would be obvious to one skilled in the art that other combinations are possible for allowing the sliding selector switch to engage an mdi canister in the cowling , and these alternatives are included within the scope of this invention . in yet another embodiment , the support structure of the cowling 101 is solid on the front and back , and their is a connecting solid between the structure supporting the two canisters , as shown in fig8 . in this embodiment , the exterior sides are left open . the particular embodiment shown in fig8 also shows an alternative embodiment for the flexible fitting and ring . in this particular embodiment , the ring and flexible fitting were omitted intentionally , and the compression spray outlet entered directly into the cowling receiving section inlet port of the housing . a preferred embodiment of the cowling receiving section is described in detail below . the cowling of this invention acts to hold the canisters in place , also . in an alternative embodiment , a locking plate 71 is included that mechanically locks each of the mdi canisters in place within the cowling 26 . fig5 shows an example of a locking plate . the previously mentioned sliding selector switch 21 has the same number of operating positions as there are canisters . therefore , a dual canister design has both a first operating position , see fig6 and a second operating position , see fig7 . by operating position , the inventors mean that one of the canisters is engaged by the sliding selector switch ( or selector ), and by depressing an actuator lever , the canister can be activated by the patient , dispensing medication . an example of an indicator display mechanism is illustrated in fig6 and 7 . when the selector is in the first operating position , a first arrow 56 is visible in the first indicator window 53 and points to the first canister 10 . when the selector is in the second operating position , as second arrow 54 is visible in the second indicator window 51 and points to the second canister 11 . in an alternative embodiment , the sliding selector switch 21 has a non - operative , locking position , which keeps an actuator lever 23 from being depressed by locking the actuating lever in the fully depressed position . in an alternative embodiment , the locking mechanism can lock the actuator lever in the fully deployed or up position . in yet another alternative , the locking mechanism is simply moved to a non - functional position , which engages no mdi canister ; therefore , the actuator lever freely moves without engaging any canister , and this embodiment can also incorporate a means for securing the actuator lever in the fully depressed or down position . this means for securing can be a fastener , an elastic band , a twist , a hold down , a hook , a snap , a keeper mounted on the chamber body or a detent on the chamber body that engages a protrusion attached to the bottom of the lever arm that approximates the shape of a portion of an oblate spheroid . in a preferred embodiment , the lever arm would be prevented from engaging the means for securing when in an operating position , because the lever arm would never be completely depressed unless the sliding selector switch was placed in the non - operating , locking position . then , the patient could simply snap the lever arm into the locked position . in one embodiment the cowling 26 is a part of a larger housing assembly . alternatively , the cowling is mechanically engaged , fastened , attached , fixed , fused or adhered within a cowling receiving section of the housing or a housing assembly of the inhaler . in general , the inventor refers to these various methods of incorporating the cowling within the cowling receiving section by the term fixedly seated ; therefore , the cowling is fixedly seated within the cowling receiving section . in one embodiment of the invention , the housing comprises a chamber receiving section 29 , a cowling receiving section , a sliding selector switch support 83 , a fresh air inlet 75 , and an enclosed passage . in this embodiment the cowling receiving section is shaped to accept the shape of the outer dimensions of the cowling 26 , and the sliding selector switch 21 . as one example , the cowling can be fixedly seated in the cowling receiving section , as shown in fig5 using an integral securing tab 114 . the cowling receiving section in fig5 has an upright centered tab support 116 and two upright pin supports , for example item 117 , that seat the cowling 26 within the cowling receiving section . other ways of fixedly seating the cowling in the cowling receiving section of the housing are known in the art and are within the scope of this invention , and the invention is not limited to the description in this particular example . the cowling receiving section has cowling receiving section inlet ports , corresponding to the position and number of mdi canisters that the cowling accepts . for a dual canister inhaler , two receiving section inlet ports 73 , 74 are located in the housing . when the mdi canisters are inserted into the cowling by the patient , the mdi canister compression spray outlets are inserted into the flexible fittings of the cowling . thereby , each of the compression spray outlets extends into the cowling receiving section inlet ports of the housing and into the enclosed passage of the housing . the enclosed passage of the housing is defined by the inner surface of the housing ( interior walls ). the enclosed passage of the housing ends in the chamber receiving section . an example of the chamber receiving section 29 is the opening of the housing adjacent to the chamber , as shown in fig8 . in one embodiment of the invention , the interior surface of the housing defines a compression spray outlet engaging stage , also . the compression spray outlet engaging stage , in this particular embodiment , is merely a platform in the housing below the cowling receiving section inlet ports , which engages the compression spray outlets of the mdi canisters , when either of the mdi canisters is depressed by the patient , depressing the actuator lever of the inhaler . in one specific embodiment , the compression spray outlet engaging stage is defined by a protrusion of the surface of the housing back into the cavity of the housing . by protrusion , the inventors mean that the solid wall that defines the surface of the housing has an indentation on one end that extends back into the cavity of the housing , making a shelf within the housing that leaves sufficient space for the compression spray outlet to rest on the shelf , when the canister is fully inserted into the cowling . in one embodiment , the shelf gradually slopes downward toward the chamber receiving section ; therefore , when the compression spray outlet of the canister is depressed , there is a gap between the shelf and the compression spray outlet . this causes the dispersal of the medication to occur in the general direction of the chamber receiving section . in another embodiment , the shelf is essentially flat , and the spray from the compression spray outlet is randomly dispersed throughout the enclosed passage of the housing . in yet another embodiment of the invention , channels are formed in the compression spray outlet engaging stage , wherein each of the compression spray outlets of the mdi canisters fit into a closed end of one of the channels , and the other end of the channels are open , directing the spray from the compression spray outlet in a desired direction within the housing of the inhaler . for example , in one embodiment , the channel directs the spray in the direction of the chamber , and in another embodiment , the channel directs the spray in a direction opposite to the chamber , enhancing mixing of the spray with external , fresh air entering through an inhalation vent in the housing prior to the spray entering the chamber through the enclosed passage of the housing . a portion of a protrusion that forms a down - sloping compression spray outlet engaging stage of one of the embodiments of the invention is shown in fig8 and is labeled as item 28 . in yet another embodiment , the protrusion is replaced by a compression spray outlet engaging stage that is defined by a step - like feature in the surface of the housing . by a step - like feature , the inventors mean that , instead of a protrusion back into the housing , the housing appears to have a tread and riser of step with a nearly 90 - degree angle or more preferably an arcuate transition , which similarly defines a shelf within the housing below the cowling receiving section inlet ports . this shelf performs the same function as the shelf formed by the protrusion , and can likewise slope downward toward the chamber to direct the medications toward the chamber . in yet other embodiments of the invention , the shelf - like feature of the previous embodiments is replaced by inserts placed between the housing and the cowling . the insert of one alternative embodiment of the invention is essentially a tube with two open ends , having one end that flares to a flange and the other end having a conical shape . the conically - shaped end of the insert is inserted into the housing through the cowling receiving port , and the flared flange end centers the insert within the cowling receiving port and secures the insert in place by fixing it between the housing and the ring in the cowling . one of the inserts is placed in each of the cowling receiving section inlet ports of the housing . when the patient inserts a canister into the cowling , the compression spray outlet of the canister is inserted into the tube of the insert . the length and diameter of the tube of the insert are selected to allow nearly all of the compression spray outlets of commonly prescribed mdi canisters to fit within the tube , with the end of the compression spray outlet resting in the taper of the conical tip of the tube of the insert . therefore , when the patient depresses the actuator lever 23 , the compression spray outlet 14 is compressed , causing dispersal of medication into the enclosed passage of the housing . in another embodiment , the inserts are mechanically attached to the housing . in an alternative embodiment the inserts are fixed to the housing . in yet another embodiment , the structure referred to as an insert is integral to the cowling receiving section inlet ports of the housing . in yet another embodiment , two inserts are joined to each other by a tab of solid between them . other ways to compress the compression spray outlets of a mdi canister are known in the art and are included within the scope of this invention . all of the various ways of compressing the spray outlets of the mdi canisters are referred to herein , generally , as a compression spray outlet compression mechanism . the term compression spray outlet engaging device refers solely to an insert device , and the term compression spray outlet engaging stage refers solely to a platform within the housing , which can be an attached platform or an integral compression spray outlet engaging stage . the term integral compression spray outlet engaging stage refers solely to a compression spray outlet engaging stage that is formed by a protrusion or a step - like feature in the surface of the housing , itself . the sliding selector switch 21 is slidably and pivotally mounted on the sliding selector switch support 83 . in a dual canister inhaler , the sliding selector switch is capable of engaging either canister , individually , when positioned by the patient in one of the two corresponding operating positions . an actuator lever 23 has a lever arm 22 and a distal end 20 . the distal end 20 of the actuator lever 23 is pivotally mounted on the sliding selector switch support 83 of the housing and engages the sliding selector switch 21 , when the actuator lever 23 is depressed by the patient . the distal end 20 of the actuator lever 23 has a cowling opening 136 , wherein the cowling 26 and canisters 10 , 11 pass through the cowling opening 136 . in one embodiment the actuator lever is pivotally mounted to the sliding selector switch support of the housing by a pin . a more preferred embodiment is shown in fig5 ; the distal end 20 of the actuator lever has a hole on each side 130 that engage two corresponding keepers 81 , 82 extending from the sliding selector switch support 83 of the housing . yet another embodiment of the actuator lever pivotal attachment is shown in fig8 which is a mechanism similar to the mechanism in fig5 except that the keeper 102 is integral with the sliding selector switch support , having projecting pins from each end of the sliding selector switch support . other methods of pivotally attaching the actuator are know in the art and are included within the scope of the invention , and the invention is not to be limited to the examples and description herein . a chamber further comprises a chamber body , 24 a mouthpiece 25 and an housing mating section 18 , wherein the chamber body is a solid shell that connects the mouthpiece at one end of the chamber body to the housing mating section at the opposing end of the chamber body . the housing mating section is an opening in the chamber , and the housing mating section 18 engages the chamber receiving section 29 of the housing 27 . in one embodiment , shown in fig5 the open housing mating section 18 fits into the chamber receiving section 29 of the housing 27 , a tab on the top of the housing mating section 93 fits a slot in the top of the chamber receiving section 92 , and another tab on the bottom of the housing mating section 94 slidably locks into a corresponding slot on the chamber receiving section . in another embodiment the housing mating section fits over the chamber receiving section , and the tabs and slots are reversed , tabs on the chamber receiving section and slots on the housing mating section . any combination of opposing tabs and slots would suffice for joining the two sections , whether on the tops or sides of the two sections . by using the term engages , the inventors specifically include known methods of fastening , fusing , adhering and attaching the sections to each other , but do not limit the scope of the invention thereto . yet other means of mechanically engaging the two sections are known in the art and are included within the scope of the invention . the mouthpiece 25 is shaped to fit the patient &# 39 ; s mouth and has a mouthpiece vent , which allows the mixture of air and medication in the chamber body to enter the patient &# 39 ; s mouth flow to the patient &# 39 ; s lungs , during inhalation . an example is shown in fig8 . in an alternative embodiment , a face mask can be attached to end of the mouthpiece . face masks are known in the art and are designed to conform to the patient &# 39 ; s face for patients that cannot use the mouthpiece properly . then inventors use the term mouthpiece to refer to the portion of the chamber that includes the surface structure of the mouthpiece , the mouthpiece vent and , in alternative embodiments of the invention , the exhalation vent or exhalation port and the valve assembly fixed within the mouthpiece end of the chamber body . as shown in fig2 the chamber 24 opposes the actuator lever 22 , and a patient can easily depress the actuator lever by squeezing the lever arm to the chamber body using the patient &# 39 ; s entire hand , rather than only the thumb and forefinger . in addition , the actuator lever 24 provides a mechanical advantage , reducing the force that must be applied by the patient to activate an mdi canister . depressing the actuator lever engages the sliding selector switch 21 . if the sliding selector switch 21 is in the first operating position , then the compression spray outlet of the first cannister is activated . if the sliding selector switch is in the second operating position , then the compression spray outlet of the second canister is activated . medication is dispensed from either the first canister or the second canister , respectively . upon dispensing the medication , the atomized mist from the inhaler is directed through the housing 27 and into the chamber 24 . during inhalation by the patient , a vent in the housing brings fresh air into the housing sweeping the remaining atomized mist from the housing into the chamber , where it mixes with the air , and is drawn through the mouthpiece and into the patient &# 39 ; s lungs through the patient &# 39 ; s mouth . in one preferred embodiment of the invention , a valve assembly in the mouthpiece of the chamber allows the mixture of medication and air to be drawn through the mouthpiece during inhalation , but during exhalation , the inhalation valve closes , and an exhalation valve opens , allowing the exhaled air to escape from an exhalation vent in the mouthpiece . this allows the patient to inhale the medication in multiple breaths . examples of the diaphragm valve 61 and valve body 62 are shown in fig5 and 8 . during inhalation air passes through the top cross - slit 65 , and the bottom cross - slit 66 is closed against the valve body , keeping any external air from entering the mouthpiece through the exhalation vent 19 . during exhalation , the top cross - slit 65 closes against the valve body , and the bottom cross - slit 66 opens , allowing exhaled air to exit through the two oval openings 67 , 68 on the diaphragm valve . the direction of the air reverses direction within the valve body 62 , and exits through the open bottom cross - slit 65 out the exhalation vent 19 of the mouthpiece . in an embodiment without a valve assembly of any kind , there would also be no exhalation vent in the mouthpiece . the mouthpiece can be integral to the chamber , or the mouthpiece can be mechanically attached , fastened , fused or adhesively bonded to the chamber body . in a preferred embodiment , a single diaphragm valve and valve body are fixed in the mouthpiece , and the diaphragm valve is held in position by the rod - like projections ( for example item 132 in fig8 ) from the valve body that engage corresponding holes in projections extending from the mouthpiece and exhalation vent ( not shown ). the rod - like projections extend through the holes in the periphery of the diaphragm valve ( for example item 69 in fig8 ), and the projections extending from the mouthpiece and exhalation vent force the diaphragm valve 61 to be in direct contact with the valve body 62 . in another embodiment of the invention , the inhalation valve is located at the inlet of the housing , while the exhalation valve remains in the mouthpiece . in yet another embodiment of the invention , the inhaler has an inhalation valve located in the mouthpiece , or in an alternative embodiment in the housing , and no exhalation valve is present , requiring the patient to remove the inhaler from the patient &# 39 ; s mouth while exhaling or to exhale through the patient &# 39 ; s nose . the return pressure exerted by the mdi canister is sufficient to return the actuator lever 23 to the up position ( or deployed position ), without any additional spring mechanism . if desirable for ergonomic reasons , it is known in the art how to insert a spring mechanism into the design . for example , a coil spring could be added at the distal end , where the distal end is pivotally attached to the housing , if it were desirable to add some additional resistance to the actuator lever or for any other reason . addition of a an additional spring mechanism is within the scope of the invention . the standard , universal cowling is designed to accept mdi canisters of nearly all commonly prescribed medications , and the cowling helps to guide the canister into the inlet port of the housing when the patient inserts a mdi canister into the inhaler . in addition , the cowling provides support to the canister when the patient depresses the actuator lever , dispensing medication into the housing of the inhaler . specialized cowlings may be designed for unusual mdi canisters or new mdi canisters that would not fit the universal cowling . by universal , the inventors mean that the cowling is designed to accept nearly all commonly prescribed mdi canisters . an example of an optional audible signaling device or whistle is shown in fig5 . the whistle shown is installed in the valve body in the mouthpiece . in an alternative embodiment , the whistle is installed in the inlet of the housing . the term whistle is used here synonymously with any type of audible signaling device that can be made to impart an audible warning when the rate of air , or alternatively the air over - pressure , exceeds a desirable limit during inhalation . the purpose of the whistle is to alert the patient that the patient is inhaling too rapidly , allowing the patient to reduce the rate of inhalation , improving the efficacy of delivery .
| 0 |
fig1 shows a cigarette pack with a rigid card pack 1 with a “ flip - top ” lid 2 containing a package 3 of cigarettes having a charge of cigarettes ( not shown ) inside a sealed enclosure formed by a barrier layer . the bounds of an aperture for allowing access to the cigarettes are indicated by parallel dotted lines 4 extending from the rearside of the package 3 where a hinge line is formed on the edge 5 across the top of the package and down the front as far as a third line 6 parallel to hinge 5 . the barrier layer which encloses the charge may be make for example of metallized plastics or of a plastics / metal foil laminate . over its aperture lies a lamella 7 in the form of a label , which has on its undersurface nearer to the barrier layer a permanently tacky adhesive . the permanently tacky adhesive covers continuously the undersurface of a main portion 13 of the lamella . however , it may be applied to selected area only , but must be present where the lamella 7 extends at edges 8 and 9 beyond the openable edges of the aperture . a permanent bonding adhesive may be used on the portion of the undersurface which does not overlie the edges of the barrier layer . beyond one edge of the main portion 13 is a tab 10 hingeable about a hinge line 12 which is free of the permanently tacky material . the tab projects so that it may be grasped by the user and used to pull the label to open the package . for the first use , the aperture edges 4 and 6 may have been defined by lines of weakening in the barrier material or by actual cuts to assist opening the aperture . the user is then free to remove cigarettes from the package through the aperture and after having done so may reseal the aperture simply by bringing down the tab so that the edge portions 8 , 9 re - adhere to the adjacent portions of the barrier layer material . the flap of barrier material formed by the separation along those lines when the tab 10 was lifted is returned to its previous position and although there will now be a line of separation in that barrier layer it is covered by the adhered edges 8 , 9 of the lamella . to ensure as far as possible efficient adhesion an inner frame within the package offers a reaction surface underneath the barrier layer against the resealing pressure exerted on edges 8 and 9 . the package 3 may be a separate entity removable from the outer carton . the latter may be of any suitable type and in particular may be of the so - called “ shell and slide ” type wherein the package may be pressed from one end of the carton to protrude from the other for the purpose of exposing cigarettes for more ready access by the user . furthermore , the package above may be an independent entity , that is to say , may be sold without a rigid carton surrounding it , at least if , preferably , means such as a conventional clear celluloid overwrap were provided to provide further protection and prevent accidental disturbance of the tab 10 . the resealable barrier layer may also be over a rigid carton . fig2 shows a plan view of the undersurface of the lamella 7 which is completely covered with a layer 18 of permanently tacky adhesive . the tab 10 has been given a layer of varnish 19 to mask the adhesive on it . fig3 is a schematic cross - sectional view of the lamella along the line aa ′ of fig2 . the lamella is in the form of a bilaminate with an inner layer 14 to lie next to the barrier layer of a pack and an outer layer 15 to be exposed . a severance line 16 has been cut through the thickness of the inner layer 14 only , to define the boundary between the main portion 13 of the lamella and the handling tab 10 . the connective hinge line 12 in the outer layer is coincident with the severance line and allows the tab 10 to hinge outwardly . fig4 shows the tab 10 folded back to overlie the main portion of the lamella . temporary ( degrading ) adhesive 20 may hold , or assist holding , in that position . fig4 also shows how permanently tacky adhesive layer 18 , if present on the tab 10 , is masked by varnish layer 19 or other covering . an advantage of constructing the lamella as a bilaminate is that a cut can be made in the inner layer 14 to form the severance line 16 before the outer layer 15 is bonded to the inner layer . this requires much less control over the depth of cut than if the lamella were formed from a unitary layer . a further advantage is that the inner 14 and outer 15 layers can be cut or stamped out of preadhesively coated sheet . the adhesive coating on the sheet of the inner layer 14 forms the permanently tacky adhesive on the inner face of the lamella , while the adhesive coating on the sheet of the outer layer 15 bonds the two layers together . if the inner layer is cut or stamped out of a pre - coated sheet , any adhesive extending to the inner surface of the tab is preferably be neutralised . this is conveniently done by applying a layer of varnish to the adhesive on the tab . alternatively the portion of the sheet which is to form the tab is left without permanently - tacky adhesive . to produce a pack as in wo - a - 98 / 22367 and in which the tab is provided in an upturned position when the pack is closed , the tab may be held folded back until the pack is closed to trap the tan in place . in a hinged - lid pack this would be by shutting the lid . the tab may be held folded back mechanically , or as described with reference to fig4 a short - term degradable adhesive may be provided on the upper surface of the tab to keep the tab turned up for as long as is necessary to complete the assembly of the pack . subsequently the short - term adhesive degrades , and a user can open the pack and find the tab upturned of the lamella . in a slide - shell pack the tab would be held mechanically by sliding the enclosure into the shell , and in a soft or semi - rigid pack by wrapping the enclosure in film . the tab will spring back to a certain extend when the pack is opened , but will still project in the manner indicated in fig1 .
| 1 |
the foam tire insert of the invention can replace pneumatic tubes , especially in bicycles , although the insert can also be used in other applications where air - filled tubes or tires are used today . the insert is made through a foam construction technique using multiple layers of differing foam materials to yield a product that can emulate the feeling and performance of pressurized air in a tire and tube system , without significantly increasing the weight over an average thickness pneumatic tube . with such a construction technique with modern materials the need for pneumatic tubes can be eliminated for large classes of users . the insert can made as a one piece annular component at its least expensive embodiment . other embodiments can be arrived at by splitting the insert and mounting a clipping device at each end in order that the foam insert can be mounted without taking the wheel off of the bicycle . in addition , different quality level embodiments can be produced using different materials and different construction methods . this allows for different market segments by price and performance to be individually addressed . fig1 and 2 show cross sectional views of a compound ( multiple layer ) foam tire insert 10 according to one embodiment of the invention , in which the insert 10 is formed of a combination of two distinct types of plastic foams known as polymer foams . the core 1 of the insert 10 is formed of a stiff , structurally durable , lightweight foam material . the core 1 contributes to providing the long term structural integrity of the insert 10 , and also provides the strength and mass that will provide the foundation for the outer layer 2 to rest upon . an appropriate material for the core 1 of the insert 10 would be light weight , non - compressible , flexible material that is in the class of closed cell cross - linked ethylene copolymer foams , closed cell cross - linked polyethylene foam ( xlpe ) or other commercially available cross linked polyethylene foams . these materials help the insert 10 emulate the structural air pressure that a pneumatic system provides . the primary characteristics of this structure are light weight , less than 5 % compressibility , less than 1 % retained deformation under - load and after load relief , long term structural integrity , ease of handling and molding to high tolerances and low cost . the closed air cells in the structure help in emulating and providing the structural component of the system . the desired material characteristics of the material should allow the cell walls to be flexible enough to undergo some level of deformation while showing high retention of structural design after loading . the outer layer 2 is formed of a different foam material from the material in the core 1 , and is responsible for providing to the rider the feel and performance of a pneumatic tube system . the material of the outer layer 2 in this embodiment preferably has significant characteristics of energy return , wide temperature tolerance , shape retention , durability over time and the ability to be extruded in precision tolerances . preferably , the material of the outer layer 2 has the property that it does not become rigid in a range of temperatures between − 20 c and + 40 c , and has the durability to last for three or more years . an appropriate material for the outer layer 2 of the insert 10 would be a class of materials known as styrene - butadiene - styrene , or sbs . this substance is a hard rubber that &# 39 ; s used for things like the soles of shoes , tire treads , and other places where durability is important . it &# 39 ; s a type of copolymer called a block copolymer . its backbone chain is made up of three segments : a long chain of polystyrene , a long chain of polybutadiene , and another long section of polystyrene . sbs is also a type of unusual material called a thermoplastic elastomer ( tpe ). these are materials that behave like elastomeric rubbers at room temperature , but when heated , can be processed like plastics . most types of rubber are difficult to process because they are crosslinked . but sbs and other thermoplastic elastomers manage to be rubbery without being crosslinked , making them easy to process into useful shapes . the use of sbs as a component in the outer layer 2 of the insert 10 strongly assists the invention in emulating the resilience of the pneumatic structure . one specific type of sbs which is useful as an outer layer 2 in this embodiment is olefin block copolymer ( obc ), which are polyolefins with alternating blocks of hard ( highly rigid ) and soft ( highly elastomeric ) segments . the block structure of obcs offers an advantaged performance balance of flexibility and heat resistance compared to random polyolefin copolymers . this material also has the distinct advantage of retaining stable performance characteristics over wide ranges of temperatures insuring correct function in a wide range of environmental conditions . the outer layer 2 in this embodiment is applied evenly around the outside of the core 1 in a uniform thickness 3 which helps determine the performance characteristics of the product . by varying this dimension 3 , the emulation by the insert 10 of pressure and performance of a pneumatic tire tube can be determined . fig3 and 4 show cross sectional views of another embodiment of the insert 10 , in which the ratio of dimensions and location of the core and outer layer is varied to yield different performance characteristics . fig3 shows an alternative embodiment of the tire insert 30 , which might be used to emulate the feeling of a high pressure , high performance tire of lighter weight . in this embodiment , the core 31 is larger relative to the outer layer 32 , than the embodiment shown in fig1 and 2 . the core 31 is offset toward the inner circumference 36 of the insert 30 so that the thickness 33 of the outer layer 32 nearest the inner circumference 36 is less than the thickness 34 of the outer layer 32 near the outer circumference 35 of the insert 30 . this provides a high ratio of stiff , light core material 31 vs a lower ratio of high density highly flexible material in the outer layer 32 . fig4 shows an alternative embodiment of the tire insert 40 , which might be used to emulate a lower air pressure tire , giving the rider more comfort and forgiveness . in this embodiment , the core 41 is smaller relative to the outer layer 42 , than the embodiment shown in fig1 and 2 . as in the embodiment of fig3 , the core 41 is also offset toward the inner circumference 46 of the insert 40 so that the thickness 43 of the outer layer 42 nearest the inner circumference 46 is less than the thickness 44 of the outer layer 42 near the outer circumference 45 of the insert 40 . this provides a lower ratio of stiff , light core material 41 vs a higher ratio of high density highly flexible material in the outer layer 42 . this ratio of compounds will give a ride quality . the ratio , form and material characteristics of these two materials combined into a tubular structure determine the characteristics of the tire insert of the invention . these two materials can be used in many ratios and in many forms in the tubular insert to emulate the desirable characteristics of a pneumatically inflated tube in such a way as to accurately imitate different types and pressures of tire and tube systems at weights that are competitive with pneumatic systems . in order to emulate ( imitate ) the required pressures and performance of a pneumatic system in the multi - layer foam insert model three distinct factors must be considered . the first factor is the diameter of the cavity into which the foam insert must be inserted . this diameter is the equivalent space that is filled by the pneumatically inflated tube . the accurate measurement of this diameter , at the desired inflated pressure is key to insuring the correct fit and function of the multilayer foam insert . once this diameter is precisely measured and the pressure of the system defined then the design of the foam insert can begin . the second factor is modeling the foam structure to achieve the desired weight and pressure emulation of the system . every tire has a recommended pressure rating . the foam insert must be constructed in such a way that it emulates this required pressure . the core material of the foam insert structure is the determining element in achieving this desired pressure . this inner core material must also be formed from a material that has weight of below ( at least ) 20 kg per cubic meter of material . this weight parameter insures that the total structural weight will be acceptable to the consumer . this inner lightweight foam core “ backbone ” is key to the concept of a light weight high performance structure . additionally , the core material must offer a kpa high enough to emulate the pressure of the inflated tube . the formula to convert kpa to psi is 1 : 0 . 15 . one kpa is equivalent to 0 . 15 psi . table 1 , below , illustrates the levels of kpa and their corresponding psi . once the defined psi has been selected then the corresponding material with the correct kpa can be selected . the third factor to achieve the emulation of the required pressures and performance of a pneumatic system are the characteristics ( dynamic and kpa ) of the outer layer of the foam insert structure . this outer layer is critical to contributing to the foam structure a dynamic and functional aspect . without this outer layer , the feel and function of the complete wheel system will be “ dead ” or “ numb ”. the tire / wheel system will not perform properly and will not give the rider to the correct road surface performance / feedback . the thickness of this outer layer , in proportion , to the light weight inner foam core can be manipulated to achieve the desired final pressure and function of the system . within the family of sbs ( tpe ) of thermoplastic elastomers there are many parameters of performance that can be defined . these material parameters can be manipulated in order to achieve the best performance for a given end user &# 39 ; s purposes . the variations in thickness of the outer layer in combination with the almost limitless variations in material properties render the predictive modeling of structural performance problematic . in the end , physical prototyping with laboratory performance measurement will be the optimal method for determining the correct materials and ratios of circumferences of said materials to validate the correct structure of the product . fig5 represents a sectional view of a bicycle wheel in which the foam insert 10 is mounted on a rim 54 , within a tire 58 . a foam pad 55 is placed around the rim 54 in the cavity 53 of the rim 54 to support the tire insert 10 . the tire 58 has a sidewall 59 , which is held within the edges 56 of the rim 54 by a bead 57 , and has a tread 50 around an outer circumference 52 which is chemically and physically bonded to the tire 58 through the vulcanization process , as is conventional . the formation of the structure of the insert 10 can occur , for example , in two ways . the first method , shown in fig6 a - 6f is through the use of an extrusion process that is well known and highly employed globally to extrude polyethylene foams . step 1 : fig6 a : by the use of a screw extrusion machine 60 with the correct dimension die 61 a in place , the core 81 can be extruded . step 2 : fig6 b : by the use of a screw extrusion machine 60 with the correct dimension die 61 b in place , the outer layer 82 can be extruded . it should be noted that steps 1 and 2 could be performed in any order , and the lengths of core 81 and outer layer 82 can be made to length as needed , or long lengths can be made in advance in preparation for the succeeding steps described below , within the teachings of the invention . step 3 : fig6 c : the lighter weight , stiff core material 81 is inserted into the denser more flexible outer layer 82 , forming the combined insert 80 . optionally , an adhesive 84 can be applied to the outside of the core 81 or the inside of outer layer 82 , so as to provide adhesion between the core 81 and outer layer 82 . an appropriate adhesive 84 for this process would be , for example , a low temperature spray - able hot melt adhesive that is hand sprayed on the product manually and then assembled into a final structure . an example of a non - toxic adhesive which could be used is tec bond 420 sprayable hot melt adhesive from hotmelt . com . the extruded core 81 and outer layer 82 , optionally connected by adhesive 84 , will form the structure of the length of insert 80 . step 4 : fig6 d : if the insert 80 was formed from long lengths of core 81 and outer layer 82 material , as noted in step 2 above , the combined insert 80 is cut to the length 62 corresponding to the desired circumference of the finished tire insert 65 . alternatively , if the core 81 and outer layer 82 were formed to exact length 62 in steps 1 and 2 before being combined in step 3 , this step can be omitted . step 5 : fig6 e : adhesive 64 is applied to both ends 63 of the insert 80 . an appropriate adhesive 64 for this process would be , for example , a tape that is made with acrylic foam which is viscoelastic in nature . this gives the foam energy absorbing and stress relaxing properties which provides these tapes with their unique characteristics . the acrylic chemistry provides outstanding durability performance . these tapes utilize a variety of specific foam , adhesive , color and release liner types to provide each product / family with specific features . these features can include adhesion to specific or a broad range of materials , conformability , high tensile strength , high shear and peel adhesion , resistance to plasticizer migration , and ul746c recognition . step 6 : fig6 f : the ends 63 of the insert 80 are joined , forming a completed tubular tire insert 65 that is ready for use in a tire system . the second method is uses a co - extrusion process using an extrusion machine 70 with compound die 73 , which is less well known to extrude polyethylene foams . this method , shown in fig7 a - 7d comprises the following steps : step 1 : fig7 a : load the material for the core 81 and outer layer 82 into separate feed hoppers 71 and 72 in the extrusion machine 70 , such that the two materials enter the extrusion machine 70 at the same time . step 2 : fig7 b : operate the extrusion machine 70 with the compound die 73 in place , thereby simultaneously extruding the inner core 81 and the outer layer 82 from the compound die 73 as a length of a complete tubular insert 80 . it should be noted that the insert 80 can be made to length as needed , or long lengths can be made in advance in preparation for the succeeding steps described below , within the teachings of the invention . step 3 : fig7 c : if the insert 80 was formed as a long length of material , as noted in step 2 above , the insert 80 is cut to the length 74 corresponding to the desired circumference of the finished tire insert 78 . alternatively , if the insert 80 was formed to exact length 74 in step 2 , this step can be omitted . step 4 : fig7 d : adhesive 76 is applied to both ends 77 of the insert 80 . an appropriate adhesive 76 for this process would be , for example , a tape that is made with acrylic foam which is viscoelastic in nature . this gives the foam energy absorbing and stress relaxing properties which provides these tapes with their unique characteristics . the acrylic chemistry provides outstanding durability performance . these tapes utilize a variety of specific foam , adhesive , color and release liner types to provide each product / family with specific features . these features can include adhesion to specific or a broad range of materials , conformability , high tensile strength , high shear and peel adhesion , resistance to plasticizer migration , and ul746c recognition . step 5 : fig7 e : the ends 77 of the insert 80 are joined , forming a completed tubular tire insert 78 that is ready for use in a tire system . accordingly , it is to be understood that the embodiments of the invention herein described are merely illustrative of the application of the principles of the invention . reference herein to details of the illustrated embodiments is not intended to limit the scope of the claims , which themselves recite those features regarded as essential to the invention .
| 1 |
the present invention will be described in detail in conjunction with what is presently considered as preferred or typical embodiments thereof by reference to the drawings . in the following description , like reference characters designate like or corresponding parts throughout the several views . also in the following description , it is to be understood that such terms as “ top ”, “ bottom ”, “ front ”, “ rear ” and the like are words of convenience and are not to be construed as limiting terms . now , description will be made of the heat generation type flow sensor according to a first embodiment of the present invention by reference to fig1 . [ 0043 ] fig1 is a top plan view showing a flow rate detecting element 1 of the heat generation type flow sensor according to the first embodiment of the invention , and fig2 is a sectional view of the same taken along a line a - a shown in fig1 . referring to fig1 and 2 , description will firstly be directed to the structure of the flow rate detecting element 1 . formed on the top surface of a silicon substrate 20 of a substantially rectangular shape are a first insulation layer 12 a and a second insulation layer 12 b in a laminated structure . each of these layers 12 a and 12 b is formed of a dielectric film such as of silicon oxide ( e . g . sio 2 ), silicon nitride ( e . g . sin ) or the like . a pair of cavities 11 a and 11 b are formed on the rear surface of the silicon substrate 20 with a predetermined distance therebetween in the longitudinal direction by removing partially or locally the material from the silicon substrate 20 by an etching process in such a manner that first and second diaphragms 10 a and 10 b formed of the first and second insulation layers 12 a and 12 b , respectively , are disposed at the top sides of the cavities 11 a and 11 b , respectively . in the region of the first diaphragm 10 a , a heat generating resistor 2 formed of platinum ( pt ), nickel ( ni ) or the like and having resistance value which exhibits temperature dependency is disposed between the first and second insulation layers 12 a and 12 b . similarly , in the region of the second diaphragm 10 b , a fluid temperature detecting resistor 7 formed of the resistance film of a same material as the heat generating resistor 2 and destined for measuring the temperature of the fluid is provided between the first and second insulation layers 12 a and 12 b . both ends of the heat generating resistor 2 are electrically connected to bonding pads 30 a and 30 g , respectively , by wiring conductors 8 . similarly , both ends of the fluid temperature detecting resistor 7 are electrically connected to bonding pads 30 b and 30 e , respectively . next , description will turn to a process of manufacturing the flow rate detecting element 1 . at first , a metallic resistance film is formed on the insulation layer 12 a deposited as a base layer on the silicon substrate 20 through a film deposition process such as sputtering or vapor deposition or evaporation or the like of platinum ( pt ), nickel ( ni ) or the like whose resistance value exhibits temperature dependency . subsequently , the metallic resistance film is subjected to a patterning through a photomechanical process so that the metallic resistance film is imparted with a desired shape or pattern and a desired resistance value . thereafter , the insulation layer 12 b is formed as a protection film to cover wholly the insulation layer 12 a inclusive of the patterned metallic resistance film . in succession , the bonding pads 30 a , 30 b , 30 e and 30 g are formed . finally , the diaphragms 10 a and 10 b are formed by etching partially the silicon substrate 20 from the rear side thereof by using the insulation layer 12 a as a mask so that no part of the substrate 20 can remain on the rear surface of the heat generating resistor 2 and the peripheral portion thereof . [ 0045 ] fig3 is a top plan view showing a mounting or packaging structure of the flow rate detecting element 1 on the supporting member 13 , fig4 is a sectional view of the same taken along a line b - b shown in fig3 and fig5 is a sectional view of the same taken along a line a - a shown in fig3 . as can be seen in fig3 the flow rate detecting element 1 is mounted on the supporting member 13 in such disposition that the one or front surface of the diaphragm is placed directly in contact with the flow of a fluid medium for measurement and that the fluid medium is difficult to flow into a region extending adjacent to the other or rear surface of the diaphragm . the bonding pads 30 a , 30 b , 30 e and 30 g of the flow rate detecting element 1 are electrically connected to lead frames 17 by means of bonding wires 16 , respectively . the lead frames 17 in turn are connected to an external circuit ( not shown ). the bonding wires 16 and peripheral portion therearound are protected against external influence by means of a cap member 18 , wherein the interior defined by the cap member 18 is filled with a gel 19 so that the bond is covered thereby . as shown in fig5 the supporting member 13 presents such a sectional shape which approximates a stream - line shape so that destratification does not occur in the layer of fluid flowing along the surface of the supporting member 13 . further , the flow rate detecting element 1 is buried in the supporting member 13 so that the exposed surfaces thereof lie flush with the surfaces of the diaphragms 10 a and 10 b . as mentioned previously , the cavities 11 a and 11 b are formed in the rear surfaces of the diaphragms 10 a and 10 b , respectively , whereby heat insulation can be realized between the supporting member 13 on one hand and heat generating resistors 2 of the diaphragms 10 a and 10 b and the fluid temperature detecting resistor 7 on the other hand . the heat generating resistor 2 is constantly so controlled that the heat generating resistor 2 is always at a temperature which is higher by a predetermined temperature value than the temperature of the fluid medium or air the flow rate of which is to be measured by the fluid temperature detecting resistor 7 . in other words , the heat generating resistor 2 is subjected to , so to say , a constant temperature - difference control . to this end , a driving or detecting circuit is provided . fig6 is a circuit diagram showing schematically the driving or detecting circuit . referring to fig6 a bridge circuit is constituted by the heat generating resistor 2 , the fluid temperature detecting resistor 7 and a plurality of fixed resistors 22 to 25 , wherein these circuit components are connected with differential amplifiers 41 and 42 and a transistor 43 in a circuit configuration as shown in fig6 . in this bridge circuit , resistance value rh of the heat generating resistor 2 is given by the undermentioned expressions in which the reference numerals designating the resistors shown in fig6 correspond , respectively , to the scripts affixed to “ r ”. rh = ( r7 + r24 ) ( r22 + r23 ) r21 / { r23 · r25 - r21 ( r7 + r24 ) } ( 1 ) ≈ ( r7 + r24 ) ( r22 + r23 ) r21 / ( r23 · r5 ) ( 2 ) when the state of the bridge circuit becomes unbalanced due to change of the temperature of the heat generating resistor 2 as brought about by variation of the flow rate of the fluid medium or air and / or change of the temperature of the fluid temperature detecting resistor 7 brought about by the change of the temperature of the air , the heating current flowing through the heat generating resistor 2 is controlled through cooperation of the differential amplifiers 41 and 42 and the transistor 43 so that the balanced state of the bridge circuit is restored . as a result of this , the heat generating resistor 2 can always assume the resistance value given by the above expressions ( 1 ) and ( 2 ), whereby the difference in temperature between the heat generating resistor 2 and the fluid temperature detecting resistor 7 is sustained to be constant . in this state , the quantity or rate hf of heat transfer from the heat generating resistor 2 to the air is given by the following expression : δt represents the temperature difference between the heat generating resistor 5 and the flow of the fluid medium or air , and on the other hand , joule heat w generated by the heat generating resistor 2 is given by the following expression : rh represents the resistance value of the heat generating resistor 2 , and ih represents the electric current flowing through the heat generating resistor 2 . in the steady state , the heat transfer rate hf given by the expression ( 3 ) and the joule heat w given by the expression ( 4 ) are equal to each other . accordingly , the following expression holds true . since the heat transfer coefficient h can be expressed in terms of a function of mass flow rate qm of the air , it is possible to detect the air flow rate q by detecting the heating current ih . in practical applications , however , the heat quantity transferred to the flow of the fluid medium or air from the heat generating resistor 2 is a part of the joule heat w . besides , loss due to heat conduction from the heat generating resistor 2 to the silicon substrate 20 and the cavity 11 a will take place . thus , the actual heating current is represented by the following expression : ps represents the heat loss due to the heat conduction to the silicon substrate 20 , and pc represents the heat loss due to the heat conduction to the cavity 11 a . as the proportions of the heat conduction losses ps and pc increase as compared with the heat transfer loss pf (= h · s · δt ), the flow dependency of the heating current ih decreases with the sensitivity of the flow sensor being lowered . accordingly , in order to improve the flow sensitivity , the size of the heat generating resistor 2 formed on the diaphragm 10 a must be optimized with the ratio between the heat transfer loss pf and the heat conduction loss ( ps + pc ) being set as large as possible . now , referring to fig1 the width of the diaphragm 10 a is represented by xd , the length of the diaphragms 10 a in the longitudinal direction orthogonal to the flow direction is represented by yd , and the thickness of the diaphragm 10 a is represented by t . stress induced in the diaphragm 10 a under the action of pressure difference between the top ( exposed ) surface and the bottom ( rear ) surface thereof becomes maximum at edge portion of the diaphragm . further , on the condition that the length yd is at least double the width xd and that xd / t is constant , such characteristics make appearance that the maximum bending stress scarcely changes even when the diaphragm size changes . [ 0068 ] fig7 is a view showing graphically and schematically relations between the heat losses from the heat generating resistor 2 on one hand and the ratio of the width xh of the heat generating resistor 2 to the width xd of the diaphragm 10 a ( xh / xd ) on the other hand . in the figure in which the width ratio xh / xd is taken along the abscissa with the heat losses from the heat generating resistor 2 being taken along the ordinate , a solid line curve 45 represents the heat loss due to heat conduction from the heat generating resistor 2 to the silicon substrate 20 , a broken line curve 46 represents a sum of the heat loss due to the heat transfer from the heat generating resistor 2 to the flow of the fluid medium such as air and the heat loss due to the heat conduction from the heat generating resistor 2 to the cavity 11 a . both the heat loss due to the heat transfer from the heat generating resistor 2 to the flow of the fluid medium and the heat loss due to the heat conduction to the cavity 11 a from the heat generating resistor 2 increase in proportion to the increase of the area of the heat generating resistor 2 , whereas the heat loss due to the heat conduction to the silicon substrate 20 from the heat generating resistor 2 increases steeply as the ratio xh / xd increases . consequently , a single - dotted broken line curve 47 representing the ratio between the heat transfer loss and the heat conduction loss shows characteristically that this ratio becomes maximum at the width ratio xh / xd of “ 0 . 5 ”. [ 0069 ] fig8 is a view showing schematically a relation between the ratio of the heat transfer loss to the heat conduction loss on one hand and the ratio of the width of the heat generating resistor to the width of the diaphragm ( xh / xd ) on the other hand as a function of the size of the diaphragm in a range of minimum flow rate . in the figure , a solid line curve 50 represents the ratio of the heat losses when the width of the diaphragm is 300 μmm ( 0 . 3 mm ). similarly , a broken line curve 51 represents the ratio of the heat losses in the case where the diaphragm width is 600 μmm ( 0 . 6 mm ), and a single - dotted broken line curve 52 represents the ratio of the heat losses in the case where the diaphragm width is 900 μmm ( 0 . 9 mm ), respectively . however , in any case , the length yd of the diaphragm 10 a is twice as long as the width xd thereof with the ratio of the width of the diaphragm to the thickness thereof is constant at the value of “ 100 ”. as will now be appreciated , the maximum sensitivity can be realized by setting the ratio of the width of the heat generating resistor to that of the diaphragm at a value falling within a range of “ 0 . 4 ” to “ 0 . 6 ” inclusive on the precondition that the mechanical strength of the diaphragm is sustained to be constant . in this conjunction , it is noted that the sensitivity can certainly be increased by increasing the size of the diaphragm . however , in that case , the responsitivity of the sensor becomes degraded more or less . accordingly , it is important to optimize the size of the heat generating resistor while determining the size of the diaphragm so as to lie within a range allowable from the standpoint of the response characteristics of the flow rate detecting element . [ 0070 ] fig9 is a view showing graphically flow characteristics when the flow rate detecting element in which the diaphragms conforming to the characteristics curves 50 , 51 and 52 and satisfying the size requirement that xh / xd = 0 . 5 are employed , respectively . parenthetically , in fig9 the output signal of the flow rate detecting element taken along the ordinate is normalized on the precondition that the output for the minimum flow rate is “ 1 ”. as can be seen in fig9 the flow rate detecting element exhibits the flow sensitivity which increases as the ratio of the heat transfer loss to the heat conduction loss increases . at this juncture , it should also be mentioned that the relation between the ratio of the length yh of the heat generating resistor to the length yd of the diaphragm and the flow sensitivity exhibits the characteristic similar to the ratio of the length yh of the heat generating resistor to the width of the diaphragm . it has experimentally been established that the maximum sensitivity can be obtained when the ratio of the length of the heat generating resistor to the length of the diaphragm falls within a range from 0 . 4 to 0 . 6 inclusive . as will now be appreciated from the foregoing description , with the structure of the flow rate detecting element according to the first embodiment of the present invention in which the ratio of the width of the diaphragm 10 a to the length thereof is selected to be at least “ 2 ” and in which the ratios of the width and the length of the heat generating resistor 2 to the width and the length of the diaphragm 10 a , respectively , are selected to fall within the range of 0 . 4 to 0 . 6 inclusive , there can be realized the flow rate detecting element of the structure which is optimal in respect to both of the mechanical strength and the sensitivity . [ 0073 ] fig1 is a top plan view of a flow rate detecting element 1 a according to a second embodiment of the present invention . as will readily be appreciated from this figure , the structure of the flow rate detecting element 1 a according to the second embodiment of the invention is substantially same as that of the flow rate detecting element 1 described hereinbefore in conjunction with the first embodiment of the invention except that a generated - heat - ascribable temperature detecting resistor 4 is additionally provided for detecting a mean temperature of the heat generating resistor 2 in the flow rate detecting element denoted generally by 1 a . incidentally , in fig1 , items same as or equivalent to those described hereinbefore in conjunction with the first embodiment of the invention are denoted by like reference symbols . the generated - heat - ascribable temperature detecting resistor 4 is disposed closely to the heat generating resistor 2 and patterned so that the former is substantially at a same temperature as the heat generating resistor 2 and provided between the insulation layers 12 a and 12 b constituting parts of the diaphragm 10 a ( see fig2 ) as in the case of the heat generating resistor 2 . the generated - heat - ascribable temperature detecting resistor 4 electrically connected to a driving or detecting circuit similar to that described previously by way of bonding pads 30 h and 30 i . the width of the heat generating resistor 2 is selected to be about a half ( or 0 . 5 ) of the width of the diaphragm with the length of the heat generating resistor 2 being also selected to be about a half ( 0 . 5 ) of the length of the diaphragm . the method of manufacturing the flow rate detecting element 1 a as well as the method of mounting or packaging the flow rate detecting element 1 a is same as those described hereinbefore in conjunction with the first embodiment . the generated - heat - ascribable temperature detecting resistor 4 is so controlled that it is always at a temperature which is higher by a predetermined value than the temperature of the fluid medium or air which is measured by the fluid temperature detecting resistor 7 . in other words , the generated - heat - ascribable temperature detecting resistor 4 is subjected to a constant temperature - difference control , so to say . to this end , a driving circuit is provided . fig1 is a circuit diagram showing schematically the driving circuit . referring to fig1 , the driving circuit is comprised of a series connection of the fluid temperature detecting resistor 7 and the fixed resistors 24 and 25 inserted between the voltage source and the ground and a series connection of the generated - heat - ascribable temperature detecting resistor 4 and the fixed resistor 22 inserted between the voltage source and the ground , wherein a junction between the fixed resistors 24 and 25 is connected to one input terminal of a differential amplifier 41 while a junction between the generated - heat - ascribable temperature detecting resistor 4 and the fixed resistor 22 is connected to the other input terminal of the differential amplifier 41 . the output terminal of the differential amplifier 41 is connected to a base electrode of a transistor 43 whose emitter is connected to the voltage source with the collector thereof being connected to the ground by way of resistors 2 and 21 , wherein a tap is led out from a junction between the resistors 2 and 21 . with the structure of the flow rate detecting element described above , the heating current flowing through the heat generating resistor 2 is detected in terms of a corresponding voltage making appearance across the resistor 21 . in this way , the flow rate can be measured . in the flow rate detecting element according to the instant embodiment of the invention , the relations between the sensitivity on one hand and the sizes of the diaphragm and the heat generating resistor on the other hand are utterly same as those described hereinbefore in conjunction with the first embodiment of the present invention . more specifically , by sizing the diaphragm 10 so that the ratio of the width to the length thereof is at least “ 2 ” and that ratios of the width and the length of the heat generating resistor 2 to those of the diaphragm , respectively , range from 0 . 4 to 0 . 6 inclusive , there can be implemented the structure of the flow rate detecting element which is optimal in respect to both the mechanical strength and the sensitivity . many modifications and variations of the present invention are possible in the light of the above techniques . it is therefore to be understood that within the scope of the appended claims , the invention may be practiced otherwise than as specifically described .
| 6 |
fig5 is a schematic circuit diagram showing a backlight control circuit according to an embodiment of the present invention . as shown in the figure , the backlight control circuit 30 according to this embodiment comprises a plurality of current matching circuits cm 1 - cmn , whose function is to match the currents at their respective paths with one another . the term “ to match currents ” as used in this specification means “ to keep the currents in a constant ratio ”, and in most cases the currents are kept the same or similar . each of the current matching circuits cm 1 - cmn has a circuit structure very similar to that of a current source , but it is referred to as a “ current matching circuit ” in this specification because it can not actually decide the current amount in its path ; it can only decide the ratio between paths . the current amount in each and all of the paths is primarily controlled by a total current setting circuit 35 . as shown in the figure , the current matching circuits cm 1 - cmn are all connected to a common node nd , which is connected to ground via the total current setting circuit 35 . the total current setting circuit 35 serves to set the current i total and keeps it . if the backlight control circuit 30 is an integrated circuit , the total current setting circuit 35 can be located partially or all in the outside of the integrated circuit and connected with the integrated circuit through a pin p so that the current setting can be performed externally . of course , if the current i total needs not be adjusted after setting , the total current setting circuit 35 can be located all inside the integrated circuit . in one embodiment , the total current setting circuit 35 can simply be a common resistor rset , as shown in fig6 . the function of the common resistor rset can be understood more clearly from fig7 a and the following description . the current matching circuits are made of field effect transistors in fig7 a . as shown in the figure , the current matching circuit cm 1 includes a common operative amplifier opa , a transistor q 1 , and a resistor r 1 ; the current matching circuit cm 2 includes the common operative amplifier opa , a transistor q 2 , and a resistor r 2 ; and so on . the resistors r 1 - rn of the current matching circuits are all connected to the common node nd , and the common node nd is connected to the common resistor rset . by virtue of the operative amplifier opa , the voltage at the node nd will be balanced at the level of the reference voltage vb , and thus the current i total passing through the common resistor rset will be kept at a constant (= vb / rset ). for convenience , let us assume the currents flowing to the paths 111 - 11 n are ignorable . thus , the current i total flowing through the common resistor rset is the total of currents flowing through all of the led paths 101 - 10 n , that is , i total = i 101 + i 102 + i 103 + . . . + i 10n and in the case where the leds are operating under the maximum brightness , the brightness of each led is proportional to the current amount on each of the paths 101 - 10 n . when anyone or more of the paths 101 - 10 n are inoperative , for example when the path 101 is open , i 101 becomes zero , so however , the total current i total is a constant (= vb / rset ), so the currents on the other paths 102 - 10 n increase , and the brightness of the leds in the paths 102 - 10 n correspondingly increase to compensate the lost brightness of the leds in the path 101 . the overall brightness is thus compensated . preferably , the currents i 101 - i 10n on the paths 101 - 10 n are equal to each other , but the leds and the resistors r 1 - rn may be different from one another due to manufacture deviations , causing deviations of the currents i 101 - i 10n ; this does not affect the effect of the present invention , however . the current matching circuits can be made of bipolar transistors , as shown in fig7 b . the circuit functions in a similar way to that in fig7 a ; the details of its operation are not redundantly repeated here . in fact , the resistors r 1 - rn in the current matching circuits cm 1 - cmn are not absolutely necessary . as shown in fig7 c , these resistors r 1 - rn can be omitted , and the current matching among the paths can be achieved by layout and matching design of the transistors in the current matching circuits cm 1 - cmn . the common resistor rset in the foregoing embodiments is provided for setting and adjusting the current i total from outside of the circuit . for the basic spirit “ to automatically compensate the overall brightness ”, it is sufficient as long as the current i total is set to be a constant . hence , the total current setting circuit 35 does not have to be a common resistor rset , but instead can be any other device . for example , as shown in fig8 , the total current can be controlled by a total control current source cs total . furthermore , as shown in fig9 , the current matching circuits cm 1 - cmn can be replaced by corresponding resistors in the led paths 101 - 10 n , for rough current matching . in this embodiment the currents on the led paths 101 - 10 n are not precisely equal to one another , but the circuit structure is simpler . fig1 shows a more detailed structure of the circuit of fig9 , in which the total control current source cs total is composed of a transistor qcs , an operative amplifier opacs , and a resistor rcs . if it is desired to set and adjust the total current from outside of the circuit , the resistor rcs can be located at the outside of the integrated circuit ( thus the total control current source cs total is partially located outside of the integrated circuit ). the transistor qcs is shown as a field effect transistor , but can be replaced by a bipolar transistor . from the above description , it can be seen that the idea of the present invention is to set the total current i total to be a constant . all equivalent ways achieving such effect should belong to the scope of the present invention . in the present invention , when one of the led paths is inoperative , the brightness of the leds in the other led paths increases to compensate the lost brightness . hence , the original brightness of each led should not be set to the maximum brightness . the original brightness of each led can be set as ( n − 1 )/ n , ( n − 2 )/ n , . . . , or ( n − m )/ n of the maximum brightness , wherein n is the number of original led paths , 1 ≦ m ≦( n − 1 ), and m is a positive integer . furthermore , as shown in fig1 , to avoid perceivable darkness on the lcd screen when one of the led paths is inoperative , the led array 40 is preferably arranged in such a manner that the neighboring leds are allocated to different led paths . thus , when one of the led paths is inoperative , the overall brightness of the screen is kept uniform . fig1 only shows one among many possible arrangements to this end , and there are numerous variations to allocate the leds under the same spirit . and as stated above , the total current setting circuit 35 needs not be located outside of the integrated circuit . moreover , as shown in fig1 , the backlight control circuit 30 can further comprise under current detection ( ucd ) circuits 31 - 3 n . the ucd circuits 31 - 3 n detect the current conditions on the led paths 101 - 10 n to determine whether an under current condition , i . e ., a “ no current ” or “ very low current ” condition , occurs in any of the paths . when “ no current ” or “ very low current ” condition does not occur , the voltage signals on the led paths 101 - 10 n pass through the ucd circuits 31 - 3 n to the corresponding voltage comparison paths 111 - 11 n , so that the lowest voltage comparison and amplifier circuit 21 receives those signals . when anyone or more led paths 101 - 10 n have no current or very low current , the ucd circuits 31 - 3 n exclude the corresponding one or more voltage comparison paths 111 - 11 n so that they are not valid inputs to the lowest voltage comparison and amplifier circuit 21 , that is , the lowest voltage comparison and amplifier circuit 21 does not accept signals on these invalid voltage comparison paths 111 - 11 n . by means of the ucd circuits 31 - 3 n , if anyone of the led paths 101 - 10 n is open or floating , the corresponding ucd circuits 31 - 3 n will cut off the corresponding paths 111 - 11 n . for example , if the led path 101 is open , because the path 111 is cut off , the lowest voltage selection circuit 21 will select the one with the lowest voltage only from the paths 112 - 11 n and input the selected one to the error amplifier circuit 13 . although the leds in the path 101 can not function , the voltage supply circuit 11 can still supply proper voltage to the rest of the operating leds ; the voltage supply circuit 11 will not increase the output voltage vout unlimitedly to burn out the circuit . furthermore , when the number of pins to be connected with led paths is more than required , the excess pins can be simply floating or grounded ; such arrangement does not consume power , nor do the devices connected with the pins have to be high voltage devices . in addition , if it is desired to ensure proper initialization of the backlight control circuit 30 , a start - up circuit or a logic circuit may be provided in the backlight control circuit 30 . for details of the ucd circuits , start - up circuit or logic circuit , please refer to the co - pending patent application filed by the same assignee under the same title , on the same filing date . practically , in one embodiment , the lowest voltage selection circuit 21 in fig5 , 6 , 8 and 12 can be integrated with the error amplifier 13 to become one “ lowest voltage comparison and amplifier circuit ” 25 , as shown in fig1 a . two examples of such lowest voltage comparison and amplifier circuit 25 are shown in fig1 b ( wherein only the input stage is shown ; the circuit can be connected with another circuit stage to amplify the output ) and fig1 c . the lowest voltage comparison and amplifier circuit 25 can be made of devices other than mosfets , such as of bipolar transistors or junction fets . it is also doable to separate the error amplifier 13 from the lowest voltage comparison and amplifier circuit 25 . all such variations should belong to the scope of the present invention . in addition to the above , the reference voltage vref of the lowest voltage comparison and amplifier circuit 25 does not have to be a constant , but instead can be a variable ; the variable reference voltage vref is preferably a function of the voltages extracted from the paths 101 - 10 n . for example , as shown in fig1 a and 14b wherein the lowest voltage comparison and amplifier circuit 25 is replaced by a high - low voltage comparison and amplifier circuit 29 . in the high - low voltage comparison and amplifier circuit 29 , the other input of the error amplifier 13 is the output of the highest voltage selection circuit 22 instead of the reference voltage vref ; the control signal 15 is generated according to the comparison result between the highest voltage and the lowest voltage . for details of the high - low voltage comparison and amplifier circuit , please refer to another co - pending patent application filed by the same assignee on the same filing date , also titled “ backlight control circuit ”. although the present invention has been described in considerable detail with reference to certain preferred embodiments , these embodiments are for illustrative purpose and not for limiting the scope of the present invention . other variations and modifications are possible . for example , in all of the embodiments , one can insert a circuit which does not affect the primary function , such as a delay circuit , between any two devices which are shown to be directly connected . in the embodiments , all the current matching circuits are connected to one common node nd , but it can be arranged such that only some of the current matching circuits are connected to one common node , or , several common nodes and several common resistors are provided and the current matching circuits are grouped and each group of current matching circuits are connected to one of the nodes . the backlight control circuit 30 is shown to be one integrated circuit , but it can be divided into several integrated circuits , or integrated with other circuit functions . the present invention is not only applicable to series - parallel connection circuits , but also to all - in - parallel circuits . the light emitting device , although shown as led in the above , are not limited thereto but can be other light emitting devices such as an organic light emitting diode . and the word “ backlight ” in the term “ backlight control circuit ” is not to be taken in a narrow sense that the circuit has to control the backlight of a screen ; the present invention can be applied to “ active light emission display ”, or “ led illuminator ”, or other apparatuses that employ light emitting devices . therefore , all modifications and variations based on the spirit of the present invention should be interpreted to fall within the scope of the following claims and their equivalents .
| 7 |
reference will now be made in detail to the preferred embodiments of the present invention , examples of which are illustrated in the accompanying drawings . fig1 and 2 illustrate device test handlers in accordance with a preferred embodiment of the present invention . referring to fig1 and 2 , there is a loading part 10 on one side of a front portion of a base 1 of the device test handler . a stack of trays 11 , having devices to be tested placed therein , are placed on the loading part 10 . a stack of trays 21 for holding good devices , classified as a result of testing , are placed on one side of the loading part 10 . a stack of trays 22 for holding devices to be re - tested are placed on the other side of the loading part 10 . there are also a plurality of trays 23 on the other side of the front portion of the base 1 for holding defective devices according to class of defect degrees . the trays 21 for holding good devices , the trays 22 for holding devices to be re - tested , and the trays 23 for holding the defective devices comprise an unloading part 20 . the trays in the loading part 10 and the unloading part 20 are movable on the base 1 in front and rear directions , as indicated by the arrows in fig1 . a plurality of shuttles , each of which is configured to hold a plurality of logic devices , move around the test handler in a loop . the shuttles transport the logic devices into and out of a test chamber 60 . logic devices to be tested are transferred to a loading shuttle 51 when it is located at a central portion of the base 1 , as shown in fig1 . the loading shuttle is divided into a plurality of cells for receiving the devices transported from the input tray 11 in the loading part 10 . a guide frame 31 in the middle of the base 1 crosses over the base 1 . a loading picker 32 , a first unloading picker 33 , and a second unloading picker 34 are movably fitted on the frame 31 . the loading picker 32 and the second unloading picker 34 are fitted on the same face of the guide frame 31 . the range of movements the loading picker 32 and the second unloading picker 34 are not overlapped . the loading picker 32 transports the devices from the input tray 11 to the loading shuttle 51 . the first and second unloading pickers 33 and 34 transport the devices from a shuttle that has left the test chamber 60 onto respective trays 21 , 22 , and 23 in the unloading part 20 . on the front portion of the base 1 there is a pre - heating part 40 which includes a heating plate 41 for pre - heating the devices on the loading shuttles 51 as the loading shuttles 51 filled with the devices are transported along the pre - heating part 40 . a transfer device 42 is used to move the loading shuttles 51 along the heating plate 41 . preferably , the heating plate 41 is operative electrically for easy temperature control . the heating plate 41 in the pre - heating part 40 may extend rearward up to a test chamber 60 in which the devices are tested . the loading shuttle 51 passes through the pre - heating part 40 and inside the test chamber 60 . when no pre - heating of the devices on the loading shuttles 51 is required , a bypass transfer mechanism 45 can be used to move a loading shuttle directly across the pre - heating part 40 and into a path leading to the test chamber . in this instance , the loading shuttle does not travel along all the path of the pre - heating part 40 , but rather through a shortened bypass path , thus reducing the test time . the test chamber 60 is substantially an enclosed space for maintaining an environmental temperature of the devices in a fixed state when the devices are tested . the devices could be tested at a temperature that is elevated or lowered relative to room temperature . in the test chamber 60 , there are test sockets 61 , each of which is configured to hold and test a logic device . there could be one or a plurality of such test sockets 61 on any given machine embodying the invention . unloading shuttles 55 are located on one side of the test sockets , each for receiving and holding the devices tested at the test sockets 61 . an indexing device is used for successive transferring and loading of devices to be tested from the loading shuttle 51 to the test socket 61 , and for transporting the tested devices from the test socket 61 to the unloading shuttle 55 . a gas supply duct 63 is used for supplying hot or cool gas to the test socket 61 when the devices are tested in a hot or cold state . the shuttles are movable in the test chamber 60 so that after the devices to be tested are emptied from one of the shuttles , the shuttle can move behind the test sockets , and around to the other side of the test socket to an unloading portion so that the shuttle can then act as an unloading shuttle 55 . once an unloading shuttle 55 has been filled with tested devices , it is moved out of the test chamber 60 to a position of the guide frame 31 in the middle of the base 1 . a buffer part 71 , located in front of the test chamber 60 , is used for temporary storage of devices classified as being defective . defective devices are transported from an unloading shuttle 55 to the buffer part 71 by the first unloading picker 33 . the buffer part 71 can then move forward to a position aligned with the second unloading picker 34 . the second unloading picker 34 can then transfer the defective devices to one of the defective device output trays 23 . if there is more than one classification of defective devices , the separate classifications could be stored in different defective output trays . there is a tray transfer device 80 in a rear portion of the base 1 for distributing empty trays 11 from the loading part 10 in either direction so that the empty trays 11 can be used as the trays 21 for loading good devices and the trays 22 for loading the devices to be re - tested . the operation of the device test handler in accordance with a preferred embodiment of the present invention will be explained . when the device test handler is put into operation after the loading part is stacked with trays 11 that contain devices to be tested , a tray 11 from the loading part 10 is transported toward the rear of the base to a position in front of the guide frame 31 in the middle of the base 1 . the loading picker 32 on the guide frame 31 transfers the devices from the tray 11 to one or more of loading shuttles 51 . once all the devices have been transferred to loading the shuttle 51 , the tray 11 is transferred to the tray transfer 80 device at a rear portion of the base . the loading shuttle 51 , which is now full of the logic devices , is transferred to the heating plate 41 in the pre - heating part 40 or directly over a rear portion of the pre - heating part 40 via the bypass mechanism 45 . the loading shuttle 51 is ultimately transported to the test chamber 60 in the rear portion of the base 1 . once the loading shuttle 51 is inside the test chamber 60 , the devices in the loading shuttle 51 are loaded into the test sockets 61 continuously by the indexing device in the test chamber 60 . the devices are then tested , and the tested devices are loaded on an unloading shuttle 55 positioned opposite to the loading shuttle 51 by the indexing device . once an unloading shuttle 55 is fully loaded with tested devices , the unloading shuttle 55 is moved out of the test chamber 60 through a front thereof to beneath the guide frame 31 . then , the first unloading picker 33 on the guide frame 31 transfers the devices from the unloading shuttle 55 to respective trays 21 , 22 , and 23 according to the classifications assigned to the devices during the testing . the devices determined to be good are loaded on the tray 21 for good devices , and the devices determined to require re - test are loaded on the tray 22 for devices to be re - tested . the devices determined defective are temporarily loaded on the buffer part 71 . the buffer part 71 then moves to an opposite side of the guide frame 31 , so that it is aligned with the second unloading picker 34 . the second unloading picker then transfers the defective devices from the buffer part 71 to the tray 23 for defective devices . because multiple separate trays for defective devices are available , the defective devices can be classified into different categories . the defective device trays can move backward and forward so that the second unloading picker 34 can load the defective devices into the appropriate defective device tray according to the classification assigned during testing . upon completion of testing of all of the devices in the loading part 10 , testing of the devices in the tray 22 for devices to be re - tested is carried out automatically . the retest tray 22 in the front portion of the base 1 is moved backward up to a position of the tray transfer device 80 , and the tray is shifted to a position aligned with the loading part 10 . the tray is then moved forward to a space under the guide frame 31 , and is advanced step by step as the devices are transferred to loading shuttles 51 by the loading picker 32 . the testing process thereafter is identical to the aforementioned process , and upon completion of unloading and test for all of the devices in the retest tray 22 , the process is completed . [ 0046 ] fig3 illustrates a perspective view of an indexing device 62 embodying the invention that can be used in the device test handler . the front , right transferring mechanism that is used to move the second index head 604 has been omitted from fig3 for purposes of clarity . referring to fig3 when the loading shuttle 51 enters into the test chamber 60 and is positioned at a test loading position , the loading shuttle 51 , the test socket 61 , and the unloading shuttle 55 are arranged on a line , with the test socket 61 positioned lower than the loading shuttle 51 and the unloading shuttle 55 . the loading shuttle 51 and the unloading shuttle 55 move step by step at fixed intervals as the devices thereon are picked up / placed . there are a pair of opposing frames 601 located over the test sockets ( note : the second frame for holding and moving the second index head 604 has been omitted from fig3 ). the frames 601 extend in the same direction ( hereafter called as ‘ x - axis direction ’) in which the loading shuttle 51 , the test socket 61 and the unloading shuttle 55 are aligned . a first index head 602 and a second index head 604 are located between the pair of frames 601 , and the indexing heads are movable in the x and y axes . the first and second indexing heads repeat a process of : ( 1 ) transferring the devices from the loading shuttle 51 to the test sockets 61 ; ( 2 ) loading the devices into the test sockets ; ( 3 ) transferring the devices from the test socket 61 to the unloading shuttle 55 ; and ( 4 ) returning back to a position of the loading shuttle 51 . the process is described in greater detail below with reference to fig4 a - 4 d . each of the first and second index heads 602 and 604 has one or more device holders 603 and 605 . the number of device holders on each index head corresponds to the number of devices that can be simultaneously loaded into the test sockets 61 . the device holders 603 or 605 move up and down in the first or second index head 602 or 604 , and are designed to hold and release the devices . there are motors 606 fitted to one side of the frames 601 for driving the first and index heads 602 and 604 , individually . there is a threaded driving rod 607 fitted to each of the motors 606 that extends along the x - axis . the driving rod 607 rotates as the motor 606 rotates . a supporting block 609 is thread coupled with the threaded driving rod 607 , for moving in an x - axis direction as the threaded driving rod 607 rotates . there is a supporting plate 610 , having the first or second index heads 602 or 604 fitted thereto , coupled with a front portion of the supporting block 609 . the first or second index heads 602 or 604 are movable in up and down directions along an lm guide 612 located between the support plate 610 and the index head . an lm guide 608 is coupled with the supporting block 609 for guiding movement of the supporting block 609 in the x direction . when the motor 606 is put into operation , to rotate the threaded rod 607 , the supporting block 609 moves along the lm guide 608 in the x - axis direction , together with the supporting plate 610 and the index head . a vertical motor 614 is also located on a central portion of each of the frames 601 for controlling vertical movement of the first or second index heads 602 or 604 . a threaded vertical driving rod 615 is connected to the vertical motor 614 . an elevating block 616 is coupled to the vertical driving rod 615 and is movable in up and down directions as the threaded vertical driving rod 615 rotates . an lm guide 617 is used for guiding the up and down movement of the elevating block 616 . a vertical plate 618 extends downward from a front portion of the elevating block 616 , and an elevating bar 619 is fixed to a lower end of the vertical plate 618 in the x - axis direction . the supporting plate 610 is coupled to the elevating bar 619 with a supporting bearing 611 inbetween , such that the supporting plate can move in both the x - axis direction and the vertical direction following movement of the elevating bar 619 . when the vertical motor 614 is put into operation , to rotate the threaded vertical driving rod 615 , the elevating block 616 coupled therewith moves along the lm guide 617 in up and down directions , to move the first or second index head 602 or 604 in up and down directions as the supporting plate 610 moves up and down together with the vertical plate 618 and the elevating bar 619 coupled with the elevating block 616 . the operation of the indexing device will be explained with reference to fig4 a - 4 d . referring to fig4 a , at an initial starting of the device test handler , the first index head 602 is positioned at a test loading position over the loading shuttle 51 , and the second index head 604 is positioned at a test unloading position over the unloading shuttle 55 , or vice versa . as the motor 614 is driven , the first index head 602 moves down and the device holder 603 grasps one or more of the devices to be tested on the loading shuttle 51 . then , as shown in fig4 b , the first index head 602 moves up in the y - axis , then over to the right in the x - axis direction to a space over the test socket 61 as the vertical and horizontal motors are driven . the device holder 603 then moves down as the vertical motor 614 is driven again , and loads the one or more devices into the test sockets 61 , for testing . the second index head 604 , which was initially positioned opposite to the first index head 602 , moves in the x - axis direction toward the loading shuttle 51 , and stops at a test loading position over the loading shuttle 51 as the motor 606 is driven . the second index head 604 then moves down and grasps one or more the devices to be tested , and stands by . the second index head 604 may come to rest at a standby position that is immediately adjacent the test sockets 61 , as illustrated by the dashed lines in fig4 c . this will allow the second index head to very quickly move into position over the test sockets as soon as the first index head 602 leaves , to minimize index time . as shown in fig4 c , after elapse of a preset time period for the testing , the first index head 602 holds the tested devices and moves up , moves to the test unloading position over the unloading shuttle 55 , moves down , and loads the tested devices into the unloading shuttle 55 . as soon as the first index head 602 moves away from the test socket 61 toward the unloading shuttle 55 , the second index head 604 moves toward the test socket 61 , and moves down and loads the devices it is holding into the test sockets 61 for testing . after the first index head 602 drops off the tested devices at the unloading shuttle 55 , it returns to the loading shuttle 51 and repeats the foregoing process . fig4 d illustrates the second index head 604 positioned over the test socket 61 , and the first index head 602 returning from a space over the unloading shuttle 55 to a position of the loading shuttle 51 . although the second index head 604 and the first index head 602 cross at a position over the test socket 61 , because one of the index heads is moved down toward the test socket 61 , the index heads do not collide . using the above process , the first index head 602 and the second index head 604 can load the devices into the test socket 61 continuously , in a manner that minimizes an index time period . during the picking up and placing of the devices by the first and second index heads 602 and 604 , the loading shuttle 51 and the unloading shuttle 55 move back and forth in steps , thereby allowing smooth continuous picking up and placing of the devices from / to the shuttles . as has been explained , the device test handler and the method for operating the same of the present invention significantly reduces the picking up and placing time periods to reduce possible damage to the devices during production , and to reduce an index time period , which maximizes testing efficiency . the continuous supply of the devices to the test sockets by the two index heads minimizes an index time period , and the one directional transportation of the devices eliminates the need for a separate device picking up and placing device , thereby simplifying the device test handler . it will be apparent to those skilled in the art that various modifications and variations can be made in the device test handler and the method for operating the same of the present invention without departing from the spirit or scope of the invention . thus , it is intended that the present invention cover the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents .
| 6 |
in the following description , for purposes of explanation and not limitation , specific details are set forth in order to provide a thorough understanding of the present invention . however , it will be apparent to one skilled in the art that the present invention may be practiced in other embodiments that depart from these specific details . in other instances , detailed descriptions of well - known methods , devices , and data structures are omitted so as not to obscure the description of the present invention . referring initially to fig1 there is illustrated a diagram of the entities comprising the contracting parties that can utilize exemplary embodiments of the invention to establish their respective contractual positions , obligations , and benefits . the term entity is utilized within the present inventive system to typically represent a business with a least one physical facility where the entity conducts business and where multiple persons are employed . however , an individual can be a contracting party within the meaning and scope of the present invention without detracting from the features available under exemplary embodiments of the invention . additionally , embodiments of the invention can be utilized by individuals and companies which lack any physical facilities or employees . the performances of each of these contracting parties can be guided by terms of agreements developed by embodiments of the invention . the present invention is couched in the environment of manufacturing facilities wherein a consumer of a manufactured product is another entity rather than an individual consumer . in the environment of industrial gases , for example , a manufacturing plant can produce cryogenic gases in the form of liquid nitrogen or liquid carbon dioxide . one typical consumer 102 of these industrial gases can be the manufacturer of cryogenic freezing and processing equipment , such as for flash - freezing food products . alternatively , the consumer 102 of cryogenic gases can be a service business that leases , operates , and maintains the cryogenic equipment on a customer &# 39 ; s site or sites . in either circumstance , the consumer 102 can be a business with a critical need for a reliable source for large volumes of industrial gases . however , as discussed above , the consumer 102 can lack the resources to build its own manufacturing plant and can further lack the expertise to operate the manufacturing plant as efficiently as possible . two key elements in this system are the operating company 100 and the experience database 108 of manufacturing plant operating parameters and contract terms . during the day - to - day operation of a manufacturing plant , literally thousands of pieces of information can be gathered and stored . within the scope of exemplary embodiments of the present invention , an operating company 100 with experience operating one or more manufacturing plants can capture information ranging from operating parameters of each piece of equipment that comprises the manufacturing plant and its processes to the daily weather conditions that may affect the plant operation . additional production information can include the volume of raw materials consumed during each period , such as a day or a week ; the source and the cost of the raw materials ; the volume of product produced during each such corresponding period ; the specifications and quality requirements for both the raw materials and the finished products ; the number of type of workers involved in each production process ; and the contractual terms of purchase agreements , lease agreements , sale agreements , and operating agreements negotiated by or on behalf of the manufacturing plant . additional information can be gleaned from other companies &# 39 ; operations , trade journals , news reports , and the like and added to the experience database 108 . the experience database 108 can also be viewed as an incident database because it can hold information related to plant and equipment breakdowns and failures , thereby providing the present system with information associated with events to be avoided during the optimum design , construction , and operation of the plant . while the experience database 108 is represented in fig1 as a single database , it can consist of a plurality of separate files and databases without detracting from the novel features of the present invention . the operating company 100 can utilize embodiments of the present invention to develop and structure various operating agreements involved in the design , building , purchase , leasing , and operating of various manufacturing plants . this process begins with the building of the experience database 108 with information gleaned from the day - to - day operation of a wide variety of manufacturing plants , including information associated with the design , construction , and financing of such plants . while a particular operating company 100 can limit its expertise and application of the present invention to a particular product line or a limited geographic portion of the world , the inventive system and method described herein can be equally applicable to any manufacturing plant anywhere that acquires raw or manufactured materials and processes them into an output product available for purchase and consumption by a consumer , whether the consumer is an end user or , instead , utilizes the manufactured product as an input material in its own manufacturing plant . referring briefly to fig2 there are shown exemplary components that comprise the inventive system . the processing accomplished by the present invention is provided through a computer 200 which has access to the experience database 108 . the computer 200 includes at least one computer readable medium that is encoded with software for effecting the processing associated with the structuring and selection of contractual terms for defining the relative responsibilities among the parties discussed above with reference to fig1 . the information stored on the experience database 108 can be input , in some instances , manually through at least one input device 202 . alternatively , the computer and / or the experience database 108 can be connected to a network 204 , including the internet , across which plant operating and experience data can be transmitted for storage on the experience database 108 . this information can be manually provided or can be transmitted directly from various sensors and equipment ( not shown ) located in and around various manufacturing plants . one or more output devices 206 can print ( or transmit across the network 204 to other users and devices of the inventive system ) the terms , agreements , and operating parameters generated by the system . additionally , the output from the inventive system can be displayed to the user through a graphical user interface 208 . although not required by exemplary embodiments of the present invention , the resources shown in fig2 can be operated by the operating company 100 , as more thoroughly discussed below . referring now to fig3 and 4 , the development of the contract terms for each agreement and the management of the performances of the contracting parties under the agreements will be discussed . initially , at step 400 , the operating company 100 acquires data related to the day - to - day operation of one or more manufacturing plants and stores it in an experience database 108 . the operating company 100 approaches a consumer 102 and proposes the design , construction , and operation of a manufacturing plant for the production of a particular product , such as the cryogenic gas , liquid nitrogen . the operating company 100 has expertise in the design and operation of the subject manufacturing plant and has available to it the experience database 108 of information , parameters , and contract terms related to the design , construction , purchase , lease , and operation of comparable manufacturing plants . alternatively , the operating company 100 can rely on the experience of an engineering company 106 to provide the expertise and information regarding the design and / or the construction of the proposed manufacturing plant . as used herein , the engineering company can have the ability to design , build , manufacture , and / or assemble a manufacturing plant . additionally , the engineering company can have the expertise to also operate the plant . the consumer 102 is a known or potential consumer of the intended manufactured product , a product with which the operating company 100 has production experience . during the meeting of the operating company 100 and the consumer 102 at step 402 , details of the potential manufacturing plant are discussed . these detailed plant and operating criteria include the product ( s ) to be produced , the range of output product ( s ) desired or anticipated , and the financial resources of the consumer 102 . this information is input to embodiments of the present invention , with the first output being one or more designs for the proposed manufacturing plant , with the optimum design noted by the system at step 403 as most closely matching the proposed criteria of the plant and the resources of the consumer 102 . upon selection of the desired plant design by the consumer 102 , the system at step 404 then produces a draft product delivery agreement 310 , a draft lease agreement 312 , and a draft operating agreement 314 . alternatively , the operating company 100 can select the desired plant design based on information provided by the consumer 102 and the optimum design recommended by the system at step 403 . those familiar with the delivery of manufacturing plants and the manufacture of products can appreciate that the product delivery agreement 310 is also known as a “ product supply agreement ” and is distinguishable from agreements to deliver and / or supply to a consumer the actual product manufactured or produced by the plant . the terms that comprise each of the agreements created by the system are selected from the information stored on the experience database 108 based on input criteria , parameters , and / or terms input by the operating company 100 and / or the consumer 102 . the system can also produce a list of engineering companies 106 who have the expertise to construct the proposed manufacturing plant . the engineering companies 106 are ranked according to the information in the experience database 108 , with those engineering companies who have constructed similar manufacturing plants within budget and on time receiving the highest ranking . additionally , a list of banks 104 can be generated by the system based on the magnitude of the plant selected and the financial resources and credit ranking of the consumer 102 . the banks 104 are ranked within the list , with banks with lower interest rates , experience with construction loans and real property lease agreements , and branches near the site of the proposed plant being assigned the highest ranking by the system . as used herein , the term , “ bank ,” can apply to any entity , including an individual , that is willing and able to provide funding for the construction of the plant and is not limited to financial institutions chartered and / or licensed to provide banking services . through meetings among the operating company 100 , the consumer 102 , the banks 104 , and the engineering companies 106 , a bank 104 and an engineering company 106 are selected to complete the quadrant of four entities who will be contractually tied together by the product delivery agreement 310 , the lease agreement 312 , and the operating agreement 314 . the draft product delivery agreement 310 is presented to the engineering company 106 and the bank 104 for their approval . while termed a product delivery agreement 310 , the agreement 310 can also be termed a construction agreement in that it can include the design and construction criteria and specifications for the construction of the manufacturing plant . it is against these design and construction criteria and specifications that the construction and ultimate completion of the manufacturing plant can be compared to determine whether delivery of the completed plant to the bank 104 should be accepted . if any modifications are proposed to the draft product delivery agreement 310 , these changes are input to the system at step 406 ; and a second product delivery agreement 310 is produced at step 408 , within the limits imposed by the system , the operating company 100 , and the consumer 102 . for example , if the consumer 102 has indicated that the plant must be operational within one year of ground - breaking , and the engineering company 106 has proposed changing this term of the product delivery agreement 310 to a fourteen month delivery , this difference will be detected by the system and noted as an exception to be resolved before a final draft of the product delivery agreement 310 will be output by the system . once all exceptions are resolved among the contracting parties , the changes are input to the present inventive system , and a final product delivery agreement 310 is produced at step 410 . the final product delivery agreement 310 includes the selected design for the plant , all building specifications and blueprints , and construction time tables . additionally , since the bank 104 has been enlisted , and has agreed , to finance the construction , a scheduled list of payments from the bank 104 to the engineering company 106 can be included in the product delivery agreement 310 along with a corresponding list of construction performances which must be met before the payments are to be tendered . the final product delivery agreement 310 produced by the system is presented to the bank 104 and the engineering company 106 for signature by their authorized representatives and becomes the contractual map by which the manufacturing plant is to be constructed by the engineering company 106 and by which the engineering company 106 is to be paid by the bank 104 . because the final product delivery agreement 310 is produced by the inventive system based on input parameters and criteria established by the operating company 100 and the consumer 102 , both parties can be assured that the contractual terms and construction criteria and standards by which the engineering company 106 will build the plant are satisfactory to the operating company 100 who will eventually operate the plant and satisfactory to the consumer 102 who will lease the plant from the bank 104 and rely on it to produce a required output product . additionally , an exemplary embodiment of the system can generate , at step 404 , a construction supervision agreement 316 that includes contractual clauses defining the role and responsibilities of the operating company 100 as a construction or supervising engineer for the bank 104 during the construction of the manufacturing plant to ensure the plant is built in accordance with the design specifications . the determination of the location for the plant and the purchase or lease of the land upon which the plant will be constructed are typically the responsibility and the authority of the consumer 102 . in the alternative , the bank can acquire the desired tract of land and include the cost of the land purchase in the lease agreement 312 . in either event , any design and construction criteria that are a function of the location of the plant can be input to the system to customize the product delivery agreement 310 accordingly . for example , the plant site may require additional grading , deeper footings , or a longer access drive , each of which can be reflected in the final design and construction terms of the product delivery agreement 310 . the draft lease agreement 312 is presented to the consumer 102 and the bank 104 for their approval . if any modifications are proposed to the draft lease agreement 312 , these changes are input to the system at step 412 ; and a second lease agreement 312 is produced at step 414 , within the limits imposed by the system , the operating company 100 , and the consumer 102 . for example , if the consumer 102 has indicated that it cannot afford a monthly lease cost in excess of $ 125 , 000 , and the bank 104 has proposed a monthly lease cost of $ 150 , 000 , this difference will be detected by the system and noted as an exception to be resolved before a final draft of the lease agreement 312 will be output by the system . once all exceptions are resolved among the contracting parties , the changes are input to an exemplary embodiment of the present inventive system , and a final lease agreement 312 is produced at step 416 . the final lease agreement 312 includes , for example , interest rate terms , monthly costs , insurance requirements , monthly payment due dates , late payment penalties , and default provisions . the final lease agreement 312 produced by the system is presented to the bank 104 and the consumer 102 for signature by their authorized representatives and becomes the contractual map by which the manufacturing plant is to be leased from its owner , the bank 104 , and by which the bank 104 is to be paid by the consumer 102 . because the final lease agreement 312 is produced by an embodiment of the inventive system based on input parameters and criteria established by the operating company 100 and the consumer 102 , both parties can be assured that the contractual and financial terms by which the consumer 102 will lease the manufacturing plant from the bank 104 are satisfactory to the consumer 102 who will lease the plant from the bank 104 and rely on it to produce a required output product . additionally , because the operation of the plant will be under terms drawn from the experience database 108 , as discussed more thoroughly below , the risk borne by the bank 104 that the plant may fail are lessened ; and the bank 104 can require less compensation through lease payments to cover the cost of the risk of failure . finally , if elected by the operating company 100 and the bank 104 , the system can generate at step 404 a buy - out agreement 318 specifying buy - out terms whereby the operating company 100 can purchase the plant from the bank 104 during or at the completion of the lease agreement 312 . through the terms and the operation of the buy - out agreement 318 , any risk to the bank 104 regarding plant operating and maintenance costs can be lessened by providing terms and specifying predetermined events whereby the purchase of the plant by the operating company 100 is triggered , including the failure of the consumer 102 to maintain lease payments . the draft operating agreement 314 is presented to the operating company 100 and the consumer 102 for their approval . if any modifications are proposed to the draft operating agreement 314 , these changes are input to the system at step 418 ; and a second operating agreement 314 is produced at step 420 , within the limits imposed by the system , the operating company 100 , and the consumer 102 . for example , if the consumer 102 has indicated that the plant must be able of producing 1 , 000 cubic feet of liquid nitrogen per day , and the operating company 100 has proposed changing this term of the operating agreement 314 to producing 750 cubic feet daily , this difference will be detected by the system and noted as an exception to be resolved before a final draft of the operating agreement 314 will be output by the system at step 422 . in this manner , the interests of all parties are protected , even in an environment where the present inventive system is being utilized by the operating company 100 to define the criteria by which the manufacturing plant will be designed , built , leased , and operated . once all exceptions are resolved among the contracting parties , the changes are input to the present inventive system , and a final operating agreement 314 is produced . the final operating agreement 314 can specify optimum settings for all equipment in the plant , including marginal operating ranges given variables agreed upon by the operating company 100 and the consumer 102 . these variables can include daily production volume , guaranteed up time for the plant , and quality of the output product ( s ). typically , the term of the operating agreement 314 can be set to the same length as the duration term of the lease agreement 312 . the arrows 310 a , 312 a , 314 a , 316 a , and 318 a represent the mutual obligations specified by the terms of the respective product delivery , lease , operating , supervision , and purchase agreements as determined , drafted , and output by exemplary embodiments of the inventive system . one advantage of the present invention is that manufacturing plant experience , including equipment operating parameters , has been stored on the experience database 108 . with this information , the present system has the information to establish proven operating parameters for a complex combination of operating equipment , thereby enabling the operating company 100 to optimize plant operation and guarantee an attainable up time percentage and , correspondingly , assure the consumer 102 that the operating company 100 and the manufacturing plant will be able to produce a desired / contracted volume and quality of the desired product . with such assurances , the consumer 102 is better prepared to plan on the availability of a known quantity of product . the final operating agreement 314 produced by the system is presented to the operating company 100 and the consumer 102 for signature by their authorized representatives and becomes the contractual map by which the manufacturing plant is to be operated by the operating company 100 and by which the manufactured products are to be timely produced for the consumer 102 . because the final operating agreement 314 is produced by the inventive system based on input parameters and criteria established by the operating company 100 and the consumer 102 , both parties can be assured that the contractual terms , plant operating criteria , and product standards are satisfactory to the operating company 100 who will operate the plant and satisfactory to the consumer 102 who will rely on the plant to produce a required output product . for example , the consumer 102 specifying a requirement that the plant operate 98 % of the time can trigger embodiments of the invention to generate such operational requirements , for example , that double compressors will be required , that two shifts of personnel at particular positions will be necessary , and that an additional $ 10 , 000 in monthly operating fees will need to be paid to the operating company 100 . additionally , during plant operation , information from the day - to - day operations are added to the experience database 108 at step 424 , and reports are generated comparing the plant &# 39 ; s operation with the operation of comparable plants . any differences in the plant &# 39 ; s operation as compared to past operations and as compared to an optimum operation are highlighted as exceptions in the reports or on a display available to the user of the inventive system ; and recommendations are made at step 426 regarding equipment settings , process flow , personnel allocation , raw materials acquisition , etc . to improve and optimize the plant &# 39 ; s operation . since the present inventive system is thereby assisting the operating company 100 with the day - to - day operation and management of the plant , the operating company 100 experiences cost savings and risk reduction over having to provide this overview and management itself , thereby increasing any profit to the operating company 100 and reducing the operating fees payable by the consumer 102 . referring now to fig5 there is shown an alternative embodiment of the present invention . in this version , the product delivery agreement of fig3 is replaced with a purchase agreement 510 . the purchase agreement 510 is developed by the system in the same manner as the product delivery agreement 310 of fig3 and also includes contract terms regarding plant design , construction criteria , and delivery deadlines . however , the financing aspect of the plant construction differs in the embodiment represented by fig3 in that the engineering company 106 finances the construction of the plant , either directly or through third party financing . the purchase agreement 510 provides terms for the required and scheduled sale of the completed plant by the engineering company 106 to the bank 104 and the corresponding obligatory purchase of the plant by the bank 104 from the engineering company 106 . the purchase terms can include , as a condition precedent for the final payment from the bank 104 to the engineering company 106 , delivery of an affidavit from the operating company 100 that the constructed plant is satisfactorily operational . in this embodiment , the engineering company 106 bears the burden of financing the construction of the manufacturing plant . such an option provides additional flexibility for the integrated design , construction , financing , and operation facilitated and managed by the present system by transferring the financial burden away from the bank 104 in those circumstances and in those economic regions where the banks 104 are either unable or unwilling to finance a construction project or will do so only at undesirably high interest rates or fees . in such an environment , the engineering company 106 may be willing to assume the financing risk and burden of designing and constructing the plant , with contractual assurances through the predetermined purchase agreement 510 that a willing and able buyer , the bank 104 , is obligated to purchase the completed plant . alternatively , the embodiment shown in fig5 can also include a purchase agreement between the bank 104 and the operating company 100 for the subsequent purchase of the completed plant in a manner similar to the flow shown in fig3 . similar to the flow shown in fig3 the arrows 312 a , 314 a , and 510 a represent the mutual obligations specified by the terms of the respective lease , operating , and purchase agreements as determined and drafted by exemplary embodiments of the inventive system . although preferred embodiments of the present invention have been shown and described , it will be appreciated by those skilled in the art that changes may be made in these embodiments without departing from the principle and spirit of the invention , the scope of which is defined in the appended claims and their equivalents .
| 6 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.